EP4544052A1 - Treatment of gpam related diseases and disorders - Google Patents
Treatment of gpam related diseases and disordersInfo
- Publication number
- EP4544052A1 EP4544052A1 EP23827986.3A EP23827986A EP4544052A1 EP 4544052 A1 EP4544052 A1 EP 4544052A1 EP 23827986 A EP23827986 A EP 23827986A EP 4544052 A1 EP4544052 A1 EP 4544052A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- oligonucleotide
- sense strand
- modified
- antisense strand
- purines
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7125—Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/343—Spatial arrangement of the modifications having patterns, e.g. ==--==--==--
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/344—Position-specific modifications, e.g. on every purine, at the 3'-end
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
- C12Y203/01015—Glycerol-3-phosphate O-acyltransferase (2.3.1.15)
Definitions
- compositions that target GPAM Described herein are compositions comprising an oligonucleotide that targets GPAM and when administered to a subject in an effective amount reduces a GPAM mRNA or protein level.
- a composition comprising an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases circulating cholesterol, apolipoprotein B, bilirubin, alanine aminotransferase, aspartate aminotransferase, or aspartate aminotransferase in a subject.
- the cholesterol comprises total cholesterol, low density lipoprotein cholesterol, or non-high density lipoprotein cholesterol.
- the decreased by about 10% or more, as compared to prior to administration.
- compositions comprising an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases a liver fibrosis score, non-alcoholic fatty liver disease (NAFLD) activity score, or liver fat percentage in a subject. In some embodiments, the decrease is by about 10% or more, as compared to prior to administration.
- compositions comprising an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases a use of statin (HMG CoA reductase inhibitor) medication. In some embodiments, the decrease is by about 10% or more, as compared to prior to administration.
- compositions comprising an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases a measurement that reflects a phenotype of esophageal varices, portal hypertension, NAFLD, NASH, alcoholic liver disease, liver fibrosis, liver cirrhosis, hepatocellular carcinoma, hyperlipidemia, ischemic heart disease, or coronary heart disease in a subject.
- the decrease is by about 10% or more, as compared to prior to administration.
- compositions comprising an oligonucleotide that targets GPAM and when administered to a subject in an effective amount increases circulating ketone -1- Attorney Docket No.54462-742.601 bodies in a subject.
- the increase is by about 10% or more, as compared to prior to administration.
- the oligonucleotide comprises a modified internucleoside linkage.
- the modified internucleoside linkage comprises alkylphosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate, or carboxymethyl ester, or a combination thereof.
- the modified internucleoside linkage comprises one or more phosphorothioate linkages.
- the oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 modified internucleoside linkages.
- the oligonucleotide comprises a modified nucleoside.
- the modified nucleoside comprises a locked nucleic acid (LNA), hexitol nucleic acid (HLA), cyclohexene nucleic acid (CeNA), 2'-O-(2- methoxyethyl), 2'-O-alkyl, 2'-O-allyl, 2'-O-allyl, 2'-fluoro, or 2'-deoxy, or a combination thereof.
- the modified nucleoside comprises an LNA.
- the modified nucleoside comprises a 2’,4’ constrained ethyl nucleic acid.
- the modified nucleoside comprises a 2'-O-methyl nucleoside, 2'-deoxyfluoro nucleoside, 2'-O-N-methylacetamido (2'- O-NMA) nucleoside, a 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE) nucleoside, 2'-O-aminopropyl (2'-O-AP) nucleoside, or 2'-ara-F, or a combination thereof.
- the modified nucleoside comprises one or more 2’fluoro modified nucleosides.
- the modified nucleoside comprises a 2' O-alkyl modified nucleoside.
- the oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 modified nucleosides.
- the oligonucleotide comprises a hydrophobic moiety attached at a 3’ or 5’ terminus of the oligonucleotide.
- the hydrophobic moiety comprises cholesterol, myristoyl, palmitoyl, stearoyl, lithocholoyl, docosanoyl, docosahexaenoyl, myristyl, palmityl, stearyl, or ⁇ - tocopherol, or a combination thereof.
- the hydrophobic moiety comprises stearyl, t- butylphenyl, n-butylphenyl, octylphenyl, dodecylphenyl, phenyl n-dodecyl, octadecylbenzamide, hexadecylbenzamide, or octadecylcyclohexyl
- the hydrophobic moiety comprises any , , or , wherein the dotted line indicates a covalent connection to an end of the oligonucleotide, n is 1-3, and R is an alkyl group containing 4-18 carbons.
- the oligonucleotide comprises an N-acetylgalactosamine (GalNAc) moiety, an N-acetylglucosamine (GlcNAc) moiety, or a mannose moiety, attached at a 3’ or 5’ terminus of the oligonucleotide.
- the oligonucleotide comprises a GalNAc moiety.
- the oligonucleotide comprises a small interfering RNA (siRNA) comprising a sense strand and an antisense strand.
- siRNA small interfering RNA
- the sense strand is 12-30 nucleosides in length.
- the antisense strand is 12-30 nucleosides in length.
- compositions comprising an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, each strand is independently about 12-30 nucleosides in length, and at least one of the sense strand and the antisense strand comprises a nucleoside sequence comprising about 12-30 contiguous nucleosides of SEQ ID NO: 12867.
- any one of the following is true with regard to the sense strand: (i) all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; (ii) all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; (iii) all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise 2’-O-methyl modified pyrimidines; (iv) all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; (v) all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; or (vi)
- the sense strand comprises any one of modification patterns 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S .
- any one of the following is true with regard to the antisense strand: (i) all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; (ii) all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified -3- Attorney Docket No.54462-742.601 pyrimidines; (iii) all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise 2’ fluoro modified pyrimidines; (iv) all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; (v) all pyrimidines comprise 2’-O- methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and
- the antisense strand comprises any one of modification patterns 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the oligonucleotide comprises an antisense oligonucleotide (ASO).
- ASO antisense oligonucleotide
- the ASO is 12-30 nucleosides in length.
- compositions comprising an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an ASO about 12-30 nucleosides in length and a nucleoside sequence complementary to about 12-30 contiguous nucleosides of SEQ ID NO: 12867.
- Some embodiments include a pharmaceutically acceptable carrier.
- Described herein are methods of treating a subject having liver disease, comprising administering an effective amount of the composition of any one of claims 1-42 to the subject.
- the liver disease comprises NAFLD, NASH, alcoholic liver disease, liver fibrosis, liver cirrhosis, or hepatocellular carcinoma.
- the cardiometabolic disease comprises hyperlipidemia, ischemic heart disease, or coronary heart disease.
- DETAILED DESCRIPTION [005] Large-scale human genetic data can improve the success rate of pharmaceutical discovery and development.
- a Genome Wide Association Study (GWAS) detects associations between genetic variants and traits in a population sample, and this improves understanding of the biology of disease and provides evidence of applicable treatments.
- a GWAS generally utilizes genotyping and/or sequencing data, and often involves an evaluation of millions of genetic variants that are relatively evenly distributed across the genome.
- the most common GWAS design is the case-control study, which involves comparing variant frequencies in cases versus controls. If a variant has a significantly different frequency in cases versus controls, that variant is considered associated with disease.
- Association statistics used in a GWAS include p-values, as a measure of statistical significance; odds ratios (OR), as a measure of effect size; or beta coefficients (beta), as a measure of effect size.
- OR odds ratios
- beta coefficients beta coefficients
- researchers often assume an additive genetic model and calculate an allelic odds ratio, which is the increased (or decreased) risk of disease conferred by each additional copy of an allele (compared to carrying no copies of that allele).
- An additional concept in design and interpretation of GWAS is that of linkage disequilibrium, which is the non-random association of alleles.
- the choice of therapeutic modality depends on factors such as the location of a target (for example, intracellular, extracellular, or secreted), a relevant tissue (for example, fat or liver) and a relevant indication.
- the GPAM also known as GPAT or GPAT1
- the GPAM may include 828 amino acids and have a mass of about 94 kDa.
- GPAM may be expressed in liver, adipose, adrenal, thyroid, heart, gall bladder, brain, salivary gland, and testis cells.
- GPAM may be intracellular.
- GPAM may exist as two different enzymatic forms, in the mitochondria or in the endoplasmic reticulum. GPAM may catalyze the initial and committing step in glycerolipid biosynthesis and can play a significant role in the regulation of cellular triacylglycerol and phospholipid levels.
- the mitochondrial enzyme GPAM may preferentially use saturated fatty acids as a substrate for the synthesis of glycerolipids.
- GPAM may catalyze the first step in this metabolic pathway.
- GPAM may interact with APP, SREBF1, AGPAT1, AGPAT2, AGPAT3, AGPAT4, AGPAT5, AGPAT6, AGPAT9, GPD1, or MBOAT2.
- inhibition of GPAM may serve as a therapeutic for treatment of liver or cardiometabolic diseases or disorders such as non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), alcoholic liver disease, liver fibrosis, liver cirrhosis, hepatocellular carcinoma, hyperlipidemia, ischemic heart disease, or coronary heart disease.
- the GPAM inhibition may result in an improved liver function, cardiovascular function, and metabolic phenotypes including favorable liver fat percentage, liver fibrosis score, NAFLD activity score, liver enzyme function test, serum metabolite test, or serum lipid panel test.
- compositions comprising an oligonucleotide that targets GPAM.
- some embodiments may include inhibiting or targeting a GPAM protein or GPAM RNA.
- a GPAM protein or GPAM RNA For example, by inhibiting or targeting an RNA (e.g. mRNA) encoded by the GPAM gene using an oligonucleotide described herein, the GPAM protein -5- Attorney Docket No.54462-742.601 may be inhibited or targeted as a result of there being less production of the GPAM protein by translation of the GPAM RNA; or a GPAM protein may be targeted or inhibited by an oligonucleotide that binds or interacts with a GPAM RNA and reduces production of the GPAM protein from the GPAM RNA.
- an RNA e.g. mRNA
- a GPAM protein may be targeted or inhibited by an oligonucleotide that binds or interacts with a GPAM RNA and reduces production of the GPAM protein from the GP
- targeting GPAM may refer to binding a GPAM RNA and reducing GPAM RNA or protein levels.
- the oligonucleotide may include a small interfering RNA (siRNA) or an antisense oligonucleotide (ASO). Administration of the oligonucleotide to a subject may improve (e.g.
- compositions comprising an oligonucleotide.
- the composition comprises an oligonucleotide that targets GPAM. In some embodiments, the composition consists of an oligonucleotide that targets GPAM. In some embodiments, the oligonucleotide reduces GPAM mRNA expression in the subject. In some embodiments, the oligonucleotide reduces GPAM protein expression in the subject.
- the oligonucleotide may include a small interfering RNA (siRNA) described herein.
- the oligonucleotide may include an antisense oligonucleotide (ASO) described herein.
- a composition described herein is used in a method of treating a disorder in a subject in need thereof.
- Some embodiments relate to a composition comprising an oligonucleotide for use in a method of treating a disorder as described herein. Some embodiments relate to use of a composition comprising an oligonucleotide, in a method of treating a disorder as described herein.
- Some embodiments include a composition comprising an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases GPAM mRNA or protein levels in a cell, fluid or tissue.
- the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases GPAM mRNA levels in a cell or tissue.
- the tissue is liver tissue.
- the tissue is fat tissue.
- the cell is a hepatocyte.
- the cell is an adipocyte.
- the GPAM mRNA levels are decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration.
- the GPAM mRNA levels are decreased by about 10% or more, as compared to prior to administration.
- the GPAM mRNA levels are decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100%, as compared to prior to administration.
- the GPAM mRNA levels are decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the GPAM mRNA levels are decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the GPAM mRNA levels are -6- Attorney Docket No.54462-742.601 decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration.
- the GPAM mRNA levels are decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases GPAM protein levels in a cell, fluid or tissue.
- the composition decreases GPAM protein levels in a cell or tissue.
- the tissue is liver tissue.
- the tissue is fat tissue.
- the cell is a hepatocyte. In some embodiments, the cell is an adipocyte. In some embodiments, the GPAM protein levels are decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the GPAM protein levels are decreased by about 10% or more, as compared to prior to administration. In some embodiments, the GPAM protein levels are decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100%, as compared to prior to administration.
- the GPAM protein levels are decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the GPAM protein levels are decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the GPAM protein levels are decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration.
- the GPAM protein levels are decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount diminishes a liver disease phenotype.
- the liver disease may include non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), alcoholic liver disease, liver fibrosis, liver cirrhosis, or hepatocellular carcinoma.
- NAFLD non-alcoholic fatty liver disease
- NASH non-alcoholic steatohepatitis
- alcoholic liver disease liver fibrosis, liver cirrhosis, or hepatocellular carcinoma.
- the liver disease phenotype is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration.
- the liver disease phenotype is decreased by about 10% or more, as compared to prior to administration.
- the liver disease phenotype is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the liver disease phenotype is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the liver disease phenotype is decreased by no more than about 10%, as compared to prior to administration.
- the liver disease phenotype is -7- Attorney Docket No.54462-742.601 decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the liver disease phenotype is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount diminishes a cardiometabolic disease phenotype.
- the cardiometabolic disease may include hyperlipidemia, ischemic heart disease, or coronary heart disease.
- the cardiometabolic disease phenotype is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the cardiometabolic disease phenotype is decreased by about 10% or more, as compared to prior to administration.
- the cardiometabolic disease phenotype is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the cardiometabolic disease phenotype is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the cardiometabolic disease phenotype is decreased by no more than about 10%, as compared to prior to administration.
- the cardiometabolic disease phenotype is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the cardiometabolic disease phenotype is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount enhances a protective phenotype against a liver disease in the subject.
- the liver disease may include non-alcoholic fatty liver disease (NAFLD), non- alcoholic steatohepatitis (NASH), alcoholic liver disease, liver fibrosis, liver cirrhosis, or hepatocellular carcinoma.
- NAFLD non-alcoholic fatty liver disease
- NASH non-alcoholic steatohepatitis
- alcoholic liver disease liver fibrosis
- liver cirrhosis liver cirrhosis
- hepatocellular carcinoma hepatocellular carcinoma.
- the protective phenotype is increased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration.
- the protective phenotype is increased by about 10% or more, as compared to prior to administration.
- the protective phenotype is increased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more, as compared to prior to administration. In some embodiments, the protective phenotype is increased by about 200% or more, about 300% or more, about 400% or more, about 500% or more, about 600% or more, about 700% or more, about 800% or more, about 900% or more, or about 1000% or more, as compared to prior to administration.
- the protective phenotype is increased by no more than about 2.5%, no more than about 5%, or no more than -8- Attorney Docket No.54462-742.601 about 7.5%, as compared to prior to administration. In some embodiments, the protective phenotype is increased by no more than about 10%, as compared to prior to administration. In some embodiments, the protective phenotype is increased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or no more than about 100%, as compared to prior to administration.
- the protective phenotype is increased by no more than about 200%, no more than about 300%, no more than about 400%, no more than about 500%, no more than about 600%, no more than about 700%, no more than about 800%, no more than about 900%, or no more than about 1000%, as compared to prior to administration.
- the protective phenotype is increased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, or 1000%, or by a range defined by any of the two aforementioned percentages.
- the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount enhances a protective phenotype against a cardiometabolic disease in the subject.
- the cardiometabolic disease may include hyperlipidemia, ischemic heart disease, or coronary heart disease.
- the protective phenotype is increased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the protective phenotype is increased by about 10% or more, as compared to prior to administration. In some embodiments, the protective phenotype is increased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more, as compared to prior to administration.
- the protective phenotype is increased by about 200% or more, about 300% or more, about 400% or more, about 500% or more, about 600% or more, about 700% or more, about 800% or more, about 900% or more, or about 1000% or more, as compared to prior to administration. In some embodiments, the protective phenotype is increased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the protective phenotype is increased by no more than about 10%, as compared to prior to administration.
- the protective phenotype is increased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or no more than about 100%, as compared to prior to administration. In some embodiments, the protective phenotype is increased by no more than about 200%, no more than about 300%, no more than about 400%, no more than about 500%, no more than about 600%, no more than about 700%, no more than about 800%, no more than about 900%, or no more than about 1000%, as compared to prior to administration.
- the protective phenotype is increased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, or 1000%, or by a range defined by any of the two aforementioned percentages.
- the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases circulating cholesterol in the subject.
- the -9- Attorney Docket No.54462-742.601 circulating cholesterol may include total cholesterol or non-high density lipoprotein (HDL) cholesterol.
- the circulating cholesterol may include total cholesterol.
- the circulating cholesterol may include non- HDL cholesterol.
- the circulating cholesterol is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration.
- the circulating cholesterol is decreased by about 10% or more, as compared to prior to administration.
- the circulating cholesterol is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration.
- the circulating cholesterol is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the circulating cholesterol is decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the circulating cholesterol is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration.
- the circulating cholesterol is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases circulating low density lipoproteins (LDL) in the subject.
- the circulating LDL is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration.
- the circulating LDL is decreased by about 10% or more, as compared to prior to administration. In some embodiments, the circulating LDL is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the circulating LDL is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the circulating LDL is decreased by no more than about 10%, as compared to prior to administration.
- the circulating LDL is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the circulating LDL is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases circulating apolipoprotein B (APOB) in the subject.
- APOB circulating apolipoprotein B
- the circulating APOB is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration.
- the circulating APOB is decreased by about 10% or more, as compared to prior to administration.
- the circulating APOB is decreased by about 20% or more, about 30% or more, about 40% -10- Attorney Docket No.54462-742.601 or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the circulating APOB is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the circulating APOB is decreased by no more than about 10%, as compared to prior to administration.
- the circulating APOB is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the circulating APOB is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases circulating alanine aminotransferase (ALT) in the subject.
- ALT circulating alanine aminotransferase
- the circulating ALT is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration.
- the circulating ALT is decreased by about 10% or more, as compared to prior to administration.
- the circulating ALT is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration.
- the circulating ALT is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the circulating ALT is decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the circulating ALT is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration.
- the circulating ALT is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases circulating aspartate aminotransferase (AST) in the subject.
- the circulating AST is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration.
- the circulating AST is decreased by about 10% or more, as compared to prior to administration. In some embodiments, the circulating AST is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the circulating AST is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the circulating AST is decreased by no more than about 10%, as compared to prior to administration.
- the circulating AST is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than -11- Attorney Docket No.54462-742.601 about 90%, as compared to prior to administration.
- the circulating AST is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases circulating aspartate aminotransferase (ASP) in the subject.
- ASP circulating aspartate aminotransferase
- the circulating ASP is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration.
- the circulating ASP is decreased by about 10% or more, as compared to prior to administration.
- the circulating ASP is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration.
- the circulating ASP is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the circulating ASP is decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the circulating ASP is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration.
- the circulating ASP is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases circulating bilirubin in the subject.
- the circulating bilirubin is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration.
- the circulating bilirubin is decreased by about 10% or more, as compared to prior to administration. In some embodiments, the circulating bilirubin is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the circulating bilirubin is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the circulating bilirubin is decreased by no more than about 10%, as compared to prior to administration.
- the circulating bilirubin is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the circulating bilirubin is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases a nonalcoholic fatty liver disease (NAFLD) activity score in the subject.
- NAFLD activity score is decreased by -12- Attorney Docket No.54462-742.601 about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration.
- the NAFLD activity score is decreased by about 10% or more, as compared to prior to administration.
- the NAFLD activity score is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the NAFLD activity score is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the NAFLD activity score is decreased by no more than about 10%, as compared to prior to administration.
- the NAFLD activity score is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the NAFLD activity score is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases a liver fat percentage in the subject.
- the liver fat percentage is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration.
- the liver fat percentage is decreased by about 10% or more, as compared to prior to administration.
- the liver fat percentage is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration.
- the liver fat percentage is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the liver fat percentage is decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the liver fat percentage is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration.
- the liver fat percentage is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases a liver fibrosis score in the subject.
- the liver fibrosis score is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration.
- the liver fibrosis score is decreased by about 10% or more, as compared to prior to administration. In some embodiments, the liver fibrosis score is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the liver fibrosis score is -13- Attorney Docket No.54462-742.601 decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the liver fibrosis score is decreased by no more than about 10%, as compared to prior to administration.
- the liver fibrosis score is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the liver fibrosis score is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases a use of an HGM CoA reductase inhibitor (e.g. a statin) medication in the subject.
- an HGM CoA reductase inhibitor e.g. a statin
- the use of statin medications is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration.
- the use of statin medications is decreased by about 10% or more, as compared to prior to administration.
- the use of statin medications is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the use of statin medications is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the use of statin medications is decreased by no more than about 10%, as compared to prior to administration.
- the use of statin medications is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the use of statin medications is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount increases circulating ketone bodies in the subject.
- the circulating ketone body 3-hydroxybutyrate is increased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration.
- the circulating ketone body 3-hydroxybutyrate is increased by about 10% or more, as compared to prior to administration.
- the circulating ketone body 3-hydroxybutyrate is increased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more, as compared to prior to administration. In some embodiments, the circulating ketone body 3-hydroxybutyrate is increased by about 200% or more, about 300% or more, about 400% or more, about 500% or more, about 600% or more, about 700% or more, about 800% or more, about 900% or more, or about 1000% or more, as compared to prior to administration.
- the circulating ketone body 3-hydroxybutyrate is increased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the circulating ketone body 3-hydroxybutyrate -14- Attorney Docket No.54462-742.601 is increased by no more than about 10%, as compared to prior to administration. In some embodiments, the circulating ketone body 3-hydroxybutyrate is increased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or no more than about 100%, as compared to prior to administration.
- the circulating ketone body 3-hydroxybutyrate is increased by no more than about 200%, no more than about 300%, no more than about 400%, no more than about 500%, no more than about 600%, no more than about 700%, no more than about 800%, no more than about 900%, or no more than about 1000%, as compared to prior to administration.
- the circulating ketone body 3-hydroxybutyrate is increased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, or 1000%, or by a range defined by any of the two aforementioned percentages.
- the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount increases circulating ketone bodies in the subject.
- the circulating ketone body acetoacetate is increased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the circulating ketone body acetoacetate is increased by about 10% or more, as compared to prior to administration. In some embodiments, the circulating ketone body acetoacetate is increased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more, as compared to prior to administration.
- the circulating ketone body acetoacetate is increased by about 200% or more, about 300% or more, about 400% or more, about 500% or more, about 600% or more, about 700% or more, about 800% or more, about 900% or more, or about 1000% or more, as compared to prior to administration. In some embodiments, the circulating ketone body acetoacetate is increased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the circulating ketone body acetoacetate is increased by no more than about 10%, as compared to prior to administration.
- the circulating ketone body acetoacetate is increased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or no more than about 100%, as compared to prior to administration. In some embodiments, the circulating ketone body acetoacetate is increased by no more than about 200%, no more than about 300%, no more than about 400%, no more than about 500%, no more than about 600%, no more than about 700%, no more than about 800%, no more than about 900%, or no more than about 1000%, as compared to prior to administration.
- the circulating ketone body acetoacetate is increased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, or 1000%, or by a range defined by any of the two aforementioned percentages.
- the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount increases circulating ketone bodies in the subject.
- the circulating ketone body acetone is increased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the circulating ketone body acetone is increased by about 10% or more, as compared to prior to administration. In some embodiments, the circulating ketone body acetone is increased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more, as compared to prior to administration.
- the circulating ketone body acetone is increased by about 200% or more, about 300% or more, about 400% or more, about 500% or more, about 600% or more, about 700% or more, about 800% or more, about 900% or more, or about 1000% or more, as compared to prior to administration. In some embodiments, the circulating ketone body acetone is increased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the circulating ketone body acetone is increased by no more than about 10%, as compared to prior to administration.
- the circulating ketone body acetone is increased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or no more than about 100%, as compared to prior to administration. In some embodiments, the circulating ketone body acetone is increased by no more than about 200%, no more than about 300%, no more than about 400%, no more than about 500%, no more than about 600%, no more than about 700%, no more than about 800%, no more than about 900%, or no more than about 1000%, as compared to prior to administration.
- the circulating ketone body acetone is increased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, or 1000%, or by a range defined by any of the two aforementioned percentages.
- the composition comprises an oligonucleotide that targets GPAM, wherein the oligonucleotide comprises a small interfering RNA (siRNA).
- the composition comprises an oligonucleotide that targets GPAM, wherein the oligonucleotide comprises a small interfering RNA (siRNA) comprising a sense strand and an antisense strand.
- siRNA small interfering RNA
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, wherein the sense strand is 12-30 nucleosides in length.
- the composition comprises a sense strange that is 10, 11, 12, 13, 14, 15, 16, 17, 18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleosides in length, or a range defined by any of the two aforementioned numbers.
- the sense strand may be 14-30 nucleosides in length.
- the composition comprises an antisense strand is 12-30 nucleosides in length.
- the composition comprises an antisense strand that is 10, 11, 12, 13, 14, 15, 16, 17, 18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleosides in length, or a range defined by any of the two aforementioned numbers.
- the antisense strand may be 14-30 nucleosides in length.
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, each strand is independently about 12-30 nucleosides in length, and at least one of the sense strand and the antisense strand comprises a nucleoside sequence comprising about 12-30 contiguous nucleosides of a full-length human GPAM mRNA sequence such as SEQ ID NO: 12867.
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a double-stranded RNA duplex.
- the first base pair of the double-stranded RNA duplex is an AU base pair.
- the sense strand further comprises a 3’ overhang.
- the 3’ overhang comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides, or a range of nucleotides defined by any two of the aforementioned numbers.
- the 3’ overhang comprises 1, 2, or more nucleosides.
- the 3’ overhang comprises 2 nucleosides.
- the sense strand further comprises a 5’ overhang.
- the 5’ overhang comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides, or a range of nucleotides defined by any two of the aforementioned numbers.
- the 5’ overhang comprises 1, 2, or more nucleosides. In some embodiments, the 5’ overhang comprises 2 nucleosides. [0037] In some embodiments, the antisense strand further comprises a 3’ overhang. In some embodiments, the 3’ overhang comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides, or a range of nucleotides defined by any two of the aforementioned numbers. In some embodiments, the 3’ overhang comprises 1, 2, or more nucleosides. In some embodiments, the 3’ overhang comprises 2 nucleosides. In some embodiments, the antisense strand further comprises a 5’ overhang.
- the 5’ overhang comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides, or a range of nucleotides defined by any two of the aforementioned numbers. In some embodiments, the 5’ overhang comprises 1, 2, or more nucleosides. In some embodiments, the 5’ overhang comprises 2 nucleosides. [0038] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, wherein the siRNA binds with a 19mer in a human GPAM mRNA.
- the siRNA binds with a 12mer, a 13mer, a 14mer, a 15mer, a 16mer, a 17mer, a 18mer, a 19mer, a 20mer, a 21mer, a 22mer, a 23mer, a 24mer, or a 25mer in a human GPAM mRNA.
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, wherein the siRNA binds with a 17mer in a non-human primate GPAM mRNA.
- the siRNA binds with a 12mer, a 13mer, a 14mer, a 15mer, a 16mer, a 17mer, a 18mer, a 19mer, a 20mer, a 21mer, a 22mer, a 23mer, a 24mer, or a 25mer in a non-human primate GPAM mRNA.
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, wherein the siRNA binds with a human GPAM mRNA and less than or equal to 20 human off-targets, with no more than 2 mismatches in the antisense strand. In some embodiments, the siRNA binds with a human GPAM mRNA and less than or equal to 10 human off-targets, with no more than 2 mismatches in the antisense strand.
- the siRNA binds with a human GPAM mRNA and less than or equal to 30 human off-targets, with no more than 2 mismatches in the antisense strand. In some embodiments, the siRNA binds with a human GPAM mRNA and less than or equal to 40 human off-targets, with no more than 2 mismatches in the antisense strand. In some embodiments, the siRNA binds with a human GPAM mRNA and less than or equal to 50 human off-targets, with no more than 2 mismatches in the antisense strand.
- the siRNA binds with a human GPAM mRNA and less than or equal to 10 human off-targets, with no more than 3 mismatches in the antisense strand. In some embodiments, the siRNA binds with a human GPAM mRNA and less than or equal to 20 human off-targets, with no more than 3 mismatches in the antisense strand. In some embodiments, the siRNA binds with a human GPAM mRNA and less than or equal to 30 human off-targets, with no more than 3 mismatches in the antisense strand.
- the siRNA binds with a human GPAM mRNA and less than or equal to 40 human off-targets, with no more than 3 mismatches in the antisense strand. In some embodiments, the siRNA binds with a human GPAM mRNA and less than or equal to 50 human off-targets, with no more than 3 mismatches in the antisense strand.
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, siRNA binds with a human GPAM mRNA target site that does not harbor an SNP, with a minor allele frequency (MAF) greater or equal to 1% (pos.2-18).
- siRNA binds with a human GPAM mRNA target site that does not harbor an SNP, with a minor allele frequency (MAF) greater or equal to 1% (pos.2-18).
- the MAF is greater or equal to about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, or about 20%.
- the siRNA comprises a sense strand having a sequence in accordance with any of SEQ ID NOs: 1-6354.
- the sense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 1-6354, at least 80% identical to any one of SEQ ID NOs: 1-6354, at least 85% identical to of any one of SEQ ID NOs: 1-6354, at least 90% identical to any one of SEQ ID NOs1-6354, or at least 95% identical to any one of SEQ ID NOs: 1-6354.
- the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 1-6354, or a sense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions.
- the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 1-6354, or a sense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 1-6354.
- the sense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the sense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, -18- Attorney Docket No.54462-742.601 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the sense strand may comprise a modification pattern described herein.
- the sense strand may comprise an overhang.
- the sense strand may comprise a lipid moiety.
- the sense strand may comprise a GalNAc moiety.
- the siRNA comprises an antisense strand having a sequence in accordance with any of SEQ ID NOs: 6355-12708.
- the antisense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 6355-12708, at least 80% identical to any one of SEQ ID NOs: 6355-12708, at least 85% identical to of any one of SEQ ID NOs: 6355- 12708, at least 90% identical to any one of SEQ ID NOs: 6355-12708, or at least 95% identical to any one of SEQ ID NOs: 6355-12708.
- the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 6355-12708, or an antisense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 6355-12708, or an antisense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 6355-12708.
- the antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the antisense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the antisense strand may comprise an overhang.
- the antisense strand may comprise a modification pattern described herein.
- the antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand having a sequence in accordance with any of SEQ ID NOs: 13082-13402.
- the sense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 13082-13402, at least 80% identical to any one of SEQ ID NOs: 13082-13402, at least 85% identical to of any one of SEQ ID NOs: 13082-13402, at least 90% identical to any one of SEQ ID NOs13082-13402, or at least 95% identical to any one of SEQ ID NOs: 13082-13402.
- the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13082-13402, or a sense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13082-13402, or a sense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 13082-13402.
- the sense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the sense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the sense strand may comprise a modification pattern described herein.
- the sense strand may comprise an overhang.
- the sense strand may comprise a lipid moiety.
- the sense strand may comprise a GalNAc moiety.
- the siRNA comprises an antisense strand having a sequence in accordance with any of SEQ ID NOs: 13403- 13723.
- the antisense strand sequence comprises or consists of sequence at least -19- Attorney Docket No.54462-742.601 75% identical to any one of SEQ ID NOs: 13403-13723, at least 80% identical to any one of SEQ ID NOs: 13403-13723, at least 85% identical to of any one of SEQ ID NOs: 13403-13723, at least 90% identical to any one of SEQ ID NOs: 13403-13723, or at least 95% identical to any one of SEQ ID NOs: 13403-13723.
- the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13403-13723, or an antisense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13403-13723, or an antisense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 13403- 13723.
- the antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the antisense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the antisense strand may comprise an overhang.
- the antisense strand may comprise a modification pattern described herein.
- the antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of subset A.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of subset A.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset A, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of subset B.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of subset B.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset B, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset B, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of subset B.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of subset C.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of subset C.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset C, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset C, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of subset C.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of subset D.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of subset D.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset D, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset D, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of subset D.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset E, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of subset E.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of subset F.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at -21- Attorney Docket No.54462-742.601 least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of subset F.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset F, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset F, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of subset F.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of subset I.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of subset I.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset I, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset I, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of subset I.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of subset J.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of subset J.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset J, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset J, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of subset J.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA herein (such as an siRNA in a table herein).
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of an siRNA herein.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of an siRNA herein, -22- Attorney Docket No.54462-742.601 or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of an siRNA herein, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of an siRNA herein.
- the sense strand or antisense strand may comprise an overhang.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 8.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 8.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 8, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 8, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 8. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 9.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 9.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 9, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 9, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 9. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 11A.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 11A.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 11A, or a sequence thereof having 3 -23- Attorney Docket No.54462-742.601 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 11A, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 11A.
- the sense strand or antisense strand may comprise an overhang.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 11B.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 11B.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 14.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 14.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 14, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 14, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 14. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 18.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 18.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 22.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 22.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 22, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 22, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 22. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 25, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 25, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 25. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 28.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 28.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 28, or a sequence thereof having 3 or -25- Attorney Docket No.54462-742.601 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 28, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 28.
- the sense strand or antisense strand may comprise an overhang.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 31.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 31.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 31, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 31, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 31. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 35, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 35, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 35. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 49.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 49.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 49, or a sequence thereof having 3 or -26- Attorney Docket No.54462-742.601 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 49, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 49.
- the sense strand or antisense strand may comprise an overhang.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 63.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 63.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 63, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 63, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 63. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 66.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 66.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 66, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 66, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 66. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand having a sequence in accordance with any of SEQ ID NOs: 13329, 13334, 13335, 13091, 13259, 13260, 13261, 13262, 13263, 13264, 13265, 13266, 13336, 13311, 13312, 13341, 13099, 13165, 13166, 13167, 13168, 13169, 13170, 13171, 13172, 13173, 13100, 13157, 13158, 13159, 13160, 13161, 13162, 13163, 13164, 13344, 13103, 13216, 13217, 13218, 13219, 13220, 13221, 13222, 13223, 13224, 13307, 13308, 13309, 13310, 13345, 13346, 13106, 13267,
- the sense -27- Attorney Docket No.54462-742.601 strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 13329, 13334, 13335, 13091, 13259, 13260, 13261, 13262, 13263, 13264, 13265, 13266, 13336, 13311, 13312, 13341, 13099, 13165, 13166, 13167, 13168, 13169, 13170, 13171, 13172, 13173, 13100, 13157, 13158, 13159, 13160, 13161, 13162, 13163, 13164, 13344, 13103, 13216, 13217, 13218, 13219, 13220, 13221, 13222, 13223, 13224, 13307, 13308, 13309, 13310, 13345, 13346, 13106, 13267, 13268, 13269, 13270, 13271
- the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13329, 13334, 13335, 13091, 13259, 13260, 13261, 13262, 13263, 13264, 13265, 13266, 13336, 13311, 13312, 13341, 13099, 13165, 13166, 13167, 13168, 13169, 13170, 13171, 13172, 13173, 13100, 13157, 13158, 13159, 13160, 13161, 13162, 13163, 13164, 13344, 13103, 13216, 13217, 13218, 13219, 13220, 13221, 13222, 13223, 13224, 13307, 13308, 13309, 13310, 13345, 13346, 13106, 13267, 13268, 13269, 13270, 13271, 13272, 13273, and 13274., or a sense
- the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13329, 13334, 13335, 13091, 13259, 13260, 13261, 13262, 13263, 13264, 13265, 13266, 13336, 13311, 13312, 13341, 13099, 13165, 13166, 13167, 13168, 13169, 13170, 13171, 13172, 13173, 13100, 13157, 13158, 13159, 13160, 13161, 13162, 13163, 13164, 13344, 13103, 13216, 13217, 13218, 13219, 13220, 13221, 13222, 13223, 13224, 13307, 13308, 13309, 13310, 13345, 13346, 13106, 13267, 13268, 13269, 13270, 13271, 13272, 13273, and 13274., or a sense
- the sense strand sequence comprises or consists of a sequence 100% identical to -28- Attorney Docket No.54462-742.601 SEQ ID NOs: 13329, 13334, 13335, 13091, 13259, 13260, 13261, 13262, 13263, 13264, 13265, 13266, 13336, 13311, 13312, 13341, 13099, 13165, 13166, 13167, 13168, 13169, 13170, 13171, 13172, 13173, 13100, 13157, 13158, 13159, 13160, 13161, 13162, 13163, 13164, 13344, 13103, 13216, 13217, 13218, 13219, 13220, 13221, 13222, 13223, 13224, 13307, 13308, 13309, 13310, 13345, 13346, 13106, 13267, 13268, 13269, 13270, 13271, 13272
- the siRNA comprises an antisense strand having a sequence in accordance with any of SEQ ID NOs: 13650, 13655, 13656, 13412, 13580, 13581, 13582, 13583, 13584, 13585, 13586, 13587, 13657, 13632, 13633, 13662, 13420, 13486, 13487, 13488, 13489, 13490, 13491, 13492, 13493, 13494, 13421, 13478, 13479, 13480, 13481, 13482, 13483, 13484, 13485, 13665, 13424, 13537, 13538, 13539, 13540, 13541, 13542, 13543, 13544, 13545, 13628, 13629, 13630, 13631, 13666, 13667, 13427, 13588, 13589, 13590, 13591, 13592, 13593, 13594, or
- the antisense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 13650, 13655, 13656, 13412, 13580, 13581, 13582, 13583, 13584, 13585, 13586, 13587, 13657, 13632, 13633, 13662, 13420, 13486, 13487, 13488, 13489, 13490, 13491, 13492, 13493, 13494, 13421, 13478, 13479, 13480, 13481, 13482, 13483, 13484, 13485, 13665, 13424, 13537, 13538, 13539, 13540, 13541, 13542, 13543, 13544, 13545, 13628, 13629, 13630, 13631, 13666, 13667, 13427, 13588, 13589, 13590, 13591, 13592, 13593, 13594, or 1359
- the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13650, 13655, 13656, 13412, 13580, 13581, 13582, 13583, 13584, 13585, 13586, 13587, 13657, 13632, 13633, 13662, 13420, 13486, 13487, 13488, 13489, 13490, 13491, 13492, 13493, 13494, 13421, 13478, 13479, 13480, 13481, 13482, 13483, 13484, 13485, 13665, 13424, 13537, 13538, 13539, 13540, 13541, 13542, 13543, 13544, 13545, 13628, 13629, 13630, 13631, 13666, 13667, 13427, 13588, 13589, 13590, 13591, 13592, 13593, 13594, or 13595, or an anti
- the antisense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 13650, 13655, 13656, 13412, 13580, 13581, 13582, 13583, 13584, 13585, 13586, 13587, 13657, 13632, 13633, 13662, 13420, 13486, 13487, 13488, 13489, 13490, 13491, 13492, 13493, 13494, 13421, 13478, 13479, 13480, 13481, 13482, 13483, 13484, 13485, 13665, 13424, 13537, 13538, 13539, 13540, 13541, 13542, 13543, 13544, 13545, 13628, 13629, 13630, 13631, 13666, 13667, 13427, 13588, 13589, 13590, 13591, 13592, 13593, 13594, or 13595.
- the antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the antisense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the antisense strand may comprise an overhang.
- the antisense strand may comprise a modification pattern described herein.
- the antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand having a sequence in accordance with any of SEQ ID NOs: 13329, 13334, 13335, 13260, 13264, 13336, 13311, 13341, 13168, 13173, 13161, 13344, 13224, 13345, 13346, 13267, 13268, 13353, 13358, 13359, 13276, 13280, 13360, 13317, 13365, 13185, 13190, 13178, 13368, 13241, 13369, 13370, 13283, 13284, 13377, 13382, 13383, 13292, 13296, 13384, 13323, 13389, 13202, 13207, 13195, 13392, 13258, 13393, 13394, 13299, or 13300.
- the sense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 13329, 13334, 13335, 13260, 13264, 13336, 13311, 13341, 13168, 13173, 13161, 13344, 13224, 13345, 13346, 13267, 13268, 13353, 13358, 13359, 13276, 13280, 13360, 13317, 13365, 13185, 13190, 13178, 13368, 13241, 13369, 13370, 13283, 13284, 13377, 13382, 13383, 13292, 13296, 13384, 13323, 13389, 13202, 13207, 13195, 13392, 13258, 13393, 13394, 13299, or 13300, at least 80% identical to any one of SEQ ID NOs: 13329, 13334, 13335, 13260, 13264, 13336,
- the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13329, 13334, 13335, 13260, 13264, 13336, 13311, 13341, 13168, 13173, 13161, 13344, 13224, 13345, 13346, 13267, 13268, 13353, 13358, 13359, 13276, 13280, 13360, 13317, 13365, 13185, 13190, 13178, 13368, 13241, 13369, 13370, 13283, 13284, 13377, 13382, 13383, 13292, 13296, 13384, 13323, 13389, 13202, 13207, 13195, 13392, 13258, 13393, 13394, 13299, or 13300, or a sense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions.
- the antisense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 13650, 13655, 13656, 13581, 13585, 13657, 13632, 13662, 13489, 13494, 13482, 13665, 13545, 13666, 13667, 13588, 13589, 13674, 13679, 13680, 13597, 13601, 13681, 13638, 13686, 13506, 13511, 13499, 13689, 13562, 13690, 13691, 13604, 13605, 13698, 13703, 13704, 13613, 13617, 13705, 13644, 13710, 13523, 13528, 13516, 13713, 13579, 13714, 13715, 13620, or 13621, at least 80% identical to any one of SEQ ID NOs: 13650, 13655, 13656, 13581, 13
- the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13650, 13655, 13656, 13581, 13585, 13657, 13632, 13662, 13489, 13494, 13482, 13665, 13545, 13666, 13667, 13588, 13589, 13674, 13679, 13680, 13597, 13601, 13681, 13638, 13686, 13506, 13511, 13499, 13689, 13562, 13690, 13691, 13604, 13605, 13698, 13703, 13704, 13613, 13617, 13705, 13644, 13710, 13523, 13528, 13516, 13713, 13579, 13714, 13715, 13620, or 13621, or an antisense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions.
- the antisense strand sequence -32- Attorney Docket No.54462-742.601 comprises or consists of a sequence 100% identical to SEQ ID NOs: 13650, 13655, 13656, 13581, 13585, 13657, 13632, 13662, 13489, 13494, 13482, 13665, 13545, 13666, 13667, 13588, 13589, 13674, 13679, 13680, 13597, 13601, 13681, 13638, 13686, 13506, 13511, 13499, 13689, 13562, 13690, 13691, 13604, 13605, 13698, 13703, 13704, 13613, 13617, 13705, 13644, 13710, 13523, 13528, 13516, 13713, 13579, 13714, 13715, 13620, or 13621.
- the antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the antisense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the antisense strand may comprise an overhang.
- the antisense strand may comprise a modification pattern described herein.
- the antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an antisense oligonucleotide (ASO).
- ASO antisense oligonucleotide
- the ASO is 12-30 nucleosides in length.
- the ASO is 14-30 nucleosides in length.
- the ASO is at least about 10, 11, 12, 13, 14, 15, 16, 17, 18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleosides in length, or a range defined by any of the two aforementioned numbers.
- the ASO is 15-25 nucleosides in length.
- the ASO is 20 nucleosides in length.
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an ASO about 12-30 nucleosides in length and comprising a nucleoside sequence complementary to about 12-30 contiguous nucleosides of a full- length human GPAM mRNA sequence such as SEQ ID NO: 12867; wherein (i) the oligonucleotide comprises a modification comprising a modified nucleoside and/or a modified internucleoside linkage, and/or (ii) the composition comprises a pharmaceutically acceptable carrier.
- the ASO comprise a nucleoside sequence complementary to at least about 10, 11, 12, 13, 14, 15, 16, 17, 18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more contiguous nucleosides of one of SEQ ID NO: 12867.
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises a modification comprising a modified nucleoside and/or a modified internucleoside linkage, and/or (ii) the composition comprises a pharmaceutically acceptable carrier.
- the oligonucleotide comprises a modification comprising a modified nucleoside and/or a modified internucleoside linkage. In some embodiments, the oligonucleotide comprises a modified internucleoside linkage. In some embodiments, the modified internucleoside linkage comprises alkylphosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate, or carboxymethyl ester, or a combination thereof. In some embodiments, the modified internucleoside linkage comprises one or more phosphorothioate linkages.
- a phosphorothioate may include a nonbridging oxygen atom in a phosphate backbone of the oligonucleotide that is replaced by -33- Attorney Docket No.54462-742.601 sulfur.
- Modified internucleoside linkages may be included in siRNAs or ASOs. Benefits of the modified internucleoside linkage may include decreased toxicity or improved pharmacokinetics.
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises a modified internucleoside linkage, wherein the oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 modified internucleoside linkages, or a range of modified internucleoside linkages defined by any two of the aforementioned numbers.
- the oligonucleotide comprises no more than 18 modified internucleoside linkages.
- the oligonucleotide comprises no more than 20 modified internucleoside linkages.
- the oligonucleotide comprises 2 or more modified internucleoside linkages, 3 or more modified internucleoside linkages, 4 or more modified internucleoside linkages, 5 or more modified internucleoside linkages, 6 or more modified internucleoside linkages, 7 or more modified internucleoside linkages, 8 or more modified internucleoside linkages, 9 or more modified internucleoside linkages, 10 or more modified internucleoside linkages, 11 or more modified internucleoside linkages, 12 or more modified internucleoside linkages, 13 or more modified internucleoside linkages, 14 or more modified internucleoside linkages, 15 or more modified internucleoside linkages, 16 or more modified internucleoside linkages, 17 or more modified internucleoside linkages, 18 or more modified internucleoside linkages, 19 or more modified internucleoside linkages, or 20 or more modified internucleoside linkages.
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises the modified nucleoside.
- the modified nucleoside comprises a locked nucleic acid (LNA), hexitol nucleic acid (HLA), cyclohexene nucleic acid (CeNA), 2'-O-(2-methoxyethyl), 2'-O-alkyl, 2'-O-allyl, 2'-fluoro, or 2'- deoxy, or a combination thereof.
- the modified nucleoside comprises a LNA.
- the modified nucleoside comprises a 2’,4’ constrained ethyl nucleic acid. In some embodiments, the modified nucleoside comprises HLA. In some embodiments, the modified nucleoside comprises CeNA. In some embodiments, the modified nucleoside comprises a 2'-methoxyethyl group. In some embodiments, the modified nucleoside comprises a 2'-O-(2-methoxyethyl) group. In some embodiments, the modified nucleoside comprises a 2'-O-alkyl group. In some embodiments, the modified nucleoside comprises a 2'-O-allyl group. In some embodiments, the modified nucleoside comprises a 2'- fluoro group.
- the modified nucleoside comprises a 2'-deoxy group. In some embodiments, the modified nucleoside comprises a 2'-O-(2-methoxyethyl). In some embodiments, the modified nucleoside comprises a 2'-O-methyl nucleoside, 2'-deoxyfluoro nucleoside, 2'-O-N- methylacetamido (2'-O-NMA) nucleoside, a 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE) nucleoside, 2'-O-aminopropyl (2'-O-AP) nucleoside, or 2'-ara-F, or a combination thereof.
- the modified nucleoside comprises a 2'-O-methyl nucleoside. In some embodiments, the modified nucleoside comprises a 2'-deoxyfluoro nucleoside. In some embodiments, the modified nucleoside comprises a 2'-O-NMA nucleoside. In some embodiments, the modified nucleoside comprises a 2'-O-DMAEOE nucleoside. In some embodiments, the modified nucleoside comprises a 2'-O- aminopropyl (2'-O-AP) nucleoside. In some embodiments, the modified nucleoside comprises 2'-ara-F.
- the modified nucleoside comprises one or more 2’fluoro modified nucleosides. In some embodiments, the modified nucleoside comprises a 2' O-alkyl modified nucleoside. Benefits of the modified nucleoside may include decreased toxicity or improved pharmacokinetics. [0076] In some embodiments, the oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 modified nucleosides, or a range of nucleosides defined by any two of the aforementioned numbers. In some embodiments, the oligonucleotide comprises no more than 19 modified nucleosides.
- the oligonucleotide comprises no more than 21 modified nucleosides. In some embodiments, the oligonucleotide comprises 2 or more modified nucleosides, 3 or more modified nucleosides, 4 or more modified nucleosides, 5 or more modified nucleosides, 6 or more modified nucleosides, 7 or more modified nucleosides, 8 or more modified nucleosides, 9 or more modified nucleosides, 10 or more modified nucleosides, 11 or more modified nucleosides, 12 or more modified nucleosides, 13 or more modified nucleosides, 14 or more modified nucleosides, 15 or more modified nucleosides, 16 or more modified nucleosides, 17 or more modified nucleosides, 18 or more modified nucleosides, 19 or more modified nucleosides, 20 or more modified nucleosides, or 21 or more modified nucleosides.
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises a moiety attached at a 3’ or 5’ terminus of the oligonucleotide.
- moieties include a hydrophobic moiety or a sugar moiety, or a combination thereof.
- the oligonucleotide is an siRNA having a sense strand, and the moiety is attached to a 5’ end of the sense strand.
- the oligonucleotide is an siRNA having a sense strand, and the moiety is attached to a 3’ end of the sense strand.
- the oligonucleotide is an siRNA having an antisense strand, and the moiety is attached to a 5’ end of the antisense strand. In some embodiments, the oligonucleotide is an siRNA having an antisense strand, and the moiety is attached to a 3’ end of the antisense strand. In some embodiments, the oligonucleotide is an ASO, and the moiety is attached to a 5’ end of the ASO. In some embodiments, the oligonucleotide is an ASO, and the moiety is attached to a 3’ end of the ASO. [0078] The oligonucleotide may include purines.
- all purines of the oligonucleotide comprise 2’ fluoro modified purines. In some embodiments, all purines of the oligonucleotide comprise 2’-O-methyl modified purines. In some embodiments, all purines of the oligonucleotide comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. 2’-O-methyl may include 2’ O-methyl.
- pyrimidines of the oligonucleotide comprise 2’ fluoro modified pyrimidines. In some embodiments, pyrimidines of the oligonucleotide comprise 2’-O-methyl modified pyrimidines.
- pyrimidines of the oligonucleotide comprise 2’-O-methyl modified pyrimidines, and purines of the oligonucleotide comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines.
- pyrimidines of the oligonucleotide comprise 2’ fluoro modified pyrimidines, and purines of the oligonucleotide comprise 2’- O-methyl modified purines.
- pyrimidines of the oligonucleotide comprise 2’-O- methyl modified pyrimidines, and purines of the oligonucleotide comprise 2’ fluoro modified purines.
- all purines of the oligonucleotide comprise 2’ fluoro modified purines, and all pyrimidines of the oligonucleotide comprise 2’-O-methyl modified pyrimidines. In some embodiments, all purines of the oligonucleotide comprise 2’-O-methyl modified purines, and all pyrimidines of the oligonucleotide comprise 2’ fluoro modified pyrimidines. In some embodiments, all pyrimidines of the oligonucleotide comprise 2’ fluoro modified pyrimidines, and all purines of the oligonucleotide comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines.
- all pyrimidines of the oligonucleotide comprise 2’-O-methyl modified pyrimidines, and all purines of the oligonucleotide comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, all pyrimidines of the oligonucleotide comprise 2’ fluoro modified pyrimidines, and all purines of the oligonucleotide comprise 2’-O-methyl modified purines. In some embodiments, all pyrimidines of the oligonucleotide comprise 2’-O-methyl modified pyrimidines, and all purines of the oligonucleotide comprise 2’ fluoro modified purines.
- the oligonucleotide comprises a particular modification pattern.
- position 9 counting from the 5’ end of the of a strand of the oligonucleotide may have a 2’F modification.
- position 9 of a strand of the oligonucleotide is a pyrimidine, then all purines in a strand of the oligonucleotide have a 2’OMe modification.
- -36- Attorney Docket No.54462-742.601 when position 9 is the only pyrimidine between positions 5 and 11 of the sense stand, then position 9 is the only position with a 2’F modification in a strand of the oligonucleotide.
- position 9 and only one other base between positions 5 and 11 of a strand of the oligonucleotide are pyrimidines, then both of these pyrimidines are the only two positions with a 2’F modification in a strand of the oligonucleotide.
- any combination of 2’F modifications can be made that give three 2’F modifications in total.
- all combinations of pyrimidines having the 2’F modification are allowed that have three to five 2’F modifications in total, provided that a strand of the oligonucleotide does not have three 2’F modifications in a row.
- a strand of the oligonucleotide of any of the siRNAs comprises a modification pattern which conforms to any or all of these a strand of the oligonucleotide rules.
- position 9 of a strand of the oligonucleotide is a purine
- all purines in a strand of the oligonucleotide have a 2’OMe modification.
- position 9 is the only purine between positions 5 and 11 of the sense stand, then position 9 is the only position with a 2’F modification in a strand of the oligonucleotide.
- both of these purines are the only two positions with a 2’F modification in a strand of the oligonucleotide.
- position 9 and only two other bases between positions 5 and 11 of a strand of the oligonucleotide are purines, and those two other purines are in adjacent positions so that there would be not three 2’F modifications in a row, then any combination of 2’F modifications can be made that give three 2’F modifications in total.
- a strand of the oligonucleotide of any of the siRNAs comprises a modification pattern which conforms to any or all of these a strand of the oligonucleotide rules.
- position 9 of a strand of the oligonucleotide can be a 2’deoxy.
- a strand of the oligonucleotide of any of the siRNAs comprises a modification pattern which conforms to these a strand of the oligonucleotide rules.
- position nine of the sense strand comprises a 2’ fluoro-modified pyrimidine.
- all purines of the sense strand comprise 2’-O-methyl modified purines.
- 1, 2, 3, 4, or 5 pyrimidines between positions 5 and 11 comprise a 2’flouro- modified pyrimidine, provided there are not three 2’ fluoro-modified pyrimidines in a row.
- the odd-numbered positions of the antisense strand comprise 2’-O-methyl modified nucleotides.
- the even-numbered positions of the antisense strand comprise 2’flouro-modified nucleotides and unmodified deoxyribonucleotide.
- the even- -37- Attorney Docket No.54462-742.601 numbered positions of the antisense strand comprise 2’flouro-modified nucleotides, 2’-O-methyl modified nucleotides and unmodified deoxyribonucleotide.
- position nine of the sense strand comprises a 2’ fluoro-modified pyrimidine; all purines of the sense strand comprises 2’-O-methyl modified purines; 1, 2, 3, 4, or 5 pyrimidines between positions 5 and 11 comprise a 2’flouro-modified pyrimidine, provided there are not three 2’ fluoro-modified pyrimidines in a row; the odd-numbered positions of the antisense strand comprise 2’-O-methyl modified nucleotides; and the even-numbered positions of the antisense strand comprise 2’flouro-modified nucleotides and unmodified deoxyribonucleotides.
- position nine of the sense strand comprises a 2’ fluoro-modified purine.
- all pyrimidines of the sense strand comprise 2’-O-methyl modified purines.
- 1, 2, 3, 4, or 5 purines between positions 5 and 11 comprise a 2’flouro-modified purine, provided there are not three 2’ fluoro-modified purine in a row.
- the odd- numbered positions of the antisense strand comprise 2’-O-methyl modified nucleotides.
- the even-numbered positions of the antisense strand comprise 2’flouro-modified nucleotides and unmodified deoxyribonucleotide.
- the even-numbered positions of the antisense strand comprise 2’flouro-modified nucleotides, 2’-O-methyl modified nucleotides and unmodified deoxyribonucleotide.
- position nine of the sense strand comprises a 2’ fluoro-modified purine; all pyrimidine of the sense strand comprises 2’-O-methyl modified pyrimidines; 1, 2, 3, 4, or 5 purines between positions 5 and 11 comprise a 2’flouro-modified purines, provided there are not three 2’ fluoro-modified purines in a row; the odd-numbered positions of the antisense strand comprise 2’-O-methyl modified nucleotides; and the even-numbered positions of the antisense strand comprise 2’flouro-modified nucleotides and unmodified deoxyribonucleotides.
- position nine of the sense strand comprises an unmodified deoxyribonucleotide.
- positions 5, 7, and 8 of the sense strand comprise 2’fluoro- modifed nucleotides.
- all pyrimidines in positions 10 to 21 of the sense strand comprise 2’-O-methyl modified pyrimidines and all purines in positions 10 to 21 of the comprise 2’-O- methyl modified purines or 2’fluoro-modified purines.
- the odd-numbered positions of the antisense strand comprise 2’-O-methyl modified nucleotides. In some embodiments, the even- numbered positions of the antisense strand comprise 2’flouro-modified nucleotides and unmodified deoxyribonucleotides. In some embodiments, the even-numbered positions of the antisense strand comprise 2’flouro-modified nucleotides, 2’-O-methyl modified nucleotides and unmodified deoxyribonucleotides.
- position nine of the sense strand comprises an unmodified deoxyribonucleotide; positions 5, 7, and 8 of the sense strand comprise 2’fluoro-modifed nucleotides; all pyrimidines in positions 10 to 21 of the sense strand comprise 2’-O-methyl modified pyrimidines and all purines in positions 10 to 21 of the comprise 2’-O-methyl modified purines or 2’fluoro-modified purines; the odd-numbered positions of the antisense strand comprise 2’-O-methyl modified nucleotides; and the -38- Attorney Docket No.54462-742.601 even-numbered positions of the antisense strand comprise 2’flouro-modified nucleotides and unmodified deoxyribonucleotides.
- position nine of the sense strand comprises an unmodified deoxyribonucleotide.
- positions 5, 7, and 8 of the sense strand comprise 2’fluoro- modifed nucleotides.
- all purines in positions 10 to 21 of the sense strand comprise 2’-O-methyl modified purines and all pyrimidines in positions 10 to 21 of the comprise 2’-O-methyl modified pyrimidines or 2’fluoro-modified pyrimidines.
- the odd-numbered positions of the antisense strand comprise 2’-O-methyl modified nucleotides.
- the even-numbered positions of the antisense strand comprise 2’flouro-modified nucleotides and unmodified deoxyribonucleotides. In some embodiments, the even-numbered positions of the antisense strand comprise 2’flouro-modified nucleotides, 2’-O-methyl modified nucleotides and unmodified deoxyribonucleotides.
- position nine of the sense strand comprises an unmodified deoxyribonucleotide; positions 5, 7, and 8 of the sense strand comprise 2’fluoro-modifed nucleotides; all purines in positions 10 to 21 of the sense strand comprise 2’-O-methyl modified purines and all pyrimidines in positions 10 to 21 of the comprise 2’-O-methyl modified pyrimidines or 2’fluoro-modified pyrimidines; the odd-numbered positions of the antisense strand comprise 2’-O-methyl modified nucleotides; and the even-numbered positions of the antisense strand comprise 2’flouro-modified nucleotides and unmodified deoxyribonucleotide.
- the moiety includes a negatively charged group attached at a 5’ end of the oligonucleotide. This may be referred to as a 5’-end group.
- the negatively charged group is attached at a 5’ end of an antisense strand of an siRNA disclosed herein.
- the 5’-end group may be or include a 5’-end phosphorothioate, 5’-end phosphorodithioate, 5’-end vinylphosphonate (5’-VP), 5’-end methylphosphonate, 5’-end cyclopropyl phosphonate, or a 5’-deoxy-5’-C-malonyl.
- the 5’-end group may comprise 5’-VP.
- the 5’-VP comprises a trans-vinylphosphate or cis-vinylphosphate.
- the 5’-end group may include an extra 5’ phosphate.
- a combination of 5’-end groups may be used.
- the oligonucleotide includes a negatively charged group.
- the negatively charged group may aid in cell or tissue penetration.
- the negatively charged group may be attached at a 5’ or 3’ end (e.g. a 5’ end) of the oligonucleotide. This may be referred to as an end group.
- the end group may be or include a phosphorothioate, phosphorodithioate, vinylphosphonate, methylphosphonate, cyclopropyl phosphonate, or a deoxy-C-malonyl.
- the end group may include an extra 5’ phosphate such as an extra 5’ phosphate.
- a combination of end groups may be used.
- the oligonucleotide includes a phosphate mimic.
- the phosphate mimic comprises vinyl phosphonate.
- the vinyl phosphonate comprises a trans-vinylphosphate.
- the vinyl phosphonate comprises a cis-vinylphosphate.
- the vinyl phosphonate increases the stability of the oligonucleotide. In some embodiments, the vinyl phosphonate increases the accumulation of the oligonucleotide in tissues. In some embodiments, the vinyl phosphonate protects the oligonucleotide from an exonuclease or a phosphatase. In some embodiments, the vinyl phosphonate improves the binding affinity of the oligonucleotide with the siRNA processing machinery.
- the oligonucleotide includes 1 vinyl phosphonate. In some embodiments, the oligonucleotide includes 2 vinyl phosphonates. In some embodiments, the oligonucleotide includes 3 vinyl phosphonates. In some embodiments, the oligonucleotide includes 4 vinyl phosphonates. In some embodiments, the antisense strand of the oligonucleotide comprises a vinyl phosphonate at the 5’ end. In some embodiments, the antisense strand of the oligonucleotide comprises a vinyl phosphonate at the 3’ end.
- the sense strand of the oligonucleotide comprises a vinyl phosphonate at the 5’ end. In some embodiments, the sense strand of the oligonucleotide comprises a vinyl phosphonate at the 3’ end.
- Hydrophobic moieties [0095] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises a hydrophobic moiety.
- the hydrophobic moiety may be attached at a 3’ or 5’ terminus of the oligonucleotide.
- the hydrophobic moiety may include a lipid such as a fatty acid.
- the hydrophobic moiety may include a hydrocarbon.
- the hydrocarbon may be linear.
- the hydrocarbon may be non-linear.
- the hydrophobic moiety may include a lipid moiety or a cholesterol moiety, or a combination thereof.
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises a lipid attached at a 3’ or 5’ terminus of the oligonucleotide.
- the lipid comprises cholesterol, myristoyl, palmitoyl, stearoyl, lithocholoyl, docosanoyl, docosahexaenoyl, myristyl, palmityl, stearyl, or ⁇ -tocopherol, or a combination thereof.
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises a hydrophobic ligand or moiety.
- the hydrophobic ligand or moiety comprises cholesterol.
- the hydrophobic ligand or moiety comprises a cholesterol derivative.
- the hydrophobic -40- Attorney Docket No.54462-742.601 ligand or moiety is attached at a 3’ terminus of the oligonucleotide. In some embodiments, the hydrophobic ligand or moiety s attached at a 5’ terminus of the oligonucleotide. In some embodiments, the composition comprises a sense strand, and the hydrophobic ligand or moiety is attached to the sense strand (e.g. attached to a 5’ end of the sense strand, or attached to a 3’ end of the sense strand). In some embodiments, the composition comprises an antisense strand, and the hydrophobic ligand or moiety is attached to the antisense strand (e.g.
- the composition comprises a hydrophobic ligand or moiety attached at a 3’ or 5’ terminus of the oligonucleotide.
- a hydrophobic moiety is attached to the oligonucleotide (e.g. a sense strand and/or an antisense strand of a siRNA).
- a hydrophobic moiety is attached at a 3’ terminus of the oligonucleotide.
- a hydrophobic moiety is attached at a 5’ terminus of the oligonucleotide.
- the hydrophobic moiety comprises cholesterol. In some embodiments, the hydrophobic moiety includes a cyclohexanyl. [0099] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises a lipid attached at a 3’ or 5’ terminus of the oligonucleotide. In some embodiments, a lipid is attached at a 3’ terminus of the oligonucleotide. In some embodiments, a lipid is attached at a 5’ terminus of the oligonucleotide.
- the lipid comprises cholesterol, myristoyl, palmitoyl, stearoyl, lithocholoyl, docosanoyl, docosahexaenoyl, myristyl, palmityl, stearyl, or ⁇ -tocopherol, or a combination thereof.
- the lipid comprises stearyl, lithocholyl, docosanyl, docosahexaenyl, or myristyl.
- the lipid comprises cholesterol.
- the lipid includes a sterol such as cholesterol.
- the lipid comprises stearyl, t-butylphenol, n-butylphenol, octylphenol, dodecylphenol, phenyl n-dodecyl, octadecylbenzamide, hexadecylbenzamide, or octadecylcyclohexyl.
- the lipid comprises phenyl para C12.
- the oligonucleotide comprises any aspect of the following structure: de comprises any aspect of the following structure: .
- the oligonucleotide comprises any aspect of the following structure: -41- Attorney Docket No.54462-742.601 n
- the oligo The aspect included in the oligonucleotide may include the entire structure, or may include the lipid moiety, of any of the structures shown.
- n is 1-3.
- n is 1.
- n is 2.
- n is 3.
- R is an alkyl group.
- the alkyl group contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 carbons.
- the alkyl group contains 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 carbons, or a range defined by any two of the aforementioned numbers of carbons. In some embodiments, the alkyl group contains 4-18 carbons.
- the lipid moiety comprises an alcohol or ether. [00101] In some embodiments, the lipid includes a fatty acid. In some embodiments, the lipid comprises a lipid depicted in Table 1. The example lipid moieties in Table 1 are shown attached at a 5’ end of an oligonucleotide, in which the 5’ terminal phosphate of the oligonucleotide is shown with the lipid moiety.
- a lipid moiety in Table 1 may be attached at a different point of attachment than shown.
- the point of attachment of any of the lipid moieties in the table may be at a 3’ oligonucleotide end.
- the lipid is used for targeting the oligonucleotide to a non-hepatic cell or tissue.
- Table 1 Hydrophobic moiety examples Moi t -42- Attorney Docket No.54462-742.601 n d ph octa hex -43- Attorney Docket No.54462-742.601 octa phe [00102]
- the lipid or lipid moiety includes 16 to 18 carbons.
- the hydrophobic moiety may include a linker that comprises a carbocycle.
- the carbocycle may be six-membered. Some examples of a carbocycle include phenyl or cyclohexyl.
- the linker may include a phenyl.
- the linker may include a cyclohexyl.
- the lipid may be attached to the carbocycle, which may in turn be attached at a phosphate (e.g.5’ or 3’ phosphate) of the oligonucleotide.
- the lipid or hydrocarbon, and the end of the sense are connected to the phenyl or cyclohexyl linker in the 1,4; 1,3; or 1,2 substitution pattern (e.g. the para, meta, or ortho phenyl configuration).
- the lipid or hydrocarbon, and the end of the sense are connected to the phenyl or cyclohexyl linker in the 1,4 substitution pattern (e.g. the para phenyl configuration).
- the lipid may be attached to the carbocycle in the 1,4 substitution pattern relative to the oligonucleotide.
- the lipid may be attached to the carbocycle in the 1,3 substitution pattern relative to the oligonucleotide.
- the lipid may be attached to the carbocycle in the 1,2 substitution pattern relative to the oligonucleotide.
- the lipid may be attached to the carbocycle in the ortho orientation relative to the oligonucleotide.
- the lipid may be -44- Attorney Docket No.54462-742.601 attached to the carbocycle in the para orientation relative to the oligonucleotide.
- the lipid may be attached to the carbocycle in the meta orientation relative to the oligonucleotide.
- the lipid moiety may comprise or consist of the following structure .
- the lipid moiety comprises or consists of the following structure: .
- the lipid moiety comprises the following structure: .
- the lipid moiety comprises or consist of the following structure: .
- the dotted line indicates a covalent connection.
- the covalent connection may between an end of the sense or antisense strand.
- the connection may be to the 5’ end of the sense strand.
- n is 0-3.
- n is 1-3.
- n is 0.
- n is 1.
- n is 2.
- n is 3.
- n is 4. In some embodiments, n is 5. In some embodiments, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
- R is an alkyl group. In some embodiments, the alkyl group contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 carbons. In some embodiments, the alkyl group contains 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 carbons, or a range defined by any two of the aforementioned numbers of carbons. In some embodiments, R comprises or consists of an alkyl group containing 4-18 carbons. [00105] The lipid moiety may be attached at a 5’ end of the oligonucleotide.
- the 5’ end may have one phosphate linking the lipid moiety to a 5’ carbon of a sugar of the oligonucleotide.
- the 5’ end may have two phosphates linking the lipid moiety to a 5’ carbon of a sugar of the oligonucleotide.
- the 5’ end may have three phosphates linking the lipid moiety to a 5’ carbon of a sugar of the oligonucleotide.
- the 5’ end may have one phosphate connected to the 5’ carbon of a sugar of the oligonucleotide, where the one phosphate is connected to the lipid moiety.
- the 5’ end may have two phosphates connected to the 5’ carbon of a sugar of the oligonucleotide, where the one of the two phosphates is connected to the lipid -45- Attorney Docket No.54462-742.601 moiety.
- the 5’ end may have three phosphates connected to the 5’ carbon of a sugar of the oligonucleotide, where the one of the three phosphates is connected to the lipid moiety.
- the sugar may include a ribose.
- the sugar may include a deoxyribose.
- the sugar may be modified a such as a 2’ modified sugar (e.g. a 2’ O-methyl or 2’ fluoro ribose).
- a phosphate of the 5’ end may include a modification such as a sulfur in place of an oxygen.
- Two phosphates of the 5’ end may include a modification such as a sulfur in place of an oxygen.
- Three phosphates of the 5’ end may include a modification such as a sulfur in place of an oxygen.
- the oligonucleotide includes 1 lipid moiety. In some embodiments, the oligonucleotide includes 2 lipid moieties. In some embodiments, the oligonucleotide includes 3 lipid moieties. In some embodiments, the oligonucleotide includes 4 lipid moieties.
- Some embodiments relate to a method of making an oligonucleotide comprising a hydrophobic conjugate.
- a strategy for making hydrophobic conjugates may include use of a phosphoramidite reagent based upon a 6-membered ring alcohol such as a phenol or cyclohexanol. The phosphoramidite may be reacted to a nucleotide to connect the nucleotide to the hydrophobic moiety, and thereby produce the hydrophobic conjugate.
- Some examples of phosphoramidite reagents that may be used to produce a hydrophobic conjugate are provided as follows: or .
- n is 1-3.
- n is 1.
- n is 2.
- n is 3.
- R is an alkyl group.
- the alkyl group contains 1, 2, 3, 4, 5, 6, 7, 8, 9, -46- Attorney Docket No.54462-742.601 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 carbons.
- the alkyl group contains 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 carbons, or a range defined by any two of the aforementioned numbers of carbons.
- R comprises or consists of an alkyl group containing 4-18 carbons.
- any one of the phosphoramidite reagents may be reacted to a 5’ end of an oligonucleotide to produce an oligonucleotide comprising a hydrophobic moiety.
- the phosphoramidite reagents is reacted to a 5’ end of a sense strand of an siRNA.
- the sense strand may then be hybridized to an antisense strand to form a duplex.
- the hybridization may be performed by incubating the sense and antisense strands in solution at a given temperature.
- the temperature may be gradually reduced.
- the temperature may comprise or include a temperature comprising an annealing temperature for the sense and antisense strands.
- the temperature may be below or include a temperature below the annealing temperature for the sense and antisense strands.
- the temperature may be below a melting temperature of the sense and antisense strands.
- the lipid may be attached to the oligonucleotide by a linker.
- the linker may include a polyethyleneglycol (e.g. tetraethyleneglycol).
- the modifications described herein may be useful for delivery to a cell or tissue, for example, extrahepatic delivery or targeting of an oligonucleotide composition.
- the modifications described herein may be useful for targeting an oligonucleotide composition to a cell or tissue. 2.
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises a sugar moiety.
- the sugar moiety may include an N-acetyl galactose moiety (e.g. an N-acetylgalactosamine (GalNAc) moiety), an N-acetyl glucose moiety (e.g. an N-acetylglucosamine (GlcNAc) moiety), a fucose moiety, or a mannose moiety.
- the sugar moiety may include 1, 2, 3, or more sugar molecules.
- the sugar moiety may be attached at a 3’ or 5’ terminus of the oligonucleotide.
- the sugar moiety may include an N-acetyl galactose moiety.
- the sugar moiety may include an N-acetylgalactosamine (GalNAc) moiety.
- the sugar moiety may include an N-acetyl glucose moiety.
- the sugar moiety may include N-acetylglucosamine (GlcNAc) moiety.
- the sugar moiety may include a fucose moiety.
- the sugar moiety may include a mannose moiety.
- N-acetyl glucose, GlcNAc, fucose, or mannose may be useful for targeting macrophages when they target or bind a mannose receptor such as CD206.
- the sugar moiety may be useful for binding or targeting an asialoglycoprotein receptor such as an asialoglycoprotein receptor of a hepatocyte.
- the GalNAc moiety may bind to an asialoglycoprotein receptor.
- the GalNAc moiety may target a hepatocyte.
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an N-acetylgalactosamine (GalNAc) moiety.
- GalNAc may be useful for hepatocyte targeting.
- the GalNAc moiety may include a bivalent or trivalent branched linker.
- the oligo may be attached to 1, 2 or 3 GalNAcs through a bivalent or trivalent branched linker.
- the GalNAc moiety may include 1, 2, 3, or more GalNAc molecules.
- the GalNAc moiety may be attached at a 3’ or 5’ terminus of the oligonucleotide.
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an N-acetylgalactosamine (GalNAc) ligand for hepatocyte targeting.
- the composition comprises GalNAc.
- the composition comprises a GalNAc derivative.
- the GalNAc ligand is attached at a 3’ terminus of the oligonucleotide.
- the GalNAc ligand is attached at a 5’ terminus of the oligonucleotide.
- the composition comprises a sense strand, and the GalNAc ligand is attached to the sense strand (e.g. attached to a 5’ end of the sense strand, or attached to a 3’ end of the sense strand).
- the composition comprises an antisense strand, and the GalNAc ligand is attached to the antisense strand (e.g. attached to a 5’ end of the antisense strand, or attached to a 3’ end of the antisense strand).
- the composition comprises a GalNAc ligand attached at a 3’ or 5’ terminus of the oligonucleotide.
- compositions comprising an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises a GalNAc moiety.
- the GalNAc moiety may be included in any formula, structure, or GalNAc moiety shown below.
- described herein is a compound (e.g.
- oligonucleotide represented by Formula (I) or (II): (II); or a salt thereof, wherein J is an oligonucleotide; each w is independently selected from any value from 1 to 20; each v is independently selected from any value from 1 to 20; n is selected from any value from 1 to 20; m is selected from any value from 1 to 20; z is selected from any value from 1 to 3, wherein if z is 3, Y is C if z is 2, Y is CR 6 , or if z is 1, Y is C(R 6 ) 2 ; Q is selected from: C 3-10 carbocycle optionally substituted with one or more substituents independently selected from halogen, -CN, -NO 2 , -OR 7 , -SR 7 , -N(R 7 ) 2 , -C(O)R 7 , -C(O)N(R 7 ) 2 , -N(R 7 )C(O)R 7
- each w is independently selected from any value from 1 to 10. In some embodiments, each w is independently selected from any value from 1 to 5. In some embodiments, each w is 1. In some embodiments, each v is independently selected from any value from 1 to 10. In some embodiments, each v is independently selected from any value from 1 to 5. In some embodiments, each v -49- Attorney Docket No.54462-742.601 is 1. In some embodiments, n is selected from any value from 1 to 10. In some embodiments, n is selected from any value from 1 to 5. In some embodiments, n is 2. In some embodiments, m is selected from any value from 1 to 10. In some embodiments, m is selected from any value from 1 to 5.
- m is selected from 1 and 2.
- z is 3 and Y is C.
- Q is selected from C5-6 carbocycle optionally substituted with one or more substituents independently selected from halogen, -CN, -NO2, -OR 7 , -SR 7 , -N(R 7 )2, -C(O)R 7 , -C(O)N(R 7 )2, -N(R 7 )C(O)R 7 , - N(R 7 )C(O)N(R 7 )2, -OC(O)N(R 7 )2, -N(R 7 )C(O)OR 7 , -C(O)OR 7 , -OC(O)R 7 , and -S(O)R 7 .
- Q is selected from C5-6 carbocycle optionally substituted with one or more substituents independently selected from halogen, -CN, -OH, -SH, -NO2, and -NH2.
- Q is selected from phenyl and cyclohexyl, each of which is optionally substituted with one or more substituents independently selected from halogen, -CN, -OH, -SH, -NO2, and -NH2.
- Q is selected from phenyl.
- Q is selected from cyclohexyl.
- R 1 is selected from -OP(O)(OR 7 )O-, -SP(O)(OR 7 )O-, -OP(S)(OR 7 )O-, -OP(O)(SR 7 )O-, - OP(O)(OR 7 )S-, -OP(O)(O-)O-, -SP(O)(O-)O-, -OP(S)(O-)O-, -OP(O)(S-)O-, -OP(O)(O-)S-, -OP(O)(OR 7 )NR 7 -, -OP(O)(N(R 7 )2)NR 7 -, -OP(OR 7 )O-, -OP(N(R 7 )2)O-, -OP(OR 7 )N(R 7 )-, and -OPN(R 7 )2- NR 7 .
- R 1 is selected from -OP(O)(OR 7 )O-, -SP(O)(OR 7 )O-, -OP(S)(OR 7 )O-, - OP(O)(SR 7 )O-, -OP(O)(OR 7 )S-, -OP(O)(O-)O-, -SP(O)(O-)O-, -OP(S)(O-)O-, -OP(O)(S-)O-, -OP(O)(O- )S-, and -OP(OR 7 )O-.
- R 1 is selected from -OP(O)(OR 7 )O-, -OP(S)(OR 7 )O-, - OP(O)(O-)O-, -OP(S)(O-)O-, -OP(O)(S-)O-, and -OP(OR 7 )O-. In some embodiments, R 1 is selected from - OP(O)(OR 7 )O- and -OP(OR 7 )O-.
- R 2 is selected from C1-3 alkyl substituted with one or more substituents independently selected from halogen, -OR 7 , -OC(O)R 7 , -SR 7 , -N(R 7 )2, -C(O)R 7 , and -S(O)R 7 .
- R 2 is selected from C1-3 alkyl substituted with one or more substituents independently selected from -OR 7 , -OC(O)R 7 , -SR 7 , and -N(R 7 )2.
- R 2 is selected from C1-3 alkyl substituted with one or more substituents independently selected from -OR 7 and - OC(O)R 7 .
- R 3 is selected from halogen, -OR 7 , -SR 7 , -N(R 7 )2, -C(O)R 7 , -OC(O)R 7 , and -S(O)R 7 . In some embodiments, R 3 is selected from -OR 7 -SR 7 , -OC(O)R 7 , and -N(R 7 )2. In some embodiments, R 3 is selected from -OR 7 - and -OC(O)R 7 .
- R 4 is selected from halogen, -OR 7 , -SR 7 , -N(R 7 ) 2 , -C(O)R 7 , -OC(O)R 7 , and -S(O)R 7 . In some embodiments, R 4 is selected from -OR 7 -SR 7 , -OC(O)R 7 , and -N(R 7 ) 2. In some embodiments, R 4 is selected from -OR 7 - and -OC(O)R 7 .
- R 5 is selected from -OC(O)R 7 , -OC(O)N(R 7 ) 2 , -N(R 7 )C(O)R 7 , -N(R 7 )C(O)N(R 7 ) 2 , and -N(R 7 )C(O)OR 7 . In some embodiments, R 5 is selected from -OC(O)R 7 and -N(R 7 )C(O)R 7 .
- each R 7 is independently selected from C 1-6 alkyl optionally substituted with one or more substituents independently selected from halogen, -CN, -OH, and -SH.
- Q is phenyl or cyclohexyl, each of which is optionally substituted with one or more substituents independently selected from halogen, -CN, -OH, -SH, -NO 2 , -NH 2 , and C 1-3 alkyl;
- R 1 is selected from -OP(O)(OR 7 )O-, -OP(S)(OR 7 )O-, -OP(O)(O-)O-, -OP(S)(O-)O-, -OP(O)(S-)O-, and - OP(OR 7 )O-;
- R 2 is C 1 alkyl substituted with -OH or -OC(O)CH 3 ;
- R 3 is -OH or -OC(O)CH3;
- the oligonucleotide (J) is attached at a 5’ end or a 3’ end of the oligonucleotide.
- the oligonucleotide comprises DNA. In some embodiments, the oligonucleotide comprises RNA. In some embodiments, the oligonucleotide comprises one or more modified internucleoside linkages. In some embodiments, the one or more modified internucleoside linkages comprise alkylphosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate, or carboxymethyl ester, or a combination thereof.
- the oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 modified internucleoside linkages.
- the compound binds to an asialoglycoprotein receptor.
- the compound targets a hepatocyte.
- J is the oligonucleotide: -57- Attorney Docket No.54462-742.601 [00115] .
- J may include one or more additional phosphates, or one or more phosphorothioates linking to the oligonucleotide.
- J may include one or more additional phosphates linking to the oligonucleotide.
- J may include one or more phosphorothioates linking to the oligonucleotide.
- Some embodiments include the following, where J is the oligonucleotide: [00117] .
- J may include one or more additional phosphates, or one or more phosphorothioates linking to the oligonucleotide.
- J may include one or more additional phosphates linking to the oligonucleotide.
- J may include one or more phosphorothioates linking to the oligonucleotide.
- J is the oligonucleotide: -58- Attorney Docket No.54462-742.601 may include one or more phosphates or phosphorothioates linking to the oligonucleotide.
- J may include one or more phosphates linking to the oligonucleotide.
- J may include a phosphate linking to the oligonucleotide.
- J may include one or more phosphorothioates linking to the oligonucleotide.
- J may include a phosphorothioate linking to the oligonucleotide.
- Some embodiments include the following, where J is the oligonucleotide: .
- J The structure in this compound attached to the oligonucleotide (J) is an example of a GalNAc moiety.
- J may include one or more phosphates or phosphorothioates linking to the oligonucleotide.
- J may include one or more phosphates linking to the oligonucleotide.
- J may include a phosphate linking to the oligonucleotide.
- -59- Attorney Docket No.54462-742.601 J may include one or more phosphorothioates linking to the oligonucleotide.
- J may include a phosphorothioate linking to the oligonucleotide.
- J is the oligonucleotide: [001 .
- J may include one or more additional phosphates, or one or more phosphorothioates linking to the oligonucleotide.
- J may include one or more additional phosphates linking to the oligonucleotide.
- J may include one or more phosphorothioates linking to the oligonucleotide.
- Some embodiments include the following, where J is the oligonucleotide: -60- Attorney Docket No.54462-742.601 .
- J may include one or more additional phosphates, or one or more phosphorothioates linking to the oligonucleotide.
- J may include one or more additional phosphates linking to the oligonucleotide.
- J may include one or more phosphorothioates linking to the oligonucleotide.
- Some embodiments include the following, where J is the oligonucleotide: .
- J may include one or more phosphates or phosphorothioates linking to the oligonucleotide.
- J may include one or more phosphates linking to the oligonucleotide.
- J may include a phosphate linking to the oligonucleotide.
- J may include one or more phosphorothioates linking to the oligonucleotide.
- J may include a phosphorothioate linking to the oligonucleotide.
- J is the oligonucleotide: .
- the structure in this compound attached to the oligonucleotide (J) may be referred to as “ETL17,” and is an example of a GalNAc moiety.
- J may include one or more phosphates or phosphorothioates linking to the oligonucleotide.
- J may include one or more phosphates linking to the oligonucleotide.
- J may include a phosphate linking to the oligonucleotide.
- J may include one or more phosphorothioates linking to the oligonucleotide.
- J may include a phosphorothioate linking to the oligonucleotide.
- Some embodiments include the following, where the phosphate or “5’” indicates a connection to the oligonucleotide: [00124] -62- Attorney Docket No.54462-742.601 [00125] Some embodiments include the following, where the phosphate or “5’” indicates a connection to the oligonucleotide: [001 [00127] Some embodiments include the following, where J is the oligonucleotide: [00128] include one or more phosphates or phosphorothioates linking to the oligonucleotide.
- J may include one or more phosphates linking to the oligonucleotide.
- J may include a phosphate linking to the oligonucleotide.
- J may include one or more phosphorothioates linking to the oligonucleotide.
- J may include a phosphorothioate linking to the oligonucleotide.
- Some embodiments include the following, where J is the oligonucleotide: -63- Attorney Docket No.54462-742.601 [001 .
- the structure in this compound attached to the oligonucleotide (J) may be referred to as ETL1, and is an example of a GalNAc moiety.
- J may include one or more phosphates or phosphorothioates linking to the oligonucleotide.
- J may include one or more phosphates linking to the oligonucleotide.
- J may include a phosphate linking to the oligonucleotide.
- J may include one or more phosphorothioates linking to the oligonucleotide.
- J may include a phosphorothioate linking to the oligonucleotide 3.
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, wherein the sense strand comprises modification pattern 1S: 5’-NfsnsNfnNfnNfNfNfnNfnNfnNfnNfnNfnNfsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 2S: 5’-nsnsnnnNfnNfNfNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 3S: 5’-nsnsnnnNfnNfnNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 4S: 5’-NfsnsNfnNfnNfNfNfnNfnNfnNfnNfnNfnNfsnsnN-moiety-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “s” is a phosphorothioate linkage, and N comprises one or more nucleosides.
- the sense strand comprises modification pattern 5S: 5’-nsnsnnnNfnNfNfNfnnnnnnnnsnsnN-moiety-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “s” is a phosphorothioate linkage, and N comprises one or more nucleosides.
- the moiety in modification pattern 4S or 5S is a lipid moiety. In some embodiments, the moiety in modification pattern 4S or 5S is a sugar moiety.
- the sense strand comprises modification pattern 6S: -64- Attorney Docket No.54462-742.601 5’-NfsnsNfnNfnNfnNfnNfnNfnNfnNfnNfnNfsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 7S: 5’-nsnsnnNfNfNfNfNfnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 8S: 5’-nsnsnnnnNfNfNfNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 9S: 5’-nsnsnnnnnNfNfNfnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 10S: 5’-snnnnNfNfnnNfnnnnnnnsn -3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 11S: 5’-snnnnnNfnnNfnNfnnnnnnnsn -3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 12S: 5’-snnnnnNfNfNfdNnnnnnnnnnsnsn -3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “dN” is a 2’ deoxy-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 13S: 5’-snnnnnNfnnNfNfnnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 14S: 5’-snnnnNfnnNfNfnnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 15S: 5’-snnnnNfnnnNfnNfnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 16S: 5’-snnnnNfNfnNfNfnNfnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 17S: 5’-snnnnnnnNfNfnNfnnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 18S: 5’-snnnnnNfNfnNfNfnnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 19S: 5’-snnnnNfnnNfNfnNfnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 20S: 5’-snnnnnNfnNfNfnnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 21S: 5’-snnnnnNfNfNfNfnnnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- -65- Attorney Docket No.54462-742.601 methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 22S: 5’-nsnsnnnnnNfnNfnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 23S: 5’-nsnsnnnnNfnnNfnNfnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 24S: 5’-nsnsnnnnNfNfnNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 25S: 5’-nsnsnnnnNfNfnNfnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 26S: 5’-nsnsnnnNfnnnNfnNfnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 27S: 5’-nsnsnnnNfnNfnNfnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 28S: 5’-nsnsnnNfNfnnNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 29S: 5’-nsnsnnnnnnNfNfnnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 30S: 5’-nsnsnnnnnNfNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 31S: 5’-nsnsnnnnNfnnNfNfnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 32S: 5’-nsnsnnnNfnnnNfNfnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 33S: 5’-nsnsnnnNfNfnnNfNfnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 34S: 5’-nsnsnnnnnnNfNfnNfnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 35S: 5’-nsnsnnnnNfnNfNfnnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 36S: 5’-nsnsnnnnNfnNfNfnNfnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 37S: -66- Attorney Docket No.54462-742.601 5’-nsnsnnnnNfNfNfNfnNfnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 38S: 5’-nsnsnnnNfnnNfNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 39S: 5’-nsnsnnnNfnnNfNfnNfnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 40S: 5’-nsnsnnnNfNfnnNfnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 41S: 5’-nsnsnnNfNfnNfNfnnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 42S: 5’-nsnsnnnnNfnNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 43S: 5’-nsnsnnnnNfnnNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 44S: 5’-nsnsnnnnnnNfNfNfnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 45S: 5’-nsnsnnnnnNfnNfNfnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 46S: 5’-nsnsnnnnnNfNfNfNfnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 47S: 5’-nsnsnnnnNfnNfNfNfNfnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 48S: 5’-nsnsnnnnNfNfNfNfNfnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 49S: 5’-nsnsnnnNfnnNfNfNfNfnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 50S: 5’-nsnsnnnnNfNfnNfNfnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 51S: 5’-nsnsnnnNfnNfnNfNfnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 52S: 5’-nsnsnnnNfnNfNfNfNfnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate -67- Attorney Docket No.54462-742.601 linkage.
- the sense strand comprises modification pattern 53S:5'- snnnnnNfNfNfdNnnnnnnnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, “Nm” is a 2’-O-(2-methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’-O-(2-methoxyethyl) thymine.
- the sense strand comprises modification pattern 54S:5'-snnnnnNfNfNfNfnnnnnnNmnnnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “Nm” is a 2’-O-(2- methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’- O-(2-methoxyethyl) thymine.
- the sense strand comprises modification pattern 55S: 5'-snnnnTmNfNfNfNfnnnNmnnnnnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “Nm” is a 2’-O-(2-methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’-O-(2-methoxyethyl) thymine.
- the sense strand comprises modification pattern 56S:5'-snnnnnnnNfNfNfnnnnnnnsn- 3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 57S:5'- snnnnnnNfnNfNfnnnnnnnnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 58S:5'-snnnnNfndNnNfnNfnnnnnnnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 59S:5'- snnnNmnNfNfNfnnnNmnnnnnnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 60S:5'-snnnNmnNfNfNfnnNmnnnnnnnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 61S:5'- snnnNmnNfNfNfnnnNmnnnnnnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, “Nm” is a 2’-O-(2-methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’-O-(2-methoxyethyl) thymine.
- the sense strand comprises modification pattern 62S:5'-snnnNmnNfNfNfNfnnnNmnnnnnnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “Nm” is a 2’-O-(2- methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’- O-(2-methoxyethyl) thymine.
- the sense strand comprises modification pattern 63S:5'-snnnNmnNfNfNfNfnnnNmnnnnnnnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “Nm” is a 2’-O-(2-methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’-O-(2-methoxyethyl) thymine.
- the sense strand comprises modification pattern 64S:5'-snnnnNfnNfnNfnnnnnnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 65AS:5'-snnnNmnnNfNfNfnnNmnnnnnnnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “Nm” is a 2’-O-(2-methoxyethyl) nucleoside, and “s” is a -68- Attorney Docket No.54462-742.601 phosphorothioate linkage. In some embodiments, the Nm is a 2’-O-(2-methoxyethyl) thymine.
- the sense strand comprises modification pattern 66AS:5'- snnnNmNfnNfNfNfNfnnNmnnnnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “Nm” is a 2’-O-(2-methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’-O-(2-methoxyethyl) thymine.
- the sense strand comprises modification pattern 67AS:5'- snnnNmnNfNfNfnnNmnnnnnnnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, “Nm” is a 2’-O-(2-methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’-O-(2-methoxyethyl) thymine.
- the sense strand comprises modification pattern 68AS:5'-snnnNmnNfNfNfNfnnnnNmnnnnnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “Nm” is a 2’-O-(2- methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’- O-(2-methoxyethyl) thymine.
- the sense strand comprises modification pattern 69AS:5'-snnnNmNfnNfNfNfNfnNmnnnnnnnsn-3' wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “Nm” is a 2’-O-(2-methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’-O-(2-methoxyethyl) thymine.
- the sense strand comprises modification pattern 70AS:5'- snnnNmNfnNfNfNfNfnnnNmnnnnnsnsn-3' wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “Nm” is a 2’-O-(2-methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’-O-(2-methoxyethyl) thymine.
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, wherein the antisense strand comprises modification pattern 1AS: 5’-nsNfsnNfnNfnNfnNfnnnNfnNfnsnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the antisense strand comprises modification pattern 2AS: 5’-nsNfsnnnNfnNfNfnnnnNfnNfnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the antisense strand comprises modification pattern 3AS: 5’-nsNfsnnnNfnnnnnnnnNfnNfnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the antisense strand comprises modification pattern 4AS: 5’-nsNfsnNfnNfnnnnnnnNfnNfnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the antisense strand comprises modification pattern 5AS: 5’-nsNfsnnnnnnnnnnnnNfnNfnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the antisense strand comprises modification pattern 6AS: 5’-nsNfsnnnNfnnNfnnnnNfnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the antisense strand comprises modification pattern 7AS: 5’-nsNfsnNfnNfnNfnNfnNfnNfnNfnNfnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, -69- Attorney Docket No.54462-742.601 “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the antisense strand comprises modification pattern 8AS: 5’-nsNfsnnnnnnnnnnnnnnnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 9AS:5'- nsNfsnnnNfnNfnNfnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 10AS:5'-nsNfsnNfnNfnnNfnnnnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 11AS:5'-nsNfsnNfnNfnnNfnnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 12AS:5'-nsNfsnNfnnNfnNfnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 13AS:5'-nsNfsnnNfnNfnNfnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 14AS:5'-nsNfsnNfnNfnNfnnnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 15AS:5'-nsNfsnnnNfnNfnnnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 16AS:5'-nsNfsnnnNfnNfnNfnnnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 17AS:5'-nsNfsnNfnnNfnnNfnNfnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 18AS:5'-nsNfsnNfnnNfnnNfnnnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 19AS:5'-nsNfsnnNfnNfnnNfnNfnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 20AS:5'-nsNfsnNfnnnNfnNfnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 21AS:5'-nsNfsnnnnNfnNfnnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 22AS:5'-nsNfsnNfnnNfnNfnnnnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern -70- Attorney Docket No.54462-742.601 23AS:5'-nsNfsnnNfnNfnNfnnNfnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 24AS:5'-nsNfsnnNfnNfnNfnnnnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 25AS:5'-nsNfsnNfnNfnNfnNfnNfnNfnNfnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 26AS:5'-nsNfsnNfnnNfnnnnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 27AS:5'-nsNfsnNfnnNfnNfnnNfnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 28AS:5'-nsNfsnnNfnNfnnNfnnnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 29AS:5'-nsNfsnnnNfnnnNfnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 30AS:5'-nsNfsnnnNfNfnnNfnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 31AS:5'-nsNfsnnNfnNfNfnNfnNfnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the sense strand comprises modification pattern 32AS:5'-nsNfsnnNfnNfNfnnnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, wherein the sense strand comprises pattern 1S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- siRNA comprising a sense strand and an antisense strand
- the sense strand comprises pattern 1S
- the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS,
- the sense strand comprises pattern 2S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 3S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 4S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, -71- Attorney Docket No.54462-742.601 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 5S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 6S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 7S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 8S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 9S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 10S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 11S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 12S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 13S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 14S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 15S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 16S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 17S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, -72- Attorney Docket No.54462-742.601 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 18S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 19S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 20S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 21S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 22S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 23S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 24S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 26S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 27S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 28S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 29S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 30S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, -73- Attorney Docket No.54462-742.601 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 31S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 32S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 33S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 34S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 35S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 36S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 37S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 38S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 39S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 40S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 41S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 42S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 43S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, -74- Attorney Docket No.54462-742.601 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 44S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 46S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 47S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 48S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 49S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 50S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 51S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 52S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 53S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 54S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 55S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 56S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, -75- Attorney Docket No.54462-742.601 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 57S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 58S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 59S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 60S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 61S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 62S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 63S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 64S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 65S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 66S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 67S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 68S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 69S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, -76- Attorney Docket No.54462-742.601 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 70S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 1AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70Sand the antisense strand comprises pattern 2AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 3AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 4AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 5AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 6AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 7AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 9AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 10AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 11AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 12AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 13AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 14AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 15AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 16AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, -78- Attorney Docket No.54462-742.601 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 18AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 19AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 20AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 21AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 22AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 23AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 24AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 25AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, -79- Attorney Docket No.54462-742.601 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 27AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 28AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 29AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 30AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 31AS.
- the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 32AS.
- the sense strand comprises modification pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S .
- the sense strand comprises modification pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, or 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the antisense strand comprises modification pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, or 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, -80- Attorney Docket No.54462-742.601 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS.
- the antisense strand comprises modification pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S .
- the sense strand or the antisense strand comprises modification pattern ASO1.
- purines of the sense strand comprise 2’ fluoro modified purines. In some embodiments, purines of the sense strand comprise 2’-O-methyl modified purines. In some embodiments, purines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, all purines of the sense strand comprise 2’ fluoro modified purines. In some embodiments, all purines of the sense strand comprise 2’-O-methyl modified purines. In some embodiments, all purines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines.
- pyrimidines of the sense strand comprise 2’ fluoro modified pyrimidines. In some embodiments, pyrimidines of the sense strand comprise 2’-O-methyl modified pyrimidines. In some embodiments, pyrimidines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. In some embodiments, all pyrimidines of the sense strand comprise 2’ fluoro modified pyrimidines. In some embodiments, all pyrimidines of the sense strand comprise 2’-O- methyl modified pyrimidines.
- all pyrimidines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines.
- purines of the sense strand comprise 2’ fluoro modified purines, and pyrimidines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines.
- purines of the sense strand comprise 2’-O-methyl modified purines, and pyrimidines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines.
- purines of the sense strand comprise 2’ fluoro modified purines, and pyrimidines of the sense strand comprise 2’-O-methyl modified pyrimidines. In some embodiments, purines of the sense strand comprise 2’-O-methyl modified purines, and pyrimidines of the sense strand comprise 2’ fluoro modified pyrimidines. In some embodiments, pyrimidines of the sense strand comprise 2’ fluoro modified pyrimidines, and purines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines.
- pyrimidines of the sense strand comprise 2’-O-methyl modified pyrimidines, and purines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, pyrimidines of the sense strand comprise 2’ fluoro modified pyrimidines, and purines of the sense strand comprise 2’-O-methyl modified purines. In some embodiments, pyrimidines of the sense strand comprise 2’-O-methyl modified pyrimidines, and purines of the sense strand comprise 2’ fluoro modified purines.
- all purines of the sense strand comprise 2’ fluoro modified purines, and all pyrimidines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. In some embodiments, all purines of the sense strand comprise 2’-O-methyl modified purines, and all pyrimidines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified -81- Attorney Docket No.54462-742.601 pyrimidines. In some embodiments, all purines of the sense strand comprise 2’ fluoro modified purines, and all pyrimidines of the sense strand comprise 2’-O-methyl modified pyrimidines.
- all purines of the sense strand comprise 2’-O-methyl modified purines, and all pyrimidines of the sense strand comprise 2’ fluoro modified pyrimidines. In some embodiments, all pyrimidines of the sense strand comprise 2’ fluoro modified pyrimidines, and all purines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, all pyrimidines of the sense strand comprise 2’-O-methyl modified pyrimidines, and all purines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines.
- all pyrimidines of the sense strand comprise 2’ fluoro modified pyrimidines, and all purines of the sense strand comprise 2’-O- methyl modified purines. In some embodiments, all pyrimidines of the sense strand comprise 2’-O-methyl modified pyrimidines, and all purines of the sense strand comprise 2’ fluoro modified purines. [00140] In some embodiments, purines of the antisense strand comprise 2’ fluoro modified purines. In some embodiments, purines of the antisense strand comprise 2’-O-methyl modified purines. In some embodiments, purines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines.
- all purines of the antisense strand comprise 2’ fluoro modified purines. In some embodiments, all purines of the antisense strand comprise 2’-O-methyl modified purines. In some embodiments, all purines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. [00141] In some embodiments, pyrimidines of the antisense strand comprise 2’ fluoro modified pyrimidines. In some embodiments, pyrimidines of the antisense strand comprise 2’-O-methyl modified pyrimidines.
- pyrimidines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. In some embodiments, all pyrimidines of the antisense strand comprise 2’ fluoro modified pyrimidines. In some embodiments, all pyrimidines of the antisense strand comprise 2’-O-methyl modified pyrimidines. In some embodiments, all pyrimidines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines.
- purines of the antisense strand comprise 2’ fluoro modified purines, and pyrimidines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. In some embodiments, purines of the antisense strand comprise 2’-O-methyl modified purines, and pyrimidines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. In some embodiments, purines of the antisense strand comprise 2’ fluoro modified purines, and pyrimidines of the antisense strand comprise 2’-O-methyl modified pyrimidines.
- purines of the antisense strand comprise 2’-O-methyl modified purines
- pyrimidines of the antisense strand comprise 2’ fluoro modified pyrimidines.
- pyrimidines of the antisense strand comprise 2’ fluoro modified pyrimidines
- purines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines.
- pyrimidines of the antisense strand comprise 2’-O-methyl modified pyrimidines
- purines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines.
- pyrimidines of the antisense strand comprise 2’ fluoro modified pyrimidines
- purines of the antisense strand comprise 2’- -82- Attorney Docket No.54462-742.601 O-methyl modified purines.
- pyrimidines of the antisense strand comprise 2’-O- methyl modified pyrimidines
- purines of the antisense strand comprise 2’ fluoro modified purines.
- all purines of the antisense strand comprise 2’ fluoro modified purines
- all pyrimidines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines.
- all purines of the antisense strand comprise 2’-O-methyl modified purines, and all pyrimidines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. In some embodiments, all purines of the antisense strand comprise 2’ fluoro modified purines, and all pyrimidines of the antisense strand comprise 2’-O-methyl modified pyrimidines. In some embodiments, all purines of the antisense strand comprise 2’-O-methyl modified purines, and all pyrimidines of the antisense strand comprise 2’ fluoro modified pyrimidines.
- all pyrimidines of the antisense strand comprise 2’ fluoro modified pyrimidines, and all purines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, all pyrimidines of the antisense strand comprise 2’-O-methyl modified pyrimidines, and all purines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, all pyrimidines of the antisense strand comprise 2’ fluoro modified pyrimidines, and all purines of the antisense strand comprise 2’-O-methyl modified purines.
- all pyrimidines of the antisense strand comprise 2’-O-methyl modified pyrimidines
- all purines of the antisense strand comprise 2’ fluoro modified purines.
- the modified oligonucleotide may be an siRNA that includes modifications to the ribose rings, and phosphate linkages. The modifications may be in particular patterns that maximize cell delivery, stability, and efficiency.
- the siRNA may also include a vinyl phosphonate and a hydrophobic group. These modifications may aid in delivery to a cell or tissue within a subject.
- the modified oligonucleotide may be used in a method such as a treatment method or a method of reducing gene expression.
- the oligonucleotide comprises a duplex consisting of 21 nucleotide single strands with base pairing between 19 of the base pairs.
- the duplex comprises single-stranded 2 nucleotide overhangs are at the 3’ ends of each strand.
- One strand (antisense strand) is complementary to a GPAM mRNA. Each end of the antisense strand has one to two phosphorothioate bonds. The 5’ end has an optional phosphate mimic such as a vinyl phosphonate.
- the oligonucleotide is used to knock down a GPAM mRNA or a target protein.
- the sense strand has the same sequence as the GPAM mRNA.
- the sense strand of any of the siRNAs comprises siRNA with a particular modification pattern.
- position 9 counting from the 5’ end of the sense strand may have a 2’F modification.
- position 9 of the sense strand is a pyrimidine
- all purines in the sense strand have a 2’OMe modification.
- position 9 is the only pyrimidine between positions 5 and 11 of the sense stand, then -83- Attorney Docket No.54462-742.601
- position 9 is the only position with a 2’F modification in the sense strand.
- position 9 and only one other base between positions 5 and 11 of the sense strand are pyrimidines, then both of these pyrimidines are the only two positions with a 2’F modification in the sense strand.
- any combination of 2’F modifications can be made that give three 2’F modifications in total.
- all combinations of pyrimidines having the 2’F modification are allowed that have three to five 2’F modifications in total, provided that the sense strand does not have three 2’F modifications in a row.
- the sense strand of any of the siRNAs comprises a modification pattern which conforms to any or all of these sense strand rules.
- position 9 of the sense strand when position 9 of the sense strand is a purine, then all purines in the sense strand have a 2’OMe modification. In some embodiments, when position 9 is the only purine between positions 5 and 11 of the sense stand, then position 9 is the only position with a 2’F modification in the sense strand. In some embodiments, when position 9 and only one other base between positions 5 and 11 of the sense strand are purines, then both of these purines are the only two positions with a 2’F modification in the sense strand.
- any combination of 2’F modifications can be made that give three 2’F modifications in total.
- all combinations of purines having the 2’F modification are allowed that have three to five 2’F modifications in total, provided that the sense strand does not have three 2’F modifications in a row.
- the sense strand of any of the siRNAs comprises a modification pattern which conforms to any or all of these sense strand rules.
- the siRNA comprises a sense strand, an antisense strand, and a lipid moiety connected to an end of the sense or antisense strand; wherein the lipid moiety comprises a phenyl or cyclohexanyl linker, wherein the linker is connected to a lipid and to the end of the sense or antisense strand.
- any one of the following is true with regard to the sense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise 2’-O-methyl modified pyrimidines; all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a
- any one of the following is true with regard to the antisense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O- -84- Attorney Docket No.54462-742.601 methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise 2’ fluoro modified pyrimidines; all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’- O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; or all pyr
- the siRNA comprises comprising a sense strand and an antisense strand; wherein the antisense strand comprises a 5’ end comprising a vinyl phosphonate and 2 phosphorothioate linkages, and a 3’ end comprising 2 phosphorothioate linkages; wherein the sense strand comprises a 5’ end comprising a hydrophobic moiety, and a 3’ end comprising 2 phosphorothioate linkages; wherein any one of the following is true with regard to the sense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’- O-methyl modified pyrimidines, all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines, all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise 2’-O-methyl modified pyrimidines,
- any one of the following is true with regard to the sense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’- O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise 2’-O-methyl modified pyrimidines; all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a
- all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a deoxy nucleoside may be included in the sense strand.
- all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a deoxy nucleoside may be included in the sense strand.
- all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise 2’-O-methyl modified pyrimidines; with the proviso that a deoxy nucleoside may be included in the sense strand.
- all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a deoxy nucleoside may be included in the sense strand.
- all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a deoxy nucleoside may be included in the sense strand.
- all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise 2’-O-methyl modified purines; with the proviso that a deoxy nucleoside may be included in the sense strand.
- the sense strand includes the deoxy nucleoside. The deoxy nucleoside may be at nucleoside position 9 of the sense strand.
- the sense strand does not include a deoxy nucleoside.
- the deoxy nucleoside of the sense strand may be otherwise unmodified.
- any one of the following is true with regard to the antisense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’- O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise 2’ fluoro modified pyrimidines; all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise 2’-O-methyl
- all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a deoxy nucleoside may be included in the antisense strand.
- all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a deoxy nucleoside may be included in the antisense strand.
- all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise 2’ fluoro modified pyrimidines; with the proviso that a deoxy nucleoside may be included in the antisense strand.
- all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a deoxy nucleoside may be included in the antisense strand.
- all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a deoxy nucleoside may be included in the antisense strand.
- all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise 2’ fluoro modified purines; with the proviso that a deoxy -86- Attorney Docket No.54462-742.601 nucleoside may be included in the antisense strand.
- the antisense strand includes the deoxy nucleoside.
- the deoxy nucleoside may be at nucleoside position 9 of the antisense strand.
- the antisense strand does not include a deoxy nucleoside.
- the deoxy nucleoside of the antisense strand may be otherwise unmodified.
- any one of the following is true with regard to the sense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’- O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise 2’-O-methyl modified pyrimidines; all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a
- all purines comprise 2’ fluoro modified purines
- all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the sense strand.
- all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a deoxy nucleoside or a 2’-O-(2- methoxyethyl) nucleoside may be included in the sense strand.
- all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise 2’-O-methyl modified pyrimidines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the sense strand.
- all pyrimidines comprise 2’ fluoro modified pyrimidines
- all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the sense strand.
- all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the sense strand.
- all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise 2’-O-methyl modified purines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the sense strand.
- the sense strand includes the deoxy nucleoside.
- the deoxy nucleoside may be at nucleoside position 9 of the sense strand.
- the sense strand does not include a deoxy nucleoside.
- the deoxy nucleoside of the sense strand may be otherwise unmodified.
- the sense strand includes the a 2’-O-(2-methoxyethyl) nucleoside.
- the 2’-O-(2- methoxyethyl) nucleoside may be at nucleoside position 4 of the sense strand.
- the 2’-O-(2-methoxyethyl) nucleoside may include a 2’-O-(2-methoxyethyl) thymine nucleoside.
- the sense strand does not include the a 2’-O-(2-methoxyethyl) nucleoside.
- the 2’-O-(2-methoxyethyl) nucleoside of the sense strand may be otherwise unmodified.
- any one of the following is true with regard to the antisense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’- O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise 2’ fluoro modified pyrimidines; all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; or
- all purines comprise 2’ fluoro modified purines
- all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the antisense strand.
- all purines comprise 2’-O-methyl modified purines
- all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the antisense strand.
- all purines comprise 2’-O-methyl modified purines
- all pyrimidines comprise 2’ fluoro modified pyrimidines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the antisense strand.
- all pyrimidines comprise 2’ fluoro modified pyrimidines
- all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the antisense strand.
- all pyrimidines comprise 2’-O-methyl modified pyrimidines
- all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the antisense strand.
- all pyrimidines comprise 2’-O-methyl modified pyrimidines
- all purines comprise 2’ fluoro modified purines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the antisense strand.
- the antisense strand includes the deoxy nucleoside.
- the deoxy nucleoside may be at nucleoside position 9 of the antisense strand.
- the antisense strand does not include a deoxy nucleoside.
- the deoxy nucleoside of the antisense strand may be otherwise unmodified.
- the antisense strand includes the a 2’-O-(2- methoxyethyl) nucleoside.
- the 2’-O-(2-methoxyethyl) nucleoside may be at nucleoside position 4 of the sense strand.
- the 2’-O-(2-methoxyethyl) nucleoside may include a 2’-O-(2-methoxyethyl) thymine nucleoside.
- the antisense strand does not include the a 2’-O-(2-methoxyethyl) nucleoside.
- the 2’-O-(2-methoxyethyl) nucleoside of the antisense strand may be otherwise unmodified.
- any one of the following is true with regard to the sense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’- O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’ fluoro -88- Attorney Docket No.54462-742.601 modified purines, and all pyrimidines comprise 2’-O-methyl modified pyrimidines; all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O
- all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’- O-methyl modified pyrimidines; with the proviso that a 2’-O-(2-methoxyethyl) nucleoside may be included in the sense strand.
- all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a 2’-O-(2-methoxyethyl) nucleoside may be included in the sense strand.
- all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise 2’-O-methyl modified pyrimidines; with the proviso that a 2’-O-(2-methoxyethyl) nucleoside may be included in the sense strand.
- all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a 2’-O-(2-methoxyethyl) nucleoside may be included in the sense strand.
- all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a 2’-O- (2-methoxyethyl) nucleoside may be included in the sense strand.
- all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise 2’-O-methyl modified purines; with the proviso that a 2’-O-(2-methoxyethyl) nucleoside may be included in the sense strand.
- the sense strand includes the a 2’-O-(2-methoxyethyl) nucleoside.
- the 2’- O-(2-methoxyethyl) nucleoside may be at nucleoside position 4 of the sense strand.
- the 2’-O-(2- methoxyethyl) nucleoside may include a 2’-O-(2-methoxyethyl) thymine nucleoside.
- the sense strand does not include the a 2’-O-(2-methoxyethyl) nucleoside.
- the 2’-O-(2- methoxyethyl) nucleoside of the sense strand may be otherwise unmodified.
- any one of the following is true with regard to the antisense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’- O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise 2’ fluoro modified pyrimidines; all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise
- all purines comprise 2’ fluoro modified purines
- all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a 2’-O-(2- methoxyethyl) nucleoside may be included in the antisense strand.
- all purines comprise 2’-O-methyl modified purines
- all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a 2’-O-(2-methoxyethyl) nucleoside may be included in the antisense strand.
- all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise 2’ fluoro modified pyrimidines; with the proviso that a 2’-O-(2-methoxyethyl) nucleoside may be included in the antisense strand.
- all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a 2’- O-(2-methoxyethyl) nucleoside may be included in the antisense strand.
- all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a 2’-O-(2-methoxyethyl) nucleoside may be included in the antisense strand.
- all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise 2’ fluoro modified purines; with the proviso that a 2’-O-(2-methoxyethyl) nucleoside may be included in the antisense strand.
- the antisense strand includes the a 2’-O-(2-methoxyethyl) nucleoside.
- the 2’-O-(2-methoxyethyl) nucleoside may be at nucleoside position 4 of the sense strand.
- the 2’-O-(2- methoxyethyl) nucleoside may include a 2’-O-(2-methoxyethyl) thymine nucleoside.
- the antisense strand does not include the a 2’-O-(2-methoxyethyl) nucleoside.
- the 2’-O-(2- methoxyethyl) nucleoside of the antisense strand may be otherwise unmodified.
- any one of the following is true with regard to the sense strand, with the proviso that the sense strand may include a 2’ deoxy nucleoside: all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all purine nucleosides comprise 2’-O-methyl, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides comprise 2’-O-methyl, all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all pyrimidine nucleosides comprise 2’-O-methyl, all pyrimidine nucleosides comprise 2’-O-methyl, all pyrimidine nucle
- all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, with the proviso that the sense strand may include a 2’ deoxy nucleoside.
- all purine nucleosides comprise 2’-O-methyl, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, with the proviso that the sense strand may include a 2’ deoxy nucleoside.
- all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides comprise 2’-O-methyl, with the proviso that the sense strand may include a 2’ deoxy nucleoside.
- all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, with the proviso that the sense strand may include a 2’ deoxy nucleoside.
- all pyrimidine nucleosides comprise 2’-O-methyl, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, with the proviso that the sense strand may include a 2’ deoxy nucleoside.
- all pyrimidine -90- Attorney Docket No.54462-742.601 nucleosides comprise 2’ fluoro, and all purine nucleosides comprise 2’-O-methyl, with the proviso that the sense strand may include a 2’ deoxy nucleoside.
- the sense strand includes the 2’ deoxy nucleoside.
- the sense strand does not include the 2’ deoxy nucleoside.
- Some embodiments include a proviso that the sense strand may include a 2’-O-(2-methoxyethyl) nucleoside (e.g. at position 4, counting from 5’ to 3’). Some embodiments include the 2’-O-(2-methoxyethyl) nucleoside in the sense strand. Some embodiments do not include the 2’-O-(2-methoxyethyl) nucleoside in the sense strand.
- any one of the following is true with regard to the sense strand: all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all purine nucleosides comprise 2’-O-methyl, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides comprise 2’-O-methyl, all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all pyrimidine nucleosides comprise 2’-O-methyl, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all pyrimidine nucleosides comprise 2’-O-methyl, and
- all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl. In some embodiments, in the sense strand, all purine nucleosides comprise 2’-O-methyl, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl. In some embodiments, in the sense strand, all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides comprise 2’-O-methyl.
- all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl. In some embodiments, in the sense strand, all pyrimidine nucleosides comprise 2’-O-methyl, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl. In some embodiments, in the sense strand, all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides comprise 2’-O-methyl.
- the sense strand may include a 2’-O-methoxyethyl nucleoside (e.g. at position 4, counting from 5’ to 3’). Some embodiments include the 2’-O-methoxyethyl nucleoside in the sense strand. Some embodiments do not include the 2’-O-methoxyethyl nucleoside in the sense strand.
- any one of the following is true with regard to the antisense strand, with the proviso that the antisense strand may include a 2’ deoxy nucleoside: all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O- methyl, all purine nucleosides comprise 2’-O-methyl, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all purine nucleosides comprise 2’-O-methyl, and all pyrimidine nucleosides comprise 2’ fluoro, all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all pyrimidine nucleosides comprise 2’-O- methyl, and all purine nucleosides are modified with a mixture of 2’ flu
- all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, with the proviso that the antisense -91- Attorney Docket No.54462-742.601 strand may include a 2’ deoxy nucleoside.
- all purine nucleosides comprise 2’-O-methyl, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, with the proviso that the antisense strand may include a 2’ deoxy nucleoside.
- all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides comprise 2’-O-methyl, with the proviso that the antisense strand may include a 2’ deoxy nucleoside.
- all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, with the proviso that the antisense strand may include a 2’ deoxy nucleoside.
- all pyrimidine nucleosides comprise 2’-O-methyl, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, with the proviso that the antisense strand may include a 2’ deoxy nucleoside.
- all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides comprise 2’-O-methyl, with the proviso that the antisense strand may include a 2’ deoxy nucleoside.
- the antisense strand includes the 2’ deoxy nucleoside.
- the antisense strand does not include the 2’ deoxy nucleoside.
- Some embodiments include a proviso that the antisense strand may include a 2’-O-methoxyethyl nucleoside (e.g. at position 4, counting from 5’ to 3’).
- Some embodiments include the 2’-O-methoxyethyl nucleoside in the antisense strand.
- Some embodiments do not include the 2’-O-methoxyethyl nucleoside in the antisense strand.
- any one of the following is true with regard to the antisense strand: all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all purine nucleosides comprise 2’-O-methyl, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all purine nucleosides comprise 2’-O-methyl, and all pyrimidine nucleosides comprise 2’ fluoro, all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all pyrimidine nucleosides comprise 2’-O-methyl, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, or all pyrimidine nucle
- all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl. In some embodiments, in the antisense strand, all purine nucleosides comprise 2’-O-methyl, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl. In some embodiments, in the antisense strand, all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides comprise 2’-O-methyl.
- all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl. In some embodiments, in the antisense strand, all pyrimidine nucleosides comprise 2’-O-methyl, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl. In some embodiments, in the antisense strand, all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides comprise 2’-O-methyl.
- the antisense strand may include a 2’-O-methoxyethyl nucleoside (e.g. at position 4, counting from 5’ to 3’). Some embodiments include the 2’-O-methoxyethyl nucleoside in the antisense strand. Some embodiments do not include the 2’-O-methoxyethyl nucleoside in the antisense strand. -92- Attorney Docket No.54462-742.601 [00159] In some embodiments, the antisense strand comprises one or two 3’ phosphorothioate linkages.
- the sense strand comprises one or two 5’ phosphorothioate linkages.
- the sense strand does not comprise one or two 5’ phosphorothioate linkages. For example, in some embodiments, there are no phosphorothioate linkages between the last 3 nucleotides at the 5’ end of the sense strand. In some embodiments, the sense strand comprises 5’ phosphate linkages. In some embodiments, the sense strand comprises one or two 3’ phosphorothioate linkages. For example, there may be a phosphorothioate linkage between the first and second nucleotides from the 3’ end of the sense strand, or there may be phosphorothioate linkages between the first, second and third nucleotides from the 3’ end of the sense strand.
- the antisense strand comprises a 5’ end comprising 2 phosphorothioate linkages.
- the 5’ end may comprise 3 nucleosides separated by the 2 phosphorothioate linkages.
- the antisense strand comprises a 3’ end comprising 2 phosphorothioate linkages.
- the 3’ end may comprise 3 nucleosides separated by the 2 phosphorothioate linkages.
- position 9 of the sense strand can be a 2’deoxy. In these cases, 2’F and 2’OMe modifications may occur at the other positions of the sense strand.
- the sense strand of any of the siRNAs comprises a modification pattern which conforms to these sense strand rules. [00162] In some cases, the sense strand of any of the siRNAs comprises a modification pattern which conforms to these sense strand rules.
- compositions comprising an oligonucleotide that targets GPAM and when administered to a cell decreases expression of GPAM, wherein the oligonucleotide comprises a small interfering RNA (siRNA) comprising a sense strand and an antisense strand, wherein the sense strand comprises a sense strand sequence described herein in which at least one internucleoside linkage is modified and at least one nucleoside is modified, or an sense strand sequence comprising 1 or 2 nucleoside substitutions, additions, or deletions of the oligonucleotide sequence in which at least one internucleoside linkage is modified and at least one nucleoside is modified, and wherein the antisense strand comprises an antisense strand sequence described herein in which at least one internucleoside linkage is modified and at least one nucleoside is modified, or an oligonucleotide sequence comprising 1 or 2 nucleoside substitution
- the siRNA comprises a sense strand having a sequence in accordance with any of SEQ ID NOs: 12709-12733.
- the sense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 12709-12733, at least 80% identical to any one of SEQ ID NOs: 12709-12733, at least 85% identical to of any one of SEQ ID NOs: -93- Attorney Docket No.54462-742.601 12709-12733, at least 90% identical to any one of SEQ ID NOs: 12709-12733, or at least 95% identical to any one of SEQ ID NOs: 12709-12733.
- the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12709-12733, or a sense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12709-12733, or a sense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 12709-12733. In some embodiments, the siRNA comprises a sense strand having a sequence in accordance with any of SEQ ID NOs: 12759-12866.
- the sense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 12759-12866, at least 80% identical to any one of SEQ ID NOs: 12759-12866, at least 85% identical to of any one of SEQ ID NOs: 12759-12866, at least 90% identical to any one of SEQ ID NOs: 12759-12866, or at least 95% identical to any one of SEQ ID NOs: 12759-12866.
- the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12759-12866, or a sense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions.
- the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12759-12866, or a sense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 12759-12866.
- the sense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the sense strand sequence may include the first 19 nucleotides of any of the aforementioned sequences.
- the sense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the sense strand may comprise an overhang.
- the sense strand may comprise a modification pattern described herein, such as a different set of modifications or modification pattern than the aforementioned sequences.
- the sense strand may comprise a lipid moiety.
- the sense strand may comprise a GalNAc moiety.
- the siRNA comprises an antisense strand having a sequence in accordance with any of SEQ ID NOs: 12734-12758.
- the antisense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 12734-12758, at least 80% identical to any one of SEQ ID NOs: 12734-12758, at least 85% identical to of any one of SEQ ID NOs: 12734-12758, at least 90% identical to any one of SEQ ID NOs: 12734-12758, or at least 95% identical to any one of SEQ ID NOs: 12734-12758.
- the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12734-12758, or an antisense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12734-12758, or an antisense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 12734- 12758.
- the antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the antisense strand -94- Attorney Docket No.54462-742.601 sequence may include the first 19 nucleotides of any of the aforementioned sequences.
- the antisense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the antisense strand may comprise an overhang.
- the antisense strand may comprise a modification pattern described herein, such as a different set of modifications or modification pattern than the aforementioned sequences.
- the antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand having a sequence in accordance with any of SEQ ID NOs: 12868-12974.
- the sense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 12868-12974, at least 80% identical to any one of SEQ ID NOs: 12868-12974, at least 85% identical to of any one of SEQ ID NOs: 12868-12974, at least 90% identical to any one of SEQ ID NOs: 12868-12974, or at least 95% identical to any one of SEQ ID NOs: 12868-12974.
- the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12868-12974, or a sense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions.
- the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12868-12974, or a sense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 12868-12974.
- the sense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the sense strand sequence may include the first 19 nucleotides of any of the aforementioned sequences.
- the sense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the sense strand may comprise an overhang.
- the sense strand may comprise a modification pattern described herein, such as a different set of modifications or modification pattern than the aforementioned sequences.
- the sense strand may comprise a lipid moiety.
- the sense strand may comprise a GalNAc moiety.
- the siRNA comprises an antisense strand having a sequence in accordance with any of SEQ ID NOs: 12975- 13081.
- the antisense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 12975-13081, at least 80% identical to any one of SEQ ID NOs: 12975-13081, at least 85% identical to of any one of SEQ ID NOs: 12975-13081, at least 90% identical to any one of SEQ ID NOs: 12975-13081, or at least 95% identical to any one of SEQ ID NOs: 12975-13081.
- the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12975-13081, or an antisense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12975-13081, or an antisense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 12975- 13081.
- the antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the antisense strand sequence may include the first 19 nucleotides of any of the aforementioned sequences.
- the antisense -95- Attorney Docket No.54462-742.601 strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the antisense strand may comprise an overhang.
- the antisense strand may comprise a modification pattern described herein, such as a different set of modifications or modification pattern than the aforementioned sequences.
- the antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand having a sequence in accordance with any of SEQ ID NOs: 13724-13751.
- the sense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 13724-13751, at least 80% identical to any one of SEQ ID NOs: 13724-13751, at least 85% identical to of any one of SEQ ID NOs: 13724-13751, at least 90% identical to any one of SEQ ID NOs: 13724-13751, or at least 95% identical to any one of SEQ ID NOs: 13724-13751.
- the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13724-13751, or a sense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions.
- the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13724-13751, or a sense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 13724-13751.
- the sense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the sense strand sequence may include the first 19 nucleotides of any of the aforementioned sequences.
- the sense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the sense strand may comprise an overhang.
- the sense strand may comprise a modification pattern described herein, such as a different set of modifications or modification pattern than the aforementioned sequences.
- the sense strand may comprise a lipid moiety.
- the sense strand may comprise a GalNAc moiety.
- the siRNA comprises an antisense strand having a sequence in accordance with any of SEQ ID NOs: 13752- 13779.
- the antisense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 13752-13779, at least 80% identical to any one of SEQ ID NOs: 13752-13779, at least 85% identical to of any one of SEQ ID NOs: 13752-13779, at least 90% identical to any one of SEQ ID NOs: 13752-13779, or at least 95% identical to any one of SEQ ID NOs: 13752-13779.
- the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13752-13779, or an antisense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions.
- the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13752-13779, or an antisense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the antisense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 13752- 13779.
- the antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the antisense strand sequence may include the first 19 nucleotides of any of the aforementioned sequences.
- the antisense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in -96- Attorney Docket No.54462-742.601 the 5’ to 3’ direction) of any of the aforementioned sequences.
- the antisense strand may comprise an overhang.
- the antisense strand may comprise a modification pattern described herein, such as a different set of modifications or modification pattern than the aforementioned sequences.
- the antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of subset G.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of subset G.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset G, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset G, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of subset G.
- the sense strand or antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the sense strand or antisense strand sequence may include the first 19 nucleotides of any of the aforementioned sequences.
- the sense strand or antisense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the sense strand or antisense strand may comprise an overhang.
- the sense strand or antisense strand may comprise any modifications described herein (e.g. a different set of modifications or modification pattern than subset G).
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of subset H.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of subset H.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset H, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset H, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of subset H.
- the sense strand or antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the sense strand or antisense strand sequence may include the first 19 nucleotides of any of the aforementioned sequences.
- the sense strand or antisense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the sense strand or antisense strand may comprise an overhang.
- the sense -97- Attorney Docket No.54462-742.601 strand or antisense strand may comprise any modifications described herein (e.g. a different set of modifications or modification pattern than subset H).
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 10.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 10.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 10, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 10, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence [00170]
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 11.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 11.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 11, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 11, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 11.
- the sense strand or antisense strand may comprise an overhang.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 15.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 15.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 15, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 15, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence. 100% identical to a sense strand or antisense strand sequence of Table 15.
- the sense strand or antisense strand may comprise an overhang.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 19.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 19.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 19, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 19, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 19.
- the sense strand or antisense strand may comprise an overhang.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 21.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 21.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 21, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 21, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 21.
- the sense strand or antisense strand may comprise an overhang.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 24.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 24.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 24, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 24, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 24.
- the sense strand or antisense strand may comprise an overhang.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 27.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 27.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 27, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 27, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 27.
- the sense strand or antisense strand may comprise an overhang.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 30.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 30.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 30, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 30, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 30.
- the sense strand or antisense strand may comprise an overhang.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 34.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 34.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 34, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 34, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 34.
- the sense strand or antisense strand may comprise an overhang.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 48.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 48.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 48, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 48, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 48.
- the sense strand or antisense strand may comprise an overhang.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 62.
- the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 62.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 62, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 62, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 62.
- the sense strand or antisense strand may comprise an overhang.
- the sense strand or antisense strand may comprise any modifications described herein.
- the sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand having a sequence in accordance with any of SEQ ID NOs: 12953, 12958, 13724, 13725, 13726, 13727, 13728, 13729, 13730, 13731, 13732, 13733, 13734, 13735, 12959, 13736, 13737, 13738, 13739, 13740, 13741, 13742, 13743, 13744, 13745, 13746, 13747, 12877, 12927, 12928, 12929, 12930, 12931, 12932, 12933, 12934, 12960, 13748, 13749, 13750, 13751, 12883, 12910, 12911, 12912, 12913, 12914, 12915, 12916, 12917, 12947, 12948, 12965, 12885, 12901, 12902, 12903
- the sense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 12953, 12958, 13724, 13725, 13726, 13727, 13728, 13729, 13730, 13731, 13732, 13733, 13734, 13735, 12959, 13736, 13737, 13738, 13739, 13740, 13741, 13742, 13743, 13744, 13745, 13746, 13747, 12877, 12927, 12928, 12929, 12930, 12931, 12932, 12933, 12934, 12960, 13748, 13749, 13750, 13751, 12883, 12910, 12911, 12912, 12913, 12914, 12915, -101- Attorney Docket No.54462-742.601 12916, 12917, 12947, 12948, 12965, 12
- the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12953, 12958, 13724, 13725, 13726, 13727, 13728, 13729, 13730, 13731, 13732, 13733, 13734, 13735, 12959, 13736, 13737, 13738, 13739, 13740, 13741, 13742, 13743, 13744, 13745, 13746, 13747, 12877, 12927, 12928, 12929, 12930, 12931, 12932, 12933, 12934, 12960, 13748, 13749, 13750, 13751, 12883, 12910, 12911, 12912, 12913, 12914, 12915, 12916, 12917, 12947, 12948, 12965, 12885, 12901, 12902, 12903, 12904, 129
- the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12953, 12958, 13724, 13725, 13726, 13727, 13728, 13729, 13730, 13731, 13732, 13733, 13734, 13735, 12959, 13736, 13737, 13738, 13739, 13740, 13741, 13742, 13743, 13744, 13745, -102- Attorney Docket No.54462-742.601 13746, 13747, 12877, 12927, 12928, 12929, 12930, 12931, 12932, 12933, 12934, 12960, 13748, 13749, 13750, 13751, 12883, 12910, 12911, 12912, 12913, 12914, 12915, 12916, 12917, 12947, 12948, 12965, 12885, 12901
- the sense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 12953, 12958, 13724, 13725, 13726, 13727, 13728, 13729, 13730, 13731, 13732, 13733, 13734, 13735, 12959, 13736, 13737, 13738, 13739, 13740, 13741, 13742, 13743, 13744, 13745, 13746, 13747, 12877, 12927, 12928, 12929, 12930, 12931, 12932, 12933, 12934, 12960, 13748, 13749, 13750, 13751, 12883, 12910, 12911, 12912, 12913, 12914, 12915, 12916, 12917, 12947, 12948, 12965, 12885, 12901, 12902, 12903, 12904, 129
- the sense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the sense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the sense strand may comprise an overhang.
- the sense strand may comprise a modification pattern described herein.
- the sense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises an antisense strand having a sequence in accordance with any of SEQ ID NOs: 13060, 13065, 13752, 13753, 13754, 13755, 13756, 13757, 13758, 13759, 13760, 13761, 13762, 13763, 13066, 13764, 12984, 13034, 13035, 13036, 13037, 13038, 13039, 13040, 13041, 13067, 13765, 13766, 13767, 13768, 12990, 13017, 13018, 13019, 13020, 13021, 13022, 13023, 13024, 13054, 13055, 13072, 12992, 13008, 13009, 13010, 13011, 13012, 13013, 13014, 13015, 13016, 12993, 13000, 13001, 13002, 13003, 13004, 13005, 13006, 13007, 13075, 12996, 13025, 13026, 13027, 13028
- the antisense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 13060, 13065, 13752, 13753, 13754, 13755, 13756, 13757, 13758, 13759, 13760, 13761, 13762, 13763, 13066, 13764, 12984, 13034, 13035, 13036, 13037, 13038, 13039, 13040, 13041, 13067, 13765, 13766, 13767, 13768, 12990, 13017, 13018, 13019, 13020, 13021, 13022, 13023, 13024, 13054, 13055, 13072, 12992, 13008, 13009, 13010, 13011, 13012, 13013, 13014, 13015, 13016, 12993, 13000, 13001, 13002, 13003, 13004, 13005, 13006, 13007, 13075, 12996, 13025, 13026, 13027, 13028, 130
- the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13060, 13065, 13752, 13753, 13754, 13755, 13756, 13757, 13758, 13759, 13760, 13761, 13762, 13763, 13066, 13764, 12984, 13034, 13035, 13036, 13037, 13038, 13039, 13040, 13041, 13067, 13765, 13766, 13767, 13768, 12990, 13017, 13018, 13019, 13020, 13021, 13022, 13023, 13024, 13054, 13055, 13072, 12992, 13008, 13009, 13010, 13011, 13012, 13013, 13014, 13015, 13016, 12993, 13000, 13001, 13002, 13003, 13004, 13005, 13006, 13007, 13075, 12996, 13025, 13026, 13027, 13028, 13029, 13030
- the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13060, 13065, 13752, 13753, 13754, 13755, 13756, 13757, 13758, 13759, 13760, 13761, 13762, 13763, 13066, 13764, 12984, 13034, 13035, 13036, 13037, 13038, 13039, 13040, 13041, 13067, 13765, 13766, 13767, 13768, 12990, 13017, 13018, 13019, 13020, 13021, 13022, 13023, 13024, 13054, 13055, 13072, 12992, 13008, 13009, 13010, 13011, 13012, 13013, 13014, 13015, 13016, 12993, 13000, 13001, 13002, 13003, 13004, 13005, 13006, 13007, 13075, 12996, 13025, 13026, 13027, 13028, 13029, 13030
- the antisense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 13060, 13065, 13752, 13753, 13754, 13755, 13756, 13757, 13758, 13759, 13760, 13761, 13762, 13763, 13066, 13764, 12984, 13034, 13035, 13036, 13037, 13038, 13039, 13040, 13041, 13067, 13765, 13766, 13767, 13768, 12990, 13017, 13018, 13019, 13020, 13021, 13022, 13023, 13024, 13054, 13055, 13072, 12992, 13008, 13009, 13010, 13011, 13012, 13013, 13014, 13015, 13016, 12993, 13000, 13001, 13002, 13003, 13004, 13005, 13006, 13007, 13075, 12996, 13025, 13026, 13027, 13028, 13029, 13030
- the antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the antisense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the antisense strand may comprise an overhang.
- the antisense strand may comprise a modification pattern described herein.
- the antisense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises a sense strand having a sequence in accordance with any of SEQ ID NOs: 12959, 12928, 12932, 12960, 12947, 12965, 12904, 12909, 12897, 12968, 12926, 12969, 12970, 12935, or 12936.
- the sense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 12959, 12928, 12932, 12960, 12947, 12965, 12904, 12909, 12897, 12968, 12926, 12969, 12970, 12935, or 12936., at least 80% identical to any one of SEQ ID NOs: 12959, 12928, 12932, 12960, 12947, 12965, 12904, 12909, 12897, 12968, 12926, 12969, 12970, 12935, or 12936., at least 85% identical to of any one of SEQ ID NOs: 12959, 12928, 12932, 12960, 12947, 12965, 12904, 12909, 12897, 12968, 12926, 12969, 12970, 12935, or 12936., at least 90% identical to any one of SEQ ID NOs:
- the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12959, 12928, 12932, 12960, 12947, 12965, 12904, 12909, 12897, 12968, 12926, 12969, 12970, 12935, or 12936., or a sense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions.
- the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12959, 12928, 12932, 12960, 12947, 12965, 12904, 12909, 12897, 12968, 12926, 12969, 12970, 12935, or 12936., or a sense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the sense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 12959, 12928, 12932, 12960, 12947, 12965, 12904, 12909, 12897, 12968, 12926, 12969, 12970, 12935, or 12936.
- the sense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the sense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the sense strand may comprise an overhang.
- the sense strand may comprise a modification pattern described herein.
- the sense strand may comprise a lipid moiety or a GalNAc moiety.
- the siRNA comprises an antisense strand having a sequence in accordance with any of SEQ ID NOs: 13060, 13065, 13066, 13035, 13039, 13067, 13054, 13072, 13011, 13016, 13004, 13075, 13033, 13076, 13077, 13042, or 13043.
- the antisense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 13060, 13065, 13066, 13035, 13039, 13067, 13054, 13072, 13011, 13016, 13004, 13075, 13033, 13076, 13077, 13042, or 13043, at least 80% identical to any one of SEQ ID NOs: 13060, 13065, 13066, 13035, 13039, 13067, 13054, 13072, 13011, 13016, 13004, 13075, 13033, 13076, 13077, 13042, or 13043, at least 85% identical to of any one of SEQ ID NOs: 13060, 13065, 13066, 13035, 13039, 13067, 13054, 13072, 13011, 13016, 13004, 13075, 13033, 13076, 13077, 13042, or 13043, at least 90% identical to any one of SEQ ID NOs: 13060, 13065, 13066, 13035, 13039, 13067, 13054, 13072, 130
- the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13060, 13065, 13066, 13035, 13039, 13067, 13054, 13072, 13011, 13016, 13004, 13075, 13033, 13076, 13077, 13042, or 13043, or an antisense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions.
- the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13060, 13065, 13066, 13035, 13039, 13067, 13054, 13072, 13011, 13016, 13004, 13075, 13033, 13076, 13077, 13042, or 13043, or an antisense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions.
- the antisense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 13060, 13065, 13066, 13035, 13039, 13067, 13054, 13072, 13011, 13016, 13004, 13075, 13033, 13076, 13077, 13042, or 13043.
- the antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the antisense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences.
- the antisense strand may comprise an overhang.
- the antisense strand may comprise a modification pattern described herein.
- the antisense strand may comprise a lipid moiety or a GalNAc moiety. 4.
- the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an antisense oligonucleotide (ASO).
- ASO antisense oligonucleotide
- the ASO comprises modification pattern ASO1: 5’-nsnsnsnsnsnsdNsdNsdNsdNsdNsdNsdNsdNsdNsnsnsnsn-3’ (SEQ ID NO: 12928), wherein “dN” is any deoxynucleotide, “n” is a 2’O-methyl or 2’-O-(2-methoxyethyl)-modified nucleoside, and “s” is a phosphorothioate linkage.
- the ASO comprises modification pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, 70S, 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, or 8AS, 9S,
- the composition is a pharmaceutical composition. In some embodiments, the composition is sterile. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. [00186] In some embodiments, the pharmaceutically acceptable carrier comprises water. In some embodiments, the pharmaceutically acceptable carrier comprises a buffer. In some embodiments, the pharmaceutically acceptable carrier comprises a saline solution. In some embodiments, the pharmaceutically acceptable carrier comprises water, a buffer, or a saline solution. In some embodiments, the composition comprises a liposome. In some embodiments, the pharmaceutically acceptable carrier comprises liposomes, lipids, nanoparticles, proteins, protein-antibody complexes, peptides, cellulose, nanogel, or a combination thereof.
- METHODS AND USES Disclosed herein, in some embodiments, are methods of administering a composition described herein to a subject. Some embodiments relate to use a composition described herein, such as administering the composition to a subject. [00188] Some embodiments relate to a method of treating a disorder in a subject in need thereof. Some embodiments relate to use of a composition described herein in the method of treatment. Some embodiments include administering a composition described herein to a subject with the disorder. In some embodiments, the administration treats the disorder in the subject. In some embodiments, the composition treats the disorder in the subject. The disorder may comprise a disease. [00189] In some embodiments, the treatment comprises prevention, inhibition, or reversion of the disorder in the subject.
- Some embodiments relate to use of a composition described herein in the method of preventing, inhibiting, or reversing the disorder. Some embodiments relate to a method of preventing, inhibiting, or reversing a disorder a disorder in a subject in need thereof. Some embodiments include administering a composition described herein to a subject with the disorder. In some embodiments, the administration prevents, inhibits, or reverses the disorder in the subject. In some embodiments, the composition prevents, inhibits, or reverses the disorder in the subject. [00190] Some embodiments relate to a method of preventing a disorder a disorder in a subject in need thereof. Some embodiments relate to use of a composition described herein in the method of preventing the disorder.
- Some embodiments include administering a composition described herein to a subject with the disorder. In some embodiments, the administration prevents the disorder in the subject. In some embodiments, the composition prevents the disorder in the subject. [00191] Some embodiments relate to a method of inhibiting a disorder a disorder in a subject in need thereof. Some embodiments relate to use of a composition described herein in the method of inhibiting the disorder. Some embodiments include administering a composition described herein to a subject with the -107- Attorney Docket No.54462-742.601 disorder. In some embodiments, the administration inhibits the disorder in the subject. In some embodiments, the composition inhibits the disorder in the subject.
- Some embodiments relate to a method of reversing a disorder a disorder in a subject in need thereof. Some embodiments relate to use of a composition described herein in the method of reversing the disorder. Some embodiments include administering a composition described herein to a subject with the disorder. In some embodiments, the administration reverses the disorder in the subject. In some embodiments, the composition reverses the disorder in the subject. [00193] In some embodiments, the administration is systemic. In some embodiments, the administration is intravenous. In some embodiments, the administration is by injection. A. Disorders [00194] Some embodiments of the methods described herein include treating a disorder in a subject in need thereof. In some embodiments, the disorder is a liver disease.
- Non-limiting examples of liver diseases may include non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), alcoholic liver disease, liver fibrosis, liver cirrhosis, or hepatocellular carcinoma.
- the disorder is a cardiometabolic disease.
- cardiometabolic diseases may include hyperlipidemia, ischemic heart disease, or coronary heart disease.
- the disorder comprises NAFLD.
- the disorder comprises NASH.
- the disorder comprises alcoholic liver disease.
- the disorder comprises liver fibrosis.
- the disorder comprises liver cirrhosis.
- the disorder comprises hepatocellular carcinoma.
- the disorder comprises hyperlipidemia. In some embodiments, the disorder comprises a heart disease. In some embodiments, the heart disease comprises ischemic heart disease. In some embodiments, the heart disease comprises coronary heart disease.
- subjects include vertebrates, animals, mammals, dogs, cats, cattle, rodents, mice, rats, primates, monkeys, and humans. In some embodiments, the subject is a vertebrate. In some embodiments, the subject is an animal. In some embodiments, the subject is a mammal. In some embodiments, the subject is a dog. In some embodiments, the subject is a cat. In some embodiments, the subject is a cattle.
- the subject is a mouse. In some embodiments, the subject is a rat. In some embodiments, the subject is a primate. In some embodiments, the subject is a monkey. In some embodiments, the subject is an animal, a mammal, a dog, a cat, cattle, a rodent, a mouse, a rat, a primate, or a monkey. In some embodiments, the subject is a human. [00196] In some embodiments, the subject is male. In some embodiments, the subject is female. In some embodiments, the subject is an adult (e.g. at least 18 years old).
- the subject has a body mass index (BMI) of 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more, or a range defined by any two of the aforementioned integers.
- BMI body mass index
- the subject is overweight.
- the subject has a BMI of 25 or more.
- the subject has a BMI of 25- 29.
- the subject is obese.
- the subject has a BMI of 30 or -108- Attorney Docket No.54462-742.601 more.
- the subject has a BMI of 30-39.
- the subject has a BMI of 40-50. In some embodiments, the subject has a BMI of 25-50.
- C. Baseline measurements [00198] Some embodiments of the methods described herein include obtaining a baseline measurement from a subject. For example, in some embodiments, a baseline measurement is obtained from the subject prior to treating the subject.
- baseline measurements include a baseline liver fat percentage measurement, a baseline liver fibrosis score measurement, a baseline NAFLD activity score measurement, a baseline blood alanine aminotransferase (ALT) measurement, a baseline blood aspartate aminotransferase (AST) measurement, a baseline blood aspartate aminotransferase (ASP) measurement, a baseline blood bilirubin measurement, a baseline low-density lipoprotein (LDL) measurement, a baseline total cholesterol measurement, a baseline non-HDL cholesterol measurement, a baseline apolipoprotein B (APOB), a baseline GPAM protein measurement, or a baseline GPAM mRNA measurement.
- the baseline measurement is obtained directly from the subject.
- the baseline measurement is obtained by observation, for example by observation of the subject or of the subject’s tissue. In some embodiments, the baseline measurement is obtained noninvasively using an imaging device. [00200] In some embodiments, the baseline measurement is obtained in a sample from the subject. In some embodiments, the baseline measurement is obtained in one or more histological tissue sections. In some embodiments, the baseline measurement is obtained by performing an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay, on the sample obtained from the subject. In some embodiments, the baseline measurement is obtained by an immunoassay, a colorimetric assay, a fluorescence assay, or a chromatography (e.g. HPLC) assay.
- an immunoassay such as an immunoassay, a colorimetric assay, a fluorescence assay, or a chromatography (e.g. HPLC) assay.
- the baseline measurement is obtained by PCR.
- the baseline measurement is a baseline liver fat percentage measurement.
- the baseline liver fat percentage measurement is a baseline percentage as measured by MRI.
- the baseline liver fat percentage measurement is a baseline percentage as measured by CT scan.
- the baseline liver fat percentage is measured in a liver biopsy.
- the baseline measurement is a baseline NAFLD activity score measurement.
- the baseline NAFLD activity score measurement is measured by histological analysis.
- the baseline NAFLD activity score measurement includes a numerical score for steatosis (0–3), hepatocyte ballooning (1–2), and lobular inflammation (0–3).
- the score thresholds of ⁇ 3 correlates with a diagnosis of not-NASH. In some embodiments, the score thresholds of > 5 correlates with a diagnosis of NASH. In some embodiments, a baseline NAFLD activity score measurement is assayed by imaging. [00203] In some embodiments, the baseline measurement is a baseline alanine aminotransferase (ALT) measurement. In some embodiments, the baseline ALT measurement includes a baseline blood ALT measurement. In some embodiments, the baseline ALT measurement is measured by enzymatic -109- Attorney Docket No.54462-742.601 activity. In some embodiments, the baseline ALT measurement is measured by presence of an ALT epitope.
- ALT a baseline alanine aminotransferase
- the baseline ALT measurement is a baseline circulating ALT measurement.
- the baseline ALT measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay.
- the baseline measurement is a baseline aspartate aminotransferase (AST) measurement.
- the baseline AST measurement includes a baseline blood AST measurement.
- the baseline AST measurement is measured by enzymatic activity.
- the baseline AST measurement is measured by presence of an AST epitope.
- the baseline AST measurement is a baseline circulating AST measurement.
- the baseline AST measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay.
- the baseline measurement is a baseline aspartate aminotransferase (ASP) measurement.
- the baseline ASP measurement includes a baseline blood ASP measurement.
- the baseline ASP measurement is measured by enzymatic activity.
- the baseline ASP measurement is measured by presence of an ASP epitope.
- the baseline ASP measurement is a baseline circulating ASP measurement.
- the baseline ASP measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay.
- the baseline measurement is a baseline bilirubin measurement.
- the baseline bilirubin measurement includes a baseline blood bilirubin measurement.
- the baseline bilirubin measurement is measured by presence of a bilirubin epitope.
- the baseline bilirubin measurement is a baseline circulating bilirubin measurement.
- the baseline bilirubin measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay.
- the baseline measurement is a baseline low-density lipoprotein (LDL) measurement.
- LDL low-density lipoprotein
- the baseline LDL measurement includes a baseline blood LDL measurement. In some embodiments, the baseline LDL measurement is measured by presence of an LDL epitope. In some embodiments, the baseline LDL measurement is a baseline circulating LDL measurement. In some embodiments, the baseline LDL measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00208] In some embodiments, the baseline measurement is a baseline total cholesterol measurement. In some embodiments, the baseline total cholesterol measurement includes a baseline blood total cholesterol measurement. In some embodiments, the baseline total cholesterol is measured by presence of a total cholesterol epitope. In some embodiments, the baseline total cholesterol measurement is a baseline circulating total cholesterol measurement.
- the baseline total cholesterol measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay.
- the baseline measurement is a baseline non-HDL cholesterol measurement.
- the baseline non-HDL cholesterol measurement includes a baseline -110- Attorney Docket No.54462-742.601 blood non-HDL cholesterol measurement.
- the baseline non-HDL cholesterol measurement is a baseline circulating non-HDL cholesterol measurement.
- the baseline non-HDL cholesterol measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay.
- the baseline measurement is a baseline apolipoprotein B (APOB) measurement.
- the baseline APOB includes a baseline blood APOB measurement.
- the baseline APOB is measured by presence of an APOB epitope.
- the baseline APOB measurement is a baseline circulating APOB measurement.
- the baseline APOB measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay.
- the baseline measurement is a baseline liver fibrosis measurement.
- the baseline liver fibrosis measurement is a baseline liver fibrosis score (LFS).
- the baseline LFS comprises a score of 0, 1, 2, 3, or 4, or a range of scores defined by any two of the aforementioned numbers. In some embodiments, the baseline LFS comprises a score of 0- 4. In some embodiments, the baseline LFS is obtained using a scoring system exemplified in Table 2. In some embodiments, the baseline LFS measurement is obtained noninvasively. In some embodiments, the baseline LFS measurement is obtained by a medical imaging device such as a vibration-controlled transient elastography (VCTE) device, a shear wave elastography device, a medical resonance imaging (MRI) device, a magnetic resonance spectroscopy device, a computed tomography device, or an ultrasound device.
- VCTE vibration-controlled transient elastography
- MRI medical resonance imaging
- spectroscopy device a computed tomography device
- computed tomography device or an ultrasound device.
- the baseline LFS measurement is obtained in a liver sample.
- the baseline LFS is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay.
- the baseline LFS is obtained using one or more indirect markers or measures of liver fibrosis such as an aspartate aminotransferase-to-platelet ratio index (APRI), a Fibrosis-4 (FIB-4) index, a FibroIndex, a Forns Index, a Hepascore, or a FibroTest.
- APRI aspartate aminotransferase-to-platelet ratio index
- FIB-4 Fibrosis-4
- FibroIndex a FibroIndex
- Forns Index a Hepascore
- Hepascore or a FibroTest.
- the baseline LFS is obtained using one or more indirect markers or measures of liver fibrosis such as a FIBROSpect test or a FIBROSpect II test.
- the baseline LFS is obtained by RT-qPCR or RNA sequencing of one or more fibrosis-related genes such as a collagen gene.
- the baseline LFS or the baseline LFS is obtained using a scoring system upon a visual inspection of a sample such as a histological sample.
- the baseline LFS or the baseline LFS is obtained using a stain with an affinity to collagen.
- the baseline LFS measurement is measured by FibroScan® in kilopascals (kPa).
- the baseline LFS is measured by histological analysis.
- the baseline LFS measurement is a baseline LFS measurement assayed by imaging.
- the imaging is by MRI or CT scan. Sc 1 Mild fibrosis Fibrous portal expansion Periportal fibrotic expansion 2 Moderate fibrosis Rare bridges or septae Periportal septae (> 1 septum) 3 Severe fibrosis Numerous bridges or septae Portal-central septae -111- Attorney Docket No.54462-742.601 4 Cirrhosis Cirrhosis Cirrhosis Cirrhosis [00212]
- the baseline measurement is a baseline GPAM mRNA measurement.
- the baseline GPAM mRNA measurement comprises a baseline GPAM mRNA level. In some embodiments, the baseline GPAM mRNA level is indicated as an amount or percentage of GPAM mRNA per sample weight. In some embodiments, the baseline GPAM mRNA level is indicated as an amount or percentage of GPAM mRNA per sample volume. In some embodiments, the baseline GPAM mRNA level is indicated as an amount or percentage of GPAM mRNA per total mRNA within the sample. In some embodiments, the baseline GPAM mRNA level is indicated as an amount or percentage of GPAM mRNA per total nucleic acids within the sample.
- the baseline GPAM mRNA level is indicated relative to another mRNA level, such as an mRNA level of a housekeeping gene, within the sample.
- the baseline GPAM mRNA measurement is a baseline tissue GPAM mRNA measurement.
- the baseline GPAM mRNA measurement is obtained by an assay such as a polymerase chain reaction (PCR) assay.
- the PCR comprises quantitative PCR (qPCR).
- the PCR comprises reverse transcription of the GPAM mRNA.
- the baseline measurement is a baseline GPAM protein measurement.
- the baseline GPAM protein measurement comprises a baseline GPAM protein level.
- the baseline GPAM protein level is indicated as a mass or percentage of GPAM protein per sample weight. In some embodiments, the baseline GPAM protein level is indicated as a mass or percentage of GPAM protein per sample volume. In some embodiments, the baseline GPAM protein level is indicated as a mass or percentage of GPAM protein per total protein within the sample. In some embodiments, the baseline GPAM protein measurement is a baseline tissue GPAM protein measurement. In some embodiments, the baseline GPAM protein measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00214] Some embodiments of the methods described herein include obtaining a sample from a subject.
- the baseline measurement is obtained in a sample obtained from the subject.
- the sample is obtained from the subject prior to administration or treatment of the subject with a composition described herein.
- a baseline measurement is obtained in a sample obtained from the subject prior to administering the composition to the subject.
- the sample is obtained from the subject in a fasted state.
- the sample is obtained from the subject after an overnight fasting period.
- the sample is obtained from the subject in a fed state.
- the sample comprises a fluid.
- the sample is a fluid sample.
- the sample is a blood, plasma, or serum sample.
- the sample comprises blood.
- the sample is a blood sample. In some embodiments, the sample is a whole-blood sample. In some embodiments, the blood is fractionated or centrifuged. In some embodiments, the sample comprises plasma. In some embodiments, the sample is a -112- Attorney Docket No.54462-742.601 plasma sample.
- a blood sample may be a plasma sample. In some embodiments, the sample comprises serum. In some embodiments, the sample is a serum sample. A blood sample may be a serum sample.
- the sample comprises a tissue. In some embodiments, the sample is a tissue sample. In some embodiments, the tissue comprises liver or adipose tissue.
- the baseline GPAM mRNA measurement, or the baseline GPAM protein measurement may be obtained in a liver or adipose sample obtained from the patient.
- the tissue comprises adipose tissue.
- the adipose tissue comprises white adipose tissue.
- the adipose tissue may include adipocytes.
- the adipose tissue may include preadipocytes.
- the tissue comprises liver tissue.
- the liver may include hepatocytes.
- the tissue comprises vasculature tissue.
- the vasculature tissue comprises endothelial cells. [00217]
- the sample includes cells.
- the sample comprises a cell.
- the cell comprises an adipose cell or a liver cell.
- the cell is an adipose cell.
- the adipose cell is an adipocyte.
- the cell is a liver cell.
- the liver cell is a hepatocyte.
- the cell is a vasculature cell.
- the vasculature cell is an endothelial cell. D.
- the composition or administration of the composition affects a measurement such as a liver fat percentage measurement, a liver fibrosis score measurement, a NAFLD activity score measurement, a blood alanine aminotransferase (ALT) measurement, a blood aspartate aminotransferase (AST) measurement, a blood aspartate aminotransferase (ASP) measurement, a blood bilirubin measurement, a low-density lipoprotein (LDL) measurement, a total cholesterol measurement, a non-HDL cholesterol measurement, an apolipoprotein B (APOB), a GPAM protein measurement, or a GPAM mRNA measurement, relative to the baseline measurement.
- a measurement such as a liver fat percentage measurement, a liver fibrosis score measurement, a NAFLD activity score measurement, a blood alanine aminotransferase (ALT) measurement, a blood aspartate aminotransferase (AST) measurement, a blood aspartate aminotransferase (ASP) measurement
- Some embodiments of the methods described herein include obtaining the measurement from a subject.
- the measurement may be obtained from the subject after treating the subject.
- the measurement is obtained in a second sample (such as a fluid or tissue sample described herein) obtained from the subject after the composition is administered to the subject.
- the measurement is an indication that the disorder has been treated.
- the measurement is obtained directly from the subject.
- the measurement is obtained noninvasively using an imaging device.
- the measurement is obtained in a second sample from the subject.
- the measurement is obtained in one or more histological tissue sections.
- the measurement is obtained by performing an assay on the second sample obtained from the subject.
- the measurement is obtained by an assay, such as an assay described herein.
- the assay is an immunoassay, a colorimetric assay, a fluorescence assay, a chromatography (e.g. HPLC) assay, or a PCR assay.
- the measurement is obtained by an assay such as an immunoassay, a colorimetric assay, a fluorescence assay, or a chromatography (e.g. HPLC) assay.
- the measurement is obtained by PCR.
- the measurement is -113- Attorney Docket No.54462-742.601 obtained by histology. In some embodiments, the measurement is obtained by observation. In some embodiments, additional measurements are made, such as in a 3rd sample, a 4th sample, or a fifth sample. [00221] In some embodiments, the measurement is obtained within 1 hour, within 2 hours, within 3 hours, within 4 hours, within 5 hours, within 6 hours, within 12 hours, within 18 hours, or within 24 hours after the administration of the composition. In some embodiments, the measurement is obtained within 1 day, within 2 days, within 3 days, within 4 days, within 5 days, within 6 days, or within 7 days after the administration of the composition.
- the measurement is obtained within 1 week, within 2 weeks, within 3 weeks, within 1 month, within 2 months, within 3 months, within 6 months, within 1 year, within 2 years, within 3 years, within 4 years, or within 5 years after the administration of the composition. In some embodiments, the measurement is obtained after 1 hour, after 2 hours, after 3 hours, after 4 hours, after 5 hours, after 6 hours, after 12 hours, after 18 hours, or after 24 hours after the administration of the composition. In some embodiments, the measurement is obtained after 1 day, after 2 days, after 3 days, after 4 days, after 5 days, after 6 days, or after 7 days after the administration of the composition.
- the measurement is obtained after 1 week, after 2 weeks, after 3 weeks, after 1 month, after 2 months, after 3 months, after 6 months, after 1 year, after 2 years, after 3 years, after 4 years, or after 5 years, following the administration of the composition.
- the composition reduces the measurement relative to the baseline measurement. For example, an adverse phenotype of NAFLD, NASH, alcoholic liver disease, liver fibrosis, liver cirrhosis, hepatocellular carcinoma, hyperlipidemia, ischemic heart disease, or coronary heart disease may be reduced upon administration of the composition.
- the reduction is measured in a second sample obtained from the subject after administering the composition to the subject.
- the reduction is measured directly in the subject after administering the composition to the subject.
- the measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline measurement.
- the measurement is decreased by about 10% or more, relative to the baseline measurement.
- the measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, relative to the baseline measurement.
- the measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline measurement.
- the measurement is decreased by no more than about 10%, relative to the baseline measurement. In some embodiments, the measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or no more than about 100% relative to the baseline measurement. In some embodiments, the measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [00223] In some embodiments, the composition increases the measurement relative to the baseline measurement.
- a protective liver function phenotype, metabolic phenotype, or level of circulating ketone bodies may be increased upon administration of the composition.
- the increase is measured in a second sample obtained from the subject after administering the composition to the subject. In some embodiments, the increase is measured directly in the subject after administering the composition to the subject. In some embodiments, the measurement is increased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline measurement. In some embodiments, the measurement is increased by about 10% or more, relative to the baseline measurement.
- the measurement is increased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, relative to the baseline measurement. In some embodiments, the measurement is increased by about 100% or more, increased by about 250% or more, increased by about 500% or more, increased by about 750% or more, or increased by about 1000% or more, relative to the baseline measurement. In some embodiments, the measurement is increased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline measurement. In some embodiments, the measurement is increased by no more than about 10%, relative to the baseline measurement.
- the measurement is increased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or no more than about 100% relative to the baseline measurement. In some embodiments, the measurement is increased by no more than about 100%, increased by no more than about 250%, increased by no more than about 500%, increased by no more than about 750%, or increased by no more than about 1000%, relative to the baseline measurement.
- the measurement is increased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 250%, 500%, 750%, or 1000%, or by a range defined by any of the two aforementioned percentages.
- the measurement is a liver fat percentage (LFP) measurement.
- the LFP measurement is a percentage as measured by MRI.
- the LFP measurement is a percentage as measured by CT scan.
- the LFP is measured in a liver biopsy.
- the composition reduces the LFP measurement relative to the baseline LFP measurement.
- the LFP measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline LFP measurement. In some embodiments, the LFP measurement is decreased by about 10% or more, relative to the baseline LFP measurement. In some embodiments, the LFP measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more relative to the baseline LFP measurement. In some embodiments, the LFP measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline LFP measurement.
- the LFP measurement is decreased by no more than about 10%, relative to the baseline LFP measurement. In some embodiments, the LFP measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline LFP -115- Attorney Docket No.54462-742.601 measurement. In some embodiments, the LFP measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the measurement is a liver fibrosis measurement.
- the liver fibrosis measurement is a liver fibrosis score (LFS).
- the LFS comprises a score of 0, 1, 2, 3, or 4, or a range of scores defined by any two of the aforementioned numbers.
- the LFS comprises a score of 0-4.
- the LFS is obtained using a scoring system exemplified in Table 2.
- the LFS measurement is obtained noninvasively.
- the LFS measurement is obtained by a medical imaging device such as a vibration-controlled transient elastography (VCTE) device, a shear wave elastography device, a medical resonance imaging (MRI) device, a magnetic resonance spectroscopy device, a computed tomography device, or an ultrasound device.
- a medical imaging device such as a vibration-controlled transient elastography (VCTE) device, a shear wave elastography device, a medical resonance imaging (MRI) device, a magnetic resonance spectroscopy device, a computed tomography device, or an ultrasound device.
- the LFS measurement is obtained in a liver sample.
- the LFS is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay.
- the LFS is obtained using one or more indirect markers or measures of liver fibrosis such as an aspartate aminotransferase-to- platelet ratio index (APRI), a Fibrosis-4 (FIB-4) index, a FibroIndex, a Forns Index, a Hepascore, or a FibroTest.
- the LFS is obtained using one or more indirect markers or measures of liver fibrosis such as a FIBROSpect test or a FIBROSpect II test.
- the LFS is obtained by RT-qPCR or RNA sequencing of one or more fibrosis-related genes such as a collagen gene.
- the LFS or the LFS is obtained using a scoring system upon a visual inspection of a sample such as a histological sample. In some embodiments, the LFS or the LFS is obtained using a stain with an affinity to collagen. In some embodiments, the LFS measurement is measured by FibroScan® in kilopascals (kPa). In some embodiments, the LFS is measured by histological analysis. In some embodiments, the LFS measurement is a LFS measurement assayed by imaging. In some embodiments, the imaging is by MRI or CT scan. [00227] In some embodiments, the composition reduces the LFS measurement relative to the baseline LFS measurement.
- the LFS measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline LFS measurement. In some embodiments, the LFS measurement is decreased by about 10% or more, relative to the baseline LFS measurement. In some embodiments, the LFS measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more relative to the baseline LFS measurement. In some embodiments, the LFS measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline LFS measurement.
- the LFS measurement is decreased by no more than about 10%, relative to the baseline LFS measurement. In some embodiments, the LFS measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline LFS measurement. In some embodiments, the LFS measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, -116- Attorney Docket No.54462-742.601 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the measurement is a NAFLD activity score measurement.
- the NAFLD activity score measurement is measured by histological analysis.
- the NAFLD activity score measurement includes a numerical score for steatosis (0–3), hepatocyte ballooning (1–2), and lobular inflammation (0–3).
- the score thresholds of ⁇ 3 correlates with a diagnosis of not-NASH.
- the score thresholds of > 5 correlates with a diagnosis of NASH.
- a NAFLD activity score measurement is assayed by imaging.
- the composition reduces the NAFLD activity score measurement relative to the baseline NAFLD activity score measurement.
- the NAFLD activity score measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline NAFLD activity score measurement. In some embodiments, the NAFLD activity score measurement is decreased by about 10% or more, relative to the baseline NAFLD activity score measurement. In some embodiments, the NAFLD activity score measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more relative to the baseline NAFLD activity score measurement.
- the NAFLD ACTIVITY SCORE measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline NAFLD ACTIVITY SCORE measurement. In some embodiments, the NAFLD ACTIVITY SCORE measurement is decreased by no more than about 10%, relative to the baseline NAFLD ACTIVITY SCORE measurement. In some embodiments, the NAFLD ACTIVITY SCORE measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline NAFLD ACTIVITY SCORE measurement.
- the NAFLD ACTIVITY SCORE measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the measurement is an alanine aminotransferase (ALT) measurement.
- the ALT measurement includes a blood ALT measurement.
- the ALT measurement is measured by enzymatic activity.
- the ALT measurement is measured by presence of an ALT epitope.
- the ALT measurement is a circulating ALT measurement.
- the ALT measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay.
- the ALT measurement is a blood ALT concentration (for example, units per liter (U/L)).
- the ALT measurement is a circulating ALT measurement.
- the ALT measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay.
- the composition reduces the ALT measurement relative to the baseline ALT measurement. In some embodiments, the composition reduces circulating ALTs relative to the -117- Attorney Docket No.54462-742.601 baseline ALT measurement.
- the reduced ALTs are measured in a second sample obtained from the subject after administering the composition to the subject.
- the ALT measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline ALT measurement.
- the ALT measurement is decreased by about 10% or more, relative to the baseline ALT measurement.
- the ALT measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more relative to the baseline ALT measurement.
- the ALT measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline ALT measurement. In some embodiments, the ALT measurement is decreased by no more than about 10%, relative to the baseline ALT measurement. In some embodiments, the ALT measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline ALT measurement.
- the ALT measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the measurement is an aspartate aminotransferase (AST) measurement.
- the AST measurement includes a blood AST measurement.
- the AST measurement is measured by enzymatic activity.
- the AST measurement is measured by presence of an AST epitope.
- the AST measurement is a blood AST concentration (for example, units per liter (U/L)).
- the AST measurement is a circulating AST measurement.
- the AST measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay.
- the composition reduces the AST measurement relative to the baseline AST measurement. In some embodiments, the composition reduces circulating ASTs relative to the baseline AST measurement. In some embodiments, the reduced ASTs are measured in a second sample obtained from the subject after administering the composition to the subject. In some embodiments, the AST measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline AST measurement. In some embodiments, the AST measurement is decreased by about 10% or more, relative to the baseline AST measurement.
- the AST measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more relative to the baseline AST measurement. In some embodiments, the AST measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline AST measurement. In some embodiments, the AST measurement is decreased by no more than about 10%, relative to the baseline AST measurement.
- the AST measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline AST measurement.
- the AST -118- Attorney Docket No.54462-742.601 measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the measurement is an aspartate aminotransferase (ASP) measurement.
- the ASP measurement includes a blood ASP measurement.
- the ASP measurement is a blood ASP concentration (for example, units per liter (U/L)).
- the ASP measurement is measured by enzymatic activity.
- the ASP measurement is measured by presence of an ASP epitope.
- the ASP measurement is a circulating ASP measurement.
- the ASP measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay.
- the composition reduces the ASP measurement relative to the baseline ASP measurement. In some embodiments, the composition reduces circulating ASPs relative to the baseline ASP measurement.
- the reduced ASPs are measured in a second sample obtained from the subject after administering the composition to the subject.
- the ASP measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline ASP measurement.
- the ASP measurement is decreased by about 10% or more, relative to the baseline ASP measurement.
- the ASP measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more relative to the baseline ASP measurement.
- the ASP measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline ASP measurement. In some embodiments, the ASP measurement is decreased by no more than about 10%, relative to the baseline ASP measurement. In some embodiments, the ASP measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline ASP measurement.
- the ASP measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the measurement is a bilirubin measurement.
- the bilirubin measurement includes a blood bilirubin measurement.
- the bilirubin measurement is a blood bilirubin concentration (for example, units per liter ( ⁇ mol/L)).
- the bilirubin measurement is measured by presence of a bilirubin epitope.
- the bilirubin measurement is a circulating bilirubin measurement.
- the bilirubin measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay.
- the composition reduces the bilirubin measurement relative to the baseline bilirubin measurement.
- the composition reduces circulating bilirubin relative to the baseline bilirubin measurement.
- the reduced bilirubin is measured in a second sample obtained from the subject after administering the composition to the subject.
- the bilirubin measurement is decreased by about 2.5% or more, about 5% or more, or about -119- Attorney Docket No.54462-742.601 7.5% or more, relative to the baseline bilirubin measurement. In some embodiments, the bilirubin measurement is decreased by about 10% or more, relative to the baseline bilirubin measurement. In some embodiments, the bilirubin measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more relative to the baseline bilirubin measurement.
- the bilirubin measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline bilirubin measurement. In some embodiments, the bilirubin measurement is decreased by no more than about 10%, relative to the baseline bilirubin measurement. In some embodiments, the bilirubin measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline bilirubin measurement.
- the bilirubin measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the measurement is a low-density lipoprotein (LDL) measurement.
- the LDL measurement includes a blood LDL measurement.
- the LDL measurement is a blood LDL concentration (for example, units per liter (mg/dL)).
- the LDL measurement is measured by presence of an LDL epitope.
- the LDL measurement is a circulating LDL measurement.
- the LDL measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay.
- the composition reduces the LDL measurement relative to the baseline LDL measurement. In some embodiments, the composition reduces circulating LDLs relative to the baseline LDL measurement. In some embodiments, the reduced LDLs are measured in a second sample obtained from the subject after administering the composition to the subject. In some embodiments, the LDL measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline LDL measurement. In some embodiments, the LDL measurement is decreased by about 10% or more, relative to the baseline LDL measurement.
- the LDL measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more relative to the baseline LDL measurement. In some embodiments, the LDL measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline LDL measurement. In some embodiments, the LDL measurement is decreased by no more than about 10%, relative to the baseline LDL measurement.
- the LDL measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline LDL measurement. In some embodiments, the LDL measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. -120- Attorney Docket No.54462-742.601 [00240] In some embodiments, the measurement is an APOB measurement.
- the APOB measurement is a blood APOB concentration (for example, units per liter (mg/dL)). In some embodiments, the APOB measurement is a circulating APOB measurement. In some embodiments, the APOB measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00241] In some embodiments, the composition reduces the APOB measurement relative to the baseline APOB measurement. In some embodiments, the composition reduces circulating APOBs relative to the baseline APOB measurement. In some embodiments, the reduced APOBs are measured in a second sample obtained from the subject after administering the composition to the subject.
- the APOB measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline APOB measurement. In some embodiments, the APOB measurement is decreased by about 10% or more, relative to the baseline APOB measurement. In some embodiments, the APOB measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more relative to the baseline APOB measurement. In some embodiments, the APOB measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline APOB measurement.
- the APOB measurement is decreased by no more than about 10%, relative to the baseline APOB measurement. In some embodiments, the APOB measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline APOB measurement. In some embodiments, the APOB measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [00242] In some embodiments, the measurement is a total cholesterol measurement.
- the total cholesterol measurement is a blood total cholesterol concentration (for example, units per liter (mg/dL)). In some embodiments, the total cholesterol measurement is a circulating total cholesterol measurement. In some embodiments, the total cholesterol measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00243] In some embodiments, the composition reduces the total cholesterol measurement relative to the baseline total cholesterol measurement. In some embodiments, the composition reduces circulating total cholesterol relative to the baseline total cholesterol measurement. In some embodiments, the reduced total cholesterol is measured in a second sample obtained from the subject after administering the composition to the subject.
- an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay.
- the total cholesterol measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline total cholesterol measurement. In some embodiments, the total cholesterol measurement is decreased by about 10% or more, relative to the baseline total cholesterol measurement. In some embodiments, the total cholesterol measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or -121- Attorney Docket No.54462-742.601 more relative to the baseline total cholesterol measurement. In some embodiments, the total cholesterol measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline total cholesterol measurement.
- the total cholesterol measurement is decreased by no more than about 10%, relative to the baseline total cholesterol measurement. In some embodiments, the total cholesterol measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline total cholesterol measurement. In some embodiments, the total cholesterol measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [00244] In some embodiments, the measurement is a non-HDL cholesterol measurement.
- the non-HDL cholesterol measurement is a blood non-HDL cholesterol concentration (for example, units per liter (mg/dL)). In some embodiments, the non-HDL cholesterol measurement is a circulating non-HDL cholesterol measurement. In some embodiments, the non-HDL cholesterol measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00245] In some embodiments, the composition reduces the non-HDL cholesterol measurement relative to the baseline non-HDL cholesterol measurement. In some embodiments, the composition reduces circulating non-HDL cholesterol relative to the baseline non-HDL cholesterol measurement.
- the reduced non-HDL cholesterol is measured in a second sample obtained from the subject after administering the composition to the subject.
- the non-HDL cholesterol measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline non-HDL cholesterol measurement.
- the non-HDL cholesterol measurement is decreased by about 10% or more, relative to the baseline non-HDL cholesterol measurement.
- the non-HDL cholesterol measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more relative to the baseline non-HDL cholesterol measurement.
- the non-HDL cholesterol measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline non-HDL cholesterol measurement. In some embodiments, the non-HDL cholesterol measurement is decreased by no more than about 10%, relative to the baseline non-HDL cholesterol measurement. In some embodiments, the non-HDL cholesterol measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline non-HDL cholesterol measurement.
- the non-HDL cholesterol measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the measurement is an GPAM protein measurement.
- the GPAM protein measurement comprises an GPAM protein level.
- -122- Attorney Docket No.54462-742.601 the GPAM protein level is indicated as a mass or percentage of GPAM protein per sample weight.
- the GPAM protein level is indicated as a mass or percentage of GPAM protein per sample volume.
- the GPAM protein level is indicated as a mass or percentage of GPAM protein per total protein within the sample.
- the GPAM protein measurement is a tissue GPAM protein measurement.
- the GPAM protein measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay.
- the composition reduces the GPAM protein measurement relative to the baseline GPAM protein measurement..
- the composition reduces tissue GPAM protein levels relative to the baseline GPAM protein measurement.
- the reduced GPAM protein levels are measured in a second sample obtained from the subject after administering the composition to the subject.
- the GPAM protein measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline GPAM protein measurement. In some embodiments, the GPAM protein measurement is decreased by about 10% or more, relative to the baseline GPAM protein measurement. In some embodiments, the GPAM protein measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100%, relative to the baseline GPAM protein measurement. In some embodiments, the GPAM protein measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline GPAM protein measurement.
- the GPAM protein measurement is decreased by no more than about 10%, relative to the baseline GPAM protein measurement. In some embodiments, the GPAM protein measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or no more than about 100% relative to the baseline GPAM protein measurement. In some embodiments, the GPAM protein measurement is decreased by 2.5%, 5%, 7.5%, 19%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages.
- the measurement is an GPAM mRNA measurement.
- the GPAM mRNA measurement comprises an GPAM mRNA level.
- the GPAM mRNA level is indicated as an amount or percentage of GPAM mRNA per sample weight.
- the GPAM mRNA level is indicated as an amount or percentage of GPAM mRNA per sample volume.
- the GPAM mRNA level is indicated as an amount or percentage of GPAM mRNA per total mRNA within the sample.
- the GPAM mRNA level is indicated as an amount or percentage of GPAM mRNA per total nucleic acids within the sample.
- the GPAM mRNA level is indicated relative to another mRNA level, such as an mRNA level of a housekeeping gene, within the sample.
- the GPAM mRNA measurement is a tissue GPAM mRNA measurement.
- the GPAM mRNA measurement is obtained by an assay such as a PCR assay.
- the PCR comprises qPCR.
- the PCR comprises reverse transcription of the GPAM mRNA. -123- Attorney Docket No.54462-742.601 [00249]
- the composition reduces the GPAM mRNA measurement relative to the baseline GPAM mRNA measurement.
- the GPAM mRNA measurement is obtained in a second sample obtained from the subject after administering the composition to the subject.
- the composition reduces GPAM mRNA levels relative to the baseline GPAM mRNA levels.
- the reduced GPAM mRNA levels are measured in a second sample obtained from the subject after administering the composition to the subject.
- the second sample is a liver sample.
- the second sample is an adipose sample.
- the GPAM mRNA measurement is reduced by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline GPAM mRNA measurement.
- the GPAM mRNA measurement is decreased by about 10% or more, relative to the baseline GPAM mRNA measurement. In some embodiments, the GPAM mRNA measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100%, relative to the baseline GPAM mRNA measurement. In some embodiments, the GPAM mRNA measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline GPAM mRNA measurement. In some embodiments, the GPAM mRNA measurement is decreased by no more than about 10%, relative to the baseline GPAM mRNA measurement.
- the GPAM mRNA measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or no more than about 100%, relative to the baseline GPAM mRNA measurement. In some embodiments, the GPAM mRNA measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% or by a range defined by any of the two aforementioned percentages. III.
- a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range.
- description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6.
- the singular forms “a”, “an” and “the” include plural references unless the context clearly dictates otherwise.
- the term “a sample” includes a plurality of samples, including mixtures thereof.
- determining means determining if an element is present or not (for example, detection). These terms can include quantitative, qualitative or quantitative and qualitative determinations. Assessing can be relative or absolute. “Detecting the presence of” can include determining the amount of something present in addition to determining whether it is present or absent depending on the context.
- subject and “patient” may be used interchangeably herein. A “subject” can be a biological entity containing expressed genetic materials.
- the biological entity can be a plant, animal, or microorganism, including, for example, bacteria, viruses, fungi, and protozoa.
- the subject can be a mammal.
- the mammal can be a human.
- the subject may be diagnosed or suspected of being at high risk for a disease. In some cases, the subject is not necessarily diagnosed or suspected of being at high risk for the disease.
- the term “about” a number refers to that number plus or minus 10% of that number.
- the term “about” a range refers to that range minus 10% of its lowest value and plus 10% of its greatest value.
- treatment or “treating” are used in reference to a pharmaceutical or other intervention regimen for obtaining beneficial or desired results in the recipient.
- beneficial or desired results include but are not limited to a therapeutic benefit and/or a prophylactic benefit.
- a therapeutic benefit may refer to eradication or amelioration of symptoms or of an underlying disorder being treated.
- a therapeutic benefit can be achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the subject, notwithstanding that the subject may still be afflicted with the underlying disorder.
- a prophylactic effect includes delaying, preventing, or eliminating the appearance of a disease or condition, delaying or eliminating the onset of symptoms of a disease or condition, slowing, halting, or reversing the progression of a disease or condition, or any combination thereof.
- a subject at risk of developing a particular disease, or to a subject reporting one or more of the physiological symptoms of a disease may undergo treatment, even though a diagnosis of this disease may not have been made.
- the term “Cx-y” or “Cx-Cy” when used in conjunction with a chemical moiety, such as alkyl, alkenyl, or alkynyl is meant to include groups that contain from x to y carbons in the chain.
- C1-6alkyl refers to substituted or unsubstituted saturated hydrocarbon groups, including straight-chain alkyl and branched-chain alkyl groups that contain from 1 to 6 carbons.
- Cx-yalkenyl and Cx-yalkynyl refer to substituted or unsubstituted unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described above, but that contain at least one double or triple bond, respectively.
- -125- Attorney Docket No.54462-742.601 refers to a saturated, unsaturated or aromatic ring in which each atom of the ring is carbon.
- Carbocycle includes 3- to 10-membered monocyclic rings, 5- to 12-membered bicyclic rings, 5- to 12-membered spiro bicycles, and 5- to 12-membered bridged rings.
- Each ring of a bicyclic carbocycle may be selected from saturated, unsaturated, and aromatic rings.
- an aromatic ring e.g., phenyl
- a bicyclic carbocycle includes any combination of saturated, unsaturated and aromatic bicyclic rings, as valence permits.
- a bicyclic carbocycle further includes spiro bicyclic rings such as spiropentane.
- a bicyclic carbocycle includes any combination of ring sizes such as 3-3 spiro ring systems, 4-4 spiro ring systems, 4-5 fused ring systems, 5-5 fused ring systems, 5-6 fused ring systems, 6-6 fused ring systems, 5-7 fused ring systems, 6-7 fused ring systems, 5- 8 fused ring systems, and 6-8 fused ring systems.
- Exemplary carbocycles include cyclopentyl, cyclohexyl, cyclohexenyl, adamantyl, phenyl, indanyl, naphthyl, and bicyclo[1.1.1]pentanyl.
- aryl refers to an aromatic monocyclic or aromatic multicyclic hydrocarbon ring system.
- the aromatic monocyclic or aromatic multicyclic hydrocarbon ring system contains only hydrogen and carbon and from five to eighteen carbon atoms, where at least one of the rings in the ring system is aromatic, i.e., it contains a cyclic, delocalized (4n+2) ⁇ -electron system in accordance with the Hückel theory.
- aryl groups include, but are not limited to, groups such as benzene, fluorene, indane, indene, tetralin and naphthalene.
- cycloalkyl refers to a saturated ring in which each atom of the ring is carbon. Cycloalkyl may include monocyclic and polycyclic rings such as 3- to 10-membered monocyclic rings, 5- to 12-membered bicyclic rings, 5- to 12-membered spiro bicycles, and 5- to 12-membered bridged rings. In certain embodiments, a cycloalkyl comprises three to ten carbon atoms.
- a cycloalkyl comprises five to seven carbon atoms.
- the cycloalkyl may be attached to the rest of the molecule by a single bond.
- monocyclic cycloalkyls include, e.g., cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl.
- Polycyclic cycloalkyl radicals include, for example, adamantyl, spiropentane, norbornyl (i.e., bicyclo[2.2.1]heptanyl), decalinyl, 7,7 dimethyl bicyclo[2.2.1]heptanyl, bicyclo[1.1.1]pentanyl, and the like.
- cycloalkenyl refers to a saturated ring in which each atom of the ring is carbon and there is at least one double bond between two ring carbons. Cycloalkenyl may include monocyclic and polycyclic rings such as 3- to 10-membered monocyclic rings, 6- to 12-membered bicyclic rings, and 5- to 12-membered bridged rings.
- a cycloalkenyl comprises five to seven carbon atoms.
- the cycloalkenyl may be attached to the rest of the molecule by a single bond.
- monocyclic cycloalkenyls include, e.g., cyclopentenyl, cyclohexenyl, cycloheptenyl, and cyclooctenyl.
- halo or, alternatively, “halogen” or “halide,” means fluoro, chloro, bromo or iodo. In some embodiments, halo is fluoro, chloro, or bromo.
- haloalkyl refers to an alkyl radical, as defined above, that is substituted by one or more halo radicals, for example, trifluoromethyl, dichloromethyl, bromomethyl, 2,2,2 trifluoroethyl, 1 chloromethyl 2 fluoroethyl, and the like.
- the alkyl part of the haloalkyl radical is optionally further substituted as described herein.
- heterocycle as used herein refers to a saturated, unsaturated or aromatic ring comprising one or more heteroatoms.
- heteroatoms include N, O, Si, P, B, and S atoms.
- Heterocycles include 3- to 10-membered monocyclic rings, 6- to 12-membered bicyclic rings, 5- to 12- membered spiro bicycles, and 5- to 12-membered bridged rings.
- a bicyclic heterocycle includes any combination of saturated, unsaturated and aromatic bicyclic rings, as valence permits.
- an aromatic ring e.g., pyridyl
- a bicyclic heterocycle includes any combination of ring sizes such as 4-5 fused ring systems, 5-5 fused ring systems, 5-6 fused ring systems, 6-6 fused ring systems, 5-7 fused ring systems, 6-7 fused ring systems, 5-8 fused ring systems, and 6-8 fused ring systems.
- a bicyclic heterocycle further includes spiro bicyclic rings, e.g., 5 to 12-membered spiro bicycles, such as 2-oxa-6-azaspiro[3.3]heptane.
- heteroaryl refers to a radical derived from a 5 to 18 membered aromatic ring radical that comprises two to seventeen carbon atoms and from one to six heteroatoms selected from nitrogen, oxygen and sulfur.
- the heteroaryl radical is a monocyclic, bicyclic, tricyclic or tetracyclic ring system, wherein at least one of the rings in the ring system is aromatic, i.e., it contains a cyclic, delocalized (4n+2) ⁇ -electron system in accordance with the Hückel theory.
- Heteroaryl includes fused or bridged ring systems.
- the heteroatom(s) in the heteroaryl radical is optionally oxidized.
- heteroaryl is attached to the rest of the molecule through any atom of the ring(s).
- heteroaryls include, but are not limited to, azepinyl, acridinyl, benzimidazolyl, benzindolyl, 1,3 benzodioxolyl, benzofuranyl, benzoxazolyl, benzo[d]thiazolyl, benzothiadiazolyl, benzo[b][1,4]dioxepinyl, benzo[b][1,4]oxazinyl, 1,4 benzodioxanyl, benzonaphthofuranyl, benzoxazolyl, benzodioxolyl, benzodioxinyl, benzopyranyl, benzopyranonyl, benzofuranyl, benzofuranonyl, benzothienyl (benzothiophenyl (benzothiopheny
- heterocycloalkyl refers to a saturated ring with carbon atoms and at least one heteroatom.
- exemplary heteroatoms include N, O, Si, P, B, and S atoms.
- Heterocycloalkyl may include monocyclic and polycyclic rings such as 3- to 10-membered monocyclic rings, 6- to 12-membered bicyclic rings, 5- to 12-membered spiro bicycles, and 5- to 12-membered bridged rings.
- the heteroatoms in the heterocycloalkyl radical are optionally oxidized.
- One or more nitrogen atoms, if present, are optionally quaternized.
- heterocycloalkyl is attached to the rest of the molecule through any atom of the heterocycloalkyl, valence permitting, such as any carbon or nitrogen atoms of the heterocycloalkyl.
- heterocycloalkyl radicals include, but are not limited to, dioxolanyl, thienyl[1,3]dithianyl, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2 oxopiperazinyl, 2 oxopiperidinyl, 2 oxopyrrolidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4 piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl
- heterocycloalkenyl refers to an unsaturated ring with carbon atoms and at least one heteroatom and there is at least one double bond between two ring carbons. Heterocycloalkenyl does not include heteroaryl rings. Exemplary heteroatoms include N, O, Si, P, B, and S atoms. Heterocycloalkenyl may include monocyclic and polycyclic rings such as 3- to 10-membered monocyclic rings, 6- to 12-membered bicyclic rings, and 5- to 12-membered bridged rings. In other embodiments, a heterocycloalkenyl comprises five to seven ring atoms.
- the heterocycloalkenyl may be attached to the rest of the molecule by a single bond.
- monocyclic cycloalkenyls include, e.g., pyrroline (dihydropyrrole), pyrazoline (dihydropyrazole), imidazoline (dihydroimidazole), triazoline (dihydrotriazole), dihydrofuran, dihydrothiophene, oxazoline (dihydrooxazole), isoxazoline (dihydroisoxazole), thiazoline (dihydrothiazole), isothiazoline (dihydroisothiazole), oxadiazoline (dihydrooxadiazole), thiadiazoline (dihydrothiadiazole), dihydropyridine, tetrahydropyridine, dihydropyridazine, tetrahydropyridazine, dihydropyrimidine, tetrahydro
- substituted refers to moieties having substituents replacing a hydrogen on one or more carbons or substitutable heteroatoms, e.g., an NH or NH2 of a compound. It will be understood that “substitution” or “substituted with” includes the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, i.e., a compound which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc.
- substituted refers to moieties having substituents replacing two hydrogen atoms on the same carbon atom, such as substituting the two hydrogen atoms on a single carbon with an oxo, imino or thioxo group.
- substituted is contemplated to include all permissible substituents of organic compounds.
- the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and non-aromatic substituents of organic compounds.
- the permissible substituents can be one or more and the same or different for appropriate organic compounds.
- a "derivative" polypeptide or peptide is one that is modified, for example, by glycosylation, pegylation, phosphorylation, sulfation, reduction/alkylation, acylation, chemical coupling, or mild formalin treatment.
- a derivative may also be modified to contain a detectable label, either directly or indirectly, including, but not limited to, a radioisotope, fluorescent, and enzyme label.
- a detectable label either directly or indirectly, including, but not limited to, a radioisotope, fluorescent, and enzyme label.
- Some embodiments refer to nucleic acid sequence information. It is contemplated that in some embodiments, thymine (T) may be interchanged with uracil (U), or vice versa. For example, some sequences in the sequence listing may recite Ts, but these may be replaced with Us in some embodiments. In some oligonucleotides with nucleic acid sequences that include uracil, the uracil may be replaced with thymine.
- oligonucleotides with nucleic acid sequences that include thymine may be replaced with uracil.
- an oligonucleotide such as an siRNA comprises or consists of RNA.
- the oligonucleotide may include DNA.
- the oligonucleotide may include 2’ deoxyribonucleotides.
- An ASO may comprise or consist of -129- Attorney Docket No.54462-742.601 DNA. To any extent that the sequence listing contradicts the disclosure in the specification, the specification takes precedence. [00274] Some aspects include sequences with nucleotide modifications or modified internucleoside linkages.
- Nf refers to a 2’ fluoro- modified nucleoside
- dN e.g. dA, dC, dG, dT, or dU
- n e.g. a, c, g, t, or u
- s refers to a phosphorothioate linkage.
- a pyrimidine may include cytosine (C), thymine (T), or uracil (U).
- a pyrimidine may include C or U.
- a pyrimidine may include C or T.
- a reference to a pyrimidine may include a nucleoside or nucleotide comprising the pyrimidine.
- a purine may include guanine (G) or adenine (A).
- a reference to a purine may include a nucleoside or nucleotide comprising a purine.
- Example 1 Functional Variants in GPAM Demonstrate Protective Associations for Non-Alcoholic Fatty Liver Disease, Alcoholic Liver Disease, Decreased Liver Fat Percentage and Decreased Blood Lipids
- Variants in GPAM were evaluated for associations with liver disease, liver fat percentage, liver function parameters, and blood lipid levels in approximately 452,000 individuals from the UK Biobank cohort.
- eQTL quantitative trait locus
- NAFLD non-alcoholic fatty liver disease
- alcoholic liver disease liver fibrosis and cirrhosis
- sequelae of chronic liver disease such as esophageal varices and portal hypertension
- MRI-derived liver fat percentage Table 5
- GPAM variants are also associated with decreased blood levels of liver enzymes, including alanine aminotransferase (ALT), aspartate aminotransferase (AST) and alkaline phosphatase (ALP), and with decreased blood bilirubin (Table 6).
- Table 5 GPAM variant liver disease-related associations ase V rs2 8 rs5 3 n V rs2 9 rs57 . ⁇ . . - ⁇ . . ⁇ .02 Tbl 6 GPAM rint li r f ntin itin V ) eta rs2 . . . . .
- GPAM variants are also associated with decreased LDL-cholesterol, total cholesterol and APOB, and with decreased use of ‘statin’ (HMG CoA reductase inhibitor) medications (Table 7). These protective associations with putative loss of function variants in GPAM across several related and distinct diseases and traits su t tht ihibiti f GPAM ld b th ti i th d related diseases.
- siRNAs with high specificity and a low number of predicted off-targets provided a benefit of increased targeting specificity.
- siRNA sequences within the seed region were analyzed for similarity to seed regions of known miRNAs.
- siRNAs can function in a miRNA like manner via base-pairing with complementary sequences within the 3’-UTR of mRNA molecules. The complementarity typically encompasses the 5‘-bases at positions 2-7 of the miRNA (seed region).
- siRNA strands containing natural miRNA seed regions can be avoided. Seed regions identified in miRNAs from human, mouse, rat, rhesus monkey, dog, rabbit, and pig are referred to as “conserved”.
- a “specificity category” This is divided into categories 1-4, with 1 having the highest specificity and 4 having the lowest specificity. Each strand of the siRNA is assigned to a specificity category.
- gnomAD Genome Aggregation Database
- siRNA sequences derived from human GPAM mRNA (ENST00000348367.9, SEQ ID NO: 12867) without consideration of specificity or species cross-reactivity was 6354 (sense and antisense strand sequences included in SEQ ID NOS: 1-6354 and 6355-12708, respectively).
- 6354 sense and antisense strand sequences included in SEQ ID NOS: 1-6354 and 6355-12708, respectively.
- Prioritizing sequences for target specificity, miRNA seed region sequences and SNPs as described above yields subset A.
- Subset A contains 1348 siRNAs whose base sequences are shown in Table 8.
- the above methods can be used to identify therapeutic siRNAs to downmodulate expression of the GPAM mRNA. Table 8.
- Subset B included the following 1344 siRNAs: 13, 18, 23, 26, 28, 54, 62, 79, 81, 82, 83, 84, 88, 90, 91, 94, 95, 96, 98, 100, 101, 106, 107, 108, 109, 110, 111, 113, 114, 118, 119, 127, 161, 162, 170, 173, 175, 176, 177, 179, 181, 190, 191, 194, 202, 206, 207, 211, 216, 218, 221, 232, 241, 246, 247, 257, 260, 261, 262, 263, 264, 265, 267, 275, 278, 279, 280, 284, 303, 331, 354, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 370, 386, 397, 401, 403, 417, 425, 427, 432, 435, 436, 444, 450, 454,
- the siRNAs in subset B had the following characteristics: Cross-reactivity: With 19mer in human GPAM mRNA; Specificity category: For human: AS2 or better, SS3 or better; miRNA seeds: AS+SS strand: seed region not conserved in human, mouse, and rat and not present in >4 species; Off- target frequency: ⁇ 20 human off-targets matched with 2 mismatches in antisense strand; and SNPs: siRNA target sites do not harbor SNPs with a MAF ⁇ 1% (pos.2-18). [00292] The siRNA sequences in subset B were further selected for absence of seed regions in the AS strand that are identical to a seed region of known human miRNA to yield subset C.
- Subset C included the following 931 siRNAs: 18, 23, 62, 79, 81, 82, 83, 84, 88, 90, 94, 95, 96, 98, 101, 106, 107, 108, 110, 113, 114, 118, 119, 127, 173, 175, 190, 191, 194, 207, 211, 218, 221, 232, 241, 257, 260, 261, 262, 263, 264, 265, 278, 280, 284, 331, 354, 357, 358, 359, 360, 361, 363, 364, 365, 386, 432, 435, 444, 450, 454, 458, 487, 493, 494, 495, 496, 497, 498, 499, 501, 506, 507, 515, 517, 518, 519, 520, 521, 537, 542, 543, 547, 549, 550, 551, 554, 562, 564, 565, 596, 601, 60
- siRNAs in subset C had the following characteristics: Cross-reactivity: With 19mer in human GPAM mRNA; Specificity category: For human: AS2 or better, SS3 or better; miRNA seeds: AS+SS strand: seed region not conserved in human, mouse, and rat and not present in >4 species. AS strand: seed region not identical to seed region of known human miRNA; Off-target frequency: ⁇ 30 human off-targets matched with 2 mismatches by antisense strand; and SNPs: siRNA target sites do not harbor SNPs with a MAF ⁇ 1% (pos.2-18).
- siRNA sequences in subset C were also selected for absence of seed regions in the AS or S strands that are identical to a seed region of known human miRNA in addition to having an off-target frequency of ⁇ 30 human off-targets matched with 2 mismatches by antisense strand to yield subset D.
- Subset D included the following 595 siRNAs: 18, 23, 79, 83, 94, 95, 98, 106, 107, 108, 110, 114, 118, 127, 173, 175, 190, 191, 207, 218, 221, 241, 257, 260, 261, 262, 264, 278, 284, 354, 357, 359, 360, 361, 363, 364, 365, 386, 435, 450, 454, 494, 495, 497, 498, 499, 501, 507, 517, 518, 520, 537, 547, 549, 550, 551, 554, 596, 601, 613, 646, 647, 664, 673, 675, 681, 683, 703, 737, 745, 746, 748, 753, 756, 819, 826, 839, 845, 850, 854, 855, 857, 859, 874, 878, 879, 887, 889, 891, 893, 894
- subset D The siRNA sequences in subset D were also selected to have an off-target frequency of ⁇ 20 human off-targets matched with 2 mismatches by antisense strand to yield subset E.
- Subset E included the following 593 siRNAs: 18, 23, 79, 83, 94, 95, 98, 106, 107, 108, 110, 114, 118, 127, 173, 175, 190, 191, 207, 218, 221, 241, 257, 260, 261, 262, 264, 278, 284, 354, 357, 359, 360, 361, 363, 364, 365, 386, 435, 450, 454, 494, 495, 497, 498, 499, 501, 507, 517, 518, 520, 537, 547, 549, 550, 551, 554, 596, 601, 613, 646, 647, 664, 673, 675, 681, 683, 703, 737, 745, 746, 748,
- any siRNA among any of subsets A-E may comprise any modification pattern described herein. If a sequence has a different number of nucleotides in length than a modification pattern, the modification pattern may still be used with the appropriate number of additional nucleotides added 5’ or 3’ to match the number of nucleotides in the modification pattern. For example, if a sense or antisense strand of the siRNA among any of subsets A-E comprises 19 nucleotides, and a modification pattern comprises 21 nucleotides, UU may be added onto the 5’ end of the sense or antisense strand.
- siRNAs were designed to target human GPAM as described above and, in some cases, the GPAM sequence of at least one toxicology-relevant species, in this case, the non-human primate (NHP) cynomolgus monkey.
- the siRNAs included in subset F had the following characteristics: Cross-reactivity: With 19mer in human GPAM mRNA, with 17mer/19mer in NHP GPAM; Specificity category: For human and NHP: AS2 or better, SS3 or better.
- Subset F included 25 siRNAs whose base sequences are shown in Table 9. Table 9.
- subset F Sequences and siRNA names in subset F (Screening Set) siR ⁇ -3 ⁇ ) siR AU siR UC siR AG siR AU siR CU siR GA siR AG siR AG siR GU siR GA siR UA siR AU siR CU siR AA siR CU siR CA siR GA siR CA siR UU siR UU siR UA siR AU siR AA siRNA 2486 2486 AACAGAAAGAAAUGUUGCA 8840 UGCAACAUUUCUUUCUGUU siRNA 2660 2660 AUAUAUUCUGAGUUUUGUG 9014 CACAAAACUCAGAAUAUAU -167- Attorney Docket No.54462-742.601 [00298]
- the sense strand of any of the siRNAs of subset F comprises siRNA with a particular modification pattern.
- position 9 counting from the 5’ end of the of the sense strand is has the 2’F modification. If position 9 of the sense strand is a pyrimidine, then all purines in the sense strand have the 2’OMe modification. If position 9 is the only pyrimidine between positions 5 and 11 of the sense stand, then position 9 is the only position with the 2’F modification in the sense strand. If position 9 and only one other base between positions 5 and 11 of the sense strand are pyrimidines, then both of these pyrimidines are the only two positions with the 2’F modification in the sense strand.
- position 9 and only two other bases between positions 5 and 11 of the sense strand are pyrimidines, and those two other pyrimidines are in adjacent positions so that there would be not three 2’F modifications in a row, then any combination of 2’F modifications can be made that give three 2’F modifications in total. If there are >2 pyrimidines between positions 5 and 11 of the sense strand, then all combinations of pyrimidines having the 2’F modification are allowed that have three to five 2’F modifications in total, provided that the sense strand does not have three 2’F modifications in a row. [00299] If position 9 of the sense strand is a purine, then all purines in the sense strand have the 2’OMe modification.
- position 9 is the only purine between positions 5 and 11 of the sense stand, then position 9 is the only position with the 2’F modification in the sense strand. If position 9 and only one other base between positions 5 and 11 of the sense strand are purines, then both of these purines are the only two positions with the 2’F modification in the sense strand. If position 9 and only two other bases between positions 5 and 11 of the sense strand are purines, and those two other purines are in adjacent positions so that there would be not three 2’F modifications in a row, then any combination of 2’F modifications can be made that give three 2’F modifications in total.
- the sense strand of any of the siRNAs of subset F comprises a modification pattern which conforms to these sense strand rules (Table 10).
- the antisense strand of any of the siRNAs of subset F comprise a modification or modification pattern.
- the siRNAs in Table 10 include a GalNAc moiety.
- Table 11 includes some additional sense strand modifications of the siRNAs in subset F.
- the siRNAs in subset F may comprise any other modification pattern(s).
- Nf e.g. Af, Cf, Gf, Tf, or Uf
- dN e.g. dA, dC, dG, dT, or dU
- n e.g.
- a, c, g, t, or u is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- Table 10 Modified Screening Set (Subset G) siRNA SEQ ID Sense strand sequence (5 ⁇ -3 ⁇ ), with SEQ ID Name NO: GalNAc moiety NO: Antisense strand sequence (5 ⁇ -3 ⁇ ) ETD01994 12709 [ETL17]saucaGfAfauAfcAfguuggasusu 12734 usCfscAfaCfaCfuGfuAfuUfcUfgAfususu ETD susu ETD usu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu
- Subset I includes 25 siRNAs whose base sequences are shown in Table 11A.
- Tbl 11A S b t I iRNA siR ⁇ -3 ⁇ ) siR AU siR UC siR AG siR AU siR CU siR GA siR AG siR AG siR GU siR GA siR UA siRNA 1098 1098 AUAGUUGAAUUACUUCGAC 7452 GUCGAAGUAAUUCAACUAU siRNA 1100 1100 AGUUGAAUUACUUCGACAG 7454 CUGUCGAAGUAAUUCAACU -171- Attorney Docket No.54462-742.601 siRNA 1111 1111 UUCGACAGCAGCAAUUCUU 7465 AAGAAUUGCUGCUGUCGAA siRNA 1199 1199 AGUUGUGGUAGAUACUCUG 7553 CAGAGUAUCUACCACAACU siR CA siR GA siR CA siR UU siR UU siR UA siR AU siR
- NHP and mouse cross-reactive siRNAs For human and NHP only cross-reactive siRNAs: human AS1 or better, human SS3 or better. For human, NHP and mouse cross-reactive siRNAs, human AS2 or better, human AS3 or better. • miRNA seeds: For human and NHP only cross-reactive siRNAs: AS and SS: seed region not in any human siRNA, seed region not conserved in human, mouse, and rat and not present in >3 species. For human, NHP and mouse cross-reactive siRNAs: seed region not in any human siRNA, seed region not conserved in human, mouse, and rat and not present in >1 species.
- siRNA target sites do not harbor SNPs with a MAF ⁇ 1% (pos.2-18)
- the siRNAs targeting human GPAM can also be selected using at least Selection Set C criteria, and including cross-reactivity with the NHP cynomolgus GPAM. Selection of these siRNAs yields Subset J.
- Subset J includes 24 siRNAs whose base sequences are shown in Table 11B.
- the siRNAs targeting GPAM can be synthesized with chemical modifications with the sense strand having modification pattern 1S and antisense strand having modification pattern 1AS.
- the siRNAs targeting GPAM can also be synthesized with chemical modifications with the sense strand having modification pattern 2S and antisense strand having modification pattern 3AS.
- the modifications included in Table 10 or Table 11 are used.
- adenosine can be placed at position 19 in the sense strand and uridine at position 1 in the antisense strand.
- Example 4 siRNA-mediated knockdown of GPAM in human hepatocyte cells
- siRNAs targeted to the GPAM mRNA that downregulate levels of GPAM mRNA may lead to subsequent decrease of lysophosphatidic acid (LPA), a metabolite produced by the GPAM gene product, when administered to cultured hepatocyte cells.
- LPA lysophosphatidic acid
- the hepatocyte cells are to be seeded at 150,000 cells/mL into a Falcon 24-well tissue culture plate (ThermoFisher Cat. No. 353047) at 0.5 mL per well .
- the GPAM siRNA and negative control siRNA master mixes are prepared.
- the GPAM siRNA master mix contains 350 uL of Opti-MEM (ThermoFisher Cat. No.4427037 - s1288 Lot No. AS02B02D) and 3.5 ul of a mixture of the two GPAM siRNAs (10 uM stock).
- the negative control siRNA master mix contains 350 uL of Opti-MEM and 3.5 ul of negative control siRNA (ThermoFisher -173- Attorney Docket No.54462-742.601 Cat. No.4390843, 10 uM stock).
- 3 uL of TransIT-X2 (Mirus Cat. No. MIR6000) is added to each master mix.
- the Stop Solution (5 ul/well) is added to each well and mixed by pipetting up and down five times and incubating at room temperature for 2 minutes.
- the reverse transcriptase reaction is performed using 22.5 ul of the lysate according to the manufacturer’s protocol. Samples are stored at -80 °C until real-time qPCR was performed in triplicate using TaqMan Gene Expression Assays (Applied Biosystems FAM/GPAM using a BioRad iCycler).
- a decrease in GPAM mRNA expression in the hepatocyte cells is expected after transfection with the GPAM siRNAs compared to GPAM mRNA levels in hepatocyte cells transfected with the non-specific control siRNA 48 hours after transfection.
- Example 5 siRNA-mediated knockdown of GPAM in human adipocyte cells
- Adipose tissue is a major site of endogenous triglyceride synthesis.
- siRNAs targeted to the GPAM mRNA that downregulate levels of GPAM mRNA may lead to subsequent decrease of lysophosphatidic acid (LPA), a metabolite produced by the GPAM gene product, when administered to cultured adipocyte cells.
- LPA lysophosphatidic acid
- a decrease in LPA production may lead to a subsequent decrease in the levels of other components of the glycerol phosphate pathway for de novo triacylglycerol synthesis.
- phosphatidic acid (PA), phosphatidylserine (DAG), and triacylglycerol (TAG) may be decreased after siRNA-mediated knockdown of GPAM in human adipocyte cells.
- PA phosphatidic acid
- DAG phosphatidylserine
- TAG triacylglycerol
- the GPAM siRNA master mix contains 350 uL of Opti-MEM (ThermoFisher Cat. No.4427037 - s1288 Lot No. AS02B02D) and 3.5 ul of a mixture of the two GPAM siRNAs (10 uM stock).
- the negative control siRNA master mix contains 350 uL of Opti-MEM and 3.5 ul of negative control siRNA (ThermoFisher -174- Attorney Docket No.54462-742.601 Cat. No.4390843, 10 uM stock).
- 3 uL of TransIT-X2 (Mirus Cat. No. MIR6000) is added to each master mix.
- the Stop Solution (5 ul/well) is added to each well and mixed by pipetting up and down five times and incubating at room temperature for 2 minutes.
- the reverse transcriptase reaction is performed using 22.5 ul of the lysate according to the manufacturer’s protocol. Samples are stored at -80 °C until real-time qPCR was performed in triplicate using TaqMan Gene Expression Assays (Applied Biosystems FAM/GPAM using a BioRad iCycler).
- a decrease in GPAM mRNA expression in the adipocyte cells is expected after transfection with the GPAM siRNAs compared to GPAM mRNA levels in adipocyte cells transfected with the non-specific control siRNA 48 hours after transfection.
- Example 6 ASO-mediated knockdown of GPAM in human hepatocyte cells
- ASOs targeted to the GPAM mRNA that downregulate levels of GPAM mRNA leading to subsequent decrease of LPA, a metabolite produced by the GPAM gene product, when administered to cultured hepatocyte cells.
- the hepatocyte cells are seeded at 150,000 cells/mL into a Falcon 24-well tissue culture plate (Cat. No.353047) at 0.5 mL per well.
- the GPAM ASO and negative control ASO master mixes are prepared.
- the GPAM ASO master mix contains 350 uL of Opti-MEM (ThermoFisher Cat.
- the negative control ASO master mix contains 350 uL of Opti-MEM and 3.5 ul of negative control ASO (ThermoFisher Cat. No. 4390843, 10 uM stock).
- 3 uL of TransIT-X2 (Mirus Cat. No. MIR6000) is added to each master -175- Attorney Docket No.54462-742.601 mix.
- the Stop Solution (5 ul/well) is added to each well and mixed by pipetting up and down five times and incubating at room temperature for 2 minutes.
- the reverse transcriptase reaction is performed using 22.5 ul of the lysate according to the manufacturer’s protocol. Samples are stored at -80 °C until real-time qPCR was performed in triplicate using TaqMan Gene Expression Assays (Applied Biosystems FAM/GPAM using a BioRad iCycler).
- a decrease in GPAM mRNA expression in the hepatocyte cells is expected after transfection with the GPAM ASOs compared to GPAM mRNA levels in hepatocyte cells transfected with the non-specific control ASO 48 hours after transfection.
- fatty liver disease is induced by feeding mice a Western Diet (WD) containing 21.1% fat, 41% Sucrose, and 1.25% Cholesterol by weight (Teklad diets, TD.120528) and a high sugar solution (23.1g/L d-fructose (Sigma-Aldrich, G8270) and 18.9 g/L d-glucose (Sigma- Aldrich, F0127)) for 12 weeks.
- WD Western Diet
- Teklad diets TD.1205208
- a high sugar solution (23.1g/L d-fructose (Sigma-Aldrich, G8270) and 18.9 g/L d-glucose (Sigma- Aldrich, F0127)
- mice are divided into five groups: Group 1 - a fatty liver disease group treated with non-targeting control siRNA, Group 2 - a fatty liver disease group treated with non-targeting control ASO, Group 3 - a fatty liver disease group treated with GPAM siRNA1, Group 4 – a fatty liver disease group treated with GPAM ASO1, Group 5 - control mice on a normal chow diet. Each group contains eight mice (4 males, 4 females). [00327] At weeks 12 weeks of Western Diet, blood samples are collected from each group prior to the first treatment.
- siRNA or ASO administration of siRNA or ASO is achieved with a 200ul subcutaneous injection of siRNA or ASO resuspended in PBS at concentration of 10uM.
- Group 1 mice are injected subcutaneously with non-targeting control siRNA
- Group 2 mice are injected subcutaneously with non- targeting control ASO
- Group 3 mice are injected subcutaneously with siRNA1 targeting mouse GPAM
- Group 4 mice are injected subcutaneously with ASO1 targeting mouse GPAM
- Group 5 mice are -176- Attorney Docket No.54462-742.601 injected subcutaneously with vehicle. Every other week thereafter starting on Day 14 the animals from each group are dosed as on Day 0 for a total of 5 injections.
- ALT, AST, ALP bilirubin, total cholesterol, HDL cholesterol and triglyceride levels are measured using VITROS 5,1 FS (Ortho Clinical Diagnostics).
- Non-fasting plasma insulin is measured with the Ultrasensitive Mouse Insulin ELISA kit (Crystal Chem, 90080) according to the manufacturer’s instructions.
- Non-fasting blood glucose is assayed with the One Touch Ultra (Life Scan).
- HOMA IR and QUICKI are calculated. Blood ketones, including 3-hydroxybutyrate, acetoacetate and acetone are measured using EnzyChrom Ketone Body Assay Kit (BioAssay Systems, EKBD-100).
- mice are sacrificed by cervical dislocation following an intraperitoneal injection of 0.3 ml Nembutal (5 mg/ml).
- Terminal blood draw is collected via cardiac puncture and final ALT, AST, ALP bilirubin, total cholesterol, HDL cholesterol and triglyceride levels are measured along with non-fasting plasma insulin and glucose and blood ketones.
- Livers and adipose tissue are removed and divided into three sections each; one section placed in RNAlater for mRNA isolation, one section flash-frozen for protein isolation, one section fixed in formalin and then paraffin-embedded.
- mRNA is isolated from tissue placed in RNAlater solution using the PureLink kit according to the manufacturer’s protocol (ThermoFisher Cat. No.12183020). The reverse transcriptase reaction is performed according to the manufacturer’s protocol. Samples are stored at -80 °C until real-time qPCR was performed in triplicate using TaqMan Gene Expression Assays (Applied Biosystems FAM/GPAM using a BioRad iCycler).
- a decrease in GPAM mRNA expression in the liver and adipose tissue from mice is dosed with the GPAM siRNAs and ASOs compared to GPAM mRNA levels in the liver and adipose tissue from mice is dosed with the non-specific control siRNA and ASO.
- NAFLD Activity Score (NAS) and fibrosis stage are evaluated by an expert pathologist according to the NASH CRN scoring system. The histological scoring is performed blinded, with no knowledge by the pathologist of the treatment(s) received.
- GPAM siRNAs and ASOs elicit -177- Attorney Docket No.54462-742.601 knockdown of GPAM mRNA in liver tissue and that the decrease in GPAM expression is correlated with a decrease in NAS and NASH CRN.
- Oligonucleotide Synthesis [00333] Oligonucleotides such as siRNAs may be synthesized according to phosphoramidite technology on a solid phase.
- a K&A oligonucleotide synthesizer may be used. Syntheses may be performed on a solid support made of controlled pore glass (CPG, 500 ⁇ or 600 ⁇ , obtained from AM Chemicals, Oceanside, CA, USA). All 2′-OMe and 2’-F phosphoramidites may be purchased from Hongene Biotech (Union City, CA, USA).
- CPG controlled pore glass
- All phosphoramidites may be dissolved in anhydrous acetonitrile (100 mM) and molecular sieves (3 ⁇ ) may be added.5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) may be used as activator solution. Coupling times may be 9-18 min (e.g. with a GalNAc such as ETL17), 6 min (e.g. with 2′OMe and 2′F).
- a 100 mM solution of 3-phenyl 1,2,4- dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, Mass., USA) in anhydrous acetonitrile may be employed.
- POS 3-phenyl 1,2,4- dithiazoline-5-one
- the dried solid support may be treated with a 1:1 volume solution of 40 wt. % methylamine in water and 28% ammonium hydroxide solution (Aldrich) for two hours at 30° C.
- the solution may be evaporated and the solid residue may be reconstituted in water and purified by anionic exchange HPLC using a TKSgel SuperQ-5PW 13u column.
- Buffer A may be 20 mM Tris, 5 mM EDTA, pH 9.0 and contained 20% Acetonitrile and buffer B may be the same as buffer A with the addition of 1 M sodium chloride. UV traces at 260 nm may be recorded. Appropriate fractions may be pooled then desalted using Sephadex G-25 medium. [00335] Equimolar amounts of sense and antisense strand may be combined to prepare a duplex.
- the duplex solution may be prepared in 0.1 ⁇ PBS (Phosphate-Buffered Saline, 1 ⁇ , Gibco). The duplex solution may be annealed at 95° C. for 5 min, and cooled to room temperature slowly.
- PBS Phosphate-Buffered Saline
- Duplex concentration may be determined by measuring the solution absorbance on a UV-Vis spectrometer at 260 nm in 0.1 ⁇ PBS. For some experiments, a conversion factor may be calculated from an experimentally determined extinction coefficient.
- Example 9 GalNAc ligand for hepatocyte targeting of oligonucleotides [00336]
- GalNAc ligands may be attached to solid phase resin for 3’ conjugation or at the 5’ terminus using GalNAc phosphoramidite reagents.
- GalNAc phosphoramidites may be coupled on solid phase as for other nucleosides in the oligonucleotide sequence at any position in the sequence.
- Reagents for GalNAc conjugation to oligonucleotides are shown in Table 12. -178- Attorney Docket No.54462-742.601 Table 12.
- GalNAc Conjugation Reagents Type of Structure conjugation Sol atta wh is r olig cha OH atta pha Sol atta pho -179- Attorney Docket No.54462-742.601 Solid phase 5’ atta Pho Sol Car ami any olig y g p y y p g g p oved under basic, acid or reducing conditions.
- the oligonucleotide is then removed from the resin and GalNAc is conjugated to the reactive site.
- the carboxy GalNAc derivatives may be coupled to amino-modified oligonucleotides.
- peptide coupling conditions are known to the skilled in the art using a carbodiimide coupling agent like DCC (N,N′-Dicyclohexylcarbodiimide), EDC (N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide) or EDC.HCl (N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride and an additive like HOBt (1- hydroxybenztriazole), HOSu (N-hydroxysuccinimide), TBTU (N,N,N′,N′-Tetramethyl-O-(benzotriazol-1- yl)uronium tetrafluoroborate, HBTU (2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate) or HOAt (1-Hydroxy-7-azabenzotriazole
- Amine groups may be incorporated into oligonucleotides using a number of known, commercially available reagents at the 5’ terminus, 3’ terminus or anywhere in between.
- Non-limiting examples of reagents for oligonucleotide synthesis to incorporate an amino group include: • 5’ attachment: • 6-(4-Monomethoxytritylamino)hexyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite CAS Number: 114616-27-2 • 5'-Amino-Modifier TEG CE-Phosphoramidite • 10-(O-trifluoroacetamido-N-ethyl)-triethyleneglycol-1-[(2-cyanoethyl)-(N,N-diisopropyl)]- phosphoramidite • 3’ attachment: • 3'-Amino-Modifier Serinol CPG • 3-Dimethoxytr
- Solution phase conjugations may occur after oligonucleotide synthesis via reactions between non-nucleosidic nucleophilic functional groups that are attached to the oligonucleotide and electrophilic GalNAc reagents.
- nucleophilic groups include amines and thiols
- electrophilic reagents include activated esters (e.g. N-hydroxysuccinimide, pentafluorophenyl) and maleimides.
- GalNAc ligands for hepatocyte targeting of oligonucleotides
- GalNAc ligands may be attached to solid phase resin for 3’ conjugation or at the 5’ terminus using GalNAc phosphoramidite reagents.
- GalNAc phosphoramidites may be coupled on solid phase as for other nucleosides in the oligonucleotide sequence at any position in the sequence.
- a non-limiting example of a phosphoramidite reagent for GalNAc conjugation to a 5’ end oligonucleotide is shown in Table 13.
- Table 13 GalNAc Conjugation Reagent Type of c Structure S ph
- the following includes examples of synthesis reactions used to create a GalNAc moiety: Scheme for the preparation of NAcegal-Linker-TMSOTf -182- Attorney Docket No.54462-742.601 General procedure for preparation of Compound 2A [00345] To a solution of Compound 1A (500 g, 4.76 mol, 476 mL) in 2-Methly-THF (2.00 L) is added CbzCl (406 g, 2.38 mol, 338 mL) in 2-Methyl-THF (750 mL) dropwise at 0 °C.
- reaction mixture is added to cold water (30.0 L) -183- Attorney Docket No.54462-742.601 and stirred at 0 °C for 0.5 hr, white solid formed, filtered and dried to give Compound 4A (1.55 kg, 3.98 mol, 85.8% yield) as a white solid and used in the next step without further purification.
- the reaction mixture is diluted with DCM (100 mL) then washed with aq.NaHCO 3 (250 mL * 1) and brine (250 mL), dried over Na 2 SO 4 , filtered and concentrated under reduced pressure to give a residue.
- Example 12 Modification motif 2 [00359]
- An example GPAM siRNA includes a combination of the following modifications: • Position 9 (from 5’ to 3’) of the sense strand is 2’ deoxy. • Sense strand positions 5, 7 and 8 are 2’ F. • All pyrimidines in positions 10-21 are 2’ OMe, and purines are a mixture of 2’ OMe and 2’ F. Alternatively, all purines in positions 10-21 are 2’ OMe and all pyrimidines in positions 10-21 are a mixture of 2’ OMe and 2’ F. • Antisense strand odd-numbered positions are 2'OMe and even-numbered positions are a mixture of 2’ F, 2’OMe and 2’ deoxy. Example 12.
- siRNAs ETD01994-ETD02018 targeting human GPAM mRNA in mice transfected with AAV8-TBG-h-GPAM [00360]
- the siRNAs contain the GalNAc ligand ETL17 followed by a phosphorothioate linkage at the 5’ end of the sense strand.
- the siRNA sequences that were used are shown in Table 14, where Nf (e.g. Af, Cf, Gf, Tf, or Uf) is a 2’ fluoro-modified nucleoside, n (e.g.
- a, c, g, t, or u is a 2’ O-methyl modified nucleoside
- dN e.g. dA, dC, dG, dT, or dU
- s is a phosphorothioate linkage.
- the base sequences for each siRNA, with and without the 3’ UU extension, are shown in Table 15. ETD01994-ETD02004 were tested in Part 1 of the study and ETD02005-ETD02018 were tested in Part 2.
- AAV8 adeno- associated virus 8 vector
- the recombinant AAV8 contains the open reading frame, the 5’ UTR, and a portion of the 3’UTR of the human GPAM sequence (ENST00000348367) under the control of the human thyroxine binding globulin promoter in an AAV2 backbone packaged in AAV8 capsid (AAV8-TBG-h-GPAM).
- mice were euthanized on Day 10 after subcutaneous injection and a liver sample from each was collected and placed in RNAlater (ThermoFisher Catalog# AM7020) until processing.
- Total liver RNA was prepared by homogenizing the liver tissue in homogenization buffer (Maxwell RSC simplyRNA Tissue Kit) using a Percellys 24 tissue homogenizer (Bertin Instruments) set at 5000 rpm for two 10 second cycles.
- RNA from the lysate was purified on a Maxwell RSC 48 platform (Promega Corporation) according to the manufacturer’s recommendations.
- Preparation of cDNA was performed using Quanta qScript cDNA SuperMix (VWR, Catalog# 95048-500) according to the manufacturer’s instructions.
- liver GPAM mRNA The relative levels of liver GPAM mRNA were assessed by RT-qPCR in triplicate on a QuantStudioTM 6 Pro Real-Time PCR System using TaqMan assays for human GPAM (ThermoFisher, assay# Hs01573684_m1), or mouse GPAM (ThermoFisher, assay# Mm01261106_m1), and the mouse housekeeping gene PPIA (ThermoFisher, assay# Mm02342430_g1), and PerfeCTa® qPCR FastMix®, Low ROXTM (VWR, Catalog# 101419-222).
- mice injected with ETD02009, ETD02011, ETD02012 or ETD02015 had the highest level of human GPAM mRNA knockdown in the liver.
- ETD usu ETD usu ETD02010 12884 [ETL17]sucgaaggUfCfaCfuacaaugasusu 12991 usCfsaUfuGfuAfgUfgAfcCfuUfcGfasusu ETD02011 12885 [ETL17]suguuAfuuAfGfaAfuguuacgasusu 12992 usCfsgUfaAfcAfuUfcUfaAfuAfaCfasusu ETD02012 12886 [ETL17]saaacuAfuGfGfuuguguccgasusu 129
- siRNAs with alternative modification patterns of ETD02012 and ETD02011 in mice transfected with AAV8-TBG-h-GPAM [00363]
- the base sequences of ETD02012 and ETD02011 were synthesized to generate siRNAs (ETD02012, ETD02285-ETD02292 and ETD02011, ETD02301-ETD02309, respectively) with alternative modification patterns.
- the activities of the siRNAs were assessed using mice transiently expressing human GPAM.
- the siRNAs contain the GalNAc ligand ETL17 followed by a phosphorothioate linkage at the 5’ end of the sense strand.
- siRNA sequences that were used are -197- Attorney Docket No.54462-742.601 shown in Table 18, where Nf (e.g. Af, Cf, Gf, Tf, or Uf) is a 2’ fluoro-modified nucleoside, n (e.g. a, c, g, t, or u) is a 2’ O-methyl modified nucleoside, Nm (e.g. Am, Cm, Gm, Tm, or Um) is a 2’-O-(2- methoxyethyl) modified nucleoside, dN (e.g.
- Nf e.g. Af, Cf, Gf, Tf, or Uf
- n e.g. a, c, g, t, or u
- Nm e.g. Am, Cm, Gm, Tm, or Um
- dN e.g.
- dA, dC, dG, dT, or dU is a 2’ deoxynucleoside, and “s” is a phosphorothioate linkage.
- the base sequences for each siRNA, with and without the 3’ UU extension, are shown in Table 19. [00364] Six to eight week old female mice (C57Bl/6) were injected with 5 uL of a recombinant adeno- associated virus 8 (AAV8) vector (1.2 x 10E13 genome copies/mL) by the retroorbital route on Day -14.
- AAV8 recombinant adeno- associated virus 8
- the recombinant AAV8 contains the open reading frame, the 5’ UTR, and a portion of the 3’UTR of the human GPAM sequence (ENST00000348367) under the control of the human thyroxine binding globulin promoter in an AAV2 backbone packaged in AAV8 capsid (AAV8-TBG-h-GPAM).
- AAV8-TBG-h-GPAM AAV8 capsid
- mice were euthanized on Day 14 after subcutaneous injection and a liver sample from each was collected and placed in RNAlater (ThermoFisher Catalog# AM7020) until processing.
- Total liver RNA was prepared by homogenizing the liver tissue in homogenization buffer (Maxwell RSC simplyRNA Tissue Kit) using a Percellys 24 tissue homogenizer (Bertin Instruments) set at 5000 rpm for two 10 second cycles. Total RNA from the lysate was purified on a Maxwell RSC 48 platform (Promega Corporation) according to the manufacturer’s recommendations. Preparation of cDNA was performed using Quanta qScript cDNA SuperMix (VWR, Catalog# 95048-500) according to the manufacturer’s instructions.
- liver GPAM mRNA The relative levels of liver GPAM mRNA were assessed by RT-qPCR in triplicate on a QuantStudioTM 6 Pro Real-Time PCR System using TaqMan assays for human GPAM (ThermoFisher, assay# Hs01573684_m1) and the mouse housekeeping gene PPIA (ThermoFisher, assay# Mm02342430_g1), and PerfeCTa® qPCR FastMix®, Low ROXTM (VWR, Catalog# 101419-222). Mice that gave low liver expression of human GPAM, as defined by having a Ct value of >30, were omitted from further analysis.
- Example 14 Screening siRNAs with alternative modification patterns of ETD02009 and ETD02015 in mice transfected with AAV8-TBG-h-GPAM [00366]
- the base sequences of ETD02009 and ETD02015 were synthesized to generate siRNAs (ETD02293-ETD02300, and ETD02015-ETD02318, respectively) with alternative modification patterns.
- the activities of the siRNAs were assessed using mice transiently expressing human GPAM.
- the siRNAs contain the GalNAc ligand ETL17 followed by a phosphorothioate linkage at the 5’ end of the sense strand.
- siRNA sequences that were used are shown in Table 21, where Nf (e.g. Af, Cf, Gf, Tf, or Uf) is a 2’ fluoro-modified nucleoside, n (e.g. a, c, g, t, or u) is a 2’ O-methyl modified nucleoside, Nm (e.g. Am, Cm, Gm, Tm, or Um) is a 2’-O-(2-methoxyethyl) modified nucleoside, dN (e.g.
- Nf e.g. Af, Cf, Gf, Tf, or Uf
- n e.g. a, c, g, t, or u
- Nm e.g. Am, Cm, Gm, Tm, or Um
- dN e.g.
- dA, dC, dG, dT, or -200- Attorney Docket No.54462-742.601 dU) is a 2’ deoxynucleoside, and “s” is a phosphorothioate linkage.
- the base sequences for each siRNA, with and without the 3’ UU extension, are shown in Table 22. [00367] Six to eight week old female mice (C57Bl/6) were injected with 5 uL of a recombinant adeno- associated virus 8 (AAV8) vector (1.2 x 10E13 genome copies/mL) by the retroorbital route on Day -14.
- AAV8 vector 1.2 x 10E13 genome copies/mL
- the recombinant AAV8 contains the open reading frame, the 5’ UTR, and a portion of the 3’UTR of the human GPAM sequence (ENST00000348367) under the control of the human thyroxine binding globulin promoter in an AAV2 backbone packaged in AAV8 capsid (AAV8-TBG-h-GPAM).
- AAV8-TBG-h-GPAM AAV8 capsid
- mice were euthanized on Day 14 after subcutaneous injection and a liver sample from each was collected and placed in RNAlater (ThermoFisher Catalog# AM7020) until processing.
- Total liver RNA was prepared by homogenizing the liver tissue in homogenization buffer (Maxwell RSC simplyRNA Tissue Kit) using a Percellys 24 tissue homogenizer (Bertin Instruments) set at 5000 rpm for two 10 second cycles. Total RNA from the lysate was purified on a Maxwell RSC 48 platform (Promega Corporation) according to the manufacturer’s recommendations. Preparation of cDNA was performed using Quanta qScript cDNA SuperMix (VWR, Catalog# 95048-500) according to the manufacturer’s instructions.
- liver GPAM mRNA The relative levels of liver GPAM mRNA were assessed by RT-qPCR in triplicate on a QuantStudioTM 6 Pro Real-Time PCR System using TaqMan assays for human GPAM (ThermoFisher, assay# Hs01573684_m1) and the mouse housekeeping gene PPIA (ThermoFisher, assay# Mm02342430_g1), and PerfeCTa® qPCR FastMix®, Low ROXTM (VWR, Catalog# 101419-222). Mice that gave low liver expression of human GPAM, as defined by having a Ct value of >30, were omitted from further analysis.
- siRNAs with alternative modification patterns of ETD02003 and ETD02018 in mice transfected with AAV8-TBG-h-GPAM [00369]
- the base sequences of ETD02003 and ETD02018 were synthesized to generate siRNAs (ETD02223-ETD02230, and ETD02201-ETD02208, respectively) with alternative modification patterns.
- the activities of the siRNAs were assessed using mice transiently expressing human GPAM.
- the siRNAs contain the GalNAc ligand ETL17 followed by a phosphorothioate linkage at the 5’ end of the sense strand.
- the siRNA sequences that were used are shown in Table 24, where Nf (e.g.
- Af, Cf, Gf, Tf, or Uf is a 2’ fluoro-modified nucleoside
- n e.g. a, c, g, t, or u
- dN e.g. dA, dC, dG, dT, or dU
- s is a phosphorothioate linkage.
- Table 25 The base sequences for each siRNA, with and without the 3’ UU extension, are shown in Table 25.
- AAV8 adeno- associated virus 8 vector
- the recombinant AAV8 contains the open reading frame, the 5’ UTR, and a portion of the 3’UTR of the human GPAM sequence (ENST00000348367) under the control of the human thyroxine binding globulin -203- Attorney Docket No.54462-742.601 promoter in an AAV2 backbone packaged in AAV8 capsid (AAV8-TBG-h-GPAM).
- mice were euthanized on Day 14 after subcutaneous injection and a liver sample from each was collected and placed in RNAlater (ThermoFisher Catalog# AM7020) until processing.
- Total liver RNA was prepared by homogenizing the liver tissue in homogenization buffer (Maxwell RSC simplyRNA Tissue Kit) using a Percellys 24 tissue homogenizer (Bertin Instruments) set at 5000 rpm for two 10 second cycles.
- RNA from the lysate was purified on a Maxwell RSC 48 platform (Promega Corporation) according to the manufacturer’s recommendations.
- Preparation of cDNA was performed using Quanta qScript cDNA SuperMix (VWR, Catalog# 95048-500) according to the manufacturer’s instructions.
- liver GPAM mRNA The relative levels of liver GPAM mRNA were assessed by RT-qPCR in triplicate on a QuantStudioTM 6 Pro Real-Time PCR System using TaqMan assays for human GPAM (ThermoFisher, assay# Hs01573684_m1) or mouse GPAM (ThermoFisher, assay# Mm01261106_m1), and the mouse housekeeping gene PPIA (ThermoFisher, assay# Mm02342430_g1), and PerfeCTa® qPCR FastMix®, Low ROXTM (VWR, Catalog# 101419-222). Data were normalized to the mean GPAM mRNA level in animals receiving a subcutaneous injection of PBS.
- Results are shown in Table 26.
- ETD02224 and ETD02228 had the greatest activity in terms of knockdown of the human GPAM mRNA.
- ETD02202 had the greatest activity in terms of knockdown of the human GPAM mRNA. Table 24.
- ETD02009 and ETD02015 were synthesized to generate siRNAs (ETD02543-ETD02544, and ETD02539-ETD02542, respectively) with alternative modification patterns including 2’-O-(2-methoxyethyl).
- the activities of the siRNAs were assessed using mice transiently expressing human GPAM.
- the siRNAs contain the GalNAc ligand ETL17 followed by a phosphorothioate linkage at the 5’ end of the sense strand.
- siRNA sequences that were used are shown in Table 27, where Nf (e.g. Af, Cf, Gf, Tf, or Uf) is a 2’ fluoro-modified nucleoside, n (e.g. a, c, g, t, or u) is a 2’ O-methyl modified nucleoside, Nm (e.g. Am, Cm, Gm, Tm, or Um) is a 2’-O-(2- methoxyethyl) modified nucleoside, and “s” is a phosphorothioate linkage.
- Nf e.g. Af, Cf, Gf, Tf, or Uf
- n e.g. a, c, g, t, or u
- Nm e.g. Am, Cm, Gm, Tm, or Um
- s is a phosphorothioate linkage.
- Table 28 The base sequences for each siRNA, with and without
- AAV8 adeno- associated virus 8 vector
- the recombinant AAV8 contains the open reading frame, the 5’ UTR, and a portion of the 3’UTR of the human GPAM sequence (ENST00000348367) under the control of the human thyroxine binding globulin promoter in an AAV2 backbone packaged in AAV8 capsid (AAV8-TBG-h-GPAM).
- mice were euthanized on Day 14 after subcutaneous injection and a liver sample from each was collected and placed in RNAlater (ThermoFisher Catalog# AM7020) until processing.
- Total liver RNA was prepared by homogenizing the liver tissue in homogenization buffer (Maxwell RSC simplyRNA Tissue Kit) using a Percellys 24 tissue homogenizer (Bertin Instruments) set at 5000 rpm for two 10 second cycles.
- RNA from the lysate was purified on a Maxwell RSC 48 platform (Promega Corporation) according to the manufacturer’s recommendations.
- Preparation of cDNA was performed using Quanta qScript cDNA SuperMix (VWR, Catalog# 95048-500) according to the manufacturer’s instructions.
- liver GPAM mRNA The relative levels of liver GPAM mRNA were assessed by RT-qPCR in triplicate on a QuantStudioTM 6 Pro Real-Time PCR System using TaqMan assays for human GPAM (ThermoFisher, assay# Hs00326039_m1) and the mouse housekeeping gene PPIA (ThermoFisher, assay# Mm02342430_g1), and PerfeCTa® qPCR FastMix®, Low ROXTM (VWR, Catalog# 101419-222). Data -206- Attorney Docket No.54462-742.601 were normalized to the mean GPAM mRNA level in animals receiving a subcutaneous injection of PBS. Results are shown in Table 29.
- ETD02541 had the greatest activity.
- ETD02009 ETD02543 and ETD2544 had the greatest activity.
- Table 27 Example siRNA Sequences ETD# SEQ Sense Strand Sequence (5 ⁇ -3 ⁇ ) with GalNAc SEQ Antisense Strand Sequence (5 ⁇ -3 ⁇ ) ID moiety ID ETD susu ETD susu ETD usu ETD usu ETD su ETD su ETD su ETD su Table 28.
- siRNA BASE Sequences siRNA SEQ ID Sense Strand Base Sequence SEQ ID Antisense Strand Base Sequence N ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU si ce N gs ET U ET A ET U ET U ET U ET U ET U ET U ET A ET A si ce N gs ET U ET A ET U ET U ET U ET U ET U ET U ET U ET U ETD02543 13323 UGGAAUCUCCUAUGAUCG 13644 CGAUCAUAGGAGAUUCCA ETD02544 13324 UGGAAUCUCCUAUGAUCG 13645 CGAUCAUAGGAGAUUCCA Table 29 h-GPAM .
- mice transfected with AAV8-TBG-h-GPAM [00375] The activities of siRNAs, namely ETD02553-ETD02576, were assessed in mice transiently expressing human GPAM.
- the siRNAs contain the GalNAc ligand ETL17 followed by a phosphorothioate linkage at the 5’ end of the sense strand.
- the siRNA sequences that were used are shown in Table 30, where Nf (e.g.
- Af, Cf, Gf, Tf, or Uf is a 2’ fluoro-modified nucleoside
- n e.g. a, c, g, t, or u
- Nm e.g. Am, Cm, Gm, Tm, or Um
- s is a phosphorothioate linkage.
- the base sequences for each siRNA, with and without the 3’ UU extension, are shown in Table 31. ETD02553-ETD02664 were tested in Part 1 of the study and ETD02565-ETD02576 were tested in Part 2.
- AAV8 adeno-associated virus 8 vector
- the recombinant AAV8 contains the open reading frame, the 5’ UTR, and a portion of the 3’UTR of the human GPAM sequence (ENST00000348367) under the control of the human thyroxine binding globulin promoter in an AAV2 backbone packaged in AAV8 capsid (AAV8-TBG-h-GPAM).
- mice were euthanized on Day 14 after subcutaneous injection and a liver sample from each was collected and placed in RNAlater (ThermoFisher Catalog# AM7020) until processing.
- Total liver RNA was prepared by homogenizing the liver tissue in homogenization buffer (Maxwell RSC simplyRNA Tissue Kit) using a Percellys 24 tissue homogenizer (Bertin Instruments) set at 5000 rpm for two 10 second cycles.
- RNA from the lysate was purified on a Maxwell RSC 48 platform (Promega Corporation) according to the manufacturer’s recommendations.
- Preparation of cDNA was performed using Quanta qScript cDNA SuperMix (VWR, Catalog# 95048-500) according to the manufacturer’s instructions.
- liver GPAM mRNA The relative levels of liver GPAM mRNA were assessed by RT-qPCR in triplicate on a QuantStudioTM 6 Pro Real-Time PCR System using TaqMan assays for human GPAM (ThermoFisher, assay# Hs01573684_m1) and the mouse housekeeping gene PPIA (ThermoFisher, assay# Mm02342430_g1), and PerfeCTa® qPCR FastMix®, Low ROXTM (VWR, Catalog# 101419-222). Mice that gave low liver expression of human GPAM in Part 2, as defined by having a Ct value of >32, were omitted from further analysis.
- ETD# SEQ Sense Strand Sequence (5 ⁇ -3 ⁇ ) with GalNAc SEQ ID Antisense Strand Sequence (5 ⁇ -3 ⁇ ) ID NO: moiety NO: ETD2 124 1 fAf fAf 1 f Af f Af f f f susu ETD susu ETD susu ETD susu ETD susu ETD usu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu Table 31.
- Example 18 Therapeutic siRNA-mediated knockdown of GPAM in a mouse model of non-alcoholic fatty liver disease (NAFLD) [00378] The effects of siRNA-mediated knockdown of GPAM in the liver was investigated in a high fat, high fructose diet-based mouse model of non-alcoholic fatty liver disease (NAFLD).
- PBS phosphate buffered saline
- the siRNAs contain the GalNAc ligand ETL17 followed by a phosphorothioate linkage at the 5’ end of the sense strand.
- the siRNA sequences that were used are shown in Table 34, where Nf (e.g. Af, Cf, Gf, Tf, or Uf) is a 2’ fluoro-modified nucleoside, n (e.g.
- a, c, g, t, or u is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the base sequences for each siRNA, with and without the 3’ UU extension, are shown in Table 35.
- PBS phosphate buffered saline
- the [00381] Body weights were recorded biweekly at the start of the Western diet until the end of the study. Mice were fasted 4-6 hours for serum collection prior to the first siRNA treatment and then 1 day prior to each biweekly siRNA injection.
- Serum was sent for the following clinical chemistry assays (IDEXX Laboratories, Incorporated): ALP, ALT, BUN, cholesterol, glucose, total bilirubin, total protein, triglycerides, and beta-hydroxybutarate. Ketones were measured in a drop of whole blood using Precision Xtra Ketone Test Strips (Abbott). [00382] All mice in Groups 1-4 were euthanized via cervical dislocation following isoflurane exposure with a final serum bleed at 16 weeks and all mice in Groups 5-8 were euthanized via cervical dislocation following isoflurane exposure with a final serum bleed at 24 weeks and the liver was separated -212- Attorney Docket No.54462-742.601 into 4 sections.
- RNAlater for qRT-PCR (Thermo Fisher #AM7020)
- one section was snap frozen in liquid nitrogen for liver triglyceride measurement
- one section was placed into 10% formalin for fixation and paraffin embedding for H&E and Picrosirius Red staining
- one section was fixed with 10% formalin at 4C for 24 hours and then embedded in OCT for Oil Red O staining.
- Total liver RNA was prepared by homogenizing the RNAlater liver tissue in homogenization buffer (Maxwell RSC simplyRNA Tissue Kit) using a Percellys 24 tissue homogenizer (Bertin Instruments) set at 5000 rpm for two 10 second cycles.
- RNA from the lysate was purified on a Maxwell RSC 48 platform (Promega Corporation) according to the manufacturer’s recommendations.
- Preparation of cDNA was performed using Quanta qScript cDNA SuperMix (VWR, Catalog# 95048-500) according to the manufacturer’s instructions.
- liver GPAM mRNA were assessed by RT- qPCR in triplicate on a QuantStudioTM 6 Pro Real-Time PCR System using TaqMan assays for mouse GPAM (ThermoFisher, assay# Mm01261106_m1), mouse COL1A1 (ThermoFisher, assay # Mm00801666_g1), mouse TIMP1 (ThermoFisher, assay # Mm00801666_g1), mouse TGFB1 (ThermoFisher, assay # Mm01341361_m1), mouse Acta2/SMA (ThermoFisher, assay # Mm00725412_s1), mouse Tnf- ⁇ (ThermoFisher, assay # Mm00443258_m1), mouse Il1B (ThermoFisher, assay # Mm00434228_m1), mouse CCL2 (ThermoFisher, assay # Mm0000
- the 16 week GPAM mRNA levels are shown in Table . Data were normalized to the level in animals receiving PBS and on the Western Diet (Group 2). Mice on the Western Diet treated with ETD02282 (Group 3) or ETD02284 (Group 4) had reduced liver GPAM mRNA levels compared to mice on the Western Diet receiving PBS (Group 2). The mice on the Western Diet had elevated levels of GPAM compared to the mice on normal chow.
- Table 37.24-week GPAM mRNA Levels in Mice Treated with ETD02282 and ETD02284 Relative Liver Mean Relative 40 0.16 [00386] The starting (Day 0) and ending (Day 112) body weights are shown in Table 38 for the 16- week study. There was reduced weight gain in the mice fed the Western Diet and treated with ETD02284 (Group 4) compared to mice on the Western Diet and treated with PBS (Group 2) at 16 weeks.
- mice Treated with ETD02282 and ETD02284 ody G 39 19.60 39.69 40 18.80 23.56 [00388]
- the 16-week serum levels of ALT, cholesterol, and ketones are shown in Table 40.
- the ALT and cholesterol levels at 16 weeks in mice treated with ETD02282 (Group 3) and ETD02284 (Group 4) were lower than mice treated with PBS (Group 2) on Western Diet.
- the ketone levels in mice at 16 weeks treated with ETD02284 (Group 4) were higher than mice treated with PBS (Group 2) on Western Diet.
- the % steatotic area was calculated by measuring the white areas left behind by lipid droplets in the tissue divided by the total area of the tissue section. Five different liver serial sections were used per animal for quantification. The 16-week % steatotic area of the H&E stained formalin fixed liver sections is in Table 42. The % steatotic area at 16 weeks was reduced in mice treated with ETD02282 (Group 3) and ETD02284 (Group 4) compared to mice treated with PBS (Group 2) on Western Diet.
- Table 43.24-week % Steatotic Area of Livers in Mice Treated with ETD02282 and ETD02284 Individual % Mean % Group # Animal # Steatotic Area Steatotic Area [00392] Liver triglycerides were measured in a piece of flash frozen liver using a Triglyceride Colorimetric Kit (Elabscience #E-BC-K238) following the manufacturer’s instructions.
- mice on normal diet treated with PBS The level of triglycerides in the liver at 16 weeks was reduced in mice treated with ETD02282 (Group 3) and ETD02284 (Group 4) compared to mice treated with PBS (Group 2) on Western Diet.
- Table 44 16-week Liver Triglyceride Levels in Mice Treated with ETD02282 and ETD02284 l 31 0.61 4 32 0.27 0.79 33 0.56 -218- Attorney Docket No.54462-742.601 34 1.55 35 0.94 [00393] ide Colorimetric Kit (Elabscience #E-BC-K238) following the manufacturer’s instructions.
- the levels of triglycerides in the flash frozen liver sections are shown in Table 45 with the data normalized to mice on normal diet treated with PBS (Group 5).
- the level of triglycerides in the liver at 24 weeks was not reduced in mice treated with ETD02282 (Group 7) and ETD02284 (Group 8) compared to mice treated with PBS (Group 6) on Western Diet.
- Expression of fibrotic and pro-inflammatory genes in the liver were measured by qRT-PCR and normalized to the mice on Western Diet receiving PBS (Group 2).
- pro-fibrotic genes COL1A1 and TIMP1 and pro-inflammatory genes TNF- ⁇ , IL1b, and CCL2 are shown in Table 46.
- Mice treated with ETD02282 (Group 3) did not show reduction of any genes compared to PBS treated mice (Group 2) except TIMP1.
- pro-fibrotic genes COL1A1 and TIMP1 and pro-inflammatory genes TNF- ⁇ , IL1b, and CCL2 are shown in Table 47.
- Mice treated with either siRNA did not show any significant change in expression of pro-inflammatory markers IL1b or CCL2 at 24 weeks.
- Preventative siRNA-mediated knockdown of GPAM in a mouse model of non-alcoholic fatty liver disease [00396] The protective effects of siRNA-mediated knockdown of GPAM in the liver was investigated in a high fat, high fructose diet-based mouse model of non-alcoholic fatty liver disease (NAFLD).
- NASH non-alcoholic fatty liver disease
- Six- to eight-week-old C57BL/6NHsd female mice (Envigo) were given a Western high fat diet (Envigo TD.120330, 0.2% cholesterol, 45% fat by calories) and high fructose water (55% fructose, 45% glucose).
- PBS phosphate buffered saline
- Mice on the 8 week study received a total of 4 siRNA doses and mice on the 16 week study received a total of 16 siRNA doses.
- the siRNA sequences that were used are shown in Table 48, where Nf (e.g.
- Af, Cf, Gf, Tf, or Uf is a 2’ fluoro-modified nucleoside
- n e.g. a, c, g, t, or u
- s is a phosphorothioate linkage.
- Table 48 The base sequences for each siRNA, with and without the 3’ UU extension, are shown in Table 49 Table 48.
- Example siRNA BASE Sequences si ce N ET UU ET UU si ce N gs ET G ET G si ce N gs ET G ETD02284 13402 CAAUAGACGUUUCUUAUC 13723 GAUAAGAAACGUCUAUUG [00398] Body weights were recorded biweekly until the end of the study. Mice were fasted 4-6 hours for serum collection on Day 0 and then 1 day prior to each biweekly siRNA injection. Serum was sent for the following clinical chemistry assays performed at IDEXX Laboratories, Incorporated – ALP, ALT, BUN, cholesterol, glucose, total bilirubin, total protein, triglycerides, and beta-hydroxybutarate.
- mice in Groups 1-6 were euthanized via cervical dislocation following isoflurane exposure with a final serum bleed at 8 weeks and all mice in Groups 7-12 were euthanized via cervical dislocation following isoflurane exposure with a final serum bleed at 16 weeks and the liver was separated into 4 sections.
- One section was placed in RNAlater for qRT-PCR (Thermo Fisher #AM7020), one section was snap frozen in liquid nitrogen for liver triglyceride measurement, one section was placed into 10% formalin for fixation and paraffin embedding for H&E and Picrosirius Red staining, and one section was fixed with 10% formalin at 4C for 24 hours and then embedded in OCT for Oil Red O staining.
- Total liver RNA was prepared by homogenizing the RNAlater liver tissue in homogenization buffer (Maxwell RSC simplyRNA Tissue Kit) using a Percellys 24 tissue homogenizer (Bertin Instruments) set at 5000 rpm for two 10 second cycles. Total RNA from the lysate was purified on a Maxwell RSC 48 platform (Promega Corporation) according to the manufacturer’s recommendations. Preparation of cDNA was performed using Quanta qScript cDNA SuperMix (VWR, Catalog# 95048-500) according to the manufacturer’s instructions.
- liver GPAM mRNA were assessed by RT- qPCR in triplicate on a QuantStudioTM 6 Pro Real-Time PCR System using TaqMan assays for mouse GPAM (ThermoFisher, assay# Mm01261106_m1), mouse COL1A1 (ThermoFisher, assay # Mm00801666_g1), mouse TIMP1 (ThermoFisher, assay # Mm00801666_g1), mouse TGFB1 (ThermoFisher, assay # Mm01341361_m1), mouse Acta2/SMA (ThermoFisher, assay # Mm00725412_s1), mouse Tnf- ⁇ (ThermoFisher, assay # Mm00443258_m1), mouse Il1B (ThermoFisher, assay # Mm00434228_m1), mouse CCL2 (ThermoFisher, assay # Mm0000
- the 8 -week GPAM mRNA levels are shown in Table . Data were normalized to the level in animals receiving PBS and on the Western Diet (Group 2). Mice on the Western Diet treated with ETD02282 (Groups 3 and 4) or ETD02284 (Groups 5 and 6) had reduced liver GPAM mRNA levels compared to mice on the Western Diet receiving PBS (Group 2). The mice on the Western Diet had elevated levels of GPAM compared to the mice on normal chow.
- Mice on the Western Diet treated with ETD02282 (Groups 9 and 10) or ETD02284 (Groups 11 and 12) had reduced liver GPAM mRNA levels compared to mice on the Western Diet receiving PBS (Group 8).
- the mice on the Western Diet had elevated levels of GPAM compared to the mice on normal chow.
- Table 51 16-week GPAM mRNA Levels in Mice Treated with ETD02282 and ETD02284 Relative Liver GPAM Mean Relative Liver GPAM G 59 0.09 60 0.08 [00403]
- the starting (Day 0) and ending (Day 56) body weights are shown in Table 52 for the 8-week study. There was reduced weight gain in the mice fed the Western Diet and treated with both doses of ETD02284 (Groups 5 and 6) compared to mice on the Western Diet and treated with PBS (Group 2) at 8 weeks.
- the 8-week serum levels of ALT, cholesterol, and ketones are shown in Table 54.
- mice treated with both doses of ETD02282 (Groups 3 and 4) and ETD02284 (Groups 5 and 6) were lower than mice treated with PBS (Group 2) on Western Diet.
- the serum cholesterol levels at 8 weeks in mice treated with either ETD02282 (Groups 3 and 4) or ETD02284 (Groups 5 and 6) on Western Diet were not significantly decreased compared to mice treated with PBS (Group 2) on Western Diet.
- mice at 8 weeks treated with both doses of ETD02284 (Groups 5 and 6) on Western Diet were higher than mice treated with PBS (Group 2) on Western Diet while the mice treated with both doses of ETD02282 (Groups 3 and 4) did not show an increase in ketones.
- mice treated with either ETD02282 (Groups 9 and 10) or ETD02284 (Groups 11 and 12) on Western Diet increased compared to mice treated with PBS (Group 8) on Western Diet.
- the (BHB) serum levels at 16 weeks were not increased with either siRNA treatment or dosage.
- liver sections were formalin fixed and paraffin embedded then stained with hematoxylin and eosin (H&E).
- H&E hematoxylin and eosin
- the % steatotic area was calculated by measuring the white areas left behind by lipid droplets in the tissue divided by the total area of the tissue section. Five different liver serial sections were used per animal for quantification. The 16-week % steatotic area of the H&E stained formalin fixed liver sections is in Table 57.
- Liver triglycerides were measured in a piece of flash frozen liver using a Triglyceride Colorimetric Kit (Elabscience #E-BC-K238) following the manufacturer’s instructions.
- the levels of triglycerides in the flash frozen liver sections are shown in Table 59 with the data normalized to mice on normal diet treated with PBS (Group 7).
- the level of triglycerides in the liver at 16 weeks were not significantly reduced in mice treated with either dose of ETD02282 (Groups 9 and 10) and 200 ug -230- Attorney Docket No.54462-742.601 ETD02284 (Group 11) compared to mice treated with PBS (Group 8) on Western Diet.
- the samples from the 60 ug dose of ETD02284 (Group 12) could not be successfully processed for this experiment.
- mice on Western Diet treated with 60 ug of ETD02282 had reduced expression of pro-fibrotic genes COL1A1 and TIMP1 and reduced expression of CCL2 compared to mice treated with PBS (Group 2).
- mice on the Western Diet for 16 weeks and treated with 200 ug (Group 9) or 60 ug (Group 10) of -232- Attorney Docket No.54462-742.601 ETD02282 or 200 ug of ETD02284 (Group 11) did not show any significant reduction in expression of pro-fibrotic or pro-inflammatory genes compared to mice treated with PBS (Group 8).
- the mice treated with 60 ug of ETD02284 (Group 12) showed significant reduction of all pro-fibrotic and pro- inflammatory genes measured at 16 weeks compared to mice on PBS (Group 8).
- Nf e.g. Af, Cf, Gf, Tf, or Uf
- n e.g.
- a, c, g, t, or u is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage.
- the base sequences for each siRNA, with and without the 3’ UU extension, are shown in Table 63.
- RNAlaterTM Stabilization Solution (Thermo Fisher, Catalog# AM7020) in 20 seconds and stored for 24 hours at 4°C. The RNAlater was then removed and the liver tissue was stored in the freezer until they were shipped to Empirico. [00416] Total liver RNA was prepared by homogenizing the RNAlater liver tissue in homogenization buffer (Maxwell RSC simplyRNA Tissue Kit) using a Percellys 24 tissue homogenizer (Bertin Instruments) set at 5000 rpm for two 10 second cycles. Total RNA from the lysate was purified on a Maxwell RSC 48 platform (Promega Corporation) according to the manufacturer’s recommendations.
- cDNA was prepared using Quanta qScript cDNA SuperMix (VWR, Catalog# 95048-500) according to the manufacturer’s instructions.
- the levels of liver GPAM mRNA were assessed by RT- qPCR in triplicate on a QuantStudioTM 6 Pro Real-Time PCR System using TaqMan assays for monkey -234- Attorney Docket No.54462-742.601 GPAM (ThermoFisher, assay# Mf02878271_m1), and the monkey housekeeping gene GAPDH (ThermoFisher, assay# Mf04392546_g1) using PerfeCTa® qPCR FastMix®, Low ROXTM (VWR, Catalog# 101419-222).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Pharmacology & Pharmacy (AREA)
- Molecular Biology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Urology & Nephrology (AREA)
- Gastroenterology & Hepatology (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Heart & Thoracic Surgery (AREA)
- Cardiology (AREA)
- Vascular Medicine (AREA)
- Epidemiology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Metabolic disorders such as liver disorders and cardiovascular disorders are widely abundant, and may affect a wide variety of people. Improved therapeutics are needed for treating these disorders. Disclosed herein are compositions comprising an oligonucleotide that targets GRAM. The oligonucleotide may include a small interfering RNA (siRNA) or an antisense oligonucleotide (ASO). Also provided herein are methods of treating conditions associated with GRAM gene mutations that include providing an oligonucleotide that targets GRAM in a subject. Some examples of diseases that may be treated include liver diseases or cardiometabolic diseases.
Description
Attorney Docket No.54462-742.601 TREATMENT OF GPAM RELATED DISEASES AND DISORDERS CROSS-REFERENCE [001] This application claims the benefit of U.S. Provisional Application No. 63/354,115, filed June 21, 2022, and U.S. Provisional Application No. 63/433,365, filed December 16, 2022, which applications are incorporated herein by reference. INCORPORATION BY REFERENCE OF SEQUENCE LISTING [002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled 54462-742_601_SL.xml, created June 16, 2023, which is 17,347,954 bytes in size. The information in the electronic format of the Sequence Listing is incorporated by reference in its entirety. BACKGROUND [003] Metabolic disorders such as liver disorders and cardiovascular disorders are widely abundant, and may affect a wide variety of people. Improved therapeutics are needed for treating these disorders. SUMMARY [004] Described herein are compositions that target GPAM. Described herein are compositions comprising an oligonucleotide that targets GPAM and when administered to a subject in an effective amount reduces a GPAM mRNA or protein level. A composition comprising an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases circulating cholesterol, apolipoprotein B, bilirubin, alanine aminotransferase, aspartate aminotransferase, or aspartate aminotransferase in a subject. In some embodiments, the cholesterol comprises total cholesterol, low density lipoprotein cholesterol, or non-high density lipoprotein cholesterol. In some embodiments, the decreased by about 10% or more, as compared to prior to administration. Described herein are compositions comprising an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases a liver fibrosis score, non-alcoholic fatty liver disease (NAFLD) activity score, or liver fat percentage in a subject. In some embodiments, the decrease is by about 10% or more, as compared to prior to administration. Described herein are compositions comprising an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases a use of statin (HMG CoA reductase inhibitor) medication. In some embodiments, the decrease is by about 10% or more, as compared to prior to administration. Described herein are compositions comprising an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases a measurement that reflects a phenotype of esophageal varices, portal hypertension, NAFLD, NASH, alcoholic liver disease, liver fibrosis, liver cirrhosis, hepatocellular carcinoma, hyperlipidemia, ischemic heart disease, or coronary heart disease in a subject. In some embodiments, the decrease is by about 10% or more, as compared to prior to administration. Described herein are compositions comprising an oligonucleotide that targets GPAM and when administered to a subject in an effective amount increases circulating ketone -1-
Attorney Docket No.54462-742.601 bodies in a subject. In some embodiments, the increase is by about 10% or more, as compared to prior to administration. In some embodiments, the oligonucleotide comprises a modified internucleoside linkage. In some embodiments, the modified internucleoside linkage comprises alkylphosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate, or carboxymethyl ester, or a combination thereof. In some embodiments, the modified internucleoside linkage comprises one or more phosphorothioate linkages. In some embodiments, the oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 modified internucleoside linkages. In some embodiments, the oligonucleotide comprises a modified nucleoside. In some embodiments, the modified nucleoside comprises a locked nucleic acid (LNA), hexitol nucleic acid (HLA), cyclohexene nucleic acid (CeNA), 2'-O-(2- methoxyethyl), 2'-O-alkyl, 2'-O-allyl, 2'-O-allyl, 2'-fluoro, or 2'-deoxy, or a combination thereof. In some embodiments, the modified nucleoside comprises an LNA. In some embodiments, the modified nucleoside comprises a 2’,4’ constrained ethyl nucleic acid. In some embodiments, the modified nucleoside comprises a 2'-O-methyl nucleoside, 2'-deoxyfluoro nucleoside, 2'-O-N-methylacetamido (2'- O-NMA) nucleoside, a 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE) nucleoside, 2'-O-aminopropyl (2'-O-AP) nucleoside, or 2'-ara-F, or a combination thereof. In some embodiments, the modified nucleoside comprises one or more 2’fluoro modified nucleosides. In some embodiments, the modified nucleoside comprises a 2' O-alkyl modified nucleoside. In some embodiments, the oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 modified nucleosides. In some embodiments, the oligonucleotide comprises a hydrophobic moiety attached at a 3’ or 5’ terminus of the oligonucleotide. In some embodiments, the hydrophobic moiety comprises cholesterol, myristoyl, palmitoyl, stearoyl, lithocholoyl, docosanoyl, docosahexaenoyl, myristyl, palmityl, stearyl, or α- tocopherol, or a combination thereof. In some embodiments, the hydrophobic moiety comprises stearyl, t- butylphenyl, n-butylphenyl, octylphenyl, dodecylphenyl, phenyl n-dodecyl, octadecylbenzamide, hexadecylbenzamide, or octadecylcyclohexyl In some embodiments the hydrophobic moiety comprises
any ,
, or , wherein the dotted line indicates a covalent connection to an end of the oligonucleotide, n is 1-3, and R is an alkyl group containing 4-18 carbons. In some embodiments, the oligonucleotide comprises an N-acetylgalactosamine (GalNAc) moiety, an N-acetylglucosamine (GlcNAc) moiety, or a mannose moiety, attached at a 3’ or 5’ terminus of the oligonucleotide. In some embodiments, the oligonucleotide comprises a GalNAc moiety. Some embodiments include: -2-
Attorney Docket No.54462-742.601 ein J comp
rises the oligonucleotide, and wherein J comprises an optional phosphate or phosphorothioate linking to the oligonucleotide. In some embodiments, the oligonucleotide comprises a small interfering RNA (siRNA) comprising a sense strand and an antisense strand. In some embodiments, the sense strand is 12-30 nucleosides in length. In some embodiments, the antisense strand is 12-30 nucleosides in length. Described herein are compositions comprising an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, each strand is independently about 12-30 nucleosides in length, and at least one of the sense strand and the antisense strand comprises a nucleoside sequence comprising about 12-30 contiguous nucleosides of SEQ ID NO: 12867. In some embodiments, any one of the following is true with regard to the sense strand: (i) all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; (ii) all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; (iii) all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise 2’-O-methyl modified pyrimidines; (iv) all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; (v) all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; or (vi) all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise 2’-O-methyl modified purines. In some embodiments, the sense strand comprises any one of modification patterns 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S . In some embodiments, any one of the following is true with regard to the antisense strand: (i) all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; (ii) all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified -3-
Attorney Docket No.54462-742.601 pyrimidines; (iii) all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise 2’ fluoro modified pyrimidines; (iv) all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; (v) all pyrimidines comprise 2’-O- methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; or (vi) all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise 2’ fluoro modified purines. In some embodiments, the antisense strand comprises any one of modification patterns 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the oligonucleotide comprises an antisense oligonucleotide (ASO). In some embodiments, the ASO is 12-30 nucleosides in length. Described herein are compositions comprising an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an ASO about 12-30 nucleosides in length and a nucleoside sequence complementary to about 12-30 contiguous nucleosides of SEQ ID NO: 12867. Some embodiments include a pharmaceutically acceptable carrier. Described herein are methods of treating a subject having liver disease, comprising administering an effective amount of the composition of any one of claims 1-42 to the subject. In some embodiments, the liver disease comprises NAFLD, NASH, alcoholic liver disease, liver fibrosis, liver cirrhosis, or hepatocellular carcinoma. Described herein are methods of treating a subject having cardiometabolic disease, comprising administering an effective amount of the composition of any one of claims 1-42 to the subject. In some embodiments, the cardiometabolic disease comprises hyperlipidemia, ischemic heart disease, or coronary heart disease. DETAILED DESCRIPTION [005] Large-scale human genetic data can improve the success rate of pharmaceutical discovery and development. A Genome Wide Association Study (GWAS) detects associations between genetic variants and traits in a population sample, and this improves understanding of the biology of disease and provides evidence of applicable treatments. A GWAS generally utilizes genotyping and/or sequencing data, and often involves an evaluation of millions of genetic variants that are relatively evenly distributed across the genome. The most common GWAS design is the case-control study, which involves comparing variant frequencies in cases versus controls. If a variant has a significantly different frequency in cases versus controls, that variant is considered associated with disease. Association statistics used in a GWAS include p-values, as a measure of statistical significance; odds ratios (OR), as a measure of effect size; or beta coefficients (beta), as a measure of effect size. Researchers often assume an additive genetic model and calculate an allelic odds ratio, which is the increased (or decreased) risk of disease conferred by each additional copy of an allele (compared to carrying no copies of that allele). An additional concept in design and interpretation of GWAS is that of linkage disequilibrium, which is the non-random association of alleles. The presence of linkage disequilibrium can obfuscate which variant is “causal.” [006] Functional annotation of variants and/or wet lab experimentation is used to identify a causal genetic variant identified via GWAS, and in many cases leads to identification of disease-causing genes. In particular, understanding the functional effect of a causal genetic variant (for example, loss of protein -4-
Attorney Docket No.54462-742.601 function, gain of protein function, increase in gene expression, or decrease in gene expression) allows that variant to be used as a proxy for therapeutic modulation of the target gene, or to gain insight into potential therapeutic efficacy and safety of a therapeutic that modulates that target. [007] Identification of such gene-disease associations has provided insights into disease biology and is used to identify novel therapeutic targets for the pharmaceutical industry. In order to translate the therapeutic insights derived from human genetics, disease biology in patients is exogenously ‘programmed’ into replicating the observation from human genetics. There are several options for therapeutic modalities that may be brought to bear in translating therapeutic targets identified via human genetics into novel medicines. These include well established therapeutic modalities such as small molecules and monoclonal antibodies, maturing modalities such as oligonucleotides, and emerging modalities such as gene therapy and gene editing. The choice of therapeutic modality depends on factors such as the location of a target (for example, intracellular, extracellular, or secreted), a relevant tissue (for example, fat or liver) and a relevant indication. [008] The GPAM (also known as GPAT or GPAT1) gene is located on chromosome 10, and encodes glycerol-3-phosphate acyltransferase, mitochondrial (GPAM). GPAM may include 828 amino acids and have a mass of about 94 kDa. GPAM may be expressed in liver, adipose, adrenal, thyroid, heart, gall bladder, brain, salivary gland, and testis cells. GPAM may be intracellular. GPAM may exist as two different enzymatic forms, in the mitochondria or in the endoplasmic reticulum. GPAM may catalyze the initial and committing step in glycerolipid biosynthesis and can play a significant role in the regulation of cellular triacylglycerol and phospholipid levels. The mitochondrial enzyme GPAM may preferentially use saturated fatty acids as a substrate for the synthesis of glycerolipids. GPAM may catalyze the first step in this metabolic pathway. GPAM may interact with APP, SREBF1, AGPAT1, AGPAT2, AGPAT3, AGPAT4, AGPAT5, AGPAT6, AGPAT9, GPD1, or MBOAT2. An example of an 828 amino acid sequence, and further description of GPAM is included at uniprot.org under accession no. Q9HCL2 (last modified May 25, 2022). A potential alternatively spliced isoform of GPAM producing a 710 amino acid sequence is included at uniprot.org under accession no. Q5VW52 (last modified Dec. 07, 2004). [009] Here it is shown that genetic loss-of-function GPAM variants result in protective blood ketone associations, liver disease-related associations, liver function associations, and blood lipid associations. Therefore, inhibition of GPAM may serve as a therapeutic for treatment of liver or cardiometabolic diseases or disorders such as non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), alcoholic liver disease, liver fibrosis, liver cirrhosis, hepatocellular carcinoma, hyperlipidemia, ischemic heart disease, or coronary heart disease. The GPAM inhibition may result in an improved liver function, cardiovascular function, and metabolic phenotypes including favorable liver fat percentage, liver fibrosis score, NAFLD activity score, liver enzyme function test, serum metabolite test, or serum lipid panel test. [0010] Disclosed herein are compositions comprising an oligonucleotide that targets GPAM. Where inhibition or targeting of GPAM is disclosed, it is contemplated that some embodiments may include inhibiting or targeting a GPAM protein or GPAM RNA. For example, by inhibiting or targeting an RNA (e.g. mRNA) encoded by the GPAM gene using an oligonucleotide described herein, the GPAM protein -5-
Attorney Docket No.54462-742.601 may be inhibited or targeted as a result of there being less production of the GPAM protein by translation of the GPAM RNA; or a GPAM protein may be targeted or inhibited by an oligonucleotide that binds or interacts with a GPAM RNA and reduces production of the GPAM protein from the GPAM RNA. Thus, targeting GPAM may refer to binding a GPAM RNA and reducing GPAM RNA or protein levels. The oligonucleotide may include a small interfering RNA (siRNA) or an antisense oligonucleotide (ASO). Administration of the oligonucleotide to a subject may improve (e.g. decrease) a liver fat percentage, liver fibrosis score, NAFLD activity score, blood alanine aminotransferase (ALT), blood aspartate aminotransferase (AST), blood aspartate aminotransferase (ASP), blood bilirubin, low-density lipoprotein (LDL), total cholesterol, non-HDL cholesterol, or apolipoprotein B (APOB) measurement, or a combination thereof in the subject. Also provided herein are methods of treating a liver or cardiometabolic disorder by providing an oligonucleotide that targets GPAM to a subject in need thereof. I. COMPOSITIONS [0011] Disclosed herein, in some embodiments, are compositions comprising an oligonucleotide. In some embodiments, the composition comprises an oligonucleotide that targets GPAM. In some embodiments, the composition consists of an oligonucleotide that targets GPAM. In some embodiments, the oligonucleotide reduces GPAM mRNA expression in the subject. In some embodiments, the oligonucleotide reduces GPAM protein expression in the subject. The oligonucleotide may include a small interfering RNA (siRNA) described herein. The oligonucleotide may include an antisense oligonucleotide (ASO) described herein. In some embodiments, a composition described herein is used in a method of treating a disorder in a subject in need thereof. Some embodiments relate to a composition comprising an oligonucleotide for use in a method of treating a disorder as described herein. Some embodiments relate to use of a composition comprising an oligonucleotide, in a method of treating a disorder as described herein. [0012] Some embodiments include a composition comprising an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases GPAM mRNA or protein levels in a cell, fluid or tissue. In some embodiments, the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases GPAM mRNA levels in a cell or tissue. In some embodiments, the tissue is liver tissue. In some embodiments, the tissue is fat tissue. In some embodiments, the cell is a hepatocyte. In some embodiments, the cell is an adipocyte. In some embodiments, the GPAM mRNA levels are decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the GPAM mRNA levels are decreased by about 10% or more, as compared to prior to administration. In some embodiments, the GPAM mRNA levels are decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the GPAM mRNA levels are decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the GPAM mRNA levels are decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the GPAM mRNA levels are -6-
Attorney Docket No.54462-742.601 decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the GPAM mRNA levels are decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or by a range defined by any of the two aforementioned percentages. [0013] In some embodiments, the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases GPAM protein levels in a cell, fluid or tissue. In some embodiments, the composition decreases GPAM protein levels in a cell or tissue. In some embodiments, the tissue is liver tissue. In some embodiments, the tissue is fat tissue. In some embodiments, the cell is a hepatocyte. In some embodiments, the cell is an adipocyte. In some embodiments, the GPAM protein levels are decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the GPAM protein levels are decreased by about 10% or more, as compared to prior to administration. In some embodiments, the GPAM protein levels are decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the GPAM protein levels are decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the GPAM protein levels are decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the GPAM protein levels are decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the GPAM protein levels are decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or by a range defined by any of the two aforementioned percentages. [0014] In some embodiments, the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount diminishes a liver disease phenotype. The liver disease may include non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), alcoholic liver disease, liver fibrosis, liver cirrhosis, or hepatocellular carcinoma. In some embodiments, the liver disease phenotype is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the liver disease phenotype is decreased by about 10% or more, as compared to prior to administration. In some embodiments, the liver disease phenotype is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the liver disease phenotype is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the liver disease phenotype is decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the liver disease phenotype is -7-
Attorney Docket No.54462-742.601 decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the liver disease phenotype is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or by a range defined by any of the two aforementioned percentages. [0015] In some embodiments, the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount diminishes a cardiometabolic disease phenotype. The cardiometabolic disease may include hyperlipidemia, ischemic heart disease, or coronary heart disease. In some embodiments, the cardiometabolic disease phenotype is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the cardiometabolic disease phenotype is decreased by about 10% or more, as compared to prior to administration. In some embodiments, the cardiometabolic disease phenotype is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the cardiometabolic disease phenotype is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the cardiometabolic disease phenotype is decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the cardiometabolic disease phenotype is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the cardiometabolic disease phenotype is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or by a range defined by any of the two aforementioned percentages. [0016] In some embodiments, the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount enhances a protective phenotype against a liver disease in the subject. The liver disease may include non-alcoholic fatty liver disease (NAFLD), non- alcoholic steatohepatitis (NASH), alcoholic liver disease, liver fibrosis, liver cirrhosis, or hepatocellular carcinoma. In some embodiments, the protective phenotype is increased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the protective phenotype is increased by about 10% or more, as compared to prior to administration. In some embodiments, the protective phenotype is increased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more, as compared to prior to administration. In some embodiments, the protective phenotype is increased by about 200% or more, about 300% or more, about 400% or more, about 500% or more, about 600% or more, about 700% or more, about 800% or more, about 900% or more, or about 1000% or more, as compared to prior to administration. In some embodiments, the protective phenotype is increased by no more than about 2.5%, no more than about 5%, or no more than -8-
Attorney Docket No.54462-742.601 about 7.5%, as compared to prior to administration. In some embodiments, the protective phenotype is increased by no more than about 10%, as compared to prior to administration. In some embodiments, the protective phenotype is increased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or no more than about 100%, as compared to prior to administration. In some embodiments, the protective phenotype is increased by no more than about 200%, no more than about 300%, no more than about 400%, no more than about 500%, no more than about 600%, no more than about 700%, no more than about 800%, no more than about 900%, or no more than about 1000%, as compared to prior to administration. In some embodiments, the protective phenotype is increased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, or 1000%, or by a range defined by any of the two aforementioned percentages. [0017] In some embodiments, the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount enhances a protective phenotype against a cardiometabolic disease in the subject. The cardiometabolic disease may include hyperlipidemia, ischemic heart disease, or coronary heart disease. In some embodiments, the protective phenotype is increased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the protective phenotype is increased by about 10% or more, as compared to prior to administration. In some embodiments, the protective phenotype is increased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more, as compared to prior to administration. In some embodiments, the protective phenotype is increased by about 200% or more, about 300% or more, about 400% or more, about 500% or more, about 600% or more, about 700% or more, about 800% or more, about 900% or more, or about 1000% or more, as compared to prior to administration. In some embodiments, the protective phenotype is increased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the protective phenotype is increased by no more than about 10%, as compared to prior to administration. In some embodiments, the protective phenotype is increased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or no more than about 100%, as compared to prior to administration. In some embodiments, the protective phenotype is increased by no more than about 200%, no more than about 300%, no more than about 400%, no more than about 500%, no more than about 600%, no more than about 700%, no more than about 800%, no more than about 900%, or no more than about 1000%, as compared to prior to administration. In some embodiments, the protective phenotype is increased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, or 1000%, or by a range defined by any of the two aforementioned percentages. [0018] In some embodiments, the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases circulating cholesterol in the subject. The -9-
Attorney Docket No.54462-742.601 circulating cholesterol may include total cholesterol or non-high density lipoprotein (HDL) cholesterol. The circulating cholesterol may include total cholesterol. The circulating cholesterol may include non- HDL cholesterol. In some embodiments, the circulating cholesterol is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the circulating cholesterol is decreased by about 10% or more, as compared to prior to administration. In some embodiments, the circulating cholesterol is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the circulating cholesterol is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the circulating cholesterol is decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the circulating cholesterol is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the circulating cholesterol is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [0019] In some embodiments, the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases circulating low density lipoproteins (LDL) in the subject. In some embodiments, the circulating LDL is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the circulating LDL is decreased by about 10% or more, as compared to prior to administration. In some embodiments, the circulating LDL is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the circulating LDL is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the circulating LDL is decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the circulating LDL is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the circulating LDL is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [0020] In some embodiments, the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases circulating apolipoprotein B (APOB) in the subject. In some embodiments, the circulating APOB is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the circulating APOB is decreased by about 10% or more, as compared to prior to administration. In some embodiments, the circulating APOB is decreased by about 20% or more, about 30% or more, about 40% -10-
Attorney Docket No.54462-742.601 or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the circulating APOB is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the circulating APOB is decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the circulating APOB is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the circulating APOB is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [0021] In some embodiments, the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases circulating alanine aminotransferase (ALT) in the subject. In some embodiments, the circulating ALT is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the circulating ALT is decreased by about 10% or more, as compared to prior to administration. In some embodiments, the circulating ALT is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the circulating ALT is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the circulating ALT is decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the circulating ALT is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the circulating ALT is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [0022] In some embodiments, the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases circulating aspartate aminotransferase (AST) in the subject. In some embodiments, the circulating AST is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the circulating AST is decreased by about 10% or more, as compared to prior to administration. In some embodiments, the circulating AST is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the circulating AST is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the circulating AST is decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the circulating AST is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than -11-
Attorney Docket No.54462-742.601 about 90%, as compared to prior to administration. In some embodiments, the circulating AST is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [0023] In some embodiments, the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases circulating aspartate aminotransferase (ASP) in the subject. In some embodiments, the circulating ASP is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the circulating ASP is decreased by about 10% or more, as compared to prior to administration. In some embodiments, the circulating ASP is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the circulating ASP is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the circulating ASP is decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the circulating ASP is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the circulating ASP is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [0024] In some embodiments, the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases circulating bilirubin in the subject. In some embodiments, the circulating bilirubin is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the circulating bilirubin is decreased by about 10% or more, as compared to prior to administration. In some embodiments, the circulating bilirubin is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the circulating bilirubin is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the circulating bilirubin is decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the circulating bilirubin is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the circulating bilirubin is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [0025] In some embodiments, the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases a nonalcoholic fatty liver disease (NAFLD) activity score in the subject. In some embodiments, the NAFLD activity score is decreased by -12-
Attorney Docket No.54462-742.601 about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the NAFLD activity score is decreased by about 10% or more, as compared to prior to administration. In some embodiments, the NAFLD activity score is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the NAFLD activity score is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the NAFLD activity score is decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the NAFLD activity score is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the NAFLD activity score is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [0026] In some embodiments, the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases a liver fat percentage in the subject. In some embodiments, the liver fat percentage is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the liver fat percentage is decreased by about 10% or more, as compared to prior to administration. In some embodiments, the liver fat percentage is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the liver fat percentage is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the liver fat percentage is decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the liver fat percentage is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the liver fat percentage is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [0027] In some embodiments, the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases a liver fibrosis score in the subject. In some embodiments, the liver fibrosis score is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the liver fibrosis score is decreased by about 10% or more, as compared to prior to administration. In some embodiments, the liver fibrosis score is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the liver fibrosis score is -13-
Attorney Docket No.54462-742.601 decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the liver fibrosis score is decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the liver fibrosis score is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the liver fibrosis score is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [0028] In some embodiments, the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases a use of an HGM CoA reductase inhibitor (e.g. a statin) medication in the subject. In some embodiments, the use of statin medications is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the use of statin medications is decreased by about 10% or more, as compared to prior to administration. In some embodiments, the use of statin medications is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, or about 90% or more, or about 100%, as compared to prior to administration. In some embodiments, the use of statin medications is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the use of statin medications is decreased by no more than about 10%, as compared to prior to administration. In some embodiments, the use of statin medications is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, or no more than about 90%, as compared to prior to administration. In some embodiments, the use of statin medications is decreased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [0029] In some embodiments, the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount increases circulating ketone bodies in the subject. In some embodiments, the circulating ketone body 3-hydroxybutyrate is increased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the circulating ketone body 3-hydroxybutyrate is increased by about 10% or more, as compared to prior to administration. In some embodiments, the circulating ketone body 3-hydroxybutyrate is increased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more, as compared to prior to administration. In some embodiments, the circulating ketone body 3-hydroxybutyrate is increased by about 200% or more, about 300% or more, about 400% or more, about 500% or more, about 600% or more, about 700% or more, about 800% or more, about 900% or more, or about 1000% or more, as compared to prior to administration. In some embodiments, the circulating ketone body 3-hydroxybutyrate is increased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the circulating ketone body 3-hydroxybutyrate -14-
Attorney Docket No.54462-742.601 is increased by no more than about 10%, as compared to prior to administration. In some embodiments, the circulating ketone body 3-hydroxybutyrate is increased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or no more than about 100%, as compared to prior to administration. In some embodiments, the circulating ketone body 3-hydroxybutyrate is increased by no more than about 200%, no more than about 300%, no more than about 400%, no more than about 500%, no more than about 600%, no more than about 700%, no more than about 800%, no more than about 900%, or no more than about 1000%, as compared to prior to administration. In some embodiments, the circulating ketone body 3-hydroxybutyrate is increased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, or 1000%, or by a range defined by any of the two aforementioned percentages. [0030] In some embodiments, the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount increases circulating ketone bodies in the subject. In some embodiments, the circulating ketone body acetoacetate is increased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the circulating ketone body acetoacetate is increased by about 10% or more, as compared to prior to administration. In some embodiments, the circulating ketone body acetoacetate is increased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more, as compared to prior to administration. In some embodiments, the circulating ketone body acetoacetate is increased by about 200% or more, about 300% or more, about 400% or more, about 500% or more, about 600% or more, about 700% or more, about 800% or more, about 900% or more, or about 1000% or more, as compared to prior to administration. In some embodiments, the circulating ketone body acetoacetate is increased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the circulating ketone body acetoacetate is increased by no more than about 10%, as compared to prior to administration. In some embodiments, the circulating ketone body acetoacetate is increased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or no more than about 100%, as compared to prior to administration. In some embodiments, the circulating ketone body acetoacetate is increased by no more than about 200%, no more than about 300%, no more than about 400%, no more than about 500%, no more than about 600%, no more than about 700%, no more than about 800%, no more than about 900%, or no more than about 1000%, as compared to prior to administration. In some embodiments, the circulating ketone body acetoacetate is increased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, or 1000%, or by a range defined by any of the two aforementioned percentages. [0031] In some embodiments, the composition comprises an oligonucleotide that targets GPAM and when administered to a subject in an effective amount increases circulating ketone bodies in the subject. -15-
Attorney Docket No.54462-742.601 In some embodiments, the circulating ketone body acetone is increased by about 2.5% or more, about 5% or more, or about 7.5% or more, as compared to prior to administration. In some embodiments, the circulating ketone body acetone is increased by about 10% or more, as compared to prior to administration. In some embodiments, the circulating ketone body acetone is increased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more, as compared to prior to administration. In some embodiments, the circulating ketone body acetone is increased by about 200% or more, about 300% or more, about 400% or more, about 500% or more, about 600% or more, about 700% or more, about 800% or more, about 900% or more, or about 1000% or more, as compared to prior to administration. In some embodiments, the circulating ketone body acetone is increased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, as compared to prior to administration. In some embodiments, the circulating ketone body acetone is increased by no more than about 10%, as compared to prior to administration. In some embodiments, the circulating ketone body acetone is increased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or no more than about 100%, as compared to prior to administration. In some embodiments, the circulating ketone body acetone is increased by no more than about 200%, no more than about 300%, no more than about 400%, no more than about 500%, no more than about 600%, no more than about 700%, no more than about 800%, no more than about 900%, or no more than about 1000%, as compared to prior to administration. In some embodiments, the circulating ketone body acetone is increased by 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, or 1000%, or by a range defined by any of the two aforementioned percentages. A. siRNAs [0032] In some embodiments, the composition comprises an oligonucleotide that targets GPAM, wherein the oligonucleotide comprises a small interfering RNA (siRNA). In some embodiments, the composition comprises an oligonucleotide that targets GPAM, wherein the oligonucleotide comprises a small interfering RNA (siRNA) comprising a sense strand and an antisense strand. [0033] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, wherein the sense strand is 12-30 nucleosides in length. In some embodiments, the composition comprises a sense strange that is 10, 11, 12, 13, 14, 15, 16, 17, 18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleosides in length, or a range defined by any of the two aforementioned numbers. The sense strand may be 14-30 nucleosides in length. In some embodiments, the composition comprises an antisense strand is 12-30 nucleosides in length. In some embodiments, the composition comprises an antisense strand that is 10, 11, 12, 13, 14, 15, 16, 17, 18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleosides in length, or a range defined by any of the two aforementioned numbers. The antisense strand may be 14-30 nucleosides in length. -16-
Attorney Docket No.54462-742.601 [0034] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, each strand is independently about 12-30 nucleosides in length, and at least one of the sense strand and the antisense strand comprises a nucleoside sequence comprising about 12-30 contiguous nucleosides of a full-length human GPAM mRNA sequence such as SEQ ID NO: 12867. In some embodiments, at least one of the sense strand and the antisense strand comprise a nucleoside sequence comprising at least about 10, 11, 12, 13, 14, 15, 16, 17, 18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more contiguous nucleosides of one of SEQ ID NO: 12867. [0035] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a double-stranded RNA duplex. In some embodiments, the first base pair of the double-stranded RNA duplex is an AU base pair. [0036] In some embodiments, the sense strand further comprises a 3’ overhang. In some embodiments, the 3’ overhang comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides, or a range of nucleotides defined by any two of the aforementioned numbers. In some embodiments, the 3’ overhang comprises 1, 2, or more nucleosides. In some embodiments, the 3’ overhang comprises 2 nucleosides. In some embodiments, the sense strand further comprises a 5’ overhang. In some embodiments, the 5’ overhang comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides, or a range of nucleotides defined by any two of the aforementioned numbers. In some embodiments, the 5’ overhang comprises 1, 2, or more nucleosides. In some embodiments, the 5’ overhang comprises 2 nucleosides. [0037] In some embodiments, the antisense strand further comprises a 3’ overhang. In some embodiments, the 3’ overhang comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides, or a range of nucleotides defined by any two of the aforementioned numbers. In some embodiments, the 3’ overhang comprises 1, 2, or more nucleosides. In some embodiments, the 3’ overhang comprises 2 nucleosides. In some embodiments, the antisense strand further comprises a 5’ overhang. In some embodiments, the 5’ overhang comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides, or a range of nucleotides defined by any two of the aforementioned numbers. In some embodiments, the 5’ overhang comprises 1, 2, or more nucleosides. In some embodiments, the 5’ overhang comprises 2 nucleosides. [0038] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, wherein the siRNA binds with a 19mer in a human GPAM mRNA. In some embodiments, the siRNA binds with a 12mer, a 13mer, a 14mer, a 15mer, a 16mer, a 17mer, a 18mer, a 19mer, a 20mer, a 21mer, a 22mer, a 23mer, a 24mer, or a 25mer in a human GPAM mRNA. [0039] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, wherein the siRNA binds with a 17mer in a non-human primate GPAM mRNA. In some embodiments, the siRNA binds with a 12mer, a 13mer, a 14mer, a 15mer, a 16mer, a 17mer, a 18mer, a 19mer, a 20mer, a 21mer, a 22mer, a 23mer, a 24mer, or a 25mer in a non-human primate GPAM mRNA. -17-
Attorney Docket No.54462-742.601 [0040] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, wherein the siRNA binds with a human GPAM mRNA and less than or equal to 20 human off-targets, with no more than 2 mismatches in the antisense strand. In some embodiments, the siRNA binds with a human GPAM mRNA and less than or equal to 10 human off-targets, with no more than 2 mismatches in the antisense strand. In some embodiments, the siRNA binds with a human GPAM mRNA and less than or equal to 30 human off-targets, with no more than 2 mismatches in the antisense strand. In some embodiments, the siRNA binds with a human GPAM mRNA and less than or equal to 40 human off-targets, with no more than 2 mismatches in the antisense strand. In some embodiments, the siRNA binds with a human GPAM mRNA and less than or equal to 50 human off-targets, with no more than 2 mismatches in the antisense strand. In some embodiments, the siRNA binds with a human GPAM mRNA and less than or equal to 10 human off-targets, with no more than 3 mismatches in the antisense strand. In some embodiments, the siRNA binds with a human GPAM mRNA and less than or equal to 20 human off-targets, with no more than 3 mismatches in the antisense strand. In some embodiments, the siRNA binds with a human GPAM mRNA and less than or equal to 30 human off-targets, with no more than 3 mismatches in the antisense strand. In some embodiments, the siRNA binds with a human GPAM mRNA and less than or equal to 40 human off-targets, with no more than 3 mismatches in the antisense strand. In some embodiments, the siRNA binds with a human GPAM mRNA and less than or equal to 50 human off-targets, with no more than 3 mismatches in the antisense strand. [0041] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, siRNA binds with a human GPAM mRNA target site that does not harbor an SNP, with a minor allele frequency (MAF) greater or equal to 1% (pos.2-18). In some embodiments, the MAF is greater or equal to about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, or about 20%. [0042] In some embodiments, the siRNA comprises a sense strand having a sequence in accordance with any of SEQ ID NOs: 1-6354. In some embodiments, the sense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 1-6354, at least 80% identical to any one of SEQ ID NOs: 1-6354, at least 85% identical to of any one of SEQ ID NOs: 1-6354, at least 90% identical to any one of SEQ ID NOs1-6354, or at least 95% identical to any one of SEQ ID NOs: 1-6354. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 1-6354, or a sense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 1-6354, or a sense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 1-6354. The sense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, -18-
Attorney Docket No.54462-742.601 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand may comprise a modification pattern described herein. The sense strand may comprise an overhang. The sense strand may comprise a lipid moiety. The sense strand may comprise a GalNAc moiety. In some embodiments, the siRNA comprises an antisense strand having a sequence in accordance with any of SEQ ID NOs: 6355-12708. In some embodiments, the antisense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 6355-12708, at least 80% identical to any one of SEQ ID NOs: 6355-12708, at least 85% identical to of any one of SEQ ID NOs: 6355- 12708, at least 90% identical to any one of SEQ ID NOs: 6355-12708, or at least 95% identical to any one of SEQ ID NOs: 6355-12708. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 6355-12708, or an antisense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 6355-12708, or an antisense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 6355-12708. The antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The antisense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The antisense strand may comprise an overhang. The antisense strand may comprise a modification pattern described herein. The antisense strand may comprise a lipid moiety or a GalNAc moiety. [0043] In some embodiments, the siRNA comprises a sense strand having a sequence in accordance with any of SEQ ID NOs: 13082-13402. In some embodiments, the sense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 13082-13402, at least 80% identical to any one of SEQ ID NOs: 13082-13402, at least 85% identical to of any one of SEQ ID NOs: 13082-13402, at least 90% identical to any one of SEQ ID NOs13082-13402, or at least 95% identical to any one of SEQ ID NOs: 13082-13402. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13082-13402, or a sense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13082-13402, or a sense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 13082-13402. The sense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand may comprise a modification pattern described herein. The sense strand may comprise an overhang. The sense strand may comprise a lipid moiety. The sense strand may comprise a GalNAc moiety. In some embodiments, the siRNA comprises an antisense strand having a sequence in accordance with any of SEQ ID NOs: 13403- 13723. In some embodiments, the antisense strand sequence comprises or consists of sequence at least -19-
Attorney Docket No.54462-742.601 75% identical to any one of SEQ ID NOs: 13403-13723, at least 80% identical to any one of SEQ ID NOs: 13403-13723, at least 85% identical to of any one of SEQ ID NOs: 13403-13723, at least 90% identical to any one of SEQ ID NOs: 13403-13723, or at least 95% identical to any one of SEQ ID NOs: 13403-13723. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13403-13723, or an antisense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13403-13723, or an antisense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 13403- 13723. The antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The antisense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The antisense strand may comprise an overhang. The antisense strand may comprise a modification pattern described herein. The antisense strand may comprise a lipid moiety or a GalNAc moiety. [0044] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of subset A. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of subset A. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset A, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset A, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of subset A. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0045] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of subset B. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of subset B. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset B, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset B, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of subset B. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. -20-
Attorney Docket No.54462-742.601 [0046] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of subset C. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of subset C. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset C, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset C, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of subset C. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0047] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of subset D. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of subset D. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset D, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset D, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of subset D. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0048] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of subset E. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of subset E. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset E, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset E, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of subset E. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0049] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of subset F. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at -21-
Attorney Docket No.54462-742.601 least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of subset F. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset F, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset F, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of subset F. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0050] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of subset I. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of subset I. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset I, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset I, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of subset I. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0051] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of subset J. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of subset J. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset J, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset J, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of subset J. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0052] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA herein (such as an siRNA in a table herein). In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of an siRNA herein. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of an siRNA herein, -22-
Attorney Docket No.54462-742.601 or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of an siRNA herein, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of an siRNA herein. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0053] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 8. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 8. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 8, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 8, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 8. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0054] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 9. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 9. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 9, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 9, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 9. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0055] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 11A. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 11A. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 11A, or a sequence thereof having 3 -23-
Attorney Docket No.54462-742.601 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 11A, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 11A. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0056] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 11B. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 11B. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 11B, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 11B, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 11B. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0057] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 14. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 14. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 14, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 14, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 14. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0058] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 18. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 18. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 18, or a sequence thereof having 3 or -24-
Attorney Docket No.54462-742.601 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 18, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 18. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0059] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 22. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 22. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 22, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 22, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 22. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0060] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 25. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 25. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 25, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 25, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 25. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0061] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 28. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 28. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 28, or a sequence thereof having 3 or -25-
Attorney Docket No.54462-742.601 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 28, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 28. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0062] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 31. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 31. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 31, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 31, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 31. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0063] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 35. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 35. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 35, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 35, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 35. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0064] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 49. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 49. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 49, or a sequence thereof having 3 or -26-
Attorney Docket No.54462-742.601 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 49, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 49. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0065] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 63. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 63. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 63, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 63, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 63. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0066] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 66. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 66. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 66, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 66, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 66. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [0067] In some embodiments, the siRNA comprises a sense strand having a sequence in accordance with any of SEQ ID NOs: 13329, 13334, 13335, 13091, 13259, 13260, 13261, 13262, 13263, 13264, 13265, 13266, 13336, 13311, 13312, 13341, 13099, 13165, 13166, 13167, 13168, 13169, 13170, 13171, 13172, 13173, 13100, 13157, 13158, 13159, 13160, 13161, 13162, 13163, 13164, 13344, 13103, 13216, 13217, 13218, 13219, 13220, 13221, 13222, 13223, 13224, 13307, 13308, 13309, 13310, 13345, 13346, 13106, 13267, 13268, 13269, 13270, 13271, 13272, 13273, and 13274. In some embodiments, the sense -27-
Attorney Docket No.54462-742.601 strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 13329, 13334, 13335, 13091, 13259, 13260, 13261, 13262, 13263, 13264, 13265, 13266, 13336, 13311, 13312, 13341, 13099, 13165, 13166, 13167, 13168, 13169, 13170, 13171, 13172, 13173, 13100, 13157, 13158, 13159, 13160, 13161, 13162, 13163, 13164, 13344, 13103, 13216, 13217, 13218, 13219, 13220, 13221, 13222, 13223, 13224, 13307, 13308, 13309, 13310, 13345, 13346, 13106, 13267, 13268, 13269, 13270, 13271, 13272, 13273, and 13274., at least 80% identical to any one of SEQ ID NOs: 13329, 13334, 13335, 13091, 13259, 13260, 13261, 13262, 13263, 13264, 13265, 13266, 13336, 13311, 13312, 13341, 13099, 13165, 13166, 13167, 13168, 13169, 13170, 13171, 13172, 13173, 13100, 13157, 13158, 13159, 13160, 13161, 13162, 13163, 13164, 13344, 13103, 13216, 13217, 13218, 13219, 13220, 13221, 13222, 13223, 13224, 13307, 13308, 13309, 13310, 13345, 13346, 13106, 13267, 13268, 13269, 13270, 13271, 13272, 13273, and 13274., at least 85% identical to of any one of SEQ ID NOs: 13329, 13334, 13335, 13091, 13259, 13260, 13261, 13262, 13263, 13264, 13265, 13266, 13336, 13311, 13312, 13341, 13099, 13165, 13166, 13167, 13168, 13169, 13170, 13171, 13172, 13173, 13100, 13157, 13158, 13159, 13160, 13161, 13162, 13163, 13164, 13344, 13103, 13216, 13217, 13218, 13219, 13220, 13221, 13222, 13223, 13224, 13307, 13308, 13309, 13310, 13345, 13346, 13106, 13267, 13268, 13269, 13270, 13271, 13272, 13273, and 13274., at least 90% identical to any one of SEQ ID NOs13329, 13334, 13335, 13091, 13259, 13260, 13261, 13262, 13263, 13264, 13265, 13266, 13336, 13311, 13312, 13341, 13099, 13165, 13166, 13167, 13168, 13169, 13170, 13171, 13172, 13173, 13100, 13157, 13158, 13159, 13160, 13161, 13162, 13163, 13164, 13344, 13103, 13216, 13217, 13218, 13219, 13220, 13221, 13222, 13223, 13224, 13307, 13308, 13309, 13310, 13345, 13346, 13106, 13267, 13268, 13269, 13270, 13271, 13272, 13273, and 13274., or at least 95% identical to any one of SEQ ID NOs: 13329, 13334, 13335, 13091, 13259, 13260, 13261, 13262, 13263, 13264, 13265, 13266, 13336, 13311, 13312, 13341, 13099, 13165, 13166, 13167, 13168, 13169, 13170, 13171, 13172, 13173, 13100, 13157, 13158, 13159, 13160, 13161, 13162, 13163, 13164, 13344, 13103, 13216, 13217, 13218, 13219, 13220, 13221, 13222, 13223, 13224, 13307, 13308, 13309, 13310, 13345, 13346, 13106, 13267, 13268, 13269, 13270, 13271, 13272, 13273, and 13274.. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13329, 13334, 13335, 13091, 13259, 13260, 13261, 13262, 13263, 13264, 13265, 13266, 13336, 13311, 13312, 13341, 13099, 13165, 13166, 13167, 13168, 13169, 13170, 13171, 13172, 13173, 13100, 13157, 13158, 13159, 13160, 13161, 13162, 13163, 13164, 13344, 13103, 13216, 13217, 13218, 13219, 13220, 13221, 13222, 13223, 13224, 13307, 13308, 13309, 13310, 13345, 13346, 13106, 13267, 13268, 13269, 13270, 13271, 13272, 13273, and 13274., or a sense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13329, 13334, 13335, 13091, 13259, 13260, 13261, 13262, 13263, 13264, 13265, 13266, 13336, 13311, 13312, 13341, 13099, 13165, 13166, 13167, 13168, 13169, 13170, 13171, 13172, 13173, 13100, 13157, 13158, 13159, 13160, 13161, 13162, 13163, 13164, 13344, 13103, 13216, 13217, 13218, 13219, 13220, 13221, 13222, 13223, 13224, 13307, 13308, 13309, 13310, 13345, 13346, 13106, 13267, 13268, 13269, 13270, 13271, 13272, 13273, and 13274., or a sense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of a sequence 100% identical to -28-
Attorney Docket No.54462-742.601 SEQ ID NOs: 13329, 13334, 13335, 13091, 13259, 13260, 13261, 13262, 13263, 13264, 13265, 13266, 13336, 13311, 13312, 13341, 13099, 13165, 13166, 13167, 13168, 13169, 13170, 13171, 13172, 13173, 13100, 13157, 13158, 13159, 13160, 13161, 13162, 13163, 13164, 13344, 13103, 13216, 13217, 13218, 13219, 13220, 13221, 13222, 13223, 13224, 13307, 13308, 13309, 13310, 13345, 13346, 13106, 13267, 13268, 13269, 13270, 13271, 13272, 13273, and 13274.. The sense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand may comprise a modification pattern described herein. The sense strand may comprise an overhang. The sense strand may comprise a lipid moiety. The sense strand may comprise a GalNAc moiety. [0068] In some embodiments, the siRNA comprises an antisense strand having a sequence in accordance with any of SEQ ID NOs: 13650, 13655, 13656, 13412, 13580, 13581, 13582, 13583, 13584, 13585, 13586, 13587, 13657, 13632, 13633, 13662, 13420, 13486, 13487, 13488, 13489, 13490, 13491, 13492, 13493, 13494, 13421, 13478, 13479, 13480, 13481, 13482, 13483, 13484, 13485, 13665, 13424, 13537, 13538, 13539, 13540, 13541, 13542, 13543, 13544, 13545, 13628, 13629, 13630, 13631, 13666, 13667, 13427, 13588, 13589, 13590, 13591, 13592, 13593, 13594, or 13595. In some embodiments, the antisense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 13650, 13655, 13656, 13412, 13580, 13581, 13582, 13583, 13584, 13585, 13586, 13587, 13657, 13632, 13633, 13662, 13420, 13486, 13487, 13488, 13489, 13490, 13491, 13492, 13493, 13494, 13421, 13478, 13479, 13480, 13481, 13482, 13483, 13484, 13485, 13665, 13424, 13537, 13538, 13539, 13540, 13541, 13542, 13543, 13544, 13545, 13628, 13629, 13630, 13631, 13666, 13667, 13427, 13588, 13589, 13590, 13591, 13592, 13593, 13594, or 13595, at least 80% identical to any one of SEQ ID NOs: 13650, 13655, 13656, 13412, 13580, 13581, 13582, 13583, 13584, 13585, 13586, 13587, 13657, 13632, 13633, 13662, 13420, 13486, 13487, 13488, 13489, 13490, 13491, 13492, 13493, 13494, 13421, 13478, 13479, 13480, 13481, 13482, 13483, 13484, 13485, 13665, 13424, 13537, 13538, 13539, 13540, 13541, 13542, 13543, 13544, 13545, 13628, 13629, 13630, 13631, 13666, 13667, 13427, 13588, 13589, 13590, 13591, 13592, 13593, 13594, or 13595, at least 85% identical to of any one of SEQ ID NOs: 13650, 13655, 13656, 13412, 13580, 13581, 13582, 13583, 13584, 13585, 13586, 13587, 13657, 13632, 13633, 13662, 13420, 13486, 13487, 13488, 13489, 13490, 13491, 13492, 13493, 13494, 13421, 13478, 13479, 13480, 13481, 13482, 13483, 13484, 13485, 13665, 13424, 13537, 13538, 13539, 13540, 13541, 13542, 13543, 13544, 13545, 13628, 13629, 13630, 13631, 13666, 13667, 13427, 13588, 13589, 13590, 13591, 13592, 13593, 13594, or 13595, at least 90% identical to any one of SEQ ID NOs: 13650, 13655, 13656, 13412, 13580, 13581, 13582, 13583, 13584, 13585, 13586, 13587, 13657, 13632, 13633, 13662, 13420, 13486, 13487, 13488, 13489, 13490, 13491, 13492, 13493, 13494, 13421, 13478, 13479, 13480, 13481, 13482, 13483, 13484, 13485, 13665, 13424, 13537, 13538, 13539, 13540, 13541, 13542, 13543, 13544, 13545, 13628, 13629, 13630, 13631, 13666, 13667, 13427, 13588, 13589, 13590, 13591, 13592, 13593, 13594, or 13595, or at least 95% identical to any one of SEQ ID NOs: 13650, 13655, 13656, 13412, 13580, 13581, 13582, 13583, 13584, 13585, 13586, 13587, 13657, 13632, 13633, 13662, 13420, 13486, 13487, -29-
Attorney Docket No.54462-742.601 13488, 13489, 13490, 13491, 13492, 13493, 13494, 13421, 13478, 13479, 13480, 13481, 13482, 13483, 13484, 13485, 13665, 13424, 13537, 13538, 13539, 13540, 13541, 13542, 13543, 13544, 13545, 13628, 13629, 13630, 13631, 13666, 13667, 13427, 13588, 13589, 13590, 13591, 13592, 13593, 13594, or 13595. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13650, 13655, 13656, 13412, 13580, 13581, 13582, 13583, 13584, 13585, 13586, 13587, 13657, 13632, 13633, 13662, 13420, 13486, 13487, 13488, 13489, 13490, 13491, 13492, 13493, 13494, 13421, 13478, 13479, 13480, 13481, 13482, 13483, 13484, 13485, 13665, 13424, 13537, 13538, 13539, 13540, 13541, 13542, 13543, 13544, 13545, 13628, 13629, 13630, 13631, 13666, 13667, 13427, 13588, 13589, 13590, 13591, 13592, 13593, 13594, or 13595, or an antisense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13650, 13655, 13656, 13412, 13580, 13581, 13582, 13583, 13584, 13585, 13586, 13587, 13657, 13632, 13633, 13662, 13420, 13486, 13487, 13488, 13489, 13490, 13491, 13492, 13493, 13494, 13421, 13478, 13479, 13480, 13481, 13482, 13483, 13484, 13485, 13665, 13424, 13537, 13538, 13539, 13540, 13541, 13542, 13543, 13544, 13545, 13628, 13629, 13630, 13631, 13666, 13667, 13427, 13588, 13589, 13590, 13591, 13592, 13593, 13594, or 13595, or an antisense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 13650, 13655, 13656, 13412, 13580, 13581, 13582, 13583, 13584, 13585, 13586, 13587, 13657, 13632, 13633, 13662, 13420, 13486, 13487, 13488, 13489, 13490, 13491, 13492, 13493, 13494, 13421, 13478, 13479, 13480, 13481, 13482, 13483, 13484, 13485, 13665, 13424, 13537, 13538, 13539, 13540, 13541, 13542, 13543, 13544, 13545, 13628, 13629, 13630, 13631, 13666, 13667, 13427, 13588, 13589, 13590, 13591, 13592, 13593, 13594, or 13595. The antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The antisense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The antisense strand may comprise an overhang. The antisense strand may comprise a modification pattern described herein. The antisense strand may comprise a lipid moiety or a GalNAc moiety. [0069] In some embodiments, the siRNA comprises a sense strand having a sequence in accordance with any of SEQ ID NOs: 13329, 13334, 13335, 13260, 13264, 13336, 13311, 13341, 13168, 13173, 13161, 13344, 13224, 13345, 13346, 13267, 13268, 13353, 13358, 13359, 13276, 13280, 13360, 13317, 13365, 13185, 13190, 13178, 13368, 13241, 13369, 13370, 13283, 13284, 13377, 13382, 13383, 13292, 13296, 13384, 13323, 13389, 13202, 13207, 13195, 13392, 13258, 13393, 13394, 13299, or 13300. In some embodiments, the sense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 13329, 13334, 13335, 13260, 13264, 13336, 13311, 13341, 13168, 13173, 13161, 13344, 13224, 13345, 13346, 13267, 13268, 13353, 13358, 13359, 13276, 13280, 13360, 13317, 13365, 13185, 13190, 13178, 13368, 13241, 13369, 13370, 13283, 13284, 13377, 13382, 13383, 13292, 13296, 13384, 13323, 13389, 13202, 13207, 13195, 13392, 13258, 13393, 13394, 13299, or 13300, at least 80% identical to any one of SEQ ID NOs: 13329, 13334, 13335, 13260, 13264, 13336, 13311, -30-
Attorney Docket No.54462-742.601 13341, 13168, 13173, 13161, 13344, 13224, 13345, 13346, 13267, 13268, 13353, 13358, 13359, 13276, 13280, 13360, 13317, 13365, 13185, 13190, 13178, 13368, 13241, 13369, 13370, 13283, 13284, 13377, 13382, 13383, 13292, 13296, 13384, 13323, 13389, 13202, 13207, 13195, 13392, 13258, 13393, 13394, 13299, or 13300, at least 85% identical to of any one of SEQ ID NOs: 13329, 13334, 13335, 13260, 13264, 13336, 13311, 13341, 13168, 13173, 13161, 13344, 13224, 13345, 13346, 13267, 13268, 13353, 13358, 13359, 13276, 13280, 13360, 13317, 13365, 13185, 13190, 13178, 13368, 13241, 13369, 13370, 13283, 13284, 13377, 13382, 13383, 13292, 13296, 13384, 13323, 13389, 13202, 13207, 13195, 13392, 13258, 13393, 13394, 13299, or 13300, at least 90% identical to any one of SEQ ID NOs 13329, 13334, 13335, 13260, 13264, 13336, 13311, 13341, 13168, 13173, 13161, 13344, 13224, 13345, 13346, 13267, 13268, 13353, 13358, 13359, 13276, 13280, 13360, 13317, 13365, 13185, 13190, 13178, 13368, 13241, 13369, 13370, 13283, 13284, 13377, 13382, 13383, 13292, 13296, 13384, 13323, 13389, 13202, 13207, 13195, 13392, 13258, 13393, 13394, 13299, or 13300, or at least 95% identical to any one of SEQ ID NOs: 13329, 13334, 13335, 13260, 13264, 13336, 13311, 13341, 13168, 13173, 13161, 13344, 13224, 13345, 13346, 13267, 13268, 13353, 13358, 13359, 13276, 13280, 13360, 13317, 13365, 13185, 13190, 13178, 13368, 13241, 13369, 13370, 13283, 13284, 13377, 13382, 13383, 13292, 13296, 13384, 13323, 13389, 13202, 13207, 13195, 13392, 13258, 13393, 13394, 13299, or 13300. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13329, 13334, 13335, 13260, 13264, 13336, 13311, 13341, 13168, 13173, 13161, 13344, 13224, 13345, 13346, 13267, 13268, 13353, 13358, 13359, 13276, 13280, 13360, 13317, 13365, 13185, 13190, 13178, 13368, 13241, 13369, 13370, 13283, 13284, 13377, 13382, 13383, 13292, 13296, 13384, 13323, 13389, 13202, 13207, 13195, 13392, 13258, 13393, 13394, 13299, or 13300, or a sense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13329, 13334, 13335, 13260, 13264, 13336, 13311, 13341, 13168, 13173, 13161, 13344, 13224, 13345, 13346, 13267, 13268, 13353, 13358, 13359, 13276, 13280, 13360, 13317, 13365, 13185, 13190, 13178, 13368, 13241, 13369, 13370, 13283, 13284, 13377, 13382, 13383, 13292, 13296, 13384, 13323, 13389, 13202, 13207, 13195, 13392, 13258, 13393, 13394, 13299, or 13300, or a sense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 13329, 13334, 13335, 13260, 13264, 13336, 13311, 13341, 13168, 13173, 13161, 13344, 13224, 13345, 13346, 13267, 13268, 13353, 13358, 13359, 13276, 13280, 13360, 13317, 13365, 13185, 13190, 13178, 13368, 13241, 13369, 13370, 13283, 13284, 13377, 13382, 13383, 13292, 13296, 13384, 13323, 13389, 13202, 13207, 13195, 13392, 13258, 13393, 13394, 13299, or 13300. The sense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand may comprise a modification pattern described herein. The sense strand may comprise an overhang. The sense strand may comprise a lipid moiety. The sense strand may comprise a GalNAc moiety. -31-
Attorney Docket No.54462-742.601 [0070] In some embodiments, the siRNA comprises an antisense strand having a sequence in accordance with any of SEQ ID NOs: 13650, 13655, 13656, 13581, 13585, 13657, 13632, 13662, 13489, 13494, 13482, 13665, 13545, 13666, 13667, 13588, 13589, 13674, 13679, 13680, 13597, 13601, 13681, 13638, 13686, 13506, 13511, 13499, 13689, 13562, 13690, 13691, 13604, 13605, 13698, 13703, 13704, 13613, 13617, 13705, 13644, 13710, 13523, 13528, 13516, 13713, 13579, 13714, 13715, 13620, or 13621. In some embodiments, the antisense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 13650, 13655, 13656, 13581, 13585, 13657, 13632, 13662, 13489, 13494, 13482, 13665, 13545, 13666, 13667, 13588, 13589, 13674, 13679, 13680, 13597, 13601, 13681, 13638, 13686, 13506, 13511, 13499, 13689, 13562, 13690, 13691, 13604, 13605, 13698, 13703, 13704, 13613, 13617, 13705, 13644, 13710, 13523, 13528, 13516, 13713, 13579, 13714, 13715, 13620, or 13621, at least 80% identical to any one of SEQ ID NOs: 13650, 13655, 13656, 13581, 13585, 13657, 13632, 13662, 13489, 13494, 13482, 13665, 13545, 13666, 13667, 13588, 13589, 13674, 13679, 13680, 13597, 13601, 13681, 13638, 13686, 13506, 13511, 13499, 13689, 13562, 13690, 13691, 13604, 13605, 13698, 13703, 13704, 13613, 13617, 13705, 13644, 13710, 13523, 13528, 13516, 13713, 13579, 13714, 13715, 13620, or 13621, at least 85% identical to of any one of SEQ ID NOs: 13650, 13655, 13656, 13581, 13585, 13657, 13632, 13662, 13489, 13494, 13482, 13665, 13545, 13666, 13667, 13588, 13589, 13674, 13679, 13680, 13597, 13601, 13681, 13638, 13686, 13506, 13511, 13499, 13689, 13562, 13690, 13691, 13604, 13605, 13698, 13703, 13704, 13613, 13617, 13705, 13644, 13710, 13523, 13528, 13516, 13713, 13579, 13714, 13715, 13620, or 13621, at least 90% identical to any one of SEQ ID NOs: 13650, 13655, 13656, 13581, 13585, 13657, 13632, 13662, 13489, 13494, 13482, 13665, 13545, 13666, 13667, 13588, 13589, 13674, 13679, 13680, 13597, 13601, 13681, 13638, 13686, 13506, 13511, 13499, 13689, 13562, 13690, 13691, 13604, 13605, 13698, 13703, 13704, 13613, 13617, 13705, 13644, 13710, 13523, 13528, 13516, 13713, 13579, 13714, 13715, 13620, or 13621, or at least 95% identical to any one of SEQ ID NOs: 13650, 13655, 13656, 13581, 13585, 13657, 13632, 13662, 13489, 13494, 13482, 13665, 13545, 13666, 13667, 13588, 13589, 13674, 13679, 13680, 13597, 13601, 13681, 13638, 13686, 13506, 13511, 13499, 13689, 13562, 13690, 13691, 13604, 13605, 13698, 13703, 13704, 13613, 13617, 13705, 13644, 13710, 13523, 13528, 13516, 13713, 13579, 13714, 13715, 13620, or 13621. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13650, 13655, 13656, 13581, 13585, 13657, 13632, 13662, 13489, 13494, 13482, 13665, 13545, 13666, 13667, 13588, 13589, 13674, 13679, 13680, 13597, 13601, 13681, 13638, 13686, 13506, 13511, 13499, 13689, 13562, 13690, 13691, 13604, 13605, 13698, 13703, 13704, 13613, 13617, 13705, 13644, 13710, 13523, 13528, 13516, 13713, 13579, 13714, 13715, 13620, or 13621, or an antisense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13650, 13655, 13656, 13581, 13585, 13657, 13632, 13662, 13489, 13494, 13482, 13665, 13545, 13666, 13667, 13588, 13589, 13674, 13679, 13680, 13597, 13601, 13681, 13638, 13686, 13506, 13511, 13499, 13689, 13562, 13690, 13691, 13604, 13605, 13698, 13703, 13704, 13613, 13617, 13705, 13644, 13710, 13523, 13528, 13516, 13713, 13579, 13714, 13715, 13620, or 13621, or an antisense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence -32-
Attorney Docket No.54462-742.601 comprises or consists of a sequence 100% identical to SEQ ID NOs: 13650, 13655, 13656, 13581, 13585, 13657, 13632, 13662, 13489, 13494, 13482, 13665, 13545, 13666, 13667, 13588, 13589, 13674, 13679, 13680, 13597, 13601, 13681, 13638, 13686, 13506, 13511, 13499, 13689, 13562, 13690, 13691, 13604, 13605, 13698, 13703, 13704, 13613, 13617, 13705, 13644, 13710, 13523, 13528, 13516, 13713, 13579, 13714, 13715, 13620, or 13621. The antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The antisense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The antisense strand may comprise an overhang. The antisense strand may comprise a modification pattern described herein. The antisense strand may comprise a lipid moiety or a GalNAc moiety. B. ASOs [0071] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an antisense oligonucleotide (ASO). In some embodiments, the ASO is 12-30 nucleosides in length. In some embodiments, the ASO is 14-30 nucleosides in length. In some embodiments, the ASO is at least about 10, 11, 12, 13, 14, 15, 16, 17, 18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleosides in length, or a range defined by any of the two aforementioned numbers. In some embodiments, the ASO is 15-25 nucleosides in length. In some embodiments, the ASO is 20 nucleosides in length. [0072] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an ASO about 12-30 nucleosides in length and comprising a nucleoside sequence complementary to about 12-30 contiguous nucleosides of a full- length human GPAM mRNA sequence such as SEQ ID NO: 12867; wherein (i) the oligonucleotide comprises a modification comprising a modified nucleoside and/or a modified internucleoside linkage, and/or (ii) the composition comprises a pharmaceutically acceptable carrier. In some embodiments, the ASO comprise a nucleoside sequence complementary to at least about 10, 11, 12, 13, 14, 15, 16, 17, 18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more contiguous nucleosides of one of SEQ ID NO: 12867. C. Oligonucleotide modifications [0073] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises a modification comprising a modified nucleoside and/or a modified internucleoside linkage, and/or (ii) the composition comprises a pharmaceutically acceptable carrier. In some embodiments, the oligonucleotide comprises a modification comprising a modified nucleoside and/or a modified internucleoside linkage. In some embodiments, the oligonucleotide comprises a modified internucleoside linkage. In some embodiments, the modified internucleoside linkage comprises alkylphosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate, or carboxymethyl ester, or a combination thereof. In some embodiments, the modified internucleoside linkage comprises one or more phosphorothioate linkages. A phosphorothioate may include a nonbridging oxygen atom in a phosphate backbone of the oligonucleotide that is replaced by -33-
Attorney Docket No.54462-742.601 sulfur. Modified internucleoside linkages may be included in siRNAs or ASOs. Benefits of the modified internucleoside linkage may include decreased toxicity or improved pharmacokinetics. [0074] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises a modified internucleoside linkage, wherein the oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 modified internucleoside linkages, or a range of modified internucleoside linkages defined by any two of the aforementioned numbers. In some embodiments, the oligonucleotide comprises no more than 18 modified internucleoside linkages. In some embodiments, the oligonucleotide comprises no more than 20 modified internucleoside linkages. In some embodiments, the oligonucleotide comprises 2 or more modified internucleoside linkages, 3 or more modified internucleoside linkages, 4 or more modified internucleoside linkages, 5 or more modified internucleoside linkages, 6 or more modified internucleoside linkages, 7 or more modified internucleoside linkages, 8 or more modified internucleoside linkages, 9 or more modified internucleoside linkages, 10 or more modified internucleoside linkages, 11 or more modified internucleoside linkages, 12 or more modified internucleoside linkages, 13 or more modified internucleoside linkages, 14 or more modified internucleoside linkages, 15 or more modified internucleoside linkages, 16 or more modified internucleoside linkages, 17 or more modified internucleoside linkages, 18 or more modified internucleoside linkages, 19 or more modified internucleoside linkages, or 20 or more modified internucleoside linkages. [0075] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises the modified nucleoside. In some embodiments, the modified nucleoside comprises a locked nucleic acid (LNA), hexitol nucleic acid (HLA), cyclohexene nucleic acid (CeNA), 2'-O-(2-methoxyethyl), 2'-O-alkyl, 2'-O-allyl, 2'-fluoro, or 2'- deoxy, or a combination thereof. In some embodiments, the modified nucleoside comprises a LNA. In some embodiments, the modified nucleoside comprises a 2’,4’ constrained ethyl nucleic acid. In some embodiments, the modified nucleoside comprises HLA. In some embodiments, the modified nucleoside comprises CeNA. In some embodiments, the modified nucleoside comprises a 2'-methoxyethyl group. In some embodiments, the modified nucleoside comprises a 2'-O-(2-methoxyethyl) group. In some embodiments, the modified nucleoside comprises a 2'-O-alkyl group. In some embodiments, the modified nucleoside comprises a 2'-O-allyl group. In some embodiments, the modified nucleoside comprises a 2'- fluoro group. In some embodiments, the modified nucleoside comprises a 2'-deoxy group. In some embodiments, the modified nucleoside comprises a 2'-O-(2-methoxyethyl). In some embodiments, the modified nucleoside comprises a 2'-O-methyl nucleoside, 2'-deoxyfluoro nucleoside, 2'-O-N- methylacetamido (2'-O-NMA) nucleoside, a 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE) nucleoside, 2'-O-aminopropyl (2'-O-AP) nucleoside, or 2'-ara-F, or a combination thereof. In some embodiments, the modified nucleoside comprises a 2'-O-methyl nucleoside. In some embodiments, the modified nucleoside comprises a 2'-deoxyfluoro nucleoside. In some embodiments, the modified nucleoside comprises a 2'-O-NMA nucleoside. In some embodiments, the modified nucleoside comprises a 2'-O-DMAEOE nucleoside. In some embodiments, the modified nucleoside comprises a 2'-O- aminopropyl (2'-O-AP) nucleoside. In some embodiments, the modified nucleoside comprises 2'-ara-F. In -34-
Attorney Docket No.54462-742.601 some embodiments, the modified nucleoside comprises one or more 2’fluoro modified nucleosides. In some embodiments, the modified nucleoside comprises a 2' O-alkyl modified nucleoside. Benefits of the modified nucleoside may include decreased toxicity or improved pharmacokinetics. [0076] In some embodiments, the oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 modified nucleosides, or a range of nucleosides defined by any two of the aforementioned numbers. In some embodiments, the oligonucleotide comprises no more than 19 modified nucleosides. In some embodiments, the oligonucleotide comprises no more than 21 modified nucleosides. In some embodiments, the oligonucleotide comprises 2 or more modified nucleosides, 3 or more modified nucleosides, 4 or more modified nucleosides, 5 or more modified nucleosides, 6 or more modified nucleosides, 7 or more modified nucleosides, 8 or more modified nucleosides, 9 or more modified nucleosides, 10 or more modified nucleosides, 11 or more modified nucleosides, 12 or more modified nucleosides, 13 or more modified nucleosides, 14 or more modified nucleosides, 15 or more modified nucleosides, 16 or more modified nucleosides, 17 or more modified nucleosides, 18 or more modified nucleosides, 19 or more modified nucleosides, 20 or more modified nucleosides, or 21 or more modified nucleosides. [0077] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises a moiety attached at a 3’ or 5’ terminus of the oligonucleotide. Examples of moieties include a hydrophobic moiety or a sugar moiety, or a combination thereof. In some embodiments, the oligonucleotide is an siRNA having a sense strand, and the moiety is attached to a 5’ end of the sense strand. In some embodiments, the oligonucleotide is an siRNA having a sense strand, and the moiety is attached to a 3’ end of the sense strand. In some embodiments, the oligonucleotide is an siRNA having an antisense strand, and the moiety is attached to a 5’ end of the antisense strand. In some embodiments, the oligonucleotide is an siRNA having an antisense strand, and the moiety is attached to a 3’ end of the antisense strand. In some embodiments, the oligonucleotide is an ASO, and the moiety is attached to a 5’ end of the ASO. In some embodiments, the oligonucleotide is an ASO, and the moiety is attached to a 3’ end of the ASO. [0078] The oligonucleotide may include purines. Examples of purines include adenine (A) or guanine (G), or modified versions thereof. The oligonucleotide may include pyrimidines. Examples of pyrimidines include cytosine (C), thymine (T), or uracil (U), or modified versions thereof. [0079] In some embodiments, purines of the oligonucleotide comprise 2’ fluoro modified purines. In some embodiments, purines of the oligonucleotide comprise 2’-O-methyl modified purines. In some embodiments, purines of the oligonucleotide comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, all purines of the oligonucleotide comprise 2’ fluoro modified purines. In some embodiments, all purines of the oligonucleotide comprise 2’-O-methyl modified purines. In some embodiments, all purines of the oligonucleotide comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. 2’-O-methyl may include 2’ O-methyl. [0080] In some embodiments, pyrimidines of the oligonucleotide comprise 2’ fluoro modified pyrimidines. In some embodiments, pyrimidines of the oligonucleotide comprise 2’-O-methyl modified pyrimidines. In some embodiments, pyrimidines of the oligonucleotide comprise a mixture of 2’ fluoro -35-
Attorney Docket No.54462-742.601 and 2’-O-methyl modified pyrimidines. In some embodiments, all pyrimidines of the oligonucleotide comprise 2’ fluoro modified pyrimidines. In some embodiments, all pyrimidines of the oligonucleotide comprise 2’-O-methyl modified pyrimidines. In some embodiments, all pyrimidines of the oligonucleotide comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. [0081] In some embodiments, purines of the oligonucleotide comprise 2’ fluoro modified purines, and pyrimidines of the oligonucleotide comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. In some embodiments, purines of the oligonucleotide comprise 2’-O-methyl modified purines, and pyrimidines of the oligonucleotide comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. In some embodiments, purines of the oligonucleotide comprise 2’ fluoro modified purines, and pyrimidines of the oligonucleotide comprise 2’-O-methyl modified pyrimidines. In some embodiments, purines of the oligonucleotide comprise 2’-O-methyl modified purines, and pyrimidines of the oligonucleotide comprise 2’ fluoro modified pyrimidines. In some embodiments, pyrimidines of the oligonucleotide comprise 2’ fluoro modified pyrimidines, and purines of the oligonucleotide comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, pyrimidines of the oligonucleotide comprise 2’-O-methyl modified pyrimidines, and purines of the oligonucleotide comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, pyrimidines of the oligonucleotide comprise 2’ fluoro modified pyrimidines, and purines of the oligonucleotide comprise 2’- O-methyl modified purines. In some embodiments, pyrimidines of the oligonucleotide comprise 2’-O- methyl modified pyrimidines, and purines of the oligonucleotide comprise 2’ fluoro modified purines. [0082] In some embodiments, all purines of the oligonucleotide comprise 2’ fluoro modified purines, and all pyrimidines of the oligonucleotide comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. In some embodiments, all purines of the oligonucleotide comprise 2’-O-methyl modified purines, and all pyrimidines of the oligonucleotide comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. In some embodiments, all purines of the oligonucleotide comprise 2’ fluoro modified purines, and all pyrimidines of the oligonucleotide comprise 2’-O-methyl modified pyrimidines. In some embodiments, all purines of the oligonucleotide comprise 2’-O-methyl modified purines, and all pyrimidines of the oligonucleotide comprise 2’ fluoro modified pyrimidines. In some embodiments, all pyrimidines of the oligonucleotide comprise 2’ fluoro modified pyrimidines, and all purines of the oligonucleotide comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, all pyrimidines of the oligonucleotide comprise 2’-O-methyl modified pyrimidines, and all purines of the oligonucleotide comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, all pyrimidines of the oligonucleotide comprise 2’ fluoro modified pyrimidines, and all purines of the oligonucleotide comprise 2’-O-methyl modified purines. In some embodiments, all pyrimidines of the oligonucleotide comprise 2’-O-methyl modified pyrimidines, and all purines of the oligonucleotide comprise 2’ fluoro modified purines. [0083] In some cases, the oligonucleotide comprises a particular modification pattern. In some embodiments, position 9 counting from the 5’ end of the of a strand of the oligonucleotide may have a 2’F modification. In some embodiments, when position 9 of a strand of the oligonucleotide is a pyrimidine, then all purines in a strand of the oligonucleotide have a 2’OMe modification. In some embodiments, -36-
Attorney Docket No.54462-742.601 when position 9 is the only pyrimidine between positions 5 and 11 of the sense stand, then position 9 is the only position with a 2’F modification in a strand of the oligonucleotide. In some embodiments, when position 9 and only one other base between positions 5 and 11 of a strand of the oligonucleotide are pyrimidines, then both of these pyrimidines are the only two positions with a 2’F modification in a strand of the oligonucleotide. In some embodiments, when position 9 and only two other bases between positions 5 and 11 of a strand of the oligonucleotide are pyrimidines, and those two other pyrimidines are in adjacent positions so that there would be not three 2’F modifications in a row, then any combination of 2’F modifications can be made that give three 2’F modifications in total. In some embodiments, when there are more than 2 pyrimidines between positions 5 and 11 of a strand of the oligonucleotide, then all combinations of pyrimidines having the 2’F modification are allowed that have three to five 2’F modifications in total, provided that a strand of the oligonucleotide does not have three 2’F modifications in a row. In some cases, a strand of the oligonucleotide of any of the siRNAs comprises a modification pattern which conforms to any or all of these a strand of the oligonucleotide rules. [0084] In some embodiments, when position 9 of a strand of the oligonucleotide is a purine, then all purines in a strand of the oligonucleotide have a 2’OMe modification. In some embodiments, when position 9 is the only purine between positions 5 and 11 of the sense stand, then position 9 is the only position with a 2’F modification in a strand of the oligonucleotide. In some embodiments, when position 9 and only one other base between positions 5 and 11 of a strand of the oligonucleotide are purines, then both of these purines are the only two positions with a 2’F modification in a strand of the oligonucleotide. In some embodiments, when position 9 and only two other bases between positions 5 and 11 of a strand of the oligonucleotide are purines, and those two other purines are in adjacent positions so that there would be not three 2’F modifications in a row, then any combination of 2’F modifications can be made that give three 2’F modifications in total. In some embodiments, when there are more than 2 purines between positions 5 and 11 of a strand of the oligonucleotide, then all combinations of purines having the 2’F modification are allowed that have three to five 2’F modifications in total, provided that a strand of the oligonucleotide does not have three 2’F modifications in a row. In some cases, a strand of the oligonucleotide of any of the siRNAs comprises a modification pattern which conforms to any or all of these a strand of the oligonucleotide rules. [0085] In some cases, position 9 of a strand of the oligonucleotide can be a 2’deoxy. In these cases, 2’F and 2’OMe modifications may occur at the other positions of a strand of the oligonucleotide. In some cases, a strand of the oligonucleotide of any of the siRNAs comprises a modification pattern which conforms to these a strand of the oligonucleotide rules. [0086] In some embodiments, position nine of the sense strand comprises a 2’ fluoro-modified pyrimidine. In some embodiments, all purines of the sense strand comprise 2’-O-methyl modified purines. In some embodiments, 1, 2, 3, 4, or 5 pyrimidines between positions 5 and 11 comprise a 2’flouro- modified pyrimidine, provided there are not three 2’ fluoro-modified pyrimidines in a row. In some embodiments, the odd-numbered positions of the antisense strand comprise 2’-O-methyl modified nucleotides. In some embodiments, the even-numbered positions of the antisense strand comprise 2’flouro-modified nucleotides and unmodified deoxyribonucleotide. In some embodiments, the even- -37-
Attorney Docket No.54462-742.601 numbered positions of the antisense strand comprise 2’flouro-modified nucleotides, 2’-O-methyl modified nucleotides and unmodified deoxyribonucleotide. In some embodiments, position nine of the sense strand comprises a 2’ fluoro-modified pyrimidine; all purines of the sense strand comprises 2’-O-methyl modified purines; 1, 2, 3, 4, or 5 pyrimidines between positions 5 and 11 comprise a 2’flouro-modified pyrimidine, provided there are not three 2’ fluoro-modified pyrimidines in a row; the odd-numbered positions of the antisense strand comprise 2’-O-methyl modified nucleotides; and the even-numbered positions of the antisense strand comprise 2’flouro-modified nucleotides and unmodified deoxyribonucleotides. [0087] In some embodiments, position nine of the sense strand comprises a 2’ fluoro-modified purine. In some embodiments, all pyrimidines of the sense strand comprise 2’-O-methyl modified purines. In some embodiments, 1, 2, 3, 4, or 5 purines between positions 5 and 11 comprise a 2’flouro-modified purine, provided there are not three 2’ fluoro-modified purine in a row. In some embodiments, the odd- numbered positions of the antisense strand comprise 2’-O-methyl modified nucleotides. In some embodiments, the even-numbered positions of the antisense strand comprise 2’flouro-modified nucleotides and unmodified deoxyribonucleotide. In some embodiments, the even-numbered positions of the antisense strand comprise 2’flouro-modified nucleotides, 2’-O-methyl modified nucleotides and unmodified deoxyribonucleotide. In some embodiments, position nine of the sense strand comprises a 2’ fluoro-modified purine; all pyrimidine of the sense strand comprises 2’-O-methyl modified pyrimidines; 1, 2, 3, 4, or 5 purines between positions 5 and 11 comprise a 2’flouro-modified purines, provided there are not three 2’ fluoro-modified purines in a row; the odd-numbered positions of the antisense strand comprise 2’-O-methyl modified nucleotides; and the even-numbered positions of the antisense strand comprise 2’flouro-modified nucleotides and unmodified deoxyribonucleotides. In some embodiments, there are not three 2’ fluoro-modified purines in a row. In some embodiments, there are not three 2’ fluoro-modified pyrimidines in a row. [0088] In some embodiments, position nine of the sense strand comprises an unmodified deoxyribonucleotide. In some embodiments, positions 5, 7, and 8 of the sense strand comprise 2’fluoro- modifed nucleotides. In some embodiments, all pyrimidines in positions 10 to 21 of the sense strand comprise 2’-O-methyl modified pyrimidines and all purines in positions 10 to 21 of the comprise 2’-O- methyl modified purines or 2’fluoro-modified purines. In some embodiments, the odd-numbered positions of the antisense strand comprise 2’-O-methyl modified nucleotides. In some embodiments, the even- numbered positions of the antisense strand comprise 2’flouro-modified nucleotides and unmodified deoxyribonucleotides. In some embodiments, the even-numbered positions of the antisense strand comprise 2’flouro-modified nucleotides, 2’-O-methyl modified nucleotides and unmodified deoxyribonucleotides. In some embodiments, position nine of the sense strand comprises an unmodified deoxyribonucleotide; positions 5, 7, and 8 of the sense strand comprise 2’fluoro-modifed nucleotides; all pyrimidines in positions 10 to 21 of the sense strand comprise 2’-O-methyl modified pyrimidines and all purines in positions 10 to 21 of the comprise 2’-O-methyl modified purines or 2’fluoro-modified purines; the odd-numbered positions of the antisense strand comprise 2’-O-methyl modified nucleotides; and the -38-
Attorney Docket No.54462-742.601 even-numbered positions of the antisense strand comprise 2’flouro-modified nucleotides and unmodified deoxyribonucleotides. [0089] In some embodiments, position nine of the sense strand comprises an unmodified deoxyribonucleotide. In some embodiments, positions 5, 7, and 8 of the sense strand comprise 2’fluoro- modifed nucleotides. In some embodiments, all purines in positions 10 to 21 of the sense strand comprise 2’-O-methyl modified purines and all pyrimidines in positions 10 to 21 of the comprise 2’-O-methyl modified pyrimidines or 2’fluoro-modified pyrimidines. In some embodiments, the odd-numbered positions of the antisense strand comprise 2’-O-methyl modified nucleotides. In some embodiments, the even-numbered positions of the antisense strand comprise 2’flouro-modified nucleotides and unmodified deoxyribonucleotides. In some embodiments, the even-numbered positions of the antisense strand comprise 2’flouro-modified nucleotides, 2’-O-methyl modified nucleotides and unmodified deoxyribonucleotides. In some embodiments, position nine of the sense strand comprises an unmodified deoxyribonucleotide; positions 5, 7, and 8 of the sense strand comprise 2’fluoro-modifed nucleotides; all purines in positions 10 to 21 of the sense strand comprise 2’-O-methyl modified purines and all pyrimidines in positions 10 to 21 of the comprise 2’-O-methyl modified pyrimidines or 2’fluoro-modified pyrimidines; the odd-numbered positions of the antisense strand comprise 2’-O-methyl modified nucleotides; and the even-numbered positions of the antisense strand comprise 2’flouro-modified nucleotides and unmodified deoxyribonucleotide. [0090] In some embodiments, the moiety includes a negatively charged group attached at a 5’ end of the oligonucleotide. This may be referred to as a 5’-end group. In some embodiments, the negatively charged group is attached at a 5’ end of an antisense strand of an siRNA disclosed herein. The 5’-end group may be or include a 5’-end phosphorothioate, 5’-end phosphorodithioate, 5’-end vinylphosphonate (5’-VP), 5’-end methylphosphonate, 5’-end cyclopropyl phosphonate, or a 5’-deoxy-5’-C-malonyl. The 5’-end group may comprise 5’-VP. In some embodiments, the 5’-VP comprises a trans-vinylphosphate or cis-vinylphosphate. The 5’-end group may include an extra 5’ phosphate. A combination of 5’-end groups may be used. [0091] In some embodiments, the oligonucleotide includes a negatively charged group. The negatively charged group may aid in cell or tissue penetration. The negatively charged group may be attached at a 5’ or 3’ end (e.g. a 5’ end) of the oligonucleotide. This may be referred to as an end group. The end group may be or include a phosphorothioate, phosphorodithioate, vinylphosphonate, methylphosphonate, cyclopropyl phosphonate, or a deoxy-C-malonyl. The end group may include an extra 5’ phosphate such as an extra 5’ phosphate. A combination of end groups may be used. [0092] In some embodiments, the oligonucleotide includes a phosphate mimic. In some embodiments, the phosphate mimic comprises vinyl phosphonate. In some embodiments, the vinyl phosphonate comprises a trans-vinylphosphate. In some embodiments, the vinyl phosphonate comprises a cis-vinylphosphate. An example of a nucleotide that includes a vinyl phosphonate is shown below. -39-
Attorney Docket No.54462-742.601 5’ v
Methyl Uridine [0093] In some embodiments, the vinyl phosphonate increases the stability of the oligonucleotide. In some embodiments, the vinyl phosphonate increases the accumulation of the oligonucleotide in tissues. In some embodiments, the vinyl phosphonate protects the oligonucleotide from an exonuclease or a phosphatase. In some embodiments, the vinyl phosphonate improves the binding affinity of the oligonucleotide with the siRNA processing machinery. [0094] In some embodiments, the oligonucleotide includes 1 vinyl phosphonate. In some embodiments, the oligonucleotide includes 2 vinyl phosphonates. In some embodiments, the oligonucleotide includes 3 vinyl phosphonates. In some embodiments, the oligonucleotide includes 4 vinyl phosphonates. In some embodiments, the antisense strand of the oligonucleotide comprises a vinyl phosphonate at the 5’ end. In some embodiments, the antisense strand of the oligonucleotide comprises a vinyl phosphonate at the 3’ end. In some embodiments, the sense strand of the oligonucleotide comprises a vinyl phosphonate at the 5’ end. In some embodiments, the sense strand of the oligonucleotide comprises a vinyl phosphonate at the 3’ end. 1. Hydrophobic moieties [0095] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises a hydrophobic moiety. The hydrophobic moiety may be attached at a 3’ or 5’ terminus of the oligonucleotide. The hydrophobic moiety may include a lipid such as a fatty acid. The hydrophobic moiety may include a hydrocarbon. The hydrocarbon may be linear. The hydrocarbon may be non-linear. The hydrophobic moiety may include a lipid moiety or a cholesterol moiety, or a combination thereof. [0096] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises a lipid attached at a 3’ or 5’ terminus of the oligonucleotide. In some embodiments, the lipid comprises cholesterol, myristoyl, palmitoyl, stearoyl, lithocholoyl, docosanoyl, docosahexaenoyl, myristyl, palmityl, stearyl, or α-tocopherol, or a combination thereof. [0097] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises a hydrophobic ligand or moiety. In some embodiments, the hydrophobic ligand or moiety comprises cholesterol. In some embodiments, the hydrophobic ligand or moiety comprises a cholesterol derivative. In some embodiments, the hydrophobic -40-
Attorney Docket No.54462-742.601 ligand or moiety is attached at a 3’ terminus of the oligonucleotide. In some embodiments, the hydrophobic ligand or moiety s attached at a 5’ terminus of the oligonucleotide. In some embodiments, the composition comprises a sense strand, and the hydrophobic ligand or moiety is attached to the sense strand (e.g. attached to a 5’ end of the sense strand, or attached to a 3’ end of the sense strand). In some embodiments, the composition comprises an antisense strand, and the hydrophobic ligand or moiety is attached to the antisense strand (e.g. attached to a 5’ end of the antisense strand, or attached to a 3’ end of the antisense strand). In some embodiments, the composition comprises a hydrophobic ligand or moiety attached at a 3’ or 5’ terminus of the oligonucleotide. [0098] In some embodiments, a hydrophobic moiety is attached to the oligonucleotide (e.g. a sense strand and/or an antisense strand of a siRNA). In some embodiments, a hydrophobic moiety is attached at a 3’ terminus of the oligonucleotide. In some embodiments, a hydrophobic moiety is attached at a 5’ terminus of the oligonucleotide. In some embodiments, the hydrophobic moiety comprises cholesterol. In some embodiments, the hydrophobic moiety includes a cyclohexanyl. [0099] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises a lipid attached at a 3’ or 5’ terminus of the oligonucleotide. In some embodiments, a lipid is attached at a 3’ terminus of the oligonucleotide. In some embodiments, a lipid is attached at a 5’ terminus of the oligonucleotide. In some embodiments, the lipid comprises cholesterol, myristoyl, palmitoyl, stearoyl, lithocholoyl, docosanoyl, docosahexaenoyl, myristyl, palmityl, stearyl, or α-tocopherol, or a combination thereof. In some embodiments, the lipid comprises stearyl, lithocholyl, docosanyl, docosahexaenyl, or myristyl. In some embodiments, the lipid comprises cholesterol. In some embodiments, the lipid includes a sterol such as cholesterol. In some embodiments, the lipid comprises stearyl, t-butylphenol, n-butylphenol, octylphenol, dodecylphenol, phenyl n-dodecyl, octadecylbenzamide, hexadecylbenzamide, or octadecylcyclohexyl. In some embodiments, the lipid comprises phenyl para C12. [00100] In some embodiments the oligonucleotide comprises any aspect of the following structure:
de comprises any aspect
of the following structure: . In some embodiments, the oligonucleotide comprises any aspect of the following structure: -41-
Attorney Docket No.54462-742.601 n some embodiments, the oligo
The aspect included in the oligonucleotide may include the entire structure, or may include the lipid moiety, of any of the structures shown. In some embodiments, n is 1-3. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, R is an alkyl group. In some embodiments, the alkyl group contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 carbons. In some embodiments, the alkyl group contains 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 carbons, or a range defined by any two of the aforementioned numbers of carbons. In some embodiments, the alkyl group contains 4-18 carbons. In some embodiments, the lipid moiety comprises an alcohol or ether. [00101] In some embodiments, the lipid includes a fatty acid. In some embodiments, the lipid comprises a lipid depicted in Table 1. The example lipid moieties in Table 1 are shown attached at a 5’ end of an oligonucleotide, in which the 5’ terminal phosphate of the oligonucleotide is shown with the lipid moiety. In some embodiments, a lipid moiety in Table 1 may be attached at a different point of attachment than shown. For example, the point of attachment of any of the lipid moieties in the table may be at a 3’ oligonucleotide end. In some embodiments, the lipid is used for targeting the oligonucleotide to a non-hepatic cell or tissue. Table 1: Hydrophobic moiety examples Moi t
-42-
Attorney Docket No.54462-742.601 n d ph octa hex
-43-
Attorney Docket No.54462-742.601 octa phe
[00102] In some embodiments, the lipid or lipid moiety includes 16 to 18 carbons. In some embodiments, the lipid includes 16 carbons. In some embodiments, the lipid includes 17 carbons. In some embodiments, the lipid includes 18 carbons. In some embodiments, the lipid moiety includes 16 carbons. In some embodiments, the lipid moiety includes 17 carbons. In some embodiments, the lipid moiety includes 18 carbons. [00103] The hydrophobic moiety may include a linker that comprises a carbocycle. The carbocycle may be six-membered. Some examples of a carbocycle include phenyl or cyclohexyl. The linker may include a phenyl. The linker may include a cyclohexyl. The lipid may be attached to the carbocycle, which may in turn be attached at a phosphate (e.g.5’ or 3’ phosphate) of the oligonucleotide. In some embodiments, the lipid or hydrocarbon, and the end of the sense are connected to the phenyl or cyclohexyl linker in the 1,4; 1,3; or 1,2 substitution pattern (e.g. the para, meta, or ortho phenyl configuration). In some embodiments, the lipid or hydrocarbon, and the end of the sense are connected to the phenyl or cyclohexyl linker in the 1,4 substitution pattern (e.g. the para phenyl configuration). The lipid may be attached to the carbocycle in the 1,4 substitution pattern relative to the oligonucleotide. The lipid may be attached to the carbocycle in the 1,3 substitution pattern relative to the oligonucleotide. The lipid may be attached to the carbocycle in the 1,2 substitution pattern relative to the oligonucleotide. The lipid may be attached to the carbocycle in the ortho orientation relative to the oligonucleotide. The lipid may be -44-
Attorney Docket No.54462-742.601 attached to the carbocycle in the para orientation relative to the oligonucleotide. The lipid may be attached to the carbocycle in the meta orientation relative to the oligonucleotide. [00104] The lipid moiety may comprise or consist of the following structure . In some embodiments, the lipid moiety comprises or
consists of the following structure: . In some embodiments,
the lipid moiety comprises the following structure:
. In some embodiments, the lipid moiety comprises or consist of the following structure:
. In some embodiments, the dotted line indicates a covalent connection. The covalent connection may between an end of the sense or antisense strand. For example, the connection may be to the 5’ end of the sense strand. In some embodiments, n is 0-3. In some embodiments, n is 1-3. In some embodiments, n is 0. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, n is 5. In some embodiments, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, R is an alkyl group. In some embodiments, the alkyl group contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 carbons. In some embodiments, the alkyl group contains 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 carbons, or a range defined by any two of the aforementioned numbers of carbons. In some embodiments, R comprises or consists of an alkyl group containing 4-18 carbons. [00105] The lipid moiety may be attached at a 5’ end of the oligonucleotide. The 5’ end may have one phosphate linking the lipid moiety to a 5’ carbon of a sugar of the oligonucleotide. The 5’ end may have two phosphates linking the lipid moiety to a 5’ carbon of a sugar of the oligonucleotide. The 5’ end may have three phosphates linking the lipid moiety to a 5’ carbon of a sugar of the oligonucleotide. The 5’ end may have one phosphate connected to the 5’ carbon of a sugar of the oligonucleotide, where the one phosphate is connected to the lipid moiety. The 5’ end may have two phosphates connected to the 5’ carbon of a sugar of the oligonucleotide, where the one of the two phosphates is connected to the lipid -45-
Attorney Docket No.54462-742.601 moiety. The 5’ end may have three phosphates connected to the 5’ carbon of a sugar of the oligonucleotide, where the one of the three phosphates is connected to the lipid moiety. The sugar may include a ribose. The sugar may include a deoxyribose. The sugar may be modified a such as a 2’ modified sugar (e.g. a 2’ O-methyl or 2’ fluoro ribose). A phosphate of the 5’ end may include a modification such as a sulfur in place of an oxygen. Two phosphates of the 5’ end may include a modification such as a sulfur in place of an oxygen. Three phosphates of the 5’ end may include a modification such as a sulfur in place of an oxygen. [00106] In some embodiments, the oligonucleotide includes 1 lipid moiety. In some embodiments, the oligonucleotide includes 2 lipid moieties. In some embodiments, the oligonucleotide includes 3 lipid moieties. In some embodiments, the oligonucleotide includes 4 lipid moieties. [00107] Some embodiments relate to a method of making an oligonucleotide comprising a hydrophobic conjugate. A strategy for making hydrophobic conjugates may include use of a phosphoramidite reagent based upon a 6-membered ring alcohol such as a phenol or cyclohexanol. The phosphoramidite may be reacted to a nucleotide to connect the nucleotide to the hydrophobic moiety, and thereby produce the hydrophobic conjugate. Some examples of phosphoramidite reagents that may be used to produce a hydrophobic conjugate are provided as follows: or
. In some embodiments, n is 1-3. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, R is an alkyl group. In some embodiments, the alkyl group contains 1, 2, 3, 4, 5, 6, 7, 8, 9, -46-
Attorney Docket No.54462-742.601 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 carbons. In some embodiments, the alkyl group contains 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 carbons, or a range defined by any two of the aforementioned numbers of carbons. In some embodiments, R comprises or consists of an alkyl group containing 4-18 carbons. Any one of the phosphoramidite reagents may be reacted to a 5’ end of an oligonucleotide to produce an oligonucleotide comprising a hydrophobic moiety. In some embodiments, the phosphoramidite reagents is reacted to a 5’ end of a sense strand of an siRNA. The sense strand may then be hybridized to an antisense strand to form a duplex. The hybridization may be performed by incubating the sense and antisense strands in solution at a given temperature. The temperature may be gradually reduced. The temperature may comprise or include a temperature comprising an annealing temperature for the sense and antisense strands. The temperature may be below or include a temperature below the annealing temperature for the sense and antisense strands. The temperature may be below a melting temperature of the sense and antisense strands. [00108] The lipid may be attached to the oligonucleotide by a linker. The linker may include a polyethyleneglycol (e.g. tetraethyleneglycol). [00109] The modifications described herein may be useful for delivery to a cell or tissue, for example, extrahepatic delivery or targeting of an oligonucleotide composition. The modifications described herein may be useful for targeting an oligonucleotide composition to a cell or tissue. 2. Sugar moieties [00110] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises a sugar moiety. The sugar moiety may include an N-acetyl galactose moiety (e.g. an N-acetylgalactosamine (GalNAc) moiety), an N-acetyl glucose moiety (e.g. an N-acetylglucosamine (GlcNAc) moiety), a fucose moiety, or a mannose moiety. The sugar moiety may include 1, 2, 3, or more sugar molecules. The sugar moiety may be attached at a 3’ or 5’ terminus of the oligonucleotide. The sugar moiety may include an N-acetyl galactose moiety. The sugar moiety may include an N-acetylgalactosamine (GalNAc) moiety. The sugar moiety may include an N-acetyl glucose moiety. The sugar moiety may include N-acetylglucosamine (GlcNAc) moiety. The sugar moiety may include a fucose moiety. The sugar moiety may include a mannose moiety. N-acetyl glucose, GlcNAc, fucose, or mannose may be useful for targeting macrophages when they target or bind a mannose receptor such as CD206. The sugar moiety may be useful for binding or targeting an asialoglycoprotein receptor such as an asialoglycoprotein receptor of a hepatocyte. The GalNAc moiety may bind to an asialoglycoprotein receptor. The GalNAc moiety may target a hepatocyte. [00111] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an N-acetylgalactosamine (GalNAc) moiety. GalNAc may be useful for hepatocyte targeting. The GalNAc moiety may include a bivalent or trivalent branched linker. The oligo may be attached to 1, 2 or 3 GalNAcs through a bivalent or trivalent branched linker. The GalNAc moiety may include 1, 2, 3, or more GalNAc molecules. The GalNAc moiety may be attached at a 3’ or 5’ terminus of the oligonucleotide. -47-
Attorney Docket No.54462-742.601 [00112] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an N-acetylgalactosamine (GalNAc) ligand for hepatocyte targeting. In some embodiments, the composition comprises GalNAc. In some embodiments, the composition comprises a GalNAc derivative. In some embodiments, the GalNAc ligand is attached at a 3’ terminus of the oligonucleotide. In some embodiments, the GalNAc ligand is attached at a 5’ terminus of the oligonucleotide. In some embodiments, the composition comprises a sense strand, and the GalNAc ligand is attached to the sense strand (e.g. attached to a 5’ end of the sense strand, or attached to a 3’ end of the sense strand). In some embodiments, the composition comprises an antisense strand, and the GalNAc ligand is attached to the antisense strand (e.g. attached to a 5’ end of the antisense strand, or attached to a 3’ end of the antisense strand). In some embodiments, the composition comprises a GalNAc ligand attached at a 3’ or 5’ terminus of the oligonucleotide. [00113] Disclosed herein, in some embodiments, are compositions comprising an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises a GalNAc moiety. The GalNAc moiety may be included in any formula, structure, or GalNAc moiety shown below. In some embodiments, described herein is a compound (e.g. oligonucleotide) represented by Formula (I) or (II):
(II); or a salt thereof, wherein J is an oligonucleotide; each w is independently selected from any value from 1 to 20; each v is independently selected from any value from 1 to 20; n is selected from any value from 1 to 20; m is selected from any value from 1 to 20; z is selected from any value from 1 to 3, wherein if z is 3, Y is C if z is 2, Y is CR6, or if z is 1, Y is C(R6)2; Q is selected from: C3-10 carbocycle optionally substituted with one or more substituents independently selected from halogen, -CN, -NO2, -OR7, -SR7, -N(R7)2, -C(O)R7, -C(O)N(R7)2, -N(R7)C(O)R7 , - N(R7)C(O)N(R7)2, -OC(O)N(R7)2, -N(R7)C(O)OR7, -C(O)OR7, -OC(O)R7, -S(O)R7, and C1-6 -48-
Attorney Docket No.54462-742.601 alkyl, wherein the C1-6 alkyl, is optionally substituted with one or more substituents independently selected from halogen, -CN, -OH, -SH, -NO2, and -NH2; R1 is a linker selected from: -O-, -S-, -N(R7)-, -C(O)-, -C(O)N(R7)-, -N(R7)C(O)-, -N(R7)C(O)N(R7)-, -OC(O)N(R7)-, - N(R7)C(O)O-, -C(O)O-, -OC(O)-, -S(O)-, -S(O)2-, -OS(O)2-, -OP(O)(OR7)O-, -SP(O)(OR7)O-, - OP(S)(OR7)O-, -OP(O)(SR7)O-, -OP(O)(OR7)S-, -OP(O)(O-)O-, -SP(O)(O-)O-, -OP(S)(O-)O-, - OP(O)(S-)O-, -OP(O)(O-)S-, -OP(O)(OR7)NR7-, -OP(O)(N(R7)2)NR7-, -OP(OR7)O-, - OP(N(R7)2)O-, -OP(OR7)N(R7)-, and -OPN(R7)2NR7-; each R2 is independently selected from: C1-6 alkyl optionally substituted with one or more substituents independently selected from halogen, -OR7, -SR7, -N(R7)2, -C(O)R7, -C(O)N(R7)2, -N(R7)C(O)R7, -N(R7)C(O)N(R7)2, - OC(O)N(R7)2, -N(R7)C(O)OR7, -C(O)OR7, -OC(O)R7, and -S(O)R7; R3 and R4 are each independently selected from: -OR7, -SR7, -N(R7)2, -C(O)R7, -C(O)N(R7)2, -N(R7)C(O)R7, -N(R7)C(O)N(R7)2, - OC(O)N(R7)2, -N(R7)C(O)OR7, -C(O)OR7, -OC(O)R7, and -S(O)R7; each R5 is independently selected from: -OC(O)R7, -OC(O)N(R7)2, -N(R7)C(O)R7, -N(R7)C(O)N(R7)2, - N(R7)C(O)OR7, -C(O)R7, -C(O)OR7, and -C(O)N(R7)2; each R6 is independently selected from: hydrogen; halogen, -CN, -NO2, -OR7, -SR7, -N(R7)2, -C(O)R7, -C(O)N(R7)2, -N(R7)C(O)R7, - N(R7)C(O)N(R7)2, -OC(O)N(R7)2, -N(R7)C(O)OR7, -C(O)OR7, -OC(O)R7, and -S(O)R7; and C1-6 alkyl optionally substituted with one or more substituents independently selected from halogen, -CN, -NO2, -OR7, -SR7, -N(R7)2, -C(O)R7, -C(O)N(R7)2, -N(R7)C(O)R7, - N(R7)C(O)N(R7)2, -OC(O)N(R7)2, -N(R7)C(O)OR7, -C(O)OR7, -OC(O)R7, and -S(O)R7; each R7 is independently selected from: hydrogen; C1-6 alkyl, C2-6 alkenyl, and C2-6 alkynyl, each of which is optionally substituted with one or more substituents independently selected from halogen, -CN, -OH, -SH, -NO2, -NH2, =O, =S, - O-C1-6 alkyl, -S-C1-6 alkyl, -N(C1-6 alkyl)2, -NH(C1-6 alkyl), C3-10 carbocycle, and 3- to 10- membered heterocycle; and C3-10 carbocycle, and 3- to 10-membered heterocycle, each of which is optionally substituted with one or more substituents independently selected from halogen, -CN, -OH, -SH, - NO2, -NH2, =O, =S, -O-C1-6 alkyl, -S-C1-6 alkyl, -N(C1-6 alkyl)2, -NH(C1-6 alkyl), C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 carbocycle, 3- to 10-membered heterocycle, and C1-6 haloalkyl. In some embodiments, each w is independently selected from any value from 1 to 10. In some embodiments, each w is independently selected from any value from 1 to 5. In some embodiments, each w is 1. In some embodiments, each v is independently selected from any value from 1 to 10. In some embodiments, each v is independently selected from any value from 1 to 5. In some embodiments, each v -49-
Attorney Docket No.54462-742.601 is 1. In some embodiments, n is selected from any value from 1 to 10. In some embodiments, n is selected from any value from 1 to 5. In some embodiments, n is 2. In some embodiments, m is selected from any value from 1 to 10. In some embodiments, m is selected from any value from 1 to 5. In some embodiments, m is selected from 1 and 2. In some embodiments, z is 3 and Y is C. In some embodiments, Q is selected from C5-6 carbocycle optionally substituted with one or more substituents independently selected from halogen, -CN, -NO2, -OR7, -SR7, -N(R7)2, -C(O)R7, -C(O)N(R7)2, -N(R7)C(O)R7, - N(R7)C(O)N(R7)2, -OC(O)N(R7)2, -N(R7)C(O)OR7, -C(O)OR7, -OC(O)R7, and -S(O)R7. In some embodiments, Q is selected from C5-6 carbocycle optionally substituted with one or more substituents independently selected from halogen, -CN, -OH, -SH, -NO2, and -NH2. In some embodiments, Q is selected from phenyl and cyclohexyl, each of which is optionally substituted with one or more substituents independently selected from halogen, -CN, -OH, -SH, -NO2, and -NH2. In some embodiments, Q is selected from phenyl. In some embodiments, Q is selected from cyclohexyl. In some embodiments, R1 is selected from -OP(O)(OR7)O-, -SP(O)(OR7)O-, -OP(S)(OR7)O-, -OP(O)(SR7)O-, - OP(O)(OR7)S-, -OP(O)(O-)O-, -SP(O)(O-)O-, -OP(S)(O-)O-, -OP(O)(S-)O-, -OP(O)(O-)S-, - OP(O)(OR7)NR7-, -OP(O)(N(R7)2)NR7-, -OP(OR7)O-, -OP(N(R7)2)O-, -OP(OR7)N(R7)-, and -OPN(R7)2- NR7. In some embodiments, R1 is selected from -OP(O)(OR7)O-, -SP(O)(OR7)O-, -OP(S)(OR7)O-, - OP(O)(SR7)O-, -OP(O)(OR7)S-, -OP(O)(O-)O-, -SP(O)(O-)O-, -OP(S)(O-)O-, -OP(O)(S-)O-, -OP(O)(O- )S-, and -OP(OR7)O-. In some embodiments, R1 is selected from -OP(O)(OR7)O-, -OP(S)(OR7)O-, - OP(O)(O-)O-, -OP(S)(O-)O-, -OP(O)(S-)O-, and -OP(OR7)O-. In some embodiments, R1 is selected from - OP(O)(OR7)O- and -OP(OR7)O-. In some embodiments, R2 is selected from C1-3 alkyl substituted with one or more substituents independently selected from halogen, -OR7, -OC(O)R7, -SR7, -N(R7)2, -C(O)R7, and -S(O)R7. In some embodiments, R2 is selected from C1-3 alkyl substituted with one or more substituents independently selected from -OR7, -OC(O)R7, -SR7, and -N(R7)2. In some embodiments, R2 is selected from C1-3 alkyl substituted with one or more substituents independently selected from -OR7 and - OC(O)R7. In some embodiments, R3 is selected from halogen, -OR7, -SR7, -N(R7)2, -C(O)R7, -OC(O)R7, and -S(O)R7. In some embodiments, R3 is selected from -OR7 -SR7, -OC(O)R7, and -N(R7)2. In some embodiments, R3 is selected from -OR7 - and -OC(O)R7. In some embodiments, R4 is selected from halogen, -OR7, -SR7, -N(R7)2, -C(O)R7, -OC(O)R7, and -S(O)R7 . In some embodiments, R4 is selected from -OR7 -SR7, -OC(O)R7, and -N(R7)2. In some embodiments, R4 is selected from -OR7 - and -OC(O)R7. In some embodiments, R5 is selected from -OC(O)R7, -OC(O)N(R7)2, -N(R7)C(O)R7 , -N(R7)C(O)N(R7)2, and -N(R7)C(O)OR7. In some embodiments, R5 is selected from -OC(O)R7 and -N(R7)C(O)R7. In some embodiments, each R7 is independently selected from: hydrogen; and C1-6 alkyl optionally substituted with one or more substituents independently selected from halogen, -CN, -OH, -SH, -NO2, -NH2, =O, =S, -O- C1-6 alkyl, -S-C1-6 alkyl, -N(C1-6 alkyl)2, -NH(C1-6 alkyl), C3-10 carbocycle, or 3- to 10-membered heterocycle. In some embodiments, each R7 is independently selected from C1-6 alkyl optionally substituted with one or more substituents independently selected from halogen, -CN, -OH, -SH, -NO2, - NH2, =O, =S, -O-C1-6 alkyl, -S-C1-6 alkyl, -N(C1-6 alkyl)2, and -NH(C1-6 alkyl). In some embodiments, each R7 is independently selected from C1-6 alkyl optionally substituted with one or more substituents independently selected from halogen, -CN, -OH, and -SH. In some embodiments, w is 1; v is 1; n is 2; m -50-
Attorney Docket No.54462-742.601 is 1 or 2; z is 3 and Y is C; Q is phenyl or cyclohexyl, each of which is optionally substituted with one or more substituents independently selected from halogen, -CN, -OH, -SH, -NO2, -NH2, and C1-3 alkyl; R1 is selected from -OP(O)(OR7)O-, -OP(S)(OR7)O-, -OP(O)(O-)O-, -OP(S)(O-)O-, -OP(O)(S-)O-, and - OP(OR7)O-; R2 is C1 alkyl substituted with -OH or -OC(O)CH3; R3 is -OH or -OC(O)CH3; R4 is -OH or -OC(O)CH3; and R5 is -NH(O)CH3. In some embodiments, the com ,
, -51-
Attorney Docket No.54462-742.601 ,
, , -52-
Attorney Docket No.54462-742.601 ,
, -53-
Attorney Docket No.54462-742.601 , ,
, -54-
Attorney Docket No.54462-742.601 , ,
, , -55-
Attorney Docket No.54462-742.601 ,
, -56-
Attorney Docket No.54462-742.601 r
. In some embodiments, the oligonucleotide (J) is attached at a 5’ end or a 3’ end of the oligonucleotide. In some embodiments, the oligonucleotide comprises DNA. In some embodiments, the oligonucleotide comprises RNA. In some embodiments, the oligonucleotide comprises one or more modified internucleoside linkages. In some embodiments, the one or more modified internucleoside linkages comprise alkylphosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate, or carboxymethyl ester, or a combination thereof. In some embodiments, the oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 modified internucleoside linkages. In some embodiments, the compound binds to an asialoglycoprotein receptor. In some embodiments, the compound targets a hepatocyte. [00114] Some embodiments include the following, where J is the oligonucleotide: -57-
Attorney Docket No.54462-742.601 [00115]
. J may include one or more additional phosphates, or one or more phosphorothioates linking to the oligonucleotide. J may include one or more additional phosphates linking to the oligonucleotide. J may include one or more phosphorothioates linking to the oligonucleotide. [00116] Some embodiments include the following, where J is the oligonucleotide:
[00117] . J may include one or more additional phosphates, or one or more phosphorothioates linking to the oligonucleotide. J may include one or more additional phosphates linking to the oligonucleotide. J may include one or more phosphorothioates linking to the oligonucleotide. [00118] Some embodiments include the following, where J is the oligonucleotide: -58-
Attorney Docket No.54462-742.601 may
include one or more phosphates or phosphorothioates linking to the oligonucleotide. J may include one or more phosphates linking to the oligonucleotide. J may include a phosphate linking to the oligonucleotide. J may include one or more phosphorothioates linking to the oligonucleotide. J may include a phosphorothioate linking to the oligonucleotide. [00119] Some embodiments include the following, where J is the oligonucleotide:
. The structure in this compound attached to the oligonucleotide (J) is an example of a GalNAc moiety. J may include one or more phosphates or phosphorothioates linking to the oligonucleotide. J may include one or more phosphates linking to the oligonucleotide. J may include a phosphate linking to the oligonucleotide. -59-
Attorney Docket No.54462-742.601 J may include one or more phosphorothioates linking to the oligonucleotide. J may include a phosphorothioate linking to the oligonucleotide. [00120] Some embodiments include the following, where J is the oligonucleotide: [001
. J may include one or more additional phosphates, or one or more phosphorothioates linking to the oligonucleotide. J may include one or more additional phosphates linking to the oligonucleotide. J may include one or more phosphorothioates linking to the oligonucleotide. [00122] Some embodiments include the following, where J is the oligonucleotide:
-60-
Attorney Docket No.54462-742.601 . J may include one or more additional phosphates, or one or more phosphorothioates linking to the oligonucleotide. J may include one or more additional phosphates linking to the oligonucleotide. J may include one or more phosphorothioates linking to the oligonucleotide. Some embodiments include the following, where J is the oligonucleotide:
. J may include one or more phosphates or phosphorothioates linking to the oligonucleotide. J may include one or more phosphates linking to the oligonucleotide. J may include a phosphate linking to the oligonucleotide. J may include one or more phosphorothioates linking to the oligonucleotide. J may include a phosphorothioate linking to the oligonucleotide. -61-
Attorney Docket No.54462-742.601 Some embodiments include the following, where J is the oligonucleotide:
. The structure in this compound attached to the oligonucleotide (J) may be referred to as “ETL17,” and is an example of a GalNAc moiety. J may include one or more phosphates or phosphorothioates linking to the oligonucleotide. J may include one or more phosphates linking to the oligonucleotide. J may include a phosphate linking to the oligonucleotide. J may include one or more phosphorothioates linking to the oligonucleotide. J may include a phosphorothioate linking to the oligonucleotide. [00123] Some embodiments include the following, where the phosphate or “5’” indicates a connection to the oligonucleotide:
[00124] -62-
Attorney Docket No.54462-742.601 [00125] Some embodiments include the following, where the phosphate or “5’” indicates a connection to the oligonucleotide: [001
[00127] Some embodiments include the following, where J is the oligonucleotide:
[00128] include one or more phosphates or phosphorothioates linking to the oligonucleotide. J may include one or more phosphates linking to the oligonucleotide. J may include a phosphate linking to the oligonucleotide. J may include one or more phosphorothioates linking to the oligonucleotide. J may include a phosphorothioate linking to the oligonucleotide. [00129] Some embodiments include the following, where J is the oligonucleotide: -63-
Attorney Docket No.54462-742.601 [001 . The
structure in this compound attached to the oligonucleotide (J) may be referred to as ETL1, and is an example of a GalNAc moiety. J may include one or more phosphates or phosphorothioates linking to the oligonucleotide. J may include one or more phosphates linking to the oligonucleotide. J may include a phosphate linking to the oligonucleotide. J may include one or more phosphorothioates linking to the oligonucleotide. J may include a phosphorothioate linking to the oligonucleotide 3. Modified siRNAs [00131] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, wherein the sense strand comprises modification pattern 1S: 5’-NfsnsNfnNfnNfNfNfnNfnNfnNfnNfnNfsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 2S: 5’-nsnsnnNfnNfNfNfnnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 3S: 5’-nsnsnnNfnNfnNfnnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 4S: 5’-NfsnsNfnNfnNfNfNfnNfnNfnNfnNfnNfsnsnN-moiety-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “s” is a phosphorothioate linkage, and N comprises one or more nucleosides. In some embodiments, the sense strand comprises modification pattern 5S: 5’-nsnsnnNfnNfNfNfnnnnnnnnnnsnsnN-moiety-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “s” is a phosphorothioate linkage, and N comprises one or more nucleosides. In some embodiments, the moiety in modification pattern 4S or 5S is a lipid moiety. In some embodiments, the moiety in modification pattern 4S or 5S is a sugar moiety. In some embodiments, the sense strand comprises modification pattern 6S: -64-
Attorney Docket No.54462-742.601 5’-NfsnsNfnNfnNfnNfnNfnNfnNfnNfnNfsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 7S: 5’-nsnsnnNfNfNfNfNfnnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 8S: 5’-nsnsnnnNfNfNfNfnnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 9S: 5’-nsnsnnnnNfNfNfNfnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 10S: 5’-snnnnNfNfnnNfnNfnnnnnnnnsnsn -3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 11S: 5’-snnnnnNfnnNfnNfnnnnnnnnsnsn -3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 12S: 5’-snnnnnNfNfNfdNnnnnnnnnnnsnsn -3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “dN” is a 2’ deoxy-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 13S: 5’-snnnnnNfnnNfNfnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 14S: 5’-snnnnNfnnNfNfnnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 15S: 5’-snnnnNfnnnNfnNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 16S: 5’-snnnnNfNfnNfNfnNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 17S: 5’-snnnnnnnNfNfnNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 18S: 5’-snnnnnNfNfnNfNfnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 19S: 5’-snnnnNfnnNfNfnNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 20S: 5’-snnnnnNfnNfNfnnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 21S: 5’-snnnnnNfNfNfNfnnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- -65-
Attorney Docket No.54462-742.601 methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 22S: 5’-nsnsnnnnNfnNfnNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 23S: 5’-nsnsnnnNfnnNfnNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 24S: 5’-nsnsnnnNfNfnNfnnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 25S: 5’-nsnsnnnNfNfnNfnNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 26S: 5’-nsnsnnNfnnnNfnNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 27S: 5’-nsnsnnNfnNfnNfnNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 28S: 5’-nsnsnnNfNfnnNfnnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 29S: 5’-nsnsnnnnnnNfNfnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 30S: 5’-nsnsnnnnnNfNfnnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 31S: 5’-nsnsnnnNfnnNfNfnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 32S: 5’-nsnsnnNfnnnNfNfnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 33S: 5’-nsnsnnNfNfnnNfNfnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 34S: 5’-nsnsnnnnnNfNfnNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 35S: 5’-nsnsnnnNfnNfNfnnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 36S: 5’-nsnsnnnNfnNfNfnNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 37S: -66-
Attorney Docket No.54462-742.601 5’-nsnsnnnNfNfNfNfnNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 38S: 5’-nsnsnnNfnnNfNfnnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 39S: 5’-nsnsnnNfnnNfNfnNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 40S: 5’-nsnsnnNfNfnnNfnNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 41S: 5’-nsnsnnNfNfnNfNfnnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 42S: 5’-nsnsnnnnNfnNfnnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 43S: 5’-nsnsnnnNfnnNfnnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 44S: 5’-nsnsnnnnnNfNfNfNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 45S: 5’-nsnsnnnnNfnNfNfnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 46S: 5’-nsnsnnnnNfNfNfNfNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 47S: 5’-nsnsnnnNfnNfNfNfNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 48S: 5’-nsnsnnnNfNfNfNfNfnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 49S: 5’-nsnsnnNfnnNfNfNfNfnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 50S: 5’-nsnsnnnNfNfnNfNfnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 51S: 5’-nsnsnnNfnNfnNfNfnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 52S: 5’-nsnsnnNfnNfNfNfNfnnnnnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate -67-
Attorney Docket No.54462-742.601 linkage. In some embodiments, the sense strand comprises modification pattern 53S:5'- snnnnnNfNfNfdNnnnnnnnnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, “Nm” is a 2’-O-(2-methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’-O-(2-methoxyethyl) thymine. In some embodiments, the sense strand comprises modification pattern 54S:5'-snnnnnNfNfNfNfnnnnnNmnnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “Nm” is a 2’-O-(2- methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’- O-(2-methoxyethyl) thymine. In some embodiments, the sense strand comprises modification pattern 55S: 5'-snnnnTmNfNfNfNfnnnNmnnnnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “Nm” is a 2’-O-(2-methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’-O-(2-methoxyethyl) thymine. In some embodiments, the sense strand comprises modification pattern 56S:5'-snnnnnnnNfNfNfNfnnnnnnnnsnsn- 3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 57S:5'- snnnnnnNfnNfNfnnnnnnnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 58S:5'-snnnnNfndNnNfnNfnnnnnnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 59S:5'- snnnNmnNfNfNfNfnnnNmnnnnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 60S:5'-snnnNmnNfNfNfNfnnNmnnnnnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 61S:5'- snnnNmnNfNfNfNfnnnNmnnnnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, “Nm” is a 2’-O-(2-methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’-O-(2-methoxyethyl) thymine. In some embodiments, the sense strand comprises modification pattern 62S:5'-snnnNmnNfNfNfNfnnnNmnnnnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “Nm” is a 2’-O-(2- methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’- O-(2-methoxyethyl) thymine. In some embodiments, the sense strand comprises modification pattern 63S:5'-snnnNmnNfNfNfNfnnnNmnnnnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “Nm” is a 2’-O-(2-methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’-O-(2-methoxyethyl) thymine. In some embodiments, the sense strand comprises modification pattern 64S:5'-snnnnNfnNfnNfnnnnnnnnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 65AS:5'-snnnNmnnNfNfNfNfnnNmnnnnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “Nm” is a 2’-O-(2-methoxyethyl) nucleoside, and “s” is a -68-
Attorney Docket No.54462-742.601 phosphorothioate linkage. In some embodiments, the Nm is a 2’-O-(2-methoxyethyl) thymine. In some embodiments, the sense strand comprises modification pattern 66AS:5'- snnnNmNfnNfNfNfNfnnNmnnnnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “Nm” is a 2’-O-(2-methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’-O-(2-methoxyethyl) thymine. In some embodiments, the sense strand comprises modification pattern 67AS:5'- snnnNmnNfNfNfNfnnNmnnnnnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O- methyl modified nucleoside, “Nm” is a 2’-O-(2-methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’-O-(2-methoxyethyl) thymine. In some embodiments, the sense strand comprises modification pattern 68AS:5'-snnnNmnNfNfNfNfnnnnNmnnnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “Nm” is a 2’-O-(2- methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’- O-(2-methoxyethyl) thymine. In some embodiments, the sense strand comprises modification pattern 69AS:5'-snnnNmNfnNfNfNfNfnNmnnnnnnnsnsn-3' wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “Nm” is a 2’-O-(2-methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’-O-(2-methoxyethyl) thymine. In some embodiments, the sense strand comprises modification pattern 70AS:5'- snnnNmNfnNfNfNfNfnnnNmnnnnnsnsn-3' wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, “Nm” is a 2’-O-(2-methoxyethyl) nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the Nm is a 2’-O-(2-methoxyethyl) thymine. [00132] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, wherein the antisense strand comprises modification pattern 1AS: 5’-nsNfsnNfnNfnNfnNfnnnNfnNfnNfnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the antisense strand comprises modification pattern 2AS: 5’-nsNfsnnnNfnNfNfnnnnNfnNfnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the antisense strand comprises modification pattern 3AS: 5’-nsNfsnnnNfnnnnnnnNfnNfnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the antisense strand comprises modification pattern 4AS: 5’-nsNfsnNfnNfnnnnnnnNfnNfnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the antisense strand comprises modification pattern 5AS: 5’-nsNfsnnnnnnnnnnnNfnNfnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the antisense strand comprises modification pattern 6AS: 5’-nsNfsnnnNfnnNfnnnnNfnNfnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the antisense strand comprises modification pattern 7AS: 5’-nsNfsnNfnNfnNfnNfnNfnNfnNfnNfnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, -69-
Attorney Docket No.54462-742.601 “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the antisense strand comprises modification pattern 8AS: 5’-nsNfsnnnnnnnnnnnNfnnnnnsnsn-3’, wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 9AS:5'- nsNfsnnnNfnNfnNfnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 10AS:5'-nsNfsnNfnNfnnNfnnnnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 11AS:5'-nsNfsnNfnNfnnNfnNfnnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 12AS:5'-nsNfsnNfnnNfnNfnNfnnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 13AS:5'-nsNfsnnNfnNfnNfnNfnnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 14AS:5'-nsNfsnNfnNfnNfnnnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 15AS:5'-nsNfsnnnNfnNfnnnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 16AS:5'-nsNfsnnnNfnNfnNfnnnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 17AS:5'-nsNfsnNfnnNfnnNfnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 18AS:5'-nsNfsnNfnnNfnnNfnnnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 19AS:5'-nsNfsnnNfnNfnnNfnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 20AS:5'-nsNfsnNfnnnNfnNfnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 21AS:5'-nsNfsnnnnNfnNfnnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 22AS:5'-nsNfsnNfnnNfnNfnnnnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern -70-
Attorney Docket No.54462-742.601 23AS:5'-nsNfsnnNfnNfnNfnnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 24AS:5'-nsNfsnnNfnNfnNfnnnnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 25AS:5'-nsNfsnNfnNfnNfnNfnNfnNfnNfnnnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 26AS:5'-nsNfsnNfnnNfnnnnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 27AS:5'-nsNfsnNfnnNfnNfnnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 28AS:5'-nsNfsnnNfnNfnnNfnnnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 29AS:5'-nsNfsnnnNfnnnNfnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 30AS:5'-nsNfsnnnNfNfnnNfnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 31AS:5'-nsNfsnnNfnNfNfnNfnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the sense strand comprises modification pattern 32AS:5'-nsNfsnnNfnNfNfnnnNfnNfnNfnNfnsnsn-3', wherein “Nf” is a 2’ fluoro-modified nucleoside, “n” is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. [00133] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, wherein the sense strand comprises pattern 1S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 2S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 3S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 4S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, -71-
Attorney Docket No.54462-742.601 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 5S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 6S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 7S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 8S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 9S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 10S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 11S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 12S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 13S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 14S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 15S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 16S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 17S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, -72-
Attorney Docket No.54462-742.601 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 18S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 19S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 20S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 21S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 22S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 23S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 24S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 25S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 26S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 27S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 28S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 29S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 30S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, -73-
Attorney Docket No.54462-742.601 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 31S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 32S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 33S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 34S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 35S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 36S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 37S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 38S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 39S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 40S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 41S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 42S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 43S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, -74-
Attorney Docket No.54462-742.601 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 44S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 45S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 46S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 47S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 48S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 49S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 50S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 51S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 52S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 53S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 54S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 55S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 56S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, -75-
Attorney Docket No.54462-742.601 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 57S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 58S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 59S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 60S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 61S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 62S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 63S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 64S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 65S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 66S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 67S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 68S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 69S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, -76-
Attorney Docket No.54462-742.601 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the sense strand comprises pattern 70S and the antisense strand comprises pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. [00134] In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 1AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70Sand the antisense strand comprises pattern 2AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 3AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 4AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 5AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 6AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 7AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the -77-
Attorney Docket No.54462-742.601 antisense strand comprises pattern 8AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 9AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 10AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 11AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 12AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 13AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 14AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 15AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 16AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, -78-
Attorney Docket No.54462-742.601 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 17AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 18AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 19AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 20AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 21AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 22AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 23AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 24AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 25AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, -79-
Attorney Docket No.54462-742.601 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 26AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 27AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 28AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 29AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 30AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 31AS. In some embodiments, the sense strand comprises pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S and the antisense strand comprises pattern 32AS. [00135] In some embodiments, the sense strand comprises modification pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S . In some embodiments, the sense strand comprises modification pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, or 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the antisense strand comprises modification pattern 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, or 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, -80-
Attorney Docket No.54462-742.601 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. In some embodiments, the antisense strand comprises modification pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, or 70S . In some embodiments, the sense strand or the antisense strand comprises modification pattern ASO1. [00136] In some embodiments, purines of the sense strand comprise 2’ fluoro modified purines. In some embodiments, purines of the sense strand comprise 2’-O-methyl modified purines. In some embodiments, purines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, all purines of the sense strand comprise 2’ fluoro modified purines. In some embodiments, all purines of the sense strand comprise 2’-O-methyl modified purines. In some embodiments, all purines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. [00137] In some embodiments, pyrimidines of the sense strand comprise 2’ fluoro modified pyrimidines. In some embodiments, pyrimidines of the sense strand comprise 2’-O-methyl modified pyrimidines. In some embodiments, pyrimidines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. In some embodiments, all pyrimidines of the sense strand comprise 2’ fluoro modified pyrimidines. In some embodiments, all pyrimidines of the sense strand comprise 2’-O- methyl modified pyrimidines. In some embodiments, all pyrimidines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. [00138] In some embodiments, purines of the sense strand comprise 2’ fluoro modified purines, and pyrimidines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. In some embodiments, purines of the sense strand comprise 2’-O-methyl modified purines, and pyrimidines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. In some embodiments, purines of the sense strand comprise 2’ fluoro modified purines, and pyrimidines of the sense strand comprise 2’-O-methyl modified pyrimidines. In some embodiments, purines of the sense strand comprise 2’-O-methyl modified purines, and pyrimidines of the sense strand comprise 2’ fluoro modified pyrimidines. In some embodiments, pyrimidines of the sense strand comprise 2’ fluoro modified pyrimidines, and purines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, pyrimidines of the sense strand comprise 2’-O-methyl modified pyrimidines, and purines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, pyrimidines of the sense strand comprise 2’ fluoro modified pyrimidines, and purines of the sense strand comprise 2’-O-methyl modified purines. In some embodiments, pyrimidines of the sense strand comprise 2’-O-methyl modified pyrimidines, and purines of the sense strand comprise 2’ fluoro modified purines. [00139] In some embodiments, all purines of the sense strand comprise 2’ fluoro modified purines, and all pyrimidines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. In some embodiments, all purines of the sense strand comprise 2’-O-methyl modified purines, and all pyrimidines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified -81-
Attorney Docket No.54462-742.601 pyrimidines. In some embodiments, all purines of the sense strand comprise 2’ fluoro modified purines, and all pyrimidines of the sense strand comprise 2’-O-methyl modified pyrimidines. In some embodiments, all purines of the sense strand comprise 2’-O-methyl modified purines, and all pyrimidines of the sense strand comprise 2’ fluoro modified pyrimidines. In some embodiments, all pyrimidines of the sense strand comprise 2’ fluoro modified pyrimidines, and all purines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, all pyrimidines of the sense strand comprise 2’-O-methyl modified pyrimidines, and all purines of the sense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, all pyrimidines of the sense strand comprise 2’ fluoro modified pyrimidines, and all purines of the sense strand comprise 2’-O- methyl modified purines. In some embodiments, all pyrimidines of the sense strand comprise 2’-O-methyl modified pyrimidines, and all purines of the sense strand comprise 2’ fluoro modified purines. [00140] In some embodiments, purines of the antisense strand comprise 2’ fluoro modified purines. In some embodiments, purines of the antisense strand comprise 2’-O-methyl modified purines. In some embodiments, purines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, all purines of the antisense strand comprise 2’ fluoro modified purines. In some embodiments, all purines of the antisense strand comprise 2’-O-methyl modified purines. In some embodiments, all purines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. [00141] In some embodiments, pyrimidines of the antisense strand comprise 2’ fluoro modified pyrimidines. In some embodiments, pyrimidines of the antisense strand comprise 2’-O-methyl modified pyrimidines. In some embodiments, pyrimidines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. In some embodiments, all pyrimidines of the antisense strand comprise 2’ fluoro modified pyrimidines. In some embodiments, all pyrimidines of the antisense strand comprise 2’-O-methyl modified pyrimidines. In some embodiments, all pyrimidines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. [00142] In some embodiments, purines of the antisense strand comprise 2’ fluoro modified purines, and pyrimidines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. In some embodiments, purines of the antisense strand comprise 2’-O-methyl modified purines, and pyrimidines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. In some embodiments, purines of the antisense strand comprise 2’ fluoro modified purines, and pyrimidines of the antisense strand comprise 2’-O-methyl modified pyrimidines. In some embodiments, purines of the antisense strand comprise 2’-O-methyl modified purines, and pyrimidines of the antisense strand comprise 2’ fluoro modified pyrimidines. In some embodiments, pyrimidines of the antisense strand comprise 2’ fluoro modified pyrimidines, and purines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, pyrimidines of the antisense strand comprise 2’-O-methyl modified pyrimidines, and purines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, pyrimidines of the antisense strand comprise 2’ fluoro modified pyrimidines, and purines of the antisense strand comprise 2’- -82-
Attorney Docket No.54462-742.601 O-methyl modified purines. In some embodiments, pyrimidines of the antisense strand comprise 2’-O- methyl modified pyrimidines, and purines of the antisense strand comprise 2’ fluoro modified purines. [00143] In some embodiments, all purines of the antisense strand comprise 2’ fluoro modified purines, and all pyrimidines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. In some embodiments, all purines of the antisense strand comprise 2’-O-methyl modified purines, and all pyrimidines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines. In some embodiments, all purines of the antisense strand comprise 2’ fluoro modified purines, and all pyrimidines of the antisense strand comprise 2’-O-methyl modified pyrimidines. In some embodiments, all purines of the antisense strand comprise 2’-O-methyl modified purines, and all pyrimidines of the antisense strand comprise 2’ fluoro modified pyrimidines. In some embodiments, all pyrimidines of the antisense strand comprise 2’ fluoro modified pyrimidines, and all purines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, all pyrimidines of the antisense strand comprise 2’-O-methyl modified pyrimidines, and all purines of the antisense strand comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines. In some embodiments, all pyrimidines of the antisense strand comprise 2’ fluoro modified pyrimidines, and all purines of the antisense strand comprise 2’-O-methyl modified purines. In some embodiments, all pyrimidines of the antisense strand comprise 2’-O-methyl modified pyrimidines, and all purines of the antisense strand comprise 2’ fluoro modified purines. [00144] Disclosed herein, in some embodiments, are modified oligonucleotides. The modified oligonucleotide may be an siRNA that includes modifications to the ribose rings, and phosphate linkages. The modifications may be in particular patterns that maximize cell delivery, stability, and efficiency. The siRNA may also include a vinyl phosphonate and a hydrophobic group. These modifications may aid in delivery to a cell or tissue within a subject. The modified oligonucleotide may be used in a method such as a treatment method or a method of reducing gene expression. [00145] In some embodiments, the oligonucleotide comprises a duplex consisting of 21 nucleotide single strands with base pairing between 19 of the base pairs. In some embodiments, the duplex comprises single-stranded 2 nucleotide overhangs are at the 3’ ends of each strand. One strand (antisense strand) is complementary to a GPAM mRNA. Each end of the antisense strand has one to two phosphorothioate bonds. The 5’ end has an optional phosphate mimic such as a vinyl phosphonate. In some embodiments, the oligonucleotide is used to knock down a GPAM mRNA or a target protein. In some embodiments, the sense strand has the same sequence as the GPAM mRNA. In some embodiments, there are 1-2 phosphorothioates at the 3’ end. In some embodiments, there are 1 or no phosphorothioates at the 5’ end. In some embodiments, there is a hydrophobic conjugate of 12 to 25 carbons attached at the 5’ end via a phosphodiester bond. [00146] In some cases, the sense strand of any of the siRNAs comprises siRNA with a particular modification pattern. In some embodiments of the modification pattern, position 9 counting from the 5’ end of the sense strand may have a 2’F modification. In some embodiments, when position 9 of the sense strand is a pyrimidine, then all purines in the sense strand have a 2’OMe modification. In some embodiments, when position 9 is the only pyrimidine between positions 5 and 11 of the sense stand, then -83-
Attorney Docket No.54462-742.601 position 9 is the only position with a 2’F modification in the sense strand. In some embodiments, when position 9 and only one other base between positions 5 and 11 of the sense strand are pyrimidines, then both of these pyrimidines are the only two positions with a 2’F modification in the sense strand. In some embodiments, when position 9 and only two other bases between positions 5 and 11 of the sense strand are pyrimidines, and those two other pyrimidines are in adjacent positions so that there would be not three 2’F modifications in a row, then any combination of 2’F modifications can be made that give three 2’F modifications in total. In some embodiments, when there are more than 2 pyrimidines between positions 5 and 11 of the sense strand, then all combinations of pyrimidines having the 2’F modification are allowed that have three to five 2’F modifications in total, provided that the sense strand does not have three 2’F modifications in a row. In some cases, the sense strand of any of the siRNAs comprises a modification pattern which conforms to any or all of these sense strand rules. [00147] In some embodiments, when position 9 of the sense strand is a purine, then all purines in the sense strand have a 2’OMe modification. In some embodiments, when position 9 is the only purine between positions 5 and 11 of the sense stand, then position 9 is the only position with a 2’F modification in the sense strand. In some embodiments, when position 9 and only one other base between positions 5 and 11 of the sense strand are purines, then both of these purines are the only two positions with a 2’F modification in the sense strand. In some embodiments, when position 9 and only two other bases between positions 5 and 11 of the sense strand are purines, and those two other purines are in adjacent positions so that there would be not three 2’F modifications in a row, then any combination of 2’F modifications can be made that give three 2’F modifications in total. In some embodiments, when there are more than 2 purines between positions 5 and 11 of the sense strand, then all combinations of purines having the 2’F modification are allowed that have three to five 2’F modifications in total, provided that the sense strand does not have three 2’F modifications in a row. In some cases, the sense strand of any of the siRNAs comprises a modification pattern which conforms to any or all of these sense strand rules. [00148] In some embodiments, the siRNA comprises a sense strand, an antisense strand, and a lipid moiety connected to an end of the sense or antisense strand; wherein the lipid moiety comprises a phenyl or cyclohexanyl linker, wherein the linker is connected to a lipid and to the end of the sense or antisense strand. In some embodiments, any one of the following is true with regard to the sense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise 2’-O-methyl modified pyrimidines; all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; or all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise 2’-O-methyl modified purines. In some embodiments, any one of the following is true with regard to the antisense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O- -84-
Attorney Docket No.54462-742.601 methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise 2’ fluoro modified pyrimidines; all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’- O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; or all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise 2’ fluoro modified purines. In some embodiments, the siRNA comprises comprising a sense strand and an antisense strand; wherein the antisense strand comprises a 5’ end comprising a vinyl phosphonate and 2 phosphorothioate linkages, and a 3’ end comprising 2 phosphorothioate linkages; wherein the sense strand comprises a 5’ end comprising a hydrophobic moiety, and a 3’ end comprising 2 phosphorothioate linkages; wherein any one of the following is true with regard to the sense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’- O-methyl modified pyrimidines, all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines, all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise 2’-O-methyl modified pyrimidines, all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines, all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines, or all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise 2’-O-methyl modified purines; and wherein any one of the following is true with regard to the antisense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines, all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O- methyl modified pyrimidines, all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise 2’ fluoro modified pyrimidines, all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines, all pyrimidines comprise 2’- O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines, or all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise 2’ fluoro modified purines. [00149] In some embodiments, any one of the following is true with regard to the sense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’- O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise 2’-O-methyl modified pyrimidines; all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; or all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise 2’-O-methyl modified purines; with the proviso that in any of the foregoing, the sense strand may include a deoxy nucleoside. In some embodiments, all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a deoxy nucleoside may be included in the sense strand. In some -85-
Attorney Docket No.54462-742.601 embodiments, in the sense strand, all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a deoxy nucleoside may be included in the sense strand. In some embodiments, in the sense strand, all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise 2’-O-methyl modified pyrimidines; with the proviso that a deoxy nucleoside may be included in the sense strand. In some embodiments, all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a deoxy nucleoside may be included in the sense strand. In some embodiments, in the sense strand, all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a deoxy nucleoside may be included in the sense strand. In some embodiments, in the sense strand, all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise 2’-O-methyl modified purines; with the proviso that a deoxy nucleoside may be included in the sense strand. In some embodiments, the sense strand includes the deoxy nucleoside. The deoxy nucleoside may be at nucleoside position 9 of the sense strand. In some embodiments, the sense strand does not include a deoxy nucleoside. The deoxy nucleoside of the sense strand may be otherwise unmodified. [00150] In some embodiments, any one of the following is true with regard to the antisense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’- O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise 2’ fluoro modified pyrimidines; all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; or all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise 2’ fluoro modified purines; with the proviso that in any of the foregoing, the sense strand may include a deoxy nucleoside. In some embodiments, all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a deoxy nucleoside may be included in the antisense strand. In some embodiments, in the antisense strand, all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a deoxy nucleoside may be included in the antisense strand. In some embodiments, in the antisense strand, all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise 2’ fluoro modified pyrimidines; with the proviso that a deoxy nucleoside may be included in the antisense strand. In some embodiments, in the antisense strand, all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a deoxy nucleoside may be included in the antisense strand. In some embodiments, in the antisense strand, all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a deoxy nucleoside may be included in the antisense strand. In some embodiments, in the antisense strand, all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise 2’ fluoro modified purines; with the proviso that a deoxy -86-
Attorney Docket No.54462-742.601 nucleoside may be included in the antisense strand. In some embodiments, the antisense strand includes the deoxy nucleoside. The deoxy nucleoside may be at nucleoside position 9 of the antisense strand. In some embodiments, the antisense strand does not include a deoxy nucleoside. The deoxy nucleoside of the antisense strand may be otherwise unmodified. [00151] In some embodiments, any one of the following is true with regard to the sense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’- O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise 2’-O-methyl modified pyrimidines; all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; or all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise 2’-O-methyl modified purines; with the proviso that in any of the foregoing, the sense strand may include a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside. In some embodiments, all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the sense strand. In some embodiments, in the sense strand, all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a deoxy nucleoside or a 2’-O-(2- methoxyethyl) nucleoside may be included in the sense strand. In some embodiments, in the sense strand, all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise 2’-O-methyl modified pyrimidines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the sense strand. In some embodiments, all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the sense strand. In some embodiments, in the sense strand, all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the sense strand. In some embodiments, in the sense strand, all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise 2’-O-methyl modified purines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the sense strand. In some embodiments, the sense strand includes the deoxy nucleoside. The deoxy nucleoside may be at nucleoside position 9 of the sense strand. In some embodiments, the sense strand does not include a deoxy nucleoside. The deoxy nucleoside of the sense strand may be otherwise unmodified. In some embodiments, the sense strand includes the a 2’-O-(2-methoxyethyl) nucleoside. The 2’-O-(2- methoxyethyl) nucleoside may be at nucleoside position 4 of the sense strand. The 2’-O-(2-methoxyethyl) nucleoside may include a 2’-O-(2-methoxyethyl) thymine nucleoside. In some embodiments, the sense strand does not include the a 2’-O-(2-methoxyethyl) nucleoside. The 2’-O-(2-methoxyethyl) nucleoside of the sense strand may be otherwise unmodified. -87-
Attorney Docket No.54462-742.601 [00152] In some embodiments, any one of the following is true with regard to the antisense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’- O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise 2’ fluoro modified pyrimidines; all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; or all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise 2’ fluoro modified purines; with the proviso that in any of the foregoing, the sense strand may include a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside. In some embodiments, all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the antisense strand. In some embodiments, in the antisense strand, all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the antisense strand. In some embodiments, in the antisense strand, all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise 2’ fluoro modified pyrimidines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the antisense strand. In some embodiments, in the antisense strand, all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the antisense strand. In some embodiments, in the antisense strand, all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the antisense strand. In some embodiments, in the antisense strand, all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise 2’ fluoro modified purines; with the proviso that a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside may be included in the antisense strand. In some embodiments, the antisense strand includes the deoxy nucleoside. The deoxy nucleoside may be at nucleoside position 9 of the antisense strand. In some embodiments, the antisense strand does not include a deoxy nucleoside. The deoxy nucleoside of the antisense strand may be otherwise unmodified. In some embodiments, the antisense strand includes the a 2’-O-(2- methoxyethyl) nucleoside. The 2’-O-(2-methoxyethyl) nucleoside may be at nucleoside position 4 of the sense strand. The 2’-O-(2-methoxyethyl) nucleoside may include a 2’-O-(2-methoxyethyl) thymine nucleoside. In some embodiments, the antisense strand does not include the a 2’-O-(2-methoxyethyl) nucleoside. The 2’-O-(2-methoxyethyl) nucleoside of the antisense strand may be otherwise unmodified. [00153] In some embodiments, any one of the following is true with regard to the sense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’- O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’ fluoro -88-
Attorney Docket No.54462-742.601 modified purines, and all pyrimidines comprise 2’-O-methyl modified pyrimidines; all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; or all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise 2’-O-methyl modified purines; with the proviso that in any of the foregoing, the sense strand may include a 2’-O-(2-methoxyethyl) nucleoside. In some embodiments, all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’- O-methyl modified pyrimidines; with the proviso that a 2’-O-(2-methoxyethyl) nucleoside may be included in the sense strand. In some embodiments, in the sense strand, all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a 2’-O-(2-methoxyethyl) nucleoside may be included in the sense strand. In some embodiments, in the sense strand, all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise 2’-O-methyl modified pyrimidines; with the proviso that a 2’-O-(2-methoxyethyl) nucleoside may be included in the sense strand. In some embodiments, all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a 2’-O-(2-methoxyethyl) nucleoside may be included in the sense strand. In some embodiments, in the sense strand, all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a 2’-O- (2-methoxyethyl) nucleoside may be included in the sense strand. In some embodiments, in the sense strand, all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise 2’-O-methyl modified purines; with the proviso that a 2’-O-(2-methoxyethyl) nucleoside may be included in the sense strand. In some embodiments, the sense strand includes the a 2’-O-(2-methoxyethyl) nucleoside. The 2’- O-(2-methoxyethyl) nucleoside may be at nucleoside position 4 of the sense strand. The 2’-O-(2- methoxyethyl) nucleoside may include a 2’-O-(2-methoxyethyl) thymine nucleoside. In some embodiments, the sense strand does not include the a 2’-O-(2-methoxyethyl) nucleoside. The 2’-O-(2- methoxyethyl) nucleoside of the sense strand may be otherwise unmodified. [00154] In some embodiments, any one of the following is true with regard to the antisense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’- O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise 2’ fluoro modified pyrimidines; all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; or all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise 2’ fluoro modified purines; with the proviso that in any of the foregoing, the sense strand may include a deoxy nucleoside or a 2’-O-(2-methoxyethyl) nucleoside. In some embodiments, all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a 2’-O-(2- methoxyethyl) nucleoside may be included in the antisense strand. In some embodiments, in the antisense -89-
Attorney Docket No.54462-742.601 strand, all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; with the proviso that a 2’-O-(2-methoxyethyl) nucleoside may be included in the antisense strand. In some embodiments, in the antisense strand, all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise 2’ fluoro modified pyrimidines; with the proviso that a 2’-O-(2-methoxyethyl) nucleoside may be included in the antisense strand. In some embodiments, in the antisense strand, all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a 2’- O-(2-methoxyethyl) nucleoside may be included in the antisense strand. In some embodiments, in the antisense strand, all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; with the proviso that a 2’-O-(2-methoxyethyl) nucleoside may be included in the antisense strand. In some embodiments, in the antisense strand, all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise 2’ fluoro modified purines; with the proviso that a 2’-O-(2-methoxyethyl) nucleoside may be included in the antisense strand. In some embodiments, the antisense strand includes the a 2’-O-(2-methoxyethyl) nucleoside. The 2’-O-(2-methoxyethyl) nucleoside may be at nucleoside position 4 of the sense strand. The 2’-O-(2- methoxyethyl) nucleoside may include a 2’-O-(2-methoxyethyl) thymine nucleoside. In some embodiments, the antisense strand does not include the a 2’-O-(2-methoxyethyl) nucleoside. The 2’-O-(2- methoxyethyl) nucleoside of the antisense strand may be otherwise unmodified. [00155] In some embodiments, any one of the following is true with regard to the sense strand, with the proviso that the sense strand may include a 2’ deoxy nucleoside: all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all purine nucleosides comprise 2’-O-methyl, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides comprise 2’-O-methyl, all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all pyrimidine nucleosides comprise 2’-O-methyl, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, or all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides comprise 2’-O-methyl. In some embodiments, in the sense strand, all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, with the proviso that the sense strand may include a 2’ deoxy nucleoside. In some embodiments, in the sense strand, all purine nucleosides comprise 2’-O-methyl, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, with the proviso that the sense strand may include a 2’ deoxy nucleoside. In some embodiments, in the sense strand, all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides comprise 2’-O-methyl, with the proviso that the sense strand may include a 2’ deoxy nucleoside. In some embodiments, in the sense strand, all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, with the proviso that the sense strand may include a 2’ deoxy nucleoside. In some embodiments, in the sense strand, all pyrimidine nucleosides comprise 2’-O-methyl, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, with the proviso that the sense strand may include a 2’ deoxy nucleoside. In some embodiments, in the sense strand, all pyrimidine -90-
Attorney Docket No.54462-742.601 nucleosides comprise 2’ fluoro, and all purine nucleosides comprise 2’-O-methyl, with the proviso that the sense strand may include a 2’ deoxy nucleoside. In some embodiments, the sense strand includes the 2’ deoxy nucleoside. In some embodiments, the sense strand does not include the 2’ deoxy nucleoside. Some embodiments include a proviso that the sense strand may include a 2’-O-(2-methoxyethyl) nucleoside (e.g. at position 4, counting from 5’ to 3’). Some embodiments include the 2’-O-(2-methoxyethyl) nucleoside in the sense strand. Some embodiments do not include the 2’-O-(2-methoxyethyl) nucleoside in the sense strand. [00156] In some embodiments, any one of the following is true with regard to the sense strand: all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all purine nucleosides comprise 2’-O-methyl, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides comprise 2’-O-methyl, all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all pyrimidine nucleosides comprise 2’-O-methyl, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O- methyl, or all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides comprise 2’-O- methyl. In some embodiments, in the sense strand, all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl. In some embodiments, in the sense strand, all purine nucleosides comprise 2’-O-methyl, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl. In some embodiments, in the sense strand, all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides comprise 2’-O-methyl. In some embodiments, in the sense strand, all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl. In some embodiments, in the sense strand, all pyrimidine nucleosides comprise 2’-O-methyl, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl. In some embodiments, in the sense strand, all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides comprise 2’-O-methyl. Some embodiments include a proviso that the sense strand may include a 2’-O-methoxyethyl nucleoside (e.g. at position 4, counting from 5’ to 3’). Some embodiments include the 2’-O-methoxyethyl nucleoside in the sense strand. Some embodiments do not include the 2’-O-methoxyethyl nucleoside in the sense strand. [00157] In some embodiments, any one of the following is true with regard to the antisense strand, with the proviso that the antisense strand may include a 2’ deoxy nucleoside: all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O- methyl, all purine nucleosides comprise 2’-O-methyl, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all purine nucleosides comprise 2’-O-methyl, and all pyrimidine nucleosides comprise 2’ fluoro, all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all pyrimidine nucleosides comprise 2’-O- methyl, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, or all pyrimidine nucleosides comprise 2’-O-methyl, and all purine nucleosides comprise 2’ fluoro. In some embodiments, in the antisense strand, all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, with the proviso that the antisense -91-
Attorney Docket No.54462-742.601 strand may include a 2’ deoxy nucleoside. In some embodiments, in the antisense strand, all purine nucleosides comprise 2’-O-methyl, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, with the proviso that the antisense strand may include a 2’ deoxy nucleoside. In some embodiments, in the antisense strand, all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides comprise 2’-O-methyl, with the proviso that the antisense strand may include a 2’ deoxy nucleoside. In some embodiments, in the antisense strand, all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, with the proviso that the antisense strand may include a 2’ deoxy nucleoside. In some embodiments, in the antisense strand, all pyrimidine nucleosides comprise 2’-O-methyl, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, with the proviso that the antisense strand may include a 2’ deoxy nucleoside. In some embodiments, in the antisense strand, all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides comprise 2’-O-methyl, with the proviso that the antisense strand may include a 2’ deoxy nucleoside. In some embodiments, the antisense strand includes the 2’ deoxy nucleoside. In some embodiments, the antisense strand does not include the 2’ deoxy nucleoside. Some embodiments include a proviso that the antisense strand may include a 2’-O-methoxyethyl nucleoside (e.g. at position 4, counting from 5’ to 3’). Some embodiments include the 2’-O-methoxyethyl nucleoside in the antisense strand. Some embodiments do not include the 2’-O-methoxyethyl nucleoside in the antisense strand. [00158] In some embodiments, any one of the following is true with regard to the antisense strand: all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all purine nucleosides comprise 2’-O-methyl, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all purine nucleosides comprise 2’-O-methyl, and all pyrimidine nucleosides comprise 2’ fluoro, all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl, all pyrimidine nucleosides comprise 2’-O-methyl, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O- methyl, or all pyrimidine nucleosides comprise 2’-O-methyl, and all purine nucleosides comprise 2’ fluoro. In some embodiments, in the antisense strand, all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl. In some embodiments, in the antisense strand, all purine nucleosides comprise 2’-O-methyl, and all pyrimidine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl. In some embodiments, in the antisense strand, all purine nucleosides comprise 2’ fluoro, and all pyrimidine nucleosides comprise 2’-O-methyl. In some embodiments, in the antisense strand, all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl. In some embodiments, in the antisense strand, all pyrimidine nucleosides comprise 2’-O-methyl, and all purine nucleosides are modified with a mixture of 2’ fluoro and 2’-O-methyl. In some embodiments, in the antisense strand, all pyrimidine nucleosides comprise 2’ fluoro, and all purine nucleosides comprise 2’-O-methyl. Some embodiments include a proviso that the antisense strand may include a 2’-O-methoxyethyl nucleoside (e.g. at position 4, counting from 5’ to 3’). Some embodiments include the 2’-O-methoxyethyl nucleoside in the antisense strand. Some embodiments do not include the 2’-O-methoxyethyl nucleoside in the antisense strand. -92-
Attorney Docket No.54462-742.601 [00159] In some embodiments, the antisense strand comprises one or two 3’ phosphorothioate linkages. For example, there may be a phosphorothioate linkage between the first and second nucleotides from the 3’ end of the antisense strand, or there may be phosphorothioate linkages between the first, second and third nucleotides from the 3’ end of the antisense strand. In some embodiments, the sense strand comprises one or two 5’ phosphorothioate linkages. For example, there may be a phosphorothioate linkage between the first and second nucleotides from the 5’ end of the sense strand, or there may be phosphorothioate linkages between the first, second and third nucleotides from the 5’ end of the sense strand. In some embodiments, the sense strand does not comprise one or two 5’ phosphorothioate linkages. For example, in some embodiments, there are no phosphorothioate linkages between the last 3 nucleotides at the 5’ end of the sense strand. In some embodiments, the sense strand comprises 5’ phosphate linkages. In some embodiments, the sense strand comprises one or two 3’ phosphorothioate linkages. For example, there may be a phosphorothioate linkage between the first and second nucleotides from the 3’ end of the sense strand, or there may be phosphorothioate linkages between the first, second and third nucleotides from the 3’ end of the sense strand. [00160] In some embodiments, the antisense strand comprises a 5’ end comprising 2 phosphorothioate linkages. The 5’ end may comprise 3 nucleosides separated by the 2 phosphorothioate linkages. In some embodiments, the antisense strand comprises a 3’ end comprising 2 phosphorothioate linkages. The 3’ end may comprise 3 nucleosides separated by the 2 phosphorothioate linkages. [00161] In some cases, position 9 of the sense strand can be a 2’deoxy. In these cases, 2’F and 2’OMe modifications may occur at the other positions of the sense strand. In some cases, the sense strand of any of the siRNAs comprises a modification pattern which conforms to these sense strand rules. [00162] In some cases, the sense strand of any of the siRNAs comprises a modification pattern which conforms to these sense strand rules. [00163] Disclosed herein, in some embodiments are compositions comprising an oligonucleotide that targets GPAM and when administered to a cell decreases expression of GPAM, wherein the oligonucleotide comprises a small interfering RNA (siRNA) comprising a sense strand and an antisense strand, wherein the sense strand comprises a sense strand sequence described herein in which at least one internucleoside linkage is modified and at least one nucleoside is modified, or an sense strand sequence comprising 1 or 2 nucleoside substitutions, additions, or deletions of the oligonucleotide sequence in which at least one internucleoside linkage is modified and at least one nucleoside is modified, and wherein the antisense strand comprises an antisense strand sequence described herein in which at least one internucleoside linkage is modified and at least one nucleoside is modified, or an oligonucleotide sequence comprising 1 or 2 nucleoside substitutions, additions, or deletions of the antisense strand sequence in which at least one internucleoside linkage is modified and at least one nucleoside is modified. Some embodiments relate to methods that include administering the composition to a subject. [00164] In some embodiments, the siRNA comprises a sense strand having a sequence in accordance with any of SEQ ID NOs: 12709-12733. In some embodiments, the sense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 12709-12733, at least 80% identical to any one of SEQ ID NOs: 12709-12733, at least 85% identical to of any one of SEQ ID NOs: -93-
Attorney Docket No.54462-742.601 12709-12733, at least 90% identical to any one of SEQ ID NOs: 12709-12733, or at least 95% identical to any one of SEQ ID NOs: 12709-12733. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12709-12733, or a sense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12709-12733, or a sense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 12709-12733. In some embodiments, the siRNA comprises a sense strand having a sequence in accordance with any of SEQ ID NOs: 12759-12866. In some embodiments, the sense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 12759-12866, at least 80% identical to any one of SEQ ID NOs: 12759-12866, at least 85% identical to of any one of SEQ ID NOs: 12759-12866, at least 90% identical to any one of SEQ ID NOs: 12759-12866, or at least 95% identical to any one of SEQ ID NOs: 12759-12866. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12759-12866, or a sense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12759-12866, or a sense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 12759-12866. The sense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand sequence may include the first 19 nucleotides of any of the aforementioned sequences. The sense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand may comprise an overhang. The sense strand may comprise a modification pattern described herein, such as a different set of modifications or modification pattern than the aforementioned sequences. The sense strand may comprise a lipid moiety. The sense strand may comprise a GalNAc moiety. In some embodiments, the siRNA comprises an antisense strand having a sequence in accordance with any of SEQ ID NOs: 12734-12758. In some embodiments, the antisense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 12734-12758, at least 80% identical to any one of SEQ ID NOs: 12734-12758, at least 85% identical to of any one of SEQ ID NOs: 12734-12758, at least 90% identical to any one of SEQ ID NOs: 12734-12758, or at least 95% identical to any one of SEQ ID NOs: 12734-12758. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12734-12758, or an antisense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12734-12758, or an antisense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 12734- 12758. The antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The antisense strand -94-
Attorney Docket No.54462-742.601 sequence may include the first 19 nucleotides of any of the aforementioned sequences. The antisense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The antisense strand may comprise an overhang. The antisense strand may comprise a modification pattern described herein, such as a different set of modifications or modification pattern than the aforementioned sequences. The antisense strand may comprise a lipid moiety or a GalNAc moiety. [00165] In some embodiments, the siRNA comprises a sense strand having a sequence in accordance with any of SEQ ID NOs: 12868-12974. In some embodiments, the sense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 12868-12974, at least 80% identical to any one of SEQ ID NOs: 12868-12974, at least 85% identical to of any one of SEQ ID NOs: 12868-12974, at least 90% identical to any one of SEQ ID NOs: 12868-12974, or at least 95% identical to any one of SEQ ID NOs: 12868-12974. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12868-12974, or a sense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12868-12974, or a sense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 12868-12974. The sense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand sequence may include the first 19 nucleotides of any of the aforementioned sequences. The sense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand may comprise an overhang. The sense strand may comprise a modification pattern described herein, such as a different set of modifications or modification pattern than the aforementioned sequences. The sense strand may comprise a lipid moiety. The sense strand may comprise a GalNAc moiety. In some embodiments, the siRNA comprises an antisense strand having a sequence in accordance with any of SEQ ID NOs: 12975- 13081. In some embodiments, the antisense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 12975-13081, at least 80% identical to any one of SEQ ID NOs: 12975-13081, at least 85% identical to of any one of SEQ ID NOs: 12975-13081, at least 90% identical to any one of SEQ ID NOs: 12975-13081, or at least 95% identical to any one of SEQ ID NOs: 12975-13081. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12975-13081, or an antisense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12975-13081, or an antisense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 12975- 13081. The antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The antisense strand sequence may include the first 19 nucleotides of any of the aforementioned sequences. The antisense -95-
Attorney Docket No.54462-742.601 strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The antisense strand may comprise an overhang. The antisense strand may comprise a modification pattern described herein, such as a different set of modifications or modification pattern than the aforementioned sequences. The antisense strand may comprise a lipid moiety or a GalNAc moiety. [00166] In some embodiments, the siRNA comprises a sense strand having a sequence in accordance with any of SEQ ID NOs: 13724-13751. In some embodiments, the sense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 13724-13751, at least 80% identical to any one of SEQ ID NOs: 13724-13751, at least 85% identical to of any one of SEQ ID NOs: 13724-13751, at least 90% identical to any one of SEQ ID NOs: 13724-13751, or at least 95% identical to any one of SEQ ID NOs: 13724-13751. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13724-13751, or a sense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13724-13751, or a sense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 13724-13751. The sense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand sequence may include the first 19 nucleotides of any of the aforementioned sequences. The sense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand may comprise an overhang. The sense strand may comprise a modification pattern described herein, such as a different set of modifications or modification pattern than the aforementioned sequences. The sense strand may comprise a lipid moiety. The sense strand may comprise a GalNAc moiety. In some embodiments, the siRNA comprises an antisense strand having a sequence in accordance with any of SEQ ID NOs: 13752- 13779. In some embodiments, the antisense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 13752-13779, at least 80% identical to any one of SEQ ID NOs: 13752-13779, at least 85% identical to of any one of SEQ ID NOs: 13752-13779, at least 90% identical to any one of SEQ ID NOs: 13752-13779, or at least 95% identical to any one of SEQ ID NOs: 13752-13779. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13752-13779, or an antisense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13752-13779, or an antisense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 13752- 13779. The antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The antisense strand sequence may include the first 19 nucleotides of any of the aforementioned sequences. The antisense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in -96-
Attorney Docket No.54462-742.601 the 5’ to 3’ direction) of any of the aforementioned sequences. The antisense strand may comprise an overhang. The antisense strand may comprise a modification pattern described herein, such as a different set of modifications or modification pattern than the aforementioned sequences. The antisense strand may comprise a lipid moiety or a GalNAc moiety. [00167] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of subset G. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of subset G. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset G, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset G, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of subset G. The sense strand or antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand or antisense strand sequence may include the first 19 nucleotides of any of the aforementioned sequences. The sense strand or antisense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein (e.g. a different set of modifications or modification pattern than subset G). The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [00168] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of subset H. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of subset H. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset H, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of subset H, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of subset H. The sense strand or antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand or antisense strand sequence may include the first 19 nucleotides of any of the aforementioned sequences. The sense strand or antisense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand or antisense strand may comprise an overhang. The sense -97-
Attorney Docket No.54462-742.601 strand or antisense strand may comprise any modifications described herein (e.g. a different set of modifications or modification pattern than subset H). The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [00169] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 10. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 10. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 10, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 10, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence [00170] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 11. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 11. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 11, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 11, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 11. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [00171] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 15. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 15. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 15, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 15, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence. 100% identical to a sense strand or antisense strand sequence of Table 15. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. -98-
Attorney Docket No.54462-742.601 [00172] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 19. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 19. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 19, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 19, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 19. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [00173] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 21. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 21. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 21, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 21, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 21. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [00174] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 24. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 24. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 24, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 24, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 24. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. -99-
Attorney Docket No.54462-742.601 [00175] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 27. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 27. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 27, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 27, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 27. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [00176] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 30. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 30. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 30, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 30, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 30. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [00177] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 34. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 34. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 34, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 34, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 34. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. -100-
Attorney Docket No.54462-742.601 [00178] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 48. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 48. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 48, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 48, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 48. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [00179] In some embodiments, the siRNA comprises a sense strand or antisense strand having a sequence in accordance with the sense strand or antisense strand sequence of an siRNA of Table 62. In some embodiments, the sense strand or antisense strand comprises a sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to a sense strand or antisense strand sequence of Table 62. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 62, or a sequence thereof having 3 or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense strand comprises a sequence of a sense or antisense strand of Table 62, or a sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand or antisense sequence comprises or consists of a sequence 100% identical to a sense strand or antisense strand sequence of Table 62. The sense strand or antisense strand may comprise an overhang. The sense strand or antisense strand may comprise any modifications described herein. The sense strand or antisense strand may comprise a lipid moiety or a GalNAc moiety. [00180] In some embodiments, the siRNA comprises a sense strand having a sequence in accordance with any of SEQ ID NOs: 12953, 12958, 13724, 13725, 13726, 13727, 13728, 13729, 13730, 13731, 13732, 13733, 13734, 13735, 12959, 13736, 13737, 13738, 13739, 13740, 13741, 13742, 13743, 13744, 13745, 13746, 13747, 12877, 12927, 12928, 12929, 12930, 12931, 12932, 12933, 12934, 12960, 13748, 13749, 13750, 13751, 12883, 12910, 12911, 12912, 12913, 12914, 12915, 12916, 12917, 12947, 12948, 12965, 12885, 12901, 12902, 12903, 12904, 12905, 12906, 12907, 12908, 12909, 12886, 12893, 12894, 12895, 12896, 12897, 12898, 12899, 12900, 12968, 12889, 12918, 12919, 12920, 12921, 12922, 12923, 12924, 12925, 12926, 12943, 12944, 12945, 12946, 12969, 12970, 12892, 12935, 12936, 12937, 12938, 12939, 12940, 12941, or 12942. In some embodiments, the sense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 12953, 12958, 13724, 13725, 13726, 13727, 13728, 13729, 13730, 13731, 13732, 13733, 13734, 13735, 12959, 13736, 13737, 13738, 13739, 13740, 13741, 13742, 13743, 13744, 13745, 13746, 13747, 12877, 12927, 12928, 12929, 12930, 12931, 12932, 12933, 12934, 12960, 13748, 13749, 13750, 13751, 12883, 12910, 12911, 12912, 12913, 12914, 12915, -101-
Attorney Docket No.54462-742.601 12916, 12917, 12947, 12948, 12965, 12885, 12901, 12902, 12903, 12904, 12905, 12906, 12907, 12908, 12909, 12886, 12893, 12894, 12895, 12896, 12897, 12898, 12899, 12900, 12968, 12889, 12918, 12919, 12920, 12921, 12922, 12923, 12924, 12925, 12926, 12943, 12944, 12945, 12946, 12969, 12970, 12892, 12935, 12936, 12937, 12938, 12939, 12940, 12941, or 12942, at least 80% identical to any one of SEQ ID NOs: 12953, 12958, 13724, 13725, 13726, 13727, 13728, 13729, 13730, 13731, 13732, 13733, 13734, 13735, 12959, 13736, 13737, 13738, 13739, 13740, 13741, 13742, 13743, 13744, 13745, 13746, 13747, 12877, 12927, 12928, 12929, 12930, 12931, 12932, 12933, 12934, 12960, 13748, 13749, 13750, 13751, 12883, 12910, 12911, 12912, 12913, 12914, 12915, 12916, 12917, 12947, 12948, 12965, 12885, 12901, 12902, 12903, 12904, 12905, 12906, 12907, 12908, 12909, 12886, 12893, 12894, 12895, 12896, 12897, 12898, 12899, 12900, 12968, 12889, 12918, 12919, 12920, 12921, 12922, 12923, 12924, 12925, 12926, 12943, 12944, 12945, 12946, 12969, 12970, 12892, 12935, 12936, 12937, 12938, 12939, 12940, 12941, or 12942, at least 85% identical to of any one of SEQ ID NOs: 12953, 12958, 13724, 13725, 13726, 13727, 13728, 13729, 13730, 13731, 13732, 13733, 13734, 13735, 12959, 13736, 13737, 13738, 13739, 13740, 13741, 13742, 13743, 13744, 13745, 13746, 13747, 12877, 12927, 12928, 12929, 12930, 12931, 12932, 12933, 12934, 12960, 13748, 13749, 13750, 13751, 12883, 12910, 12911, 12912, 12913, 12914, 12915, 12916, 12917, 12947, 12948, 12965, 12885, 12901, 12902, 12903, 12904, 12905, 12906, 12907, 12908, 12909, 12886, 12893, 12894, 12895, 12896, 12897, 12898, 12899, 12900, 12968, 12889, 12918, 12919, 12920, 12921, 12922, 12923, 12924, 12925, 12926, 12943, 12944, 12945, 12946, 12969, 12970, 12892, 12935, 12936, 12937, 12938, 12939, 12940, 12941, or 12942, at least 90% identical to any one of SEQ ID NOs: 13403-13723, or at least 95% identical to any one of SEQ ID NOs: 12953, 12958, 13724, 13725, 13726, 13727, 13728, 13729, 13730, 13731, 13732, 13733, 13734, 13735, 12959, 13736, 13737, 13738, 13739, 13740, 13741, 13742, 13743, 13744, 13745, 13746, 13747, 12877, 12927, 12928, 12929, 12930, 12931, 12932, 12933, 12934, 12960, 13748, 13749, 13750, 13751, 12883, 12910, 12911, 12912, 12913, 12914, 12915, 12916, 12917, 12947, 12948, 12965, 12885, 12901, 12902, 12903, 12904, 12905, 12906, 12907, 12908, 12909, 12886, 12893, 12894, 12895, 12896, 12897, 12898, 12899, 12900, 12968, 12889, 12918, 12919, 12920, 12921, 12922, 12923, 12924, 12925, 12926, 12943, 12944, 12945, 12946, 12969, 12970, 12892, 12935, 12936, 12937, 12938, 12939, 12940, 12941, or 12942. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12953, 12958, 13724, 13725, 13726, 13727, 13728, 13729, 13730, 13731, 13732, 13733, 13734, 13735, 12959, 13736, 13737, 13738, 13739, 13740, 13741, 13742, 13743, 13744, 13745, 13746, 13747, 12877, 12927, 12928, 12929, 12930, 12931, 12932, 12933, 12934, 12960, 13748, 13749, 13750, 13751, 12883, 12910, 12911, 12912, 12913, 12914, 12915, 12916, 12917, 12947, 12948, 12965, 12885, 12901, 12902, 12903, 12904, 12905, 12906, 12907, 12908, 12909, 12886, 12893, 12894, 12895, 12896, 12897, 12898, 12899, 12900, 12968, 12889, 12918, 12919, 12920, 12921, 12922, 12923, 12924, 12925, 12926, 12943, 12944, 12945, 12946, 12969, 12970, 12892, 12935, 12936, 12937, 12938, 12939, 12940, 12941, or 12942, or a sense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12953, 12958, 13724, 13725, 13726, 13727, 13728, 13729, 13730, 13731, 13732, 13733, 13734, 13735, 12959, 13736, 13737, 13738, 13739, 13740, 13741, 13742, 13743, 13744, 13745, -102-
Attorney Docket No.54462-742.601 13746, 13747, 12877, 12927, 12928, 12929, 12930, 12931, 12932, 12933, 12934, 12960, 13748, 13749, 13750, 13751, 12883, 12910, 12911, 12912, 12913, 12914, 12915, 12916, 12917, 12947, 12948, 12965, 12885, 12901, 12902, 12903, 12904, 12905, 12906, 12907, 12908, 12909, 12886, 12893, 12894, 12895, 12896, 12897, 12898, 12899, 12900, 12968, 12889, 12918, 12919, 12920, 12921, 12922, 12923, 12924, 12925, 12926, 12943, 12944, 12945, 12946, 12969, 12970, 12892, 12935, 12936, 12937, 12938, 12939, 12940, 12941, or 12942, or a sense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 12953, 12958, 13724, 13725, 13726, 13727, 13728, 13729, 13730, 13731, 13732, 13733, 13734, 13735, 12959, 13736, 13737, 13738, 13739, 13740, 13741, 13742, 13743, 13744, 13745, 13746, 13747, 12877, 12927, 12928, 12929, 12930, 12931, 12932, 12933, 12934, 12960, 13748, 13749, 13750, 13751, 12883, 12910, 12911, 12912, 12913, 12914, 12915, 12916, 12917, 12947, 12948, 12965, 12885, 12901, 12902, 12903, 12904, 12905, 12906, 12907, 12908, 12909, 12886, 12893, 12894, 12895, 12896, 12897, 12898, 12899, 12900, 12968, 12889, 12918, 12919, 12920, 12921, 12922, 12923, 12924, 12925, 12926, 12943, 12944, 12945, 12946, 12969, 12970, 12892, 12935, 12936, 12937, 12938, 12939, 12940, 12941, or 12942. The sense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand may comprise an overhang. The sense strand may comprise a modification pattern described herein. The sense strand may comprise a lipid moiety or a GalNAc moiety. [00181] In some embodiments, the siRNA comprises an antisense strand having a sequence in accordance with any of SEQ ID NOs: 13060, 13065, 13752, 13753, 13754, 13755, 13756, 13757, 13758, 13759, 13760, 13761, 13762, 13763, 13066, 13764, 12984, 13034, 13035, 13036, 13037, 13038, 13039, 13040, 13041, 13067, 13765, 13766, 13767, 13768, 12990, 13017, 13018, 13019, 13020, 13021, 13022, 13023, 13024, 13054, 13055, 13072, 12992, 13008, 13009, 13010, 13011, 13012, 13013, 13014, 13015, 13016, 12993, 13000, 13001, 13002, 13003, 13004, 13005, 13006, 13007, 13075, 12996, 13025, 13026, 13027, 13028, 13029, 13030, 13031, 13032, 13033, 13050, 13051, 13052, 13053, 13076, 13077, 12999, 13042, 13043, 13044, 13045, 13046, 13047, 13048, or 13049. In some embodiments, the antisense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 13060, 13065, 13752, 13753, 13754, 13755, 13756, 13757, 13758, 13759, 13760, 13761, 13762, 13763, 13066, 13764, 12984, 13034, 13035, 13036, 13037, 13038, 13039, 13040, 13041, 13067, 13765, 13766, 13767, 13768, 12990, 13017, 13018, 13019, 13020, 13021, 13022, 13023, 13024, 13054, 13055, 13072, 12992, 13008, 13009, 13010, 13011, 13012, 13013, 13014, 13015, 13016, 12993, 13000, 13001, 13002, 13003, 13004, 13005, 13006, 13007, 13075, 12996, 13025, 13026, 13027, 13028, 13029, 13030, 13031, 13032, 13033, 13050, 13051, 13052, 13053, 13076, 13077, 12999, 13042, 13043, 13044, 13045, 13046, 13047, 13048, or 13049, at least 80% identical to any one of SEQ ID NOs: 13060, 13065, 13752, 13753, 13754, 13755, 13756, 13757, 13758, 13759, 13760, 13761, 13762, 13763, 13066, 13764, 12984, 13034, 13035, 13036, 13037, 13038, 13039, 13040, 13041, 13067, 13765, 13766, 13767, 13768, 12990, 13017, 13018, 13019, 13020, 13021, 13022, 13023, 13024, 13054, 13055, 13072, 12992, 13008, 13009, 13010, 13011, -103-
Attorney Docket No.54462-742.601 13012, 13013, 13014, 13015, 13016, 12993, 13000, 13001, 13002, 13003, 13004, 13005, 13006, 13007, 13075, 12996, 13025, 13026, 13027, 13028, 13029, 13030, 13031, 13032, 13033, 13050, 13051, 13052, 13053, 13076, 13077, 12999, 13042, 13043, 13044, 13045, 13046, 13047, 13048, or 13049, at least 85% identical to of any one of SEQ ID NOs: 13060, 13065, 13752, 13753, 13754, 13755, 13756, 13757, 13758, 13759, 13760, 13761, 13762, 13763, 13066, 13764, 12984, 13034, 13035, 13036, 13037, 13038, 13039, 13040, 13041, 13067, 13765, 13766, 13767, 13768, 12990, 13017, 13018, 13019, 13020, 13021, 13022, 13023, 13024, 13054, 13055, 13072, 12992, 13008, 13009, 13010, 13011, 13012, 13013, 13014, 13015, 13016, 12993, 13000, 13001, 13002, 13003, 13004, 13005, 13006, 13007, 13075, 12996, 13025, 13026, 13027, 13028, 13029, 13030, 13031, 13032, 13033, 13050, 13051, 13052, 13053, 13076, 13077, 12999, 13042, 13043, 13044, 13045, 13046, 13047, 13048, or 13049, at least 90% identical to any one of SEQ ID NOs: 13060, 13065, 13752, 13753, 13754, 13755, 13756, 13757, 13758, 13759, 13760, 13761, 13762, 13763, 13066, 13764, 12984, 13034, 13035, 13036, 13037, 13038, 13039, 13040, 13041, 13067, 13765, 13766, 13767, 13768, 12990, 13017, 13018, 13019, 13020, 13021, 13022, 13023, 13024, 13054, 13055, 13072, 12992, 13008, 13009, 13010, 13011, 13012, 13013, 13014, 13015, 13016, 12993, 13000, 13001, 13002, 13003, 13004, 13005, 13006, 13007, 13075, 12996, 13025, 13026, 13027, 13028, 13029, 13030, 13031, 13032, 13033, 13050, 13051, 13052, 13053, 13076, 13077, 12999, 13042, 13043, 13044, 13045, 13046, 13047, 13048, or 13049, or at least 95% identical to any one of SEQ ID NOs: 13060, 13065, 13752, 13753, 13754, 13755, 13756, 13757, 13758, 13759, 13760, 13761, 13762, 13763, 13066, 13764, 12984, 13034, 13035, 13036, 13037, 13038, 13039, 13040, 13041, 13067, 13765, 13766, 13767, 13768, 12990, 13017, 13018, 13019, 13020, 13021, 13022, 13023, 13024, 13054, 13055, 13072, 12992, 13008, 13009, 13010, 13011, 13012, 13013, 13014, 13015, 13016, 12993, 13000, 13001, 13002, 13003, 13004, 13005, 13006, 13007, 13075, 12996, 13025, 13026, 13027, 13028, 13029, 13030, 13031, 13032, 13033, 13050, 13051, 13052, 13053, 13076, 13077, 12999, 13042, 13043, 13044, 13045, 13046, 13047, 13048, or 13049. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13060, 13065, 13752, 13753, 13754, 13755, 13756, 13757, 13758, 13759, 13760, 13761, 13762, 13763, 13066, 13764, 12984, 13034, 13035, 13036, 13037, 13038, 13039, 13040, 13041, 13067, 13765, 13766, 13767, 13768, 12990, 13017, 13018, 13019, 13020, 13021, 13022, 13023, 13024, 13054, 13055, 13072, 12992, 13008, 13009, 13010, 13011, 13012, 13013, 13014, 13015, 13016, 12993, 13000, 13001, 13002, 13003, 13004, 13005, 13006, 13007, 13075, 12996, 13025, 13026, 13027, 13028, 13029, 13030, 13031, 13032, 13033, 13050, 13051, 13052, 13053, 13076, 13077, 12999, 13042, 13043, 13044, 13045, 13046, 13047, 13048, or 13049, or an antisense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13060, 13065, 13752, 13753, 13754, 13755, 13756, 13757, 13758, 13759, 13760, 13761, 13762, 13763, 13066, 13764, 12984, 13034, 13035, 13036, 13037, 13038, 13039, 13040, 13041, 13067, 13765, 13766, 13767, 13768, 12990, 13017, 13018, 13019, 13020, 13021, 13022, 13023, 13024, 13054, 13055, 13072, 12992, 13008, 13009, 13010, 13011, 13012, 13013, 13014, 13015, 13016, 12993, 13000, 13001, 13002, 13003, 13004, 13005, 13006, 13007, 13075, 12996, 13025, 13026, 13027, 13028, 13029, 13030, 13031, 13032, 13033, 13050, 13051, 13052, 13053, 13076, 13077, 12999, 13042, 13043, 13044, 13045, 13046, 13047, 13048, or -104-
Attorney Docket No.54462-742.601 13049, or an antisense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 13060, 13065, 13752, 13753, 13754, 13755, 13756, 13757, 13758, 13759, 13760, 13761, 13762, 13763, 13066, 13764, 12984, 13034, 13035, 13036, 13037, 13038, 13039, 13040, 13041, 13067, 13765, 13766, 13767, 13768, 12990, 13017, 13018, 13019, 13020, 13021, 13022, 13023, 13024, 13054, 13055, 13072, 12992, 13008, 13009, 13010, 13011, 13012, 13013, 13014, 13015, 13016, 12993, 13000, 13001, 13002, 13003, 13004, 13005, 13006, 13007, 13075, 12996, 13025, 13026, 13027, 13028, 13029, 13030, 13031, 13032, 13033, 13050, 13051, 13052, 13053, 13076, 13077, 12999, 13042, 13043, 13044, 13045, 13046, 13047, 13048, or 13049. The antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The antisense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The antisense strand may comprise an overhang. The antisense strand may comprise a modification pattern described herein. The antisense strand may comprise a lipid moiety or a GalNAc moiety. [00182] In some embodiments, the siRNA comprises a sense strand having a sequence in accordance with any of SEQ ID NOs: 12959, 12928, 12932, 12960, 12947, 12965, 12904, 12909, 12897, 12968, 12926, 12969, 12970, 12935, or 12936.. In some embodiments, the sense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 12959, 12928, 12932, 12960, 12947, 12965, 12904, 12909, 12897, 12968, 12926, 12969, 12970, 12935, or 12936., at least 80% identical to any one of SEQ ID NOs: 12959, 12928, 12932, 12960, 12947, 12965, 12904, 12909, 12897, 12968, 12926, 12969, 12970, 12935, or 12936., at least 85% identical to of any one of SEQ ID NOs: 12959, 12928, 12932, 12960, 12947, 12965, 12904, 12909, 12897, 12968, 12926, 12969, 12970, 12935, or 12936., at least 90% identical to any one of SEQ ID NOs: 13403-13723, or at least 95% identical to any one of SEQ ID NOs: 12959, 12928, 12932, 12960, 12947, 12965, 12904, 12909, 12897, 12968, 12926, 12969, 12970, 12935, or 12936.. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12959, 12928, 12932, 12960, 12947, 12965, 12904, 12909, 12897, 12968, 12926, 12969, 12970, 12935, or 12936., or a sense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 12959, 12928, 12932, 12960, 12947, 12965, 12904, 12909, 12897, 12968, 12926, 12969, 12970, 12935, or 12936., or a sense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the sense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 12959, 12928, 12932, 12960, 12947, 12965, 12904, 12909, 12897, 12968, 12926, 12969, 12970, 12935, or 12936.. The sense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The sense strand may comprise an overhang. The sense strand may comprise a modification pattern described herein. The sense strand may comprise a lipid moiety or a GalNAc moiety. -105-
Attorney Docket No.54462-742.601 [00183] In some embodiments, the siRNA comprises an antisense strand having a sequence in accordance with any of SEQ ID NOs: 13060, 13065, 13066, 13035, 13039, 13067, 13054, 13072, 13011, 13016, 13004, 13075, 13033, 13076, 13077, 13042, or 13043. In some embodiments, the antisense strand sequence comprises or consists of sequence at least 75% identical to any one of SEQ ID NOs: 13060, 13065, 13066, 13035, 13039, 13067, 13054, 13072, 13011, 13016, 13004, 13075, 13033, 13076, 13077, 13042, or 13043, at least 80% identical to any one of SEQ ID NOs: 13060, 13065, 13066, 13035, 13039, 13067, 13054, 13072, 13011, 13016, 13004, 13075, 13033, 13076, 13077, 13042, or 13043, at least 85% identical to of any one of SEQ ID NOs: 13060, 13065, 13066, 13035, 13039, 13067, 13054, 13072, 13011, 13016, 13004, 13075, 13033, 13076, 13077, 13042, or 13043, at least 90% identical to any one of SEQ ID NOs: 13060, 13065, 13066, 13035, 13039, 13067, 13054, 13072, 13011, 13016, 13004, 13075, 13033, 13076, 13077, 13042, or 13043, or at least 95% identical to any one of SEQ ID NOs: 13060, 13065, 13066, 13035, 13039, 13067, 13054, 13072, 13011, 13016, 13004, 13075, 13033, 13076, 13077, 13042, or 13043. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13060, 13065, 13066, 13035, 13039, 13067, 13054, 13072, 13011, 13016, 13004, 13075, 13033, 13076, 13077, 13042, or 13043, or an antisense strand sequence thereof having 1, 2, 3, or 4 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of the sequence of any one of SEQ ID NOs: 13060, 13065, 13066, 13035, 13039, 13067, 13054, 13072, 13011, 13016, 13004, 13075, 13033, 13076, 13077, 13042, or 13043, or an antisense strand sequence thereof having 1 or 2 nucleoside substitutions, additions, or deletions. In some embodiments, the antisense strand sequence comprises or consists of a sequence 100% identical to SEQ ID NOs: 13060, 13065, 13066, 13035, 13039, 13067, 13054, 13072, 13011, 13016, 13004, 13075, 13033, 13076, 13077, 13042, or 13043. The antisense strand sequence may include the first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The antisense strand sequence may include the last 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides (in the 5’ to 3’ direction) of any of the aforementioned sequences. The antisense strand may comprise an overhang. The antisense strand may comprise a modification pattern described herein. The antisense strand may comprise a lipid moiety or a GalNAc moiety. 4. Modified ASOs [00184] In some embodiments, the composition comprises an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an antisense oligonucleotide (ASO). In some embodiments, the ASO comprises modification pattern ASO1: 5’-nsnsnsnsnsdNsdNsdNsdNsdNsdNsdNsdNsdNsdNsnsnsnsnsn-3’ (SEQ ID NO: 12928), wherein “dN” is any deoxynucleotide, “n” is a 2’O-methyl or 2’-O-(2-methoxyethyl)-modified nucleoside, and “s” is a phosphorothioate linkage. In some embodiments, the ASO comprises modification pattern 1S, 2S, 3S, 4S, 5S, 6S, 7S, 8S, 9S, 10S, 11S, 12S, 13S, 14S, 15S, 16S, 17S, 18S, 19S, 20S, 21S, 22S, 23S, 24S, 25S, 26S, 27S, 28S, 29S, 30S, 31S, 32S, 33S, 34S, 35S, 36S, 37S, 38S, 39S, 40S, 41S, 42S, 43S, 44S, 45S, 46S, 47S, 48S, 49S, 50S, 51S, 52S, 52S, 54S, 55S, 56S, 57S, 58S, 59S, 60S, 61S, 62S, 63S, 64S, 65S, 66S, 67S, 68S, 69S, 70S, 1AS, 2AS, 3AS, 4AS, 5AS, 6AS, 7AS, or 8AS, 9AS, 10AS, 11AS, 12AS, 13AS, -106-
Attorney Docket No.54462-742.601 14AS, 15AS, 16AS, 17AS, 18AS, 19AS, 20AS, 21AS, 22AS, 23AS, 24AS, 25AS, 26AS, 27AS, 28AS, 29AS, 30AS, 31AS, or 32AS. D. Formulations [00185] In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the composition is sterile. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. [00186] In some embodiments, the pharmaceutically acceptable carrier comprises water. In some embodiments, the pharmaceutically acceptable carrier comprises a buffer. In some embodiments, the pharmaceutically acceptable carrier comprises a saline solution. In some embodiments, the pharmaceutically acceptable carrier comprises water, a buffer, or a saline solution. In some embodiments, the composition comprises a liposome. In some embodiments, the pharmaceutically acceptable carrier comprises liposomes, lipids, nanoparticles, proteins, protein-antibody complexes, peptides, cellulose, nanogel, or a combination thereof. II. METHODS AND USES [00187] Disclosed herein, in some embodiments, are methods of administering a composition described herein to a subject. Some embodiments relate to use a composition described herein, such as administering the composition to a subject. [00188] Some embodiments relate to a method of treating a disorder in a subject in need thereof. Some embodiments relate to use of a composition described herein in the method of treatment. Some embodiments include administering a composition described herein to a subject with the disorder. In some embodiments, the administration treats the disorder in the subject. In some embodiments, the composition treats the disorder in the subject. The disorder may comprise a disease. [00189] In some embodiments, the treatment comprises prevention, inhibition, or reversion of the disorder in the subject. Some embodiments relate to use of a composition described herein in the method of preventing, inhibiting, or reversing the disorder. Some embodiments relate to a method of preventing, inhibiting, or reversing a disorder a disorder in a subject in need thereof. Some embodiments include administering a composition described herein to a subject with the disorder. In some embodiments, the administration prevents, inhibits, or reverses the disorder in the subject. In some embodiments, the composition prevents, inhibits, or reverses the disorder in the subject. [00190] Some embodiments relate to a method of preventing a disorder a disorder in a subject in need thereof. Some embodiments relate to use of a composition described herein in the method of preventing the disorder. Some embodiments include administering a composition described herein to a subject with the disorder. In some embodiments, the administration prevents the disorder in the subject. In some embodiments, the composition prevents the disorder in the subject. [00191] Some embodiments relate to a method of inhibiting a disorder a disorder in a subject in need thereof. Some embodiments relate to use of a composition described herein in the method of inhibiting the disorder. Some embodiments include administering a composition described herein to a subject with the -107-
Attorney Docket No.54462-742.601 disorder. In some embodiments, the administration inhibits the disorder in the subject. In some embodiments, the composition inhibits the disorder in the subject. [00192] Some embodiments relate to a method of reversing a disorder a disorder in a subject in need thereof. Some embodiments relate to use of a composition described herein in the method of reversing the disorder. Some embodiments include administering a composition described herein to a subject with the disorder. In some embodiments, the administration reverses the disorder in the subject. In some embodiments, the composition reverses the disorder in the subject. [00193] In some embodiments, the administration is systemic. In some embodiments, the administration is intravenous. In some embodiments, the administration is by injection. A. Disorders [00194] Some embodiments of the methods described herein include treating a disorder in a subject in need thereof. In some embodiments, the disorder is a liver disease. Non-limiting examples of liver diseases may include non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), alcoholic liver disease, liver fibrosis, liver cirrhosis, or hepatocellular carcinoma. In some embodiments, the disorder is a cardiometabolic disease. Non-limiting examples of cardiometabolic diseases may include hyperlipidemia, ischemic heart disease, or coronary heart disease. In some embodiments, the disorder comprises NAFLD. In some embodiments, the disorder comprises NASH. In some embodiments, the disorder comprises alcoholic liver disease. In some embodiments, the disorder comprises liver fibrosis. In some embodiments, the disorder comprises liver cirrhosis. In some embodiments, the disorder comprises hepatocellular carcinoma. In some embodiments, the disorder comprises hyperlipidemia. In some embodiments, the disorder comprises a heart disease. In some embodiments, the heart disease comprises ischemic heart disease. In some embodiments, the heart disease comprises coronary heart disease. B. Subjects [00195] Some embodiments of the methods described herein include treatment of a subject. Non- limiting examples of subjects include vertebrates, animals, mammals, dogs, cats, cattle, rodents, mice, rats, primates, monkeys, and humans. In some embodiments, the subject is a vertebrate. In some embodiments, the subject is an animal. In some embodiments, the subject is a mammal. In some embodiments, the subject is a dog. In some embodiments, the subject is a cat. In some embodiments, the subject is a cattle. In some embodiments, the subject is a mouse. In some embodiments, the subject is a rat. In some embodiments, the subject is a primate. In some embodiments, the subject is a monkey. In some embodiments, the subject is an animal, a mammal, a dog, a cat, cattle, a rodent, a mouse, a rat, a primate, or a monkey. In some embodiments, the subject is a human. [00196] In some embodiments, the subject is male. In some embodiments, the subject is female. In some embodiments, the subject is an adult (e.g. at least 18 years old). [00197] In some embodiments, the subject has a body mass index (BMI) of 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more, or a range defined by any two of the aforementioned integers. In some embodiments, the subject is overweight. In some embodiments, the subject has a BMI of 25 or more. In some embodiments, the subject has a BMI of 25- 29. In some embodiments, the subject is obese. In some embodiments, the subject has a BMI of 30 or -108-
Attorney Docket No.54462-742.601 more. In some embodiments, the subject has a BMI of 30-39. In some embodiments, the subject has a BMI of 40-50. In some embodiments, the subject has a BMI of 25-50. C. Baseline measurements [00198] Some embodiments of the methods described herein include obtaining a baseline measurement from a subject. For example, in some embodiments, a baseline measurement is obtained from the subject prior to treating the subject. Non-limiting examples of baseline measurements include a baseline liver fat percentage measurement, a baseline liver fibrosis score measurement, a baseline NAFLD activity score measurement, a baseline blood alanine aminotransferase (ALT) measurement, a baseline blood aspartate aminotransferase (AST) measurement, a baseline blood aspartate aminotransferase (ASP) measurement, a baseline blood bilirubin measurement, a baseline low-density lipoprotein (LDL) measurement, a baseline total cholesterol measurement, a baseline non-HDL cholesterol measurement, a baseline apolipoprotein B (APOB), a baseline GPAM protein measurement, or a baseline GPAM mRNA measurement. [00199] In some embodiments, the baseline measurement is obtained directly from the subject. In some embodiments, the baseline measurement is obtained by observation, for example by observation of the subject or of the subject’s tissue. In some embodiments, the baseline measurement is obtained noninvasively using an imaging device. [00200] In some embodiments, the baseline measurement is obtained in a sample from the subject. In some embodiments, the baseline measurement is obtained in one or more histological tissue sections. In some embodiments, the baseline measurement is obtained by performing an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay, on the sample obtained from the subject. In some embodiments, the baseline measurement is obtained by an immunoassay, a colorimetric assay, a fluorescence assay, or a chromatography (e.g. HPLC) assay. In some embodiments, the baseline measurement is obtained by PCR. [00201] In some embodiments, the baseline measurement is a baseline liver fat percentage measurement. In some embodiments, the baseline liver fat percentage measurement is a baseline percentage as measured by MRI. In some embodiments, the baseline liver fat percentage measurement is a baseline percentage as measured by CT scan. In some embodiments, the baseline liver fat percentage is measured in a liver biopsy. [00202] In some embodiments, the baseline measurement is a baseline NAFLD activity score measurement. In some embodiments, the baseline NAFLD activity score measurement is measured by histological analysis. In some embodiments, the baseline NAFLD activity score measurement includes a numerical score for steatosis (0–3), hepatocyte ballooning (1–2), and lobular inflammation (0–3). In some embodiments, the score thresholds of < 3 correlates with a diagnosis of not-NASH. In some embodiments, the score thresholds of > 5 correlates with a diagnosis of NASH. In some embodiments, a baseline NAFLD activity score measurement is assayed by imaging. [00203] In some embodiments, the baseline measurement is a baseline alanine aminotransferase (ALT) measurement. In some embodiments, the baseline ALT measurement includes a baseline blood ALT measurement. In some embodiments, the baseline ALT measurement is measured by enzymatic -109-
Attorney Docket No.54462-742.601 activity. In some embodiments, the baseline ALT measurement is measured by presence of an ALT epitope. In some embodiments, the baseline ALT measurement is a baseline circulating ALT measurement. In some embodiments, the baseline ALT measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00204] In some embodiments, the baseline measurement is a baseline aspartate aminotransferase (AST) measurement. In some embodiments, the baseline AST measurement includes a baseline blood AST measurement. In some embodiments, the baseline AST measurement is measured by enzymatic activity. In some embodiments, the baseline AST measurement is measured by presence of an AST epitope. In some embodiments, the baseline AST measurement is a baseline circulating AST measurement. In some embodiments, the baseline AST measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00205] In some embodiments, the baseline measurement is a baseline aspartate aminotransferase (ASP) measurement. In some embodiments, the baseline ASP measurement includes a baseline blood ASP measurement. In some embodiments, the baseline ASP measurement is measured by enzymatic activity. In some embodiments, the baseline ASP measurement is measured by presence of an ASP epitope. In some embodiments, the baseline ASP measurement is a baseline circulating ASP measurement. In some embodiments, the baseline ASP measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00206] In some embodiments, the baseline measurement is a baseline bilirubin measurement. In some embodiments, the baseline bilirubin measurement includes a baseline blood bilirubin measurement. In some embodiments, the baseline bilirubin measurement is measured by presence of a bilirubin epitope. In some embodiments, the baseline bilirubin measurement is a baseline circulating bilirubin measurement. In some embodiments, the baseline bilirubin measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00207] In some embodiments, the baseline measurement is a baseline low-density lipoprotein (LDL) measurement. In some embodiments, the baseline LDL measurement includes a baseline blood LDL measurement. In some embodiments, the baseline LDL measurement is measured by presence of an LDL epitope. In some embodiments, the baseline LDL measurement is a baseline circulating LDL measurement. In some embodiments, the baseline LDL measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00208] In some embodiments, the baseline measurement is a baseline total cholesterol measurement. In some embodiments, the baseline total cholesterol measurement includes a baseline blood total cholesterol measurement. In some embodiments, the baseline total cholesterol is measured by presence of a total cholesterol epitope. In some embodiments, the baseline total cholesterol measurement is a baseline circulating total cholesterol measurement. In some embodiments, the baseline total cholesterol measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00209] In some embodiments, the baseline measurement is a baseline non-HDL cholesterol measurement. In some embodiments, the baseline non-HDL cholesterol measurement includes a baseline -110-
Attorney Docket No.54462-742.601 blood non-HDL cholesterol measurement. In some embodiments, the baseline non-HDL cholesterol measurement is a baseline circulating non-HDL cholesterol measurement. In some embodiments, the baseline non-HDL cholesterol measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00210] In some embodiments, the baseline measurement is a baseline apolipoprotein B (APOB) measurement. In some embodiments, the baseline APOB includes a baseline blood APOB measurement. In some embodiments, the baseline APOB is measured by presence of an APOB epitope. In some embodiments, the baseline APOB measurement is a baseline circulating APOB measurement. In some embodiments, the baseline APOB measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00211] In some embodiments, the baseline measurement is a baseline liver fibrosis measurement. In some embodiments, the baseline liver fibrosis measurement is a baseline liver fibrosis score (LFS). In some embodiments, the baseline LFS comprises a score of 0, 1, 2, 3, or 4, or a range of scores defined by any two of the aforementioned numbers. In some embodiments, the baseline LFS comprises a score of 0- 4. In some embodiments, the baseline LFS is obtained using a scoring system exemplified in Table 2. In some embodiments, the baseline LFS measurement is obtained noninvasively. In some embodiments, the baseline LFS measurement is obtained by a medical imaging device such as a vibration-controlled transient elastography (VCTE) device, a shear wave elastography device, a medical resonance imaging (MRI) device, a magnetic resonance spectroscopy device, a computed tomography device, or an ultrasound device. In some embodiments, the baseline LFS measurement is obtained in a liver sample. In some embodiments, the baseline LFS is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. In some embodiments, the baseline LFS is obtained using one or more indirect markers or measures of liver fibrosis such as an aspartate aminotransferase-to-platelet ratio index (APRI), a Fibrosis-4 (FIB-4) index, a FibroIndex, a Forns Index, a Hepascore, or a FibroTest. In some embodiments, the baseline LFS is obtained using one or more indirect markers or measures of liver fibrosis such as a FIBROSpect test or a FIBROSpect II test. In some embodiments, the baseline LFS is obtained by RT-qPCR or RNA sequencing of one or more fibrosis-related genes such as a collagen gene. In some embodiments, the baseline LFS or the baseline LFS is obtained using a scoring system upon a visual inspection of a sample such as a histological sample. In some embodiments, the baseline LFS or the baseline LFS is obtained using a stain with an affinity to collagen. In some embodiments, the baseline LFS measurement is measured by FibroScan® in kilopascals (kPa). In some embodiments, the baseline LFS is measured by histological analysis. In some embodiments, the baseline LFS measurement is a baseline LFS measurement assayed by imaging. In some embodiments, the imaging is by MRI or CT scan. Sc
1 Mild fibrosis Fibrous portal expansion Periportal fibrotic expansion 2 Moderate fibrosis Rare bridges or septae Periportal septae (> 1 septum) 3 Severe fibrosis Numerous bridges or septae Portal-central septae -111-
Attorney Docket No.54462-742.601 4 Cirrhosis Cirrhosis Cirrhosis [00212] In some embodiments, the baseline measurement is a baseline GPAM mRNA measurement. In some embodiments, the baseline GPAM mRNA measurement comprises a baseline GPAM mRNA
level. In some embodiments, the baseline GPAM mRNA level is indicated as an amount or percentage of GPAM mRNA per sample weight. In some embodiments, the baseline GPAM mRNA level is indicated as an amount or percentage of GPAM mRNA per sample volume. In some embodiments, the baseline GPAM mRNA level is indicated as an amount or percentage of GPAM mRNA per total mRNA within the sample. In some embodiments, the baseline GPAM mRNA level is indicated as an amount or percentage of GPAM mRNA per total nucleic acids within the sample. In some embodiments, the baseline GPAM mRNA level is indicated relative to another mRNA level, such as an mRNA level of a housekeeping gene, within the sample. In some embodiments, the baseline GPAM mRNA measurement is a baseline tissue GPAM mRNA measurement. In some embodiments, the baseline GPAM mRNA measurement is obtained by an assay such as a polymerase chain reaction (PCR) assay. In some embodiments, the PCR comprises quantitative PCR (qPCR). In some embodiments, the PCR comprises reverse transcription of the GPAM mRNA. [00213] In some embodiments, the baseline measurement is a baseline GPAM protein measurement. In some embodiments, the baseline GPAM protein measurement comprises a baseline GPAM protein level. In some embodiments, the baseline GPAM protein level is indicated as a mass or percentage of GPAM protein per sample weight. In some embodiments, the baseline GPAM protein level is indicated as a mass or percentage of GPAM protein per sample volume. In some embodiments, the baseline GPAM protein level is indicated as a mass or percentage of GPAM protein per total protein within the sample. In some embodiments, the baseline GPAM protein measurement is a baseline tissue GPAM protein measurement. In some embodiments, the baseline GPAM protein measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00214] Some embodiments of the methods described herein include obtaining a sample from a subject. In some embodiments, the baseline measurement is obtained in a sample obtained from the subject. In some embodiments, the sample is obtained from the subject prior to administration or treatment of the subject with a composition described herein. In some embodiments, a baseline measurement is obtained in a sample obtained from the subject prior to administering the composition to the subject. In some embodiments, the sample is obtained from the subject in a fasted state. In some embodiments, the sample is obtained from the subject after an overnight fasting period. In some embodiments, the sample is obtained from the subject in a fed state. [00215] In some embodiments, the sample comprises a fluid. In some embodiments, the sample is a fluid sample. In some embodiments, the sample is a blood, plasma, or serum sample. In some embodiments, the sample comprises blood. In some embodiments, the sample is a blood sample. In some embodiments, the sample is a whole-blood sample. In some embodiments, the blood is fractionated or centrifuged. In some embodiments, the sample comprises plasma. In some embodiments, the sample is a -112-
Attorney Docket No.54462-742.601 plasma sample. A blood sample may be a plasma sample. In some embodiments, the sample comprises serum. In some embodiments, the sample is a serum sample. A blood sample may be a serum sample. [00216] In some embodiments, the sample comprises a tissue. In some embodiments, the sample is a tissue sample. In some embodiments, the tissue comprises liver or adipose tissue. For example, the baseline GPAM mRNA measurement, or the baseline GPAM protein measurement, may be obtained in a liver or adipose sample obtained from the patient. In some embodiments, the tissue comprises adipose tissue. In some embodiments, the adipose tissue comprises white adipose tissue. The adipose tissue may include adipocytes. The adipose tissue may include preadipocytes In some embodiments, the tissue comprises liver tissue. The liver may include hepatocytes. In some embodiments, the tissue comprises vasculature tissue. In some embodiments, the vasculature tissue comprises endothelial cells. [00217] In some embodiments, the sample includes cells. In some embodiments, the sample comprises a cell. In some embodiments, the cell comprises an adipose cell or a liver cell. In some embodiments, the cell is an adipose cell. In some embodiments, the adipose cell is an adipocyte. In some embodiments, the cell is a liver cell. In some embodiments, the liver cell is a hepatocyte. In some embodiments, the cell is a vasculature cell. In some embodiments, the vasculature cell is an endothelial cell. D. Effects [00218] In some embodiments, the composition or administration of the composition affects a measurement such as a liver fat percentage measurement, a liver fibrosis score measurement, a NAFLD activity score measurement, a blood alanine aminotransferase (ALT) measurement, a blood aspartate aminotransferase (AST) measurement, a blood aspartate aminotransferase (ASP) measurement, a blood bilirubin measurement, a low-density lipoprotein (LDL) measurement, a total cholesterol measurement, a non-HDL cholesterol measurement, an apolipoprotein B (APOB), a GPAM protein measurement, or a GPAM mRNA measurement, relative to the baseline measurement. [00219] Some embodiments of the methods described herein include obtaining the measurement from a subject. For example, the measurement may be obtained from the subject after treating the subject. In some embodiments, the measurement is obtained in a second sample (such as a fluid or tissue sample described herein) obtained from the subject after the composition is administered to the subject. In some embodiments, the measurement is an indication that the disorder has been treated. [00220] In some embodiments, the measurement is obtained directly from the subject. In some embodiments, the measurement is obtained noninvasively using an imaging device. In some embodiments, the measurement is obtained in a second sample from the subject. In some embodiments, the measurement is obtained in one or more histological tissue sections. In some embodiments, the measurement is obtained by performing an assay on the second sample obtained from the subject. In some embodiments, the measurement is obtained by an assay, such as an assay described herein. In some embodiments, the assay is an immunoassay, a colorimetric assay, a fluorescence assay, a chromatography (e.g. HPLC) assay, or a PCR assay. In some embodiments, the measurement is obtained by an assay such as an immunoassay, a colorimetric assay, a fluorescence assay, or a chromatography (e.g. HPLC) assay. In some embodiments, the measurement is obtained by PCR. In some embodiments, the measurement is -113-
Attorney Docket No.54462-742.601 obtained by histology. In some embodiments, the measurement is obtained by observation. In some embodiments, additional measurements are made, such as in a 3rd sample, a 4th sample, or a fifth sample. [00221] In some embodiments, the measurement is obtained within 1 hour, within 2 hours, within 3 hours, within 4 hours, within 5 hours, within 6 hours, within 12 hours, within 18 hours, or within 24 hours after the administration of the composition. In some embodiments, the measurement is obtained within 1 day, within 2 days, within 3 days, within 4 days, within 5 days, within 6 days, or within 7 days after the administration of the composition. In some embodiments, the measurement is obtained within 1 week, within 2 weeks, within 3 weeks, within 1 month, within 2 months, within 3 months, within 6 months, within 1 year, within 2 years, within 3 years, within 4 years, or within 5 years after the administration of the composition. In some embodiments, the measurement is obtained after 1 hour, after 2 hours, after 3 hours, after 4 hours, after 5 hours, after 6 hours, after 12 hours, after 18 hours, or after 24 hours after the administration of the composition. In some embodiments, the measurement is obtained after 1 day, after 2 days, after 3 days, after 4 days, after 5 days, after 6 days, or after 7 days after the administration of the composition. In some embodiments, the measurement is obtained after 1 week, after 2 weeks, after 3 weeks, after 1 month, after 2 months, after 3 months, after 6 months, after 1 year, after 2 years, after 3 years, after 4 years, or after 5 years, following the administration of the composition. [00222] In some embodiments, the composition reduces the measurement relative to the baseline measurement. For example, an adverse phenotype of NAFLD, NASH, alcoholic liver disease, liver fibrosis, liver cirrhosis, hepatocellular carcinoma, hyperlipidemia, ischemic heart disease, or coronary heart disease may be reduced upon administration of the composition. In some embodiments, the reduction is measured in a second sample obtained from the subject after administering the composition to the subject. In some embodiments, the reduction is measured directly in the subject after administering the composition to the subject. In some embodiments, the measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline measurement. In some embodiments, the measurement is decreased by about 10% or more, relative to the baseline measurement. In some embodiments, the measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, relative to the baseline measurement. In some embodiments, the measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline measurement. In some embodiments, the measurement is decreased by no more than about 10%, relative to the baseline measurement. In some embodiments, the measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or no more than about 100% relative to the baseline measurement. In some embodiments, the measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [00223] In some embodiments, the composition increases the measurement relative to the baseline measurement. For example, a protective liver function phenotype, metabolic phenotype, or level of circulating ketone bodies may be increased upon administration of the composition. In some -114-
Attorney Docket No.54462-742.601 embodiments, the increase is measured in a second sample obtained from the subject after administering the composition to the subject. In some embodiments, the increase is measured directly in the subject after administering the composition to the subject. In some embodiments, the measurement is increased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline measurement. In some embodiments, the measurement is increased by about 10% or more, relative to the baseline measurement. In some embodiments, the measurement is increased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, relative to the baseline measurement. In some embodiments, the measurement is increased by about 100% or more, increased by about 250% or more, increased by about 500% or more, increased by about 750% or more, or increased by about 1000% or more, relative to the baseline measurement. In some embodiments, the measurement is increased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline measurement. In some embodiments, the measurement is increased by no more than about 10%, relative to the baseline measurement. In some embodiments, the measurement is increased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or no more than about 100% relative to the baseline measurement. In some embodiments, the measurement is increased by no more than about 100%, increased by no more than about 250%, increased by no more than about 500%, increased by no more than about 750%, or increased by no more than about 1000%, relative to the baseline measurement. In some embodiments, the measurement is increased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 250%, 500%, 750%, or 1000%, or by a range defined by any of the two aforementioned percentages. [00224] In some embodiments, the measurement is a liver fat percentage (LFP) measurement. In some embodiments, the LFP measurement is a percentage as measured by MRI. In some embodiments, the LFP measurement is a percentage as measured by CT scan. In some embodiments, the LFP is measured in a liver biopsy. [00225] In some embodiments, the composition reduces the LFP measurement relative to the baseline LFP measurement. In some embodiments, the LFP measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline LFP measurement. In some embodiments, the LFP measurement is decreased by about 10% or more, relative to the baseline LFP measurement. In some embodiments, the LFP measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more relative to the baseline LFP measurement. In some embodiments, the LFP measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline LFP measurement. In some embodiments, the LFP measurement is decreased by no more than about 10%, relative to the baseline LFP measurement. In some embodiments, the LFP measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline LFP -115-
Attorney Docket No.54462-742.601 measurement. In some embodiments, the LFP measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [00226] In some embodiments, the measurement is a liver fibrosis measurement. In some embodiments, the liver fibrosis measurement is a liver fibrosis score (LFS). In some embodiments, the LFS comprises a score of 0, 1, 2, 3, or 4, or a range of scores defined by any two of the aforementioned numbers. In some embodiments, the LFS comprises a score of 0-4. In some embodiments, the LFS is obtained using a scoring system exemplified in Table 2. In some embodiments, the LFS measurement is obtained noninvasively. In some embodiments, the LFS measurement is obtained by a medical imaging device such as a vibration-controlled transient elastography (VCTE) device, a shear wave elastography device, a medical resonance imaging (MRI) device, a magnetic resonance spectroscopy device, a computed tomography device, or an ultrasound device. In some embodiments, the LFS measurement is obtained in a liver sample. In some embodiments, the LFS is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. In some embodiments, the LFS is obtained using one or more indirect markers or measures of liver fibrosis such as an aspartate aminotransferase-to- platelet ratio index (APRI), a Fibrosis-4 (FIB-4) index, a FibroIndex, a Forns Index, a Hepascore, or a FibroTest. In some embodiments, the LFS is obtained using one or more indirect markers or measures of liver fibrosis such as a FIBROSpect test or a FIBROSpect II test. In some embodiments, the LFS is obtained by RT-qPCR or RNA sequencing of one or more fibrosis-related genes such as a collagen gene. In some embodiments, the LFS or the LFS is obtained using a scoring system upon a visual inspection of a sample such as a histological sample. In some embodiments, the LFS or the LFS is obtained using a stain with an affinity to collagen. In some embodiments, the LFS measurement is measured by FibroScan® in kilopascals (kPa). In some embodiments, the LFS is measured by histological analysis. In some embodiments, the LFS measurement is a LFS measurement assayed by imaging. In some embodiments, the imaging is by MRI or CT scan. [00227] In some embodiments, the composition reduces the LFS measurement relative to the baseline LFS measurement. In some embodiments, the LFS measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline LFS measurement. In some embodiments, the LFS measurement is decreased by about 10% or more, relative to the baseline LFS measurement. In some embodiments, the LFS measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more relative to the baseline LFS measurement. In some embodiments, the LFS measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline LFS measurement. In some embodiments, the LFS measurement is decreased by no more than about 10%, relative to the baseline LFS measurement. In some embodiments, the LFS measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline LFS measurement. In some embodiments, the LFS measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, -116-
Attorney Docket No.54462-742.601 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [00228] In some embodiments, the measurement is a NAFLD activity score measurement. In some embodiments, the NAFLD activity score measurement is measured by histological analysis. In some embodiments, the NAFLD activity score measurement includes a numerical score for steatosis (0–3), hepatocyte ballooning (1–2), and lobular inflammation (0–3). In some embodiments, the score thresholds of < 3 correlates with a diagnosis of not-NASH. In some embodiments, the score thresholds of > 5 correlates with a diagnosis of NASH. In some embodiments, a NAFLD activity score measurement is assayed by imaging. [00229] In some embodiments, the composition reduces the NAFLD activity score measurement relative to the baseline NAFLD activity score measurement. In some embodiments, the NAFLD activity score measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline NAFLD activity score measurement. In some embodiments, the NAFLD activity score measurement is decreased by about 10% or more, relative to the baseline NAFLD activity score measurement. In some embodiments, the NAFLD activity score measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more relative to the baseline NAFLD activity score measurement. In some embodiments, the NAFLD ACTIVITY SCORE measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline NAFLD ACTIVITY SCORE measurement. In some embodiments, the NAFLD ACTIVITY SCORE measurement is decreased by no more than about 10%, relative to the baseline NAFLD ACTIVITY SCORE measurement. In some embodiments, the NAFLD ACTIVITY SCORE measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline NAFLD ACTIVITY SCORE measurement. In some embodiments, the NAFLD ACTIVITY SCORE measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [00230] In some embodiments, the measurement is an alanine aminotransferase (ALT) measurement. In some embodiments, the ALT measurement includes a blood ALT measurement. In some embodiments, the ALT measurement is measured by enzymatic activity. In some embodiments, the ALT measurement is measured by presence of an ALT epitope. In some embodiments, the ALT measurement is a circulating ALT measurement. In some embodiments, the ALT measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. In some embodiments, the ALT measurement is a blood ALT concentration (for example, units per liter (U/L)). In some embodiments, the ALT measurement is a circulating ALT measurement. In some embodiments, the ALT measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00231] In some embodiments, the composition reduces the ALT measurement relative to the baseline ALT measurement. In some embodiments, the composition reduces circulating ALTs relative to the -117-
Attorney Docket No.54462-742.601 baseline ALT measurement. In some embodiments, the reduced ALTs are measured in a second sample obtained from the subject after administering the composition to the subject. In some embodiments, the ALT measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline ALT measurement. In some embodiments, the ALT measurement is decreased by about 10% or more, relative to the baseline ALT measurement. In some embodiments, the ALT measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more relative to the baseline ALT measurement. In some embodiments, the ALT measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline ALT measurement. In some embodiments, the ALT measurement is decreased by no more than about 10%, relative to the baseline ALT measurement. In some embodiments, the ALT measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline ALT measurement. In some embodiments, the ALT measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [00232] In some embodiments, the measurement is an aspartate aminotransferase (AST) measurement. In some embodiments, the AST measurement includes a blood AST measurement. In some embodiments, the AST measurement is measured by enzymatic activity. In some embodiments, the AST measurement is measured by presence of an AST epitope. In some embodiments, the AST measurement is a blood AST concentration (for example, units per liter (U/L)). In some embodiments, the AST measurement is a circulating AST measurement. In some embodiments, the AST measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00233] In some embodiments, the composition reduces the AST measurement relative to the baseline AST measurement. In some embodiments, the composition reduces circulating ASTs relative to the baseline AST measurement. In some embodiments, the reduced ASTs are measured in a second sample obtained from the subject after administering the composition to the subject. In some embodiments, the AST measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline AST measurement. In some embodiments, the AST measurement is decreased by about 10% or more, relative to the baseline AST measurement. In some embodiments, the AST measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more relative to the baseline AST measurement. In some embodiments, the AST measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline AST measurement. In some embodiments, the AST measurement is decreased by no more than about 10%, relative to the baseline AST measurement. In some embodiments, the AST measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline AST measurement. In some embodiments, the AST -118-
Attorney Docket No.54462-742.601 measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [00234] In some embodiments, the measurement is an aspartate aminotransferase (ASP) measurement. In some embodiments, the ASP measurement includes a blood ASP measurement. In some embodiments, the ASP measurement is a blood ASP concentration (for example, units per liter (U/L)). In some embodiments, the ASP measurement is measured by enzymatic activity. In some embodiments, the ASP measurement is measured by presence of an ASP epitope. In some embodiments, the ASP measurement is a circulating ASP measurement. In some embodiments, the ASP measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00235] In some embodiments, the composition reduces the ASP measurement relative to the baseline ASP measurement. In some embodiments, the composition reduces circulating ASPs relative to the baseline ASP measurement. In some embodiments, the reduced ASPs are measured in a second sample obtained from the subject after administering the composition to the subject. In some embodiments, the ASP measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline ASP measurement. In some embodiments, the ASP measurement is decreased by about 10% or more, relative to the baseline ASP measurement. In some embodiments, the ASP measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more relative to the baseline ASP measurement. In some embodiments, the ASP measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline ASP measurement. In some embodiments, the ASP measurement is decreased by no more than about 10%, relative to the baseline ASP measurement. In some embodiments, the ASP measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline ASP measurement. In some embodiments, the ASP measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [00236] In some embodiments, the measurement is a bilirubin measurement. In some embodiments, the bilirubin measurement includes a blood bilirubin measurement. In some embodiments, the bilirubin measurement is a blood bilirubin concentration (for example, units per liter (µmol/L)). In some embodiments, the bilirubin measurement is measured by presence of a bilirubin epitope. In some embodiments, the bilirubin measurement is a circulating bilirubin measurement. In some embodiments, the bilirubin measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00237] In some embodiments, the composition reduces the bilirubin measurement relative to the baseline bilirubin measurement. In some embodiments, the composition reduces circulating bilirubin relative to the baseline bilirubin measurement. In some embodiments, the reduced bilirubin is measured in a second sample obtained from the subject after administering the composition to the subject. In some embodiments, the bilirubin measurement is decreased by about 2.5% or more, about 5% or more, or about -119-
Attorney Docket No.54462-742.601 7.5% or more, relative to the baseline bilirubin measurement. In some embodiments, the bilirubin measurement is decreased by about 10% or more, relative to the baseline bilirubin measurement. In some embodiments, the bilirubin measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more relative to the baseline bilirubin measurement. In some embodiments, the bilirubin measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline bilirubin measurement. In some embodiments, the bilirubin measurement is decreased by no more than about 10%, relative to the baseline bilirubin measurement. In some embodiments, the bilirubin measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline bilirubin measurement. In some embodiments, the bilirubin measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [00238] In some embodiments, the measurement is a low-density lipoprotein (LDL) measurement. In some embodiments, the LDL measurement includes a blood LDL measurement. In some embodiments, the LDL measurement is a blood LDL concentration (for example, units per liter (mg/dL)). In some embodiments, the LDL measurement is measured by presence of an LDL epitope. In some embodiments, the LDL measurement is a circulating LDL measurement. In some embodiments, the LDL measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00239] In some embodiments, the composition reduces the LDL measurement relative to the baseline LDL measurement. In some embodiments, the composition reduces circulating LDLs relative to the baseline LDL measurement. In some embodiments, the reduced LDLs are measured in a second sample obtained from the subject after administering the composition to the subject. In some embodiments, the LDL measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline LDL measurement. In some embodiments, the LDL measurement is decreased by about 10% or more, relative to the baseline LDL measurement. In some embodiments, the LDL measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more relative to the baseline LDL measurement. In some embodiments, the LDL measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline LDL measurement. In some embodiments, the LDL measurement is decreased by no more than about 10%, relative to the baseline LDL measurement. In some embodiments, the LDL measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline LDL measurement. In some embodiments, the LDL measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. -120-
Attorney Docket No.54462-742.601 [00240] In some embodiments, the measurement is an APOB measurement. In some embodiments, the APOB measurement is a blood APOB concentration (for example, units per liter (mg/dL)). In some embodiments, the APOB measurement is a circulating APOB measurement. In some embodiments, the APOB measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00241] In some embodiments, the composition reduces the APOB measurement relative to the baseline APOB measurement. In some embodiments, the composition reduces circulating APOBs relative to the baseline APOB measurement. In some embodiments, the reduced APOBs are measured in a second sample obtained from the subject after administering the composition to the subject. In some embodiments, the APOB measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline APOB measurement. In some embodiments, the APOB measurement is decreased by about 10% or more, relative to the baseline APOB measurement. In some embodiments, the APOB measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more relative to the baseline APOB measurement. In some embodiments, the APOB measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline APOB measurement. In some embodiments, the APOB measurement is decreased by no more than about 10%, relative to the baseline APOB measurement. In some embodiments, the APOB measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline APOB measurement. In some embodiments, the APOB measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [00242] In some embodiments, the measurement is a total cholesterol measurement. In some embodiments, the total cholesterol measurement is a blood total cholesterol concentration (for example, units per liter (mg/dL)). In some embodiments, the total cholesterol measurement is a circulating total cholesterol measurement. In some embodiments, the total cholesterol measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00243] In some embodiments, the composition reduces the total cholesterol measurement relative to the baseline total cholesterol measurement. In some embodiments, the composition reduces circulating total cholesterol relative to the baseline total cholesterol measurement. In some embodiments, the reduced total cholesterol is measured in a second sample obtained from the subject after administering the composition to the subject. In some embodiments, the total cholesterol measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline total cholesterol measurement. In some embodiments, the total cholesterol measurement is decreased by about 10% or more, relative to the baseline total cholesterol measurement. In some embodiments, the total cholesterol measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or -121-
Attorney Docket No.54462-742.601 more relative to the baseline total cholesterol measurement. In some embodiments, the total cholesterol measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline total cholesterol measurement. In some embodiments, the total cholesterol measurement is decreased by no more than about 10%, relative to the baseline total cholesterol measurement. In some embodiments, the total cholesterol measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline total cholesterol measurement. In some embodiments, the total cholesterol measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [00244] In some embodiments, the measurement is a non-HDL cholesterol measurement. In some embodiments, the non-HDL cholesterol measurement is a blood non-HDL cholesterol concentration (for example, units per liter (mg/dL)). In some embodiments, the non-HDL cholesterol measurement is a circulating non-HDL cholesterol measurement. In some embodiments, the non-HDL cholesterol measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00245] In some embodiments, the composition reduces the non-HDL cholesterol measurement relative to the baseline non-HDL cholesterol measurement. In some embodiments, the composition reduces circulating non-HDL cholesterol relative to the baseline non-HDL cholesterol measurement. In some embodiments, the reduced non-HDL cholesterol is measured in a second sample obtained from the subject after administering the composition to the subject. In some embodiments, the non-HDL cholesterol measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline non-HDL cholesterol measurement. In some embodiments, the non-HDL cholesterol measurement is decreased by about 10% or more, relative to the baseline non-HDL cholesterol measurement. In some embodiments, the non-HDL cholesterol measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more relative to the baseline non-HDL cholesterol measurement. In some embodiments, the non-HDL cholesterol measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline non-HDL cholesterol measurement. In some embodiments, the non-HDL cholesterol measurement is decreased by no more than about 10%, relative to the baseline non-HDL cholesterol measurement. In some embodiments, the non-HDL cholesterol measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or about 100% relative to the baseline non-HDL cholesterol measurement. In some embodiments, the non-HDL cholesterol measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [00246] In some embodiments, the measurement is an GPAM protein measurement. In some embodiments, the GPAM protein measurement comprises an GPAM protein level. In some embodiments, -122-
Attorney Docket No.54462-742.601 the GPAM protein level is indicated as a mass or percentage of GPAM protein per sample weight. In some embodiments, the GPAM protein level is indicated as a mass or percentage of GPAM protein per sample volume. In some embodiments, the GPAM protein level is indicated as a mass or percentage of GPAM protein per total protein within the sample. In some embodiments, the GPAM protein measurement is a tissue GPAM protein measurement. In some embodiments, the GPAM protein measurement is obtained by an assay such as an immunoassay, a colorimetric assay, or a fluorescence assay. [00247] In some embodiments, the composition reduces the GPAM protein measurement relative to the baseline GPAM protein measurement.. In some embodiments, the composition reduces tissue GPAM protein levels relative to the baseline GPAM protein measurement. In some embodiments, the reduced GPAM protein levels are measured in a second sample obtained from the subject after administering the composition to the subject. In some embodiments, the GPAM protein measurement is decreased by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline GPAM protein measurement. In some embodiments, the GPAM protein measurement is decreased by about 10% or more, relative to the baseline GPAM protein measurement. In some embodiments, the GPAM protein measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100%, relative to the baseline GPAM protein measurement. In some embodiments, the GPAM protein measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline GPAM protein measurement. In some embodiments, the GPAM protein measurement is decreased by no more than about 10%, relative to the baseline GPAM protein measurement. In some embodiments, the GPAM protein measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or no more than about 100% relative to the baseline GPAM protein measurement. In some embodiments, the GPAM protein measurement is decreased by 2.5%, 5%, 7.5%, 19%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or by a range defined by any of the two aforementioned percentages. [00248] In some embodiments, the measurement is an GPAM mRNA measurement. In some embodiments, the GPAM mRNA measurement comprises an GPAM mRNA level. In some embodiments, the GPAM mRNA level is indicated as an amount or percentage of GPAM mRNA per sample weight. In some embodiments, the GPAM mRNA level is indicated as an amount or percentage of GPAM mRNA per sample volume. In some embodiments, the GPAM mRNA level is indicated as an amount or percentage of GPAM mRNA per total mRNA within the sample. In some embodiments, the GPAM mRNA level is indicated as an amount or percentage of GPAM mRNA per total nucleic acids within the sample. In some embodiments, the GPAM mRNA level is indicated relative to another mRNA level, such as an mRNA level of a housekeeping gene, within the sample. In some embodiments, the GPAM mRNA measurement is a tissue GPAM mRNA measurement. In some embodiments, the GPAM mRNA measurement is obtained by an assay such as a PCR assay. In some embodiments, the PCR comprises qPCR. In some embodiments, the PCR comprises reverse transcription of the GPAM mRNA. -123-
Attorney Docket No.54462-742.601 [00249] In some embodiments, the composition reduces the GPAM mRNA measurement relative to the baseline GPAM mRNA measurement. In some embodiments, the GPAM mRNA measurement is obtained in a second sample obtained from the subject after administering the composition to the subject. In some embodiments, the composition reduces GPAM mRNA levels relative to the baseline GPAM mRNA levels. In some embodiments, the reduced GPAM mRNA levels are measured in a second sample obtained from the subject after administering the composition to the subject. In some embodiments, the second sample is a liver sample. In some embodiments, the second sample is an adipose sample. In some embodiments, the GPAM mRNA measurement is reduced by about 2.5% or more, about 5% or more, or about 7.5% or more, relative to the baseline GPAM mRNA measurement. In some embodiments, the GPAM mRNA measurement is decreased by about 10% or more, relative to the baseline GPAM mRNA measurement. In some embodiments, the GPAM mRNA measurement is decreased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100%, relative to the baseline GPAM mRNA measurement. In some embodiments, the GPAM mRNA measurement is decreased by no more than about 2.5%, no more than about 5%, or no more than about 7.5%, relative to the baseline GPAM mRNA measurement. In some embodiments, the GPAM mRNA measurement is decreased by no more than about 10%, relative to the baseline GPAM mRNA measurement. In some embodiments, the GPAM mRNA measurement is decreased by no more than about 20%, no more than about 30%, no more than about 40%, no more than about 50%, no more than about 60%, no more than about 70%, no more than about 80%, no more than about 90%, or no more than about 100%, relative to the baseline GPAM mRNA measurement. In some embodiments, the GPAM mRNA measurement is decreased by 2.5%, 5%, 7.5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% or by a range defined by any of the two aforementioned percentages. III. DEFINITIONS [00250] Unless defined otherwise, all terms of art, notations and other technical and scientific terms or terminology used herein are intended to have the same meaning as is commonly understood by one of ordinary skill in the art to which the claimed subject matter pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and/or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art. [00251] Throughout this application, various embodiments may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range. -124-
Attorney Docket No.54462-742.601 [00252] As used in the specification and claims, the singular forms “a”, “an” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a sample” includes a plurality of samples, including mixtures thereof. [00253] The terms “determining,” “measuring,” “evaluating,” “assessing,” “assaying,” and “analyzing” are often used interchangeably herein to refer to forms of measurement. The terms include determining if an element is present or not (for example, detection). These terms can include quantitative, qualitative or quantitative and qualitative determinations. Assessing can be relative or absolute. “Detecting the presence of” can include determining the amount of something present in addition to determining whether it is present or absent depending on the context. [00254] The terms “subject,” and “patient” may be used interchangeably herein. A “subject” can be a biological entity containing expressed genetic materials. The biological entity can be a plant, animal, or microorganism, including, for example, bacteria, viruses, fungi, and protozoa. The subject can be a mammal. The mammal can be a human. The subject may be diagnosed or suspected of being at high risk for a disease. In some cases, the subject is not necessarily diagnosed or suspected of being at high risk for the disease. [00255] As used herein, the term “about” a number refers to that number plus or minus 10% of that number. The term “about” a range refers to that range minus 10% of its lowest value and plus 10% of its greatest value. [00256] As used herein, the terms “treatment” or “treating” are used in reference to a pharmaceutical or other intervention regimen for obtaining beneficial or desired results in the recipient. Beneficial or desired results include but are not limited to a therapeutic benefit and/or a prophylactic benefit. A therapeutic benefit may refer to eradication or amelioration of symptoms or of an underlying disorder being treated. Also, a therapeutic benefit can be achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the subject, notwithstanding that the subject may still be afflicted with the underlying disorder. A prophylactic effect includes delaying, preventing, or eliminating the appearance of a disease or condition, delaying or eliminating the onset of symptoms of a disease or condition, slowing, halting, or reversing the progression of a disease or condition, or any combination thereof. For prophylactic benefit, a subject at risk of developing a particular disease, or to a subject reporting one or more of the physiological symptoms of a disease may undergo treatment, even though a diagnosis of this disease may not have been made. [00257] The term “Cx-y” or “Cx-Cy” when used in conjunction with a chemical moiety, such as alkyl, alkenyl, or alkynyl is meant to include groups that contain from x to y carbons in the chain. For example, the term “C1-6alkyl” refers to substituted or unsubstituted saturated hydrocarbon groups, including straight-chain alkyl and branched-chain alkyl groups that contain from 1 to 6 carbons. [00258] The terms “Cx-yalkenyl” and “Cx-yalkynyl” refer to substituted or unsubstituted unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described above, but that contain at least one double or triple bond, respectively. -125-
Attorney Docket No.54462-742.601 [00259] The term “carbocycle” as used herein refers to a saturated, unsaturated or aromatic ring in which each atom of the ring is carbon. Carbocycle includes 3- to 10-membered monocyclic rings, 5- to 12-membered bicyclic rings, 5- to 12-membered spiro bicycles, and 5- to 12-membered bridged rings. Each ring of a bicyclic carbocycle may be selected from saturated, unsaturated, and aromatic rings. In an exemplary embodiment, an aromatic ring, e.g., phenyl, may be fused to a saturated or unsaturated ring, e.g., cyclohexane, cyclopentane, or cyclohexene. A bicyclic carbocycle includes any combination of saturated, unsaturated and aromatic bicyclic rings, as valence permits. A bicyclic carbocycle further includes spiro bicyclic rings such as spiropentane. A bicyclic carbocycle includes any combination of ring sizes such as 3-3 spiro ring systems, 4-4 spiro ring systems, 4-5 fused ring systems, 5-5 fused ring systems, 5-6 fused ring systems, 6-6 fused ring systems, 5-7 fused ring systems, 6-7 fused ring systems, 5- 8 fused ring systems, and 6-8 fused ring systems. Exemplary carbocycles include cyclopentyl, cyclohexyl, cyclohexenyl, adamantyl, phenyl, indanyl, naphthyl, and bicyclo[1.1.1]pentanyl. [00260] The term “aryl” refers to an aromatic monocyclic or aromatic multicyclic hydrocarbon ring system. The aromatic monocyclic or aromatic multicyclic hydrocarbon ring system contains only hydrogen and carbon and from five to eighteen carbon atoms, where at least one of the rings in the ring system is aromatic, i.e., it contains a cyclic, delocalized (4n+2) π-electron system in accordance with the Hückel theory. The ring system from which aryl groups are derived include, but are not limited to, groups such as benzene, fluorene, indane, indene, tetralin and naphthalene. [00261] The term "cycloalkyl" refers to a saturated ring in which each atom of the ring is carbon. Cycloalkyl may include monocyclic and polycyclic rings such as 3- to 10-membered monocyclic rings, 5- to 12-membered bicyclic rings, 5- to 12-membered spiro bicycles, and 5- to 12-membered bridged rings. In certain embodiments, a cycloalkyl comprises three to ten carbon atoms. In other embodiments, a cycloalkyl comprises five to seven carbon atoms. The cycloalkyl may be attached to the rest of the molecule by a single bond. Examples of monocyclic cycloalkyls include, e.g., cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Polycyclic cycloalkyl radicals include, for example, adamantyl, spiropentane, norbornyl (i.e., bicyclo[2.2.1]heptanyl), decalinyl, 7,7 dimethyl bicyclo[2.2.1]heptanyl, bicyclo[1.1.1]pentanyl, and the like. [00262] The term "cycloalkenyl" refers to a saturated ring in which each atom of the ring is carbon and there is at least one double bond between two ring carbons. Cycloalkenyl may include monocyclic and polycyclic rings such as 3- to 10-membered monocyclic rings, 6- to 12-membered bicyclic rings, and 5- to 12-membered bridged rings. In other embodiments, a cycloalkenyl comprises five to seven carbon atoms. The cycloalkenyl may be attached to the rest of the molecule by a single bond. Examples of monocyclic cycloalkenyls include, e.g., cyclopentenyl, cyclohexenyl, cycloheptenyl, and cyclooctenyl. [00263] The term “halo” or, alternatively, “halogen” or “halide,” means fluoro, chloro, bromo or iodo. In some embodiments, halo is fluoro, chloro, or bromo. [00264] The term “haloalkyl” refers to an alkyl radical, as defined above, that is substituted by one or more halo radicals, for example, trifluoromethyl, dichloromethyl, bromomethyl, 2,2,2 trifluoroethyl, 1 chloromethyl 2 fluoroethyl, and the like. In some embodiments, the alkyl part of the haloalkyl radical is optionally further substituted as described herein. -126-
Attorney Docket No.54462-742.601 [00265] The term “heterocycle” as used herein refers to a saturated, unsaturated or aromatic ring comprising one or more heteroatoms. Exemplary heteroatoms include N, O, Si, P, B, and S atoms. Heterocycles include 3- to 10-membered monocyclic rings, 6- to 12-membered bicyclic rings, 5- to 12- membered spiro bicycles, and 5- to 12-membered bridged rings. A bicyclic heterocycle includes any combination of saturated, unsaturated and aromatic bicyclic rings, as valence permits. In an exemplary embodiment, an aromatic ring, e.g., pyridyl, may be fused to a saturated or unsaturated ring, e.g., cyclohexane, cyclopentane, morpholine, piperidine or cyclohexene. A bicyclic heterocycle includes any combination of ring sizes such as 4-5 fused ring systems, 5-5 fused ring systems, 5-6 fused ring systems, 6-6 fused ring systems, 5-7 fused ring systems, 6-7 fused ring systems, 5-8 fused ring systems, and 6-8 fused ring systems. A bicyclic heterocycle further includes spiro bicyclic rings, e.g., 5 to 12-membered spiro bicycles, such as 2-oxa-6-azaspiro[3.3]heptane. [00266] The term "heteroaryl" refers to a radical derived from a 5 to 18 membered aromatic ring radical that comprises two to seventeen carbon atoms and from one to six heteroatoms selected from nitrogen, oxygen and sulfur. As used herein, the heteroaryl radical is a monocyclic, bicyclic, tricyclic or tetracyclic ring system, wherein at least one of the rings in the ring system is aromatic, i.e., it contains a cyclic, delocalized (4n+2) π-electron system in accordance with the Hückel theory. Heteroaryl includes fused or bridged ring systems. The heteroatom(s) in the heteroaryl radical is optionally oxidized. One or more nitrogen atoms, if present, are optionally quaternized. The heteroaryl is attached to the rest of the molecule through any atom of the ring(s). Examples of heteroaryls include, but are not limited to, azepinyl, acridinyl, benzimidazolyl, benzindolyl, 1,3 benzodioxolyl, benzofuranyl, benzoxazolyl, benzo[d]thiazolyl, benzothiadiazolyl, benzo[b][1,4]dioxepinyl, benzo[b][1,4]oxazinyl, 1,4 benzodioxanyl, benzonaphthofuranyl, benzoxazolyl, benzodioxolyl, benzodioxinyl, benzopyranyl, benzopyranonyl, benzofuranyl, benzofuranonyl, benzothienyl (benzothiophenyl), benzothieno[3,2 d]pyrimidinyl, benzotriazolyl, benzo[4,6]imidazo[1,2 a]pyridinyl, carbazolyl, cinnolinyl, cyclopenta[d]pyrimidinyl, 6,7 dihydro 5H cyclopenta[4,5]thieno[2,3 d]pyrimidinyl, 5,6 dihydrobenzo[h]quinazolinyl, 5,6 dihydrobenzo[h]cinnolinyl, 6,7-dihydro-5H-benzo[6,7]cyclohepta[1,2-c]pyridazinyl, dibenzofuranyl, dibenzothiophenyl, furanyl, furanonyl, furo[3,2 c]pyridinyl, 5,6,7,8,9,10 hexahydrocycloocta[d]pyrimidinyl, 5,6,7,8,9,10 hexahydrocycloocta[d]pyridazinyl, 5,6,7,8,9,10 hexahydrocycloocta[d]pyridinyl, isothiazolyl, imidazolyl, indazolyl, indolyl, indazolyl, isoindolyl, indolinyl, isoindolinyl, isoquinolyl, indolizinyl, isoxazolyl, 5,8 methano 5,6,7,8 tetrahydroquinazolinyl, naphthyridinyl, 1,6 naphthyridinonyl, oxadiazolyl, 2 oxoazepinyl, oxazolyl, oxiranyl, 5,6,6a,7,8,9,10,10a octahydrobenzo[h]quinazolinyl, 1 phenyl 1H pyrrolyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyrazolo[3,4 d]pyrimidinyl, pyridinyl, pyrido[3,2 d]pyrimidinyl, pyrido[3,4 d]pyrimidinyl, pyrazinyl, pyrimidinyl, pyridazinyl, pyrrolyl, quinazolinyl, quinoxalinyl, quinolinyl, isoquinolinyl, tetrahydroquinolinyl, 5,6,7,8 tetrahydroquinazolinyl, 5,6,7,8 tetrahydrobenzo[4,5]thieno[2,3 d]pyrimidinyl, 6,7,8,9 tetrahydro 5H cyclohepta[4,5]thieno[2,3 d]pyrimidinyl, 5,6,7,8 tetrahydropyrido[4,5 c]pyridazinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, thieno[2,3 d]pyrimidinyl, thieno[3,2 d]pyrimidinyl, thieno[2,3 c]pyridinyl, and thiophenyl (i.e. thienyl). -127-
Attorney Docket No.54462-742.601 [00267] The term "heterocycloalkyl" refers to a saturated ring with carbon atoms and at least one heteroatom. Exemplary heteroatoms include N, O, Si, P, B, and S atoms. Heterocycloalkyl may include monocyclic and polycyclic rings such as 3- to 10-membered monocyclic rings, 6- to 12-membered bicyclic rings, 5- to 12-membered spiro bicycles, and 5- to 12-membered bridged rings. The heteroatoms in the heterocycloalkyl radical are optionally oxidized. One or more nitrogen atoms, if present, are optionally quaternized. The heterocycloalkyl is attached to the rest of the molecule through any atom of the heterocycloalkyl, valence permitting, such as any carbon or nitrogen atoms of the heterocycloalkyl. Examples of heterocycloalkyl radicals include, but are not limited to, dioxolanyl, thienyl[1,3]dithianyl, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2 oxopiperazinyl, 2 oxopiperidinyl, 2 oxopyrrolidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4 piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, trithianyl, tetrahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1 oxo thiomorpholinyl, 2-oxa-6-azaspiro[3.3]heptane, and 1,1 dioxo thiomorpholinyl. [00268] The term "heterocycloalkenyl" refers to an unsaturated ring with carbon atoms and at least one heteroatom and there is at least one double bond between two ring carbons. Heterocycloalkenyl does not include heteroaryl rings. Exemplary heteroatoms include N, O, Si, P, B, and S atoms. Heterocycloalkenyl may include monocyclic and polycyclic rings such as 3- to 10-membered monocyclic rings, 6- to 12-membered bicyclic rings, and 5- to 12-membered bridged rings. In other embodiments, a heterocycloalkenyl comprises five to seven ring atoms. The heterocycloalkenyl may be attached to the rest of the molecule by a single bond. Examples of monocyclic cycloalkenyls include, e.g., pyrroline (dihydropyrrole), pyrazoline (dihydropyrazole), imidazoline (dihydroimidazole), triazoline (dihydrotriazole), dihydrofuran, dihydrothiophene, oxazoline (dihydrooxazole), isoxazoline (dihydroisoxazole), thiazoline (dihydrothiazole), isothiazoline (dihydroisothiazole), oxadiazoline (dihydrooxadiazole), thiadiazoline (dihydrothiadiazole), dihydropyridine, tetrahydropyridine, dihydropyridazine, tetrahydropyridazine, dihydropyrimidine, tetrahydropyrimidine, dihydropyrazine, tetrahydropyrazine, pyran, dihydropyran, thiopyran, dihydrothiopyran, dioxine, dihydrodioxine, oxazine, dihydrooxazine, thiazine, and dihydrothiazine. [00269] The term “substituted” refers to moieties having substituents replacing a hydrogen on one or more carbons or substitutable heteroatoms, e.g., an NH or NH2 of a compound. It will be understood that “substitution” or “substituted with” includes the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, i.e., a compound which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc. In certain embodiments, substituted refers to moieties having substituents replacing two hydrogen atoms on the same carbon atom, such as substituting the two hydrogen atoms on a single carbon with an oxo, imino or thioxo group. As used herein, the term “substituted” is contemplated to include all permissible substituents of organic compounds. In a broad aspect, the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and non-aromatic substituents of organic compounds. The permissible substituents can be one or more and the same or different for appropriate organic compounds. -128-
Attorney Docket No.54462-742.601 [00270] In some embodiments, substituents may include any substituents described herein, for example: halogen, hydroxy, oxo (=O), thioxo (=S), cyano (-CN), nitro (-NO2), imino (=N-H), oximo (=N-OH), hydrazino (=N-NH2), -Rb ORa, -Rb OC(O) Ra, -Rb OC(O) ORa, -Rb OC(O) N(Ra)2, -Rb N(Ra)2, -Rb C(O)Ra, -Rb C(O)ORa, -Rb C(O)N(Ra)2, -Rb O Rc C(O)N(Ra)2, -Rb N(Ra)C(O)ORa, -Rb N(Ra)C(O)Ra, -Rb N(Ra)S(O)tRa (where t is 1 or 2), -Rb S(O)tRa (where t is 1 or 2), -Rb S(O)tORa (where t is 1 or 2), and -Rb S(O)tN(Ra)2 (where t is 1 or 2); and alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl, aralkynyl, cycloalkyl, cycloalkylalkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl, and heteroarylalkyl, any of which may be optionally substituted by alkyl, alkenyl, alkynyl, halogen, haloalkyl, haloalkenyl, haloalkynyl, oxo (=O), thioxo (=S), cyano (-CN), nitro (-NO2), imino (=N-H), oximo (=N- OH), hydrazine (=N-NH2), -Rb ORa, -Rb OC(O) Ra, -Rb OC(O) ORa, -Rb OC(O) N(Ra)2, -Rb N(Ra)2, - Rb C(O)Ra, -Rb C(O)ORa, -Rb C(O)N(Ra)2, -Rb O Rc C(O)N(Ra)2, -Rb N(Ra)C(O)ORa, -Rb N(Ra)C(O)Ra, -Rb N(Ra)S(O)tRa (where t is 1 or 2), -Rb S(O)tRa (where t is 1 or 2), -Rb S(O)tORa (where t is 1 or 2) and -Rb S(O)tN(Ra)2 (where t is 1 or 2); wherein each Ra is independently selected from hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl, or heteroarylalkyl, wherein each Ra, valence permitting, may be optionally substituted with alkyl, alkenyl, alkynyl, halogen, haloalkyl, haloalkenyl, haloalkynyl, oxo (=O), thioxo (=S), cyano (-CN), nitro (-NO2), imino (=N-H), oximo (=N-OH), hydrazine (=N-NH2), -Rb ORa, -Rb OC(O) Ra, -Rb OC(O) ORa, -Rb OC(O) N(Ra)2, -Rb N(Ra)2, -Rb C(O)Ra, -Rb C(O)ORa, -Rb C(O)N(Ra)2, -Rb O Rc C(O)N(Ra)2, -Rb N(Ra)C(O)ORa, -Rb N(Ra)C(O)Ra, -Rb N(Ra)S(O)tRa (where t is 1 or 2), -Rb S(O)tRa (where t is 1 or 2), -Rb S(O)tORa (where t is 1 or 2) and -Rb S(O)tN(Ra)2 (where t is 1 or 2); and wherein each Rb is independently selected from a direct bond or a straight or branched alkylene, alkenylene, or alkynylene chain, and each Rc is a straight or branched alkylene, alkenylene or alkynylene chain. [00271] Double bonds to oxygen atoms, such as oxo groups, are represented herein as both “=O” and “(O)”. Double bonds to nitrogen atoms are represented as both “=NR” and “(NR)”. Double bonds to sulfur atoms are represented as both “=S” and “(S)”. [00272] In some embodiments, a "derivative" polypeptide or peptide is one that is modified, for example, by glycosylation, pegylation, phosphorylation, sulfation, reduction/alkylation, acylation, chemical coupling, or mild formalin treatment. A derivative may also be modified to contain a detectable label, either directly or indirectly, including, but not limited to, a radioisotope, fluorescent, and enzyme label. [00273] Some embodiments refer to nucleic acid sequence information. It is contemplated that in some embodiments, thymine (T) may be interchanged with uracil (U), or vice versa. For example, some sequences in the sequence listing may recite Ts, but these may be replaced with Us in some embodiments. In some oligonucleotides with nucleic acid sequences that include uracil, the uracil may be replaced with thymine. Similarly, in some oligonucleotides with nucleic acid sequences that include thymine, the thymine may be replaced with uracil. In some embodiments, an oligonucleotide such as an siRNA comprises or consists of RNA. In some embodiments, the oligonucleotide may include DNA. For example, the oligonucleotide may include 2’ deoxyribonucleotides. An ASO may comprise or consist of -129-
Attorney Docket No.54462-742.601 DNA. To any extent that the sequence listing contradicts the disclosure in the specification, the specification takes precedence. [00274] Some aspects include sequences with nucleotide modifications or modified internucleoside linkages. Generally, and unless otherwise specified, Nf (e.g. Af, Cf, Gf, Tf, or Uf) refers to a 2’ fluoro- modified nucleoside, dN (e.g. dA, dC, dG, dT, or dU) refers to a 2’ deoxy nucleoside, n (e.g. a, c, g, t, or u) refers to a 2’ O-methyl modified nucleoside, and “s” refers to a phosphorothioate linkage. [00275] A pyrimidine may include cytosine (C), thymine (T), or uracil (U). A pyrimidine may include C or U. A pyrimidine may include C or T. A reference to a pyrimidine may include a nucleoside or nucleotide comprising the pyrimidine. A purine may include guanine (G) or adenine (A). A reference to a purine may include a nucleoside or nucleotide comprising a purine. [00276] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. VI. EXAMPLES Example 1: Functional Variants in GPAM Demonstrate Protective Associations for Non-Alcoholic Fatty Liver Disease, Alcoholic Liver Disease, Decreased Liver Fat Percentage and Decreased Blood Lipids [00277] Variants in GPAM were evaluated for associations with liver disease, liver fat percentage, liver function parameters, and blood lipid levels in approximately 452,000 individuals from the UK Biobank cohort. Variants evaluated included rs2792751, a common (AAF=0.73) missense variant (I43V); and rs57128949 a common (AAF=0.18) intergenic variant that is a GPAM mRNA expression quantitative trait locus (eQTL) associated with decreased GPAM mRNA expression in multiple tissues, including liver. Stepwise conditional analyses in multiple traits, as well as direct evaluation of linkage disequilibrium, confirmed that rs2792751 and rs57128949 are independent variants. Some details of these variants are shown in Table 3.
. rs57128949 eQTL 0.18 [00278] The analyses resulted in identification of associations for the individual GPAM variants and phenotypes. Applicant hypothesizes that individually these variants result in a decrease in the abundance and/or activity of the GPAM gene product, and that it is this loss of function that leads to the observed genetic associations. This hypothesis is supported by associations between the GPAM variants and increased levels of blood ketone bodies as measured by nuclear magnetic resonance in the UK Biobank, including 3-hydroxybutyrate, acetoacetate and acetone (Table 4). These results were consistent with observations in GPAM knockout mice, which demonstrate increased plasma ketone bodies, and with the known function of GPAM in triacylglycerol (TAG) metabolism. -130-
Attorney Docket No.54462-742.601 Table 4. GPAM variant blood ketone associations 3-Hydroxybutyrate Acetoacetate Acetone Variant (n=108,920) (n=110,462) (n=110,671) rs2 3 rs5 6 [00279 ple, there w
ere proec ve assoca ons w mu pe ver sease-reae ra s. varans are individually associated with decreased risk of non-alcoholic fatty liver disease (NAFLD), alcoholic liver disease, liver fibrosis and cirrhosis, decreased risk of sequelae of chronic liver disease such as esophageal varices and portal hypertension, and with decreased MRI-derived liver fat percentage (Table 5). GPAM variants are also associated with decreased blood levels of liver enzymes, including alanine aminotransferase (ALT), aspartate aminotransferase (AST) and alkaline phosphatase (ALP), and with decreased blood bilirubin (Table 6). Table 5. GPAM variant liver disease-related associations ase V rs2 8 rs5 3 n V rs2 9 rs57
. ↓. . - ↓. . ↓.02 Tbl 6 GPAM rint li r f ntin itin V ) eta rs2
. . . . . . . .003 rs57128949 1.94E-16 ↓-0.004 2.17E-06 ↓-0.001 4.79E-23 ↓-0.003 6.40E-08 ↓-0.002 [00280] GPAM variants are also associated with decreased LDL-cholesterol, total cholesterol and APOB, and with decreased use of ‘statin’ (HMG CoA reductase inhibitor) medications (Table 7). These protective associations with putative loss of function variants in GPAM across several related and distinct diseases and traits su t tht ihibiti f GPAM ld b th ti i th d related diseases.
P value Beta P value Beta rs2792751 1.09E-24 ↓-0.003 1.11E-35 ↓-0.002 -131-
Attorney Docket No.54462-742.601 rs57128949 1.85E-08 ↓-0.002 9.76E-13 ↓-0.002 APOB Statin Medication rs rs Example 2: Bioinfo
iRNAs to downmodulate expression of the GPAM mRNA [00281] Screening sets were defined based on bioinformatic analysis. Therapeutic siRNAs were designed to target human GPAM. Predicted specificity in human, rhesus monkey, cynomolgus monkey, mouse, rat, rabbit, and dog was determined for sense (S) and antisense (AS) strands. These were assigned a “specificity score” which considers the likelihood of unintended downregulation of any other transcript by full or partial complementarity of an siRNA strand (up to 2 mismatches within positions 2-18) as well as the number and positions of mismatches. Thus, off-target(s) transcripts for antisense and sense strands of each siRNA were identified. As identified, siRNAs with high specificity and a low number of predicted off-targets provided a benefit of increased targeting specificity. [00282] In addition to selecting siRNA sequences with high sequence specificity to GPAM mRNA, siRNA sequences within the seed region were analyzed for similarity to seed regions of known miRNAs. siRNAs can function in a miRNA like manner via base-pairing with complementary sequences within the 3’-UTR of mRNA molecules. The complementarity typically encompasses the 5‘-bases at positions 2-7 of the miRNA (seed region). To circumvent siRNAs to act via functional miRNA binding sites, siRNA strands containing natural miRNA seed regions can be avoided. Seed regions identified in miRNAs from human, mouse, rat, rhesus monkey, dog, rabbit, and pig are referred to as “conserved”. Combining the “specificity score” with miRNA seed analysis yielded a “specificity category”. This is divided into categories 1-4, with 1 having the highest specificity and 4 having the lowest specificity. Each strand of the siRNA is assigned to a specificity category. [00283] Analysis of the Genome Aggregation Database (gnomAD) to identify siRNAs targeting regions with known SNPs was also carried out to identify siRNAs that may be non-functional in individuals containing the SNP. Information regarding the positions of SNPs within the target sequence as well as minor allele frequency (MAF) in case data was obtained in this analysis. [00284] Initial analysis of the relevant GPAM mRNA sequence revealed few sequences that fulfil the specificity parameters and at the same time target GPAM mRNA in all the analyzed relevant species. Therefore, independent screening subsets were designed for the therapeutic siRNAs. [00285] The siRNAs in these subsets recognized at least the human GPAM sequences. Therefore, the siRNAs in these subsets can be used to target human GPAM in a therapeutic setting. [00286] The number of siRNA sequences derived from human GPAM mRNA (ENST00000348367.9, SEQ ID NO: 12867) without consideration of specificity or species cross-reactivity was 6354 (sense and antisense strand sequences included in SEQ ID NOS: 1-6354 and 6355-12708, respectively). -132-
Attorney Docket No.54462-742.601 [00287] Prioritizing sequences for target specificity, miRNA seed region sequences and SNPs as described above yields subset A. Subset A contains 1348 siRNAs whose base sequences are shown in Table 8. [00288] The above methods can be used to identify therapeutic siRNAs to downmodulate expression of the GPAM mRNA. Table 8. Sequences in siRNA subset A siRNA SEQ SEQ Nm ID Sense strand sequence (5´-3´) ID Antisense strand sequence (5´-3´) si G si U si G si CC si GU si GG si CC si CU si CG si CC si GC si AG si GG si CA si AC si AC si UA si AU si CC siR GU siR UG siR CA siR GC siR UG siR GU siR GG siR GG siR UC siR UU siR CA siR UC siR CU siR AA siR AA siR CU siR
GU siRNA 175 175 AUGAUUUGGGAAUUACACU 6529 AGUGUAAUUCCCAAAUCAU siRNA 176 176 UGAUUUGGGAAUUACACUU 6530 AAGUGUAAUUCCCAAAUCA -133-
Attorney Docket No.54462-742.601 siRNA 177 177 GAUUUGGGAAUUACACUUU 6531 AAAGUGUAAUUCCCAAAUC siRNA 179 179 UUUGGGAAUUACACUUUGU 6533 ACAAAGUGUAAUUCCCAAA siR CA siR UG siR GU siR AA siR CA siR CA siR UC siR AG siR AG siR UC siR GG siR UA siR AG siR AG siR CA siR AU siR CU siR UC siR UU siR AU siR UA siR GU siR CU siR GA siR AU siR CA siR AC siR GC siR CC siR GA siR UU siR CU siR UC siR UU siR UU siR CU siR GC siR GG siR AG siR UA siR UU siR AC siR CA siR
AC siRNA 401 401 UUACUCCUGCACUCCCCAG 6755 CUGGGGAGUGCAGGAGUAA siRNA 403 403 ACUCCUGCACUCCCCAGAG 6757 CUCUGGGGAGUGCAGGAGU -134-
Attorney Docket No.54462-742.601 siRNA 417 417 CAGAGCUGGGACAAAUUUU 6771 AAAAUUUGUCCCAGCUCUG siRNA 425 425 GGACAAAUUUUUCAACCCC 6779 GGGGUUGAAAAAUUUGUCC siR GU siR AA siR AA siR GA siR CU siR GG siR AG siR CA siR CC siR UU siR GU siR UG siR GU siR UG siR UU siR CU siR UC siR UG siR CG siR CC siR CA siR CC siR CA siR UG siR UU siR CU siR UC siR GU siR CG siR GU siR GA siR AG siR UA siR AU siR AA siR UU siR CU siR UC siR CU siR GC siR CU siR AU siR UU siR
CU siRNA 596 596 UGUGCUGAACAGCAGUAGA 6950 UCUACUGCUGUUCAGCACA siRNA 598 598 UGCUGAACAGCAGUAGAGU 6952 ACUCUACUGCUGUUCAGCA -135-
Attorney Docket No.54462-742.601 siRNA 601 601 UGAACAGCAGUAGAGUACA 6955 UGUACUCUACUGCUGUUCA siRNA 603 603 AACAGCAGUAGAGUACAAG 6957 CUUGUACUCUACUGCUGUU siR UC siR AG siR CA siR UU siR AU siR AG siR GC siR UG siR CU siR GC siR UG siR UU siR UG siR UU siR CU siR CU siR UG siR CA siR CC siR AA siR GG siR UG siR GU siR AG siR CA siR AC siR GA siR GA siR UG siR GU siR CG siR AU siR U siR UC siR U siR G siR AC siR CA siR AG siR UA siR GA siR UG siR UU siR
UG siRNA 820 820 ACAAAGGUCAACUUGAGAU 7174 AUCUCAAGUUGACCUUUGU siRNA 824 824 AGGUCAACUUGAGAUGGUU 7178 AACCAUCUCAAGUUGACCU -136-
Attorney Docket No.54462-742.601 siRNA 826 826 GUCAACUUGAGAUGGUUAA 7180 UUAACCAUCUCAAGUUGAC siRNA 834 834 GAGAUGGUUAAAGCUGCAA 7188 UUGCAGCUUUAACCAUCUC siR CU siR CC siR UU siR CU siR GC siR UG siR UU siR GU siR AG siR CA siR UC siR UC siR CG siR GG siR CA siR GA siR AG siR UA siR GA siR AU siR CU siR UC siR AU siR GA siR GG siR GG siR CA siR UU siR UG siR UU siR UG siR CA siR GC siR GA siR UG siR CC siR GA siR GG siR GA siR CU siR AC siR GG siR AG siR
CA siRNA 1001 1001 GAUCCAUAAGCUUGGGGGC 7355 GCCCCCAAGCUUAUGGAUC siRNA 1005 1005 CAUAAGCUUGGGGGCUUCU 7359 AGAAGCCCCCAAGCUUAUG -137-
Attorney Docket No.54462-742.601 siRNA 1006 1006 AUAAGCUUGGGGGCUUCUU 7360 AAGAAGCCCCCAAGCUUAU siRNA 1018 1018 GCUUCUUCAUACGACGAAG 7372 CUUCGUCGUAUGAAGAAGC siR AG siR GA siR AG siR AA siR GA siR UG siR AU siR CG siR UC siR GU siR CG siR UC siR UU siR CU siR UC siR UU siR UG siR CU siR AU siR GU siR UC siR AG siR GA siR CU siR CA siR AG siR GA siR CA siR CC siR CC siR AU siR UA siR AU siR UA siR CU siR AA siR UU siR AU siR AA siR CG siR GC siR UG siR AU siR
GA siRNA 1136 1136 CUUCCUGGAAGGCACACGU 7490 ACGUGUGCCUUCCAGGAAG siRNA 1140 1140 CUGGAAGGCACACGUUCUA 7494 UAGAACGUGUGCCUUCCAG -138-
Attorney Docket No.54462-742.601 siRNA 1141 1141 UGGAAGGCACACGUUCUAG 7495 CUAGAACGUGUGCCUUCCA siRNA 1142 1142 GGAAGGCACACGUUCUAGG 7496 CCUAGAACGUGUGCCUUCC siR CU siR GU siR CG siR UU siR UU siR UU siR AC siR AG siR GA siR AG siR AA siR AC siR GA siR CU siR CA siR UA siR CU siR UC siR AU siR UA siR GU siR AG siR AC siR AU siR GA siR GG siR UC siR AG siR CA siR AU siR UA siR UA siR AG siR AA siR CA siR CC siR UU siR AU siR GA siR GG siR AG siR UA siR AU siR
CA siRNA 1269 1269 GAUCGCAUUAUCGAAGGUC 7623 GACCUUCGAUAAUGCGAUC siRNA 1270 1270 AUCGCAUUAUCGAAGGUCA 7624 UGACCUUCGAUAAUGCGAU -139-
Attorney Docket No.54462-742.601 siRNA 1272 1272 CGCAUUAUCGAAGGUCACU 7626 AGUGACCUUCGAUAAUGCG siRNA 1279 1279 UCGAAGGUCACUACAAUGG 7633 CCAUUGUAGUGACCUUCGA siR UC siR CU siR AC siR GA siR GU siR AG siR AC siR UC siR UU siR GU siR AG siR CC siR CU siR GC siR A siR AC siR CA siR AC siR CU siR UU siR CC siR CA siR AA siR UA siR UA siR CU siR UU siR CA siR GU siR UU siR UU siR AU siR UU siR CU siR GG siR AG siR AG siR AA siR GA siR GG siR GG siR AG siR CC siR
UC siRNA 1474 1474 AGCAAGCGUUGUUACCAGC 7828 GCUGGUAACAACGCUUGCU siRNA 1476 1476 CAAGCGUUGUUACCAGCUA 7830 UAGCUGGUAACAACGCUUG -140-
Attorney Docket No.54462-742.601 siRNA 1477 1477 AAGCGUUGUUACCAGCUAU 7831 AUAGCUGGUAACAACGCUU siRNA 1478 1478 AGCGUUGUUACCAGCUAUA 7832 UAUAGCUGGUAACAACGCU siR GC siR CG siR AC siR AA siR CA siR AC siR GG siR AU siR CC siR AC siR CU siR UC siR GU siR UG siR GU siR CG siR GA siR GG siR AA siR UU siR GU siR UC siR AU siR CA siR UC siR AU siR GG siR AG siR GU siR UC siR CU siR UC siR AU siR UC siR UA siR AU siR AA siR AG siR UA siR AU siR UG siR CA siR AC siR
GA siRNA 1639 1639 GUGCCAUUAUGUCCACACA 7993 UGUGUGGACAUAAUGGCAC siRNA 1645 1645 UUAUGUCCACACACAUUGU 7999 ACAAUGUGUGUGGACAUAA -141-
Attorney Docket No.54462-742.601 siRNA 1647 1647 AUGUCCACACACAUUGUGG 8001 CCACAAUGUGUGUGGACAU siRNA 1650 1650 UCCACACACAUUGUGGCUU 8004 AAGCCACAAUGUGUGUGGA siR GG siR GU siR UG siR UG siR UG siR CU siR CU siR UU siR AU siR AG siR GA siR AG siR GA siR GG siR UG siR GU siR UC siR UC siR CC siR UU siR AC siR AG siR GA siR CA siR CC siR AA siR UG siR UA siR AG siR UU siR CA siR GA siR UG siR UA siR AU siR UG siR GU siR GG siR UG siR UG siR AG siR CA siR AC siR
GG siRNA 1891 1891 CAUCAGUCUUCGAACUCAA 8245 UUGAGUUCGAAGACUGAUG siRNA 1892 1892 AUCAGUCUUCGAACUCAAC 8246 GUUGAGUUCGAAGACUGAU -142-
Attorney Docket No.54462-742.601 siRNA 1894 1894 CAGUCUUCGAACUCAACUU 8248 AAGUUGAGUUCGAAGACUG siRNA 1896 1896 GUCUUCGAACUCAACUUCU 8250 AGAAGUUGAGUUCGAAGAC siR AA siR AA siR GU siR CU siR GC siR UG siR UU siR AC siR AA siR CA siR AA siR AA siR UA siR CA siR CC siR CC siR GC siR UG siR UA siR CA siR GC siR CA siR UG siR CU siR AC siR AA siR C siR CC siR UC siR CA siR CC siR CC siR CC siR UG siR GU siR AG siR CU siR UG siR UG siR C siR GC siR CA siR AG siR
GA siRNA 2078 2078 CUCCAAUGAAGGCACCAUC 8432 GAUGGUGCCUUCAUUGGAG siRNA 2082 2082 AAUGAAGGCACCAUCUCAC 8436 GUGAGAUGGUGCCUUCAUU -143-
Attorney Docket No.54462-742.601 siRNA 2093 2093 CAUCUCACUGCCUUGCCAG 8447 CUGGCAAGGCAGUGAGAUG siRNA 2105 2105 UUGCCAGACAUUUUACCAA 8459 UUGGUAAAAUGUCUGGCAA siR CU siR GU siR GA siR AG siR AU siR CU siR CC siR UC siR CU siR AU siR CC siR AG siR AA siR UG siR CU siR GU siR UC siR UG siR CC siR UC siR AU siR GG siR CC siR UC siR CU siR CC siR UU siR UG siR CU siR GC siR CG siR GU siR UC siR GG siR UG siR CU siR GC siR UC siR CU siR GC siR GG siR AC siR CU siR
CA siRNA 2436 2436 GUUCCAGAACCUGAGUAUC 8790 GAUACUCAGGUUCUGGAAC siRNA 2437 2437 UUCCAGAACCUGAGUAUCU 8791 AGAUACUCAGGUUCUGGAA -144-
Attorney Docket No.54462-742.601 siRNA 2440 2440 CAGAACCUGAGUAUCUGCA 8794 UGCAGAUACUCAGGUUCUG siRNA 2449 2449 AGUAUCUGCAAAAGUUGCA 8803 UGCAACUUUUGCAGAUACU siR GA siR CU siR AC siR AA siR CA siR GC siR UG siR UG siR UU siR UC siR UU siR CA siR CU siR AU siR GC siR CU siR AC siR GU siR UG siR AA siR CC siR UA siR AA siR GA siR CU siR AC siR CA siR UG siR CU siR GC siR AA siR GA siR AG siR UA siR GU siR GG siR AG siR GA siR UU siR CA siR GU siR GG siR UU siR
UA siRNA 2660 2660 AUAUAUUCUGAGUUUUGUG 9014 CACAAAACUCAGAAUAUAU siRNA 2661 2661 UAUAUUCUGAGUUUUGUGG 9015 CCACAAAACUCAGAAUAUA -145-
Attorney Docket No.54462-742.601 siRNA 2674 2674 UUGUGGUGCUGUAGGUAAC 9028 GUUACCUACAGCACCACAA siRNA 2676 2676 GUGGUGCUGUAGGUAACGU 9030 ACGUUACCUACAGCACCAC siR CC siR AC siR CA siR GC siR CA siR AC siR CG siR CA siR UG siR AU siR UC siR AU siR CA siR UC siR AC siR AG siR CU siR GU siR AG siR AG siR GA siR UG siR CU siR AG siR GC siR UC siR UU siR CC siR UC siR GU siR GC siR GG siR AG siR AG siR UA siR AU siR AA siR GA siR CG siR GC siR UG siR UU siR GU siR
AG siRNA 2920 2920 UCAUAAUCCGUAGACUACA 9274 UGUAGUCUACGGAUUAUGA siRNA 2921 2921 CAUAAUCCGUAGACUACAA 9275 UUGUAGUCUACGGAUUAUG -146-
Attorney Docket No.54462-742.601 siRNA 2922 2922 AUAAUCCGUAGACUACAAG 9276 CUUGUAGUCUACGGAUUAU siRNA 2924 2924 AAUCCGUAGACUACAAGAU 9278 AUCUUGUAGUCUACGGAUU siR AU siR GA siR GG siR CG siR CU siR CU siR CU siR CC siR UC siR AG siR AC siR CC siR UC siR UU siR GU siR UC siR AU siR GA siR AG siR AA siR UA siR GU siR AC siR GC siR CA siR CC siR AU siR AC siR CC siR UA siR UA siR AC siR CA siR UU siR GA siR AC siR AA siR AA siR AA siR UA siR GA siR AG siR GA siR
GC siRNA 3185 3185 CAUUUUUAAUGGGAGCACC 9539 GGUGCUCCCAUUAAAAAUG siRNA 3189 3189 UUUAAUGGGAGCACCUUUU 9543 AAAAGGUGCUCCCAUUAAA -147-
Attorney Docket No.54462-742.601 siRNA 3190 3190 UUAAUGGGAGCACCUUUUA 9544 UAAAAGGUGCUCCCAUUAA siRNA 3191 3191 UAAUGGGAGCACCUUUUAU 9545 AUAAAAGGUGCUCCCAUUA siR UU siR CA siR CC siR AA siR AG siR CA siR CC siR CA siR UC siR UA siR AU siR AU siR GA siR AC siR AG siR CA siR AA siR GC siR GU siR UG siR CU siR UG siR UU siR AU siR UA siR AU siR AA siR UA siR AA siR AA siR CU siR CC siR CC siR UU siR UG siR AA siR AU siR CC siR UA siR AU siR AA siR AG siR UC siR
UU siRNA 3409 3409 UUGGCCAGAAAACUGGUGU 9763 ACACCAGUUUUCUGGCCAA siRNA 3411 3411 GGCCAGAAAACUGGUGUUG 9765 CAACACCAGUUUUCUGGCC -148-
Attorney Docket No.54462-742.601 siRNA 3425 3425 UGUUGAAGGCUUUUGCUCA 9779 UGAGCAAAAGCCUUCAACA siRNA 3429 3429 GAAGGCUUUUGCUCAUAUA 9783 UAUAUGAGCAAAAGCCUUC siR CU siR AG siR GC siR AG siR AU siR UA siR UU siR CU siR CA siR AA siR AA siR GA siR UG siR UU siR AU siR UU siR AU siR AA siR AA siR GG siR AA siR AA siR AC siR AG siR CG siR GA siR UG siR GU siR GG siR GG siR GU siR CU siR CA siR GA siR AU siR GA siR AG siR GA siR GG siR UU siR AU siR AA siR AA siR
GA siRNA 3595 3595 CCUAACUUGAUUAGCUUGA 9949 UCAAGCUAAUCAAGUUAGG siRNA 3598 3598 AACUUGAUUAGCUUGAGCU 9952 AGCUCAAGCUAAUCAAGUU -149-
Attorney Docket No.54462-742.601 siRNA 3599 3599 ACUUGAUUAGCUUGAGCUG 9953 CAGCUCAAGCUAAUCAAGU siRNA 3606 3606 UAGCUUGAGCUGACAGACU 9960 AGUCUGUCAGCUCAAGCUA siR GC siR CA siR CU siR UG siR GU siR UC siR CC siR AA siR AC siR AG siR CA siR GC siR GU siR UG siR CA siR AC siR CA siR GC siR GA siR UG siR AC siR CA siR CC siR AC siR GG siR GG siR UG siR GU siR AG siR GA siR AC siR GC siR UG siR AG siR CU siR AU siR CA siR GC siR AC siR CA siR CC siR CA siR GC siR
GG siRNA 3766 3766 CUACUGACUGGUAAUGGUU 10120 AACCAUUACCAGUCAGUAG siRNA 3771 3771 GACUGGUAAUGGUUAGAGG 10125 CCUCUAACCAUUACCAGUC -150-
Attorney Docket No.54462-742.601 siRNA 3773 3773 CUGGUAAUGGUUAGAGGCA 10127 UGCCUCUAACCAUUACCAG siRNA 3780 3780 UGGUUAGAGGCAUUUAUGG 10134 CCAUAAAUGCCUCUAACCA siR AA siR CA siR AA siR GU siR AU siR AA siR AU siR CC siR UA siR AU siR GC siR GG siR GU siR GG siR AA siR UA siR AU siR CA siR UG siR CU siR CA siR AC siR UG siR AC siR UG siR CC siR CC siR CA siR CA siR UU siR UU siR UU siR GU siR GA siR AG siR CU siR AC siR AG siR AA siR AG siR UA siR AU siR AA siR
GG siRNA 4058 4058 CAGAUGAGUGUUACAUAGA 10412 UCUAUGUAACACUCAUCUG siRNA 4073 4073 UAGAUUCUUUGAAUUUAGU 10427 ACUAAAUUCAAAGAAUCUA -151-
Attorney Docket No.54462-742.601 siRNA 4087 4087 UUAGUAUAAAAGUACUGAG 10441 CUCAGUACUUUUAUACUAA siRNA 4091 4091 UAUAAAAGUACUGAGAAUU 10445 AAUUCUCAGUACUUUUAUA siR UU siR UA siR AG siR UU siR CA siR AC siR UG siR UC siR UA siR CU siR UA siR C siR U siR CC siR UC siR AU siR UA siR UA siR GG siR CA siR CA siR GG siR GA siR AU siR AC siR GA siR AU siR AC siR CU siR AC siR AA siR CA siR AU siR AA siR AU siR AA siR AA siR UA siR UC siR UU siR CU siR UU siR UA siR
GU siRNA 4428 4428 GGAUACCCAGGGAGUCUUG 10782 CAAGACUCCCUGGGUAUCC siRNA 4429 4429 GAUACCCAGGGAGUCUUGG 10783 CCAAGACUCCCUGGGUAUC -152-
Attorney Docket No.54462-742.601 siRNA 4430 4430 AUACCCAGGGAGUCUUGGG 10784 CCCAAGACUCCCUGGGUAU siRNA 4437 4437 GGGAGUCUUGGGUGUUCCU 10791 AGGAACACCCAAGACUCCC siR AC siR AC siR GC siR UG siR GU siR AG siR CA siR UA siR UU siR AU siR AA siR UC siR AU siR AA siR UA siR GU siR UU siR CU siR GA siR GU siR GG siR AA siR UA siR AU siR AA siR UG siR UU siR UC siR CC siR UC siR AG siR GA siR AG siR CG siR CA siR CA siR AG siR CA siR GC siR AG siR UU siR CU siR CC siR
AA siRNA 4666 4666 UUGUUUUCUAGAAGUACGU 11020 ACGUACUUCUAGAAAACAA siRNA 4667 4667 UGUUUUCUAGAAGUACGUU 11021 AACGUACUUCUAGAAAACA -153-
Attorney Docket No.54462-742.601 siRNA 4669 4669 UUUUCUAGAAGUACGUUCA 11023 UGAACGUACUUCUAGAAAA siRNA 4670 4670 UUUCUAGAAGUACGUUCAG 11024 CUGAACGUACUUCUAGAAA siR AA siR GA siR AG siR CU siR GU siR CU siR AA siR CA siR AC siR UA siR AU siR AU siR AG siR GA siR GA siR GA siR GU siR AA siR UA siR GU siR CA siR UU siR AU siR UC siR CU siR GA siR GA siR UU siR AC siR UA siR GA siR GU siR CA siR UA siR AU siR UU siR CU siR GC siR UU siR CA siR UC siR CU siR AG siR
AA siRNA 4942 4942 GAUAGCACCGUUUUGCUAA 11296 UUAGCAAAACGGUGCUAUC siRNA 4943 4943 AUAGCACCGUUUUGCUAAA 11297 UUUAGCAAAACGGUGCUAU -154-
Attorney Docket No.54462-742.601 siRNA 4947 4947 CACCGUUUUGCUAAAAGAU 11301 AUCUUUUAGCAAAACGGUG siRNA 4948 4948 ACCGUUUUGCUAAAAGAUA 11302 UAUCUUUUAGCAAAACGGU siR GG siR UG siR CC siR GC siR AA siR GA siR AU siR UA siR CU siR UA siR UU siR GU siR UG siR GU siR AU siR AA siR UA siR AA siR UA siR UG siR CU siR AC siR AA siR UA siR UA siR AU siR GU siR GG siR CC siR AC siR UU siR AA siR UU siR UU siR CA siR CU siR UC siR AA siR CA siR CA siR CC siR GU siR UA siR
AC siRNA 5246 5246 GGGAAAUGUGUAGAACUGU 11600 ACAGUUCUACACAUUUCCC siRNA 5251 5251 AUGUGUAGAACUGUUAACU 11605 AGUUAACAGUUCUACACAU -155-
Attorney Docket No.54462-742.601 siRNA 5279 5279 UCGAGUCUUCCUUCUGGAA 11633 UUCCAGAAGGAAGACUCGA siRNA 5301 5301 GUUAAAUUUCACAAAGUCA 11655 UGACUUUGUGAAAUUUAAC siR UG siR UU siR UG siR AU siR AU siR UG siR AU siR CA siR CU siR CU siR AU siR UU siR GG siR UG siR GC siR GA siR GG siR UA siR CA siR CA siR AA siR UA siR CA siR UU siR GU siR GG siR GU siR GG siR CA siR GU siR AA siR UA siR GU siR UG siR AU siR CA siR GC siR UG siR GU siR AG siR CU siR GC siR CG siR
CU siRNA 5527 5527 GUAAGGGCUUGGCAUCCGG 11881 CCGGAUGCCAAGCCCUUAC siRNA 5528 5528 UAAGGGCUUGGCAUCCGGU 11882 ACCGGAUGCCAAGCCCUUA -156-
Attorney Docket No.54462-742.601 siRNA 5529 5529 AAGGGCUUGGCAUCCGGUA 11883 UACCGGAUGCCAAGCCCUU siRNA 5531 5531 GGGCUUGGCAUCCGGUAGU 11885 ACUACCGGAUGCCAAGCCC siR CC siR GC siR AA siR CA siR UG siR AU siR GA siR GG siR AC siR CU siR AC siR AG siR CA siR AG siR GG siR CU siR GC siR CA siR GC siR GG siR GG siR UU siR AG siR UA siR AA siR GA siR AG siR GA siR AA siR CA siR AU siR AG siR AA siR UC siR UU siR GG siR AG siR UG siR GU siR UA siR CA siR UG siR AU siR
UU siRNA 5661 5661 ACACUAUGUUAGAUAGUUC 12015 GAACUAUCUAACAUAGUGU siRNA 5662 5662 CACUAUGUUAGAUAGUUCU 12016 AGAACUAUCUAACAUAGUG -157-
Attorney Docket No.54462-742.601 siRNA 5663 5663 ACUAUGUUAGAUAGUUCUU 12017 AAGAACUAUCUAACAUAGU siRNA 5664 5664 CUAUGUUAGAUAGUUCUUU 12018 AAAGAACUAUCUAACAUAG siR AU siR AG siR AA siR AA siR UA siR UU siR CU siR UC siR GU siR UU siR GU siR CC siR CA siR UG siR AG siR CC siR CC siR AU siR CA siR GC siR UG siR AU siR AC siR UA siR UU siR GG siR CU siR AC siR AC siR CA siR CC siR GC siR CU siR CA siR CA siR CU siR UU siR UU siR UU siR AU siR UA siR UA siR CA siR
AC siRNA 5812 5812 UAGGUGAUCGGAGCUCUUU 12166 AAAGAGCUCCGAUCACCUA siRNA 5813 5813 AGGUGAUCGGAGCUCUUUC 12167 GAAAGAGCUCCGAUCACCU -158-
Attorney Docket No.54462-742.601 siRNA 5817 5817 GAUCGGAGCUCUUUCCUUU 12171 AAAGGAAAGAGCUCCGAUC siRNA 5819 5819 UCGGAGCUCUUUCCUUUGA 12173 UCAAAGGAAAGAGCUCCGA siR CG siR GA siR AA siR CA siR CU siR GC siR AG siR AA siR AA siR AA siR GU siR AG siR UC siR AU siR CA siR CC siR AA siR AU siR UA siR AU siR GA siR GG siR UG siR CU siR UC siR AU siR UA siR AA siR CA siR AC siR AA siR UA siR CU siR GU siR AU siR CA siR UC siR GU siR UG siR CU siR CC siR UC siR GG siR
GA siRNA 6007 6007 GUUGAGGUUUCUAAGACUU 12361 AAGUCUUAGAAACCUCAAC siRNA 6010 6010 GAGGUUUCUAAGACUUACU 12364 AGUAAGUCUUAGAAACCUC -159-
Attorney Docket No.54462-742.601 siRNA 6012 6012 GGUUUCUAAGACUUACUAU 12366 AUAGUAAGUCUUAGAAACC siRNA 6016 6016 UCUAAGACUUACUAUGGGC 12370 GCCCAUAGUAAGUCUUAGA siR UA siR UA siR AU siR CC siR UA siR UA siR UC siR UU siR GG siR UC siR CU siR GG siR AU siR CA siR CA siR UC siR GU siR AG siR AA siR UA siR AU siR AA siR GA siR UU siR UU siR CG siR AA siR CA siR CU siR CC siR AC siR UU siR AU siR CA siR UU siR UU siR UU siR CA siR AC siR AG siR GA siR CU siR UC siR
GU siRNA 6239 6239 AAGGUACUGUGAAAUAACU 12593 AGUUAUUUCACAGUACCUU siRNA 6243 6243 UACUGUGAAAUAACUGCGA 12597 UCGCAGUUAUUUCACAGUA -160-
Attorney Docket No.54462-742.601 siRNA 6244 6244 ACUGUGAAAUAACUGCGAU 12598 AUCGCAGUUAUUUCACAGU siRNA 6245 6245 CUGUGAAAUAACUGCGAUU 12599 AAUCGCAGUUAUUUCACAG siR CA siR CA siR GC siR CA siR CA siR AG siR UC siR AA siR AA siR CA siR UG siR AA
[00289] The siRNAs in subset A had the following characteristics: Cross-reactivity: With 19mer in human GPAM mRNA; Specificity category: For human: AS2 or better, SS3 or better; and miRNA seeds: AS+SS strand: seed region not conserved in human, mouse, and rat and not present in >4 species; Off- target frequency: ≤30 human off-targets matched with 2 mismatches in antisense strand; and SNPs: siRNA target sites do not harbor SNPs with a MAF ≥ 1% (pos.2-18.) [00290] The siRNA sequences in subset A were selected for more stringent specificity to yield subset B. Subset B included the following 1344 siRNAs: 13, 18, 23, 26, 28, 54, 62, 79, 81, 82, 83, 84, 88, 90, 91, 94, 95, 96, 98, 100, 101, 106, 107, 108, 109, 110, 111, 113, 114, 118, 119, 127, 161, 162, 170, 173, 175, 176, 177, 179, 181, 190, 191, 194, 202, 206, 207, 211, 216, 218, 221, 232, 241, 246, 247, 257, 260, 261, 262, 263, 264, 265, 267, 275, 278, 279, 280, 284, 303, 331, 354, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 370, 386, 397, 401, 403, 417, 425, 427, 432, 435, 436, 444, 450, 454, 457, 458, 487, 493, 494, 495, 496, 497, 498, 499, 501, 506, 507, 510, 511, 515, 517, 518, 519, 520, 521, 522, 532, 536, 537, 542, 543, 544, 547, 548, 549, 550, 551, 554, 562, 564, 565, 596, 598, 601, 603, 613, 643, 644, 646, 647, 664, 671, 672, 673, 674, 675, 676, 679, 681, 683, 703, 723, 730, 731, 733, 736, 737, 738, 739, 740, 741, 742, 744, 745, 746, 748, 753, 756, 760, 765, 766, 770, 771, 777, 781, 790, 809, 814, 819, 820, 824, 826, 834, 835, 839, 843, 845, 846, 850, 851, 852, 853, 854, 855, 857, 859, 867, 874, 878, 879, 880, 887, 889, 891, 892, 893, 894, 895, 896, 933, 939, 944, 945, 956, 959, 960, 963, 964, 966, 974, 984, 991, 993, 994, 997, 998, 1000, 1001, 1005, 1006, 1018, 1019, 1021, 1022, 1023, 1024, 1025, 1026, 1029, 1030, 1031, 1032, 1033, 1034, 1035, 1044, 1046, 1048, 1052, 1054, 1058, 1065, 1071, 1072, 1079, 1084, 1086, 1087, 1091, 1092, 1093, 1096, 1097, 1098, 1099, 1100, 1102, 1105, 1106, 1111, 1113, 1121, 1122, 1134, 1135, 1136, 1140, 1141, 1142, 1145, 1151, 1152, 1166, 1167, 1169, 1177, 1180, 1181, 1191, 1194, 1196, 1197, 1199, 1202, 1207, 1208, 1209, 1210, 1211, 1212, 1213, 1217, 1230, 1231, 1233, 1236, 1241, 1243, 1245, 1246, 1249, 1252, 1255, 1256, 1257, 1259, 1260, 1263, 1264, 1265, 1266, 1267, 1268, 1269, 1270, 1272, 1279, 1281, 1283, 1285, 1286, 1288, 1289, 1297, 1299, 1300, 1301, 1305, 1308, 1329, 1330, 1333, 1339, 1340, 1341, 1343, 1346, 1350, 1352, 1354, 1355, 1358, 1359, 1361, 1363, 1367, 1373, 1374, 1426, 1432, 1434, 1436, 1461, 1464, 1466, 1467, 1468, 1469, 1470, 1472, 1473, 1474, 1476, 1477, 1478, 1479, 1480, 1481, 1482, 1483, 1484, 1488, 1525, 1530, 1531, 1533, 1534, 1537, 1538, 1539, 1540, 1542, 1543, 1546, 1565, -161-
Attorney Docket No.54462-742.601 1566, 1569, 1570, 1571, 1572, 1574, 1577, 1578, 1580, 1582, 1584, 1586, 1600, 1608, 1613, 1614, 1615, 1617, 1618, 1619, 1622, 1625, 1634, 1635, 1639, 1645, 1647, 1650, 1651, 1655, 1656, 1686, 1688, 1689, 1693, 1697, 1702, 1704, 1705, 1706, 1707, 1708, 1709, 1710, 1733, 1736, 1742, 1744, 1746, 1753, 1754, 1757, 1779, 1784, 1786, 1795, 1818, 1824, 1829, 1831, 1832, 1868, 1869, 1871, 1872, 1873, 1877, 1880, 1885, 1886, 1887, 1890, 1891, 1892, 1894, 1896, 1899, 1911, 1915, 1917, 1918, 1919, 1920, 1926, 1930, 1934, 1938, 1939, 1940, 1945, 1946, 1949, 1950, 1955, 1957, 1962, 1963, 1973, 1975, 1976, 1977, 1978, 1982, 1992, 1993, 1996, 1997, 1999, 2001, 2006, 2007, 2008, 2010, 2012, 2017, 2055, 2067, 2076, 2077, 2078, 2082, 2093, 2105, 2110, 2112, 2125, 2126, 2131, 2141, 2142, 2143, 2146, 2158, 2160, 2166, 2167, 2170, 2171, 2182, 2187, 2190, 2192, 2193, 2199, 2205, 2294, 2295, 2296, 2297, 2299, 2301, 2302, 2303, 2304, 2314, 2324, 2332, 2340, 2344, 2345, 2366, 2367, 2378, 2407, 2415, 2427, 2435, 2436, 2437, 2440, 2449, 2453, 2461, 2462, 2463, 2464, 2465, 2466, 2468, 2486, 2494, 2496, 2498, 2504, 2507, 2511, 2515, 2518, 2523, 2524, 2557, 2561, 2564, 2574, 2575, 2597, 2600, 2603, 2618, 2619, 2620, 2626, 2627, 2628, 2629, 2630, 2631, 2632, 2633, 2635, 2637, 2641, 2642, 2649, 2656, 2660, 2661, 2674, 2676, 2678, 2679, 2680, 2681, 2683, 2684, 2692, 2702, 2708, 2711, 2713, 2725, 2726, 2727, 2740, 2816, 2818, 2826, 2829, 2834, 2855, 2872, 2878, 2880, 2883, 2886, 2896, 2898, 2899, 2905, 2906, 2907, 2909, 2910, 2911, 2912, 2913, 2914, 2915, 2916, 2917, 2918, 2919, 2920, 2921, 2922, 2924, 2925, 2926, 2927, 2928, 2931, 2939, 3003, 3004, 3005, 3007, 3033, 3046, 3047, 3048, 3049, 3052, 3054, 3055, 3056, 3057, 3058, 3059, 3073, 3078, 3080, 3081, 3086, 3090, 3093, 3097, 3100, 3106, 3111, 3131, 3159, 3162, 3163, 3164, 3165, 3166, 3168, 3169, 3172, 3181, 3185, 3189, 3190, 3191, 3192, 3194, 3195, 3205, 3219, 3233, 3234, 3238, 3239, 3241, 3244, 3246, 3247, 3265, 3268, 3269, 3274, 3305, 3316, 3317, 3318, 3321, 3322, 3323, 3324, 3325, 3326, 3327, 3330, 3331, 3333, 3334, 3338, 3341, 3358, 3365, 3370, 3374, 3380, 3382, 3383, 3388, 3404, 3406, 3409, 3411, 3425, 3429, 3431, 3434, 3439, 3440, 3445, 3446, 3447, 3452, 3454, 3464, 3465, 3466, 3467, 3468, 3470, 3480, 3481, 3487, 3498, 3503, 3504, 3508, 3516, 3518, 3520, 3522, 3523, 3524, 3526, 3537, 3556, 3559, 3563, 3571, 3572, 3574, 3575, 3576, 3583, 3584, 3591, 3593, 3594, 3595, 3598, 3599, 3606, 3614, 3616, 3620, 3646, 3647, 3656, 3659, 3662, 3667, 3670, 3671, 3672, 3674, 3677, 3682, 3683, 3684, 3699, 3701, 3704, 3709, 3710, 3711, 3714, 3715, 3716, 3717, 3718, 3719, 3731, 3733, 3734, 3740, 3746, 3749, 3752, 3753, 3757, 3758, 3759, 3761, 3763, 3765, 3766, 3771, 3773, 3780, 3808, 3810, 3829, 3832, 3836, 3840, 3842, 3845, 3848, 3849, 3853, 3854, 3859, 3861, 3863, 3864, 3865, 3866, 3871, 3874, 3896, 3898, 3905, 3926, 3931, 3933, 3934, 3986, 3991, 3995, 3996, 3997, 3998, 4004, 4005, 4010, 4011, 4016, 4019, 4022, 4024, 4025, 4053, 4057, 4058, 4073, 4087, 4091, 4095, 4099, 4101, 4106, 4115, 4116, 4142, 4146, 4148, 4149, 4151, 4179, 4180, 4186, 4197, 4207, 4211, 4218, 4220, 4227, 4256, 4262, 4265, 4319, 4324, 4325, 4327, 4330, 4333, 4334, 4335, 4336, 4361, 4377, 4381, 4383, 4384, 4385, 4389, 4400, 4401, 4403, 4418, 4419, 4428, 4429, 4430, 4437, 4441, 4448, 4467, 4468, 4478, 4479, 4506, 4508, 4510, 4511, 4512, 4517, 4518, 4519, 4520, 4521, 4525, 4526, 4529, 4531, 4532, 4535, 4536, 4537, 4538, 4540, 4541, 4543, 4548, 4549, 4551, 4552, 4555, 4564, 4577, 4600, 4602, 4603, 4604, 4615, 4621, 4623, 4663, 4665, 4666, 4667, 4669, 4670, 4671, 4672, 4673, 4675, 4681, 4687, 4694, 4695, 4708, 4709, 4710, 4713, 4718, 4723, 4725, 4727, 4732, 4734, 4735, 4737, 4768, 4771, 4772, 4804, 4805, 4812, 4814, 4821, 4823, 4825, 4830, 4838, 4844, 4856, 4873, 4917, 4918, 4919, 4929, 4931, 4932, 4934, 4936, 4937, 4942, 4943, 4947, 4948, 4949, 4973, 4993, 4994, 4996, 4997, 5002, 5003, 5005, 5009, 5011, 5012, 5013, 5016, 5031, -162-
Attorney Docket No.54462-742.601 5036, 5037, 5039, 5040, 5042, 5043, 5044, 5046, 5047, 5052, 5053, 5067, 5082, 5093, 5101, 5125, 5156, 5162, 5168, 5170, 5192, 5194, 5202, 5205, 5218, 5233, 5240, 5242, 5244, 5246, 5251, 5279, 5301, 5312, 5314, 5318, 5340, 5349, 5353, 5359, 5360, 5364, 5385, 5395, 5403, 5411, 5413, 5417, 5421, 5422, 5430, 5432, 5441, 5462, 5463, 5477, 5485, 5486, 5487, 5497, 5498, 5500, 5505, 5507, 5508, 5509, 5510, 5512, 5513, 5514, 5515, 5516, 5517, 5521, 5522, 5523, 5526, 5527, 5528, 5529, 5531, 5532, 5533, 5535, 5536, 5539, 5540, 5541, 5542, 5545, 5547, 5548, 5556, 5557, 5560, 5565, 5567, 5568, 5572, 5573, 5574, 5575, 5578, 5580, 5581, 5601, 5603, 5604, 5605, 5608, 5610, 5614, 5617, 5618, 5622, 5623, 5625, 5626, 5630, 5631, 5633, 5643, 5650, 5651, 5660, 5661, 5662, 5663, 5664, 5673, 5679, 5680, 5681, 5682, 5683, 5687, 5688, 5689, 5693, 5694, 5696, 5701, 5712, 5714, 5716, 5718, 5724, 5727, 5728, 5733, 5734, 5739, 5740, 5741, 5746, 5748, 5749, 5751, 5752, 5753, 5754, 5763, 5768, 5782, 5798, 5800, 5801, 5802, 5803, 5805, 5807, 5810, 5811, 5812, 5813, 5817, 5819, 5820, 5830, 5833, 5835, 5839, 5849, 5865, 5866, 5867, 5868, 5872, 5873, 5875, 5891, 5892, 5902, 5917, 5959, 5964, 5965, 5966, 5967, 5968, 5971, 5972, 5973, 5974, 5977, 5983, 5984, 5986, 5987, 5988, 5990, 5992, 5993, 5994, 5995, 5996, 5997, 5998, 5999, 6001, 6005, 6007, 6010, 6012, 6016, 6018, 6028, 6029, 6032, 6056, 6061, 6063, 6065, 6067, 6070, 6071, 6078, 6098, 6113, 6132, 6133, 6134, 6136, 6137, 6138, 6139, 6141, 6142, 6145, 6146, 6148, 6169, 6170, 6177, 6178, 6179, 6184, 6189, 6192, 6204, 6205, 6209, 6211, 6212, 6219, 6220, 6228, 6229, 6234, 6239, 6243, 6244, 6245, 6246, 6248, 6258, 6267, 6282, 6290, 6296, 6299, 6300, 6314, 6330, and 6349. [00291] The siRNAs in subset B had the following characteristics: Cross-reactivity: With 19mer in human GPAM mRNA; Specificity category: For human: AS2 or better, SS3 or better; miRNA seeds: AS+SS strand: seed region not conserved in human, mouse, and rat and not present in >4 species; Off- target frequency: ≤20 human off-targets matched with 2 mismatches in antisense strand; and SNPs: siRNA target sites do not harbor SNPs with a MAF ≥ 1% (pos.2-18). [00292] The siRNA sequences in subset B were further selected for absence of seed regions in the AS strand that are identical to a seed region of known human miRNA to yield subset C. Subset C included the following 931 siRNAs: 18, 23, 62, 79, 81, 82, 83, 84, 88, 90, 94, 95, 96, 98, 101, 106, 107, 108, 110, 113, 114, 118, 119, 127, 173, 175, 190, 191, 194, 207, 211, 218, 221, 232, 241, 257, 260, 261, 262, 263, 264, 265, 278, 280, 284, 331, 354, 357, 358, 359, 360, 361, 363, 364, 365, 386, 432, 435, 444, 450, 454, 458, 487, 493, 494, 495, 496, 497, 498, 499, 501, 506, 507, 515, 517, 518, 519, 520, 521, 537, 542, 543, 547, 549, 550, 551, 554, 562, 564, 565, 596, 601, 603, 613, 643, 646, 647, 664, 671, 673, 674, 675, 679, 681, 683, 703, 730, 733, 736, 737, 741, 742, 745, 746, 748, 753, 756, 760, 770, 777, 781, 790, 814, 819, 826, 839, 843, 845, 846, 850, 852, 854, 855, 857, 859, 867, 874, 878, 879, 887, 889, 891, 892, 893, 894, 895, 896, 933, 939, 944, 956, 959, 963, 966, 974, 991, 993, 994, 997, 998, 1006, 1018, 1019, 1024, 1025, 1026, 1029, 1030, 1031, 1032, 1033, 1035, 1044, 1046, 1052, 1054, 1058, 1065, 1071, 1079, 1084, 1086, 1087, 1092, 1093, 1097, 1098, 1099, 1100, 1105, 1106, 1111, 1113, 1135, 1136, 1140, 1145, 1151, 1152, 1166, 1169, 1180, 1181, 1191, 1194, 1196, 1197, 1199, 1202, 1207, 1208, 1209, 1210, 1211, 1212, 1230, 1241, 1243, 1246, 1252, 1255, 1256, 1257, 1259, 1260, 1263, 1264, 1265, 1266, 1267, 1268, 1269, 1285, 1286, 1288, 1289, 1297, 1300, 1308, 1330, 1333, 1339, 1340, 1341, 1343, 1346, 1352, 1354, 1355, 1358, 1359, 1361, 1363, 1367, 1373, 1374, 1426, 1432, 1434, 1436, 1461, 1464, 1466, 1467, 1468, 1470, 1472, 1473, 1476, 1477, 1479, 1480, 1481, 1482, 1484, 1525, 1530, 1531, 1533, 1534, 1537, 1538, 1539, 1543, -163-
Attorney Docket No.54462-742.601 1546, 1565, 1566, 1569, 1571, 1577, 1578, 1580, 1582, 1584, 1586, 1600, 1608, 1613, 1617, 1618, 1619, 1625, 1634, 1635, 1645, 1647, 1651, 1655, 1686, 1689, 1702, 1704, 1705, 1706, 1708, 1710, 1742, 1753, 1757, 1779, 1786, 1795, 1824, 1831, 1868, 1869, 1871, 1873, 1877, 1880, 1885, 1886, 1887, 1890, 1891, 1894, 1899, 1917, 1919, 1920, 1926, 1930, 1938, 1945, 1946, 1950, 1955, 1957, 1962, 1963, 1973, 1978, 1982, 1997, 1999, 2008, 2010, 2012, 2017, 2055, 2067, 2077, 2078, 2082, 2093, 2105, 2110, 2125, 2126, 2131, 2141, 2142, 2166, 2167, 2170, 2171, 2182, 2187, 2192, 2193, 2294, 2295, 2299, 2301, 2303, 2304, 2314, 2332, 2340, 2345, 2367, 2407, 2427, 2435, 2436, 2437, 2440, 2453, 2462, 2463, 2464, 2465, 2466, 2486, 2494, 2496, 2504, 2511, 2515, 2518, 2524, 2574, 2575, 2618, 2620, 2627, 2628, 2629, 2630, 2631, 2632, 2633, 2635, 2637, 2660, 2674, 2676, 2678, 2679, 2680, 2681, 2708, 2713, 2725, 2726, 2727, 2808, 2826, 2855, 2872, 2883, 2886, 2896, 2898, 2899, 2905, 2906, 2907, 2909, 2910, 2911, 2912, 2913, 2915, 2916, 2918, 2920, 2921, 2924, 2925, 2926, 2928, 2931, 2939, 3003, 3004, 3007, 3033, 3046, 3049, 3052, 3054, 3055, 3056, 3057, 3058, 3059, 3073, 3078, 3080, 3086, 3090, 3093, 3100, 3106, 3111, 3159, 3162, 3163, 3164, 3165, 3166, 3168, 3169, 3172, 3181, 3185, 3190, 3191, 3194, 3195, 3244, 3316, 3317, 3321, 3322, 3323, 3324, 3325, 3327, 3331, 3333, 3334, 3338, 3341, 3358, 3365, 3370, 3380, 3382, 3383, 3404, 3425, 3429, 3434, 3439, 3440, 3445, 3446, 3454, 3465, 3466, 3467, 3468, 3480, 3487, 3496, 3498, 3503, 3504, 3516, 3518, 3524, 3537, 3556, 3563, 3571, 3572, 3574, 3575, 3584, 3591, 3593, 3594, 3595, 3606, 3616, 3646, 3647, 3656, 3659, 3662, 3667, 3671, 3672, 3674, 3677, 3682, 3683, 3690, 3699, 3704, 3709, 3710, 3714, 3716, 3718, 3719, 3733, 3734, 3740, 3746, 3752, 3753, 3757, 3759, 3761, 3763, 3780, 3808, 3810, 3829, 3832, 3836, 3842, 3849, 3859, 3861, 3863, 3864, 3865, 3871, 3874, 3896, 3898, 3926, 3933, 3934, 3986, 3991, 3996, 3998, 4005, 4010, 4019, 4024, 4025, 4053, 4058, 4091, 4095, 4099, 4106, 4115, 4116, 4142, 4146, 4149, 4151, 4186, 4197, 4207, 4211, 4218, 4220, 4227, 4256, 4262, 4265, 4319, 4324, 4325, 4327, 4330, 4334, 4336, 4361, 4383, 4384, 4385, 4401, 4403, 4429, 4430, 4437, 4441, 4467, 4468, 4478, 4479, 4506, 4510, 4511, 4518, 4519, 4520, 4521, 4525, 4529, 4531, 4532, 4536, 4537, 4538, 4540, 4548, 4549, 4551, 4552, 4600, 4602, 4603, 4604, 4615, 4621, 4663, 4665, 4666, 4667, 4669, 4672, 4675, 4687, 4694, 4695, 4708, 4709, 4713, 4725, 4732, 4734, 4737, 4771, 4805, 4812, 4814, 4830, 4844, 4856, 4873, 4917, 4918, 4919, 4929, 4931, 4932, 4936, 4947, 4948, 4949, 4993, 4994, 4996, 4997, 5002, 5003, 5005, 5011, 5012, 5013, 5016, 5031, 5036, 5039, 5040, 5042, 5043, 5044, 5047, 5052, 5053, 5093, 5101, 5125, 5156, 5168, 5170, 5192, 5218, 5233, 5242, 5244, 5251, 5301, 5312, 5349, 5353, 5359, 5360, 5364, 5403, 5421, 5422, 5432, 5441, 5462, 5463, 5477, 5485, 5486, 5498, 5500, 5507, 5508, 5509, 5512, 5513, 5515, 5516, 5521, 5526, 5528, 5529, 5531, 5532, 5535, 5536, 5539, 5540, 5542, 5545, 5547, 5548, 5556, 5557, 5560, 5565, 5567, 5572, 5573, 5575, 5578, 5580, 5581, 5601, 5603, 5604, 5605, 5610, 5614, 5622, 5623, 5630, 5643, 5650, 5651, 5660, 5661, 5662, 5663, 5673, 5679, 5680, 5681, 5682, 5683, 5687, 5689, 5693, 5694, 5696, 5701, 5712, 5716, 5727, 5728, 5734, 5739, 5748, 5749, 5751, 5752, 5798, 5800, 5801, 5802, 5803, 5805, 5807, 5811, 5812, 5819, 5820, 5833, 5839, 5865, 5866, 5867, 5868, 5872, 5875, 5891, 5892, 5902, 5917, 5959, 5964, 5966, 5971, 5972, 5974, 5977, 5983, 5984, 5986, 5987, 5988, 5990, 5992, 5993, 5995, 5996, 5997, 5999, 6001, 6005, 6007, 6010, 6012, 6016, 6018, 6029, 6056, 6061, 6063, 6065, 6067, 6071, 6098, 6113, 6132, 6133, 6134, 6136, 6141, 6145, 6169, 6170, 6177, 6179, 6189, 6192, 6205, 6209, 6219, 6220, 6228, 6234, 6239, 6243, 6244, 6245, 6246, 6258, 6282, 6290, 6296, 6300, 6314, 6330, and 6349. -164-
Attorney Docket No.54462-742.601 [00293] The siRNAs in subset C had the following characteristics: Cross-reactivity: With 19mer in human GPAM mRNA; Specificity category: For human: AS2 or better, SS3 or better; miRNA seeds: AS+SS strand: seed region not conserved in human, mouse, and rat and not present in >4 species. AS strand: seed region not identical to seed region of known human miRNA; Off-target frequency: ≤30 human off-targets matched with 2 mismatches by antisense strand; and SNPs: siRNA target sites do not harbor SNPs with a MAF ≥ 1% (pos.2-18). [00294] The siRNA sequences in subset C were also selected for absence of seed regions in the AS or S strands that are identical to a seed region of known human miRNA in addition to having an off-target frequency of ≤30 human off-targets matched with 2 mismatches by antisense strand to yield subset D. Subset D included the following 595 siRNAs: 18, 23, 79, 83, 94, 95, 98, 106, 107, 108, 110, 114, 118, 127, 173, 175, 190, 191, 207, 218, 221, 241, 257, 260, 261, 262, 264, 278, 284, 354, 357, 359, 360, 361, 363, 364, 365, 386, 435, 450, 454, 494, 495, 497, 498, 499, 501, 507, 517, 518, 520, 537, 547, 549, 550, 551, 554, 596, 601, 613, 646, 647, 664, 673, 675, 681, 683, 703, 737, 745, 746, 748, 753, 756, 819, 826, 839, 845, 850, 854, 855, 857, 859, 874, 878, 879, 887, 889, 891, 893, 894, 895, 933, 956, 959, 966, 974, 991, 993, 997, 998, 1006, 1024, 1025, 1026, 1029, 1030, 1031, 1033, 1035, 1044, 1046, 1058, 1065, 1071, 1084, 1087, 1092, 1093, 1097, 1098, 1099, 1100, 1106, 1111, 1135, 1145, 1151, 1152, 1191, 1194, 1196, 1197, 1199, 1207, 1208, 1209, 1210, 1212, 1241, 1243, 1246, 1252, 1256, 1257, 1259, 1263, 1264, 1265, 1266, 1267, 1268, 1269, 1285, 1289, 1297, 1300, 1308, 1339, 1340, 1352, 1354, 1355, 1358, 1359, 1361, 1363, 1367, 1373, 1374, 1426, 1432, 1434, 1461, 1472, 1476, 1477, 1479, 1480, 1481, 1482, 1484, 1531, 1534, 1538, 1539, 1543, 1546, 1569, 1571, 1577, 1578, 1580, 1586, 1600, 1608, 1613, 1618, 1619, 1634, 1645, 1651, 1655, 1705, 1706, 1708, 1710, 1742, 1753, 1757, 1779, 1795, 1824, 1831, 1868, 1873, 1877, 1880, 1887, 1890, 1894, 1899, 1917, 1962, 1963, 1973, 1978, 1982, 1999, 2010, 2012, 2017, 2055, 2067, 2078, 2082, 2110, 2131, 2141, 2142, 2166, 2182, 2299, 2301, 2303, 2367, 2407, 2427, 2435, 2440, 2462, 2463, 2464, 2466, 2486, 2494, 2504, 2524, 2618, 2620, 2627, 2629, 2630, 2631, 2632, 2633, 2635, 2637, 2660, 2674, 2676, 2678, 2679, 2725, 2726, 2727, 2855, 2872, 2883, 2886, 2898, 2899, 2905, 2906, 2907, 2909, 2910, 2911, 2912, 2913, 2915, 2918, 2920, 2921, 2925, 2926, 2928, 2931, 2939, 3007, 3033, 3046, 3052, 3054, 3056, 3059, 3073, 3086, 3090, 3093, 3111, 3162, 3163, 3164, 3165, 3166, 3169, 3181, 3185, 3190, 3244, 3317, 3321, 3323, 3324, 3325, 3327, 3331, 3333, 3334, 3338, 3341, 3370, 3380, 3382, 3383, 3404, 3425, 3429, 3434, 3439, 3445, 3446, 3454, 3468, 3496, 3498, 3503, 3504, 3516, 3518, 3524, 3556, 3572, 3574, 3575, 3591, 3593, 3594, 3595, 3616, 3646, 3667, 3672, 3674, 3677, 3683, 3690, 3699, 3709, 3710, 3716, 3719, 3734, 3746, 3752, 3757, 3780, 3829, 3832, 3836, 3859, 3861, 3864, 3871, 3898, 3926, 3934, 3986, 3991, 3996, 3998, 4005, 4010, 4019, 4024, 4053, 4058, 4095, 4099, 4106, 4115, 4142, 4146, 4149, 4186, 4197, 4211, 4220, 4256, 4265, 4327, 4330, 4336, 4361, 4383, 4384, 4401, 4403, 4429, 4441, 4467, 4468, 4506, 4510, 4518, 4519, 4521, 4529, 4540, 4548, 4549, 4600, 4602, 4604, 4621, 4665, 4666, 4667, 4669, 4687, 4708, 4709, 4732, 4771, 4805, 4812, 4814, 4830, 4856, 4917, 4918, 4919, 4929, 4947, 4948, 4949, 4994, 4996, 4997, 5002, 5003, 5005, 5011, 5012, 5016, 5040, 5042, 5043, 5044, 5052, 5053, 5093, 5170, 5244, 5251, 5301, 5349, 5353, 5359, 5360, 5364, 5422, 5441, 5462, 5463, 5485, 5507, 5509, 5513, 5515, 5516, 5521, 5526, 5528, 5531, 5532, 5536, 5539, 5540, 5542, 5547, 5548, 5556, 5557, 5560, 5567, 5572, 5575, 5578, 5580, 5581, 5603, 5604, 5610, 5614, 5630, 5650, 5651, 5661, 5662, 5663, -165-
Attorney Docket No.54462-742.601 5673, 5681, 5687, 5693, 5694, 5696, 5701, 5712, 5727, 5728, 5734, 5739, 5751, 5752, 5798, 5800, 5802, 5803, 5805, 5807, 5812, 5819, 5833, 5839, 5865, 5867, 5868, 5875, 5917, 5959, 5966, 5971, 5972, 5974, 5977, 5983, 5984, 5986, 5987, 5988, 5990, 5992, 5993, 5996, 5999, 6001, 6005, 6012, 6016, 6056, 6061, 6063, 6065, 6071, 6113, 6133, 6134, 6136, 6145, 6189, 6209, 6219, 6220, 6228, 6234, 6239, 6246, 6258, 6290, 6296, 6314, 6330, and 6349. [00295] The siRNA sequences in subset D were also selected to have an off-target frequency of ≤20 human off-targets matched with 2 mismatches by antisense strand to yield subset E. Subset E included the following 593 siRNAs: 18, 23, 79, 83, 94, 95, 98, 106, 107, 108, 110, 114, 118, 127, 173, 175, 190, 191, 207, 218, 221, 241, 257, 260, 261, 262, 264, 278, 284, 354, 357, 359, 360, 361, 363, 364, 365, 386, 435, 450, 454, 494, 495, 497, 498, 499, 501, 507, 517, 518, 520, 537, 547, 549, 550, 551, 554, 596, 601, 613, 646, 647, 664, 673, 675, 681, 683, 703, 737, 745, 746, 748, 753, 756, 819, 826, 839, 845, 850, 854, 855, 857, 859, 874, 878, 879, 887, 889, 891, 893, 894, 895, 933, 956, 959, 966, 974, 991, 993, 997, 998, 1006, 1024, 1025, 1026, 1029, 1030, 1031, 1033, 1035, 1044, 1046, 1058, 1065, 1071, 1084, 1087, 1092, 1093, 1097, 1098, 1099, 1100, 1106, 1111, 1135, 1145, 1151, 1152, 1191, 1194, 1196, 1197, 1199, 1207, 1208, 1209, 1210, 1212, 1241, 1243, 1246, 1252, 1256, 1257, 1259, 1263, 1264, 1265, 1266, 1267, 1268, 1269, 1285, 1289, 1297, 1300, 1308, 1339, 1340, 1352, 1354, 1355, 1358, 1359, 1361, 1363, 1367, 1373, 1374, 1426, 1432, 1434, 1461, 1472, 1476, 1477, 1479, 1480, 1481, 1482, 1484, 1531, 1534, 1538, 1539, 1543, 1546, 1569, 1571, 1577, 1578, 1580, 1586, 1600, 1608, 1613, 1618, 1619, 1634, 1645, 1651, 1655, 1705, 1706, 1708, 1710, 1742, 1753, 1757, 1779, 1795, 1824, 1831, 1868, 1873, 1877, 1880, 1887, 1890, 1894, 1899, 1917, 1962, 1963, 1973, 1978, 1982, 1999, 2010, 2012, 2017, 2055, 2067, 2078, 2082, 2110, 2131, 2141, 2142, 2166, 2182, 2299, 2301, 2303, 2367, 2407, 2427, 2435, 2440, 2462, 2463, 2464, 2466, 2486, 2494, 2504, 2524, 2618, 2620, 2627, 2629, 2630, 2631, 2632, 2633, 2635, 2637, 2660, 2674, 2676, 2678, 2679, 2725, 2726, 2727, 2855, 2872, 2883, 2886, 2898, 2899, 2905, 2906, 2907, 2909, 2910, 2911, 2912, 2913, 2915, 2918, 2920, 2921, 2925, 2926, 2928, 2931, 2939, 3007, 3033, 3046, 3052, 3054, 3056, 3059, 3073, 3086, 3090, 3093, 3111, 3162, 3163, 3164, 3165, 3166, 3169, 3181, 3185, 3190, 3244, 3317, 3321, 3323, 3324, 3325, 3327, 3331, 3333, 3334, 3338, 3341, 3370, 3380, 3382, 3383, 3404, 3425, 3429, 3434, 3439, 3445, 3446, 3454, 3468, 3498, 3503, 3504, 3516, 3518, 3524, 3556, 3572, 3574, 3575, 3591, 3593, 3594, 3595, 3616, 3646, 3667, 3672, 3674, 3677, 3683, 3699, 3709, 3710, 3716, 3719, 3734, 3746, 3752, 3757, 3780, 3829, 3832, 3836, 3859, 3861, 3864, 3871, 3898, 3926, 3934, 3986, 3991, 3996, 3998, 4005, 4010, 4019, 4024, 4053, 4058, 4095, 4099, 4106, 4115, 4142, 4146, 4149, 4186, 4197, 4211, 4220, 4256, 4265, 4327, 4330, 4336, 4361, 4383, 4384, 4401, 4403, 4429, 4441, 4467, 4468, 4506, 4510, 4518, 4519, 4521, 4529, 4540, 4548, 4549, 4600, 4602, 4604, 4621, 4665, 4666, 4667, 4669, 4687, 4708, 4709, 4732, 4771, 4805, 4812, 4814, 4830, 4856, 4917, 4918, 4919, 4929, 4947, 4948, 4949, 4994, 4996, 4997, 5002, 5003, 5005, 5011, 5012, 5016, 5040, 5042, 5043, 5044, 5052, 5053, 5093, 5170, 5244, 5251, 5301, 5349, 5353, 5359, 5360, 5364, 5422, 5441, 5462, 5463, 5485, 5507, 5509, 5513, 5515, 5516, 5521, 5526, 5528, 5531, 5532, 5536, 5539, 5540, 5542, 5547, 5548, 5556, 5557, 5560, 5567, 5572, 5575, 5578, 5580, 5581, 5603, 5604, 5610, 5614, 5630, 5650, 5651, 5661, 5662, 5663, 5673, 5681, 5687, 5693, 5694, 5696, 5701, 5712, 5727, 5728, 5734, 5739, 5751, 5752, 5798, 5800, 5802, 5803, 5805, 5807, 5812, 5819, 5833, 5839, 5865, 5867, 5868, 5875, 5917, 5959, 5966, 5971, 5972, 5974, 5977, 5983, 5984, 5986, 5987, 5988, 5990, -166-
Attorney Docket No.54462-742.601 5992, 5993, 5996, 5999, 6001, 6005, 6012, 6016, 6056, 6061, 6063, 6065, 6071, 6113, 6133, 6134, 6136, 6145, 6189, 6209, 6219, 6220, 6228, 6234, 6239, 6246, 6258, 6290, 6296, 6314, 6330, and 6349. [00296] Any siRNA among any of subsets A-E may comprise any modification pattern described herein. If a sequence has a different number of nucleotides in length than a modification pattern, the modification pattern may still be used with the appropriate number of additional nucleotides added 5’ or 3’ to match the number of nucleotides in the modification pattern. For example, if a sense or antisense strand of the siRNA among any of subsets A-E comprises 19 nucleotides, and a modification pattern comprises 21 nucleotides, UU may be added onto the 5’ end of the sense or antisense strand. [00297] Therapeutic siRNAs were designed to target human GPAM as described above and, in some cases, the GPAM sequence of at least one toxicology-relevant species, in this case, the non-human primate (NHP) cynomolgus monkey. The siRNAs included in subset F had the following characteristics: Cross-reactivity: With 19mer in human GPAM mRNA, with 17mer/19mer in NHP GPAM; Specificity category: For human and NHP: AS2 or better, SS3 or better. Subset F included 25 siRNAs whose base sequences are shown in Table 9. Table 9. Sequences and siRNA names in subset F (Screening Set) siR ´-3´) siR AU siR UC siR AG siR AU siR CU siR GA siR AG siR AG siR GU siR GA siR UA siR AU siR CU siR AA siR CU siR CA siR GA siR CA siR UU siR UU siR UA siR AU siR
AA siRNA 2486 2486 AACAGAAAGAAAUGUUGCA 8840 UGCAACAUUUCUUUCUGUU siRNA 2660 2660 AUAUAUUCUGAGUUUUGUG 9014 CACAAAACUCAGAAUAUAU -167-
Attorney Docket No.54462-742.601 [00298] In some cases, the sense strand of any of the siRNAs of subset F comprises siRNA with a particular modification pattern. In this modification pattern, position 9 counting from the 5’ end of the of the sense strand is has the 2’F modification. If position 9 of the sense strand is a pyrimidine, then all purines in the sense strand have the 2’OMe modification. If position 9 is the only pyrimidine between positions 5 and 11 of the sense stand, then position 9 is the only position with the 2’F modification in the sense strand. If position 9 and only one other base between positions 5 and 11 of the sense strand are pyrimidines, then both of these pyrimidines are the only two positions with the 2’F modification in the sense strand. If position 9 and only two other bases between positions 5 and 11 of the sense strand are pyrimidines, and those two other pyrimidines are in adjacent positions so that there would be not three 2’F modifications in a row, then any combination of 2’F modifications can be made that give three 2’F modifications in total. If there are >2 pyrimidines between positions 5 and 11 of the sense strand, then all combinations of pyrimidines having the 2’F modification are allowed that have three to five 2’F modifications in total, provided that the sense strand does not have three 2’F modifications in a row. [00299] If position 9 of the sense strand is a purine, then all purines in the sense strand have the 2’OMe modification. If position 9 is the only purine between positions 5 and 11 of the sense stand, then position 9 is the only position with the 2’F modification in the sense strand. If position 9 and only one other base between positions 5 and 11 of the sense strand are purines, then both of these purines are the only two positions with the 2’F modification in the sense strand. If position 9 and only two other bases between positions 5 and 11 of the sense strand are purines, and those two other purines are in adjacent positions so that there would be not three 2’F modifications in a row, then any combination of 2’F modifications can be made that give three 2’F modifications in total. If there are >2 purines between positions 5 and 11 of the sense strand, then all combinations of purines having the 2’F modification are allowed that have three to five 2’F modifications in total, provided that the sense strand does not have three 2’F modifications in a row. [00300] In some cases, position 9 of the sense strand can be a 2’deoxy. In these cases, 2’F and 2’OMe modifications may occur at the other positions of the sense strand. [00301] In some cases, the sense strand of any of the siRNAs of subset F comprises a modification pattern which conforms to these sense strand rules (Table 10). [00302] In some cases, the antisense strand of any of the siRNAs of subset F comprise a modification or modification pattern. Some such examples are included in Table 10. The siRNAs in Table 10 include a GalNAc moiety. Table 11 includes some additional sense strand modifications of the siRNAs in subset F. The siRNAs in subset F may comprise any other modification pattern(s). In the tables, Nf (e.g. Af, Cf, Gf, Tf, or Uf) is a 2’ fluoro-modified nucleoside, dN (e.g. dA, dC, dG, dT, or dU) is a 2’ deoxy nucleoside, n (e.g. a, c, g, t, or u) is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. -168-
Attorney Docket No.54462-742.601 Table 10: Modified Screening Set (Subset G) siRNA SEQ ID Sense strand sequence (5´-3´), with SEQ ID Name NO: GalNAc moiety NO: Antisense strand sequence (5´-3´) ETD01994 12709 [ETL17]saucaGfAfauAfcAfguguuggasusu 12734 usCfscAfaCfaCfuGfuAfuUfcUfgAfususu ETD susu ETD usu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD usu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD usu ETD susu ETD susu ETD susu ETD susu ETD susu ETD
susu Table 11: Additional Examples of Modified siRNAs (Subset H) s ´) siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siRN
A 12779 12779 uscsuaCfcagUfuCfauagaucasusu 12739 usGfsaUfcUfaUfgAfaCfuGfgUfaGfasusu siRNA 12780 12780 uscsuaCfcagUfUfcauagaucasusu 12739 usGfsaUfcUfaUfgAfaCfuGfgUfaGfasusu siRNA 12781 12781 uscsuaCfCfagUfucauagaucasusu 12739 usGfsaUfcUfaUfgAfaCfuGfgUfaGfasusu -169-
Attorney Docket No.54462-742.601 siRNA 12782 12782 uscsuaCfCfagUfUfcauagaucasusu 12739 usGfsaUfcUfaUfgAfaCfuGfgUfaGfasusu siRNA 12783 12783 csusacCfaguUfCfauagauccasusu 12740 usGfsgAfuCfuAfuGfaAfcUfgGfuAfgsusu siRNA 12784 12784 ascs aaaGfAfuGfuucucuaasusu 12742 usUfsaGfaGfaAfcAfuCfuUfuCfcGfususu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR asusu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siRN
A 12834 12834 asascagaaAfGfaAfauguugcasusu 12757 usGfscAfaCfaUfuUfcUfuUfcUfgUfususu siRNA 12835 12835 asascagaaAfGfAfAfauguugcasusu 12757 usGfscAfaCfaUfuUfcUfuUfcUfgUfususu siRNA 12836 12836 asascagaAfaGfaAfauguugcasusu 12757 usGfscAfaCfaUfuUfcUfuUfcUfgUfususu -170-
Attorney Docket No.54462-742.601 siRNA 12837 12837 asascagaAfaGfAfaauguugcasusu 12757 usGfscAfaCfaUfuUfcUfuUfcUfgUfususu siRNA 12838 12838 asascagaAfAfGfAfaauguugcasusu 12757 usGfscAfaCfaUfuUfcUfuUfcUfgUfususu siRNA 12839 12839 asascaaAfAfGfAfAfauuucasusu 12757 usGfscAfaCfaUfuUfcUfuUfcUf Ufususu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siR susu siRN
susu [00303] The siRNAs targeting human GPAM can also be selected using other criteria including cross- reactivity with the NHP cynomolgus GPAM, and in some cases mouse GPAM. Selection of these siRNAs yields Subset I. Subset I includes 25 siRNAs whose base sequences are shown in Table 11A. Tbl 11A S b t I iRNA siR ´-3´) siR AU siR UC siR AG siR AU siR CU siR GA siR AG siR AG siR GU siR GA siR
UA siRNA 1098 1098 AUAGUUGAAUUACUUCGAC 7452 GUCGAAGUAAUUCAACUAU siRNA 1100 1100 AGUUGAAUUACUUCGACAG 7454 CUGUCGAAGUAAUUCAACU -171-
Attorney Docket No.54462-742.601 siRNA 1111 1111 UUCGACAGCAGCAAUUCUU 7465 AAGAAUUGCUGCUGUCGAA siRNA 1199 1199 AGUUGUGGUAGAUACUCUG 7553 CAGAGUAUCUACCACAACU siR CA siR GA siR CA siR UU siR UU siR UA siR AU siR AA siR UU siR AU [00
30] e s N sn suset ave te o owng caracterstcs: • Cross-reactivity: With 19mer in human GPAM mRNA, with 17mer or 19mer in NHP GPAM mRNA, and in some cases 17mer or 19mer in mouse GPAM. • Specificity category: For human and NHP only cross-reactive siRNAs: human AS1 or better, human SS3 or better. For human, NHP and mouse cross-reactive siRNAs, human AS2 or better, human AS3 or better. • miRNA seeds: For human and NHP only cross-reactive siRNAs: AS and SS: seed region not in any human siRNA, seed region not conserved in human, mouse, and rat and not present in >3 species. For human, NHP and mouse cross-reactive siRNAs: seed region not in any human siRNA, seed region not conserved in human, mouse, and rat and not present in >1 species. • SNPs: siRNA target sites do not harbor SNPs with a MAF
≥ 1% (pos.2-18) [00305] The siRNAs targeting human GPAM can also be selected using at least Selection Set C criteria, and including cross-reactivity with the NHP cynomolgus GPAM. Selection of these siRNAs yields Subset J. Subset J includes 24 siRNAs whose base sequences are shown in Table 11B. Tbl 11B S b t J iRNA siR ´-3´) siR UU siR AA siR CU siR UU siR AU siR UA siR AU siR AA siR AG siR UA siR
UG siRNA 1105 1105 AAUUACUUCGACAGCAGCA 7459 UGCUGCUGUCGAAGUAAUU siRNA 1106 1106 AUUACUUCGACAGCAGCAA 7460 UUGCUGCUGUCGAAGUAAU -172-
Attorney Docket No.54462-742.601 siRNA 1191 1191 CUUUUGUCAGUUGUGGUAG 7545 CUACCACAACUGACAAAAG siRNA 1241 1241 CUUGAUAAUACCUGUUGGA 7595 UCCAACAGGUAUUAUCAAG siR CA siR UU siR CA siR AU siR AG siR UA siR UU siR CU siR GA [00
e s s su se ave e o ow g c a ac e s cs: • Cross-reactivity: With 19mer in human GPAM mRNA, with 17mer or 19mer in NHP GPAM mRNA. • Specificity category: human AS2 or better, human SS3 or better. NHP AS2 or better, NHP SS3 or better • miRNA seeds: For human and NHP only cross-reactive siRNAs: AS strand: seed region not in any human siRNA, seed region not conserved in human, mouse, and rat and not present in >4 species. SS strand: seed region not conserved in human, mouse, and rat and not present in >4 species. • SNPs: siRNA target sites do not harbor SNPs with a MAF ≥ 1% (pos.2-18) Example 3: Chemically modified GPAM siRNAs [00307] Any set of modifications, or any modification pattern may be used. For example, The siRNAs targeting GPAM can be synthesized with chemical modifications with the sense strand having modification pattern 1S and antisense strand having modification pattern 1AS. In some embodiments, the siRNAs targeting GPAM can also be synthesized with chemical modifications with the sense strand having modification pattern 2S and antisense strand having modification pattern 3AS. In some embodiments, the modifications included in Table 10 or Table 11 are used. In addition, adenosine can be placed at position 19 in the sense strand and uridine at position 1 in the antisense strand. Example 4: siRNA-mediated knockdown of GPAM in human hepatocyte cells [00308] siRNAs targeted to the GPAM mRNA that downregulate levels of GPAM mRNA may lead to subsequent decrease of lysophosphatidic acid (LPA), a metabolite produced by the GPAM gene product, when administered to cultured hepatocyte cells. [00309] On Day 0, the hepatocyte cells are to be seeded at 150,000 cells/mL into a Falcon 24-well tissue culture plate (ThermoFisher Cat. No. 353047) at 0.5 mL per well . [00310] On Day 1, the GPAM siRNA and negative control siRNA master mixes are prepared. The GPAM siRNA master mix contains 350 uL of Opti-MEM (ThermoFisher Cat. No.4427037 - s1288 Lot No. AS02B02D) and 3.5 ul of a mixture of the two GPAM siRNAs (10 uM stock). The negative control siRNA master mix contains 350 uL of Opti-MEM and 3.5 ul of negative control siRNA (ThermoFisher -173-
Attorney Docket No.54462-742.601 Cat. No.4390843, 10 uM stock). Next, 3 uL of TransIT-X2 (Mirus Cat. No. MIR6000) is added to each master mix. The mixes are incubated for 15 minutes to allow transfection complexes to form, then 51 ul of the appropriate master mix + TransIT-X2 is added to duplicate wells of hepatocyte cells with a final siRNA concentration of 10 nM. [00311] On Day 3, 48 hours post transfection, cells are lysed using the Cells-to-Ct kit according to the manufacturer’s protocol (ThermoFisher Cat. No.4399002). In brief, cells are washed with 50 ul using cold 1X PBS and lysed by adding 49.5 ul of Lysis Solution and 0.5 ul DNase I per well and pipetting up and down 5 times and incubating for 5 minutes at room temperature. The Stop Solution (5 ul/well) is added to each well and mixed by pipetting up and down five times and incubating at room temperature for 2 minutes. The reverse transcriptase reaction is performed using 22.5 ul of the lysate according to the manufacturer’s protocol. Samples are stored at -80 °C until real-time qPCR was performed in triplicate using TaqMan Gene Expression Assays (Applied Biosystems FAM/GPAM using a BioRad iCycler). [00312] A decrease in GPAM mRNA expression in the hepatocyte cells is expected after transfection with the GPAM siRNAs compared to GPAM mRNA levels in hepatocyte cells transfected with the non- specific control siRNA 48 hours after transfection. There is an expected decrease in the amount of LPA in wells containing hepatocytes cells transfected with the GPAM siRNAs relative to the amount of LPA in wells containing hepatocyte cells transfected with a non-specific control siRNA 48 hours after transfection. These results show that the GPAM siRNAs elicit knockdown of GPAM mRNA in hepatocyte cells and that the decrease in GPAM expression is correlated with a decrease in LPA production. [00313] The GPAM siRNAs showing the greatest degree of knockdown of GPAM mRNA at 10 nM will be tested in a second screen for activity at 1 nM concentration using the transfection procedures as described above. Example 5: siRNA-mediated knockdown of GPAM in human adipocyte cells [00314] Adipose tissue is a major site of endogenous triglyceride synthesis. siRNAs targeted to the GPAM mRNA that downregulate levels of GPAM mRNA may lead to subsequent decrease of lysophosphatidic acid (LPA), a metabolite produced by the GPAM gene product, when administered to cultured adipocyte cells. A decrease in LPA production may lead to a subsequent decrease in the levels of other components of the glycerol phosphate pathway for de novo triacylglycerol synthesis. Namely, phosphatidic acid (PA), phosphatidylserine (DAG), and triacylglycerol (TAG) may be decreased after siRNA-mediated knockdown of GPAM in human adipocyte cells. [00315] On Day 0, the differentiated adipocyte cells (Cell Applications, Inc.) are to be seeded at 150,000 cells/mL into a Falcon 24-well tissue culture plate (ThermoFisher Cat. No.353047) at 0.5 mL per well and cultured in adipocyte maintenance medium according to manufacturer’s instructions. [00316] On Day 1, the GPAM siRNA and negative control siRNA master mixes are prepared. The GPAM siRNA master mix contains 350 uL of Opti-MEM (ThermoFisher Cat. No.4427037 - s1288 Lot No. AS02B02D) and 3.5 ul of a mixture of the two GPAM siRNAs (10 uM stock). The negative control siRNA master mix contains 350 uL of Opti-MEM and 3.5 ul of negative control siRNA (ThermoFisher -174-
Attorney Docket No.54462-742.601 Cat. No.4390843, 10 uM stock). Next, 3 uL of TransIT-X2 (Mirus Cat. No. MIR6000) is added to each master mix. The mixes are incubated for 15 minutes to allow transfection complexes to form, then 51 ul of the appropriate master mix + TransIT-X2 is added to duplicate wells of differentiated adipocyte cells with a final siRNA concentration of 10 nM. [00317] On Day 3, 48 hours post transfection, cells are lysed using the Cells-to-Ct kit according to the manufacturer’s protocol (ThermoFisher Cat. No.4399002). In brief, cells are washed with 50 ul using cold 1X PBS and lysed by adding 49.5 ul of Lysis Solution and 0.5 ul DNase I per well and pipetting up and down 5 times and incubating for 5 minutes at room temperature. The Stop Solution (5 ul/well) is added to each well and mixed by pipetting up and down five times and incubating at room temperature for 2 minutes. The reverse transcriptase reaction is performed using 22.5 ul of the lysate according to the manufacturer’s protocol. Samples are stored at -80 °C until real-time qPCR was performed in triplicate using TaqMan Gene Expression Assays (Applied Biosystems FAM/GPAM using a BioRad iCycler). [00318] A decrease in GPAM mRNA expression in the adipocyte cells is expected after transfection with the GPAM siRNAs compared to GPAM mRNA levels in adipocyte cells transfected with the non- specific control siRNA 48 hours after transfection. There is an expected decrease in the amount of LPA in wells containing adipocyte cells transfected with the GPAM siRNAs relative to the amount of LPA in wells containing adipocyte cells transfected with a non-specific control siRNA 48 hours after transfection. These results show that the GPAM siRNAs elicit knockdown of GPAM mRNA in adipocyte cells and that the decrease in GPAM expression is correlated with a decrease in LPA production. PA, DAG, and TAG levels are measured in wells containing adipocyte cells transfected with a GPAM siRNA and with a non- specific control siRNA 48 hours after transfection if there was compensation for reduced GPAM activity at various steps of the triacylglycerol synthesis pathway. These results show that the GPAM siRNAs elicit knockdown of GPAM mRNA in adipocyte cells and that the decrease in GPAM expression is correlated with a decrease in LPA production, PA production, DAG production, and TAG production. [00319] The GPAM siRNAs showing the greatest degree of knockdown of GPAM mRNA at 10 nM will be tested in a second screen for activity at 1 nM concentration using the transfection procedures as described above. Example 6: ASO-mediated knockdown of GPAM in human hepatocyte cells [00320] ASOs targeted to the GPAM mRNA that downregulate levels of GPAM mRNA leading to subsequent decrease of LPA, a metabolite produced by the GPAM gene product, when administered to cultured hepatocyte cells. [00321] On Day 0, the hepatocyte cells are seeded at 150,000 cells/mL into a Falcon 24-well tissue culture plate (Cat. No.353047) at 0.5 mL per well. [00322] On Day 1, the GPAM ASO and negative control ASO master mixes are prepared. The GPAM ASO master mix contains 350 uL of Opti-MEM (ThermoFisher Cat. No.4427037 - s1288 Lot No. AS02B02D) and 3.5 ul of a mixture of the two GPAM ASOs (10 uM stock). The negative control ASO master mix contains 350 uL of Opti-MEM and 3.5 ul of negative control ASO (ThermoFisher Cat. No. 4390843, 10 uM stock). Next, 3 uL of TransIT-X2 (Mirus Cat. No. MIR6000) is added to each master -175-
Attorney Docket No.54462-742.601 mix. The mixes are incubated for 15 minutes to allow transfection complexes to form, then 51 ul of the appropriate master mix + TransIT-X2 is added to duplicate wells of hepatocyte cells with a final ASO concentration of 10 nM. [00323] On Day 3, 48 hours post transfection, cells are lysed using the Cells-to-Ct kit according to the manufacturer’s protocol (ThermoFisher Cat. No.4399002). In brief, cells are washed with 50 ul using cold 1X PBS and lysed by adding 49.5 ul of Lysis Solution and 0.5 ul DNase I per well and pipetting up and down 5 times and incubating for 5 minutes at room temperature. The Stop Solution (5 ul/well) is added to each well and mixed by pipetting up and down five times and incubating at room temperature for 2 minutes. The reverse transcriptase reaction is performed using 22.5 ul of the lysate according to the manufacturer’s protocol. Samples are stored at -80 °C until real-time qPCR was performed in triplicate using TaqMan Gene Expression Assays (Applied Biosystems FAM/GPAM using a BioRad iCycler). [00324] A decrease in GPAM mRNA expression in the hepatocyte cells is expected after transfection with the GPAM ASOs compared to GPAM mRNA levels in hepatocyte cells transfected with the non- specific control ASO 48 hours after transfection. There is an expected decrease in the amount of LPA in wells containing hepatocytes cells transfected with the GPAM ASOs relative to the amount of LPA in wells containing hepatocyte cells transfected with a non-specific control ASO 48 hours after transfection. These results show that the GPAM ASOs elicit knockdown of GPAM mRNA in hepatocyte cells and that the decrease in GPAM expression is correlated with a decrease in LPA production. Example 7: Inhibition of GPAM in a Mouse Model for Fatty Liver Disease Using Modified GPAM siRNAs and ASOs [00325] A murine model of fatty liver disease is used to evaluate the effect of siRNA or ASO inhibition of GPAM. In the murine model, fatty liver disease is induced by feeding mice a Western Diet (WD) containing 21.1% fat, 41% Sucrose, and 1.25% Cholesterol by weight (Teklad diets, TD.120528) and a high sugar solution (23.1g/L d-fructose (Sigma-Aldrich, G8270) and 18.9 g/L d-glucose (Sigma- Aldrich, F0127)) for 12 weeks. At 4-week-old C57BL/6J mice are fed a Western Diet instead of regular chow for 12 weeks. [00326] Briefly, mice are divided into five groups: Group 1 - a fatty liver disease group treated with non-targeting control siRNA, Group 2 - a fatty liver disease group treated with non-targeting control ASO, Group 3 - a fatty liver disease group treated with GPAM siRNA1, Group 4 – a fatty liver disease group treated with GPAM ASO1, Group 5 - control mice on a normal chow diet. Each group contains eight mice (4 males, 4 females). [00327] At weeks 12 weeks of Western Diet, blood samples are collected from each group prior to the first treatment. [00328] Administration of siRNA or ASO is achieved with a 200ul subcutaneous injection of siRNA or ASO resuspended in PBS at concentration of 10uM. On Study Day 0, Group 1 mice are injected subcutaneously with non-targeting control siRNA, Group 2 mice are injected subcutaneously with non- targeting control ASO, Group 3 mice are injected subcutaneously with siRNA1 targeting mouse GPAM, Group 4 mice are injected subcutaneously with ASO1 targeting mouse GPAM, and Group 5 mice are -176-
Attorney Docket No.54462-742.601 injected subcutaneously with vehicle. Every other week thereafter starting on Day 14 the animals from each group are dosed as on Day 0 for a total of 5 injections. [00329] Weekly blood draws are taken and serum and plasma isolated. ALT, AST, ALP bilirubin, total cholesterol, HDL cholesterol and triglyceride levels are measured using VITROS 5,1 FS (Ortho Clinical Diagnostics). Non-fasting plasma insulin is measured with the Ultrasensitive Mouse Insulin ELISA kit (Crystal Chem, 90080) according to the manufacturer’s instructions. Non-fasting blood glucose is assayed with the One Touch Ultra (Life Scan). HOMA IR and QUICKI are calculated. Blood ketones, including 3-hydroxybutyrate, acetoacetate and acetone are measured using EnzyChrom Ketone Body Assay Kit (BioAssay Systems, EKBD-100). [00330] At the end of 12 weeks of Western Diet and siRNA/ASO treatment, mice are sacrificed by cervical dislocation following an intraperitoneal injection of 0.3 ml Nembutal (5 mg/ml). Terminal blood draw is collected via cardiac puncture and final ALT, AST, ALP bilirubin, total cholesterol, HDL cholesterol and triglyceride levels are measured along with non-fasting plasma insulin and glucose and blood ketones. Livers and adipose tissue are removed and divided into three sections each; one section placed in RNAlater for mRNA isolation, one section flash-frozen for protein isolation, one section fixed in formalin and then paraffin-embedded. [00331] mRNA is isolated from tissue placed in RNAlater solution using the PureLink kit according to the manufacturer’s protocol (ThermoFisher Cat. No.12183020). The reverse transcriptase reaction is performed according to the manufacturer’s protocol. Samples are stored at -80 °C until real-time qPCR was performed in triplicate using TaqMan Gene Expression Assays (Applied Biosystems FAM/GPAM using a BioRad iCycler). A decrease in GPAM mRNA expression in the liver and adipose tissue from mice is dosed with the GPAM siRNAs and ASOs compared to GPAM mRNA levels in the liver and adipose tissue from mice is dosed with the non-specific control siRNA and ASO. There is an expected decrease in the amount of SDF-1 in the liver and adipose tissue from mice that receive the GPAM siRNAs and ASOs compared to the amount of SDF-1 in the liver and adipose tissue from mice that receive the non-specific control siRNA or ASO. These results show that the GPAM siRNAs and ASOs elicit knockdown of GPAM mRNA in liver and adipose tissue and that the decrease in GPAM expression is correlated with a decrease in SDF-1 production. There is an expected decrease in blood ALT, AST, ALP, bilirubin and total cholesterol, and an expected increase in blood ketones in mice that receive the GPAM siRNA or ASO compared to the blood ALT, AST, ALP, bilirubin, total cholesterol and ketones in mice that receive the non-specific control. These results show that the GPAM siRNA or ASO elicit knockdown of GPAM mRNA in liver and adipose tissue and that the decrease in GPAM expression is correlated with a decrease in blood ALT, AST, ALP, bilirubin and total cholesterol, and an increase in blood ketones. [00332] Formalin-fixed, paraffin-embedded liver sections are stained with hematoxylin and eosin (H&E) for assessment of liver histology, with Sirius Red (Sigma, 365548-5G)/Fast Green (Sigma, F258) for assessment of fibrosis, and with periodic acid-Schiff (PAS) for assessment of glycogen accumulation. NAFLD Activity Score (NAS) and fibrosis stage are evaluated by an expert pathologist according to the NASH CRN scoring system. The histological scoring is performed blinded, with no knowledge by the pathologist of the treatment(s) received. These results show that the GPAM siRNAs and ASOs elicit -177-
Attorney Docket No.54462-742.601 knockdown of GPAM mRNA in liver tissue and that the decrease in GPAM expression is correlated with a decrease in NAS and NASH CRN. Example 8: Oligonucleotide Synthesis [00333] Oligonucleotides such as siRNAs may be synthesized according to phosphoramidite technology on a solid phase. For example, a K&A oligonucleotide synthesizer may be used. Syntheses may be performed on a solid support made of controlled pore glass (CPG, 500 Å or 600 Å, obtained from AM Chemicals, Oceanside, CA, USA). All 2′-OMe and 2’-F phosphoramidites may be purchased from Hongene Biotech (Union City, CA, USA). All phosphoramidites may be dissolved in anhydrous acetonitrile (100 mM) and molecular sieves (3 Å) may be added.5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) may be used as activator solution. Coupling times may be 9-18 min (e.g. with a GalNAc such as ETL17), 6 min (e.g. with 2′OMe and 2′F). In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4- dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, Mass., USA) in anhydrous acetonitrile may be employed. [00334] After solid phase synthesis, the dried solid support may be treated with a 1:1 volume solution of 40 wt. % methylamine in water and 28% ammonium hydroxide solution (Aldrich) for two hours at 30° C. The solution may be evaporated and the solid residue may be reconstituted in water and purified by anionic exchange HPLC using a TKSgel SuperQ-5PW 13u column. Buffer A may be 20 mM Tris, 5 mM EDTA, pH 9.0 and contained 20% Acetonitrile and buffer B may be the same as buffer A with the addition of 1 M sodium chloride. UV traces at 260 nm may be recorded. Appropriate fractions may be pooled then desalted using Sephadex G-25 medium. [00335] Equimolar amounts of sense and antisense strand may be combined to prepare a duplex. The duplex solution may be prepared in 0.1×PBS (Phosphate-Buffered Saline, 1×, Gibco). The duplex solution may be annealed at 95° C. for 5 min, and cooled to room temperature slowly. Duplex concentration may be determined by measuring the solution absorbance on a UV-Vis spectrometer at 260 nm in 0.1×PBS. For some experiments, a conversion factor may be calculated from an experimentally determined extinction coefficient. Example 9: GalNAc ligand for hepatocyte targeting of oligonucleotides [00336] Without limiting the disclosure to these individual methods, there are at least two general methods for attachment of multivalent N-acetylgalactosamine (GalNAc) ligands to oligonucleotides: solid or solution-phase conjugations. GalNAc ligands may be attached to solid phase resin for 3’ conjugation or at the 5’ terminus using GalNAc phosphoramidite reagents. GalNAc phosphoramidites may be coupled on solid phase as for other nucleosides in the oligonucleotide sequence at any position in the sequence. Reagents for GalNAc conjugation to oligonucleotides are shown in Table 12. -178-
Attorney Docket No.54462-742.601 Table 12. GalNAc Conjugation Reagents Type of Structure conjugation Sol atta wh is r olig cha OH atta pha Sol atta pho
-179-
Attorney Docket No.54462-742.601 Solid phase 5’ atta Pho Sol Car ami any olig
y g p y y p g g p oved under basic, acid or reducing conditions. -180-
Attorney Docket No.54462-742.601 [00337] In solution phase conjugation, the oligonucleotide sequence—including a reactive conjugation site—is formed on the resin. The oligonucleotide is then removed from the resin and GalNAc is conjugated to the reactive site. [00338] The carboxy GalNAc derivatives may be coupled to amino-modified oligonucleotides. The peptide coupling conditions are known to the skilled in the art using a carbodiimide coupling agent like DCC (N,N′-Dicyclohexylcarbodiimide), EDC (N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide) or EDC.HCl (N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride and an additive like HOBt (1- hydroxybenztriazole), HOSu (N-hydroxysuccinimide), TBTU (N,N,N′,N′-Tetramethyl-O-(benzotriazol-1- yl)uronium tetrafluoroborate, HBTU (2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate) or HOAt (1-Hydroxy-7-azabenzotriazole and common combinations thereof such as TBTU/HOBt or HBTU/HOAt to form activated amine-reactive esters. [00339] Amine groups may be incorporated into oligonucleotides using a number of known, commercially available reagents at the 5’ terminus, 3’ terminus or anywhere in between. [00340] Non-limiting examples of reagents for oligonucleotide synthesis to incorporate an amino group include: • 5’ attachment: • 6-(4-Monomethoxytritylamino)hexyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite CAS Number: 114616-27-2 • 5'-Amino-Modifier TEG CE-Phosphoramidite • 10-(O-trifluoroacetamido-N-ethyl)-triethyleneglycol-1-[(2-cyanoethyl)-(N,N-diisopropyl)]- phosphoramidite • 3’ attachment: • 3'-Amino-Modifier Serinol CPG • 3-Dimethoxytrityloxy-2-(3-(fluorenylmethoxycarbonylamino)propanamido)propyl-1-O-succinyl- long chain alkylamino-CPG (where CPG stands for controlled-pore glass and is the solid support) • Amino-Modifier Serinol Phosphoramidite • 3-Dimethoxytrityloxy-2-(3-(fluorenylmethoxycarbonylamino)propanamido)propyl-1-O-(2- cyanoethyl)-(N,N-diisopropyl)-phosphoramidite [00341] Internal (base modified): • Amino-Modifier C6 dT • 5'-Dimethoxytrityl-5-[N-(trifluoroacetylaminohexyl)-3-acrylimido]-2'-deoxyUridine,3'-[(2- cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite. CAS Number: 178925-21-8 [00342] Solution phase conjugations may occur after oligonucleotide synthesis via reactions between non-nucleosidic nucleophilic functional groups that are attached to the oligonucleotide and electrophilic GalNAc reagents. Examples of nucleophilic groups include amines and thiols, and examples of electrophilic reagents include activated esters (e.g. N-hydroxysuccinimide, pentafluorophenyl) and maleimides. -181-
Attorney Docket No.54462-742.601 Example 10: GalNAc ligands for hepatocyte targeting of oligonucleotides [00343] Without limiting the disclosure to these individual methods, there are at least two general methods for attachment of multivalent N-acetylgalactosamine (GalNAc) ligands to oligonucleotides: solid or solution-phase conjugations. GalNAc ligands may be attached to solid phase resin for 3’ conjugation or at the 5’ terminus using GalNAc phosphoramidite reagents. GalNAc phosphoramidites may be coupled on solid phase as for other nucleosides in the oligonucleotide sequence at any position in the sequence. A non-limiting example of a phosphoramidite reagent for GalNAc conjugation to a 5’ end oligonucleotide is shown in Table 13. Table 13. GalNAc Conjugation Reagent Type of c Structure S ph
[00344] The following includes examples of synthesis reactions used to create a GalNAc moiety: Scheme for the preparation of NAcegal-Linker-TMSOTf -182-
Attorney Docket No.54462-742.601
General procedure for preparation of Compound 2A
[00345] To a solution of Compound 1A (500 g, 4.76 mol, 476 mL) in 2-Methly-THF (2.00 L) is added CbzCl (406 g, 2.38 mol, 338 mL) in 2-Methyl-THF (750 mL) dropwise at 0 °C. The mixture is stirred at 25 °C for 2 hrs under N2 atmosphere. TLC (DCM: MeOH = 20:1, PMA) may indicate CbzCl is consumed completely and one new spot (Rf = 0.43) formed. The reaction mixture is added HCl/EtOAc (1 N, 180 mL) and stirred for 30 mins, white solid is removed by filtration through celite, the filtrate is concentrated under vacuum to give Compound 2A (540 g, 2.26 mol, 47.5% yield) as a pale yellow oil and used into the next step without further purification. 1H NMR: δ 7.28 - 7.41 (m, 5 H), 5.55 (br s, 1 H), 5.01 - 5.22 83 - 3.02 (m, 1 H). Gene
[00346] To a solution of Compound 3A (1.00 kg, 4.64 mol, HCl) in pyridine (5.00 L) is added acetyl acetate (4.73 kg, 46.4 mol, 4.34 L) dropwise at 0 °C under N2 atmosphere. The mixture is stirred at 25 °C for 16 hrs under N2 atmosphere. TLC (DCM: MeOH = 20:1, PMA) indicated Compound 3A is consumed completely and two new spots (Rf = 0.35) formed. The reaction mixture is added to cold water (30.0 L) -183-
Attorney Docket No.54462-742.601 and stirred at 0 °C for 0.5 hr, white solid formed, filtered and dried to give Compound 4A (1.55 kg, 3.98 mol, 85.8% yield) as a white solid and used in the next step without further purification.1H NMR: δ 7.90 (d, J = 9.29 Hz, 1 H), 5.64 (d, J = 8.78 Hz, 1 H), 5.26 (d, J = 3.01 Hz, 1 H), 5.06 (dd, J = 11.29, 3.26 Hz, 1 H), 4.22 (t, J = 6.15 Hz, 1 H), 3.95 - 4.16 (m, 3 H), 2.12 (s, 3 H), 2.03 (s, 3 H), 1.99 (s, 3 H), 1.90 (s, 3 H), 1.78 (s, 3 H). General procedure for preparation of Compound 5A
[00347] To a solution of Compound 4A (300 g, 771 mmol) in DCE (1.50 L) is added TMSOTf (257 g, 1.16 mol, 209 mL) and stirred for 2 hrs at 60 °C, and then stirred for 1 hr at 25 °C. Compound 2A (203 g, 848 mmol) is dissolved in DCE (1.50 L) and added 4 Å powder molecular sieves (150 g) stirring for 30 mins under N2 atmosphere. Then the solution of Compound 4A in DCE is added dropwise to the mixture at 0 °C. The mixture is stirred at 25 °C for 16 hrs under N2 atmosphere. TLC (DCM: MeOH = 25:1, PMA) indicated Compound 4A is consumed completely and new spot (Rf = 0.24) formed. The reaction mixture is filtered and washed with sat. NaHCO3 (2.00 L), water (2.00 L) and sat. brine (2.00 L). The organic layer is dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue is triturated with 2-Me-THE/heptane (5/3, v/v, 1.80 L) for 2 hrs, filtered and dried to give Compound 5A (225 g, 389 mmol, 50.3% yield, 98.4% purity) as a white solid. 1H NMR: δ 7.81 (d, J = 9.29 Hz, 1 H), 7.20 - 7.42 (m, 6 H), 5.21 (d, J = 3.26 Hz, 1 H), 4.92 - 5.05 (m, 3 H), 4.55 (d, J = 8.28 Hz, 1 H), 3.98 - 4.07 (m, 3 H), 3.82 - 3.93 (m, 1 H),3.71 - 3.81 (m, 1 H), 3.55 - 3.62 (m, 1 H), 3.43 - 3.53 (m, 2 H), 3.37 - 3.43 (m, 2 H), 3.14 (q, J = 5.77 Hz, 2 H), 2.10 (s, 3 H), 1.99 (s, 3 H), 1.89 (s, 3 H), 1.77 (s, 3 Gene
[00348] To a solution of Compound 5A (200 g, 352 mmol) in THF (1.0 L) is added dry Pd/C (15.0 g, 10% purity) and TsOH (60.6 g, 352 mmol) under N2 atmosphere. The suspension is degassed under vacuum and purged with H2 several times. The mixture is stirred at 25 °C for 3 hrs under H2 (45 psi) -184-
Attorney Docket No.54462-742.601 atmosphere. TLC (DCM: MeOH = 10:1, PMA) indicated Compound 5A is consumed completely and one new spot (Rf = 0.04) is formed. The reaction mixture is filtered and concentrated (≤ 40 °C) under reduced pressure to give a residue. Diluted with anhydrous DCM (500 mL, dried overnight with 4 Å molecular sieves (dried at 300 °C for 12 hrs)) and concentrate to give a residue and run Karl Fisher (KF) to check for water content. This is repeated 3 times with anhydrous DCM (500 mL) dilutions and concentration to give NAcegal-Linker-TMSOTf (205 g, 95.8% yield, TsOH salt) as a foamy white solid. 1H NMR: δ 7.91 (d, J = 9.03 Hz, 1 H), 7.53 - 7.86 (m, 2 H), 7.49 (d, J = 8.03 Hz, 2 H), 7.13 (d, J = 8.03 Hz, 2 H), 5.22 (d, J = 3.26 Hz, 1 H), 4.98 (dd, J = 11.29, 3.26 Hz, 1 H), 4.57 (d, J = 8.53 Hz, 1 H), 3.99 - 4.05 (m, 3 H), 3.87 - 3.94 (m, 1 H), 3.79 - 3.85 (m, 1 H), 3.51 - 3.62 (m, 5 H), 2.96 (br t, J = 5.14 Hz, 2 H), 2.29 (s, 3 H), 2.10 (s, 3 H), 2.00 (s, 3 H), 1.89 (s, 3 H), 1.78 (s, 3 H). Scheme for the preparation of TRIS-PEG2-CBZ
-185-
Attorney Docket No.54462-742.601 General procedure for preparation of Compound 5B [003 16.7 mL, 0.10
eq) in THF (2.00 L) is added Compound 4B_2 (1.07 kg, 8.36 mol, 1.20 L, 5.00 eq), the mixture is stirred at 30 °C for 2 hrs. LCMS showed the desired MS is given. Five batches of solution are combined to one batch, then the mixture is diluted with water (6.00 L), extracted with ethyl acetate (3.00 L*3), the combined organic layer is washed with brine (3.00 L), dried over Na2SO4, filtered and concentrated under vacuum. The crude is purified by column chromatography (SiO2, petroleum ether : ethyl acetate=100:1- 10:1, Rf=0.5) to give Compound 5B (2.36 kg, 6.43 mol, 76.9% yield) as light yellow oil. HNMR: δ 7.31- 7.36 (m, 5 H), 5.38 (s, 1 H), 5.11-5.16 (m, 2 H), 3.75 (t, J=6.4 Hz), 3.54-3.62 (m, 6 H), 3.39 (d, J=5.2 Hz), 2.61 (t, J=6.0 Hz). General procedure for preparation of 3-oxo-1-phenyl-2710-trioxa-4-azatridecan-13-oic acid (Com
[00350] To a solution of Compound 5B (741 g, 2.02 mol, 1.00 eq) in DCM (2.80 L) is added TFA (1.43 kg, 12.5 mol, 928 mL, 6.22 eq), the mixture is stirred at 25 °C for 3 hrs. LCMS showed the desired MS is given. The mixture is diluted with DCM (5.00 L), washed with water (3.00 L*3), brine (2.00 L), the combined organic layer is dried over Na2SO4, filtered and concentrated under vacuum to give Compound 2B (1800 g, crude) as light yellow oil. HNMR: δ 9.46 (s, 5 H), 7.27-7.34 (m, 5 H), 6.50-6.65 (m, 1 H), 5.71 (s, 1 H), 5.10-5.15 (m, 2 H), 3.68-3.70 (m, 14 H), 3.58-3.61 (m, 6 H), 3.39 (s, 2 H), 2.55 (s, 6 H) 244 2 H Gen
[00351] To a solution of Compound 2B (375 g, 999 mmol, 83.0% purity, 1.00 eq) in DCM (1.80 L) is added HATU (570 g, 1.50 mol, 1.50 eq) and DIEA (258 g, 2.00 mol, 348 mL, 2.00 eq) at 0 °C, the mixture is stirred at 0 °C for 30 min, then Compound 1B (606 g, 1.20 mol, 1.20 eq) is added, the mixture -186-
Attorney Docket No.54462-742.601 is stirred at 25 °C for 1 hr. LCMS showed desired MS is given. The mixture is combined to one batch, then the mixture is diluted with DCM (5.00 L), washed with 1 N HCl aqueous solution (2.00 L*2), then the organic layer is washed with saturated Na2CO3 aqueous solution (2.00 L *2) and brine (2.00 L), the organic layer is dried over Na2SO4, filtered and concentrated under vacuum to give Compound 3B (3.88 kg, crude) as yellow oil. General procedure for preparation of TRIS-PEG2-CBZ. [0035
2] A souton o Compound 3B (775 g, 487 mmo, 50.3% pur ty, 1.00 eq) n HC/d oxane (4 M, 2.91 L, 23.8 eq) is stirred at 25 °C for 2 hrs. LCMS showed the desired MS is given. The mixture is concentrated under vacuum to give a residue. Then the combined residue is diluted with DCM (5.00 L), adjusted to pH=8 with 2.5 M NaOH aqueous solution, and separated. The aqueous phase is extracted with DCM (3.00 L) again, then the aqueous solution is adjusted to pH=3 with 1 N HCl aqueous solution, then extracted with DCM (5.00 L*2), the combined organic layer is washed with brine (3.00 L), dried over Na2SO4, filtered and concentrated under vacuum. The crude is purified by column chromatography (SiO2, DCM:MeOH=0:1-12:1, 0.1% HOAc, Rf=0.4). The residue is diluted with DCM (5.00 L), adjusted to pH=8 with 2.5 M NaOH aqueous solution, separated, the aqueous solution is extracted with DCM (3.00 L) again, then the aqueous solution is adjusted to pH=3 with 6 N HCl aqueous solution, extracted with DCM:MeOH=10:1 (5.00 L*2), the combined organic layer is washed with brine (2.00 L), dried over Na2SO4, filtered and concentrated under vacuum to give a residue. Then the residue is diluted with MeCN (5.00 L), concentrated under vacuum, repeat this procedure twice to remove water to give TRIS-PEG2- CBZ (1.25 kg, 1.91 mol, 78.1% yield, 95.8% purity) as light yellow oil. 1HNMR: 400 MHz, MeOD, δ 7.30-7.35 (5 H), 5.07 (s, 2 H), 3.65-3.70 (m, 16 H), 3.59 (s, 4 H), 3.45 (t, J=5.6 Hz), 2.51 (t, J=6.0 Hz), 2.43 (t, 6.4 Hz). Sche
-187-
Attorney Docket No.54462-742.601
-188-
Attorney Docket No.54462-742.601
TriGNal-TRIS-Peg2-Phosph 8c Gene
[00353] To a solution of Compound 1C (155 g, 245 mmol, 1.00 eq) in ACN (1500 mL) is added TBTU (260 g, 811 mmol, 3.30 eq), DIEA (209 g, 1.62 mol, 282 mL, 6.60 eq) and Compound 2C (492 g, 811 mmol, 3.30 eq, TsOH) at 0 °C, the mixture is stirred at 15 °C for 16 hrs. LCMS showed the desired MS is given. The mixture is concentrated under vacuum to give a residue, then the mixture is diluted with DCM (2000 mL), washed with 1 N HCl aqueous solution (700 mL * 2), then saturated NaHCO3 aqueous solution (700 mL *2) and concentrated under vacuum. The crude is purified by column chromatography to give Compound 3C (304 g, 155 mmol, 63.1% yield, 96.0% purity) as a yellow solid. -189-
Attorney Docket No.54462-742.601 General procedure for preparation of Compound 4C [0035
. , . , . s added Pd/C (6.60 g, 19.1 mmol, 10.0 % purity) and TFA (3.34 g, 29.2 mmol, 2.17 mL, 1.00 eq), the mixture is degassed under vacuum and purged with H2. The mixture is stirred under H2 (15 psi) at 15 °C for 2 hours. LCMS showed the desired MS is given. The mixture is filtered and the filtrate is concentrated under vacuum to give Compound 4C (106 g, 54.8 mmol, 93.7% yield, 96.2% purity, TFA) as a white solid. General procedure for preparation of compound 5C
[00355] Two batches in parallel. To a solution of EDCI (28.8 g, 150 mmol, 1.00 eq) in DCM (125 mL) is added compound 4a (25.0 g, 150 mmol, 1.00 eq) dropwise at 0 °C, then the mixture is added to compound 4 (25.0 g, 150 mmol, 1.00 eq) in DCM (125 mL) at 0 °C, then the mixture is stirred at 25 °C for 1 hr. TLC (Petroleum ether : Ethyl acetate = 3 : 1, Rf = 0.45) showed the reactant is consumed and one new spot is formed. The reaction mixture is diluted with DCM (100 mL) then washed with aq.NaHCO3 (250 mL * 1) and brine (250 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue is purified by column chromatography (SiO2, Petroleum ether : Ethyl acetate = 100 : 1 to 3 : 1), TLC (SiO2, Petroleum ether : Ethyl acetate = 3:1), Rf = 0.45 , then concentrated under reduced pressure to give a residue. Compound 5C (57.0 g, 176 mmol, 58.4% yield, 96.9% purity) is obtained as colorless oil and confirmed 1HNMR: EW33072-2-P1A, 400 MHz, DMSO δ 9.21 (s, 1 H), 7.07-7.09 (m, 2 H), 6.67-6.70 (m, 2 H), 3.02-3.04 (m, 2 H), 2.86-2.90 (m, 2 H) -190-
Attorney Docket No.54462-742.601 General procedure for preparation of compound 6
[00356] To a mixture of compound 3 (79.0 g, 41.0 mmol, 96.4% purity, 1.00 eq, TFA) and compound 6C (14.2 g, 43.8 mmol, 96.9% purity, 1.07 eq) in DCM (800 mL) is added TEA (16.6 g, 164 mmol, 22.8 mL, 4.00 eq) dropwise at 0 °C, the mixture is stirred at 15 °C for 16 hrs. LCMS (EW33072-12-P1B, Rt = 0.844 min) showed the desired mass is detected. The reaction mixture is diluted with DCM (400 mL) and washed with aq.NaHCO3 (400 mL * 1) and brine(400 mL * 1), then the mixture is diluted with DCM (2.00 L) and washed with 0.7 M Na2CO3 (1000 mL * 3) and brine(800 mL * 3), dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue is used to next step directly without purification. Compound 6 (80.0 g, crude) is obtained as white solid and confirmed via 1HNMR: EW33072-12-P1A, 400 MHz, MeOD δ 7.02 - 7.04 (m, 2 H), 6.68 - 6.70 (m, 2 H), 5.34 - 5.35 (s, 3 H), 5.07 - 5.08 (d, J = 4.00 Hz, 3 H), 4.62 - 4.64 (d, J = 8.00 Hz, 3 H), 3.71 - 4.16 (m, 16 H), 3.31 - 3.70 (m, 44 H), 2.80 - 2.83 (m, 2 H), 2.68 (m, 2 H), 2.46 - 2.47 (m, 10 H), 2.14 (s, 9 H), 2.03 (s, 9 H), 1.94 - 1.95 (d, J = 4.00 Hz, 18 H). -191-
Attorney Docket No.54462-742.601 General procedure for preparation of TriGNal-TRIS-Peg2-Phosph 8c
[00357] Two batches are synthesized in parallel. To a solution of compound 6C (40.0 g, 21.1 mmol, 1.00 eq in DCM (600 mL) is added diisopropylammonium tetrazolide (3.62 g, 21.1 mmol, 1.00 eq) and compound 7c (6.37 g, 21.1 mmol, 6.71 mL, 1.00 eq) in DCM (8.00 mL) drop-wise, the mixture is stirred at 30 °C for 1 hr, then added compound 7c (3.18 g, 10.6 mmol, 3.35 mL, 0.50 eq) in DCM (8.00 mL) drop-wise, the mixture is stirred at 30 °C for 30 mins, then added compound 7c (3.18 g, 10.6 mmol, 3.35 mL, 0.50 eq) in DCM (8.00 mL) drop-wise, the mixture is stirred at 30 °C for 1.5 hrs. LCMS (EW33072- 17-P1C1, Rt = 0.921 min) showed the desired MS+1 is detected. LCMS (EW33072-17-P1C2, Rt = 0.919 min) showed the desired MS+1 is detected. Two batches are combined for work-up. The mixture is -192-
Attorney Docket No.54462-742.601 diluted with DCM (1.20 L), washed with saturated NaHCO3 aqueous solution (1.60 L * 2), 3% DMF in H2O (1.60 L * 2), H2O (1.60 L * 3), brine (1.60 L), dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue is purified by column chromatography (SiO2, DCM : MeOH : TEA = 100 : 3 : 2) TLC (SiO2, DCM: MeOH = 10:1, Rf = 0.45), then concentrated under reduced pressure to give a residue. Compound 8C (76.0 g, 34.8 mmol, 82.5% yield, 96.0% purity) is obtained as white solid and confirmed via 1HNMR: EW33072-19-P1C, 400 MHz, MeOD δ 7.13-7.15 (d, J = 8.50 Hz, 2 H), 6.95-6.97 (dd, J =8.38, 1.13 Hz, 2 H), 5.34 (d, J =2.88 Hz, 3 H), .09 (dd, J =11.26, 3.38 Hz, 3 H), 4.64 (d, J =8.50 Hz, 3 H), 3.99 - 4.20 (m, 12 H), 3.88 - 3.98 (m, 5 H), 3.66 - 3.83 (m, 20 H), 3.51 - 3.65 (m, 17 H), 3.33 - 3.50 (m, 9 H), 2.87 (t, J =7.63 Hz, 2 H), 2.76 (t, J =5.94 Hz, 2 H), 2.42 - 2.50 (m, 10 H), 2.14 (s, 9 H), 2.03 (s, 9 H), 1.94 - 1.95 (d, J =6.13 Hz, 18 H), 1.24-1.26 (d, J =6.75 Hz, 6 H), 1.18-1.20 (d, J =6.75 Hz, 6 H) Example 11: Modification motif 1 [00358] An example GPAM siRNA includes a combination of the following modifications: • Position 9 (from 5’ to 3’) of the sense strand is 2’ F. • If position 9 is a pyrimidine then all purines in the Sense Strand are 2’OMe, and 1-5 pyrimidines between positions 5 and 11 are 2’ F provided that there are never three 2’F modifications in a row. • If position 9 is a purine then all pyrimidines in the Sense Strand are 2’OMe, and 1-5 purines between positions 5 and 11 are 2’ F provided that there are never three 2’F modifications in a row. • Antisense strand odd-numbered positions are 2'OMe and even-numbered positions are a mixture of 2’ F, 2’OMe and 2’ deoxy. Example 12: Modification motif 2 [00359] An example GPAM siRNA includes a combination of the following modifications: • Position 9 (from 5’ to 3’) of the sense strand is 2’ deoxy. • Sense strand positions 5, 7 and 8 are 2’ F. • All pyrimidines in positions 10-21 are 2’ OMe, and purines are a mixture of 2’ OMe and 2’ F. Alternatively, all purines in positions 10-21 are 2’ OMe and all pyrimidines in positions 10-21 are a mixture of 2’ OMe and 2’ F. • Antisense strand odd-numbered positions are 2'OMe and even-numbered positions are a mixture of 2’ F, 2’OMe and 2’ deoxy. Example 12. Screening of siRNAs ETD01994-ETD02018 targeting human GPAM mRNA in mice transfected with AAV8-TBG-h-GPAM [00360] The activities of siRNAs, namely ETD01994-ETD02018, were assessed in mice transiently expressing human GPAM. The siRNAs contain the GalNAc ligand ETL17 followed by a phosphorothioate linkage at the 5’ end of the sense strand. The siRNA sequences that were used are shown in Table 14, where Nf (e.g. Af, Cf, Gf, Tf, or Uf) is a 2’ fluoro-modified nucleoside, n (e.g. a, c, g, t, or u) is a 2’ O-methyl modified nucleoside, dN (e.g. dA, dC, dG, dT, or dU) is a 2' deoxynucleoside, and “s” is a phosphorothioate linkage. The base sequences for each siRNA, with and without the 3’ UU extension, are shown in Table 15. ETD01994-ETD02004 were tested in Part 1 of the study and ETD02005-ETD02018 were tested in Part 2. -193-
Attorney Docket No.54462-742.601 [00361] Six to eight week old female mice (C57Bl/6) were injected with 5 uL of a recombinant adeno- associated virus 8 (AAV8) vector (1.3 x 10E13 genome copies/mL) by the retroorbital route on Day -14. The recombinant AAV8 contains the open reading frame, the 5’ UTR, and a portion of the 3’UTR of the human GPAM sequence (ENST00000348367) under the control of the human thyroxine binding globulin promoter in an AAV2 backbone packaged in AAV8 capsid (AAV8-TBG-h-GPAM). On Day 0, infected mice were given a subcutaneous injection of a single 100ug dose of a GalNAc-conjugated siRNA or PBS as vehicle control (n=4). [00362] Mice were euthanized on Day 10 after subcutaneous injection and a liver sample from each was collected and placed in RNAlater (ThermoFisher Catalog# AM7020) until processing. Total liver RNA was prepared by homogenizing the liver tissue in homogenization buffer (Maxwell RSC simplyRNA Tissue Kit) using a Percellys 24 tissue homogenizer (Bertin Instruments) set at 5000 rpm for two 10 second cycles. Total RNA from the lysate was purified on a Maxwell RSC 48 platform (Promega Corporation) according to the manufacturer’s recommendations. Preparation of cDNA was performed using Quanta qScript cDNA SuperMix (VWR, Catalog# 95048-500) according to the manufacturer’s instructions. The relative levels of liver GPAM mRNA were assessed by RT-qPCR in triplicate on a QuantStudio™ 6 Pro Real-Time PCR System using TaqMan assays for human GPAM (ThermoFisher, assay# Hs01573684_m1), or mouse GPAM (ThermoFisher, assay# Mm01261106_m1), and the mouse housekeeping gene PPIA (ThermoFisher, assay# Mm02342430_g1), and PerfeCTa® qPCR FastMix®, Low ROX™ (VWR, Catalog# 101419-222). Only ETD01997, ETD01998, ETD02003, ETD02010, ETD02018 have highly similar target sequences in human and mouse GPAM. Data were normalized to the mean GPAM mRNA level in animals receiving a subcutaneous injection of PBS. Results for Part 1 are shown in Table 16, and those for Part 2 in Table 17. Of the siRNAs in this screening set, mice injected with ETD02009, ETD02011, ETD02012 or ETD02015 had the highest level of human GPAM mRNA knockdown in the liver. T bl 14 E m l iRNA S n E ´) ETD usu ETD usu ETD usu ETD usu ETD usu ETD usu ETD susu ETD usu ETD usu ETD usu ETD usu ETD usu ETD usu ETD usu ETD usu ETD
usu ETD02010 12884 [ETL17]sucgaaggUfCfaCfuacaaugasusu 12991 usCfsaUfuGfuAfgUfgAfcCfuUfcGfasusu ETD02011 12885 [ETL17]suguuAfuuAfGfaAfuguuacgasusu 12992 usCfsgUfaAfcAfuUfcUfaAfuAfaCfasusu ETD02012 12886 [ETL17]saaacuAfuGfGfuuguguccgasusu 12993 usCfsgGfaCfaCfaAfcCfaUfaGfuUfususu -194-
Attorney Docket No.54462-742.601 ETD02013 12887 [ETL17]saagcgUfUfgUfUfaccagcuaasusu 12994 usUfsaGfcUfgGfuAfaCfaAfcGfcUfususu ETD02014 12888 [ETL17]suauucAfCfUfdGcuagcaaguasusu 12995 usAfscUfuGfcUfaGfcAfgUfgAfaUfasusu ETD02015 12889 [ETL17]sauucaCfUfgCfUfagcaagucasusu 12996 usGfsaCfuUfgCfuAfgCfaGfuGfaAfususu ETD usu ETD usu ETD usu
siRNA SEQ Sense Strand SEQ ID Antisense Strand Base Sequence (5' Name ID NO: Base Sequence (5' to 3') NO: to 3') ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU si (5' N ET U ET C ET G ET U ET U ET A ET G ET
G ETD02002 13115 ACGGAAAGAUGUUCUCUAA 13436 UUAGAGAACAUCUUUCCGU ETD02003 13116 UCCAUGGGCAUAUAGUUGA 13437 UCAACUAUAUGCCCAUGGA -195-
Attorney Docket No.54462-742.601 ETD02004 13117 UAUAGUUGAAUUACUUCGA 13438 UCGAAGUAAUUCAACUAUA ETD02005 13118 AUAGUUGAAUUACUUCGAA 13439 UUCGAAGUAAUUCAACUAU ET U ET A ET U ET A ET A ET A ET U ET U ET A ET U ET A ET U ET U si (5' N ET ET ET ET ET ET ET ET ET ET ET ET ET ET ET ET ET ET ET ET ET ET ET
ETD02017 13155 AACAGAAAGAAAUGUUGC 13476 GCAACAUUUCUUUCUGUU ETD02018 13156 AUAUAUUCUGAGUUUUGU 13477 ACAAAACUCAGAAUAUAU -196-
Attorney Docket No.54462-742.601 Table 16. Relative GPAM mRNA Levels in Livers of Mice Transfected with AAV8-TGB-h-GPAM – Part 1 Mean GPAM mRNA (Normalized to Group 1, Day 10) Dose G A
Table 17. Relative GPAM mRNA Levels in Livers of Mice Transfected with AAV8-TGB-h-GPAM – Part 2 G
14 4 ETD02017 100 0.49 0.72 15 4 ETD02018 100 0.35 0.50 Example 13. Screening siRNAs with alternative modification patterns of ETD02012 and ETD02011 in mice transfected with AAV8-TBG-h-GPAM [00363] The base sequences of ETD02012 and ETD02011 were synthesized to generate siRNAs (ETD02012, ETD02285-ETD02292 and ETD02011, ETD02301-ETD02309, respectively) with alternative modification patterns. The activities of the siRNAs were assessed using mice transiently expressing human GPAM. The siRNAs contain the GalNAc ligand ETL17 followed by a phosphorothioate linkage at the 5’ end of the sense strand. The siRNA sequences that were used are -197-
Attorney Docket No.54462-742.601 shown in Table 18, where Nf (e.g. Af, Cf, Gf, Tf, or Uf) is a 2’ fluoro-modified nucleoside, n (e.g. a, c, g, t, or u) is a 2’ O-methyl modified nucleoside, Nm (e.g. Am, Cm, Gm, Tm, or Um) is a 2’-O-(2- methoxyethyl) modified nucleoside, dN (e.g. dA, dC, dG, dT, or dU) is a 2’ deoxynucleoside, and “s” is a phosphorothioate linkage. The base sequences for each siRNA, with and without the 3’ UU extension, are shown in Table 19. [00364] Six to eight week old female mice (C57Bl/6) were injected with 5 uL of a recombinant adeno- associated virus 8 (AAV8) vector (1.2 x 10E13 genome copies/mL) by the retroorbital route on Day -14. The recombinant AAV8 contains the open reading frame, the 5’ UTR, and a portion of the 3’UTR of the human GPAM sequence (ENST00000348367) under the control of the human thyroxine binding globulin promoter in an AAV2 backbone packaged in AAV8 capsid (AAV8-TBG-h-GPAM). On Day 0, infected mice were given a subcutaneous injection of a single 100ug dose of a GalNAc-conjugated siRNA or PBS as vehicle control (n=5). [00365] Mice were euthanized on Day 14 after subcutaneous injection and a liver sample from each was collected and placed in RNAlater (ThermoFisher Catalog# AM7020) until processing. Total liver RNA was prepared by homogenizing the liver tissue in homogenization buffer (Maxwell RSC simplyRNA Tissue Kit) using a Percellys 24 tissue homogenizer (Bertin Instruments) set at 5000 rpm for two 10 second cycles. Total RNA from the lysate was purified on a Maxwell RSC 48 platform (Promega Corporation) according to the manufacturer’s recommendations. Preparation of cDNA was performed using Quanta qScript cDNA SuperMix (VWR, Catalog# 95048-500) according to the manufacturer’s instructions. The relative levels of liver GPAM mRNA were assessed by RT-qPCR in triplicate on a QuantStudio™ 6 Pro Real-Time PCR System using TaqMan assays for human GPAM (ThermoFisher, assay# Hs01573684_m1) and the mouse housekeeping gene PPIA (ThermoFisher, assay# Mm02342430_g1), and PerfeCTa® qPCR FastMix®, Low ROX™ (VWR, Catalog# 101419-222). Mice that gave low liver expression of human GPAM, as defined by having a Ct value of >30, were omitted from further analysis. Data were normalized to the mean GPAM mRNA level in animals receiving a subcutaneous injection of PBS. Results are shown in Table 20. Of the alternatively modified versions of ETD02012, ETD02289 had the greatest activity. Of the alternatively modified versions of ETD02011, ETD02304 and ETD02309 had the greatest activity. E ´) ETD susu ETD susu ETD usu ETD usu ETD su ETD usu ETD usu ETD usu ETD
susu ETD02011 12885 [ETL17]suguuAfuuAfGfaAfuguuacgasusu 12992 usCfsgUfaAfcAfuUfcUfaAfuAfaCfasusu ETD02301 12901 [ETL17]suguuauuAfGfAfAfuguuacgasusu 13008 usCfsgUfaAfcAfuUfcUfaAfuAfaCfasusu ETD02302 12902 [ETL17]suguuAfuuAfGfaAfuguuacgasusu 13009 usCfsguaAfcAfuUfcUfaAfuAfaCfasusu -198-
Attorney Docket No.54462-742.601 ETD02303 12903 [ETL17]suguuAfuuAfGfaAfuguuacgasusu 13010 usCfsgUfaAfcAfuUfcuaAfuAfaCfasusu ETD02304 12904 [ETL17]suguuAfuuAfGfaAfuguuacgasusu 13011 usCfsgUfaAfcAfuucUfaAfuAfaCfasusu ETD02305 12905 [ETL17]suguuAfuuAfGfaAfuguuacgasusu 13012 usCfsguaAfcAfuucUfaAfuAfaCfasusu ETD su ETD usu ETD su ETD usu
siRNA SEQ ID Sense Strand Base Sequence SEQ ID Antisense Strand Base Sequence Name NO: (5' to 3') NO: (5' to 3') ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU si (5' N ET U ET U ET U ET U ET U ET U ET U ET U ET U ET A ET A ET A ET A ET A ET A ET A ET A ET A ET A si ce N gs ET U ET U ET
U ETD02287 13193 AAACUAUGGUUGUGUCCG 13514 CGGACACAACCAUAGUUU ETD02288 13194 AAACUAUGGUUGUGUCCG 13515 CGGACACAACCAUAGUUU ETD02289 13195 AAACUAUGGUUGUGUCCG 13516 CGGACACAACCAUAGUUU -199-
Attorney Docket No.54462-742.601 ETD02290 13196 AAACUAUGGUUGUGUCCG 13517 CGGACACAACCAUAGUUU ETD02291 13197 AAACUAUGGUUGUGUCCG 13518 CGGACACAACCAUAGUUU ETD02292 13198 AAACUAUGGUUGUGUCCG 13519 CGGACACAACCAUAGUUU ET A ET A ET A ET A ET A ET A ET A ET A ET A ET A Ta
. AM Group n Treatment Dose Mean human GPAM mRNA level
20 4 ETD02309 100 0.19 Example 14. Screening siRNAs with alternative modification patterns of ETD02009 and ETD02015 in mice transfected with AAV8-TBG-h-GPAM [00366] The base sequences of ETD02009 and ETD02015 were synthesized to generate siRNAs (ETD02293-ETD02300, and ETD02015-ETD02318, respectively) with alternative modification patterns. The activities of the siRNAs were assessed using mice transiently expressing human GPAM. The siRNAs contain the GalNAc ligand ETL17 followed by a phosphorothioate linkage at the 5’ end of the sense strand. The siRNA sequences that were used are shown in Table 21, where Nf (e.g. Af, Cf, Gf, Tf, or Uf) is a 2’ fluoro-modified nucleoside, n (e.g. a, c, g, t, or u) is a 2’ O-methyl modified nucleoside, Nm (e.g. Am, Cm, Gm, Tm, or Um) is a 2’-O-(2-methoxyethyl) modified nucleoside, dN (e.g. dA, dC, dG, dT, or -200-
Attorney Docket No.54462-742.601 dU) is a 2’ deoxynucleoside, and “s” is a phosphorothioate linkage. The base sequences for each siRNA, with and without the 3’ UU extension, are shown in Table 22. [00367] Six to eight week old female mice (C57Bl/6) were injected with 5 uL of a recombinant adeno- associated virus 8 (AAV8) vector (1.2 x 10E13 genome copies/mL) by the retroorbital route on Day -14. The recombinant AAV8 contains the open reading frame, the 5’ UTR, and a portion of the 3’UTR of the human GPAM sequence (ENST00000348367) under the control of the human thyroxine binding globulin promoter in an AAV2 backbone packaged in AAV8 capsid (AAV8-TBG-h-GPAM). On Day 0, infected mice were given a subcutaneous injection of a single 100ug dose of a GalNAc-conjugated siRNA or PBS as vehicle control (n=5). [00368] Mice were euthanized on Day 14 after subcutaneous injection and a liver sample from each was collected and placed in RNAlater (ThermoFisher Catalog# AM7020) until processing. Total liver RNA was prepared by homogenizing the liver tissue in homogenization buffer (Maxwell RSC simplyRNA Tissue Kit) using a Percellys 24 tissue homogenizer (Bertin Instruments) set at 5000 rpm for two 10 second cycles. Total RNA from the lysate was purified on a Maxwell RSC 48 platform (Promega Corporation) according to the manufacturer’s recommendations. Preparation of cDNA was performed using Quanta qScript cDNA SuperMix (VWR, Catalog# 95048-500) according to the manufacturer’s instructions. The relative levels of liver GPAM mRNA were assessed by RT-qPCR in triplicate on a QuantStudio™ 6 Pro Real-Time PCR System using TaqMan assays for human GPAM (ThermoFisher, assay# Hs01573684_m1) and the mouse housekeeping gene PPIA (ThermoFisher, assay# Mm02342430_g1), and PerfeCTa® qPCR FastMix®, Low ROX™ (VWR, Catalog# 101419-222). Mice that gave low liver expression of human GPAM, as defined by having a Ct value of >30, were omitted from further analysis. Data were normalized to the mean GPAM mRNA level in animals receiving a subcutaneous injection of PBS. Results are shown in Table 23. Of the alternatively modified versions of ETD02009, ETD02296 had the greatest activity. Of the alternatively modified versions of ETD02015, ETD02318 had the greatest activity. E ´) ET susu ET susu ET usu ET usu ET usu ET u ET usu ET su ET su ET susu ET susu ET usu ET usu ET
su ETD02314 12922 [ETL17]sauucaCfUfgCfUfagcaagucasusu 13029 usGfsacuUfgCfuagCfaGfuGfaAfususu ETD02315 12923 [ETL17]sauucaCfUfgCfUfagcaagucasusu 13030 usGfsaCfuuGfcuAfgCfaGfuGfaAfususu ETD02316 12924 [ETL17]sauucaCfUfgCfUfagcaagucasusu 13031 usGfsacUfuGfcuAfgCfaGfuGfaAfususu -201-
Attorney Docket No.54462-742.601 ETD02317 12925 [ETL17]sauucaCfUfgCfUfagcaagucasusu 13032 usGfsacUfuGfcUfagCfaGfuGfaAfususu ETD02318 12926 [ETL17]sauucaCfUfgCfUfagcaagucasusu 13033 usGfsacUfuGfcUfagcaGfuGfaAfususu
siRNA SEQ ID Sense Strand Base Sequence SEQ ID Antisense Strand Base Sequence Name NO: (5' to 3') NO: (5' to 3') ETD02009 1309 GGAA C CC A GA CGA 13418 CGA CA AGGAGA CCAUU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU si ce N gs ET A ET A ET A ET A ET A ET A ET A ET A ET A ET U ET U ET U ET U ET U ET U ET U ET U ET U ET U si ce N gs ET A ET A ET A ET A ET A ET A ET A ET
A ETD02300 13249 UGGAAUCUCCUAUGAUCG 13570 CGAUCAUAGGAGAUUCCA ETD02015 13153 AUUCACUGCUAGCAAGUC 13474 GACUUGCUAGCAGUGAAU ETD02310 13250 AUUCACUGCUAGCAAGUC 13571 GACUUGCUAGCAGUGAAU -202-
Attorney Docket No.54462-742.601 ETD02311 13251 AUUCACUGCUAGCAAGUC 13572 GACUUGCUAGCAGUGAAU ETD02312 13252 AUUCACUGCUAGCAAGUC 13573 GACUUGCUAGCAGUGAAU ETD02313 13253 AUUCACUGCUAGCAAGUC 13574 GACUUGCUAGCAGUGAAU ET U ET U ET U ET U ET U Ta
AM Group n Treatment Dose Mean human GPAM mRNA level (ug) (Normalized to Group 1, Day 14)
20 5 ETD02318 100 0.08 Example 15. Screening siRNAs with alternative modification patterns of ETD02003 and ETD02018 in mice transfected with AAV8-TBG-h-GPAM [00369] The base sequences of ETD02003 and ETD02018 were synthesized to generate siRNAs (ETD02223-ETD02230, and ETD02201-ETD02208, respectively) with alternative modification patterns. The activities of the siRNAs were assessed using mice transiently expressing human GPAM. The siRNAs contain the GalNAc ligand ETL17 followed by a phosphorothioate linkage at the 5’ end of the sense strand. The siRNA sequences that were used are shown in Table 24, where Nf (e.g. Af, Cf, Gf, Tf, or Uf) is a 2’ fluoro-modified nucleoside, n (e.g. a, c, g, t, or u) is a 2’ O-methyl modified nucleoside, dN (e.g. dA, dC, dG, dT, or dU) is a 2’ deoxynucleoside, and “s” is a phosphorothioate linkage. The base sequences for each siRNA, with and without the 3’ UU extension, are shown in Table 25. [00370] Six to eight week old female mice (C57Bl/6) were injected with 5 uL of a recombinant adeno- associated virus 8 (AAV8) vector (1.3 x 10E13 genome copies/mL) by the retroorbital route on Day -14. The recombinant AAV8 contains the open reading frame, the 5’ UTR, and a portion of the 3’UTR of the human GPAM sequence (ENST00000348367) under the control of the human thyroxine binding globulin -203-
Attorney Docket No.54462-742.601 promoter in an AAV2 backbone packaged in AAV8 capsid (AAV8-TBG-h-GPAM). On Day 0, infected mice were given a subcutaneous injection of a single 100ug dose of a GalNAc-conjugated siRNA or PBS as vehicle control (n=4). [00371] Mice were euthanized on Day 14 after subcutaneous injection and a liver sample from each was collected and placed in RNAlater (ThermoFisher Catalog# AM7020) until processing. Total liver RNA was prepared by homogenizing the liver tissue in homogenization buffer (Maxwell RSC simplyRNA Tissue Kit) using a Percellys 24 tissue homogenizer (Bertin Instruments) set at 5000 rpm for two 10 second cycles. Total RNA from the lysate was purified on a Maxwell RSC 48 platform (Promega Corporation) according to the manufacturer’s recommendations. Preparation of cDNA was performed using Quanta qScript cDNA SuperMix (VWR, Catalog# 95048-500) according to the manufacturer’s instructions. The relative levels of liver GPAM mRNA were assessed by RT-qPCR in triplicate on a QuantStudio™ 6 Pro Real-Time PCR System using TaqMan assays for human GPAM (ThermoFisher, assay# Hs01573684_m1) or mouse GPAM (ThermoFisher, assay# Mm01261106_m1), and the mouse housekeeping gene PPIA (ThermoFisher, assay# Mm02342430_g1), and PerfeCTa® qPCR FastMix®, Low ROX™ (VWR, Catalog# 101419-222). Data were normalized to the mean GPAM mRNA level in animals receiving a subcutaneous injection of PBS. Results are shown in Table 26. Of the alternatively modified versions of ETD02003, ETD02224 and ETD02228 had the greatest activity in terms of knockdown of the human GPAM mRNA. Of the alternatively modified versions of ETD02018, ETD02202 had the greatest activity in terms of knockdown of the human GPAM mRNA. Table 24. Example siRNA Sequences ´) ETD usu ETD su ETD u ETD su ETD su ETD u ETD su ETD su ETD su ETD u ETD usu ETD usu ETD u ETD
usu ETD02207 12941 [ETL17]sauauaUfUfCfUfgaguuuuguasusu 13048 usAfscAfaaAfcuCfagaAfuAfuAfususu ETD02208 12942 [ETL17]sauauaUfUfCfUfgaguuuuguasusu 13049 usAfscaAfaAfcuCfagaAfuAfuAfususu si ce N ET UU ET UU ET
UU ETD02226 13262 UCCAUGGGCAUAUAGUUGAUU 13583 UCAACUAUAUGCCCAUGGAUU ETD02227 13263 UCCAUGGGCAUAUAGUUGAUU 13584 UCAACUAUAUGCCCAUGGAUU ETD02228 13264 UCCAUGGGCAUAUAGUUGAUU 13585 UCAACUAUAUGCCCAUGGAUU -204-
Attorney Docket No.54462-742.601 ETD02229 13265 UCCAUGGGCAUAUAGUUGAUU 13586 UCAACUAUAUGCCCAUGGAUU ETD02230 13266 UCCAUGGGCAUAUAGUUGAUU 13587 UCAACUAUAUGCCCAUGGAUU ETD02201 13267 AUAUAUUCUGAGUUUUGUAUU 13588 UACAAAACUCAGAAUAUAUUU ET UU ET UU ET UU ET UU ET UU ET UU ET UU si ce N gs ET A ET A ET A ET A ET A ET A ET A ET A ET U ET U ET U ET U ET U ET U ET U ET U si ce N gs ET A ET A ET A ET A ET A ET A ET A ET A ET U ET U ET U ET U ET U ET U ETD
02207 13305 AUAUAUUCUGAGUUUUGU 13626 ACAAAACUCAGAAUAUAU ETD02208 13306 AUAUAUUCUGAGUUUUGU 13627 ACAAAACUCAGAAUAUAU Ta M G
. . 5 4 ETD02226 100 0.35 0.12 6 4 ETD02227 100 0.19 0.16 -205-
Attorney Docket No.54462-742.601 7 4 ETD02228 100 0.11 0.16 8 4 ETD02229 100 0.34 0.10 Exa
p e . c ee g o ca o pa e s o a co a g - -( - methoxyethyl) in mice transfected with AAV8-TBG-h-GPAM [00372] The base sequences of ETD02009 and ETD02015 were synthesized to generate siRNAs (ETD02543-ETD02544, and ETD02539-ETD02542, respectively) with alternative modification patterns including 2’-O-(2-methoxyethyl). The activities of the siRNAs were assessed using mice transiently expressing human GPAM. The siRNAs contain the GalNAc ligand ETL17 followed by a phosphorothioate linkage at the 5’ end of the sense strand. The siRNA sequences that were used are shown in Table 27, where Nf (e.g. Af, Cf, Gf, Tf, or Uf) is a 2’ fluoro-modified nucleoside, n (e.g. a, c, g, t, or u) is a 2’ O-methyl modified nucleoside, Nm (e.g. Am, Cm, Gm, Tm, or Um) is a 2’-O-(2- methoxyethyl) modified nucleoside, and “s” is a phosphorothioate linkage. The base sequences for each siRNA, with and without the 3’ UU extension, are shown in Table 28. [00373] Six to eight week old female mice (C57Bl/6) were injected with 5 uL of a recombinant adeno- associated virus 8 (AAV8) vector (1.2 x 10E13 genome copies/mL) by the retroorbital route on Day -14. The recombinant AAV8 contains the open reading frame, the 5’ UTR, and a portion of the 3’UTR of the human GPAM sequence (ENST00000348367) under the control of the human thyroxine binding globulin promoter in an AAV2 backbone packaged in AAV8 capsid (AAV8-TBG-h-GPAM). On Day 0, infected mice were given a subcutaneous injection of a single 100ug dose of a GalNAc-conjugated siRNA or PBS as vehicle control (n=5). [00374] Mice were euthanized on Day 14 after subcutaneous injection and a liver sample from each was collected and placed in RNAlater (ThermoFisher Catalog# AM7020) until processing. Total liver RNA was prepared by homogenizing the liver tissue in homogenization buffer (Maxwell RSC simplyRNA Tissue Kit) using a Percellys 24 tissue homogenizer (Bertin Instruments) set at 5000 rpm for two 10 second cycles. Total RNA from the lysate was purified on a Maxwell RSC 48 platform (Promega Corporation) according to the manufacturer’s recommendations. Preparation of cDNA was performed using Quanta qScript cDNA SuperMix (VWR, Catalog# 95048-500) according to the manufacturer’s instructions. The relative levels of liver GPAM mRNA were assessed by RT-qPCR in triplicate on a QuantStudio™ 6 Pro Real-Time PCR System using TaqMan assays for human GPAM (ThermoFisher, assay# Hs00326039_m1) and the mouse housekeeping gene PPIA (ThermoFisher, assay# Mm02342430_g1), and PerfeCTa® qPCR FastMix®, Low ROX™ (VWR, Catalog# 101419-222). Data -206-
Attorney Docket No.54462-742.601 were normalized to the mean GPAM mRNA level in animals receiving a subcutaneous injection of PBS. Results are shown in Table 29. Of the alternatively modified versions of ETD02015, ETD02541 had the greatest activity. Of the alternatively modified versions of ETD02009, ETD02543 and ETD2544 had the greatest activity. Table 27. Example siRNA Sequences ETD# SEQ Sense Strand Sequence (5´-3´) with GalNAc SEQ Antisense Strand Sequence (5´-3´) ID moiety ID ETD susu ETD susu ETD usu ETD usu ETD su ETD su ETD su ETD su
Table 28. Example siRNA BASE Sequences siRNA SEQ ID Sense Strand Base Sequence SEQ ID Antisense Strand Base Sequence N ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU si ce N gs ET U ET A ET U ET U ET U ET U ET A ET A si ce N gs ET U ET A ET U ET U ET U ET
U ETD02543 13323 UGGAAUCUCCUAUGAUCG 13644 CGAUCAUAGGAGAUUCCA ETD02544 13324 UGGAAUCUCCUAUGAUCG 13645 CGAUCAUAGGAGAUUCCA Table 29 h-GPAM
. 2 5 ETD02015 100 1.25 3 5 ETD02539 100 1.27 -207-
Attorney Docket No.54462-742.601 4 5 ETD02540 100 0.84 5 5 ETD02541 100 0.79 Example
n mice transfected with AAV8-TBG-h-GPAM [00375] The activities of siRNAs, namely ETD02553-ETD02576, were assessed in mice transiently expressing human GPAM. The siRNAs contain the GalNAc ligand ETL17 followed by a phosphorothioate linkage at the 5’ end of the sense strand. The siRNA sequences that were used are shown in Table 30, where Nf (e.g. Af, Cf, Gf, Tf, or Uf) is a 2’ fluoro-modified nucleoside, n (e.g. a, c, g, t, or u) is a 2’ O-methyl modified nucleoside, Nm (e.g. Am, Cm, Gm, Tm, or Um) is a 2’-O-(2- methoxyethyl) modified nucleoside, and “s” is a phosphorothioate linkage. The base sequences for each siRNA, with and without the 3’ UU extension, are shown in Table 31. ETD02553-ETD02664 were tested in Part 1 of the study and ETD02565-ETD02576 were tested in Part 2. [00376] Six to eight week old female mice (C57Bl/6) were injected with 10 uL of a recombinant adeno-associated virus 8 (AAV8) vector (1.3 x 10E13 genome copies/mL) by the retroorbital route on Day -14. The recombinant AAV8 contains the open reading frame, the 5’ UTR, and a portion of the 3’UTR of the human GPAM sequence (ENST00000348367) under the control of the human thyroxine binding globulin promoter in an AAV2 backbone packaged in AAV8 capsid (AAV8-TBG-h-GPAM). On Day 0, infected mice were given a subcutaneous injection of a single 100ug dose of a GalNAc-conjugated siRNA or PBS as vehicle control (n=5). [00377] Mice were euthanized on Day 14 after subcutaneous injection and a liver sample from each was collected and placed in RNAlater (ThermoFisher Catalog# AM7020) until processing. Total liver RNA was prepared by homogenizing the liver tissue in homogenization buffer (Maxwell RSC simplyRNA Tissue Kit) using a Percellys 24 tissue homogenizer (Bertin Instruments) set at 5000 rpm for two 10 second cycles. Total RNA from the lysate was purified on a Maxwell RSC 48 platform (Promega Corporation) according to the manufacturer’s recommendations. Preparation of cDNA was performed using Quanta qScript cDNA SuperMix (VWR, Catalog# 95048-500) according to the manufacturer’s instructions. The relative levels of liver GPAM mRNA were assessed by RT-qPCR in triplicate on a QuantStudio™ 6 Pro Real-Time PCR System using TaqMan assays for human GPAM (ThermoFisher, assay# Hs01573684_m1) and the mouse housekeeping gene PPIA (ThermoFisher, assay# Mm02342430_g1), and PerfeCTa® qPCR FastMix®, Low ROX™ (VWR, Catalog# 101419-222). Mice that gave low liver expression of human GPAM in Part 2, as defined by having a Ct value of >32, were omitted from further analysis. Data were normalized to the mean GPAM mRNA level in animals receiving a subcutaneous injection of PBS. Results for Part 1 are shown in Table 32, and those for Part 2 in Table 33. Of the siRNAs in this screening set, mice injected with ETD02557, ETD02562, ETD02563, -208-
Attorney Docket No.54462-742.601 ETD02564, ETD02572, ETD02573 or ETD02574 had the highest level of human GPAM mRNA knockdown in the liver. Table 30. Example siRNA Sequences ETD# SEQ Sense Strand Sequence (5´-3´) with GalNAc SEQ ID Antisense Strand Sequence (5´-3´) ID NO: moiety NO: ETD2 124 1 fAf fAf 1 f Af f Af f Af f f f susu ETD susu ETD susu ETD susu ETD usu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD usu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD susu ETD
susu Table 31. Example siRNA BASE Sequences si ce N ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET UU ET
UU ETD02574 13346 AAUGGGGUACUUCAUGUCAUU 13667 UGACAUGAAGUACCCCAUUUU ETD02575 13347 AGGAAAGUUUAUCCAGUAAUU 13668 UUACUGGAUAAACUUUCCUUU ETD02576 13348 UCUGCAAAAGUUGCACAAAUU 13669 UUUGUGCAACUUUUGCAGAUU -209-
Attorney Docket No.54462-742.601 siRNA SEQ ID Sense Strand Base Sequence (5' to SEQ ID Antisense Strand Base Sequence Name NO” 3'), without 3' overhangs NO: (5' to 3'), without 3' overhangs ETD02553 13349 AAACUGAUAGCUGAGUCCA 13670 UGGACUCAGCUAUCAGUUU ET A ET U ET U ET U ET A ET U ET A ET G ET A ET G ET U ET U ET G ET G ET A ET U ET A ET U ET G ET A ET U ET U ET A si ce N gs ET U ET A ET U ET U ET U ET A ET U ET A ET G ET A ET G ET U ET U ET G ET G ET A ET U ET A ET U ET G ET A ET
U ETD02575 13395 AGGAAAGUUUAUCCAGUA 13716 UACUGGAUAAACUUUCCU ETD02576 13396 UCUGCAAAAGUUGCACAA 13717 UUGUGCAACUUUUGCAGA -210-
Attorney Docket No.54462-742.601 Table 32. Relative GPAM mRNA Levels in Livers of Mice Transfected with AAV8-TGB-h-GPAM – Part 1 Group n Treatment Dose Mean human GPAM mRNA level (ug) (Normalized to Group 1, Day 14)
Table 33. Relative GPAM mRNA Levels in Livers of Mice Transfected with AAV8-TGB-h-GPAM – Part 2
13 5 ETD02576 100 0.33 Example 18: Therapeutic siRNA-mediated knockdown of GPAM in a mouse model of non-alcoholic fatty liver disease (NAFLD) [00378] The effects of siRNA-mediated knockdown of GPAM in the liver was investigated in a high fat, high fructose diet-based mouse model of non-alcoholic fatty liver disease (NAFLD). Six- to eight- week-old C57BL/6NHsd female mice (Envigo) were given a Western high fat diet (Envigo TD.120330, 0.2% cholesterol, 45% fat by calories) and high fructose water (55% fructose, 45% glucose) for eight weeks (Groups 2-4) or sixteen weeks (Groups 6-8) prior to siRNA injection. -211-
Attorney Docket No.54462-742.601 [00379] After 8 weeks, mice in Group 1 on regular chow (n=5) and Group 2 on Western Diet (n=5) were injected with 100 ul of phosphate buffered saline (PBS) subcutaneously biweekly until 16 weeks (Day 112). Mice in Group 3 on Western Diet (n=5) were injected with 100 ug of siRNA ETD02282 targeting mouse GPAM and Group 4 on Western Diet (n=5) were injected with 100 ug of siRNA ETD02284 targeting mouse GPAM by subcutaneous injection biweekly until 16 weeks (Day 112) for a total of 4 injections. The siRNAs contain the GalNAc ligand ETL17 followed by a phosphorothioate linkage at the 5’ end of the sense strand. The siRNA sequences that were used are shown in Table 34, where Nf (e.g. Af, Cf, Gf, Tf, or Uf) is a 2’ fluoro-modified nucleoside, n (e.g. a, c, g, t, or u) is a 2’ O- methyl modified nucleoside, and “s” is a phosphorothioate linkage. The base sequences for each siRNA, with and without the 3’ UU extension, are shown in Table 35. Table 34. Example siRNA Sequences ETD# SEQ Sense Strand Sequence (5´-3´) with SEQ ID Antisense Strand Sequence (5´-3´) ETD susu ETD usu
Table 35. Example siRNA BASE Sequences siRNA SE ID S St d B S SE ID A ti St d B S nce N ET UU ET UU si ce N gs ET G ET G si ce N gs ET G ETD
02284 13402 CAAUAGACGUUUCUUAUC 13723 GAUAAGAAACGUCUAUUG [00380] After 16 weeks, mice in Group 5 on regular chow (n=5) and Group 6 on Western Diet (n=5) were injected with 100 ul of phosphate buffered saline (PBS) subcutaneously biweekly until 24 weeks (Day 168). Mice in Group 7 on Western Diet (n=5) were injected with 100 ug of siRNA ETD02282 targeting mouse GPAM and Group 8 on Western Diet (n=5) were injected with 100 ug of siRNA ETD02284 targeting mouse GPAM by subcutaneous injection biweekly until 24 weeks (Day 168) for a total of 4 injections. The [00381] Body weights were recorded biweekly at the start of the Western diet until the end of the study. Mice were fasted 4-6 hours for serum collection prior to the first siRNA treatment and then 1 day prior to each biweekly siRNA injection. Serum was sent for the following clinical chemistry assays (IDEXX Laboratories, Incorporated): ALP, ALT, BUN, cholesterol, glucose, total bilirubin, total protein, triglycerides, and beta-hydroxybutarate. Ketones were measured in a drop of whole blood using Precision Xtra Ketone Test Strips (Abbott). [00382] All mice in Groups 1-4 were euthanized via cervical dislocation following isoflurane exposure with a final serum bleed at 16 weeks and all mice in Groups 5-8 were euthanized via cervical dislocation following isoflurane exposure with a final serum bleed at 24 weeks and the liver was separated -212-
Attorney Docket No.54462-742.601 into 4 sections. One section was placed in RNAlater for qRT-PCR (Thermo Fisher #AM7020), one section was snap frozen in liquid nitrogen for liver triglyceride measurement, one section was placed into 10% formalin for fixation and paraffin embedding for H&E and Picrosirius Red staining, and one section was fixed with 10% formalin at 4C for 24 hours and then embedded in OCT for Oil Red O staining. [00383] Total liver RNA was prepared by homogenizing the RNAlater liver tissue in homogenization buffer (Maxwell RSC simplyRNA Tissue Kit) using a Percellys 24 tissue homogenizer (Bertin Instruments) set at 5000 rpm for two 10 second cycles. Total RNA from the lysate was purified on a Maxwell RSC 48 platform (Promega Corporation) according to the manufacturer’s recommendations. Preparation of cDNA was performed using Quanta qScript cDNA SuperMix (VWR, Catalog# 95048-500) according to the manufacturer’s instructions. The levels of liver GPAM mRNA were assessed by RT- qPCR in triplicate on a QuantStudio™ 6 Pro Real-Time PCR System using TaqMan assays for mouse GPAM (ThermoFisher, assay# Mm01261106_m1), mouse COL1A1 (ThermoFisher, assay # Mm00801666_g1), mouse TIMP1 (ThermoFisher, assay # Mm00801666_g1), mouse TGFB1 (ThermoFisher, assay # Mm01341361_m1), mouse Acta2/SMA (ThermoFisher, assay # Mm00725412_s1), mouse Tnf-⍺ (ThermoFisher, assay # Mm00443258_m1), mouse Il1B (ThermoFisher, assay # Mm00434228_m1), mouse CCL2 (ThermoFisher, assay # Mm00441242_m1), and the mouse housekeeping gene PPIA (ThermoFisher, assay# Mm02342430_g1) using PerfeCTa® qPCR FastMix®, Low ROX™ (VWR, Catalog# 101419-222). Data was normalized to the mouse group on Western Diet receiving PBS (Group 2) by the delta-delta Ct method. [00384] The 16 week GPAM mRNA levels are shown in Table . Data were normalized to the level in animals receiving PBS and on the Western Diet (Group 2). Mice on the Western Diet treated with ETD02282 (Group 3) or ETD02284 (Group 4) had reduced liver GPAM mRNA levels compared to mice on the Western Diet receiving PBS (Group 2). The mice on the Western Diet had elevated levels of GPAM compared to the mice on normal chow. Table 36.16-w k GPAM mRNA L l in Mi Tr t d ith ETD02282 and ETD02284 e
24 0.30 25 0.13 4 31 0.12 0.07 -213-
Attorney Docket No.54462-742.601 32 0.13 33 0.02 34 019 [00385] The 24 - rmalized to the level
in animals receiving PBS and on the Western Diet (Group 6). Mice on the Western Diet treated with ETD02282 (Group 7) or ETD02284 (Group 8) had reduced liver GPAM mRNA levels compared to mice on the Western Diet receiving PBS (Group 6). The mice on the Western Diet had elevated levels of GPAM compared to the mice on normal chow. Table 37.24-week GPAM mRNA Levels in Mice Treated with ETD02282 and ETD02284 Relative Liver Mean Relative
40 0.16 [00386] The starting (Day 0) and ending (Day 112) body weights are shown in Table 38 for the 16- week study. There was reduced weight gain in the mice fed the Western Diet and treated with ETD02284 (Group 4) compared to mice on the Western Diet and treated with PBS (Group 2) at 16 weeks. ody G (g)
11 17.3 31.28 2 12 18.8 18.12 35.24 32.08 13 18.1 31.02 -214-
Attorney Docket No.54462-742.601 14 18.1 32.04 15 18.3 30.81 21 180 3308 [00387]
g y g y y g he 24- week study. There was no reduced weight gain in the mice fed the Western Diet and treated with ETD02282 (Group 7) or ETD02284 (Group 8) compared to mice on the Western Diet and treated with PBS (Group 6) at 24 weeks. Table 39.24-week Body Weights of Mice Treated with ETD02282 and ETD02284 ody G (g)
39 19.60 39.69 40 18.80 23.56 [00388] The 16-week serum levels of ALT, cholesterol, and ketones are shown in Table 40. The ALT and cholesterol levels at 16 weeks in mice treated with ETD02282 (Group 3) and ETD02284 (Group 4) were lower than mice treated with PBS (Group 2) on Western Diet. The ketone levels in mice at 16 weeks treated with ETD02284 (Group 4) were higher than mice treated with PBS (Group 2) on Western Diet. -215-
Attorney Docket No.54462-742.601 Table 40.16-week ALT, Cholesterol, and Ketone Levels in Mice Treated with ETD02282 and ETD02284 ALT (U/L) Cholesterol (mg/dL) Ketones (mmol/L) Gr an 55 3 36 56
. [00389] The 24-week serum levels of ALT, cholesterol, and ketones are shown in Table 41. The ALT and cholesterol levels at 24 weeks in mice treated with ETD02282 (Group 7) and ETD02284 (Group 8) were lower than mice treated with PBS (Group 6) on Western Diet. The ketone levels in mice at 16 weeks treated with ETD02282 (Group 7) and ETD02284 (Group 8) were slightly higher than mice treated with PBS (Group 6) on Western Diet. Table 41.24-week ALT Cholesterol and Ketone Levels in Mice Treated with ETD02282 and L) Gr an
54 9 22 63 0.6 10 19 86 0.4 -216-
Attorney Docket No.54462-742.601 16 54 131 0.4 17 66 134 0.5 48 52 56
[00390] To assess liver histology, liver sections were formalin fixed and paraffin embedded then stained with hematoxylin and eosin (H&E). The % steatotic area was calculated by measuring the white areas left behind by lipid droplets in the tissue divided by the total area of the tissue section. Five different liver serial sections were used per animal for quantification. The 16-week % steatotic area of the H&E stained formalin fixed liver sections is in Table 42. The % steatotic area at 16 weeks was reduced in mice treated with ETD02282 (Group 3) and ETD02284 (Group 4) compared to mice treated with PBS (Group 2) on Western Diet. Table 42.16-week % Steatotic Area of Livers in Mice Treated with ETD02282 and ETD02284
34 2.69 35 4.86 [00391] To assess liver histology, liver sections were formalin fixed and paraffin embedded then stained with hematoxylin and eosin (H&E). The % steatotic area was calculated by measuring the white areas left behind by lipid droplets in the tissue divided by the total area of the tissue section. Five different liver serial sections were used per animal for quantification. The 24-week % steatotic area of the H&E -217-
Attorney Docket No.54462-742.601 stained formalin fixed liver sections is in Table 43. The % steatotic area at 24 weeks was reduced in mice treated with ETD02282 (Group 7) and ETD02284 (Group 8) compared to mice treated with PBS (Group 6) on Western Diet. Table 43.24-week % Steatotic Area of Livers in Mice Treated with ETD02282 and ETD02284 Individual % Mean % Group # Animal # Steatotic Area Steatotic Area
[00392] Liver triglycerides were measured in a piece of flash frozen liver using a Triglyceride Colorimetric Kit (Elabscience #E-BC-K238) following the manufacturer’s instructions. The relative levels of triglycerides in the flash frozen liver sections are shown in Table 44 with the data normalized to mice on normal diet treated with PBS (Group 1). The level of triglycerides in the liver at 16 weeks was reduced in mice treated with ETD02282 (Group 3) and ETD02284 (Group 4) compared to mice treated with PBS (Group 2) on Western Diet. Table 44 16-week Liver Triglyceride Levels in Mice Treated with ETD02282 and ETD02284 l
31 0.61 4 32 0.27 0.79 33 0.56 -218-
Attorney Docket No.54462-742.601 34 1.55 35 0.94 [00393] ide
Colorimetric Kit (Elabscience #E-BC-K238) following the manufacturer’s instructions. The levels of triglycerides in the flash frozen liver sections are shown in Table 45 with the data normalized to mice on normal diet treated with PBS (Group 5). The level of triglycerides in the liver at 24 weeks was not reduced in mice treated with ETD02282 (Group 7) and ETD02284 (Group 8) compared to mice treated with PBS (Group 6) on Western Diet. Table 45.24-week Liver Triglyceride Levels in Mice Treated with ETD02282 and ETD02284 Relative Liver Relative Liver l
40 1.01 [00394] Expression of fibrotic and pro-inflammatory genes in the liver were measured by qRT-PCR and normalized to the mice on Western Diet receiving PBS (Group 2). The expression of pro-fibrotic genes COL1A1 and TIMP1 and pro-inflammatory genes TNF- ⍺, IL1b, and CCL2 are shown in Table 46. Mice on Western Diet treated with ETD02284 (Group 4) had reduced expression of pro-fibrotic genes COL1A1 and TIMP1 and pro-inflammatory genes TNF-alpha and CCL2 at 16 weeks compared to mice treated with PBS (Group 2) on Western Diet. Mice treated with ETD02282 (Group 3) did not show reduction of any genes compared to PBS treated mice (Group 2) except TIMP1. -219-
Attorney Docket No.54462-742.601 Table 46.16-week Expression of Pro-fibrotic and Pro-inflammatory Genes in Mice Treated with ETD02282 and ETD02284 COL1A1 TIMP1 TNF- alpha IL1b CCL2 Day 112 Day 112 Day 112 Day 112 Day 112 Grou # Mean 1 0.33 2 1.00 3 2.52 4 0.51
35 0.07 0.03 0.14 1.32 0.36 [00395] Expression of fibrotic and pro-inflammatory genes in the liver were measured by qRT-PCR and normalized to the mice on Western Diet receiving PBS (Group 2). The expression of pro-fibrotic genes COL1A1 and TIMP1 and pro-inflammatory genes TNF- ⍺, IL1b, and CCL2 are shown in Table 47. Mice on Western Diet treated with ETD02282 (Group 7) and ETD02284 (Group 8) had reduced expression of pro-fibrotic genes COL1A1 and TIMP1 and pro-inflammatory gene TNF-alpha at 24 weeks compared to mice treated with PBS (Group 6). Mice treated with either siRNA did not show any significant change in expression of pro-inflammatory markers IL1b or CCL2 at 24 weeks. -220-
Attorney Docket No.54462-742.601 Table 47.24-week Expression of Pro-fibrotic and Pro-inflammatory Genes in Mice Treated with ETD02282 and ETD02284 COL1A1 TIMP1 TNF- alpha IL1b CCL2 Day 168 Day 168 Day 168 Day 168 Day 168 Gro # Mean 5 0.32 6 1.00 7 0.71 8 1.06
40 1.72 0.17 1.60 9.19 0.87 Example 19. Preventative siRNA-mediated knockdown of GPAM in a mouse model of non-alcoholic fatty liver disease (NAFLD) [00396] The protective effects of siRNA-mediated knockdown of GPAM in the liver was investigated in a high fat, high fructose diet-based mouse model of non-alcoholic fatty liver disease (NAFLD). Six- to eight-week-old C57BL/6NHsd female mice (Envigo) were given a Western high fat diet (Envigo TD.120330, 0.2% cholesterol, 45% fat by calories) and high fructose water (55% fructose, 45% glucose). Mice were on diet for eight weeks (Groups 2-6) or sixteen weeks (Groups 8-12) with the following siRNAs targeting GPAM starting Day 0 of the study: Group 1 (n=5) on regular chow were injected with 100 ul of phosphate buffered saline (PBS) subcutaneously biweekly until 8 weeks (Day 56) or Group 7 (n=5) until 16 weeks (Day 112). Group 2 (n=5) on the Western diet were injected with 100 ul of phosphate buffered saline (PBS) subcutaneously biweekly until 8 weeks (Day 56) or Group 8 (n=5) until 16 weeks (Day 112). -221-
Attorney Docket No.54462-742.601 [00397] Group 3 (n=5) on the Western diet were injected with 200 ug of siRNA ETD02282 targeting mouse GPAM subcutaneously biweekly until 8 weeks (Day 56) or Group 9 (n=5) until 16 weeks (Day 112). Group 4 (n=5) on the Western diet were injected with 60 ug of siRNA ETD02282 targeting mouse GPAM subcutaneously biweekly until 8 weeks (Day 56) or Group 10 (n=5) until 16 weeks (Day 112). Group 5 (n=5) on the Western diet were injected with 200 ug of siRNA ETD02284 targeting mouse GPAM subcutaneously biweekly until 8 weeks (Day 56) or Group 11 (n=5) until 16 weeks (Day 112). Group 6 (n=5) on the Western diet were injected with 60 ug of siRNA ETD02284 targeting mouse GPAM subcutaneously biweekly until 8 weeks (Day 56) or Group 12 (n=5) until 16 weeks (Day 112). Mice on the 8 week study received a total of 4 siRNA doses and mice on the 16 week study received a total of 16 siRNA doses. The siRNA sequences that were used are shown in Table 48, where Nf (e.g. Af, Cf, Gf, Tf, or Uf) is a 2’ fluoro-modified nucleoside, n (e.g. a, c, g, t, or u) is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. The base sequences for each siRNA, with and without the 3’ UU extension, are shown in Table 49 Table 48. Example siRNA Sequences ETD# SEQ Sense Strand Sequence (5´-3´) with SEQ ID Antisense Strand Sequence (5´-3´) ETD susu ETD usu
Table 49. Example siRNA BASE Sequences si ce N ET UU ET UU si ce N gs ET G ET G si ce N gs ET
G ETD02284 13402 CAAUAGACGUUUCUUAUC 13723 GAUAAGAAACGUCUAUUG [00398] Body weights were recorded biweekly until the end of the study. Mice were fasted 4-6 hours for serum collection on Day 0 and then 1 day prior to each biweekly siRNA injection. Serum was sent for the following clinical chemistry assays performed at IDEXX Laboratories, Incorporated – ALP, ALT, BUN, cholesterol, glucose, total bilirubin, total protein, triglycerides, and beta-hydroxybutarate. [00399] All mice in Groups 1-6 were euthanized via cervical dislocation following isoflurane exposure with a final serum bleed at 8 weeks and all mice in Groups 7-12 were euthanized via cervical dislocation following isoflurane exposure with a final serum bleed at 16 weeks and the liver was separated into 4 sections. One section was placed in RNAlater for qRT-PCR (Thermo Fisher #AM7020), one section was snap frozen in liquid nitrogen for liver triglyceride measurement, one section was placed into 10% formalin for fixation and paraffin embedding for H&E and Picrosirius Red staining, and one section was fixed with 10% formalin at 4C for 24 hours and then embedded in OCT for Oil Red O staining. -222-
Attorney Docket No.54462-742.601 [00400] Total liver RNA was prepared by homogenizing the RNAlater liver tissue in homogenization buffer (Maxwell RSC simplyRNA Tissue Kit) using a Percellys 24 tissue homogenizer (Bertin Instruments) set at 5000 rpm for two 10 second cycles. Total RNA from the lysate was purified on a Maxwell RSC 48 platform (Promega Corporation) according to the manufacturer’s recommendations. Preparation of cDNA was performed using Quanta qScript cDNA SuperMix (VWR, Catalog# 95048-500) according to the manufacturer’s instructions. The levels of liver GPAM mRNA were assessed by RT- qPCR in triplicate on a QuantStudio™ 6 Pro Real-Time PCR System using TaqMan assays for mouse GPAM (ThermoFisher, assay# Mm01261106_m1), mouse COL1A1 (ThermoFisher, assay # Mm00801666_g1), mouse TIMP1 (ThermoFisher, assay # Mm00801666_g1), mouse TGFB1 (ThermoFisher, assay # Mm01341361_m1), mouse Acta2/SMA (ThermoFisher, assay # Mm00725412_s1), mouse Tnf-⍺ (ThermoFisher, assay # Mm00443258_m1), mouse Il1B (ThermoFisher, assay # Mm00434228_m1), mouse CCL2 (ThermoFisher, assay # Mm00441242_m1), and the mouse housekeeping gene PPIA (ThermoFisher, assay# Mm02342430_g1) using PerfeCTa® qPCR FastMix®, Low ROX™ (VWR, Catalog# 101419-222). Data was normalized to the mouse group on Western Diet receiving PBS (Group 2) using the delta-delta Ct method. [00401] The 8 -week GPAM mRNA levels are shown in Table . Data were normalized to the level in animals receiving PBS and on the Western Diet (Group 2). Mice on the Western Diet treated with ETD02282 (Groups 3 and 4) or ETD02284 (Groups 5 and 6) had reduced liver GPAM mRNA levels compared to mice on the Western Diet receiving PBS (Group 2). The mice on the Western Diet had elevated levels of GPAM compared to the mice on normal chow. Table 50.8-week GPAM mRNA Levels in Mice Treated with ETD02282 and ETD02284 M G
41 0.06 5 42 0.01 0.05 43 0.13 -223-
Attorney Docket No.54462-742.601 44 0.05 45 0.04 51 005 [004
d to the level in animals receiving PBS and on the Western Diet (Group 8). Mice on the Western Diet treated with ETD02282 (Groups 9 and 10) or ETD02284 (Groups 11 and 12) had reduced liver GPAM mRNA levels compared to mice on the Western Diet receiving PBS (Group 8). The mice on the Western Diet had elevated levels of GPAM compared to the mice on normal chow. Table 51.16-week GPAM mRNA Levels in Mice Treated with ETD02282 and ETD02284 Relative Liver GPAM Mean Relative Liver GPAM G
59 0.09 60 0.08 [00403] The starting (Day 0) and ending (Day 56) body weights are shown in Table 52 for the 8-week study. There was reduced weight gain in the mice fed the Western Diet and treated with both doses of ETD02284 (Groups 5 and 6) compared to mice on the Western Diet and treated with PBS (Group 2) at 8 weeks. -224-
Attorney Docket No.54462-742.601 Table 52.8-week Body Weights of Mice Treated with ETD02282 and ETD02284 Day 0 Day 56 Individual Individual ody G (g)
55 18.1 30.6 [00404] The starting (Day 0) and ending (Day 112) body weights are shown in Table 53 for the 16- week study. There was no reduced weight gain in the mice fed the Western Diet and treated with the 200 ug dose of ETD02282 (Group 9) or ETD02284 (Group 11) compared to mice on the Western Diet and treated with PBS (Group 8) at 16 weeks. However, there was reduced weight gain in mice fed the Western Diet and treated with 60 ug dose of ETD02282 (Group 10) and ETD02284 (Group 12). ody G (g)
7 8 19.88 21.44 27.17 27.54 9 22.13 27.05 10 20.76 26.35 -225-
Attorney Docket No.54462-742.601 16 19.25 30.36 17 21.26 39.01 8 18 1738 2006 2702 3353
[00405] The 8-week serum levels of ALT, cholesterol, and ketones are shown in Table 54. The ALT levels at 8 weeks in mice treated with both doses of ETD02282 (Groups 3 and 4) and ETD02284 (Groups 5 and 6) were lower than mice treated with PBS (Group 2) on Western Diet. The serum cholesterol levels at 8 weeks in mice treated with either ETD02282 (Groups 3 and 4) or ETD02284 (Groups 5 and 6) on Western Diet were not significantly decreased compared to mice treated with PBS (Group 2) on Western Diet. The ketone levels in mice at 8 weeks treated with both doses of ETD02284 (Groups 5 and 6) on Western Diet were higher than mice treated with PBS (Group 2) on Western Diet while the mice treated with both doses of ETD02282 (Groups 3 and 4) did not show an increase in ketones. Table 54.8-week ALT, Cholesterol, and Ketone Levels in Mice Treated with ETD02282 and L) Gr an 4
2 12 31 32.8 105 117.0 0.4 0.42 13 40 150 0.4 -226-
Attorney Docket No.54462-742.601 14 36 113 0.3 15 33 117 0.6 5 4 72 58
[00406] The 16-week serum levels of ALT, cholesterol, and ketone betahydroxybutyrate (BHB) are shown in Table 55. The ALT levels at 16 weeks in mice treated with both doses of ETD02282 (Groups 9 and 10) and ETD02284 (Groups 11 and 12) were lower than mice treated with PBS (Group 8) on Western Diet. The serum cholesterol levels at 16 weeks in mice treated with either ETD02282 (Groups 9 and 10) or ETD02284 (Groups 11 and 12) on Western Diet increased compared to mice treated with PBS (Group 8) on Western Diet. The (BHB) serum levels at 16 weeks were not increased with either siRNA treatment or dosage. Table 55.16-week ALT, Cholesterol, and Ketone Levels in Mice Treated with ETD02282 and Gr an 08
16 70 138 8.9 8 96.8 111.8 6.78 17 172 72 8.3 -227-
Attorney Docket No.54462-742.601 18 41 125 3.9 19 125 154 8.2 62 96 02 96
[00407] To assess liver histology, liver sections were formalin fixed and paraffin embedded then stained with hematoxylin and eosin (H&E). The % steatotic area was calculated by measuring the white areas left behind by lipid droplets in the tissue divided by the total area of the tissue section. Five different liver serial sections were used per animal for quantification. The 8-week % steatotic area of the H&E stained formalin fixed liver sections is in Table 56. Mice on the Western diet treated with the 200 ug dose of ETD02282 (Group 3) and both doses of ETD02284 (Groups 5 and 6) had reduced % steatotic area compared to mice received PBS (Group 2) on Western Diet. The mice treated with ETD02284 had a greater reduction in steatotic area than the mice treated with ETD02282. T TD02284 G
3 23 2.05 1.69 24 1.68 25 1.00 -228-
Attorney Docket No.54462-742.601 31 2.58 32 2.45 4 33 271 281 [0040
8] To assess liver histology, liver sections were formalin fixed and paraffin embedded then stained with hematoxylin and eosin (H&E). The % steatotic area was calculated by measuring the white areas left behind by lipid droplets in the tissue divided by the total area of the tissue section. Five different liver serial sections were used per animal for quantification. The 16-week % steatotic area of the H&E stained formalin fixed liver sections is in Table 57. Mice on the Western Diet treated with both doses of ETD02282 (Groups 9 and 10) and ETD02284 (Groups 11 and 12) for 16 weeks had reduced % steatotic area compared to mice on Western Diet treated with PBS. Mice treated with the 60 ug dose of ETD02284 (Group 12) had a larger reduction in % steatotic area compared to mice treated with ETD02282. Table 57.16-week % Steatotic Area of Livers in Mice Treated with ETD02282 and ETD02284 G
56 0.55 12 57 3.21 2.23 58 2.51 -229-
Attorney Docket No.54462-742.601 59 2.34 60 2.56 [004 eride
Colorimetric Kit (Elabscience #E-BC-K238) following the manufacturer’s instructions. The levels of triglycerides in the flash frozen liver sections are shown in Table 58 with the data normalized to mice on normal diet treated with PBS (Group 1). The level of triglycerides in the liver at 8 weeks was reduced in mice treated with 200 ug (Group 3) and 60 ug (Group 4) of ETD02282 and 200 ug (Group 5) and 60 ug (Group 6) of ETD02284 (Group 4) compared to mice treated with PBS (Group 2) on Western Diet. Table 58.8-week Liver Triglyceride Levels in Mice Treated with ETD02282 and ETD02284 Relative Liver Relative Liver l
54 0.13 55 0.14 [00410] Liver triglycerides were measured in a piece of flash frozen liver using a Triglyceride Colorimetric Kit (Elabscience #E-BC-K238) following the manufacturer’s instructions. The levels of triglycerides in the flash frozen liver sections are shown in Table 59 with the data normalized to mice on normal diet treated with PBS (Group 7). The level of triglycerides in the liver at 16 weeks were not significantly reduced in mice treated with either dose of ETD02282 (Groups 9 and 10) and 200 ug -230-
Attorney Docket No.54462-742.601 ETD02284 (Group 11) compared to mice treated with PBS (Group 8) on Western Diet. The samples from the 60 ug dose of ETD02284 (Group 12) could not be successfully processed for this experiment. Table 59.16-week Liver Triglyceride Levels in Mice Treated with ETD02282 and ETD02284 Relative Liver Relative Liver Triglyceride Level Triglyceride Level
60 - [00411] Expression of fibrotic and pro-inflammatory genes in the liver were measured by qRT-PCR and normalized to the mice on Western Diet receiving PBS (Group 2). The expression of pro-fibrotic genes COL1A1 and TIMP1 and pro-inflammatory genes TNF- ⍺, IL1b, and CCL2 are shown in Table 60. Mice on Western Diet treated with 200 ug ETD02282 (Group 3) showed no reduction of pro-fibrotic or pro-inflammatory genes compared to mice treated with PBS (Group 2). Mice on Western Diet treated with 60 ug of ETD02282 (Group 4) had reduced expression of pro-fibrotic genes COL1A1 and TIMP1 and reduced expression of CCL2 compared to mice treated with PBS (Group 2). Mice on Western Diet treated with 200 ug of ETD02284 (Group 5) and 60 ug (Group 6) had reduced expression of pro-fibrotic genes COL1A1 and TIMP1 and reduced expression of pro-inflammatory genes TNF-alpha, IL1b, and CCL2 when compared to mice treated with PBS (Group 2). -231-
Attorney Docket No.54462-742.601 Table 60.8-week Expression of Pro-fibrotic and Pro-inflammatory Genes in Mice Treated with ETD02282 and ETD02284 COL1A1 TIMP1 TNF- alpha IL1b CCL2 Day 56 Day 56 Day 56 Day 56 Day 56 Grou # Mean 1 0.34 2 1.00 3 0.76 4 0.63 5 0.53 6 0.67
54 0.3 0.0 0. 0.94 0.46 55 0.96 1.64 1.07 1.78 1.00 [00412] Expression of fibrotic and pro-inflammatory genes in the liver were measured by qRT-PCR and normalized to the mice on Western Diet receiving PBS (Group 2). The expression of pro-fibrotic genes COL1A1 and TIMP1 and pro-inflammatory genes TNF- ⍺, IL1b, and CCL2 are shown in Table 61. Mice on the Western Diet for 16 weeks and treated with 200 ug (Group 9) or 60 ug (Group 10) of -232-
Attorney Docket No.54462-742.601 ETD02282 or 200 ug of ETD02284 (Group 11) did not show any significant reduction in expression of pro-fibrotic or pro-inflammatory genes compared to mice treated with PBS (Group 8). The mice treated with 60 ug of ETD02284 (Group 12) showed significant reduction of all pro-fibrotic and pro- inflammatory genes measured at 16 weeks compared to mice on PBS (Group 8). Table 61.16-week Expression of Pro-fibrotic and Pro-inflammatory Genes in Mice Treated with ETD02282 and ETD02284 COL1A1 TIMP1 TNF- alpha IL1b CCL2 2 Gro # Mean 7 0.89 8 1.00 9 1.41 10 0.92 11 1.41 12
0.65 59 0.31 0.00 0.09 0.46 0.58 60 0.28 0.00 0.08 0.59 0.46 -233-
Attorney Docket No.54462-742.601 Example 20: Determining the activity of a siRNA ETD02318 targeting GPAM in a single dose study in non-human primates [00413] One group of four male cynomolgus monkeys >3 years old was utilized for this study. Monkeys were maintained on normal chow with ad libitum access throughout the study except prior to blood collections in which they were fasted overnight (at least 12 hours). On study Day 0, cynomolgus monkeys were injected subcutaneously (2 mL/kg) with a single dose of 3 mg/kg ETD02318 at a concentration of 1.5 mg/mL. The sequence of the siRNA used are shown in Table 62, where Nf (e.g. Af, Cf, Gf, Tf, or Uf) is a 2’ fluoro-modified nucleoside, n (e.g. a, c, g, t, or u) is a 2’ O-methyl modified nucleoside, and “s” is a phosphorothioate linkage. The base sequences for each siRNA, with and without the 3’ UU extension, are shown in Table 63. Table 62. Example siRNA Sequence ETD# SEQ Sense Strand Sequence (5´-3´) with SEQ Antisense Strand Sequence (5´-3´) ET sus 8
Table 63. Example siRNA BASE Sequence siR A A i nce N ET UU si ce N gs ET U si ce N gs ETD
U [00414] Body weights were recorded weekly on Days -8, -2, 7, 14, 21, and 28 of the study. On study Days -8, -2, 7, 14, 21, and 28 whole blood was collected into tubes with no anti-coagulant and centrifuged to obtain serum after clotting. Clinical chemistry for ALT, AST, ALP, DBIL, TBIL, GLU, UREA, CREA, TG, CHOL, TP, GGT, HDL-CH, LDL-CH, and B-HDBH were analyzed. [00415] On study Day -8 and Day 28, a 5 mg liver biopsy was conducted by anesthetizing the animals with Zoletil (1.5-5.0 mg/kg, i.m.) and xylazine (0.5-2.0 mg/kg, i.m.). The liver biopsy was then placed into 10 v/v RNAlater™ Stabilization Solution (Thermo Fisher, Catalog# AM7020) in 20 seconds and stored for 24 hours at 4°C. The RNAlater was then removed and the liver tissue was stored in the freezer until they were shipped to Empirico. [00416] Total liver RNA was prepared by homogenizing the RNAlater liver tissue in homogenization buffer (Maxwell RSC simplyRNA Tissue Kit) using a Percellys 24 tissue homogenizer (Bertin Instruments) set at 5000 rpm for two 10 second cycles. Total RNA from the lysate was purified on a Maxwell RSC 48 platform (Promega Corporation) according to the manufacturer’s recommendations. Preparation of cDNA was performed using Quanta qScript cDNA SuperMix (VWR, Catalog# 95048-500) according to the manufacturer’s instructions. The levels of liver GPAM mRNA were assessed by RT- qPCR in triplicate on a QuantStudio™ 6 Pro Real-Time PCR System using TaqMan assays for monkey -234-
Attorney Docket No.54462-742.601 GPAM (ThermoFisher, assay# Mf02878271_m1), and the monkey housekeeping gene GAPDH (ThermoFisher, assay# Mf04392546_g1) using PerfeCTa® qPCR FastMix®, Low ROX™ (VWR, Catalog# 101419-222). [00417] The results of the liver biopsy mRNA analysis are summarized in Table 64. Data for each individual was normalized to its Day -8 liver biopsy mRNA levels using the delta-delta Ct method. A 64% mean reduction in liver GPAM mRNA was observed with a single dose of ETD02318 at Day 28 after injection. There were no significant changes in body weight or any of the clinical parameters measured during this study. Table 64. GPAM liver mRNA Levels in Monkeys treated with a single dose of ETD02318 Day -8 Day -8 Mean Day 28 Day 28 ive M el
[00418] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and compositions within the scope of these claims and their equivalents be covered thereby. -235-
Attorney Docket No.54462-742.601 IV. SEQUENCE INFORMATION [00419] Some embodiments include one or more nucleic acid sequences in the following tables: Table 65. Sequence Information SEQ ID NO: Description 1-6354 GPAM siRNA sense strand sequences 6 1 1 1 1 1 1 1 1 1 1 1
Table 66. GPAM siRNA Sequences SEQ ID SEQ ID Anti n trnd n (5´- siR s GC s CG s GC s GG s UG s GU s AG s CA s GC si UG si CU si GC si AG si CA si CC si GC si UG si AU si AA si CA si CC si GC si GG si CG si CC siR
NA 26 26 U 6380 AAGCCCGCACUUCCAGUCC siRNA 27 27 GACUGGAAGUGCGGGCUUC 6381 GAAGCCCGCACUUCCAGUC siRNA 28 28 ACUGGAAGUGCGGGCUUCU 6382 AGAAGCCCGCACUUCCAGU -236-
Attorney Docket No.54462-742.601 siRNA 29 29 CUGGAAGUGCGGGCUUCUG 6383 CAGAAGCCCGCACUUCCAG siRNA 30 30 UGGAAGUGCGGGCUUCUGC 6384 GCAGAAGCCCGCACUUCCA siR A 31 31 GGAAG GCGGGC C GCA 638 GCAGAAGCCCGCAC UCC si UC si UU si CU si AC si CA si GC si CG si CCC si GCC si GC si AG si AA si GA si AG si CA si GC si UG si CU si GC si UG si CU si GC si GG si CG si UC si UU si CU si GC si AG si CA si CC si UC si CU si GC si AG si CA si GC si AG si UA si CU si CCC si CC si GC si UG si CU si GC si UG si CU siR
NA 80 80 GCGGCUCCCCUGUUGUAUG 6434 CAUACAACAGGGGAGCCGC siRNA 81 81 CGGCUCCCCUGUUGUAUGG 6435 CCAUACAACAGGGGAGCCG siRNA 82 82 GGCUCCCCUGUUGUAUGGA 6436 UCCAUACAACAGGGGAGCC -237-
Attorney Docket No.54462-742.601 siRNA 83 83 GCUCCCCUGUUGUAUGGAC 6437 GUCCAUACAACAGGGGAGC siRNA 84 84 CUCCCCUGUUGUAUGGACA 6438 UGUCCAUACAACAGGGGAG siR A 8 8 CCCC G G A GGACA 6439 A G CCA ACAACAGGGGA si GG si GG si GG si AG si CA si AC si CAA si ACA si UAC si UA si CAU si CCA si UCC GU si UG siR AU siR AA siR GA siR AG siR siR CAG siR GCA siR UGC siR UG siR GU siR GG siR GG siR CG siR UC siR UU siR UU siR GU siR AG siR CA siR UC siR AU siR UA siR CU
siRNA 123 123 A 6477 UAAAACUUCAGGACUCAGC CUGAGUCCUGAAGUUUUA siRNA 124 124 U 6478 AUAAAACUUCAGGACUCAG -238-
Attorney Docket No.54462-742.601 UGAGUCCUGAAGUUUUAU siRNA 125 125 G 6479 CAUAAAACUUCAGGACUCA GAGUCCUGAAGUUUUAUG siR CUC siR ACU siR GAC GG siR siR GG siR CAG siR UCA siR UUC CU siR AC siR siR AAC AA siR AA siR siR AA siR UA siR CAU siR ACA siR AAC UA siR AU siR CA siR UC siR UU siR UU siR GU siR UG siR CU siR UC siR
UU siRNA 154 154 GAAGAACUUUCAUCCCAGC 6508 C UGCUGGGAUGAAAGUUCU siRNA 155 155 AAGAACUUUCAUCCCAGCA 6509 U -239-
Attorney Docket No.54462-742.601 GUGCUGGGAUGAAAGUUC siRNA 156 156 AGAACUUUCAUCCCAGCAC 6510 U UGUGCUGGGAUGAAAGUU siR GU siR AG siR AA siR AA siR GA siR UG siR AU siR siR AU siR GA siR GG siR GG siR UG siR CU siR GC siR UG siR GU siR UG siR CAU siR UCA siR AUC siR AU siR AA siR AA siR CCA siR CCC siR UCC UU siR AU siR
siRNA 186 186 G 6540 CCAUGUCACAAAGUGUAAU UUACACUUUGUGACAUGG siRNA 187 187 A 6541 UCCAUGUCACAAAGUGUAA -240-
Attorney Docket No.54462-742.601 UACACUUUGUGACAUGGA siRNA 188 188 U 6542 AUCCAUGUCACAAAGUGUA ACACUUUGUGACAUGGAU siR GU siR UG siR GU siR AG siR AA siR AA siR CA siR AC siR CA siR UC siR GU siR UG siR AU siR CCA siR UCC siR AUC CA siR UC siR siR UUC siR UU siR AU siR GA siR CAG siR GCA siR UGC GU siR AG siR siR CAG siR UCA siR GUC siR GU siR GG siR GG siR AG siR CAA siR CCA
siRNA 225 225 U 6579 AAGAAACAUCUAUUGUACC GUACAAUAGAUGUUUCUU UAAGAAACAUCUAUUGUA siRNA 226 226 A 6580 C -241-
Attorney Docket No.54462-742.601 UACAAUAGAUGUUUCUUA AUAAGAAACAUCUAUUGU siRNA 227 227 U 6581 A ACAAUAGAUGUUUCUUAU GAUAAGAAACAUCUAUUG siR UU siR AU siR UA siR CU siR UC siR AU siR CA siR AC siR AA siR AA siR GA siR AG siR AA siR UA siR AU siR GA siR AG siR CA siR GC siR GG siR UG siR GU siR UG siR AU siR AA siR GA siR siR GA
siRNA 256 256 G 6610 CCAACACUGUAUUCUGAUG AUCAGAAUACAGUGUUGG siRNA 257 257 U 6611 ACCAACACUGUAUUCUGAU -242-
Attorney Docket No.54462-742.601 UCAGAAUACAGUGUUGGU siRNA 258 258 C 6612 GACCAACACUGUAUUCUGA CAGAAUACAGUGUUGGUC siR UG siR CU siR UC siR UU siR AU siR UA siR GU siR UG siR CU siR AC siR CA siR AC siR AA siR CCA siR ACC siR AC siR CGA siR CG siR UC siR AU siR CA siR AC siR UA siR UU siR CU siR GC siR UG siR GU siR UG siR GU
siRNA 289 289 A 6643 UCACCCCAUUCCUCACUUG AAGUGAGGAAUGGGGUGA siRNA 290 290 G 6644 CUCACCCCAUUCCUCACUU -243-
Attorney Docket No.54462-742.601 AGUGAGGAAUGGGGUGAG siRNA 291 291 U 6645 ACUCACCCCAUUCCUCACU GUGAGGAAUGGGGUGAGU siR AC siR CA siR UC siR CU siR CC siR UC siR UU siR AU siR CA siR CC siR CC siR CC siR AC siR CA siR UC siR CU siR CAC siR ACA siR CAC CC siR GC siR AG siR AA siR AA siR UA siR CU siR UC siR GU siR GG siR GG siR
UG siRNA 322 322 CCACCAUCUUCAGAUCUGC 6676 G UGCAGAUCUGAAGAUGGU siRNA 323 323 CACCAUCUUCAGAUCUGCA 6677 G -244-
Attorney Docket No.54462-742.601 UUGCAGAUCUGAAGAUGG siRNA 324 324 ACCAUCUUCAGAUCUGCAA 6678 U GUUGCAGAUCUGAAGAUG siR AU siR GA siR AG siR AA siR GA siR UG siR CU siR UC siR AU siR GA siR AG siR CA siR GC siR siR UGC UU siR GU siR AG siR siR AG siR AA siR AA siR UA siR UU siR UU siR UU siR AU siR CCA siR UCC
siRNA 353 353 U 6707 ACUCAUUAGGCUUUCUUUC AAAGAAAGCCUAAUGAGU siRNA 354 354 C 6708 GACUCAUUAGGCUUUCUUU -245-
Attorney Docket No.54462-742.601 AAGAAAGCCUAAUGAGUC siRNA 355 355 G 6709 CGACUCAUUAGGCUUUCUU AGAAAGCCUAAUGAGUCG siR CU siR UC siR UU siR UU siR CU siR GC siR GG siR AG siR UA siR UU siR AU siR CA siR UC siR CU siR AC siR GA siR CG siR CC siR UC siR UU siR UU siR UU siR CU siR CC siR GC siR GG siR UG siR AU
siRNA 384 384 U 6738 AACAACAUCUUCCAACAAA UUGUUGGAAGAUGUUGUU siRNA 385 385 A 6739 UAACAACAUCUUCCAACAA -246-
Attorney Docket No.54462-742.601 UGUUGGAAGAUGUUGUUA siRNA 386 386 C 6740 GUAACAACAUCUUCCAACA GUUGGAAGAUGUUGUUAC siR AC siR AA siR CCA siR UCC siR UC siR CUU siR UCU siR AUC CA siR AC siR AA siR CA siR AC siR AA siR UA siR GU siR AG siR GA siR GG siR siR GG siR AG siR CA siR GC siR UG siR GU siR AG siR GA siR GG siR GG siR GG siR UG siR CU siR CUC siR GCU
siRNA 421 421 A 6775 UUGAAAAAUUUGUCCCAGC GUUGAAAAAUUUGUCCCA siRNA 422 422 CUGGGACAAAUUUUUCAAC 6776 G -247-
Attorney Docket No.54462-742.601 GGUUGAAAAAUUUGUCCC siRNA 423 423 UGGGACAAAUUUUUCAACC 6777 A GGGUUGAAAAAUUUGUCC siR UC siR GU siR UG siR UU siR UU siR AU siR AA siR AA siR AA siR AA siR GA siR UG siR UU siR GU siR GG siR GG siR siR GG siR GG siR UG siR CU siR AC siR UA siR AU siR GA siR GG siR GG siR CG siR AC siR GA siR AG siR AA
siRNA 456 456 A 6810 UAACAUUCCGCAAACCCAA UGGGUUUGCGGAAUGUUA siRNA 457 457 U 6811 AUAACAUUCCGCAAACCCA -248-
Attorney Docket No.54462-742.601 GGGUUUGCGGAAUGUUAU siRNA 458 458 U 6812 AAUAACAUUCCGCAAACCC GGUUUGCGGAAUGUUAUU siR ACC siR AC siR AA siR CAA siR GCA siR CGC CC siR UC siR UU siR AU siR CA siR AC siR AA siR UA siR AU siR AA siR AA siR UA siR AU siR UA siR AU siR GA siR UG siR UU siR AU siR CA siR UC siR UU siR
UU siRNA 487 487 AAACUCACACAAGACACCG 6841 U GCGGUGUCUUGUGUGAGU siRNA 488 488 AACUCACACAAGACACCGC 6842 U -249-
Attorney Docket No.54462-742.601 CGCGGUGUCUUGUGUGAG siRNA 489 489 ACUCACACAAGACACCGCG 6843 U siRNA 490 490 CUCACACAAGACACCGCGG 6844 CCGCGGUGUCUUGUGUGAG siR GA siR UG siR GU siR UG siR GU siR UG siR UU siR CU siR UC siR GU siR UG siR GU siR GG siR CG siR GC siR CG siR CC siR UC siR AU siR CCA siR GCC siR AGC AA siR CA siR GC siR siR UGC UU siR CU siR UC siR GU siR CG siR GC siR GG siR AG siR AA siR AA siR GA siR
AG siRNA 528 528 UCUUACGUUCUUUUUAUUC 6882 A UGAAUAAAAAGAACGUAA siRNA 529 529 CUUACGUUCUUUUUAUUCA 6883 G -250-
Attorney Docket No.54462-742.601 UUACGUUCUUUUUAUUCA UUGAAUAAAAAGAACGUA siRNA 530 530 A 6884 A UACGUUCUUUUUAUUCAA CUUGAAUAAAAAGAACGU siR CG siR AC siR AA siR GA siR AG siR siR AG siR AA siR AA siR AA siR AA siR UA siR AU siR AA siR GA siR UG siR UU siR CU siR UC siR CU siR GC siR CG siR UC siR CU siR UC siR AU siR CA siR AC
siRNA 559 559 C 6913 GCAAACAUGCCCUUAUGCA siRNA 560 560 GCAUAAGGGCAUGUUUGCC 6914 GGCAAACAUGCCCUUAUGC siRNA 561 561 CAUAAGGGCAUGUUUGCCA 6915 UGGCAAACAUGCCCUUAUG -251-
Attorney Docket No.54462-742.601 siRNA 562 562 AUAAGGGCAUGUUUGCCAC 6916 GUGGCAAACAUGCCCUUAU siRNA 563 563 UAAGGGCAUGUUUGCCACC 6917 GGUGGCAAACAUGCCCUUA siR A 64 64 AAGGGCA G GCCACCA 6918 GG GGCAAACA GCCCUU siR CCU siR CCC siR GCC siR UGC siR UG siR CAU siR ACA siR AAC siR AA siR CAA siR GCA siR GGC UG siR GU siR siR GU siR GG siR UG siR UU siR AU siR CA siR AC siR CA siR UC siR GU siR AG siR CA siR UC siR UU siR UU siR UU siR AU siR CA
siRNA 597 597 G 6951 CUCUACUGCUGUUCAGCAC UGCUGAACAGCAGUAGAG siRNA 598 598 U 6952 ACUCUACUGCUGUUCAGCA -252-
Attorney Docket No.54462-742.601 GCUGAACAGCAGUAGAGU siRNA 599 599 A 6953 UACUCUACUGCUGUUCAGC siRNA 600 600 CUGAACAGCAGUAGAGUAC 6954 GUACUCUACUGCUGUUCAG siR CA siR UC siR UU siR GU siR UG siR CU siR GC siR UG siR CU siR AC siR UA siR CU siR UC siR CU siR AC siR UA siR GU siR UG siR UU siR CU siR UC siR CU siR CC siR GC siR UG siR UU siR AU siR AA
siRNA 629 629 A 6983 UUCAGCAGCCACUUCUGCA GCAGAAGUGGCUGCUGAA siRNA 630 630 U 6984 AUUCAGCAGCCACUUCUGC -253-
Attorney Docket No.54462-742.601 CAGAAGUGGCUGCUGAAU siRNA 631 631 U 6985 AAUUCAGCAGCCACUUCUG AGAAGUGGCUGCUGAAUU siR CU siR UC siR UU siR CU siR CAC siR CCA siR GCC siR AGC CA siR GC siR siR AGC siR CAG siR UCA siR UUC AU siR AA siR siR AA siR UA siR UU siR UU siR GU siR GG siR GG siR AG siR CA siR UC siR AU siR CCA siR ACC siR AAC GA siR AG siR CA siR GC siR siR GGC GG siR UG siR siR
NA 669 669 CAGCAGCAAUCAAAAGCCG 7023 CGGCUUUUGAUUGCUGCUG siRNA 670 670 AGCAGCAAUCAAAAGCCGU 7024 ACGGCUUUUGAUUGCUGCU siRNA 671 671 GCAGCAAUCAAAAGCCGUU 7025 AACGGCUUUUGAUUGCUGC -254-
Attorney Docket No.54462-742.601 UAACGGCUUUUGAUUGCU siRNA 672 672 CAGCAAUCAAAAGCCGUUA 7026 G UUAACGGCUUUUGAUUGC siR UG siR UU siR AU siR GA siR UG siR UU siR siR UU siR UU siR CUU siR GCU siR GGC CG siR siR ACG siR AAC UA siR UU siR siR UU siR GU siR UG siR UU siR CUU siR ACU siR CAC siR UCA siR UC siR UU siR UU
siRNA 701 701 U 7055 AAUCCUUUUAGCUUUCUUU AAGAAAGCUAAAAGGAUU siRNA 702 702 C 7056 GAAUCCUUUUAGCUUUCUU -255-
Attorney Docket No.54462-742.601 AGAAAGCUAAAAGGAUUC siRNA 703 703 U 7057 AGAAUCCUUUUAGCUUUCU GAAAGCUAAAAGGAUUCU siR UUC UU siR CU siR GC siR siR AGC UA siR UU siR UU siR UU siR siR CUU siR CCU siR UCC siR AUC siR AU siR AA siR GA siR AG siR AA siR GA siR UG siR UU siR CU siR UC siR UU siR UU siR CAU siR CCA siR ACC siR AC siR CAA siR GCA siR GGC UG siR siR UG siR GU siR CAG siR ACA siR
NA 741 741 GUCUCACCGGCAAUGAUCA 7095 UGAUCAUUGCCGGUGAGAC siRNA 742 742 UCUCACCGGCAAUGAUCAG 7096 CUGAUCAUUGCCGGUGAGA siRNA 743 743 CUCACCGGCAAUGAUCAGA 7097 UCUGAUCAUUGCCGGUGAG -256-
Attorney Docket No.54462-742.601 siRNA 744 744 UCACCGGCAAUGAUCAGAC 7098 GUCUGAUCAUUGCCGGUGA siRNA 745 745 CACCGGCAAUGAUCAGACU 7099 AGUCUGAUCAUUGCCGGUG siR A 46 46 ACCGGCAA GA CAGAC G 100 CAG C GA CA GCCGGU siR GG siR CCG siR GCC siR GC siR UG siR UU siR AU siR CA siR UC siR AU siR GA siR UG siR CU siR UC siR GU siR AG siR CA siR UC siR GU siR AG siR CA siR CC siR CC siR AC siR CA siR CCC siR ACC siR CAC GC siR AG siR CA siR
GC siRNA 778 778 UGCUAAAACUGUUCAACAG 7132 A GCUGUUGAACAGUUUUAG siRNA 779 779 GCUAAAACUGUUCAACAGC 7133 C -257-
Attorney Docket No.54462-742.601 AGCUGUUGAACAGUUUUA siRNA 780 780 CUAAAACUGUUCAACAGCU 7134 G AAGCUGUUGAACAGUUUU siR UU siR UU siR GU siR AG siR CA siR AC siR siR AAC GA siR UG siR UU siR GU siR UG siR CU siR GC siR AG siR AA siR GA siR AG siR AA siR AA siR AA siR CA siR CC siR UC siR UU siR GU siR UG siR
AU siRNA 809 809 CAUUCAAAUUCACAAAGGU 7163 G GACCUUUGUGAAUUUGAA siRNA 810 810 AUUCAAAUUCACAAAGGUC 7164 U -258-
Attorney Docket No.54462-742.601 UGACCUUUGUGAAUUUGA siRNA 811 811 UUCAAAUUCACAAAGGUCA 7165 A UUGACCUUUGUGAAUUUG siR UU siR UU siR AU siR AA siR GA siR siR GA siR UG siR GU siR UG siR UU siR UU siR CU siR ACC siR AC siR GA siR UG siR UU siR GU siR AG siR AA siR CA siR UC siR CU siR UC siR AU siR CCA siR ACC siR AC siR
NA 841 841 UUAAAGCUGCAACUGAGAC 7195 GUCUCAGUUGCAGCUUUAA siRNA 842 842 UAAAGCUGCAACUGAGACG 7196 CGUCUCAGUUGCAGCUUUA siRNA 843 843 AAAGCUGCAACUGAGACGA 7197 UCGUCUCAGUUGCAGCUUU -259-
Attorney Docket No.54462-742.601 siRNA 844 844 AAGCUGCAACUGAGACGAA 7198 UUCGUCUCAGUUGCAGCUU siRNA 845 845 AGCUGCAACUGAGACGAAU 7199 AUUCGUCUCAGUUGCAGCU siR A 846 846 GC GCAAC GAGACGAA 200 AA CG C CAG GCAGC siR CAG siR CA siR GC siR UG siR UU siR GU siR AG siR CA siR CUC siR UCU siR UC siR CGU siR UCG siR UUC AU siR AA siR AA siR CA siR GC siR GG siR CG siR GC siR AG siR AA siR GA siR AG siR CA siR AC siR AA siR AA siR GA siR AG siR UA siR
GU siRNA 880 880 UACCAGUUCAUAGAUCCCA 7234 A AUGGGAUCUAUGAACUGG siRNA 881 881 ACCAGUUCAUAGAUCCCAU 7235 U -260-
Attorney Docket No.54462-742.601 UAUGGGAUCUAUGAACUG siRNA 882 882 CCAGUUCAUAGAUCCCAUA 7236 G AUAUGGGAUCUAUGAACU siR AC siR AA siR GA siR UG siR AU siR UA siR CU siR UC siR AU siR GA siR GG siR GG siR UG siR AU siR UA siR AU siR AA siR CA siR UC siR GU siR AG siR UA siR AU siR GA siR AG siR CA siR GC siR
AG siRNA 911 911 GCUGCUCACUUUCAUUCUC 7265 C AGAGAAUGAAAGUGAGCA siRNA 912 912 CUGCUCACUUUCAUUCUCU 7266 G -261-
Attorney Docket No.54462-742.601 AAGAGAAUGAAAGUGAGC siRNA 913 913 UGCUCACUUUCAUUCUCUU 7267 A GAAGAGAAUGAAAGUGAG siR GA siR UG siR GU siR AG siR AA siR AA siR GA siR UG siR AU siR AA siR GA siR AG siR GA siR AG siR AA siR GA siR AG siR CA siR GC siR GG siR UG siR AU siR UA siR UU siR GU siR UG siR AU siR
GA siRNA 942 942 AUCAAAGCACCAUACAUUG 7296 U GCAAUGUAUGGUGCUUUG siRNA 943 943 UCAAAGCACCAUACAUUGC 7297 A -262-
Attorney Docket No.54462-742.601 AGCAAUGUAUGGUGCUUU siRNA 944 944 CAAAGCACCAUACAUUGCU 7298 G AAGCAAUGUAUGGUGCUU siR CU siR GC siR UG siR GU siR GG siR UG siR AU siR UA siR GU siR UG siR AU siR AA siR CA siR GC siR AG siR AA siR GA siR UG siR CU siR CC siR GC siR UG siR UU siR AU siR UA siR UU siR AU siR
GA siRNA 973 973 AUCUCAACAUCCCAAUCUU 7327 U GAAGAUUGGGAUGUUGAG siRNA 974 974 UCUCAACAUCCCAAUCUUC 7328 A -263-
Attorney Docket No.54462-742.601 UGAAGAUUGGGAUGUUGA siRNA 975 975 CUCAACAUCCCAAUCUUCA 7329 G CUGAAGAUUGGGAUGUUG siR UU siR GU siR UG siR AU siR GA siR GG siR GG siR UG siR UU siR AU siR GA siR AG siR AA siR GA siR UG siR CU siR AC siR UA siR GU siR GG siR siR GG siR AG siR AA siR CA siR UC siR AU siR GA siR GG siR UG siR AU siR UA
siRNA 1008 1008 AAGCUUGGGGGCUUCUUCA 7362 UGAAGAAGCCCCCAAGCUU siRNA 1009 1009 AGCUUGGGGGCUUCUUCAU 7363 AUGAAGAAGCCCCCAAGCU siRNA 1010 1010 GCUUGGGGGCUUCUUCAUA 7364 UAUGAAGAAGCCCCCAAGC -264-
Attorney Docket No.54462-742.601 siRNA 1011 1011 CUUGGGGGCUUCUUCAUAC 7365 GUAUGAAGAAGCCCCCAAG siRNA 1012 1012 UUGGGGGCUUCUUCAUACG 7366 CGUAUGAAGAAGCCCCCAA siR A 1013 1013 GGGGGC C CA ACGA 36 CG A GAAGAAGCCCCCA siR CCC siR CCC siR CCC siR GCC siR AGC siR AG siR AA siR GA siR AG siR AA siR GA siR UG siR AU siR UA siR GU siR CG siR UC siR GU siR CG siR UC siR CUU siR CCU siR GCC siR AGC siR AG siR GA siR CG siR UC siR AU siR CA siR UC siR UU siR UU siR GU siR UG siR GU siR GG siR UG siR CU siR UC siR AU siR CA
siRNA 1056 1056 U 7410 AGAGAACAUCUUUCCGUCC GACGGAAAGAUGUUCUCU siRNA 1057 1057 A 7411 UAGAGAACAUCUUUCCGUC -265-
Attorney Docket No.54462-742.601 ACGGAAAGAUGUUCUCUA siRNA 1058 1058 U 7412 AUAGAGAACAUCUUUCCGU CGGAAAGAUGUUCUCUAU siR CCG siR UCC siR UUC siR UU siR CUU siR UCU siR AUC CA siR siR ACA siR AAC GA siR AG siR GA siR AG siR UA siR siR UA siR AU siR UA siR CU siR UC siR CU siR GC siR AG siR AA siR AA siR CA siR GC siR AG siR GA siR GG siR UG siR AU siR CCA siR CCC
siRNA 1093 1093 U 7447 AGUAAUUCAACUAUAUGCC GCAUAUAGUUGAAUUACU AAGUAAUUCAACUAUAUG siRNA 1094 1094 U 7448 C -266-
Attorney Docket No.54462-742.601 CAUAUAGUUGAAUUACUU GAAGUAAUUCAACUAUAU siRNA 1095 1095 C 7449 G AUAUAGUUGAAUUACUUC CGAAGUAAUUCAACUAUA siR AU siR UA siR CU siR siR ACU siR AAC CA siR siR UCA siR UUC AU siR AA siR UA siR GU siR AG siR AA siR GA siR siR CGA siR CG siR UC siR GU siR UG siR CU siR GC siR CUG siR GCU siR UGC UU siR AU siR siR AU siR AA siR GA siR AG siR AA siR CA siR CC siR
NA 1131 1131 GAGAUCUUCCUGGAAGGCA 7485 UGCCUUCCAGGAAGAUCUC siRNA 1132 1132 AGAUCUUCCUGGAAGGCAC 7486 GUGCCUUCCAGGAAGAUCU siRNA 1133 1133 GAUCUUCCUGGAAGGCACA 7487 UGUGCCUUCCAGGAAGAUC -267-
Attorney Docket No.54462-742.601 siRNA 1134 1134 AUCUUCCUGGAAGGCACAC 7488 GUGUGCCUUCCAGGAAGAU siRNA 1135 1135 UCUUCCUGGAAGGCACACG 7489 CGUGUGCCUUCCAGGAAGA siR A 1136 1136 C CC GGAAGGCACACG 490 ACG G GCC CCAGGAAG siR AA siR GA siR GG siR AG siR CA siR CC siR UC siR UU siR CU siR CC siR GC siR UG siR GU siR UG siR GU siR CG siR AC siR AA siR GA siR AG siR UA siR CCU siR UCC siR CUC siR CU siR CAC siR CCA siR UCC siR UUC siR UU siR UU siR UU siR UU siR GU siR GG siR AG siR GA siR AG siR AA siR
CA siRNA 1177 1177 GUGCUCGGGCAGGACUUUU 7531 AAAAGUCCUGCCCGAGCAC siRNA 1178 1178 UGCUCGGGCAGGACUUUUG 7532 CAAAAGUCCUGCCCGAGCA siRNA 1179 1179 GCUCGGGCAGGACUUUUGU 7533 ACAAAAGUCCUGCCCGAGC -268-
Attorney Docket No.54462-742.601 siRNA 1180 1180 CUCGGGCAGGACUUUUGUC 7534 GACAAAAGUCCUGCCCGAG siRNA 1181 1181 UCGGGCAGGACUUUUGUCA 7535 UGACAAAAGUCCUGCCCGA siR A 1182 1182 CGGGCAGGAC G CAG 36 C GACAAAAG CC GCCCG siR CCC siR GCC siR GC siR UG siR CU siR CC siR UC siR GU siR AG siR AA siR AA siR AA siR CA siR AC siR GA siR UG siR CU siR AC siR AA siR CA siR CAC siR CCA siR ACC UA siR CU siR UC siR AU siR UA siR
GU siRNA 1211 1211 UACUCUGUCUACCAAUGUC 7565 A UGACAUUGGUAGACAGAG siRNA 1212 1212 ACUCUGUCUACCAAUGUCA 7566 U -269-
Attorney Docket No.54462-742.601 AUGACAUUGGUAGACAGA siRNA 1213 1213 CUCUGUCUACCAAUGUCAU 7567 G GAUGACAUUGGUAGACAG siR CA siR AC siR GA siR AG siR UA siR GU siR GG siR UG siR UU siR AU siR CA siR AC siR GA siR UG siR AU siR GA siR GG siR GG siR UG siR CU siR UC siR GU siR UG siR AU siR GA siR siR GA siR AG
siRNA 1242 1242 A 7596 UUCCAACAGGUAUUAUCAA UGAUAAUACCUGUUGGAA siRNA 1243 1243 U 7597 AUUCCAACAGGUAUUAUCA -270-
Attorney Docket No.54462-742.601 GAUAAUACCUGUUGGAAU siRNA 1244 1244 C 7598 GAUUCCAACAGGUAUUAUC AUAAUACCUGUUGGAAUC AGAUUCCAACAGGUAUUA siR UU siR AU siR UA siR GU siR GG siR siR GG siR CAG siR ACA siR AAC siR CAA siR CCA siR UCC UU siR AU siR GA siR AG siR GA siR GG siR AG siR UA siR siR UA siR AU siR CA siR UC siR AU siR CGA siR GCG siR UGC AU siR AA siR UA siR AU siR siR
NA 1278 1278 AUCGAAGGUCACUACAAUG 7632 CAUUGUAGUGACCUUCGAU siRNA 1279 1279 UCGAAGGUCACUACAAUGG 7633 CCAUUGUAGUGACCUUCGA siRNA 1280 1280 CGAAGGUCACUACAAUGGU 7634 ACCAUUGUAGUGACCUUCG -271-
Attorney Docket No.54462-742.601 GAAGGUCACUACAAUGGU siRNA 1281 1281 G 7635 CACCAUUGUAGUGACCUUC AAGGUCACUACAAUGGUG siR UU siR CCU siR ACC siR GAC UG siR GU siR AG siR siR AG siR UA siR GU siR UG siR UU siR AU siR CA siR ACC siR CAC siR UCA siR UUC GU siR siR GU siR UG siR UU siR GU siR AG siR CCA siR CCC siR GCC siR UGC siR UG siR UU siR UU siR GU siR GG siR AG
siRNA 1316 1316 G 7670 CAGGCUCUCAUUCUUCUUA AAGAAGAAUGAGAGCCUG siRNA 1317 1317 U 7671 ACAGGCUCUCAUUCUUCUU -272-
Attorney Docket No.54462-742.601 AGAAGAAUGAGAGCCUGU siRNA 1318 1318 G 7672 CACAGGCUCUCAUUCUUCU GAAGAAUGAGAGCCUGUG siR UC siR UU siR CU siR UC siR UU siR AU siR CA siR UC siR CU siR UC siR CU siR GC siR GG siR AG siR CA siR AC siR CA siR CC siR UC siR CU siR AC siR CA siR AC siR UA siR CU siR GC siR UG siR UU
siRNA 1347 1347 U 7701 ACAUUCUAAUAACACCUCU GAGGUGUUAUUAGAAUGU siRNA 1348 1348 U 7702 AACAUUCUAAUAACACCUC -273-
Attorney Docket No.54462-742.601 AGGUGUUAUUAGAAUGUU siRNA 1349 1349 A 7703 UAACAUUCUAAUAACACCU GGUGUUAUUAGAAUGUUA siR ACC siR CAC siR ACA siR AAC UA siR AU siR AA siR UA siR CU siR UC siR UU siR AU siR CA siR siR ACA siR AAC UA siR siR UA siR CGU siR CG siR UC siR UU siR UU siR UU siR UU siR UU siR GU siR AG siR UA
siRNA 1378 1378 A 7732 UCCACUCGGACACAACCAU UGGUUGUGUCCGAGUGGA siRNA 1379 1379 U 7733 AUCCACUCGGACACAACCA -274-
Attorney Docket No.54462-742.601 GGUUGUGUCCGAGUGGAU siRNA 1380 1380 U 7734 AAUCCACUCGGACACAACC GUUGUGUCCGAGUGGAUU siR AC siR AA siR CA siR AC siR CA siR AC siR GA siR GG siR CG siR UC siR CU siR CAC siR CCA siR UCC AU siR AA siR AA siR AA siR CA siR GC siR UG siR GU siR UG siR CU siR GC siR GG siR UG siR AU siR AA siR AA siR AA siR GA siR
GG siRNA 1413 1413 G 7767 A CCUUAAAGGAAUAUUUAG UCUAAAUAUUCCUUUAAG siRNA 1414 1414 A 7768 G -275-
Attorney Docket No.54462-742.601 CUUAAAGGAAUAUUUAGA UUCUAAAUAUUCCUUUAA siRNA 1415 1415 A 7769 G UUAAAGGAAUAUUUAGAA UUUCUAAAUAUUCCUUUA siR siR UA siR UU siR CUU siR CCU siR UCC UU siR AU siR UA siR AU siR AA siR siR AA siR AA siR CUA siR UCU siR UUC UU siR siR CUU siR CU siR GC siR GG siR UG siR UU siR UU siR CU siR AC siR GA siR UG siR CU siR UC siR UU siR UU siR GU siR CGG siR CCG siR ACC
CA siRNA 1452 1452 GUGUCUGCUCUACUUUCCC 7806 C AGGGAAAGUAGAGCAGAC siRNA 1453 1453 UGUCUGCUCUACUUUCCCU 7807 A -276-
Attorney Docket No.54462-742.601 CAGGGAAAGUAGAGCAGA siRNA 1454 1454 GUCUGCUCUACUUUCCCUG 7808 C CCAGGGAAAGUAGAGCAG siR CA siR siR GCA siR AGC GA siR AG siR siR AG siR UA siR GU siR AG siR AA siR AA siR GA siR GG siR GG siR AG siR CA siR UCC siR UC siR CU siR GC siR UG siR CUU siR GCU siR CGC AC siR AA siR CA siR AC siR AA siR UA siR GU siR GG siR UG siR CU siR GC siR AG siR
UA siRNA 1492 1492 CUAUACUUCCUUCAAGACC 7846 G GGGUCUUGAAGGAAGUAU siRNA 1493 1493 UAUACUUCCUUCAAGACCC 7847 A -277-
Attorney Docket No.54462-742.601 UGGGUCUUGAAGGAAGUA siRNA 1494 1494 AUACUUCCUUCAAGACCCA 7848 U CUGGGUCUUGAAGGAAGU siR AG siR AA siR GA siR GG siR siR GG siR AG siR AA siR GA siR UG siR UU siR CU siR UC siR GU siR GG siR GG siR UG siR CU siR AC siR CA siR UC siR AU siR CA siR GC siR AG siR CA siR GC siR AG siR CA siR UC siR AU siR CA siR UC siR UU siR
NA 1529 1529 AGGUAGAGACACGUCCAUU 7883 AAUGGACGUGUCUCUACCU siRNA 1530 1530 GGUAGAGACACGUCCAUUA 7884 UAAUGGACGUGUCUCUACC siRNA 1531 1531 GUAGAGACACGUCCAUUAA 7885 UUAAUGGACGUGUCUCUAC -278-
Attorney Docket No.54462-742.601 AUUAAUGGACGUGUCUCU siRNA 1532 1532 UAGAGACACGUCCAUUAAU 7886 A siRNA 1533 1533 AGAGACACGUCCAUUAAUG 7887 CAUUAAUGGACGUGUCUCU siR CUC siR UCU siR GUC UG siR GU siR CG siR siR ACG siR GAC GG siR UG siR AU siR siR AU siR AA siR UA siR UU siR CAU siR UCA siR CUC siR ACU siR GAC siR GA siR GG siR CUG siR UCU siR UUC UU siR AU siR CA siR GC siR UG siR UU siR GU siR UG siR
siRNA 1567 1567 CAGAUGAAUCCCUACGAAG 7921 CUUCGUAGGGAUUCAUCUG siRNA 1568 1568 AGAUGAAUCCCUACGAAGG 7922 CCUUCGUAGGGAUUCAUCU siRNA 1569 1569 GAUGAAUCCCUACGAAGGA 7923 UCCUUCGUAGGGAUUCAUC -279-
Attorney Docket No.54462-742.601 siRNA 1570 1570 AUGAAUCCCUACGAAGGAG 7924 CUCCUUCGUAGGGAUUCAU siRNA 1571 1571 UGAAUCCCUACGAAGGAGG 7925 CCUCCUUCGUAGGGAUUCA siR A 1 2 1 2 GAA CCC ACGAAGGAGG 926 ACC CC CG AGGGAUUC siR UU siR AU siR GA siR GG siR GG siR AG siR UA siR GU siR CG siR UC siR UU siR CU siR UCC siR UC siR CU siR ACC siR AC siR AA siR CA siR UC siR AU siR AA siR CA siR GC siR UG siR UU siR UU siR AU siR GA siR CAG siR CCA siR GCC AG siR
CA siRNA 1606 1606 CUGAGCAUAUUCUAUUCAC 7960 G AGUGAAUAGAAUAUGCUC siRNA 1607 1607 UGAGCAUAUUCUAUUCACU 7961 A -280-
Attorney Docket No.54462-742.601 CAGUGAAUAGAAUAUGCU siRNA 1608 1608 GAGCAUAUUCUAUUCACUG 7962 C GCAGUGAAUAGAAUAUGC siR UG siR AU siR UA siR AU siR AA siR GA siR AG siR UA siR AU siR AA siR GA siR siR GA siR UG siR GU siR AG siR CA siR GC siR AG siR CUA siR GCU siR UGC siR UG siR CUU siR ACU siR GAC GG siR AG siR CA siR AC siR CA siR GC siR GG siR UG siR
AU siRNA 1643 1643 CAUUAUGUCCACACACAUU 7997 G CAAUGUGUGUGGACAUAA siRNA 1644 1644 AUUAUGUCCACACACAUUG 7998 U -281-
Attorney Docket No.54462-742.601 ACAAUGUGUGUGGACAUA siRNA 1645 1645 UUAUGUCCACACACAUUGU 7999 A CACAAUGUGUGUGGACAU siR siR CAU siR ACA siR GAC GG siR siR GG siR UG siR GU siR UG siR GU siR UG siR GU siR UG siR AU siR AA siR CA siR CAC siR CCA siR GCC AG siR AA siR CA siR GC siR GG siR AG siR CA siR GC siR siR AGC GA siR GG siR siR GG siR AG siR GA siR AG siR UA siR GU siR UG siR CU siR
UC ACACAGGCAGGGAAUUGA siRNA 1685 1685 U 8039 AUCAAUUCCCUGCCUGUGU siRNA 1686 1686 CACAGGCAGGGAAUUGAUC 8040 GAUCAAUUCCCUGCCUGUG -282-
Attorney Docket No.54462-742.601 ACAGGCAGGGAAUUGAUC siRNA 1687 1687 U 8041 AGAUCAAUUCCCUGCCUGU siRNA 1688 1688 CAGGCAGGGAAUUGAUCUC 8042 GAGAUCAAUUCCCUGCCUG siR CU siR GCC siR GC siR CUG siR CCU siR CCC UC siR UU siR AU siR AA siR CA siR UC siR siR AUC GA siR AG siR siR AG siR GA siR AG siR GA siR GG siR UG siR GU siR UG siR AU siR AA siR CCA siR ACC siR AC siR CGA siR CG siR UC siR CUU siR UCU
siRNA 1722 1722 G 8076 CUUUCAUCACAAAGAAGUC ACUUCUUUGUGAUGAAAG siRNA 1723 1723 A 8077 UCUUUCAUCACAAAGAAGU -283-
Attorney Docket No.54462-742.601 CUUCUUUGUGAUGAAAGA siRNA 1724 1724 G 8078 CUCUUUCAUCACAAAGAAG UUCUUUGUGAUGAAAGAG siR AA siR GA siR AG siR AA siR AA siR CA siR AC siR CA siR UC siR AU siR CA siR UC siR UU siR UU siR CU siR UC siR CU siR CC siR UC siR UU siR CU siR AC siR GA siR GG siR AG siR CCA siR GCC siR GC siR AG siR GA siR CG siR AC siR CA siR UC siR AU siR AA siR AA siR
NA 1762 1762 UUGACCUGGGGUUCUCAGG 8116 CCUGAGAACCCCAGGUCAA siRNA 1763 1763 UGACCUGGGGUUCUCAGGA 8117 UCCUGAGAACCCCAGGUCA siRNA 1764 1764 GACCUGGGGUUCUCAGGAA 8118 UUCCUGAGAACCCCAGGUC -284-
Attorney Docket No.54462-742.601 siRNA 1765 1765 ACCUGGGGUUCUCAGGAAA 8119 UUUCCUGAGAACCCCAGGU siRNA 1766 1766 CCUGGGGUUCUCAGGAAAU 8120 AUUUCCUGAGAACCCCAGG CUGGGGUUCUCAGGAAAU siR AG siR CA siR CCC siR CCC siR ACC siR AAC siR AA siR GA siR AG siR GA siR UG siR CCU siR UCC siR UC siR UU siR UU siR AU siR AA siR GA siR UG siR CU siR UC siR UU siR CU siR UC siR CAU siR ACA siR UAC CU siR
NA 1795 1795 UAGUAAUGCAUGCCAUACA 8149 A siRNA 1796 1796 AGUAAUGCAUGCCAUACAG 8150 CUGUAUGGCAUGCAUUACU siRNA 1797 1797 GUAAUGCAUGCCAUACAGC 8151 GCUGUAUGGCAUGCAUUAC -285-
Attorney Docket No.54462-742.601 AGCUGUAUGGCAUGCAUU siRNA 1798 1798 UAAUGCAUGCCAUACAGCU 8152 A siRNA 1799 1799 AAUGCAUGCCAUACAGCUG 8153 CAGCUGUAUGGCAUGCAUU siR CAU siR GCA siR GC siR UG siR AU siR CA siR GC siR GG siR UG siR AU siR UA siR GU siR UG siR CU siR GC siR AG siR CA siR GC siR AG siR CCA siR CCC siR UCC UU siR UU siR AU siR AA siR CA siR AC siR CA siR AC siR GA siR
UG siRNA 1831 1831 UCACAAUCACCCACACUAG 8185 A GCUAGUGUGGGUGAUUGU siRNA 1832 1832 CACAAUCACCCACACUAGC 8186 G -286-
Attorney Docket No.54462-742.601 UGCUAGUGUGGGUGAUUG siRNA 1833 1833 ACAAUCACCCACACUAGCA 8187 U CUGCUAGUGUGGGUGAUU siR AU siR GA siR UG siR GU siR siR GU siR GG siR GG siR UG siR GU siR UG siR GU siR AG siR UA siR CU siR GC siR UG siR CCU siR UCC siR UUC GU siR CG siR UC siR AU siR CA siR UC siR CU siR AC siR AA siR AA siR
AA siRNA 1864 1864 UUUUUAUCACCCCCAGCAC 8218 A UGUGCUGGGGGUGAUAAA siRNA 1865 1865 UUUUAUCACCCCCAGCACA 8219 A -287-
Attorney Docket No.54462-742.601 UUGUGCUGGGGGUGAUAA siRNA 1866 1866 UUUAUCACCCCCAGCACAA 8220 A GUUGUGCUGGGGGUGAUA siR AU siR GA siR UG siR GU siR GG siR GG siR GG siR GG siR UG siR CU siR GC siR UG siR GU siR UG siR UU siR GU siR AG siR CA siR AC siR GA siR GG siR GG siR UG siR AU siR GA siR UG siR CU siR
AC siRNA 1895 1895 AGUCUUCGAACUCAACUUC 8249 U AGAAGUUGAGUUCGAAGA siRNA 1896 1896 GUCUUCGAACUCAACUUCU 8250 C -288-
Attorney Docket No.54462-742.601 UAGAAGUUGAGUUCGAAG siRNA 1897 1897 UCUUCGAACUCAACUUCUA 8251 A GUAGAAGUUGAGUUCGAA siR GA siR CG siR UC siR UU siR GU siR AG siR GA siR UG siR siR UG siR UU siR GU siR AG siR AA siR GA siR AG siR UA siR GU siR UG siR CU siR GC siR UG siR UU siR AU siR CCA siR CCC siR CCC AC siR UA siR GU siR AG siR AA siR GA siR
siRNA 1931 1931 G 8285 CUCCAUGAUAAAGACAUGA CAUGUCUUUAUCAUGGAG siRNA 1932 1932 G 8286 CCUCCAUGAUAAAGACAUG -289-
Attorney Docket No.54462-742.601 AUGUCUUUAUCAUGGAGG siRNA 1933 1933 C 8287 GCCUCCAUGAUAAAGACAU siRNA 1934 1934 UGUCUUUAUCAUGGAGGCC 8288 GGCCUCCAUGAUAAAGACA siR AC siR GA siR AG siR AA siR AA siR UA siR AU siR GA siR UG siR AU siR CA siR UCC siR CUC siR CCU siR GCC siR GGC UG siR AU siR GA siR UG siR AU siR siR AU siR CUA siR GCU siR GC siR AG siR CAA siR GCA siR UGC siR CUG siR GCU siR GGC AG siR AA siR AA siR siR AA siR UA siR AU siR CA
siRNA 1974 1974 G 8328 CCCUCUUGUUCAGAACUGC CAGUUCUGAACAAGAGGG siRNA 1975 1975 G 8329 CCCCUCUUGUUCAGAACUG -290-
Attorney Docket No.54462-742.601 AGUUCUGAACAAGAGGGG siRNA 1976 1976 A 8330 UCCCCUCUUGUUCAGAACU GUUCUGAACAAGAGGGGA siR AC siR AA siR GA siR AG siR CA siR UC siR UU siR GU siR UG siR UU siR CU siR UC siR CU siR CC siR CC siR CC siR UC siR GU siR AG siR CA siR CCC siR CCC siR CCC siR CCC AC siR GA siR GG siR GG siR UG siR GU siR AG siR UA siR CU siR
GC siRNA 2010 2010 AGCACCCCACCUAACCUGA 8364 U AUCAGGUUAGGUGGGGUG siRNA 2011 2011 GCACCCCACCUAACCUGAU 8365 C -291-
Attorney Docket No.54462-742.601 GAUCAGGUUAGGUGGGGU siRNA 2012 2012 CACCCCACCUAACCUGAUC 8366 G UGAUCAGGUUAGGUGGGG siR GG siR GG siR UG siR GU siR GG siR siR GG siR AG siR UA siR UU siR GU siR GG siR AG siR CA siR UC siR AU siR GA siR UG siR CU siR GC siR GG siR UG siR CU siR CC siR UC siR CU siR GC siR UG siR CU siR GC siR AG siR CA siR CC siR AC siR CA siR GC siR CG siR CC siR UC siR UU siR CU siR CC siR GC siR
NA 2056 2056 CGGCCAGCCUGUGCUACCU 8410 AGGUAGCACAGGCUGGCCG siRNA 2057 2057 GGCCAGCCUGUGCUACCUU 8411 AAGGUAGCACAGGCUGGCC siRNA 2058 2058 GCCAGCCUGUGCUACCUUC 8412 GAAGGUAGCACAGGCUGGC -292-
Attorney Docket No.54462-742.601 AGAAGGUAGCACAGGCUG siRNA 2059 2059 CCAGCCUGUGCUACCUUCU 8413 G GAGAAGGUAGCACAGGCU siR GC siR GG siR AG siR CA siR AC siR CA siR GC siR AG siR UA siR GU siR GG siR AG siR AA siR GA siR AG siR GA siR AG siR GA siR GG siR UG siR UU siR AU siR CA siR siR UCA siR UUC CU siR CC siR GC siR
UG siRNA 2089 2089 GCACCAUCUCACUGCCUUG 8443 C GCAAGGCAGUGAGAUGGU siRNA 2090 2090 CACCAUCUCACUGCCUUGC 8444 G -293-
Attorney Docket No.54462-742.601 GGCAAGGCAGUGAGAUGG siRNA 2091 2091 ACCAUCUCACUGCCUUGCC 8445 U UGGCAAGGCAGUGAGAUG siR AU siR GA siR AG siR GA siR UG siR GU siR AG siR CA siR GC siR GG siR AG siR AA siR CA siR GC siR GG siR UG siR CU siR UC siR GU siR UG siR AU siR AA siR AA siR AA siR UA siR GU siR GG siR
UG siRNA 2120 2120 CCAAGUCUGCCAUGAAACA 8474 G siRNA 2121 2121 CAAGUCUGCCAUGAAACAG 8475 CUGUUUCAUGGCAGACUUG siRNA 2122 2122 AAGUCUGCCAUGAAACAGU 8476 ACUGUUUCAUGGCAGACUU -294-
Attorney Docket No.54462-742.601 siRNA 2123 2123 AGUCUGCCAUGAAACAGUA 8477 UACUGUUUCAUGGCAGACU siRNA 2124 2124 GUCUGCCAUGAAACAGUAG 8478 CUACUGUUUCAUGGCAGAC siR A 212 212 C GCCA GAAACAG AGG 849 CC AC G CA GGCAGA siR AG siR CA siR GC siR GG siR UG siR AU siR CA siR UC siR UU siR UU siR GU siR CUG siR CU siR AC siR CUA siR CCU siR UCC siR UC siR UU siR CUU siR ACU siR AAC AA siR UA siR AU siR GA siR GG siR UG siR
siRNA 2154 2154 CAGUAUGGCAUUCUUACAG 8508 CUGUAAGAAUGCCAUACUG AGUAUGGCAUUCUUACAG siRNA 2155 2155 U 8509 ACUGUAAGAAUGCCAUACU -295-
Attorney Docket No.54462-742.601 GUAUGGCAUUCUUACAGU siRNA 2156 2156 G 8510 CACUGUAAGAAUGCCAUAC UAUGGCAUUCUUACAGUG siR UA siR AU siR CCA siR GCC siR GC siR UG siR AU siR AA siR GA siR AG siR AA siR UA siR GU siR UG siR CU siR AC siR CA siR CC siR GC siR UG siR CU siR UC siR CU siR GC siR UG siR GU siR CG siR UC siR AU siR CA siR UC siR GU siR GG siR CUG siR CCU siR UCC siR UUC CU siR UC siR siR AUC UA siR AU siR
siRNA 2199 2199 AUCAGUCCUAGUCUUGCUG 8553 CAGCAAGACUAGGACUGAU siRNA 2200 2200 UCAGUCCUAGUCUUGCUGA 8554 UCAGCAAGACUAGGACUGA siRNA 2201 2201 CAGUCCUAGUCUUGCUGAG 8555 CUCAGCAAGACUAGGACUG -296-
Attorney Docket No.54462-742.601 siRNA 2202 2202 AGUCCUAGUCUUGCUGAGC 8556 GCUCAGCAAGACUAGGACU siRNA 2203 2203 GUCCUAGUCUUGCUGAGCA 8557 UGCUCAGCAAGACUAGGAC siR A 2204 2204 CC AG C GC GAGCAG 8 8 C GC CAGCAAGAC AGGA siR GG siR AG siR UA siR CU siR AC siR GA siR AG siR AA siR CA siR GC siR AG siR CA siR UC siR CU siR GC siR UG siR CU siR GC siR UG siR CU siR AC siR CA siR CCC siR UCC siR GUC UG siR UU siR CU siR UC siR siR UUC CU siR GC siR AG siR AA siR GA siR siR GA siR
GG siRNA 2242 2242 CAGAACCUUUGUCUUGGAG 8596 CUCCAAGACAAAGGUUCUG AGAACCUUUGUCUUGGAG siRNA 2243 2243 A 8597 UCUCCAAGACAAAGGUUCU -297-
Attorney Docket No.54462-742.601 GAACCUUUGUCUUGGAGA siRNA 2244 2244 A 8598 UUCUCCAAGACAAAGGUUC AACCUUUGUCUUGGAGAA siR UU siR GU siR GG siR AG siR AA siR AA siR CA siR AC siR GA siR AG siR AA siR CA siR CC siR UC siR CU siR UC siR UU siR CU siR AC siR CA siR UC siR AU siR CA siR UC siR UU siR CU siR UC siR UU
siRNA 2273 2273 U 8627 AAAGUCACUGUCUUCAUCU GAUGAAGACAGUGACUUU siRNA 2274 2274 G 8628 CAAAGUCACUGUCUUCAUC -298-
Attorney Docket No.54462-742.601 AUGAAGACAGUGACUUUG siRNA 2275 2275 G 8629 CCAAAGUCACUGUCUUCAU UGAAGACAGUGACUUUGG siR CA siR UC siR UU siR CU siR UC siR GU siR UG siR CU siR AC siR CA siR UC siR GU siR AG siR AA siR AA siR CA siR CC siR CC siR CC siR UC siR CU siR UCC siR UC siR UU siR GU siR UG siR CU siR GC siR CG siR UC siR CU siR
UC AUUGCUACCUGAAGGUGA siRNA 2308 2308 G 8662 CUCACCUUCAGGUAGCAAU siRNA 2309 2309 UUGCUACCUGAAGGUGAGC 8663 GCUCACCUUCAGGUAGCAA -299-
Attorney Docket No.54462-742.601 siRNA 2310 2310 UGCUACCUGAAGGUGAGCC 8664 GGCUCACCUUCAGGUAGCA siRNA 2311 2311 GCUACCUGAAGGUGAGCCA 8665 UGGCUCACCUUCAGGUAGC siR A 2312 2312 C ACC GAAGG GAGCCAA 8666 GGC CACC CAGGUAG siR UA siR GU siR GG siR AG siR CA siR UC siR UU siR CU siR CC siR AC siR CA siR CUC siR GCU siR GGC siR GG siR UG siR UU siR AU siR GA siR GG siR UG siR UU siR CCU siR UCC siR CUC GC siR UG siR GU siR GG siR UG siR CU siR GC siR UG siR CU siR AC siR AA siR AA siR UA siR
AU siRNA 2351 2351 UAUCACCUUCUUACAGAGA 8705 A GUCUCUGUAAGAAGGUGA siRNA 2352 2352 AUCACCUUCUUACAGAGAC 8706 U -300-
Attorney Docket No.54462-742.601 AGUCUCUGUAAGAAGGUG siRNA 2353 2353 UCACCUUCUUACAGAGACU 8707 A GAGUCUCUGUAAGAAGGU siR GG siR AG siR AA siR GA siR siR GA siR AG siR AA siR UA siR GU siR UG siR CU siR UC siR CU siR UC siR GU siR AG siR GA siR GG siR AG siR AA siR CA siR CC siR CC siR GC siR GG siR AG siR AA siR AA siR CA siR GC siR AG siR CA siR UCC siR UC siR CCU siR GCC siR GGC AG siR UA siR GU siR UG siR
CU siRNA 2396 2396 CAGCUCUGCUGCCAUCUUU 8750 G siRNA 2397 2397 AGCUCUGCUGCCAUCUUUG 8751 CAAAGAUGGCAGCAGAGCU siRNA 2398 2398 GCUCUGCUGCCAUCUUUGU 8752 ACAAAGAUGGCAGCAGAGC -301-
Attorney Docket No.54462-742.601 AACAAAGAUGGCAGCAGA siRNA 2399 2399 CUCUGCUGCCAUCUUUGUU 8753 G GAACAAAGAUGGCAGCAG siR CA siR GC siR AG siR CA siR GC siR GG siR UG siR AU siR GA siR AG siR AA siR AA siR siR CAA siR ACA siR AAC GA siR UG siR siR UG siR GU siR UG siR UU siR GU siR AG siR AA siR GA siR UG siR CU siR CAC siR CCA siR ACC siR GAC siR GA siR GG siR CAG siR ACA siR AAC GA siR
siRNA 2438 2438 UCCAGAACCUGAGUAUCUG 8792 CAGAUACUCAGGUUCUGGA siRNA 2439 2439 CCAGAACCUGAGUAUCUGC 8793 GCAGAUACUCAGGUUCUGG siRNA 2440 2440 CAGAACCUGAGUAUCUGCA 8794 UGCAGAUACUCAGGUUCUG -302-
Attorney Docket No.54462-742.601 siRNA 2441 2441 AGAACCUGAGUAUCUGCAA 8795 UUGCAGAUACUCAGGUUCU siRNA 2442 2442 GAACCUGAGUAUCUGCAAA 8796 UUUGCAGAUACUCAGGUUC UUUUGCAGAUACUCAGGU siR siR GU siR GG siR CAG siR CA siR CUC siR ACU siR UAC AU siR GA siR AG siR CA siR GC siR UG siR UU siR UU siR UU siR CU siR AC siR AA siR CA siR GC siR UG siR GU siR UG siR UU siR UU siR AU siR UA siR
GU siRNA 2472 2472 UACCUAAUAACCAGAACAG 8826 A UCUGUUCUGGUUAUUAGG siRNA 2473 2473 ACCUAAUAACCAGAACAGA 8827 U -303-
Attorney Docket No.54462-742.601 UUCUGUUCUGGUUAUUAG siRNA 2474 2474 CCUAAUAACCAGAACAGAA 8828 G UUUCUGUUCUGGUUAUUA siR UU siR AU siR UA siR UU siR GU siR siR GU siR GG siR CUG siR CU siR UC siR UU siR GU siR UG siR CU siR UC siR UU siR CUU siR CU siR UC siR UU siR UU siR AU siR CA siR AC siR AA siR CA siR GC
siRNA 2503 2503 C 8857 GCACUCUCAGCAUAUACUG AGUAUAUGCUGAGAGUGC siRNA 2504 2504 C 8858 GGCACUCUCAGCAUAUACU -304-
Attorney Docket No.54462-742.601 GUAUAUGCUGAGAGUGCC siRNA 2505 2505 A 8859 UGGCACUCUCAGCAUAUAC siRNA 2506 2506 UAUAUGCUGAGAGUGCCAC 8860 GUGGCACUCUCAGCAUAUA siR AU siR UA siR AU siR CA siR GC siR AG siR CA siR CUC siR UCU siR CUC siR ACU siR CAC siR GCA siR GGC UG siR siR UG siR GU siR UG siR AU siR UA siR AU siR AA siR CA siR AC siR GA siR AG siR AA siR CA siR AC siR CA siR UC siR UU siR CU
siRNA 2540 2540 U 8894 AAACAUUUUCACAGCAUUC AAUGCUGUGAAAAUGUUU siRNA 2541 2541 A 8895 UAAACAUUUUCACAGCAUU -305-
Attorney Docket No.54462-742.601 AUGCUGUGAAAAUGUUUA siRNA 2542 2542 A 8896 UUAAACAUUUUCACAGCAU UGCUGUGAAAAUGUUUAA siR CA siR GC siR AG siR CA siR CAC siR UCA siR UUC siR UU siR UU siR UU siR AU siR CA siR AC siR AA siR AA siR UA siR UU siR CU siR CC siR UC siR AU siR UA siR AU siR AA siR CA siR CCC siR CCC siR
ACC siRNA 2571 2571 GUUUUCAAGGAGACCAAAC 8925 GUUUGGUCUCCUUGAAAAC UGUUUGGUCUCCUUGAAA siRNA 2572 2572 UUUUCAAGGAGACCAAACA 8926 A -306-
Attorney Docket No.54462-742.601 UUGUUUGGUCUCCUUGAA siRNA 2573 2573 UUUCAAGGAGACCAAACAA 8927 A UUUGUUUGGUCUCCUUGA siR UG siR siR UG siR CUU siR CCU siR UCC siR CUC siR UCU siR UC siR GU siR GG siR UG siR UU siR UU siR GU siR UG siR UU siR UU siR UU siR CU siR UC siR CU siR CUC siR CU siR CAC siR CA siR AC siR GA siR AG
siRNA 2603 2603 C 8957 GCUGCUCAGUUCUAAAACA GUUUUAGAACUGAGCAGC siRNA 2604 2604 A 8958 UGCUGCUCAGUUCUAAAAC -307-
Attorney Docket No.54462-742.601 siRNA 2605 2605 UUUUAGAACUGAGCAGCAC 8959 GUGCUGCUCAGUUCUAAAA siRNA 2606 2606 UUUAGAACUGAGCAGCACU 8960 AGUGCUGCUCAGUUCUAAA siR A 260 260 AGAAC GAGCAGCAC 8961 AAG GC GC CAG CUAA siR CUA siR UCU siR UUC GU siR AG siR CA siR UC siR CU siR GC siR UG siR CU siR GC siR UG siR GU siR AG siR AA siR AA siR AA siR GA siR AG siR UA siR GU siR GG siR AG siR GA siR UG siR UU siR AU siR
CA siRNA 2636 2636 AUGCAACCGACAAAAACUU 8990 U GAAGUUUUUGUCGGUUGC siRNA 2637 2637 UGCAACCGACAAAAACUUC 8991 A -308-
Attorney Docket No.54462-742.601 AGAAGUUUUUGUCGGUUG siRNA 2638 2638 GCAACCGACAAAAACUUCU 8992 C UAGAAGUUUUUGUCGGUU siR GU siR GG siR CG siR UC siR GU siR UG siR UU siR UU siR UU siR UU siR GU siR AG siR AA siR GA siR AG siR UA siR CU siR UC siR siR UUC AU siR siR AU siR UA siR AU siR UA siR AU siR AA siR GA
siRNA 2667 2667 U 9021 ACAGCACCACAAAACUCAG UGAGUUUUGUGGUGCUGU siRNA 2668 2668 A 9022 UACAGCACCACAAAACUCA -309-
Attorney Docket No.54462-742.601 GAGUUUUGUGGUGCUGUA siRNA 2669 2669 G 9023 CUACAGCACCACAAAACUC AGUUUUGUGGUGCUGUAG siR CU siR AC siR AA siR AA siR AA siR CA siR AC siR CA siR CC siR AC siR CA siR GC siR AG siR CA siR AC siR UA siR CU siR CC siR AC siR UA siR UU siR GU siR CG siR AC siR CA siR AC siR CA siR GCC siR GC siR UG siR GU siR AG siR CA siR GC
siRNA 2704 2704 G 9058 CAUGACCUUCAUUUGCCAG UGGCAAAUGAAGGUCAUG siRNA 2705 2705 A 9059 UCAUGACCUUCAUUUGCCA -310-
Attorney Docket No.54462-742.601 GGCAAAUGAAGGUCAUGA siRNA 2706 2706 G 9060 CUCAUGACCUUCAUUUGCC GCAAAUGAAGGUCAUGAG siR GC siR UG siR UU siR UU siR AU siR CA siR UC siR UU siR CU siR ACC siR AC siR GA siR UG siR AU siR CA siR UC siR CU siR UC siR AU siR CA siR CUC siR CU siR AC siR AA siR GA siR GG siR AG siR AA siR CA siR AC siR UA siR CCU siR ACC siR UAC siR UA siR
NA 2742 2742 ACCAGCUUCUGGCUCAAGA 9096 UCUUGAGCCAGAAGCUGGU siRNA 2743 2743 CCAGCUUCUGGCUCAAGAG 9097 CUCUUGAGCCAGAAGCUGG siRNA 2744 2744 CAGCUUCUGGCUCAAGAGU 9098 ACUCUUGAGCCAGAAGCUG -311-
Attorney Docket No.54462-742.601 siRNA 2745 2745 AGCUUCUGGCUCAAGAGUU 9099 AACUCUUGAGCCAGAAGCU siRNA 2746 2746 GCUUCUGGCUCAAGAGUUG 9100 CAACUCUUGAGCCAGAAGC siR A 24 24 C C GGC CAAGAG GA 9101 CAAC C GAGCCAGAAG siR AA siR GA siR AG siR CA siR CC siR GC siR AG siR GA siR UG siR UU siR CU siR UC siR CU siR AC siR AA siR CA siR UC siR UU siR CU siR CC siR AC siR CA siR GC siR GG siR UG siR AU siR GA siR CG siR GC siR UG siR CU siR CCC siR ACC siR AC siR GA siR UG siR CCU siR GCC siR GC siR GG siR AG siR
NA 2789 2789 UGCCCUGUCCCGAAGUGAU 9143 AUCACUUCGGGACAGGGCA siRNA 2790 2790 GCCCUGUCCCGAAGUGAUC 9144 GAUCACUUCGGGACAGGGC siRNA 2791 2791 CCCUGUCCCGAAGUGAUCU 9145 AGAUCACUUCGGGACAGGG -312-
Attorney Docket No.54462-742.601 siRNA 2792 2792 CCUGUCCCGAAGUGAUCUC 9146 GAGAUCACUUCGGGACAGG siRNA 2793 2793 CUGUCCCGAAGUGAUCUCC 9147 GGAGAUCACUUCGGGACAG siR A 294 294 G CCCGAAG GA C CC 9148 AGGAGA CAC CGGGACA siR AC siR GA siR GG siR GG siR CG siR UC siR UU siR CU siR CAC siR CA siR UC siR AU siR GA siR AG siR GA siR GG siR AG siR CCA siR UCC siR UUC CU siR UC siR GU siR UG siR UU siR CU siR AC siR siR CAC GC siR GG siR AG siR AA siR GA siR AG siR siR AG siR GA siR GG siR GG
siRNA 2833 2833 CUCCAUGGAUCUGUGAUCU 9187 AGAUCACAGAUCCAUGGAG siRNA 2834 2834 UCCAUGGAUCUGUGAUCUU 9188 AAGAUCACAGAUCCAUGGA siRNA 2835 2835 CCAUGGAUCUGUGAUCUUC 9189 GAAGAUCACAGAUCCAUGG -313-
Attorney Docket No.54462-742.601 siRNA 2836 2836 CAUGGAUCUGUGAUCUUCC 9190 GGAAGAUCACAGAUCCAUG siRNA 2837 2837 AUGGAUCUGUGAUCUUCCC 9191 GGGAAGAUCACAGAUCCAU siR A 2838 2838 GGA C G GA C CCCA 9192 GGGAAGA CACAGA CCA siR UCC siR AUC GA siR AG siR CA siR siR ACA siR CAC UC siR AU siR GA siR AG siR AA siR GA siR GG siR GG siR UG siR CU siR GC siR AG siR GA siR AG siR CA siR GC siR siR UGC AU siR GA siR siR GA siR UG siR UU siR GU siR UG siR GU siR
NA 2871 2871 CAGCAGCCUGCAGAUAACA 9225 UGUUAUCUGCAGGCUGCUG siRNA 2872 2872 AGCAGCCUGCAGAUAACAC 9226 GUGUUAUCUGCAGGCUGCU siRNA 2873 2873 GCAGCCUGCAGAUAACACU 9227 AGUGUUAUCUGCAGGCUGC -314-
Attorney Docket No.54462-742.601 AAGUGUUAUCUGCAGGCU siRNA 2874 2874 CAGCCUGCAGAUAACACUU 9228 G siRNA 2875 2875 AGCCUGCAGAUAACACUUG 9229 CAAGUGUUAUCUGCAGGCU siR GC siR GG siR AG siR CA siR GC siR UG siR CU siR UC siR AU siR UA siR UU siR GU siR UG siR GU siR AG siR AA siR CA siR CCC siR CCC siR CCC siR CCC siR UCC GU siR GG siR AG siR GA siR UG siR CU siR GC siR GG siR AG siR GA siR AG siR UA siR AU siR
AA siRNA 2911 2911 AUUCGCAACUCAUAAUCCG 9265 U ACGGAUUAUGAGUUGCGA siRNA 2912 2912 UUCGCAACUCAUAAUCCGU 9266 A -315-
Attorney Docket No.54462-742.601 UACGGAUUAUGAGUUGCG siRNA 2913 2913 UCGCAACUCAUAAUCCGUA 9267 A CUACGGAUUAUGAGUUGC siR UG siR UU siR GU siR AG siR GA siR UG siR AU siR UA siR UU siR AU siR siR AU siR GA siR CGG siR ACG siR UAC CU siR UC siR GU siR AG siR UA siR GU siR UG siR UU siR CU siR UC siR AU siR CA siR UC siR
UU siRNA 2943 2943 U 9297 C AAAUCUCAAUAAAUUAUU AAAUAAUUUAUUGAGAUU siRNA 2944 2944 U 9298 U -316-
Attorney Docket No.54462-742.601 AAUCUCAAUAAAUUAUUU AAAAUAAUUUAUUGAGAU siRNA 2945 2945 U 9299 U AUCUCAAUAAAUUAUUUU AAAAAUAAUUUAUUGAGA siR AG siR GA siR UG siR UU siR AU siR UA siR UU siR UU siR AU siR AA siR UA siR AU siR AA siR AA siR AA siR AA siR siR CAA siR UCA siR CUC AC siR AA siR AA siR UA siR AU siR AA siR UA siR UU siR
UU siRNA 2974 2974 U 9328 U AAGAUUGACAUUUUAAGU UACUUAAAAUGUCAAUCU siRNA 2975 2975 A 9329 U -317-
Attorney Docket No.54462-742.601 AGAUUGACAUUUUAAGUA GUACUUAAAAUGUCAAUC siRNA 2976 2976 C 9330 U GAUUGACAUUUUAAGUAC UGUACUUAAAAUGUCAAU siR AA siR CA siR UC siR GU siR UG siR AU siR AA siR AA siR AA siR UA siR UU siR CU siR AC siR UA siR GU siR UG siR UU siR GU siR AG siR AA siR AA siR AA siR siR AA siR UA siR CUU siR CCU siR UCC
siRNA 3005 3005 A 9359 UCCAUCACAGUAAUUAGUC ACUAAUUACUGUGAUGGA siRNA 3006 3006 C 9360 GUCCAUCACAGUAAUUAGU -318-
Attorney Docket No.54462-742.601 CUAAUUACUGUGAUGGAC siRNA 3007 3007 A 9361 UGUCCAUCACAGUAAUUAG UAAUUACUGUGAUGGACA siR UA siR UU siR AU siR AA siR UA siR GU siR AG siR CA siR AC siR CA siR UC siR AU siR CCA siR UCC siR UC siR GU siR UG siR GU siR UG siR CU siR UC siR UU siR UU siR AU siR CA siR AC siR UA siR CU
siRNA 3036 3036 A 9390 UUCAGUUCCAGAACACAGC CUGUGUUCUGGAACUGAA siRNA 3037 3037 U 9391 AUUCAGUUCCAGAACACAG -319-
Attorney Docket No.54462-742.601 UGUGUUCUGGAACUGAAU siRNA 3038 3038 C 9392 GAUUCAGUUCCAGAACACA GUGUUCUGGAACUGAAUC siR CAC siR ACA siR AAC GA siR AG siR CA siR siR CCA siR UCC siR UUC GU siR AG siR CA siR UC siR UU siR AU siR GA siR AG siR AA siR siR AA siR UA siR GU siR UG siR AU siR CCA siR ACC siR AC siR UA siR AU
siRNA 3067 3067 A 9421 UACCCAGCAGCACUAAGUA ACUUAGUGCUGCUGGGUA siRNA 3068 3068 A 9422 UUACCCAGCAGCACUAAGU -320-
Attorney Docket No.54462-742.601 CUUAGUGCUGCUGGGUAA siRNA 3069 3069 U 9423 AUUACCCAGCAGCACUAAG UUAGUGCUGCUGGGUAAU siR AA siR UA siR CU siR AC siR CA siR GC siR AG siR CA siR GC siR AG siR CA siR CCC siR ACC siR UAC UU siR AU siR AA siR siR AA siR AA siR CA siR AC siR CAA siR CCA siR ACC siR AC siR UA siR AU siR UA
siRNA 3098 3098 A 9452 UAACCACUAACCAGAUAAU UUAUCUGGUUAGUGGUUA siRNA 3099 3099 A 9453 UUAACCACUAACCAGAUAA -321-
Attorney Docket No.54462-742.601 UAUCUGGUUAGUGGUUAA siRNA 3100 3100 U 9454 AUUAACCACUAACCAGAUA AUCUGGUUAGUGGUUAAU siR AU siR GA siR AG siR CA siR ACC siR AC siR AA siR CUA siR ACU siR CAC CC siR AC siR AA siR UA siR UU siR AU siR CA siR GC siR AG siR AA siR GA siR GG siR AG siR AA siR AA siR UA siR UU siR UU siR
UU siRNA 3129 3129 A 9483 U AAAUAAUUGAGUCAUCCA AUGGAUGACUCAAUUAUU siRNA 3130 3130 U 9484 U -322-
Attorney Docket No.54462-742.601 AAUAAUUGAGUCAUCCAU AAUGGAUGACUCAAUUAU siRNA 3131 3131 U 9485 U GAAUGGAUGACUCAAUUA siR UU siR AU siR AA siR CA siR UC siR CU siR AC siR GA siR UG siR AU siR GA siR GG siR UG siR AU siR AA siR GA siR UG siR GU siR AG siR GA siR AG siR AA siR AA siR AA siR AA siR GA siR UG siR
CU siRNA 3160 3160 G 9514 G AGUUUUAUCUGUCAAUAG ACUAUUGACAGAUAAAAC siRNA 3161 3161 U 9515 U -323-
Attorney Docket No.54462-742.601 GUUUUAUCUGUCAAUAGU UACUAUUGACAGAUAAAA siRNA 3162 3162 A 9516 C UUUUAUCUGUCAAUAGUA CUACUAUUGACAGAUAAA siR AA siR UA siR AU siR GA siR AG siR CA siR AC siR GA siR UG siR UU siR AU siR UA siR CU siR AC siR siR UAC siR CUA siR GCU siR GC siR AG siR UA siR GU siR UG siR AU siR AA siR AA siR AA siR AA siR
NA 3191 3191 U 9545 AUAAAAGGUGCUCCCAUUA siRNA 3192 3192 AAUGGGAGCACCUUUUAUC 9546 GAUAAAAGGUGCUCCCAUU siRNA 3193 3193 AUGGGAGCACCUUUUAUCC 9547 GGAUAAAAGGUGCUCCCAU -324-
Attorney Docket No.54462-742.601 siRNA 3194 3194 UGGGAGCACCUUUUAUCCC 9548 GGGAUAAAAGGUGCUCCCA siRNA 3195 3195 GGGAGCACCUUUUAUCCCA 9549 UGGGAUAAAAGGUGCUCCC UUGGGAUAAAAGGUGCUC siR CU siR GC siR UG siR GU siR GG siR AG siR AA siR AA siR AA siR UA siR AU siR GA siR GG siR GG siR UG siR UU siR UU siR siR CUU siR ACU siR CAC siR CA siR GC siR AG siR AA siR AA siR UA siR AU
siRNA 3224 3224 A 9578 UAUCAGUCCACUCAAUUUA AAAUUGAGUGGACUGAUA siRNA 3225 3225 U 9579 AUAUCAGUCCACUCAAUUU -325-
Attorney Docket No.54462-742.601 AAUUGAGUGGACUGAUAU siRNA 3226 3226 A 9580 UAUAUCAGUCCACUCAAUU AUUGAGUGGACUGAUAUA siR AU siR AA siR CA siR CUC siR ACU siR CAC CC siR UC siR GU siR AG siR CA siR UC siR AU siR UA siR AU siR UA siR AU siR UA siR AU siR GA siR UG siR GU siR siR GU siR UG siR GU siR GG siR GG siR UG siR CCU siR ACC siR UAC AU siR siR
NA 3259 3259 AUCACUGUGCUGUCCUUUG 9613 CAAAGGACAGCACAGUGAU siRNA 3260 3260 UCACUGUGCUGUCCUUUGC 9614 GCAAAGGACAGCACAGUGA siRNA 3261 3261 CACUGUGCUGUCCUUUGCU 9615 AGCAAAGGACAGCACAGUG -326-
Attorney Docket No.54462-742.601 siRNA 3262 3262 ACUGUGCUGUCCUUUGCUG 9616 CAGCAAAGGACAGCACAGU siRNA 3263 3263 CUGUGCUGUCCUUUGCUGU 9617 ACAGCAAAGGACAGCACAG siR A 3264 3264 G GC G CC GC G C 9618 GACAGCAAAGGACAGCACA siR CAC siR CA siR GC siR CAG siR ACA siR GAC GG siR siR GG siR AG siR AA siR CAA siR GCA siR GC siR CAG siR ACA siR GAC UG siR CU siR UC siR AU siR AA siR AA siR siR AA siR CUA siR UCU siR UUC UU siR siR UU siR CAU siR CA
siRNA 3295 3295 A 9649 UCACAUAGCUCUUAAAAAC UUUUUAAGAGCUAUGUGA siRNA 3296 3296 A 9650 UUCACAUAGCUCUUAAAAA -327-
Attorney Docket No.54462-742.601 UUUUAAGAGCUAUGUGAA siRNA 3297 3297 A 9651 UUUCACAUAGCUCUUAAAA UUUAAGAGCUAUGUGAAA siR AA siR AA siR UA siR UU siR CU siR CUC siR GCU siR AGC UA siR AU siR CA siR AC siR CA siR UC siR UU siR UU siR UU siR GU siR UG siR siR CUG siR UCU siR GUC siR GU siR UG siR UU siR AU siR UA siR AU
siRNA 3326 3326 U 9680 AGUUCCCGACCUAAACUAA UAGUUUAGGUCGGGAACU siRNA 3327 3327 G 9681 CAGUUCCCGACCUAAACUA -328-
Attorney Docket No.54462-742.601 AGUUUAGGUCGGGAACUG siRNA 3328 3328 A 9682 UCAGUUCCCGACCUAAACU GUUUAGGUCGGGAACUGA siR AC siR AA siR AA siR UA siR CU siR CC siR AC siR GA siR CG siR CCC siR UCC siR UUC GU siR AG siR CA siR UC siR CU siR UC siR AU siR UA siR AU siR AA siR CA siR AC siR UA siR UU siR AU siR GA siR
UG siRNA 3357 3357 G 9711 A CAAAUAGUUAACAUCAGG UCCUGAUGUUAACUAUUU siRNA 3358 3358 A 9712 G -329-
Attorney Docket No.54462-742.601 AAAUAGUUAACAUCAGGA UUCCUGAUGUUAACUAUU siRNA 3359 3359 A 9713 U AAUAGUUAACAUCAGGAA siR UU siR AU siR CUA siR ACU siR AAC UA siR UU siR GU siR siR GU siR UG siR AU siR GA siR UG siR CU siR CC siR UC siR UU siR CU siR AC siR AA siR UA siR UU siR AU siR AA siR AA siR CA siR CC siR GC
siRNA 3388 3388 A 9742 UUCCCUAGAAUUUUGCCAG UGGCAAAAUUCUAGGGAA siRNA 3389 3389 A 9743 UUUCCCUAGAAUUUUGCCA -330-
Attorney Docket No.54462-742.601 GGCAAAAUUCUAGGGAAA siRNA 3390 3390 C 9744 GUUUCCCUAGAAUUUUGCC GCAAAAUUCUAGGGAAAC siR UGC UU siR siR UU siR UU siR UU siR AU siR AA siR GA siR AG siR UA siR CU siR CCC siR UCC siR UUC siR UU siR UU siR GU siR AG siR AA siR CA siR CC siR GC siR GG siR UG siR CU siR UC siR UU siR UU siR UU siR GU siR AG siR CA
siRNA 3423 3423 U 9777 AGCAAAAGCCUUCAACACC GUGUUGAAGGCUUUUGCU siRNA 3424 3424 C 9778 GAGCAAAAGCCUUCAACAC -331-
Attorney Docket No.54462-742.601 UGUUGAAGGCUUUUGCUC siRNA 3425 3425 A 9779 UGAGCAAAAGCCUUCAACA GUUGAAGGCUUUUGCUCA siR AC siR CAA siR UCA siR UUC CU siR CC siR GC siR AG siR AA siR AA siR AA siR CA siR GC siR AG siR GA siR UG siR AU siR UA siR AU siR siR AU siR UA siR UU siR UU siR GU siR UG siR CUU siR ACU siR CAC siR GCA
siRNA 3455 3455 A 9809 UCAUUUGAAACUCAAUGGC GUCAUUUGAAACUCAAUG siRNA 3456 3456 CCAUUGAGUUUCAAAUGAC 9810 G -332-
Attorney Docket No.54462-742.601 GGUCAUUUGAAACUCAAU siRNA 3457 3457 CAUUGAGUUUCAAAUGACC 9811 G AUUGAGUUUCAAAUGACC UGGUCAUUUGAAACUCAA siR siR CAA siR UCA siR CUC AC siR AA siR AA siR GA siR UG siR UU siR UU siR AU siR CA siR UC siR GU siR GG siR UG siR CU siR GC siR UG siR UU siR UU siR AU siR UA siR AU siR UA siR AU siR AA siR AA siR
UA siRNA 3487 3487 UUAGAACCCUUCCUGUUUU 9841 A UAAAACAGGAAGGGUUCU siRNA 3488 3488 UAGAACCCUUCCUGUUUUA 9842 A -333-
Attorney Docket No.54462-742.601 AUAAAACAGGAAGGGUUC siRNA 3489 3489 AGAACCCUUCCUGUUUUAU 9843 U CAUAAAACAGGAAGGGUU siR GU siR GG siR GG siR AG siR AA siR GA siR GG siR AG siR CA siR AC siR siR AAC AA siR AA siR UA siR AU siR CA siR AC siR GA siR AG siR CA siR AC siR UA siR GU siR GG siR AG siR GA siR CG siR
AC siRNA 3518 3518 CGUCCACCCCUCAGGUAAU 9872 G UAUUACCUGAGGGGUGGA siRNA 3519 3519 GUCCACCCCUCAGGUAAUA 9873 C -334-
Attorney Docket No.54462-742.601 GUAUUACCUGAGGGGUGG siRNA 3520 3520 UCCACCCCUCAGGUAAUAC 9874 A GGUAUUACCUGAGGGGUG siR GU siR GG siR GG siR GG siR AG siR GA siR UG siR CU siR CC siR AC siR UA siR UU siR AU siR UA siR GU siR GG siR AG siR siR CAG siR GCA siR GGC siR GG siR AG siR GA siR AG siR GA siR UG siR GU siR UG siR CU siR ACC siR AC siR
UA ACAGCUGUUUCUUGGAAA siRNA 3554 3554 U 9908 AUUUCCAAGAAACAGCUGU siRNA 3555 3555 CAGCUGUUUCUUGGAAAUC 9909 GAUUUCCAAGAAACAGCUG -335-
Attorney Docket No.54462-742.601 siRNA 3556 3556 AGCUGUUUCUUGGAAAUCC 9910 GGAUUUCCAAGAAACAGCU siRNA 3557 3557 GCUGUUUCUUGGAAAUCCU 9911 AGGAUUUCCAAGAAACAGC GAGGAUUUCCAAGAAACA siR AC siR AA siR AA siR GA siR AG siR AA siR CA siR CC siR UC siR UU siR UU siR AU siR GA siR GG siR AG siR GA siR GG siR UG siR UU siR GU siR GG siR UG siR UU siR UU siR AU siR UA siR CU siR
GC siRNA 3586 3586 AGCAGUUUUCCUAACUUGA 9940 U AUCAAGUUAGGAAAACUG siRNA 3587 3587 GCAGUUUUCCUAACUUGAU 9941 C -336-
Attorney Docket No.54462-742.601 AAUCAAGUUAGGAAAACU siRNA 3588 3588 CAGUUUUCCUAACUUGAUU 9942 G AGUUUUCCUAACUUGAUU UAAUCAAGUUAGGAAAAC siR AA siR AA siR AA siR GA siR GG siR AG siR siR AG siR UA siR UU siR GU siR AG siR AA siR CA siR UC siR AU siR AA siR UA siR CU siR GC siR AG siR AA siR CA siR UC siR CU siR GC siR CAG siR UCA siR GUC siR GU
siRNA 3619 3619 U 9973 ACUGUAUUCUAACAGUCUG AGACUGUUAGAAUACAGU siRNA 3620 3620 U 9974 AACUGUAUUCUAACAGUCU -337-
Attorney Docket No.54462-742.601 GACUGUUAGAAUACAGUU siRNA 3621 3621 C 9975 GAACUGUAUUCUAACAGUC ACUGUUAGAAUACAGUUC AGAACUGUAUUCUAACAG siR CA siR AC siR siR AAC siR AA siR CUA siR UCU siR UUC AU siR UA siR siR UA siR GU siR CUG siR CU siR AC siR AA siR GA siR AG siR GA siR AG siR CA siR CC siR GC siR GG siR UG siR GU siR UG siR CU siR GC siR AG siR CA siR UC siR AU siR CA siR UC siR CCU siR CCC siR GCC AG siR
AA siRNA 3661 3661 CUUUCUGUACUGCACACAG 10015 G UCUGUGUGCAGUACAGAA siRNA 3662 3662 UUUCUGUACUGCACACAGA 10016 A -338-
Attorney Docket No.54462-742.601 AUCUGUGUGCAGUACAGA siRNA 3663 3663 UUCUGUACUGCACACAGAU 10017 A AAUCUGUGUGCAGUACAG siR siR CAG siR ACA siR AC siR UA siR GU siR CAG siR GCA siR GC siR UG siR GU siR UG siR GU siR CUG siR UCU siR AUC siR AU siR CAA siR ACA siR CAC AC siR siR UAC siR UA siR GU siR AG siR CA siR GC siR UG siR GU siR GG siR GG siR GG siR UG siR CU siR AC siR GA siR GG siR UG siR CCU siR ACC siR CAC siR CA siR UC siR GU siR AG siR CCA siR ACC siR AC siR UA
siRNA 3713 3713 ACCCACUCGAGUUGUGCCG 10067 CGGCACAACUCGAGUGGGU siRNA 3714 3714 CCCACUCGAGUUGUGCCGU 10068 ACGGCACAACUCGAGUGGG siRNA 3715 3715 CCACUCGAGUUGUGCCGUG 10069 CACGGCACAACUCGAGUGG -339-
Attorney Docket No.54462-742.601 siRNA 3716 3716 CACUCGAGUUGUGCCGUGC 10070 GCACGGCACAACUCGAGUG siRNA 3717 3717 ACUCGAGUUGUGCCGUGCA 10071 UGCACGGCACAACUCGAGU siR A 318 318 C CGAG G GCCG GCAC 1002 G GCACGGCACAAC CGAG siR GA siR CG siR UC siR CU siR AC siR AA siR CA siR CAC siR GCA siR GGC siR CGG siR ACG siR CAC GC siR UG siR GU siR UG siR UU siR GU siR GG siR siR GG siR CAG siR CA siR AC siR GA siR GG siR UG siR CU siR AC siR UA siR AU siR UA siR AU siR CA siR GC siR UG siR AU siR CA
siRNA 3757 3757 GUGGUGGCCCUACUGACUG 10111 CAGUCAGUAGGGCCACCAC siRNA 3758 3758 UGGUGGCCCUACUGACUGG 10112 CCAGUCAGUAGGGCCACCA siRNA 3759 3759 GGUGGCCCUACUGACUGGU 10113 ACCAGUCAGUAGGGCCACC -340-
Attorney Docket No.54462-742.601 siRNA 3760 3760 GUGGCCCUACUGACUGGUA 10114 UACCAGUCAGUAGGGCCAC siRNA 3761 3761 UGGCCCUACUGACUGGUAA 10115 UUACCAGUCAGUAGGGCCA siR A 362 362 GGCCC AC GAC GG AA 10116 A ACCAG CAG AGGGCC siR GC siR GG siR GG siR AG siR UA siR GU siR AG siR CA siR UC siR GU siR AG siR CA siR CC siR AC siR UA siR UU siR AU siR CA siR CC siR AC siR AA siR UA siR CU siR CUC siR CCU siR GCC siR UGC AU siR
AA siRNA 3791 3791 U 10145 U UUUAUGGAUUUUUAGCUU AAAGCUAAAAAUCCAUAA siRNA 3792 3792 U 10146 A -341-
Attorney Docket No.54462-742.601 UUAUGGAUUUUUAGCUUU siRNA 3793 3793 G 10147 CAAAGCUAAAAAUCCAUAA UAUGGAUUUUUAGCUUUG siR UA siR AU siR CA siR UCC siR UC siR AU siR AA siR AA siR AA siR AA siR CUA siR GCU siR GC siR AG siR AA siR CAA siR UCA siR CUC CC siR UC siR UU siR UU siR UU siR UU siR GU siR GG siR UG siR AU siR
CA siRNA 3822 3822 U 10176 U UGACUUUUAACAAAUUUU AAAAAUUUGUUAAAAGUC siRNA 3823 3823 U 10177 A -342-
Attorney Docket No.54462-742.601 GACUUUUAACAAAUUUUU UAAAAAUUUGUUAAAAGU siRNA 3824 3824 A 10178 C ACUUUUAACAAAUUUUUA AUAAAAAUUUGUUAAAAG siR AA siR AA siR AA siR UA siR UU siR GU siR UG siR UU siR UU siR siR UU siR AU siR AA siR AA siR AA siR AA siR UA siR CAU siR CCA siR CCC AC siR AA siR UA siR AU siR UA siR AU siR CA siR GC siR GG siR
AG siRNA 3854 3854 CCUAAACCCUUAUGCCACA 10208 G AUGUGGCAUAAGGGUUUA siRNA 3855 3855 CUAAACCCUUAUGCCACAU 10209 G -343-
Attorney Docket No.54462-742.601 UAUGUGGCAUAAGGGUUU siRNA 3856 3856 UAAACCCUUAUGCCACAUA 10210 A CUAUGUGGCAUAAGGGUU siR GU siR GG siR siR GG siR GG siR AG siR AA siR UA siR CAU siR GCA siR GGC UG siR GU siR UG siR AU siR siR AU siR CUA siR ACU siR CAC CC siR AC siR UA siR UU siR UU siR AU siR UA siR UU siR siR UU siR AU
siRNA 3886 3886 U 10240 AACAGACCAUUUUUCAUAA UAUGAAAAAUGGUCUGUU siRNA 3887 3887 C 10241 GAACAGACCAUUUUUCAUA -344-
Attorney Docket No.54462-742.601 AUGAAAAAUGGUCUGUUC siRNA 3888 3888 A 10242 UGAACAGACCAUUUUUCAU UGAAAAAUGGUCUGUUCA siR UCA siR UUC UU siR UU siR UU siR siR UU siR AU siR CCA siR ACC siR AC siR GA siR AG siR CA siR AC siR AA siR GA siR UG siR AU siR UA siR UU siR AU siR AA siR CA siR CC siR AC siR UA siR CU siR CC
siRNA 3917 3917 G 10271 CCCUGCUCACAAAAGGCAC UGCCUUUUGUGAGCAGGG siRNA 3918 3918 A 10272 UCCCUGCUCACAAAAGGCA -345-
Attorney Docket No.54462-742.601 GCCUUUUGUGAGCAGGGA siRNA 3919 3919 G 10273 CUCCCUGCUCACAAAAGGC siRNA 3920 3920 CCUUUUGUGAGCAGGGAGC 10274 GCUCCCUGCUCACAAAAGG siR AG siR AA siR AA siR AA siR CA siR AC siR CA siR UC siR CU siR GC siR UG siR CU siR CCC siR UCC siR CUC GC siR UG siR AU siR UA siR UU siR siR UU siR AU siR AA siR UA siR AU siR CAA siR CCA
siRNA 3948 3948 U 10302 AUAAUUACCAUAAUAAACC GUUUAUUAUGGUAAUUAU siRNA 3949 3949 G 10303 CAUAAUUACCAUAAUAAAC -346-
Attorney Docket No.54462-742.601 UUUAUUAUGGUAAUUAUG siRNA 3950 3950 G 10304 CCAUAAUUACCAUAAUAAA UUAUUAUGGUAAUUAUGG siR AA siR UA siR AU siR AA siR UA siR AU siR CCA siR ACC siR UAC UU siR AU siR AA siR UA siR AU siR CA siR CC siR AC siR CA siR UC siR AU siR AA siR AA siR AA siR AA siR AA siR UA siR UU siR UU siR
AU siRNA 3979 3979 A 10333 U AUAUCAUGUAAUGUUAAA UUUUAACAUUACAUGAUA siRNA 3980 3980 A 10334 U -347-
Attorney Docket No.54462-742.601 UAUCAUGUAAUGUUAAAA GUUUUAACAUUACAUGAU siRNA 3981 3981 C 10335 A AUCAUGUAAUGUUAAAAC CGUUUUAACAUUACAUGA siR UG siR AU siR CA siR AC siR UA siR UU siR AU siR CA siR AC siR AA siR UA siR UU siR UU siR UU siR GU siR CG siR AC siR AA siR AA siR AA siR GA siR AG siR UA siR UU siR GU siR UG siR CU siR
AC siRNA 4010 4010 U 10364 U GAGAUAAGCAACAGUAAA siRNA 4011 4011 GUUUACUGUUGCUUAUCUC 10365 C -348-
Attorney Docket No.54462-742.601 GGAGAUAAGCAACAGUAA siRNA 4012 4012 UUUACUGUUGCUUAUCUCC 10366 A UGGAGAUAAGCAACAGUA siR GU siR AG siR CA siR AC siR AA siR CA siR GC siR AG siR AA siR UA siR AU siR GA siR AG siR GA siR GG siR UG siR UU siR siR CUU siR UCU siR AUC UA siR AU siR AA siR UA siR AU siR CA siR CC siR
UC siRNA 4041 4041 A 10395 C GAAUUAAGAAUUUUUCCA CUGGAAAAAUUCUUAAUU siRNA 4042 4042 G 10396 C -349-
Attorney Docket No.54462-742.601 AAUUAAGAAUUUUUCCAG UCUGGAAAAAUUCUUAAU siRNA 4043 4043 A 10397 U AUUAAGAAUUUUUCCAGA AUCUGGAAAAAUUCUUAA siR UA siR UU siR siR CUU siR UCU siR UC siR UU siR AU siR AA siR AA siR AA siR AA siR GA siR GG siR UG siR CU siR UC siR CAU siR UCA siR CUC AC siR siR CAC AC siR AA siR UA siR GU siR UG siR AU siR
UA siRNA 4072 4072 G 10426 U UAGAUUCUUUGAAUUUAG ACUAAAUUCAAAGAAUCU siRNA 4073 4073 U 10427 A -350-
Attorney Docket No.54462-742.601 AGAUUCUUUGAAUUUAGU UACUAAAUUCAAAGAAUC siRNA 4074 4074 A 10428 U GAUUCUUUGAAUUUAGUA AUACUAAAUUCAAAGAAU siR AA siR GA siR AG siR AA siR AA siR CA siR UC siR UU siR AU siR AA siR AA siR siR AA siR CUA siR ACU siR UAC AU siR UA siR UU siR siR UU siR UU siR CUU siR ACU siR AC siR UA siR GU siR CAG siR UCA
siRNA 4103 4103 U 10457 AAGUACAAACUUAAUUCUC AGAAUUAAGUUUGUACUU GAAGUACAAACUUAAUUC siRNA 4104 4104 C 10458 U -351-
Attorney Docket No.54462-742.601 GAAUUAAGUUUGUACUUC GGAAGUACAAACUUAAUU siRNA 4105 4105 C 10459 C AAUUAAGUUUGUACUUCC UGGAAGUACAAACUUAAU siR AA siR UA siR UU siR CU siR AC siR AA siR AA siR CA siR siR ACA siR UAC GU siR AG siR AA siR GA siR GG siR UG siR AU siR UA siR UU siR CU siR GC siR siR AGC AA siR CA siR CC siR siR UCC AU siR AA siR
AA siRNA 4135 4135 U 10489 A UUUAAACACUGAUAGUAU GAUACUAUCAGUGUUUAA siRNA 4136 4136 C 10490 A -352-
Attorney Docket No.54462-742.601 UUAAACACUGAUAGUAUC AGAUACUAUCAGUGUUUA siRNA 4137 4137 U 10491 A GAGAUACUAUCAGUGUUU siR UU siR GU siR UG siR GU siR siR GU siR CAG siR UCA siR AUC UA siR siR CUA siR ACU siR AC siR UA siR AU siR GA siR AG siR GA siR UG siR AU siR CA siR UC siR CU siR AC siR UA siR UU siR AU siR CA
siRNA 4166 4166 A 10520 UCCCUCUCCCAAAACACAC UGUGUUUUGGGAGAGGGA siRNA 4167 4167 G 10521 CUCCCUCUCCCAAAACACA -353-
Attorney Docket No.54462-742.601 GUGUUUUGGGAGAGGGAG siRNA 4168 4168 G 10522 CCUCCCUCUCCCAAAACAC UGUUUUGGGAGAGGGAGG siR CA siR AC siR AA siR AA siR AA siR CA siR CC siR CC siR UC siR CU siR UC siR CU siR CC siR CC siR UC siR CU siR CCC siR UCC siR AUC CA siR GC siR AG siR CA siR UC siR AU siR AA siR CA siR UC siR
AU siRNA 4197 4197 A 10551 C AUAUUUCACAUUGUAUGA UUCAUACAAUGUGAAAUA siRNA 4198 4198 A 10552 U -354-
Attorney Docket No.54462-742.601 UAUUUCACAUUGUAUGAA UUUCAUACAAUGUGAAAU siRNA 4199 4199 A 10553 A AUUUCACAUUGUAUGAAA AUUUCAUACAAUGUGAAA siR AA siR GA siR UG siR GU siR UG siR AU siR AA siR CA siR AC siR siR UAC AU siR CA siR UC siR UU siR UU siR AU siR UA siR GU siR GG siR UG siR AU siR CA siR AC siR AA siR AA siR CA siR UC siR
UU siRNA 4228 4228 G 10582 C GCAUUAUUGCUAUGAGUU siRNA 4229 4229 AAACUCAUAGCAAUAAUGC 10583 U -355-
Attorney Docket No.54462-742.601 AGCAUUAUUGCUAUGAGU siRNA 4230 4230 AACUCAUAGCAAUAAUGCU 10584 U UAGCAUUAUUGCUAUGAG siR GA siR UG siR AU siR UA siR siR CUA siR GCU siR UGC siR UG siR UU siR AU siR UA siR UU siR AU siR CA siR GC siR AG siR UA siR CAU siR GCA siR AGC CA siR siR ACA siR AAC CA siR AC siR CA siR UC siR AU siR GA siR GG siR GG siR
AG siRNA 4263 4263 CCUCUCAAGUUCUGCAUUU 10617 G UAAAUGCAGAACUUGAGA siRNA 4264 4264 CUCUCAAGUUCUGCAUUUA 10618 G -356-
Attorney Docket No.54462-742.601 UUAAAUGCAGAACUUGAG siRNA 4265 4265 UCUCAAGUUCUGCAUUUAA 10619 A UUUAAAUGCAGAACUUGA siR UG siR UU siR CU siR AC siR AA siR GA siR AG siR CA siR GC siR UG siR AU siR AA siR AA siR UA siR UU siR UU siR UU siR AU siR UA siR AU siR UA siR AU siR AA siR AA siR AA siR AA siR AA siR
siRNA 4294 4294 G 10648 CAUCAAUUCCUAUAAAGAA UCUUUAUAGGAAUUGAUG siRNA 4295 4295 U 10649 ACAUCAAUUCCUAUAAAGA -357-
Attorney Docket No.54462-742.601 CUUUAUAGGAAUUGAUGU siRNA 4296 4296 A 10650 UACAUCAAUUCCUAUAAAG UUUAUAGGAAUUGAUGUA siR AA siR AA siR UA siR AU siR CUA siR CCU siR UCC siR UUC AU siR siR AU siR CAA siR UCA siR AUC CA siR AC siR siR UAC AU siR UA siR GU siR siR GU siR GG siR UG siR AU siR CA siR UC siR UU siR CU siR AC siR GA
siRNA 4326 4326 C 10680 GCUACUACAACUGACAAUG AUUGUCAGUUGUAGUAGC siRNA 4327 4327 U 10681 AGCUACUACAACUGACAAU -358-
Attorney Docket No.54462-742.601 UUGUCAGUUGUAGUAGCU siRNA 4328 4328 C 10682 GAGCUACUACAACUGACAA UGUCAGUUGUAGUAGCUC siR CA siR AC siR GA siR UG siR CU siR AC siR AA siR CA siR AC siR UA siR CU siR AC siR UA siR CU siR GC siR AG siR GA siR AG siR CA siR UC siR CAU siR CA siR AC siR CAA siR UCA siR UUC AU siR siR CAU
siRNA 4357 4357 C 10711 GCUAAAACAUGAUAUCUCA GAGAUAUCAUGUUUUAGC siRNA 4358 4358 A 10712 UGCUAAAACAUGAUAUCUC -359-
Attorney Docket No.54462-742.601 AGAUAUCAUGUUUUAGCA AUGCUAAAACAUGAUAUC siRNA 4359 4359 U 10713 U GAUAUCAUGUUUUAGCAU AAUGCUAAAACAUGAUAU siR UA siR AU siR GA siR UG siR AU siR CA siR AC siR AA siR AA siR AA siR UA siR CU siR GC siR UG siR AU siR AA siR GA siR siR GA siR GG siR UG siR AU siR AA siR AA siR AA siR UA siR GU siR AG siR CA
siRNA 4389 4389 C 10743 GUGUUCUUCUACCCUAGUC ACUAGGGUAGAAGAACAC siRNA 4390 4390 U 10744 AGUGUUCUUCUACCCUAGU -360-
Attorney Docket No.54462-742.601 CUAGGGUAGAAGAACACU siRNA 4391 4391 U 10745 AAGUGUUCUUCUACCCUAG UAGGGUAGAAGAACACUU siR UA siR CCU siR CCC siR ACC UA siR CU siR siR UCU siR UUC CU siR UC siR UU siR GU siR UG siR GU siR AG siR AA siR siR AA siR AA siR AA siR GA siR AG siR AA siR CA siR GCC siR GC siR AG siR UA siR GU siR UG siR AU
siRNA 4422 4422 A 10776 UCCCUGGGUAUCCUCCAAA UUGGAGGAUACCCAGGGA siRNA 4423 4423 G 10777 CUCCCUGGGUAUCCUCCAA -361-
Attorney Docket No.54462-742.601 UGGAGGAUACCCAGGGAG siRNA 4424 4424 U 10778 ACUCCCUGGGUAUCCUCCA siRNA 4425 4425 GGAGGAUACCCAGGGAGUC 10779 GACUCCCUGGGUAUCCUCC siR UC siR CU siR CC siR UC siR AU siR UA siR GU siR GG siR GG siR UG siR CU siR CC siR CC siR UC siR CU siR AC siR GA siR AG siR AA siR CA siR CC siR CC siR AC siR CA siR AC siR AA siR GA siR GG siR AG siR AA siR UA siR AU siR GA siR AG siR
NA 4460 4460 A 10814 UGAAAUGUUUGCUUCCCCA siRNA 4461 4461 GGGGAAGCAAACAUUUCAC 10815 GUGAAAUGUUUGCUUCCCC siRNA 4462 4462 GGGAAGCAAACAUUUCACU 10816 AGUGAAAUGUUUGCUUCCC -362-
Attorney Docket No.54462-742.601 UAGUGAAAUGUUUGCUUC siRNA 4463 4463 GGAAGCAAACAUUUCACUA 10817 C CUAGUGAAAUGUUUGCUU siR CU siR GC siR UG siR UU siR UU siR GU siR UG siR AU siR AA siR AA siR GA siR UG siR GU siR AG siR UA siR CU siR AC siR GA siR AG siR GA siR AG siR AA siR AA siR AA siR AA siR AA siR AA siR
GA siRNA 4492 4492 A 10846 A UCAUCCUUUAAAUUGUAA UUUACAAUUUAAAGGAUG siRNA 4493 4493 A 10847 A -363-
Attorney Docket No.54462-742.601 CAUCCUUUAAAUUGUAAA AUUUACAAUUUAAAGGAU siRNA 4494 4494 U 10848 G AUCCUUUAAAUUGUAAAU AAUUUACAAUUUAAAGGA siR GG siR AG siR AA siR AA siR UA siR UU siR UU siR AU siR AA siR CA siR AC siR UA siR UU siR UU siR AU siR AA siR UA siR UU siR CU siR CC siR UC siR AU siR AA siR UA siR GU siR AG siR GA siR
UG siRNA 4523 4523 UCAAGCUCACCAUUAUUCA 10877 A UUGAAUAAUGGUGAGCUU siRNA 4524 4524 CAAGCUCACCAUUAUUCAA 10878 G -364-
Attorney Docket No.54462-742.601 CUUGAAUAAUGGUGAGCU siRNA 4525 4525 AAGCUCACCAUUAUUCAAG 10879 U UCUUGAAUAAUGGUGAGC siR AG siR GA siR UG siR GU siR siR GU siR GG siR UG siR AU siR AA siR UA siR AU siR AA siR GA siR UG siR UU siR CU siR UC siR AU siR AA siR CCA siR CCC siR UCC siR GUC AG siR GA siR CG siR GC siR AG siR AA siR GA siR GG siR GG siR UG siR
siRNA 4560 4560 CAGUCGACACUCUGCCCUG 10914 CAGGGCAGAGUGUCGACUG siRNA 4561 4561 AGUCGACACUCUGCCCUGC 10915 GCAGGGCAGAGUGUCGACU siRNA 4562 4562 GUCGACACUCUGCCCUGCC 10916 GGCAGGGCAGAGUGUCGAC -365-
Attorney Docket No.54462-742.601 AGGCAGGGCAGAGUGUCG siRNA 4563 4563 UCGACACUCUGCCCUGCCU 10917 A siRNA 4564 4564 CGACACUCUGCCCUGCCUG 10918 CAGGCAGGGCAGAGUGUCG siR GUC UG siR GU siR AG siR GA siR siR GA siR CAG siR GCA siR GC siR GG siR GG siR CAG siR GCA siR GC siR GG siR AG siR CA siR AC siR GA siR UG siR AU siR AA siR CA siR GC siR AG siR CA siR GC siR UG siR UU siR UU siR CU siR CUC siR GCU siR AGC CA siR GC siR siR AGC CA siR GC siR AG siR AA siR
AA siRNA 4606 4606 UUUGCCAACCUAAGCAAAG 10960 A UCUUUGCUUAGGUUGGCA siRNA 4607 4607 UUGCCAACCUAAGCAAAGA 10961 A -366-
Attorney Docket No.54462-742.601 UUCUUUGCUUAGGUUGGC siRNA 4608 4608 UGCCAACCUAAGCAAAGAA 10962 A UUUCUUUGCUUAGGUUGG siR UG siR UU siR GU siR GG siR AG siR siR AG siR UA siR CUU siR GCU siR UGC UU siR UU siR CU siR UC siR siR UUC UU siR UU siR AU siR UA siR GU siR CG siR CC siR GC siR AG siR AA siR GA siR AG siR GA siR
AG siRNA 4638 4638 UCUUGCAUUAUUUUCCCUU 10992 A AAAGGGAAAAUAAUGCAA siRNA 4639 4639 CUUGCAUUAUUUUCCCUUU 10993 G -367-
Attorney Docket No.54462-742.601 AAAAGGGAAAAUAAUGCA siRNA 4640 4640 UUGCAUUAUUUUCCCUUUU 10994 A CAAAAGGGAAAAUAAUGC siR UG siR AU siR AA siR UA siR siR UA siR AU siR AA siR AA siR AA siR GA siR GG siR GG siR AG siR AA siR AA siR AA siR CA siR ACC siR AC siR AA siR CCA siR ACC siR AAC siR AA siR CAA siR ACA siR AAC
AA siRNA 4669 4669 A 11023 A UUUCUAGAAGUACGUUCA siRNA 4670 4670 G 11024 CUGAACGUACUUCUAGAAA -368-
Attorney Docket No.54462-742.601 UUCUAGAAGUACGUUCAG siRNA 4671 4671 A 11025 UCUGAACGUACUUCUAGAA UCUAGAAGUACGUUCAGA siR GA siR AG siR UA siR CU siR UC siR CUU siR CU siR AC siR UA siR GU siR CG siR AC siR AA siR GA siR UG siR CU siR UC siR AU siR CA siR GC siR AG siR AA siR AA siR CA siR CCC siR CCC siR UCC siR UC
siRNA 4700 4700 C 11054 GCAAAUCAUACAUUGCAUU AUGCAAUGUAUGAUUUGC siRNA 4701 4701 U 11055 AGCAAAUCAUACAUUGCAU -369-
Attorney Docket No.54462-742.601 UGCAAUGUAUGAUUUGCU siRNA 4702 4702 A 11056 UAGCAAAUCAUACAUUGCA GCAAUGUAUGAUUUGCUA siR GC siR UG siR UU siR CAU siR ACA siR UAC AU siR CA siR UC siR AU siR AA siR AA siR CA siR GC siR AG siR UA siR CU siR GC siR AG siR GA siR AG siR GA siR AG siR GA siR UG siR GU siR GG siR UG siR siR
NA 4731 4731 CACUUAACUCACUGUGAGG 11085 CCUCACAGUGAGUUAAGUG siRNA 4732 4732 ACUUAACUCACUGUGAGGA 11086 UCCUCACAGUGAGUUAAGU siRNA 4733 4733 CUUAACUCACUGUGAGGAU 11087 AUCCUCACAGUGAGUUAAG -370-
Attorney Docket No.54462-742.601 UUAACUCACUGUGAGGAU siRNA 4734 4734 A 11088 UAUCCUCACAGUGAGUUAA UAACUCACUGUGAGGAUA siR UA siR UU siR GU siR AG siR GA siR UG siR GU siR AG siR CA siR AC siR CA siR CUC siR CCU siR UCC AU siR UA siR UU siR UU siR AU siR UA siR AU siR CA siR GC siR UG siR AU siR CA siR GC siR siR AGC
AA siRNA 4763 4763 U 11117 G UUUUUGUAAUUAACUGGU siRNA 4764 4764 G 11118 CACCAGUUAAUUACAAAAA -371-
Attorney Docket No.54462-742.601 UUUUGUAAUUAACUGGUG siRNA 4765 4765 C 11119 GCACCAGUUAAUUACAAAA UUUGUAAUUAACUGGUGC siR AA siR CAA siR ACA siR AC siR UA siR UU siR AU siR AA siR UA siR UU siR GU siR CAG siR CCA siR ACC CA siR GC siR AG siR AA siR AA siR CA siR siR UCA siR UUC siR UU siR UU siR UU siR AU siR GA siR AG
siRNA 4794 4794 U 11148 AUUUUUCUCCCUUAAAAAA UUUUUAAGGGAGAAAAAU siRNA 4795 4795 C 11149 GAUUUUUCUCCCUUAAAAA -372-
Attorney Docket No.54462-742.601 UUUUAAGGGAGAAAAAUC siRNA 4796 4796 U 11150 AGAUUUUUCUCCCUUAAAA UUUAAGGGAGAAAAAUCU siR AA siR AA siR UA siR CUU siR CCU siR CCC UC siR CU siR UC siR UU siR UU siR UU siR UU siR AU siR GA siR AG siR GA siR UG siR UU siR GU siR GG siR UG siR UU siR UU siR CU siR AC siR AA siR UA siR AU siR
AGCUUGUCUGGAUGAGCA siRNA 4826 4826 AUGCUCAUCCAGACAAGCU 11180 U siRNA 4827 4827 UGCUCAUCCAGACAAGCUG 11181 CAGCUUGUCUGGAUGAGCA -373-
Attorney Docket No.54462-742.601 siRNA 4828 4828 GCUCAUCCAGACAAGCUGA 11182 UCAGCUUGUCUGGAUGAGC GUCAGCUUGUCUGGAUGA siRNA 4829 4829 CUCAUCCAGACAAGCUGAC 11183 G UG siR AU siR GA siR GG siR siR GG siR CUG siR CU siR UC siR GU siR UG siR CUU siR GCU siR AGC CA siR UC siR GU siR GG siR AG siR AA siR AA siR CA siR UC siR CU siR AC siR AA siR UA siR UU siR AU siR AA siR AA siR
GA siRNA 4860 4860 UUCAGCACAACUCAUUCUU 11214 A GAAGAAUGAGUUGUGCUG siRNA 4861 4861 UCAGCACAACUCAUUCUUC 11215 A -374-
Attorney Docket No.54462-742.601 UGAAGAAUGAGUUGUGCU siRNA 4862 4862 CAGCACAACUCAUUCUUCA 11216 G CUGAAGAAUGAGUUGUGC siR UG siR GU siR UG siR UU siR GU siR AG siR GA siR UG siR AU siR AA siR GA siR AG siR siR AG siR AA siR GA siR CUG siR ACU siR CAC GC siR GG siR AG siR GA siR UG siR AU siR CA siR UC siR GU siR AG siR CA siR
UC siRNA 4893 4893 A 11247 A GAAAACAAAAAACAAAAA UUUUUUGUUUUUUGUUUU siRNA 4894 4894 A 11248 C -375-
Attorney Docket No.54462-742.601 AAAACAAAAAACAAAAAA UUUUUUUGUUUUUUGUUU siRNA 4895 4895 A 11249 U AAACAAAAAACAAAAAAA GUUUUUUUGUUUUUUGUU siR GU siR UG siR UU siR UU siR UU siR UU siR UU siR GU siR UG siR UU siR UU siR UU siR UU siR UU siR UU siR GU siR CG siR UC siR UU siR UU siR CU siR GC siR UG siR AU siR GA siR AG siR AA siR
GA siRNA 4924 4924 UUCACAAUGAAGCUUCCAG 11278 A UCUGGAAGCUUCAUUGUG siRNA 4925 4925 UCACAAUGAAGCUUCCAGA 11279 A -376-
Attorney Docket No.54462-742.601 AUCUGGAAGCUUCAUUGU siRNA 4926 4926 CACAAUGAAGCUUCCAGAU 11280 G UAUCUGGAAGCUUCAUUG siR siR UG siR UU siR CAU siR UCA siR UUC siR CUU siR GCU siR AGC AA siR GA siR siR GA siR GG siR CUG siR UCU siR AUC UA siR CU siR siR GCU siR UGC GU siR GG siR CG siR AC siR AA siR AA siR AA siR CA siR GC siR AG siR UA siR UU siR UU siR UU siR
CU siRNA 4961 4961 U 11315 U AGAUACAUUCUCAUUGUU AAACAAUGAGAAUGUAUC siRNA 4962 4962 U 11316 U -377-
Attorney Docket No.54462-742.601 GAUACAUUCUCAUUGUUU AAAACAAUGAGAAUGUAU siRNA 4963 4963 U 11317 C GAAAACAAUGAGAAUGUA siR GU siR UG siR AU siR AA siR GA siR AG siR GA siR UG siR AU siR AA siR siR CAA siR CA siR AC siR AA siR AA siR AA siR GA siR GG siR UG siR UU siR GU siR CUG siR ACU siR CAC siR CA siR UC siR CAU siR CCA siR GCC AG siR AA siR GA siR GG siR UG siR
GU siRNA 4999 4999 CACAUAAGGUUAAACAAAC 11353 G ACAUAAGGUUAAACAAAC AGUUUGUUUAACCUUAUG siRNA 5000 5000 U 11354 U -378-
Attorney Docket No.54462-742.601 CAUAAGGUUAAACAAACU UAGUUUGUUUAACCUUAU siRNA 5001 5001 A 11355 G AUAAGGUUAAACAAACUA CUAGUUUGUUUAACCUUA siR siR UA siR CUU siR CCU siR ACC siR AAC UA siR siR UA siR UU siR UU siR GU siR UG siR UU siR UU siR GU siR AG siR CUA siR CCU siR ACC CA siR GC siR AG siR AA siR CA siR AC siR UA siR UU siR UU siR
AU siRNA 5030 5030 A 11384 U AUAAUUUAUUACAGUUUA GUAAACUGUAAUAAAUUA siRNA 5031 5031 C 11385 U -379-
Attorney Docket No.54462-742.601 UAAUUUAUUACAGUUUAC AGUAAACUGUAAUAAAUU siRNA 5032 5032 U 11386 A AAUUUAUUACAGUUUACU GAGUAAACUGUAAUAAAU siR AA siR AA siR UA siR AU siR AA siR UA siR GU siR UG siR CU siR AC siR AA siR AA siR UA siR GU siR AG siR GA siR AG siR UA siR AU siR GA siR CG siR GC siR UG siR AU siR AA siR AA siR GA siR
AG siRNA 5061 5061 U 11415 A CUGUAACAUGAAAUGCAU siRNA 5062 5062 G 11416 CAUGCAUUUCAUGUUACAG -380-
Attorney Docket No.54462-742.601 UGUAACAUGAAAUGCAUG siRNA 5063 5063 C 11417 GCAUGCAUUUCAUGUUACA siRNA 5064 5064 GUAACAUGAAAUGCAUGCC 11418 GGCAUGCAUUUCAUGUUAC UU siR GU siR UG siR AU siR CA siR UC siR UU siR UU siR AU siR siR CAU siR CA siR GC siR UG siR AU siR CA siR GC siR GG siR GG siR AG siR AA siR GA siR AG siR AA siR GA siR UG siR CU siR CC siR CC siR CC siR UC siR UU siR CU
siRNA 5097 5097 A 11451 UUUUAACUUGACCACAGUC ACUGUGGUCAAGUUAAAA siRNA 5098 5098 A 11452 UUUUUAACUUGACCACAGU -381-
Attorney Docket No.54462-742.601 CUGUGGUCAAGUUAAAAA siRNA 5099 5099 A 11453 UUUUUUAACUUGACCACAG UGUGGUCAAGUUAAAAAA siR ACA siR CAC CC siR AC siR GA siR UG siR UU siR CU siR AC siR AA siR UA siR UU siR UU siR UU siR UU siR UU siR UU siR UU siR UU siR UU siR UU siR UU siR GU siR UG siR UU siR AU siR UA siR AU siR
AA siRNA 5128 5128 G 11482 U GCAGUUUCAUGUUGUUUA siRNA 5129 5129 UUAAACAACAUGAAACUGC 11483 A -382-
Attorney Docket No.54462-742.601 UGCAGUUUCAUGUUGUUU siRNA 5130 5130 UAAACAACAUGAAACUGCA 11484 A CUGCAGUUUCAUGUUGUU siR GU siR UG siR UU siR siR UU siR GU siR UG siR CAU siR UCA siR UUC siR UU siR UU siR GU siR CAG siR GCA siR UGC siR CUG siR ACU siR AC siR GA siR CAG siR ACA siR AC siR AA siR AA siR AA siR CAA siR UCA siR UUC
siRNA 5160 5160 G 11514 CUUAGGACAUUCUCAUUUU AAAUGAGAAUGUCCUAAG siRNA 5161 5161 U 11515 ACUUAGGACAUUCUCAUUU -383-
Attorney Docket No.54462-742.601 AAUGAGAAUGUCCUAAGU siRNA 5162 5162 G 11516 CACUUAGGACAUUCUCAUU AUGAGAAUGUCCUAAGUG siR AU siR CA siR CUC siR UCU siR UUC siR UU siR CAU siR ACA siR AC siR GA siR GG siR AG siR UA siR UU siR CU siR AC siR CA siR UC siR AU siR AA siR GA siR UG siR CU siR UC siR UU siR CU siR UC siR CU
siRNA 5191 5191 C 11545 GUGCACAACUUCCCUCCUC AGGAGGGAAGUUGUGCAC siRNA 5192 5192 U 11546 AGUGCACAACUUCCCUCCU -384-
Attorney Docket No.54462-742.601 GGAGGGAAGUUGUGCACU siRNA 5193 5193 C 11547 GAGUGCACAACUUCCCUCC GAGGGAAGUUGUGCACUC siR UC siR CU siR CCC siR UCC siR UC siR CUU siR ACU siR AC siR CAA siR ACA siR CAC siR GCA siR UGC GU siR AG siR GA siR AG siR CA siR UC siR UU siR UU siR UU siR siR UU siR CAU siR GCA siR UGC AU siR CA siR UC siR UU siR
UU siRNA 5224 5224 U 11578 U AAAACAAAGGCAAAAACU UAGUUUUUGCCUUUGUUU siRNA 5225 5225 A 11579 U -385-
Attorney Docket No.54462-742.601 AAACAAAGGCAAAAACUA CUAGUUUUUGCCUUUGUU siRNA 5226 5226 G 11580 U AACAAAGGCAAAAACUAG ACUAGUUUUUGCCUUUGU siR siR GU siR UG siR UU siR UU siR CU siR GCC siR GC siR UG siR UU siR UU siR UU siR UU siR GU siR AG siR UA siR CU siR AC siR CA siR CCC siR UCC siR UC siR UU siR UU siR CAU siR CA siR CAC siR CA
siRNA 5255 5255 A 11609 UCUCAGUUAACAGUUCUAC UAGAACUGUUAACUGAGA siRNA 5256 5256 U 11610 AUCUCAGUUAACAGUUCUA -386-
Attorney Docket No.54462-742.601 AGAACUGUUAACUGAGAU siRNA 5257 5257 G 11611 CAUCUCAGUUAACAGUUCU GAACUGUUAACUGAGAUG siR UC siR UU siR GU siR AG siR CA siR AC siR AA siR UA siR UU siR GU siR AG siR CA siR UC siR CU siR UC siR CAU siR CCA siR GCC siR AGC siR AG siR AA siR CGA siR UCG siR CUC AC siR siR GAC AG siR AA siR GA siR GG siR AG siR AA siR GA siR AG siR
CA siRNA 5292 5292 C 11646 G UGGAAUCUGUUAAAUUUC UGAAAUUUAACAGAUUCC siRNA 5293 5293 A 11647 A -387-
Attorney Docket No.54462-742.601 GGAAUCUGUUAAAUUUCA GUGAAAUUUAACAGAUUC siRNA 5294 5294 C 11648 C GAAUCUGUUAAAUUUCAC UGUGAAAUUUAACAGAUU siR AU siR GA siR AG siR CA siR AC siR AA siR UA siR UU siR UU siR AU siR siR AU siR AA siR AA siR GA siR UG siR GU siR UG siR UU siR UU siR CU siR AC siR GA siR UG siR AU siR CA siR UC siR CU
siRNA 5323 5323 U 11677 AUAUUUUCUCCAUUUACCC GGUAAAUGGAGAAAAUAU siRNA 5324 5324 U 11678 AAUAUUUUCUCCAUUUACC -388-
Attorney Docket No.54462-742.601 GUAAAUGGAGAAAAUAUU siRNA 5325 5325 U 11679 AAAUAUUUUCUCCAUUUAC UAAAUGGAGAAAAUAUUU GAAAUAUUUUCUCCAUUU siR UU siR siR UU siR AU siR CA siR UCC siR CUC siR UCU siR UUC UU siR UU siR AU siR UA siR siR UA siR AU siR AA siR AA siR GA siR AG siR CCA siR CCC siR UCC siR AUC AA siR UA siR GU siR UG siR UU siR
AU siRNA 5354 5354 U 11708 U AUGAAUGUAAGCCCAAAU AAUUUGGGCUUACAUUCA siRNA 5355 5355 U 11709 U -389-
Attorney Docket No.54462-742.601 UGAAUGUAAGCCCAAAUU siRNA 5356 5356 G 11710 CAAUUUGGGCUUACAUUCA GAAUGUAAGCCCAAAUUG siR UUC siR UU siR AU siR CA siR AC siR UA siR CUU siR CU siR GC siR GG siR GG siR UG siR UU siR UU siR AU siR AA siR CA siR CAC siR CCA siR UCC siR UC siR UU siR AU siR AA siR CA siR GC siR GG siR UG siR CU siR AC siR UA siR UU siR GU siR GG
siRNA 5391 5391 U 11745 AAUGCUUUUCCCCAUCCAG UGGAUGGGGAAAAGCAUU siRNA 5392 5392 U 11746 AAAUGCUUUUCCCCAUCCA -390-
Attorney Docket No.54462-742.601 GGAUGGGGAAAAGCAUUU siRNA 5393 5393 C 11747 GAAAUGCUUUUCCCCAUCC GAUGGGGAAAAGCAUUUC siR UC siR AU siR CCA siR CCC siR CCC siR UCC UU siR UU siR UU siR CU siR GC siR UG siR AU siR AA siR AA siR GA siR GG siR GG siR UG siR AU siR UA siR CU siR GC siR siR UGC GU siR siR GU siR AG siR GA siR GG siR UG siR AU
siRNA 5425 5425 U 11779 ACAGAGCACUCAUAUUACA GUAAUAUGAGUGCUCUGU siRNA 5426 5426 G 11780 CACAGAGCACUCAUAUUAC -391-
Attorney Docket No.54462-742.601 UAAUAUGAGUGCUCUGUG siRNA 5427 5427 A 11781 UCACAGAGCACUCAUAUUA AAUAUGAGUGCUCUGUGA siR UU siR AU siR UA siR AU siR CA siR UC siR CU siR AC siR CA siR GC siR AG siR GA siR AG siR CA siR AC siR CA siR CUC siR UCU siR AUC CA siR AC siR siR AAC GA siR UG siR AU siR GA siR siR GA siR UG siR CU
siRNA 5457 5457 G 11811 CACCAUUUCUAUAAAACAC UGUUUUAUAGAAAUGGUG siRNA 5458 5458 U 11812 ACACCAUUUCUAUAAAACA -392-
Attorney Docket No.54462-742.601 GUUUUAUAGAAAUGGUGU siRNA 5459 5459 U 11813 AACACCAUUUCUAUAAAAC UUUUAUAGAAAUGGUGUU siR AA siR AA siR AA siR UA siR AU siR UA siR CU siR UC siR UU siR UU siR AU siR CA siR CC siR AC siR CA siR AC siR AA siR CA siR GC siR AG siR CCA siR CCC siR UCC siR UUC siR UU siR UU siR GU siR GG siR UG siR CUU siR ACU siR AAC AA siR CA siR
GC siRNA 5494 5494 UGCACCUGGAAACUUACAA 11848 A AUUGUAAGUUUCCAGGUG siRNA 5495 5495 GCACCUGGAAACUUACAAU 11849 C -393-
Attorney Docket No.54462-742.601 CAUUGUAAGUUUCCAGGU siRNA 5496 5496 CACCUGGAAACUUACAAUG 11850 G GCAUUGUAAGUUUCCAGG siR AG siR CA siR CC siR UC siR UU siR UU siR GU siR AG siR AA siR UA siR GU siR siR GU siR UG siR UU siR CAU siR CA siR GC siR UG siR GU siR AG siR AA siR AA siR UA siR CU siR GC siR CG siR GC siR UG siR CU siR AC siR UA siR UU siR CU siR CC siR CC siR GC siR AG
siRNA 5535 5535 A 11889 UUUCACUACCGGAUGCCAA UGGCAUCCGGUAGUGAAA siRNA 5536 5536 A 11890 UUUUCACUACCGGAUGCCA -394-
Attorney Docket No.54462-742.601 GGCAUCCGGUAGUGAAAA siRNA 5537 5537 A 11891 UUUUUCACUACCGGAUGCC siRNA 5538 5538 GCAUCCGGUAGUGAAAAAC 11892 GUUUUUCACUACCGGAUGC siR UG siR AU siR GA siR GG siR CCG siR ACC siR UAC CU siR AC siR CA siR UC siR UU siR UU siR UU siR UU siR GU siR AG siR CA siR AC siR GA siR AG siR UA siR UU siR GU siR GG siR GG siR UG siR CU siR
GC siRNA 5567 5567 AGCAUUGCCCAAACUAUUU 11921 U AAAAUAGUUUGGGCAAUG siRNA 5568 5568 GCAUUGCCCAAACUAUUUU 11922 C -395-
Attorney Docket No.54462-742.601 CAAAAUAGUUUGGGCAAU siRNA 5569 5569 CAUUGCCCAAACUAUUUUG 11923 G UCAAAAUAGUUUGGGCAA siR CA siR GC siR GG siR GG siR UG siR UU siR UU siR GU siR AG siR UA siR AU siR AA siR AA siR AA siR CA siR UC siR GU siR UG siR GU siR GG siR UG siR CU siR CC siR siR UCC siR GUC GG siR AG siR AA siR
AA siRNA 5599 5599 UUUUUCUCCUUUGGGAUAC 11953 A AGUAUCCCAAAGGAGAAA siRNA 5600 5600 UUUUCUCCUUUGGGAUACU 11954 A -396-
Attorney Docket No.54462-742.601 AAGUAUCCCAAAGGAGAA siRNA 5601 5601 UUUCUCCUUUGGGAUACUU 11955 A UAAGUAUCCCAAAGGAGA siR AG siR siR AG siR GA siR GG siR AG siR AA siR CAA siR CCA siR CCC UC siR AU siR UA siR GU siR AG siR AA siR UA siR AU siR CA siR UC siR UU siR GU siR GG siR AG siR GA siR siR GA siR AG siR GA siR UG siR GU siR AG
siRNA 5633 5633 A 11987 UGUUCUCCACAGGACAUUA AAUGUCCUGUGGAGAACA siRNA 5634 5634 U 11988 AUGUUCUCCACAGGACAUU -397-
Attorney Docket No.54462-742.601 AUGUCCUGUGGAGAACAU siRNA 5635 5635 U 11989 AAUGUUCUCCACAGGACAU UGUCCUGUGGAGAACAUU siR CA siR AC siR GA siR GG siR AG siR CA siR AC siR CA siR UCC siR CUC siR UCU siR UUC GU siR UG siR siR UG siR AU siR AA siR AA siR AA siR CCA siR CCC siR UCC siR UUC UU siR GU siR UG siR GU siR AG siR
UA siRNA 5664 5664 U 12018 G UAUGUUAGAUAGUUCUUU UAAAGAACUAUCUAACAU siRNA 5665 5665 A 12019 A -398-
Attorney Docket No.54462-742.601 AUGUUAGAUAGUUCUUUA UUAAAGAACUAUCUAACA siRNA 5666 5666 A 12020 U UGUUAGAUAGUUCUUUAA siR ACA siR AC siR AA siR UA siR CU siR UC siR AU siR CUA siR ACU siR AAC GA siR siR GA siR AG siR AA siR AA siR UA siR UU siR CU siR UCC siR CUC siR UCU siR GUC siR GU siR UG siR UU siR UU siR UU siR GU
siRNA 5695 5695 A 12049 UGCUAUCUGUUCAUUACCG GGUAAUGAACAGAUAGCA siRNA 5696 5696 C 12050 GUGCUAUCUGUUCAUUACC -399-
Attorney Docket No.54462-742.601 GUAAUGAACAGAUAGCAC siRNA 5697 5697 U 12051 AGUGCUAUCUGUUCAUUAC UAAUGAACAGAUAGCACU siR UA siR UU siR AU siR CA siR UC siR UU siR GU siR UG siR CU siR UC siR AU siR UA siR CU siR GC siR UG siR GU siR AG siR CA siR CCC siR CCC siR GCC siR UGC CU siR siR UCU siR UUC AU siR UA siR AU siR siR CAU siR GCA siR UGC
AU siRNA 5729 5729 CAUGCAUUUUGUAACGUCC 12083 G UGGACGUUACAAAAUGCA siRNA 5730 5730 AUGCAUUUUGUAACGUCCA 12084 U -400-
Attorney Docket No.54462-742.601 siRNA 5731 5731 UGCAUUUUGUAACGUCCAG 12085 CUGGACGUUACAAAAUGCA siRNA 5732 5732 GCAUUUUGUAACGUCCAGU 12086 ACUGGACGUUACAAAAUGC siR A 33 33 CA G AACG CCAG G 1208 CAC GGACG ACAAAAUG siR AU siR AA siR AA siR AA siR CA siR AC siR UA siR UU siR GU siR CG siR AC siR GA siR GG siR UG siR CU siR AC siR CA siR AC siR CA siR CC siR GC siR CG siR AC siR CAA siR UCA siR UUC AU siR UA siR CU siR UC siR
AU siRNA 5764 5764 GAUGUGUAUUUCCUCCCCU 12118 C CAGGGGAGGAAAUACACA siRNA 5765 5765 AUGUGUAUUUCCUCCCCUG 12119 U -401-
Attorney Docket No.54462-742.601 GCAGGGGAGGAAAUACAC siRNA 5766 5766 UGUGUAUUUCCUCCCCUGC 12120 A UGCAGGGGAGGAAAUACA siR AC siR UA siR AU siR AA siR AA siR GA siR GG siR AG siR GA siR GG siR GG siR GG siR AG siR siR CAG siR GCA siR UGC CU siR UC siR UU siR UU siR UU siR AU siR UA siR UU siR CU siR GC siR UG siR
GU siRNA 5795 5795 A 12149 G ACAGAAAAUUAUAAUGUA CUACAUUAUAAUUUUCUG siRNA 5796 5796 G 12150 U -402-
Attorney Docket No.54462-742.601 CAGAAAAUUAUAAUGUAG siRNA 5797 5797 G 12151 CCUACAUUAUAAUUUUCUG AGAAAAUUAUAAUGUAGG siR UCU siR UC siR UU siR UU siR UU siR AU siR AA siR UA siR AU siR UA siR UU siR AU siR CA siR AC siR UA siR CU siR ACC siR CAC siR UCA siR AUC siR AU siR CGA siR CCG siR UCC siR CUC GC siR siR AGC GA siR siR GA siR AG siR AA siR AA siR GA
siRNA 5831 5831 G 12185 CUGUUCUCUCUAUCAAAGG CUUUGAUAGAGAGAACAG siRNA 5832 5832 C 12186 GCUGUUCUCUCUAUCAAAG -403-
Attorney Docket No.54462-742.601 UUUGAUAGAGAGAACAGC siRNA 5833 5833 C 12187 GGCUGUUCUCUCUAUCAAA siRNA 5834 5834 UUGAUAGAGAGAACAGCCC 12188 GGGCUGUUCUCUCUAUCAA siR CA siR UC siR AU siR CUA siR CU siR CUC siR UCU siR CUC UC siR UU siR GU siR siR GU siR CUG siR GCU siR GGC GG siR GG siR UG siR UU siR AU siR CA siR UC siR siR AUC GA siR GG siR AG siR siR CAG siR CCA siR GCC AG siR AA siR AA siR AA siR AA siR
GA siRNA 5869 5869 UUCACUGAACGUAUCAGAA 12223 A AUUCUGAUACGUUCAGUG siRNA 5870 5870 UCACUGAACGUAUCAGAAU 12224 A -404-
Attorney Docket No.54462-742.601 UAUUCUGAUACGUUCAGU siRNA 5871 5871 CACUGAACGUAUCAGAAUA 12225 G GUAUUCUGAUACGUUCAG siR CA siR UC siR siR UUC siR UU siR CGU siR ACG siR AC siR UA siR AU siR GA siR CUG siR CU siR UC siR UU siR AU siR UA siR GU siR UG siR AU siR CA siR CC siR UC siR AU siR CA siR UC siR UU siR AU
siRNA 5900 5900 U 12254 AAAACCUUAUUUACCCCAA UGGGGUAAAUAAGGUUUU siRNA 5901 5901 A 12255 UAAAACCUUAUUUACCCCA -405-
Attorney Docket No.54462-742.601 GGGGUAAAUAAGGUUUUA siRNA 5902 5902 A 12256 UUAAAACCUUAUUUACCCC GGGUAAAUAAGGUUUUAA siR CCC siR ACC UA siR UU siR UU siR AU siR UA siR UU siR CU siR CC siR siR ACC AA siR AA siR AA siR UA siR UU siR AU siR siR AU siR AA siR GA siR CUG siR UCU siR UC siR AU siR GA siR AG siR UA siR CU
siRNA 5931 5931 U 12285 AACGUACAAUACUUUCUUC AAGAAAGUAUUGUACGUU siRNA 5932 5932 U 12286 AAACGUACAAUACUUUCUU -406-
Attorney Docket No.54462-742.601 AGAAAGUAUUGUACGUUU siRNA 5933 5933 G 12287 CAAACGUACAAUACUUUCU GAAAGUAUUGUACGUUUG siR UC siR UU siR CUU siR CU siR AC siR UA siR AU siR AA siR CA siR AC siR UA siR CGU siR ACG siR AAC AA siR CA siR UC siR UU siR AU siR CA siR GC siR UG siR CU siR UC siR AU siR AA siR AA siR AA siR
AA siRNA 5962 5962 U 12316 A UUAUCCACAGAUAGUUGU UACAACUAUCUGUGGAUA siRNA 5963 5963 A 12317 A -407-
Attorney Docket No.54462-742.601 UAUCCACAGAUAGUUGUA siRNA 5964 5964 G 12318 CUACAACUAUCUGUGGAUA AUCCACAGAUAGUUGUAG siR AU siR GA siR GG siR UG siR GU siR UG siR CU siR UC siR AU siR UA siR CU siR AC siR AA siR CA siR AC siR UA siR CU siR AC siR CA siR AC siR AA siR AA siR CUA siR UCU siR UC siR GU siR UG siR AU siR CA siR UC siR GU siR UG siR CU siR UCC
siRNA 5999 5999 GACCUAUCGUUGAGGUUUC 12353 GAAACCUCAACGAUAGGUC siRNA 6000 6000 ACCUAUCGUUGAGGUUUCU 12354 AGAAACCUCAACGAUAGGU siRNA 6001 6001 CCUAUCGUUGAGGUUUCUA 12355 UAGAAACCUCAACGAUAGG -408-
Attorney Docket No.54462-742.601 CUAUCGUUGAGGUUUCUA siRNA 6002 6002 A 12356 UUAGAAACCUCAACGAUAG UAUCGUUGAGGUUUCUAA siR UA siR AU siR GA siR CG siR AC siR CAA siR UCA siR CUC CC siR AC siR AA siR AA siR siR AA siR GA siR AG siR UA siR UU siR CU siR UC siR GU siR AG siR AA siR UA siR GU siR AG siR UA siR AU siR CCA siR CCC siR GCC AG siR
CA siRNA 6034 6034 A 12388 G UGUAAACCUGUUUUUUAA UUUAAAAAACAGGUUUAC siRNA 6035 6035 A 12389 A -409-
Attorney Docket No.54462-742.601 GUAAACCUGUUUUUUAAA UUUUAAAAAACAGGUUUA siRNA 6036 6036 A 12390 C UAAACCUGUUUUUUAAAA GUUUUAAAAAACAGGUUU siR UU siR GU siR GG siR AG siR CA siR AC siR AA siR AA siR AA siR AA siR AA siR UA siR UU siR UU siR UU siR GU siR AG siR UA siR AU siR AA siR AA siR siR AA siR AA siR CUA siR CU siR UC siR UU siR UU siR GU siR GG siR AG siR
NA 6069 6069 UGAGACUUGCCGUCUGGCA 12423 UGCCAGACGGCAAGUCUCA siRNA 6070 6070 GAGACUUGCCGUCUGGCAU 12424 AUGCCAGACGGCAAGUCUC siRNA 6071 6071 AGACUUGCCGUCUGGCAUU 12425 AAUGCCAGACGGCAAGUCU -410-
Attorney Docket No.54462-742.601 siRNA 6072 6072 GACUUGCCGUCUGGCAUUU 12426 AAAUGCCAGACGGCAAGUC siRNA 6073 6073 ACUUGCCGUCUGGCAUUUU 12427 AAAAUGCCAGACGGCAAGU siR A 604 604 C GCCG C GGCA A 12428 AAAA GCCAGACGGCAAG siR AA siR CA siR GC siR CGG siR ACG siR GAC AG siR CA siR CC siR GC siR UG siR AU siR AA siR AA siR AA siR UA siR CU siR AC siR AA siR AA siR UA siR UU siR AU siR UA siR GU siR UG siR UU siR UU siR GU siR
AG siRNA 6104 6104 A 12458 U CUAAUGAUUGCAUUUGAA UUUCAAAUGCAAUCAUUA siRNA 6105 6105 A 12459 G -411-
Attorney Docket No.54462-742.601 UAAUGAUUGCAUUUGAAA siRNA 6106 6106 G 12460 CUUUCAAAUGCAAUCAUUA AAUGAUUGCAUUUGAAAG siR UU siR AU siR CA siR UC siR AU siR CAA siR GCA siR UGC siR UG siR AU siR AA siR CAA siR UCA siR UUC UU siR CU siR UC siR CU siR UC siR AU siR AA siR GA siR AG siR AA siR CA siR UC siR GU siR GG siR
AG siRNA 6135 6135 CCUUAUUUCUAAACGUCUA 12489 G CUAGACGUUUAGAAAUAA siRNA 6136 6136 CUUAUUUCUAAACGUCUAG 12490 G -412-
Attorney Docket No.54462-742.601 UUAUUUCUAAACGUCUAG UCUAGACGUUUAGAAAUA siRNA 6137 6137 A 12491 A UAUUUCUAAACGUCUAGA CUCUAGACGUUUAGAAAU siR AA siR AA siR GA siR AG siR siR AG siR UA siR UU siR UU siR CGU siR CG siR AC siR GA siR AG siR CUA siR CU siR CUC siR GCU siR GC siR AG siR GA siR AG siR CA siR UC siR UU siR UU siR AU siR CA siR AC siR GA siR AG
siRNA 6169 6169 C 12523 GUUUAAUACCUUCCAUCAA UGAUGGAAGGUAUUAAAC siRNA 6170 6170 U 12524 AGUUUAAUACCUUCCAUCA -413-
Attorney Docket No.54462-742.601 GAUGGAAGGUAUUAAACU siRNA 6171 6171 A 12525 UAGUUUAAUACCUUCCAUC AUGGAAGGUAUUAAACUA siR CAU siR CCA siR UCC siR UUC CU siR CC siR AC siR UA siR AU siR AA siR UA siR UU siR UU siR GU siR AG siR UA siR AU siR siR AU siR AA siR CAA siR GCA siR GGC siR GG siR CAG siR ACA siR AAC CA siR siR ACA
siRNA 6200 6200 A 12554 UCUUAACAUUUCUUUGUAC UACAAAGAAAUGUUAAGA GUCUUAACAUUUCUUUGU siRNA 6201 6201 C 12555 A -414-
Attorney Docket No.54462-742.601 ACAAAGAAAUGUUAAGAC AGUCUUAACAUUUCUUUG siRNA 6202 6202 U 12556 U CAAAGAAAUGUUAAGACU GAGUCUUAACAUUUCUUU siR siR UU siR CUU siR CU siR UC siR UU siR UU siR CAU siR CA siR AC siR AA siR UA siR CUU siR UCU siR GUC AG siR GA siR CG siR AC siR CA siR UC siR siR UUC UU siR UU siR CU siR UC siR siR UUC AU siR
siRNA 6231 6231 G 12585 CACAGUACCUUAUAGUAAU UUACUAUAAGGUACUGUG siRNA 6232 6232 A 12586 UCACAGUACCUUAUAGUAA -415-
Attorney Docket No.54462-742.601 UACUAUAAGGUACUGUGA siRNA 6233 6233 A 12587 UUCACAGUACCUUAUAGUA ACUAUAAGGUACUGUGAA siR GU siR AG siR UA siR AU siR UA siR CUU siR CCU siR ACC siR AC siR UA siR GU siR CAG siR ACA siR CAC siR UCA siR UUC siR UU siR UU siR AU siR UA siR UU siR GU siR AG siR CA siR CGC siR UCG siR AUC AA siR
AA siRNA 6262 6262 C 12616 A UUUGUGAGCAAAACAUAC AGUAUGUUUUGCUCACAA siRNA 6263 6263 U 12617 A -416-
Attorney Docket No.54462-742.601 UUGUGAGCAAAACAUACU AAGUAUGUUUUGCUCACA siRNA 6264 6264 U 12618 A UGUGAGCAAAACAUACUU siR ACA siR CAC siR UCA siR CUC GC siR UG siR UU siR UU siR UU siR siR UU siR GU siR UG siR AU siR UA siR GU siR AG siR AA siR CCA siR UCC siR UUC UU siR AU siR siR CAU siR GCA siR AGC CA siR siR UCA siR AUC
AA siRNA 6293 6293 U 12647 U UUGAUUUUUAUGCUUGUU UAACAAGCAUAAAAAUCA siRNA 6294 6294 A 12648 A -417-
Attorney Docket No.54462-742.601 UGAUUUUUAUGCUUGUUA siRNA 6295 6295 G 12649 CUAACAAGCAUAAAAAUCA GAUUUUUAUGCUUGUUAG siR AUC siR AU siR AA siR AA siR AA siR AA siR UA siR AU siR CA siR GC siR AG siR AA siR CA siR AC siR AA siR CUA siR ACU siR CAC siR ACA siR UAC AU siR AA siR CA siR GC siR siR UGC UU siR CU siR siR UCU
siRNA 6324 6324 U 12678 ACUACAUUUUCUGUGUUUC AAACACAGAAAAUGUAGU AACUACAUUUUCUGUGUU siRNA 6325 6325 U 12679 U -418-
Attorney Docket No.54462-742.601 AACACAGAAAAUGUAGUU AAACUACAUUUUCUGUGU siRNA 6326 6326 U 12680 U ACACAGAAAAUGUAGUUU AAAACUACAUUUUCUGUG siR siR UG siR GU siR CUG siR UCU siR UUC UU siR UU siR AU siR CA siR AC siR UA siR CU siR AC siR AA siR AA siR AA siR CA siR AC siR AA siR AA siR AA siR UA siR UU siR AU siR UA siR UU siR
NA 6353 6353 U 12707 A AAACCAAAAAUUGAACAU UAUGUUCAAUUUUUGGUU siRNA 6354 6354 A 12708 U -419-
Attorney Docket No.54462-742.601 Table 67. Additional Sequence SEQ ID Sequence (5’ to 3’) NO GC TG ACA GT AT TTA TG CTT CA GCA AC GGA CT AT AGC AG AAG AC CG AA TCC GT AA ATT AG TG GC AC 128 CA CC AA CC CA GA AT CA AC ATG CA TA CA GTG TT TA CA GT GTT AG TT TTA GGC GT AA GTT
GT GACTGGTACCCACTCGAGTTGTGCCGTGCACAACCTGTCCAGTATATGCATGTGGTGGCCCTACTGA CTGGTAATGGTTAGAGGCATTTATGGATTTTTAGCTTTGAGGAAAAACCATGACTTTTAACAAATTTT TATGGGTTATATGCCTAAACCCTTATGCCACATAGTGGTAAATAATTATGAAAAATGGTCTGTTCATA -420-
Attorney Docket No.54462-742.601 SEQ ID Sequence (5’ to 3’) NO: TT AA AG GA GC TA TT GT ATT TG CTT TC AT ATT TCA GGC CT ATT AG CT AAT ATG TAT GG CT AT GC GA TTT GA CCT GA TA AG AA AGT 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 1374
1 [ETL17]scauTmgCfUfUfCfaggCmaauaaasusu 13742 [ETL17]scauTmgCfUfUfCfaggCmaauaaasusu 13743 [ETL17]scauTmgCfUfUfCfaggCmaauaaasusu -421-
Attorney Docket No.54462-742.601 SEQ ID Sequence (5’ to 3’) NO: 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137 137
13765 usGfscUfgCfuGfuCfgAfaGfuAfaUfususu -422-
Claims
Attorney Docket No.54462-742.601 CLAIMS What is claimed is: 1. A composition comprising an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases circulating cholesterol, apolipoprotein B, bilirubin, alanine aminotransferase, aspartate aminotransferase, or aspartate aminotransferase in a subject. 2. The composition of claim 1, wherein the cholesterol comprises total cholesterol, low density lipoprotein cholesterol, or non-high density lipoprotein cholesterol. 3. The composition of claim 1, wherein the decreased by about 10% or more, as compared to prior to administration. 4. A composition comprising an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases a liver fibrosis score, non-alcoholic fatty liver disease (NAFLD) activity score, or liver fat percentage in a subject. 5. The composition of claim 4, wherein the decrease is by about 10% or more, as compared to prior to administration. 6. A composition comprising an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases a use of statin (HMG CoA reductase inhibitor) medication. 7. The composition of claim 6, wherein the decrease is by about 10% or more, as compared to prior to administration. 8. A composition comprising an oligonucleotide that targets GPAM and when administered to a subject in an effective amount decreases a measurement that reflects a phenotype of esophageal varices, portal hypertension, NAFLD, NASH, alcoholic liver disease, liver fibrosis, liver cirrhosis, hepatocellular carcinoma, hyperlipidemia, ischemic heart disease, or coronary heart disease in a subject. 9. The composition of claim 8, wherein the decrease is by about 10% or more, as compared to prior to administration. 10. A composition comprising an oligonucleotide that targets GPAM and when administered to a subject in an effective amount increases circulating ketone bodies in a subject. 11. The composition of claim 10, wherein the increase is by about 10% or more, as compared to prior to administration. 12. The composition of any one of claims 1-11, wherein the oligonucleotide comprises a modified internucleoside linkage. 13. The composition of claim 12, wherein the modified internucleoside linkage comprises alkylphosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate, or carboxymethyl ester, or a combination thereof. 14. The composition of claim 12, wherein the modified internucleoside linkage comprises one or more phosphorothioate linkages. 15. The composition of any one of claims 1-11, wherein the oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 modified internucleoside linkages. -423-
Attorney Docket No.54462-742.601 16. The composition of any one of claims 1-11, wherein the oligonucleotide comprises a modified nucleoside. 17. The composition of claim 16, wherein the modified nucleoside comprises a locked nucleic acid (LNA), hexitol nucleic acid (HLA), cyclohexene nucleic acid (CeNA), 2’-O-(2-methoxyethyl), 2'-O- alkyl, 2'-O-allyl, 2'-O-allyl, 2'-fluoro, or 2'-deoxy, or a combination thereof. 18. The composition of claim 16, wherein the modified nucleoside comprises an LNA. 19. The composition of claim 16, wherein the modified nucleoside comprises a 2’,4’ constrained ethyl nucleic acid. 20. The composition of claim 16, wherein the modified nucleoside comprises a 2'-O-methyl nucleoside, 2'-deoxyfluoro nucleoside, 2’-O-(2-methoxyethyl), 2'-O-N-methylacetamido (2'-O-NMA) nucleoside, a 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE) nucleoside, 2'-O-aminopropyl (2'-O-AP) nucleoside, or 2'-ara-F, or a combination thereof. 21. The composition of claim 16, wherein the modified nucleoside comprises one or more 2’fluoro modified nucleosides. 22. The composition of claim 16, wherein the modified nucleoside comprises a 2' O-alkyl modified nucleoside. 23. The composition of any one of claims 1-11, wherein the oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 modified nucleosides. 24. The composition of any one of claims 1-11, wherein the oligonucleotide comprises a hydrophobic moiety attached at a 3’ or 5’ terminus of the oligonucleotide. 25. The composition of claim 24, wherein the hydrophobic moiety comprises cholesterol, myristoyl, palmitoyl, stearoyl, lithocholoyl, docosanoyl, docosahexaenoyl, myristyl, palmityl, stearyl, or α-tocopherol, or a combination thereof. 26. The composition of claim 24, wherein the hydrophobic moiety comprises stearyl, t- butylphenyl, n-butylphenyl, octylphenyl, dodecylphenyl, phenyl n-dodecyl, octadecylbenzamide, hexadecylbenzamide, or octadecylcyclohexyl. 27. The composition of claim 24, wherein the hydrophobic moiety comprises any one of the follo
, , or
, wherein the dotted line indicates a covalent connection to an end of the oligonucleotide, n is 1-3, and R is an alkyl group containing 4-18 carbons. -424-
Attorney Docket No.54462-742.601 28. The composition of any one of claims 1-27, wherein the oligonucleotide comprises an N- acetylgalactosamine (GalNAc) moiety, an N-acetylglucosamine (GlcNAc) moiety, or a mannose moiety, attached at a 3’ or 5’ terminus of the oligonucleotide. 29. The composition of any one of claims 1-28 , wherein the oligonucleotide comprises a GalNAc moiety. 30. The composition of claim 29, comprising:
prises the oligonucleotide, and wherein J comprises an optional phosphate or phosphorothioate linking to the oligonucleotide. 31. The composition of any one of claims 1-11, wherein the oligonucleotide comprises a small interfering RNA (siRNA) comprising a sense strand and an antisense strand. 32. The composition of claim 31, wherein the sense strand is 12-30 nucleosides in length. 33. The composition of claim 31, wherein the antisense strand is 12-30 nucleosides in length. 34. A composition comprising an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an siRNA comprising a sense strand and an antisense strand, each strand is independently about 12-30 nucleosides in length, and at least one of the sense strand and the antisense strand comprises a nucleoside sequence comprising about 12-30 contiguous nucleosides of SEQ ID NO: 12867. 35. The composition of claim 31, wherein any one of the following is true with regard to the sense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise 2’-O- methyl modified pyrimidines; -425-
Attorney Docket No.54462-742.601 all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; or all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise 2’-O- methyl modified purines. 36. The composition of claim 31, wherein any one of the following is true with regard to the antisense strand: all purines comprise 2’ fluoro modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise a mixture of 2’ fluoro and 2’-O-methyl modified pyrimidines; all purines comprise 2’-O-methyl modified purines, and all pyrimidines comprise 2’ fluoro modified pyrimidines; all pyrimidines comprise 2’ fluoro modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise a mixture of 2’ fluoro and 2’-O-methyl modified purines; or all pyrimidines comprise 2’-O-methyl modified pyrimidines, and all purines comprise 2’ fluoro modified purines. 37. The composition of any one of claims 1-11, wherein the oligonucleotide comprises an antisense oligonucleotide (ASO). 38. The composition of claim 37, wherein the ASO is 12-30 nucleosides in length. 39. A composition comprising an oligonucleotide that inhibits the expression of GPAM, wherein the oligonucleotide comprises an ASO about 12-30 nucleosides in length and a nucleoside sequence complementary to about 12-30 contiguous nucleosides of SEQ ID NO: 12867. 40. The composition of any one of claims 1-11, further comprising a pharmaceutically acceptable carrier. 41. A method of treating a subject having liver disease, comprising administering an effective amount of the composition of claim 40 to the subject. 42. The method of claim 41, wherein the liver disease comprises NAFLD, NASH, alcoholic liver disease, liver fibrosis, liver cirrhosis, or hepatocellular carcinoma. 43. A method of treating a subject having cardiometabolic disease, comprising administering an effective amount of the composition of claim 40 to the subject. 44. The method of claim 43, wherein the cardiometabolic disease comprises hyperlipidemia, ischemic heart disease, or coronary heart disease. -426-
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202263354115P | 2022-06-21 | 2022-06-21 | |
| US202263433365P | 2022-12-16 | 2022-12-16 | |
| PCT/US2023/068741 WO2023250327A1 (en) | 2022-06-21 | 2023-06-20 | Treatment of gpam related diseases and disorders |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4544052A1 true EP4544052A1 (en) | 2025-04-30 |
Family
ID=89380657
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP23827986.3A Pending EP4544052A1 (en) | 2022-06-21 | 2023-06-20 | Treatment of gpam related diseases and disorders |
Country Status (2)
| Country | Link |
|---|---|
| EP (1) | EP4544052A1 (en) |
| WO (1) | WO2023250327A1 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2025137167A2 (en) * | 2023-12-20 | 2025-06-26 | Empirico Inc. | Treatment of gpam related diseases and disorders |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2685127C (en) * | 2007-04-23 | 2019-01-08 | Alnylam Pharmaceuticals, Inc. | Glycoconjugates of rna interference agents |
| CN116075592A (en) * | 2020-06-09 | 2023-05-05 | 阿尔尼拉姆医药品有限公司 | SIRNA compositions and methods for silencing GPAM (mitochondrial glycerol-3-phosphate acyltransferase 1) expression |
-
2023
- 2023-06-20 WO PCT/US2023/068741 patent/WO2023250327A1/en not_active Ceased
- 2023-06-20 EP EP23827986.3A patent/EP4544052A1/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| WO2023250327A1 (en) | 2023-12-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240287518A1 (en) | Treatment of mtres1 related diseases and disorders | |
| US12258564B2 (en) | GalNAc compositions for improving siRNA bioavailability | |
| US20250195555A1 (en) | Treatment of hgfac related diseases and disorders | |
| WO2023250327A1 (en) | Treatment of gpam related diseases and disorders | |
| EP4355430A1 (en) | Treatment of mst1r related diseases and disorders | |
| WO2022140365A1 (en) | Galnac compositions for improving sirna bioavailability | |
| US20240287517A1 (en) | Treatment of plin1 related diseases and disorders | |
| EP4634391A2 (en) | Treatment of mst1 related diseases and disorders | |
| EP4540391A2 (en) | Treatment of ms4a4e related diseases and disorders | |
| WO2025137167A2 (en) | Treatment of gpam related diseases and disorders | |
| WO2024206673A2 (en) | Treatment of fgg related hearing disorders | |
| WO2025137323A1 (en) | Treatment of cpn1 related diseases and disorders | |
| WO2025059328A1 (en) | Modified oligonucleotides | |
| EP4627082A1 (en) | Treatment of mtres1 related diseases and disorders | |
| EP4720298A1 (en) | Treatment of fgg related diseases and disorders | |
| WO2025255269A1 (en) | Treatment of mtres1 related diseases and disorders | |
| WO2025059345A1 (en) | Treatment of hgfac related diseases and disorders |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20241218 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) |