EP4444284A1 - Mitofusin inhibitors and uses thereof - Google Patents
Mitofusin inhibitors and uses thereofInfo
- Publication number
- EP4444284A1 EP4444284A1 EP22905260.0A EP22905260A EP4444284A1 EP 4444284 A1 EP4444284 A1 EP 4444284A1 EP 22905260 A EP22905260 A EP 22905260A EP 4444284 A1 EP4444284 A1 EP 4444284A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- alkyl
- 6alkyl
- cancer
- compound
- pharmaceutically acceptable
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C215/00—Compounds containing amino and hydroxy groups bound to the same carbon skeleton
- C07C215/46—Compounds containing amino and hydroxy groups bound to the same carbon skeleton having hydroxy groups bound to carbon atoms of at least one six-membered aromatic ring and amino groups bound to acyclic carbon atoms or to carbon atoms of rings other than six-membered aromatic rings of the same carbon skeleton
- C07C215/48—Compounds containing amino and hydroxy groups bound to the same carbon skeleton having hydroxy groups bound to carbon atoms of at least one six-membered aromatic ring and amino groups bound to acyclic carbon atoms or to carbon atoms of rings other than six-membered aromatic rings of the same carbon skeleton with amino groups linked to the six-membered aromatic ring, or to the condensed ring system containing that ring, by carbon chains not further substituted by hydroxy groups
- C07C215/50—Compounds containing amino and hydroxy groups bound to the same carbon skeleton having hydroxy groups bound to carbon atoms of at least one six-membered aromatic ring and amino groups bound to acyclic carbon atoms or to carbon atoms of rings other than six-membered aromatic rings of the same carbon skeleton with amino groups linked to the six-membered aromatic ring, or to the condensed ring system containing that ring, by carbon chains not further substituted by hydroxy groups with amino groups and the six-membered aromatic ring, or the condensed ring system containing that ring, bound to the same carbon atom of the carbon chain
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C233/00—Carboxylic acid amides
- C07C233/01—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms
- C07C233/16—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by singly-bound oxygen atoms
- C07C233/17—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by singly-bound oxygen atoms with the substituted hydrocarbon radical bound to the nitrogen atom of the carboxamide group by an acyclic carbon atom
- C07C233/18—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by singly-bound oxygen atoms with the substituted hydrocarbon radical bound to the nitrogen atom of the carboxamide group by an acyclic carbon atom having the carbon atom of the carboxamide group bound to a hydrogen atom or to a carbon atom of an acyclic saturated carbon skeleton
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C235/00—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms
- C07C235/42—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings and singly-bound oxygen atoms bound to the same carbon skeleton
- C07C235/44—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings and singly-bound oxygen atoms bound to the same carbon skeleton with carbon atoms of carboxamide groups and singly-bound oxygen atoms bound to carbon atoms of the same non-condensed six-membered aromatic ring
- C07C235/58—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings and singly-bound oxygen atoms bound to the same carbon skeleton with carbon atoms of carboxamide groups and singly-bound oxygen atoms bound to carbon atoms of the same non-condensed six-membered aromatic ring with carbon atoms of carboxamide groups and singly-bound oxygen atoms, bound in ortho-position to carbon atoms of the same non-condensed six-membered aromatic ring
- C07C235/64—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings and singly-bound oxygen atoms bound to the same carbon skeleton with carbon atoms of carboxamide groups and singly-bound oxygen atoms bound to carbon atoms of the same non-condensed six-membered aromatic ring with carbon atoms of carboxamide groups and singly-bound oxygen atoms, bound in ortho-position to carbon atoms of the same non-condensed six-membered aromatic ring having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a six-membered aromatic ring
Definitions
- Mitochondria provide eukaryotic cells with a means to generate significant quantities of ATP through oxidative phosphorylation. They are also potentially dangerous organelles because of their abilities to generate reactive oxygen and nitrogen species and mediate cell death. In part because of these liabilities, mitochondria engage in repeated cycles of fission and fusion. These events, referred to in the aggregate as mitochondrial dynamics, are tightly coupled with the elimination of damaged mitochondria through macroautophagy (mitophagy) and with mitochondrial biogenesis, processes which together maintain the health of the mitochondrial collective in a cell.
- mitochondrial dynamics are tightly coupled with the elimination of damaged mitochondria through macroautophagy (mitophagy) and with mitochondrial biogenesis, processes which together maintain the health of the mitochondrial collective in a cell.
- Mitochondrial fusion is a two step process; the first step requires the fusion of the outer mitochondrial membrane (OMM), which is mediated by mitofusin- 1 (MFN1) and mitofusin- 2 (MFN2).
- MFN1 and MFN2 are mediator of mitochondrial fusion. They are mitochondrial membrane proteins that interact with each other to facilitate mitochondrial targeting.
- the second step requires the fusion of the inner mitochondrial membrane, which is mediated by optic atrophy - 1 (OPA1). Loss of either MFN1/2 or OPA1 proteins results in a network of hyper-fragmented mitochondria.
- MFN1 knockout cells display severe mitochondrial fragmentation with formation of small spheres of similar size and MFN2 knockout cells display mitochondrial spheres or ovals of variable but larger size.
- Overexpression of either MFN1 or MFN2 in wild type cells leads to extensive mitochondrial clustering in the perinuclear area.
- overexpression of MFN1 in MFN2 KO and MFN2 in MFN1 KO cells restores mitochondrial fusion, highlighting the degree of redundancy between the MFN proteins.
- Mitofusins reside in the outer mitochondrial membrane and regulate mitochondrial fusion, a physiological process that impacts diverse cellular processes. Mitofusins are activated by conformational changes and subsequently oligomerize to enable mitochondrial fusion. Mitofusin activation increases mitochondrial fusion and functionality, whereas mitofusin inhibition decreases mitochondrial fusion and functionality.
- mitofusin inhibition also induces minority mitochondrial outer membrane permeabilization (MOMP), followed by sub-lethal caspase-3/7 activation, which induces DNA damage and upregulated DNA damage response genes.
- MOMP minority mitochondrial outer membrane permeabilization
- This patent disclosure provides compounds that induce fragmented mitochondria and lead to decreased membrane potential, mitochondrial respiration and ATP production.
- An aspect of the patent document provides a compound of Formula I and pharmaceutically acceptable salts thereof.
- compositions comprising a therapeutically effective amount of a compound of Formula (I) disclosed herein or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.
- Another aspect provides a method for treating a disease or condition. The method includes administering to a subject in need thereof a compound of formula (I), a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof.
- Another aspect provides a method for inhibiting mitofusin-mediated mitochondrial fusion. The method includes contacting a cell with an effective amount of the compound of formula (I) or a pharmaceutically acceptable salt thereof or a pharmaceutical composition thereof. DESCRIPTION OF THE DRAWINGS [0011] Fig.
- Fig. 1A shows a pharmacophore hypothesis based on the sidechains of the HR1- amino acids: Val372, Met376, His380 interacting with HR2 comprising of 3 hydrophobic points, one aromatic ring and one hydrogen bond donor.
- Fig.1B shows the chemical structure of MASM7.
- Fig. 2A shows a pharmacophore hypothesis based on the sidechains of the HR1- amino acids: Leu408, Ala412, Tyr415 interacting with HR2 comprising 2 hydrophobic points, one aromatic ring and one hydrogen bond donor or acceptor.
- Fig.2B shows the chemical structures of MFI8 and its analogs.
- FIG. 2C illustrates a pharmacophore model of an inhibitor of mitofusin-mediated mitochondrial fusion.
- Fig. 4 shows that MFI8 reduces viability in melanoma cells. MFI8 concentration responsively reduces viability in A375 (A) and SKML-30 (B) cells. Cell titer Glo was used to measure viability.
- FIG. 7 shows that MFI8 reduces viability in lung cancer cells.
- MFI8 concentration responsively reduces viability in Calu-6 (A), H2405 (B) cells.
- Cell titer Glo was used to measure viability.
- Fig.8 shows that MFI8 induces apoptosis in Calu-6 cells.
- Calu-6 cells were treated with MFI8 (20 ⁇ ).
- alkyl refers to a hydrocarbon or a hydrocarbon chain which may be either straight-chained or branched.
- C1-6 alkyl refers to alkyl groups having 1, 2, 3, 4, 5 or 6 carbon atoms. Non-limiting examples include groups such as CH 3 , (CH 2 ) 2 CH 3 , CH2CH(CH3)CH3, and the like.
- C2-5 alkyl refers to alkyl groups having 2, 3, 4 or 5 carbon atoms.
- alkylene refers to a divalent hydrocarbon or a hydrocarbon chain which may be either straight-chained or branched.
- Non-limiting examples include groups such as CH2, (CH2)2CH2, CH2CH(CH3)CH2, and the like.
- a C1-3alkylene includes alkylenes with 1, 2 or 3 carbons such as CH 2 , (CH 2 ) 2 , CHCH 3 ,(CH 2 ) 3 , and CH(CH 3 )CH 2 .
- the term "cycloalkyl” refers to saturated and partially unsaturated cyclic hydrocarbon groups having 3 to 12 ring carbons, for example 3 to 8 carbons, and as a further example 3 to 6 carbons, wherein the cycloalkyl group additionally is optionally substituted.
- cycloalkyl groups include, without limitation, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, and cyclooctyl.
- aryl refers to a C6-14 aromatic moiety comprising one to three aromatic rings, which is optionally substituted. Examples of aryl groups include, without limitation, phenyl, naphthyl, anthracenyl, fluorenyl, and dihydrobenzofuranyl.
- alkeny refers to a carbon chain containing a carbon-carbon double bond moiety.
- alkenyl groups include ethylenyl, 1-propenyl, allyl and 2- butenyl.
- alkynyl refers to a caron chain containing a carbon-carbon triple bond moiety.
- alkynyl groups include ethynyl, 1-propanyl, propargyl and 2-butynyl.
- haloalkyl refers to a C 6 - 10 alkyl chain, straight or branched, in which one or more hydrogen has been replaced by a halogen.
- Non-limiting examples of haloalkyls include CHF 2 , CFH 2 , CF 3 , CH 2 CHF 2 , CH 2 CH 2 Cl, CH 2 CF 3 , and CH 2 CH 2 F.
- the alkyl in haloalkyl has 1, 2, 3 or 4 carbons.
- the term “heteroalkyl” refers to a C6-10alkyl group, straight or branched, wherein one or more carbon atoms in the chain are replaced by one or more heteroatoms selected from the group consisting of O, S, N and NR m .
- the alkyl in heteroalkyl has 1 to 10 carbons.
- the alkyl in heteroalkyl has 2, 3, 4 or more than 2 carbons.
- hydroxyalkyl refers to a C6-10alkyl chain, straight or branched, wherein a carbon is substituted with a hydroxyl group. The carbon the hydroxyl is attached to is a primary carbon or secondary carbon.
- the alkyl in hydroxylalkyl has 2, 3, 4 or more than 2 carbons.
- dihydroxyalkyl refers to a C 2 - 10 alkyl chain, straight or branched, wherein two carbons are each substituted with a hydroxyl group.
- the alkyl in dihydroxylalkyl has 2, 3, 4 or more than 2 carbons.
- the term “heterocyclyl” or “heterocyclic” group is a ring structure having from about 3 to about 12 atoms, for example 4 to 8 atoms, wherein one or more atoms are selected from the group consisting of N, O, and S, the remainder of the ring atoms being carbon.
- the heterocyclyl may be a monocyclic, a bicyclic, a spirocyclic or a bridged ring system.
- heterocyclic groups include, without limitation, epoxy, azetidinyl, aziridinyl, azocanyl, azepanyl, diazepanyl, dihydrofuranyl, tetrahydrofuranyl, tetrahydropyranyl, oxazepanyl, pyrrolidinyl, pyrrolidinonyl, piperidinyl, piperazinyl, imidazolidinyl, thiazolidinyl, thiooxazepanyl, dithianyl, trithianyl, dioxolanyl, oxazolidinyl, oxazolidinonyl, decahydroquinolinyl, piperidonyl, 4-piperidinonyl, thiomorpholinyl, thiomorpholinyl 1,1 dioxide, morpholinyl, oxazepanyl, azabicyclohexanes, azabicycloheptanes and
- heteroaryl refers to groups having 5 to 14 ring atoms, preferably 5, 6, 9, or 10 ring atoms; having 6, 10, or 14 ⁇ electrons shared in a cyclic array; and having, in addition to carbon atoms, from one to three heteroatoms per ring selected from the group consisting of N, O, and S.
- heteroaryl groups include acridinyl, azocinyl, benzimidazolyl, benzofuranyl, benzothiofuranyl, benzothiophenyl, benzoxazolyl, benzthiazolyl, benztriazolyl, benztetrazolyl, benzisoxazolyl, benzisothiazolyl, benzimidazolinyl, carbazolyl, 4aH-carbazolyl, carbolinyl, chromanyl, chromenyl, cinnolinyl, furanyl, furazanyl, imidazolinyl, imidazolyl, 1H- indazolyl, indolenyl, indolinyl, indolizinyl, indolyl, 3H-indolyl, isobenzofuranyl, isochromanyl, isoindazolyl, isoindolinyl, isoindolyl,
- halogen refers to F, Cl, Br or I.
- subject refers to humans or animals including for example sheep, horses, cattle, pigs, dogs, cats, rats, mice, birds, and reptiles. Preferably, the subject is a human or other mammal.
- effective amount or “therapeutically effective amount” of a compound is an amount that is sufficient to ameliorate, or in some manner reduce a symptom or stop or reverse progression of a condition, or negatively modulate or inhibit activity. Such amount may be administered as a single dosage or may be administered according to a regimen, whereby it is effective.
- hydrogen bond donor refers to a group containing a hydrogen, which can be form a hydrogen bond with another electronegative atom such as F, N or O.
- Non-limiting examples of hydrogen bond donor include OH and NH 2 , which can share its hydrogen with electron rich atoms to form a hydrogen bond.
- hydrogen bond acceptor refers to a group or atom rich in electrons, which can form a hydrogen bond with a hydrogen bond donor.
- Non-limiting examples of hydrogen bond acceptor include O, N and F.
- pharmaceutically acceptable refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues, organs, and/or bodily fluids of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit/risk ratio.
- pharmaceutically acceptable carrier refers to a chemical compound that facilitates the delivery or incorporation of a compound or therapeutic agent into cells or tissues.
- salts means salts of compounds of the present invention which are pharmaceutically acceptable, as defined above, and which possess the desired pharmacological activity.
- Non-limiting examples of such salts include acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid; or with organic acids such as 1,2-ethanedisulfonic acid, 2-hydroxyethanesulfonic acid, 2-naphthalenesulfonic acid, 3 -phenylpropionic acid,
- Pharmaceutically acceptable salts also include base addition salts which may be formed when acidic protons present are capable of reacting with inorganic or organic bases.
- Acceptable inorganic bases include sodium hydroxide, sodium carbonate, potassium hydroxide, aluminum hydroxide and calcium hydroxide.
- Nonlimiting examples of acceptable organic bases include ethanolamine, diethanolamine, ethylenediamine, triethanolamine, tromethamine, and /V-methylglucamine. It should be recognized that the particular anion or cation forming a part of any salt of this invention is not critical, so long as the salt, as a whole, is pharmacologically acceptable. Additional examples of pharmaceutically acceptable salts and their methods of preparation and use are presented in Handbook of Pharmaceutical Salts: Properties, and Use (P. H. Stahl & C. G. Wermuth eds., Verlag Helvetica Chimica Acta, 2002).
- composition refers to a mixture of a compound disclosed herein with other chemical components, such as diluents or additional carriers.
- the pharmaceutical composition facilitates administration of the compound to an organism. Multiple techniques of administering a pharmaceutical composition exist in the art including, but not limited to, oral, injection, aerosol, parenteral, intranasal, sublingual, inhalational, and topical administration.
- pharmaceutically acceptable salts of the compounds disclosed herein are provided.
- treating refers, in some embodiments, to ameliorating the disease or disorder (i.e., arresting or reducing the development of the disease or at least one of the clinical signs and symptoms thereof). In some embodiments “treating” or “treatment” refers to ameliorating at least one physical parameter, which may not be discernible by the subject. In some embodiments, “treating” or “treatment” refers to modulating the disease or disorder, either physically, (e.g., stabilization of a discernible symptom), physiologically, (e.g., stabilization of a physical parameter), or both. In some embodiments, “treating” or “treatment” refers to delaying the onset of the disease or disorder, or even preventing the same. “Prophylactic treatment” is to be construed as any mode of treatment that is used to prevent progression of the disease or is used for precautionary purpose for persons at risk of developing the condition.
- Mitochondria fuse divide and interact with other organelle structures to regulate cellular fitness and fate while they produce the majority of energy to sustain cellular activity. They are highly dynamic organelles constantly undergoing the physiological process of fusion and fission which regulates mitochondrial morphology and dynamics. Among different cell types or within the same type of cells, mitochondria morphology varies among small spheres, short rods or long tubules. This dynamism allows mitochondria to exchange components (e.g., lipid membranes, proteins), promote repair and removal of defective mitochondria, thus maintaining mitochondrial function and quality. Furthermore, mitochondrial fusion and fission enable mitochondria to meet cellular energy demands in response to environmental stimuli. Fused mitochondria often lead to increased oxidative phosphorylation and mitochondrial membrane potential.
- components e.g., lipid membranes, proteins
- An aspect of the disclosure provides a compound of formula I or a pharmaceutically acceptable salt thereof, which are capable of regulating directly MFN1/2 activity and subsequently mitochondrial fusion.
- the compound binds directly to the recombinant HR2 domain of MFN2 and in cells to intact protein, decreases the GTP-dependent MFN2 higher-order oligomers, and therefore impedes mitochondrial fusion by directly interfering with the tethering permissive structure of MFNs.
- Ar 1 is a substituted phenyl wherei ho substituent is R 1 selected from the group consisting of OH, SH, COOH, N(R m ) 2 , C(O)N(R m ) 2 , hydroxyC 1-6 alkyl, dihydroxyC 1-10 alkyl, C 3-6 cycloalkyl, NR m SO 2 C 1-6 alkyl, and S(O)OH, wherein at least one R m in N(R m )2, C(O)N(R m )2, and NR m SO2C1-6alkyl is hydrogen;
- R 2 , R 3 , R 4 , and R 5 are independently selected from the group consisting of hydrogen, deuterium, OC1-6alkyl, SC1-6alkyl, CN, OH, SH, halogen, NO2, N(R m )2, C(O)OR m , C(O)N(R m )2, C(O)C1- 6 alky
- Ar 1 is a substituted phenyl comprising a substituent, ortho to L, selected from the group consisting of OH, SH, COOH, N(R m )2, C(O)N(R m )2, hydroxyC1- 6 alkyl, dihydroxyC 1-10 alkyl, C 3-6 cycloalkyl, NR m SO 2 C 1-6 alkyl, or S(O)OH, wherein at least one R m in N(R m )2, C(O)N(R m )2, and NR m SO2C1-6alkyl is hydrogen.
- Ar 1 is a substituted phenyl comprising an OH ortho to L.
- Ar 1 is a substituted phenyl comprising a substituent ortho to L and one or more additional substituents selected from the group consisitng of CN, halogen, NO2, C(O)OR m , C(O)N(R m ) 2 , C(O)C 1-6 alkyl, haloC 1-6 alkyl, haloC 1-6 alkyleneO, C 1-6 alkyl, C(O)SR m , C 2- 6alkynyl, C2-6alkenyl, SO2N(R m )2, NR m SO2C1-6alkyl, C1-6alkylSO2 (sulfone), S(O)OH, C1- 6 alkylS(O) (sulfoxide), nitroso, and C 1-6 alkylOSO 2 .
- Ar 1 further comprises a substituent, para to the first ortho substituent, selected from the group consisitng of CN, halogen, NO2, C(O)OR m , C(O)N(R m )2, C(O)C 1-6 alkyl, haloC 1-6 alkyl, haloC 1-6 alkyleneO, C 1-6 alkyl, C(O)SR m , C 2-6 alkynyl, C 2-6 alkenyl, SO2N(R m )2, NR m SO2C1-6alkyl, C1-6alkylSO2 (sulfone), S(O)OH, C1-6alkylS(O) (sulfoxide), nitroso, and C 1-6 alkylOSO 2 .
- a substituent para to the first ortho substituent, selected from the group consisitng of CN, halogen, NO2, C(O)OR m , C(O)N(R m )2, C(O)C 1-6
- the para substituent is a F, Cl or Br.
- the ortho substituent is OH and the substituent para to it is Cl.
- Ar 2 is a substituted phenyl, pyridinyl, or pyrimidinyl.
- Ar 2 comprises an ortho substituent selected from OC 1-6 alkyl, SC 1-6 alkyl, C 1- 4alkyl, CN, halogen, C1-6alkylene-CN, OC1-6alkylene-CN, haloC1-6alkyl, SC1-6alkylene-CN, C2- 6 alkynyl, C 2-6 alkenyl, and C 1-6 alkylSO 2 (sulfone).
- Ar 2 is a substituted phenyl
- R m and R m are as described above consisting of OC1-6alkyl, SC1-6alkyl, C1-4alkyl, CN, halogen, haloC1-6alkyl, C2-6alkynyl, and C2- 6alkenyl.
- ortho substituent is C 1-4 alkyl.
- Ar 2 comprises a meta substituent next to the second ortho substituent, wherein the meta substituent is selected from the group consisting of C1-4alkyl, OC1- 6alkyl, SC 1-6 alkyl, CN, halogen, C 1-6 alkylene-CN, OC 1-6 alkylene-CN, haloC 1-6 alkyl, SC 1- 6alkylene-CN, C2-6alkynyl, C2-6alkenyl, C1-6alkylSO2 (sulfone).
- Ar 2 is phenyl
- the second ortho substituent is C 1-4 alkyl
- the meta substituent is C 1-4 alkyl.
- Ar 2 further comprises a second meta substituent (meta to X and para to the second ortho substituent) selected from SC 1-6 alkyl, CN, OH, SH, halogen, NO 2 , N(R m ) 2 , and C(O)OR m , C(O)N(R m )2.
- a second meta substituent metal to X and para to the second ortho substituent
- Ar 2 is phenyl
- the second ortho substituent is C1-4alkyl
- the meta substituent is C 1-4 alkyl
- the substituent para to the second ortho substituent is selected from halogen, C(O)OR m (e.g.
- L is methylene, ethylene, or CH(CH3).
- L is C(O).
- X is NH.
- X is NC(O)C1-6alkyl.
- Compounds described in this patent specification may be formulated by any method well known in the art and may be prepared for administration by any route, including, without limitation, parenteral, peroral, sublingual, buccal, intrathecal, transdermal, topical, subcutaneous, intramuscular, intraperitoneal, intranasal, intratracheal, or intrarectal.
- Nonlimiting examples of pharmaceutically acceptable carriers include physiologically acceptable surface active agents, glidants, plasticizers, diluents, excipients, smoothing agents, suspension agents, complexing agents, film forming substances, and coating assistants.
- Preservatives, stabilizers, dyes, sweeteners, fragrances, flavoring agents, and the like may be provided in the pharmaceutical composition.
- sodium benzoate, ascorbic acid and esters of p-hydroxybenzoic acid may be added as preservatives.
- antioxidants and suspending agents may be used.
- alcohols, esters, sulfated aliphatic alcohols, and the like may be used as surface active agents.
- Suitable exemplary binders include crystalline cellulose, sucrose, D-mannitol, dextrin, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, and the like.
- Suitable exemplary disintegrants include starch, carboxymethylcellulose, calcium carboxymethylcellulose, croscarmellose sodium, sodium carboxymethylstarch, and the like.
- Suitable exemplary solvents or dispersion media include water, alcohol (for example, ethanol), polyols (for example, glycerol, propylene glycol, and polyethylene glycol, sesame oil, com oil, and the like), and suitable mixtures thereof that are physiologically compatible.
- Suitable exemplary solubilizing agents include polyethylene glycol, propylene glycol, D-mannitol, benzylbenzoate, cyclodextrins, ethanol, trisaminomethane, cholesterol, triethanolamine, sodium carbonate, sodium citrate, and the like.
- Suitable exemplary suspending agents include surfactants such as stearyltriethanolamine, sodium laurylsulfate, laurylaminopropionic acid, lecithin, benzalkonium chloride, benzethonium chloride, glycerin monostearate, coconut oil, olive oil, sesame oil, peanut oil, soya and the like; and hydrophilic polymers such as polyvinyl alcohol, polyvinylpyrrolidone, sodium carboxymethylcellulose, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, and the like.
- Suitable exemplary isotonic agent includes sodium chloride, glycerin, D-mannose, and the like.
- Suitable exemplary buffer agents include buffer solutions of salts, such as phosphate, acetates, carbonates, and citrates.
- Suitable exemplary soothing agents include benzyl alcohol, and the like.
- Suitable exemplary antiseptic substances include para- oxybenzoic acid esters, benzethonium chloride, benzalkonium chloride, chlorobutanol, benzyl alcohol, phenethyl alcohol, dehydroacetic acid, sorbic acid, and the like.
- Suitable exemplary antioxidants include sulfite salts, ascorbic acid, and the like.
- Suitable exemplary sealers include, but are not limited to HPMC (or hypromellose), HPC, PEG and combinations thereof.
- Suitable exemplary lubricants include magnesium stearate, calcium stearate, talc, colloidal silica, hardened oil and the like.
- carriers or excipients include diluents, lubricants, binders, and disintegrants.
- carriers include solvents, solubilizing agents, suspending agents, isotonic agents, buffer agents, soothing agents, and the like.
- salts include, but are not limited to acid addition salts formed with inorganic acids (for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, and the like), and salts formed with organic acids such as acetic acid, oxalic acid, tartaric acid, succinic acid, malic acid, ascorbic acid, benzoic acid, tannic acid, pamoic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, naphthalenedisulfonic acid, and polygalacturonic acid.
- inorganic acids for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, and the like
- organic acids such as acetic acid, oxalic acid, tartaric acid, succinic acid, malic acid, ascorbic acid, benzoic acid, tannic acid, pamoic acid, alginic acid, polyglutamic acid
- the compounds can also be administered as pharmaceutically acceptable quaternary salts known by those skilled in the art, which specifically include the quaternary ammonium salt, wherein the counterion includes, for example, chloride, bromide, iodide, -O-alkyl, toluenesulfonate, methylsulfonate, sulfonate, phosphate, or carboxylate (such as benzoate, succinate, acetate, glycolate, maleate, malate, citrate, tartrate, ascorbate, benzoate, cinnamoate, mandeloate, benzyloate, and diphenylacetate).
- the counterion includes, for example, chloride, bromide, iodide, -O-alkyl, toluenesulfonate, methylsulfonate, sulfonate, phosphate, or carboxylate (such as benzoate, succinate, acetate, glycolate, maleate, mal
- kits which includes a compound of Formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof and an instruction for treating or preventing certain diseases or conditions.
- the kit further includes an additional secondary therapeutic agent.
- the secondary agent is an anti-cancer agent.
- the administration or inclusion of a secondary agent having a cytotoxic effect on a cancer cell is contemplated.
- a cytotoxic effect refers to the depletion, elimination and/or the killing of target cells (i.e., tumor cells).
- the cytotoxic agent may be at least one selected from the group consisting of an antimetabolite, a mitotic inhibitor, an alkylating agent, an antibody -based EGFR inhibitor, an antibody based HER2/3 inhibitor, an angiogenesis inhibitor, a mTOR inhibitor, a CDK4 and CDK6 inhibitor or an aromatase inhibitor.
- the combination may include at least two cytotoxic agents.
- the combination may include at least 2, at least 3, or at least 4 selected from the group consisting of an antimetabolite, a mitotic inhibitor, an alkylating agent, an angiogenesis inhibitor, or all of them.
- the antimetabolite may be a drug that inhibits DNA synthesis in cells by suppressing formation of purines or pyrimidines, which are bases of a nucleotide.
- the antimetabolite may be selected from the group consisting of Capecitabine, 5- Fluorouracil, Gemcitabine, Pemetrexed, Methotrexate, 6-Mercaptopurine, Cladribine, Cytarabine, Doxifludine, Floxuridine, Fludarabine, Hydroxycarbamide, decarbazine, hydroxyurea, and asparaginase.
- the antimetabolite is a base analog, with the term base analogs herein including nucleotide and nucleoside analogs in addition to purine base analogs such as 5 -fluorouracil.
- the mitotic inhibitor may be a microtubule-destabilizing agent, a microtubulestabilizing agent, or a combination thereof.
- the mitotic inhibitor may be selected from taxanes, vinca alkaloids, epothilone, or a combination thereof.
- the mitotic inhibitor is a taxane, for example including but not limited to, paclitaxel, docetaxel and cabazitaxel.
- the mitotic inhibitor is a vinca alkaloid or its derivative, for example including but not limited to, vinblastine, vincristine, vinflunine, vinorelbine, vincaminol, vinbumine,ieridine and vindesine.
- the mitotic inhibitor may be selected from BT-062, HMN-214, eribulin mesylate, vindesine, EC-1069, EC-1456, EC-531, vintafolide, 2-methoxyestradiol, GTx-230, trastuzumab emtansine (T-DM1), crolibulin, D1302A-maytansinoid conjugates IMGN-529, lorvotuzumab mertansine, SAR-3419, SAR-566658, IMP-03138, topotecan/ vincristine combinations, BPH-8, fosbretabulin tromethamine, estramustine phosphate sodium, vincristine, vinflunine, vinorelbine, RX-21101, cabazitaxel, STA-9584, vinblastine, epothilone A, patupilone, ixabepilone, Epothilone D, paclitaxe
- Non-limiting examples of checkpoint inhibitors include those that target PD-1, PD- Ll, CTLA4 and TIGIT (T cell immunoglobulin and ITIM domain). Further examples include Ipilimumab (Yervoy®; blocking a checkpoint protein called CTLA-4); pembrolizumab (Keytruda®), Cemiplimab (Libtayo) and nivolumab (Opdivo®) (targeting another checkpoint protein called PD-1); atezolizumab (Tecentriq®), Avelumab (Bavencio), and Durvalumab (Imfinzi) (targeting PD-L1); MK-7684, Etigilimab /OMP-313 M32,
- the EGFR inhibitors may be selected from erlotinib, gefitinib, lapatinib, canetinib, pelitinib, neratinib, (R,E)-N-(7-chloro-l-(l-(4-(dimethylamino)but-2-enoyl)azepan-3-yl)-lH- benzo[d]imidazol-2-yl)-2-methylisonicotinamide, Trastuzumab, Margetuximab, panitumumab, matuzumab, necitumumab, pertuzumab, nimotuzumab, zalutumumab, cetuximab, icotinib, afatinib, and pharmaceutically acceptable salt thereof.
- the EGFR inhibitor may be an antibody based EGFR inhibitor such as cetuximab and in another embodiment, it is necitumumab and yet in another embodiment it is pantitumumab.
- the molecularly targeted agent may be an anti -EGFR family antibody or a complex including the anti-EGFR family antibody.
- the anti-EGFR family antibody may be an anti-HERl antibody, an anti-HER2 antibody, or an anti- HER4 antibody.
- agents for chemotherapy include SHP2 inhibitors (e.g. RMC- 4550 and RMC-4630), phosphatase inhibitors (e.g. Tautomycin), CDK 4/6 inhibitors (abemaciclib (Lilly), palbociclib (Pfizer)), protein-protein interaction disruptors (BI 1701963), HSP90 inhibitor, tubulin inhibitor, apoptosis inhibitor, chemopreventative agent, and therapies targeting PBK/AKT/mTOR pathway.
- SHP2 inhibitors e.g. RMC- 4550 and RMC-4630
- phosphatase inhibitors e.g. Tautomycin
- CDK 4/6 inhibitors abemaciclib (Lilly), palbociclib (Pfizer)
- protein-protein interaction disruptors BI 1701963
- HSP90 inhibitor e.g., HSP90 inhibitor, tubulin inhibitor, apoptosis inhibitor, chemopreventative agent, and therapies targeting PBK/AKT/mTOR
- Antibody-drug conjugates have emerged as a breakthrough approach to the development of cancer therapeutics. Cancer is one of the leading causes of deaths in the world.
- Antibody-drug conjugates comprise monoclonal antibodies (MAbs) that are covalently linked to cell-killing drugs. This approach combines the high specificity of MAbs against their antigen targets with highly potent cytotoxic drugs, resulting in “armed” MAbs that deliver the payload (drug) to tumor cells with enriched levels of the antigen. Targeted delivery of the drug also minimizes its exposure in normal tissues, resulting in decreased toxicity and improved therapeutic index.
- ADCETRIS® currentuximab vedotin
- KADCYLA® tacuzumab emtansine or T-DM1
- T-DM1 trastuzumab duocarmazine
- Another aspect of the patent specification provides for methods for treating a disease or condition associated with imbalance between mitochondrial fission and fusion, including for example abnormal or elevated mitochondrial fusion and abnormal or decreased mitochondrial fission.
- the method includes administering to a subject in need thereof the compound of formula (I), a pharmaceutically acceptable salt thereof, or a corresponding pharmaceutical composition disclosed herein.
- the compounds of this patent specification directly target mitofusins and impact on mitochondrial dynamics.
- Diseases or conditions treatable with the compounds and their pharmaceutically acceptable salts include for example neurodegenerative diseases, metabolic disease, cardiovascular diseases, autoimmune disease, hypertension, inflammatory disease, ageing and cancer.
- the disease treatable with the methods disclosed herein is cancer including for example breast cancer, colorectal cancer, gastric cancer, glioma, anal cancer, appendix cancer, bile duct cancer (i.e., cholangiocarcinoma), bladder cancer, brain tumor, cervical cancer, esophageal cancer, eye cancer, fallopian tube cancer, kidney cancer, liver cancer, lung cancer, medulloblastoma, melanoma, oral cancer, ovarian cancer, pancreatic cancer, parathyroid disease, penile cancer, pituitary tumor, prostate cancer, rectal cancer, skin cancer, gastric cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, vaginal cancer, vulvar cancer, leukemia, lymphoma or a solid tumor, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL) or chronic myeloid leukemia (CML), non- Hosis, a solid tumor,
- the disease treatable with the methods disclosed herein is a cardiovascular disease including for example arrhythmia, ischemic heart disease, hypertensive heart disease and pulmonary hypertensive heart disease, valvular disease, congenital heart disease, cardiomyopathy, stroke ischemic heart disease, cardiac ischemia-reperfusion injury, myocardial infarction, chemotherapy-induced cardiotoxicity, arteriosclerosis, heart failure, heart transplantation.
- a cardiovascular disease including for example arrhythmia, ischemic heart disease, hypertensive heart disease and pulmonary hypertensive heart disease, valvular disease, congenital heart disease, cardiomyopathy, stroke ischemic heart disease, cardiac ischemia-reperfusion injury, myocardial infarction, chemotherapy-induced cardiotoxicity, arteriosclerosis, heart failure, heart transplantation.
- the disease treatable with the methods disclosed herein is a metabolic disorder including for example type II diabetes, obesity, insulin resistance, sarcopenia, diabetes, acute liver failure, NASH, hepatosteatosis, alcoholic fatty liver, renal failure and chronic kidney disease.
- a metabolic disorder including for example type II diabetes, obesity, insulin resistance, sarcopenia, diabetes, acute liver failure, NASH, hepatosteatosis, alcoholic fatty liver, renal failure and chronic kidney disease.
- the disease treatable with the methods disclosed herein is a neurodegenerative diseases including for example Alzheimer’s disease, Lewy body dementia, frontotemporal dementia, traumatic brain injury, prion diseases, Huntington’s disease, Parkinson’s disease, chronic traumatic encephalopathy, amyotrophic lateral sclerosis, mixed dementias, vascular dementia, hydrocephalus, and amyotrophic lateral sclerosis.
- a neurodegenerative diseases including for example Alzheimer’s disease, Lewy body dementia, frontotemporal dementia, traumatic brain injury, prion diseases, Huntington’s disease, Parkinson’s disease, chronic traumatic encephalopathy, amyotrophic lateral sclerosis, mixed dementias, vascular dementia, hydrocephalus, and amyotrophic lateral sclerosis.
- Also disclosed in this patent document is the use of a therapeutically effective amount of a compound of Formula I or a pharmaceutically acceptable salt thereof to treat a disease or condition.
- This patent document further provides a therapeutically effective amount of a compound of Formula I or a pharmaceutically acceptable salt thereof for use in the treatment of a disease or condition.
- the disease or condition, the means of administration, the dosage form and formulation, and the additional agents are the same as in the methods described herein.
- Another aspect of the patent document discloses a method of inhibiting mitofusin 1 and/or mitofusin 2.
- the method is applicable to attenuating or inhibiting mitofusin-mediated mitochondrial fusion.
- the method includes contacting a cell containing mitofusin 1 and/or mitofusin 2 with an effective amount of the compound of formula (I) or the pharmaceutically acceptable salt thereof or pharmaceutical composition disclosed herein to inhibit mitofusin 1 and/or mitofusin 2.
- the compounds are also effective for promoting decreased mitochondrial respiration and functionality, decreased metabolites of TCA cycle and/or promoting mitochondrial outer membrane permeabilization that leads to sublethal caspase activation and DNA damage.
- the contacting takes place in vitro.
- the contacting takes place in vivo.
- this patent document further provides an effective amount of a compound of Formula I or a pharmaceutically acceptable salt thereof for use in inhibiting mitofusin-mediated mitochondrial fusion. Also disclosed in this patent document is the use of an effective amount of a compound of Formula I or a pharmaceutically acceptable salt thereof to inhibit mitofusin- mediated mitochondrial fusion.
- a related aspect provides a method of inducing or promoting apoptosis/cell death in tumor cells.
- the method includes contacting a cell with an effective amount of the compound of formula (I) or the pharmaceutically acceptable salt thereof or pharmaceutical composition disclosed herein.
- the contacting takes place in vitro, or the compound or its salt is administered to a subject in need thereof.
- the scope of cancer is as descried above.
- the cancer is leukemia, melanoma, pancreatic cancer, colon cancer, lung cancer, head and neck cancer, lymphoma, ovarian cancer, prostate cancer, breast cancer, kindey cancer, liver cancer, or bladder cancer.
- a compound of Formula I or its salt inhibits MFN1/2 and/or fragmentation of mitochondria and is able to induce a robust apoptosis induction and cell death.
- BH3 mimetics is a class of small molecules that antagonizes with the pro-apoptotic BH3 domains in the binding to the hydrophobic pocket of the anti-apoptotic BCL-2 family of proteins such as Bcl-2, Bcl-xL, Mcl-1.
- BH3 mimetics are essentially selective inhibitors of Bcl-2 or Bcl-xL or Mcl-1 proteins or inhibit more than one anti-apoptotic BCL-2 family of proteins and activate the intrinsic pathway of apoptosis by inducing mitochondrial outer membrane permeabilization (MOMP).
- MOMP mitochondrial outer membrane permeabilization
- BH3 mimetics have been used as an anti-cancer treatment in the clinic in various solid tumors and hematological malignancies as they induce cell death/apoptosis in cancer cells.
- SMAC mimetics is a class of small molecules that mimics the interaction of second mitochondria-derived activator of caspases (SMAC) with the inhibitor of apoptosis proteins (IAPS).
- SMAC mimetics are antagonists of cIAPl, cIAP2, XIAP proteins. Inhibition of IAPs by SMAC mimetics induces cell death/apoptosis in cancer cells by activating the intrinsic and/or the extrinsic pathway of apoptosis. SMAC mimetics are evaluated in the clinic as anti-cancer treatment against solid tumors and hematological malignancies.
- Nonlimiting examples of SMAC mimetics include Birinapant (TL32711), GDC- 0152, Xevinapant (AT406), Tolinapant (ASTX660), AZD5582, BV-6, SM-164, LCL161, and APG-1387.
- Nonlimiting examples of BH3 mimetics include Venetoclax (ABT-199), Lisaftoclax (APG-2575), S55746, DT2216, Navitoclax (ABT-263), ABT-737, APG-1252, A-1331852, A- 115546, S64315 (MIK665), S63845, AMG-176 and AZD5991.
- the SMAC mimetic or BH3 mimetic can be administered prior to, simultaneously with, or subsequent to the administration of the compound of Formula I or a salt thereof.
- the compound of Formula I or a salt thereof in the combination is in an effective amount to decrease cell viability by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 80%, or about 100% in comparison with the SMAC mimetic or BH3 mimetic administered by itself.
- the compound of Formula I or a salt thereof in the combination is in an effective amount to increase caspase 3/7 activation by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 80%, or about 100% in comparison with the SMAC mimetic or BH3 mimetic administered by itself.
- Another aspect of the patent document provides a method of sensitizing cells to caspase activation or to apoptosis/cell death.
- the method includes contacting a cell with an effective amount of the compound of formula (I) or the pharmaceutically acceptable salt thereof or pharmaceutical composition disclosed herein.
- the method improves caspase activation.
- the method sensitizes the cells to improve the response to a SMAC mimetic or BH3 mimetic or other pro-apoptotic drug or agent.
- the compound of Formula I or a salt thereof can be administered prior to, simultaneously with, or subsequent to the administration of the SMAC mimetic or BH3 mimetic or other pro-apoptotic drug.
- the method includes contacting the compound or agent with a cell in vitro.
- the method includes contacting the compound or agent with a cell in vivo or administering the compound or agent to a suject.
- the compound of Formula I or a salt thereof in the combination is in an effective amount to decrease cell viability by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 80%, or about 100% in comparison with a vehicle alone. In some embodiments, the compound of Formula I or a salt thereof in the combination is in an effective amount to increase caspase 3/7 activation by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 80%, or about 100% in comparison with a vehicle alone.
- the compound of Formula I or a salt thereof in the combination is in an effective amount to sensitize cells to apoptosis/cell death to other pro-apopotic molecules (e.g. SMAC mimetic or BH3 mimetic, etc) by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 80%, or about 100% in comparison with a vehicle or the pro-apopotic molecule.
- pro-apopotic molecules e.g. SMAC mimetic or BH3 mimetic, etc
- Administration Regimen [0093] The compound of Formula I, or a pharmaceutically acceptable salt thereof or a pharmaceutically composition thereof for the methods or kit described herein described herein may be administered to the subject by any suitable means.
- Non-limiting examples of methods of administration include, among others, (a) administration though oral pathways, which administration includes administration in capsule, tablet, granule, spray, syrup, or other such forms; (b) administration through non-oral pathways such as rectal, vaginal, intraurethral, intraocular, intranasal, or intraauricular, which administration includes administration as an aqueous suspension, an oily preparation or the like or as a drip, spray, suppository, salve, ointment or the like; (c) administration via injection, subcutaneously, intraperitoneally, intravenously, intramuscularly, intradermally, intraorbitally, intracapsularly, intraspinally, intrasternally, or the like, including infusion pump delivery; as well as (d) administration topically; as deemed appropriate by those of skill in the art for bringing the active compound into contact with living tissue.
- the compound of Formula I, or a pharmaceutically acceptable salt thereof or a pharmaceutically composition thereof for administrations described above are prepared into dosage forms in a unit dose suited to fit a dose of the active ingredients.
- dosage forms in a unit dose include, for example, tablets, pills, capsules, injections (ampoules), suppositories, etc.
- the composition can be a tablet, coated tablet, capsule, caplet, cachet, lozenges, gel capsule, hard gelatin capsule, soft gelatin capsule, troche, dragee, dispersion, powder, granule, pill, liquid, an aqueous or non- aqueous liquid suspension, an oil-in-liquid or oil-in-water emulsion, including sustained release formulations that are known in the art.
- suspensions, syrups and chewable tablets are especially suitable.
- the therapeutically effective amount (dosage) of the compound of Formula I, or a pharmaceutically acceptable salt thereof required will depend on the route of administration, the species (human or animal), and the physical characteristics of the particular subject or patient being treated.
- the dose can be tailored to achieve a desired effect, but will depend on such factors as weight, diet, concurrent medication and other factors which those skilled in the medical arts will recognize.
- a therapeutically effective amount means an amount of compound effective to prevent, alleviate or ameliorate symptoms of disease or prolong the survival of the patient or animal being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
- dosages may range broadly, depending upon the desired effects and the therapeutic indication. Typically, dosages may be about 10 pg/kg to about 100 mg/kg body weight, preferably about 100 pg/kg to about 10 mg/kg body weight. Alternatively, dosages may be based and calculated upon the surface area of the animal, as understood by those of skill in the art.
- the dose range of the compound of Formula I or a pharmaceutically acceptable salt thereof administered to the subject or patient can be from about 0.5 to about 1000 mg/kg of their body weight.
- the dosage may be a single one or a series of two or more given in the course of one or more days, as is needed by the patient.
- those same dosages, or dosages that are about 0.1% to about 500%, more preferably about 25% to about 250% of the established human dosage may be used.
- the attending physician would know how to and when to terminate, interrupt, or adjust administration due to side-effects, toxicity or organ dysfunctions. Conversely, the attending physician would also know to adjust treatment to higher levels if the clinical response was not adequate (precluding toxicity).
- the magnitude of an administrated dose in the management of the disorder of interest will vary with the severity of the condition to be treated and to the route of administration. The severity of the condition may, for example, be evaluated, in part, by standard prognostic evaluation methods. Further, the dose and perhaps dose frequency will also vary according to the age, body weight, and response of the individual patient. A program comparable to that discussed above may also be used in veterinary medicine.
- the daily dosage regimen for an adult human patient may be, for example, a peroral dose of about 0.01 mg to 2000 mg of the active ingredient, preferably from about 0.01 mg to about 500 mg.
- an intravenous, subcutaneous, or intramuscular dose of the active ingredient of about 0.01 mg to about 100 mg, preferably about 0.01 mg to about 60 mg is used.
- dosages may be calculated as the freebase.
- the composition is administered 1 to 4 times per day.
- a compound of Formula I or a pharmaceutically acceptable salt thereof may be administered by continuous intravenous infusion, preferably at a dose of up to about 1000 mg per day.
- a compound of Formula I or a pharmaceutically acceptable salt thereof disclosed herein in amounts that exceed, or even far exceed, the abovestated, preferred dosage range in order to effectively and aggressively treat particularly intractable diseases or conditions.
- a compound of Formula I or a pharmaceutically acceptable salt thereof will be administered for a period of continuous therapy, for example for a week or more, or for months or years.
- a compound of Formula I or a pharmaceutically acceptable salt thereof is formulated into a dosage form for release for a period of 1 to 12, typically 3 to 12 hours, more typically 6-12 hours after administration.
- the oral pharmaceutical compositions described herein may be administered in single or divided doses, from one to four times a day.
- the oral dosage forms may be conveniently presented in unit dosage forms and prepared by any methods well known to those skilled in the art of pharmacy.
- a compound of Formula I or a pharmaceutically acceptable salt thereof can be evaluated for efficacy and toxicity using known methods.
- the toxicology of the compound may be established by determining in vitro toxicity towards a cell line, such as a mammalian, and preferably human, cell line. The results of such studies are often predictive of toxicity in animals, such as mammals, or more specifically, humans.
- the toxicity may be determined in an animal model (such as mice, rats, rabbits, or monkeys) using known methods.
- the efficacy of a particular compound may be established using several recognized methods, such as in vitro methods, animal models, or human clinical trials. Recognized in vitro models exist for nearly every class of condition.
- a compound of Formula I or a pharmaceutically acceptable salt thereof may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient.
- the pack may for example comprise metal or plastic foil, such as a blister pack.
- the pack or dispenser device may be accompanied by instructions for administration.
- the pack or dispenser may also be accompanied with a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the drug for human or veterinary administration.
- a notice for example, may be the labeling approved by the U.S. Food and Drug Administration for prescription drugs, or the approved product insert.
- Compositions comprising a compound of Formula I or a pharmaceutically acceptable salt thereof formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition.
- Another aspect provides a method of screening for an inhibitor of mitofusin- mediated mitochondrial fusion.
- the method includes the following steps: (i) providing a pharmacophore, wherein the pharmacophore comprises the structure: Formula II wherein: A and B are each a hydrophobic moiety, C is an aromatic moiety, D is a hydrogen bond acceptor or a hydrogen bond acceptor the distance (AB) between A and B is 4.0 angstrom, the distance (BC) between B and C is 7 angstrom, the distance (CD) between C and D is 3 angstrom, the distance (AD) between A and D is 10 angstrom, B AD is 62°,
- ZDBC is 17 °
- ZBDC is 51°
- D is a hydrogen bond acceptor or a hydrogen bond acceptor the distance (AB) between A and B is 4.0 angstrom, the distance (BC) between B and C is 6.7 angstrom, the distance (CD) between C and D is 2.8 angstrom, the distance (AD) between A and D is 9.8 angstrom,
- ZB AD is 61.92°
- ZABD 91.38°
- ZDBC is 17.13°
- ZBDC is 50.68°.
- a library of compounds can be efficiently screened to identify one or more candidate inhibitors of mitofusin-mediated mitochondrial fusion.
- the qualify as a candidate, a compound also needs to have two hydrophobic moieties (A’ and B’), an aromatic moiety (C’) and a hydrogen bond acceptor or a hydrogen bond acceptor (D’) as those components of the pharmacophore of Formula I.
- the compound resembles the pharmacophore when the distances are within a pre-dertermined range of the respective distances (AB, BC, CD, and AD) and angles in the pharmacophore.
- the pre- dertermined range for each of the distances and angles is independently about 1%, about 3%, about 5%, about 8%, about 10%, about 12%, about 15%, about 20%, about 25%, about 30%, about 40%, or about 50%.
- the distance is generally measured between atoms, between the centers of two groups or between an atom and the center of a group.
- the center of a ring is easeily determined.
- the center of a group is the center of a sphere that encloses the group.
- the sphere can not be further reduced without exposing a portion of the enclosed group.
- a flexibility tolerance of 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.5 or 2 Angstrom in the radius of the sphere is acceptable.
- Hydrophobic group or moiety decreases a compound’s solubility in water.
- Nonlimiting examples include alkyl (e.g Ci-ioalkyl, branched or straight chained), haloCi- loalkyl (e.g. mono, di, or tri halo-substituted Ci-ioalkyl), 3-10 membered cycloakyl group, optionally substituted 6-10 membered aryl, and optionally substituted 5 to 14 membered heteroaryl.
- the hydrophobic moiety for comparison purpose with the pharmacophore is an alkyl, an alkyl substituent on 3-10 membered ring (not the 3-10 membered ring), an optinally substituted 6-10 membered aryl or an optinally substituted 5 to 14 membered heteroaryl.
- the optional substituents include alkyl, halogen, 6-10 membered aryl and 5 to 14 membered heteroaryl.
- Assays that can be used to monitor compound-induced inhibition of mitochondrial fusion in a mitofusin dependent manner include, for example, fluorescent microscopy to monitor mitochondrial shape and measurement of mitochondrial aspect ratio, EM microscopy to monitor mitochondrial shape, PEG mitochondrial fusion assay, and In vitro mitochondrial fusion luminescent and fluorescent-based assays.
- MASM7 was obtained from Enamine (cat. # EN300-396282). Screened MASMs were purchased from Enamine, ChemBridge and ChemDiv. MFI8 was obtained from ChemBridge (cat. # 7681311) and also synthesized in house in a more stable form as a HCl salt. MFI8 was freshly dissolved in DMSO at 10 mM prior each experiment. MFI22-26 were also synthesized in house as HCl salts. The rest of the screened MFIs were purchased from Enamine, ChemBridge, ChemDiv, Vitas M and UORSY.
- U2OS cells were provided from Stephen Tait’s laboratory. All cells maintained in DMEM (Life Technologies) supplemented with 10% FBS, 100 U ml –1 penicillin/streptomycin and 2 mM L-glutamine. [0114] Mice. All animal experiments were approved by and performed in compliance with the guidelines and regulations approved by the Institutional Animal Care and Use Committee of the Albert Einstein College of Medicine. [0115] Structural model of MFN2. The structural model of MFN2 was calculated based on the I-TASSER (Iterative Threading ASSEmbly Refinement) hierarchical approach to protein structure as we previously described and truncated crystal structure of MFN2 (PDB ID: 6JFL).
- I-TASSER Intelligent Threading ASSEmbly Refinement
- the Nose- Hoover Chain thermostat and Martyna–Tobias–Klein barostat were used to maintain the temperature and pressure, respectively.
- the system was neutralized by Na+ and Cl- ions at a final concentration of 0.15 M.
- the system was minimized and pre-equilibrated using the standard equilibration protocol implemented in DESMOND. Analysis of the trajectories was performed using MAESTRO simulation event analysis tools (Schrodinger LLC, 2021). Interatomic distance plots obtained from MAESTRO were plotted using GraphPad Prism 9. PyMOL (Schrodinger LLC, 2021) was used to show structures of the MD trajectory snapshots. [0117] In silico small molecule library preparation.
- eMolecules www.emolecules.com
- library of purchasable compounds was converted to 3D structures using LIGPREP (LigPrep, Schrödinger Release 2016, Schrödinger, LLC) and EPIK (Epik, Schrödinger Release 2016, Schrödinger, LLC) generating an in silico library of approximately 13.8 million compounds containing compounds with different ionization state at pH 7.0 ⁇ 2.0, stereochemistry and tautomeric form, excluding potential Pan Assay Interference Compounds (PAINS) using PAINS definitions included in Canvas. Conformation analysis of ligands was calculated using the OPLS3 force field. [0118] 3D Pharmacophore model generation and screen.
- Phase (Phase, Schrödinger Release 2016, Schrödinger, LLC) module was used to generate a pharmacophore hypothesis and a 3D pharmacophore screen.
- the coordinates of the HR1 helix residues Val372, Met376 and His380 from the structural model of MFN2 were used to assign pharmacophore points in 3D coordinates.
- Pharmacophore hypothesis included 5 features as defined in Phase for 3 hydrophobic groups to mimic the sidechain residues of Val273 and Met376 and an aromatic ring with a hydrogen-bond donor to mimic the sidechain of His380.
- the pharmacophore screen used the in silico library of compounds prepared from the eMolecules library in pre-existing conformations with the requirement to satisfy at least 4 out of the 5 pharmacophore features of the hypothesis.
- the top 1000 compounds ranked based on the Phase Score were selected for further visual analysis and clustered for diversity using dendritic fingerprints in Canvas.
- Physicochemical and AMDET properties including Lipinski rules, permeability, logP, metabolic liabilities and hERG inhibition were evaluated using QikProp (QikProp, Schrödinger Release 2016, Schrödinger, LLC). The highest 8 ranked compounds and the 10 most diverse compounds yielded selected molecules for experimental validation.
- MASM7 and MFI8 were checked for potential Pan Assay Interference Compounds (PAINS) and has not been reported as a hit in previous screens in Pubchem database.
- PAINS Pan Assay Interference Compounds
- Mutagenesis Mutagenesis on the HR2 domain for the NMR analysis or the MFN2 gene that was used for the packaging of the adenovirus was performed by using QuikChange Lightning Site-Directed mutagenesis Kit (Qiagen; Cat.210518).
- S685A (adeno): 5’-CTGGCTCCAACTGCGCCCACCAAGTCCAGC-3’
- L692A (adeno): 5’-CCAAGTCCAGCAGGAAGCGTCTGGGACCTTTGC-3’
- S685A (NMR): 5’-TGGGTAGCAACTGCGCCCACCAGGTGCAGC-3’
- L692A (NMR): 5’-AGGTGCAGCAAGAGGCGAGCGGCACCTTCG-3’
- D725A/L727A 5’- AAGAAAATTGAAGTTCTGGCCAGCGCGCAAAGCAAGGCGAAACTG-3’
- L727A 5’-AATTGAAGTTCTGGACAGCGCGCAAAGCAAGGCGAAACT-3’ [0123] Recombinant HR2 protein production.
- Human MFN2 residues 678-757 corresponding to the HR2 domain were cloned into a pET-28 vector fused to a His-tag and transformed into BL21(DE3) CodonPlus (DE3)-RIPL E. coli cells.
- Cells were grown at 37°C in 1 L of LB media to an OD 600 of 0.8, cells were then harvested and resuspended in 1 L of Luria Broth media or M9 media supplemented with 1.5 gr/L of 15 N ammonium chloride grown for 45 min at 37°C and induced at 18°C for 16 hours with 1 mM isopropyl [3-d- 1 -thiogalactopyranoside.
- MFN2- HR2 or 15 N-MFN2-HR2 domain was purified from bacterial pellets by high-pressure homogenization in lysis buffer (20 mM Tris.HCl pH 7, 250 mM KC1, 25 mM imidazole, and Roche complete EDTA free protease inhibitor cocktail) and ultracentrifuged at 45,000 g for 45 min. The supernatant was applied to pre-equilibrated 1 mL HisPur Ni-NTA Resin washed in lysis buffer and eluted using elution buffer (20 mM Tris.HCl pH 6, 250 mM KC1, 400 mM imidazole).
- MFN2- HR2 or 15 N-MFN2-HR2 was further purified by size exclusion chromatography (Superdex 75 Increase 10/300 GL column) in gel filtration buffer (20 mM potassium phosphate pH 6, 150 mM KC1). Fractions containing the MFN2-HR2 domain were confirmed by SDS-PAGE, pooled and concentrated to 50 pM in NMR buffer (20 mM potassium phosphate pH 6, 150 mM KC1, 10% D2O) using a 10 KDa cut-off Centricon spin concentrator (Millipore) for prompt use in biochemical and NMR studies.
- NMR experiments The uniformly 15 N-labeled protein samples were prepared by growing the bacteria in a minimal medium, as described above. Correlation J H- 15 N-HSQC spectra of 50 pM MFN2-HR2 in the presence and absence of MASM7 or MFI8 or 367-384Gly or 398- 418Gly were recorded on a BRUKER AVANCE IIIHD 600MHz system equipped with a 5mm H/F-TCI CryoProbe at 25°C. All experiments were performed using an independent sample for each experimental measurement as a 400 pL sample in a 5-mm Shigemi; all samples were DMSO matched with 2% d 6 -DMSO. Spectra were processed using qMDD (mddnmr v2.0) and NMRPIPE and analyzed using Analysis (CCPNMR).
- Microscale Thermopheresis Freshly purified His-tagged MFN2-HR2 domain was used for Microscale Thermophoresis (MST) binding studies.
- MST Microscale Thermophoresis
- a fresh stock of 5 pM His-tag-RED-tris-NTA 2 nd generation dye (Nanotemper) in 25 mM Hepes pH 7.5, 100 mM NaCl, 0.005% Tween-20 (assay buffer) was used to label 500 nM of MFN2-HR2 in the same buffer.
- the labeling reaction was incubated for 30 min at RT and centrifuged at 15.000 xg at 4 °C for 10 min. Labelled protein from the supernatant was kept on ice and used immediately.
- MEFs were seeded in 8 x 15 cm 2 dishes and grown at ⁇ 90% confluence. Then, mitochondria were isolated according to previously published protocol. Briefly, cells were harvested, pelleted and washed with cold PBS. Then, cells were resuspended in cold mitochondrial isolation buffer (0.2 M sucrose, 10 mM Tris-MOPS pH 7.4, 1 mM EGTA, 5 mM Mg(OAc) 2 , 50 mM KOAc, 1 x HALT protease inhibitors, 0.5 mM PMSF) and homogenized in dounce homogenizer with 20 strokes.
- cold mitochondrial isolation buffer 0.2 M sucrose, 10 mM Tris-MOPS pH 7.4, 1 mM EGTA, 5 mM Mg(OAc) 2 , 50 mM KOAc, 1 x HALT protease inhibitors, 0.5 mM PMSF
- Isolated mitochondria were incubated with 2 mM GTP, 10 ⁇ M MASM7 and 40 ⁇ M MFI8 at 37 o C for 30 min. Equal volume of 2X lysis buffer was added to each reaction to have final concentration of (50 mM Bis-Tris, 50 mM NaCl, 10% Glycerol, and 1% wt/vol Digitonin), then samples were incubated on ice for 15 min. Lysates were centrifuged at 16,000g at 4 o C for 30 min. Subsequently, supernatant was mixed with NativePAGE 5% G-250 Sample Additive to a final concentration of 0.25%.
- the dark cathode buffer was replaced with light cathode buffer and the gels were run at 100 V for 30 min and at 200 V for 1 hr and 50 min.
- the gels were transferred to polyvinylidene fluororide (PVDF) membranes at 30 V for 16 h using a transfer buffer (Tris 25 mM, 192 mM glycine, 20 % methanol).
- PVDF polyvinylidene fluororide
- the membranes were incubated 8% acetic acid for 15 min and subsequently washed with water for 5 min. Then, membranes were dried at 37 o C for 20 min, rehydrated in 100% methanol, and washed with water.
- a suspension of 1 ml cells was treated with MASM7 (100 ⁇ M), MFI8 (100 ⁇ M), the combination of both compounds or DMSO (100 ⁇ M) and left rotating for 1 hr at room temperature.
- 50 ⁇ l of the suspension of cells were transferred to PCR tubes and heated in a Biorad C1000 Touch Thermal Cycler for 3 minutes using a temperature gradient (25, 37, 39, 42, 46, 51, 56, 59 °C). All cells were lysed by four cycles of freeze thawing using liquid nitrogen. Samples were then centrifuged at 2 x 10 4 g for 15 minutes.
- MEFs (10 4 cells/well) were seeded in a 96-well black plate and treated with MASM7 or MFI8 for 6 hrs. Following treatments, cells were stained with 250 nM TMRE (Sigma; Cat. 87917) for 20 min at 37°C. Subsequently, cells were washed with thrice with PBS. Fluorescence intensity was detected by a M100 microplate reader (TECAN, Ex: 540 nm/Em: 579 nm). [0132] Mitochondrial respiration in cellulo. Mitochondrial oxygen consumption rates (OCR) were assessed using a XF24 Analyzer (Seahorse Biosciences, Billerica MA, USA).
- OCR Mitochondrial oxygen consumption rates
- Mitochondria were isolated based on previously published protocol. Isolated mitochondria were treated with MFI8 (20 ⁇ M) for 30 min prior to OCR analysis. OCR was measured using the Mitocell (MT200), a Clarktype electrode from Strathkelvin instruments. Isolated mitochondria (50 ⁇ g) from murine cardiomyocytes were loaded into the 50 ⁇ L magnetically stirred respiration chamber containing EBm buffer (1 M sucrose, 0.01 M Tris/HCl, 1 M MgCl2, 0.1 M EGTA/ Tris, 2 mM KH2PO4, pH 7.4). Glutamate and malate were added to the vessel at final concentrations of 0.25 M and 0.125 M, respectively.
- EBm buffer (1 M sucrose, 0.01 M Tris/HCl, 1 M MgCl2, 0.1 M EGTA/ Tris, 2 mM KH2PO4, pH 7.4
- Caspase 3/7 activation was measured after 6 hr by addition of the Caspase-Glo 3/7 reagent according to the manufacturer’s protocol (Promega). Luminescence was detected by a F200 PRO microplate reader (TECAN). Caspase assays were performed in at least triplicate and the data normalized to vehicle-treated control wells. Dilutions of MASM7 or MFI8 were performed using a TECAN D300e Digital Dispenser from 10 mM stocks. [0135] Cytochrome C release. MEFs were seeded in a 10 cm 2 dish and grown at ⁇ 70% confluence.
- Solubilized Pellets were subjected to a 14,000 x rpm spin for 10 min. Samples were prepared for western blot analysis and separated by 4-12% NuPage (Life Technologies). [0136] Cell viability assay. Cells (5 x IO 3 cells/well) were seeded in a 96-well white plate and treated with serial dilutions of MASM7 or MFI8. Cell viability was assayed after 72 hrs by addition of CellTiter-Glo reagent according to the manufacturer’s protocol (Promega). Luminescence was measured using a F200 PRO microplate reader (TECAN). Viability assays were performed in at least triplicate and the data normalized to vehicle-treated control wells. Dilutions of MASM7 or MFI8 were performed using a TECAN D300e Digital Dispenser from 10 mM stocks.
- Cell death assay Cells (2 x 10 5 cells/well) were seeded in a 6-well plate and treated with the indicated drugs for 6 hours. Cells were dissociated using Accutase (Thermo Fisher; Cat. #00-4555-56) in order to avoid accidental exposure of phosphatidylserine on the outer plasma membrane. Cell death was evaluated with Dead Cell Apoptosis Kit with Annexin V Alexa FluorTM 488 & Propidium Iodide (Thermo Fisher; Cat. # V13241) according to manufacturer’s protocol. Data was acquired by BD LSRII flow cytometer system using BD FACSDiva software. Data was analyzed by FlowJo (BD).
- BD FlowJo
- MEFs were treated with MASM7 and MFI8.
- Cells were harvested using a cell scraper and centrifuged at 1200 rpm in 4 °C for 3 min.
- Each cell pellet sample was suspended into 250 to 700 pL of 80% aqueous methanol in an Eppendorf tube.
- the samples were vortex mixed for 15 s and sonicated in an ice-water bath for 5 min, followed by centrifugal clarification at 15,000 rpm and 5 °C in an Eppendorf 5424R centrifuge.
- the clear supernatants were collected.
- a standard stock solution of TCA cycle carboxylic acids, NAD and NADH was prepared in 80% methanol as SI.
- This standard solution SI was serially diluted 1 to 4 (v/v) with the same solvent to make standard solutions S2 to S10.
- 20 pL of each standard solution and an aliquot of the clear supernatant from each cell was mixed with 20 pL of an internal standard solution containing 9 13 C- or deuterium labeled analogues of the TCA cycle carboxylic acids (except isocitric acid), 20 pL of 200 mM 3-NPH solution and 20 pL of 150 mM of EDC solution.
- the mixtures were allowed to react at 30 °C for 30 min. After reaction, 120 pL of water was added to each solution.
- 10 pL of the resultant solutions was injected into a Cl 8 UPLC column to quantitate the TCA cycle carboxylic acids by UPLC-MRM/MS with (-) ion detection, according to the procedure we described in a publication.
- q-PCR was performed using the following primers: Rpl139 Forward: CAAAATCGCCCTATTCCTCA
- each reaction consisted of 10 ng cDNA, 5 ⁇ L Power SYBR Green master mix, 200 nM primers (forward and reverse), and RNase-free water up to 10 ⁇ L.
- q-PCR was performed on the ViiA 7 Real-Time PCR System (Thermo Scientific) with the following cycle parameter: 95 °C for 10 min, 40 cycles of 95 °C for 15 s, and 60 °C for 1 min.
- q-PCR products were analyzed by melting curves for unspecific products or primer dimer formation.
- Rpl39 was used as housekeeping gene and 2 - ⁇ CT method was applied to determine the relative mRNAs expression.
- mtDNA mitochondrial DNA
- gn DNA genomic DNA
- the following primers were used for q-PCR reaction: mt DNA (Nd2) Forward: CCTATCACCCTTGCCATCAT mt DNA (Nd2) Reverse: GAGGCTGTTGCTTGTGTGTGAC gn DNA (Pecam1) Forward: ATGGAAAGCCTGCCATCATG gn DNA (Pecam1) Reverse: TCCTTGTTGTTCAGCATCAC [0143]
- Each reaction consisted of 5 ng of DNA, 5 ⁇ L Power SYBR Green master mix (Thermo Scientific), 200 nM primers (forward and reverse), and RNase-free water up to 10 ⁇ L.
- RNA-seq RNA-seq. Sequencing results were demultiplexed and converted to FASTQ format using Illumina bcl2fastq software. The sequencing reads were adapter and quality trimmed with Trimmomatic and then aligned to the mouse genome (build mm10/GRCm38) using the splice- aware STAR aligner.
- the featureCounts program was utilized to generate counts for each gene based on how many aligned reads overlap its exons. These counts were then normalized and used to test for differential expression using negative binomial generalized linear models implemented by the DESeq2 R package.
- Chemical syntheses All chemical reagents and solvents were obtained from commercial sources and used without further purification.
- FastWoRX TM was purchased from Faster Chemistry LLC. Microwave reactions were performed using an Anton Paar Monowave 300 reactor. Chromatography was performed on a Teledyne ISCO CombiFlash R f 200i using disposable silica cartridges. Analytical thin layer chromatography (TLC) was performed on Merck silica gel plates and compounds were visualized using UV.
- Cyclopropanecarbohydrazide (2) A mixture of methyl cyclopropanecarboxylate (26.31 g, 26.28 mmol) of 1 and hydrazine hydrate (30 g) was refluxed for 12 hours and then placed in vacuum desiccators over sulfuric acid for several days. The crude product was recrystallized from benzene containing a small amount of ethanol and yielded hydrazide 2 (22.4 g, 85%). [0149] Step 2. 2-(cyclopropanecarbonyl)-N-phenylhydrazine-1-carbothioamide (3).
- Step 3 5-cyclopropyl-4-phenyl-4H-1,2,4-triazole-3-thiol (4).
- a solution of potassium hydroxide (2.16 g (38.5 mmol) in water (50 mL) was stirred while 3 (3.50 g, 14.9 mmol) was added. The solution was warmed on a steam bath for 1 hour.
- FIG. 1a shows a pharmacophore hypothesis based on the sidechains of the HR1-amino acids: Val372, Met376, His380 interacting with HR2 as in (C) comprising of 3 hydrophobic points, one aromatic ring and one hydrogen bond donor.
- Fig. 1b shows the chemical structure of MASM7. Previously a helical peptide from the MFN2 HR1 residues: 398-418 was found to inhibit mitochondrial fusion in cells by inhibiting HR2-HR2 inter- molecular interactions and subsequently MFNs oligomerization. This prompted visual inspection of the interactions of the HR1-residues 398-418 with the HR2 residues to gain structural insights for small molecule mimicry.
- a strategy was adopted including virtual library preparation, pharmacophore screen with Phase, selection of top-ranked hits, interaction analysis and molecular property-based selection, and testing of selected hits experimentally.
- An in silico pharmacophore model was generated that screens small molecules to mimic specifically the side chains of the HR1 residues: Leu408, Ala412 and Tyr415 and bind to the corresponding HR2 residues.
- the pharmacophore model includes two hydrophobic interactions, an aromatic ring and a hydrogen bond donor/acceptor (Fig. 2a).
- the in silico library of 13.8 x 10 6 commercially available small molecules was screened using the strategy described above.
- a set of 21 putative Mitochondrial Fusion Inhibitors (MFIs) was selected for experimental validation based on their fit to the pharmacophore model and molecular diversity of their scaffolds.
- Selected hits were screened for their capacity to inhibit mitochondrial fusion in cells by monitoring mitochondrial morphology and using mitochondrial aspect ratio as a readout. Strikingly, MFI8 reduced significantly mitochondrial aspect ratio and emerged as the most effective compound in inhibiting mitochondrial fusion and subsequently promoting mitochondrial fission (Fig. 2b). Titration of MFI8 showed a concentration-dependent reduction of the mitochondrial aspect ratio. MFI8 has a small structure but possesses functional groups that could fulfill the 4 criteria of the pharmacophore model used for the in silico screen.
- the phenolic ring could participate in pi-stacking interactions and act as a hydrogen bond donor/ acceptor, as the side chain of Tyr415, while the dimethyl-substituted phenyl ring could mimic the hydrophobic interactions of Leu408 and Ala412.
- structure activity relationships around the MFI8 scaffold were investigated. A series of MFI8 analogues were generated and evaluated for their capacity to promote mitochondrial fragmentation in cells. Substitution of the chlorine with hydrogen in the aromatic ring of MFI22 significantly reduced the capacity of the compound to promote mitochondrial fragmentation, suggesting that loss of chlorine affects the electron density of the aromatic ring and impairs its interaction.
- MFI8 inhibited mitochondrial fusion in a MFNs dependent manner using mitochondrial aspect ratio as a readout.
- MFI8 was still capable of reducing mitochondrial aspect ratio when either MFN1 or MFN2 was knocked out.
- double knockout of MFN1 and MFN2 completely abolished MFI8 from reducing mitochondrial aspect ratio.
- MFI8 can promote mitochondrial fission by inhibiting mitochondrial fusion and interfering with the formation of either homotypic or heterotypic MFNs complexes.
- MFI8 reduced mitochondrial aspect ratio even when it was co-treated with MASM7 in MEFs.
- MFI8 operates on the tethering permissive structure of MFNs and inhibits MFNs oligomerization by reducing the HR2- HR2 inter-molecular interactions.
- Mitochondrial fusion positively correlates with mitochondrial respiration and membrane potential. Furthermore, inhibition of mitochondrial fusion decreases mitochondrial membrane potential and subsequently respiration.
- MASM7 increases mitochondrial functionality such as mitochodnrial respiration and membrane potential.
- MFI8 decreases mitochondrial functionality such as mitochondrial respiration and membrane potential.
- a series of mutagenesis experiments in vitro and in cellulo supported the observation that both MASM7 and MFI8 interact specifically with the HR2 domain of MFN2, albeit at different binding sites.
- MASM7 and MFI8 modulate the conformational plasticity of MFN2 and its capacity to form oligomers.
- MASM7 promotes oligomerization of MFN2 by promoting the pro-tethering conformation of MFN2, while MFI8 directly inhibits the mitofusin oligomerization.
- Inhibition of mitochondrial fusion promotes minority mitochondrial outer membrane permeabilization, and subsequently caspase 3/7 activation, albeit at sub-lethal levels. Aberrant mitochondrial fragmentation promotes minority MOMP and sub-lethal caspase 3/7 activation. Experiments have connected mitochondrial shape with mitochondrial membrane integrity and caspase 3/7 activation.
- MFI8 sensitizes cells to BV6 (SMAC mimetic) treatment in a mitofusin and APAF-1 dependent manner. Inhibition of mitochondrial fusion promotes minority MOMP and activates caspases 3/7, which can be used in combination with chemotherapeutic agents that act downstream of MOMP, such as Smac mimetics (e.g.BV6) , to promote synergistic cell death in cells.
- Smac mimetics e.g.BV6
- MFN2-HR2 domain (residues 678-757) was produced and evaluated for their interaction in comparison with 367-384Gly and 398-418Gly peptides using microscale thermophoresis (MST).
- MST microscale thermophoresis
- MASM7 and MFI8 demonstrated direct binding to the HR2 domain of MFN2 with Kds in the low micrormolar range and that was comparable to the binding interactions of 367-384Gly and 398- 418Gly peptides, respectively.
- MASM23 and MFI23 demonstrated direct binding to the HR2 domain of MFN2, in line with our previous results that showed that these small molecules are capable of increasing or decreasing the mitochondrial aspect ratio, respectively.
- MASM19, MASM21, MASM22, MFI22, MFI25 and MFI26 did not demonstrate measurable binding to the HR2 domain of MFN2, in agreement with the inability or weak activity of these compounds to promote mitochondrial fusion or fision, respectively.
- MFI8 also interacted with the HR2 domain of MFN2 in cells.
- MASM7 markedly increased mitochondrial aspect ratio in MFN1/MFN2 DKO MEFs when reconstituted with WT MFN2, but not when reconstituted with D725A/L727A or L727A MFN2 mutants, underscoring that MASM7 specifically targets the HR2 domain of MFN2 in cells.
- MFI8 significantly decreased mitochondrial aspect ratio in MFN1/MFN2 DKO MEFs when reconstituted with WT MFN2, but not when reconstituted with S685A or L692A MFN2 mutants, indicatinging that MFI8 interacts specifically with the HR2 domain of MFN2 in cells.
- MST, NMR and mitochondrial morphology data supported that MASM7 and MFI8 specifically interact with the HR2 domain as predicted from the pharmacophore models.
- MASM7 and MFI8 modulates MFN conformation and complexes. Next, it was investigated whether MASM7 and MFI8 can modulate MFN2 oligomerization in its native membrane environment.
- isolated mitochondria from MEFs were treated with MASM7 or MFI8 and the capacity of MFN2 to form oligomers was monitored using blue native gel electrophoresis (BN-PAGE).
- MFN2 migrated as a dimer in the absence of GTP, while incubation with GTP promoted higher order oligomers ⁇ 450 kD.
- treatment of MASM7 in isolated mitochondria increased the ratio of higher order oligomers ⁇ 450 kD to dimers upon GTP binding, whereas MFI8 reduced the ratio.
- CTSA cellular extract thermal shift assay
- MFI8 binds in vitro and in cells on the HR2 domain of MFN2, reduces the ratio of higher order MFN2 oligomers to dimers and inhibits mitochondrial fusion in a MFN dependent manner, it was speculated that MFI8 engages better with the pro- tethering conformation of MFN2 in which the HR2 domain is exposed in the cytoplasm. To test this hypothesis cells were co-treated with MFI8 and MASM7, where the latter compound was found promote the pro-tethering conformation and increase the Tm of MFN2.
- Tm 42.9 ⁇ 0.8 o C
- MASM7-induced MFN2 stabilization can also be attributed to the increased complexation of MFN2 with other proteins, presumably MFN1 and MFN2 as part of their functional oligomerization to mediate mitochondrial fusion.
- MFI8 destabilizes homotypic (MFN2- MFN2) or heterotypic (MFN1-MFN2) complex formation.
- MFN2- MFN2 homotypic
- MFN1-MFN2 heterotypic
- MASM7 nor MFI8 altered MFN1 and MFN2 gene expression and their corresponding protein levels.
- MASM7 nor MFI8 altered Tomm20 protein levels, mitotracker green intensity and mitochondrial to nuclear DNA ratio, suggesting that none of the compounds altered mitochondrial biomass.
- no alteration in the gene expression levels of mitochondrial biogenesis markers was detected upon MASM7 or MFI8 treatment.
- MFI8 did not alter the ratio of state Ill/state II respiration of isolated mitochondria, indicating that MFI8 does not impact directly the electron transport chain (ETC) or is an unspecific uncoupler to isolated mitochondria but it rather reduces mitochondrial respiration by modulating mitochondrial dynamics.
- WT MFN2 or [3-Galactosidase (PGal) was reconstituted in MFN1/MFN2 DKO MEFs and the mitochondrial membrane potential was evaluated using TMRE staining as a readout.
- WT MFN2 possessed a higher mitochondrial membrane potential compared to cells that expressed PGal.
- MASM7 concentration responsively increased mitochondrial membrane potential in WT MEFs.
- MASM7 significantly increased mitochondrial membrane potential of MFN1/MFN2 DKO MEFs when reconstituted with WT MFN2 and to a lesser extent when reconstituted with L727A MFN2.
- MASM7-induced increase in mitochondrial membrane potential was revoked when cells were co-treated with myxothiazol or rotenone, indicating that the increase in the membrane potential upon MASM7 treatment is derived from an increased activity of the ETC.
- MFI8 concentration responsively decreased mitochondrial membrane potential in WT MEFs. It is noteworthy that MFI8 significantly decreased mitochondrial membrane potential of MFN1/MFN2 DKO MEFs when reconstituted with WT MFN2 but not when reconstituted with L692A MFN2.
- MFI8 reduced the gene expression of several nuclear-encoded subunits of the respiratory complexes as revealed by RNA-seq analysis, while MASM7 altered expression of selected genes of the respiratory complexes rather than inducing a consistent trend. Such result is in line with the idea that MFI8 promotes mitochondrial dysfunction and highlights that alterations in mitochondrial dynamics can affect gene transcription. [0194] Next, it was determined whether such alterations can have an impact on the metabolites of the TCA cycle. Surprisingly, MASM7 had no significant effect in the majority of the metabolites of the TCA cycle. On the contrary, MFI8 markedly reduced several metabolites such as malate, oxaloacetate, and ⁇ -ketoglutarate.
- MFI8 decreased the total NAD + /NADH ratio, which is consistent with reduced oxidative capacity.
- MASM7 had no effect on total NAD + /NADH ratio.
- MFI8 an analogue of MFI8 that is unable to inhibit MFNs’ fusogenic activity and induce aberrant mitochondrial fragmentation, MFI22, did not increase caspase-3/7 activity. Consistently, deletion of MFN1/MFN2 also impaired the capacity of MFI8 to increase caspase-3/7 activity. Taken together these data indicate that MFI8 induces caspase 3/7 activation in a MFNs dependent manner, and such phenotype is associated with mitochondrial fragmentation. Deletion of APAF-1 was detrimental for the capacity of MFI8 to increase caspase 3/7 activity, indicating that apoptosome formation is crucial for the MFI8- induced caspase 3/7 activation.
- cytosolic and mitochondrial fractions were also analyzed upon treatment with MFI8 and it was found that cytochrome c was released to the cytosol, albeit at modest levels and in a mitofusin dependent manner.
- MFI8 did not increase the percentage of dead cells upon caspase 3/7 activation. Consistently, neither MFI8 nor MASM7 decreased cellular viability over the course of 72 hours.
- Figures 3-8 further illustrates that MFI8 induces apoptosis in Calu-6 cells and various cancer cell lines. [0196] Since cytochrome c release and caspase-3/7 activation was detected upon MFI8 treatment, it was posited that inhibition of mitochondrial fusion by MFI8 could induce mitochondrial outer membrane permeabilization (MOMP).
- MOMP mitochondrial outer membrane permeabilization
- MFI8 increased yH2AX foci in WT MEFs but not in MFN1/MFN2 DKO MEFs, demonstrating that MFI8 induces DNA damage in a MFNs dependent manner.
- MASM7 did not induce DNA damage in any of the cell lines.
- MFI8 up-regulated several genes that are involved in DNA damage response in MEFs.
- MFI8 induced DNA damage in U2OS cells.
- co-treatment of a pan-caspase inhibitor, Q-VD-OPh, with MFI8 abolished the capacity of the latter to induce DNA damage in U2OS.
- MFI8 induction of minority MOMP by MFI8 can be used to enhance the capacity of another pro-apopotic agent to induce cell death.
- BV6 a bivalent SMAC mimetic that induces caspase-dependent cell death predominantly via XIAP inhibition was used.
- deletion of MFNs sensitized cells to BV6 treatment.
- MFI8 potentiated the capacity of BV6 to induce cell death.
- the effect of MFI8 was specific to MFN1/2 inhibition as MFI22 did not sensitize cells to BV6 treatment.
- deletion of MFN1/2 and APAF abolished the capacity of MFI8 to sensitize cells to BV6 treatment.
- MASM7 and MFI8 were found to increase or decrease, respectively, the GTP-dependent MFN2 higher-order oligomers, demonstrating these small molecules can modulate the levels of pro-fusion oligomers, and therefore the extent of fusion among mitochondria. These data also support that the activity of MASM7 and MFI8 through their interactions with the HR2 domain of MFN1/2 is compatible with the proposed GTP -mediated dimerization mechanism of the GTPase domains of MFNs. The data indicated that MASM7 can activate both MFN2 and MFN1, while MFI8 can inhibit both MFN2 and MFN1. This can be attributed to the high sequence homology between MFN1 and MFN2, and the conservation of the residues that are located in the binding region of each small molecule between MFN1 and MFN2.
- MFNs modulators reported here allow temporal manipulation of the fusogenic activity of MFNs in a reversible fashion. This is in contrast to other small molecules that have been reported such as the drug Leflunomide, which alters MFNs protein levels through loss of pyrimidine synthesis and are likely to affect non-fusogenic functions of MFNs.
- the rational discovery of MASM7 and MFI8 enables development of novel therapeutics for disorders/syndromes where impaired mitochondrial dynamics contributes to pathogenesis.
- Defective MFN2 mutants have been associated with development of Charcot-Marie-Tooth disease type 2A (CMT2A) and imbalances in mitochondrial dynamics have been linked to metabolic disorders such as type II diabetes, obesity, neurodegeneration, cancer and aging.
- CMT2A Charcot-Marie-Tooth disease type 2A
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202163286264P | 2021-12-06 | 2021-12-06 | |
| US202263366746P | 2022-06-21 | 2022-06-21 | |
| PCT/US2022/080900 WO2023107880A1 (en) | 2021-12-06 | 2022-12-05 | Mitofusin inhibitors and uses thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP4444284A1 true EP4444284A1 (en) | 2024-10-16 |
| EP4444284A4 EP4444284A4 (en) | 2026-02-25 |
Family
ID=86731254
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP22905260.0A Pending EP4444284A4 (en) | 2021-12-06 | 2022-12-05 | Mitofusin inhibitors and their uses |
Country Status (2)
| Country | Link |
|---|---|
| EP (1) | EP4444284A4 (en) |
| WO (1) | WO2023107880A1 (en) |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EA008622B1 (en) * | 2002-06-05 | 2007-06-29 | Инститьют Оф Медисинал Молекьюлар Дизайн. Инк. | Immunity-related protein kinase inhibitors |
| CN1658872B (en) * | 2002-06-06 | 2010-09-22 | 株式会社医药分子设计研究所 | anti allergy medicine |
| AU2003300360A1 (en) * | 2002-12-20 | 2004-07-22 | Migenix Corp. | Ligands of adenine nucleotide translocase (ant) and compositions and methods related thereto |
| KR20060054308A (en) * | 2003-07-16 | 2006-05-22 | 가부시키가이샤 이야쿠 분지 셋케이 겐쿠쇼 | Skin pigmentation treatment |
| BRPI0713314A2 (en) * | 2006-06-20 | 2012-03-06 | Lek Pharmaceuticals D.D. | PROCESS FOR THE PREPARATION OF 3- (2-HYDROXY-5-PHENY SUBSTITUTED) -N-ALKYL-3-PHENYLPROPYLAMINS |
| US8530593B2 (en) * | 2009-10-28 | 2013-09-10 | Exxonmobil Chemical Patents Inc. | Catalyst compounds and use thereof |
| KR101434461B1 (en) * | 2011-10-21 | 2014-09-01 | 한국생명공학연구원 | 2-hydroxyarylamide derivatives or pharmaceutically acceptable salts thereof, process for the preparation thereof, and pharmaceutical composition for the prevention and treatment of cancers containing the same as an active ingredient |
| CN104045604B (en) * | 2014-06-09 | 2016-03-09 | 湖南科技大学 | Have 3 of fungicidal activity, 4 (6)-two replace-1,3-benzoxazine-2-ketone compounds |
-
2022
- 2022-12-05 WO PCT/US2022/080900 patent/WO2023107880A1/en not_active Ceased
- 2022-12-05 EP EP22905260.0A patent/EP4444284A4/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| EP4444284A4 (en) | 2026-02-25 |
| WO2023107880A1 (en) | 2023-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12077507B2 (en) | Compositions and methods for treating cancer | |
| EP3184519B1 (en) | Acid-addition salt of trk-inhibiting compound | |
| US9238654B2 (en) | Singleton inhibitors of sumoylation enzymes and methods for their use | |
| US12428405B2 (en) | Chalcone-based chemotherapeutic compound for triple negative breast cancer | |
| Li et al. | Development of a novel thymidylate synthase (TS) inhibitor capable of up-regulating P53 expression and inhibiting angiogenesis in NSCLC | |
| Yang et al. | Discovery of fused benzimidazole-imidazole autophagic flux inhibitors for treatment of triple-negative breast cancer | |
| Wu et al. | Green synthesis and anti-tumor efficacy via inducing pyroptosis of novel 1H-benzo [e] indole-2 (3H)-one spirocyclic derivatives | |
| US20240366540A1 (en) | Mitofusin inhibitors and uses thereof | |
| JP2022522395A (en) | New Salts of Selective Estrogen Receptor Degradants | |
| WO2023107880A1 (en) | Mitofusin inhibitors and uses thereof | |
| WO2014038894A1 (en) | Ethyl(2-methyl-3{(e)-[(naphtha[2,1-b]furan-2-ylcarbonyl)hydrazono]methyl}-1h-indole-1-yl)acetate, and composition comprising analogues thereof as active component, for preventing and treating cancer | |
| WO2024254174A2 (en) | Novel mitofusin inhibitors | |
| US20240317762A1 (en) | Phthalazinone-based parp-1 inhibitors | |
| US11512073B2 (en) | Benzimidazole derivatives, pharmaceutical composition comprising the same, and use thereof | |
| CN104496896A (en) | Preparation and application of sorafenib derivative containing sulfonylurea structure | |
| WO2021189036A1 (en) | Taf1 inhibitors | |
| Zhang et al. | Discovery of Potent and Selective Pyrrolo [2, 3-d] Pyrimidine-Based Aurora A Inhibitors with Demonstrated Efficacy against Patient-Derived Gastric Cancer Organoids | |
| WO2026050773A1 (en) | Protein kinase inhibitors and uses thereof | |
| EP4499617A1 (en) | An oxaziridine platform for targeting functional allosteric methionine sites | |
| HK1234061B (en) | Acid-addition salt of trk-inhibiting compound | |
| HK1234061A1 (en) | Acid-addition salt of trk-inhibiting compound | |
| HK40016602B (en) | Compositions and methods for treating cancer | |
| HK40016602A (en) | Compositions and methods for treating cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20240702 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R079 Free format text: PREVIOUS MAIN CLASS: A61K0031165000 Ipc: C07C0233640000 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: C07C 233/64 20060101AFI20251027BHEP Ipc: C07C 215/50 20060101ALI20251027BHEP Ipc: C07C 233/18 20060101ALI20251027BHEP Ipc: C07C 235/64 20060101ALI20251027BHEP Ipc: A61K 31/165 20060101ALI20251027BHEP Ipc: A61K 31/167 20060101ALI20251027BHEP Ipc: A61P 35/00 20060101ALI20251027BHEP |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20260123 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: C07C 233/64 20060101AFI20260119BHEP Ipc: C07C 215/50 20060101ALI20260119BHEP Ipc: C07C 233/18 20060101ALI20260119BHEP Ipc: C07C 235/64 20060101ALI20260119BHEP Ipc: A61K 31/165 20060101ALI20260119BHEP Ipc: A61K 31/167 20060101ALI20260119BHEP Ipc: A61P 35/00 20060101ALI20260119BHEP |