EP4430408A1 - Systems and methods for digital affinity-based detection assays - Google Patents
Systems and methods for digital affinity-based detection assaysInfo
- Publication number
- EP4430408A1 EP4430408A1 EP22893789.2A EP22893789A EP4430408A1 EP 4430408 A1 EP4430408 A1 EP 4430408A1 EP 22893789 A EP22893789 A EP 22893789A EP 4430408 A1 EP4430408 A1 EP 4430408A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- emission
- analyte
- light
- agent
- detectable
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N15/00—Investigating characteristics of particles; Investigating permeability, pore-volume or surface-area of porous materials
- G01N15/10—Investigating individual particles
- G01N15/14—Optical investigation techniques, e.g. flow cytometry
- G01N15/1456—Optical investigation techniques, e.g. flow cytometry without spatial resolution of the texture or inner structure of the particle, e.g. processing of pulse signals
- G01N15/1459—Optical investigation techniques, e.g. flow cytometry without spatial resolution of the texture or inner structure of the particle, e.g. processing of pulse signals the analysis being performed on a sample stream
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B03—SEPARATION OF SOLID MATERIALS USING LIQUIDS OR USING PNEUMATIC TABLES OR JIGS; MAGNETIC OR ELECTROSTATIC SEPARATION OF SOLID MATERIALS FROM SOLID MATERIALS OR FLUIDS; SEPARATION BY HIGH-VOLTAGE ELECTRIC FIELDS
- B03C—MAGNETIC OR ELECTROSTATIC SEPARATION OF SOLID MATERIALS FROM SOLID MATERIALS OR FLUIDS; SEPARATION BY HIGH-VOLTAGE ELECTRIC FIELDS
- B03C1/00—Magnetic separation
- B03C1/005—Pretreatment specially adapted for magnetic separation
- B03C1/01—Pretreatment specially adapted for magnetic separation by addition of magnetic adjuvants
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B03—SEPARATION OF SOLID MATERIALS USING LIQUIDS OR USING PNEUMATIC TABLES OR JIGS; MAGNETIC OR ELECTROSTATIC SEPARATION OF SOLID MATERIALS FROM SOLID MATERIALS OR FLUIDS; SEPARATION BY HIGH-VOLTAGE ELECTRIC FIELDS
- B03C—MAGNETIC OR ELECTROSTATIC SEPARATION OF SOLID MATERIALS FROM SOLID MATERIALS OR FLUIDS; SEPARATION BY HIGH-VOLTAGE ELECTRIC FIELDS
- B03C1/00—Magnetic separation
- B03C1/02—Magnetic separation acting directly on the substance being separated
- B03C1/28—Magnetic plugs and dipsticks
- B03C1/288—Magnetic plugs and dipsticks disposed at the outer circumference of a recipient
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B03—SEPARATION OF SOLID MATERIALS USING LIQUIDS OR USING PNEUMATIC TABLES OR JIGS; MAGNETIC OR ELECTROSTATIC SEPARATION OF SOLID MATERIALS FROM SOLID MATERIALS OR FLUIDS; SEPARATION BY HIGH-VOLTAGE ELECTRIC FIELDS
- B03C—MAGNETIC OR ELECTROSTATIC SEPARATION OF SOLID MATERIALS FROM SOLID MATERIALS OR FLUIDS; SEPARATION BY HIGH-VOLTAGE ELECTRIC FIELDS
- B03C1/00—Magnetic separation
- B03C1/02—Magnetic separation acting directly on the substance being separated
- B03C1/30—Combinations with other devices, not otherwise provided for
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N15/00—Investigating characteristics of particles; Investigating permeability, pore-volume or surface-area of porous materials
- G01N15/06—Investigating concentration of particle suspensions
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N15/00—Investigating characteristics of particles; Investigating permeability, pore-volume or surface-area of porous materials
- G01N15/10—Investigating individual particles
- G01N15/14—Optical investigation techniques, e.g. flow cytometry
- G01N15/1429—Signal processing
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N15/00—Investigating characteristics of particles; Investigating permeability, pore-volume or surface-area of porous materials
- G01N15/10—Investigating individual particles
- G01N15/14—Optical investigation techniques, e.g. flow cytometry
- G01N15/1434—Optical arrangements
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/54313—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being characterised by its particulate form
- G01N33/54326—Magnetic particles
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/54313—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being characterised by its particulate form
- G01N33/54326—Magnetic particles
- G01N33/54333—Modification of conditions of immunological binding reaction, e.g. use of more than one type of particle, use of chemical agents to improve binding, choice of incubation time or application of magnetic field during binding reaction
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B03—SEPARATION OF SOLID MATERIALS USING LIQUIDS OR USING PNEUMATIC TABLES OR JIGS; MAGNETIC OR ELECTROSTATIC SEPARATION OF SOLID MATERIALS FROM SOLID MATERIALS OR FLUIDS; SEPARATION BY HIGH-VOLTAGE ELECTRIC FIELDS
- B03C—MAGNETIC OR ELECTROSTATIC SEPARATION OF SOLID MATERIALS FROM SOLID MATERIALS OR FLUIDS; SEPARATION BY HIGH-VOLTAGE ELECTRIC FIELDS
- B03C2201/00—Details of magnetic or electrostatic separation
- B03C2201/18—Magnetic separation whereby the particles are suspended in a liquid
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B03—SEPARATION OF SOLID MATERIALS USING LIQUIDS OR USING PNEUMATIC TABLES OR JIGS; MAGNETIC OR ELECTROSTATIC SEPARATION OF SOLID MATERIALS FROM SOLID MATERIALS OR FLUIDS; SEPARATION BY HIGH-VOLTAGE ELECTRIC FIELDS
- B03C—MAGNETIC OR ELECTROSTATIC SEPARATION OF SOLID MATERIALS FROM SOLID MATERIALS OR FLUIDS; SEPARATION BY HIGH-VOLTAGE ELECTRIC FIELDS
- B03C2201/00—Details of magnetic or electrostatic separation
- B03C2201/26—Details of magnetic or electrostatic separation for use in medical or biological applications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N1/00—Sampling; Preparing specimens for investigation
- G01N1/28—Preparing specimens for investigation including physical details of (bio-)chemical methods covered elsewhere, e.g. G01N33/50, C12Q
- G01N1/34—Purifying; Cleaning
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N15/00—Investigating characteristics of particles; Investigating permeability, pore-volume or surface-area of porous materials
- G01N15/06—Investigating concentration of particle suspensions
- G01N15/075—Investigating concentration of particle suspensions by optical means
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N15/00—Investigating characteristics of particles; Investigating permeability, pore-volume or surface-area of porous materials
- G01N15/10—Investigating individual particles
- G01N15/14—Optical investigation techniques, e.g. flow cytometry
- G01N15/149—Optical investigation techniques, e.g. flow cytometry specially adapted for sorting particles, e.g. by their size or optical properties
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N15/00—Investigating characteristics of particles; Investigating permeability, pore-volume or surface-area of porous materials
- G01N15/06—Investigating concentration of particle suspensions
- G01N2015/0687—Investigating concentration of particle suspensions in solutions, e.g. non volatile residue
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N15/00—Investigating characteristics of particles; Investigating permeability, pore-volume or surface-area of porous materials
- G01N15/10—Investigating individual particles
- G01N2015/1006—Investigating individual particles for cytology
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N15/00—Investigating characteristics of particles; Investigating permeability, pore-volume or surface-area of porous materials
- G01N15/10—Investigating individual particles
- G01N15/14—Optical investigation techniques, e.g. flow cytometry
- G01N15/1434—Optical arrangements
- G01N2015/1438—Using two lasers in succession
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N15/00—Investigating characteristics of particles; Investigating permeability, pore-volume or surface-area of porous materials
- G01N15/10—Investigating individual particles
- G01N15/14—Optical investigation techniques, e.g. flow cytometry
- G01N15/1434—Optical arrangements
- G01N2015/1452—Adjustment of focus; Alignment
Definitions
- the Sequence Listing XML associated with this application is provided in XML format and is hereby incorporated by reference into the specification.
- the name of the XML file containing the sequence listing is 3915-P1137WO UW SL.
- the XML file is 3 pages long; was created on September 29, 2022; and is being submitted via Patent Center with the filing of the specification.
- Typical flow-based particle analysis includes flowing a number of particles dispersed in a fluid suspension through a channel. As a size of the particles decreases, the particles tend to diffuse faster than larger particles. Additionally, because a velocity of fluid flowing through the channel under laminar conditions varies radially according to its distance from a wall of the channel, the velocity of the particles flowing through the channel correspondingly varies according to their distance from the wall. Accordingly, it is more difficult to differentiate between various smaller particles flowing through a channel as particle velocity is dependent upon their radial position, which is, in turn strongly affected by their relatively high diffusivity. The issues of detection sensitivity as the particles or molecules flow through is particularly relevant in digital affinity-based detection assays in which the presence of even a single molecule should be reliably detected and counted as it flows past a detection region or laser probe volume.
- the present disclosure provides a method for digital affinity-based detection assays.
- the method is a method of digital affinity-based assays of analytes.
- the method is a method of digital affinity-based assays of single-molecule analytes.
- the method is a method of digital affinity-based assays of single-molecule analytes without the need for and/or does not include performing an amplification step.
- the method comprises associating an analyte in a sample with a detectable agent; flowing the sample including the analyte associated with the detectable agent through a flow channel; outputting excitation light through an interrogation window through a portion of the flow channel; and generating an emission signal with a photodetector based on emission light received through the interrogation window from the portion of the flow channel.
- the present disclosure provides a system for analyzing singlemolecule analytes.
- the system for analyzing single-molecule analytes does not include reagents or structures for performing an amplification step, such as an analyte amplification step
- the system comprises a flow channel configured to flow a single-molecule analyte through a lumen of the flow channel, the flow channel defining an interrogation window configured to allow light to pass into and out of the lumen; a light engine configured to output excitation light into the flow channel through the interrogation window; a detector system positioned to receive emission light emitted from the flow channel and configured to generate a signal based upon the received emission light; a light collection system positioned to collect the emission light from the flow channel and direct the collected emission light onto the detector system; and a controller operatively coupled to the light engine and the detector system, including logic that, when executed by the controller, causes the system to perform operations including: outputting excitation light with the light engine through the interrog
- FIGURE 1A is a schematic illustration of a flow-based, single-particle/molecule analysis system using a high-numeric aperture (NA) air objective, in accordance with an embodiment of the disclosure
- FIGURE IB is a schematic illustration of emission fiber bundle heads of the system of FIGRUE 1 A, in accordance with an embodiment of the disclosure
- FIGURE 2 is schematic illustration of a detector module of a flow-based, single- molecule/particle system, in accordance with an embodiment of the disclosure
- FIGURE 3A is a schematic illustration of a light engine and channel of a flow-based, single-molecule/particle system, in accordance with an embodiment of the disclosure
- FIGURE 3B is a schematic illustration of an interrogation window of the channel of FIGURE 3 A, in accordance with an embodiment of the present disclosure
- FIGURE 3C is a schematic illustration of an example of the light engine and the channel of FIGURE 3 A, in accordance with an embodiment of the disclosure
- FIGURE 3D is a schematic illustration of an example of the light engine and the channel of FIGURE 3 A, in accordance with an embodiment of the disclosure
- FIGURE 3E is a schematic illustration of an example of the light engine and the channel of FIGURE 3 A, in accordance with an embodiment of the disclosure
- FIGURE 3F is a schematic illustration of an example of the light engine and the channel of FIGURE 3 A, in accordance with an embodiment of the disclosure
- FIGURE 4 is an image of a channel of a system, in accordance with an embodiment of the present disclosure, in accordance with an embodiment of the disclosure;
- FIGURE 5A schematically illustrates emission light passing through apertures of an optically opaque cover and onto an emission fiber bundle head of a detector system, in accordance with an embodiment of the present disclosure
- FIGURE 5B illustrates an example of the optically opaque cover of FIGURE 5 A, in accordance with an embodiment of the present disclosure
- FIGURE 5C is an image of an emission fiber bundle head of a flow-based, single- molecule/particle system, in accordance with an embodiment of the present disclosure
- FIGURE 6 is a schematic illustration of a flow-based, single-molecule/particle system using a high-NA air objective in accordance with an embodiment of the disclosure
- FIGURE 7A is a schematic illustration of a flow-based, single-molecule/particle system in accordance with an embodiment of the disclosure
- FIGURE 7B is a schematic illustration of focusing a high-NA air objective relative to the sample of the system of FIGURE 7A on a channel of the system, in accordance with an embodiment of the present disclosure
- FIGURE 7C is a block diagram illustrating a method of focusing a high-NA air objective of a flow-based, single-molecule/particle system, in accordance with an embodiment of the present disclosure
- FIGURE 7D is a series of images of a channel taken a number of distances between the channel and the high-NA air objective and having different amounts of defocus, in accordance with an embodiment of the disclosure
- FIGURE 7E illustrates an amount of focusing quality at various distances between the channel and the high-NA air objective, in accordance with an embodiment of the disclosure, noting the positions of the images of FIGURE 7D;
- FIGURE 7F is a block diagram illustrating a feedback control loop used to set a focal plane using near infrared imaging with a high-NA air objective, in accordance with an embodiment of the disclosure;
- FIGURE 7G is another block diagram illustrating a feedback control loop used to perform real-time focusing assisted by near infrared machine vision and a high-NA air objective, in accordance with an embodiment of the disclosure
- FIGURE 8 is a schematic illustration of a system including a purification subsystem, in accordance with an embodiment of the present disclosure
- FIGURE 9A is a block diagram of a method, in accordance with an embodiment of the present disclosure.
- FIGURE 9B is a block diagram of a method, in accordance with an embodiment of the present disclosure.
- FIGURE 10A is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- FIGURE 10B is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- FIGURE 10C is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- FIGURE 12A is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- FIGURE 12B is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- FIGURE 13 is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- FIGURE 14 is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- FIGURE 15 is a schematic illustration of a method, in accordance with an embodiment of the present disclosure
- FIGURE 16A is a schematic illustration of a method, in accordance with an embodiment of the present disclosure
- FIGURE 16B is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- FIGURE 17 is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- FIGURE 18A is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- FIGURE 18B is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- FIGURE 18C is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- FIGURE 19 is a schematic illustration of a system, in accordance with an embodiment of the present disclosure.
- FIGURE 20 is a schematic illustration of a system, in accordance with an embodiment of the present disclosure.
- FIGURE 21 is a block diagram of a method, in accordance with an embodiment of the present disclosure.
- FIGURE 22 is a block diagram of a method, in accordance with an embodiment of the present disclosure.
- FIGURE 23A is a data trace showing five two-color colocalized events (i.e., analyte, non-fluorescent streptavidin), three unbound detectable agents (i.e., biotin-Alexa647), and two unbound capture agents (i.e., anti-streptavidin-PE antibodies), in accordance with an embodiment of the present disclosure;
- FIGURE 23B is a scatter plot showing 372 analyte molecules (i.e., streptavidin) counted using a method, according to an embodiment of the present disclosure, from FIGURE 23 A;
- FIGURE 24A is a data trace showing seven two-color colocalized events (i.e., non- fluorescent analyte, mouse-anti-rabbit IgG), five unbound detectable agents (i.e., goat-anti- mouse IgG-PE), and three unbound capture agents (i.e., rabbit-anti-human IgG-Alexa647), according to an embodiment of the present disclosure;
- seven two-color colocalized events i.e., non- fluorescent analyte, mouse-anti-rabbit IgG
- five unbound detectable agents i.e., goat-anti- mouse IgG-PE
- three unbound capture agents i.e., rabbit-anti-human IgG-Alexa647
- FIGURE 24B is a scattered plot showing 765 analyte molecules (i.e., non-fluorescent mouse-anti-rabbit IgG) counted using a method, according to an embodiment of the present disclosure, from FIGURE 24A;
- 765 analyte molecules i.e., non-fluorescent mouse-anti-rabbit IgG
- FIGURE 25A is a data trace showing eight two-color colocalized non-fluorescent analytes and three unbound capture agents (i.e., rabbit-anti-human IgG-Alexa647), in accordance with an embodiment of the present disclosure;
- FIGURE 25B is a scatter plot showing 655 analyte molecules counted using a method, according to an embodiment of the present disclosure, from FIGURE 25A;
- FIGURE 26A illustrates a data trace of nine two-color colocalized events from a sample prepared without purification indicating the presence of nine analyte molecules counted, and nineteen unbound capture agents (i.e., goat-anti-mouse IgG-Alexa647) that did not colocalize with any signal in the channel of the fluorescence from beads/nanoparticles, in an accordance with an embodiment of the present disclosure,
- unbound capture agents i.e., goat-anti-mouse IgG-Alexa647
- FIGURE 26B illustrates a data trace of eight two-color colocalized events prepared with sample purification, suggesting the presence of nine analyte molecules counted with only three unbound capture agents (i.e., goat-anti-mouse IgG-Alexa647), in accordance with an embodiment of the present disclosure;
- FIGURE 27 illustrates a data trace showing twelve peaks from the fluorescence of Alexa647, indicating the presence of twelve analyte molecules (i.e., mouse-IgG) counted in the digital dual-affinity protein assay after magnetic bead capture and purification, in accordance with an embodiment of the present disclosure
- FIGURE 28A illustrates a library of nine sample barcodes, among which the target barcode showed the medium level of Alexa488 (green fluorescence) and high intensity of Alexa561 (orange fluorescence), in accordance with an embodiment of the present disclosure
- FIGURE 28B three events with the colocalization of a target barcode and the peaks from Alexa647 channel (red fluorescence) identified as the presence of mouse-IgG, in accordance with an embodiment of the present disclosure
- FIGURE 29 illustrates a data trace showing seven events with the colocalization of capture agent and detectable agent counted as seven copies of the target or analyte gene molecule, in accordance with an embodiment of the present disclosure
- FIGURE 30 illustrates a data trace in which each peak in the data trace of Alexa647 channel represents a single target or analyte gene captured by a capture agent comprising of nucleic acid molecules associated with a magnetic bead, in accordance with an embodiment of the present disclosure
- FIGURE 31 A illustrates data traces for a library of nine model barcodes, among which the target barcode showed a high level of Alexa488 (green fluorescence) and low intensity of Alexa561 (orange fluorescence), according to an embodiment of the present disclosure
- FIGURE 3 IB shows a data trace including in which three events with the colocalization of target barcode and the peaks from Alexa647 channel (red fluorescence) were detected and counted as the target or analyte gene molecules, according to an embodiment of the present disclosure
- FIGURE 32 illustrates a data trace from which each fluorescence peak from YOYO-3 was counted as a copy of the target gene, in accordance with an embodiment of the present disclosure
- FIGURE 33 illustrates a data trace from which each colocalized event from Alexa647 and YOYO-3 indicates the presence of a copy of the target gene, in accordance with an embodiment of the present disclosure
- FIGURE 34A schematically illustrates a method of labelling and analyzing a fluorescently labelled analyte with a fluorescently barcoded bead, in accordance with an embodiment of the present disclosure
- FIGURE 34B illustrates a data trace showing two triple-positive events based on single streptavidin-PE (analyte, Orange color) molecules captured by fluorescence barcode beads (Blue and Purple color), and two other events corresponding to unbound beads in the absence of analyte, in accordance with an embodiment of the present disclosure
- FIGURE 34C is a scatter plot showing 566 colocalized events enumerated in 2 min, in accordance with an embodiment of the present disclosure.
- Small particles and molecules tend to diffuse in a fluid flowing within a channel more than larger particles. Radial displacement of the particles, i.e., displacement of the particles in a direction orthogonal to a major flow axis of the channel, due to diffusion of the particle can make measuring characteristics of such small particles, such as fluorescence measurements, challenging, particularly when there are a number of particles or molecules flowing through the channel. For example, with multiple particles or molecules flowing through the channel simultaneously, individual particles or molecules may have different velocities through the channel. Where particles and/or molecules in the channel are measured at various points in the channel, correlating signals generated by photodetectors positioned to interrogate the channel at various points along a length of the channel with a single molecule or particle can become challenging. Indeed, as a size of the particles decreases toward the size of, for example, extracellular vesicles, or even single molecules, such measurement can become very challenging.
- SYSTEMS SYSTEMS
- the present disclosure provides a system for analyzing particles, such as single biological nanoparticles, and/or molecules.
- FIGURES 1 A and IB attention is directed to FIGURES 1 A and IB, in which a system 100, in accordance with an embodiment of the present disclosure, is illustrated.
- the system 100 includes a channel 102 configured to flow a particle and/or molecules through a lumen 104 of the channel 102, the channel 102 defining an interrogation window 106 configured to allow light to pass into and out of the lumen 104; a light engine 108 configured to output light into the interrogation window 106; an emission fiber bundle 130 positioned to receive emission light emitted from the interrogation window 106; and a detector system 142 positioned to receive the emission light emitted from the emission fiber bundle 130.
- the system 100 or a portion thereof including, for example, the channel 102 and interrogation window 106 includes a microfluidic chip.
- Microfluidic chips may be formed from substrates (e.g., silicon, glass, ceramic, plastic, organosilicon, quartz, polymeric materials, or a combination thereof) and may include a network of microfluidic channels through which fluid flows.
- Microfluidic devices can be used to process minute volumes of fluidic samples, and offer advantages over traditional macro-scale devices (e.g., by requiring substantially smaller volumes of fluidic samples, requiring less reagent use, and processing time is decreased in comparison to macro-scale devices).
- Microfluidic chips provide an attractive and versatile platform for the manipulation, isolation, sorting, and/or transport of particles and/or molecules.
- Microfluidic chips are planar devices and thus can facilitate the detection and analyses of particles and/or molecules by enabling the use of high light-collecti on-efficiency objectives, which enhances light collection and thus facilitate the detection, analyses, determination, and/or identification of the particles and/or molecules.
- the methods, systems, devices, and apparatuses of this disclosure include a microfluidic chip, which can facilitate the manipulation, detection, analyses, determination, and/or identification of the biological nanoparticles and/or single molecules in transit.
- Microfluidic chips can be used to process small volumes of fluidic samples, and offer advantages over traditional macro-scale devices (e.g., microfluidic chips require only minute volumes of fluidic samples, require less reagent, and are processed in a smaller amount of time, adding to efficiency in comparison to macro-scale devices).
- Microfluidic chips are planar devices and, thus, can facilitate the detection and analyses of bionanoparticles and/or by enabling the use of high-NA (numerical aperture) objectives (e.g., high-NA air objectives), such as an air objective having a NA of around 0.95 or between 0.91 and 0.99, lenses, or light collection systems with high numerical apertures, which enhances light collection and, thus, facilitates the detection, analyses, determination, and/or identification of the biological nanoparticles and/or molecules.
- microfluidic chips are planar devices, enhancing their compatibility with a microscope setup (e.g., with a translation stage on which the microfluidic chip is placed).
- Microfluidic chips additionally can allow for the design and generation of interconnected fluidic networks without having dead volumes, which in turn can facilitate the detection and manipulation of bionanoparticles and/or molecules (e.g., sorting using flow displacement at a junction of three or more fluidic channels).
- Dead volume is a portion of volume within the microfluidic chip that is outside of the flow path (e.g., a volume into which liquid, potentially carrying sample nanoparticles and/or molecules, can diffuse into, thus potentially decreasing accuracy).
- Microfluidic chips through methods of microfabrication, can allow for the creation of channels with cross sections that are non-spherical or non-square (e.g., rectangular), which can facilitate the detection, analyses, determination, and/or identification of the biological nanoparticles and/or molecules in transit.
- Microfluidic chips can facilitate the creation of channels with different widths or heights along the length of the channel (e.g., a constriction or a step change in width and/or height of the channel) to facilitate the manipulation, detection, analyses, determination, and/or identification of the biological nanoparticles and/or molecules in transit.
- Microfluidic chips can be formed by bonding to a coverslip (e.g., made of glass or plastic) of a desirable thickness as well as having a desirable material property (e.g., refractive index) to enhance compatibility with high-efficiency light collection system (e.g., a high numerical aperture objective, such as high-NA air objective, requiring the appropriate substrate thickness for maximal light collection) to facilitate the manipulation, detection, analyses, determination, and/or identification of the biological nanoparticles and/or single molecules in transit.
- a coverslip e.g., made of glass or plastic
- a desirable material property e.g., refractive index
- high-efficiency light collection system e.g., a high numerical aperture objective, such as high-NA air objective, requiring the appropriate substrate thickness for maximal light collection
- Microfluidic chips provide an attractive and versatile platform for the manipulation, isolation, sorting, and/or transport of bionanoparticles and/or single molecules.
- portions of the system 100 are fabricated from materials including, but not limited to, polymeric materials (polydimethylsiloxane (PDMS), polyurethane-methacrylate (PUMA), polymethylmethacrylate (PMMA), polyethylene, polyester (PET), polytetrafluoroethylene (PTFE), polycarbonate, parylene, polyvinyl chloride, fluoroethylpropylene, lexan, polystyrene, cyclic olefin polymers, cyclic olefin copolymers, polyurethane, polyestercarbonate, polypropylene, polybutylene, polyacrylate, polycaprolactone, polyketone, polyphthal amide, cellulose acetate, polyacrylonitrile, polysulfone, epoxy polymers, thermoplastics, fluoropolymer, and polyvinylidene fluoride, polyamide, polyimide),
- PDMS polydimethylsiloxane
- PUMA polyurethane-meth
- the system 100 comprises porous membranes, woven or non-woven fibers (such as cloth or mesh) of wool, metal (e.g., stainless steel or Monel), glass, paper, or synthetic (e.g., nylon, polypropylene, polycarbonate, parylene, and various polyesters), sintered stainless steel and other metals, and porous inorganic materials such as alumina, silica or carbon.
- the interrogation window 106 of the channel 102 allows excitation light, such as from the light engine 108, to pass into the lumen 104 of the channel 102 and emission light to pass out of the channel 102 for receipt by the detector system 142.
- excitation light and emission light can include light from a number of wavelength ranges, such as including but not limited to visible light, infrared light, near-infrared light, and ultraviolet light, and combinations thereof.
- the interrogation window 106 is suitable to excite particles and/or molecules flowing through the channel 102 and to allow light emitted from the interrogation window 106 to be received by the detector system 142 for further analysis.
- the lumen 104 of the channel 102 within the interrogation window 106, or in certain embodiments adjacent to the interrogation window 106, defines a constriction or other narrowing of a cross section or diameter or other size feature of the lumen 104.
- a constriction or narrowing of the lumen 104 is configured to flow particles and/or molecules through the portion of the channel 102 including the interrogation window 106 on a parti cle-by-particle and/or molecule-by-molecule basis and under laminar flow conditions.
- the interrogation window 106 includes a portion of the channel within a field of view of the objective 186 and/or detectable by the detector system 142. In an embodiment, the interrogation window 106 includes a portion of the channel 102 defining a constriction relative to other portions of the channel 102. As described further herein, in such an embodiment, the constriction of the interrogation window 106 can have a dimension, such as a height, width, cross-sectional area, etc., that is smaller than other immediately adjacent portions of the channel 102.
- the constriction has a width smaller than the widest part of the microfluidic channel 102. In certain embodiments, the constriction has a width relative to the widest part of the microfluidic channel 102. In some embodiments, the constriction has a width less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 14%, less than 13%, less than 12%, less than 11%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, or less than 1% the maximum width of the microfluidic channel.
- a microfluidic channel 102 having a maximum width of 100 pm can have a constriction that is less than 25% the value of the maximum width (i.e., less than 25 pm).
- the constriction has a width less than 10% the width of the maximum width of the microfluidic channel 102.
- the maximum width of the microfluidic channel 102 has a value less than 900 pm and greater than 0.1 pm, less than 800 pm and greater than 0.5 pm, less than 700 pm and greater than 1 pm, less than 600 pm and greater than 5 pm, less than 500 pm and greater than 10 pm, less than 1,000 pm and greater than 10 pm, less than 900 pm and greater than 10 pm, less than 800 pm and greater than 10 pm, less than 700 pm and greater than 10 pm, less than 600 pm and greater than 10 gm, less than 500 gm and greater than 10 gm, less than 400 gm and greater than 10 gm, less than 300 gm and greater than 10 gm, less than 500 pm and greater than 0.1 gm, less than 500 gm and greater than 1 gm, less than 500 gm and greater than 2 gm, less than 500 gm and greater than 5 gm, less than 800 gm and greater than 0.1 pm, less than 700 gm and greater than 0.1 gm, less than 600
- the constriction has a width smaller than the average width of the microfluidic channel. In certain embodiments, the constriction has a width relative to the average width of the microfluidic channel. In some embodiments, the constriction has a width less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 14%, less than 13%, less than 12%, less than 11%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, or less than 1% the average width of the microfluidic channel 102.
- the average width of the microfluidic channel 102 has a value less than 900 pm and greater than 0.1 pm, less than 800 pm and greater than 0.5 pm, less than 700 pm and greater than 1 pm, less than 600 pm and greater than 5 pm, less than 500 pm and greater than 10 pm, less than 1,000 pm and greater than 10 pm, less than 900 pm and greater than 10 pm, less than 800 pm and greater than 10 pm, less than 700 pm and greater than 10 pm, less than 600 pm and greater than 10 pm, less than 500 pm and greater than 10 pm, less than 400 pm and greater than 10 pm, less than 300 pm and greater than 10 pm, less than 500 pm and greater than 0.1 pm, less than 500 pm and greater than 1 pm, less than 500 pm and greater than 2 pm, less than 500 pm and greater than 5 pm, less than 800 pm and greater than 0.1 pm, less than 700 pm and greater than 0.1 pm, less than 600 pm and greater than 0.1 pm, less than 500 pm and greater than 0.1 pm, less than 400 pm and greater than 0.1 pm, or less than 300 pm and greater than
- the constriction has a height smaller than greatest height value (i.e., the maximum height) of the microfluidic channel 102. In certain embodiments, the constriction has a height relative to the maximum height of the microfluidic channel. In some embodiments, the constriction has a height less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 14%, less than 13%, less than 12%, less than 11%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, or less than 1% of the maximum height of the microfluidic channel.
- a microfluidic channel 102 having a maximum height of 20 pm can have a constriction that is less than 10% the value of the maximum height (i.e., less than 2 pm). In preferred embodiments, the constriction has a height less than 25% the maximum height of the microfluidic channel 102.
- the maximum height of the microfluidic channel 102 has a value less than 900 pm and greater than 0.1 pm, less than 800 pm and greater than 0.5 pm, less than 700 pm and greater than 1 pm, less than 600 pm and greater than 5 pm, less than 500 pm and greater than 10 pm, less than 1,000 pm and greater than 10 pm, less than 900 pm and greater than 10 pm, less than 800 pm and greater than 10 pm, less than 700 pm and greater than 10 pm, less than 600 pm and greater than 10 pm, less than 500 pm and greater than 10 pm, less than 400 pm and greater than 10 pm, less than 300 pm and greater than 10 pm, less than 500 pm and greater than 0.1 pm, less than 500 pm and greater than 1 pm, less than 500 pm and greater than 2 pm, less than 500 pm and greater than 5 pm, less than 800 pm and greater than 0.1 pm, less than 700 pm and greater than 0.1 pm, less than 600 pm and greater than 0.1 pm, less than 500 pm and greater than 0.1 pm, less than 400 pm and greater than 0.1 pm, or less than 300 pm and greater than
- the constriction has a height smaller than the average height of the microfluidic channel. In certain embodiments, the constriction has a height relative to the average height of the microfluidic channel. In some embodiments, the constriction has a height less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 14%, less than 13%, less than 12%, less than 11%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, or less than 1% of the average height of the microfluidic channel.
- the average height of the microfluidic channel has a value less than 900 gm and greater than 0.1 gm, less than 800 gm and greater than 0.5 gm, less than 700 pm and greater than 1 gm, less than 600 gm and greater than 5 gm, less than 500 gm and greater than 10 gm, less than 1,000 gm and greater than 10 gm, less than 900 gm and greater than 10 pm, less than 800 gm and greater than 10 gm, less than 700 gm and greater than 10 pm, less than 600 gm and greater than 10 gm, less than 500 gm and greater than 10 gm, less than 400 gm and greater than 10 gm, less than 300 gm and greater than 10 gm, less than 500 pm and greater than 0.1 gm, less than 500 gm and greater than 1 gm, less than 500 gm and greater than 2 gm, less than 500 gm and greater than 5 gm, less
- the constriction has a cross sectional area less than the greatest cross-sectional area (i.e., the maximum cross-sectional area) of the microfluidic channel. In certain embodiments, the constriction has a cross sectional area relative to the maximum cross- sectional area of the microfluidic channel.
- the constriction has a cross sectional area less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 24%, less than 23%, less than 22%, less than 21%, less than 20%, less than 19%, less than 18%, less than 17%, less than 16%, less than 15%, less than 14%, less than 13%, less than 12%, less than 11%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.5%, less than 0.2%, less than 0.1%, less than 0.05%, less than 0.02%, less than 0.01%, less than 0.005%, less than 0.002%, or less than 0.001% of the maximum cross sectional area of the microfluidic channel.
- a microfluidic channel having a maximum cross-sectional area of 200 pm 2 can have a constriction that is less than 10% the value of the maximum cross-sectional area (i.e., less than 20 pm 2 ).
- the constriction has a cross sectional area between 10% and 0.01% the maximum cross- sectional area of the microfluidic channel.
- maximum cross sectional area of the microfluidic channel has a value less than 1,000,000 pm 2 and greater than 10 gm 2 , less than 750,000 pm 2 and greater than 25 gm 2 , less than 500,000 pm 2 and greater than 100 gm 2 , less than 250,000 pm 2 and greater than 250 gm 2 , less than 900,000 pm 2 and greater than 100 gm 2 , less than 800,000 pm 2 and greater than 100 gm 2 , less than 700,000 pm 2 and greater than 100 gm 2 , less than 600,000 pm 2 and greater than 100 gm 2 , less than 400,000 pm 2 and greater than 100 gm 2 , less than 300,000 pm 2 and greater than 100 gm 2 , less than 200,000 pm 2 and greater than 100 gm 2 , less than 100,000 pm 2 and greater than 100 gm 2 , less than 50,000 pm 2 and greater than 100 gm 2 , less than 25,000 pm 2 and greater than 100 gm 2 , less than 10,000 pm 2
- the constriction has a cross sectional area less than the average cross-sectional area of the microfluidic channel. In certain embodiments, the constriction has a cross sectional area relative to the average cross-sectional area of the microfluidic channel.
- the constriction has a cross sectional area less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 24%, less than 23%, less than 22%, less than 21%, less than 20%, less than 19%, less than 18%, less than 17%, less than 16%, less than 15%, less than 14%, less than 13%, less than 12%, less than 11%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.5%, less than 0.2%, less than 0.1%, less than 0.05%, less than 0.02%, less than 0.01%, less than 0.005%, less than 0.002%, or less than 0.001% of the average cross sectional area of the microfluidic channel.
- average cross sectional area of the microfluidic channel has a value less than 1,000,000 gm 2 and greater than 10 gm 2 , less than 750,000 gm 2 and greater than 25 pm 2 , less than 500,000 gm 2 and greater than 100 gm 2 , less than 250,000 gm 2 and greater than 250 gm 2 , less than 900,000 gm 2 and greater than 100 gm 2 , less than 800,000 gm 2 and greater than 100 gm 2 , less than 700,000 gm 2 and greater than 100 gm 2 , less than 600,000 pm 2 and greater than 100 gm 2 , less than 400,000 gm 2 and greater than 100 gm 2 , less than 300,000 pm 2 and greater than 100 gm 2 , less than 200,000 gm 2 and greater than 100 gm 2 , less than 100,000 gm 2 and greater than 100 gm 2 , less than 50,000 gm 2 and greater than 100 gm 2 , less than gm
- the constriction has a height of less than 10 pm, a height of less than 9 pm, a height of less than 8 pm, a height of less than 7 pm, a height of less than 6 pm, a height of less than 5 pm, a height of less than 4 pm, a height of less than 3 pm, a height of less than 2 pm, or a height of less than 1 pm 2
- the constriction has a width of less than 10 pm, a width of less than 9 pm, a width of less than 8 pm, a width of less than 7 pm, a width of less than 6 pm, a width of less than 5 pm, a width of less than 4 pm, a width of less than 3 pm, a width of less than 2 pm, or a width of less than 1 pm.
- the at least one microfluidic channel comprises one, two, three, four, five, six, seven, eight, nine, ten, or more than ten constrictions.
- the microfluidic chip comprises a plurality of microfluidic channels, at least a portion of which each comprise one, two, three, four, five, six, seven, eight, nine, ten, or more than ten constrictions.
- the microfluidic chip comprises a plurality of microfluidic channels, the majority of which each comprise one, two, three, four, five, six, seven, eight, nine, ten, or more than ten constrictions.
- the microfluidic chip comprises a plurality of microfluidic channels, each of which comprises one, two, three, four, five, six, seven, eight, nine, ten, or more than ten constrictions.
- At least a portion of at least one microfluidic channel 102 has a cross sectional area of less than 10,000 pm 2 , a cross sectional area of less than 5,000 pm 2 , a cross sectional area of less than 3,000 pm 2 , a cross sectional area of less than 1,000 pm 2 , a cross sectional area of less than 800 pm 2 , a cross sectional area of less than 600 pm 2 , a cross sectional area of less than 400 pm 2 , a cross sectional area of less than 200 pm 2 , or a cross sectional area of less than 100 pm 2 .
- At least a portion of at least one microfluidic channel has a cross sectional area of less than 100 pm 2 , a cross sectional area of less than 90 pm 2 , a cross sectional area of less than 80 pm 2 , a cross sectional area of less than 70 pm 2 , a cross sectional area of less than 60 pm 2 , a cross sectional area of less than 50 pm 2 , a cross sectional area of less than 40 pm 2 , a cross sectional area of less than 30 pm 2 , a cross sectional area of less than 20 pm 2 , a cross sectional area of less than 10 pm 2 , a cross sectional area of less than 5 pm 2 , a cross sectional area of less than 2 pm 2 , or a cross sectional area of less than 1 pm 2 .
- the at least one microfluidic channel has a maximum cross-sectional area of less than 250,000 pm 2 , less than 100,000 pm 2 , less than 50,000 pm 2 , less than 25,000 pm 2 , less than 10,000 pm 2 , less than 5,000 pm 2 , less than 3,000 pm 2 , less than 1,000 pm 2 , less than 800 pm 2 , less than 600 pm 2 , less than 400 pm 2 , less than 200 pm 2 , or less than 100 pm 2 .
- the at least one microfluidic channel has a maximum cross-sectional area of less than 100 pm 2 , less than 90 pm 2 , less than 80 pm 2 , less than 70 pm 2 , less than 60 pm 2 , less than 50 pm 2 , less than 40 pm 2 , less than 30 pm 2 , less than 20 pm 2 , less than 10 pm 2 , less than 5 pm 2 , less than 2 pm 2 , or less than 1 pm 2 .
- at least a portion of at least one microfluidic channel has a cross sectional area of between 1 pm 2 and 100 pm 2 .
- the at least one microfluidic channel has a maximum cross-sectional area of between 100 pm 2 and 10,000 pm 2 .
- At least a portion of at least one microfluidic channel comprises a discontinuous change in at least one of its width or height (e.g., achieved using techniques of microfabrication).
- the microfluidic chip used herein can comprise a microfluidic channel with a step gradient or a step change of at least one of its height or width, which is in contrast to a microfluidic channel comprising a continuous change in height or width.
- Channels comprising a continuous change in height or width is common in devices comprising, e.g., glass tubes, which can be achieved by pulling a heated tube.
- at least a portion of at least one microfluidic channel has a height and a width that are changed independently from one another.
- the independent change of height and width is in contrast to, for example, glass tubes, wherein fabrication of a decreased height is accompanied by a corresponding decrease of width (e.g., the drawing and thinning of a glass tube that has been heated close to its melting temperature).
- the system 100 includes a light engine 108.
- the light engine 108 is shown to include a number of light sources 110, 114, 118, and 120 each positioned to emit or output excitation light onto respective and separate portions 122, 124, 126, and 128 of the channel 102 in the interrogation window 106.
- the light engine 108 is shown to include a first light source 110 positioned to output first excitation light 112 onto a first portion 122 of the channel 102 in the interrogation window 106; and a second light source 114 positioned to emit or output second excitation light 116 onto a second portion 124 of the channel 102 in the interrogation window 106 separate from the first portion 122.
- the light engine 108 is shown to further include third light source 118 and fourth light source 120 positioned to output third excitation light and fourth excitation light, respectively, onto third portion 126 and fourth portion 128 of the channel 102 in the interrogation window 106.
- the portions 122, 124, 126, and 128 are defined by a width of excitation light after being focused by the objective 186 and impinging on the channel 102.
- portion 122 has a width defined by a width of excitation light 112 impinging upon channel 102.
- a width of the portions 122, 124, 126, and 128 is less than 2.0 pm, 1.5 pm, 1.0 pm, 0.9 pm, 0.8 pm, 0.7 pm, 0.6 pm, 0.5 pm, 0.4 pm, 0.3 pm, or 0.2 pm.
- the width of the portions 122, 124, 126, and 128 is in a range of about 2.0 pm to about 0.2 pm, 1.0 pm to about 0.2 pm, 0.9 pm to about 0.2 pm, 0.8 pm to about 0.2 pm, 0.7 pm to about 0.2 pm, or about 0.6 pm to about 0.2 pm.
- a width of the portions 122, 124, 126, and 128 are defined a 1/e 2 of a maximum of the excitation light intensity.
- a width of the portions 122, 124, 126, and 128 are defined 1/e of a maximum of the excitation light intensity.
- a signal -to-noise ratio will be too low for, for example, single molecule/particle detection and analysis.
- excitation line widths that are too wide and too closely spaced e.g., when there is substantial overlap of two excitation lines
- excitation line widths that are too wide will illuminate larger portions of the channel 102 creating larger amounts of background light that will lower a signal-to-noise ratio, especially where amounts of light emitted by a single particle/molecule may be relatively low.
- the light sources 110 and 114 are optically coupled to optical fibers 164 and 168 such that excitation light 112 and 116 output therefrom is received and transmitted by the optical fibers 164 and 168.
- the first light source 110 is optically coupled to a proximal end 166 of a first excitation optical fiber 164; and the second light source 114 is optically coupled to a proximal end 170 of a second excitation optical fiber 168.
- the light sources 110, 114, 118, and 120 of the light engine 108 are free-space light sources, which are not optically coupled to excitation optical fibers.
- the free-space light sources do not have an optical fiber disposed between the free-space light sources and the interrogation window 106 positioned to receive the excitation light and output excitation light into free space.
- spacing between excitation light of adjacent light sources is defined, at least in part, by additional optical components of the system 100, which direct and/or shape the excitation light emitted therefrom.
- the excitation optical fibers, such as excitation optical fiber 164 and 168 of the excitation optical fiber bundle 172 are optional. And in some embodiment, the excitation optical fiber bundle 172 is absent.
- the excitation light output by the light sources 110, 114, 118, and 120 of the light engine 108 can be of any wavelength.
- the excitation light of one light source is the same as the excitation light output by another light source of the light engine 108.
- the excitation light of one light source is different from the excitation light output by another light source of the light engine 108.
- the first excitation light 112 has wavelengths in a first wavelength range, and wherein the second excitation light 116 has wavelengths in a second wavelength range distinct from the first wavelength range.
- the first excitation light 112 has wavelengths in a first wavelength range, and wherein the second excitation light 116 has wavelengths in a second wavelength range common with the first wavelength range.
- the first excitation light 112 and second excitation light 116 can be any excitation light suitable to optically excite a dye or other detectable agent in or on a particle or associated with a molecule.
- the first excitation light 112 and/or second excitation light 116 includes coherent light, such as from a laser.
- the first light source 110 and the second light source 114 are each independently selected from the group consisting of a solid-state laser, a diode-pumped laser, a light-emitting diode (LED), a lamp, an arc discharge, and a natural light.
- the first excitation light 112 is in a wavelength range of about 350 nm to about 360 nm, in a wavelength range of about 400 nm to about 410 nm, in a wavelength range of about 480 nm to about 490 nm, in a wavelength range of about 530 nm to about 540 nm, in a wavelength range of about 555 nm to about 565 nm, or in a wavelength range of about 630 nm to about 690 nm.
- the second excitation light 116 is in a wavelength range of about 350 nm to about 360 nm, in a wavelength range of about 400 nm to about 410 nm, in a wavelength range of about 480 nm to about 490 nm, in a wavelength range of about 530 nm to about 540 nm, in a wavelength range of about 555 nm to about 565 nm, or in a wavelength range of about 630 nm to about 690 nm.
- a distal end of the first excitation optical fiber 164 and a distal end of the second excitation optical fiber 168 are arranged in an excitation fiber bundle head 172.
- the distal ends of the excitation optical fibers 164 and 168 are spaced apart by a spacing 176.
- this spacing 176 defines, at least in part, a spacing of the excitation light 112 and 116 output by the excitation fiber bundle head 172 and the light engine 108.
- a spacing 176 between the distal end of the first excitation optical fiber 164 and the distal end of the second excitation optical fiber 168 corresponds to a spacing between the first portion 122 and the second portion 124.
- excitation light can be output by disparately positioned light sources 110, 112, 118, and 120 of the light engine 108, brought together by the excitation fiber bundle head 172, and outputted onto positionally separate portions of the interrogation window 106 of the channel 102 according to a spacing 176 of the distal ends of the excitation optical fibers.
- excitation fiber bundle head 172 can be further manipulated by excitation optics. Not shown, see for example, FIGURE 3A.
- the excitation optical fibers 164 and 168 are disposed adjacent to one another in the fiber bundle head, such as within one fiber diameter of each other (e.g., edge-to-edge distance).
- a fiber bundle such as an excitation fiber bundle 172, refers to optical fibers coupled or otherwise brought into proximity at an end of the optical fibers.
- a fiber diameter width By bringing ends of optical fibers into proximity to one another, such as within a fiber diameter width, light output from disparately positioned light sources coupled to optical fibers can be transmitted through the optical fibers and emitted therefrom in an orientation shaped or otherwise defined in part by an orientation of the optical fibers in the optical fiber bundle.
- the light engine 108 can include free-space light sources, such as is discussed further herein with respect to FIGURE 6. Further, it will be understood that portions of the interrogation window 106 illuminated by the light engine 108 and spacing therebetween are manipulated by optical elements positioned between the free-space light sources and the interrogation window 106.
- the system 100 includes a dichroic mirror 160 positioned to reflect at least a portion of the excitation light 112 and 116 toward the interrogation window 106 of the channel 102.
- the system 100 further includes an objective 186, such as an air objective 186, positioned to collect the excitation light reflected off the dichroic mirror 160 and configured to focus the excitation light 112 and 116 onto the channel 102.
- excitation light from the light sources is output onto spatially separate portions of the channel 102 within the interrogation window 106.
- the interrogation window 106 is defined, at least in part, by the field of view of the objective 186.
- dichroic mirror 160 is illustrated, it will be understood that other optical components may be used to selectively or partially transmit and reflect light.
- dichroic mirror 160 is replaced with a transmissive mirror, such as a 20% reflective/80% transmissive mirror, or other structure configured to selectively or partially transmit and reflect light.
- particles or molecules flowing through the channel 102 can be excited by the excitation light 112 and 116.
- Such excited particles/molecules can emit emission light 146 and 152, which is radiated or otherwise emitted out of the interrogation window 106 and through the dichroic mirror 160.
- the emission light 146 and 152 has the same or similar relative spacing as the excitation light 112 and 116 impinging upon the interrogation window 106.
- the emission light 146 and 152 is shown impinging upon the emission fiber bundle 130 of the system 100.
- the emission fiber bundle 130 is shown to include four emission optical fibers closely coupled in space.
- the emission optical fiber bundle 130 brings ends of optical fibers, here emission optical fibers 134 and 138, in close proximity and according to a particular orientation or arrangement.
- the particular arrangement of the emission optical fibers within fiber bundle head 132 is suitable to position the emission optical fibers 134 and 138 to receive the emission light 146 and 152.
- the emission fiber bundle 130 comprises at least three emission optical fibers, at least four emission optical fibers, at least five emission optical fibers, at least six emission optical fibers, at least seven emission optical fibers, or more.
- the emission fiber bundle 130 includes a first emission optical fiber 134 and a second emission optical fiber 138, wherein a proximal end 136 of first emission optical fiber 134 and second emission optical fiber 138 are arranged in an emission fiber bundle head 132, and wherein the proximal end 136 of the first emission optical fiber 134 is positioned to receive first emission light 146 emitted from the first portion 122 and the proximal end 140 of the second emission optical fiber 138 is positioned to receive second emission light 152 emitted from the second portion 124.
- proximal ends 136 and 140 of each emission optical fibers 134 and 138 of the emission fiber bundle 130 are disposed in the emission fiber bundle head 132. In an embodiment, proximal ends 136 and 140 of each emission optical fiber 134 and 138 of the emission fiber bundle 130 are positioned to receive emission light 146 and 152 emitted from a distinct portion 122 and 124 of interrogation window 106. In an embodiment, the proximal ends 136 and 140 of the emission optical fibers 134 and 138 are disposed adjacent to each other, such as within one fiber diameter of each other (e.g., a distance between an edge of one fiber to a nearest edge of the neighboring fiber is within one fiber diameter).
- the emission optical fibers of the emission fiber bundle head 132 are arranged to receive, such as to individually or separately receive, emission light that corresponds to distinct excitation regions or portions of the interrogation window 106.
- the portions of the interrogation window 106 such as portions 122 and 124, are defined by a width of the excitation light, such as a width of excitation light 112 and 116, as it impinges upon the interrogation window.
- the emission optical fibers 134 and 138 are positioned to receive emission light from different portions of the channel 102, such as portions of the channel 102 that are excited by different light sources of the light engine 108.
- a spacing between proximal ends 136 and 140 of the emission optical fibers 134 and 138 is based upon a spacing of the portions 122 and 124 of the channel 102, such as based upon a spacing of excitation light 112 and 116 impinging upon the interrogation window 106.
- FIGURE IB is a schematic illustration of an emission fiber bundle head 132 of the system 100.
- FIGURE IB illustrates a number of configurations for the emission optical fibers of the emission fiber bundle head 132.
- the emission optical fibers 134 are arranged in a linear configuration within the emission fiber bundle head 132.
- a spacing 174 and/or arrangement of proximal ends 136 and 140 of the emission optical fibers 134 and 138 corresponds to a spacing and/or arrangement of portions of the interrogation window 106 excited by light sources of the light engine 108.
- the proximal ends 136 and 140 of the emission optical fibers 134 and 138 are arranged in a linear configuration.
- the emission optical fibers 134 and 138 are arranged in the emission optical fiber bundle head 132 to receive emission light 146 and 152 from the channel 102 in which the light engine 108 is configured to emit or output excitation light into the interrogation window 106 in, for example, a linear configuration.
- the spacing 174 is within a range of about 1 pm and about 1,000 pm, within a range of about 100 pm and about 900 pm, within a range of about 1 pm and about 100 pm, within a range of about 10 pm and about 500 pm, within a range of about 50 pm and about 800 pm.
- the distance between an edge of an emission optical fiber and the nearest edge of another emission optical fiber in the proximal end of the fiber bundle head is near zero (i.e., touching) or within the radius of the fiber.
- the spacing 174 is a distance between a center of one emission optical fiber and a center of a different emission optical fiber. In an embodiment, the spacing 174 is a distance between an edge of an emission optical fiber and the nearest edge of another emission optical fiber.
- a spacing 174 between the proximal end 136 of the first emission optical fiber 134 and the proximal end 140 of the second emission optical fiber 138 corresponds to a spacing between the first portion 122 and the second portion 124 of the interrogation window 106.
- the spacing is the center-to-center distance.
- such correspondence is a direct correspondence in which a spacing between proximal ends 136 and 140 of the emission optical fibers 134 and 138 and a spacing between the first portion 122 and the second portion 124 matches directly or closely after accounting for magnification of the optical system.
- the correspondence is adjusted and/or modified according to optics of the system 100, such as the objective 186 and any other lenses, mirrors, and the like disposed between the interrogation window 106 and the emission fiber bundle head 132.
- a spacing 176 between the distal end 166 of the first excitation optical fiber 164 and the distal end 170 of the second excitation optical fiber 168 corresponds to a spacing between the first portion 122 and the second portion 124 of the interrogation window 106.
- such correspondence is a direct correspondence in which a spacing between distal ends 166 and 170 of the excitation optical fibers 164 and 168 and a spacing between the first portion 122 and the second portion 124 matches directly or closely after accounting for magnification of the optical system.
- a spacing between the first light source 110 outputting from distal end 166 and the second light source 114 outputting from distal end 170 corresponds to a spacing between the first portion 122 and the second portion 124.
- the correspondence is adjusted and/or modified according to optics of the system 100, such as the objective 186 and any other lenses, mirrors, and the like disposed between the interrogation window 106 and the excitation fiber bundle head 172.
- a spacing 176 between the distal end 166 of the first excitation optical fiber 164 and the distal end 170 of the second excitation optical fiber 168 corresponds to a spacing 174 between the proximal end 136 of the first emission optical fiber 134 and the proximal end 140 of the second emission optical fiber 138.
- correspondence can be a direct correspondence, or a correspondence modified by any optical components that manipulate or direct emission light.
- the spacing 176 is within a range of about 1 pm and about 1,000 pm, within a range of about 1 pm and about 100 pm, within a range of about 250 pm and about 750 pm, within a range of about 1 pm and about 50 pm, within a range of about 10 pm and about 500 pm.
- the distance between an edge of an optical fiber and the nearest edge of another optical fiber in the fiber bundle head is near zero (i.e., touching) or within the radius of the fiber.
- the system 100 includes a detector system 142 positioned to receive the emission light emitted from the emission fiber bundle 130.
- the emission optical fibers 134 and 138 fan out from the emission fiber bundle head 132 at their proximal ends 136 and 140, respectively, to terminate at their distal ends 148 and 154 adjacent and optically coupled to detector modules 144 and 150 of the detector system 142.
- a "detector module” refers to a detection structure and/or collection of detection components configured to generate a signal or a set of signals based on light received by the detector module, such as received by one or more detection structures and/or components.
- the detector systems of the present disclosure, such as detector system 142 can include one or more detector modules and/or one or more individual detectors, such as one or more individual photodetectors.
- one or more of the detector modules 144 and 150 includes a single photodetector optically coupled and positioned to receive emission light 146 and 152. In another embodiment, one or more of the detector modules 144 and 150 includes a plurality of individual photodetectors, such as discussed further herein with respect to FIGURE 2. In this regard, each of the detector modules 144 and 150 can be configured to receive emission light 146 and 152 and generate multiple signals based upon that emission light 146 and 152, such as based upon particular wavelength ranges within emission light 146 and 152.
- a distal end 148 and 154 of each emission optical fiber 134 and 138 is positioned to emit light onto at least one respective detector modules 144 and 150.
- the detector system 142 is positioned to receive scattered emission light, luminescent emission light, fluorescent emission light, or a combination thereof from the interrogation window 106.
- the scattered emission light is selected from backscattered light, side-scattered light, or forward-scattered light.
- the photodetectors within detector modules 144 and 150 are selected from the group consisting of a camera, an electron multiplier, a charge-coupled device (CCD) image sensor, a photomultiplier tube (PMT), a microchannel plate PMT (MCP), a hybrid PMT detector, an avalanche photodiode (APD), a single-photon avalanche diode (SPAD), a single-photon counting module (SPCM), a silicon photomultiplier (SiPM), and a complementary metal oxide semiconductor (CMOS) image sensor.
- a camera an electron multiplier, a charge-coupled device (CCD) image sensor, a photomultiplier tube (PMT), a microchannel plate PMT (MCP), a hybrid PMT detector, an avalanche photodiode (APD), a single-photon avalanche diode (SPAD), a single-photon counting module (SPCM), a silicon photomultiplier (SiPM), and a complementary metal
- each emission optical fiber is optically coupled to a detector module for receipt of emission light.
- the detector system 142 is shown to include a first detector module 144 positioned to receive the first emission light 146 emitted from a distal end 148 of the first emission optical fiber 134; and a second detector module 150 positioned to receive the second emission light 152 emitted from a distal end 154 of the second emission optical fiber 138.
- the system 100 is shown to further include a controller 156 operatively coupled to the light engine 108 and the detector system 142.
- a controller 156 includes logic configured to choreograph the operation of these components. While one controller 156 is shown directly coupled to these components, it will be understood that multiple controllers, such as those wirelessly coupled and/or in a distributed system, are possible and within the scope of the present disclosure.
- the controller 156 includes logic for performing some or all aspects of the methods described further herein. In an embodiment, the controller 156 includes logic for outputting excitation light with the light engine 108 into the interrogation window 106 and generating a signal with the detector system 142 based upon emission light emitted from the interrogation window 106 and received by the detector system 142.
- the controller 156 includes logic that when executed by the controller 156, causes the system 100 to perform operations including outputting the first excitation light 112 with the first light source 110; outputting the second excitation light 116 with the second light source 114; generating a first emission signal with the first detector module 144 based upon the first excitation light 112 received from the first emission optical fiber 134; and generating a second emission signal with the second detector module 150 based upon the second excitation light 116 received from the second emission optical fiber 138.
- the controller 156 further includes logic that, when executed by the controller 156, causes the system 100 to perform operations including flowing a suspension of particles and/or a solution of molecules through the channel 102, such as a suspension in fluid communication with the channel 102.
- a "particle” refers to a localized object or entity, such as within a surrounding medium.
- the particle defines a phase discontinuity relative to its surroundings, such as where a solid particle is surrounded and suspended in a liquid or gas phase.
- the particle is a biological particle, such as a biological nanoparticle, from a subject, derived from a subject, from an organism, derived from an organism, from an environmental sample, and the like.
- flowing the suspension through the channel 102 comprises flowing the suspension through the channel 102 on a parti cle-by-particle basis or molecule-by- molecule basis.
- a particle-by-particle flow of the particles or molecule-by-molecule flow of the molecules is suitable to individually analyze the particles and/or molecules flowing through the channel 102.
- the interrogation window 106 defines a constriction relative to other portions of the channel 102, which narrows the lumen 104.
- the particle-by-particle flow and/or molecule-by-molecule flow occurs within the constriction of the lumen 104.
- the controller 156 includes logic that, when executed by the controller 156, causes the system 100 to perform operations including ranking particles and/or molecules in the channel 102.
- Such ranking can be based upon, for example, a presence or absence of emission light associated with the particle and/or molecule, such as emission light detected by the detector system 142.
- the ranking is based upon an intensity of emission light and/or a wavelength of the emission light, such as detected by the detector system 142.
- the ranking corresponds with measured emission spectra of the particle and/or molecule based upon one or more of the first emission light 146 and the second emission light 152.
- the ranking corresponds with measured excitation spectra of the particle and/or molecule based upon one or more of the first excitation light 112 and the second excitation light 116.
- ranking can include grouping, classification, and/or decoding of particles, beads, nanoparticles, or fluorescent probes, such as capture agents and/or detectable agents associated therewith.
- ranking is based at least in part on decoding detectable agent and/or capture agent emission signals associated with an analyte, such as to determine an identity of the analyte associated with the detectable agent and/or capture agent whose respective signals are detected by the systems and methods of the present disclosure.
- the term "assigning" refers to designating a quantitative property, qualitative property, or importance of a particle and/or molecule categorization to the particle and/or molecule subject of the assigning.
- a size value can be assigned to a particle.
- assigning is based upon light emitted from the particle or molecule and assigning is based upon the presence, absence, and/or intensity of such emission light.
- size value refers to a relative size value or to an actual size value. The size value provides a true or relative measure of a linear distance.
- the assigning is performed by a computer and a software representing an assigning algorithm.
- the term "ranking" refers to assessing a quantitative property, qualitative property, or importance of a particle and/or molecule by categorization.
- a particle and/or molecule may be ranked as either null (for example, when a nanoparticle and/or molecule has an emission intensity below a detectable threshold), or nonzero (for example, when a particle and/or molecule is detected).
- the ranking is binary. For example, each particle and/or molecule having a detected light intensity above a threshold limit is assigned a value of 1, while each measured sample not having a detected light intensity above the threshold limit is assigned a value of 0, thus forming a binary ranking.
- a particle and/or molecule may be ranked according to additional categories, e.g., which correlate with the identity of the particle and/or molecule, the presence of a detectable characteristic, the presence of a distinguishing feature, and the like.
- the rankings may be assigned an arbitrary number corresponding to one of a number of predetermined quantitative or qualitative categories.
- the ranking is nonbinary, for example, the value is assigned based on the amount of emitted light intensity measured from a particle and/or molecule.
- the ranking is performed by a computer and a software representing a ranking algorithm.
- a “detectable characteristic” refers to an observable property associated with a particle and/or molecule, for example, a photoactive, electroactive, bioactive, or magnetic property that is associated with the particle and/or molecule, or which is intrinsic to the nanoparticle and/or molecule.
- the "detectable characteristic” includes the association of the particle and/or molecule with a detectable agent, or a biomarker.
- amplification refers to the use of molecules, structures or reagents configured to generate amplicons or copies of a target analyte, or amplicons or copies of a molecule that is correlated with the presence of a target analyte.
- the molecule that is correlated with the presence of a target analyte is selected from a molecule requiring the presence of the target analyte to be formed or expressed.
- the molecule that is correlated with the presence of a target analyte is selected from an amplification product of the target analyte or portion thereof, a fragment of the target analyte, or a molecule or complex stabilized by the target analyte.
- the systems and methods of the present disclosure do not include an amplification step.
- photoactive properties include, for example, alterations in optical intensity (optical reflection, scattering, deflection, transmission, absorbance, or emission) commonly induced by bioparticle morphology (particle size, internal subcellular structures), fluorescence, luminescence, immunofluorescence, and the like. Detection of the photoactive properties can, for example, report the size, mass, surface area, volume, protein content, membrane area, lipid content, enzyme content, metabolite content, carbohydrate content, peptide content, nucleic- acid content, protein identity, or nucleic-acid identity on, in, or associated with the nanoparticle.
- the ranking corresponds with a measured size value of the particle.
- the measured size value is a relative size value.
- the measured size value is measured by a difference in a detected emission light intensity.
- the measured size value is an actual size value.
- the system 100 further comprises a flow director, such as including one or more valves, configured to direct flow of the particle and/or molecule in the channel 102.
- the flow director is operatively coupled to the controller 156, and wherein the controller 156 includes logic that, when executed by the controller 156, causes the system 100 to perform operations including: directing flow of the particle and/or molecule based upon a presence or absence of emission light received from the interrogation window 106 and associated with the particle and/or molecule.
- the flow director is operatively coupled to the controller 156, and wherein the controller 156 includes logic that, when executed by the controller 156, causes the system 100 to perform operations including directing flow of the particle and/or molecule based upon the ranking.
- directing the flow of the particle and/or molecule includes directing the particle and/or molecule into one of two or more sorting channels.
- the flow director is operatively coupled to the controller 156, and wherein the controller 156 includes logic that, when executed by the controller 156, causes the system 100 to perform operations including quantifying a number of particles and/or molecules associated with emission light from the interrogation; and determining a concentration of the particles and/or molecules associated with the emission light from the interrogation window 106.
- the concentration is further based upon a measured flow volume, as discussed further herein with respect to FIGURES 11 A and 1 IB.
- the flow director or flow directing mechanism for directing the flow of the particle and/or molecule comprises an electrode, a magnetic element, an acoustic element, an electro- actuated element, and optically actuated element, an electric field, or a magnetic field.
- the mechanism for directing the flow of the particle and/or molecule comprises one or more electro-actuated valves or pistons, wherein the valves or pistons control the flow of a liquid in at least a first directional flow channel that intersects with the first input channel and the two exit channels at a first junction.
- solenoid pistons are subcomponents of electro-actuated solenoid valves.
- solenoid pistons are embedded in device by molding.
- the embedded solenoid pistons may be replaced by solenoid valves in fluidic communication via tubings.
- an apparatus provided herein may comprise one or more electrodes for tracking and/or manipulating the trajectory or flow of a particle and/or molecule, particle, molecule, or fluid sample.
- the electrode may enhance the separation of a nanoparticle and/or molecule based on phenomena such dielectrophoresis or electro-osmotic flow or electrophoresis.
- sheath flow focusing or acoustic focusing may not be sufficient to adequately manipulate the trajectory of a particle for the methods and apparatus disclosed herein, such as to direct the trajectory of the particle within the channel 102. See, e.g.: Optics Express Vol. 15, Issue 10, pp.
- the mechanism for focusing the particle excludes sheath flow focusing, acoustic flow focusing, or a combination thereof.
- the particle is directed, with the proviso that said directing does not use acoustic focusing, sheath flow focusing, or a combination thereof.
- the systems and methods of the present disclosure do not include structures or reagents configured to generate, for example, amplicons or copies of a target analyte, or amplicons or copies of a molecule that is correlated with the presence of a target analyte ⁇ In an embodiment, the systems and methods of the present disclosure do not include structures or reagents configured to generate amplicons or copies of a molecule that is correlated with the presence of a target analyte, wherein the molecule that is correlated with the presence of the target analyte is selected from an amplification product of the target analyte or portion thereof, a fragment of the target analyte, a molecule or complex stabilized by the target analyte, or a molecule requiring the presence of the target analyte to be formed or expressed.
- the systems and methods of the present disclosure are not configured to or do not include structures, reagents, and/or
- the system 100 includes a channel 102 configured to flow a particle through a lumen 104 of the channel 102, the channel 102 defining an interrogation window 106 configured to allow light to pass into and out of the lumen 104; a light engine 108 comprising: a first light source 110 positioned to output first excitation light 112 onto a first portion 122 of the channel 102 in the interrogation window 106; and a second light source 114 positioned to output second excitation light 116 onto a second portion 124 of the channel 102 in the interrogation window 106 separate from the first portion 122; and a detector system 142 comprising: a first detector module 144 positioned to receive first emission light 146 emitted from the first portion 122 of the channel 102; and a second detector module 150 positioned to receive second emission light 152 emitted from the second portion 124.
- Such an embodiment of the system 100 of the present disclosure are suitable for use in self-corrected, single-particle and/or single-molecule flow analysis.
- measurement of fluorescence emitted from single-particle and/or single molecules in a flow stream is heavily influenced by the profile of flow and laser beams.
- the accurate quantification of fluorescent particles and/or molecules thus requires the deconvolution of the signal from the flow profile and/or laser-beam profile.
- the present disclosure provides systems and methods to analyze single molecules and particles, such as vesicles, viruses, lipoproteins, and macromolecular complexes, in a flow stream.
- Such systems and methods are suitable to accurately 1) colocalize biomarkers expressed on the same particle and/or molecule that flows through multiple interrogation windows or portions of a single interrogation window 106, 2) identify and enumerate single particles and/or molecule, 3) obtain the flow rate sampled by each individual particle and/or molecule, and 4) thus, determine a concentration of analyzed particles and/or molecules.
- spatially separate portions of the interrogation window 106 are disposed with a known spatial pattern, and a property (e.g., fluorescence emission) of a particle and/or molecule is measured twice at two different portions of the interrogation window 106 (see for example FIGURE 8).
- a property e.g., fluorescence emission
- a transit time of a specific particle flowing through two adjacent portions or two different portions of the interrogation window 106 is proportional to a distance between these two portions.
- the position of a specific particle and/or molecule in the cross-section of channel 102 generally remains the same. This is particularly so where a distance between two such portions is small, and the transit time is short such that diffusion of the particle within the channel is correspondingly small.
- this characteristic suggests that a particle and/or molecule interacts with different excitation light of different light sources at very similar positions in the cross section of the channel.
- single analytes e.g., vesicles or virions or lipid nanoparticles or single molecules stained by fluorescent dyes
- use the extracted transit times or extracted locations or relative locations of the analytes in the cross section of the channel 102 to further colocalize fluorescent signals associated with other biological markers on the analyte, such as from different dye-tagged antibodies bound to their corresponding biological markers and/or from different nucleic-acid stains and/or other specific fluorescent stains of the analyte or biological nanoparticle see FIGURE 8).
- the system 100 for use in self-corrected, single- nanoparticle or single-molecule flow analysis includes logic for performing self-corrected, single-molecule/particle flow analysis methods of the present disclosure.
- the system 100 includes a controller 156 operatively coupled to the light engine 108 and detector system 142 and including logic that, when executed by the controller 156, causes the system 100 to perform operations including measuring a characteristic of a parti cl e/molecule at various portions of the interrogation window 106.
- the system 100 includes a controller 156 operatively coupled to the first light source 110, the second light source 114, the first detector module 144, and the second detector module 150, including logic that, when executed by the controller 156, causes the system 100 to perform operations including: outputting the first excitation light 112 with the first light source 110; outputting the second excitation light 116 with the second light source 114; generating a first emission signal with the first detector module 144 based upon first emission light 146 received from the first portion 122; generating a second emission signal with the second detector module 150 based upon second emission light 152 received from the second portion 124; and determining a velocity of a particle in the channel 102 based on a time difference between generating the first emission signal and the second emission signal and a distance between the first portion 122 and the second portion 124.
- the velocity of the particle is used to determine a volumetric flow rate through the lumen 104.
- a flow profile in the channel is sampled by measuring a linear velocity of many individual particles (such as greater than 100, 500, 1,000, 5,000, 10,000 or more particles), to obtain a mean observed value (u 0 /, s ).
- C the concentration of particles.
- the average of observed linear velocities is, thus, where r is the radial position at the cross section.
- r 2 u(r) u max (l - —) (eq. 3)
- eq. 2 can be reorganized to
- V -u obs nR , as shown in Fig. 11 A.
- the volumetric flow rate is determined by the following formula,
- V — — u obs nR ' V — — u obs nR ' , wherein 4 u obs is the mean observed linear velocity of many individual particles through the channel.
- A is a radius of the channel.
- the above analysis assumes a channel with a cylindrical geometry, but can be easily adjusted to one with a rectangular geometry or square geometry or any other geometries.
- the controller 156 further includes logic that, when executed by the controller 156, causes the system 100 to perform operation include correlating the first emission signal and the second emission signal based on an excitation or emission signal characteristic or relationship shared by the first emission signal and the second emission signal.
- the system 100 further includes a light collection system 184 positioned to collect emission light, such as the first emission light 146 and the second emission light 152, from the channel 102 and direct the collected emission light onto the detector system 142, the light collection system 184 comprising an air objective 186 having a numerical aperture in a range of greater than 0.91 and less than 0.99.
- the objective 186 such as an air objective 186, has a numerical aperture of about 0.95.
- an "air objective” refers to an optical objective or lens wherein a space between the objective and its focal plane or focus is occupied, at least in part, by a gas, such as air, and not occupied by an immersion liquid, such as an oil or water.
- a gas such as air
- an immersion liquid such as an oil or water.
- an air objective is in contrast to an oil-immersion lens or water-immersion lens in which the lens is immersed in an oil or water disposed between the lens and the sample, usually between the lens and the coverslip or sample holder.
- a "high NA (numerical aperture) air objective” refers to an air objective with a NA of between 0.91 and 0.99, preferably between 0.92 and 0.98, more preferably between 0.93 and 0.97, and even more preferably between 0.94 and 0.96. In an embodiment, the air objective has a NA of about 0.95. As discussed further herein, such high NA air objectives are suitable to perform single-molecule and/or single particle analyses, such as in determining the presence, absence, or concentration of particles/molecules passing through the devices and systems of the present disclosure. As noted elsewhere herein, high NA air objectives provide numerous advantages over conventional objectives, such as oil-immersion objectives or water-immersion objectives, such as high light collection efficiency, the ability to scanning accurately and efficiently, among many others.
- Air objectives are generally easier to scan and more stable than, for example, oilimmersion objectives. Further, in certain embodiments, the objective 186 is not used for high image quality (e.g., high resolution), but rather for its high light-collection efficiency. In this regard, as well, air objectives are superior to oil-immersion objectives. Accordingly, an air objective 186 having a lower numerical aperture, such as in a range of greater than 0.91 and less than 0.99, is suitable for detection of single particles and/or single molecules in a flow channel 102.
- a detector module of the systems of the present disclosure includes two or more photodetectors each positioned to receive emission light from a distal end of an emission optical fiber.
- FIGURE 2 a schematic illustration of a detector module 242 of a system, in accordance with an embodiment of the disclosure, is shown.
- the detector module 242 shown is an example of a detector module 144 or 150 of detector system 142 illustrated in FIGURE 1A.
- the detector module 242 is shown to include a number of photodetectors 244, 250A, 250B, and 250C positioned to receive emission light 246A or portions thereof, shown here as fluorescence emission light 246A, from a distal end 248 of an emission optical fiber 234.
- the detector module 242 includes a number of dichroic mirrors 260 positioned to receive emission light 246A emitted from the distal end 248 of the emission optical fiber 234.
- dichroic mirrors 260 are configured to reflect a portion (e.g., one wavelength range) of the emission light 246A and to allow a different portion of the emission light (e.g., a different wavelength range) to pass through the dichroic mirrors 260.
- each dichroic mirror 260 is positioned to reflect a portion of the emission light 246A toward a photodetector 244, 250A, 250B, 250C configured to generate a signal based upon this reflected or transmitted portion of the emission light 246A.
- the detector module 242 is shown to include a dichroic mirror 260 disposed between the distal end 248 of the first emission optical fiber 234 and the first photodetector 244 and positioned to reflect a portion 246B of the first emission light 246A onto a first photodetector 244.
- a detector of a system according to the embodiments of the present disclosure further includes a second detector module optically coupled to a second emission optical fiber, as illustrated in FIGURE 1A, such as a second detector module including a second photodetector.
- the detector module 242 is shown to include a third, fourth, and fifth photodetectors 250A, 250B, and 250C, respectively.
- the first photodetector 244 is configured to generate a first emission signal based upon a first emission wavelength range of the first emission light 246B, such as including emission light 246B, and wherein the third, fourth, and fifth photodetectors 250A, 250B, and 250C are configured to generate third, fourth, and fifth emission signals based upon a third, fourth, and fifth emission wavelength range in emission light 246C, 246D, and 246E different or substantially different from the first emission wavelength range of emission light 246B.
- the detector module 242 is shown to include 4 photodetectors 244, 250A, 250B, and 250C, it will be understood that any number of photodetectors are possible. In an embodiment, the detector modules include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 or more photodetectors.
- the detector module 242 further includes filters 262, such as bandpass filters 262, configured to filter a portion of the reflected emission light 246B- 246E.
- the photodetectors 244 and 250A-250C are configured and positioned to generate signals based upon a filtered portion 246B-246E of the emission light 246A.
- the light engine excites particles and/or molecules in the channel with light of different wavelengths.
- the particles and/or molecules themselves can be impregnated or associated with one or more detectable agents configured to emit fluorescence having different wavelength ranges and configured to be excited by different wavelength light.
- the detector module 242 configuration illustrated in FIGURE 2 is suitable to generate signals based on emission light having wavelengths in one or more wavelength ranges with the arrayed photodetectors and corresponding filters.
- the illustrated detector module 242 is suitable to perform emission multiplexing of particles and/or molecules, which emit light onto the portion of the detector module 242.
- emission multiplexing refers to systems or methods suitable for analyzing particles, molecules, or other analytes by analyzing different wavelength ranges of light emitted from such particles, molecules, or other analytes.
- the distal end 248 of the first emission optical fiber 234 is configured to emit the first emission light 246A onto at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or more photodetectors.
- each of the photodetectors is configured to receive a substantially different spectral portion of the emission light, such as when received through one or more dichroic mirrors or optical filters.
- the portion of the detector module 242 illustrated in FIGURE 2 is shown to further include lens 290 shaped and positioned to focus reflected and/or transmitted emission light onto their respective photodetectors.
- the systems of the present disclosure include multiple detector modules, such as one or more detector modules 242 as illustrated in FIGURE 2.
- each of the distal ends of the emission optical fibers are configured to emit emission light into a detector module, such as is illustrated in FIGURE 2.
- light engines of the systems of the present disclosure can include light sources configured to output light of various wavelength ranges, such as in wavelength ranges suitable to excite one or more detectable agents disposed in or on particles flowing through the channel. In some embodiments, such light wavelength ranges overlap. In some embodiments, the light wavelength ranges are separate. In this regard, attention is directed to FIGURES 3A-3F, in which embodiments of a light engine 308 and channel 302 illuminated by the light engine 308, in accordance with an embodiment of the present disclosure, are illustrated.
- FIGURE 3A is a schematic illustration of a light engine 308 and channel 302 of a system, in accordance with an embodiment of the disclosure.
- the light engine 308 and channel 302 are examples of a light engine 108 and channel 102 of the system 100 of FIGURES 1A.
- the light engine 308 and channel 302 are suitable for use in conjunction with the portion of the detector module 242 of FIGURE 2.
- the light engine 308 is shown to include four light sources each coupled to distal ends of excitation optical fibers. While four light sources are illustrated, it will be understood that more or fewer light sources are possible and within the scope of the present disclosure. It will also be understood that free-space light sources may be used within the scope of the present disclosure, as discussed further herein.
- the excitation optical fibers are shown to terminate in an excitation fiber bundle positioned to output the excitation light. As shown, the excitation fiber bundle head 372 is positioned to output the excitation light onto dichroic mirror 360 and into the objective 386. The excitation light is shown emitted from the objective 386 and onto respective portions of the channel 302 within the interrogation window 306.
- FIGURE 3B is a schematic illustration of an interrogation window 306 of the channel 302 defining a lumen 304 through which particles and/or molecules are configured to flow.
- first excitation light 312 is directed to a first portion 322 of the channel 302
- second excitation light 316 is directed to a second portion 324 of the channel 302 separate from the first portion 322
- third excitation light is directed to a third portion 326 of the channel 302 separate from the first portion 322 and second portion 324 of the channel 302
- fourth excitation light is directed to a fourth portion 328 of the channel 302 separate from the first, second, and third portions 322, 324, and 326 of the channel 302.
- the first portion 322 and the second portion 324 of the channel 302 are shown separated by a spacing 374.
- the spacing 374 of the first portion 322 and the second portion 324 corresponds to and is defined, at least in part, by a spacing 376 between the distal ends 366 and 370 of the first excitation optical fiber 364 and the second excitation optical fiber 368.
- a spacing 376 between the distal ends 366 and 370 of the excitation optical fibers 364 and 368 determines a spacing 374 between portions 322 and 324 of the channel 302 illuminated by light sources of the light engine 308.
- FIGURE 4 is a fluorescence image of a channel 302 illuminated by a light engine 308, according to an embodiment of the present disclosure.
- portions 322, 324, 326, and 328 are separated by a spacing 374.
- a spacing 374 is in a range of about 100 nm to about 100 microns, about 10 nm to about 10 microns, about 500 nm to about 10 microns, about 1 micron to about 20 microns, 3 microns to about 30 microns, or 2 microns to about 8 microns.
- spacing 374 is based upon distance between a center of one excitation light, such as excitation light 312, impinging upon the interrogation window 306, and a center of another excitation light, such as excitation light 316, impinging upon the interrogation window 306. In another embodiment, the spacing 374 is based upon a distance between edges of excitation light, such as an edge of excitation light 312 and an opposing edge of excitation light 316, impinging upon interrogation window 306.
- portions 322, 324, 326, and 328 have a width defined by a width of excitation light, such as excitation light 312 and 316, impinging upon the interrogation window 306 after passing through or being focused by the high-NA air objective 386.
- a ratio of the spacing 374 to a width of one or more of portions 322, 324, 326, and 328 is greater than 1 : 1, 2: 1, 3: 1, 4: 1, 5: 1, 6: 1, 7: 1, 8: 1, 9: 1, 10: 1, 20: 1 or greater.
- a ratio of the spacing 374 to a width of one or more of portions 322, 324, 326, and 328 is in a range of about 1 : 1 to about 20: 1, 2: 1 to about 20: 1, 2: 1 to about 10: 1, 2: 1 to about 5: 1.
- Such ratios are sufficiently large to generate excitation light from the various portions with, for example, minimal cross-talk between emission from the distinct portions 322, 324, 326, and 328, such as detected by detector modules of the systems of the present disclosure.
- FIGURES 3C-3F are schematic illustrations of a light engine 308 and a channel 302, in accordance with the present disclosure.
- the light engines 308 and channels 302 are examples of the light engine 308 and channel 302 of FIGURE 3 A.
- the light engine 308 includes a first light source 310, a second light source 314, a third light source 318, and a fourth light source 320.
- the light sources 310, 314, 318, and 320 are optically coupled to excitation optical fibers 364, 368, etc., the distal ends of which are coupled together in an excitation fiber bundle 372.
- the distal ends 366 and 370 of the first excitation optical fiber 364 and the second excitation optical fiber 368 are arranged to provide a spacing 376.
- the light sources 310, 314, 318, and 320 include a number of lasers having noted wavelengths. As shown, in certain embodiments, two or more of the lasers 310, 314, 318, and 320 are configured to output light having a common wavelength. In certain other embodiments, the lasers 310, 314, 318, and 320 are configured to output light having different wavelengths.
- the light engines 308 can be configured to analyze or manipulate particles and/or molecules passing through the channel 302 with the same wavelengths of light, such as in tracking a particular particle as it moves through the channel 302.
- the light engine 308 can be configured to analyze or manipulate a particle with different wavelengths of light to help determine the presence or absence of particular detectable agents associated different markers.
- variable arrangements and wavelength ranges of the light sources of the light engine 308 are suitable to perform excitation and emission multiplexing.
- excitation multiplexing refers to methods of analyzing particles, molecules, or other analytes including exciting detectable agents associated with such particles, molecules, or other analytes with excitation light having different wavelength ranges.
- by exciting the detectable agents with excitation light having different wavelength ranges different qualities or characteristics of the particle, molecule, or other analyte associated with the detectable agent can be determined.
- the system of the present disclosure includes a cover coupled to the emission fiber bundle.
- a cover coupled to the emission fiber bundle.
- FIGURES 5A-5C attention is directed to FIGURES 5A-5C in which covers, according to embodiments of the present disclosure are illustrated.
- FIGURE 5A schematically illustrates emission light passing through apertures 594A and 594B of an optically opaque cover 592 and onto an emission fiber bundle 530 of a system, in accordance with an embodiment of the present disclosure.
- FIGURE 5B illustrates an example of the optically opaque cover 592 of FIGURE 5 A.
- the emission fiber bundle 530 is an example of the emission fiber bundle 130 of FIGURE 1 A.
- lens 590 directs first emission light 552 and second emission light 546 to emission fiber bundle head 532.
- the cover 592 defines an aperture 594A shaped to allow passage of the first emission light 552 onto the proximal end 536 of the first emission optical fiber 534.
- the first emission light 552 is allowed to pass through the aperture 594A and onto a proximal end 536 of the first emission optical fiber 534.
- the cover 592 is optically opaque. In this regard, light, such as light that is not the first emission light 552, is less likely to enter the first emission optical fiber 534.
- the cover 592 is shown separated from the emission fiber bundle head 532.
- the optically opaque cover 592 is coupled to the emission fiber bundle head 532 to prevent or mitigate stray light from entering emission optical fibers.
- the optically opaque cover 592 is suitable to increase a signal-to-noise ratio of a detector system and/or minimize or eliminate crosstalk (e.g., a portion of the first emission light 552 entering the proximal end 540 of the second emission optical fiber 538 and vice versa) between the different emission lights.
- the optically opaque cover defines a second aperture 594B shaped to allow passage of the second emission light 546 onto the proximal end 540 of the second emission optical fiber 538.
- second emission light 546 is allowed to pass through the cover 592 and into the second emission optical fiber 538.
- apertures 594A and 594B in a linear arrangement are illustrated, it will be understood that any number of apertures of the cover 592 can be arranged in various configurations to correspond to emission optical fibers of the emission fiber bundle 530, such as those discussed further herein with respect to FIGURE 1 A and IB.
- FIGURE 5C is an image of the proximal end of the fiber bundle head 532 of a system, in accordance with an embodiment of the present disclosure. As shown, the optical fibers are arranged in a linear configuration, such that when the cover 592 of FIGURES 5 A and 5B is coupled thereto, the apertures 594A and 594B are in registry with the optical fibers of the fiber bundle head.
- FIGURE 6 is a schematic illustration of a system 600, in accordance with an embodiment of the disclosure, which will now be described.
- the system 600 includes a channel 602 configured to flow a particle or molecule through a lumen 604 of the channel 602, the channel 602 defining an interrogation window 606 configured to allow light to pass into and out of the lumen 604; a light engine 608; an emission fiber bundle 630 shaped and positioned to receive emission light emitted from the interrogation window 606; and a detector system configured to generate signals based on the collected emission lights.
- the light engine 608 includes four light sources positioned to output light onto the channel 602.
- the light engine 608 includes a first light source positioned to output first excitation light 612 onto a first portion of the channel 602 in the interrogation window 606; and a second light source positioned or configured to output second excitation light 616 onto a second portion of the channel 602 in the interrogation window 606 separate from the first portion.
- the light sources are free-space light sources, which are not coupled to excitation optical fibers.
- a spacing of excitation light is defined, at least in part, by a spacing of the free-space light sources.
- an excitation spacing from free-space light sources is defined, at least in part, by the way in which excitation light output therefrom is combined, such as with dichroics and/or lenses and other optical components.
- the light engine 608 includes fiber-coupled light sources as discussed further herein with respect to FIGURE 1 A.
- the excitation light is directed through lenses 690 and impinges upon a dichroic mirror 660, which reflects the excitation light to an objective 686.
- the objective 686 collects the excitation light and directs it into the interrogation window 606 of the channel 602.
- Emission light emitted from the channel 602 passes back through the objective 686 and the dichroic mirror 660 to an emission fiber bundle 630.
- the dichroic mirror 660 As discussed further herein, while a dichroic mirror is illustrated, other partially reflective/transmissive structures are possible within the scope of the present disclosure.
- the system 600 is shown to further include a mirror positioned to reflect the light onto the emission fiber bundle 630 and a cover 692 configured to occlude light other than the emission light from entering the emission fiber bundle 630.
- the system 600 is shown to include a number of photodetectors optically coupled to the emission optical fibers.
- the system 600 is shown to include an emission fiber bundle 630 comprising a first emission optical fiber 634 and a second emission optical fiber 638, wherein a portion of proximal end 636 of first emission optical fiber 634 and second emission optical fiber 638 are arranged in an emission fiber bundle head 632, and wherein the proximal end 636 of the first emission optical fiber 634 is positioned to receive first emission light 646 emitted from the first portion and the proximal end 640 of the second emission optical fiber 638 is positioned to receive second emission light 652 emitted from the second portion.
- Proximal ends of emission optical fibers can refer to portions of such fibers disposed in emission fiber bundle, such as emission fiber bundle 630, and portions adjacent to the emission fiber bundle.
- the system 600 is shown to include a first photodetectors 644, 658A, and 658B positioned to receive the first emission light 646 emitted from a distal end of the first emission optical fiber 634; and second photodetectors 650A and 650C positioned to receive the second emission light 652 emitted from a distal end of the second emission optical fibers 638.
- the system 600 further includes a dichroic mirror 660 disposed between the distal end of the first emission optical fiber 634 and the first photodetector 644 and positioned to reflect a portion of the first emission light 646 onto third photodetectors 658A and 658B.
- each emission optical fiber is optically coupled dichroic mirrors 660 as well as band pass filters 662, which are in turn optically coupled to second photodetectors 650A, 650B, and 650C and third photodetectors 658B, 658C, 658D, 658E, and 658F.
- the first photodetector 644 is configured to generate a first signal based on a first wavelength range of the first emission light 646, the third photodetectors 658A and 658B are configured to generate a set of signals based on a different set of wavelength ranges of the first emission light 646.
- the second photodetectors 650A-650C are configured and positioned to generate a set of signals based on emission light other than first emission light 646, such as based upon second emission light 652.
- emission light received by each emission optical fiber is configured to be spectrally analyzed by a number of photodetectors.
- each emission optical fiber is optically coupled to a number of photodetectors.
- first emission optical fiber 634 is optically coupled to photodetectors 644, 658 A, and 658B.
- photodetectors 644, 658 A, and 658B comprise a detector module, such as a detector module as discussed further herein with respect to FIGURE 2.
- photodetectors 650A and 658C are group in a second detector module.
- such detector modules comprise a box or other enclosure encapsulating the various photodetectors of the detector module.
- the system 600 is shown to further include a controller 656 operatively coupled to the light engine 608 and the photodetectors.
- the controller 656 is configured to choreograph the operation of the light engine 608 and photodetectors system, such as to perform one or more methods of the present disclosure.
- the controller 656 is also shown operatively coupled to a moveable stage 688 physically coupled to the channel 602.
- the channel 602 is shown to be part of a microfluidic chip defining a number of channels.
- the controller 656 includes logic that, when executed by the controller 656, causes the system 600 to move the microfluidic chip with the moveable stage 688.
- a focus of the objective 686 is changed from a first channel 602 to a second channel of the microfluidic chip.
- the system 600 can be used to analyze particles and/or molecules flowing through a number of channels, such as a number of channels flowing different suspensions of particles and/or solutions of molecules.
- FIGURES 7A and 7B attention is directed to FIGURES 7A and 7B in which a system 700, in accordance with an embodiment of the disclosure, is illustrated.
- FIGURE 7A is a schematic illustration of the system 700.
- FIGURE 7B is a schematic illustration of focusing a high-NA air objective 786 of the system 700 on a channel 702 of the system 700.
- the system 700 is an example of the system 100 of FIGURE 1A or an example of the system 600 of FIGURE 6.
- the system 700 includes a channel 702 configured to flow a particle and/or molecule through a lumen of the channel 702, the channel 702 defining an interrogation window 706 configured to allow light to pass into and out of the channel 702; a moveable stage 788 coupled to the channel 702 and configured to move the channel 702 relative to a light collection system 784; a light engine 708; a detector system; a controller 756 operatively coupled to the light engine 708, the moveable stage 788, and the detector system.
- the channel 702 defines a constriction within the interrogation window 706. As discussed further herein, such a constriction is suitable to provide particle-by-particle flow of particles and/or molecule-by-molecule flow of molecules through the channel 702.
- the light engine 708 is shown outputting excitation light 712 onto a dichroic mirror 760 which is reflected into the light collection system 784 and into the interrogation window 706 of the channel 702.
- Emission light 746 is shown emitted from the interrogation window 706, through the dichroic mirror 760, lens 790A, and an aperture 794 of optically opaque cover 778 to be received by emission fiber bundle 730 including emission fiber bundle head 732.
- a distal end of one of the emission optical fibers 734 of the emission fiber bundle 730 is shown to terminate adjacent to photodetector 744 of the detector system.
- Emission light passes through lens 790 and bandpass filter 762 before impinging upon photodetector.
- the photodetector 744 is configured to generate a signal based upon the received emission light 746.
- the controller 756 includes logic that, when executed by the controller 756, causes the system 700 to perform operations.
- such operations include one or more of the methods of focusing optical components on a fluidic channel 702, in accordance with an embodiment of the disclosure.
- the operations include illuminating an interrogation window 706 of a fluidic channel 702 with light from a light source; focusing the light onto the interrogation window 706 with optical components disposed between the channel 702 and the photodetector 744; generating a lock signal with the photodetector 744 based on the focused light back reflected from the interrogation window 706 at a first time; generating a test signal with the photodetector 744 based on the focused light back reflected from the interrogation window 706 at a second time after the first time; determining whether the test signal is within a predetermined percentage of the lock signal; and moving the fluidic channel 702 relative to the high-NA air objective 786 if the test signal is outside of the pre
- the high-NA air objective 786 can be moved relative to the channel 702 to focus the excitation light 712 within the lumen 704 of the channel 702.
- such movement of the air objective 786 is controlled with the moveable stage 788, such as in response to instructions received from the controller 756, as discussed further herein with respect to FIGURE 6.
- FIGURE 7C is a block diagram illustrating a method of focusing a high-NA air objective 786 of a system 700, in accordance with an embodiment of the present disclosure.
- the block diagram illustrates a feed-back loop that controls the motion of objective lens 786 by comparing the current value of reflection, with the value at previous time point (e.g., 200 ms ago), as well as the reference value. Where a difference between a measured value and a reference or lock value is above a predetermined threshold, a motor is driven to move the fluidic channel 702 relative to the high-NA air objective 786.
- the light is in a non-visible wavelength range.
- the light is infrared light, such as in a range of about 700 nm to about 2000nm.
- the operations include illuminating an imaging area of the system 700 with light from a light source; generating an image of the imaging area with a camera or other image sensor; determining an amount of defocus of the image; determining whether the amount of defocus is within a predetermined amount of defocus; and moving the fluidic channel 702 relative to the high-NA air objective if the test signal is outside of the predetermined range.
- the channel is moved relative to the high-NA air objective with the moveable stage 788.
- the operations are iterative in that, for example, the camera periodically generates images to confirm focus and/or move the channel 702 relative the high-NA air objective to adjust focus.
- the light source is in a non-visible wavelength range.
- the light is near-infrared light, such as in a range of about 700 nm to about 2000 nm.
- the objective is an air objective.
- the objective is an air objective with a NA between 0.91 and 0.99.
- the objective is an air objective with a NA between 0.92 and 0.98.
- the objective is an air objective with a NA between 0.93 and 0.97.
- the objective is an air objective with a NA between 0.94 and 0.96.
- the objective is an air objective with a NA of around 0.95.
- FIGURE 8 illustrates a system 800 according to an embodiment.
- the system 800 is an example of any of the systems and subcomponents thereof discussed further herein with respect to FIGURES 1 A, IB, 2, 3A-3F, 5A-5C, 6, 7A-7G, 19, and 20.
- the system 800 includes a flow channel 802 configured to flow an analyte, such as a single-molecule analyte, through a lumen of the flow channel 802, the flow channel 802 defining an interrogation window configured to allow light to pass into and out of the lumen; a light engine 808 configured to output excitation light 812 into the flow channel 802 through the interrogation window; a detector system 844 positioned to receive emission light 846 emitted from the flow channel 802 and configured to generate a signal based upon the received emission light 846; a light collection system 884 positioned to collect the emission light 846 from the flow channel 802 and direct the collected emission light 846 onto the detector system 844; and a controller 856 operatively coupled to the light engine 808 and the detector system 844.
- analyte such as a single-molecule analyte
- the system 800 includes a flow channel 802 configured to flow an analyte, such as a single-molecule analyte through the flow channel.
- the flow channel is configured to flow the single-molecule analyte associated with, for example, a detectable agent and a capture agent or a first detection agent and a second detection agent, through the flow channel 802.
- the flow channel 802 is shaped to flow, for example, a single-molecule analyte associated with a capture agent, which comprises a bead.
- the system 800 further optionally includes a purification subsystem controller 898, configured to choreograph operations of the optional purification subsystem 896.
- the purification subsystem 896 is a separate system or instrument distinct and/or physically separate from the other system 800 components described with respect to FIGURE 8.
- the operations of the system 800 are described further herein with respect to FIGURES 21 and 22.
- the operations of the system 800 including the purification subsystem 896 are described further herein with respect to, for example, FIGURES 9 A and 9B.
- the controller 856 includes logic that, when executed by the controller 856, causes the system 800 to perform operations, including one or more of the methods of the present disclosure. In an embodiment, the controller 856 includes logic that, when executed by the controller 856, causes the system 800 to perform operations, including outputting excitation light 812 with the light engine 808 through the interrogation window onto a portion of the flow channel 802; generating a detectable agent emission signal with the detector 844 based on detectable agent emission light 846 from the detectable agent; and optionally flowing a sample including an analyte associated with a detectable agent through the flow channel 802.
- the system 800 is shown to include an optional purification subsystem 896 configured to associate the analyte with a capture agent configured to isolate the analyte from a portion of the sample when the analyte is associated with the capture agent and when the capture agent is subject to an isolation procedure.
- a capture agent refers to a particle, bead, nanoparticle, molecule, group of associated moieties configured to isolate the analyte from a portion of the sample when the analyte is associated with the capture agent and when the capture agent is subject to an isolation procedure.
- the purification subsystem 896 is configured to isolate the analyte associated with the capture agent from a portion of the sample to provide a purified sample; wherein flowing the analyte associated with the detectable agent through the flow channel 802 includes flowing the purified sample through the flow channel 802. As shown, the purification subsystem 896 is shown positioned upstream of the flow channel 802 and configured to provide the purified sample to the flow channel 802 for detection therein.
- flowing the analyte associated with the detectable agent through the flow channel 802 includes flowing a complex including the analyte associated with the capture agent and the detectable agent.
- the capture agent includes a magnetic bead.
- the term "bead" refers to a particle, such as a micron- or sub-micron- scale particle.
- the bead is a nanoparticle.
- the bead is sized and shaped to flow through a flow channel of a system according to an embodiment of the present disclosure.
- the bead has a largest dimension that is smaller than a cross-section of a lumen of the flow channel, including a cross-section of the lumen within a constriction of the flow channel, such that the bead can pass through the flow channel including the constriction.
- the capture agent includes a primary antibody or nucleic acid molecule configured to selectively associate with a moiety of an analyte.
- the bead is functionalized with a moiety configured to specifically associate with an analyte and/or an association agent. In an embodiment, the bead is functionalized with a moiety configured to specifically associate with a detectable agent, such as free detectable agent not associated with an analyte.
- the bead is a fluorescent bead. In an embodiment, the bead is an encoded fluorescent bead as described further herein. In an embodiment, the bead is a magnetic bead.
- the bead has a diameter of less than 1 micrometer. In an embodiment, the bead has a diameter of less than 1 micrometer, 900 nm, 800 nm, 700nm, 600 nm, 500 nm, 400 nm, 300 nm, 200 nm, or 100 nm. In an embodiment, the bead has a diameter of less than 100 nm, 90 nm 80 nm, 70 nm, 60 nm, 50 nm, or 40 nm. In an embodiment, the bead has a diameter of greater than 1 micrometer. In an embodiment, the bead has a diameter of between 1 and 5 micrometer.
- a ratio of capture agent to detectable agent is in a range of 10: 1 to 1 : 10, 9: 1 to 1 :9, 8: 1 to 1:8, 7: 1 to 1 :7, 6: 1 to 1 :6, 5: 1 to 1 :5, 4: 1 to 1 :4, 3: 1 to 1 :3, 2:1 to 1 :2, and 1 : 1. In an embodiment, a ratio of capture agent to detectable agent is about 1 : 1.
- the purification subsystem 896 comprises a magnet.
- the purification subsystem controller 898 is operatively coupled to the purification subsystem 896 and further includes logic that, when executed by the purification subsystem controller 898, causes the subsystem 896 to perform operations including: associating the analyte associated with the capture agent with the magnet; and removing a portion of the sample not associated with the magnet from the analyte associated with the capture agent to provide the purified sample.
- the purification subsystem 896 comprises a centrifuge.
- the purification subsystem controller 898 is operatively coupled to the purification subsystem 896, and includes logic that, when executed by the purification subsystem controller 898, causes the subsystem 896 to perform operations including: centrifuging the sample including the capture agent associated with the analyte with the centrifuge to provide supernatant and a pellet including the analyte associated with the capture agent; and decanting the supernatant to provide the purified sample.
- the capture agent includes a bead
- the purification subsystem 896 comprises a size exclusion chromatography column and the controller 856 is operatively coupled to the purification subsystem 896
- the purification subsystem controller 898 includes logic that, when executed by the purification subsystem controller 898, cause the subsystem 896 to perform operations including: passing the sample including the analyte associated with the capture agent through the size exclusion chromatography column to provide the purified sample including the analyte associated with the capture agent.
- the optional purification subsystem 896 includes a surface, wherein the capture agent is coupled a surface.
- the purification subsystem controller 898, operatively coupled to the purification subsystem 896 further includes logic that, when executed by the purification subsystem controller 898, causes the subsystem 896 to perform operations including removing a portion of the sample not associated with the capture agent coupled to the surface.
- the purification subsystem controller 898, operatively coupled to the purification subsystem 896 further includes logic that, when executed by the purification subsystem controller 898, causes the subsystem 896 to perform operations including contacting the surface with an elution buffer to elute analyte associated with the capture agent from the surface.
- the analyte can be associated with a capture agent, wherein the capture agent is configured to emit capture agent emission light upon excitation.
- the controller 856 further includes logic that, when executed by the controller 856, causes the system 800 to perform operations including generating a capture agent emission signal based on the capture agent emission light.
- capture agent emission signals are useful in detecting analyte associated with the capture agent, such as analytes also associated with a detectable agent emission signal.
- generating the capture agent emission signal includes illuminating the capture agent with the excitation light 812 and detecting the capture agent emission light with the photodetector.
- the controller 856 further includes logic that, when executed by the controller 856, causes the system 800 to perform operations including: outputting second excitation light 812 through the interrogation window onto a second portion of the flow channel 802 distinct from the first portion; and generating the capture agent emission signal with a second photodetector based on capture agent emission light received from the second portion of the flow channel 802.
- the system 800 is suitable for use with encoded capture agents, such as discussed further herein with respect to FIGURE 12A.
- the capture agent comprises a plurality of distinct chromophores, wherein each chromophore of the plurality of distinct chromophores comprises a predetermined set of tunable optical coding parameters, thereby defining an optically detectable code of the capture agent.
- the capture agent is configured to emit capture agent emission light upon excitation
- the controller 856 further includes logic that, when executed by the controller 856, cause the system 800 to perform operations including: generating, with the photodetector, a capture agent emission signal based on the capture agent emission light, and determining the concentration of the analytes associated with the emission light 846 from the interrogation window further based on a number of analytes associated with both emission light 846 from the detectable agent and the capture agent emission.
- the optically detectable code comprises a predetermined emission spectrum of the capture agent, a predetermined absorption spectrum of the capture agent, or a combination thereof.
- the system 800 is suitable for use with two or more detectable agents, which, for example, are configured to associate with different moieties of an analyte and emit distinct and distinguishable detectable agent or capture agent emission light, such as fluorescence.
- the detectable agent is a first detectable agent configured to emit first emission light in a first wavelength range upon excitation of the first detectable agent
- the controller 856 further includes logic that, when executed by the controller 856, causes the system 800 to perform operations including exciting a second detectable agent associated with the analyte and configured to emit second emission light in a second wavelength range upon excitation of the second detectable agent, and wherein the first emission wavelength range is distinct from the second wavelength range.
- the first detectable agent associates with a first moiety of the analyte
- the second detectable agent associates with a second moiety of the analyte distinct from the first moiety.
- the controller 856 further includes logic that, when executed by the controller 856, causes the system 800 to perform operations including associating the analyte with an association agent configured to specifically associate with the analyte, and wherein associating the analyte with the detectable agent comprises associating the detectable agent with the association agent associated with the analyte.
- the subsystem 896 includes and/or is configured to work with a removal bead configured to remove detectable agent that is not associated with an analyte, such as after the detectable agent has had a chance to associate with the analyte.
- the controller 898 further includes logic that, when executed by the controller 898, causes the subsystem 896 to perform operations including, after associating the analyte in the sample with the detectable agent, contacting the sample with a removal bead configured to selectively associate with any detectable agent not associated with the analyte; and removing the removal bead associated with the detectable agent not associated with the analyte from the sample.
- the flow channel 802 defines a constriction.
- the flow channel 802 within the interrogation window defines a constriction relative to adjacent portions of the flow channel 802.
- the controller 856 further includes logic that, when executed by the controller 856, causes the system 800 to perform operations including flowing a plurality of analytes of the sample through the flow channel 802.
- flowing the analytes through the flow channel 802 includes flowing a plurality of analytes of the sample including the analytes associated with detectable agents through the flow channel 802, wherein flowing the analytes associated with detectable agents through the flow channel 802 includes flowing the analyte associated with detectable agents through a constriction of the flow channel 802 on an analyte-associated-with- detectable agent by analyte-associated-with-detectable agent basis.
- flowing the analytes through the flow channel 802 includes flowing a plurality of analytes of the sample including the analytes associated with detectable agents and capture agents through the flow channel 802, wherein flowing the analytes associated with detectable agents and capture agents through the flow channel 802 includes flowing the analyte associated with detectable agents and capture agents through a constriction of the flow channel 802 on an analyte-associated-with-capture-and-detectable agent by analyte- associated-with-capture-and-detectable agent basis.
- flowing the analytes through the flow channel 802 includes flowing a plurality of analytes of the sample including the analytes associated with two or more detectable agents through the flow channel 802, wherein flowing the analytes associated with two or more detectable agents through the flow channel 802 includes flowing the analyte associated with two or more detectable agents through a constriction of the flow channel 802 on an analyte-associated-with-detectable agents by analyte-associated-with-detectable agents basis.
- the system 800 is configured to determine a number of analytes flowed through the flow channel 802. In an embodiment, the system 800 is further configured to determine a concentration of the analytes in a sample, such as based upon the number of analytes flowed through the channel and a flow rate of fluid flow through the channel. In an embodiment, the controller 856 further includes logic that, when executed by the controller 856, causes the system 800 to perform operations including: quantifying a number of analytes associated with the emission light 846; and determining a concentration of the analytes associated with the emission light 846 from the interrogation window based on the number of analytes associated with the emission light 846 and a volume of liquid flowed through the flow channel 802.
- the capture agent is configured to emit capture agent emission light upon excitation
- the controller 856 includes logic that, when executed by the controller 856 causes the system 800 to perform operations including: generating a capture agent emission signal based on the capture agent emission light.
- determining the concentration of the analyte is based on a number of detectable agent emission signals associated with the capture agent emission signals or second detectable agent emission signals.
- determining the concentration of the analyte is based on a ratio of the number of detectable agent emission signals associated with the capture agent emission signals or second detectable agent emission signals to a number of the capture agent emission signals, detectable agent emission signals, second detectable agent emission signals, or combinations thereof.
- determining the concentration of the analyte is based on a volume of liquid flowed through the flow channel.
- the present disclosure provides systems configured for detection of analytes through co-linear excitation and emission measurement.
- the systems illuminate a single portion of a flow channel, such as a single cross-section of a lumen of the flow channel, rather than multiple portions of the flow channel, such as is illustrated in and discussed with respect to FIGURES 1 A-6 of the present disclosure.
- such systems are configured to and otherwise suitable for singlemolecule analyte analysis.
- a "single-molecule analyte” refers to an analyte, such as a protein or nucleic acid molecule, that includes a single molecule.
- Such a singlemolecule analyte is in contrast to, for example, an agglomeration or aggregate of multiple molecules, such as a granule, vesicle, cell, and the like, which include many molecules associated together.
- Examples of a single-molecule analyte include a single protein molecule comprised of one or more chains of amino-acids or a single nucleic acid molecule, either in a single-stranded unhybridized state or in a double-stranded hybridized state.
- the systems of the present disclosure are configured to detect, count, analyze, and the like single-molecule analytes in flow, based on the specific association with one or more detectable agents and/or capture agents, such as to identify them, count them, and determine their concentration in a sample
- specific association refers to an association caused by a specific molecular recognition and binding, including antibody-antigen binding, nucleic-acid hybridization, aptamer-antigen binding, antibody-fragment-antigen binding, peptide-antigen binding, and the like.
- FIGURE 19 attention is directed to FIGURE 19, in which a system 1900 for analyzing an analyte, is illustrated.
- the system 1900 includes a flow channel 1902, a light engine 1908 configured to illuminate the channel 1902, a detector 1942, and a controller operatively coupled to the light engine 1908 and the detector 1942.
- the channel 1902 is configured to flow an analyte through a lumen 1904 of the channel 1902, the channel 1902 defining an interrogation window 1906 configured to allow light to pass into and out of the lumen 1904.
- the system 1900 can include or be combined with a purification subsystem, such as a purification subsystem 896 discussed further herein with respect to FIGURE 8.
- the system 1900 includes a channel 1902 configured to flow an analyte through the lumen 1904.
- the flow channel 1902 is sized and shaped to flow a single-molecule analyte through the flow channel 1902.
- the channel 1902 is sized and shaped to flow a single-molecule analyte associated with a detectable agent and a capture agent or a first detectable agent and a second detectable agent, as described elsewhere herein.
- the flow channel 1902 is sized and shaped to flow a single-molecule analyte associate with a capture agent, which includes a bead.
- the system 1900 is shown to include a pump 1998, which is fluidically coupled to the channel 1902, such as to flow particles and/or molecules (i.e., analytes) through the flow channel 1902.
- the pump 1998 is operatively coupled to the controller 1956, which can operate the pump 1998 in pumping fluid through the channel 1902.
- the pump 1998 is optional, such as where fluid is flowed through the channel 1902 by gravity or by surface-tension driven forces.
- the light engine 1908 is shown to include a number of light sources 1910, 1914, and 1918 optically coupled to the channel 1902.
- the light engine 1908 is shown to include a first light source 1910, a second light source 1914, and a third light source 1918.
- the first light source 1910 is configured to emit light having a wavelength of about 488 nm
- the second light source 1914 is configured to emit light having a wavelength of about 561 nm
- the third light source 1918 is configured to emit light having a wavelength of about 637 nm. While these particular excitation light wavelengths are illustrated, it will be understood that other excitation wavelengths can be used and are within the scope of the present disclosure, such as to illuminate and excite particular detectable agents, capture agents, and the like.
- a light engine 1908 having a number of light sources configured to emit excitation light of different light wavelengths, which are then combined in a co-linear excitation beam 1919, is suitable to excite, for example, small dye molecule-containing or other detectable agents and/or capture agents with small Stokes shifts.
- the fluorophores can be excited separately with a co-linear excitation beam 1919 and emission light 1945 at different wavelength ranges roughly corresponding to their respective excitation wavelengths can be detected by the detector 1942, as discussed further herein.
- the detector 1942 is configured to generate signals, such as emission signals, in response to received emission light 1945.
- the system 1900 includes dichroic mirrors 1960 positioned to combine excitation light, including first excitation light 1912 and second excitation light 1916, into a co-linear excitation light beam 1919, which is directed to the interrogation window 1906.
- the light engine 1908 is configured to illuminate the interrogation window 1906 with a co-linear beam 1919 of excitation light, that is a combination of excitation light from light sources 1910, 1914, and 1918 of the light engine 1908, the system 1900 does not have to include and is not shown to include an emission fiber bundle as discussed with respect to certain other systems of the present disclosure.
- the light sources 1910, 1912, and 1914 of the light engine 1908 are free-space laser light sources.
- the light sources 1910, 1914, and 1918 of the light engine 1908 are fiber-coupled laser light sources.
- the system 1900 is shown to include lenses 1990, which can be a cylindrical lens and a plano-convex lens, positioned between the light engine 1908 and a light collection system 1984 and configured to direct the co-linear beam 1919 from the light engine 1908 to the light collection system 1984.
- the light collection system 1984 includes an air objective 1986, as discussed elsewhere herein.
- the co-linear combined excitation beam 1919 is shown illuminating a single portion of the channel 1902, shown here illuminating a cross-section of the lumen 1904 of the channel 1902.
- Emission light 1945 such as from a detectable agent and/or a capture agent associated with an analyte in the interrogation window 1906 of the flow channel 1902 is received by the light collection system 1984 and directed, through optics 1990, such as a mirror and/or a tube lens, to an aperture 1980 of an optically opaque cover 1978.
- Such emission light 1945 passing through the aperture 1980 is shown received by an optical fiber 1966, which is optional.
- the fluorescence coming out of tube lens 1990 can be collimated using a planar convex lens.
- the emission light 1945 is shown received by the detector 1942, which is configured to generate one or more signals based upon the received emission light 1945.
- the detector 1942 is shown to include a number of dichroic mirrors 1960 configured to reflect a first portion 1946 of the emission light 1945 onto a first photodetector 1944 and allow a second portion 1952 of the emission light 1945 to pass through.
- the second portion 1952 of the emission light 1945 impinges upon a second dichroic mirror 1960, which reflects second emission light 1952 onto a second photodetector 1950.
- the detector 1942 includes third photodetectors 1958, positioned to receive yet further portions 1952 of the emission light 1945.
- the detector 1942 is further shown to include bandpass filters 1962 configured to filter a portion of received emission light 1945 and optics 1990, such as aspheric lenses, each positioned between the dichroic mirrors 1960 and their respective photodetectors 1944, 1950, and 1958.
- the detector 1942 is configured to spectrally divide emission light 1945, for example according to wavelength range, to separately detect wavelength ranges within the emission light 1945.
- the detector 1942 is configured to detect the presence or absence, for example, of a detectable agent and/or capture agent associated with an analyte within the interrogation window 1906 of the channel 1902, such as through detection of detectable agent fluorescence and capture agent fluorescence, which may be spectrally combined in the emission light 1945 received by the detector 1942.
- the present disclosure provides systems including a single light source for detecting and analyzing analytes in flow.
- FIGURE 20 attention is directed to FIGURE 20 in which a system 2000 according to an embodiment of the present disclosure is illustrated.
- the system 2000 includes a flow channel 2002, a light engine 2008 configured to illuminate the channel 2002, a detector 2042, and a controller operatively coupled to the light engine 2008 and the detector 2042.
- the channel 2002 is configured to flow an analyte, such as a single-molecule analyte, through a lumen 2004 of the channel 2002, the channel 2002 defining an interrogation window 2006 configured to allow light to pass into and out of the lumen 2004.
- the system 2000 can include or be combined with a purification subsystem, such as a purification subsystem 896 discussed further herein with respect to FIGURE 8.
- the system 2000 is shown to include a pump 2098, which is fluidically coupled to the flow channel 2002, such as to flow analytes through the channel 2002.
- the pump 2098 is operatively coupled to the controller, which can operate the pump 2098 in pumping fluid through the channel 2002.
- the pump 2098 is optional, such as where fluid is flowed through the channel 2002 by gravity or by surfacetension driven forces.
- the light engine 2008 is shown to include a light source 2010 configured to emit excitation light 2012 through optics 2090, such as including a cylindrical lens and a planoconvex lens, off of a dichroic mirror 2060, into light collection system 2084 including an air objective 2086, and onto the channel 2002.
- optics 2090 such as including a cylindrical lens and a planoconvex lens, off of a dichroic mirror 2060, into light collection system 2084 including an air objective 2086, and onto the channel 2002.
- a single-light source system reduces system 2000 complexity and cost by reducing the number of expensive components, such as lasers, and the optics 2090 used to combine light source excitation beams and/or fiber coupling to illuminate different portions of the interrogation window 2006.
- Emission light 2045 such as light from a detectable agent or capture agent
- the light collection system 2084 is directed, through optics 2090 such as a mirror and a tube lens, to an aperture 2080 of an optically opaque cover 2078.
- optics 2090 such as a mirror and a tube lens
- Such emission light 2045 passing through the aperture 2080 is shown received by an optical fiber 2066, which is optional.
- the fluorescence coming out of tube lens 2090 can be collimated using a planar convex lens here.
- the emission light 2045 is shown received by the detector 2042.
- the detector 2042 is configured to generate an emission signal based upon the emission light 2045 received by the detector 2042.
- the detector 2042 is shown to include a number of dichroic mirrors 2060 configured to reflect a first portion 2046 of the emission light 2045 onto a first photodetector 2044 and allow a second portion 2052 of the emission light 2045 to pass through.
- the second portion 2052 of the emission light 2045 impinges upon a second dichroic mirror 2060, which reflects second emission light 2052 onto a second photodetector 2050.
- the detector 2042 includes third photodetectors 2058, positioned to receive yet further portions 2052 of the emission light 2045.
- the detector 2042 is further shown to include bandpass filters 2062 configured to filter a portion of received emission light 2045 and optics 2090, such as aspheric lenses, each positioned between the dichroic mirrors 2060 and their respective photodetectors 2044, 2050, and 2058.
- the detector 2042 is configured to spectrally divide emission light 2045, for example according to wavelength range, to separately detect wavelength ranges within the emission light 2045, such as through generation of one or more emission signals based upon the received emission light 2045.
- the system 2000 illustrated in FIGURE 20 is suitable to excite, for example, a number of fluorophores, such as detectable agents and/or capture agents as described herein, that are excited by a common wavelength range, which then emit light at different wavelengths.
- fluorophores such as detectable agents and/or capture agents as described herein
- polymer dots can have large Stokes shifts with tunable emission peaks, can be excited by the single light source and then emit at widely varying wavelengths that are separately detectable by the detector 2042.
- a detectable agent and a capture agent each associated with an analyte can be excited with the single light source of the light engine 2008 and their distinct fluorescence separately detected by the detector 2042, thus confirming, for example, co-localization of the detectable agent and the capture agent on the analyte.
- the systems of the present disclosure include controllers, 1956 and 2056, respectively.
- controllers 1956 and 2056 are suitable to and configured to choreograph components of the systems 1900 and 2000 operatively coupled thereto.
- the controllers include logic that, when executed by the controller, cause the system to perform operations, such as operations described with respect to the methods of the present disclosure.
- FIGURE 21 a method 2100 for control and operation of a system, in accordance with an embodiment of the present disclosure are illustrated.
- the method 2100 is for system control, such as for systems 1900 or 2000 discussed further herein with respect to FIGURES 19 and 20, respectively, for example, for digital affinity assays.
- Such system control methods can be performed through the execution of logic stored in one or more controllers 1956 and/or 2056 in the systems 1900 and/or 2000.
- such logic is stored on a remote server and/or in a distributed system operatively coupled or coupleable to the controller.
- the system control methods include the use of and execution of logic stored on purification subsystem controllers, such as described further herein with respect to FIGURE 8.
- the method 2100 begins with process block 2101, which includes flowing a sample including an analyte associated with the detection agent through a flow channel.
- the analyte is incubated with the detectable agent under conditions and for a time sufficient to associate the analyte with the detectable agent.
- the analyte is also associated with a capture agent, such as also through incubation of the analyte under conditions and for a time sufficient to associate the analyte with the capture agent.
- flowing analytes through the flow channel comprises flowing a plurality of analyte-associated-detectable agents through a constriction of the flow channel on an analyte-associated-with-detectable agent -by-analyte-associated-with-detectable agent basis.
- flowing analytes through the flow channel comprises flowing a plurality of analyte-associated-capture-and-detectable agents through a constriction of the flow channel on an analyte-associated-with-capture-and-detectable-agents-by-analyte-associated- with-capture-and-detectable agent basis.
- flowing the sample through the channel is conducted through operation of one or more pumps configured to pump the sample, such as a liquid sample, through the flow channel.
- the sample is flowed through the flow channel through gravity or surface-tension driven flow and, in an embodiment, process block 2101 is optional, as it pertains to a method of system controls for a system according to an embodiment of the present disclosure.
- process block 2101 is followed by or method 2100 begins with process block 2103, which includes outputting excitation light through an interrogation window of a portion of the flow channel.
- outputting the excitation light includes operation of a light engine, such as outputting excitation light from a light source of the light engine.
- a light engine such as outputting excitation light from a light source of the light engine.
- excitation light can be configured to excite one or more of a detectable agent and/or capture agent associated with the analyte.
- process block 2103 is follow by process block 2105, which includes outputting second excitation light through the interrogation window of the flow channel.
- outputting second excitation light occurs through operation of a light engine, such as a light engine including two or more light sources.
- the light engines can include one light source or two or more light sources, such as depending upon the type of detectable agents and/capture agents used in the digital affinity assays.
- the light engine includes only a single light source and, accordingly, in an embodiment, process block 2105 is optional.
- process blocks 2103 or 2105 are follow by process block 2107, which includes generating detectable agent emission signals with a photodetector based on a detectable agent emission light received from the flow channel.
- detectable agents are configured to associate with an analyte, such as through specific association (e.g., via specific molecular recognition) with the analyte, and generate a detectable agent emission light, such as fluorescence, in response to being optically excited, where such detectable agent emission light may be detected by a photodetector.
- process block 2107 includes generating, with the detector, a plurality of detectable agent emission signals based on detectable agent emission light from a plurality of detectable agents, such as when flowing a plurality of analytes associated with detectable agents through the flow channel.
- process block 2107 is followed by process block 2109, which includes generating a capture agent emission signal based on capture agent emission light received by the detector.
- the analyte is associated with a capture agent, such as through specific association (e.g., via specific molecular recognition) between the two, as discussed elsewhere herein.
- a sample including the analyte includes the capture agent, but the analyte is not associated with the capture agent.
- the capture agent is configured to emit capture agent emission light, such as when excited by excitation light from a light source of the light engine.
- process block 2109 is optional.
- process block 2109 includes generating, with the detector, a plurality of capture agent emission signals based on capture agent emission light from the capture agents, such as when flowing a plurality of analytes associated with capture agents through the flow channel.
- process block 2107 or process block 2109 is followed by process block 2111, which includes correlating or colocalizing two or more emission signals to determine presence and/or identity of an analyte. In an embodiment, this includes correlating or colocalizing the detectable agent emission light with the capture agent emission light or second detectable agent emission light, such as to determine a presence and/or identity of the analyte. As discussed elsewhere herein, in an embodiment, each of the detectable agent and the capture agent are configured to specifically associate with an analyte.
- the capture agent and the detectable agent are associated with a single analyte molecule or particle.
- the analyte includes moieties with which the detectable agent and the capture agent are configured to specifically associate (e.g., via specific molecular recognition).
- the correlation or colocation of the detectable agent emission signal and the capture agent emission signal can be used to detect the presence and/or identify the identity of the analyte, at least with respect to moieties on the analyte with which the detectable agent and the capture agent are configured to specifically associate. While a detectable agent and capture agent are discussed with respect to process block 2109, it will be understood that analogous approaches may be used wherein, for example, two or more detectable agents and their respective detectable agent emission signals can be used to determine the presence or identity of an analyte.
- process block 2111 is followed by process block 2113, which includes relating ratios of intensities of emission signals to identities of the analyte.
- this can include relating a ratio of an intensity of the capture agent emission light to an identity of the capture agent and an identity of the analyte associated with the capture agent.
- this can include relating a ratio of an intensity of the detectable agent emission light to an identity of the detectable agent and an identity of the analyte associated with the detectable agent.
- this can include relating an optical barcode of the capture agent emission light and/or the detectable agent emission light to an identity of the analyte associated with the capture agent and the detectable agent.
- this can include relating a fluorescence spectral-intensity barcode of the capture agent emission light and/or the detectable agent emission light to an identity of the analyte associated with the capture agent and the detectable agent.
- the capture agent for example, is an encoded capture agent configured to emit encoded capture agent emission light, such as where the encoded capture agent includes a plurality of distinct chromophores, wherein each chromophore of the plurality of distinct chromophores comprises a predetermined set of tunable optical coding parameters, thereby defining an optically detectable code for the capture agent.
- the capture agent can include a first chromophore at a first concentration and a second chromophore at a second concentration such that the capture agent emits first fluorescence and second fluorescence, wherein a ratio of the intensities of the first fluorescence to second fluorescence defines a ratio suitable to identify the capture agent.
- the analyte may be identified as the capture agent is configured to specifically associate with particular moieties of the analyte.
- process block 2113 includes relating an optical barcode of the capture agent emission light and/or the detectable agent emission light to an identity of the analyte associated with the capture agent and the detectable agent. In an embodiment, process block 2113 is optional.
- process block 2111 or process block 2113 is followed by process block 2115.
- process block 2115 includes quantifying a number of detectable agent emission signals associated with the capture agent emission signals or second detectable agent emission signals.
- process block 2115 includes quantifying a number of detectable agent emission signals associated with two or more detectable agent emission signals.
- process block 2115 includes quantifying a ratio of the number of detectable agent emission signals associated with the capture agent emission signals or second detectable agent emission signals to a number of the capture agent emission signals, detectable agent emission signals, second detectable agent emission signals, or combinations thereof.
- the analyte may be associated with both a detectable agent and a capture agent or with two detectable agents, in which cases, two or more emission signals will be roughly contemporaneously detected, such as when using single excitation of the flow channel, indicating that the capture agent and detectable agent or two detectable agents are associated with the analyte.
- detectable agent, second detectable agent, or capture agent will not be associated with the analyte, in which case only a detectable agent emission signal, second detectable agent emission signal, or only a capture agent emission signal will be detected in a given time period.
- process block 2115 can include quantifying or otherwise determining a number or a ratio of analyte associated with detectable agents and capture agents/ second detectable agents, such as relative to empty detectable agent, capture agents/second detectable agents (i.e., those detectable/capture agents not associated with an analyte).
- quantifying the number of analytes comprises single-molecule sensitivity or detection efficiency.
- quantifying the number of analytes comprises single-molecule sensitivity or detection efficiency without amplification of the analytes, such as without amplifying the analytes to generate, for example, amplicons or copies of a target analyte, or amplicons or copies of a molecule that is correlated with the presence of a target analyte.
- single-molecule sensitivity or detection efficiency includes detecting more than 99%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, ,60%, 55%, or 50% of the molecules flowing through the flow channel.
- singlemolecule detection efficiency includes detecting more than 50%, 55%, 60%, 65%, 70% 75, 80%, 85%, 90%, 95%, or 99% of the single molecules flowing through the flow channel.
- process block 2115 is followed by process block 2117, which includes determining a concentration of an analyte or a ratio of the analyte associated with the emission signals. As discussed elsewhere herein, by counting a number of analytes associated with an emission signal and by determining a flow rate through the flow channel, a concentration of the analyte in the sample can be determined. In an embodiment, process block 2117 includes determining a concentration of the analytes based on the number of capture agent emission signals associated with the detectable agent emission signals. In an embodiment, determining the concentration of the analytes is based upon a volume of liquid flowed through the flow channel.
- process block 2117 includes determining a concentration of the analytes based on the number of detectable agent emission signals associated with two or more detectable agent emission signals and a volume of liquid flowed through the flow channel. In an embodiment, determining the concentration of the analytes is based upon a ratio of the number of detectable agent emission signals associated with the capture agent emission signals to a number of the capture agent emission signals, a number of detectable agent emission signals, and combinations thereof.
- process block 2117 can include determining a ratio of the number of detectable agent emission signals associated with the capture agent emission signals to a number of all of the capture agent emission signals (whether or not associated with a detectable agent emission signal), all of the detectable agent emission signals (whether or not associate with a capture agent emission signal), and combinations thereof.
- method 2100 can further include ranking the analytes in the flow channel based on a presence or absence of the detectable agent and/or capture agent emission light from the interrogation window, such as discussed further herein with respect to FIGURES 1 A and IB. In an embodiment, the ranking corresponds with the detectable agent emission signal and/or the capture agent emission signal.
- ranking corresponds with measured emission spectra of the analyte-associated capture agent and detectable agent based upon one or more of the first emission light and the second emission light. In an embodiment, the ranking corresponds with a measured light scattering light of a bead.
- FIGURE 22 illustrates a method 2200 for control and operation of a system, in accordance with an embodiment of the present disclosure.
- the method 2200 is for system controls, such as for systems 1900 or 2000 discussed further herein with respect to FIGURES 19 and 20, respectively, for example, for digital affinity assays.
- system controls can be performed through the execution of logic stored in one or more controllers 1956 and/or 2056 in the systems 1900 and/or 2000.
- logic is stored on a remote server and/or in a distributed system operatively coupled or coupleable to the controller.
- the system controls include the use of and execution of logic stored on purification subsystem controllers, such as described further herein with respect to FIGURE 8.
- the method 2200 begins with process block 2201, which includes flowing a sample including an analyte associated with the detection agent through a flow channel.
- the analyte is incubated with the detectable agent under conditions and for a time sufficient to associate the analyte with the detectable agent.
- the analyte is also associated with a capture agent, such as also through incubation of the analyte under conditions and for a time sufficient to associate the analyte with the capture agent.
- flowing the sample through the channel is conducted through operation of one or more pump configured to pump the sample, such as a liquid sample, through the flow channel.
- process block 2201 is optional, as it pertains to a method of system controls for a system according to an embodiment of the present disclosure.
- process block 2201 is followed by or method 2200 begins with process block 2203, which includes outputting excitation light through an interrogation window of a portion of the flow channel.
- outputting the excitation light includes operation of a light engine, such as outputting excitation light from a light source of the light engine.
- a light engine such as outputting excitation light from a light source of the light engine.
- excitation light can be configured to excite one or more of a detectable agent and/or capture agent associated with the analyte.
- process block 2203 is follow by process block 2205, which includes outputting second excitation light through the interrogation window of the flow channel.
- outputting second excitation light occurs through operation of a light engine, such as a light engine including two or more light sources.
- the light engines can include one light source or two or more light sources, such as depending upon the type of detectable agents and/capture agents used in the digital affinity assays.
- the light engine includes only a single light source and, accordingly, in an embodiment, process block 2205 is optional.
- process blocks 2203 or 2205 is follow by process block 2207, which includes generating detectable agent emission signal with a photodetector based on a detectable agent emission light received from the flow channel.
- detectable agents are configured to associate with an analyte, such as through specific association with the analyte, and generate a detectable agent emission light, such as fluorescence, in response to being optically excited, where such fluorescence may be detected by a photodetector.
- process block 2207 is followed by process block 2209, which includes generating a capture agent emission signal based on capture agent emission light.
- the analyte is associated with a capture agent, such as through specific association between the two, as discussed elsewhere herein.
- a sample including the analyte includes the capture agent, but the analyte is not associated with the capture agent.
- the capture agent is configured to emit capture agent emission light, such as when excited by excitation light from a light source of the light engine.
- process block 2209 is optional.
- process block 2209 is followed by process block 2211, which includes correlating or colocalizing two or more emission signals to determine presence and/or identity of an analyte.
- each of the detectable agent and the capture agent are configured to specifically associate with an analyte.
- by detecting the presence of the detectable agent and the capture agent in the interrogation window such as roughly contemporaneous detection of detectable agent emission signal and capture agent emission signal, it can be determined with some confidence that the capture agent and the detectable agent are associated with a single analyte molecule or particle.
- the analyte includes moieties with which the detectable agent and the capture agent are configured to specifically associate.
- the correlation or colocation of the detectable agent emission signal and the capture agent emission signal can be used to identify the identity of the analyte, at least with respect to moieties on the analyte with which the detectable agent and the capture agent are configured to specifically associate. While a detectable agent and capture agent are discussed with respect to process block 2109, it will be understood that analogous approaches may be used wherein, for example, two or more detectable agents and their respective detectable agent emission light/signals can be used to determine the presence or identity of an analyte.
- process block 2211 is followed by process block 2213, which includes relating ratios of intensities of emission signals to identities of the analyte. In an embodiment, this can include relating a ratio of an intensity of the capture agent emission light to an identity of the capture agent and an identity of the analyte associated with the capture agent. In an embodiment, this can include relating a ratio of an intensity of the detectable agent emission light to an identity of the detectable agent and an identity of the analyte associated with the detectable agent.
- the capture agent is an encoded capture agent configured to emit encoded capture agent emission light, such as where the encoded capture agent includes a plurality of distinct chromophores, wherein each chromophore of the plurality of distinct chromophores comprises a predetermined set of tunable optical coding parameters, thereby defining an optically detectable code for the capture agent.
- the capture agent can include a first chromophore at a first concentration and a second chromophore at a second concentration such that the capture agent emits first fluorescence and second fluorescence, wherein a ratio of the intensities of the first fluorescence to second fluorescence defines a ratio of capture agent emission intensities, for example, suitable to identify the capture agent.
- the analyte may be identified as the capture agent is configured to specifically associate with particular moieties of the analyte.
- process block 2213 is optional.
- process block 2211 or process block 2213 is followed by process block 2215, which includes quantifying a number of detectable agent emission signals associated with the capture agent emission signals or second detectable agent emission signals or a ratio of the number of detectable agent emission signals associated with the capture agent emission signals or second detectable agent emission signals to a number of the capture agent emission signals, detectable agent emission signals, second detectable agent emission signals, or combinations thereof.
- process block 2211 or process block 2213 is followed by process block 2215, which includes quantifying a number of detectable agent emission signals associated with two or more detectable agent emission signals.
- the analyte may be associated with both a detectable agent and a capture agent or with two detectable agents, in which cases, two or more emission signals, such as a capture agent emission signal and a detectable agent emission signal, will be roughly contemporaneously detected indicating that the capture agent and detectable agent or two detectable agents are associated with the analyte.
- either or both of the detectable agent or capture agent are not associated with the analyte, in which case only a detectable agent emission signal or only a capture agent emission signal will be detected in a given time period.
- process block 2115 can include quantifying or otherwise determining a number or a ratio of analyte associated with detectable/capture agents, such as relative to empty detectable agent and/or capture agent (i.e., those detectable/capture agents not associated with an analyte).
- process block 2215 is followed by process block 2217, which includes determining a concentration of the analytes based on the number of capture agent emission signals associated with the detectable agent emission signals and a volume of liquid flowed through the flow channel.
- determining the concentration of the analytes is based upon a ratio of the number of detectable agent emission signals associated with the capture agent emission signals to a number of the capture agent emission signals, a number of detectable agent emission signals, and combinations thereof.
- determining a concentration of the analytes is based on a volume of liquid flowed through the flow channel.
- a concentration of the analyte in the sample can be determined.
- the present disclosure provides methods of interrogating a particle and/or molecule, such as an analyte.
- the methods include use of the systems described herein.
- the method is a method for single-molecule detection.
- the method includes the use of, such as light collection with, a light collection assembly including a high-NA air objective.
- the method is a method for single-molecule analyte analysis.
- a "single-molecule analyte” refers to an analyte, such as a protein or nucleic acid molecule, that includes a single molecule.
- Such a single-molecule analyte is in contrast to, for example, an agglomeration or aggregate of multiple molecules, such as a granule, vesicle, cell, and the like, which include many molecules associated together.
- Examples of a singlemolecule analyte include a single protein molecule comprised of one or more chains of aminoacids or a single nucleic acid molecule, either in a single-stranded unhybridized state or in a double-stranded hybridized state.
- the method of the present disclosure includes the detection, identification, counting, quantification, analyses, concentration determination, and the like single-molecule analytes in flow, based on the specific association with one or more detectable agents and/or capture agents, such as to identify them, count them, and determine their concentration in a sample
- detectable agents and/or capture agents such as to identify them, count them, and determine their concentration in a sample
- specific association refers to an association caused by a specific molecular recognition and binding, including antibody-antigen binding, nucleic-acid hybridization, aptamer-antigen binding, antibody-fragment-antigen binding, peptide-antigen binding, and the like.
- the method includes flowing a plurality of molecules associated with a detectable agent through a channel.
- such flow includes flowing the plurality of molecules associated with the detectable agent through the channel comprises flowing molecules of the plurality of molecules through the channel on a molecule-by- molecule basis.
- molecules of the plurality of molecules pass through the channel, such as a portion of the channel including a constriction, one at a time.
- the method is suitable to individually illuminate the molecules flowing through the channel.
- the molecules are associated with a detectable agent.
- individual molecules are associated with one or more detectable agents.
- a molecule of the plurality of molecules is associated with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more detectable agents.
- detectable agents are configured to generate a signal, such as a fluorescent signal, in response to excitation light.
- a "detectable agent” refers to a molecule, collection of molecules, moiety of a molecule, a particle, and the like, that is configured to generate a detectable signal, such as fluorescent emission.
- the detectable agent is configured to emit an optically detectable signal, such as fluorescence, which is detectable, such as through the use of a photodetector.
- the detectable agent is a fluorescently labelled antibody.
- the detectable agent is a fluorescently labelled nucleic acid probe.
- the detectable agent includes a fluorescent moiety, such as a fluorescent moiety selected from the group consisting of a fluorescent small molecule, a chromophoric semiconducting polymer, a fluorescent polymer dot, a quantum dot, a fluorescent bead, a fluorescent polymer, and combinations thereof.
- the detectable agent is functionalized with a moiety, such as an antibody or a nucleic acid probe, configured to specifically associate with an analyte, such as a specific association cause by a specific molecular recognition or binding, such as antibody-antigen binding or nucleic-acid hybridization.
- a moiety such as an antibody or a nucleic acid probe
- the molecules are selected from the group consisting of cellsignaling molecules, cytokines, chemokines, antibodies, proteins, nucleic acids, nucleic-acid binding proteins, RNA-binding proteins, peptides, carbohydrates, drug molecules, and therapeutic molecules.
- the method further comprises illuminating in the channel a molecule of the plurality of molecules.
- illuminating the molecules includes illuminating on molecule of the plurality of molecules, as the molecules flow through the channel on a molecule-by-molecule basis.
- illuminating the plurality of molecules includes illuminating the molecules with multiple light sources whose light is in one or more wavelength ranges. In an embodiment, such one or more light sources are positioned to illuminate spatially distinct portions of the channel, such as different portions of an interrogation window, as discussed elsewhere herein.
- the method comprises collecting the emission light from more than 99%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, ,60%, 55%, 50% of the single molecules flowing through the channel.
- particles such as molecules
- Such efficient and accurate detection is suitable to accurately determine concentration of particles and molecules in a large population of particles/molecules. This is particularly important where, for example, assigning a value to a molecule or particle is based upon detection of signals from a number of detectable agents. If each different detectable agent associated with a molecule or particle is not detected, then accurately identifying that molecule or particle is not possible.
- single-molecule sensitivity refers to the ability to detect more than 99%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, ,60%, 55%, 50% of the single molecules flowing through the channel, preferably more than 90% of the single molecules flowing through the channel.
- single-molecule sensitivity refers to a detection efficiency of more than 99%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, ,60%, 55%, 50%, preferably, more than 90%.
- detection efficiency of single molecules and/or particles under flow is the number of molecules/particles detected versus the number of molecules/ particles that flow through the channel (e.g., through the excitation regions).
- singlemolecule detection efficiency refers to a detection efficiency of more than 99%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, ,60%, 55%, 50%, preferably, more than 90%.
- single-molecule detection efficiency refers to the ability to detect more than 99%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, ,60%, 55%, 50% of the single molecules flowing through the channel, preferably more than 90% of the single molecules flowing through the channel.
- single-molecule sensitivity or “singlemolecule detection efficiency” is a direct indicator of the sensitivity of flow system or apparatus, and thus an important metric to evaluate the sensitivity and performance of the apparatus or instrument.
- illuminating in the channel the molecule of the plurality of molecules comprises outputting excitation light through an interrogation window onto a portion of the channel using line illumination. In an embodiment, illuminating in the channel the molecule of the plurality of molecules comprises outputting excitation light through an interrogation window onto a portion of the channel using confocal detection geometry or line confocal detection geometry.
- illuminating the channel is achieved with a tightly focused laser line that covers the entire cross section of the channel to ensure every molecule that passes through the channel is illuminated and excited with very high probability, such as over 90% probability, and preferably close to 100% probability.
- confocal detection geometry is achieved by using an aperture (e.g., fiber opening or slit aperture), which improves detection sensitivity by increasing the signal-to-noise ratio and by minimizing cross talk between different excitation regions or laser lines.
- an apparatus that employs a high- NA air objective, line illumination using tightly focused laser lines, and confocal detection geometry was used to ensure every or close to every molecule or particle that flow through the channel is detected with high detection efficiency and high single-molecule sensitivity and high throughput.
- the method includes collecting emission light emitted from the channel with a light collection system comprising a high-NA air objective having a numerical aperture in a range of 0.91 to less than 0.99, preferably around 0.95.
- a high-NA air objective is especially suitable to collective relatively large amounts of light. Additionally, such an air objective is suitable to accurately scan a device while maintaining a consistent distance between the air objective and imaged device. Frequently, an oil-immersion or water-immersion objective will drag oil or water over the imaged device and, thus, is not able to maintain a consistent distance between the objective and imaged device while scanning.
- the air objective has a numerical aperture between 0.91 and less than 0.99. In an embodiment, the air objective has a numerical aperture in a range of about 0.92 and about 0.98, in a range of about 0.93 and about 0.97, in a range of about 0.94 and about 0.96. In an embodiment the air objective has a numerical aperture of about 0.95.
- the method includes generating an emission signal based on the collected emission light emitted from the channel based on the molecule.
- the signal is generated using one or more detector systems, detector modules, and/or photodetectors, as described elsewhere herein.
- the method includes assigning a value to the analyte based on the signal.
- the value is based upon one or more fluorescent signal emitted from the particle/molecule.
- Such a value can be used, for example, for sorting particles/molecules of the plurality of particles/molecules, such as in sorting based upon the presence and/or absence of one or more detectable moieties disposed on the particle/molecule.
- the methods, systems, devices, and apparatuses of this disclosure include a microfluidic chip comprising a microfluidic channel which can facilitate the manipulation, detection, analyses, determination, and/or identification of the biological nanoparticles and/or single molecules.
- Microfluidic chips comprising a microfluidic channel can be used to process small volumes of fluidic samples, and offer advantages over traditional macro-scale devices (e.g., microfluidic chips require only minute volumes of fluidic samples, require less reagent, and are processed in a smaller amount of time, adding to efficiency in comparison to macro-scale devices).
- the microfluidic chips are planar devices and, thus, can facilitate the detection and analyses of bionanoparticles and single molecules and/or by enabling the use of high-NA (numerical aperture) objectives (e.g., high-NA air objectives), lenses, or light collection systems with high numerical apertures, which enhances light collection and thus facilitates the detection, analyses, determination, and/or identification of the biological nanoparticles and/or molecules in transit.
- the microfluidic chips are planar devices, enhancing their compatibility with a microscope setup (e.g., with a translation stage on which the microfluidic chip is placed).
- Microfluidic chips additionally can allow for the design and generation of interconnected fluidic networks without having dead volumes, which in turn can facilitate the detection and manipulation of bionanoparticles and/or molecules (e.g., sorting using flow displacement at a junction of three or more fluidic channels).
- Dead volume is a portion of volume within the microfluidic chip that is outside of the flow path (e.g., a volume into which liquid, potentially carrying sample nanoparticles and/or molecules, can diffuse into, thus potentially decreasing accuracy).
- Microfluidic chips through methods of microfabrication, can allow for the creation of channels with cross sections that are non-spherical or non-square (e.g.
- Microfluidic chips can facilitate the creation of channels with different widths or heights along the length of the channel (e.g., a constriction or a step change in width and/or height of the channel) to facilitate the manipulation, detection, analyses, determination, and/or identification of the biological nanoparticles and/or molecules in transit.
- Microfluidic chips can be formed by bonding to a coverslip (e.g., made of glass or plastic) of a desirable thickness as well as having a desirable material property (e.g., refractive index) to enhance compatibility with high-efficiency light collection system (e.g., a high numerical aperture objective, such as high-NA air objective, requiring the appropriate substrate thickness for maximal light collection) to facilitate the manipulation, detection, analyses, determination, and/or identification of the biological nanoparticles and/or single molecules in transit.
- a coverslip e.g., made of glass or plastic
- a desirable material property e.g., refractive index
- high-efficiency light collection system e.g., a high numerical aperture objective, such as high-NA air objective, requiring the appropriate substrate thickness for maximal light collection
- Microfluidic devices make possible the generation of many channels on the same device (e.g., 96 or 384 channels for 96 or 384 samples) for high-throughput analysis of a larger number of samples (e.g., 96 or 384 in a format compatible with multi-channel pipettors).
- Microfluidic chips provide an attractive and versatile platform for the manipulation, isolation, sorting, and/or transport of bionanoparticles and/or single molecules.
- the method comprises flowing a particle and/or molecule through a channel; outputting first excitation light through an interrogation window onto a first portion of the channel; outputting second excitation light through the interrogation window onto a second portion of the channel distinct from the first portion; generating a first emission signal with a first photodetector based on first emission light received through a proximal end of a first emission optical fiber; and generating a second emission signal with a second photodetector based on second emission light received through a proximal end of a second emission optical fiber, wherein the proximal end of the first emission optical fiber and the proximal end of the second emission optical fiber are arranged in an emission fiber bundle head.
- outputting first excitation light and second excitation light includes outputting light with a light engine as discussed further herein.
- the first and/or second excitation light includes coherent light, such as from a laser.
- the first light source and the second light source are each independently selected from the group consisting of a solid-state laser, a diode-pumped laser, a light-emitting diode (LED), a lamp, an arc discharge, and a natural light.
- the first and second photodetectors are each optically coupled to an emission fiber bundle, as described elsewhere herein.
- the first photodetector is part of a first detector module, such as a detector module described further herein with respect to FIGURE 2, optically coupled to a first emission optical fiber of the emission fiber bundle.
- the second photodetector is part of a second detector module, as described further herein with respect to FIGURE 1 A, optically coupled to a second emission optical fiber of the emission optical fiber bundle.
- the method includes receiving first emission light and second emission light with an emission fiber bundle comprising a first emission optical fiber and a second emission optical fiber, wherein a proximal end of first emission optical fiber and second emission optical fiber are arranged in an emission fiber bundle head, and wherein the proximal end of the first emission optical fiber is positioned to receive first emission light emitted from the first portion and the proximal end of the second emission optical fiber is positioned to receive second emission light emitted from the second portion.
- flowing the particle and/or molecule through the channel includes flowing a suspension of particles and/or solution of molecules including the particle and/or the molecule through the channel.
- the suspension of particles or solution of molecules is or is derived from a biological sample.
- the suspension of particles or solution of molecules comprises or is based upon a bodily fluid or is based upon a fluid from or associated with a cell.
- the particle is selected from the group consisting of an extracellular vesicle, a biological nanoparticle, an organelle, a microvesicle, a cell-derived vesicle, a lipoprotein, a macromolecular complex, an exomere, an RNA binding protein, a nucleic acid binding protein, a biological aggregate comprising a protein or nucleic acid, a protein aggregate, a nucleic acid aggregate, a lipid aggregate, a single biological molecule, a cytokine, a chemokine, an antibody, a cell-signaling molecule, a therapeutic molecule, a nucleic acid, a virus, a bacterium, and an exosome.
- the particle is an extracellular vesicle.
- the bodily fluid comprises serum, plasma, spinal fluid, saliva, nasopharyngeal fluid, tear, whole blood, urine, sputum, or lymph fluid.
- the particle is isolated.
- the molecule is isolated.
- the particle is associated with at least one biomarker.
- flowing the suspension of particles and/or the solution of molecules through the channel includes flowing the suspension and/or solution through the channel on a particle-by-particle and/or molecule-by-molecule basis.
- at least some of the plurality of particles are detected on a particle-by-particle basis.
- at least some of the plurality of molecules are detected on a molecule-by-molecule basis.
- at least some of the plurality of particles and/or molecules are illuminated on a particle-by-particle and/or molecule-by-molecule basis.
- a particle-by-particle or molecule-by-molecule basis describes the observation of a plurality of particles or molecules passing through a region (e.g., a light beam having a given width) individually (i.e., one at a time).
- a region e.g., a light beam having a given width
- a fluid sample comprising a plurality of particles or molecules can flow through a constriction of a microfluidic channel and pass through a light beam, such that at least some of the plurality of particles or molecules pass through the light beam individually (i.e., in the absence of any of the other particles of the plurality).
- a fluid sample comprising a plurality of particles or molecules can flow through a microchannel and pass through a light beam, such that no more than one particle or molecule passes through the light beam at a time, without any overlap with other particles or molecules of the plurality.
- a majority of the particles or molecules pass through the light beam, such that no more than one particle or molecule passes through the light beam at a time, without overlap with other particles or molecule of the plurality.
- the illumination of an individual particle or molecule can refer to a particle or molecule that is in a fluid sample comprising a plurality of particles or molecules and is illuminated absent any of the other particles or molecules of the plurality.
- the illumination of an individual particle or molecule is distinct from the illumination of two or more particles or molecules that are randomly co-localized to the illumination region.
- the illumination of an individual particle or molecule is distinct from the illumination of an aggregation of particles or molecules.
- an individual particle or molecule can pass through a light beam, and is thus illuminated.
- the individual particle or molecule can pass through the light beam in the absence of any of the other particles or molecules of the plurality, the individual particle or molecule thus being illuminated by itself.
- the individual particle or molecule is a singular nanoparticle or molecule that can be interrogated by a light source in the absence of any of the other particles or molecules present in the fluidic sample (e.g., for a given light beam width, a single particle or molecule is present in the beam, thus allowing it to be illuminated absent any of the other particles or molecules of the plurality). While flowing particles through the channel and detecting the particles on a particle- by-particle basis is described, it will be understood that the same concepts apply by analogy to flow and detection of molecules with the methods and systems of the present disclosure on a molecule-by-molecule basis.
- the methods of the present disclosure include flowing molecules through a channel, such as through an interrogation window of the channel, on a molecule-by-molecule basis.
- molecules of interest such as those associated with one or more detectable agents, pass through the interrogation one at a time.
- other molecules are within the interrogation window of the channel with the molecule of interest associated with the detectable agent.
- Such molecules can include, for example, solvent molecules assisting in the flow of the molecule of interest
- such molecules that can pass through the interrogation window on a molecule-by-molecule basis are selected from the group consisting of proteins, peptides, antibodies, cytokines, chemokines, signaling molecules, therapeutic molecules, drug molecules, RNA binding proteins, macromolecular complexes, nucleic acids, DNAs, RNAs, synthetic molecules, aptamers, and the like.
- the molecules are selected from the group consisting of a single dye molecule, a single protein dye molecule, a single polymer dye molecule, single Pdot, single fluorescent probe, single fluorescent unit, a single antibody conjugated with one or more dyes, a single protein conjugated with one or more dyes, a single nucleic acid molecule conjugated with one or more dyes.
- the first emission light and the second emission light are independently selected from the group consisting of scattered emission light, luminescent emission light, fluorescent emission light, and a combination thereof.
- the particle is a biological particle.
- the biological particle is a biological nanoparticle.
- the particle is selected from the group consisting of an extracellular vesicle, an organelle, a microvesicle, a cell-derived vesicle, a lipoprotein, a macromolecular complex, an exomere, an RNA binding protein, a nucleic acid binding protein, a biological aggregate comprising a protein or nucleic acid, a protein aggregate, a nucleic acid aggregate, a lipid aggregate, a single biological molecule, a cytokine, a chemokine, an antibody, a cell-signaling molecule, a therapeutic molecule, a nucleic acid, a nucleic-acid binding protein, an RNA binding protein, a DNA binding protein, a therapeutic molecule, a virus, a bacterium, and an exosome.
- a size of the particle is a hydrodynamic diameter.
- the hydrodynamic diameter is less than 1,000 nanometers, less than 900 nanometers, less than 800 nanometers, less than 700 nanometers, less than 600 nanometers, less than 500 nanometers, less than 400 nanometers, less than 300 nanometers, less than 200 nanometers, less than 150 nanometers, less than 100 nanometers, less than 90 nanometers, less than 80 nanometers, less than 70 nanometers, less than 60 nanometers, less than 50 nanometers, less than 40 nanometers, or less than 30 nanometers.
- the hydrodynamic diameter is less than 100 nanometers. In certain embodiments, the hydrodynamic diameter is determined by measuring dynamic light scattering (DLS), and refers to the size of a hard sphere that diffuses light in the same fashion as that of the biological nanoparticle being measured.
- DLS dynamic light scattering
- the hydrodynamic diameter is between 1,000 nanometers and 1 nanometers, between 900 nanometers and 1 nanometers, between 800 nanometers and 1 nanometers, between 700 nanometers and 1 nanometers, between 600 nanometers and 1 nanometers, between 500 nanometers and 1 nanometers, between 400 nanometers and 1 nanometers, between 300 nanometers and 1 nanometers, between 200 nanometers and 1 nanometers, between 100 nanometers and 1 nanometers, between 90 nanometers and 1 nanometers, between 80 nanometers and 1 nanometers, between 70 nanometers and 1 nanometers, between 60 nanometers and 1 nanometers, between 50 nanometers and 10 nanometers, or between 40 nanometers and 1 nanometers.
- the hydrodynamic diameter is between 1,000 nanometers and 800 nanometers, between 800 nanometers and 600 nanometers, between 600 nanometers and 400 nanometers, between 400 nanometers and 200 nanometers, or between 200 nanometers and 10 nanometers. In preferred embodiments, the hydrodynamic diameter is between 200 nanometers and 2 nanometers. In another preferred embodiment, the hydrodynamic diameter is between 200 nanometers and 10 nanometers. In a more preferred embodiment, the hydrodynamic diameter is between 100 nanometers and 20 nanometers.
- a size of the particle is a diameter.
- the diameter is less than 1,000 nanometers, less than 900 nanometers, less than 800 nanometers, less than 700 nanometers, less than 600 nanometers, less than 500 nanometers, less than 400 nanometers, less than 300 nanometers, less than 200 nanometers, less than 150 nanometers, less than 100 nanometers, less than 90 nanometers, less than 80 nanometers, less than 70 nanometers, less than 60 nanometers, less than 50 nanometers, less than 40 nanometers, or less than 30 nanometers.
- the diameter is less than 100 nanometers.
- the diameter is determined by measuring using electron microscopy (TEM) or super-resolution imaging.
- the diameter is between 1,000 nanometers and 1 nanometers, between 900 nanometers and 1 nanometers, between 800 nanometers and 1 nanometers, between 700 nanometers and 1 nanometers, between 600 nanometers and 1 nanometers, between 500 nanometers and 1 nanometers, between 400 nanometers and 1 nanometers, between 300 nanometers and 1 nanometers, between 200 nanometers and 1 nanometers, between 100 nanometers and 1 nanometers between 90 nanometers and 1 nanometers, between 80 nanometers and 1 nanometers, between 70 nanometers and 1 nanometers, between 60 nanometers and 1 nanometers, between 50 nanometers and 10 nanometers, or between 40 nanometers and 1 nanometers.
- the diameter is between 1,000 nanometers and 800 nanometers, between 800 nanometers and 600 nanometers, between 600 nanometers and 400 nanometers, between 400 nanometers and 200 nanometers, or between 200 nanometers and 10 nanometers. In preferred embodiments, the diameter is between 200 nanometers and 2 nanometers. In another preferred embodiments, the diameter is between 200 nanometers and 10 nanometers. In a more preferred embodiment, the diameter is between 100 nanometers and 20 nanometers.
- the method further comprises directing flow of the particle or molecule. In an embodiment, directing flow of the particle or molecule is based upon a presence or absence of emission light received from the interrogation window and associated with the particle or molecule. In an embodiment, directing flow of the particle or molecule is based upon an intensity of emission light received by the detector system from the interrogation window. In this regard, the method is suitable to separate particles or molecules that, for example, emit fluorescence and/or scatter excitation light from those particles or molecules that do not.
- directing the flow of the particle or molecule includes directing the particle or molecule into one or two or more sorting channels, such a two or more channels including a channel for those particles or molecules that provide a fluorescent signal or an emission signal over a predetermined threshold and a channel for those that do not.
- the method comprises sorting the particle or molecule into an enriched population.
- the sorting comprises flow-displacement sorting.
- the sorting does not include acoustic focusing or the use of physical barriers.
- the sorting is determined by the size value, the presence of a biomarker, the absence of a biomarker, the detected light intensity, an emitted wavelength, a plurality of emitted wavelengths, an identification of the particle or molecule, or a combination thereof. In some embodiments, the sorting is determined by the presence of a combination of biomarkers. In some embodiments, the sorting is determined by the presence of one or more biomarkers and the absence of one or more other biomarkers, such as based upon an immune phenotype or immuno-phenotype (phenotype based on the presence, absence, or amount of markers as measured by the binding of a combination of antibodies).
- the phenotype is determined, at least in part, by the presence or absence of two or more biomarkers on the particle (e.g., immuno-phenotype), and may be further informed or determined by physical characteristics, such as particle size or whether the particle contains nucleic acid or the amount of lipid molecules that comprise the particle. See, for example, Example 9 discussed further herein.
- the sorting is determined by the number or type of biomarkers present by setting a sorting threshold.
- the method includes quantifying or counting a number of particles and/or molecules associated with emission light from the interrogation; and determining a concentration of the particles and/or molecules associated with the emission light from the interrogation window.
- the method includes ranking particles or molecules in the channel based on a presence or absence of emission light from the interrogation window.
- the ranking corresponds with measured emission spectra of the particle or molecule based upon one or more of the first emission light and the second emission light.
- the ranking corresponds with a measured size value of the particle.
- the measured size value is a relative size value.
- the measured size value is measured by a difference in a detected light intensity.
- the particle or molecule is associated with a detectable agent.
- a detectable agent can, for example, be a molecule of interest present on or in a particle to be analyzed (e.g., a protein on or in an extracellular vesicle, or a nucleic acid, or a biomarker).
- a detectable agent can be a molecule (e.g., an antibody conjugated with fluorescent probe or a fluorescent nucleic-acid probe) that associates with a molecule of interest (e.g., the protein on or in an extracellular vesicle or biological nanoparticle or macromolecular complex, or the nucleic acid molecule, or the biomarker) associated with the particle, thereby allowing the nanoparticle to be detected.
- a detectable agent is fluorescent and, thus, can be detected by fluorescence-based detection methods known in the art.
- the particle comprises at least one biomarker, such as a biomarker associated with one or more detectable agents.
- the method comprises determining at least one copy number of the at least one biomarker.
- the detectable agent can be covalently attached to the particle or molecule.
- the detectable agent can, for example, be embedded in the membrane of a particle and/or in the hydrophobic interior of a particle or intercalated into a double stranded DNA or RNA.
- the detectable agent can be embedded in the membrane of a particle via non-covalent interactions, such as van der Waals forces or electrostatic forces.
- the terms "specifically associate” or “specifically associated with” refer to the ability of a reagent to associate with a target moiety, such as based on affinity and/or avidity of the reagent for the target moiety. "Specific association" can occur based on a specific molecular recognition, such as an antibody-antigen association, an aptamer-antigen association, a peptide-antigen association, and a nucleic acid hybridization association.
- a detectable agent is associated with the surface of the particle.
- a detectable agent can be covalently and/or non- covalently attached to the surface of the particle.
- a detectable agent can be embedded within the surface of the particle.
- a detectable agent is surrounded by the surface of the particle, e.g., a membrane dye embedded into the lipid layer of a vesicle.
- the relation of detectable agents associated with the surface of a particle provides information on the size of the particle. For example, a particle having a large surface area will associate with a large number of detectable agents, while a particle having a small surface area will associate with a smaller number of detectable agents.
- the relation of the number of detectable agents associated with the particle surface provides a correlation between light intensity and nanoparticle surface area. In this manner, the amount of emitted light intensity corresponds with the size of the particle, and specifically corresponds with the surface area of the particle.
- the determined size of the particles such as through an intensity of fluorescence from a membrane dye, in conjunction with a copy of number of detectable agents associated with analyte on a surface of the particle can be used to determine whether the particle is an intact particle.
- a detectable agent is associated with the interior of the particle.
- the detectable agent is embedded within the particle (e.g., lipophilic dyes embedded within a lipoprotein).
- the detectable agent is not associated with the surface of the particle, and is embedded within the particle, or otherwise is surrounded by the particle.
- the detectable agent is encompassed by the particle, but does not associate with the internal surface, e.g., a dye floating freely within an extracellular vesicle that does not associate internally with its lipid membrane.
- volume dyes Internal detectable agents, such as those embedded in the particle (e.g., lipophilic dyes embedded in a lipoprotein) or encompassed by the particle without associating with the internal surface (e.g., free floating dyes within a vesicle) are also referred to herein as "volume dyes".
- volume dyes Internal detectable agents, such as those embedded in the particle (e.g., lipophilic dyes embedded in a lipoprotein) or encompassed by the particle without associating with the internal surface (e.g., free floating dyes within a vesicle) are also referred to herein as "volume dyes".
- the relation of a volume dye embedded or surrounded by a particle provides information on the size of the particle. For example, a particle having a large volume will comprise a large number of volume dyes, while a particle having a small volume will comprise fewer volume dyes.
- the relation of the number of volume dyes within the particle provides a correlation between light intensity and nanoparticle
- a particle comprises both a volume dye and a detectable agent associated with the surface.
- a nanoparticle comprising both a volume dye and surface- associated detectable agent can provide information relating to both the surface area and the volume of the particle.
- the volume dye and the surface area detectable agent are the same. In other embodiments, the volume dye and the surface area detectable agent are different.
- the volume dye can provide information regarding the identity or type of particle being detected or isolated.
- the use of a volume dye that is a fluorogenic substrate can provide information regarding the identity or type of particle being detected or isolated.
- the use of a volume dye that is a fluorogenic substrate of an enzyme specific to a particle, such as an exosome can further provide information regarding the identity or type of particle being detected or isolated.
- the particle is labelled with a membrane dye and a membranepermeant nucleic acid dye, such as a membrane-permeant RNA dye.
- a membranepermeant nucleic acid dye such as a membrane-permeant RNA dye.
- detectable agents is suitable to determine whether the particle includes nucleic acids, such as RNA or DNA, and whether the particle includes a membrane or contains lipid molecules.
- Such particles can be further labelled with a detectable agent, such as a fluorescently labelled antibody, configured to selectively bind to a surface marker, such as to determine a immuno-phenotype of the particle in addition to whether it includes a membrane and/or nucleic acid, that is, the overall phenotype, which includes physical characteristics (e.g., if lipid membrane and/or nucleic acids are present) and immuno-phenotype (e.g., if certain biomarkers are present or absent or of different amounts as reported by antibodies).
- a detectable agent such as a fluorescently labelled antibody
- a surface marker such as to determine a immuno-phenotype of the particle in addition to whether it includes a membrane and/or nucleic acid, that is, the overall phenotype, which includes physical characteristics (e.g., if lipid membrane and/or nucleic acids are present) and immuno-phenotype (e.g., if certain biomarkers are present or absent or of different amounts as reported by antibodies).
- the detectable agent is selected from a fluorescently labeled antibody, a fluorescently labeled protein, a fluorescently labeled nucleic acid, a fluorescently labeled lipid, a membrane dye, a fluorogenic dye, a dye, a polymer dot, and a combination thereof.
- the detectable agent is selected from the group consisting of a luminescent dye, a fluorescent dye, a fluorescently labeled antibody, a fluorescently labeled protein, a fluorescently labeled nucleic acid, a fluorescently labeled lipid, a fluorescently labeled carbohydrate, a fluorescently labeled small molecule, a membrane dye, a fluorogenic dye, a dye, a polymer dot, a fluorogenic substrate of an enzyme, a membrane-permeant nucleic acid dye (such as a membrane-permeant RNA dye), or a combination thereof.
- detectable agents specifically bind to one or more binding targets associated with a particle.
- the binding target is a polypeptide, such as a protein
- the detectable agent is a fluorescently labeled antibody that specifically binds to the target polypeptide.
- the specified antibodies bind to a particular biological nanoparticle at least two times greater than the background and more typically more than 10 to 100 times greater than the background.
- Specific binding to an antibody under such conditions requires an antibody that is selected for its specificity for a particular biological nanoparticle or for a particular biomarker or for a particular molecule (e.g., cytokine, chemokine, antibodies, nucleic acids).
- polyclonal antibodies can be selected to obtain only those polyclonal antibodies that are specifically immunoreactive with the selected antigen and not with other proteins. This selection may be achieved by subtracting out antibodies that cross-react with other molecules.
- the detectable agent is a first detectable agent, and wherein the particle is associated with a second detectable agent.
- the detectable agent is a first detectable agent, and wherein the molecule (e.g., cytokine or cell signaling molecule) is associated with a second detectable agent.
- the first detectable agent has a first emission spectrum in a first emission wavelength range and the second detectable agent has a second emission spectrum in a second emission wavelength range different than the first emission wavelength range.
- the first detectable agent has a first excitation spectrum in a first excitation wavelength range and the second detectable agent has a second excitation spectrum in a second excitation wavelength range.
- the first and second detectable agents have similar, the same, and/or overlapping emission spectra. In an embodiment, the first and second detectable agents have different emission spectra. In an embodiment, the first and second detectable agents have similar, the same, and/or overlapping excitation spectra. In an embodiment, the first and second detectable agents have different excitation spectra.
- the detectable agent is attached to the surface of the particle, the detectable agent is in the surface of the particle, the detectable agent is within the interior of the particle, the detectable agent is within the matrix of the particle, or a combination thereof.
- the detectable agent is fluorescent, the detectable agent is luminescent, or any combination thereof.
- the particle is associated with a plurality of detectable agents. In some embodiments, at least one of the plurality of detectable agents is attached to the surface of the particle. In some embodiments, at least one of the plurality of detectable agents is attached to the surface of the particle and at least one of the plurality of detectable agents is in the surface of the particle.
- At least one of the plurality of detectable agents is attached to the surface of the particle and at least one of the plurality of detectable agents is within the interior of the particle. In some embodiments, at least one of the plurality of detectable agents is attached to the surface of the particle and at least one of the plurality of detectable agents is within the matrix of the particle. In some embodiments, at least one of the plurality of detectable agents is attached to the surface of the particle, at least one of the plurality of detectable agents is in the surface of the particle, at least one of the plurality of detectable agents is within the interior of the particle, or a combination thereof. In some embodiments, detectable agents of the plurality of detectable agents have overlapping emission profiles.
- detectable agents of the plurality of detectable agents have the same emission profiles. In some embodiments, the emission profiles have the same peak wavelengths. In some embodiments, detectable agents of the plurality of detectable agents have overlapping excitation profiles. In some embodiments, detectable agents of the plurality of detectable agents have the same excitation profiles. In some embodiments, the excitation profiles have the same peak wavelengths. In some embodiments, detectable agents of the plurality of detectable agents comprise the same detectable agent. In some embodiments, detectable agents of the plurality of detectable agents comprise more than one type of detectable agent.
- detectable agents of the plurality of detectable agents have different emission profiles.
- the emission profiles have different peak wavelengths.
- the detectable agents are suitable for use in emission multiplexing, whereby the different emission spectra are used in detecting different detectable agents.
- the detectable agents having different emission lifetimes.
- the detectable agents have different emission intensities at common wavelengths.
- the first detectable has a first excitation spectrum in a first excitation wavelength range and the second detectable agent has a second excitation spectrum in a second excitation wavelength range different than the first excitation wavelength range.
- the detectable agents are suitable for use in excitation multiplexing, whereby different detectable agents can be used by exciting them with different excitation wavelength ranges.
- the detectable agent is configured to be excited by light in different wavelength ranges.
- the detectable agent is configured to be excited by a first amount by first excitation light in a first wavelength range and by a second amount by second excitation light in a second wavelength range different than the first wavelength range.
- the detectable agent is configured to emit emission light of a first intensity in response to the first excitation light and emission light of a second intensity in response to the second excitation light.
- a ratio of the first and second emission light can be used to track or otherwise identify a particle associated with the detectable agent.
- the peak wavelengths are separated by more than 10 nanometers, by more than 20 nanometers, by more than 30 nanometers, by more than 40 nanometers, by more than 50 nanometers, by more than 75 nanometers, by more than 100 nanometers, by more than 120 nanometers, by more than 140 nanometers, by more than 160 nanometers, by more than 180 nanometers, by more than 200 nanometers, by more than 300 nanometers, by more than 400 nanometers, by more than 500 nanometers, by more than 600 nanometers, or by more than 700 nanometers.
- the present disclosure provides a method for analyzing a particle in a fluid sample.
- the method includes flowing a fluid sample comprising a plurality of particles and/or molecules through a channel; illuminating in the channel a particle of the plurality of particles or a molecule of the plurality of molecules; collecting emission light emitted from the channel with a light collection system comprising a high-NA air objective having a numerical aperture in a range of about 0.91 to less than 0.99; and generating a signal based on the collected emission light emitted from the channel based on the particle or molecule; and assigning a value to the particle or molecule based on the signal.
- detection or imaging employing the fluidic device uses light collection systems with a numerical aperture equal to or greater than 0.91, equal to or greater than 0.92, equal to or greater than 0.93, equal to or greater than 0.94, equal to or greater than 0.95, equal to or greater than 0.96, equal to or greater than 0.97, or equal to or greater than 0.98.
- the light collection system includes an air objective having a numerical aperture of about 0.95.
- high-NA air objectives are suitable for single-molecule flow detection. Such air objectives are generally more stable and easier to scan than oil-immersion objectives. This is particularly so where light collection efficiency is more important than image quality, such as in flow-based analysis and singlemolecule flow detection.
- the methods of the present disclosure include generating a signal based upon emission from an interrogation channel.
- a signal is frequently not a conventional image signal, such as one generating an image of a particle or molecule in the channel or immobilized on a surface or in a matrix.
- the methods of the present disclosure rely instead on a presence, absence, or intensity of light emitted from the channel.
- light collection efficiency and emission light intensity are more important to the methods of the present disclosure.
- image resolution and lack of optical aberrations e.g., spherical aberration or chromatic aberration
- a high-NA air objective is frequently appropriate, and an oil-immersion or water-immersion objective is unnecessary and frequently inappropriate for the methods of the present disclosure.
- the method is a method of determining a size of the particle, and wherein the value is a size value.
- ranking particles in the channel is based on a presence or absence of emission light from the interrogation window.
- ranking particles in the channel is based on an intensity of emission light from the interrogation window.
- the ranking corresponds with measured emission spectra of the particle is based upon one or more of the first emission light and the second emission light.
- the ranking corresponds with a measured size value of the particle.
- the measured size value is a relative size value.
- the measured size value is measured by a difference in a detected light intensity.
- the particle or molecule is associated with a detectable agent.
- the detectable agent is a first detectable agent, and wherein the particle or molecule is associated with a second detectable agent.
- the first detectable agent has a first emission spectrum in a first emission wavelength range and the second detectable agent has a second emission spectrum in a second emission wavelength range different than the first emission wavelength range.
- the detectable agent is a fluorescent detectable agent.
- the first detectable has a first emission spectrum in a first emission wavelength range and the second detectable agent has a second emission spectrum common with, the same as, similar to, and/or overlapping with the first emission wavelength range.
- the methods of the present disclosure do not include an amplification step to generate, for example, amplicons or copies of an analyte, or amplicons or copies of a molecule that is correlated with the presence of an analyte.
- the methods of the present disclosure do not include the use of reagents and/or conditions used for or required for amplification of a target analyte or of a molecule that is correlated with the presence of a target analyte, such as nucleic acid amplification or protein-based amplification of a target analyte or of a molecule correlated with the presence of a target analyte, such as a polymerase chain reaction, enzymatic amplification, isothermal nucleic acid-based amplification, rolling-circle amplification or ELISA.
- a target analyte such as nucleic acid amplification or protein-based amplification of a target analyte or of a molecule correlated with the presence of a target analyte, such as a polymerase chain reaction, enzymatic amplification, isothermal nucleic acid-based amplification, rolling-circle amplification or ELISA.
- the present disclosure provides a method of self-corrected single- molecule/single-particle flow analysis.
- the measurement of fluorescence emitted from single molecules or particles in a flow stream is heavily influenced by the profile of flow and/or laser beams. Accordingly, in an embodiment, the accurate quantification of fluorescent molecules requires deconvolution of signal(s) from the flow profile, which is often difficult if not impossible.
- the challenges include: i) colocalization of biomarkers, important to the phenotyping of EVs or other biological nanoparticles, ii) measurement of a concentration of the particles, iii) examination of biological heterogeneity, often described by the copy number of biomarkers, iv) determining of the copy number of biomarkers associated with EVs or other biological nanoparticles, and v) characterization of physical properties, such as the size of vesicles or particles stained with membrane dye.
- the present disclosure provides methods suitable to analyze single molecules and particles in a flow stream in a self-correct manner.
- a self-corrected, single-molecule/particle it is possible to accurately: 1) co-localize biomarkers expressed on the same particle that flows through multiple excitation regions or portions of a channel within an interrogation window, 2) identify and enumerate single particles and/or molecules, 3) obtain the flow rate sampled by each individual particle and/or molecules, and 4) thus, measure the concentration of analyzed particles and/or molecules.
- a self-corrected, single-molecule/particle it is also possible to accurately determine the copy number of biomarkers associated with EVs or other biological nanoparticles.
- the multiple excitation regions or portions of a channel within an interrogation window are configured with a known spatial pattern.
- a particle or molecule is measured twice at two different portions of the microchannel through which the particle is flowing. Because flow through a microfluidic channel is typically laminar, the transit time of a specific particle flowing through any two adjacent or closely spaced excitation regions or portions of a channel is generally proportional to a distance between these two excitation regions or portions of a channel and the velocity of the particle. Also due to the nature of laminar flow and the small separation distance between excitation regions or portions of a channel, the position of a specific particle in the cross-section of channel generally remains the same during the transit time.
- That particle generally interacts with different laser beams focused on different portions of the channel at very similar positions in the crosssection of the channel.
- single analytes e.g., vesicles stained by fluorescence dyes or bionanoparticles labeled with antibodies
- the extracted transit time or particle velocity to further colocalize other biological markers.
- the method includes flowing a particle through a lumen of a channel, the channel defining an interrogation window configured to allow light to pass into and out of the lumen; outputting first excitation light with a first light source into a first portion of the channel or interrogation window; outputting second excitation light with a second light source into a second portion of the channel or the interrogation window separate from the first portion; generating a first emission signal with a first photodetector based upon first emission light received from the first portion; generating a second emission signal with a second photodetector based upon second emission light received from the second portion; and determining a velocity of a particle in the channel based on a time difference between the first emission signal and the second emission signal and a distance between the first portion and the second portion.
- the method includes use of any of the systems of the present disclosure.
- the first photodetector is part of a first detector module
- the method includes detecting light, such as first and second emission light, using time bins.
- the disclosed apparatus and methods for determination of biological nanoparticle characteristics can be conducted swiftly, with a short signal-integration time, or fast bin time.
- a bin time can be used to assess, for example, a start-stop time of interrogation of fluorescence, in order to aid in the sorting of information.
- Time bins also referred to herein as signal integration times
- the detection, measuring, and/or interrogation of a biological nanoparticle uses time bins.
- the time bins have a range of less than 10 ms, less than 5 ms, less than 1 ms, less than 0.5 ms, less than 0.1 ms, less than 90 ps, less than 80 ps, less than 70 ps, less than 60 ps, less than 50 ps, less than 40 ps, less than 30 ps, less than 20 ps, less than 10 ps, less than 5 ps, or less than 1 ps.
- the time bins have a value between 10 ms and 0.1 ms, between 5 ms and 0.1 ms, between 1 ms and 0.1 ms, between 0.5 ms and 0.1 ms, between 0.1 ms and 1 ps, between 90 psand 1 ps, between 80 ns and 1 ps, between 70 ns and 1 ps, between 60 ns and 1 ps, between 50 ns and 1 ps, between 40 ns and 1 ps, between 30 ns and 1 ps, between 20 ns and 1 ps, between 10 psand 0.1 ps, between 5 psand 0.1 ps, or between 1 psand 0.1 ps.
- the time bins have a range of between 1 psand 2 ms.
- the method includes correlating the first emission signal and the second emission signal based on an emission signal characteristic or particle characteristic shared by the first emission signal and the second emission signal.
- the correlating the first emission signal and the second emission signal is based on an emission signal characteristic or on a particle characteristic.
- Signals detected in a first detection window or a first portion of a channel or a first excitation line can be detected downstream in a second detection window or second portion of a channel or second excitation line.
- a particle can be tracked as it proceeds through a channel. Additionally, the particle can also be interrogated for various different biomarkers.
- a detection window includes and/or is defined at least in part by a portion of the channel, as discussed further herein, or an excitation line of the excitation light.
- the methods include correlating the first emission signal and the second emission signal based on an emission signal characteristic or based on a particle characteristic.
- correlating the first emission signal and the second emission signal includes comparing an intensity of the first emission signal with an intensity of the second emission signal.
- the method further comprises enumerating a number of particles passing through the channel based upon correlating the first emission signal and the second emission signal.
- the method further comprises colocalizing target molecules on a particle based upon correlating the first emission signal with the second emission signal.
- the method further comprises determining a particle concentration based upon correlating the first emission signal with the second emission signal. Accurate enumeration and colocalization.
- the methods of the present disclosure remove or decrease many interfering signals, such as background fluctuation and small aggregates of dyes, in the identification of real events (e.g., extracellular vesicles or biological nanoparticles), the present methods are suitable to obtain or determine more accurate numbers of analytes (e.g., extracellular vesicles or biological nanoparticles or molecules).
- Colocalization of single-molecule events in a flow stream by statistical methods e.g., cross-correlation function
- the self-corrected methods of the present disclosure provide a transit time of each particle that flows through different positions in the cross section of the channel. With known spacing between portions of the channel or detection window illuminated by different spatially separated excitation lights, it is possible to calculate the linear velocity of each examined particle, and determine the volumetric flow rate sample accordingly. It is possible to convert an averaged liner velocity to a volumetric flow rate through a channel. Knowing the volumetric flow rate in microfluidic based analysis is often required to determine the volume of sample that has been analyzed during an experiment. The absolute concentration of single particles/molecules can thus be measured based on the counts of analytes/molecules/nanoparticles and the analyzed volume. Volumetric flow rate is also a useful parameter to evaluate the throughput and consumption of samples.
- volumetric flow rate can be determined using the transit time of each molecule and/or particle that flow through the laser lines or excitation regions, based on the fact that the flow is laminar in this microfluidic environment. Consequently, the linear velocity of each particle and/or molecule can be calculated, knowing the distance between these laser lines or excitation regions. From the measured average particle and/or molecule velocity and by knowing the area of the channel cross section, volumetric flow rate can be measured. Using the methods of the present disclosure, therefore, volumetric flow rate can be determined by using the measured single-particle and/or single-molecule transit times and/or velocities.
- the present methods are also suitable to measure the concentration of analytes accurately. Because the methods of the present disclosure provide an absolute counting of analytes in a given volume, without relying on parameters obtained from bulk sample (e.g., extinction coefficient), and any external calibration curves, a more accurate determination of analyte concentration is possible.
- Detection efficiency may be defined as a fraction of analytes counted, such as by the methods of the present disclosure, in the analytes that flow through the channel or excitation region(s) or detection region(s) or detection window(s). If the distribution of signal associated with analytes flowing through the channel follows a known statistic model (e.g., lognormal distribution commonly seen in flow analysis), it is possible to quantify detection efficiency by knowing the Cumulative distribution function (CDF) at cut-off values.
- CDF Cumulative distribution function
- Recovery rate such as a recovery rate defined as the ratio between the counted analytes to the amount of analytes spiked into or present in a given volume, is influenced by many other factors (e.g., the accuracy of stock concentration, possible aggregation and degradation of analytes, surface absorption, etc.), besides detection efficiency. If the stock concentration of the analyte is accurately known, it is also possible to determine the recovery rate accordingly. Accurate determination of copy number
- the methods of the present disclosure are suitable to determine copy number of biomarkers present on a single particle. Because the present methods are suitable to detect an entire population of single molecules/particles present in a sample or an aliquot of a sample or a very large percentage of such molecules/particles (such as greater than 90%) that pass through the microchannel, the present methods can also use the single-molecule intensity distribution to de-convolve the single-particle intensity distribution to determine precisely the number of bound antibodies, and thus the corresponding protein, on each particle. Such an approach is useful in determining, for example, the number of fluorescently labelled antibodies associated with a particle, such as an EV, to provide quantitative information about the molecular composition of single particles. This information, in conjunction with other information regarding the size of the particle, can be used in determining whether the analyzed particle is intact or fragmented or whether the analyzed particle is empty (e.g., contain nucleic acid) and non-functional or biologically functional.
- the methods of the present disclosure do not include an amplification step to generate, for example, amplicons or copies of an analyte, or amplicons or copies of a molecule that is correlated with the presence of an analyte.
- the methods of the present disclosure do not include the use of reagents and/or conditions used for or required for amplification of a target analyte or of a molecule that is correlated with the presence of a target analyte, such as nucleic acid amplification or protein-based amplification of a target analyte or of a molecule that is correlated with the presence of a target analyte, such as rolling-circle amplification or ELISA.
- reagents and/or conditions used for or required for amplification of a target analyte or of a molecule that is correlated with the presence of a target analyte such as nucleic acid amplification or protein-based amplification of a target analyte or of a molecule that is correlated with the presence of a target analyte, such as rolling-circle amplification or ELISA.
- the present disclosure provides a method of focusing optical components of a system on a channel of the system.
- Counting and measuring particles and molecules in flow such as extracellular vesicles, viruses, lipoproteins, RNA binding proteins, or cytokines, on the level of single molecules/particles is often extremely sensitive to the changes in environment (e.g., thermal induced expansion) and instrument configuration (e.g., subtle drift of optical alignment, and variations of channel dimension).
- the present disclosure provides an auto-focusing method.
- excitation light such as a specific laser light (e.g., 870 nm) back reflected by the microfluidic device is collected, such as via a fiber-coupled confocal scheme discussed further herein with respect to FIGURE 7A.
- a magnitude of this back reflection is externally calibrated and attenuated with neutral density filters to ensure it is in a dynamic range of photodetectors.
- a preferred or optimal value of the back-reflected light is determined when the correct focusing of the detection channel is achieved and set as a reference to "lock" the focus level (See, for example, FIGURE 7B).
- a portion of the microfluidic device such as the channel including the interrogation window, or objective lens is operatively coupled to a motorized moveable stage, such as a stage driven by piezo or DC motor.
- the light collection system is configured to move relative to the interrogation window of the channel to focus the light collection system on the interrogation window.
- the moveable stage can be controlled based upon comparing the current value of reflection, with the value at previous time point (e.g., 200 ms ago), as well as the reference value.
- the present disclosure provides method of focusing excitation light through optical components on a fluidic channel.
- the method includes using the system 700 discussed further herein with respect to FIGURES 7A and 7B.
- the method comprises illuminating an interrogation window or other portion of a fluidic channel with light from a light source; focusing the light onto the interrogation window with optical components disposed between the channel and a photodetector; generating a lock signal with the photodetector based on the focused light back reflected from the interrogation window at a first time; generating a test signal with the photodetector based on the focused light back reflected from the interrogation window at a second time after the first time; determining whether the test signal is within a predetermined percentage of the lock signal; and moving the fluidic channel relative to the high-NA air objective if the test signal is outside of the predetermined percentage of the lock signal.
- the predetermined percentage is about 5%. In an embodiment, the predetermined percentage is in a range of about 0.5% to about 15%, a range of about 1% to about 10%, a range of about 2% to about 8%, a range of about 2.5% to about 7.5%, a range of about 3% to about 6%, or a range of about 3% to about 5%.
- the method comprises , the present disclosure provides a method of maintaining focus on a fluidic channel, the method comprising: illuminating an imaging area of a microfluidic system with light from a near infrared light source; generating an image of the imaging area with a camera; determining an amount of defocus of the image; determining whether the amount of defocus is within a predetermined amount of defocus; and moving the fluidic channel relative to the high-NA air objective if the test signal is outside of the predetermined range.
- the structure being imaged is a structure adjacent to, and in certain embodiments, separate from, the channel.
- the structure has a high level of contrast relative to other portions of the imaging area.
- the structure defines an air-filled enclosure within the microfluidic system.
- Such an air-filled structure will have higher contrast than, for example, a fluid-filled channel, and, in this regard, is suitable for generating an image a determining an amount of defocus of the image.
- FIGURE 7D is a series of images of a channel taken a number of distances from the high-NA air objective and having different amounts of defocus, in accordance with an embodiment of the disclosure.
- FIGURE 7E illustrates an amount of focusing quality at various distances between the channel and the high-NA air objective, in accordance with an embodiment of the disclosure, noting the positions of the images of FIGURE 7D.
- a focal plane was detected using NIR imaging and a NA 0.95 air objective.
- the focal channel includes a constriction.
- the focusing quality for the constriction was monitored in real time, as shown in FIGURE 7E. When the objective was moved up, the focusing quality increased until it reached the first maximum, which indicated the focal plane was at the bottom of constriction channel.
- FIGURE 7D show the real-time imaging, when the high-NA air objective was at the four positions correspondingly.
- FIGURE 7F schematically illustrates a feedback control loop used to set a focal plane, in accordance with an embodiment of the disclosure.
- FIGURE 7G is another feedback control loop used to perform real-time focusing assisted by near infrared machine vision through a high-NA air objective, in accordance with an embodiment of the disclosure.
- the focusing methods schematically illustrated in FIGURES7F and 7G can be used to achieve focus of the channels.
- the method includes collecting the focused light back reflected from the interrogation with a light collection system, wherein the light collection system comprises an air objective having a numerical aperture in a range of about 0.91 to less than 0.99, or about 0.95.
- the method includes collecting light for generating the image of the imaging area with the camera by collecting light with a light collection system, wherein the light collection system comprises an air objective having a numerical aperture in a range of about 0.91 to less than 0.99, or about 0.95.
- the light is in a range of about 700 nm to about 1.5 pm. In an embodiment, the light is in a range of about 700 nm to about 1100 nm. In an embodiment, the light is in a non-visible wavelength range.
- the method is a method for digital affinity-based detection assays.
- the digital affinity-based detection assay can be performed with or on one or more of the systems of the present disclosure.
- a "digital affinity assay” refers to an assay including the detection, identification, and/or counting of individual singlemolecule analytes through the specific association with one or more detectable agents and/or capture agents.
- such a digital affinity assay comprises the detection of individual single protein analyte molecules, in the case of digital protein assays, or individual single nucleic-acid molecules, in the case of digital nucleic-acid assays.
- digital protein assays can include the single-molecule detection, identification, and concentration determination of a non-fluorescent protein molecule through the specific association (e.g., antibody-antigen binding) with one or more fluorescent detectable agents (e.g., fluorescently labeled antibodies) and/or capture agents.
- digital nucleic-acid assays can include the single-molecule detection, identification, and concentration determination of a non-fluorescent nucleic-acid molecule through the specific association (e.g., nucleic acid hybridization) with one or more fluorescent detectable agents (e.g., fluorescently labeled nucleic-acid probes) and/or capture agents.
- such a digital affinity assay comprises the detection, without the use of amplification, of individual single protein analyte molecules or individual single nucleic-acid molecules.
- the method includes associating an analyte in a sample with a detectable agent; flowing the sample including the analyte associated with the detectable agent, and, in certain embodiments, associated with a capture agent, through a flow channel; outputting excitation light through an interrogation window through a portion of the flow channel; and generating an emission signal with a photodetector based on emission light received from the portion of the flow channel.
- FIGURE 9A is a block diagram of method 900A, in accordance with an embodiment of the present disclosure.
- method 900 A begins with process block 901 A, which includes associating an analyte with an association agent.
- the association agent is a primary antibody configured to selectively associate with an analyte, such as a protein or peptide.
- the association agent is a nucleic acid probe configured to selectively associate with an analyte including a nucleic acid sequence.
- the association agent is not configured to generate a detectable signal, such as in response to excitation, such as through illumination with excitation light.
- process block 901 A is optional.
- associating the analyte with the association agent includes incubating the association agent with the analyte under conditions and for a time sufficient to associate the association agent with the analyte, such as through molecular recognition, antigen-antibody binding, nucleic-acid hybridization, covalent bonding, non-covalent binding, and the like.
- method 900A begins with process block 903A or process block 901A is followed by process block 903A, which includes associating the analyte with a detectable agent.
- associating the analyte with the detectable agent can render the analyte detectable, such as through detecting a signal generated by the detectable agent and inferring a presence of the analyte, such as based on a time and/or position from which the signal is detected.
- associating the analyte with the detectable agent and/or the association agent includes incubating the detectable agent and/or the association agent with the analyte under conditions and for a time sufficient to associate the detectable agent and/or the association agent with the analyte, such as through molecular recognition, antigen-antibody binding, nucleic-acid hybridization, covalent bonding, non-covalent binding, and the like.
- associating the analyte with the detectable agent comprises associating the detectable agent with the association agent associated with the analyte.
- the association agent is, for example, a primary antibody configured to associate with the analyte and the detectable agent is a secondary antibody configured to associate with the association agent.
- associating the analyte with a detectable agent includes directly associating the analyte with the detectable agent, such as where there is no intermediary component disposed between the analyte and the detectable agent, such as a primary antibody where the detectable agent is a secondary antibody.
- the primary antibody is, for example, a fluorescently tagged antibody and is, thus, the detectable agent.
- the assay such as a digital affinity assay, comprises a number of binding events, such as discussed with respect to the association steps of process blocks 901 A- 907A.
- the digital affinity assay comprises one affinity binding event to a single-molecule analyte.
- the digital affinity assay comprises two affinity binding events to the single-molecule analyte.
- the digital affinity assay comprises more than two affinity binding events to the single-molecule analyte.
- process block 903A is followed by process block 905A, which includes associating the analyte with a second detectable agent.
- the detectable agent is a first detectable agent configured to emit first emission light in a first wavelength range upon excitation of the first detectable agent
- the method further comprises associating a second detectable agent with the analyte configured to emit second emission light in a second wavelength range upon excitation of the second detectable agent, and wherein the first emission wavelength range is distinct from the second wavelength range.
- the first and second detectable agents associated with the analyte are detectable, such as simultaneously or separately detectable.
- an analyte may be assayed through the methods of the present disclosure to detect two or more moieties or sequences in or on the analyte.
- the first detectable agent associates with a first moiety of the analyte
- the second detectable agent associates with a second moiety of the analyte distinct from the first moiety.
- the assay is a digital protein assay.
- the assay is a digital sandwich assay.
- the first moiety is an epitope on the analyte that binds to a first detectable agent, such as a first antibody
- the second moiety is a different epitope on the analyte that binds to a second detectable agent, such as a second different antibody.
- the first moiety is a first portion of the sequence of the analyte nucleic acid that hybridizes to a first detectable agent, such as a first probe nucleic-acid sequence complementary to the first portion of the sequence on the analyte nucleic acid
- a first detectable agent such as a first probe nucleic-acid sequence complementary to the first portion of the sequence on the analyte nucleic acid
- the second moiety is a second portion of the sequence on the analyte nucleic acid that is different from the first portion and which hybridizes to a first detectable agent, such as a second probe nucleic-acid sequence complementary to the second portion of the sequence on the analyte nucleic acid.
- the first and second antibody or the first and second nucleic acid probe can be labeled with different fluorescent entities, such as different fluorescent dyes, or different fluorescent barcoded magnetic beads, or combinations thereof.
- process block 905A is optional.
- process blocks 901A, 903A, and/or 905A are followed by process block 907A, which includes associating the analyte with a capture agent.
- the capture agent is configured to isolate the analyte from a portion of the sample when the analyte is associated with the capture agent and when the capture agent is subject to an isolation procedure.
- the capture agent can include a bead, such as a magnetic bead.
- the capture agent includes a surface on which is attached or otherwise associated a moiety configured to specifically associate with an analyte.
- the capture agent includes a bead.
- the bead is magnetic.
- the bead is fluorescent.
- the bead is fluorescent with a spectral -intensity optical barcode.
- the bead is both magnetic and fluorescent.
- the bead is both magnetic and fluorescent with a spectral-intensity optical barcode.
- the bead is configured to isolate the capture agent and analyte associated therewith from a portion of a sample, such as through application of a magnetic field, via magnetic bead capture, centrifugation, magnetophoresis, and the like.
- the capture agent does not include a bead, but is otherwise separable from a portion of a sample.
- the capture agent is coupled to a surface, as discussed further herein.
- the analyte is associated with the capture agent coupled to a surface, which can then be eluted or otherwise cleaved from the surface.
- the capture agent is configured to emit capture agent emission upon excitation.
- the bead is a fluorescent bead configured to emit bead fluorescence upon excitation by the excitation light.
- the fluorescent bead is a spectral-intensity barcoded bead or nanoparticle configured to emit bead fluorescence upon excitation by the excitation light.
- the bead comprises a plurality of distinct chromophores, wherein each chromophore of the plurality of distinct chromophores comprises a predetermined set of tunable optical coding parameters, thereby defining an optically detectable code for the capture agent.
- the optically detectable code comprises a predetermined emission spectrum of the capture agent.
- the optically detectable code comprises a predetermined absorption spectrum of the capture agent.
- the optically detectable code comprises a predetermined emission and absorption spectrum of the capture agent.
- the bead has a diameter of less than 1 micrometer. In an embodiment, the bead has a diameter of less than 1 micrometer, 900 nm, 800 nm, 700nm, 600 nm, 500 nm, 400 nm, 300 nm, 200 nm, or 100 nm. In an embodiment, the bead has a diameter of less than 100 nm, 90 nm 80 nm, 70 nm, 60 nm, 50 nm, or 40 nm,. In an embodiment, the bead has a diameter of greater than 1 micrometer. In an embodiment, the bead has a diameter of between 1 and 5 micrometer.
- a ratio of capture agent to detectable agent is in a range of 10: 1 to 1 : 10, 9: 1 to 1 :9, 8: 1 to 1:8, 7: 1 to 1 :7, 6: 1 to 1 :6, 5: 1 to 1 :5, 4: 1 to 1 :4, 3: 1 to 1 :3, 2:1 to 1 :2, and 1 : 1. In an embodiment, a ratio of capture agent to detectable agent is about 1 : 1.
- process block 907A is optional.
- process block 907A is followed by process block 909A, which includes isolating the analyte associated with the capture agent from a portion of the sample.
- the capture agent includes an optically barcoded magnetic bead, wherein isolating the analyte associated with the capture agent from the sample comprises associating the magnetic bead with a magnet; and removing a portion of the sample not associated with the magnet from the analyte associated with the capture agent to provide the purified sample.
- isolating the analyte associated with the capture agent from the sample comprises centrifuging the sample including the capture agent associated with the analyte to provide supernatant and a pellet including the analyte associated with the capture agent; and decanting or removing the supernatant to provide the purified sample.
- isolating the analyte coupled to the capture agent from the sample comprises passing the sample including the analyte associated with the capture agent through a size exclusion chromatography column to provide the purified sample including the analyte associated with the capture agent.
- capture agent is coupled to a surface.
- the surface is a surface of a well plate, such as a 96 or 384 well plate. In an embodiment, the surface is the surface of a bead. In an embodiment, the surface is a surface of a microfluidic channel. In an embodiment, isolating the analyte associated with the capture agent from a portion of the sample includes removing a portion of the sample not associated with the capture agent coupled to the surface.
- process block 909A is optional.
- process blocks 903A, 905A, 907A, or 909A is/are followed by process block 911 A, which includes contacting the sample with a removal bead.
- the removal bead is configured to selectively associate with any detectable agent not associated with the analyte.
- process block 911 A further includes removing the removal bead associated with the detectable agent not associated with the analyte from the sample.
- a removal bead is suitable or otherwise configured to remove, for example, unbound detectable agent (i.e., detectable agent which is not associated with the analyte).
- unbound or unassociated detectable agents can generate unwanted signal when detected downstream in the interrogation window.
- Signal from unbound or unassociated detectable agent may complicate the distinguishing of the signal from detectable agent associated with the analyte; by removing the unbound or unassociated detectable agent from the sample, detection of the analyte associated with the detectable agent becomes easier.
- process block 911 A is optional.
- process blocks 903 A, 905A, 907A, 909A, or 911 A is/are followed by process block 913 A, which includes flowing the sample including the analyte associated with the detectable agent through a flow channel.
- flowing the sample including the analyte associated with the detectable agent through a flow channel comprises flowing a plurality of analytes of the sample including the analyte associated with detectable agents and capture agents through the flow channel.
- flowing a plurality of analytes of the sample including the analyte associated with detectable agents and capture agents through the flow channel includes flowing the analyte associated with detectable agents and capture agents through a constriction of the flow channel on an analyte-associated-with-capture-and-detectable agent by analyte-associated-with-capture-and- detectable agent basis.
- a capture agent can be replaced with a second detectable agent and it is within the scope of the present disclosure to prepare and flow a complex including two or more detectable agent through the flow channel on an analyte- associated-with-two-or-more-detectable agent by analyte-associated-with-two-or-more- detectable agent basis.
- flowing the sample including the analyte associated with the detectable agent through the flow channel includes flowing a purified sample through the flow channel, such as a purified sample prepared in process blocks 909 A or 911 A.
- the flow channel is a flow channel of a device or system described further herein, which includes an interrogation window.
- the device includes one or more portions of the systems of the present disclosure.
- the flow channel is a flow channel of a system of the present disclosure.
- the flow channel defines a constriction as defined and described elsewhere herein.
- flowing the analyte associated with the detectable agent through the flow channel includes flowing a complex including the analyte associated with the capture agent and the detectable agent.
- the complex includes an optical barcoded bead with bound analyte, which is further bound to the detectable agent.
- the complex is an optically barcoded bead with a capture primary antibody bound to an analyte, such as a protein via an epitope on the analyte, wherein the analyte is further bound via a different moiety or epitope to another fluorescently tagged primary antibody.
- the complex is an optically barcoded bead with a capture nucleic-acid sequence hybridized to an analyte nucleic acid via a first sequence on the analyte nucleic acid, wherein the analyte nucleic acid is further hybridized via a second sequence different from the first sequence to another fluorescently tagged nucleic acid probe that serves as the detectable agent.
- flowing the sample through the flow channel excludes sheath flow focusing, acoustic flow focusing, or a combination thereof.
- process block 913 A is followed by process block 915 A, which includes outputting excitation light through an interrogation window through a portion of the flow channel.
- outputting the excitation light through the interrogation window through the portion of the flow channel includes outputting the excitation across a cross-section of a lumen of the flow channel. Outputting the excitation across a cross-section of a lumen of the flow channel is distinct from outputting excitation light onto only a portion of a cross-section of the lumen, such that particles or molecules and detectable agents associated therewith can pass through the lumen without being contacted by the excitation light.
- process block 915 A is followed by or is contemporaneous with process block 917A, which includes outputting second excitation light through the interrogation window onto a second portion of the flow channel.
- second excitation light may be suitable for and/or configured to excite, for example a second detectable agent or the capture agent.
- process block 917A is optional.
- process blocks 915 A and/or 917A are followed by process block 919A, which includes generating detectable agent emission signal, such as with a photodetector, based on detectable agent emission light received from the portion of the flow channel.
- the photodetector is an example of photodetector described further herein with respect to the systems of the present disclosure.
- the detectable agent emission signal is based on detectable agent emission light emitted from the detectable agent.
- flowing the sample including the analyte associated with the detectable agent through a flow channel includes flowing a plurality of analytes of the sample including the analyte associated with detectable agents and capture agents through the flow channel.
- process block 919A can include generating a plurality of detectable agent emission signals based on detectable agent emission light from the detectable agents.
- the detectable agent emission signal is suitable to determine the presence of the analyte within the flow channel.
- process block 919A is followed by process block 921A, which includes generating a capture agent emission signal based on the capture agent emission light.
- the capture agent is configured to emit light, such as upon excitation.
- generating the capture agent emission signal includes illuminating the capture agent with the excitation light and detecting the capture agent emission light with the photodetector.
- generating the capture agent emission signal is based on capture agent emission light received from a second portion of the flow channel, different from a portion in which the detectable agent emission light is emitted.
- the capture agent is optically encoded or otherwise configured to emit signals defining tunable optical coding parameters.
- encoded capture agents are suitable to detect a number of analytes, such as when different encoded capture agents configured to selectively associate with different analytes are used in assaying a sample.
- the capture agent comprises a plurality of distinct chromophores, wherein each chromophore of the plurality of distinct chromophores comprises a predetermined set of tunable optical coding parameters, thereby defining an optically detectable code for the capture agent.
- the optically detectable code comprises a predetermined emission spectrum of the capture agent, a predetermined absorption or excitation spectrum of the capture agent, or a combination thereof.
- flowing the sample including the analyte associated with the detectable agent through a flow channel includes flowing a plurality of analytes of the sample including the analyte associated with detectable agents and capture agents through the flow channel.
- process block 921 A includes generating a plurality of capture agent emission signals based on capture agent emission light from the capture agents.
- the method 900 includes correlating or colocalizing the detectable agent emission light with the capture agent emission light to determine a presence and/or identity of the analyte.
- the method 900 includes correlating or colocalizing the detectable agent emission light with a second detectable agent emission light to determine a presence and/or identity of the analyte.
- the method 900 includes correlating or colocalizing the detectable agent emission light with the capture agent emission light and a second detectable agent emission light to determine a presence and/or identity of the analyte. In an embodiment, the method 900 includes correlating or colocalizing two or more detectable agent emission light to determine a presence and/or identity of the analyte.
- process block 921A is optional.
- process block 919A and/921 A are followed by process block 923 A, which includes quantifying a number of detectable agent emission signals associated with the capture agent emission signals or second detectable agent emission signals or a ratio of the number of detectable agent emission signals associated with the capture agent emission signals or second detectable agent emission signals to a number of the capture agent emission signals, detectable agent emission signals, second detectable agent emission signals, or combinations thereof.
- process block 919A and/921 A are followed by process block 923 A, which includes quantifying a number of detectable agent emission signals associated with one or more additional detectable agent emission signals or a ratio of the number of detectable agent emission signals associated with one or more additional detectable agent emission signals to a number of the individual detectable agent emission signals, or combinations thereof.
- the methods of the present disclosure are suitable to generate signals associated with single-molecule analytes passing through flow channels. Such signals can be counted and associated with such single-molecule analytes to further count the number of the analytes associated with detectable agents, capture agents, second detectable agents, additional detectable agents, and the like passing through the flow channel, such as for a given period of time.
- process block 923A is followed by process block 925A, which includes determining a concentration of the analytes associated with the emission signals. In an embodiment, such a determination is based on the number of analytes associated with the emission signals, such as detectable agent emission signals, second detectable agent emission signals, and/or capture agent emission signals. In an embodiment, determining a concentration of the analytes is based on a volume of liquid flowed through the flow channel.
- determining the concentration of the analyte is based on a number of analytes associated with both emission light from the detectable agent and the capture agent (such as determined from capture agent emission signal associated with detectable agent emission signal) or analyte associated with emission light from two or more detectable agents (such as determined from detectable agent emission signal associated with second detectable agent emission signal). In an embodiment, determining the concentration of the analyte is based on analyte associated with emission light. In an embodiment, analyte associated with emission light includes analyte associated with capture agent emission light and/or detectable agent emission light, as discussed above with respect to process block 923 A.
- determining a concentration of the analytes is based on a number of the capture agent emission signals associated with the detectable agent emission signals. In some embodiments, determining a concentration of the analytes is based on a volume of liquid flowed through the flow channel.
- determining the concentration of the analytes is based upon a ratio of the number of detectable agent emission signals associated with the capture agent emission signals to a number of the capture agent emission signals. In an embodiment, determining the concentration of the analytes is based upon a ratio of the number of detectable agent emission signals associated with the capture agent emission signals to a number of the detectable agent emission signals. In an embodiment, determining the concentration of the analytes is based upon a ratio of the number of detectable agent emission signals associated with the capture agent emission signals to a number of the capture agent emission signals, to a number of the detectable agent emission signals, or combinations thereof.
- determining a concentration of the analyte in a sample takes into account detectable agent emission light and capture agent emission light, for example, co-co-located (such as when associated with the analyte) and detectable agent and capture agent that is not associated with the analyte.
- determining the concentration of the analyte associated with the emission signals is based on a ratio of a number of analyte associated with both detectable agent and capture agent emission signals and the number of capture agent emission signals but not detectable agent emission signals or only detectable agent emission signals but not capture agent emission signals, or combinations thereof. In an embodiment, determining the concentration of the analyte associated with the emission signals is based on a number of analyte associated with two or more detectable agent emission signals. In an embodiment, determining the concentration of the analyte associated with the emission signals is based on a ratio of analyte associated with two or more detectable agent emission signals and the number of non-analyte associated emission signals.
- determining the concentration of the analyte is further based upon a flow rate of the sample through the channel.
- FIGURE 9B is a block diagram of a method 900B in accordance with an embodiment of the present disclosure.
- method 900B can be performed on and/or with one or more components of a system according to an embodiment of the present disclosure as described elsewhere herein.
- method 900B is a digital affinity assay, such as a digital protein or nucleic acid assay.
- method 900B is an example of method 900A.
- method 900B begins with process block 90 IB, which includes associating an analyte in a sample with a detectable agent.
- process block 901B is analogous to and/or an example of process block 901A.
- the analyte can include a protein and the detectable agent can include a fluorescently labelled antibody, and/or the detectable agent can include a nucleic acid and the detectable agent can include a fluorescently labelled nucleic acid probe.
- process block 90 IB is followed by process block 903B, which includes associating the analyte with a capture agent.
- the capture agent is configured to isolate the analyte from a portion of the sample when the analyte is associated with the analyte and when the capture agent is subject to an isolation procedure.
- process block 903B is analogous to and/or an example of process block 907A.
- process block 903B is followed by process block 905B, which includes isolating the analyte associated with the capture agent from a portion of the sample.
- process block 905B includes isolating the analyte associated with the capture agent from a portion of the sample.
- isolation can include, for example, the use of magnets to isolate magnetic beads of capture agents or of removal beads, centrifugation, size exclusion chromatography, and the like.
- process block 905B is an example of process block 909A.
- process block 90 IB or process blocks 903B and 905B is/are followed by process block 907B, which includes flowing the sample including the analyte associated with the detectable agent through a flow channel.
- flowing the sample including the analyte associated with the detectable agent through a flow channel includes flowing a plurality of analytes of the sample including the analyte associated with detectable agents and capture agents through the flow channel.
- the method includes flowing a plurality of analytes of the sample including the analyte associated with detectable agents and capture agents through the flow channel, wherein flowing the analytes associated with detectable agents and capture agents through the flow channel includes flowing the analyte associated with detectable agents and capture agents through a constriction of the flow channel on an analyte-associated-with-capture-and-detectable agent by analyte- associated-with-capture-and-detectable agent basis.
- flowing the sample including the analyte associated with the detectable agent through a flow channel includes flowing a plurality of analytes of the sample including the analyte associated with detectable agents through the flow channel.
- the method includes flowing a plurality of analytes of the sample including the analyte associated with detectable agents through the flow channel, wherein flowing the analytes associated with detectable agents through the flow channel includes flowing the analyte associated with detectable agents through a constriction of the flow channel on an analyte-associated-with-detectable agent by analyte-associated-with- detectable agent basis.
- flowing the sample including the analyte associated with the detectable agent through a flow channel includes flowing a plurality of analytes of the sample including the analyte associated with two or more detectable agents through the flow channel.
- the method includes flowing a plurality of analytes of the sample including the analyte associated with two or more detectable agents through the flow channel, wherein flowing the analytes associated with two or more detectable agents through the flow channel includes flowing the analyte associated with detectable agents through a constriction of the flow channel on an analyte-associated-with-detectable-agents-by-analyte-associated- with-detectable-agents basis.
- process block 907B is an example of process block 913A.
- flowing the sample through the flow channel includes flowing the sample through a flow channel of a system according to an embodiment of the present disclosure.
- the flow channel defines a constriction as described elsewhere herein.
- process block 907B is followed by process block 909B, which includes outputting excitation light through an interrogation window of a portion of the flow channel.
- process block 909B is an example of process block 915A.
- the excitation light is configured to optically excite the detectable agent and/or capture.
- process block 909B is followed by process block 91 IB, which includes outputting second excitation light through the interrogation window of the flow channel.
- the second excitation light is configured to excite a capture agent and/or a second detectable agent, as described elsewhere herein.
- process block 91 IB is an example of process block 917A.
- process block 911 A is optional.
- process block 909B or process block 91 IB is followed by process block 913B, which includes generating a detectable agent emission signal, such as with a photodetector, based on detectable agent emission light received from the flow channel.
- the detectable agent emission light is generated in response to the detectable agent receiving the excitation light from process block 909B.
- flowing the sample including the analyte associated with the detectable agent through a flow channel includes flowing a plurality of analytes of the sample including the analyte associated with detectable agents and capture agents through the flow channel.
- generating a detectable agent emission signal further includes generating a plurality of detectable agent emission signals based on detectable agent emission light from the detectable agents.
- process block 91 IB is an example of process block 919A.
- process block 913B is followed by process block 915B, which includes generating a capture agent emission signal based on capture agent emission light received from the flow channel.
- generating a capture agent emission signal includes or is part of generating a plurality of capture agent emission signals based on capture agent emission light from the capture agents.
- process block 915B is an example of process block 921 A.
- process block 915B is followed by process block 917B, which includes quantifying a number of detectable agent emission signals associated with the capture agent emission signals or second detectable agent emission signals.
- process block 917B includes quantifying a ratio of the number of detectable agent emission signals associated with the capture agent emission signals or second detectable agent emission signals to a number of the capture agent emission signals, detectable agent emission signals, second detectable agent emission signals, or combinations thereof.
- process block 917B includes quantifying the number of detectable agent emission signals associated with two or more detectable agent emission signals.
- process block 917B is an example of process block 923 A.
- process block 917B is followed by process block 919B, which includes determining a concentration of the analyte associated with emission light, such as emission light including the detectable agent emission light and/or the capture agent emission light.
- process block 919B includes determining a concentration of the analytes based on a number of the capture agent emission signals associated with the detectable agent emission signals.
- determining the concentration of the analytes is based on a volume of liquid flowed through the flow channel.
- determining the concentration of the analytes is based upon a ratio of the number of detectable agent emission signals associated with the capture agent emission signals to a number of the capture agent emission signals.
- determining the concentration of the analytes is based upon a ratio of the number of detectable agent emission signals associated with the capture agent emission signals to a number of the detectable agent emission signals. In an embodiment, determining the concentration of the analyte and/or particles and/or molecules associated with the emission signals is further based on a ratio of a number of particles analyte associated with both detectable agent and capture agent emission signals and the number of particles associated only with capture agent emission signals but not detectable agent emission signals or only detectable agent emission signals but not capture agent emission signals, or combinations thereof. In an embodiment, determining the concentration of the analytes is based upon quantifying the number of detectable agent emission signals associated with the capture agent emission signals.
- determining the concentration of the analytes is based upon quantifying the number of detectable agent emission signals associated with a second detectable agent emission signals. In an embodiment, determining the concentration of the analytes is based upon quantifying the number of detectable agent emission signals associated with a second and third detectable agent emission signals. In an embodiment, determining the concentration of the analytes is based upon quantifying the number of detectable agent emission signals associated with two or more detectable agent emission signals. In an embodiment, process block 919B is an example of process block 925 A.
- FIGURES 10A-18C Various embodiments of the methods of the present disclosure will now be described with reference to FIGURES 10A-18C.
- the methods illustrated and described with respect to FIGURES 10A-18C are examples of methods 900A and/or 900B discussed with respect to FIGURES 9A and 9B respectively or portions thereof.
- FIGURE 10A is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- an analyte e.g., a protein
- a capture agent including a bead and an antibody configured to selectively associate with the analyte.
- the analyte and the bead are incubated together for a time and under condition sufficient to associate the analyte and the antibody.
- a particular embodiment of the method of 10A is described further herein with respect to Example 4.
- a fluorescent bead can be orders of magnitude brighter than a single molecule (e.g., a dye-tagged antibody molecule); is much larger than a single molecule (e.g., approximately a billion times in terms of mass between a 1-pm diameter bead and a single dye molecule); and often can generate significant background light from fluorescence cross talk, autofluorescence, and/or scattering.
- the single-molecule flow systems and methods of the present disclosure are able to isolate and detect the single-molecule fluorescence in the presence of the single-bead fluorescence/auto-fluorescence/light scattering when they flowed through the interrogation window of the flow channel together in a bound complex. As a result, it is possible to detect the single-molecule fluorescence emission with high sensitivity and detection efficiency in the presence of the bead as they flowed through the interrogation window of the systems and according to methods of the present disclosure.
- the capture agent includes a bead coupled to a plurality of antibodies.
- the capture agent is configured to associate with one or a plurality of analytes, depending on the concentration of the analytes and the number of beads.
- the bead is fluorescent, and preferably optically barcoded (spectral-intensity barcode), and optionally, the bead is magnetic.
- the capture agent associated with the analyte is then contacted with a detectable agent, shown here as an antibody coupled to a fluorescent moiety, such as a dye, a polymer dot, or other structure configured to emit a detectable signal.
- a detectable agent shown here as an antibody coupled to a fluorescent moiety, such as a dye, a polymer dot, or other structure configured to emit a detectable signal.
- the antibody of the detectable agent is configured to selectively associate with the analyte, such as with a moiety of the analyte not directly associated with the capture agent.
- the sample is subjected to a purification process in which the capture agent associated with the analyte is isolated or otherwise separated from the sample, such as to remove unbound detectable agent from the complex of the capture agent, analyte, and detectable agent.
- a purified sample including the analyte associated with the capture agent and the detectable agent is flowed through a flow channel.
- the flow channel is illuminated with excitation light #1 (first excitation light) illuminating a first portion and excitation light #2 (second excitation light) illuminating a second portion distinct from the first portion.
- the detectable agent is excited by one excitation light, such as the first excitation light, and upon excitation emits fluorescence.
- the capture agent is excited by the second excitation light and emits a capture agent fluorescence upon excitation by the second excitation light.
- the detectable agent and the capture agent are both excited by the same excitation light, but they emit at different peak emission wavelengths.
- detectable agent fluorescence and capture agent fluorescence can be detected to generate emission signals, such as detectable agent emission signals and capture agent emission signals.
- emission signals such as detectable agent emission signals and capture agent emission signals.
- the capture agent is configured to associate with a first moiety of the analyte and the detectable agent is configured to associate with a second moiety of the analyte different than the first moiety
- the methods of the present disclosure are suitable to co-locate two different moieties on a single analyte.
- FIGURE 10B is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- the method includes associating a capture agent with an analyte, where the capture agent includes a magnetic bead coupled to an antibody configured to specifically associate with the analyte.
- the bead is magnetic.
- the method is shown to further include a magnetic purification step in which analyte associated with the capture agent is isolated from the sample.
- a purification step allows unbound or unassociated detectable agent, here fluorescently labelled antibodies, to be removed from the analyte associated with the capture agent and the detectable agent.
- the magnetic bead is also fluorescent so it can be detected when flowed through the flow channel.
- the magnetic bead can be detected with scattered light upon illumination by an excitation light, such as back scattered light.
- the intensity of the scattered light can be related to the size of the bead; for example, larger beads generate more scattered light than smaller beads.
- Magnetic beads are known to generate high levels of autofluorescence, and given a magnetic bead is also much larger than a single molecule (e.g., almost 10 million times in terms of mass between a 200nm diameter magnetic bead and a single dye molecule), it generates scattered light of an intensity that can be orders of magnitude higher than background scattered light from a single molecule.
- the single-molecule flow systems and methods of the present disclosure are able to isolate and detect the singlemolecule fluorescence in the presence of the single magnetic bead when they flowed through the interrogation window of the flow channel together in a bound complex. Consequently, it is possible to detect the single-molecule fluorescence emission with high sensitivity and detection efficiency in the presence of the magnetic bead, as they flowed through the interrogation window of the systems of the present disclosure and according to the methods of the present disclosure.
- the method further includes flowing the analyte through a channel across which excitation light is output.
- a channel across which excitation light is output only a single excitation light is output; however, because the method includes a purification step, fluorescence emitted from the detectable agent and, in some embodiments, the capture agent, may be sufficient to distinguish or otherwise identify the analyte flowing through the flow channel. Because free detectable agent has been removed or its concentration in the purified sample greatly reduced, a single excitation light may be used to detect the complexed analyte.
- the detectable agent and the capture agent can emit detectable agent emission light and capture agent emission light at different peak emission wavelengths, which can be used respectively to generate detectable agent emission signal and capture agent emission signal, suitable to detect the complexed analyte.
- FIGURE 10C is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- FIGURE 10C illustrates a method analogous to the method illustrated in FIGURE 10B with respect to purification through magnetic capture agents and detection with single excitation light in the flow channel.
- the method of FIGURE 10C is shown to include associating the analyte with an association agent, shown here as a primary, unlabeled antibody configured to specifically to associate with the analyte.
- the analyte associated with both the magnetic capture agent and the association agent is magnetically isolated from free association agent with a magnet, as described with respect to FIGURE 10B.
- the method is shown to further include associating a detectable agent, here a fluorescently labelled antibody configured to specifically associate with the association agent.
- a detectable agent here a fluorescently labelled antibody configured to specifically associate with the association agent.
- the analyte can be labelled with greater flexibility and/or specificity and its detection determined with greater ease and/or confidence.
- the detectable agent-labelled analyte complex is then further magnetically isolated from any free detectable agent, and the purified sample is flowed through the flow channel for excitation and detection as described with respect to FIGURE 10B.
- FIGURE 11 is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- an analyte is shown to be associated with a capture agent including a bead and an antibody configured to specifically associate with the analyte.
- the bead can be fluorescent, such as to emit capture agent emission upon excitation.
- a particular embodiment of the method of FIGURE 11 is described further herein with respect to Example 4.
- the analyte is then associated with a fluorescently labelled detectable agent to provide a complex including the analyte associated with the capture agent and the detectable agent.
- the method includes flowing this complex through the flow channel without further purification, such that free detectable agent is passed through the flow channel and the first and second excitation light. Because the analyte is associated with both the detectable agent the capture agent, which can include a fluorescent bead, it is possible to distinguish between fluorescence generated by free detectable agent and fluorescence generated by a complex including an analyte associated with the detectable agent and the fluorescent capture agent.
- free detectable agent will fluoresce only upon excitation by one of the first excitation light and the second excitation light, whereas a complex including an analyte associated with the detectable agent and the fluorescent capture agent will emit fluorescence when excited by both the first and second excitation light.
- free detectable agent and the complex including an analyte associated with the detectable agent and the fluorescent capture agent will both emit fluorescence when excited by the same excitation light, but will emit respective fluorescence with different and distinguishable fluorescence emission characteristics, such as different peak emission wavelengths, or emission spectra, or emission intensities, or any combinations thereof.
- a bead can be orders of magnitude brighter than a single molecule (e.g., a dye-tagged antibody molecule), is much larger than a single molecule (e.g., approximately a billion times in terms of mass between a 1-pm diameter bead and a single dye molecule), and often can generate significant background light from fluorescence cross talk and/or autofluorescence and/or scattering.
- the single-molecule flow systems and methods of the present disclosure are suitable or otherwise configured to isolate and detect the single-molecule fluorescence in the presence of the single-bead fluorescence and/or auto-fluorescence and/or light scattering when they flowed through the interrogation window of the flow channel together in a bound complex. As a result, it is possible to detect the single-molecule fluorescence emission with high sensitivity and detection efficiency in the presence of the bead as they flowed through the interrogation window of the systems of the present disclosure.
- a bead is much larger than a single molecule and with very different surface properties, a bead can interact with the flow channel walls very differently than a single molecule, especially in the constriction region, and thus can cause additional challenges in the flow-through analysis of single-bead-molecule complexes.
- the single-molecule flow systems and methods of the present disclosure are able to detect and analyze single-bead-molecule complexes with high sensitivity and detection efficiency.
- FIGURE 12A is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- the analyte is shown to include a nucleic acid molecule.
- the method is shown to include associating the analyte with a detectable agent including a nucleic acid probe molecule coupled to a fluorescent label.
- the detectable agent is shown associated with a first moiety, here a first nucleic acid sequence, of the analyte nucleic acid molecule.
- a particular embodiment of the method of FIGURE 12 is described further herein with respect to Example 9.
- the method is shown to further include associating a capture agent with the analyte associated with the detectable agent. As shown, the capture agent includes a magnetic bead.
- the magnetic bead is an encoded magnetic bead (e.g., spectral- intensity barcoded or encoded magnetic bead).
- the encoded magnetic bead comprises a plurality of distinct chromophores, wherein each chromophore of the plurality of distinct chromophores comprises a predetermined set of tunable optical coding parameters, thereby defining an optically detectable code for the capture agent.
- the optically detectable code comprises a predetermined emission spectrum of the capture agent, a predetermined absorption spectrum of the capture agent, or a combination thereof.
- Such encoding allows for the different capture agents, such as different capture agents configured to specifically associate with different analytes to emit distinctive and different fluorescence upon excitation at a particular wavelength, and, in this regard, provide signals indicative of the different analytes with which they are associated.
- a first capture agent configured to associate with a first analyte may have tunable optical coding parameters defining a first optically detectable code that is different than a second optically detectable code of a second capture agent that is configured to associate with a second analyte.
- the first and second optically detectable codes can be used to detect the first capture agent associated with a first analyte and the second capture agent associated with the second analyte, such as without having to separate the first analyte from the second analyte when flowing the sample or purified sample through the flow channel.
- encoded capture agents allow for relating a ratio of an intensity of the capture agent emission light to an identity of the capture agent and an identity of the analyte associated with the capture agent.
- the method is shown to include isolating the complex including the analyte nucleic acid molecule, the detectable agent, and the capture agent from a sample to provide a purified sample.
- the purified sample is then flowed through the flow channel and excited by first and second excitation light as discussed further herein with respect to FIGURE 10A.
- FIGURE 12B is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- the analyte is shown to include a nucleic acid molecule.
- the method is shown to include associating the analyte with a detectable agent including a nucleic acid probe molecule coupled to a fluorescent label.
- the detectable agent is shown associated with a first moiety, here a first nucleic acid sequence, of the analyte nucleic acid molecule.
- the method is shown to further include associating the analyte associated with the detectable agent with a capture agent.
- the capture agent includes a magnetic bead coupled to a second nucleic acid probe sequence.
- the capture agent is shown to associate with a second moiety of the analyte nucleic acid molecule to provide a complex including the analyte, the detectable agent, and the capture.
- the method includes magnetically isolating the complex from the sample, thereby providing a purified sample, which is free of or has reduced concentration of detectable agent that is not associated with the analyte.
- a purified sample including the complex is flowed through the flow channel and detected using a single excitation light as described further herein with respect to FIGURE 10B.
- FIGURE 13 is a schematic illustration of a method, in accordance with an embodiment of the present disclosure. As shown, the method includes associating an analyte with a first detectable agent and a second detectable agent. A particular embodiment of the method of FIGURE 13 is described further herein with respect to Examples 1 and 2.
- the detectable agent is a first detectable agent configured to emit first emission light in a first wavelength range upon excitation of the first detectable agent.
- the second detectable agent is configured to emit second emission light in a second wavelength range upon excitation of the second detectable agent.
- the first emission wavelength range is distinct from the second wavelength range. As shown, the first detectable agent associates with a first moiety of the analyte, and the second detectable agent associates with a second moiety of the analyte distinct from the first moiety.
- the first and second detectable agents are fluorescently labelled antibodies; however, it will be understood that the first and second detectable agents can include, for example, first and second fluorescently labelled nucleic acid probe molecules configured to couple with different nucleic acid sequences of a nucleic acid target molecule.
- the method includes flowing the analyte associated with the first and the second detectable agent, along with unbound or unassociated first and second detectable agents, through the flow channel.
- the flow channel is shown illuminated by first and second excitation light, such as first excitation light configured to excite the first detectable agent and second excitation light configured to excite the second detectable agent.
- first and second excitation light such as first excitation light configured to excite the first detectable agent
- second excitation light configured to excite the second detectable agent.
- the method of FIGURE 13 does not require purification, as it can be used to distinguish between signals from both detectable agents associated with an analyte and detectable agents not associated with an analyte.
- an unassociated detectable agent flows through the flow channel, it will emit fluorescence in response to only one of the first excitation light or the second excitation light, whereas a complex including an analyte associated with a first and second detectable agent with emit fluorescence in response to both the first and second excitation light.
- FIGURE 14 is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- the method of FIGURE 14 illustrates labelling an analyte with a first detectable agent and a second detectable agent, as in FIGURE 13.
- the method is shown to further include after associating the analyte (e.g., a protein or a nucleic acid molecule) in the sample with the detectable agents, contacting the sample with a removal bead configured to selectively associate with any detectable agent not associated with the analyte; and removing the removal bead associated with the detectable agent not associated with the analyte from the sample.
- the removal bead is magnetic and may be isolated from the sample including the labelled antibody with a magnet configured to magnetophoresce the removal bead or otherwise associate the removal bead with the magnet to remove it from the labeled sample.
- While the method of FIGURE 14 does not require removing unbound or unassociated detectable agents, removing such detectable agents from the sample can decrease signals generated from unbound or unassociated detectable agents, thereby increasing confidence that signals generated by the method are associated with labelled analyte.
- Digital dual affinity protein assays are an example of sandwich immunoassays.
- sandwich immunoassays involve the immobilization of the capture reagent (e.g., capture antibody) onto a solid planar surface, as is done in the commonly used ELISA (enzyme-linked immuno-sorbent assay) format, because immobilizing the capture agent onto a solid surface in a conventional sandwich immunoassay format can provide important known benefits.
- ELISA enzyme-linked immuno-sorbent assay
- digital sandwich immunoassays performed by using the single-molecule flow analysis systems and methods of the present disclosure do not require immobilization of the capture reagent (e.g., capture antibody) onto a planar solid surface in order to achieve highly sensitive and accurate digital sandwich immunoassays.
- any residual unbound detectable agent/antibody i.e., not bound to the analyte
- the systems and methods of the present disclosure do not include structures, reagents, and/or steps for amplification.
- amplification can refer to the generation of molecules, such as through PCR, isothermal amplification, enzymatic amplification, DNA- or RNA-based amplification (such as rollingcircle amplification) processes to increase a number of molecules based on the presence of an analyte (e.g., amplicons).
- analyte e.g., amplicons
- FIGURE 15 is a schematic illustration of a method, in accordance with an embodiment of the present disclosure. A particular embodiment of the method of FIGURE 15 is described further herein with respect to Example 7.
- the analyte is a nucleic acid molecule.
- the method includes associating the analyte nucleic acid molecule with a first and a second detectable agent.
- the first detectable agent is a fluorescent nucleic acid probe, wherein the fluorescent nucleic acid probe comprises a probe nucleic acid strand associated with a fluorescent emitter.
- the first detectable agent is configured to emit first emission light in a first wavelength range upon excitation of the first detectable agent.
- the second detectable agent is configured to emit second emission light in a second wavelength range upon excitation of the second detectable agent.
- the first emission wavelength range is distinct from the second wavelength range.
- the first detectable agent associates with a first moiety of the nucleic acid
- the second detectable agent associates with a second moiety of the nucleic acid distinct from the first moiety.
- first and second detectable agents can be determined to be co-located on the analyte, such as by flowing the analyte associated with the first and second detectable agents through a flow channel and detecting fluorescence emitted by the first and second detectable agents.
- the method includes flowing the analyte associated with the first and second detectable agents, as well as unbound or unassociated first and second detectable agents, through the flow channel.
- the method can distinguish between, on the one hand, a complex including the analyte, the first detectable agent, and the second detectable agent, and, on the other, free first and/or second detectable agent, as discussed elsewhere herein.
- the flow channel is excited by a single excitation light, and the method can distinguish based on differences in emission wavelength ranges between, on the one hand, a complex including the analyte, the first detectable agent, and the second detectable agent, and, on the other, free first and/or second detectable agent, as discussed elsewhere herein.
- nucleic acid molecules can interact with the flow channel walls very differently than protein molecules (e.g., interactions of the molecule with the channel wall that can affect their transit time through the channel), especially in the constriction region of a flow channel, because nucleic-acid molecules can behave very differently than protein molecules (e.g., different charges, conformations, size, flexibilities, etc.).
- the singlemolecule flow systems and methods of the present disclosure are suitable or otherwise configured to perform digital nucleic-acid assays just as well as digital protein assays, such as digital sandwich immunoassays.
- FIGURE 16A is a schematic illustration of a method, in accordance with an embodiment of the present disclosure. A particular embodiment of the method of FIGURE 16A is described further herein with respect to Example 11.
- the analyte includes a nucleic acid molecule.
- the method includes associating the analyte nucleic acid molecule with a detectable agent including a complementary nucleic acid molecule complementary with the analyte nucleic acid molecule and a fluorescent label.
- the method is also shown to include associating the analyte nucleic acid molecule with an intercalating dye, such as after associating the analyte nucleic acid molecule with the detectable agent including the complementary nucleic acid molecule.
- the intercalating nucleic acid dye is configured to emit an intercalating agent emission light, such as intercalating agent fluorescence, different from fluorescence (i.e., detectable agent emission light) emitted from the fluorescent label of the detectable agent.
- an intercalating agent emission light such as intercalating agent fluorescence
- the intercalating dye fluorescence is suitable to confirm that the analyte nucleic acid molecule is hybridized with the detectable agent, since, in an embodiment, the intercalating dye is configured to associate with or intercalate into double-stranded nucleic acid molecules.
- Such a confirmation of association may be further configured to validate that a signal generated by a photodetector, such as a detectable agent emission signal, is generated by a complex including the analyte and the detectable agent, rather than free detectable agent.
- the method is shown to include flowing the complex and free detectable agent through the flow channel.
- the flow channel is illuminated by first and second excitation light, such as first excitation light configured to excite the detectable agent and second excitation light configured to excite the intercalating agent.
- FIGURE 16B is a schematic illustration of a method, in accordance with an embodiment of the present disclosure. A particular embodiment of the method of FIGURE 16B is described further herein with respect to Example 10.
- an analyte is associated with detectable agent including a nucleic acid probe complementary to the analyte nucleic acid molecule, and associating the analyte nucleic acid molecule with an intercalating dye, as illustrated in and discussed with respect to FIGURE 16 A.
- FIGURE 16B shows illuminating the flow channel with only one excitation light.
- the excitation light is configured to excite both detectable agent and the intercalating dye.
- fluorescence from the detectable agent and the intercalating dye can be separately detected, because they have different emission wavelength ranges, such as with the detectors of the systems of the present disclosure.
- FIGURE 17 is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- an analyte is associated with a detectable agent including a nucleic acid probe complementary to the analyte nucleic acid molecule, and associating the analyte nucleic acid molecule with an intercalating dye, as illustrated in and discussed with respect to FIGURE 16A.
- the method is shown to further include associating the unbound detectable agent (detectable agent not associated with analyte nucleic acid molecule) with a magnetic capture agent so the unbound detectable agents can be removed.
- the method further includes flowing a purified sample including the complex including the analyte associated with the detectable agent through the flow channel for detection by a single excitation light as discussed further herein.
- FIGURE 18A is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- the method includes associating an analyte with a magnetic capture agent and a detectable agent, as discussed further herein with respect to FIGURE 10B.
- a complex including the analyte associated with the capture agent and the detectable agent is purified through magnetophoresis or association of the magnetic bead with a magnet.
- free detectable agent is removed, such as through decanting or pipetting out the solution or otherwise separating the free detectable agent from the complex to provide a purified sample.
- the purified sample is contacted with an elution buffer configured to release the complex comprising of the analyte, detectable agent, and capture antibody from the bead.
- the elution buffer release antibodies coupled to the magnetic bead from the magnetic bead.
- the elution buffer releases analyte associated with the detectable agent and the antibody previously coupled to the magnetic bead, which is then flowed through the flow channel for detection as described elsewhere herein.
- FIGURE 18B is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- an analyte is labelled and purified with an association agent, a detectable agent, and a magnetic capture agent as discussed further herein with respect to FIGURE 10C.
- the method includes eluting the analyte-antibody complex from the bead with an elution buffer. The eluted analyte complexed with the association agent and the detectable agent is flowed through the flow channel for detection as discussed elsewhere herein.
- FIGURE 18C is a schematic illustration of a method, in accordance with an embodiment of the present disclosure.
- the method includes associating an analyte with a capture agent coupled to a surface, such as the surface of a well plate.
- the method includes contacting the analyte associated with the capture agent with a detectable agent, such as by flowing the detectable agent over the surface.
- the method is shown to further include contacting the surface with an elution buffer to elute the analyte associated with the detectable agent from the surface. The eluted and labelled analyte is then flowed through the flow channel, excited, and detected as described elsewhere herein.
- a tangible machine-readable storage medium includes any mechanism that provides (i.e., stores) information in a non-transitory form accessible by a machine (e.g., a computer, network device, personal digital assistant, manufacturing tool, any device with a set of one or more processors, etc.).
- a machine-readable storage medium includes recordable/non-recordable media (e.g., read only memory (ROM), random access memory (RAM), magnetic disk storage media, optical storage media, flash memory devices, etc.).
- This example describes the experimental method and apparatus that enable the digital detection and enumeration and concentration determination of analyte molecules in flow.
- Accurate detection and quantification of the molecules of interest i.e., analyte
- Accurate detection and quantification of the molecules of interest is fundamentally important for many applications (e.g., clinical diagnostic). Because of the ultra-low concentrations of many analytes, traditional methods often require 1) the enrichment of analyte molecules, 2) the purification of analyte molecules to remove interference, and/or 3) the amplification of read-out signals (e.g., the amplification of nucleic acids). Additionally, to measure the concentration of analyte quantitatively, an appropriate calibration method, using internal or external standard samples, is often required. This example demonstrates that the presence and concentrations of analyte molecules, which are sandwiched by two binders (i.e., a capture agent and a detectable agent or two different detectable agents), can be directly detected and determined without any calibration methods.
- two binders i.e., a capture agent and a detectable agent or two different detectable agents
- non-fluorescent streptavidin was used as the model analyte
- antistreptavidin antibody conjugated with Phycoerythrin (PE) was used as the model capture agent (or as the second detectable agent)
- biotin-Alexa647 was used as the detectable agent.
- 1 uL of 2 nM of Streptavidin was first mixed with excess amount (1 uL of 10 nM) of anti-streptavidin-PE antibody in 997 ul of PBS buffer for 30 min, so analyte molecule was captured or bound by a corresponding antibody.
- Two excitation laser beams (561 nm, 5 mW and 637 nm, 25 mW) with the emission filter of 585/30 nm and 690/50 nm, respectively, were used to measure the fluorescence from the capture agent and detectable agent.
- FIGURE 23 A shows 5 such colocalized events in 800 ms, indicating 5 corresponding streptavidin molecules flowed through the detection window during this period. The peaks in this figure that could not be colocalized with the fluorescence signal from the other channel were unbound capture or detectable agents.
- the two- dimensional scatter plot shows there were 372 colocalized events enumerated in 1 min. The flow rate could also be determined using an internal standard (e.g., fluorescent beads spiked into the same sample), so the concentration of analyte molecule could be directly calculated.
- This example describes the experimental method and apparatus that enable the digital detection and enumeration of non-fluorescent analyte molecules in flow based on digital sandwich immunoassay.
- antibody and other specific molecular binders, such as aptamers and other antibody like molecules capable of specific molecular recognition and binding
- antigen is the foundation of immune recognition and immunoassays, and widely used to detect molecules of interest (i.e., analyte), because of the high specificity and affinity.
- analyte molecule binds with two antibodies, with one serving as a capture agent (or second detectable agent) and the other as a detectable agent, respectively.
- these sandwich immunoassays typically require the amplification of read-out signals (e.g., ELISA), and/or the calibration of obtained signals using external standards, if the read-out method is analog.
- sandwich immunoassay can be greatly simplified using the method and system described here without utilizing the above cumbersome processes.
- mouse-anti-rabbit IgG was the model non-fluorescent analyte
- rabbit- IgG conjugated with Alexa647 was the model capture agent (or second detectable agent)
- goat-anti-mouse IgG conjugated with PE was the model detectable agent.
- 1 uL of 2 nM of mouse-anti -rabbit IgG was first mixed with excess amount (1 uL of 10 nM) of rabbit- IgG-Alexa647 in 997 ul of PBS buffer (with BSA) for 30 min, so analyte molecules were captured or bound by corresponding antibodies.
- This mixture was then incubated with excess amount (e.g., 1 ul of 10 nM) of goat-anti-mouse IgG-PE for another 30 min, so captured analyte molecules could bind with the detectable agents. Although we did the two incubations sequentially in this example, they can be performed in parallel together in the same reaction volume. After incubation, this sample was introduced to a reservoir connected with a microfluidic channel (2 * 2 * 125 pm) made of Poly dimethyl siloxane (PDMS) and glass. The flow of sample was either driven by capillary force and surface chemistry, or by an external vacuum or positive pressure.
- excess amount e.g., 1 ul of 10 nM
- Two excitation laser beams (561 nm, 5 mW and 637 nm, 25 mW) with the emission filter of 585/30 nm and 690/50 nm, respectively, were used to measure the fluorescence from the capture agent (or second detectable agent) and detectable agent.
- fluorophores i.e., Alexa647 and PE
- FIGURE 24A Each of these colocalized events, as shown in FIGURE 24A, indicated the presence of an analyte in the sample as reported by the digital sandwich immunoassay. Fluorescence signals that lacked the colocalized signals from the other channel represented unbound capture (or unbound second detectable agent) or detectable agents.
- This example describes the experimental method and apparatus that enables the digital detection and enumeration and concentration determination of analyte molecules in flow based on sandwiched immunoassay followed by proper purification methods.
- a generalized detection and purification scheme along these lines is illustrated in and described with respect to FIGURE 14.
- Example 2 demonstrated that, if properly designed, digital sandwich immunoassay could be successfully performed without removing the unbound capture and detectable agents, adding such a purification step can be beneficial and improve the efficiency and performance of these assays.
- mouse-anti-rabbit IgG was the model analyte
- rabbit-anti-human IgG conjugated with Alexa647 was the model capture agent (or second detectable agent)
- goat-anti-mouse IgG conjugated with PE was the model detectable agent.
- I uL of 2 nM of mouse-anti-rabbit IgG was first mixed with excess amount (1 uL of 5 nM) of rabbit-anti-human IgG-Alexa647 in 997 ul of PBS buffer (with BSA) for 30 min, so analyte molecules were captured or bound by their corresponding antibodies.
- a proper magnetic field was applied to enrich or associate the magnetic beads with the magnet and/or remove the magnetic beads, so the analyte sandwiched by the capture and detectable agents, as well as unbound capture agents, remained in the solution.
- This sample was introduced to a reservoir connected with a microfluidic channel (2 x 2 x 125 pm constriction) made of Poly dimethylsiloxane (PDMS) and glass.
- PDMS Poly dimethylsiloxane
- Two excitation laser beams (561 nm, 5 mW and 637 nm, 25 mW) with the emission filter of 585/30 nm and 690/50 nm, respectively, were used to measure the fluorescence from the capture agent (or second detectable agent) and detectable agent.
- unbound detectable agents were removed using magnetic beads, every fluorescence peak emitted from Alexa647 shown was colocalized with a signal from PE channel. Fluorescence signals from Alexa647 that lacked the colocalized signal from the channel of PE represent unbound capture agents.
- those two-color colocalized fluorescence events were summarized in the scatter plot (FIGURE 25B), and enumerated to report the concentration of analyte.
- beads or nanoparticles with proper surface modification can be used as capture agents with certain advantages: 1) The composition and size of the beads or nanoparticles can be easily tuned to enhance the compatibility with sample matrix and analytical technologies; 2) Many purification technologies (e.g., size-exclusion chromatography, spin column/filtration, and magnetic separation) can be applied with these beads or nanoparticles to improve the efficiency and accuracy of the assays; 3) The optical properties of the beads or nanoparticles containing capture agents can be tuned (e.g., encoded with spectral-intensity barcodes) to provide another set of read-out signal, so the efficiency and multiplexing can be greatly improved.
- analyte molecules were specifically captured on the surface of fluorescent beads/nanoparticles, labelled by another detectable agent based on immunoaffinity, and then counted based on the digitized two-color colocalization events/emission signals.
- mouse-anti-human CD63 is the model analyte
- fluorescent nanoparticles with CD63 molecules on the surface were used as the model capture agents
- goat-anti-mouse IgG conjugated with Alexa647 were the model detectable agent.
- 1 uL of 2 nM of mouse-anti-human CD63 was first mixed with excess amount (1 uL of 10 nM) of capture agents in 997 ul of PBS buffer (with BSA) for 30 min, so analyte molecules were captured by the beads/nanoparticles containing the capture molecule (CD63). This mixture was then incubated with excess amount (e.g., 1 ul of 10 nM) of goat-anti-mouse IgG-Alexa647 for another 30 min, so captured analyte molecules could bind with detectable agents.
- excess amount e.g., 1 ul of 10 nM
- the sample was introduced to a reservoir connected with a microfluidic channel (2 x 2 x 125 pm) made of Polydimethylsiloxane (PDMS) and glass.
- PDMS Polydimethylsiloxane
- the flow of sample was either driven by capillary force and surface chemistry, or by an external vacuum or positive pressure source.
- Two laser lines (488 nm, 5 mW and 637 nm, 25 mW) with the emission filter of 600/50 nm and 690/50 nm, respectively, were used to measure the fluorescence from the capture agent and detectable agent.
- a suitable purification method e.g., magnetic isolation, size-exclusion chromatography, or spin filtration/centrifugation
- the supernatant was removed from the filtration device, and introduced to a reservoir connected with a microfluidic channel (with a 2 x 2 x 125 pm constriction) made of Polydimethylsiloxane (PDMS) and glass.
- PDMS Polydimethylsiloxane
- the flow of sample was either driven by capillary force and surface chemistry, or by an external vacuum or a positive pressure pump.
- Two excitation laser beams (488 nm, 5 mW and 637 nm, 25 mW) with the emission filter of 600/50 nm and 690/50 nm, respectively, were used to measure the fluorescence from the capture agent and detectable agent.
- This example describes the experimental method and apparatus that enable the digital detection, enumeration, and concentration determination of protein molecules, which were captured and purified using capture agents comprised of antibody conjugated magnetic beads, and identified using a detectable agent (dye-tagged antibody).
- a detection scheme along these lines is more generically illustrated in and described further herein with respect to FIGURE 10B.
- analyte molecules are often sandwiched between a capture agent and a detectable agent.
- the capture agent is magnetic (e.g., magnetic beads)
- unbound detectable agent can be removed conveniently, so fluorescence signals detected from the sample corresponds to capture agent-analyte-detectable agent complex.
- Magentalyte e.g., magnetic beads
- goat-anti-mouse IgG conjugated magnetic beads 200 nm
- rabbit-anti-mouse IgG conjugated with Alexa647 was used as the detectable agent.
- 1 uL of 1 nM of mouse-IgG was first mixed with excess amount (1 uL of 10 nM) of magnetic capture beads in 997 ul of PBS buffer (with BSA) for 30 min, to ensure analyte molecules were captured by the beads.
- This mixture was then incubated with excess amount (e.g., 1 ul of 10 nM) of rabbit-anti-mouse IgG- Alexa647 for another 30 min, so captured analyte molecules were bound with detectable agents.
- excess amount e.g., 1 ul of 10 nM
- FIGURE 27 shows the signal of fluorescence emitted from Alexa647. Because the sample was purified magnetically before loading onto the single-molecule flow analysis platform, each peak in FIGURE 27 represents a single analyte molecule (i.e., mouse-IgG), and the concentration of analyte was precisely measured.
- This example describes the experimental method and apparatus that enable the digital detection and enumeration/concentration determination of protein analyte molecules, which were captured by optically barcoded beads with immobilized capture antibodies, and further confirmed using a detectable agent.
- fluorescent beads can be designed and prepared in a way that each bead has 5 different fluorescent dyes each with a different peak emission wavelength or range of emission, and each of which can have 10 different fluorescence intensity levels per bead (e.g., by tuning the amount of the respective dyes per bead).
- optically barcoded beads can be the ideal capture agents for a highly multiplexed protein assay or nucleic acid assay.
- a model set of 9 optically barcoded beads were prepared. Briefly, a green-fluorescent dye (i.e., Alexa488) and an orange- fluorescent dye (i.e., Alexa561) were immobilized onto polystyrene beads at different ratios, so three types of intensities (i.e., high, medium, and low) could be distinguished with each dye. As shown in FIGURE 28A, nine optical barcodes were thus developed and prepared.
- a detectable agent i.e., goat-anti-mouse-IgG-Alexa647 was also applied, so the presence of the analyte molecule was confirmed and counted when the fluorescence from Alexa647 was colocalized with that of the specific barcode.
- Both barcoded capture beads and detectable agents were in excess amounts compared to the analyte molecules (e.g., molar ratio > 5: 1), to ensure mouse-IgG analyte molecules were captured on beads with the target barcode.
- this sample was introduced to a reservoir connected with a microfluidic channel (with a 2 * 2 * 125 pm constriction) made of Polydimethylsiloxane (PDMS) and glass.
- PDMS Polydimethylsiloxane
- the flow of sample was either driven by capillary force and surface chemistry, or by an external vacuum or a positive pressure.
- Three laser lines (488 nm, 5 mW, 561 nm, 5 mW and 637 nm, 25 mW) equipped with the emission filter of 520/30 nm, 585/30 nm and 690/50 nm, respectively, were used to measure the fluorescence from the capture agent with barcodes and detectable agent.
- a suitable purification method can be applied easily in this example to remove the unbound detectable agents, thereby minimizing the interference from randomly colocalized events.
- this purification process can be easily performed using immunomagnetic isolation as described in a prior example.
- This example describes the experimental method and apparatus that enable the digital detection and enumeration/quantification of nucleic acid molecules with a specific sequence of interest, sandwiched by a capture agent (or second detectable agent) and a detectable agent.
- a detection scheme along these lines is illustrated in and described further herein with respect to FIGURE 15.
- nucleic acid molecules e.g., DNA and RNA
- assays often rely on the amplification of target sequence using polymerase chain reaction (PCR), or other isothermal amplification methods, such as rolling circle amplification.
- PCR polymerase chain reaction
- rolling circle amplification amplification-based methods often suffer from non-specific amplification, the requirement of internal standards (e.g., house-keeping gene) for quantification, and tedious processes for amplification.
- internal standards e.g., house-keeping gene
- single strand (ss) DNA was synthesized as the model target/analyte gene, with the sequence of 5'-ATGGACGACGACATCGCCGCC- CTGGTGGTGGACAACGGCAGCGGCATGTGCAAGGCCGGC-3' (SEQ ID NO: 1).
- ssDNA was synthesized as the capture agent (or second detectable agent) used for this digital dual-affinity nucleic acid sandwich assay, with the sequence of Alexa-647-3 1 - TACCTGCTGCTGTAGCGGCGG-5' (SEQ ID NO: 2).
- Another ssDNA with the sequence of 3'-TCGCCGTACACGTTCCGGCCG-5'-Alexa-546 was prepared as the detectable agent.
- the two shorter ssDNA molecules i.e., capture/ second detectable agent and detectable agent
- capture/ second detectable agent and detectable agent were in excess amount to ensure each target or analyte DNA molecule was bound with the two agents simultaneously.
- this sample was introduced to a reservoir connected with a microfluidic channel (2 * 2 * 125 pm) made of Polydimethylsiloxane (PDMS) and glass, without any further purification process.
- PDMS Polydimethylsiloxane
- Two excitation laser lines (561 nm, 5 mW and 637 nm, 25 mW) equipped with the emission filter of 585/30 nm and 690/50 nm, respectively, were used to measure the fluorescence from the capture agent and detectable agent.
- the example trace in FIGURE 29 shows seven events with colocalized fluorescence signals from Alexa546 and Alexa647, indicating the presence of seven copies of the target or analyte sequence. Other peaks in either Alexa546 or Alexa647 channel could not be colocalized with the peaks in the other channels, indicating they were unbound capture/ second detectable agents or detectable agents.
- This example describes the experimental method and apparatus that enable the digital detection and quantification of nucleic acid with a specific sequence of interest, sandwiched by a detectable agent and a capture agent comprising of a magnetic bead.
- a detection scheme along these lines is illustrated in and described further herein with respect to FIGURE 12B.
- target sequence binds with two complementary sequences, one of which can be considered as the capture/ second detectable agent. If a magnetic bead is conjugated with this capture sequence, unbound detectable agents (i.e., the other complementary sequence) can be removed conveniently, so fluorescent molecules in the sample correspond to a copy of the target or analyte gene.
- ssDNA was synthesized as the model target gene, with the sequence of 5'- ATGGACGACGACATCGCCGCCCTGGTGGTGGACAACGGCAGCGGCATGTGCAAG GCCGGC-3' (SEQ ID NO: 1).
- This example clearly demonstrates that the digital dual-affinity assay performed on the single-molecule flow platform enables the direct counting and quantification of the target gene, without the need of amplification and/or calibration of signals.
- Magnetic beads were covalently coupled with ssDNA (5'- GCCGGCCTTGCACATGCCGC-3' (SEQ ID NO: 4)) at the 5'-end, so they could be used as the magnetic capture agents.
- Another ssDNA with the sequence of Alexa-647-3'- TACCTGCTGCTGTAGCGGCGG-5' (SEQ ID NO: 2) was used the detectable agent.
- the two shorter ssDNA molecules i.e., capture and detectable agent
- capture and detectable agent were in excess amount to ensure target/analyte DNA molecules were bound with the two agents simultaneously.
- a proper magnetic field was applied to enrich capture beads at the bottom of the sample, so unbound detectable agents remained in the solution phase, and were thus removed from the sample by removing the supernatant.
- this sample was introduced to a reservoir connected with a microfluidic channel (with a 2 * 2 * 125 pm constriction) made of Polydimethylsiloxane (PDMS) and glass.
- PDMS Polydimethylsiloxane
- An excitation laser beam (637 nm, 25 mW) with the emission filter of 690/50 nm was used to measure the fluorescence from the detectable agent that was bound with the target/analyte gene captured by the magnetic beads.
- the example trace in FIGURE 30 shows 13 events with the fluorescence from Alexa647, indicating the presence of 13 copies of the target sequence.
- This example describes the experimental method and apparatus that enable the digital single-molecule detection and quantification of nucleic acid with the target sequence, which were captured by optically barcoded magnetic beads and bound with a detectable agent.
- a detection scheme along these lines is illustrated in and described further herein with respect to FIGURE 12.
- utilizing optically barcoded capture beads enables multiplexed digital dual-affinity assays, so multiple types of analyte molecules can be detected quantitatively in one measurement.
- the nucleic acid molecule with a specific sequence can be selectively captured by a barcoded agent, detection and quantification of multiple gene sequences in the same sample can be carried out. It is a critically important feature for molecular diagnostics and many other applications, in which multiplexed analysis of genes is often required or highly desired.
- the barcoded capture agent is also magnetic, unbound probes after hybridization can be removed from the sample, to minimize the interference from random colocalization of signals.
- a model library with 9 optically barcoded magnetic beads were prepared. Briefly, a green fluorescence dye (i.e., Alexa488) and an orange fluorescence dye (Alexa561) were immobilized onto magnetic beads at different ratios, so three types of intensities could be observed in each fluorescence channel (i.e., high, medium, and low). As shown in FIGURE 31 A, nine optical barcodes were prepared. Only the beads with a specific code (i.e., G1O3) was further modified with the capture sequence (5'- GCCGGCCTTGCACATGCCGC-3' (SEQ ID NO: 4)) at the 5'-end, which can be considered as the capture agent.
- a specific code i.e., G1O3
- ssDNA (5'- ATGGACGACGACATCGCCGCCCTGGTGGTGGACAACGGCAGCGGCATGTGCAAG GCCGGC-3' (SEQ ID NO: 1)) was used as the model target gene, while another ssDNA with the sequence of Alexa-647-3'-TACCTGCTGCTGTAGCGGCGG-5' (SEQ ID NO: 2) was used as the detectable agent. Capture beads with all the other eight barcodes were surface modified with a ssDNA that could not bind with target gene to ensure the specificity of the assay.
- Both barcoded capture beads and detectable agents were in excess amounts compared to the target gene molecules (e.g., molar ratio > 5 : 1), to ensure the target sequence was captured on the bead with that specific barcode as well as associated with the detectable agent.
- a proper magnetic field was applied to retain the magnetic beads with the captured target analyte gene molecule so the unbound detectable agents could be removed by pipetting away the solution containing the unbound detectable agents.
- This sample was introduced to a reservoir connected with a microfluidic channel (with a 2 * 2 * 125 pm constriction) made of Polydimethylsiloxane (PDMS) and glass.
- PDMS Polydimethylsiloxane
- Three excitation laser lines (488 nm, 5 mW, 561 nm, 5 mW and 637 nm, 25 mW) with the corresponding emission filter of 520/30 nm, 585/30 nm and 690/50 nm, respectively, were used to measure the fluorescence from the capture agent with barcodes and the detectable agent.
- This example describes the experimental method and apparatus that enable the digital detection and quantification of nucleic acid with the target sequence, using one hybridization or affinity event.
- a detection scheme along these lines is more generically illustrated in and described further herein with respect to FIGURE 16.
- DNA binding dyes e.g., DAPI, Hoechst, YOYO-4, and DRAQ-5
- DAPI double strand
- YOYO-4 a DNA binding dye that has high fluorescence
- DRAQ-5 DNA binding dyes that have high fluorescence when they intercalate into the double strand (ds) nucleic acid structures, but normally do not exhibit strong fluorescence when there is no hybridized dsDNA in the sample.
- digital detection of a specific DNA sequence of interest can be enabled on the single-molecule flow platform.
- a ssDNA with the sequence of 5'-ATGGACGACGACATCGCCGCC- 3' was used as the model target gene
- another ssDNA with the complementary sequence (3'-TACCTGCTGCTGTAGCGGCGC-5' (SEQ ID NO: 6)) was used as the detectable agent, and was in excess amount compared to the target or analyte gene molecule, so the target gene was hybridized with the complementary sequence to form a dsDNA after incubation for 30 min.
- a DNA dye i.e., YOYO-3 was incubated with the sample solution for 30 min in dark.
- FIGURE 32 shows the example trace of fluorescence signal emitted from YOYO-3.
- This example describes the experimental method and apparatus that enable the digital detection and quantification of nucleic acid with the target sequence, using one hybridization process and two-color colocalization.
- a detection scheme along these lines is more generically illustrated in and discussed further herein with respect to FIGURE 16A.
- this example describes a modified method. Briefly, a ssDNA with the sequence of 5'-ATGGACGACGACATCGCCGCC-3' (SEQ ID NO: 5) was used as the model target gene, while another ssDNA with the complementary sequence (3'- TACCTGCTGCTGTAGCGGCGC-5' (SEQ ID NO: 6)) was used as a hybridization detectable agent that was applied in excess amount compared with the target or analyte gene molecule, so the target gene was hybridized with the complementary sequence of the detectable agent to form a dsDNA after the incubation of 30 min.
- This hybridization detectable agent was also conjugated with Alexa647 (red fluorescence) at its 3'-end to generate a fluorescence signal specific to the target gene when the detectable agent was hybridized with the target gene.
- a DNA dye i.e., YOYO-3 was then incubated with the sample solution for 30 min. This sample was introduced to a reservoir connected with a microfluidic channel (with a 2 * 2 * 125 pm constriction) made of Poly dimethyl siloxane (PDMS) and glass. The flow of sample was either driven by capillary force and surface chemistry, or by an external pressure source.
- Two laser beams (561 nm, 5 mW, and 637 nm, 25 mW) were used as the excitation light source, with the emission filter of 610/20 nm and 690/60 nm, respectively, to measure the fluorescence from YOYO-3 intercalated into the hybridized dsDNA and the Alexa647 conjugated with the detectable DNA agent.
- FIGURE 33 shows the example trace of fluorescence signal emitted from these two fluorophores. Because the DNA intercalation dye only emitted strong fluorescence when it was intercalated into dsDNA, each peak in this channel that could be colocalized with a peak in the channel of Alexa647, signaled the presence of a target gene. When multiple genes are in the sample, a mixture of detectable DNA molecules, each of which is conjugated with a different dye or fluorescence barcode as described in previous examples, are used to label the sample. The specific fluorescence correlated to each detectable agent sequence complementary to the target sequence, further colocalized with the intercalated DNA dye, indicates the presence of the corresponding target gene, and thus enables multiplexed digital single-affinity nucleic acid assay.
- EXAMPLE 12 DIGITAL SINGLE- AFFINITY ASSAY USING BARCODED
- This example describes the experimental method and apparatus that enable the digital detection and enumeration of a target molecule (analyte) tagged or associated with a fluorescent probe, using capture agent with barcoded fluorescence.
- Fluorescent tagging has been widely used to detect and quantify non-fluore scent analyte (e.g., proteins, nucleic acid, and small molecules).
- analyte e.g., proteins, nucleic acid, and small molecules.
- the present Example demonstrates a method, in which a capture agent (e.g., micro- or nano-particles) with barcoded fluorescence ensures the selectivity of the analysis (FIGURE 34A), while the accuracy is improved by multicolor colocalization performed at the single-molecule level.
- every capture agent that flows past the detection region can be counted. If the signal from one capture agent is colocalized with the signal associated with the analyte, it is considered as a “positive” count.
- a protein, streptavidin is used as a model analyte, which was further tagged or associated with a fluorescent probe (e.g., PE, orange (O)).
- a fluorescent probe e.g., PE, orange (O)
- Polystyrene beads 40 nm, 200 nm, 1000 nm, or 2000 nm with biotin immobilized on the surface were used as capture agents. These beads were also encoded with blue (B, Ex488/Em515) and purple (G, Ex405/Em515) colors as a specific “barcode.”
- Streptavidin-PE was mixed with an excess amount of fluorescent (blue and purple color encoded) barcoded biotin beads for 30 min at room temperature.
- this sample could be further purified using centrifugation and/or size-exclusion chromatography. After incubation and optional purification process, this sample was introduced to a reservoir connected with a microfluidic channel (either with a 2 * 2 * 125 pm constriction or with a 5 x 5 x 125 pm constriction) made of PDMS and glass. The flow of sample was either driven by capillary force and surface chemistry, or by an external vacuum applied to the outlet reservoir.
- a microfluidic channel either with a 2 * 2 * 125 pm constriction or with a 5 x 5 x 125 pm constriction
- Three laser lines (405 nm: 20 mW, 488 nm: 5 mW, and 561 nm: 5 mW) with corresponding emission filters were used to measure the fluorescence from the capture agent and analyte (B: Ex488/Em515, P: Ex405/Em515, and O: Ex561/Em585).
- the concentration of analyte can be quantified as 5.55 x 10 7 molecules/mL, which equals to 92 fM, an extremely low concentration that is normally difficult to be measured using other methods.
Landscapes
- Health & Medical Sciences (AREA)
- Immunology (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Dispersion Chemistry (AREA)
- Hematology (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Signal Processing (AREA)
- Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202163263864P | 2021-11-10 | 2021-11-10 | |
| PCT/US2022/079493 WO2023086794A1 (en) | 2021-11-10 | 2022-11-08 | Systems and methods for digital affinity-based detection assays |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP4430408A1 true EP4430408A1 (en) | 2024-09-18 |
| EP4430408A4 EP4430408A4 (en) | 2025-09-03 |
Family
ID=86336771
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP22893789.2A Pending EP4430408A4 (en) | 2021-11-10 | 2022-11-08 | SYSTEMS AND METHODS FOR DIGITAL AFFINITY-BASED DETECTION TESTS |
Country Status (4)
| Country | Link |
|---|---|
| EP (1) | EP4430408A4 (en) |
| JP (1) | JP2024544905A (en) |
| CN (1) | CN118679391A (en) |
| WO (1) | WO2023086794A1 (en) |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7858307B2 (en) * | 2005-08-09 | 2010-12-28 | Maxwell Sensors, Inc. | Light transmitted assay beads |
| WO2015002975A1 (en) * | 2013-07-05 | 2015-01-08 | University Of Washington Through Its Center For Commercialization | Methods, compositions and systems for microfluidic assays |
| WO2015117163A2 (en) * | 2014-02-03 | 2015-08-06 | Integrated Dna Technologies, Inc. | Methods to capture and/or remove highly abundant rnas from a heterogeneous rna sample |
| CN107209095A (en) * | 2014-11-28 | 2017-09-26 | 奇普凯尔公司 | Multiple pearl array is determined |
| AU2020361681A1 (en) * | 2019-10-10 | 2022-05-05 | 1859, Inc. | Methods and systems for microfluidic screening |
-
2022
- 2022-11-08 EP EP22893789.2A patent/EP4430408A4/en active Pending
- 2022-11-08 WO PCT/US2022/079493 patent/WO2023086794A1/en not_active Ceased
- 2022-11-08 CN CN202280079990.5A patent/CN118679391A/en active Pending
- 2022-11-08 JP JP2024527427A patent/JP2024544905A/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| EP4430408A4 (en) | 2025-09-03 |
| WO2023086794A1 (en) | 2023-05-19 |
| JP2024544905A (en) | 2024-12-05 |
| CN118679391A (en) | 2024-09-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7076092B2 (en) | High-throughput, dual probe biological assays based on single molecule detection | |
| US12313519B2 (en) | Method and apparatus for flow-based, single-particle and/or single-molecule analysis | |
| US20260014561A1 (en) | Methods and apparatus for single biological nanoparticle analysis | |
| EP1558934B1 (en) | A method for assessment of particles | |
| CA2458802C (en) | Rapid and sensitive detection of molecules | |
| CN102165305B (en) | Detection system and method | |
| US20060068412A1 (en) | Integrated multistep bioprocessor and sensor | |
| KR101799163B1 (en) | Optical probe for the biosensor, optical biosensor having the optical probe, and method of manufacturing optical marker for the biosensor | |
| US9551030B2 (en) | Filter architecture for analytical devices | |
| US20060129327A1 (en) | Ultrasensitive sensor and rapid detection of analytes | |
| US20230333020A1 (en) | A diagnostic device suitable for detection of pathogens, and detection methods using such a device | |
| CA2829178A1 (en) | Rapid quantification of biomolecules in a selectively functionalized nanofluidic biosensor and method thereof | |
| EP3329279A2 (en) | Decoding methods for multiplexing assays and associated fluidic devices, kits, and solid supports | |
| JP2013511713A (en) | Improved fluorescence detection and method | |
| CN103733047B (en) | Detection methods of target particles | |
| US20040023229A1 (en) | Direct detection of individual molecules | |
| Stanley et al. | Opto-digital molecular analytics | |
| WO2023086794A1 (en) | Systems and methods for digital affinity-based detection assays | |
| JP2007003401A (en) | Sample analyzer | |
| US20060024815A1 (en) | High sensitivity array-based detection system | |
| US20060148103A1 (en) | Highly sensitive biological assays | |
| Simon et al. | Chemical Tests | |
| WO2022008931A1 (en) | Improvements in or relating to an apparatus for imaging |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20240605 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20250805 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: G01N 35/08 20060101AFI20250730BHEP Ipc: G01N 15/14 20240101ALI20250730BHEP Ipc: G01N 35/10 20060101ALI20250730BHEP Ipc: G01N 33/543 20060101ALI20250730BHEP Ipc: B03C 1/01 20060101ALI20250730BHEP Ipc: B03C 1/28 20060101ALI20250730BHEP Ipc: G01N 1/34 20060101ALI20250730BHEP Ipc: G01N 15/06 20240101ALI20250730BHEP Ipc: G01N 15/1429 20240101ALI20250730BHEP Ipc: G01N 15/1434 20240101ALI20250730BHEP Ipc: B03C 1/30 20060101ALI20250730BHEP Ipc: G01N 15/10 20240101ALI20250730BHEP |