EP4511004A1 - Inhalable pharmaceutical composition comprising the protein anakinra for the treatment of inflammation in cystic fibrosis - Google Patents

Inhalable pharmaceutical composition comprising the protein anakinra for the treatment of inflammation in cystic fibrosis

Info

Publication number
EP4511004A1
EP4511004A1 EP23725446.1A EP23725446A EP4511004A1 EP 4511004 A1 EP4511004 A1 EP 4511004A1 EP 23725446 A EP23725446 A EP 23725446A EP 4511004 A1 EP4511004 A1 EP 4511004A1
Authority
EP
European Patent Office
Prior art keywords
pharmaceutical composition
mannitol
anakinra
sucrose
trehalose
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP23725446.1A
Other languages
German (de)
French (fr)
Inventor
Stefano GIOVAGNOLI
Marilena PARIANO
Matteo PUCCETTI
Maurizio Ricci
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fondazione Per La Ricerca Sulla Fibrosi Cistica Onlus
Universita degli Studi di Perugia
Original Assignee
Fondazione Per La Ricerca Sulla Fibrosi Cistica Onlus
Universita degli Studi di Perugia
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fondazione Per La Ricerca Sulla Fibrosi Cistica Onlus, Universita degli Studi di Perugia filed Critical Fondazione Per La Ricerca Sulla Fibrosi Cistica Onlus
Publication of EP4511004A1 publication Critical patent/EP4511004A1/en
Pending legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/007Pulmonary tract; Aromatherapy
    • A61K9/0073Sprays or powders for inhalation; Aerolised or nebulised preparations generated by other means than thermal energy
    • A61K9/0075Sprays or powders for inhalation; Aerolised or nebulised preparations generated by other means than thermal energy for inhalation via a dry powder inhaler [DPI], e.g. comprising micronized drug mixed with lactose carrier particles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19Cytokines; Lymphokines; Interferons
    • A61K38/20Interleukins [IL]
    • A61K38/2006IL-1
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/14Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
    • A61K9/16Agglomerates; Granulates; Microbeadlets ; Microspheres; Pellets; Solid products obtained by spray drying, spray freeze drying, spray congealing,(multiple) emulsion solvent evaporation or extraction
    • A61K9/1682Processes
    • A61K9/1694Processes resulting in granules or microspheres of the matrix type containing more than 5% of excipient
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system

Definitions

  • Inhalable pharmaceutical composition comprising the protein anakinra for the treatment of inflammation in cystic fibrosis
  • the present invention relates to an inhalable pharmaceutical composition
  • an inhalable pharmaceutical composition comprising the protein anakinra for the treatment of inflammation in cystic fibrosis.
  • the invention relates to an inhalable pharmaceutical composition
  • an inhalable pharmaceutical composition comprising the protein anakinra for the treatment of inflammation in cystic fibrosis, and which is capable of preserving the stability of the active ingredient and providing an effective dose thereof through the inhalation route.
  • Cystic fibrosis is an autosomal recessive pathology that affects multiple organs, including the respiratory, gastrointestinal, and genital tracts (1 ), and is more common in the Caucasian population, with a frequency of about 1 out of 2500. It is caused by mutations in the gene encoding for the transmembrane conductance regulator (CFTR) and more than 2000 variants have been identified. The most frequent mutation is the deletion of the phenylalanine residue at position 508, which causes the misfolding and degradation of CFTR before the protein can reach the plasma membrane for its functional activity. CFTR is a chloride/bicarbonate channel that regulates the ion equilibrium of surface fluid. It has been demonstrated that cells which express the most common CFTR mutant variant are defective in autophagy and accumulate polyubiquitinated proteins and similar structures (2).
  • CFTR activity leads to the dehydration of surface fluid and excessive production of mucus, with two important pathological consequences.
  • the altered surface fluid and mucus create areas of hypoxia that cause the death of airway epithelial cells due to necrosis.
  • the consequent release of molecular patterns associated with the damage gives rise to the recruitment of neutrophils and onset of an inflammatory response.
  • the removal of microorganisms by mucociliary clearance is compromised, thus favouring microbial colonisation and infection, which further exacerbate the inflammatory state.
  • a failure to resolve the inflammatory response leads, finally, to chronic inflammation, with the accumulation of neutrophils in the airways, tissue damage and the start of fibrotic processes.
  • TRIKAFTA a combination of two correctors (tezacaftor and elexacaftor) and a potentiator (ivacaftor) has received FDA approval for the treatment of the most common mutation, Phe508del. Notwithstanding the significant impact of these molecules in the treatment of CF patients, at least in the case of Phe508del carriers, it is not clear whether an improvement in the inflammatory response and autophagy also falls within their range of action. Therefore, inflammation appears as an independent factor of morbidity and the search for anti-inflammatory drugs remains an interesting area of research in the field of CF.
  • ibuprofen the non-steroidal anti-inflammatory drug ibuprofen, which is capable of slowing the progression of lung disease at high doses, especially in children (6).
  • Other drugs include Acebilustat, Lenabasum and Fenretinide, which target lipid mediators (1 , 7, 8).
  • anti-inflammatory drugs Whilst the use of anti-inflammatory drugs is certainly a valid therapeutic strategy in CF, the method of administering them must be carefully assessed in order to optimise their effectiveness/safety profile. In fact, anti-inflammatory drugs should lower the basal level of the inflammation that is harmful for tissues without compromising the mechanisms of defence against pathogens. In this regard, exploiting endogenous anti-inflammatory pathways could represent an interesting strategy for restoring a homeostatic regulation of inflammation.
  • Anakinra (Kineret®) is a drug placed on the market in 2001 for the treatment of rheumatoid arthritis and, more recently, of cryopyrin-associated periodic syndromes as well as systemic-onset juvenile idiopathic arthritis (12-14). It is presented in the form of pre-filled syringes for subcutaneous injection at a single dose of 100 mg/0.67 mL/day.
  • Anakinra is a recombinant, non-glycosylated form of the endogenous IL-1 receptor antagonist (IL-1 Ra), from which it differs because of the presence of an extra methionine at the amino terminus.
  • IL-1 Ra endogenous IL-1 receptor antagonist
  • Anakinra exerts its effects by inhibiting the binding of IL-1 (3 to IL-1 R1 (12).
  • IL-1 Ra In addition to a secreted protein, three non-secreted intracellular isoforms of IL-1 Ra have been described in humans and in mouse tissues (15). Whilst it is known that extracellular IL-1 Ra inhibits the activity of IL-1 by binding to IL-1 Rl, it has been observed that intracellular IL-1 Ra1 also has antiinflammatory properties (16).
  • anakinra has shown superior action compared to the neutralising IL-1 (3 antibody against infection and mouse lung pathology (11 ), a cellular absorption of exogenous anakinra has been observed (17) and IL-IRa bound to the surface does not undergo receptor-mediated internalisation (18) - suggest that anakinra may exert receptorindependent intracellular activities.
  • the inventors of the present invention have recently identified two new potential mechanisms of anakinra tied to induction of the enzyme SOD2 and autophagy activation (19, 20).
  • anakinra Administered subcutaneously, anakinra is highly bioavailable (95%) and reaches maximum plasma levels in 3-7 hours (21 ). Less than 10% of the drug is eliminated unmodified through urine, with a terminal half-life of 6-8 hours (22). The site of metabolism and levels of anakinra in organs are unknown. The clearance of anakinra is reduced by 70-75% in patients with severe kidney failure.
  • the prior art document WO2021/113334 A1 describes the use of a liquid pharmaceutical composition comprising anakinra and excipients comprising a sugar selected from among lactose, mannitol, sucrose and sorbitol and amino acids such as histidine, proline, hydroxyproline and glycine.
  • document D1 describes an anakinra-based liquid composition for aerosol comprising a filler such as, for example, mannitol, and a tonicity modifier such as, for example, hydroxyproline, proline or combinations thereof (D1 , para. 211 ).
  • the composition can contain a buffer, such as, for example, histidine (D1 , par. 200), and further amino acids such as glycine (D1 , para. 261 ).
  • document D1 describes liquid anakinra compositions and suggests making powder formulations of anakinra.
  • the solution according to the present invention fits into this context; it aims to provide a therapy that is effective against inflammation in cystic fibrosis, assures high compliance and has fewer side effects compared to the known therapies.
  • anakinra can be advantageously administered by inhalation in a suitable pharmaceutical form so that the active ingredient is effective in the treatment of pathological inflammation in patients with CF.
  • a pharmaceutical composition comprising anakinra in dry powder form for inhalational use has been developed for the treatment of pathological inflammation in patients with CF.
  • a pharmaceutical composition in dry powder form, suitable for administration by inhalation which comprises an amount of the protein anakinra that is effective for this route of administration and wherein, at the same time, the stability of the protein itself is preserved.
  • a spray drying process suitable for obtaining the advantageous properties of the composition according to the present invention has also been developed.
  • the choice of excipients and of the preparation process conditions is capable of ensuring the stability of the protein both in the processing phase and during storage.
  • the preparation according to the present invention is intended to overcome the limitations of the present subcutaneous administration by enabling direct administration to the lungs. A reduction of the dosage and of systemic side effects and a considerable increase in compliance are the greatest advantages of the preparation according to the present invention, also by virtue of the elimination of the discomfort associated with the conventional method of administration.
  • the composition of the present invention is not only effective by inhalation against the inflammatory lung pathology in CF, but also provides greater effectiveness compared to administration by injection, the dose being equal. Therefore, the composition according to the present invention makes it possible to decrease the dose of the active ingredient and consequently any side effects of the active ingredient itself, besides enabling a decrease in the costs of the preparation.
  • a pharmaceutical composition comprising the protein anakinra, as the active ingredient, in combination with one or more pharmaceutically acceptable excipients, said pharmaceutical composition being in a dry powder form suitable for administration by inhalation, wherein said one or more excipients comprise or consist of one or more sugars selected from among mannitol, sucrose, trehalose, or lactose and one or more amino acids selected from among leucine, trileucine, lysine, tryptophan, arginine, aspartic acid, threonine, or phenylalanine.
  • the amino acid is leucine and/or trileucine, since these amino acids improve the yield of the process for producing the composition of the invention and the respirability thereof.
  • the leucine can be D-leucine or L-leucine, preferably the leucine is D- leucine.
  • the leucine can be present in the composition in an amount by weight ranging from 10 to 80%, preferably from 30 to 60%, relative to the total weight of the composition.
  • the trileucine can be present in the composition in an amount by weight ranging from 1 to 10%, preferably from 4 to 8%, relative to the total weight of the composition.
  • one or more excipients comprise means that the excipients, and hence the composition of the invention, can also comprise other types of excipients besides said sugar or said amino acid.
  • one or more excipients consist of means that the excipients, and hence the composition of the invention, do not comprise other types of excipients besides said one or more sugars and said one or more amino acids.
  • said one or more excipients can comprise a single sugar selected from among mannitol, trehalose, or sucrose, or a mixture of said sugars selected from among mannitol and sucrose, mannitol and trehalose or mannitol, trehalose, and sucrose.
  • the excipients of the pharmaceutical composition comprise, among the sugars, only the non-reducing ones listed above or mixtures thereof, but they could comprise other types of excipients.
  • said one or more sugars can consist of a single sugar selected from among mannitol, trehalose, or sucrose or a mixture of said sugars selected from among mannitol and sucrose, mannitol and trehalose or mannitol, trehalose, and sucrose.
  • said one or more excipients can comprise the amino acid leucine. Therefore, according to this embodiment, when the term “comprise” is considered, it means that the excipients of the pharmaceutical composition comprise, among the amino acids, only leucine, but they could comprise, in addition to sugar, other types of excipients. Again in this embodiment, when the term “consist of” or “consists of” is considered, it means that the excipients of the composition consist of the amino acid leucine and one or more sugars among those listed above, whereas they do not comprise other types of excipients.
  • said one or more amino acids can consist of the amino acid leucine and/or the amino acid trileucine, preferably the amino acid leucine.
  • said one or more excipients can comprise or consist of one of the following mixtures of said one or more sugars and said one or more amino acids: mannitol and leucine, trehalose and leucine, sucrose and leucine or mannitol, trehalose, sucrose, and leucine, mannitol and trileucine, trehalose and trileucine, sucrose, and trileucine, mannitol, trehalose, sucrose and trileucine.
  • the term “comprise” when the term “comprise” is considered, it means that the excipients of the pharmaceutical composition comprise the sugars specifically mentioned, and no other sugars, in combination with the amino acid leucine or the amino acid trileucine, and not in combination with another of the amino acids of the invention; however, the excipients could comprise other types of excipients.
  • the term “consist of” or “consists of” when the term “consist of” or “consists of” is considered, it means that the excipients of the composition consist of the above-mentioned mixtures of specific sugars with the amino acid leucine or trileucine and do not comprise other types of excipients.
  • said one or more excipients can further comprise a lipid selected from among dipalmitoylphosphatidylcholine, distearoylphosphatidylcholine, dimyristoylphosphatidylcholine, cholesterol, magnesium or potassium stearate, or mixtures of said lipids.
  • said one or more excipients can further comprise a hydrophilic polymer selected from among chitosan, polyethylene glycol, polyethylenepolypropylene glycol, or mixtures of said hydrophilic polymers.
  • the protein anakinra is present in the pharmaceutical composition in an amount that can range from 1 % to 40% by weight relative to the weight of the pharmaceutical composition, preferably from 10% to 30%, even more preferably from 15% to 25%.
  • the dry powder of the composition according to the present invention is characterised by particles with an average volume size that can range from 1 to 40 microns, preferably from 5 to 20 microns, even more preferably from 8 to 15 microns.
  • the pharmaceutical composition according to the present invention can be obtained by means of the spray drying technique in order to obtain the best characteristics suitable for administration by inhalation.
  • the present invention further relates to a pharmaceutical composition as defined above for use in the prevention or treatment of inflammation, wherein said pharmaceutical composition or protein anakinra is administered by inhalation.
  • the pharmaceutical composition as defined above can be advantageously used, by inhalation, in the prevention or treatment of inflammation in a patient with cystic fibrosis.
  • composition according to the present invention administered by inhalation is advantageously capable of performing its anti-inflammatory action, and in particular in a patient with cystic fibrosis, both at the level of the respiratory system and at a systemic level.
  • the present invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising the protein anakinra, as the active ingredient, in combination with one or more pharmaceutically acceptable excipients, said pharmaceutical composition being in a dry powder form suitable for administration by inhalation, wherein said one or more excipients comprise or consist of the amino acid leucine, for example D-leucine, and do not comprise sugars.
  • the present invention further relates to a process for preparing the composition as defined above, said process comprising: a) preparing an aqueous solution of anakinra and one or more pharmaceutically acceptable excipients, wherein said one or more excipients comprise or consist of a sugar selected from among mannitol, sucrose and trehalose, or lactose and an amino acid selected from among leucine, trileucine, lysine, tryptophan, arginine, aspartic acid, threonine, or phenylalanine; b) subjecting the solution to spray drying, wherein the temperature ranges from 120 to 180°C, preferably from 120 to 160°C, even more preferably from 135 to 145°C; the feed rate ranges from 1 to 10 mL/min, preferably from 2 to 8 mL/min, even more preferably from 2 to 4 mL/min; the airflow speed ranges from 200 to 400 L/hour, preferably from 250 to 350 L/hour,
  • the amino acid is leucine and/or trileucine, since these amino acids improve the yield of the process for producing the composition of the invention and the respirability thereof.
  • the leucine can be D-leucine or L-leucine; preferably, the leucine is D-leucine.
  • the leucine can be present in the composition in an amount by weight ranging from 10 to 80%, preferably from 30 to 60%, relative to the total weight of the composition.
  • the trileucine can be present in the composition in an amount by weight ranging from 1 to 10 %, preferably from 4 to 8 %, relative to the total weight of the composition.
  • said one or more excipients can comprise a single sugar selected from among mannitol, trehalose or sucrose, or a mixture of said sugars selected from among mannitol and sucrose, mannitol and trehalose or mannitol, trehalose and sucrose. Therefore, according to the present invention, said one or more sugars can consist of a single sugar selected from among mannitol, trehalose or sucrose or a mixture of said sugars selected from among mannitol and sucrose, mannitol and trehalose or mannitol, trehalose and sucrose.
  • said one or more excipients can comprise the amino acid leucine.
  • said one or more amino acids can consist of the amino acid leucine and/or the amino acid trileucine, preferably the amino acid leucine.
  • said one or more excipients can comprise or consist of one of the following mixtures of said one sugar and said one amino acid: mannitol and leucine, trehalose and leucine, sucrose and leucine or mannitol, trehalose, sucrose and leucine, mannitol and trileucine, trehalose and trileucine, sucrose and trileucine, mannitol, trehalose, sucrose, and trileucine.
  • said one or more excipients can further comprise a lipid selected from among dipalmitoylphosphatidylcholine, distearoylphosphatidylcholine, dimyristoylphosphatidylcholine, cholesterol, magnesium or potassium stearate, or mixtures of said lipids.
  • said one or more excipients can further comprise a hydrophilic polymer selected from among chitosan, polyethylene glycol, polyethylenepolypropylene glycol or mixtures of said hydrophilic polymers.
  • the solution of step a) comprises the protein anakinra at a concentration that can range from 0.25 to 10 mg/mL, preferably from 2 to 5 mg/mL, even more preferably from 3 to 4 mg/mL, and said one or more excipients at a concentration that can range from 5 to 25 mg/mL, preferably from 8 to 20 mg/mL, even more preferably from 10 to 15 mg/mL.
  • concentrations are in milligrams relative to the millilitres of the total aqueous solution of protein and excipients.
  • the present invention also relates to a process for preparing the composition as defined above, said process comprising: a) preparing an aqueous solution of anakinra and one or more pharmaceutically acceptable excipients, wherein said one or more excipients comprise or consist of the amino acid leucine, such as, for example, D-leucine, and do not comprise sugars; b) subjecting the solution to spray drying, wherein the temperature ranges from 120 to 180°C, preferably from 120 to 160°C, even more preferably from 135 to 145°C; the feed rate ranges from 1 to 10 mL/min, preferably from 2 to 8 mL/min, even more preferably from 2 to 4 mL/min; the airflow speed ranges from 200 to 400 L/hour, preferably from 250 to 350 L/hour, even more preferably from 290 to 310 L/hour.
  • the temperature ranges from 120 to 180°C, preferably from 120 to 160°C, even more preferably from 135 to 145°C
  • the present invention relates to a kit for the administration by inhalation of a pharmaceutical composition according to the present invention as defined above, wherein said kit comprises: a) a device for administration by dry powder inhalation; and b) a pharmaceutical composition as defined above.
  • FIG. 1 shows that the dry powder of anakinra shows characteristics suitable for administration by DPI.
  • FIG. 2 shows that the dry powder of anakinra preserves IL-10 inhibitory activity in vitro.
  • THP-1 cells were treated with 10 pg/mL of anakinra IP or PI prior to stimulation with 50 pg/mL of human recombinant IL-10.
  • the cells were collected at 2, 6 and 24 hours after the treatments and evaluated for the expression of hlL-10 by RT-PCR.
  • the graph shows the mean ⁇ S.D. and is representative of one experiment. ****value p ⁇ 0.0001.
  • One-way-ANOVA Bonferroni post hoc test;
  • FIG. 3 shows that individual pulmonary insufflation of anakinra prevents inflammatory lung pathology in CF mice.
  • CFTR F508del mice were infected with live conidia of A. fumigatus and treated with 10 mg/kg of anakinra administered directly into the lungs by insufflation (PI) once three days after the infection and administered intraperitoneally (IP) daily for one week starting from the day of infection.
  • PI insufflation
  • IP intraperitoneally
  • anakinra administered intraperitoneally (Anakinra IP) or via pulmonary insufflation (Anakinra PI) once 3 days after the infection.
  • A Experimental programme.
  • B Fungal growth (Log10 CFU in the lungs);
  • C PAS staining of the lungs and % recruitment of neutrophils in the bronchoalveolar lavage fluid (squares);
  • D genes by RT-PCR in the lungs. The tests were performed 7 days after the infection. The photographs were taken using a high-resolution Olympus DP71 microscope using a 10x objective. Scale bar 400 pm.
  • FIG. 6 shows the aerodynamic evaluation of the batch with the different amino acids listed in Table 4.
  • the test was carried out using a Twin- Stage Glass Impinger (TSGI).
  • TSGI Twin- Stage Glass Impinger
  • the samples were loaded into a size 3 Quali-V® hard capsule made of hydroxypropyl methylcellulose.
  • the DPI used was the RS01 7 model (Aereolizer®).
  • the conditions were fixed following European Pharmacopeia guidelines (apparatus A) (5 s of suction time, at a suction speed of 60 ⁇ 5 L/min).
  • Appatus A 5 s of suction time, at a suction speed of 60 ⁇ 5 L/min.
  • the amount of protein deposited on the capsule, on the inhaler, on the throat and on every stage of the TSGI was evaluated as reported in the methods section.
  • the results were expressed as a mean of three determinations and the error as S.D.
  • the measured parameters are the emitted fraction (ED) and the respirable fractions expressed as a percentage of the nominal dose (RFN) and percentage of the dose emitted (RFE).
  • ED emitted fraction
  • RFE percentage of the dose emitted
  • EXAMPLE 1 Preparation of anakinra in inhalable forma and study of its effectiveness against inflammation in cystic fibrosis
  • the dry powder formulation of anakinra was prepared using a Mini Spray dryer, model B-290 (Buchi, Switzerland) and employing mannitol and D-Leucine as excipients.
  • the solution of anakinra, mannitol and leucine was prepared in water by solubilising first the excipients, namely 80 mg of mannitol and 40 mg of leucine, and then 40 mg of protein, thereby obtaining a total amount of 160 mg of preparation.
  • the spray drying was carried out in the co-current mode, with a spray dryer provided with a 2-fluid nozzle with a 0.7 mm nozzle tip and 1 .5 mm diameter nozzle cap.
  • the spray drying operating parameters are: inlet temperature 140°C, air flow rate 301 L/hour, feed rate 2.4 mL/min and aspirator capacity of 20 m 3 /hour. Briefly, mannitol and leucine were dispersed in water and allowed to solubilise under magnetic stirring before the aqueous solution of anakinra was added; the complete protein solution was immediately processed. The dried powders obtained were recovered using a high-performance cyclone (Buchi, Switzerland).
  • the yield (%w/w) of the spray drying process was determined as follows:
  • the morphology of the particles and the surface characteristics of the dry powders of anakinra were evaluated by scanning electron microscopy (SEM) using an FEG LEO 1525 microscope (LEO Electron Microscopy Inc., NY). The potential tension of acceleration was maintained at 1 keV.
  • the samples were placed on aluminium stubs covered with double-sided carbon tape.
  • the stubs were coated with chromium prior to analysis by means of a high-resolution sputter coater (Quorum Technologies, East Essex, United Kingdom). The coating was applied at 20 mA for 20 s.
  • the particle size analysis was carried out with the Single Particle Optical Sensing technique.
  • a PSS Accusizer C770 equipped with an automatic dilution system PSS, Santa Barbara, CA
  • the measurements were performed in triplicate in the gravity mode using n-hexane as the dispersion medium.
  • the samples were prepared by dispersing an amount of powder in n-hexane and sonicating for several seconds to allow a homogeneous dispersion of the particles in the solvent.
  • the size was expressed as the volume mean diameter (VMD) and the error as S.D.
  • VMD volume mean diameter
  • a dry powder insufflator model DP-4M (Penn-Century Inc., Wyndmoor, PA, USA), was used to aerosolise and administer a precise dose of dry powder to the mouse lungs.
  • the device performance was evaluated to ensure an adequate and reproducible emission of powder.
  • the chamber was filled with 2.5 mg of powder to be delivered with a single puff.
  • the device was actuated by a volume of air of 0.2 mL. After every use, the residual anakinra was recovered from the device, which was then washed with ethanol and dried for 3 minutes.
  • DD delivered dose
  • the aerodynamic behaviour of the dry powders of anakinra was evaluated using a Twin-Stage Glass Impinger (TSGI) (Disa, Milan, Italy). The stages were loaded with 7 mL (stage 1 ) and 30 mL (stage 2) of an aqueous solution. Twenty mg of powder were manually loaded into a size 3 Quali-V® hard capsule made of hydroxypropyl methylcellulose (HPMC) (Qualicaps®, Alcobendas, Spain), which was placed in the capsule compartment of the dry powder inhalation device. The DPI used in this study was model RS01 7 (Plastiape, Lecco, Italy), used commercially for Aereolizer®. The capsule was weighed before and after every activation.
  • TSGI Twin-Stage Glass Impinger
  • EF Emitted fraction of proteins (stages 1 and 2) x Nominal dose > 100 Eq. 4
  • RFN% Amount of protein stage 2 x Nominal dose x 100
  • RFE% Amount of protein stage 2 x Emitted dose x 100
  • the human monocytic cell line THP-1 (ATCC Number: TIB-202) was maintained at 37 ° C in 5% CO2 in RPMI 1640 supplemented with 10% heat- inactivated FBS, L-glutamine, 100 units/mL of penicillin and 0.1 mg/mL of streptomycin.
  • the cells were seeded in a 12-well plate at a density of 5 x 10 5 cells/mL and incubated for 24 hours prior to the treatments.
  • the cells were treated with a final concentration of 10 pg/mL of standard anakinra or formulation 30 minutes before stimulation with 50 pg/mL of human recombinant IL-10 (research and development systems) and collected at different times (2, 6 and 24 hours).
  • the thermal profile for SYBR Green RT-PCR was at 95 °C for 3 min, followed by 40 denaturation cycles for 30 s at 95 °C and a 30 s annealing/extension step at 60 °C.
  • the following human primers were used: GAPDH (forward: CTGCACCACCAACTGCTTAG (SEQ ID NO:1 ), reverse: AGGTCCACCACTGACACGTT (SEQ ID NO:2)); IL-10 (forward: GGACAAGCTGAGGAAGATGC (SEQ ID NO:3), reverse: TCGTTATCCCATGTGTCGAA (SEQ ID NO:4)).
  • mice homozygous for F508del-CFTR which had been crossed for 12 generations with the strain C57BL/6, or in the FVB/129 outbred background (CftrtmlEUR mice, F508del, abbreviated CftrF508del) were obtained from Bob Scholte, Erasmus Medical Center Rotterdam, the Netherlands.
  • the mice were housed in a controlled environment at the animal breeding department of the University of Perugia. For infection, the mice were anaesthetised in a plastic cage by inhalation of 3% isoflurane (Forane, Abbott) in oxygen prior to intranasal instillation of 2 x 10 7 conidia of A.
  • mice were treated with 10 mg/kg of anakinra, as Kineret (Kineret IP) and the standard protein administered intraperitoneally (Anakinra IP), every day for one week starting from the day of infection, or administered into the lung by pulmonary insufflation (Anakinra PI) once 3 days after the infection. Seven days after the infection, the mice were monitored for fungal growth as described (11 ), lung histopathology on sections embedded in paraffin and stained with periodic acid- Schiff (PAS), the recruitment of neutrophils (PMN) in the bronchoalveolar lavage fluid, and the gene expression of inflammatory cytokines by RT-PCR. The images were acquired by means of an Olympus DP71 high-resolution microscope. The experiments on mice were carried out in accordance with authorisation no. 1021/2020-PR issued by the Italian Health Ministry as per Legislative Decree 26/2014.
  • anakinra was administered once at two dosages corresponding to 10 mg/kg and 5 mg/kg (200-100 pg/mouse), intraperitoneally (Anakinra IP) or by insufflation (Anakinra PI), at day 3 after the infection. Seven days after the infection, the mice were monitored as described above. Furthermore, peripheral neutropenia was studied by analysing peripheral blood smears of C57BL/6 mice treated with the different doses of anakinra.
  • RNA extraction and quantitative RT-PCR RNA extraction and quantitative RT-PCR (qRT-PCR).
  • the cDNA synthesis kit (BioRad, Milan, Italy) was used for reverse transcription according to the manufacturer’s protocol.
  • RT-PCR amplification (PCR using the CFX96 TouchTM Real-Time PCR Detection System) was carried out using the SYBR Green QPCR master mix (Agilent Technologies, Milan, Italy) under the following conditions: 45 cycles at 95°C for 1 min, appropriate annealing temperature for 1 min and 72°C for 30 s. All the reactions were repeated independently at least three times to guarantee the reproducibility of the results. Statistical analysis.
  • the dry powders of anakinra obtained showed a typical collapsed, irregular shape with a rough surface (Fig. 1 ). These characteristics support a potential respirability for the particles.
  • the size distribution also showed to be compatible with a potential respirability, with a DMV slightly greater than 10 pm and a homogeneous population (Fig. 1 , Table 1 ).
  • the dry powder ofanakinra preserves activity in vitro.
  • the insufflated dry powder ofanakinra protects against lung pathology in mouse cystic fibrosis.
  • the therapeutic effectiveness of the formulations was evaluated in relation to Kineret and standard anakinra administered IP daily for 7 days.
  • CF mice were infected with A. fumigatus and a single dose of the dry powder of anakinra was insufflated 3 days after the infection.
  • the single pulmonary insufflation reduced the growth and spread of the infection in a generally more efficient manner than the systemic daily administration of Kineret and the standard protein.
  • PMN recruitment was equal to or less than in the case of IP administration and the lung histopathology improved, as also confirmed by a significant reduction in the expression of inflammatory cytokines and chemokines.
  • the insufflated dry powder of anakinra allows for a reduction in the dose and prevention of peripheral neutropenia.
  • the therapeutic effectiveness of the formulations was evaluated in comparison with IP administration of the standard.
  • CF mice were infected with A. fumigatus and insufflated with the dry powder of anakinra or received anakinra IP 3 days after the infection.
  • the single pulmonary insufflation reduced fungal growth and dissemination more efficiently than the single IP administration.
  • PMN recruitment and the expression of inflammatory cytokines and chemokines were significantly reduced and the lung histopathology improved.
  • the results show that local administration of anakinra apparently improved its therapeutic effectiveness when evaluated comparatively with IP administration, at the same dose.
  • the insufflated dose is halved, one obtains the same effectiveness as with the systemic dose. This suggests a possible significant reduction of the dosage by exploiting the pulmonary route.
  • EXAMPLE 2 Comparative evaluation of respirability and preparation of dry powders of the protein anakinra comprising the amino acids of the present invention versus dry powders of the protein anakinra comprising the amino acids described in the prior art (W02021/113334 A1).
  • compositions of anakinra that can comprise amino acids selected from among proline, hydroxyproline, glycine and histidine.
  • formulations comprising the aforesaid amino acids were compared with formulations according to the present invention comprising D- leucine, trileucine, arginine, threonine, tryptophan, lysine, and aspartic acid; the yield of the preparation process and respirability were evaluated under identical conditions.
  • Table 3 shows the batches prepared using the selected amino acids.
  • Table 3 shows the composition of the mannitol-amino acid-protein formulations.
  • the amino acids were used in percentages of 40% and 5% (w/w), the protein anakinra was used in a percentage of 20% (w/w) and mannitol was used in percentages of 40% (w/w) in the compositions with 40% amino acid and 75% (w/w) in the compositions with 5% amino acid.
  • Table 4 shows the results obtained with respect to the preparation process compared to the formulation with D-leucine, trileucine and mannitol alone. Only the batches obtained at a 5% w/w content of amino acids are shown, since at the same percentage used with D-leucine (40% w/w), all the amino acids produced yields that were too low, with an impossibility of recovering the formulation in acceptable amounts after spray drying. In particular, unlike the other amino acids, which showed yields between 15 and 25%, at percentages between 10 and 20%, the amino acids mentioned in prior art D1 produced insufficient or zero yields if used at percentages above 5%.
  • Table 4 shows the process yield and protein content for the formulations obtained at 5% w/w of the amino acids tested.
  • Anakinra Activates Superoxide Dismutase 2 to Mitigate Inflammasome Activity.
  • O'Dell J.R. Anti-cytokine therapy - a new era in the treatment of rheumatoids arthritis? N Engl J Med, 1999. 340: p. 310-1. Chamberlain, C. S. et al. Interleukin expression after injury and the effects of interleukin-1 receptor antagonist. PLoS ONE 8, e71631 (2013).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • General Health & Medical Sciences (AREA)
  • Epidemiology (AREA)
  • Pulmonology (AREA)
  • Otolaryngology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates to an inhalable pharmaceutical composition comprising the protein anakinra for the treatment of inflammation in cystic fibrosis, and which is capable of preserving the stability of the active ingredient and providing an effective dose thereof by inhalation.

Description

Inhalable pharmaceutical composition comprising the protein anakinra for the treatment of inflammation in cystic fibrosis
The present invention relates to an inhalable pharmaceutical composition comprising the protein anakinra for the treatment of inflammation in cystic fibrosis.
In greater detail, the invention relates to an inhalable pharmaceutical composition comprising the protein anakinra for the treatment of inflammation in cystic fibrosis, and which is capable of preserving the stability of the active ingredient and providing an effective dose thereof through the inhalation route.
Cystic fibrosis (CF) is an autosomal recessive pathology that affects multiple organs, including the respiratory, gastrointestinal, and genital tracts (1 ), and is more common in the Caucasian population, with a frequency of about 1 out of 2500. It is caused by mutations in the gene encoding for the transmembrane conductance regulator (CFTR) and more than 2000 variants have been identified. The most frequent mutation is the deletion of the phenylalanine residue at position 508, which causes the misfolding and degradation of CFTR before the protein can reach the plasma membrane for its functional activity. CFTR is a chloride/bicarbonate channel that regulates the ion equilibrium of surface fluid. It has been demonstrated that cells which express the most common CFTR mutant variant are defective in autophagy and accumulate polyubiquitinated proteins and similar structures (2).
In the airways, a defective CFTR activity leads to the dehydration of surface fluid and excessive production of mucus, with two important pathological consequences. First, the altered surface fluid and mucus create areas of hypoxia that cause the death of airway epithelial cells due to necrosis. The consequent release of molecular patterns associated with the damage gives rise to the recruitment of neutrophils and onset of an inflammatory response. Second, the removal of microorganisms by mucociliary clearance is compromised, thus favouring microbial colonisation and infection, which further exacerbate the inflammatory state. A failure to resolve the inflammatory response leads, finally, to chronic inflammation, with the accumulation of neutrophils in the airways, tissue damage and the start of fibrotic processes. The clinical situation eventually evolves towards respiratory failure, which represents the primary cause of morbidity and mortality in CF patients (3). Therefore, the genetic defect of CFTR associated with defective autophagy (4, 5), which contribute to recurrent infections and a chronic inflammatory state, represent the concomitant factors in the deterioration of pulmonary function in CF patients.
The therapeutic approach has recently seen an important stride forward with the development of small molecules capable of correcting the basic defect of CFTR (correctors) and potentiating its channel activity (potentiators). TRIKAFTA, a combination of two correctors (tezacaftor and elexacaftor) and a potentiator (ivacaftor) has received FDA approval for the treatment of the most common mutation, Phe508del. Notwithstanding the significant impact of these molecules in the treatment of CF patients, at least in the case of Phe508del carriers, it is not clear whether an improvement in the inflammatory response and autophagy also falls within their range of action. Therefore, inflammation appears as an independent factor of morbidity and the search for anti-inflammatory drugs remains an interesting area of research in the field of CF.
Although the development of new anti-inflammatory drugs is flourishing, to date only a few of them have been approved or are being studied in CF patients. One of these molecules is the non-steroidal anti-inflammatory drug ibuprofen, which is capable of slowing the progression of lung disease at high doses, especially in children (6). Other drugs include Acebilustat, Lenabasum and Fenretinide, which target lipid mediators (1 , 7, 8).
Whilst the use of anti-inflammatory drugs is certainly a valid therapeutic strategy in CF, the method of administering them must be carefully assessed in order to optimise their effectiveness/safety profile. In fact, anti-inflammatory drugs should lower the basal level of the inflammation that is harmful for tissues without compromising the mechanisms of defence against pathogens. In this regard, exploiting endogenous anti-inflammatory pathways could represent an interesting strategy for restoring a homeostatic regulation of inflammation.
Furthermore, concomitant strategies aimed at restoring autophagy can be valid therapeutic approaches in CF (2, 9). In this context, it has recently been demonstrated that replacement therapy with anakinra is capable of restoring defective autophagy and limiting the activation of NLRP3-dependent inflammation in chronic granulomatous disease (10) and in CF (11 ).
Anakinra (Kineret®) is a drug placed on the market in 2001 for the treatment of rheumatoid arthritis and, more recently, of cryopyrin-associated periodic syndromes as well as systemic-onset juvenile idiopathic arthritis (12-14). It is presented in the form of pre-filled syringes for subcutaneous injection at a single dose of 100 mg/0.67 mL/day.
Anakinra is a recombinant, non-glycosylated form of the endogenous IL-1 receptor antagonist (IL-1 Ra), from which it differs because of the presence of an extra methionine at the amino terminus. Anakinra exerts its effects by inhibiting the binding of IL-1 (3 to IL-1 R1 (12). In addition to a secreted protein, three non-secreted intracellular isoforms of IL-1 Ra have been described in humans and in mouse tissues (15). Whilst it is known that extracellular IL-1 Ra inhibits the activity of IL-1 by binding to IL-1 Rl, it has been observed that intracellular IL-1 Ra1 also has antiinflammatory properties (16). These characteristics - together with the fact that anakinra has shown superior action compared to the neutralising IL-1 (3 antibody against infection and mouse lung pathology (11 ), a cellular absorption of exogenous anakinra has been observed (17) and IL-IRa bound to the surface does not undergo receptor-mediated internalisation (18) - suggest that anakinra may exert receptorindependent intracellular activities. In this regard, the inventors of the present invention have recently identified two new potential mechanisms of anakinra tied to induction of the enzyme SOD2 and autophagy activation (19, 20).
Administered subcutaneously, anakinra is highly bioavailable (95%) and reaches maximum plasma levels in 3-7 hours (21 ). Less than 10% of the drug is eliminated unmodified through urine, with a terminal half-life of 6-8 hours (22). The site of metabolism and levels of anakinra in organs are unknown. The clearance of anakinra is reduced by 70-75% in patients with severe kidney failure.
However, the present subcutaneous injection of anakinra once a day is not conceivable for managing chronic therapies, as in the case of CF. Low compliance, tied also to the invasiveness of the administration, which produces pain and local swelling, problems of self-medication and unfavourable pharmacokinetic characteristics limit the application of this regime to CF. Furthermore, in the long run, side effects such as peripheral neutropenia, often associated with the administration of Kineret®, can increase the risks of comorbidity, especially in patients who are particularly compromised.
Though an administration of the protein anakinra by inhalation has been suggested, to date there are no known pharmaceutical compositions suited to this purpose, for example with adequate stability and efficacy.
For example, the prior art document WO2021/113334 A1 describes the use of a liquid pharmaceutical composition comprising anakinra and excipients comprising a sugar selected from among lactose, mannitol, sucrose and sorbitol and amino acids such as histidine, proline, hydroxyproline and glycine. In particular, document D1 describes an anakinra-based liquid composition for aerosol comprising a filler such as, for example, mannitol, and a tonicity modifier such as, for example, hydroxyproline, proline or combinations thereof (D1 , para. 211 ). Furthermore, in document D1 it is stated that the composition can contain a buffer, such as, for example, histidine (D1 , par. 200), and further amino acids such as glycine (D1 , para. 261 ). In the examples, document D1 describes liquid anakinra compositions and suggests making powder formulations of anakinra.
In the light of the foregoing, it appears evident that there is a need to have new formulations and therapies for cystic fibrosis, or rather, for the inflammation in cystic fibrosis, which are capable of overcoming the disadvantages of the known formulations and therapies.
The solution according to the present invention fits into this context; it aims to provide a therapy that is effective against inflammation in cystic fibrosis, assures high compliance and has fewer side effects compared to the known therapies.
According to the present invention, it has now been found that anakinra can be advantageously administered by inhalation in a suitable pharmaceutical form so that the active ingredient is effective in the treatment of pathological inflammation in patients with CF. In particular, according to the present invention, a pharmaceutical composition comprising anakinra in dry powder form for inhalational use has been developed for the treatment of pathological inflammation in patients with CF. It has in fact been surprisingly found that by using particular excipients and process conditions with the spray drying technique it is possible to obtain a pharmaceutical composition in dry powder form, suitable for administration by inhalation, which comprises an amount of the protein anakinra that is effective for this route of administration and wherein, at the same time, the stability of the protein itself is preserved. According to the present invention, a spray drying process suitable for obtaining the advantageous properties of the composition according to the present invention has also been developed.
The choice of excipients and of the preparation process conditions is capable of ensuring the stability of the protein both in the processing phase and during storage. The preparation according to the present invention is intended to overcome the limitations of the present subcutaneous administration by enabling direct administration to the lungs. A reduction of the dosage and of systemic side effects and a considerable increase in compliance are the greatest advantages of the preparation according to the present invention, also by virtue of the elimination of the discomfort associated with the conventional method of administration.
As shown from the in vitro and in vivo experimental results described further below, the composition of the present invention is not only effective by inhalation against the inflammatory lung pathology in CF, but also provides greater effectiveness compared to administration by injection, the dose being equal. Therefore, the composition according to the present invention makes it possible to decrease the dose of the active ingredient and consequently any side effects of the active ingredient itself, besides enabling a decrease in the costs of the preparation.
It is therefore a specific object of the present invention a pharmaceutical composition comprising the protein anakinra, as the active ingredient, in combination with one or more pharmaceutically acceptable excipients, said pharmaceutical composition being in a dry powder form suitable for administration by inhalation, wherein said one or more excipients comprise or consist of one or more sugars selected from among mannitol, sucrose, trehalose, or lactose and one or more amino acids selected from among leucine, trileucine, lysine, tryptophan, arginine, aspartic acid, threonine, or phenylalanine. Preferably, the amino acid is leucine and/or trileucine, since these amino acids improve the yield of the process for producing the composition of the invention and the respirability thereof. The leucine can be D-leucine or L-leucine, preferably the leucine is D- leucine.
According to the present invention the leucine can be present in the composition in an amount by weight ranging from 10 to 80%, preferably from 30 to 60%, relative to the total weight of the composition.
Furthermore, according to the present invention the trileucine can be present in the composition in an amount by weight ranging from 1 to 10%, preferably from 4 to 8%, relative to the total weight of the composition.
The term “one or more excipients comprise” means that the excipients, and hence the composition of the invention, can also comprise other types of excipients besides said sugar or said amino acid.
The term “one or more excipients consist of” means that the excipients, and hence the composition of the invention, do not comprise other types of excipients besides said one or more sugars and said one or more amino acids.
According to some embodiments of the composition of the present invention, said one or more excipients can comprise a single sugar selected from among mannitol, trehalose, or sucrose, or a mixture of said sugars selected from among mannitol and sucrose, mannitol and trehalose or mannitol, trehalose, and sucrose. In these embodiments, when the term “comprise” is considered, it means that the excipients of the pharmaceutical composition comprise, among the sugars, only the non-reducing ones listed above or mixtures thereof, but they could comprise other types of excipients. Again according to the embodiments just described, when the term “consist of” or “consists of” is considered, it means that the excipients of the composition consist of the sugars listed above and the mixtures thereof and, besides comprising said one or more amino acids, they do not comprise other types of excipients.
Therefore, according to the present invention, said one or more sugars can consist of a single sugar selected from among mannitol, trehalose, or sucrose or a mixture of said sugars selected from among mannitol and sucrose, mannitol and trehalose or mannitol, trehalose, and sucrose.
According to a further embodiment of the composition of the present invention, said one or more excipients can comprise the amino acid leucine. Therefore, according to this embodiment, when the term “comprise” is considered, it means that the excipients of the pharmaceutical composition comprise, among the amino acids, only leucine, but they could comprise, in addition to sugar, other types of excipients. Again in this embodiment, when the term “consist of” or “consists of” is considered, it means that the excipients of the composition consist of the amino acid leucine and one or more sugars among those listed above, whereas they do not comprise other types of excipients.
Therefore, according to the present invention, said one or more amino acids can consist of the amino acid leucine and/or the amino acid trileucine, preferably the amino acid leucine.
According to further embodiments of the composition of the present invention, said one or more excipients can comprise or consist of one of the following mixtures of said one or more sugars and said one or more amino acids: mannitol and leucine, trehalose and leucine, sucrose and leucine or mannitol, trehalose, sucrose, and leucine, mannitol and trileucine, trehalose and trileucine, sucrose, and trileucine, mannitol, trehalose, sucrose and trileucine. In these embodiments, when the term “comprise” is considered, it means that the excipients of the pharmaceutical composition comprise the sugars specifically mentioned, and no other sugars, in combination with the amino acid leucine or the amino acid trileucine, and not in combination with another of the amino acids of the invention; however, the excipients could comprise other types of excipients. Again in these embodiments, when the term “consist of” or “consists of” is considered, it means that the excipients of the composition consist of the above-mentioned mixtures of specific sugars with the amino acid leucine or trileucine and do not comprise other types of excipients.
According to the present invention, said one or more excipients can further comprise a lipid selected from among dipalmitoylphosphatidylcholine, distearoylphosphatidylcholine, dimyristoylphosphatidylcholine, cholesterol, magnesium or potassium stearate, or mixtures of said lipids. Alternatively or in addition to the lipid, said one or more excipients can further comprise a hydrophilic polymer selected from among chitosan, polyethylene glycol, polyethylenepolypropylene glycol, or mixtures of said hydrophilic polymers.
According to the present invention, the protein anakinra is present in the pharmaceutical composition in an amount that can range from 1 % to 40% by weight relative to the weight of the pharmaceutical composition, preferably from 10% to 30%, even more preferably from 15% to 25%.
The dry powder of the composition according to the present invention is characterised by particles with an average volume size that can range from 1 to 40 microns, preferably from 5 to 20 microns, even more preferably from 8 to 15 microns.
The pharmaceutical composition according to the present invention can be obtained by means of the spray drying technique in order to obtain the best characteristics suitable for administration by inhalation.
The present invention further relates to a pharmaceutical composition as defined above for use in the prevention or treatment of inflammation, wherein said pharmaceutical composition or protein anakinra is administered by inhalation.
In particular, the pharmaceutical composition as defined above can be advantageously used, by inhalation, in the prevention or treatment of inflammation in a patient with cystic fibrosis.
The composition according to the present invention administered by inhalation is advantageously capable of performing its anti-inflammatory action, and in particular in a patient with cystic fibrosis, both at the level of the respiratory system and at a systemic level.
According to one aspect, the present invention also relates to a pharmaceutical composition comprising the protein anakinra, as the active ingredient, in combination with one or more pharmaceutically acceptable excipients, said pharmaceutical composition being in a dry powder form suitable for administration by inhalation, wherein said one or more excipients comprise or consist of the amino acid leucine, for example D-leucine, and do not comprise sugars.
The present invention further relates to a process for preparing the composition as defined above, said process comprising: a) preparing an aqueous solution of anakinra and one or more pharmaceutically acceptable excipients, wherein said one or more excipients comprise or consist of a sugar selected from among mannitol, sucrose and trehalose, or lactose and an amino acid selected from among leucine, trileucine, lysine, tryptophan, arginine, aspartic acid, threonine, or phenylalanine; b) subjecting the solution to spray drying, wherein the temperature ranges from 120 to 180°C, preferably from 120 to 160°C, even more preferably from 135 to 145°C; the feed rate ranges from 1 to 10 mL/min, preferably from 2 to 8 mL/min, even more preferably from 2 to 4 mL/min; the airflow speed ranges from 200 to 400 L/hour, preferably from 250 to 350 L/hour, even more preferably from 290 to 310 L/hour.
Preferably, the amino acid is leucine and/or trileucine, since these amino acids improve the yield of the process for producing the composition of the invention and the respirability thereof. The leucine can be D-leucine or L-leucine; preferably, the leucine is D-leucine.
According to the invention, the leucine can be present in the composition in an amount by weight ranging from 10 to 80%, preferably from 30 to 60%, relative to the total weight of the composition.
Furthermore, according to the invention, the trileucine can be present in the composition in an amount by weight ranging from 1 to 10 %, preferably from 4 to 8 %, relative to the total weight of the composition.
According to the process of the present invention, said one or more excipients can comprise a single sugar selected from among mannitol, trehalose or sucrose, or a mixture of said sugars selected from among mannitol and sucrose, mannitol and trehalose or mannitol, trehalose and sucrose. Therefore, according to the present invention, said one or more sugars can consist of a single sugar selected from among mannitol, trehalose or sucrose or a mixture of said sugars selected from among mannitol and sucrose, mannitol and trehalose or mannitol, trehalose and sucrose.
According to a further embodiment of the process of the invention, said one or more excipients can comprise the amino acid leucine. In particular, according to the present invention, said one or more amino acids can consist of the amino acid leucine and/or the amino acid trileucine, preferably the amino acid leucine.
According to further embodiments of the process of the present invention, said one or more excipients can comprise or consist of one of the following mixtures of said one sugar and said one amino acid: mannitol and leucine, trehalose and leucine, sucrose and leucine or mannitol, trehalose, sucrose and leucine, mannitol and trileucine, trehalose and trileucine, sucrose and trileucine, mannitol, trehalose, sucrose, and trileucine.
According to the process of the present invention, said one or more excipients can further comprise a lipid selected from among dipalmitoylphosphatidylcholine, distearoylphosphatidylcholine, dimyristoylphosphatidylcholine, cholesterol, magnesium or potassium stearate, or mixtures of said lipids. Alternatively or in addition to the lipid, said one or more excipients can further comprise a hydrophilic polymer selected from among chitosan, polyethylene glycol, polyethylenepolypropylene glycol or mixtures of said hydrophilic polymers.
According to the process of the present invention, the solution of step a) comprises the protein anakinra at a concentration that can range from 0.25 to 10 mg/mL, preferably from 2 to 5 mg/mL, even more preferably from 3 to 4 mg/mL, and said one or more excipients at a concentration that can range from 5 to 25 mg/mL, preferably from 8 to 20 mg/mL, even more preferably from 10 to 15 mg/mL. The concentrations are in milligrams relative to the millilitres of the total aqueous solution of protein and excipients. According to one aspect, the present invention also relates to a process for preparing the composition as defined above, said process comprising: a) preparing an aqueous solution of anakinra and one or more pharmaceutically acceptable excipients, wherein said one or more excipients comprise or consist of the amino acid leucine, such as, for example, D-leucine, and do not comprise sugars; b) subjecting the solution to spray drying, wherein the temperature ranges from 120 to 180°C, preferably from 120 to 160°C, even more preferably from 135 to 145°C; the feed rate ranges from 1 to 10 mL/min, preferably from 2 to 8 mL/min, even more preferably from 2 to 4 mL/min; the airflow speed ranges from 200 to 400 L/hour, preferably from 250 to 350 L/hour, even more preferably from 290 to 310 L/hour.
A further object of the present invention is a pharmaceutical composition comprising the protein anakinra, as the active ingredient, in combination with one or more pharmaceutically acceptable excipients and/or adjuvants, said pharmaceutical composition being in a dry powder form suitable for administration by inhalation, wherein said pharmaceutical composition is obtainable by means of the process as defined above. The pharmaceutical composition according to the present invention advantageously enables the stabilisation of the protein in dry powder form, also allowing it to be stored at room temperature. Furthermore, the composition according to the present invention advantageously allows for easier administration using a dry powder inhaler. The pharmaceutical composition and method of administration improve the effectiveness and safety of the treatment with anakinra compared to systemic administration.
Furthermore, the present invention relates to a kit for the administration by inhalation of a pharmaceutical composition according to the present invention as defined above, wherein said kit comprises: a) a device for administration by dry powder inhalation; and b) a pharmaceutical composition as defined above.
The present invention will now be described by way of non-limiting illustration according to a preferred embodiment thereof, with particular reference to some illustrative examples and the figures in the appended drawings, wherein:
- figure 1 shows that the dry powder of anakinra shows characteristics suitable for administration by DPI. Above) Size distributions of dry powders of anakinra, 20% and 30% w/w loading; below) Microphotographs of particles 1 :1 mannitol-D-leucine loaded with 20% w/w of anakinra;
- figure 2 shows that the dry powder of anakinra preserves IL-10 inhibitory activity in vitro. THP-1 cells were treated with 10 pg/mL of anakinra IP or PI prior to stimulation with 50 pg/mL of human recombinant IL-10. The cells were collected at 2, 6 and 24 hours after the treatments and evaluated for the expression of hlL-10 by RT-PCR. The graph shows the mean ± S.D. and is representative of one experiment. ****value p < 0.0001. One-way-ANOVA, Bonferroni post hoc test;
- figure 3 shows that individual pulmonary insufflation of anakinra prevents inflammatory lung pathology in CF mice. CFTR F508del mice were infected with live conidia of A. fumigatus and treated with 10 mg/kg of anakinra administered directly into the lungs by insufflation (PI) once three days after the infection and administered intraperitoneally (IP) daily for one week starting from the day of infection. A) Treatment diagram; B) fungal growth (Log CFU in the lungs); C) PAS staining of lungs and recruitment of neutrophils (%) in the bronchoalveolar lavage fluid (see inserts); D) expression of cytokine genes by RT-PCR. The tests were performed 7 days after the infection. Naive: uninfected mice; None: infected mice. *, P<0.05; **, P<0.01 ; ***, P<0.001 ; ****, P<0.0001 PI vs None; figure 4 shows that the single injection of insufflated anakinra allows a reduction in the dose and greater effectiveness compared to the single IP administration. CFtr F508del/F508del mice were infected with live conidia of A. fumigatus and treated with two doses (200-100 pg/mouse, corresponding to 5 and 10 mg/kg) of anakinra administered intraperitoneally (Anakinra IP) or via pulmonary insufflation (Anakinra PI) once 3 days after the infection. (A) Experimental programme. (B) Fungal growth (Log10 CFU in the lungs); (C) PAS staining of the lungs and % recruitment of neutrophils in the bronchoalveolar lavage fluid (squares); (D) genes by RT-PCR in the lungs. The tests were performed 7 days after the infection. The photographs were taken using a high-resolution Olympus DP71 microscope using a 10x objective. Scale bar 400 pm. The values represent the mean ± SD of 3 mice per group or are representative of three experiments. Naive, non-infected mice. No treatment, infected mice. *, P<0.05; **, P<0.01 ; ***, P<0.001 , one-way ANOVA - Bonferroni, Anakinra IP and Anakinra PI vs No treatment; figure 5 shows that a single pulmonary administration of anakinra prevents peripheral neutropenia. Peripheral blood smears of C57BL/6 mice treated with two doses (200-100 pg/mouse) of Anakinra administered once intraperitoneally (Anakinra IP) or administered in the lungs by insufflation (Anakinra PI). The numbers refer to the % of polymorphonuclear neutrophils (PMN) at 1 and 3 days after administration. Original magnification, *100; and
- figure 6 shows the aerodynamic evaluation of the batch with the different amino acids listed in Table 4. The test was carried out using a Twin- Stage Glass Impinger (TSGI). The samples were loaded into a size 3 Quali-V® hard capsule made of hydroxypropyl methylcellulose. The DPI used was the RS01 7 model (Aereolizer®). The conditions were fixed following European Pharmacopeia guidelines (apparatus A) (5 s of suction time, at a suction speed of 60 ± 5 L/min). The amount of protein deposited on the capsule, on the inhaler, on the throat and on every stage of the TSGI was evaluated as reported in the methods section. The results were expressed as a mean of three determinations and the error as S.D. The measured parameters are the emitted fraction (ED) and the respirable fractions expressed as a percentage of the nominal dose (RFN) and percentage of the dose emitted (RFE). The amino acids reported in the prior art document WO2021/113334 A1 are shown in the square.
EXAMPLE 1 : Preparation of anakinra in inhalable forma and study of its effectiveness against inflammation in cystic fibrosis
Materials and methods
Spray drying formulation of a dry powder of anakinra
The dry powder formulation of anakinra was prepared using a Mini Spray dryer, model B-290 (Buchi, Switzerland) and employing mannitol and D-Leucine as excipients. The solution of anakinra, mannitol and leucine was prepared in water by solubilising first the excipients, namely 80 mg of mannitol and 40 mg of leucine, and then 40 mg of protein, thereby obtaining a total amount of 160 mg of preparation. The spray drying was carried out in the co-current mode, with a spray dryer provided with a 2-fluid nozzle with a 0.7 mm nozzle tip and 1 .5 mm diameter nozzle cap. The spray drying operating parameters are: inlet temperature 140°C, air flow rate 301 L/hour, feed rate 2.4 mL/min and aspirator capacity of 20 m3/hour. Briefly, mannitol and leucine were dispersed in water and allowed to solubilise under magnetic stirring before the aqueous solution of anakinra was added; the complete protein solution was immediately processed. The dried powders obtained were recovered using a high-performance cyclone (Buchi, Switzerland).
Quantification ofanakinra and process yield.
The amount of anakinra in the formulations obtained was determined by UV- Vis spectrophotometry using an Agilent 8453 spectrophotometer (Agilent, Germany). The analysis was performed at Amax = 280 nm after calibration in the range of 160-800 pg/mL in aqueous solution (r2 = 0.998). The measurements were performed in triplicate and the error was expressed as standard deviation (S.D.). A weighed amount of powder was dissolved in water and the solutions obtained, after appropriate dilution in water, were subjected to UV-Vis analysis. The protein content (DC) was calculated using the following equation:
% DC- Anakinra (mg)/powder (mg) x 100 Eq. 1
The yield (%w/w) of the spray drying process was determined as follows:
Yield (%w/w) = Powder obtained (mg)/Excipients (mg)+ Anakinra (mg) x
100 Eq. 2
Morphology and particle size.
The morphology of the particles and the surface characteristics of the dry powders of anakinra were evaluated by scanning electron microscopy (SEM) using an FEG LEO 1525 microscope (LEO Electron Microscopy Inc., NY). The potential tension of acceleration was maintained at 1 keV. The samples were placed on aluminium stubs covered with double-sided carbon tape. The stubs were coated with chromium prior to analysis by means of a high-resolution sputter coater (Quorum Technologies, East Essex, United Kingdom). The coating was applied at 20 mA for 20 s.
The particle size analysis was carried out with the Single Particle Optical Sensing technique. In order to measure the particle size distributions, a PSS Accusizer C770 equipped with an automatic dilution system (PSS, Santa Barbara, CA) was used. The measurements were performed in triplicate in the gravity mode using n-hexane as the dispersion medium. The samples were prepared by dispersing an amount of powder in n-hexane and sonicating for several seconds to allow a homogeneous dispersion of the particles in the solvent. The size was expressed as the volume mean diameter (VMD) and the error as S.D.
Insufflation conditions. A dry powder insufflator, model DP-4M (Penn-Century Inc., Wyndmoor, PA, USA), was used to aerosolise and administer a precise dose of dry powder to the mouse lungs. The device performance was evaluated to ensure an adequate and reproducible emission of powder. The chamber was filled with 2.5 mg of powder to be delivered with a single puff. The device was actuated by a volume of air of 0.2 mL. After every use, the residual anakinra was recovered from the device, which was then washed with ethanol and dried for 3 minutes.
Determination of the dose delivered for in vivo experiments.
For every administration, the insufflator, the tip and the PTFE tube were cleaned with ethanol and the solution was collected and analysed by spectrophotometry. The delivered dose (DD) was calculated using the following equation:
DD=Anakinra in the device chamber - Anakinra in the washing solution
Eq. 3
Aerodynamic evaluation in vitro.
The aerodynamic behaviour of the dry powders of anakinra was evaluated using a Twin-Stage Glass Impinger (TSGI) (Disa, Milan, Italy). The stages were loaded with 7 mL (stage 1 ) and 30 mL (stage 2) of an aqueous solution. Twenty mg of powder were manually loaded into a size 3 Quali-V® hard capsule made of hydroxypropyl methylcellulose (HPMC) (Qualicaps®, Alcobendas, Spain), which was placed in the capsule compartment of the dry powder inhalation device. The DPI used in this study was model RS01 7 (Plastiape, Lecco, Italy), used commercially for Aereolizer®. The capsule was weighed before and after every activation. The conditions were fixed according to European Pharmacopeia guidelines (apparatus A) (5 s of suction time, at a suction speed of 60 ± 5 L/min) and the flow was controlled prior to analysis with a calibrated flowmeter (Platon NG, France). The amount of protein deposited on the capsule, on the inhaler, on the throat and on every stage of the TSGI was recovered by washing with appropriate volumes of water. The samples were analysed by UV-Vis spectrophotometry.
The results have been reported as the mean of three determinations and the error expressed as S.D.
The emitted fraction (EF) and the respirable fractions, expressed as a percentage of the nominal dose (RFN) and percentage of the dose emitted (RFE), were calculated using the following equations: EF% = Emitted dose of proteins (stages 1 and 2) x Nominal dose > 100 Eq. 4
RFN% = Amount of protein stage 2 x Nominal dose x 100
Eq. 5
RFE% = Amount of protein stage 2 x Emitted dose x 100
Eq. 6
Activity in vitro
Cells and treatments.
The human monocytic cell line THP-1 (ATCC Number: TIB-202) was maintained at 37 ° C in 5% CO2 in RPMI 1640 supplemented with 10% heat- inactivated FBS, L-glutamine, 100 units/mL of penicillin and 0.1 mg/mL of streptomycin. The cells were seeded in a 12-well plate at a density of 5 x 105 cells/mL and incubated for 24 hours prior to the treatments. The cells were treated with a final concentration of 10 pg/mL of standard anakinra or formulation 30 minutes before stimulation with 50 pg/mL of human recombinant IL-10 (research and development systems) and collected at different times (2, 6 and 24 hours).
Real-Time PCR.
RT-PCR analysis was carried out using the CFX96 Touch Real-Time PCR detection system and an iTaq Universal SYBR Green Supermix (Bio-Rad). The cells were lysed, the total RNA was isolated with TRIZOL Reagent (Thermo Fisher Scientific) and cDNAs were synthesised using a PrimeScript RT Reagent Kit with gDNA Eraser (Takara), according to the manufacturer’s instructions. The amplification efficiencies were validated and normalised to GAPDH. Each data point was examined to verify its integrity by analysing the amplification graph. The thermal profile for SYBR Green RT-PCR was at 95 °C for 3 min, followed by 40 denaturation cycles for 30 s at 95 °C and a 30 s annealing/extension step at 60 °C. The following human primers were used: GAPDH (forward: CTGCACCACCAACTGCTTAG (SEQ ID NO:1 ), reverse: AGGTCCACCACTGACACGTT (SEQ ID NO:2)); IL-10 (forward: GGACAAGCTGAGGAAGATGC (SEQ ID NO:3), reverse: TCGTTATCCCATGTGTCGAA (SEQ ID NO:4)).
Effectiveness in vivo
Animals, infection and treatment.
CF mice homozygous for F508del-CFTR which had been crossed for 12 generations with the strain C57BL/6, or in the FVB/129 outbred background (CftrtmlEUR mice, F508del, abbreviated CftrF508del) were obtained from Bob Scholte, Erasmus Medical Center Rotterdam, the Netherlands. The mice were housed in a controlled environment at the animal breeding department of the University of Perugia. For infection, the mice were anaesthetised in a plastic cage by inhalation of 3% isoflurane (Forane, Abbott) in oxygen prior to intranasal instillation of 2 x 107 conidia of A. fumigates (Af293) per 20 pL of saline solution. The mice were treated with 10 mg/kg of anakinra, as Kineret (Kineret IP) and the standard protein administered intraperitoneally (Anakinra IP), every day for one week starting from the day of infection, or administered into the lung by pulmonary insufflation (Anakinra PI) once 3 days after the infection. Seven days after the infection, the mice were monitored for fungal growth as described (11 ), lung histopathology on sections embedded in paraffin and stained with periodic acid- Schiff (PAS), the recruitment of neutrophils (PMN) in the bronchoalveolar lavage fluid, and the gene expression of inflammatory cytokines by RT-PCR. The images were acquired by means of an Olympus DP71 high-resolution microscope. The experiments on mice were carried out in accordance with authorisation no. 1021/2020-PR issued by the Italian Health Ministry as per Legislative Decree 26/2014.
In a second study, anakinra was administered once at two dosages corresponding to 10 mg/kg and 5 mg/kg (200-100 pg/mouse), intraperitoneally (Anakinra IP) or by insufflation (Anakinra PI), at day 3 after the infection. Seven days after the infection, the mice were monitored as described above. Furthermore, peripheral neutropenia was studied by analysing peripheral blood smears of C57BL/6 mice treated with the different doses of anakinra.
RNA extraction and quantitative RT-PCR (qRT-PCR).
Total RNA was extracted from the lungs with the TRIzol method (Invitrogen, Milan, Italy) according to the manufacturer’s protocol. The cDNA synthesis kit (BioRad, Milan, Italy) was used for reverse transcription according to the manufacturer’s protocol. RT-PCR amplification (PCR using the CFX96 Touch™ Real-Time PCR Detection System) was carried out using the SYBR Green QPCR master mix (Agilent Technologies, Milan, Italy) under the following conditions: 45 cycles at 95°C for 1 min, appropriate annealing temperature for 1 min and 72°C for 30 s. All the reactions were repeated independently at least three times to guarantee the reproducibility of the results. Statistical analysis.
In order to determine statistical significance, Student’s t-test and one- or two- way ANOVA with the Bonferroni post-hoc test were used. Significance was defined as p <0.05. The results were expressed as aggregate data (mean ± SEM) or images representative of three experiments. For the analysis, GraphPad Prism 6.01 software (GraphPad Software) was used.
Results
Properties ofanakinra powders.
The dry powders of anakinra obtained showed a typical collapsed, irregular shape with a rough surface (Fig. 1 ). These characteristics support a potential respirability for the particles. The size distribution also showed to be compatible with a potential respirability, with a DMV slightly greater than 10 pm and a homogeneous population (Fig. 1 , Table 1 ).
Table 1. Properties of the dry powders of anakinra.
DC (% w/w) ± Loading DMV (urn) ±
Batch# Yield (%) DL (% w/w)
S.D. Efficiency (%) S.D.
1 57 30 28.8 ± 0.5 96% 11.1 ± 0.5
2 50 20 16.7 ± 1.8 84% 13 ± 1
The yields of the dry powders of anakinra obtained are in line with the average performance of a spray drying process. Therefore, the spray drying process proved to be efficient for the production of inhalable anakinra powders with an adequate recovery of powder. With respect to the theoretical loading, the DC was satisfactory with a minimum efficiency of 84% with a theoretical loading of 20% w/w (Table 1 ). This is a desirable characteristic, as it ensures an adequate efficiency of the process and a reduced waste of material.
The aerodynamic evaluation of the anakinra formulations showed good performances in terms of respirable fraction (Table 2), in line with or superior to the majority of commercial DPI products. The EF and recovery were quantitative.
Table 2. Aerodynamic evaluation of the dry powders of anakinra.
EF (%) RFN (%) RFE (%) Recovery (%) 102.0 ± 2.8 53.9 ± 4.6 52.8 ± 3.2 107.0 ± 3.1
The dry powder ofanakinra preserves activity in vitro.
The evaluation of the in vitro activity of the dry powder of anakinra obtained compared to the non-transformed standard protein confirmed a complete maintenance of the inhibitory activity against IL1 -p (Fig. 2). Therefore, the process did not influence the integrity of the protein in spite of the high temperatures used. This is ensured by the very short time of exposure of the solution to thermal shock and by the excipients used for the dry powder formulation. Mannitol, in fact, even if used mainly in freezing, is a well-known stabiliser of biomolecules since, like other substances, it prevents an abrupt rupture of the hydration layer of proteins as a result of thermal shock.
The insufflated dry powder ofanakinra protects against lung pathology in mouse cystic fibrosis.
The therapeutic effectiveness of the formulations was evaluated in relation to Kineret and standard anakinra administered IP daily for 7 days. CF mice were infected with A. fumigatus and a single dose of the dry powder of anakinra was insufflated 3 days after the infection. As shown in Fig. 3, the single pulmonary insufflation reduced the growth and spread of the infection in a generally more efficient manner than the systemic daily administration of Kineret and the standard protein. In line with these results, PMN recruitment was equal to or less than in the case of IP administration and the lung histopathology improved, as also confirmed by a significant reduction in the expression of inflammatory cytokines and chemokines. These results indicate that the therapeutic effectiveness of anakinra can be improved by optimising the administration thereof to the site of inflammation, which probably indicates that anakinra acts on the local anti-inflammatory pathways, improving the homeostasis of the mucosa.
The insufflated dry powder of anakinra allows for a reduction in the dose and prevention of peripheral neutropenia.
The therapeutic effectiveness of the formulations was evaluated in comparison with IP administration of the standard. CF mice were infected with A. fumigatus and insufflated with the dry powder of anakinra or received anakinra IP 3 days after the infection. As shown in Fig. 6, the single pulmonary insufflation reduced fungal growth and dissemination more efficiently than the single IP administration. Similarly, at both dosages, PMN recruitment and the expression of inflammatory cytokines and chemokines were significantly reduced and the lung histopathology improved. The results show that local administration of anakinra apparently improved its therapeutic effectiveness when evaluated comparatively with IP administration, at the same dose. Furthermore, when the insufflated dose is halved, one obtains the same effectiveness as with the systemic dose. This suggests a possible significant reduction of the dosage by exploiting the pulmonary route.
In fact, the results clearly show that a slight, albeit significant, neutropenia was observed with anakinra administered intraperitoneally and not by pulmonary insufflation (Fig. 7).
The analysis of the peripheral blood smears suggested that insufflated anakinra can be superior to anakinra IP in the prevention of peripheral neutropenia, a well-known side effect due to the administration of Kineret.
Overall, all the results obtained show that anakinra by inhalation expresses a greater effectiveness compared to systemic administration.
EXAMPLE 2: Comparative evaluation of respirability and preparation of dry powders of the protein anakinra comprising the amino acids of the present invention versus dry powders of the protein anakinra comprising the amino acids described in the prior art (W02021/113334 A1).
As mentioned above, the prior art document WO2021/113334 A1 , published on 10 June 2021 , describes compositions of anakinra that can comprise amino acids selected from among proline, hydroxyproline, glycine and histidine.
Therefore, formulations comprising the aforesaid amino acids were compared with formulations according to the present invention comprising D- leucine, trileucine, arginine, threonine, tryptophan, lysine, and aspartic acid; the yield of the preparation process and respirability were evaluated under identical conditions.
Materials and methods
The methods used are the same as described in Example 1 .
Results
Table 3 shows the batches prepared using the selected amino acids. In particular, Table 3 shows the composition of the mannitol-amino acid-protein formulations. The amino acids were used in percentages of 40% and 5% (w/w), the protein anakinra was used in a percentage of 20% (w/w) and mannitol was used in percentages of 40% (w/w) in the compositions with 40% amino acid and 75% (w/w) in the compositions with 5% amino acid. A composition comprising mannitol as the only excipient, without the presence of amino acids, was also prepared as a control.
Table 3 amino acids mentioned in the prior art.
Table 4 shows the results obtained with respect to the preparation process compared to the formulation with D-leucine, trileucine and mannitol alone. Only the batches obtained at a 5% w/w content of amino acids are shown, since at the same percentage used with D-leucine (40% w/w), all the amino acids produced yields that were too low, with an impossibility of recovering the formulation in acceptable amounts after spray drying. In particular, unlike the other amino acids, which showed yields between 15 and 25%, at percentages between 10 and 20%, the amino acids mentioned in prior art D1 produced insufficient or zero yields if used at percentages above 5%.
Therefore, Table 4 shows the process yield and protein content for the formulations obtained at 5% w/w of the amino acids tested.
Table 4 amino acids mentioned in the prior art.
In any case, for formulations obtained at 5% w/w, the yields were lower than those obtained with D-leucine, trileucine or mannitol alone and, except in the case of histidine, the protein content was also lower compared to D-leucine.
The evaluation of respirability (Figure 6) demonstrated that D-leucine, in particular, and trileucine are superior to all the other tested amino acids, and above all to glycine, proline, hydroxyproline and histidine (prior art WO2021/113334 A1 ), which barely reach 8% respirability, which is insufficient to guarantee minimum standards of quality for an inhalation application. It should be stressed that the study was carried out by adding, as described above, the amino acids at 5% w/w, as higher percentages cause a considerable loss of material, thus reducing the process yield. This effect was particularly significant in the case of glycine, proline, hydroxyproline and histidine, described in document WO2021/113334 A1 (Fig. 6 square).
REFERENCES
1. Bell SC, Mall MA, Gutierrez H, Macek M, Madge S, Davies JC, et al. The future of cystic fibrosis care: a global perspective. Lancet Respir Med. 2020;8(1 ):65-124.
2. Luciani, A., et al., Defective CFTR induces aggresome formation and lung inflammation in cystic fibrosis through ROS-mediated autophagy inhibition. Nat Cell Biol, 2010. 12(9): p. 863-75.
3. Rey MM, Bonk MP, Hadjiliadis D. Cystic Fibrosis: Emerging Understanding and Therapies. Annu Rev Med. 2019;70:197-210. 4. Mayer, M.L., et al., Rescue of dysfunctional autophagy attenuates hyperinflammatory responses from cystic fibrosis cells. J Immunol, 2013. 190(3): p. 1227-38.
5. Junkins, R.D., et al., Autophagy enhances bacterial clearance during P. aeruginosa lung infection. PLoS One, 2013. 8(8): p. e72263.
6. Lands LC, Stanojevic S. Oral non-steroidal anti-inflammatory drug therapy for lung disease in cystic fibrosis. Cochrane Database Syst Rev. 2019;9:CD001505.
7. Roesch EA, Nichols DP, Chmiel JF. Inflammation in cystic fibrosis: An update. Pediatr Pulmonol. 2018;53(S3):S30-S50.
8. Perrem L, Ratjen F. Anti-inflammatories and mucociliary clearance therapies in the age of CFTR modulators. Pediatr Pulmonol. 2019;54 Suppl 3:S46-S55.
9. Luciani, A., et al., Targeting autophagy as a novel strategy for facilitating the therapeutic action of potentiators on DeltaF508 cystic fibrosis transmembrane conductance regulator. Autophagy, 2012. 8(11 ): p. 1657-72.
10. de Luca, A., et al., IL-1 receptor blockade restores autophagy and reduces inflammation in chronic granulomatous disease in mice and in humans. Proc Natl Acad Sci U S A, 2014. 111 (9): p. 3526-31 .
11. lannitti, R.G., et al., IL-1 receptor antagonist ameliorates inflammasome- dependent inflammation in murine and human cystic fibrosis. Nat Commun, 2016. 7: p. 10791.
12. Cavalli, G. and C.A. Dinarello, Anakinra Therapy for Non-cancer Inflammatory Diseases. Front Pharmacol, 2018. 9: p. 1157.
13. Dinarello, C.A., A. Simon, and J.W. van der Meer, Treating inflammation by blocking interleukin-1 in a broad spectrum of diseases. Nat Rev Drug Discov, 2012. 11 (8): p. 633-52.
14. Castaneda S., Atienza-Mateo B., Martin-Varillas J.L., Serra Lopez-Matencio J.M., Gonzalez-Gay M.A., Anakinra for the treatment of adult-onset Still's disease. Expert Rev Clin Immunol, 2018. 14(12): p. 979-992.
15. Gabay, C., et al., Mouse IL-1 receptor antagonist isoforms: complementary DNA cloning and protein expression of intracellular isoform and tissue distribution of secreted and intracellular IL-1 receptor antagonist in vivo. J Immunol, 1997. 159(12): p. 5905-13. Banda, N.K., et al., Intracellular IL-1 receptor antagonist type 1 inhibits IL-1- induced cytokine production in keratinocytes through binding to the third component of the COP9 signalosome. J Immunol, 2005. 174(6): p. 3608-16. Vecile, E., et al., Intracellular function of interleukin-1 receptor antagonist in ischemic cardiomyocytes. PLoS One, 2013. 8(1 ): p. e53265. Dripps, D.J., et al., Interleukin-1 (IL-1 ) receptor antagonist binds to the 80- kDa IL-1 receptor but does not initiate IL-1 signal transduction. J Biol Chem, 1991. 266(16): p. 10331 -6. Pariano, M.; Pieroni, S.; De Luca, A.; lannitti, R.G.; Borghi, M.; Puccetti, M.; Giovagnoli, S.; Renga, G.; D’Onofrio, F.; Belief, M.M.; et al. Anakinra Activates Superoxide Dismutase 2 to Mitigate Inflammasome Activity. Int. J. Mol. Sci. 2021 , 22, 6531. van de Veerdonk, F. L., Renga, G., Pariano, M., Belief, M. M., Servillo, G., Fallarino, F., ... & Romani, L. Anakinra restores cellular proteostasis by coupling mitochondrial redox balance to autophagy. The Journal of clinical investigation, 2022, e144983. O'Dell J.R., Anti-cytokine therapy - a new era in the treatment of rheumatoids arthritis? N Engl J Med, 1999. 340: p. 310-1. Chamberlain, C. S. et al. Interleukin expression after injury and the effects of interleukin-1 receptor antagonist. PLoS ONE 8, e71631 (2013).

Claims

1 ) Pharmaceutical composition comprising the protein anakinra, as the active ingredient, in combination with one or more excipients, said pharmaceutical composition being in a dry powder form suitable for administration by inhalation, wherein said one or more excipients comprise or consist of one or more sugars selected from among mannitol, sucrose, trehalose, or lactose and one or more amino acids selected from among leucine, trileucine, lysine, tryptophan, arginine, aspartic acid, threonine, or phenylalanine.
2) Pharmaceutical composition according to claim 1 , wherein said one or more amino acids consist of the amino acid leucine and/or the amino acid trileucine.
3) Pharmaceutical composition according to any one of claims 1 -2, wherein said one or more sugars consist of a single sugar selected from among mannitol, trehalose, or sucrose or a mixture of said sugars selected from among mannitol and sucrose, mannitol and trehalose or mannitol, trehalose, and sucrose.
4) Pharmaceutical composition according to claim 1 , wherein said one or more excipients comprise or consist of one of the following mixtures of said one or more sugars and of said one or more amino acids: mannitol and leucine, trehalose and leucine, sucrose and leucine, mannitol, trehalose, sucrose, and leucine, mannitol and trileucine, trehalose, and trileucine, sucrose and trileucine, mannitol, trehalose, sucrose and trileucine.
5) Pharmaceutical composition according to any one of claims 1 -4, wherein said one or more excipients further comprise a lipid selected from among dipalmitoylphosphatidylcholine, distearoylphosphatidylcholine, dimyristoylphosphatidylcholine, cholesterol, magnesium or potassium stearate or mixtures of said lipids.
6) Pharmaceutical composition according to any one of claims 1 -5, wherein said one or more excipients further comprise a hydrophilic polymer selected from among chitosan, polyethylene glycol, polyethylene-polypropylene glycol, or mixtures of said hydrophilic polymers.
7) Pharmaceutical composition according to any one of claims 1 -6, wherein the protein anakinra is present in an amount ranging from 1 % to 40% by weight relative to the weight of the pharmaceutical composition, preferably from 10% to 30%, even more preferably from 15% to 25%.
8) Pharmaceutical composition according to any one of claims 1 -7, wherein the dry powder is characterised by particles with an average volume size ranging from 1 to 40 microns, preferably from 5 to 20 microns, even more preferably from 8 to 15 microns.
9) Pharmaceutical composition according to any one of claims 1 -8, wherein the pharmaceutical composition is obtained by means of the spray drying technique.
10) Pharmaceutical composition as defined in any one of claims 1 -9, for use in the prevention or treatment of inflammation, wherein said pharmaceutical composition is administered by inhalation.
11 ) Pharmaceutical composition as defined in any one of claims 1 -9, for use according to claim 10, in the prevention or treatment of inflammation in a patient with cystic fibrosis.
12) Process for preparing a composition as defined in any one of claims 1 -9, said process comprising: a) preparing an aqueous solution of anakinra and one or more excipients, wherein said one or more excipients comprise or consist of one or more sugars selected from among mannitol, sucrose, trehalose, or lactose and one or more amino acids selected from among leucine, trileucine, lysine, tryptophan, arginine, aspartic acid, threonine, or phenylalanine; b) subjecting the solution to spray drying, wherein the temperature ranges from 120 to 180°C, preferably from 120 to 160°C, even more preferably from 135 to 145°C; the feed rate ranges from 1 to 10 mL/min, preferably from 2 to 8 mL/min, even more preferably from 2 to 4 mL/min; the airflow speed ranges from 200 to 400 L/hour, preferably from 250 to 350 L/hour, even more preferably from 290 to 310 L/hour.
13) Process according to claim 12, wherein said one or more sugars consist of a single sugar selected from among mannitol, trehalose or sucrose or a mixture of said sugars selected from among mannitol and sucrose, mannitol and trehalose or mannitol, trehalose and sucrose.
14) Process according to claim 12, wherein said one or more amino acids consist of the amino acid leucine and/or the amino acid trileucine. 15) Process according to claim 12, wherein said one or more excipients comprise or consist of one of the following mixtures of said one sugar and of said one amino acid: mannitol and leucine, trehalose and leucine, sucrose and leucine, mannitol, trehalose, sucrose and leucine, mannitol and trileucine, trehalose and trileucine, sucrose and trileucine, mannitol, trehalose, sucrose and trileucine.
16) Process according to any one of claims 12-15, wherein said one or more excipients further comprise a lipid selected from among dipalmitoylphosphatidylcholine, distearoylphosphatidylcholine, dimyristoylphosphatidylcholine, cholesterol, magnesium or potassium stearate, or mixtures of said lipids.
17) Process according to any one of claims 12-16, wherein said one or more excipients further comprise a hydrophilic polymer selected from among chitosan, polyethylene glycol, polyethylene-polypropylene glycol, or mixtures of said hydrophilic polymers.
18) Process according to any one of claims 12-17, wherein the solution of step a) comprises the protein anakinra at a concentration ranging from 0.25 to 10 mg/mL, preferably from 2 to 5 mg/mL, even more preferably from 3 to 4 mg/mL and said one or more excipients at a concentration ranging from 5 to 25 mg/mL, preferably from 8 to 20 mg/mL, even more preferably from 10 to 15 mg/mL.
19) Pharmaceutical composition comprising the protein anakinra, as the active ingredient, in combination with one or more pharmaceutically acceptable excipients and/or adjuvants, said pharmaceutical composition being in a dry powder form suitable for administration by inhalation, wherein said pharmaceutical composition can be obtained by means of the process as defined in any one of claims 12-18.
20) Kit for the administration by inhalation of a pharmaceutical composition as defined in any one of claims 1 -9 or 19, wherein said kit comprises: a) a device for the administration of dry powder by inhalation; and b) a pharmaceutical composition as defined in any one of claims 1 -9 or 19.
EP23725446.1A 2022-04-21 2023-04-19 Inhalable pharmaceutical composition comprising the protein anakinra for the treatment of inflammation in cystic fibrosis Pending EP4511004A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IT102022000007844A IT202200007844A1 (en) 2022-04-21 2022-04-21 Inhalable pharmaceutical composition including the protein anakinra for the treatment of inflammation in cystic fibrosis
PCT/IT2023/050105 WO2023203586A1 (en) 2022-04-21 2023-04-19 Inhalable pharmaceutical composition comprising the protein anakinra for the treatment of inflammation in cystic fibrosis

Publications (1)

Publication Number Publication Date
EP4511004A1 true EP4511004A1 (en) 2025-02-26

Family

ID=82483351

Family Applications (1)

Application Number Title Priority Date Filing Date
EP23725446.1A Pending EP4511004A1 (en) 2022-04-21 2023-04-19 Inhalable pharmaceutical composition comprising the protein anakinra for the treatment of inflammation in cystic fibrosis

Country Status (3)

Country Link
EP (1) EP4511004A1 (en)
IT (1) IT202200007844A1 (en)
WO (1) WO2023203586A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118416033B (en) * 2024-04-30 2025-01-03 杭州畅溪制药有限公司 Apremilast inhalation powder aerosol and preparation method and application thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2013270447B2 (en) * 2006-08-10 2016-10-13 Onspira Therapeutics, Inc. Localized therapy of lower airways inflammatory disorders with proinflammatory cytokine inhibitors
MX2022006636A (en) * 2019-12-02 2022-11-09 Altavant Sciences Gmbh Treatment of lower airways disorders.

Also Published As

Publication number Publication date
WO2023203586A1 (en) 2023-10-26
IT202200007844A1 (en) 2023-10-21

Similar Documents

Publication Publication Date Title
Crosby et al. Inhaled ENaC antisense oligonucleotide ameliorates cystic fibrosis-like lung disease in mice
ES3033142T3 (en) Dry powder formulation comprising a phosphodiesterase inhibitor
ES2770073T5 (en) Therapeutic use of bone morphogenetic proteins
Esposito et al. Manipulating proteostasis to repair the F508del-CFTR defect in cystic fibrosis
Smaldone Repurposing of gamma interferon via inhalation delivery
JP2005532988A (en) Methods and compositions for treating respiratory epithelial lesions
KR102316762B1 (en) Dry-powder peptide medicament
JP5970465B2 (en) Composition comprising peptide and viral neuraminidase inhibitor
JP2022515858A (en) Dry powder inhalation formulation, and its use for therapeutic treatment of the lungs
WO2023203586A1 (en) Inhalable pharmaceutical composition comprising the protein anakinra for the treatment of inflammation in cystic fibrosis
EP4333853A1 (en) Methods for treating a pulmonary disease with an alk-5 (tgf beta r1) inhibitor
Shi et al. Inhaled nintedanib dry powder formulation for the treatment of idiopathic pulmonary fibrosis: Pharmacodynamic and pharmacokinetic study
Kang et al. In vivo pharmacokinetic and pharmacodynamic study of inhalable pirfenidone microparticles prepared via high-energy bead milling
RU2724932C2 (en) Thymosin alpha-1 for use in treating cystic fibrosis
WO2017070338A1 (en) Methods and compositions for treating lung disease of prematurity
US9872831B2 (en) Pharmaceutical composition of oxidised avidin suitable for inhalation
CN118175998A (en) Inhalable protease inhibitors for the prevention and/or treatment of fibrotic autoimmune or inflammatory lung diseases
Zaman et al. Novel s-nitrosothiols have potential therapeutic uses for cystic fibrosis
JP2023521412A (en) Compositions and methods for treating and preventing lung disease
US20240325383A1 (en) Small Molecule Targeting of BRD4 for Treatment of COVID-19
KR20180065224A (en) A pharmaceutical composition for treating or alleviating pulmonary fibrosis
Sasidharan et al. Select amino acids recover cytokine-altered ENaC function in human bronchial epithelial cells
KR20180065223A (en) A pharmaceutical composition for treating or alleviating asthma
KR20250114044A (en) Chronic respiratory disease treatment medication
CN118043055A (en) Compositions and methods for treating bronchopulmonary dysplasia (BPD) and BPD-associated pulmonary hypertension

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20241118

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)