EP4486114A2 - Ind variants and resistance to pod shatter in brassica - Google Patents
Ind variants and resistance to pod shatter in brassicaInfo
- Publication number
- EP4486114A2 EP4486114A2 EP23764045.3A EP23764045A EP4486114A2 EP 4486114 A2 EP4486114 A2 EP 4486114A2 EP 23764045 A EP23764045 A EP 23764045A EP 4486114 A2 EP4486114 A2 EP 4486114A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- bnind
- variant
- allele
- plant
- deletion
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/12—Processes for modifying agronomic input traits, e.g. crop yield
- A01H1/1205—Abscission; Dehiscence; Senescence
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- sequence listing is submitted electronically via EFS-Web as an xml-formatted sequence listing file named 8928-WO-PCT ST.26 created on February 23, 2023, and having a size of 52,248 bytes which is filed concurrently with the specification.
- compositions and methods including sequences, markers, assays and the use of marker assisted selection for improving agronomic traits in plants, specifically improving pod shatter resistance in Brassica plants.
- Brassica napus also referred to as canola or oilseed rape
- Brassica napus is one of the most important vegetable oilseed crops in the world, especially in China, Canada, the European Union and Australia, where the oils are used extensively in the food industry and for biodiesel production.
- Oilseed rape is a recently domesticated plant and retains some of the traits of its wild ancestors which were useful in the wild but are not useful in commercial crop plants.
- fruit dehiscence refers to the natural opening of reproductive structures to disperse seeds. In species that disperse their fruit through dehiscense, siliques or pods are composed of two carpels that are held together by a central replum via a valve margin.
- the dehiscence zone (DZ).
- DZ dehiscence zone
- pod shatter In addition to direct losses of income from reduced seed yield, increased input costs and reduced price paid for low oil content seeds, pod shatter also results in additional indirect costs to the grower.
- the shed seed results in self-sown or volunteer B. napus plants growing in the next year's crop, which creates further expense due to the need for increased herbicide use.
- Such self-sown B. napus plants cause losses due to competition with subsequent crop and can cause problems for farmers using reduced-tillage strategies such as no-till, zone-till, and strip tillage.
- Variant 1 and “Variant 2” located in the INDEHISCENT gene (BnIND-C) on chromosome N13 of B. napus. Also disclosed herein is the discovery that Variant 2 contributes to a reduced or resistant pod shatter phenotype in Brassica plants and/or their progeny. Accordingly, Brassica plants containing Variant 2 are useful, e.g., as a parent or trait donor in a breeding or introgression program, to generate progeny having improved pod shatter resistance phenotype.
- the methods, sequences, and markers disclosed herein can be used to identify (i) a plant with improved pod shatter resistance phenotype and/or (ii) a plant suitable for use as a parent plant in a breeding program to generate progeny plants that are resistant to pod shatter.
- the disclosed methods, sequences, assays, and molecular markers can be used with a Brassica crop plant.
- Brassica preferably refers to Brassica napus.
- this disclosure provides a method of identifying a Brassica plant, cell, or germplasm thereof comprising the Variant 2 sequence that contributes to improved pod shatter resistance phenotype.
- the method comprises obtaining a nucleic acid sample from a Brassica plant, plant cell, or germplasm; and screening the sample for genomic sequence comprising a Variant 2 sequence.
- the disclosure provides a method of detecting the presence of Variant 2 and thereby determining that the source of nucleic sample may be useful as a parent or trait donor in a breeding program to confer and/or contribute to pod shatter resistance in progeny of the parent or trait donor (source of nucleic acid sample) comprising the Variant 2 sequence.
- the method of identifying a Brassica (e.g. B. napus) plant, cell, or germplasm thereof comprising Variant 2 can comprise obtaining a nucleic acid sample from the Brassica (e.g. B. napus) plant, plant cell, or germplasm screening its genomic sequence for the presence of a variation in the BnIND-C sequence that encodes a histidine at the amino acid corresponding to position 67 of SEQ ID NO:2.
- This method can further include screening its genomic sequence for the presence of a variation in the BnIND-C sequence that encodes (i) a methionine at the amino acid corresponding to position 82 of SEQ ID NO: 2, (ii) a cysteine at the amino acid corresponding to position 186 of SEQ ID NO:2, or (iii) each of the foregoing histidine, methionine, and cysteine at the amino acids corresponding to SEQ ID NO:2 positions 67, 82, and 186, respectively. Screening the sample can be done using any suitable method for detecting a genetic polymorphism, including any such method disclosed herein, such as by genomic sequencing.
- the disclosed methods can include amplifying the genomic sequence to produce an amplicon.
- the amplicon comprises amplified genomic sequence which is generated using a nucleic acid amplification such as polymerase chain reaction (PCR).
- PCR polymerase chain reaction
- the method can include amplifying genomic DNA to produce an amplicon that includes BnIND-C coding sequence that encodes amino acid position corresponding to position 67 of SEQ ID N0:2, and confirming the presence of a histidine at the amino acid corresponding to position 67 of SEQ ID NO:2.
- the method can include amplifying genomic DNA to produce an amplicon that includes BnIND-C coding sequence that encodes amino acid position corresponding to position 82 of SEQ ID NO:2, and then confirming the presence of methionine at the position corresponding to position 82 of SEQ ID NO:2.
- the method can include amplifying genomic DNA to produce an amplicon that includes BnIND-C coding sequence that encodes amino acid position corresponding to position 186 of SEQ ID NO:2, and then confirming the presence of cysteine at the position corresponding to position 186 of SEQ ID NO:2.
- the method can include amplifying genomic DNA to produce an amplicon and then confirming that the amplicon includes BnIND-C coding sequence that encodes each of the foregoing histidine, methionine, and cysteine amino acids at the positions corresponding to SEQ ID NO:2 positions 67, 82, and 186, respectively.
- the method of identifying a Brassica (e.g. B. napus) plant, cell, or germplasm thereof comprising Variant 2 can comprise screening its genomic sequence for the presence of a variation in the BnIND-C sequence that includes an adenine at position 200 of SEQ ID NO: 5.
- the method of identifying a Brassica (e.g. B. napus) plant, cell, or germplasm thereof comprising Variant 2 can comprise screening its genomic sequence for the presence of a variation in the BnIND-C sequence that includes an adenine at position 200 of SEQ ID NO: 5.
- Variant 2 can comprise screening its genomic sequence for the presence of a variation in the BnIND-C sequence that includes one or more of the following Variant 2 SNP alleles (each of which is also referred to herein as a “Variant 2 allele”) corresponding to a thymine at position 36, adenine at position 200, guanine at position 246, cytosine at position 462, or thymine at position 556 as shown in SEQ ID NO:5.
- Variant 2 SNP alleles each of which is also referred to herein as a “Variant 2 allele”
- a Brassica e.g. B.
- Variant 2 can comprise screening its genomic sequence for the presence of a variation in the BnIND-C sequence shown in Table 1, which variation is a codon change to encode histidine, methionine, and cysteine at the amino acids corresponding to SEQ ID NO:2 or SEQ ID NO:5 positions 67, 82, and 186, respectively.
- This screening can be done using any suitable method for detecting a genetic polymorphism, including any such method disclosed herein such as by sequencing, PCR amplification-based methods, or a method that combines amplification and sequencing.
- Sequencing or amplification of BnIND-C allele can produce a sequencing product or amplicon, respectively, comprising one or more of the Variant 2 alleles (i.e., thymine at position 36, adenine at position 200, guanine at position 246, cytosine at position 462, or thymine at position 556 of SEQ ID NO:5) and 5 bp or more, 10 bp or more, 15 bp or more, 20 bp or more, 30 bp or more, 40 bp or more, 50 bp or more, 60 bp or more, 70 bp or more, 80 bp or more, 90 bp or more, 100 bp or more, 110 bp or more, 120 bp or more, 130 bp or more, 140 bp or more, 150 bp or more, 175 bp or more, 200 bp or more, 250 bp or more, 300 bp or more, 350 bp or more,
- each of the one or more Variant 2 alleles can be detected by analyzing the sequence (of the sequencing product or amplicon) or by use of an allele specific probe that selectively hybridizes to the Variant 2 allele.
- Allele specific probes can be labeled, e.g., with a radioactive or fluorescent label for detection of amplified product.
- the disclosure also provides a method of selective amplification, e.g., by PCR, that comprises obtaining a nucleic acid sample from a Brassica (e.g. B. riapus) plant, cell, or germplasm thereof, isolating genomic nucleic acid from the sample and screening the isolated nucleic for genomic sequence comprising one or more Variant 2 allele disclosed herein by contacting the isolated genomic nucleic acid with a forward primer and reverse primer that selectively produce an amplicon comprising the Variant 2 allele.
- a method of selective amplification e.g., by PCR, that comprises obtaining a nucleic acid sample from a Brassica (e.g. B. riapus) plant, cell, or germplasm thereof, isolating genomic nucleic acid from the sample and screening the isolated nucleic for genomic sequence comprising one or more Variant 2 allele disclosed herein by contacting the isolated genomic nucleic acid with a forward primer and reverse primer that selectively produce an amplicon comprising the Vari
- Selective amplification of the Variant 2 allele can be achieved using at least one primer (forward or reverse primer) that selectively anneals and amplifies isolated genomic nucleic acid that includes the one or more Variant 2 alleles (e.g., thymine at position 36, adenine at position 200, guanine at position 246, cytosine at position 462, thymine at position 556 of SEQ ID NO:5, or a Variant 2 codon identified in Table 1), but does not effectively amplify wild-type BnIND-C nucleic acid sequence (e.g., containing nucleotide corresponding to the nucleotide at position 36, 200, 246, 462, or 556 of SEQ ID NO: 1).
- a primer forward or reverse primer
- the primers used in such a selective amplification assay can be labeled, e.g., with a radioactive or fluorescent label for detection of amplified product. If the selective amplification assay further includes one or more labeled primers that selectively amplify wild-type BnIND-C nucleic acid sequence, the label on wild-type primer(s) is preferably different from the label on the primer(s) used to selectively amplify Variant 2.
- a disclosed amplification or PCR assay can include obtaining a nucleic acid sample from Brassica (e.g. B. napus) plant, cell, or germplasm thereof, isolating genomic DNA from the sample and screening for genomic sequence comprising one or more of the Variant 2 alleles disclosed herein, (e.g., an adenine at position 200, thymine at position 36, guanine at position 246, cytosine at position 462, or thymine at position 556 of SEQ ID NO:5 and/or any of the codons disclosed in Table 1 herein) by contacting the isolated genomic DNA with a forward primer and reverse primer to produce an amplicon comprising the Variant 2 sequence position, and then contacting a labeled probe (Variant 2 probe) to the amplicon comprising Variant 2 sequence, and thereby detecting the one or more Variant 2 alleles.
- a nucleic acid sample from Brassica (e.g. B. napus) plant, cell, or germplasm thereof
- the method can further, optionally, include contacting the isolated genomic DNA with a wild-type forward primer and wild-type reverse primer capable of producing a second amplicon of wild-type genomic BnIND-C sequence (e.g., the nucleotide shown at one or more of positions 200, 36, 246, 462 or 556 of SEQ ID NO:2) and then adding a labeled wild-type probe which is capable of detecting wild-type BnIND-C sequence genomic sequence in amplicon.
- the deletion probe and wild-type probe are preferably differently labeled to enable the use of both probes in the same reaction mix or in a high throughput amplification assay method.
- primers and probes that can be and have been used for the detection of Variant 2 allele and wild-type genomic BnIND-C sequence, respectively, are provided in Table 2.
- Table 2 each bold and underlined “Sequence” nucleotide detects the corresponding indicated “Position” of SEQ ID NO: 1 corresponding to a Variant 2 allele or wild-type allele, as indicated.
- KASP primers can be fluorescently labeled, e.g., using 5’-sequence conjugated to fluorescent dye.
- KASP primers in Table 2 have been used, for example, with a 5’-tail GAAGGTCGGAGTCAACGGATT (SEQ ID NO: 14) conjugated to HEX fluorescent dye or 5’-tail GAAGGTGACCAAGTTCATGCT (SEQ ID NO: 15) conjugated to FAM fluorescent dye, as indicated.
- Each of the methods disclosed herein for identifying a Brassica (e.g. B. napus plant, cell, or germplasm thereof comprising the disclosed Variant 2 alleles can further include selecting such a Brassica (e.g. B. napus) plant, cell, or germplasm thereof comprising the one or more disclosed Variant 2 alleles (e.g., preferably an adenine at position 200, thymine at position 36, guanine at position 246, cytosine at position 462, or thymine at position 556 of SEQ ID NO:5 and/or any of the codons disclosed in Table 1 herein) that contributes to an improved pod shatter resistance phenotype.
- This method of selection can be used advantageously in methods of introducing the one or more Variant 2 alleles into a Brassica variety and thereby generate new plant lines comprising the one or more Variant 2 alleles.
- a method of introducing the Variant 2 allele(s) into a new Brassica (e.g. B. napus) plant having a BnIND- variant gene that contributes to improved pod shatter resistance phenotype can include crossing a first parent Brassica plant comprising a Variant 2 allele with a second parent Brassica plant that does not have the Variant 2 allele to produce progeny plants (e.g. hybrid progeny), obtaining a nucleic acid sample from one or more of the progeny plants, and identifying one or more of the progeny plants that has the Variant 2 allele sequence.
- progeny plants e.g. hybrid progeny
- Progeny plants comprising Variant 2 allele can be identified using one or more of the methods disclosed herein (which include, but are not limited to, whole genome sequencing, coupled genomic DNA amplification and sequencing, DNA amplification methods that include the use of labeled primers and/or labeled probes, marker assisted selection, primer extension etc.) to identify a Brassica (e.g. B. napus) plant, cell, or germplasm thereof comprising the disclosed Variant 2 allele(s).
- the method can further include selecting the hybrid progeny plant identified as having the Variant 2 allele(s). This method can thus be used to create progeny plants having the Variant 2 allele(s) that contributes to the improved pod shatter resistance phenotype disclosed herein.
- a Variant 2 allele from one parent is combined with one or more other traits that contribute(s) to pod shatter resistance to thereby improve, relative to the parent plants, the pod shatter resistance of a progeny plant comprising the Variant 2 allele(s) and the one or more other Pod Shatter Trait(s).
- Non-limiting example of Pod Shatter Trait(s) that can be combined with Variant 2 allele include: BnIND- variants, ALCATRAZ (ALC-A or ALC-C) variants, FRUITFULL genes (ectopically expressed), SHATTERPROOF (SHP-1, SHP-2, SHP-3, SHP-4, SHP-5, SHP-6, SHP-7, SHP-8) variants, POLYGALACTURONASE gene (RDPG1-A, RDPG1-C, PGAZ-A, PGAZ-C, or PGAZBRAN) variants.
- BnIND- variants ALCATRAZ (ALC-A or ALC-C) variants
- FRUITFULL genes ectopically expressed
- SHATTERPROOF SHP-1, SHP-2, SHP-3, SHP-4, SHP-5, SHP-6, SHP-7, SHP-8 variants
- POLYGALACTURONASE gene RDPG1-A, RDPG1-
- BnIND- variants include mutant alleles having diminished function or BnIND-A knock-out alleles, e.g., as disclosed in International Patent Application Publications WO 2009/068313 and WO 2010/006732.
- BnIND- variants also include genomic deletions of BnIND- , such as the BnIND- deletion shown in SEQ ID NO: 7 disclosed herein.
- a. BnIND-A deletion is detected using markers alleles that are flanking and linked to the BnIND- deletion breakpoint locus on chromosome N03.
- these can be markers in the N03 chromosome interval flanked by and including positions that correspond to positions (i) 14,453,580 and 14,688,286 of DH12075 reference genome (ii) positions 14,236,228 and 14,447,394 of DH12075 reference genome or (iii) positions 14,693,565 to 14,954,238 of DH12075 reference genome.
- Primers and probes useful to detect BnIND- deletion can comprise SEQ ID NOs:8-10, for SEQ ID NOs: 11-13 can be used as control (see Table 2).
- the foregoing method steps can be repeated by crossing the one or more selected progeny plants with the first or second parent Brassica (e.g. B. napus) plant (the recurrent parent plant) to produce backcross progeny plants.
- Nucleic acid samples are obtained from one or more backcross progeny plants; and backcross progeny plants comprising the disclosed Variant 2 allele(s) are identified.
- the method can further include selecting the one or more backcross progeny plants having the Variant 2 allele(s) to produce another generation of backcross progeny plants.
- backcross progeny plants can also include a one or more other Pod Shatter Trait(s) (see non-limiting examples disclosed herein).
- the selected additional backcross progeny plants have both a Variant 2 allele and a BnIND- variant. Repeated backcrossing to the recurrent parent plant can be used to create Brassica (e.g. B.
- riapus plant lines that combine (i) the Variant 2 allele (with or without another Pod Shatter Trait such as a BnIND-A variant) and (ii) the agronomic characteristics of the recurrent parent plant, when backcross lines and recurrent parent are grown in the same environmental conditions.
- the Brassica plant can comprise the Variant 2 allele and an ALCATRAZ (ALC-A or ALC-C) variant, FRUITFULL genes (ectopically expressed), SHATTERPROOF (SHP-1, SHP-2, SHP- 3, SHP-4, SHP-5, SHP-6, SHP-7, SHP-P) variant, POLYGALACTURONASE gene (RDPG1- A, RDPG1-C, PGAZ-A, PGAZ-C, or PGAZBRAN) variant.
- ALCATRAZ ALCATRAZ
- FRUITFULL genes ectopically expressed
- SHATTERPROOF SHP-1, SHP-2, SHP- 3, SHP-4, SHP-5, SHP-6, SHP-7, SHP-P
- POLYGALACTURONASE gene RDPG1-
- Brassica e.g. B. napus
- a Brassica plant comprising the Variant 2 allele and a BnIND-A variant, e.g., a mutant allele having diminished BnIND- function or a BnIND- knock-out disclosed in International Patent Application Publications W02009/068313 and W02010/006732.
- a Brassica plant line that comprises both the Variant 2 allele and a genomic deletion of BnIND- , such as SEQ ID NO:7 disclosed herein.
- a targeted genomic modification of the BnIND-C gene in a Brassica e.g. B. napus genomic locus that produces the Variant 2 allele disclosed herein.
- the modification can be done in a Brassica (e.g. B. napus) plant, cell, or germplasm that comprises wild-type BnIND-A (e.g., without any other Pod Shatter Trait).
- the modification can be done in Brassica (e.g. B. riapiis) plant, cell, or germplasm that includes a Pod Shatter Trait (see non-limiting examples disclosed herein) such as a genomic deletion of BnIND-N or in particular, SEQ ID NO:7 disclosed herein.
- Methods for creating such gene edited plants dropouts comprise inducing a first and second double strand break in genomic DNA using a TALE-nuclease (TALEN), a meganuclease, a zinc finger nuclease, or a CRISPR-associated nuclease.
- the method comprises introducing a CRISPR-associated nuclease and guide RNAs into a B. napus plant cell.
- FIG. 1 is a box and whisker plot showing the results of field studies in percent shattered pods (“SHTPC”) score distributions of a set of plant lines containing BnIND-C Variant 2 and a BnIND-N deletion (aacc genotype) and a second set of plant lines with wildtype BnIND-C and BnIND-N deletions (aaCC genotype).
- SHTPC percent shattered pods
- nucleic acid sequences listed in the accompanying sequence listing and referenced herein are shown using standard letter abbreviations for nucleotide bases. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood to be included by any reference to the displayed strand. Sequence listings in addition to those referenced in Table 2 are provided in the following Table 3.
- ALC ALC TRAZ
- ALC TRA7P or ALC when used in connection with a gene allele or variant, refers herein to a gene allele that can contribute to pod shatter resistance in B. napus and A. thaliana.
- ALC gene variants that have been described as contributing to pod shatter resistance are disclosed, for example, in International Application Publication WO 2012/084742.
- An “allele” is one of several alternative forms of a gene occupying a given locus on a chromosome. When all the alleles present at a given locus on a chromosome are the same, that plant is “homozygous” at that locus. If the alleles present at a given locus on a chromosome differ, that plant is “heterozygous” at that locus. In B. napus, a plant can be homozygous wild type for the IND gene locus of the A genome, but heterozygous mutant for the IND gene locus of the C genome.
- An “amplicon” is amplified nucleic acid, e.g., a nucleic acid that is produced by amplifying a template nucleic acid by any available amplification method (e.g., PCR, LCR, transcription, or the like).
- amplification method e.g., PCR, LCR, transcription, or the like.
- “Backcrossing” refers to the process whereby hybrid progeny plants are repeatedly crossed back to one of the parents.
- the “donor” parent refers to the parental plant with the desired gene or locus to be introgressed.
- the “recipient” parent (used one or more times) or “recurrent” parent (used two or more times) refers to the parental plant into which the gene or locus is being introgressed.
- Backcrossing has been widely used to introduce new traits into plants. See e.g., Jensen, N., Ed. Plant Breeding Methodology, John Wiley & Sons, Inc., 1988.
- recurrent parent the original variety of interest (recurrent parent) is crossed to a second variety (non-recurrent parent) that carries a gene of interest to be transferred.
- non-recurrent parent a second variety that carries a gene of interest to be transferred.
- the resulting progeny from this cross are then crossed again to the recurrent parent, and the process is repeated until a plant is obtained wherein essentially all of the desired morphological and physiological characteristics of the recurrent plant are recovered in the converted plant, in addition to the transferred gene from the nonrecurrent parent.
- a “Cas protein” refers to a polypeptide encoded by a Cas (CRISPR-associated) gene.
- a Cas protein includes but is not limited to: a Cas9 protein, a Cpfl (Casl2) protein, a C2cl protein, a C2c2 protein, a C2c3 protein, Cas3, Cas3-HD, Cas 5, Cas7, Cas8, CaslO, or combinations or complexes of these.
- a Cas protein may be a “Cas endonuclease” or “Cas effector protein”, that when in complex with a suitable polynucleotide component, is capable of recognizing, binding to, and optionally nicking or cleaving all or part of a specific polynucleotide target sequence.
- a “Cas endonuclease” may comprise domains that enable it to function as a double- strand-break-inducing agent.
- a “Cas endonuclease” may also comprise one or more modifications or mutations that abolish or reduce its ability to cleave a double-strand polynucleotide (dCas).
- the Cas endonuclease molecule may retain the ability to nick a single-strand polynucleotide (for example, a D10A mutation in a Cas9 endonuclease molecule) (nCas9).
- the guide polynucleotide/Cas endonuclease complex When complexed with a guide polynucleotide, the guide polynucleotide/Cas endonuclease complex”, (or “guide polynucleotide/Cas endonuclease system”, “ guide polynucleotide/Cas complex”, “guide polynucleotide/Cas system” and “guided Cas system” or “Polynucleotide-guided endonuclease” , “PGEN”” are capable of directing the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind to, and nick or cleave (introduce a single or double-strand break) the DNA target site.
- a guided Cas system referred to herein can comprise Cas protein(s) and suitable polynucleotide component(s) of any known CRISPR systems (Horvath and Barrangou, 2010, Science 327: 167-170; Makarova et al. 2015, Nature Reviews Microbiology Vol. 13: 1-15; Zetsche et al., 2015, Cell 163, 1-13; Shmakov et al., 2015, Molecular Cell 60, 1-13).
- the term “commercially useful” refers to plant lines and hybrids that have sufficient plant vigor and fertility, such that a crop of the plant line or hybrid can be produced by farmers using conventional farming equipment.
- plant commodity products with described components and/or qualities may be extracted from plants or plant materials of the commercially useful variety.
- oil comprising desired oil components may be extracted from the seed of a commercially useful plant line or hybrid utilizing conventional crushing and extraction equipment.
- canola meal may be prepared from the crushed seed of commercially useful plant lines which are provided by the invention and which have the Variant 2 allele disclosed herein.
- a commercially useful plant line is an inbred line or a hybrid line. “Agronomically elite” lines and hybrids typically have desirable agronomic characteristics; for example and without limitation: improved yield of at least one plant commodity product; maturity; disease resistance; and standability.
- crossing refers to the fusion of gametes via pollination to produce progeny (e.g., cells, seeds, and plants). This term encompasses both sexual crosses (i.e., the pollination of one plant by another) and selfing (i.e., self-pollination, for example, using pollen and ovule from the same plant).
- dropout refers to a DNA sequence of a cell (e.g. the BnIND-N gene or BnALC gene) that has been excised from the genome by targeted deletion mediated by a Cas protein.
- elite line means any line that has resulted from breeding and selection for superior agronomic performance.
- An elite plant is any plant from an elite line.
- FRUITFULL used in connection with a gene allele or variant, refers herein to a gene allele that can contribute to pod shatter resistance in B. napus and A. thaliana. Examples of FULL genes described as contributing to pod shatter resistance are disclosed, for example, in International Application Publication WO 2017/025420.
- gene may refer to a heritable genomic DNA sequence with functional significance.
- a gene includes a nucleic acid fragment that expresses a functional molecule such as, but not limited to, a specific protein, including regulatory sequences preceding (5’ non-coding sequences) and following (3’ non-coding sequences) the coding sequence, as well as intervening intron sequences.
- the term “gene” may also be used to refer to, for example and without limitation, a cDNA and/or an mRNA encoded by a heritable genomic DNA sequence.
- genomic as it applies to a prokaryotic and eukaryotic cell or organism cells encompasses not only chromosomal DNA found within the nucleus, but organelle DNA found within subcellular components (e.g., mitochondria, or plastid) of the cell.
- a “genomic sequence” or “genomic region” is a segment of a chromosome in the genome of a cell that is present on either side of the target site or, alternatively, also comprises the target site or a portion thereof.
- An “endogenous genomic sequence” refers to genomic sequence within a plant cell, (e.g. an endogenous genomic sequence of an IND gene present within the genome of a Brassica plant cell).
- a “genomic locus” as used herein refers to the genetic or physical location on a chromosome of a gene.
- gene includes a nucleic acid fragment that expresses a functional molecule such as, but not limited to, a specific protein coding sequence and regulatory elements, such as those preceding (5’ non-coding sequences) and following (3’ noncoding sequences) the coding sequence.
- genotyp refers to the physical components, i.e., the actual nucleic acid sequence at one or more loci in an individual plant.
- germplasm refers to genetic material of or from an individual plant or group of plants (e.g., a plant line, variety, and family), and a clone derived from a plant or group of plants.
- a germplasm may be part of an organism or cell, or it may be separate (e.g., isolated) from the organism or cell.
- germplasm provides genetic material with a specific molecular makeup that is the basis for hereditary qualities of the plant.
- “germplasm” refers to cells of a specific plant; seed; tissue of the specific plant (e.g., tissue from which new plants may be grown); and non-seed parts of the specific plant (e.g., leaf, stem, pollen, and cells).
- germplasm is synonymous with “genetic material,” and it may be used to refer to seed (or other plant material) from which a plant may be propagated.
- a germplasm utilized in a method or plant as described herein is from a canola line or variety.
- a germplasm is seed of the canola line or variety.
- a germplasm is a nucleic acid sample from the canola line or variety.
- a “haplotype” is the genotype of an individual at a plurality of genetic loci.
- the genetic loci described by a haplotype may be physically and genetically linked; i.e., the loci may be positioned on the same chromosome segment.
- INDEHISCENT gene refers herein to a gene that can contribute to pod shatter resistance in B. napus and A. thaliana.
- IND encodes a member of an atypical class of eukaryotic bHLH proteins which are required for seed dispersal.
- IND genes are involved in the differentiation of all three cell types required for fruit dehiscence and acts as the key regulator in a network that controls specification of the valve margin. Examples of IND gene sequences include BnIND-N and BnIND-C sequences disclosed herein.
- “fully shattered pods” are those with both valves detached from the replum and all seeds dispersed.
- “Half shattered pods” are those with one valve fully or partially detached from the replum, seeds dispersed, though the second valve is still attached and all or some seeds remain between the attached valve and the septum.
- “Unshattered pods” have both valves attached to the replum and seeds are contained between both valves and the septum.
- the “Percent shattered pods” or “SHTPC” is used herein as a quantitative measure of seed pod integrity after a laboratory assay or field trial shatter inducing treatment.
- SHTPC refers to the number of fully shattered + half shattered pods/total number of pods * 100%. In field trial results, SHTPC refers to the number of fully shattered/total number of pods * 100%.
- introgression refers to the transmission of an allele at a genetic locus into a genetic background.
- introgression of a specific allele form at the locus may occur by transmitting the allele form to at least one progeny via a sexual cross between two parents of the same species, where at least one of the parents has the specific allele form in its genome.
- Progeny comprising the specific allele form may be repeatedly backcrossed to a line having a desired genetic background. Backcross progeny may be selected for the specific allele form, so as to produce a new variety wherein the specific allele form has been fixed in the genetic background.
- introgression of a specific allele form may occur by recombination between two donor genomes (e.g., in a fused protoplast), where at least one of the donor genomes has the specific allele form in its genome.
- Introgression may involve transmission of a specific allele form that may be, for example and without limitation, a selected allele form of a marker allele, a QTL, and/or a transgene.
- introgression may involve transmission of one or more alleles of the Variant 2 allele (provided by this disclosure) into a progeny plant.
- an “isolated” biological component such as a nucleic acid or protein
- a nucleic acid has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component naturally occurs (i.e., other chromosomal and extra-chromosomal DNA and RNA, and proteins), while effecting a chemical or functional change in the component.
- a nucleic acid may be isolated from a chromosome by breaking chemical bonds connecting the nucleic acid to the remaining DNA in the chromosome and/or the other material previously associated with the nucleic acid in its cellular milieu (e.g., the nucleus).
- Nucleic acid molecules and proteins that have been “isolated” include nucleic acid molecules and proteins that are enriched or purified.
- the term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell, as well as chemically-synthesized nucleic acid molecules, proteins, and peptides.
- Marker Unlike DNA sequences that encode proteins, which are generally well- conserved within a species, other regions of DNA (e.g., non-coding DNA and introns) tend to develop and accumulate polymorphism, and therefore may be variable between individuals of the same species.
- the genomic variability can be of any origin, for example, the variability may be due to DNA insertions, deletions, duplications, repetitive DNA elements, point mutations, recombination events, and the presence and sequence of transposable elements.
- regions may contain useful molecular genetic markers.
- any differentially inherited polymorphic trait including nucleic acid polymorphisms that segregates among progeny is a potential marker.
- a marker refers to a nucleic acid or encoded product thereof (e.g., a protein) used as a point of reference when identifying a linked locus.
- a marker may refer to a gene or nucleic acid that can be used to identify plants having a particular allele.
- a marker may be described as a variation at a given genomic locus.
- a genetic marker may be a short DNA sequence, such as a sequence surrounding a single base-pair change (single nucleotide polymorphism, or “SNP”), or a long one, for example, a microsatellite/simple sequence repeat (“SSR”).
- SNP single nucleotide polymorphism
- SSR microsatellite/simple sequence repeat
- a “marker allele” or “marker allele form” refers to the version of the marker that is present in a particular individual.
- the term “marker” as used herein may refer to a cloned segment of chromosomal DNA and may also or alternatively refer to a DNA molecule that is complementary to a cloned segment of chromosomal DNA.
- the term also refers to nucleic acid sequences complementary to genomic marker sequences, such as nucleic acid primers and probes.
- a marker may be described, for example, as a specific polymorphic genetic element at a specific location in the genetic map of an organism.
- a genetic map may be a graphical representation of a genome (or a portion of a genome, such as a single chromosome) where the distances between landmarks on the chromosome are measured by the recombination frequencies between the landmarks.
- a genetic landmark can be any of a variety of known polymorphic markers, for example and without limitation: simple sequence repeat (SSR) markers; restriction fragment length polymorphism (RFLP) markers; and single nucleotide polymorphism (SNP) markers.
- SSR markers can be derived from genomic or expressed nucleic acids (e.g., expressed sequence tags (ESTs)).
- Additional markers include, for example and without limitation, ESTs; amplified fragment length polymorphisms (AFLPs) (Vos et al., 1995, Nucl. Acids Res. 23:4407; Becker et al., 1995, Mol. Gen. Genet. 249:65; Meksem et al., 1995, Mol. Gen. Genet. 249:74); randomly amplified polymorphic DNA (RAPD); and isozyme markers.
- Isozyme markers may be employed as genetic markers, for example, to track isozyme markers or other types of markers that are linked to a particular first marker.
- Isozymes are multiple forms of enzymes that differ from one another with respect to amino acid sequence (and therefore with respect to their encoding nucleic acid sequences). Some isozymes are multimeric enzymes containing slightly different subunits. Other isozymes are either multimeric or monomeric, but have been cleaved from a pro-enzyme at different sites in the pro-enzyme amino acid sequence. Isozymes may be characterized and analyzed at the protein level or at the nucleic acid level. Thus, any of the nucleic acid based methods described herein can be used to analyze isozyme markers in particular examples.
- genetic marker alleles that are polymorphic in a population can be detected and distinguished by one or more analytic methods such as, PCR-based sequence specific amplification methods, RFLP analysis, AFLP analysis, isozyme marker analysis, SNP analysis, SSR analysis, allele specific hybridization (ASH) analysis, detection of amplified variable sequences of the plant genome, detection of self-sustained sequence replication, detection of simple sequence repeats (SSRs), randomly amplified polymorphic DNA (RAPD) analysis.
- analytic methods such as, PCR-based sequence specific amplification methods, RFLP analysis, AFLP analysis, isozyme marker analysis, SNP analysis, SSR analysis, allele specific hybridization (ASH) analysis, detection of amplified variable sequences of the plant genome, detection of self-sustained sequence replication, detection of simple sequence repeats (SSRs), randomly amplified polymorphic DNA (RAPD) analysis.
- SSRs simple sequence repeats
- RAPD randomly amplified polymorphic DNA
- markers are genetically linked to a QTL (or to another marker) are known to those of skill in the art and include, for example and without limitation, standard linear models (e.g., ANOVA or regression mapping; Haley and Knott, 1992, Heredity 69:315); and maximum likelihood methods (e.g., expectationmaximization algorithms; Lander and Botstein, 1989, Genetics 121 : 185-99; Jansen, 1992, Theor. Appl. Genet. 85:252-60; Jansen ,1993, Biometrics 49:227-31; Jansen, 1994, “Mapping of quantitative trait loci by using genetic markers: an overview of biometrical models,” In J. W.
- Exemplary statistical methods include single point marker analysis; interval mapping (Lander and Botstein, 1989, Genetics 121 : 185); composite interval mapping; penalized regression analysis; complex pedigree analysis; MCMC analysis; MQM analysis (Jansen, 1994, Genetics 138:871); HAPLO-IM+ analysis, HAPLO-MQM analysis, and HAPLO-MQM+ analysis; Bayesian MCMC; ridge regression; identity-by-descent analysis; and Haseman-Elston regression, any of which are suitable in the context of particular embodiments of the invention.
- Alternative statistical methods applicable to complex breeding populations that may be used to identify and localize QTLs in particular examples are described in U.S. Patent 6,399,855 and PCT International Patent Publication No. W00149104 A2. All of these approaches are computationally intensive and are usually performed with the assistance of a computer-based system comprising specialized software. Appropriate statistical packages are available from a variety of public and commercial sources, and are known to those of skill in the art.
- Marker-assisted selection is a process by which phenotypes are selected based on marker genotypes. Marker assisted selection includes the use of marker genotypes for identifying plants for inclusion in and/or removal from a breeding program or planting.
- Molecular marker technologies generally increase the efficiency of plant breeding through MAS.
- a molecular marker allele that demonstrates linkage disequilibrium with a desired phenotypic trait provides a useful tool for the selection of the desired trait in a plant population.
- the key components to the implementation of an MAS approach are the creation of a dense (information rich) genetic map of molecular markers in the plant germplasm; the detection of at least one QTL based on statistical associations between marker and phenotypic variability; the definition of a set of particular useful marker alleles based on the results of the QTL analysis; and the use and/or extrapolation of this information to the current set of breeding germplasm to enable marker-based selection decisions to be made.
- the genetic markers disclosed herein can be used in MAS programs to identity canola varieties that have or can generate progeny that have increased pod shatter resistance (when compared to parental varieties and/or otherwise isogenic plants lacking the Variant 2 allele), to identify individual canola plants comprising this increased pod shatter resistance trait, and to breed this trait into other canola varieties to improve their pod shatter resistance.
- a “marker set” or a “set” of markers or probes refers to a specific collection of markers (or data derived therefrom) that may be used to identify individuals comprising a trait of interest.
- a set of markers linked to Variant 2 allele may be used to identify a Brassica plant comprising one or more allele of the Variant 2 allele herein.
- Data corresponding to a marker set may be stored in an electronic medium. While each marker in a marker set may possess utility with respect to trait identification, individual markers selected from the set and subsets including some, but not all, of the markers may also be effective in identifying individuals comprising the trait of interest.
- a “mutated gene” or “modified gene” is a gene that has been altered through human intervention. Such a “mutated” or “modified” gene has a sequence that differs from the sequence of the corresponding non-mutated gene by at least one nucleotide addition, deletion, or substitution. In certain embodiments of the disclosure, the mutated gene comprises an excision or deletion of a sequence of nucleotides within that results from two double strands break which are specifically targeted to a genomic sequence by guide polynucleotide/Cas endonuclease system as disclosed herein.
- a “mutated” or “modified” plant is a plant comprising a mutated gene or deletion.
- a “targeted mutation” is a mutation in a gene (referred to as the target gene), including a native gene, that was made by altering a target sequence within the target gene using any method known to one skilled in the art, including a method involving a guided Cas endonuclease system as disclosed herein.
- mutant gene refers to a gene as found in its natural endogenous location with its own regulatory sequences.
- mutated or modified is not a native gene.
- nucleic acid molecule is a polymeric form of nucleotides, which can include both sense and anti-sense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above.
- a nucleotide refers to a ribonucleotide, deoxynucleotide, or a modified form of either type of nucleotide.
- a "nucleic acid molecule” as used herein is synonymous with “nucleic acid”, “nucleotide sequence”, “nucleic acid sequence", and “polynucleotide.” The term includes single- and double-stranded forms of DNA.
- a nucleic acid molecule can include either or both naturally occurring and modified nucleotides linked together by naturally occurring and/or non-naturally occurring nucleotide linkages.
- Nucleic acid molecules may be modified chemically or biochemically, or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications, such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g., peptides), intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.).
- uncharged linkages e.g., methyl phosphonates, phosphotriesters, phosphorami
- nucleic acid molecule also includes any topological conformation, including single-stranded, double-stranded, partially duplexed, triplexed, hairpinned, circular, and padlocked conformations.
- endogenous nucleic acid sequence refers to a nucleic acid sequence within a plant cell, (e.g. an endogenous allele of an IND gene present within the genome of a Brassica plant cell).
- SNP single-nucleotide polymorphism
- markers linked to a Variant 2 allele or BnIND-N deletion disclosed herein are SNP markers.
- Recent high-throughput genotyping technologies such as GoldenGate® and INFINIUM® assays (Illumina, San Diego, CA) may be used in accurate and quick genotyping methods by multiplexing SNPs from 384-plex to >100,000-plex assays per sample.
- phenotype means the detectable characteristics (e.g. susceptibility to pod shatter or pod shatter resistance) of a cell or organism which can be influenced by genotype.
- plant material refers to any processed or unprocessed material derived, in whole or in part, from a plant.
- a plant material may be a plant part, a seed, a fruit, a leaf, a root, a plant tissue, a plant tissue culture, a plant explant, or a plant cell.
- the term “plant” may refer to a whole plant, a cell or tissue culture derived from a plant, and/or any part of any of the foregoing.
- the term “plant” encompasses, for example and without limitation, whole plants; plant components and/or organs (e.g., leaves, stems, and roots); plant tissue; seed; and a plant cell.
- a plant cell may be, for example and without limitation, a cell in and/or of a plant, a cell isolated from a plant, and a cell obtained through culturing of a cell isolated from a plant.
- Brassica “plant” may refer to, for example and without limitation, a whole Brassica plant; multiple Brassica plants; Brassica plant cell(s); Brassica plant protoplast; Brassica tissue culture (e.g., from which a canola plant can be regenerated); Brassica plant callus; Brassica plant parts (e.g., seed, flower, cotyledon, leaf, stem, bud, root, and root tip); and Brassica plant cells that are intact in a Brassica plant or in a part of a Brassica plant.
- a plant or Brassica “line” refers to a group of plants that display little genetic variation (e.g., no genetic variation) between individuals for at least one trait. Inbred lines may be created by several generations of self-pollination and selection or, alternatively, by vegetative propagation from a single parent using tissue or cell culture techniques. As used herein, the terms “cultivar,” “variety,” and “type” are synonymous, and these terms refer to a line that is used for commercial production.
- POLYGALACTURONASE when used in connection with a gene allele or variant, refers herein to a gene allele that can contribute to pod shatter resistance in B. napus.
- polygalacturonase genes include RDPG1-A, RDPG1-C, BDPG1-A, RDPG1-C, PGAZ-A, PGAZ-C, or PGAZBRAN.
- POLYGALACTURONASE is involved in pectin degradation and subsequent loss of cell cohesion (Hadfield and Bennet 1998, Plant physiology, 117(2), 337-343.).
- PGAZ expression increases during a number of developmental processes thought to involve cell wall breakdown, including silique shattering (Jenkins et al., 1996, Journal of Exp. Botany, 47(1), 111-115; Jenkins et al., 1999, Plant, Cell & Environment, 22(2), 159-167; Ferrandiz, 2002, Journal of Exp. Botany, 53(377), 2031-2038), Gonzales- Carranza et al., 2002, Plant Physiology 128(2):534-543 and Petersen et al., 1996, Plant Molecular Biology 31(3):517-527.
- SHP when used in connection with a gene allele or variant, refers herein to a gene allele that can contribute to pod shatter resistance in B. napus. Examples of SHP variants that have been described as contributing to pod shatter resistance are disclosed, for example, in International Application Publication WO 2019/140009.
- Trait or phenotype The terms “trait” and “phenotype” are used interchangeably herein.
- the traits of particular interest are the pod shatter resistance trait disclosed herein.
- a “variety” or “cultivar” is a plant line that is used for commercial production which is distinct, stable and uniform in its characteristics when propagated. In the case of a hybrid variety or cultivar, the parental lines are distinct, stable, and uniform in their characteristics.
- BnIND-C Variant 2 [0076] Detection of BnIND-C Variant 2, [0077] The methods and assays of the disclosure are based, at least in part, on the discovery of an INDEHISCENT allele on Chromosome N13 (BnIND-C) of B. napus referred to herein as “Variant 2” or “Variant 2 allele”, which was unexpectedly found to enhance or contribute to the pod shatter resistance phenotype present in certain genetic backgrounds that provide a second trait that contributes to improved pod shatter resistance. For example, the Variant 2 allele unexpectedly contributes to an improvement in pod shatter resistance phenotype when combined with the BnIND- deletion disclosed herein.
- the Variant 2 allele disclosed herein can be detected by nucleotide sequencing and/or amplification of the genomic DNA, which will reveal the Variant 2 allele sequence disclosed herein.
- the Variant 2 allele can be detected by nucleotide sequencing and/or amplification of genomic sequencing flanking and including the alleles disclosed in Table 1 herein.
- Such sequencing or amplification of a Variant 2 allele will produce a sequencing product or amplicon comprising the codon changes disclosed in Table 1.
- detecting the Variant 2 allele can include DNA sequencing, amplification, or the combined amplification and sequencing of the breakpoint locus and 5 bp or more, 10 bp or more, 15 bp or more, 20 bp or more, 30 bp or more, 40 bp or more, 50 bp or more, 60 bp or more, 70 bp or more, 80 bp or more, 90 bp or more, 100 bp or more, 110 bp or more, 120 bp or more, 130 bp or more, 140 bp or more, 150 bp or more, 175 bp or more, 200 bp or more, 250 bp or more, 300 bp or more, 350 bp or more, 400 bp or more, 450 bp or more, 500 bp or more, 550 bp or more, or 600 bp or more of flanking sequence that is (i) upstream of a codon change disclosed in Table 1/Ex
- the Variant 2 allele disclosed herein can be detected by amplifying genomic sequence to produce an amplicon comprising one or more of the Variant 2 allele sequences identified in Table 1/Example 1 herein.
- the Variant 2 allele disclosed herein can be detected by nucleotide sequencing to detect the presence of the genomic sequence (including, e.g., by first amplifying genomic sequence and sequencing the amplicon or amplified genomic sequence) comprising a Variant 2 allele sequence identified in Table lor Example 1 herein.
- Detection of the Variant 2 allele disclosed herein can be done using any method for detecting polymorphisms. Additionally, such methods can be used to detect a polymorphic marker that is genetically linked to the Variant 2 allele. These methods include allele-specific amplification and PCR based amplification assays such as TaqMan, rhAmp-SNP, KASPar, and molecular beacons. Such an assay can include the use of one or more probes that detect the breakpoint locus of the Variant 2 allele, a marker associated with the Variant 2 allele, or an amplicon that is selectively amplified by amplification of genomic sequence comprising the Variant 2 allele. Optionally, such an assay can further include an additional set of primers and/or one or more probes that detect the presence of a BnIND-C allele(e.g., wild-type allele) that does not include the Variant 2 allele.
- allele-specific amplification and PCR based amplification assays
- Additional methods for genotyping and detecting the Variant 2 allele disclosed herein (or a linked marker) include but are not limited to, hybridization, primer extension, oligonucleotide ligation, nuclease cleavage, mini sequencing and coded spheres. Such methods are reviewed in publications including Gut, 2001, Hum. Mutat. 17:475; Shi, 2001, Clin. Chem. 47: 164; Kwok, 2000, Pharmacogenomics 1 :95; Bhattramakki and Rafalski, “Discovery and application of single nucleotide polymorphism markers in plants”, in PLANT GENOTYPING: THE DNA FINGERPRINTING OF PLANTS (CABI Publishing, Wallingford 2001).
- SBE single base extension
- Methods of detecting the Variant 2 allele disclosed herein also include LCR; and transcription-based amplification methods (e.g., SNP detection, SSR detection, RFLP analysis, and others).
- Useful techniques include hybridization of a probe nucleic acid to a nucleic acid corresponding to the Variant 2 allele disclosed herein, or a linked marker (e.g., an amplified nucleic acid produced using a genomic canola DNA molecule as a template).
- Hybridization formats including, for example and without limitation, solution phase; solid phase; mixed phase; and in situ hybridization assays may be useful for allele detection in particular embodiments.
- An extensive guide to hybridization of nucleic acids is discussed in Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology- Hybridization with Nucleic Acid Probes (Elsevier, NY. 1993).
- Markers corresponding to genetic polymorphisms between members of a population may be detected by any of numerous methods including, for example and without limitation, nucleic acid amplification-based methods, and nucleotide sequencing of a polymorphic marker region.
- Many detection methods including amplification-based and sequencing-based methods
- the detecting of a Variant 2 allele or a marker associated with that Variant 2 allele can be performed by any of a number or techniques, including, but not limited to, the use of nucleotide sequencing products, amplicons, or probes comprising detectable labels.
- Detectable labels suitable for use include any composition detectable by spectroscopic, radioisotopic, photochemical, biochemical, immunochemical, electrical, optical, or chemical means.
- a particular allele of a SNP may be detected using, for example, autoradiography, fluorography, or other similar detection techniques, depending on the particular label to be detected.
- Useful labels include biotin (for staining with labeled streptavidin conjugate), magnetic beads, fluorescent dyes, radiolabels, enzymes, and colorimetric labels.
- Other labels include ligands that bind to antibodies or specific binding targets labeled with fluorophores, chemiluminescent agents, and enzymes.
- detection techniques include the use of fluorescent dyes. Examples of fluorescent dyes include HEX fluorescent dye, VIC fluorescent dye, FAM fluorescent dye, JOE fluorescent dye, TET fluorescent dye, Cy 3 fluorescent dye, Cy 3.5 fluorescent dye, Cy 5 fluorescent dye, Cy 5.5 fluorescent dye, Cy 7 fluorescent dye, or ROX fluorescent dye
- the Variant 2 allele disclosed herein is associated with a pod shatter resistance trait. Therefore, any of the methods of detecting the Variant 2 allele can be used to detect the presence of a pod shatter resistance trait which is heritable and therefore useful in a breeding program, for example to create progeny Brassica plants comprising the Variant 2 allele (alone or in combination with a second pod shatter resistance trait such as a Pod Shatter Trait disclosed herein) and one or more other desirable agronomic or end use qualities.
- the invention provides a method of selecting, detecting and/or identifying a Brassica plant, cell, or germplasm thereof (e.g., a seed) having an allele that contributes to pod shatter resistance. The method comprises detecting in said Brassica plant, cell, or germplasm thereof, the presence of the Variant 2 allele or a marker associated with the Variant 2 allele and thereby identifying a Brassica plant having the allele that contributes to pod shatter resistance.
- identification of Brassica e.g., B. napus, B. juncea, B. carinala, B. rapa or B. oleracea plants or germplasm comprising the Variant 2 allele that contributes to pod shatter resistance
- Brassica e.g., B. napus, B. juncea, B. carinala, B. rapa or B. oleracea plants or germplasm comprising the Variant 2 allele that contributes to pod shatter resistance
- at least one Brassica plant that comprises the Variant 2 allele is selected for; and plants that do not include the Variant 2 allele may be selected against.
- This disclosure thus provides methods for selecting a canola plant having a trait that contributes to pod shatter resistance, which methods comprise detecting in the plant the Variant 2 allele (or one or more genetic markers associated with the Variant 2 allele).
- This can be used in a method for selecting such a plant, the method comprises providing a sample of genomic nucleic acid from a. Brassica plant; and (b) using any method disclosed herein for detecting in the sample the Variant 2 allele (or at least one genetic marker associated with the Variant 2 allele).
- This disclosure also provides a method comprising the transfer by introgression of the Variant 2 allele from one plant into a recipient plant by crossing the plants.
- This transfer can be accomplished using, e.g., traditional breeding techniques to improve the pod shatter resistance of the recipient plant and/or the progeny of the recipient plant.
- Variant 2 allele is introgressed into one or more commercial or elite Brassica varieties using marker- assisted selection (MAS) or marker-assisted breeding (MAB).
- MAS marker- assisted selection
- MAB marker-assisted breeding
- MAS and MAB involve the use of one or more molecular markers that indicate the presence or co- segregation with Variant 2 allele, and used for the identification and selection of those offspring plants that contain Variant 2 allele, e.g., by detecting a genomic sequence or amplicon disclosed herein which distinguishes the Variant 2 allele from a BnIND-C (e.g., wild-type) allele that differs from Variant 2 allele.
- BnIND-C e.g., wild-type
- MAS is particularly suitable for introgressing Variant 2 allele into a plant line that includes one or more additional desirable traits. Additional desirable traits can include another Pod Shatter Trait (see non-limiting examples disclosed herein), disease or herbicide resistance trait, or an end use trait such as oil quality or meal quality.
- Another use of MAS in plant breeding is to assist the recovery of the recurrent parent genotype by backcross breeding.
- Backcross breeding is the process of crossing a progeny back to one of its parents. Backcrossing is usually done for the purpose of introgressing one or a few loci from a donor parent, i.e., the Variant 2 allele, into an otherwise desirable genetic background from the recurrent parent. The more cycles of backcrossing that are done, the greater the genetic contribution of the recurrent parent to the resulting variety. This is desirable when the recurrent parent is an elite variety and/or has more desirable qualities than the donor plant, even though the recurrent parent may need improved pod shatter resistance. For example, backcrossing can be desirable when a recurrent plant provides better disease resistance, herbicide resistance, yield, fecundity, oil and/or meal qualities and the like, as compared to the donor Variant 2 allele-containing plant.
- MAB can also be used to develop near-isogenic lines (NIL) harboring the Variant 2 allele disclosed herein, allowing a more detailed study of an effect of such allele.
- MAB is also an effective method for development of backcross inbred line (BIL) populations. Brassica plants developed according to these embodiments can derive a majority of their traits from the recipient plant and derive the pod shatter resistance from the donor Variant 2 allele-containing plant.
- MAB/MAS techniques increase the efficiency of backcrossing and introgressing genes using marker-assisted selection (MAS) or marker-assisted breeding (MAB).
- inbred Variant 2 allele plant lines can be developed using the techniques of recurrent selection and backcrossing, selfing, and/or dihaploids, or any other technique used to make parental lines.
- the Variant 2 allele can be introgressed into a target recipient plant (the recurrent parent) by crossing the recurrent parent with a first donor plant, which differs from the recurrent parent and is referred to herein as the “non-recurrent parent.”
- the recurrent parent is a plant that, in some cases, comprises commercially desirable characteristics, such as, but not limited to another Pod Shatter Trait (see non-limiting examples disclosed herein), disease and/or herbicide resistance, valuable nutritional characteristics, valuable abiotic stress tolerance (including, but not limited to, drought tolerance, salt tolerance), and the like.
- the non-recurrent parent can be any plant variety or inbred line that is cross-fertile with the recurrent parent.
- the resulting progeny plant population is then screened for the desired characteristics, including the Variant 2 allele, which screening can occur in a number of different ways.
- the progeny population can be screened using phenotypic pathology screens or quantitative bioassays as are known in the art.
- bioassays instead of using bioassays, MAS or MAB can be performed using one or more of molecular markers described herein to identify progeny plants or germplasm that comprise a Variant 2 allele.
- MAS or MAB can be used to confirm the results obtained from the quantitative bioassays.
- the markers, primers, and probes described herein can be used to select progeny plants by genotypic screening.
- the F 1 progeny (e.g., hybrid) plants having the Variant 2 allele can be selected and backcrossed to the recurrent parent for one or more generations in order to allow for the canola plant to become increasingly inbred. This process can be repeated for one, two, three, four, five, six, seven, eight, or more generations.
- the recurrent parent plant or germplasm used in this method is of an elite variety of the Brassica species.
- this crossing and introgression method can be used to produce a progeny Brassica plant or germplasm having the Variant 2 allele introgressed into a genome that is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% identical to that of the elite variety of the Brassica species.
- Also provided is a method of producing a plant, cell, or germplasm (e.g., seed thereof) that comprises crossing a first Brassica plant or germplasm with a second Brassica plant or germplasm, wherein said first Brassica plant or germplasm comprises within its genome the Variant 2 allele disclosed herein, collecting seed from the cross and growing a progeny Brassica plant from the seed, wherein said progeny Brassica plant comprises in its genome said Variant 2 allele, thereby producing a progeny plant that carries the allele that contributes to the improved pod shatter resistance trait disclosed herein.
- a Brassica plant, cell, or germplasm having the Variant 2 allele may be produced by any method whereby the Variant 2 allele is introduced into or generated in the canola plant or germplasm by such methods that include, but are not limited to, transformation (including, but not limited to, bacterial-mediated nucleic acid delivery (e.g., via Agrobacteria)), viral-mediated nucleic acid delivery, silicon carbide or nucleic acid whisker-mediated nucleic acid delivery, liposome mediated nucleic acid delivery, microinjection, microparticle bombardment, electroporation, sonication, infiltration, PEG- mediated nucleic acid uptake, as well as any other electrical, chemical, physical (mechanical) and/or biological mechanism that results in the introduction of nucleic acid into the plant cell, or any combination thereof, protoplast transformation or fusion, a double haploid technique, embryo rescue, or by any other nucleic acid transfer system.
- transformation including, but not limited to, bacterial-mediated nucleic acid delivery (e.g.
- “Introducing” in the context of a plant cell, plant and/or plant part means contacting a nucleic acid molecule with the plant, plant part, and/or plant cell in such a manner that the nucleic acid molecule gains access to the interior of the plant cell and/or a cell of the plant and/or plant part.
- these nucleic acid molecules can be assembled as part of a single polynucleotide or nucleic acid construct, or as separate polynucleotide or nucleic acid constructs, and can be located on the same or different nucleic acid constructs.
- these polynucleotides can be introduced into plant cells in a single transformation event, in separate transformation events, or, e.g., as part of a breeding protocol.
- transformation refers to the introduction of a heterologous nucleic acid into a cell.
- Example 1 Discovery of BnIND-C variants.
- SNPs were identified in the N13 chromosome BnIND-C gene.
- Genotype comparisons identified two variants, each containing SNPs that produce amino acid changes relative to the coding sequence of NS1822BC reference genome.
- the two variants are referenced herein as Variant 1 and Variant 2.
- the genomic positions (relative to NS1822BC reference genome) and each polymorphism found in Variant 1 and Variant 2 are shown in Table 4, which also indicates whether the variant SNP allele encodes an amino acid change or a silent mutation, and discloses the corresponding position of each SNP in SEQ ID NO: 1, 3, or 5 (CDS SNP position).
- Variantl and Variant 2 were found to encode the following amino acid substitutions shown in Table 4: arginine to cysteine and isoleucine to methionine. Variant 2 was found to encode an additional proline to histidine mutation, such that Variant 2 includes three amino acid changes.
- a laboratory assay was developed to evaluate the shatter resistance (integrity) of pods subjected to mechanical agitation at a specific speeds and times.
- GENO/GRINDER device SPEX®SamplePrep, Metuchen, NJ was used to mechanically break canola pods and thereby assess shattering resistance or susceptibility.
- Pods with pedicels were harvested at maturity in the field at Marseville, Ontario, Canada in two different years. They were kept in the dryer at 26°C for one week before testing to ensure dryness/uniformity of material.
- Pods of similar sizes were harvested for each entry in both years for each genotype. Ten pods from individual plants were placed in plastic boxes of 12 x 8.5 x 6.5 cm and mechanically agitated for 15 seconds at 1500 rpm using GENO/GRINDER device. After disruption, individual pods were scored according to half shattered (one valve detached from the replum and about half seeds dispersed), fully shattered (both valves detached from the replum and seeds dispersed), and unshattered phenotype (both valves attached and containing seeds). This was repeated three times for each variety.
- Example 3 Laboratory and Field Testing of Pod Shatter Resistance in plants that combine BnIND-C Variant 2 and BnIND- deletion.
- BnIND-C Variant 2 allele can contribute to pod shatter resistance. Brassica napus plants were grown in Marseville, Ontario, Canada in 2020 and 2021. Pods with pedicels were harvested at maturity in the field.
- Example 2 Laboratory pod integrity testing was performed as described in Example 2, with the following modifications: pods were mechanically agitated at 1300 rpm for 10 seconds in the GENO/GRINDER device; and total number of shattered pods was calculated as the sum of the fully shattered pods and half shattered pods. As in Example 2, testing was repeated three times for each line tested.
- SHTPC Percent shattered pods
- Example 4 Allelic Studies of BnIND-C Variant 2 Provide Additional Shatter Resistance in Reduced Pod Shatter Background.
- SHTPC Percent shattered pods
- Example 5 Introgression of BnIND-N deletion into BnIND-C Variant 2 lines [0120] Further testing was done to confirm the interaction of BnIND-N and BnIND-C Variant 2 allele in the field.
- a BnIND-N deletion (aa) was introgressed into plants that were either homozygous for BnIND-C Variant 2 (cc) or wild-type BnIND-C (CC).
- Field testing was done as described in Example 3 (year 2021) and included the evaluations of six inbreds for each genotype and comparing them to their respective base (prior to introgression) wild-type BnIND-N (AA) genotypes. Results are shown in Table 9.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Botany (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Environmental Sciences (AREA)
- Biotechnology (AREA)
- Developmental Biology & Embryology (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202263315788P | 2022-03-02 | 2022-03-02 | |
| PCT/US2023/063403 WO2023168213A2 (en) | 2022-03-02 | 2023-02-28 | Ind variants and resistance to pod shatter in brassica |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP4486114A2 true EP4486114A2 (en) | 2025-01-08 |
| EP4486114A4 EP4486114A4 (en) | 2026-02-18 |
Family
ID=87884317
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP23764045.3A Pending EP4486114A4 (en) | 2022-03-02 | 2023-02-28 | IND variants and resistance to pod breakage in Brassica |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP4486114A4 (en) |
| AU (1) | AU2023227524A1 (en) |
| CA (1) | CA3244569A1 (en) |
| CL (1) | CL2024002589A1 (en) |
| WO (1) | WO2023168213A2 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN118853746A (en) * | 2024-09-03 | 2024-10-29 | 中国农业科学院油料作物研究所 | Application of Brassica BnNST2 gene in improving the crack resistance of rapeseed siliques |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA3288083A1 (en) * | 2008-07-17 | 2025-11-29 | BASF Agricultural Solutions Seed US LLC | Brassica partial knockout mutant indehiscent alleles |
| CN109879945B (en) * | 2019-03-21 | 2021-05-28 | 华中农业大学 | The function and application of the anti-cracking horn gene BnIND in Brassica napus |
| WO2020257251A1 (en) * | 2019-06-19 | 2020-12-24 | Pioneer Hi-Bred International, Inc. | Compositions and methods for improving pod shatter tolerance in canola |
-
2023
- 2023-02-28 AU AU2023227524A patent/AU2023227524A1/en active Pending
- 2023-02-28 EP EP23764045.3A patent/EP4486114A4/en active Pending
- 2023-02-28 CA CA3244569A patent/CA3244569A1/en active Pending
- 2023-02-28 WO PCT/US2023/063403 patent/WO2023168213A2/en not_active Ceased
-
2024
- 2024-08-29 CL CL2024002589A patent/CL2024002589A1/en unknown
Also Published As
| Publication number | Publication date |
|---|---|
| WO2023168213A2 (en) | 2023-09-07 |
| EP4486114A4 (en) | 2026-02-18 |
| WO2023168213A3 (en) | 2023-10-05 |
| CL2024002589A1 (en) | 2025-01-31 |
| AU2023227524A1 (en) | 2024-08-29 |
| CA3244569A1 (en) | 2023-09-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2020202265B2 (en) | Genetic markers for myb28 | |
| US20260035709A1 (en) | Pod shatter tolerance in brassica plants | |
| US12295309B2 (en) | Melon with red flesh linked to earliness | |
| WO2022164752A1 (en) | Clubroot resistance in brassica | |
| US12612668B2 (en) | SNP markers and selection of low fiber in brassica | |
| EP2102364B1 (en) | Genetic markers for orobanche resistance in sunflower | |
| WO2023168213A2 (en) | Ind variants and resistance to pod shatter in brassica | |
| US20260076322A1 (en) | Brassica cytoplasmic male sterility (cms) fertility restorer nucleic acids, markers, methods, and zygosity assays | |
| AU2019402999B2 (en) | SNP markers and selection of low fiber in Brassica | |
| WO2024076956A2 (en) | N15 deletion qtl for low fiber, compositions and methods in brassica | |
| RU2849753C2 (en) | New genetic loci associated with disease resistance in soybeans | |
| RU2834673C2 (en) | Snp markers and selection for low fiber content in members of genus brassica | |
| WO2024107714A2 (en) | Improved white corn | |
| WO2024015712A2 (en) | Novel loci in grapes | |
| US20250338807A1 (en) | Clubroot resistance in brassica |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20240813 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20260119 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: A01H 6/20 20180101AFI20260113BHEP Ipc: A01H 5/10 20180101ALI20260113BHEP |