EP4402260A1 - Compounds and methods for reducing dnm1l or drp1 expression - Google Patents

Compounds and methods for reducing dnm1l or drp1 expression

Info

Publication number
EP4402260A1
EP4402260A1 EP22870970.5A EP22870970A EP4402260A1 EP 4402260 A1 EP4402260 A1 EP 4402260A1 EP 22870970 A EP22870970 A EP 22870970A EP 4402260 A1 EP4402260 A1 EP 4402260A1
Authority
EP
European Patent Office
Prior art keywords
modified
nucleobase
modified oligonucleotide
oligomeric compound
sugar moiety
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP22870970.5A
Other languages
German (de)
French (fr)
Inventor
Susan M. Freier
Huynh-Hoa Bui
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ionis Pharmaceuticals Inc filed Critical Ionis Pharmaceuticals Inc
Publication of EP4402260A1 publication Critical patent/EP4402260A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/712Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes
    • C12N2320/11Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids

Definitions

  • oligomeric agents for reducing DNM1L, and in certain instances reducing DRP1, as well as uses thereof for ameliorating at least one symptom of a kidney disease or kidney injury and treatment of a cardiac disorder or cardiac injury.
  • Kidney diseases and kidney injuries can prevent kidneys from functioning properly.
  • the kidney’s main function is to filter and eliminate waste and fluids from the body.
  • Symptoms of kidney diseases and injuries include, but are not limited to, nausea, vomiting, loss of appetite, reduced urine output, elevated serum creatinine levels, muscle cramping, swelling, itching, chest pain, shortness of breath and elevated blood pressure.
  • Acute kidney injury (AKI) is an abrupt loss in kidney function. Individuals with diabetes, cancer, cardiovascular disease and human immunodeficiency virus (HIV) acquired immune deficiency syndrome (AIDS), or who have recently undergone a surgical procedure, are at risk for AKI.
  • HIV human immunodeficiency virus
  • An individual with an increase in serum creatinine of at least 26.4 pmol/L (0.3 mg/dL), a percentage increase in serum creatinine of more than 50% from baseline, or a reduction in urine output ( ⁇ 0.5 mL/kg hourly for > 6 h) may be diagnosed with AKI. Furthermore, if the acute loss of kidney function extends beyond seven days, the episode is reclassified as acute kidney disease (AKD). Finally, if the condition persists for more than three months it is again reclassified as chronic kidney disease or CKD.
  • CKD also referred to as chronic kidney failure, is a gradual loss of kidney function that can progress to end stage renal disease (ESRD). Kidney diseases and injuries may be treated with fluid replacement and dialysis. However, if not treated sufficiently, they may result in heart failure and/or death.
  • Mitochondria are highly dynamic organelles that produce ATP and maintain metabolic, catabolic, and redox homeostasis.
  • the dynamic nature of mitochondria is due to their ability to constantly divide and fuse - processes that are believed to be regulated in part by a key mediator of mitochondrial fission, Dynamin-related protein 1 (DRP1).
  • DRP1 is encoded by the DNM1L gene. Mitochondrial fission and fusion are known to influence mitochondrial morphology and function, and mitophagy represents a key mechanism governing mitochondrial quality and abundance. Regulation of mitochondrial dynamics, in particular modulation of aberrant DRP1 mediated fission, is a potential target for therapeutic intervention.
  • Oligomeric agents, oligomeric compounds, modified oligonucleotides, methods, and pharmaceutical compositions of certain embodiments described herein are useful for reducing or inhibiting DNM1L expression in a cell or animal.
  • DNM1L RNA or protein levels can be reduced in a cell or animal.
  • methods of treating a disorder associated with mitochondrial equilibrium for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
  • the kidney disorder may be associated with sepsis, cardiovascular surgery, exposure to nephrotoxic drugs, and/or trauma.
  • oligomeric agents, oligomeric compounds, modified oligonucleotides, methods, and pharmaceutical compositions provided herein may improve a symptom of kidney disease or kidney injury.
  • Symptoms of kidney diseases and injuries include, but are not limited to, nausea, vomiting, loss of appetite, reduced urine output, elevated serum creatinine levels, muscle cramping, swelling, itching, chest pain, shortness of breath and elevated blood pressure.
  • side means a nucleoside according to the structure: , wherein Bx is a nucleobase.
  • “2 ’-deoxy sugar moiety” means the sugar moiety of a 2’-deoxynucleoside. As indicated in the above structure, a 2’-deoxy sugar moiety can have any stereochemistry.
  • 2’-deoxy sugar moieties include, but are not limited to 2’-p-D-deoxyribosyl sugar moieties and 2’-p-D-deoxyxylosyl sugar moieties.
  • “2’-p-D-deoxyribosyl nucleoside” means a nucleoside according to the structure: , wherein Bx is a nucleobase.
  • “2’-p-D-deoxyribosyl sugar moiety” means the sugar moiety of a 2’-p-D-deoxyribosyl nucleoside.
  • the nucleobase of a 2’-deoxynucleoside or 2’-p-D-deoxyribosyl nucleoside may be a modified nucleobase or any natural nucleobase, including but not limited to an RNA nucleobase (uracil).
  • “Ribo-2’-MOE nucleoside” means a nucleoside according to the structure: herein Bx is a nucleobase.
  • “Ribo-2’-MOE sugar moiety” means the sugar moiety of a 2 ’-MOE nucleoside as defined herein.
  • MOE means an -OCH2CH2OCH3 group.
  • “2’-OMe nucleoside” means a nucleoside according to the structure: , wherein Bx is a nucleobase.
  • “2’-OMe sugar moiety” means the sugar moiety of a 2’-OMe nucleoside. As indicated in the above structure, a 2’-OMe sugar moiety can have any stereochemistry.
  • 2’-OMe sugar moieties include, but are not limited to 2’-OCH 3 -p-D-xylosyl sugar moieties, 2’-OCH 3 -a-L-ribosyl sugar moieties, and ribo-2’-OMe sugar moieties as defined herein.
  • “Ribo-2’-OMe nucleoside” means a nucleoside according to the structure: , wherein Bx is a nucleobase.
  • Ribo-2’-OMe sugar moiety means the sugar moiety of a ribo-2’-OMe nucleoside.
  • “2’-F nucleoside” means a nucleoside according to the structure: , wherein Bx is a nucleobase.
  • “2’-F sugar moiety” means the sugar moiety of a 2’-F nucleoside. As indicated in the above structure, a 2’-F sugar moiety can have any stereochemistry.
  • 2’-F sugar moieties include, but are not limited to, 2’-F-P-D- xylosyl sugar moieties, 2’-F-p-D-arabinosyl sugar moieties, 2’-F-a-L-ribosyl sugar moieties, and ribo-2’-F sugar moieties as defined herein.
  • “Ribo-2’-F nucleoside” means a nucleoside according to the structure: , wherein Bx is a nucleobase.
  • Ribo-2’-F sugar moiety means the sugar moiety of a ribo-2’-F nucleoside as defined herein.
  • 2’-NMA nucleoside means a nucleoside according to the structure: , wherein Bx is a nucleobase.
  • “2’-NMA sugar moiety” means the sugar moiety of a 2’-NMA nucleoside.
  • Ribo-2’-NMA nucleoside means a nucleoside according to the structure: , wherein Bx is a nucleobase.
  • Ribo-2’-NMA sugar moiety means the sugar moiety of a ribo-2’-NMA nucleoside.
  • “2 ’-substituted” in reference to a sugar moiety means a furanosyl sugar moiety comprising at least one 2'-substituent group other than H or OH.
  • “2 ’-substituted nucleoside” means a nucleoside comprising a 2’-substituted furanosyl sugar moiety.
  • 3’ target site refers to the 3 ’-most nucleotide of a target nucleic acid which is complementary to an antisense oligonucleotide, when the antisense oligonucleotide is hybridized to the target nucleic acid.
  • 5’ target site refers to the 5 ’-most nucleotide of a target nucleic acid which is complementary to an antisense oligonucleotide, when the antisense oligonucleotide is hybridized to the target nucleic acid.
  • 5-methylcytosine means a cytosine modified with a methyl group attached to the 5-position.
  • a 5-methylcytosine is a modified nucleobase.
  • abasic sugar moiety means a sugar moiety of a nucleoside that is not attached to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as “abasic nucleosides.”
  • administering means providing a pharmaceutical agent to a subject.
  • amelioration in reference to a treatment means improvement in at least one symptom relative to the same symptom in the absence of the treatment.
  • amelioration is the reduction in the severity or frequency of a symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom.
  • antisense activity means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.
  • antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
  • antisense activity is the modulation of splicing of a target pre-mRNA.
  • antisense agent means an antisense compound and optionally one or more additional features, such as a sense compound.
  • antisense compound means an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group.
  • antisense oligonucleotide means an oligonucleotide, including the oligonucleotide portion of an antisense compound, that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity.
  • Antisense oligonucleotides include but are not limited to antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.
  • bicyclic sugar or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure, wherein the first ring of the bicyclic sugar moiety is a furanosyl ring.
  • bicyclic sugar moieties include LNA (locked nucleic acid) sugar moiety and cEt sugar moiety as defined herein.
  • a “bicyclic nucleoside” is a nucleoside comprising a bicyclic sugar moiety.
  • cell-targeting moiety means a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.
  • chirally enriched in reference to a population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom as defined herein. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers.
  • the molecules are modified oligonucleotides.
  • the molecules are oligomeric compounds comprising modified oligonucleotides.
  • the chiral center is at the phosphorous atom of a phosphorothioate intemucleoside linkage. In certain embodiments, the chiral center is at the phosphorous atom of a mesyl phosphoramidate intemucleoside linkage.
  • cleavable moiety means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
  • oligonucleotide in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions.
  • “Complementary region” in reference to a region of an oligonucleotide means that at least 70% of the nucleobases of that region and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions.
  • Complementary nucleobases mean nucleobases that are capable of forming hydrogen bonds with one another.
  • Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine ( m C) and guanine (G).
  • Certain modified nucleobases that pair with natural nucleobases or with other modified nucleobases are known in the art and are not considered complementary nucleobases as defined herein unless indicated otherwise.
  • inosine can pair, but is not considered complementary, with adenosine, cytosine, or uracil.
  • Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside.
  • oligonucleotides are complementary to another oligonucleotide or nucleic acid at each nucleoside of the oligonucleotide.
  • conjugate group means a group of atoms that is directly attached to an oligonucleotide.
  • Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
  • conjugate linker means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
  • conjugate moiety means a covalently bound group of atoms that modifies one or more pharmacological properties of a molecule compared to the identical molecule lacking the conjugate moiety, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.
  • constrained ethyl nucleoside or “cEt nucleoside” means , wherein Bx is a nucleobase
  • Consstrained ethyl or “cEf ’ or “cEt sugar moiety” means the sugar moiety of a cEt nucleoside.
  • deoxy region means a region of 5-12 contiguous nucleotides, wherein at least 70% of the nucleosides comprise a 2’-deoxy sugar moiety.
  • a deoxy region is the gap of a gapmer.
  • oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or intemucleoside linkages that are immediately adjacent to each other.
  • contiguous nucleobases means nucleobases that are immediately adjacent to each other in a sequence.
  • double-stranded refers to a region of hybridized nucleic acid(s). In certain embodiments, such double-strand results from hybridization of an oligonucleotide (or portion thereof) to a target region of a transcript. In certain embodiments, a double-strand results from hybridization of two oligonucleotides (or portions thereof) to one another. In certain embodiments, the hybridized regions are portions (including the entirety) of two separate molecules (e.g., no covalent bond connects the two complementary strands together). In certain embodiments, the hybridized regions are portions of the same molecule that have hybridized (e.g., a hairpin structure).
  • duplex means a structure formed by two separate nucleic acid molecules at least a portion of which are complementary and that are hybridized to one another, but are not covalently bonded to one another.
  • gapmer means a modified oligonucleotide comprising an internal region positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions, and wherein the modified oligonucleotide supports RNAse H cleavage.
  • the internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.”
  • the internal region is a deoxy region.
  • the positions of the internal region or gap refer to the order of the nucleosides of the internal region and are counted starting from the 5 ’-end of the internal region.
  • each nucleoside of the gap is a 2’-deoxynucleoside.
  • the gap comprises one 2’-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2’-deoxynucleosides.
  • MOE gapmer indicates a gapmer having a gap comprising 2’ - deoxynucleosides and wings comprising 2 ’-MOE nucleosides.
  • the term “mixed wing gapmer” indicates a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified intemucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.
  • hotspot region is a range of nucleobases on a target nucleic acid that is amenable to reduction of the amount or activity of the target nucleic acid by the action of an oligomeric agent, oligomeric compound, antisense compound, or antisense agent.
  • hybridization means the annealing of oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
  • complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target.
  • intemucleoside linkage is the covalent linkage between adjacent nucleosides in an oligonucleotide.
  • modified intemucleoside linkage means any intemucleoside linkage other than a phosphodiester intemucleoside linkage.
  • linked nucleosides are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).
  • linker-nucleoside means an RNA or DNA nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety through at least one labile bond. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.
  • mismatch or “non-complementary” means a nucleobase of a first nucleic acid sequence that is not complementary with the corresponding nucleobase of a second nucleic acid sequence or target nucleic acid when the first and second nucleic acid sequences are aligned.
  • motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.
  • modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.
  • modified sugar moiety means a sugar moiety of a nucleoside other than 2’-p-D-deoxyribosyl sugar moiety (the sugar moiety of unmodified DNA) or p-D-ribosyl sugar moiety (the sugar moiety of unmodified RNA).
  • non-bicyclic modified sugar moiety means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
  • nucleobase means an unmodified nucleobase or a modified nucleobase.
  • a nucleobase is a heterocyclic moiety.
  • an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G).
  • a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one other nucleobase.
  • a “5-methylcytosine” is an example of a modified nucleobase.
  • a universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
  • nucleobase sequence means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or intemucleoside linkage modification.
  • nucleoside means a compound or fragment of a compound comprising a nucleobase and a sugar moiety.
  • the nucleobase and sugar moiety are each, independently, unmodified or modified.
  • oligomeric agent means an oligomeric compound and optionally one or more additional features, such as a second oligomeric compound.
  • An oligomeric agent may be a single-stranded oligomeric compound or may be an oligomeric duplex formed by two complementary oligomeric compounds.
  • oligomeric compound means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
  • An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired.
  • a “singled-stranded oligomeric compound” is an unpaired oligomeric compound.
  • oligomeric duplex means a duplex formed by two oligomeric compounds having complementary nucleobase sequences.
  • oligonucleotide means a strand of linked nucleosides connected via intemucleoside linkages, wherein each nucleoside and intemucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides.
  • modified oligonucleotide means an oligonucleotide comprising one or more modified nucleosides or having one or more modified intemucleoside linkages.
  • unmodified oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or intemucleoside modifications.
  • pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, symps, slurries, suspension and lozenges for the oral ingestion by a subject.
  • a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.
  • pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
  • a pharmaceutical composition means a mixture of substances suitable for administering to a subject.
  • a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution.
  • a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
  • prodrug means a therapeutic agent in a first form outside the body that is converted to a second form within an animal or cells thereof.
  • conversion of a prodmg within the animal is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.
  • an enzymes e.g., endogenous or viral enzyme
  • the first form of the prodmg is less active than the second form.
  • RNAi agent means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
  • RNAi agents include, but are not limited to double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics.
  • RNAi agents may comprise conjugate groups and/or terminal groups.
  • an RNAi agent modulates the amount and/or activity, of a target nucleic acid.
  • the term RNAi agent excludes antisense agents that act through RNase H.
  • RNase H agent means an antisense agent that acts through RNase H to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
  • RNase H agents are singlestranded.
  • RNase H agents are double-stranded.
  • RNase H agents may comprise conjugate groups and/or terminal groups.
  • an RNase H agent modulates the amount and/or activity of a target nucleic acid.
  • the term RNase H agent excludes antisense agents that act principally through RISC/Ago2.
  • oligonucleotide that at least partially hybridizes to itself.
  • sense compound means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.
  • sense oligonucleotide means an oligonucleotide, including the oligonucleotide portion of a sense compound, that is capable of hybridizing to an antisense oligonucleotide.
  • stabilized phosphate group means a 5 ’-phosphate analog that is metabolically more stable than a 5 ’-phosphate as naturally occurs on DNA or RNA.
  • standard cell assay means the assays described in the Examples and reasonable variations thereof.
  • stereorandom or “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center that is not controlled during synthesis, or enriched following synthesis, for a particular absolute stereochemical configuration.
  • the stereochemical configuration of a chiral center is random when it is the result of a synthetic method that is not designed to control the stereochemical configuration.
  • the number of molecules having the (S) configuration of the stereorandom chiral center may be the same as the number of molecules having the (R) configuration of the stereorandom chiral center (“racemic”).
  • the stereorandom chiral center is not racemic because one absolute configuration predominates following synthesis, e.g., due to the action of non-chiral reagents near the enriched stereochemistry of an adjacent sugar moiety.
  • the stereorandom chiral center is at the phosphorous atom of a stereorandom phosphorothioate or mesyl phosphoramidate intemucleoside linkage.
  • subject means a human or non-human animal. In certain embodiments, the subject is a human.
  • sugar moiety means any sugar moiety described herein and may be an unmodified sugar moiety or a modified sugar moiety.
  • unmodified sugar moiety means a -D-ribosyl moiety, as found in natural RNA (an “unmodified RNA sugar moiety”), or a 2’- -D-deoxyribosyl sugar moiety, as found in natural DNA (an “unmodified DNA sugar moiety”).
  • modified sugar moiety or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
  • sugar surrogate means a moiety that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group in an oligonucleotide, but which is not a furanosyl sugar moiety or a bicyclic sugar moiety.
  • Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.
  • sugar surrogates include GNA (glycol nucleic acid), FHNA (fluoro hexitol nucleic acid), morpholino, and other structures described herein and known in the art.
  • symptom means any physical feature or test result that indicates the existence or extent of a disease or disorder. In certain embodiments, a symptom is apparent to a subject or to a medical professional examining or testing said subject.
  • target nucleic acid and “target RNA” mean a nucleic acid that an oligomeric compound is designed to affect.
  • Target RNA means an RNA transcript and includes pre-mRNA and mRNA unless otherwise specified.
  • target region means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
  • terminal group means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
  • treating means improving a subject’s disease or condition by administering an oligomeric agent or oligomeric compound described herein.
  • treating a subject improves a symptom relative to the same symptom in the absence of the treatment.
  • treatment reduces in the severity or frequency of a symptom, or delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom.
  • terapéuticaally effective amount means an amount of a pharmaceutical agent or composition that provides a therapeutic benefit to an animal. For example, a therapeutically effective amount improves a symptom of a disease.
  • Embodiment 1 An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of a DNM1L nucleic acid, and wherein at least one sugar moiety of the modified oligonucleotide is a modified sugar moiety and at least one intemucleoside linkage of the modified oligonucleotide isa modified intemucleoside linkage.
  • Embodiment 2 The oligomeric compound of embodiment 1, wherein the DNM1L nucleic acid has the nucleobase sequence of any of SEQ ID NOs: 1 or 2.
  • Embodiment s The oligomeric compound of embodiment 1 or 2, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 3238-3253, 3370- 3385, 3405-3420, 3435-3450, 3439-3454, 3440-3455, 3441-3456, 3442-3457, 3443-3458, 3560-3575, 3561-3576, 3710-
  • 36033 36019-36034, 36020-36035, 36021-36036, 36023-36038, 36024-36039, 36025-36040, 36027-36042, 36054
  • 60630 60616-60631, 60617-60632, 60690-60705, 60773-60788, 60872-60887, 60997-61012, 60998-61013, 61002-
  • Embodiment 4 The oligomeric compound of any of embodiments 1-3, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 39-54, 171-186, 206-221, 236-251, 240-255, 241-256, 242-257, 243-258, 244-259, 341-356, 342-357, 343-358, 361-376, 376-391, 499- 514, 501-516, 504-519, 572-587, 574-589, 576-591, 578-593, 579-594, 580-595, 581-596, 582-597, 583-598, 584-599, 586-601, 587-602, 588-603, 589-604, 602-617, 617-632, 623-638, 624-639, 626-641, 628-643, 630-645, 669-684, 670- 685, 703-718, 704-719, 70
  • Embodiment 5 The oligomeric compound of any of embodiments 1-4, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 31654-31669, 34257-34272, 34258-34273, 34298-34313, 34331-34346, 37266-37281, 38988-39003, 46554-46569, 46573-46588, 63191-63206, 63344-63359, or 67414-67429 of SEQ ID NO: 1.
  • oligomeric compound of any of embodiments 1-5 wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the DNM1L nucleic acid.
  • Embodiment 7 The oligomeric compound of embodiment 6, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of any of the nucleobase sequences of any of SEQ ID NOs: 12-2620.
  • Embodiment 8 The oligomeric compound of embodiment 7, wherein the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 12-2620.
  • Embodiment 9 The oligomeric compound of embodiment 8, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any of SEQ ID NOs: 12-2620.
  • Embodiment 10 The oligomeric compound of any of embodiments 7-9, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2608, 2609, 2610, 2611, 2612, 2613, 2614, 2615, 2617, 2618, 2619, or 2620.
  • Embodiment 11 The oligomeric compound of embodiment 10, wherein the nucleobase sequence of the modified oligonucleotide consists of 15 to 80 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 2608, 2609, 2610, 2611, 2612, 2613, 2614, 2615, 2617, 2618, 2619, or 2620.
  • Embodiment 12 The oligomeric compound of embodiment 11, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 2608, 2609, 2610, 2611, 2612, 2613, 2614, 2615, 2617, 2618, 2619, or 2620.
  • Embodiment 13 The oligomeric compound of any of embodiments 7-11, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of a DNM1L nucleic acid, wherein the DNM1L nucleic acid has the nucleobase sequence of SEQ ID NOs: 1 or 2.
  • Embodiment 14 The oligomeric compound of any of embodiments 1-13, wherein the modified oligonucleotide consists of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18,16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.
  • the modified oligonucleotide consists of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to
  • Embodiment 15 The oligomeric compound of any of embodiments 1-14, wherein the modified oligonucleotide comprises at least two modified nucleosides comprising a modified sugar moiety.
  • Embodiment 16 The oligomeric compound of any of embodiments 1-15, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.
  • Embodiment 17 The oligomeric compound of embodiment 16, wherein the bicyclic sugar moiety comprises a 2’-4’ bridge selected from -O-CH 2 -; and -O-CH(CH 3 )-.
  • Embodiment 18 The oligomeric compound of any of embodiments 1-15, wherein the modified sugar moiety comprises a non-bicyclic modified sugar moiety.
  • Embodiment 19 The oligomeric compound of embodiment 18, wherein the non-bicyclic modified sugar moiety is a 2 ’-MOE sugar moiety or 2’-OMe sugar moiety.
  • Embodiment 20 The oligomeric compound of any of embodiments 1-19, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.
  • Embodiment 21 The oligomeric compound of any of embodiments 1-20, wherein the modified oligonucleotide comprises at least one modified intemucleoside linkage.
  • Embodiment 22 The oligomeric compound of embodiment 21, wherein at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Embodiment 23 The oligomeric compound of embodiment 21 or 22, wherein each intemucleoside linkage is a modified intemucleoside linkage.
  • Embodiment 24 The oligomeric compound of embodiment 23, wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Embodiment 25 The oligomeric compound of any of embodiments 21-23, wherein at least one intemucleoside linkage of the modified oligonucleotide is a phosphodiester intemucleoside linkage.
  • Embodiment 26 The oligomeric compound of any of embodiments 1-21, wherein each intemucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester or a phosphorothioate intemucleoside linkage.
  • Embodiment 27 The oligomeric compound of any of embodiments 1-26, wherein at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 intemucleoside linkages of the modified oligonucleotide are phosphorothioate intemucleoside linkages.
  • Embodiment 28 The oligomeric compound of any of embodiments 1-27, wherein the modified oligonucleotide comprises at least one modified nucleobase.
  • Embodiment 29 The oligomeric compound of embodiment 28, wherein the modified nucleobase is 5- methylcytosine.
  • Embodiment 30 The oligomeric compound of embodiment 29, wherein each cytosine is a 5-methylcytosine.
  • Embodiment 31 The oligomeric compound of any of embodiments 1-30, wherein the modified oligonucleotide comprises a deoxy region consisting of 5-12 contiguous 2’-deoxynucleosides.
  • Embodiment 32 The oligomeric compound of embodiment 31, wherein each 2’-deoxynucleoside of the deoxy region is a 2’-p-D-deoxynucleoside.
  • Embodiment 33 The oligomeric compound of embodiment 31 or 32, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides.
  • Embodiment 34 The oligomeric compound of any of embodiments 31-33, wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety.
  • Embodiment 35 The oligomeric compound of any of embodiments 31-34, wherein the deoxy region is flanked on the 5’-side by a 5’-region consisting of 1-6 linked 5 ’-region nucleosides and on the 3’-side by a 3 ’-region consisting of 1-6 linked 3 ’-region nucleosides; wherein. the 3’-most nucleoside of the 5’ region comprises a modified sugar moiety; and the 5’-most nucleoside of the 3’ region comprises a modified sugar moiety.
  • Embodiment 36 The oligomeric compound of embodiment 35, wherein each nucleoside of the 3’ region comprises a modified sugar moiety.
  • Embodiment 37 The oligomeric compound of embodiment 35 or 36, wherein each nucleoside of the 5’ region comprises a modified sugar moiety.
  • Embodiment 38 The oligomeric compound of any of embodiments 31-37, wherein the modified oligonucleotide has: a 5’ region consisting of 3 linked nucleosides; a deoxy region consisting of 10 linked nucleosides; and a 3 ’ region consisting of 3 linked nucleosides; wherein each of the 5 ’-region nucleosides and each of the 3 ’-region nucleosides is a cEt nucleoside.
  • Embodiment 39 The oligomeric compound of any of embodiments 31-37, wherein the modified oligonucleotide has: a 5’ region consisting of 1-6 linked nucleosides; a deoxy region consisting of 6-10 linked nucleosides; and a 3’ region consisting of 1-6 linked nucleosides; wherein each of the 5 ’ region nucleosides and each of the 3 ’ region nucleosides is a cEt nucleoside or a 2 ’ -MOE nucleoside; and each of the deoxy region nucleosides is a 2’-p-D-deoxynucleoside.
  • Embodiment 40 The oligomeric compound of any of embodiments 31-37, wherein the modified oligonucleotide has: a 5’ region consisting of 5 linked nucleosides; a deoxy region consisting of 8 linked nucleosides; and a 3 ’ region consisting of 3 linked nucleosides; wherein three of the 5’ region nucleosides is a cEt nucleoside and one is a 2’-OMe nucleoside; each of the 3’ region nucleosides is a cEt nucleoside; and each of the deoxy region nucleosides is a 2’-p-D-deoxynucleoside.
  • Embodiment 41 The oligomeric compound of any of embodiments 31-37, wherein the modified oligonucleotide has a sugar motif comprising: a 5’ region consisting of 3-6 linked nucleosides; a deoxy region consisting of 7-8 linked nucleosides; and a 3’ region consisting of 3-6 linked nucleosides; wherein each of the 3’ region nucleosides is selected from a 2 ’-MOE nucleoside and a cEt nucleoside, and the 5’ region has the following formula:
  • Nk Nkn(Nd)(Nx) wherein each Nk is a bicyclic nucleoside, Nx is a 2’-OMe nucleoside and Nd is a 2’-p-D- deoxynucleoside; and n is from 1-4.
  • Embodiment 42 An oligomeric compound of any of embodiments 1-30, wherein the modified oligonucleotide has a sugar motif (5’ to 3’) selected from: kkkddddddddddkkk, kkkdddddddddkkke, and kkkdyddddddddkkk, wherein ‘d’ represents a 2’-deoxyribosyl sugar moiety, ‘e’ represents a 2’-MOE sugar moiety, ‘k’ represents a cEt sugar moiety, and ‘y’ represents a 2’-OMe sugar moiety.
  • Embodiment 43 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: wherein
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • k a cEt sugar moiety
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage.
  • Embodiment 44 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: wherein
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • k a cEt sugar moiety
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage.
  • Embodiment 45 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation wherein
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • k a cEt sugar moiety
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage.
  • Embodiment 46 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: wherein
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • k a cEt sugar moiety
  • e a 2’-OCH2CH2OCH 3 ribosyl sugar moiety
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage.
  • Embodiment 48 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation. wherein
  • A an adenine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • k a cEt sugar moiety
  • e a 2’-OCH2CH2OCH 3 ribosyl sugar moiety
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage.
  • Embodiment 49 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation wherein
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • k a cEt sugar moiety
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage.
  • Embodiment 50 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation wherein
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • k a cEt sugar moiety
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage.
  • Embodiment 51 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation. T , wherein
  • A an adenine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • k a cEt sugar moiety
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage.
  • Embodiment 52 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation wherein
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • k a cEt sugar moiety
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage.
  • Embodiment 53 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: , wherein
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • k a cEt sugar moiety
  • e a 2’-OCH2CH2OCH 3 ribosyl sugar moiety
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage.
  • Embodiment 54 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: wherein
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • k a cEt sugar moiety
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage.
  • Embodiment 55 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: , wherein
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • k a cEt sugar moiety
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage.
  • Embodiment 56 The oligomeric compound of any of embodiments 1-55, wherein the oligomeric compound comprises a conjugate group.
  • Embodiment 57 The oligomeric compound of embodiment 56, wherein the conjugate group comprises a celltargeting moiety.
  • Embodiment 58 The oligomeric compound of any of embodiments 1 to 57, wherein the oligomeric compound comprises a terminal group.
  • Embodiment 59 The oligomeric compound of embodiment 58, wherein the terminal group is an abasic sugar moiety.
  • Embodiment 60 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 61 The modified oligonucleotide of embodiment 60, which is the sodium salt or the potassium salt.
  • Embodiment 62 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 63 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 64 The modified oligonucleotide of embodiment 63, which is the sodium salt or the potassium salt.
  • Embodiment 65 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 66 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 67 The modified oligonucleotide of embodiment 66, which is the sodium salt or the potassium salt.
  • Embodiment 68 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 69 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 70 The modified oligonucleotide of embodiment 69, which is the sodium salt or the potassium salt.
  • Embodiment 71 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 72 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 73 The modified oligonucleotide of embodiment 72, which is the sodium salt or the potassium salt.
  • Embodiment 74 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 75 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 76 The modified oligonucleotide of embodiment 75, which is the sodium salt or the potassium salt.
  • Embodiment 77 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 78 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 79 The modified oligonucleotide of embodiment 78, which is the sodium salt or the potassium salt.
  • Embodiment 80 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 81 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 82 The modified oligonucleotide of embodiment 81, which is the sodium salt or the potassium salt.
  • Embodiment 84 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 85 The modified oligonucleotide of embodiment 84, which is the sodium salt or the potassium salt.
  • Embodiment 86 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 87 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 88 The modified oligonucleotide of embodiment 87, which is the sodium salt or the potassium salt.
  • Embodiment 89 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 90 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 91 The modified oligonucleotide of embodiment 90, which is the sodium salt or the potassium salt.
  • Embodiment 92 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 93 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 94 The modified oligonucleotide of embodiment 93, which is the sodium salt or the potassium salt.
  • Embodiment 96 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 97 The modified oligonucleotide of embodiment 96, which is the sodium salt or the potassium salt.
  • Embodiment 98 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 99 A chirally enriched population of oligomeric compounds of any of embodiments 1-59 or modified oligonucleotides of any of embodiment 60-98, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having a particular stereochemical configuration.
  • Embodiment 100 The chirally enriched population of embodiment 99, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having the (Sp) or (Rp) configuration.
  • Embodiment 101 The chirally enriched population of embodiment 100, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate intemucleoside linkage.
  • Embodiment 102 The chirally enriched population of embodiment 100, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate intemucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate intemucleoside linkages.
  • Embodiment 103 The chirally enriched population of embodiment 100, wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate intemucleoside linkages in the Sp, Sp, and Rp configurations, in the 5’ to 3’ direction.
  • Embodiment 104 A population of oligomeric compounds of any of embodiments 1-59 or modified oligonucleotides of any of embodiments 60-98, wherein all phosphorothioate intemucleoside linkages are stereorandom.
  • Embodiment 105 An oligomeric duplex, comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound of any of embodiments 1-59 or a modified oligonucleotide of any of embodiments 60-98.
  • Embodiment 106 An antisense agent comprising an antisense compound, wherein the antisense compound is the oligomeric compound of any of embodiments 1-59 or the modified oligonucleotide of any of embodiments 60-98.
  • Embodiment 107 The antisense agent of embodiment 106, wherein the antisense agent is the oligomeric duplex of embodiment 88.
  • Embodiment 108 The antisense agent of embodiment 106 or 107, wherein the antisense agent is: i. an RNase H agent capable of reducing the amount of DNM1L nucleic acid through the activation of RNase H; or ii. an RNAi agent capable of reducing the amount of DNM1L nucleic acid through the activation of RISC/Ago2.
  • Embodiment 109 The antisense agent of any of embodiments 106-108, wherein the conjugate group is a celltargeting moiety.
  • Embodiment 110 A pharmaceutical composition comprising the oligomeric compound of any of embodiments 1-59, the modified oligonucleotide of any of embodiments 60-98, the population of any of embodiments 99-104, the oligomeric duplex of embodiment 105, or the antisense agent of any of embodiments 106-109, and a pharmaceutically acceptable diluent or carrier.
  • Embodiment 111 The pharmaceutical composition of embodiment 110, wherein the pharmaceutically acceptable diluent is water or saline.
  • Embodiment 112. The pharmaceutical composition of embodiment 110, wherein the pharmaceutical composition consists essentially of the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, or the antisense agent, and water or saline.
  • Embodiment 113 A method comprising administering to a subject the oligomeric compound of any of embodiments 1-59, the modified oligonucleotide of any of embodiments 60-98, the population of any of embodiments 99-104, the oligomeric duplex of embodiment 105, the antisense agent of any of embodiments 106-109, or the pharmaceutical composition of any of embodiments 110-112.
  • Embodiment 114 A method of treating a disease associated with DNM1L comprising administering to a subject having a disease associated with DNM1L a therapeutically effective amount of the oligomeric compound of any of embodiments 1-59, the modified oligonucleotide of any of embodiments 60-98, the population of any of embodiments 99-104, the oligomeric duplex of embodiment 105, the antisense agent of any of embodiments 106-109, or the pharmaceutical composition of any of embodiments 110-112 and thereby treating the subject.
  • Embodiment 115 The method of embodiment 114, wherein the disease associated with DNM1L is acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
  • Embodiment 116 The method of embodiment 114 or 115, wherein administering the oligomeric compound of any of embodiments 1-59, the modified oligonucleotide of any of embodiments 60-98, the population of any of embodiments 99-104, the oligomeric duplex of embodiment 105, the antisense agent of any of embodiments 106-109, or the pharmaceutical composition of any of embodiments 110-112 reduces a marker of kidney health or kidney function selected from ALT/AST, creatinine, BUN, cystatin-c, proteinuria, and eGFR, DRP1, KIM-1, FABP1, NGAL, hematoxylin and eosin (H&E) staining, cytochrome-c, TIMP-2, IGFBP-7, RIFLE, and/or AKI-K
  • Embodiment 117 A method of reducing expression of DNM1L in a cell comprising contacting the cell with the oligomeric compound of any of embodiments 1-59, the modified oligonucleotide of any of embodiments 60-98, the population of any of embodiments 99-104, the oligomeric duplex of embodiment 105, the antisense agent of any of embodiments 106-109, or the pharmaceutical composition of any of embodiments 110-112.
  • Embodiment 118 The method of embodiment 117, wherein the cell is a kidney cell.
  • Embodiment 120 Use of the oligomeric compound of any of embodiments 1-59, the modified oligonucleotide of any of embodiments 60-98, the population of any of embodiments 99-104, the oligomeric duplex of embodiment 105, the antisense agent of any of embodiments 106-109, or the pharmaceutical composition of any of embodiments 110- 112 in the manufacture of a medicament for treating a disease associated with DNM1L.
  • Embodiment 121 The use of embodiment 119 or 120, wherein the disease associated with DNM1L is acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
  • AKI acute kidney injury
  • AKD acute kidney disease
  • CKD chronic kidney injury
  • Certain embodiments are directed to oligomeric duplexes comprising a first oligomeric compound and a second oligomeric compound.
  • an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 3238-3253, 3370-3385, 3405-3420, 3435-3450, 3439-3454, 3440-3455, 3441-3456, 3442-3457, 3443-3458, 3560-3575, 3561-3576, 3710-3725, 3711-3726,
  • an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 39-54, 171-186, 206-221, 236-251, 240-255, 241- 256, 242-257, 243-258, 244-259, 341-356, 342-357, 343-358, 361-376, 376-391, 499-514, 501-516, 504-519, 572-587, 574-589, 576-591, 578-593, 579-594, 580-595, 581-596, 582-597, 583-598, 584-599, 586-601, 587- 602, 588-603, 589-604, 602-617, 617-632, 623-638, 624-639, 626-641,
  • 1616-1631 1649-1664, 1650-1665, 1653-1668, 1663-1678, 1665-1680, 1667-1682, 1669-1684, 1670-1685, 1671-1686, 1672-1687, 1673-1688, 1674-1689, 1675-1690, 1677-1692, 1693-1708, 1694-1709, 1715-1730,
  • a second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
  • an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 12-2607, wherein each thymine is replaced by uracil; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
  • the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.
  • an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 16 to 80 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 12-2607, wherein each thymine is replaced by uracil; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 16 to 80 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 16 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
  • the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.
  • At least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a modified sugar moiety.
  • suitable modified sugar moieties include, but are not limited to, a bicyclic sugar moiety, such as a 2 ’-4’ bridge selected from -O-CH2-; and -O- CH(CH3)-, and a non-bicyclic sugar moiety, such as a 2’-MOE sugar moiety, a 2’-F sugar moiety, a 2’-OMe sugar moiety, or a 2’-NMA sugar moiety.
  • At least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and/or the second modified oligonucleotide comprises a modified sugar moiety selected from 2’-F and 2’-OMe.
  • At least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a sugar surrogate.
  • suitable sugar surrogates include, but are not limited to, morpholino, peptide nucleic acid (PNA), glycol nucleic acid (GNA), and unlocked nucleic acid (UNA).
  • PNA peptide nucleic acid
  • GNA glycol nucleic acid
  • UNA unlocked nucleic acid
  • at least one nucleoside of the first modified oligonucleotide comprises a sugar surrogate, which can be a GNA.
  • At least one intemucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a modified intemucleoside linkage.
  • the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • at least one of the first, second, or third intemucleoside linkages from the 5’ end and/or the 3’ end of the first modified oligonucleotide comprises a phosphorothioate linkage.
  • at least one of the first, second, or third intemucleoside linkages from the 5’ end and/or the 3’ end of the second modified oligonucleotide comprises a phosphorothioate linkage.
  • At least one intemucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a phosphodiester intemucleoside linkage.
  • each intemucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can be independently selected from a phosphodiester or a phosphorothioate intemucleoside linkage.
  • At least one nucleobase of the first modified oligonucleotide and/orthe second modified oligonucleotide can be modified nucleobase.
  • the modified nucleobase is 5-methylcytosine.
  • the first modified oligonucleotide can comprise a stabilized phosphate group attached to the 5’ position of the 5 ’-most nucleoside.
  • the stabilized phosphate group comprises a cyclopropyl phosphorate or an /EJ-vinyl phosphorate.
  • the first modified oligonucleotide can comprise a conjugate group.
  • the conjugate group comprises a conjugate linker and a conjugate moiety.
  • the conjugate group is attached to the first modified oligonucleotide at the 5 ’-end of the first modified oligonucleotide.
  • the conjugate group is attached to the first modified oligonucleotide at the 3’- end of the modified oligonucleotide.
  • the conjugate group comprises N-acetyl galactosamine.
  • the conjugate group is a GalNAci.
  • the conjugate group comprises a celltargeting moiety having an affinity for transferrin receptor (TfR), also known as TfRl and CD71.
  • TfR transferrin receptor
  • the conjugate group comprises an anti-TfRl antibody or fragment thereof.
  • the conjugate group comprises a protein or peptide capable of binding TfRl.
  • the conjugate group comprises an aptamer capable of binding TfRl.
  • conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cll alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, Cll alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
  • conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cll alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.
  • an antisense agent comprises an antisense compound, which comprises an oligomeric compound or an oligomeric duplex described herein.
  • an antisense agent which can comprise an oligomeric compound or an oligomeric duplex described herein, is an RNAi agent capable of reducing the amount of DNM1L nucleic acid through the activation of RISC/Ago2.
  • an oligomeric agent comprising two or more oligomeric duplexes.
  • an oligomeric agent comprises two or more of any of the oligomeric duplexes described herein.
  • an oligomeric agent comprises two or more of the same oligomeric duplex, which can be any of the oligomeric duplexes described herein.
  • the two or more oligomeric duplexes are linked together.
  • the two or more oligomeric duplexes are covalently linked together.
  • the second modified oligonucleotides of two or more oligomeric duplexes are covalently linked together.
  • the second modified oligonucleotides of two or more oligomeric duplexes are covalently linked together at their 3 ’ ends.
  • the two or more oligomeric duplexes are covalently linked together by a glycol linker, such as a tetraethylene glycol linker. Certain such compounds are described in, e.g., Alterman, et al., Nature Biotech., 37:844-894, 2019.
  • oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides.
  • Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides.
  • Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified intemucleoside linkage. Certain modified nucleosides and modified intemucleoside linkages suitable for use in modified oligonucleotides are described below.
  • Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.
  • modified nucleosides comprising the following modified sugar moieties and/or the following modified nucleobases may be incorporated into modified oligonucleotides.
  • modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties. In certain embodiments, the modified sugar moiety is a ribosyl modified sugar moiety.
  • modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure.
  • Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2’, 3’, 4’, and/or 5’ positions.
  • one or more non-bridging substituent of non- bicyclic modified sugar moieties is branched.
  • 2 ’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2’-F, 2'-OCH 3 (“OMe” or “O-methyl”), and 2'-O(CH 2 )2OCH3 (“MOE” or “O- methoxy ethyl”).
  • non-bicyclic modified sugar moieties comprise a substituent group at the 3 ’-position.
  • substituent groups suitable for the 3 ’-position of modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl).
  • non-bicyclic modified sugar moieties comprise a substituent group at the 4’-position.
  • 4’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128.
  • non-bicyclic modified sugar moieties examples include but are not limited to: 5’-methyl (R or S), 5'-vinyl, ethyl, and 5 ’-methoxy.
  • non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836).
  • a non-bridging 2 ’-substituent group selected from
  • a 2 ’-substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2 ’-substituent group selected from: F, OCF 3 , OCH 3 , OCH 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(CH 3 ) 2 , O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 , O(CH 2 ) 2 ON(CH 3 ) 2 (“DMAOE”), O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2
  • a non-bridging 2 ’-substituent group selected from: F, OCF 3 , OCH 3 , OCH 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(CH 3 ) 2 , O(CH 2 ) 2 O(CH 2 ) 2 N(
  • a 2 ’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2’-substituent group selected from: F, OCH 3 , and OCH 2 CH 2 OCH 3 .
  • modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration.
  • a 2’-deoxyfuranosyl sugar moiety may be in seven isomeric configurations other than the naturally occurring p-D-deoxyribosyl configuration.
  • modified sugar moieties are described in, e.g., WO 2019/157531, incorporated by reference herein.
  • a 2’-modified sugar moiety has an additional stereocenter at the 2’-position relative to a 2’-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations.
  • 2’-modified sugar moieties described herein are in the P-D-ribosyl isomeric configuration unless otherwise specified.
  • oligonucleotides include one or more nucleoside or sugar moiety linked at an alternative position, for example at the 2’ or inverted 5’ to 3’.
  • the linkage is at the 2’ position
  • the 2’-substituent groups may instead be at the 3’- position.
  • Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety.
  • Nucleosides comprising such bicyclic sugar moieties have been referred to as bicyclic nucleosides (BNAs), locked nucleosides, or conformationally restricted nucleotides (CRN).
  • BNAs bicyclic nucleosides
  • CNN conformationally restricted nucleotides
  • the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms.
  • the furanose ring is a ribose ring.
  • Examples of such 4’ to 2’ bridging sugar substituents include but are not limited to: 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 ) 3 -2', 4'-CH 2 -O-2' (“LNA”), 4'-CH 2 -S-2', 4'-(CH 2 ) 2 -O-2' (“ENA”), 4'- CH(CH 3 )-O-2' (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4’-CH 2 -O-CH 2 -2’, 4’-CH 2 -N(R)- 2’, 4'-CH(CH 2 OCH3)-O-2' (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S.
  • each R, R a , and R b is, independently, H, a protecting group, or C1-C12 alkyl (see, e.g. Imanishi et al., U.S. 7,427,672).
  • bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration.
  • an LNA nucleoside (described herein) may be in the a-L configuration or in the -D configuration.
  • a-L-methyleneoxy (4’-CH 2 -O-2’) or a-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).
  • the addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J.
  • bicyclic nucleosides include both isomeric configurations.
  • positions of specific bicyclic nucleosides e.g., LNA or cEt
  • they are in the -D configuration, unless otherwise specified.
  • modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 ’-substituted and 4’-2’ bridged sugars).
  • modified sugar moieties are sugar surrogates.
  • the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom.
  • such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein.
  • certain sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'-position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,939,677) and/or the 5’ position.
  • sugar surrogates comprise rings having other than 5 atoms.
  • a sugar surrogate comprises a six-membered tetrahydropyran (“THP”).
  • TTP tetrahydropyrans
  • Such tetrahydropyrans may be further modified or substituted.
  • Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MN A”) (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:
  • F-HNA see e.g. Swayze et al., U.S. 8,088,904; Swayze et al., U.S. 8,440,803; Swayze et al., U.S. 8,796,437; and Swayze et al., U.S. 9,005,906; F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula: wherein, independently, for each of said modified THP nucleoside:
  • Bx is a nucleobase moiety
  • T 3 and T 4 are each, independently, an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T 3 and T 4 is an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T 3 and T 4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group; qi, c
  • modified THP nucleosides are provided wherein q 1, q 2 , q 3 , q 4 , q 5 , qe and q 7 are each H. In certain embodiments, at least one of qi, q2, q 3 , q 4 , qs, qe and q 7 is other than H. In certain embodiments, at least one of qi, q 7 , q 3 , q 4 , qs, qe and q 7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of Ri and R2 is F. In certain embodiments, Ri is F and R2 is H, in certain embodiments, Ri is methoxy and R2 is H, and in certain embodiments, Ri is methoxyethoxy and R2 is H.
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. 5,698,685; Summerton et al., U.S. 5,166,315; Summerton et al., U.S. 5,185,444; and Summerton et al., U.S. 5,034,506).
  • morpholino means a sugar surrogate having the following structure:
  • morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
  • sugar surrogates are referred to herein as “modified morpholinos.”
  • sugar surrogates comprise acyclic moieties.
  • nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.
  • Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos.
  • sugar surrogates are the “unlocked” sugar structure of UNA (unlocked nucleic acid) nucleosides.
  • UNA is an unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked sugar surrogate.
  • Representative U.S. publications that teach the preparation of UNA include, but are not limited to, US Patent No. 8,314,227; and US Patent Publication Nos. 2013/0096289; 2013/0011922; and 2011/0313020, the entire contents of each of which are hereby incorporated herein by reference.
  • sugar surrogates are the glycerol as found in GNA (glycol nucleic acid) nucleosides as depicted below:
  • modified oligonucleotides comprise one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleosides that does not comprise a nucleobase, referred to as an abasic nucleoside. In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides comprising a hypoxanthine nucleobase).
  • modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines.
  • nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine- 2-one, l,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2-one (G-clamp).
  • Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
  • Further nucleobases include those disclosed in Merigan et al., U.S.
  • nucleosides of modified oligonucleotides may be linked together using one or more modified intemucleoside linkages.
  • the two main classes of intemucleoside linking groups are defined by the presence or absence of a phosphoms atom.
  • Modified intemucleoside linkages compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide.
  • intemucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing intemucleoside linkages are well known to those skilled in the art.
  • a modified intemucleoside linkage is any of those described in WO/2021/030778, incorporated by reference herein.
  • a modified intemucleoside linkage comprises the formula: wherein independently for each intemucleoside linking group of the modified oligonucleotide: X is selected from O or S; Ri is selected from H, C 1 -C 6 alkyl, and substituted C 1 -C 6 alkyl; and
  • R2 is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, a C 1 -C 6 alkoxy, C 1 -C 6 alkyl, C 1 -C 6 alkenyl, C 1 -C 6 alkynyl, substituted C 1 -C 6 alkyl, substituted C 1 -C 6 alkenyl substituted C 1 -C 6 alkynyl, and a conjugate group;
  • Rs is selected from an aryl, a substituted aryl, CH 3 , N(CH 3 ) 2 , OCH 3 and a conjugate group;
  • R4 is selected from OCH 3 , OH, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl and a conjugate group;
  • R 5 is selected from OCH 3 , OH, C 1 -C 6 alkyl, and substituted C 1 -C 6 alkyl.
  • a modified intemucleoside linkage comprises a mesyl phosphoramidate linking group having a formula:
  • a mesyl phosphoramidate intemucleoside linkage may comprise a chiral center.
  • modified oligonucleotides comprising (7?p) and/or (.S'p) mesyl phosphoramidates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
  • Representative intemucleoside linkages having a chiral center include but are not limited to alkylphosphonates, mesyl phosphoramidates, and phosphorothioates.
  • Modified oligonucleotides comprising intemucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom intemucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate or other linkages containing chiral centers in particular stereochemical configurations.
  • populations of modified oligonucleotides comprise phosphorothioate intemucleoside linkages wherein all of the phosphorothioate intemucleoside linkages are stereorandom.
  • populations of modified oligonucleotides comprise mesyl phosphoramidate intemucleoside linkages wherein all of the mesyl phosphoramidate intemucleoside linkages are stereorandom.
  • Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate or mesyl phosphoramidate linkage.
  • each individual phosphorothioate or mesyl phosphoramidate of each individual oligonucleotide molecule has a defined stereoconfiguration.
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate or mesyl phosphoramidate intemucleoside linkages in a particular, independently selected stereochemical configuration.
  • the particular configuration of the particular phosphorothioate or mesyl phosphoramidate linkage is present in at least 65% of the molecules in the population.
  • the particular configuration of the particular phosphorothioate or mesyl phosphoramidate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate or mesyl phosphoramidate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate or mesyl phosphoramidate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate or mesyl phosphoramidate linkage is present in at least 99% of the molecules in the population.
  • Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate or mesyl phosphoramidate in the (Sp) configuration.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate or mesyl phosphoramidate in the (Rp) configuration.
  • modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
  • chiral intemucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
  • Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research', Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH 2 component parts.
  • modified oligonucleotides comprise one or more inverted nucleoside, as shown below:
  • each Bx independently represents any nucleobase.
  • an inverted nucleoside is terminal (i.e., the last nucleoside on one end of an oligonucleotide) and so only one intemucleoside linkage depicted above will be present.
  • additional features such as a conjugate group may be attached to the inverted nucleoside.
  • Such terminal inverted nucleosides can be attached to either or both ends of an oligonucleotide.
  • such groups lack a nucleobase and are referred to herein as inverted sugar moieties.
  • an inverted sugar moiety is terminal (i.e., attached to the last nucleoside on one end of an oligonucleotide) and so only one intemucleoside linkage above will be present.
  • additional features such as a conjugate group may be attached to the inverted sugar moiety.
  • Such terminal inverted sugar moieties can be attached to either or both ends of an oligonucleotide.
  • nucleic acids can be linked 2’ to 5’ rather than the standard 3’ to 5’ linkage. Such a linkage is illustrated below. wherein each Bx represents any nucleobase.
  • modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety.
  • modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase.
  • modified oligonucleotides comprise one or more modified intemucleoside linkage.
  • the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or intemucleoside linkages of a modified oligonucleotide define a pattern or motif.
  • the patterns of sugar moieties, nucleobases, and intemucleoside linkages are each independent of one another.
  • a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
  • oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif.
  • sugar motifs include but are not limited to any of the sugar modifications discussed herein.
  • modified oligonucleotides comprise or consist of a region having a fully modified sugar motif.
  • each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety.
  • each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety.
  • modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif.
  • a fully modified oligonucleotide is a uniformly modified oligonucleotide.
  • each nucleoside of a uniformly modified nucleotide comprises the same 2 ’-modification.
  • modified oligonucleotides comprise or consist of a region having a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.”
  • the three regions of a gapmer motif (the 5 ’ -wing, the gap, and the 3 ’ -wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap.
  • the sugar moieties of the nucleosides of each wing that are closest to the gap differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction).
  • the sugar moieties within the gap are the same as one another.
  • the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap.
  • the sugar motifs of the two wings are the same as one another (symmetric gapmer).
  • the sugar motif of the 5'-wing differs from the sugar motif of the 3'-wing (asymmetric gapmer).
  • the wings of a gapmer comprise 1-6 nucleosides.
  • each nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • at least two nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • at least three nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • at least four nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • the gap of a gapmer comprises 7-12 nucleosides.
  • each nucleoside of the gap of a gapmer comprises a 2’-(3-D-deoxyribosyl sugar moiety.
  • at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety.
  • the gapmer is a deoxy gapmer.
  • the nucleosides on the gap side of each wing/gap junction comprise 2’- deoxyribosyl sugar moieties and the nucleosides on the wing sides of each wing/gap junction comprise modified sugar moieties.
  • each nucleoside of the gap comprises a 2’- (3-D-deoxyribosyl sugar moiety.
  • each nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety.
  • one nucleoside of the gap comprises a modified sugar moiety and each remaining nucleoside of the gap comprises a 2’-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a 2’-OMe sugar moiety.
  • the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5’-wing] - [# of nucleosides in the gap] - [# of nucleosides in the 3’-wing],
  • a 3-10-3 gapmer consists of 3 linked nucleosides in each wing and 10 linked nucleosides in the gap.
  • that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprise 2’-p-D-deoxyribosyl sugar moieties.
  • a 5-10-5 MOE gapmer consists of 5 linked 2’-MOE nucleosides in the 5’- wing, 10 linked 2’- p-D-deoxynucleosides in the gap, and 5 linked 2’-MOE nucleosides in the 3 ’-wing.
  • a 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5’-wing, 10 linked 2’-p-D-deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3 ’-wing.
  • the gap consists of 2’-p-D-deoxyribosyl sugar moieties (e.g., nine 2’-p-D-deoxyribosyl sugar moieties) and one 2’-OMe sugar moiety.
  • modified oligonucleotides have a sugar motif selected from the following (5’ to 3’): kkkdddddddddddkkk, kkkdddddddddkkke, or kkkdyddddddddkkk, wherein ‘d’ represents a 2’-deoxyribosyl sugar moiety, ‘e’ represents a 2’-MOE sugar moiety, ‘k’ represents a cEt sugar moiety, and ‘y’ represents a 2’-OMe sugar moiety.
  • modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 BNA gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 cEt gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 LNA gapmers.
  • modified oligonucleotides have a sugar motif selected from the following (5’ to 3’): kkkdddddddddddkkk, kkkdddddddddkkke, or kkkdyddddddddkkk, wherein ‘d’ represents a 2’-deoxyribosyl sugar moiety, ‘e’ represents a 2’-MOE sugar moiety, ‘k’ represents a cEt sugar moiety, and ‘y’ represents a 2’-OMe sugar moiety.
  • oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif.
  • each nucleobase is modified.
  • none of the nucleobases are modified.
  • each purine or each pyrimidine is modified.
  • each adenine is modified.
  • each guanine is modified.
  • each thymine is modified.
  • each uracil is modified.
  • each cytosine is modified.
  • cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines. In certain embodiments, all of the cytosine nucleobases are 5-methyl cytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.
  • modified oligonucleotides comprise a block of modified nucleobases.
  • the block is at the 3 ’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3’-end of the oligonucleotide. In certain embodiments, the block is at the 5’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5 ’-end of the oligonucleotide.
  • oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase.
  • one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif.
  • the sugar moiety of said nucleoside is a 2’- deoxyribosyl sugar moiety.
  • the modified nucleobase is selected from: a 2-thiopyrimidine and a 5 -propynepyrimidine .
  • oligonucleotides comprise modified and/or unmodified intemucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif.
  • each intemucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate intemucleoside linkage and phosphodiester intemucleoside linkage.
  • each phosphorothioate intemucleoside linkage is independently selected from a stereorandom phosphorothioate a (.S'p) phosphorothioate, and a (ftp) phosphorothioate.
  • each intemucleoside linkage is a phosphorothioate linkage.
  • the sugar motif of a modified oligonucleotide is a gapmer and the intemucleoside linkages within the gap are all modified.
  • some or all of the intemucleoside linkages in the wings are unmodified phosphodiester intemucleoside linkages.
  • the terminal intemucleoside linkages are modified.
  • the sugar motif of a modified oligonucleotide is a gapmer
  • the intemucleoside linkage motif comprises at least one phosphodiester intemucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal intemucleoside linkage, and the remaining intemucleoside linkages are phosphorothioate intemucleoside linkages.
  • all of the phosphorothioate linkages are stereorandom.
  • all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates
  • the gap comprises at least one Sp, Sp, Rp motif.
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such intemucleoside linkage motifs.
  • oligonucleotide it is possible to increase or decrease the length of an oligonucleotide without eliminating activity.
  • Woolf et al. Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992
  • a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model.
  • Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches.
  • target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.
  • oligonucleotides can have any of a variety of ranges of lengths.
  • oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range.
  • X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X ⁇ Y.
  • oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18,
  • a modified oligonucleotide consists of 16 linked nucleosides.
  • modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each intemucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications.
  • the intemucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the intemucleoside linkages of the gap region of the sugar motif.
  • sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.
  • Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for -D ribosyl sugar moieties, and all of the phosphorothioate intemucleoside linkages are stereorandom.
  • the modified oligonucleotides of a chirally enriched population are enriched for both -D ribosyl sugar moieties and at least one, particular phosphorothioate intemucleoside linkage in a particular stereochemical configuration.
  • oligonucleotides are further described by their nucleobase sequence.
  • oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
  • a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
  • the nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.
  • oligomeric compounds which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups.
  • Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups.
  • conjugate groups or terminal groups are attached at the 3’ and/or 5 ’-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3 ’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3 ’-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5 ’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5 ’-end of oligonucleotides.
  • terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
  • oligomeric compounds comprise one or more terminal groups.
  • oligomeric compounds comprise a stabilized 5 ’-phosphate.
  • Stabilized 5’-phosphates include, but are not limited to 5 ’-phosphorates, including, but not limited to 5’-vinylphosphorates.
  • terminal groups comprise one or more abasic sugar moieties and/or inverted nucleosides.
  • terminal groups comprise one or more 2 ’-linked nucleosides or sugar moieties.
  • the 2 ’-linked group is an abasic sugar moiety.
  • oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds.
  • antisense compounds have antisense activity when they reduce or inhibit the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid.
  • Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
  • hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid.
  • certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid.
  • RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex.
  • the DNA in such an RNA:DNA duplex need not be unmodified DNA.
  • described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity.
  • one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
  • an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid.
  • RISC RNA-induced silencing complex
  • certain antisense compounds result in cleavage of the target nucleic acid by Argonaute.
  • Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA).
  • hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.
  • Antisense activities may be observed directly or indirectly.
  • observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or animal.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid.
  • the target nucleic acid is an endogenous RNA molecule.
  • the target nucleic acid encodes a protein.
  • the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions.
  • the target RNA is a mature mRNA.
  • the target nucleic acid is a pre-mRNA.
  • the target region is entirely within an intron.
  • the target region spans an intron/exon junction.
  • the target region is at least 50% within an intron.
  • oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20, 10 to 18, or 18 to 20 nucleobases in length.
  • Gautschi et al J. Natl. Cancer Inst. 93:463-471, March 2001
  • this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res.
  • oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid.
  • antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount.
  • selectivity of the oligonucleotide is improved.
  • the mismatch is specifically positioned within an oligonucleotide having a gapmer motif.
  • the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5’-end of the gap region.
  • the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3 ’-end of the gap region.
  • the mismatch is at position 1, 2, 3, or 4 from the 5’-end of the wing region.
  • the mismatch is at position 4, 3, 2, or 1 from the 3 ’-end of the wing region.
  • oligomeric agents or oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is DNM1L.
  • DNM1L nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NC 000012.12, truncated from nucleosides 32676001 to 32749000) or SEQ ID NO: 2 (GENBANK Accession No. NM 001278464.1).
  • contacting a cell with an oligomeric compound complementary to SEQ ID NOs: 1 or 2 reduces the amount of DNM1L RNA, and in certain embodiments reduces the amount of DNM1L protein.
  • the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide and a conjugate group.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue.
  • the pharmacologically relevant tissues are the kidney cells and tissues.
  • Certain embodiments provided herein relate to methods of inhibiting DNM1L expression, which can be useful for treating a disease associated with DNM1L or DRP1 in a subject, by administration of an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex, any of which comprising a modified oligonucleotide having a nucleobase sequence complementary to a DNM1L nucleic acid.
  • diseases associated with DNM1L treatable with the oligomeric agents, oligomeric compounds, modified oligonucleotides, oligomeric duplexes, and methods provided herein include a disorder associated with mitochondrial equilibrium, for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
  • a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
  • CKD chronic kidney injury
  • CKD also referred to as chronic kidney failure, is a gradual loss of kidney function that can progress to end stage renal disease (ESRD).
  • the kidney disorder may be associated with diabetes, sepsis, cardiovascular surgery, exposure to nephrotoxic drugs, and/or trauma.
  • a method comprises administering to a subject an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex, any of which having a nucleobase sequence complementary to a DNM1L nucleic acid.
  • the subject has a disorder associated with mitochondrial equilibrium, for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
  • the kidney disorder may be associated with diabetes, sepsis, cardiovascular surgery, exposure to nephrotoxic drugs, and/or trauma.
  • a method of treating a disorder associated with mitochondrial equilibrium for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
  • a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
  • administering the therapeutically effective amount of the oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex improves a marker of kidney health or kidney function.
  • Plasma markers include ALT/AST, creatinine, BUN, cystatin-c, proteinuria, and eGFR; genetic markers include DRP1, KIM-1, FABP1, and NGAL; histopathological markers include hematoxylin and eosin (H&E) staining; urine markers include cytochrome-c, KIM-1, NGAL, TIMP-2 and IGFBP-7. Renal scores (e.g., RIFLE and/or AKI-KDIGO) may also be determined in the subject.
  • a method of inhibiting expression of DNM1L nucleic acid, such as RNA, in a subject having a disease associated with DNM1L comprises administering to the subject an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex, any of which having a nucleobase sequence complementary to a DNM1L nucleic acid, thereby inhibiting expression of DNM1L nucleic acid in the subject.
  • administering the oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex inhibits expression of DNM1L in the kidney.
  • the subject has a disorder associated with mitochondrial equilibrium, for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
  • a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
  • the kidney disorder may be associated with diabetes, sepsis, cardiovascular surgery, exposure to nephrotoxic drugs, and/or trauma.
  • a method of inhibiting expression of DNM1L nucleic acid in a cell comprises contacting the cell with an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex, any of which having a nucleobase sequence complementary to a DNM1L nucleic acid, thereby inhibiting expression of DNM1L nucleic acid in the cell.
  • the cell is a kidney cell.
  • the cell is in a subject having a disorder associated with mitochondrial equilibrium, for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
  • Certain embodiments are drawn to an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex, any of which having a nucleobase sequence complementary to a DNM1L nucleic acid, for use in treating a disease associated with DNM1L.
  • the disease is a disorder associated with mitochondrial equilibrium, for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
  • an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex is for use in improving a marker of kidney health or kidney function associated with a disorder associated with mitochondrial equilibrium, for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
  • a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
  • Certain embodiments are drawn to an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex, any of which comprising a modified oligonucleotide having a nucleobase sequence complementary to a DNM1L nucleic acid, for the manufacture or preparation of a medicament for treating a disease associated with DNM1L.
  • the disease is a disorder associated with mitochondrial equilibrium, for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
  • an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex is for the manufacture or preparation of a medicament for improving a marker of kidney health or kidney function, associated with a disorder associated with mitochondrial equilibrium, for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
  • a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
  • the oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex can be any described herein.
  • compositions comprising one or more oligomeric compounds or modified oligonucleotides.
  • the one or more oligomeric compounds each consists of a modified oligonucleotide.
  • the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier.
  • a pharmaceutical composition comprises or consists of a saline solution and one or more oligomeric compound or modified oligonucleotide.
  • a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound or modified oligonucleotide.
  • the sterile saline is pharmaceutical grade saline.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound or modified oligonucleotide and water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound or modified oligonucleotide and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound or modified oligonucleotide and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS.
  • PBS phosphate-buffered saline
  • compositions comprise one or more oligomeric compound or modified oligonucleotide and one or more excipients.
  • excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
  • oligomeric compounds or modified oligonucleotides may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • compositions comprising an oligomeric compound or modified oligonucleotide encompass any pharmaceutically acceptable salts of the oligomeric compound or modified oligonucleotide, esters of the oligomeric compound or modified oligonucleotide, or salts of such esters.
  • pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide, upon administration to an animal, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
  • the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds or modified oligonucleotide, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
  • Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
  • prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.
  • Lipid moieties have been used in nucleic acid therapies in a variety of methods.
  • the nucleic acid such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids.
  • DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
  • compositions comprise a delivery system.
  • delivery systems include, but are not limited to, liposomes and emulsions.
  • Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds.
  • certain organic solvents such as dimethylsulfoxide are used.
  • compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types.
  • pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
  • compositions comprise a co-solvent system.
  • co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
  • co-solvent systems are used for hydrophobic compounds.
  • a non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80TM and 65% w/v polyethylene glycol 300.
  • the proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics.
  • co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
  • compositions are prepared for oral administration.
  • pharmaceutical compositions are prepared for buccal administration.
  • a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.).
  • a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
  • other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
  • injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like.
  • compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers.
  • Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
  • certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” is intended to include all such forms.
  • modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with potassium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in PBS. In certain embodiments, modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HC1 to achieve a desired pH. VII.
  • Compound No. 1424075 is characterized as a 3-10-3 cEt gapmer.
  • Compound 1424075 has a sequence (from 5’ to 3’) of CGTAGATAACAAGTTG (SEQ ID NO: 2610), wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
  • Compound No. 1424075 is represented by the following chemical notation: wherein:
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • Compound No. 1424075 is represented by the following chemical structure:
  • Compound No. 1424075 is a sodium salt or a potassium salt. In certain embodiments, Compound No. 1424075 is represented by the following chemical stmcture:
  • Compound No. 1424132 is characterized as a 3-10-3 cEt gapmer.
  • Compound 1424132 has a sequence (from 5’ to 3’) of CAGTATTACATAGTTC (SEQ ID NO: 2611), wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
  • Compound No 1424132 is represented by the following chemical notation: wherein
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • Compound No. 1424132 is represented by the following chemical structure:
  • Compound No. 1424132 is represented by the following chemical structure:
  • Compound No. 1424230 is characterized as a 3-10-3 cEt gapmer.
  • Compound 1424230 has a sequence (from 5’ to 3’) of TTGAATATCAAGTGGC (SEQ ID NO: 2612), wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
  • Compound No. 1424230 is represented by the following chemical notation: TksTksGksAdsAdsTdsAdsTds m CdsAdsAdsGdsTdsGksGks m Ck (SEQ ID NO: 2612), wherein
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • k a cEt sugar moiety
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • Compound No. 1424230 is represented by the following chemical structure:
  • Compound No. 1424230 is represented by the following chemical structure:
  • Compound No. 1461395 is characterized as a 3-9-4 cEt/MOE mixed wing gapmer.
  • Compound 1461395 has a sequence (from 5’ to 3’) of TTGAATATCAAGTGGC (SEQ ID NO: 2615), wherein nucleosides 1-3 have sugar modifications ofk-k-k (from 5’ to 3’), wherein nucleosides 13-16 have sugar modifications of k-k-k-e, wherein each ‘e’ represents a 2'- MOE sugar moiety, and each ‘k’ refers to a cEt sugar moiety; and each of nucleosides 4-12 are 2’-p-D-deoxynucleosides, wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
  • Compound No. 1461395 is represented by the following chemical notation: TksTksGksAdsAdsTdsAdsTds m CdsAdsAdsGdsTksGksGks m C e (SEQ ID NO: 2615), wherein
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • Compound No. 1461395 is represented by the following chemical structure: In certain embodiments, Compound No. 1461395 is represented by the following chemical structure: Compound No. 1461496
  • Compound No. 1461496 is characterized as a 3-9-4 cEt/MOE mixed wing gapmer.
  • Compound 1461496 has a sequence (from 5’ to 3’) of AAATTTATGAGGTTCC (SEQ ID NO: 2617), wherein nucleosides 1-3 have sugar modifications ofk-k-k (from 5’ to 3’), wherein nucleosides 13-16 have sugar modifications of k-k-k-e, wherein each ‘e’ represents a 2'- MOE sugar moiety, and each ‘k’ refers to a cEt sugar moiety; and each of nucleosides 4-12 are 2’-p-D-deoxynucleosides, wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
  • Compound No. 1461496 is represented by the following chemical notation:
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • k a cEt sugar moiety
  • e a 2’-OCH2CH 2 OCH3 ribosyl sugar moiety
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage.
  • Compound No. 1461496 is represented by the following chemical structure:
  • Compound No. 1461496 is represented by the following chemical structure:
  • Compound No. 1462196 is characterized as a 3-9-4 cEt/MOE mixed wing gapmer.
  • Compound 1462196 has a sequence (from 5’ to 3’) of AAATGGTAGTTTGAGG (SEQ ID NO: 2618), wherein nucleosides 1-3 have sugar modifications ofk-k-k (from 5’ to 3’), wherein nucleosides 13-16 have sugar modifications of k-k-k-e, wherein each ‘e’ represents a 2'- MOE sugar moiety, and each ‘k’ refers to a cEt sugar moiety; and each of nucleosides 4-12 are 2’-p-D-deoxynucleosides, and wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Compound No. 1462196 is represented by the following chemical notation: AksAksAksTdsGdsGdsTdsAdsGdsTdsTdsTdsGksAksGksGe (SEQ ID NO: 2618), wherein
  • A an adenine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • k a cEt sugar moiety
  • e a 2’-OCH2CH2OCH 3 ribosyl sugar moiety
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage.
  • Compound No. 1462196 is represented by the following chemical structure:
  • Compound No. 1462196 is represented by the following chemical structure: Compound No. 1273321
  • Compound No. 1273321 is characterized as a 3-10-3 cEt gapmer.
  • Compound 1273321 has a sequence (from 5’ to 3’) of GATTACTGATGAACCG (SEQ ID NO: 2608), wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
  • Compound No. 1273321 is represented by the following chemical notation: GksAksTksTdsAds m CdsTdsGdsAdsTdsGdsAdsAds m Cks m CksGk (SEQ ID NO: 2608), wherein
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • k a cEt sugar moiety
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage.
  • Compound No. 1273321 is represented by the following chemical stmcture: Compound No. 1423984
  • Compound No. 1423984 is characterized as a 3-10-3 cEt gapmer.
  • Compound 1423984 has a sequence (from 5’ to 3’) of ATGTATTAGTCTTGAC (SEQ ID NO: 2609), wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
  • Compound No. 1423984 is represented by the following chemical notation: AksTksGksTdsAdsTdsTdsAdsGdsTds m CdsTdsTdsGksAks m Ck (SEQ ID NO: 2609), wherein
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • k a cEt sugar moiety
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage.
  • Compound No. 1423984 is represented by the following chemical structure:
  • Compound No. 1423984 is represented by the following chemical structure:
  • Compound No. 1461222 is characterized as a 3-10-3 cEt gapmer.
  • Compound 1461222 has a sequence (from 5’ to 3’) of TGGTAATAAGTTGGAG (SEQ ID NO: 2613), and wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Compound No. 1461222 is represented by the following chemical notation: Tk S Gk S Gk S T C
  • A an adenine nucleobase
  • G a guanine nucleobase
  • Compound No. 1461222 is represented by the following chemical structure:
  • Compound No. 1461222 is represented by the following chemical structure: Compound No. 1461267
  • Compound No. 1461267 is characterized as a 3-10-3 cEt gapmer.
  • Compound 1461267 has a sequence (from 5’ to 3’) of CAATATTCTGTGGCAA (SEQ ID NO: 2614), wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
  • Compound No. 1461267 is represented by the following chemical notation: m CksAksAksTdsAdsTdsTds m CdsTdsGdsTdsGdsGds m CksAksAk (SEQ ID NO: 2614), wherein
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • k a cEt sugar moiety
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage.
  • Compound No. 1461267 is represented by the following chemical structure:
  • Compound No. 1461267 is represented by the following chemical structure:
  • Compound No. 1461396 is characterized as a 3-9-4 cEt/MOE mixed wing gapmer.
  • Compound 1461396 has a sequence (from 5’ to 3’) of TTTGAATATCAAGTGG (SEQ ID NO: 2616), wherein nucleosides 1-3 have sugar modifications ofk-k-k (from 5’ to 3’), wherein nucleosides 13-16 have sugar modifications of k-k-k-e, wherein each ‘e’ represents a 2'- MOE sugar moiety, and each ‘k’ refers to a cEt sugar moiety; and each of nucleosides 4-12 are 2’-p-D-deoxynucleosides, wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
  • Compound No. 1461396 is represented by the following chemical notation: TksTksTksGdsAdsAdsTdsAdsTds m CdsAdsAdsGksTksG e (SEQ ID NO: 2616), wherein
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • k a cEt sugar moiety
  • e a 2’-OCH2CH2OCH 3 ribosyl sugar moiety
  • d a 2’-P-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage.
  • Compound No. 1461396 is represented by the following chemical structure:
  • Compound No. 1461396 is represented by the following chemical stmcture: Compound No. 1546021
  • Compound No. 1546021 is characterized as a 3-10-3 cEt gapmer.
  • Compound 1546021 has a sequence (from 5’ to 3’) of CCATTACGAACTTTTC (SEQ ID NO: 2619), wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
  • Compound No. 1546021 is represented by the following chemical notation: “C ⁇ CksAksTdsTdsAds ⁇ CdsGdsAdsAds ⁇ CdsTdsTksT ⁇ Ck (SEQ ID NO: 2619), wherein
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • Compound No. 1546021 is represented by the following chemical structure:
  • Compound No. 1546021 is a sodium salt or a potassium salt.
  • Compound No. 1546021 is represented by the following chemical structure: Compound No. 1546275
  • Compound No. 1546275 is characterized as a 3-10-3 cEt gapmer.
  • Compound 1546275 has a sequence (from 5’ to 3’) of GTTTTTTACGAAGGTC (SEQ ID NO: 2620), wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
  • Compound No. 1546275 is represented by the following chemical notation: GksTksTksTdsTdsTdsAds m CdsGdsAdsAdsGdsGksTks m Ck (SEQ ID NO: 2620), wherein
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • k a cEt sugar moiety
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • Compound No. 1546275 is represented by the following chemical structure:
  • Compound No. 1546275 is represented by the following chemical structure:
  • RNA nucleoside comprising a 2’-OH sugar moiety and a thymine base
  • RNA a DNA having a modified sugar (2 ’-OH in place of one 2’-H of DNA
  • RNA a modified base
  • thymine methylated uracil
  • nucleic acid sequences provided herein are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, unless otherwise stated, including, but not limited to such nucleic acids having modified nucleobases.
  • an oligomeric compound or a modified oligonucleotide having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “AT m CGAUCG,” wherein m C indicates a cytosine base comprising a methyl group at the 5-position.
  • nucleobase sequence of SEQ ID NO: X refers only to the sequence of nucleobases in that SEQ ID NO. : X, independent of any sugar or intemucleoside linkage modifications also described in such SEQ ID.
  • Certain compounds described herein e.g., modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or 0 such as for sugar anomers, or as (D) or (L), such as for amino acids, etc.
  • Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds.
  • Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise.
  • tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.
  • the compounds described herein include variations in which one or more atoms are replaced with a nonradioactive isotope or radioactive isotope of the indicated element.
  • compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 1 H hydrogen atoms.
  • Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2 H or 3 H in place of 'H. 13 C or 14 C in place of 12 C, 15 N in place of 14 N, 17 O or 18 O in place of 16 O, and 33 S, 34 S, 35 S, or 36 S in place of 32 S.
  • nonradioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool.
  • radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.
  • Example 1 Effect of 3-10-3 cEt uniform phosphorothioate modified oligonucleotides on human DNM1L RNA in vitro, single dose Modified oligonucleotides complementary to human DNM1L nucleic acid were designed and tested for their single dose effects on DNM1L RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
  • the modified oligonucleotides in the table below are 3-10-3 cEt modified oligonucleotides with uniform phosphorothioate intemucleoside linkages.
  • the modified oligonucleotides are 16 nucleosides in length, wherein the central gap region consists of ten 2’-p-D-deoxynucleosides, and wherein the 5’ and 3’ wing regions each consist of three cEt nucleosides.
  • the sugar motif for the modified oligonucleotides is (from 5’ to 3’): kkkdddddddddkkk; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, and each “k” represents a cEt modified sugar moiety.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): ssssssssssssssss; wherein each “s” represents a phosphorothioate intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
  • “Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
  • Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NC 000012.12, truncated from nucleosides 32676001 to 32749000), to SEQ ID NO: 2 (GENBANK Accession No. NM 001278464.1), or to both.
  • “N/A” indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • DNM1L RNA levels were measured by human primer-probe set RTS50433 (forward sequence TTCCATTATCCTCGCTGTCAC, designated herein as SEQ ID NO: 6; reverse sequence CCGCATCCATGAGATCAAGT, designated herein as SEQ ID NO: 7; probe sequence AGATCCAGATGGTCGCAGAACCCTA, designated herein as SEQ ID NO: 8).
  • DNM1L RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DNM1L RNA is presented in the table below as percent DNM1L RNA relative to the amount in untreated control cells (% UTC). The values marked with a “f ” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer-probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region. N.D. in the table below refers to where the % UTC value was Not Defined.
  • “Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
  • Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 3 (GENBANK Accession No. NM 001278465.1), to SEQ ID NO: 4 (GENBANK AccessionNo. NM 012063.3), orto SEQ ID NO: 5 (GENBANK Accession No. NM 001330380.1). “N/A” indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • Example 2 Effect of mixed MOE and cEt, uniform phosphorothioate modified oligonucleotides on human DNM1L RNA in vitro, single dose
  • Modified oligonucleotides complementary to human DNM1L nucleic acid were designed and tested for their single dose effects on DNM1L RNA in vitro.
  • the modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
  • the modified oligonucleotides in the table below are 16 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): kkkddddddddkkke; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, each “e” represents a 2’-MOE sugar moiety, and each “k” represents a cEt modified sugar moiety.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): ssssssssssssss; wherein each “s” represents a phosphorothioate intemucleoside linkage.
  • “Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (described herein above), or to both. “N/A” indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • RNA samples were treated with modified oligonucleotide at a concentration of 2000 nM by free uptake at a density of 10,000 cells per well. After a treatment period of approximately 48 hours, total RNA was isolated from the cells and DNM1L RNA levels were measured by quantitative real-time RTPCR. DNM1L RNA levels were measured by human primer-probe set RTS50433 (described herein above). DNM1L RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DNM1L RNA is presented in the table below as percent DNM1L RNA relative to the amount in untreated control cells (% UTC).
  • the values marked with a “f ” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer-probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.
  • Example 3 Effect of mixed cEt and 2’-OMe, uniform phosphorothioate modified oligonucleotides on human DNM1L RNA in vitro, single dose
  • Modified oligonucleotides complementary to human DNM1L nucleic acid were designed and tested for their single dose effects on DNM1L RNA in vitro.
  • the modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
  • the modified oligonucleotides in the table below are 16 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): kkkdydddddddkkk; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, each “y” represents a 2’-OMe sugar moiety, and each “k” represents a cEt modified sugar moiety.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): ssssssssssssss; wherein each “s” represents a phosphorothioate intemucleoside linkage.
  • Each cytosine residue is a 5-methylcytosine unless otherwise marked; nonmethylated cytosine residues are indicated by a bold and underlined C.
  • “Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (described herein above), or to both. “N/A” indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • RNA samples were treated with modified oligonucleotide at a concentration of 2000 nM by free uptake at a density of 10,000 cells per well. After a treatment period of approximately 48 hours, total RNA was isolated from the cells and DNM1L RNA levels were measured by quantitative real-time RTPCR. DNM1L RNA levels were measured by human primer-probe set RTS50433 (described herein above). DNM1L RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DNM1L RNA is presented in the table below as percent DNM1L RNA relative to the amount in untreated control cells (% UTC).
  • the values marked with a “f ” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer-probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.
  • Example 4 Dose-dependent inhibition of human DNM1L in A431 cells by modified oligonucleotides
  • Modified oligonucleotides selected from the examples above were tested at various doses in A431 cells.
  • Cultured A431 cells at a density of 10,000 cells per well were treated by free uptake with various concentrations of modified oligonucleotide as specified in the tables below.
  • total RNA was isolated from the cells, and DNM1L RNA levels were measured by quantitative real-time RTPCR.
  • Human DNM1L primer-probe set RTS50433 (described herein above) was used to measure RNA levels as described above. DNM1L RNA levels were normalized to total RNA content, as measured by RIBOGREEN®.
  • DNM1L RNA Reduction of DNM1L RNA is presented in the tables below as percent DNM1L RNA, relative to the amount in untreated control cells (% UTC).
  • IC50 half maximal inhibitory concentration
  • Example 5 Dose-dependent inhibition of human DNM1L in A431 cells by modified oligonucleotides
  • Modified oligonucleotides selected from the examples above were tested at various doses in A431 cells.
  • Cultured A431 cells at a density of 10,000 cells per well were treated by free uptake with various concentrations of modified oligonucleotide as specified in the tables below.
  • total RNA was isolated from the cells, and DNM1L RNA levels were measured by quantitative real-time RTPCR.
  • Human DNM1L primer-probe set RTS50433 (described herein above) was used to measure RNA levels as described above.
  • DNM1L RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DNM1L RNA is presented in the tables below as percent DNM1L RNA, relative to the amount in untreated control cells (% UTC). N.D. in the tables below refers to instances where the % UTC value was Not Defined.
  • IC50 half maximal inhibitory concentration
  • Example 6 Dose-dependent inhibition of human DNM1L in A431 cells by modified oligonucleotides
  • Modified oligonucleotides selected from the examples above were tested at various doses in A431 cells.
  • Cultured A431 cells at a density of 20,000 cells per well were treated by free uptake with various concentrations of modified oligonucleotide as specified in the tables below.
  • total RNA was isolated from the cells, and DNM1L RNA levels were measured by quantitative real-time RTPCR.
  • Human DNM1L primer-probe set RTS50433 (described herein above) was used to measure RNA levels as described above.
  • DNM1L RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DNM1L RNA is presented in the tables below as percent DNM1L RNA, relative to the amount in untreated control cells (% UTC). N.D. in the tables below refers to instances where the % UTC value was Not Defined.
  • IC50 half maximal inhibitory concentration
  • Example 7 Dose-dependent inhibition of human DNM1L in A431 cells by modified oligonucleotides
  • Modified oligonucleotides selected from the examples above were tested at various doses in A431 cells.
  • Cultured A431 cells at a density of 20,000 cells per well were treated by free uptake with various concentrations of modified oligonucleotide as specified in the tables below.
  • total RNA was isolated from the cells, and DNM1L RNA levels were measured by quantitative real-time RTPCR.
  • Human DNM1L primer-probe set RTS50433 (described herein above) was used to measure RNA levels as described above. DNM1L RNA levels were normalized to total RNA content, as measured by RIBOGREEN®.
  • DNM1L RNA Reduction of DNM1L RNA is presented in the tables below as percent DNM1L RNA, relative to the amount in untreated control cells (% UTC).
  • Modified oligonucleotides marked with a “f ” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.
  • IC50 half maximal inhibitory concentration
  • Wildtype BALB/c mice (Jackson Laboratory) were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.
  • ALT alanine aminotransferase
  • AST aspartate aminotransferase
  • BUN blood urea nitrogen
  • TBIL total bilirubin
  • ALB Albumin
  • CREA Creatinine
  • Counts taken include red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), Mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC).
  • RBC red blood cell
  • WBC white blood cell
  • HGB hemoglobin
  • HCT hematocrit
  • MCV Mean corpuscular volume
  • MH mean corpuscular hemoglobin
  • MHC mean corpuscular hemoglobin concentration
  • Individual white blood cell counts such as that of monocytes (MON), neutrophils (NEU), lymphocytes (LYM), eosinophils (EOS), basophils (BAS), reticulocytes (RETI), and platelets (PLT) were evaluated. The results are presented in the tables below. Modified oligonucleotides that caused changes in the blood cell count outside the expected range were excluded in further studies.
  • Body and organ weights Body weights of BALB/c mice were measured on days 1 and 38, and the average body weight for each group is presented in the table below. Liver, kidney, and spleen weights were measured on the day the mice were sacrificed (day 38), and the average organ weights for each group are presented in the tables below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
  • mice Groups of four male BALB/c mice each were injected subcutaneously once a week for five weeks (for a total of 6 treatments) with 100 mg/kg of modified oligonucleotides.
  • One group of four male BALB/C mice was injected with PBS.
  • mice were euthanized seventy -two hours post the final administration of modified oligonucleotide.
  • ALT alanine aminotransferase
  • AST aspartate aminotransferase
  • BUN blood urea nitrogen
  • TBIL total bilirubin
  • ALB Albumin
  • CREA Creatinine
  • Counts taken include red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), Mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC).
  • RBC red blood cell
  • WBC white blood cell
  • HGB hemoglobin
  • HCT hematocrit
  • MCV Mean corpuscular volume
  • MH mean corpuscular hemoglobin
  • MHC mean corpuscular hemoglobin concentration
  • Individual white blood cell counts such as that of monocytes (MON), neutrophils (NEU), lymphocytes (LYM), eosinophils (EOS), basophils (BAS), reticulocytes (RETI), and platelets (PLT) were evaluated. The results are presented in the tables below. Modified oligonucleotides that caused changes in the blood cell count outside the expected range were excluded in further studies.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Provided are oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions for reducing the amount or activity of DNM1L RNA in a cell or animal, and in certain instances reducing the amount of DNM1L protein in a cell or animal. Such oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions are useful to treat a disorder associated with mitochondrial equilibrium, for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).

Description

COMPOUNDS AND METHODS FOR REDUCING DNM1L OR DRP1 EXPRESSION
Sequence Listing
The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0417WOSEQ.xml which is 2,529 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.
Field
Provided are oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions for reducing DNM1L, and in certain instances reducing DRP1, as well as uses thereof for ameliorating at least one symptom of a kidney disease or kidney injury and treatment of a cardiac disorder or cardiac injury.
Background
Kidney diseases and kidney injuries can prevent kidneys from functioning properly. The kidney’s main function is to filter and eliminate waste and fluids from the body. Symptoms of kidney diseases and injuries include, but are not limited to, nausea, vomiting, loss of appetite, reduced urine output, elevated serum creatinine levels, muscle cramping, swelling, itching, chest pain, shortness of breath and elevated blood pressure. Acute kidney injury (AKI) is an abrupt loss in kidney function. Individuals with diabetes, cancer, cardiovascular disease and human immunodeficiency virus (HIV) acquired immune deficiency syndrome (AIDS), or who have recently undergone a surgical procedure, are at risk for AKI. An individual with an increase in serum creatinine of at least 26.4 pmol/L (0.3 mg/dL), a percentage increase in serum creatinine of more than 50% from baseline, or a reduction in urine output (< 0.5 mL/kg hourly for > 6 h) may be diagnosed with AKI. Furthermore, if the acute loss of kidney function extends beyond seven days, the episode is reclassified as acute kidney disease (AKD). Finally, if the condition persists for more than three months it is again reclassified as chronic kidney disease or CKD. CKD, also referred to as chronic kidney failure, is a gradual loss of kidney function that can progress to end stage renal disease (ESRD). Kidney diseases and injuries may be treated with fluid replacement and dialysis. However, if not treated sufficiently, they may result in heart failure and/or death.
Mitochondria are highly dynamic organelles that produce ATP and maintain metabolic, catabolic, and redox homeostasis. The dynamic nature of mitochondria is due to their ability to constantly divide and fuse - processes that are believed to be regulated in part by a key mediator of mitochondrial fission, Dynamin-related protein 1 (DRP1). DRP1 is encoded by the DNM1L gene. Mitochondrial fission and fusion are known to influence mitochondrial morphology and function, and mitophagy represents a key mechanism governing mitochondrial quality and abundance. Regulation of mitochondrial dynamics, in particular modulation of aberrant DRP1 mediated fission, is a potential target for therapeutic intervention.
Summary
Oligomeric agents, oligomeric compounds, modified oligonucleotides, methods, and pharmaceutical compositions of certain embodiments described herein are useful for reducing or inhibiting DNM1L expression in a cell or animal. In certain embodiments, DNM1L RNA or protein levels can be reduced in a cell or animal. Also provided are methods of treating a disorder associated with mitochondrial equilibrium, for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD). The kidney disorder may be associated with sepsis, cardiovascular surgery, exposure to nephrotoxic drugs, and/or trauma. The oligomeric agents, oligomeric compounds, modified oligonucleotides, methods, and pharmaceutical compositions provided herein may improve a symptom of kidney disease or kidney injury. Symptoms of kidney diseases and injuries include, but are not limited to, nausea, vomiting, loss of appetite, reduced urine output, elevated serum creatinine levels, muscle cramping, swelling, itching, chest pain, shortness of breath and elevated blood pressure.
Detailed Description
It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.
Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art.
Section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety.
Definitions
Unless specifically indicated otherwise, the following terms as used herein have the following definitions: side” means a nucleoside according to the structure: , wherein Bx is a nucleobase.
“2 ’-deoxy sugar moiety” means the sugar moiety of a 2’-deoxynucleoside. As indicated in the above structure, a 2’-deoxy sugar moiety can have any stereochemistry. For example, 2’-deoxy sugar moieties include, but are not limited to 2’-p-D-deoxyribosyl sugar moieties and 2’-p-D-deoxyxylosyl sugar moieties.
“2’-p-D-deoxyribosyl nucleoside” means a nucleoside according to the structure: , wherein Bx is a nucleobase. “2’-p-D-deoxyribosyl sugar moiety” means the sugar moiety of a 2’-p-D-deoxyribosyl nucleoside. The nucleobase of a 2’-deoxynucleoside or 2’-p-D-deoxyribosyl nucleoside may be a modified nucleobase or any natural nucleobase, including but not limited to an RNA nucleobase (uracil).
“Ribo-2’-MOE nucleoside” means a nucleoside according to the structure: herein Bx is a nucleobase.
“Ribo-2’-MOE sugar moiety” means the sugar moiety of a 2 ’-MOE nucleoside as defined herein.
“MOE” means an -OCH2CH2OCH3 group.
“2’-OMe nucleoside” means a nucleoside according to the structure: , wherein Bx is a nucleobase.
“2’-OMe sugar moiety” means the sugar moiety of a 2’-OMe nucleoside. As indicated in the above structure, a 2’-OMe sugar moiety can have any stereochemistry. For example, 2’-OMe sugar moieties include, but are not limited to 2’-OCH3-p-D-xylosyl sugar moieties, 2’-OCH3-a-L-ribosyl sugar moieties, and ribo-2’-OMe sugar moieties as defined herein.
“Ribo-2’-OMe nucleoside” means a nucleoside according to the structure: , wherein Bx is a nucleobase.
“Ribo-2’-OMe sugar moiety” means the sugar moiety of a ribo-2’-OMe nucleoside.
“2’-F nucleoside” means a nucleoside according to the structure: , wherein Bx is a nucleobase.
“2’-F sugar moiety” means the sugar moiety of a 2’-F nucleoside. As indicated in the above structure, a 2’-F sugar moiety can have any stereochemistry. For example, 2’-F sugar moieties include, but are not limited to, 2’-F-P-D- xylosyl sugar moieties, 2’-F-p-D-arabinosyl sugar moieties, 2’-F-a-L-ribosyl sugar moieties, and ribo-2’-F sugar moieties as defined herein.
“Ribo-2’-F nucleoside” means a nucleoside according to the structure: , wherein Bx is a nucleobase.
“Ribo-2’-F sugar moiety” means the sugar moiety of a ribo-2’-F nucleoside as defined herein. “2’-NMA nucleoside” means a nucleoside according to the structure: , wherein Bx is a nucleobase.
“2’-NMA sugar moiety” means the sugar moiety of a 2’-NMA nucleoside. “Ribo-2’-NMA nucleoside” means a nucleoside according to the structure: , wherein Bx is a nucleobase.
“Ribo-2’-NMA sugar moiety” means the sugar moiety of a ribo-2’-NMA nucleoside.
As used herein, “2 ’-substituted” in reference to a sugar moiety means a furanosyl sugar moiety comprising at least one 2'-substituent group other than H or OH. As used herein, “2 ’-substituted nucleoside” means a nucleoside comprising a 2’-substituted furanosyl sugar moiety.
As used herein, “3’ target site” refers to the 3 ’-most nucleotide of a target nucleic acid which is complementary to an antisense oligonucleotide, when the antisense oligonucleotide is hybridized to the target nucleic acid.
As used herein, “5’ target site” refers to the 5 ’-most nucleotide of a target nucleic acid which is complementary to an antisense oligonucleotide, when the antisense oligonucleotide is hybridized to the target nucleic acid.
As used herein, “5-methylcytosine” means a cytosine modified with a methyl group attached to the 5-position. A 5-methylcytosine is a modified nucleobase.
As used herein, “abasic sugar moiety” means a sugar moiety of a nucleoside that is not attached to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as “abasic nucleosides.”
As used herein, “administering” means providing a pharmaceutical agent to a subject.
As used herein, “ameliorate” in reference to a treatment means improvement in at least one symptom relative to the same symptom in the absence of the treatment. In certain embodiments, amelioration is the reduction in the severity or frequency of a symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom.
As used herein, “antisense activity” means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound. In certain embodiments, antisense activity is the modulation of splicing of a target pre-mRNA.
As used herein, “antisense agent” means an antisense compound and optionally one or more additional features, such as a sense compound.
As used herein, “antisense compound” means an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group.
As used herein, “antisense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of an antisense compound, that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity. Antisense oligonucleotides include but are not limited to antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.
As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure, wherein the first ring of the bicyclic sugar moiety is a furanosyl ring. Examples of bicyclic sugar moieties include LNA (locked nucleic acid) sugar moiety and cEt sugar moiety as defined herein. A “bicyclic nucleoside” is a nucleoside comprising a bicyclic sugar moiety.
As used herein, “cell-targeting moiety” means a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.
As used herein, “chirally enriched” in reference to a population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom as defined herein. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds comprising modified oligonucleotides. In certain embodiments, the chiral center is at the phosphorous atom of a phosphorothioate intemucleoside linkage. In certain embodiments, the chiral center is at the phosphorous atom of a mesyl phosphoramidate intemucleoside linkage.
As used herein, “cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
As used herein, “complementary” in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. “Complementary region” in reference to a region of an oligonucleotide means that at least 70% of the nucleobases of that region and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. Complementary nucleobases mean nucleobases that are capable of forming hydrogen bonds with one another. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (mC) and guanine (G). Certain modified nucleobases that pair with natural nucleobases or with other modified nucleobases are known in the art and are not considered complementary nucleobases as defined herein unless indicated otherwise. For example, inosine can pair, but is not considered complementary, with adenosine, cytosine, or uracil. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, “fully complementary” or “100% complementary” in reference to oligonucleotides means that oligonucleotides are complementary to another oligonucleotide or nucleic acid at each nucleoside of the oligonucleotide.
As used herein, “conjugate group” means a group of atoms that is directly attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide. As used herein, “conjugate linker” means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
As used herein, “conjugate moiety” means a covalently bound group of atoms that modifies one or more pharmacological properties of a molecule compared to the identical molecule lacking the conjugate moiety, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.
As used herein, “constrained ethyl nucleoside” or “cEt nucleoside” means , wherein Bx is a nucleobase
“Constrained ethyl” or “cEf ’ or “cEt sugar moiety” means the sugar moiety of a cEt nucleoside.
As used herein, “deoxy region” means a region of 5-12 contiguous nucleotides, wherein at least 70% of the nucleosides comprise a 2’-deoxy sugar moiety. In certain embodiments, a deoxy region is the gap of a gapmer.
As used herein, "contiguous" in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or intemucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.
As used herein, “double-stranded” refers to a region of hybridized nucleic acid(s). In certain embodiments, such double-strand results from hybridization of an oligonucleotide (or portion thereof) to a target region of a transcript. In certain embodiments, a double-strand results from hybridization of two oligonucleotides (or portions thereof) to one another. In certain embodiments, the hybridized regions are portions (including the entirety) of two separate molecules (e.g., no covalent bond connects the two complementary strands together). In certain embodiments, the hybridized regions are portions of the same molecule that have hybridized (e.g., a hairpin structure).
As used herein, “duplex” means a structure formed by two separate nucleic acid molecules at least a portion of which are complementary and that are hybridized to one another, but are not covalently bonded to one another.
As used herein, “gapmer” means a modified oligonucleotide comprising an internal region positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions, and wherein the modified oligonucleotide supports RNAse H cleavage. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.” In certain embodiments, the internal region is a deoxy region. The positions of the internal region or gap refer to the order of the nucleosides of the internal region and are counted starting from the 5 ’-end of the internal region. Unless otherwise indicated, “gapmer” refers to a sugar motif. In certain embodiments, each nucleoside of the gap is a 2’-deoxynucleoside. In certain embodiments, the gap comprises one 2’-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2’-deoxynucleosides. As used herein, the term “MOE gapmer” indicates a gapmer having a gap comprising 2’ - deoxynucleosides and wings comprising 2 ’-MOE nucleosides. As used herein, the term “mixed wing gapmer” indicates a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified intemucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications. As used herein, “hotspot region” is a range of nucleobases on a target nucleic acid that is amenable to reduction of the amount or activity of the target nucleic acid by the action of an oligomeric agent, oligomeric compound, antisense compound, or antisense agent.
As used herein, “hybridization” means the annealing of oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target.
As used herein, “intemucleoside linkage” is the covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein “modified intemucleoside linkage” means any intemucleoside linkage other than a phosphodiester intemucleoside linkage.
As used herein, “linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).
As used herein, “linker-nucleoside” means an RNA or DNA nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety through at least one labile bond. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.
As used herein, “mismatch” or “non-complementary” means a nucleobase of a first nucleic acid sequence that is not complementary with the corresponding nucleobase of a second nucleic acid sequence or target nucleic acid when the first and second nucleic acid sequences are aligned.
As used herein, “motif’ means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.
As used herein, “modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.
As used herein, “modified sugar moiety” means a sugar moiety of a nucleoside other than 2’-p-D-deoxyribosyl sugar moiety (the sugar moiety of unmodified DNA) or p-D-ribosyl sugar moiety (the sugar moiety of unmodified RNA).
As used herein, “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
As used herein, “nucleobase” means an unmodified nucleobase or a modified nucleobase. A nucleobase is a heterocyclic moiety. As used herein an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one other nucleobase. A “5-methylcytosine” is an example of a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
As used herein, “nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or intemucleoside linkage modification.
As used herein, “nucleoside” means a compound or fragment of a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. As used herein, “oligomeric agent” means an oligomeric compound and optionally one or more additional features, such as a second oligomeric compound. An oligomeric agent may be a single-stranded oligomeric compound or may be an oligomeric duplex formed by two complementary oligomeric compounds.
As used herein, “oligomeric compound” means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired. A “singled-stranded oligomeric compound” is an unpaired oligomeric compound.
The term “oligomeric duplex” means a duplex formed by two oligomeric compounds having complementary nucleobase sequences.
As used herein, “oligonucleotide” means a strand of linked nucleosides connected via intemucleoside linkages, wherein each nucleoside and intemucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide comprising one or more modified nucleosides or having one or more modified intemucleoside linkages. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not comprise any nucleoside modifications or intemucleoside modifications.
As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, symps, slurries, suspension and lozenges for the oral ingestion by a subject. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.
As used herein “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
As used herein “pharmaceutical composition” means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
As used herein “prodrug” means a therapeutic agent in a first form outside the body that is converted to a second form within an animal or cells thereof. Typically, conversion of a prodmg within the animal is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions. In certain embodiments, the first form of the prodmg is less active than the second form.
As used herein, “RNAi agent” means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi agents include, but are not limited to double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may comprise conjugate groups and/or terminal groups. In certain embodiments, an RNAi agent modulates the amount and/or activity, of a target nucleic acid. The term RNAi agent excludes antisense agents that act through RNase H.
As used herein, “RNase H agent” means an antisense agent that acts through RNase H to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. In certain embodiments, RNase H agents are singlestranded. In certain embodiments, RNase H agents are double-stranded. RNase H agents may comprise conjugate groups and/or terminal groups. In certain embodiments, an RNase H agent modulates the amount and/or activity of a target nucleic acid. The term RNase H agent excludes antisense agents that act principally through RISC/Ago2.
As used herein, “self-complementary” in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.
As used herein, “sense compound” means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.
As used herein, “sense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of a sense compound, that is capable of hybridizing to an antisense oligonucleotide.
As used herein, “stabilized phosphate group” means a 5 ’-phosphate analog that is metabolically more stable than a 5 ’-phosphate as naturally occurs on DNA or RNA.
As used herein, “standard cell assay” means the assays described in the Examples and reasonable variations thereof.
As used herein, “stereorandom” or “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center that is not controlled during synthesis, or enriched following synthesis, for a particular absolute stereochemical configuration. The stereochemical configuration of a chiral center is random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be the same as the number of molecules having the (R) configuration of the stereorandom chiral center (“racemic”). In certain embodiments, the stereorandom chiral center is not racemic because one absolute configuration predominates following synthesis, e.g., due to the action of non-chiral reagents near the enriched stereochemistry of an adjacent sugar moiety. In certain embodiments, the stereorandom chiral center is at the phosphorous atom of a stereorandom phosphorothioate or mesyl phosphoramidate intemucleoside linkage.
As used herein, “subject” means a human or non-human animal. In certain embodiments, the subject is a human.
As used herein, “sugar moiety” means any sugar moiety described herein and may be an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a -D-ribosyl moiety, as found in natural RNA (an “unmodified RNA sugar moiety”), or a 2’- -D-deoxyribosyl sugar moiety, as found in natural DNA (an “unmodified DNA sugar moiety”). As used herein, “modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
As used herein, “sugar surrogate” means a moiety that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group in an oligonucleotide, but which is not a furanosyl sugar moiety or a bicyclic sugar moiety. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids. Examples of sugar surrogates include GNA (glycol nucleic acid), FHNA (fluoro hexitol nucleic acid), morpholino, and other structures described herein and known in the art.
As used herein, “symptom” means any physical feature or test result that indicates the existence or extent of a disease or disorder. In certain embodiments, a symptom is apparent to a subject or to a medical professional examining or testing said subject. As used herein, “target nucleic acid” and “target RNA” mean a nucleic acid that an oligomeric compound is designed to affect. Target RNA means an RNA transcript and includes pre-mRNA and mRNA unless otherwise specified.
As used herein, “target region” means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
As used herein, “terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
As used herein, “treating” means improving a subject’s disease or condition by administering an oligomeric agent or oligomeric compound described herein. In certain embodiments, treating a subject improves a symptom relative to the same symptom in the absence of the treatment. In certain embodiments, treatment reduces in the severity or frequency of a symptom, or delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom.
As used herein, “therapeutically effective amount” means an amount of a pharmaceutical agent or composition that provides a therapeutic benefit to an animal. For example, a therapeutically effective amount improves a symptom of a disease.
CERTAIN EMBODIMENTS
Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of a DNM1L nucleic acid, and wherein at least one sugar moiety of the modified oligonucleotide is a modified sugar moiety and at least one intemucleoside linkage of the modified oligonucleotide isa modified intemucleoside linkage.
Embodiment 2. The oligomeric compound of embodiment 1, wherein the DNM1L nucleic acid has the nucleobase sequence of any of SEQ ID NOs: 1 or 2.
Embodiment s. The oligomeric compound of embodiment 1 or 2, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 3238-3253, 3370- 3385, 3405-3420, 3435-3450, 3439-3454, 3440-3455, 3441-3456, 3442-3457, 3443-3458, 3560-3575, 3561-3576, 3710-
3725, 3711-3726, 3784-3799, 3788-3803, 3789-3804, 3836-3851, 3841-3856, 3845-3860, 3896-3911, 3996-4011, 4075-
4090, 4080-4095, 4082-4097, 4083-4098, 4102-4117, 4111-4126, 4112-4127, 4113-4128, 4114-4129, 4115-4130, 4117-
4132, 4121-4136, 4158-4173, 4159-4174, 4160-4175, 4161-4176, 4162-4177, 4289-4304, 4290-4305, 4292-4307, 4293-
4308, 4295-4310, 4320-4335, 4384-4399, 4414-4429, 4415-4430, 4416-4431, 4447-4462, 4458-4473, 4467-4482, 4498-
4513, 4499-4514, 4501-4516, 4504-4519, 4505-4520, 4587-4602, 4588-4603, 4590-4605, 4592-4607, 4632-4647, 4723-
4738, 4725-4740, 4727-4742, 4729-4744, 4733-4748, 4734-4749, 4807-4822, 5145-5160, 5158-5173, 5159-5174, 5308-
5323, 5310-5325, 5660-5675, 5746-5761, 5787-5802, 5798-5813, 5801-5816, 5802-5817, 5803-5818, 5804-5819, 5805-
5820, 5806-5821, 5810-5825, 5811-5826, 5812-5827, 5813-5828, 5814-5829, 5815-5830, 6016-6031, 6529-6544, 6530-
6545, 6531-6546, 6535-6550, 6536-6551, 6537-6552, 6539-6554, 6540-6555, 6541-6556, 6564-6579, 6566-6581, 6567-
6582, 6568-6583, 6583-6598, 6584-6599, 6619-6634, 6623-6638, 6627-6642, 6940-6955, 6942-6957, 7053-7068, 7072-
7087, 7073-7088, 7074-7089, 7082-7097, 7094-7109, 7095-7110, 7130-7145, 7282-7297, 7283-7298, 7402-7417, 7403- 7418, 7404-7419, 7405-7420, 7406-7421, 7968-7983, 7969-7984, 8115-8130, 8117-8132, 8120-8135, 8163-8178, 8242-
8257, 8243-8258, 8268-8283, 8269-8284, 8270-8285, 8274-8289, 8275-8290, 8276-8291, 8278-8293, 8279-8294, 8280-
8295, 8303-8318, 8305-8320, 8306-8321, 8307-8322, 8322-8337, 8323-8338, 8753-8768, 9296-9311, 9550-9565, 9695-
9710, 9705-9720, 9747-9762, 9807-9822, 10436-10451, 11181-11196, 12291-12306, 12548-12563, 12799-12814, 12838-
12853, 12995-13010, 13478-13493, 13479-13494, 13480-13495, 13481-13496, 13482-13497, 13483-13498, 13484-
13499, 13486-13501, 13487-13502, 13706-13721, 13940-13955, 13996-14011, 14015-14030, 14016-14031, 14018-
14033, 14019-14034, 14061-14076, 14066-14081, 14069-14084, 14147-14162, 14358-14373, 14409-14424, 14411-
14426, 14412-14427, 14413-14428, 14420-14435, 14464-14479, 14465-14480, 14468-14483, 14534-14549, 14544-
14559, 14569-14584, 14592-14607, 14608-14623, 14701-14716, 14725-14740, 14736-14751, 14739-14754, 14740-
14755, 14742-14757, 14743-14758, 14744-14759, 14745-14760, 14746-14761, 14968-14983, 14969-14984, 15643-
15658, 15665-15680, 15666-15681, 15667-15682, 15689-15704, 15690-15705, 15692-15707, 15700-15715, 15755-
15770, 15762-15777, 15811-15826, 15860-15875, 15897-15912, 15898-15913, 15903-15918, 15938-15953, 15976-
15991, 15977-15992, 16003-16018, 16011-16026, 16287-16302, 16288-16303, 16348-16363, 16415-16430, 16460-
16475, 16461-16476, 16462-16477, 16485-16500, 16487-16502, 16543-16558, 16591-16606, 16594-16609, 16620-
16635, 16621-16636, 16696-16711, 16722-16737, 16728-16743, 16776-16791, 16809-16824, 16828-16843, 16830-
16845, 16904-16919, 16905-16920, 16915-16930, 16916-16931, 16917-16932, 16926-16941, 16927-16942, 16970-
16985, 16972-16987, 17002-17017, 17003-17018, 17004-17019, 17005-17020, 17006-17021, 17007-17022, 17009-
17024, 17010-17025, 17011-17026, 17074-17089, 17095-17110, 17539-17554, 18061-18076, 18238-18253, 18379-
18394, 18433-18448, 18434-18449, 18486-18501, 18489-18504, 18490-18505, 18491-18506, 18492-18507, 18493-
18508, 18494-18509, 18495-18510, 18496-18511, 18554-18569, 18570-18585, 18571-18586, 18583-18598, 18616-
18631, 18716-18731, 18721-18736, 18761-18776, 18820-18835, 18821-18836, 18822-18837, 18823-18838, 18824-
18839, 18868-18883, 18870-18885, 18872-18887, 18920-18935, 18921-18936, 18976-18991, 19046-19061, 19048-
19063, 19049-19064, 19060-19075, 19187-19202, 19208-19223, 19211-19226, 19364-19379, 19395-19410, 19398-
19413, 19456-19471, 19861-19876, 19869-19884, 19983-19998, 20080-20095, 20083-20098, 20084-20099, 20130-
20145, 20146-20161, 21297-21312, 21298-21313, 21300 21315, 21438-21453, 21475-21490, 22008-22023, 22122- 22137, 22124-22139, 22139-22154, 22140-22155, 22151 22166, 22250-22265, 22324-22339, 22326-22341, 22327- 22342, 22328-22343, 22447-22462, 22464-22479, 22467 22482, 22646-22661, 22674-22689, 22676-22691, 22677- 22692, 22775-22790, 22776-22791, 22777-22792, 22783 22798, 22788-22803, 22789-22804, 22794-22809, 23071- 23086, 23072-23087, 23077-23092, 23100-23115, 23115 23130, 23116-23131, 23117-23132, 23228-23243, 23270- 23285, 23498-23513, 23499-23514, 23506-23521, 23507 23522, 23508-23523, 23639-23654, 23876-23891, 23878- 23893, 23908-23923, 23909-23924, 23911-23926, 23912 23927, 23950-23965, 23951-23966, 23971-23986, 24074- 24089, 24075-24090, 24076-24091, 24077-24092, 24079 24094, 24777-24792, 25489-25504, 25490-25505, 25491- 25506, 25509-25524, 25524-25539, 25655-25670, 25996 26011, 26259-26274, 26261-26276, 26262-26277, 26263- 26278, 26265-26280, 26268-26283, 26269-26284, 26270 26285, 26271-26286, 26272-26287, 26273-26288, 26274- 26289, 26275-26290, 26276-26291, 26277-26292, 26279 26294, 26280-26295, 26320-26335, 26351-26366, 26352- 26367, 26353-26368, 26359-26374, 26512-26527, 26594 26609, 26730-26745, 26762-26777, 26773-26788, 26913-
26928, 26915-26930, 27018-27033, 27023-27038, 27100 27115, 27193-27208, 27194-27209, 27195-27210, 27258-
27273, 27271-27286, 27286-27301, 27362-27377, 27392 27407, 27420-27435, 27421-27436, 27422-27437, 27423-
27438, 27424-27439, 27425-27440, 27567-27582, 27570 27585, 27676-27691, 27679-27694, 27693-27708, 27696- 27711, 27703-27718, 27705-27720, 27709-27724, 27748-27763, 27762-27777, 27936-27951, 28023-28038, 28024-
28039, 28025-28040, 28026-28041, 28027-28042, 28028-28043, 28034-28049, 28109-28124, 28125-28140, 28570-
28585, 28572-28587, 28579-28594, 28582-28597, 28643-28658, 28786-28801, 28803-28818, 28844-28859, 28967-
28982, 29480-29495, 29484-29499, 29485-29500, 29494-29509, 29496-29511, 29498-29513, 29499-29514, 29500-
29515, 29501-29516, 29502-29517, 29503-29518, 29504-29519, 29505-29520, 29564-29579, 29640-29655, 29642-
29657, 29644-29659, 29672-29687, 29676-29691, 29686-29701, 29734-29749, 29786-29801, 29921-29936, 30019-
30034, 30133-30148, 30189-30204, 30213-30228, 30216-30231, 30254-30269, 30256-30271, 30294-30309, 30318
30333, 30350-30365, 30494-30509, 30495-30510, 30593-30608, 30754-30769, 30889-30904, 30890-30905, 30892
30907, 30936-30951, 30938-30953, 31087-31102, 31130-31145, 31221-31236, 31243-31258, 31491-31506, 31596
31611, 31653-31668, 31654-31669, 31656-31671, 32146-32161, 32151-32166, 32153-32168, 32156-32171, 32274
32289, 32297-32312, 32299-32314, 32301-32316, 32302-32317, 32303-32318, 32304-32319, 32305-32320, 32309
32324, 32311-32326, 32342-32357, 32344-32359, 32346-32361, 32347-32362, 32348-32363, 32349-32364, 32352
32367, 32353-32368, 32362-32377, 32532-32547, 32533-32548, 32558-32573, 32559-32574, 32564-32579, 32633
32648, 32637-32652, 32638-32653, 32641-32656, 32785-32800, 32797-32812, 32798-32813, 32960-32975, 32970
32985, 32972-32987, 32974-32989, 32976-32991, 32977-32992, 32978-32993, 32979-32994, 32980-32995, 32981
32996, 32982-32997, 32984-32999, 32986-33001, 32987-33002, 32988-33003, 32990-33005, 33012-33027, 33024
33039, 33071-33086, 33072-33087, 33080-33095, 33099-33114, 33144-33159, 33212-33227, 33219-33234, 33220
33235, 33223-33238, 33226-33241, 33253-33268, 33254-33269, 33255-33270, 33257-33272, 33264-33279, 33266
33281, 33520-33535, 33521-33536, 33522-33537, 33523-33538, 33538-33553, 33677-33692, 33722-33737, 33734
33749, 33740-33755, 33741-33756, 33742-33757, 33743-33758, 33744-33759, 33746-33761, 33748-33763, 33750
33765, 33752-33767, 33762-33777, 33803-33818, 33804-33819, 33813-33828, 33824-33839, 33834-33849, 33838
33853, 33840-33855, 33842-33857, 33843-33858, 33844-33859, 33845-33860, 33852-33867, 33875-33890, 33900
33915, 33920-33935, 33959-33974, 33977-33992, 33980-33995, 33981-33996, 33983-33998, 34003-34018, 34040
34055, 34043-34058, 34046-34061, 34051-34066, 34056-34071, 34057-34072, 34077-34092, 34084-34099, 34087
34102, 34088-34103, 34095-34110, 34139-34154, 34140-34155, 34183-34198, 34184-34199, 34189-34204, 34190
34205, 34194-34209, 34203-34218, 34210-34225, 34211-34226, 34212-34227, 34214-34229, 34216-34231, 34227
34242, 34228-34243, 34235-34250, 34237-34252, 34239-34254, 34242-34257, 34243-34258, 34244-34259, 34245
34260, 34246-34261, 34247-34262, 34249-34264, 34250-34265, 34252-34267, 34253-34268, 34254-34269, 34255
34270, 34256-34271, 34257-34272, 34258-34273, 34261-34276, 34262-34277, 34264-34279, 34265-34280, 34266
34281, 34278-34293, 34279-34294, 34280-34295, 34283-34298, 34287-34302, 34288-34303, 34290-34305, 34293
34308, 34294-34309, 34295-34310, 34296-34311, 34297-34312, 34298-34313, 34317-34332, 34318-34333, 34321
34336, 34323-34338, 34325-34340, 34327-34342, 34328-34343, 34329-34344, 34330-34345, 34331-34346, 34332
34347, 34334-34349, 34373-34388, 34374-34389, 34375-34390, 34376-34391, 34377-34392, 34406-34421, 34426
34441, 34427-34442, 34430-34445, 34432-34447, 34433-34448, 34434-34449, 34486-34501, 34487-34502, 34728
34743, 34732-34747, 34733-34748, 34735-34750, 34845-34860, 34928-34943, 34930-34945, 34932-34947, 34934
34949, 34935-34950, 34936-34951, 34937-34952, 34938-34953, 34939-34954, 34940-34955, 34942-34957, 34943
34958, 34944-34959, 34945-34960, 34958-34973, 34973-34988, 34979-34994, 34980-34995, 34982-34997, 34984
34999, 34986-35001, 35020-35035, 35063-35078, 35064-35079, 35069-35084, 35070-35085, 35117-35132, 35294
35309, 35365-35380, 35369-35384, 35371-35386, 35374-35389, 35376-35391, 35378-35393, 35380-35395, 35382 35397, 35383-35398, 35384-35399, 35385-35400, 35386-35401, 35387-35402, 35389-35404, 35396-35411, 35397
35412, 35398-35413, 35401-35416, 35404-35419, 35407-35422, 35408-35423, 35413-35428, 35415-35430, 35417
35432, 35419-35434, 35420-35435, 35421-35436, 35422-35437, 35423-35438, 35425-35440, 35426-35441, 35427
35442, 35458-35473, 35459-35474, 35460-35475, 35461-35476, 35463-35478, 35464-35479, 35465-35480, 35466
35481, 35467-35482, 35469-35484, 35475-35490, 35478-35493, 35479-35494, 35484-35499, 35490-35505, 35503
35518, 35523-35538, 35570-35585, 35574-35589, 35902-35917, 35926-35941, 35936-35951, 35943-35958, 35949
35964, 35999-36014, 36000-36015, 36004-36019, 36011-36026, 36013-36028, 36015-36030, 36017-36032, 36018
36033, 36019-36034, 36020-36035, 36021-36036, 36023-36038, 36024-36039, 36025-36040, 36027-36042, 36054
36069, 36061-36076, 36063-36078, 36088-36103, 36100-36115, 36102-36117, 36107-36122, 36108-36123, 36109
36124, 36110-36125, 36111-36126, 36155-36170, 36164-36179, 36260-36275, 36270-36285, 36359-36374, 36705
36720, 36733-36748, 36735-36750, 36741-36756, 36742-36757, 36743-36758, 36744-36759, 36745-36760, 36775
36790, 36776-36791, 36777-36792, 36778-36793, 36779-36794, 36780-36795, 36781-36796, 36782-36797, 36783
36798, 36784-36799, 36785-36800, 36797-36812, 36815-36830, 36838-36853, 36844-36859, 36846-36861, 36847
36862, 36889-36904, 36893-36908, 36903-36918, 36911-36926, 36917-36932, 36918-36933, 36919-36934, 36946
36961, 36947-36962, 36957-36972, 36961-36976, 36966-36981, 36969-36984, 36970-36985, 36971-36986, 36972
36987, 36973-36988, 36990-37005, 37031-37046, 37041-37056, 37043-37058, 37045-37060, 37051-37066, 37052
37067, 37123-37138, 37124-37139, 37125-37140, 37132-37147, 37134-37149, 37154-37169, 37158-37173, 37218
37233, 37219-37234, 37252-37267, 37253-37268, 37254-37269, 37256-37271, 37258-37273, 37260-37275, 37262
37277, 37263-37278, 37264-37279, 37265-37280, 37266-37281, 37267-37282, 37268-37283, 37274-37289, 37276
37291, 37284-37299, 37286-37301, 37287-37302, 37288-37303, 37290-37305, 37305-37320, 37413-37428, 37654
37669, 37833-37848, 37864-37879, 37873-37888, 38001-38016, 38003-38018, 38004-38019, 38022-38037, 38061
38076, 38063-38078, 38066-38081, 38096-38111, 38981-38996, 38983-38998, 38984-38999, 38986-39001, 38987
39002, 38988-39003, 39061-39076, 39252-39267, 39263-39278, 39265-39280, 39873-39888, 39876-39891, 39877
39892, 39879-39894, 39880-39895, 39881-39896, 39882-39897, 39883-39898, 39884-39899, 39986-40001, 40012
40027, 40014-40029, 40015-40030, 40025-40040, 40073-40088, 40074-40089, 40147-40162, 40152-40167, 40153-
40168, 40888-40903, 40922-40937, 40923-40938, 41011-41026, 41013-41028, 41018-41033, 41021-41036, 41022-
41037, 41024-41039, 41027-41042, 41519-41534, 41520-41535, 41522-41537, 41527-41542, 41530-41545, 41531-
41546, 41533-41548, 41536-41551, 41572-41587, 41575-41590, 41576-41591, 41577-41592, 41578-41593, 41603-
41618, 41605-41620, 41608-41623, 41609-41624, 41610-41625, 41611-41626, 41636-41651, 41638-41653, 41641-
41656, 41642-41657, 41643-41658, 41644-41659, 41669-41684, 41671-41686, 41674-41689, 41675-41690, 41676-
41691, 41677-41692, 41702-41717, 41704-41719, 41707-41722, 41708-41723, 41709-41724, 41710-41725, 41735-
41750, 41737-41752, 41740-41755, 41741-41756, 41742-41757, 41743-41758, 41770-41785, 41773-41788, 41774-
41789, 41775-41790, 41776-41791, 42491-42506, 42528-42543, 42570-42585, 42644-42659, 42649-42664, 42653-
42668, 42675-42690, 42680-42695, 42681-42696, 42682-42697, 42699-42714, 42700-42715, 42717-42732, 42728-
42743, 42729-42744, 42743-42758, 42748-42763, 42755-42770, 42760-42775, 42763-42778, 42772-42787, 42784-
42799, 42791-42806, 42797-42812, 42804-42819, 42866-42881, 42867-42882, 42868-42883, 42905-42920, 43032-
43047, 43305-43320, 43315-43330, 43316-43331, 43317-43332, 43319-43334, 43336-43351, 43338-43353, 43339-
43354, 43340-43355, 43344-43359, 43345-43360, 43347-43362, 43349-43364, 43350-43365, 43361-43376, 43365-
43380, 43410-43425, 43431-43446, 43438-43453, 43450-43465, 43451-43466, 43452-43467, 43454-43469, 43469- 43484, 43471-43486, 43483-43498, 43511-43526, 43529-43544, 43530-43545, 43531-43546, 43532-43547, 43533-
43548, 43535-43550, 43558-43573, 43559-43574, 43567-43582, 43573-43588, 43595-43610, 43621-43636, 43631-
43646, 43643-43658, 43671-43686, 43688-43703, 43689-43704, 43690-43705, 43691-43706, 43692-43707, 43695-
43710, 43697-43712, 43726-43741, 43728-43743, 43890-43905, 43893-43908, 43894-43909, 43895-43910, 43896-
43911, 43918-43933, 43920-43935, 43921-43936, 43923-43938, 43959-43974, 44001-44016, 44011-44026, 44012-
44027, 44212-44227, 44213-44228, 44215-44230, 44216-44231, 44222-44237, 44308-44323, 44333-44348, 44334-
44349, 44335-44350, 44337-44352, 44339-44354, 44341-44356, 44387-44402, 44390-44405, 44391-44406, 44392-
44407, 44405-44420, 44406-44421, 44434-44449, 44443-44458, 44561-44576, 44594-44609, 44598-44613, 44619-
44634, 44630-44645, 44631-44646, 44632-44647, 44634-44649, 44663-44678, 44664-44679, 44665-44680, 44666-
44681, 44667-44682, 44668-44683, 44689-44704, 44697-44712, 44698-44713, 44699-44714, 44701-44716, 44703-
44718, 44705-44720, 44707-44722, 44708-44723, 44709-44724, 44710-44725, 44711-44726, 44713-44728, 44764-
44779, 44961-44976, 45354-45369, 45355-45370, 45356-45371, 45357-45372, 45386-45401, 45389-45404, 45559-
45574, 45589-45604, 45590-45605, 45792-45807, 45807-45822, 45892-45907, 46208-46223, 46219-46234, 46220-
46235, 46221-46236, 46304-46319, 46318-46333, 46440-46455, 46444-46459, 46445-46460, 46446-46461, 46448-
46463, 46473-46488, 46474-46489, 46475-46490, 46476-46491, 46477-46492, 46478-46493, 46479-46494, 46484-
46499, 46485-46500, 46486-46501, 46488-46503, 46489-46504, 46490-46505, 46492-46507, 46494-46509, 46495-
46510, 46496-46511, 46497-46512, 46501-46516, 46502-46517, 46504-46519, 46507-46522, 46508-46523, 46509-
46524, 46514-46529, 46524-46539, 46527-46542, 46528-46543, 46529-46544, 46533-46548, 46542-46557, 46545-
46560, 46547-46562, 46549-46564, 46551-46566, 46552-46567, 46553-46568, 46554-46569, 46555-46570, 46564-
46579, 46565-46580, 46566-46581, 46567-46582, 46573-46588, 46574-46589, 46575-46590, 46584-46599, 46594-
46609, 46614-46629, 46616-46631, 46617-46632, 46627-46642, 46651-46666, 46661-46676, 46662-46677, 46705-
46720, 46706-46721, 46709-46724, 46774-46789, 46962-46977, 47178-47193, 47180-47195, 47316-47331, 47317-
47332, 47318-47333, 47751-47766, 47754-47769, 47789-47804, 47859-47874, 47863-47878, 47928-47943, 48006-
48021, 48024-48039, 48025-48040, 48041-48056, 48047-48062, 48065-48080, 48068-48083, 48088-48103, 48174-
48189, 48175-48190, 48178-48193, 48186-48201, 48197-48212, 48243-48258, 48246-48261, 48743-48758, 48744-
48759, 48793-48808, 48819-48834, 48862-48877, 48880-48895, 48884-48899, 48931-48946, 48946-48961, 49053-
49068, 49165-49180, 49166-49181, 49167-49182, 49169-49184, 49313-49328, 49324-49339, 49467-49482, 49470-
49485, 49499-49514, 49933-49948, 49934-49949, 49997-50012, 50047-50062, 50138-50153, 50213-50228, 50225-
50240, 50342-50357, 50359-50374, 50416-50431, 50424-50439, 50478-50493, 50522-50537, 50539-50554, 50544-
50559, 50724-50739, 50765-50780, 50786-50801, 50788-50803, 50849-50864, 50896-50911, 50979-50994, 51018-
51033, 51039-51054, 51234-51249, 51254-51269, 51255-51270, 51258-51273, 51327-51342, 51338-51353, 51537-
51552, 51539-51554, 51554-51569, 51579-51594, 51609-51624, 51618-51633, 51619-51634, 51621-51636, 51622-
51637, 51648-51663, 51650-51665, 51651-51666, 51652-51667, 51654-51669, 51677-51692, 51704-51719, 51707-
51722, 51719-51734, 51772-51787, 51775-51790, 51776-51791, 51785-51800, 51959-51974, 51966-51981, 52002-
52017, 52004-52019, 52124-52139, 52267-52282, 52279-52294, 52280-52295, 52281-52296, 52282-52297, 52283-
52298, 52289-52304, 52295-52310, 52308-52323, 52318-52333, 52319-52334, 52321-52336, 52322-52337, 52326-
52341, 52327-52342, 52328-52343, 52329-52344, 52407-52422, 52535-52550, 52536-52551, 52538-52553, 52741-
52756, 53377-53392, 53752-53767, 53756-53771, 53881-53896, 53882-53897, 53946-53961, 53947-53962, 53948-
53963, 54511-54526, 54512-54527, 54513-54528, 54561-54576, 54649-54664, 54657-54672, 54658-54673, 54865- 54880, 54866-54881, 54922-54937, 54923-54938, 54924-54939, 54984-54999, 55009-55024, 55043-55058, 55046
55061, 55055-55070, 55056-55071, 55057-55072, 55058-55073, 55059-55074, 55111-55126, 55112-55127, 55114
55129, 55128-55143, 55129-55144, 55130-55145, 55131-55146, 55132-55147, 55133-55148, 55135-55150, 55143
55158, 55148-55163, 55172-55187, 55178-55193, 55184-55199, 55186-55201, 55187-55202, 55188-55203, 55189
55204, 55190-55205, 55473-55488, 55736-55751, 55777-55792, 55848-55863, 55849-55864, 55863-55878, 55896
55911, 55900-55915, 55901-55916, 55902-55917, 55904-55919, 55906-55921, 55907-55922, 55910-55925, 55943
55958, 55944-55959, 55945-55960, 55949-55964, 55950-55965, 55951-55966, 56019-56034, 56027-56042, 56029
56044, 56033-56048, 56038-56053, 56039-56054, 56040-56055, 56041-56056, 56056-56071, 56079-56094, 56123
56138, 56207-56222, 56208-56223, 56210-56225, 56211-56226, 56212-56227, 56213-56228, 56239-56254, 56240
56255, 56264-56279, 56266-56281, 56288-56303, 56289-56304, 56290-56305, 56298-56313, 56299-56314, 56300
56315, 56302-56317, 56303-56318, 56306-56321, 56311-56326, 56315-56330, 56317-56332, 56319-56334, 56320
56335, 56321-56336, 56323-56338, 56325-56340, 56337-56352, 56347-56362, 56348-56363, 56351-56366, 56360
56375, 56361-56376, 56368-56383, 56369-56384, 56372-56387, 56373-56388, 56374-56389, 56375-56390, 56376
56391, 56377-56392, 56380-56395, 56381-56396, 56382-56397, 56384-56399, 56385-56400, 56386-56401, 56387
56402, 56388-56403, 56389-56404, 56390-56405, 56392-56407, 56393-56408, 56403-56418, 56404-56419, 56405
56420, 56407-56422, 56448-56463, 56481-56496, 56482-56497, 56522-56537, 56523-56538, 56524-56539, 56525
56540, 56531-56546, 56534-56549, 56551-56566, 56570-56585, 56571-56586, 56572-56587, 56573-56588, 56574
56589, 56575-56590, 56576-56591, 56592-56607, 56597-56612, 56598-56613, 56601-56616, 56602-56617, 56620
56635, 56645-56660, 56649-56664, 56655-56670, 56659-56674, 56660-56675, 56668-56683, 56669-56684, 56670
56685, 56672-56687, 56679-56694, 56680-56695, 56681-56696, 56683-56698, 56720-56735, 56729-56744, 56752
56767, 56755-56770, 56756-56771, 56757-56772, 56758-56773, 56769-56784, 56770-56785, 56773-56788, 56789
56804, 57119-57134, 57122-57137, 57127-57142, 57128-57143, 57139-57154, 57140-57155, 57141-57156, 57187
57202, 57218-57233, 57219-57234, 57229-57244, 57230-57245, 57238-57253, 57248-57263, 57250-57265, 57251
57266, 57252-57267, 57253-57268, 57254-57269, 57255-57270, 57258-57273, 57261-57276, 57262-57277, 57263
57278, 57275-57290, 57296-57311, 57298-57313, 57299-57314, 57352-57367, 57354-57369, 57358-57373, 57366
57381, 57387-57402, 57413-57428, 57418-57433, 57424-57439, 57443-57458, 57444-57459, 57547-57562, 57548
57563, 57552-57567, 57553-57568, 57554-57569, 57584-57599, 57585-57600, 57593-57608, 57594-57609, 57596
57611, 57606-57621, 57607-57622, 57613-57628, 57616-57631, 57617-57632, 57619-57634, 57684-57699, 57685
57700, 57686-57701, 57687-57702, 57688-57703, 57689-57704, 57690-57705, 57691-57706, 57692-57707, 57711
57726, 57713-57728, 57714-57729, 57715-57730, 57718-57733, 57728-57743, 57730-57745, 57732-57747, 57734
57749, 57735-57750, 57736-57751, 57737-57752, 57738-57753, 57739-57754, 57740-57755, 57742-57757, 57758
57773, 57759-57774, 57780-57795, 57855-57870, 57857-57872, 57881-57896, 57884-57899, 57906-57921, 58154
58169, 58169-58184, 58482-58497, 58873-58888, 58901-58916, 58978-58993, 59017-59032, 59019-59034, 59101
59116, 59103-59118, 59105-59120, 59106-59121, 59107-59122, 59110-59125, 59111-59126, 59112-59127, 59113
59128, 59131-59146, 59135-59150, 59208-59223, 59259-59274, 59308-59323, 59361-59376, 59381-59396, 59397
59412, 59398-59413, 59399-59414, 59406-59421, 59408-59423, 59409-59424, 59971-59986, 60397-60412, 60410
60425, 60417-60432, 60418-60433, 60419-60434, 60421-60436, 60512-60527, 60551-60566, 60606-60621, 60615-
60630, 60616-60631, 60617-60632, 60690-60705, 60773-60788, 60872-60887, 60997-61012, 60998-61013, 61002-
61017, 61005-61020, 61011-61026, 61012-61027, 61013-61028, 61046-61061, 61048-61063, 61051-61066, 61058- 61073, 61059-61074, 61061-61076, 61063-61078, 61064-61079, 61126-61141, 61130-61145, 61182-61197, 61186-
61201, 61187-61202, 61188-61203, 61189-61204, 61193-61208, 61194-61209, 61211-61226, 61230-61245, 61231-
61246, 61265-61280, 61266-61281, 61272-61287, 61281-61296, 61282-61297, 61294-61309, 61295-61310, 61429-
61444, 61434-61449, 61435-61450, 61480-61495, 61481-61496, 61482-61497, 61521-61536, 61551-61566, 61560-
61575, 61728-61743, 61844-61859, 61869-61884, 61938-61953, 61940-61955, 61952-61967, 61964-61979, 61966-
61981, 61974-61989, 61976-61991, 61978-61993, 61980-61995, 61982-61997, 61983-61998, 61984-61999, 61985-
62000, 61986-62001, 61987-62002, 62004-62019, 62011-62026, 62039-62054, 62054-62069, 62055-62070, 62059-
62074, 62060-62075, 62061-62076, 62100-62115, 62119-62134, 62122-62137, 62130-62145, 62131-62146, 62132-
62147, 62133-62148, 62134-62149, 62136-62151, 62138-62153, 62182-62197, 62183-62198, 62199-62214, 62200-
62215, 62201-62216, 62202-62217, 62203-62218, 62204-62219, 62205-62220, 62318-62333, 62322-62337, 62323-
62338, 62324-62339, 62325-62340, 62326-62341, 62328-62343, 62349-62364, 62355-62370, 62356-62371, 62357-
62372, 62358-62373, 62372-62387, 62373-62388, 62374-62389, 62375-62390, 62382-62397, 62383-62398, 62384-
62399, 62403-62418, 62426-62441, 62445-62460, 62472-62487, 62473-62488, 62502-62517, 62505-62520, 62615-
62630, 62621-62636, 62622-62637, 62623-62638, 62624-62639, 62625-62640, 62628-62643, 62629-62644, 62630-
62645, 62631-62646, 62632-62647, 62636-62651, 62654-62669, 62655-62670, 62658-62673, 62659-62674, 62661-
62676, 62667-62682, 62668-62683, 62671-62686, 62672-62687, 62673-62688, 62674-62689, 62679-62694, 62680-
62695, 62681-62696, 62682-62697, 62683-62698, 62690-62705, 62693-62708, 62694-62709, 62705-62720, 62706-
62721, 62741-62756, 62750-62765, 62815-62830, 62816-62831, 62817-62832, 62818-62833, 62819-62834, 62820-
62835, 62821-62836, 62822-62837, 62824-62839, 62825-62840, 62826-62841, 62846-62861, 62880-62895, 62935-
62950, 62936-62951, 62937-62952, 62941-62956, 62942-62957, 62944-62959, 62945-62960, 62946-62961, 62947-
62962, 62949-62964, 62950-62965, 62951-62966, 62952-62967, 62953-62968, 62954-62969, 62955-62970, 62956-
62971, 62957-62972, 62958-62973, 62959-62974, 62960-62975, 62961-62976, 62965-62980, 62966-62981, 62969-
62984, 63032-63047, 63037-63052, 63038-63053, 63042-63057, 63043-63058, 63044-63059, 63126-63141, 63127-
63142, 63128-63143, 63129-63144, 63131-63146, 63137-63152, 63139-63154, 63175-63190, 63179-63194, 63185-
63200, 63186-63201, 63188-63203, 63191-63206, 63192-63207, 63198-63213, 63207-63222, 63208-63223, 63209-
63224, 63210-63225, 63211-63226, 63212-63227, 63213-63228, 63215-63230, 63216-63231, 63217-63232, 63219-
63234, 63220-63235, 63221-63236, 63222-63237, 63223-63238, 63224-63239, 63253-63268, 63283-63298, 63284-
63299, 63285-63300, 63341-63356, 63342-63357, 63343-63358, 63344-63359, 63345-63360, 63346-63361, 63371-
63386, 63381-63396, 63382-63397, 63383-63398, 63384-63399, 63385-63400, 63386-63401, 63387-63402, 63388-
63403, 63389-63404, 63391-63406, 63396-63411, 63397-63412, 63398-63413, 63399-63414, 63416-63431, 63417-
63432, 63418-63433, 63419-63434, 63420-63435, 63421-63436, 63423-63438, 63425-63440, 63427-63442, 63429-
63444, 63439-63454, 63442-63457, 63443-63458, 63444-63459, 63445-63460, 63446-63461, 63459-63474, 63462-
63477, 63463-63478, 63464-63479, 63465-63480, 63466-63481, 63467-63482, 63491-63506, 63493-63508, 63494-
63509, 63495-63510, 63496-63511, 63497-63512, 63498-63513, 63499-63514, 63501-63516, 63503-63518, 63509-
63524, 63512-63527, 63537-63552, 63540-63555, 63541-63556, 63542-63557, 63547-63562, 63548-63563, 63549-
63564, 63550-63565, 63567-63582, 63694-63709, 63723-63738, 63724-63739, 63725-63740, 63726-63741, 63727-
63742, 63728-63743, 63729-63744, 63784-63799, 63785-63800, 63787-63802, 63791-63806, 63795-63810, 63824-
63839, 63825-63840, 63826-63841, 63827-63842, 63829-63844, 63830-63845, 63838-63853, 63848-63863, 63849-
63864, 63850-63865, 63891-63906, 63893-63908, 63894-63909, 63895-63910, 63896-63911, 63907-63922, 63908- 63923, 63909-63924, 63913-63928, 63915-63930, 63940-63955, 63958-63973, 63959-63974, 63961-63976, 63962-
63977, 63963-63978, 63965-63980, 63967-63982, 63968-63983, 63969-63984, 63970-63985, 63971-63986, 63973-
63988, 63974-63989, 63975-63990, 63977-63992, 63979-63994, 63981-63996, 63982-63997, 64012-64027, 64021-
64036, 64025-64040, 64085-64100, 64149-64164, 64178-64193, 64179-64194, 64180-64195, 64181-64196, 64182-
64197, 64183-64198, 64222-64237, 64226-64241, 64231-64246, 64243-64258, 64245-64260, 64246-64261, 64250-
64265, 64257-64272, 64258-64273, 64261-64276, 64262-64277, 64263-64278, 64264-64279, 64273-64288, 64275-
64290, 64276-64291, 64277-64292, 64278-64293, 64279-64294, 64280-64295, 64320-64335, 64393-64408, 64424-
64439, 64427-64442, 64429-64444, 64442-64457, 64443-64458, 64510-64525, 64514-64529, 64515-64530, 64539-
64554, 64540-64555, 64541-64556, 64542-64557, 64543-64558, 64544-64559, 64546-64561, 64553-64568, 64619-
64634, 64632-64647, 64634-64649, 64639-64654, 64640-64655, 64641-64656, 64642-64657, 64643-64658, 64644-
64659, 64645-64660, 64646-64661, 64647-64662, 64649-64664, 64651-64666, 64652-64667, 64662-64677, 64665-
64680, 64669-64684, 64684-64699, 64685-64700, 64694-64709, 64695-64710, 64696-64711, 64698-64713, 64699-
64714, 64703-64718, 64707-64722, 64708-64723, 64756-64771, 64759-64774, 64835-64850, 64865-64880, 64870-
64885, 64871-64886, 64885-64900, 64888-64903, 64918-64933, 64939-64954, 64943-64958, 64944-64959, 64946-
64961, 64950-64965, 64951-64966, 64971-64986, 64973-64988, 64974-64989, 64975-64990, 64977-64992, 64978-
64993, 64981-64996, 64991-65006, 64992-65007, 64994-65009, 65001-65016, 65025-65040, 65026-65041, 65028-
65043, 65029-65044, 65074-65089, 65075-65090, 65096-65111, 65097-65112, 65098-65113, 65111-65126, 65113-
65128, 65115-65130, 65150-65165, 65192-65207, 65194-65209, 65196-65211, 65576-65591, 65577-65592, 65578-
65593, 65579-65594, 65580-65595, 65581-65596, 65600-65615, 65608-65623, 65609-65624, 65611-65626, 65618-
65633, 65619-65634, 65620-65635, 65621-65636, 65623-65638, 65668-65683, 65676-65691, 65677-65692, 65678-
65693, 65679-65694, 65680-65695, 65681-65696, 65682-65697, 65683-65698, 65684-65699, 65685-65700, 65686-
65701, 65711-65726, 65753-65768, 65754-65769, 65755-65770, 65756-65771, 65759-65774, 65760-65775, 65816-
65831, 65818-65833, 65821-65836, 65826-65841, 65827-65842, 65828-65843, 65830-65845, 65831-65846, 65832-
65847, 65875-65890, 65876-65891, 65912-65927, 65913-65928, 65914-65929, 65915-65930, 65918-65933, 65925-
65940, 65950-65965, 65952-65967, 65960-65975, 65961-65976, 65962-65977, 65987-66002, 66091-66106, 66401-
66416, 66402-66417, 66403-66418, 66439-66454, 66441-66456, 66445-66460, 66446-66461, 66447-66462, 66448-
66463, 66449-66464, 66450-66465, 66454-66469, 66455-66470, 66475-66490, 66477-66492, 66478-66493, 66483-
66498, 66488-66503, 66489-66504, 66513-66528, 66514-66529, 66515-66530, 66524-66539, 66527-66542, 66564-
66579, 66641-66656, 66642-66657, 66643-66658, 66653-66668, 66656-66671, 66657-66672, 66660-66675, 66679-
66694, 66680-66695, 66772-66787, 66778-66793, 67189-67204, 67190-67205, 67191-67206, 67192-67207, 67193-
67208, 67194-67209, 67217-67232, 67222-67237, 67262-67277, 67278-67293, 67279-67294, 67280-67295, 67281-
67296, 67282-67297, 67284-67299, 67285-67300, 67288-67303, 67289-67304, 67290-67305, 67364-67379, 67367-
67382, 67377-67392, 67391-67406, 67392-67407, 67393-67408, 67394-67409, 67402-67417, 67404-67419, 67406-
67421, 67407-67422, 67408-67423, 67409-67424, 67411-67426, 67412-67427, 67413-67428, 67414-67429, 67417-
67432, 67418-67433, 67419-67434, 67420-67435, 67422-67437, 67429-67444, 67431-67446, 67432-67447, 67434-
67449, 67435-67450, 67436-67451, 67437-67452, 67438-67453, 67439-67454, 67440-67455, 67441-67456, 67443-
67458, 67445-67460, 67447-67462, 67449-67464, 67454-67469, 67457-67472, 67459-67474, 67463-67478, 67467-
67482, 67468-67483, 67479-67494, 67484-67499, 67485-67500, 67488-67503, 67489-67504, 67490-67505, 67491-
67506, 67493-67508, 67494-67509, 67495-67510, 67496-67511, 67497-67512, 67498-67513, 67499-67514, 67501- 67516, 67502-67517, 67503-67518, 67504-67519, 67505-67520, 67506-67521, 67507-67522, 67509-67524, 67510-
67525, 67511-67526, 67513-67528, 67515-67530, 67524-67539, 67525-67540, 67528-67543, 67550-67565, 67552-
67567, 67560-67575, 67608-67623, 67611-67626, 67633-67648, 67635-67650, 67637-67652, 67639-67654, 67653-
67668, 67661-67676, 67662-67677, 67680-67695, 67689-67704, 67714-67729, 67715-67730, 67727-67742, 67728-
67743, 67730-67745, 67751-67766, 67752-67767, 67762-67777, 67763-67778, 67764-67779, 67766-67781, 67801-
67816, 67809-67824, 67811-67826, 67815-67830, 67816-67831, 67823-67838, 67824-67839, 67825-67840, 67826-
67841, 67838-67853, 67852-67867, 67854-67869, 67859-67874, 67877-67892, 67883-67898, 67934-67949, 67967-
67982, 67969-67984, 67982-67997, 67997-68012, 67998-68013, 68003-68018, 68011-68026, 68015-68030, 68025-
68040, 68069-68084, 68073-68088, 68074-68089, 68096-68111, 68098-68113, 68102-68117, 68103-68118, 68104-
68119, 68126-68141, 68128-68143, 68129-68144, 68131-68146, 68134-68149, 68156-68171, 68167-68182, 68198-
68213, 68203-68218, 68204-68219, 68205-68220, 68208-68223, 68244-68259, 68276-68291, 68279-68294, 68299-
68314, 68300-68315, 68310-68325, 68312-68327, 68313-68328, 68317-68332, 68329-68344, 68331-68346, 68334-
68349, 68335-68350, 68355-68370, 68391-68406, 68392-68407, 68731-68746, 68732-68747, 68733-68748, 68744-
68759, 68745-68760, 68747-68762, 68748-68763, 68749-68764, 68752-68767, 68763-68778, 68765-68780, 68775-
68790, 68780-68795, 68795-68810, 68801-68816, 68834-68849, 68838-68853, 68856-68871, 68880-68895, 68885-
68900, 68887-68902, 68891-68906, 68908-68923, 68965-68980, 68976-68991, 68977-68992, 68978-68993, 69009-
69024, 69013-69028, 69023-69038, 69024-69039, 69025-69040, 69026-69041, 69027-69042, 69029-69044, 69031-
69046, 69061-69076, 69099-69114, 69102-69117, 69105-69120, 69115-69130, 69117-69132, 69118-69133, 69119-
69134, 69124-69139, 69125-69140, 69126-69141, 69127-69142, 69137-69152, 69149-69164, 69166-69181, 69186-
69201, 69187-69202, 69188-69203, 69193-69208, 69221-69236, 69242-69257, 69248-69263, 69309-69324, 69323-
69338, 69324-69339, 69352-69367, 69353-69368, 69355-69370, 69356-69371, 69357-69372, 69369-69384, 69370-
69385, 69371-69386, 69372-69387, 69374-69389, 69381-69396, 69383-69398, 69384-69399, 69385-69400, 69447-
69462, 69448-69463, 69479-69494, 69482-69497, 69496-69511, 69544-69559, 69604-69619, 69605-69620, 69614-
69629, 69629-69644, 69630-69645, 69631-69646, 69632-69647, 69633-69648, 69634-69649, or 69635-69650 of SEQ ID NO: 1.
Embodiment 4. The oligomeric compound of any of embodiments 1-3, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 39-54, 171-186, 206-221, 236-251, 240-255, 241-256, 242-257, 243-258, 244-259, 341-356, 342-357, 343-358, 361-376, 376-391, 499- 514, 501-516, 504-519, 572-587, 574-589, 576-591, 578-593, 579-594, 580-595, 581-596, 582-597, 583-598, 584-599, 586-601, 587-602, 588-603, 589-604, 602-617, 617-632, 623-638, 624-639, 626-641, 628-643, 630-645, 669-684, 670- 685, 703-718, 704-719, 705-720, 707-722, 709-724, 711-726, 713-728, 714-729, 715-730, 716-731, 717-732, 718-733, 719-734, 725-740, 727-742, 735-750, 737-752, 738-753, 739-754, 741-756, 756-771, 824-839, 829-844, 833-848, 855- 870, 860-875, 861-876, 862-877, 879-894, 880-895, 897-912, 908-923, 909-924, 923-938, 928-943, 943-958, 944-959, 945-960, 946-961, 947-962, 948-963, 969-984, 977-992, 978-993, 979-994, 981-996, 983-998, 985-1000, 987-1002, 988- 1003, 989-1004, 990-1005, 991-1006, 993-1008, 1044-1059, 1089-1104, 1093-1108, 1094-1109, 1095-1110, 1097-1112, 1122-1137, 1123-1138, 1124-1139, 1125-1140, 1126-1141, 1127-1142, 1128-1143, 1133-1148, 1134-1149, 1135-1150,
1137-1152, 1138-1153, 1139-1154, 1141-1156, 1143-1158, 1144-1159, 1145-1160, 1146-1161, 1150-1165, 1151-1166,
1153-1168, 1156-1171, 1157-1172, 1158-1173, 1163-1178, 1173-1188, 1176-1191, 1177-1192, 1178-1193, 1182-1197,
1191-1206, 1194-1209, 1196-1211, 1198-1213, 1200-1215, 1201-1216, 1202-1217, 1203-1218, 1204-1219, 1213-1228, 1214-1229, 1215-1230, 1216-1231, 1222-1237, 1223-1238, 1224-1239, 1233-1248, 1243-1258, 1263-1278, 1265-1280,
1266-1281, 1271-1286, 1273-1288, 1275-1290, 1278-1293, 1312-1327, 1315-1330, 1324-1339, 1325-1340, 1326-1341,
1327-1342, 1328-1343, 1380-1395, 1381-1396, 1383-1398, 1398-1413, 1400-1415, 1401-1416, 1521-1536, 1569-1584,
1602-1617, 1606-1621, 1607-1622, 1608-1623, 1610-1625, 1612-1627, 1613-1628, 1616-1631, 1649-1664, 1650-1665,
1653-1668, 1663-1678, 1665-1680, 1667-1682, 1669-1684, 1670-1685, 1671-1686, 1672-1687, 1673-1688, 1674-1689,
1675-1690, 1677-1692, 1693-1708, 1694-1709, 1715-1730, 1764-1779, 1768-1783, 1791-1806, 1804-1819, 1869-1884,
1871-1886, 1872-1887, 1908-1923, 1932-1947, 1996-2011, 2025-2040, 2026-2041, 2027-2042, 2028-2043, 2029-2044,
2030-2045, 2069-2084, 2073-2088, 2085-2100, 2103-2118, 2106-2121, 2108-2123, 2121-2136, 2122-2137, 2250-2265,
2251-2266, 2252-2267, 2262-2277, 2265-2280, 2266-2281, 2269-2284, 2288-2303, 2289-2304, 2368-2383, 2371-2386,
2381-2396, 2395-2410, 2396-2411, 2397-2412, 2398-2413, 2406-2421, 2408-2423, 2410-2425, 2411-2426, 2412-2427,
2413-2428, 2415-2430, 2416-2431, 2417-2432, 2418-2433, 2421-2436, 2422-2437, 2423-2438, 2424-2439, 2426-2441,
2433-2448, 2435-2450, 2436-2451, 2438-2453, 2439-2454, 2440-2455, 2441-2456, 2442-2457, 2443-2458, 2444-2459,
2445-2460, 2447-2462, 2449-2464, 2451-2466, 2453-2468, 2458-2473, 2461-2476, 2463-2478, 2467-2482, 2471-2486,
2472-2487, 2483-2498, 2488-2503, 2489-2504, 2492-2507, 2493-2508, 2494-2509, 2495-2510, 2497-2512, 2498-2513,
2499-2514, 2500-2515, 2501-2516, 2502-2517, 2503-2518, 2505-2520, 2506-2521, 2507-2522, 2508-2523, 2509-2524,
2510-2525, 2511-2526, 2513-2528, 2514-2529, 2515-2530, 2517-2532, 2519-2534, 2528-2543, 2529-2544, 2532-2547,
2554-2569, 2556-2571, 2564-2579, 2612-2627, 2615-2630, 2637-2652, 2639-2654, 2641-2656, 2643-2658, 2657-2672,
2665-2680, 2666-2681, 2684-2699, 2693-2708, 2718-2733, 2719-2734, 2731-2746, 2732-2747, 2734-2749, 2755-2770,
2756-2771, 2766-2781, 2767-2782, 2768-2783, 2770-2785, 2805-2820, 2813-2828, 2815-2830, 2819-2834, 2820-2835,
2827-2842, 2828-2843, 2829-2844, 2830-2845, 2842-2857, 2856-2871, 2858-2873, 2863-2878, 2881-2896, 2887-2902,
2938-2953, 2971-2986, 2973-2988, 2986-3001, 3001-3016, 3002-3017, 3007-3022, 3015-3030, 3019-3034, 3029-3044,
3073-3088, 3077-3092, 3078-3093, 3100-3115, 3102-3117, 3106-3121, 3107-3122, 3108-3123, 3130-3145, 3132-3147,
3133-3148, 3135-3150, 3138-3153, 3160-3175, 3171-3186, 3202-3217, 3207-3222, 3208-3223, 3209-3224, 3212-3227,
3248-3263, 3280-3295, 3283-3298, 3303-3318, 3304-3319, 3314-3329, 3316-3331, 3317-3332, 3321-3336, 3333-3348,
3335-3350, 3338-3353, 3339-3354, 3359-3374, 3395-3410, 3396-3411, 3735-3750, 3736-3751, 3737-3752, 3748-3763,
3749-3764, 3751-3766, 3752-3767, 3753-3768, 3756-3771, 3767-3782, 3769-3784, 3779-3794, 3784-3799, 3799-3814,
3805-3820, 3838-3853, 3842-3857, 3860-3875, 3884-3899, 3889-3904, 3891-3906, 3895-3910, 3912-3927, 3969-3984,
3980-3995, 3981-3996, 3982-3997, 4013-4028, 4017-4032, 4027-4042, 4028-4043, 4029-4044, 4030-4045, 4031-4046,
4033-4048, 4035-4050, 4065-4080, 4103-4118, 4106-4121, 4109-4124, 4119-4134, 4121-4136, 4122-4137, 4123-4138,
4128-4143, 4129-4144, 4130-4145, 4131-4146, 4141-4156, 4153-4168, 4170-4185, 4190-4205, 4191-4206, 4192-4207,
4197-4212, 4225-4240, 4246-4261, 4252-4267, 4313-4328, 4327-4342, 4328-4343, 4356-4371, 4357-4372, 4359-4374,
4360-4375, 4361-4376, 4373-4388, 4374-4389, 4375-4390, 4376-4391, 4378-4393, 4385-4400, 4387-4402, 4388-4403,
4389-4404, 4451-4466, 4452-4467, 4483-4498, 4486-4501, 4500-4515, 4548-4563, 4608-4623, 4609-4624, 4618-4633,
4633-4648, 4634-4649, 4635-4650, 4636-4651, 4637-4652, 4638-4653, or 4639-4654 of SEQ ID NO: 2.
Embodiment 5. The oligomeric compound of any of embodiments 1-4, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 31654-31669, 34257-34272, 34258-34273, 34298-34313, 34331-34346, 37266-37281, 38988-39003, 46554-46569, 46573-46588, 63191-63206, 63344-63359, or 67414-67429 of SEQ ID NO: 1. Embodiment 6. The oligomeric compound of any of embodiments 1-5, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the DNM1L nucleic acid.
Embodiment 7. The oligomeric compound of embodiment 6, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of any of the nucleobase sequences of any of SEQ ID NOs: 12-2620.
Embodiment 8. The oligomeric compound of embodiment 7, wherein the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 12-2620.
Embodiment 9. The oligomeric compound of embodiment 8, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any of SEQ ID NOs: 12-2620.
Embodiment 10. The oligomeric compound of any of embodiments 7-9, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2608, 2609, 2610, 2611, 2612, 2613, 2614, 2615, 2617, 2618, 2619, or 2620.
Embodiment 11. The oligomeric compound of embodiment 10, wherein the nucleobase sequence of the modified oligonucleotide consists of 15 to 80 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 2608, 2609, 2610, 2611, 2612, 2613, 2614, 2615, 2617, 2618, 2619, or 2620.
Embodiment 12. The oligomeric compound of embodiment 11, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 2608, 2609, 2610, 2611, 2612, 2613, 2614, 2615, 2617, 2618, 2619, or 2620.
Embodiment 13. The oligomeric compound of any of embodiments 7-11, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of a DNM1L nucleic acid, wherein the DNM1L nucleic acid has the nucleobase sequence of SEQ ID NOs: 1 or 2.
Embodiment 14. The oligomeric compound of any of embodiments 1-13, wherein the modified oligonucleotide consists of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18,16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.
Embodiment 15. The oligomeric compound of any of embodiments 1-14, wherein the modified oligonucleotide comprises at least two modified nucleosides comprising a modified sugar moiety.
Embodiment 16. The oligomeric compound of any of embodiments 1-15, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.
Embodiment 17. The oligomeric compound of embodiment 16, wherein the bicyclic sugar moiety comprises a 2’-4’ bridge selected from -O-CH2-; and -O-CH(CH3)-.
Embodiment 18. The oligomeric compound of any of embodiments 1-15, wherein the modified sugar moiety comprises a non-bicyclic modified sugar moiety.
Embodiment 19. The oligomeric compound of embodiment 18, wherein the non-bicyclic modified sugar moiety is a 2 ’-MOE sugar moiety or 2’-OMe sugar moiety. Embodiment 20. The oligomeric compound of any of embodiments 1-19, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.
Embodiment 21. The oligomeric compound of any of embodiments 1-20, wherein the modified oligonucleotide comprises at least one modified intemucleoside linkage.
Embodiment 22. The oligomeric compound of embodiment 21, wherein at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
Embodiment 23. The oligomeric compound of embodiment 21 or 22, wherein each intemucleoside linkage is a modified intemucleoside linkage.
Embodiment 24. The oligomeric compound of embodiment 23, wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage.
Embodiment 25. The oligomeric compound of any of embodiments 21-23, wherein at least one intemucleoside linkage of the modified oligonucleotide is a phosphodiester intemucleoside linkage.
Embodiment 26. The oligomeric compound of any of embodiments 1-21, wherein each intemucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester or a phosphorothioate intemucleoside linkage.
Embodiment 27. The oligomeric compound of any of embodiments 1-26, wherein at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 intemucleoside linkages of the modified oligonucleotide are phosphorothioate intemucleoside linkages.
Embodiment 28. The oligomeric compound of any of embodiments 1-27, wherein the modified oligonucleotide comprises at least one modified nucleobase.
Embodiment 29. The oligomeric compound of embodiment 28, wherein the modified nucleobase is 5- methylcytosine.
Embodiment 30. The oligomeric compound of embodiment 29, wherein each cytosine is a 5-methylcytosine.
Embodiment 31. The oligomeric compound of any of embodiments 1-30, wherein the modified oligonucleotide comprises a deoxy region consisting of 5-12 contiguous 2’-deoxynucleosides.
Embodiment 32. The oligomeric compound of embodiment 31, wherein each 2’-deoxynucleoside of the deoxy region is a 2’-p-D-deoxynucleoside.
Embodiment 33. The oligomeric compound of embodiment 31 or 32, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides.
Embodiment 34. The oligomeric compound of any of embodiments 31-33, wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety.
Embodiment 35. The oligomeric compound of any of embodiments 31-34, wherein the deoxy region is flanked on the 5’-side by a 5’-region consisting of 1-6 linked 5 ’-region nucleosides and on the 3’-side by a 3 ’-region consisting of 1-6 linked 3 ’-region nucleosides; wherein. the 3’-most nucleoside of the 5’ region comprises a modified sugar moiety; and the 5’-most nucleoside of the 3’ region comprises a modified sugar moiety.
Embodiment 36. The oligomeric compound of embodiment 35, wherein each nucleoside of the 3’ region comprises a modified sugar moiety. Embodiment 37. The oligomeric compound of embodiment 35 or 36, wherein each nucleoside of the 5’ region comprises a modified sugar moiety.
Embodiment 38. The oligomeric compound of any of embodiments 31-37, wherein the modified oligonucleotide has: a 5’ region consisting of 3 linked nucleosides; a deoxy region consisting of 10 linked nucleosides; and a 3 ’ region consisting of 3 linked nucleosides; wherein each of the 5 ’-region nucleosides and each of the 3 ’-region nucleosides is a cEt nucleoside.
Embodiment 39. The oligomeric compound of any of embodiments 31-37, wherein the modified oligonucleotide has: a 5’ region consisting of 1-6 linked nucleosides; a deoxy region consisting of 6-10 linked nucleosides; and a 3’ region consisting of 1-6 linked nucleosides; wherein each of the 5 ’ region nucleosides and each of the 3 ’ region nucleosides is a cEt nucleoside or a 2 ’ -MOE nucleoside; and each of the deoxy region nucleosides is a 2’-p-D-deoxynucleoside.
Embodiment 40. The oligomeric compound of any of embodiments 31-37, wherein the modified oligonucleotide has: a 5’ region consisting of 5 linked nucleosides; a deoxy region consisting of 8 linked nucleosides; and a 3 ’ region consisting of 3 linked nucleosides; wherein three of the 5’ region nucleosides is a cEt nucleoside and one is a 2’-OMe nucleoside; each of the 3’ region nucleosides is a cEt nucleoside; and each of the deoxy region nucleosides is a 2’-p-D-deoxynucleoside.
Embodiment 41. The oligomeric compound of any of embodiments 31-37, wherein the modified oligonucleotide has a sugar motif comprising: a 5’ region consisting of 3-6 linked nucleosides; a deoxy region consisting of 7-8 linked nucleosides; and a 3’ region consisting of 3-6 linked nucleosides; wherein each of the 3’ region nucleosides is selected from a 2 ’-MOE nucleoside and a cEt nucleoside, and the 5’ region has the following formula:
(Nk)n(Nd)(Nx) wherein each Nk is a bicyclic nucleoside, Nx is a 2’-OMe nucleoside and Nd is a 2’-p-D- deoxynucleoside; and n is from 1-4.
Embodiment 42. An oligomeric compound of any of embodiments 1-30, wherein the modified oligonucleotide has a sugar motif (5’ to 3’) selected from: kkkddddddddddkkk, kkkdddddddddkkke, and kkkdyddddddddkkk, wherein ‘d’ represents a 2’-deoxyribosyl sugar moiety, ‘e’ represents a 2’-MOE sugar moiety, ‘k’ represents a cEt sugar moiety, and ‘y’ represents a 2’-OMe sugar moiety. Embodiment 43. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
Embodiment 44. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
Embodiment 45. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
Embodiment 46. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, e = a 2’-OCH2CH2OCH3 ribosyl sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
Embodiment 47. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation , wherein A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, e = a 2’-OCH2CH2OCH3 ribosyl sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
Embodiment 48. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation. wherein
A = an adenine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, e = a 2’-OCH2CH2OCH3 ribosyl sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
Embodiment 49. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
Embodiment 50. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
Embodiment 51. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation. T , wherein
A = an adenine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
Embodiment 52. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
Embodiment 53. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: , wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, e = a 2’-OCH2CH2OCH3 ribosyl sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
Embodiment 54. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
Embodiment 55. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: , wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
Embodiment 56. The oligomeric compound of any of embodiments 1-55, wherein the oligomeric compound comprises a conjugate group. Embodiment 57. The oligomeric compound of embodiment 56, wherein the conjugate group comprises a celltargeting moiety.
Embodiment 58. The oligomeric compound of any of embodiments 1 to 57, wherein the oligomeric compound comprises a terminal group.
Embodiment 59. The oligomeric compound of embodiment 58, wherein the terminal group is an abasic sugar moiety.
Embodiment 60. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2610), or a salt thereof.
Embodiment 61. The modified oligonucleotide of embodiment 60, which is the sodium salt or the potassium salt. Embodiment 62. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2610).
Embodiment 63. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2611), or a salt thereof.
Embodiment 64. The modified oligonucleotide of embodiment 63, which is the sodium salt or the potassium salt.
Embodiment 65. A modified oligonucleotide according to the following chemical structure:
Embodiment 66. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2612), or a salt thereof.
Embodiment 67. The modified oligonucleotide of embodiment 66, which is the sodium salt or the potassium salt.
Embodiment 68. A modified oligonucleotide according to the following chemical structure:
Embodiment 69. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2615), or a salt thereof.
Embodiment 70. The modified oligonucleotide of embodiment 69, which is the sodium salt or the potassium salt.
Embodiment 71. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2615).
Embodiment 72. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2617), or a salt thereof.
Embodiment 73. The modified oligonucleotide of embodiment 72, which is the sodium salt or the potassium salt.
Embodiment 74. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2617).
Embodiment 75. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2618), or a salt thereof.
Embodiment 76. The modified oligonucleotide of embodiment 75, which is the sodium salt or the potassium salt.
Embodiment 77. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2618).
Embodiment 78. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2608), or a salt thereof.
Embodiment 79. The modified oligonucleotide of embodiment 78, which is the sodium salt or the potassium salt.
Embodiment 80. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2608).
Embodiment 81. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2609), or a salt thereof.
Embodiment 82. The modified oligonucleotide of embodiment 81, which is the sodium salt or the potassium salt.
Embodiment 84. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2613), or a salt thereof.
Embodiment 85. The modified oligonucleotide of embodiment 84, which is the sodium salt or the potassium salt.
Embodiment 86. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2613).
Embodiment 87. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2614), or a salt thereof.
Embodiment 88. The modified oligonucleotide of embodiment 87, which is the sodium salt or the potassium salt.
Embodiment 89. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2614).
Embodiment 90. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2616), or a salt thereof.
Embodiment 91. The modified oligonucleotide of embodiment 90, which is the sodium salt or the potassium salt.
Embodiment 92. A modified oligonucleotide according to the following chemical structure:
Embodiment 93. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2619), or a salt thereof.
Embodiment 94. The modified oligonucleotide of embodiment 93, which is the sodium salt or the potassium salt.
Embodiment 96. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2620), or a salt thereof.
Embodiment 97. The modified oligonucleotide of embodiment 96, which is the sodium salt or the potassium salt.
Embodiment 98. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2620).
Embodiment 99. A chirally enriched population of oligomeric compounds of any of embodiments 1-59 or modified oligonucleotides of any of embodiment 60-98, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having a particular stereochemical configuration.
Embodiment 100. The chirally enriched population of embodiment 99, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having the (Sp) or (Rp) configuration.
Embodiment 101. The chirally enriched population of embodiment 100, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate intemucleoside linkage.
Embodiment 102. The chirally enriched population of embodiment 100, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate intemucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate intemucleoside linkages. Embodiment 103. The chirally enriched population of embodiment 100, wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate intemucleoside linkages in the Sp, Sp, and Rp configurations, in the 5’ to 3’ direction.
Embodiment 104. A population of oligomeric compounds of any of embodiments 1-59 or modified oligonucleotides of any of embodiments 60-98, wherein all phosphorothioate intemucleoside linkages are stereorandom.
Embodiment 105. An oligomeric duplex, comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound of any of embodiments 1-59 or a modified oligonucleotide of any of embodiments 60-98.
Embodiment 106. An antisense agent comprising an antisense compound, wherein the antisense compound is the oligomeric compound of any of embodiments 1-59 or the modified oligonucleotide of any of embodiments 60-98.
Embodiment 107. The antisense agent of embodiment 106, wherein the antisense agent is the oligomeric duplex of embodiment 88.
Embodiment 108. The antisense agent of embodiment 106 or 107, wherein the antisense agent is: i. an RNase H agent capable of reducing the amount of DNM1L nucleic acid through the activation of RNase H; or ii. an RNAi agent capable of reducing the amount of DNM1L nucleic acid through the activation of RISC/Ago2.
Embodiment 109. The antisense agent of any of embodiments 106-108, wherein the conjugate group is a celltargeting moiety.
Embodiment 110. A pharmaceutical composition comprising the oligomeric compound of any of embodiments 1-59, the modified oligonucleotide of any of embodiments 60-98, the population of any of embodiments 99-104, the oligomeric duplex of embodiment 105, or the antisense agent of any of embodiments 106-109, and a pharmaceutically acceptable diluent or carrier.
Embodiment 111. The pharmaceutical composition of embodiment 110, wherein the pharmaceutically acceptable diluent is water or saline.
Embodiment 112. The pharmaceutical composition of embodiment 110, wherein the pharmaceutical composition consists essentially of the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, or the antisense agent, and water or saline.
Embodiment 113. A method comprising administering to a subject the oligomeric compound of any of embodiments 1-59, the modified oligonucleotide of any of embodiments 60-98, the population of any of embodiments 99-104, the oligomeric duplex of embodiment 105, the antisense agent of any of embodiments 106-109, or the pharmaceutical composition of any of embodiments 110-112.
Embodiment 114. A method of treating a disease associated with DNM1L comprising administering to a subject having a disease associated with DNM1L a therapeutically effective amount of the oligomeric compound of any of embodiments 1-59, the modified oligonucleotide of any of embodiments 60-98, the population of any of embodiments 99-104, the oligomeric duplex of embodiment 105, the antisense agent of any of embodiments 106-109, or the pharmaceutical composition of any of embodiments 110-112 and thereby treating the subject.
Embodiment 115. The method of embodiment 114, wherein the disease associated with DNM1L is acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD). Embodiment 116. The method of embodiment 114 or 115, wherein administering the oligomeric compound of any of embodiments 1-59, the modified oligonucleotide of any of embodiments 60-98, the population of any of embodiments 99-104, the oligomeric duplex of embodiment 105, the antisense agent of any of embodiments 106-109, or the pharmaceutical composition of any of embodiments 110-112 reduces a marker of kidney health or kidney function selected from ALT/AST, creatinine, BUN, cystatin-c, proteinuria, and eGFR, DRP1, KIM-1, FABP1, NGAL, hematoxylin and eosin (H&E) staining, cytochrome-c, TIMP-2, IGFBP-7, RIFLE, and/or AKI-KDIGO in the subject.
Embodiment 117. A method of reducing expression of DNM1L in a cell comprising contacting the cell with the oligomeric compound of any of embodiments 1-59, the modified oligonucleotide of any of embodiments 60-98, the population of any of embodiments 99-104, the oligomeric duplex of embodiment 105, the antisense agent of any of embodiments 106-109, or the pharmaceutical composition of any of embodiments 110-112.
Embodiment 118. The method of embodiment 117, wherein the cell is a kidney cell.
Embodiment 119.Use of the oligomeric compound of any of embodiments 1-59, the modified oligonucleotide of any of embodiments 60-98, the population of any of embodiments 99-104, the oligomeric duplex of embodiment 105, the antisense agent of any of embodiments 106-109, or the pharmaceutical composition of any of embodiments 110- 112 for treating a disease associated with DNM1L.
Embodiment 120. Use of the oligomeric compound of any of embodiments 1-59, the modified oligonucleotide of any of embodiments 60-98, the population of any of embodiments 99-104, the oligomeric duplex of embodiment 105, the antisense agent of any of embodiments 106-109, or the pharmaceutical composition of any of embodiments 110- 112 in the manufacture of a medicament for treating a disease associated with DNM1L.
Embodiment 121. The use of embodiment 119 or 120, wherein the disease associated with DNM1L is acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
Certain Oligomeric Duplexes
Certain embodiments are directed to oligomeric duplexes comprising a first oligomeric compound and a second oligomeric compound.
In certain embodiments, an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 3238-3253, 3370-3385, 3405-3420, 3435-3450, 3439-3454, 3440-3455, 3441-3456, 3442-3457, 3443-3458, 3560-3575, 3561-3576, 3710-3725, 3711-3726,
3784-3799, 3788-3803, 3789-3804, 3836-3851, 3841-3856, 3845-3860, 3896-3911, 3996-4011, 4075-4090,
4080-4095, 4082-4097, 4083-4098, 4102-4117, 4111-4126, 4112-4127, 4113-4128, 4114-4129, 4115-4130,
4117-4132, 4121-4136, 4158-4173, 4159-4174, 4160-4175, 4161-4176, 4162-4177, 4289-4304, 4290-4305,
4292-4307, 4293-4308, 4295-4310, 4320-4335, 4384-4399, 4414-4429, 4415-4430, 4416-4431, 4447-4462,
4458-4473, 4467-4482, 4498-4513, 4499-4514, 4501-4516, 4504-4519, 4505-4520, 4587-4602, 4588-4603,
4590-4605, 4592-4607, 4632-4647, 4723-4738, 4725-4740, 4727-4742, 4729-4744, 4733-4748, 4734-4749, 4807-4822, 5145-5160, 5158-5173, 5159-5174, 5308-5323, 5310-5325, 5660-5675, 5746-5761, 5787-5802,
5798-5813, 5801-5816, 5802-5817, 5803-5818, 5804-5819, 5805-5820, 5806-5821, 5810-5825, 5811-5826,
5812-5827, 5813-5828, 5814-5829, 5815-5830, 6016-6031, 6529-6544, 6530-6545, 6531-6546, 6535-6550,
6536-6551, 6537-6552, 6539-6554, 6540-6555, 6541-6556, 6564-6579, 6566-6581, 6567-6582, 6568-6583,
6583-6598, 6584-6599, 6619-6634, 6623-6638, 6627-6642, 6940-6955, 6942-6957, 7053-7068, 7072-7087,
7073-7088, 7074-7089, 7082-7097, 7094-7109, 7095-7110, 7130-7145, 7282-7297, 7283-7298, 7402-7417,
7403-7418, 7404-7419, 7405-7420, 7406-7421, 7968-7983, 7969-7984, 8115-8130, 8117-8132, 8120-8135,
8163-8178, 8242-8257, 8243-8258, 8268-8283, 8269-8284, 8270-8285, 8274-8289, 8275-8290, 8276-8291,
8278-8293, 8279-8294, 8280-8295, 8303-8318, 8305-8320, 8306-8321, 8307-8322, 8322-8337, 8323-8338,
8753-8768, 9296-9311, 9550-9565, 9695-9710, 9705-9720, 9747-9762, 9807-9822, 10436-10451, 11181-11196, 12291-12306, 12548-12563, 12799-12814, 12838-12853, 12995-13010, 13478-13493, 13479-13494, 13480- 13495, 13481-13496, 13482-13497, 13483-13498, 13484-13499, 13486-13501, 13487-13502, 13706-13721, 13940-13955, 13996-14011, 14015-14030, 14016-14031, 14018-14033, 14019-14034, 14061-14076, 14066- 14081, 14069-14084, 14147-14162, 14358-14373, 14409-14424, 14411-14426, 14412-14427, 14413-14428, 14420-14435, 14464-14479, 14465-14480, 14468-14483, 14534-14549, 14544-14559, 14569-14584, 14592- 14607, 14608-14623, 14701-14716, 14725-14740, 14736-14751, 14739-14754, 14740-14755, 14742-14757, 14743-14758, 14744-14759, 14745-14760, 14746-14761, 14968-14983, 14969-14984, 15643-15658, 15665- 15680, 15666-15681, 15667-15682, 15689-15704, 15690-15705, 15692-15707, 15700-15715, 15755-15770, 15762-15777, 15811-15826, 15860-15875, 15897-15912, 15898-15913, 15903-15918, 15938-15953, 15976- 15991, 15977-15992, 16003-16018, 16011-16026, 16287-16302, 16288-16303, 16348-16363, 16415-16430, 16460-16475, 16461-16476, 16462-16477, 16485-16500, 16487-16502, 16543-16558, 16591-16606, 16594- 16609, 16620-16635, 16621-16636, 16696-16711, 16722-16737, 16728-16743, 16776-16791, 16809-16824, 16828-16843, 16830-16845, 16904-16919, 16905-16920, 16915-16930, 16916-16931, 16917-16932, 16926- 16941, 16927-16942, 16970-16985, 16972-16987, 17002-17017, 17003-17018, 17004-17019, 17005-17020, 17006-17021, 17007-17022, 17009-17024, 17010-17025, 17011-17026, 17074-17089, 17095-17110, 17539- 17554, 18061-18076, 18238-18253, 18379-18394, 18433-18448, 18434-18449, 18486-18501, 18489-18504, 18490-18505, 18491-18506, 18492-18507, 18493-18508, 18494-18509, 18495-18510, 18496-18511, 18554- 18569, 18570-18585, 18571-18586, 18583-18598, 18616-18631, 18716-18731, 18721-18736, 18761-18776, 18820-18835, 18821-18836, 18822-18837, 18823-18838, 18824-18839, 18868-18883, 18870-18885, 18872- 18887, 18920-18935, 18921-18936, 18976-18991, 19046-19061, 19048-19063, 19049-19064, 19060-19075, 19187-19202, 19208-19223, 19211-19226, 19364-19379, 19395-19410, 19398-19413, 19456-19471, 19861- 19876, 19869-19884, 19983-19998, 20080-20095, 20083-20098, 20084-20099, 20130-20145, 20146-20161, 21297-21312, 21298-21313, 21300-21315, 21438-21453, 21475-21490, 22008-22023, 22122-22137, 22124- 22139, 22139-22154, 22140-22155, 22151-22166, 22250-22265, 22324-22339, 22326-22341, 22327-22342, 22328-22343, 22447-22462, 22464-22479, 22467-22482, 22646-22661, 22674-22689, 22676-22691, 22677- 22692, 22775-22790, 22776-22791, 22777-22792, 22783-22798, 22788-22803, 22789-22804, 22794-22809, 23071-23086, 23072-23087, 23077-23092, 23100-23115, 23115-23130, 23116-23131, 23117-23132, 23228- 23243, 23270-23285, 23498-23513, 23499-23514, 23506-23521, 23507-23522, 23508-23523, 23639-23654, 23876-23891, 23878-23893, 23908-23923, 23909-23924, 23911-23926, 23912-23927, 23950-23965, 23951- 23966, 23971-23986, 24074-24089, 24075-24090, 24076-24091, 24077-24092, 24079-24094, 24777-24792, 25489-25504, 25490-25505, 25491-25506, 25509-25524, 25524-25539, 25655-25670, 25996-26011, 26259- 26274, 26261-26276, 26262-26277, 26263-26278, 26265-26280, 26268-26283, 26269-26284, 26270-26285, 26271-26286, 26272-26287, 26273-26288, 26274-26289, 26275-26290, 26276-26291, 26277-26292, 26279- 26294, 26280-26295, 26320-26335, 26351-26366, 26352-26367, 26353-26368, 26359-26374, 26512-26527, 26594-26609, 26730-26745, 26762-26777, 26773-26788, 26913-26928, 26915-26930, 27018-27033, 27023- 27038, 27100-27115, 27193-27208, 27194-27209, 27195-27210, 27258-27273, 27271-27286, 27286-27301, 27362-27377, 27392-27407, 27420-27435, 27421-27436, 27422-27437, 27423-27438, 27424-27439, 27425- 27440, 27567-27582, 27570-27585, 27676-27691, 27679-27694, 27693-27708, 27696-27711, 27703-27718, 27705-27720, 27709-27724, 27748-27763, 27762-27777, 27936-27951, 28023-28038, 28024-28039, 28025- 28040, 28026-28041, 28027-28042, 28028-28043, 28034-28049, 28109-28124, 28125-28140, 28570-28585, 28572-28587, 28579-28594, 28582-28597, 28643-28658, 28786-28801, 28803-28818, 28844-28859, 28967- 28982, 29480-29495, 29484-29499, 29485-29500, 29494-29509, 29496-29511, 29498-29513, 29499-29514, 29500-29515, 29501-29516, 29502-29517, 29503-29518, 29504-29519, 29505-29520, 29564-29579, 29640- 29655, 29642-29657, 29644-29659, 29672-29687, 29676-29691, 29686-29701, 29734-29749, 29786-29801, 29921-29936, 30019-30034, 30133-30148, 30189-30204, 30213-30228, 30216-30231, 30254-30269, 30256- 30271, 30294-30309, 30318-30333, 30350-30365, 30494-30509, 30495-30510, 30593-30608, 30754-30769, 30889-30904, 30890-30905, 30892-30907, 30936-30951, 30938-30953, 31087-31102, 31130-31145, 31221- 31236, 31243-31258, 31491-31506, 31596-31611, 31653-31668, 31654-31669, 31656-31671, 32146-32161, 32151-32166, 32153-32168, 32156-32171, 32274-32289, 32297-32312, 32299-32314, 32301-32316, 32302- 32317, 32303-32318, 32304-32319, 32305-32320, 32309-32324, 32311-32326, 32342-32357, 32344-32359, 32346-32361, 32347-32362, 32348-32363, 32349-32364, 32352-32367, 32353-32368, 32362-32377, 32532- 32547, 32533-32548, 32558-32573, 32559-32574, 32564-32579, 32633-32648, 32637-32652, 32638-32653, 32641-32656, 32785-32800, 32797-32812, 32798-32813, 32960-32975, 32970-32985, 32972-32987, 32974- 32989, 32976-32991, 32977-32992, 32978-32993, 32979-32994, 32980-32995, 32981-32996, 32982-32997, 32984-32999, 32986-33001, 32987-33002, 32988-33003, 32990-33005, 33012-33027, 33024-33039, 33071- 33086, 33072-33087, 33080-33095, 33099-33114, 33144-33159, 33212-33227, 33219-33234, 33220-33235, 33223-33238, 33226-33241, 33253-33268, 33254-33269, 33255-33270, 33257-33272, 33264-33279, 33266- 33281, 33520-33535, 33521-33536, 33522-33537, 33523-33538, 33538-33553, 33677-33692, 33722-33737, 33734-33749, 33740-33755, 33741-33756, 33742-33757, 33743-33758, 33744-33759, 33746-33761, 33748- 33763, 33750-33765, 33752-33767, 33762-33777, 33803-33818, 33804-33819, 33813-33828, 33824-33839, 33834-33849, 33838-33853, 33840-33855, 33842-33857, 33843-33858, 33844-33859, 33845-33860, 33852- 33867, 33875-33890, 33900-33915, 33920-33935, 33959-33974, 33977-33992, 33980-33995, 33981-33996, 33983-33998, 34003-34018, 34040-34055, 34043-34058, 34046-34061, 34051-34066, 34056-34071, 34057- 34072, 34077-34092, 34084-34099, 34087-34102, 34088-34103, 34095-34110, 34139-34154, 34140-34155, 34183-34198, 34184-34199, 34189-34204, 34190-34205, 34194-34209, 34203-34218, 34210-34225, 34211- 34226, 34212-34227, 34214-34229, 34216-34231, 34227-34242, 34228-34243, 34235-34250, 34237-34252, 34239-34254, 34242-34257, 34243-34258, 34244-34259, 34245-34260, 34246-34261, 34247-34262, 34249- 34264, 34250-34265, 34252-34267, 34253-34268, 34254-34269, 34255-34270, 34256-34271, 34257-34272, 34258-34273, 34261-34276, 34262-34277, 34264-34279, 34265-34280, 34266-34281, 34278-34293, 34279- 34294, 34280-34295, 34283-34298, 34287-34302, 34288-34303, 34290-34305, 34293-34308, 34294-34309, 34295-34310, 34296-34311, 34297-34312, 34298-34313, 34317-34332, 34318-34333, 34321-34336, 34323- 34338, 34325-34340, 34327-34342, 34328-34343, 34329-34344, 34330-34345, 34331-34346, 34332-34347, 34334-34349, 34373-34388, 34374-34389, 34375-34390, 34376-34391, 34377-34392, 34406-34421, 34426- 34441, 34427-34442, 34430-34445, 34432-34447, 34433-34448, 34434-34449, 34486-34501, 34487-34502, 34728-34743, 34732-34747, 34733-34748, 34735-34750, 34845-34860, 34928-34943, 34930-34945, 34932- 34947, 34934-34949, 34935-34950, 34936-34951, 34937-34952, 34938-34953, 34939-34954, 34940-34955, 34942-34957, 34943-34958, 34944-34959, 34945-34960, 34958-34973, 34973-34988, 34979-34994, 34980- 34995, 34982-34997, 34984-34999, 34986-35001, 35020-35035, 35063-35078, 35064-35079, 35069-35084, 35070-35085, 35117-35132, 35294-35309, 35365-35380, 35369-35384, 35371-35386, 35374-35389, 35376- 35391, 35378-35393, 35380-35395, 35382-35397, 35383-35398, 35384-35399, 35385-35400, 35386-35401, 35387-35402, 35389-35404, 35396-35411, 35397-35412, 35398-35413, 35401-35416, 35404-35419, 35407- 35422, 35408-35423, 35413-35428, 35415-35430, 35417-35432, 35419-35434, 35420-35435, 35421-35436, 35422-35437, 35423-35438, 35425-35440, 35426-35441, 35427-35442, 35458-35473, 35459-35474, 35460- 35475, 35461-35476, 35463-35478, 35464-35479, 35465-35480, 35466-35481, 35467-35482, 35469-35484, 35475-35490, 35478-35493, 35479-35494, 35484-35499, 35490-35505, 35503-35518, 35523-35538, 35570- 35585, 35574-35589, 35902-35917, 35926-35941, 35936-35951, 35943-35958, 35949-35964, 35999-36014, 36000-36015, 36004-36019, 36011-36026, 36013-36028, 36015-36030, 36017-36032, 36018-36033, 36019- 36034, 36020-36035, 36021-36036, 36023-36038, 36024-36039, 36025-36040, 36027-36042, 36054-36069, 36061-36076, 36063-36078, 36088-36103, 36100-36115, 36102-36117, 36107-36122, 36108-36123, 36109- 36124, 36110-36125, 36111-36126, 36155-36170, 36164-36179, 36260-36275, 36270-36285, 36359-36374, 36705-36720, 36733-36748, 36735-36750, 36741-36756, 36742-36757, 36743-36758, 36744-36759, 36745- 36760, 36775-36790, 36776-36791, 36777-36792, 36778-36793, 36779-36794, 36780-36795, 36781-36796, 36782-36797, 36783-36798, 36784-36799, 36785-36800, 36797-36812, 36815-36830, 36838-36853, 36844- 36859, 36846-36861, 36847-36862, 36889-36904, 36893-36908, 36903-36918, 36911-36926, 36917-36932, 36918-36933, 36919-36934, 36946-36961, 36947-36962, 36957-36972, 36961-36976, 36966-36981, 36969- 36984, 36970-36985, 36971-36986, 36972-36987, 36973-36988, 36990-37005, 37031-37046, 37041-37056, 37043-37058, 37045-37060, 37051-37066, 37052-37067, 37123-37138, 37124-37139, 37125-37140, 37132- 37147, 37134-37149, 37154-37169, 37158-37173, 37218-37233, 37219-37234, 37252-37267, 37253-37268, 37254-37269, 37256-37271, 37258-37273, 37260-37275, 37262-37277, 37263-37278, 37264-37279, 37265- 37280, 37266-37281, 37267-37282, 37268-37283, 37274-37289, 37276-37291, 37284-37299, 37286-37301, 37287-37302, 37288-37303, 37290-37305, 37305-37320, 37413-37428, 37654-37669, 37833-37848, 37864- 37879, 37873-37888, 38001-38016, 38003-38018, 38004-38019, 38022-38037, 38061-38076, 38063-38078, 38066-38081, 38096-38111, 38981-38996, 38983-38998, 38984-38999, 38986-39001, 38987-39002, 38988- 39003, 39061-39076, 39252-39267, 39263-39278, 39265-39280, 39873-39888, 39876-39891, 39877-39892, 39879-39894, 39880-39895, 39881-39896, 39882-39897, 39883-39898, 39884-39899, 39986-40001, 40012- 40027, 40014-40029, 40015-40030, 40025-40040, 40073-40088, 40074-40089, 40147-40162, 40152-40167, 40153-40168, 40888-40903, 40922-40937, 40923-40938, 41011-41026, 41013-41028, 41018-41033, 41021- 41036, 41022-41037, 41024-41039, 41027-41042, 41519-41534, 41520-41535, 41522-41537, 41527-41542, 41530-41545, 41531-41546, 41533-41548, 41536-41551, 41572-41587, 41575-41590, 41576-41591, 41577- 41592, 41578-41593, 41603-41618, 41605-41620, 41608-41623, 41609-41624, 41610-41625, 41611-41626, 41636-41651, 41638-41653, 41641-41656, 41642-41657, 41643-41658, 41644-41659, 41669-41684, 41671- 41686, 41674-41689, 41675-41690, 41676-41691, 41677-41692, 41702-41717, 41704-41719, 41707-41722, 41708-41723, 41709-41724, 41710-41725, 41735-41750, 41737-41752, 41740-41755, 41741-41756, 41742- 41757, 41743-41758, 41770-41785, 41773-41788, 41774-41789, 41775-41790, 41776-41791, 42491-42506, 42528-42543, 42570-42585, 42644-42659, 42649-42664, 42653-42668, 42675-42690, 42680-42695, 42681- 42696, 42682-42697, 42699-42714, 42700-42715, 42717-42732, 42728-42743, 42729-42744, 42743-42758, 42748-42763, 42755-42770, 42760-42775, 42763-42778, 42772-42787, 42784-42799, 42791-42806, 42797- 42812, 42804-42819, 42866-42881, 42867-42882, 42868-42883, 42905-42920, 43032-43047, 43305-43320, 43315-43330, 43316-43331, 43317-43332, 43319-43334, 43336-43351, 43338-43353, 43339-43354, 43340- 43355, 43344-43359, 43345-43360, 43347-43362, 43349-43364, 43350-43365, 43361-43376, 43365-43380, 43410-43425, 43431-43446, 43438-43453, 43450-43465, 43451-43466, 43452-43467, 43454-43469, 43469- 43484, 43471-43486, 43483-43498, 43511-43526, 43529-43544, 43530-43545, 43531-43546, 43532-43547, 43533-43548, 43535-43550, 43558-43573, 43559-43574, 43567-43582, 43573-43588, 43595-43610, 43621- 43636, 43631-43646, 43643-43658, 43671-43686, 43688-43703, 43689-43704, 43690-43705, 43691-43706, 43692-43707, 43695-43710, 43697-43712, 43726-43741, 43728-43743, 43890-43905, 43893-43908, 43894- 43909, 43895-43910, 43896-43911, 43918-43933, 43920-43935, 43921-43936, 43923-43938, 43959-43974, 44001-44016, 44011-44026, 44012-44027, 44212-44227, 44213-44228, 44215-44230, 44216-44231, 44222- 44237, 44308-44323, 44333-44348, 44334-44349, 44335-44350, 44337-44352, 44339-44354, 44341-44356, 44387-44402, 44390-44405, 44391-44406, 44392-44407, 44405-44420, 44406-44421, 44434-44449, 44443- 44458, 44561-44576, 44594-44609, 44598-44613, 44619-44634, 44630-44645, 44631-44646, 44632-44647, 44634-44649, 44663-44678, 44664-44679, 44665-44680, 44666-44681, 44667-44682, 44668-44683, 44689- 44704, 44697-44712, 44698-44713, 44699-44714, 44701-44716, 44703-44718, 44705-44720, 44707-44722, 44708-44723, 44709-44724, 44710-44725, 44711-44726, 44713-44728, 44764-44779, 44961-44976, 45354- 45369, 45355-45370, 45356-45371, 45357-45372, 45386-45401, 45389-45404, 45559-45574, 45589-45604, 45590-45605, 45792-45807, 45807-45822, 45892-45907, 46208-46223, 46219-46234, 46220-46235, 46221- 46236, 46304-46319, 46318-46333, 46440-46455, 46444-46459, 46445-46460, 46446-46461, 46448-46463, 46473-46488, 46474-46489, 46475-46490, 46476-46491, 46477-46492, 46478-46493, 46479-46494, 46484- 46499, 46485-46500, 46486-46501, 46488-46503, 46489-46504, 46490-46505, 46492-46507, 46494-46509, 46495-46510, 46496-46511, 46497-46512, 46501-46516, 46502-46517, 46504-46519, 46507-46522, 46508- 46523, 46509-46524, 46514-46529, 46524-46539, 46527-46542, 46528-46543, 46529-46544, 46533-46548, 46542-46557, 46545-46560, 46547-46562, 46549-46564, 46551-46566, 46552-46567, 46553-46568, 46554- 46569, 46555-46570, 46564-46579, 46565-46580, 46566-46581, 46567-46582, 46573-46588, 46574-46589, 46575-46590, 46584-46599, 46594-46609, 46614-46629, 46616-46631, 46617-46632, 46627-46642, 46651- 46666, 46661-46676, 46662-46677, 46705-46720, 46706-46721, 46709-46724, 46774-46789, 46962-46977, 47178-47193, 47180-47195, 47316-47331, 47317-47332, 47318-47333, 47751-47766, 47754-47769, 47789- 47804, 47859-47874, 47863-47878, 47928-47943, 48006-48021, 48024-48039, 48025-48040, 48041-48056, 48047-48062, 48065-48080, 48068-48083, 48088-48103, 48174-48189, 48175-48190, 48178-48193, 48186- 48201, 48197-48212, 48243-48258, 48246-48261, 48743-48758, 48744-48759, 48793-48808, 48819-48834, 48862-48877, 48880-48895, 48884-48899, 48931-48946, 48946-48961, 49053-49068, 49165-49180, 49166- 49181, 49167-49182, 49169-49184, 49313-49328, 49324-49339, 49467-49482, 49470-49485, 49499-49514, 49933-49948, 49934-49949, 49997-50012, 50047-50062, 50138-50153, 50213-50228, 50225-50240, 50342- 50357, 50359-50374, 50416-50431, 50424-50439, 50478-50493, 50522-50537, 50539-50554, 50544-50559, 50724-50739, 50765-50780, 50786-50801, 50788-50803, 50849-50864, 50896-50911, 50979-50994, 51018- 51033, 51039-51054, 51234-51249, 51254-51269, 51255-51270, 51258-51273, 51327-51342, 51338-51353, 51537-51552, 51539-51554, 51554-51569, 51579-51594, 51609-51624, 51618-51633, 51619-51634, 51621- 51636, 51622-51637, 51648-51663, 51650-51665, 51651-51666, 51652-51667, 51654-51669, 51677-51692, 51704-51719, 51707-51722, 51719-51734, 51772-51787, 51775-51790, 51776-51791, 51785-51800, 51959- 51974, 51966-51981, 52002-52017, 52004-52019, 52124-52139, 52267-52282, 52279-52294, 52280-52295, 52281-52296, 52282-52297, 52283-52298, 52289-52304, 52295-52310, 52308-52323, 52318-52333, 52319- 52334, 52321-52336, 52322-52337, 52326-52341, 52327-52342, 52328-52343, 52329-52344, 52407-52422, 52535-52550, 52536-52551, 52538-52553, 52741-52756, 53377-53392, 53752-53767, 53756-53771, 53881- 53896, 53882-53897, 53946-53961, 53947-53962, 53948-53963, 54511-54526, 54512-54527, 54513-54528, 54561-54576, 54649-54664, 54657-54672, 54658-54673, 54865-54880, 54866-54881, 54922-54937, 54923- 54938, 54924-54939, 54984-54999, 55009-55024, 55043-55058, 55046-55061, 55055-55070, 55056-55071, 55057-55072, 55058-55073, 55059-55074, 55111-55126, 55112-55127, 55114-55129, 55128-55143, 55129- 55144, 55130-55145, 55131-55146, 55132-55147, 55133-55148, 55135-55150, 55143-55158, 55148-55163, 55172-55187, 55178-55193, 55184-55199, 55186-55201, 55187-55202, 55188-55203, 55189-55204, 55190- 55205, 55473-55488, 55736-55751, 55777-55792, 55848-55863, 55849-55864, 55863-55878, 55896-55911, 55900-55915, 55901-55916, 55902-55917, 55904-55919, 55906-55921, 55907-55922, 55910-55925, 55943- 55958, 55944-55959, 55945-55960, 55949-55964, 55950-55965, 55951-55966, 56019-56034, 56027-56042, 56029-56044, 56033-56048, 56038-56053, 56039-56054, 56040-56055, 56041-56056, 56056-56071, 56079- 56094, 56123-56138, 56207-56222, 56208-56223, 56210-56225, 56211-56226, 56212-56227, 56213-56228, 56239-56254, 56240-56255, 56264-56279, 56266-56281, 56288-56303, 56289-56304, 56290-56305, 56298- 56313, 56299-56314, 56300-56315, 56302-56317, 56303-56318, 56306-56321, 56311-56326, 56315-56330, 56317-56332, 56319-56334, 56320-56335, 56321-56336, 56323-56338, 56325-56340, 56337-56352, 56347- 56362, 56348-56363, 56351-56366, 56360-56375, 56361-56376, 56368-56383, 56369-56384, 56372-56387, 56373-56388, 56374-56389, 56375-56390, 56376-56391, 56377-56392, 56380-56395, 56381-56396, 56382- 56397, 56384-56399, 56385-56400, 56386-56401, 56387-56402, 56388-56403, 56389-56404, 56390-56405, 56392-56407, 56393-56408, 56403-56418, 56404-56419, 56405-56420, 56407-56422, 56448-56463, 56481- 56496, 56482-56497, 56522-56537, 56523-56538, 56524-56539, 56525-56540, 56531-56546, 56534-56549, 56551-56566, 56570-56585, 56571-56586, 56572-56587, 56573-56588, 56574-56589, 56575-56590, 56576- 56591, 56592-56607, 56597-56612, 56598-56613, 56601-56616, 56602-56617, 56620-56635, 56645-56660, 56649-56664, 56655-56670, 56659-56674, 56660-56675, 56668-56683, 56669-56684, 56670-56685, 56672- 56687, 56679-56694, 56680-56695, 56681-56696, 56683-56698, 56720-56735, 56729-56744, 56752-56767, 56755-56770, 56756-56771, 56757-56772, 56758-56773, 56769-56784, 56770-56785, 56773-56788, 56789- 56804, 57119-57134, 57122-57137, 57127-57142, 57128-57143, 57139-57154, 57140-57155, 57141-57156, 57187-57202, 57218-57233, 57219-57234, 57229-57244, 57230-57245, 57238-57253, 57248-57263, 57250- 57265, 57251-57266, 57252-57267, 57253-57268, 57254-57269, 57255-57270, 57258-57273, 57261-57276, 57262-57277, 57263-57278, 57275-57290, 57296-57311, 57298-57313, 57299-57314, 57352-57367, 57354- 57369, 57358-57373, 57366-57381, 57387-57402, 57413-57428, 57418-57433, 57424-57439, 57443-57458, 57444-57459, 57547-57562, 57548-57563, 57552-57567, 57553-57568, 57554-57569, 57584-57599, 57585- 57600, 57593-57608, 57594-57609, 57596-57611, 57606-57621, 57607-57622, 57613-57628, 57616-57631, 57617-57632, 57619-57634, 57684-57699, 57685-57700, 57686-57701, 57687-57702, 57688-57703, 57689- 57704, 57690-57705, 57691-57706, 57692-57707, 57711-57726, 57713-57728, 57714-57729, 57715-57730, 57718-57733, 57728-57743, 57730-57745, 57732-57747, 57734-57749, 57735-57750, 57736-57751, 57737- 57752, 57738-57753, 57739-57754, 57740-57755, 57742-57757, 57758-57773, 57759-57774, 57780-57795, 57855-57870, 57857-57872, 57881-57896, 57884-57899, 57906-57921, 58154-58169, 58169-58184, 58482- 58497, 58873-58888, 58901-58916, 58978-58993, 59017-59032, 59019-59034, 59101-59116, 59103-59118, 59105-59120, 59106-59121, 59107-59122, 59110-59125, 59111-59126, 59112-59127, 59113-59128, 59131- 59146, 59135-59150, 59208-59223, 59259-59274, 59308-59323, 59361-59376, 59381-59396, 59397-59412, 59398-59413, 59399-59414, 59406-59421, 59408-59423, 59409-59424, 59971-59986, 60397-60412, 60410- 60425, 60417-60432, 60418-60433, 60419-60434, 60421-60436, 60512-60527, 60551-60566, 60606-60621, 60615-60630, 60616-60631, 60617-60632, 60690-60705, 60773-60788, 60872-60887, 60997-61012, 60998- 61013, 61002-61017, 61005-61020, 61011-61026, 61012-61027, 61013-61028, 61046-61061, 61048-61063, 61051-61066, 61058-61073, 61059-61074, 61061-61076, 61063-61078, 61064-61079, 61126-61141, 61130- 61145, 61182-61197, 61186-61201, 61187-61202, 61188-61203, 61189-61204, 61193-61208, 61194-61209, 61211-61226, 61230-61245, 61231-61246, 61265-61280, 61266-61281, 61272-61287, 61281-61296, 61282- 61297, 61294-61309, 61295-61310, 61429-61444, 61434-61449, 61435-61450, 61480-61495, 61481-61496, 61482-61497, 61521-61536, 61551-61566, 61560-61575, 61728-61743, 61844-61859, 61869-61884, 61938- 61953, 61940-61955, 61952-61967, 61964-61979, 61966-61981, 61974-61989, 61976-61991, 61978-61993, 61980-61995, 61982-61997, 61983-61998, 61984-61999, 61985-62000, 61986-62001, 61987-62002, 62004- 62019, 62011-62026, 62039-62054, 62054-62069, 62055-62070, 62059-62074, 62060-62075, 62061-62076, 62100-62115, 62119-62134, 62122-62137, 62130-62145, 62131-62146, 62132-62147, 62133-62148, 62134- 62149, 62136-62151, 62138-62153, 62182-62197, 62183-62198, 62199-62214, 62200-62215, 62201-62216, 62202-62217, 62203-62218, 62204-62219, 62205-62220, 62318-62333, 62322-62337, 62323-62338, 62324- 62339, 62325-62340, 62326-62341, 62328-62343, 62349-62364, 62355-62370, 62356-62371, 62357-62372, 62358-62373, 62372-62387, 62373-62388, 62374-62389, 62375-62390, 62382-62397, 62383-62398, 62384- 62399, 62403-62418, 62426-62441, 62445-62460, 62472-62487, 62473-62488, 62502-62517, 62505-62520, 62615-62630, 62621-62636, 62622-62637, 62623-62638, 62624-62639, 62625-62640, 62628-62643, 62629- 62644, 62630-62645, 62631-62646, 62632-62647, 62636-62651, 62654-62669, 62655-62670, 62658-62673, 62659-62674, 62661-62676, 62667-62682, 62668-62683, 62671-62686, 62672-62687, 62673-62688, 62674- 62689, 62679-62694, 62680-62695, 62681-62696, 62682-62697, 62683-62698, 62690-62705, 62693-62708, 62694-62709, 62705-62720, 62706-62721, 62741-62756, 62750-62765, 62815-62830, 62816-62831, 62817- 62832, 62818-62833, 62819-62834, 62820-62835, 62821-62836, 62822-62837, 62824-62839, 62825-62840, 62826-62841, 62846-62861, 62880-62895, 62935-62950, 62936-62951, 62937-62952, 62941-62956, 62942- 62957, 62944-62959, 62945-62960, 62946-62961, 62947-62962, 62949-62964, 62950-62965, 62951-62966, 62952-62967, 62953-62968, 62954-62969, 62955-62970, 62956-62971, 62957-62972, 62958-62973, 62959- 62974, 62960-62975, 62961-62976, 62965-62980, 62966-62981, 62969-62984, 63032-63047, 63037-63052, 63038-63053, 63042-63057, 63043-63058, 63044-63059, 63126-63141, 63127-63142, 63128-63143, 63129- 63144, 63131-63146, 63137-63152, 63139-63154, 63175-63190, 63179-63194, 63185-63200, 63186-63201, 63188-63203, 63191-63206, 63192-63207, 63198-63213, 63207-63222, 63208-63223, 63209-63224, 63210- 63225, 63211-63226, 63212-63227, 63213-63228, 63215-63230, 63216-63231, 63217-63232, 63219-63234, 63220-63235, 63221-63236, 63222-63237, 63223-63238, 63224-63239, 63253-63268, 63283-63298, 63284- 63299, 63285-63300, 63341-63356, 63342-63357, 63343-63358, 63344-63359, 63345-63360, 63346-63361, 63371-63386, 63381-63396, 63382-63397, 63383-63398, 63384-63399, 63385-63400, 63386-63401, 63387- 63402, 63388-63403, 63389-63404, 63391-63406, 63396-63411, 63397-63412, 63398-63413, 63399-63414, 63416-63431, 63417-63432, 63418-63433, 63419-63434, 63420-63435, 63421-63436, 63423-63438, 63425- 63440, 63427-63442, 63429-63444, 63439-63454, 63442-63457, 63443-63458, 63444-63459, 63445-63460, 63446-63461, 63459-63474, 63462-63477, 63463-63478, 63464-63479, 63465-63480, 63466-63481, 63467- 63482, 63491-63506, 63493-63508, 63494-63509, 63495-63510, 63496-63511, 63497-63512, 63498-63513, 63499-63514, 63501-63516, 63503-63518, 63509-63524, 63512-63527, 63537-63552, 63540-63555, 63541- 63556, 63542-63557, 63547-63562, 63548-63563, 63549-63564, 63550-63565, 63567-63582, 63694-63709, 63723-63738, 63724-63739, 63725-63740, 63726-63741, 63727-63742, 63728-63743, 63729-63744, 63784- 63799, 63785-63800, 63787-63802, 63791-63806, 63795-63810, 63824-63839, 63825-63840, 63826-63841, 63827-63842, 63829-63844, 63830-63845, 63838-63853, 63848-63863, 63849-63864, 63850-63865, 63891- 63906, 63893-63908, 63894-63909, 63895-63910, 63896-63911, 63907-63922, 63908-63923, 63909-63924, 63913-63928, 63915-63930, 63940-63955, 63958-63973, 63959-63974, 63961-63976, 63962-63977, 63963- 63978, 63965-63980, 63967-63982, 63968-63983, 63969-63984, 63970-63985, 63971-63986, 63973-63988, 63974-63989, 63975-63990, 63977-63992, 63979-63994, 63981-63996, 63982-63997, 64012-64027, 64021- 64036, 64025-64040, 64085-64100, 64149-64164, 64178-64193, 64179-64194, 64180-64195, 64181-64196, 64182-64197, 64183-64198, 64222-64237, 64226-64241, 64231-64246, 64243-64258, 64245-64260, 64246- 64261, 64250-64265, 64257-64272, 64258-64273, 64261-64276, 64262-64277, 64263-64278, 64264-64279, 64273-64288, 64275-64290, 64276-64291, 64277-64292, 64278-64293, 64279-64294, 64280-64295, 64320- 64335, 64393-64408, 64424-64439, 64427-64442, 64429-64444, 64442-64457, 64443-64458, 64510-64525, 64514-64529, 64515-64530, 64539-64554, 64540-64555, 64541-64556, 64542-64557, 64543-64558, 64544- 64559, 64546-64561, 64553-64568, 64619-64634, 64632-64647, 64634-64649, 64639-64654, 64640-64655, 64641-64656, 64642-64657, 64643-64658, 64644-64659, 64645-64660, 64646-64661, 64647-64662, 64649- 64664, 64651-64666, 64652-64667, 64662-64677, 64665-64680, 64669-64684, 64684-64699, 64685-64700, 64694-64709, 64695-64710, 64696-64711, 64698-64713, 64699-64714, 64703-64718, 64707-64722, 64708- 64723, 64756-64771, 64759-64774, 64835-64850, 64865-64880, 64870-64885, 64871-64886, 64885-64900, 64888-64903, 64918-64933, 64939-64954, 64943-64958, 64944-64959, 64946-64961, 64950-64965, 64951- 64966, 64971-64986, 64973-64988, 64974-64989, 64975-64990, 64977-64992, 64978-64993, 64981-64996, 64991-65006, 64992-65007, 64994-65009, 65001-65016, 65025-65040, 65026-65041, 65028-65043, 65029- 65044, 65074-65089, 65075-65090, 65096-65111, 65097-65112, 65098-65113, 65111-65126, 65113-65128, 65115-65130, 65150-65165, 65192-65207, 65194-65209, 65196-65211, 65576-65591, 65577-65592, 65578- 65593, 65579-65594, 65580-65595, 65581-65596, 65600-65615, 65608-65623, 65609-65624, 65611-65626, 65618-65633, 65619-65634, 65620-65635, 65621-65636, 65623-65638, 65668-65683, 65676-65691, 65677- 65692, 65678-65693, 65679-65694, 65680-65695, 65681-65696, 65682-65697, 65683-65698, 65684-65699, 65685-65700, 65686-65701, 65711-65726, 65753-65768, 65754-65769, 65755-65770, 65756-65771, 65759- 65774, 65760-65775, 65816-65831, 65818-65833, 65821-65836, 65826-65841, 65827-65842, 65828-65843, 65830-65845, 65831-65846, 65832-65847, 65875-65890, 65876-65891, 65912-65927, 65913-65928, 65914- 65929, 65915-65930, 65918-65933, 65925-65940, 65950-65965, 65952-65967, 65960-65975, 65961-65976, 65962-65977, 65987-66002, 66091-66106, 66401-66416, 66402-66417, 66403-66418, 66439-66454, 66441- 66456, 66445-66460, 66446-66461, 66447-66462, 66448-66463, 66449-66464, 66450-66465, 66454-66469, 66455-66470, 66475-66490, 66477-66492, 66478-66493, 66483-66498, 66488-66503, 66489-66504, 66513- 66528, 66514-66529, 66515-66530, 66524-66539, 66527-66542, 66564-66579, 66641-66656, 66642-66657, 66643-66658, 66653-66668, 66656-66671, 66657-66672, 66660-66675, 66679-66694, 66680-66695, 66772- 66787, 66778-66793, 67189-67204, 67190-67205, 67191-67206, 67192-67207, 67193-67208, 67194-67209, 67217-67232, 67222-67237, 67262-67277, 67278-67293, 67279-67294, 67280-67295, 67281-67296, 67282- 67297, 67284-67299, 67285-67300, 67288-67303, 67289-67304, 67290-67305, 67364-67379, 67367-67382, 67377-67392, 67391-67406, 67392-67407, 67393-67408, 67394-67409, 67402-67417, 67404-67419, 67406- 67421, 67407-67422, 67408-67423, 67409-67424, 67411-67426, 67412-67427, 67413-67428, 67414-67429, 67417-67432, 67418-67433, 67419-67434, 67420-67435, 67422-67437, 67429-67444, 67431-67446, 67432- 67447, 67434-67449, 67435-67450, 67436-67451, 67437-67452, 67438-67453, 67439-67454, 67440-67455, 67441-67456, 67443-67458, 67445-67460, 67447-67462, 67449-67464, 67454-67469, 67457-67472, 67459- 67474, 67463-67478, 67467-67482, 67468-67483, 67479-67494, 67484-67499, 67485-67500, 67488-67503, 67489-67504, 67490-67505, 67491-67506, 67493-67508, 67494-67509, 67495-67510, 67496-67511, 67497- 67512, 67498-67513, 67499-67514, 67501-67516, 67502-67517, 67503-67518, 67504-67519, 67505-67520, 67506-67521, 67507-67522, 67509-67524, 67510-67525, 67511-67526, 67513-67528, 67515-67530, 67524- 67539, 67525-67540, 67528-67543, 67550-67565, 67552-67567, 67560-67575, 67608-67623, 67611-67626, 67633-67648, 67635-67650, 67637-67652, 67639-67654, 67653-67668, 67661-67676, 67662-67677, 67680- 67695, 67689-67704, 67714-67729, 67715-67730, 67727-67742, 67728-67743, 67730-67745, 67751-67766, 67752-67767, 67762-67777, 67763-67778, 67764-67779, 67766-67781, 67801-67816, 67809-67824, 67811- 67826, 67815-67830, 67816-67831, 67823-67838, 67824-67839, 67825-67840, 67826-67841, 67838-67853, 67852-67867, 67854-67869, 67859-67874, 67877-67892, 67883-67898, 67934-67949, 67967-67982, 67969- 67984, 67982-67997, 67997-68012, 67998-68013, 68003-68018, 68011-68026, 68015-68030, 68025-68040, 68069-68084, 68073-68088, 68074-68089, 68096-68111, 68098-68113, 68102-68117, 68103-68118, 68104- 68119, 68126-68141, 68128-68143, 68129-68144, 68131-68146, 68134-68149, 68156-68171, 68167-68182, 68198-68213, 68203-68218, 68204-68219, 68205-68220, 68208-68223, 68244-68259, 68276-68291, 68279- 68294, 68299-68314, 68300-68315, 68310-68325, 68312-68327, 68313-68328, 68317-68332, 68329-68344, 68331-68346, 68334-68349, 68335-68350, 68355-68370, 68391-68406, 68392-68407, 68731-68746, 68732- 68747, 68733-68748, 68744-68759, 68745-68760, 68747-68762, 68748-68763, 68749-68764, 68752-68767, 68763-68778, 68765-68780, 68775-68790, 68780-68795, 68795-68810, 68801-68816, 68834-68849, 68838- 68853, 68856-68871, 68880-68895, 68885-68900, 68887-68902, 68891-68906, 68908-68923, 68965-68980, 68976-68991, 68977-68992, 68978-68993, 69009-69024, 69013-69028, 69023-69038, 69024-69039, 69025- 69040, 69026-69041, 69027-69042, 69029-69044, 69031-69046, 69061-69076, 69099-69114, 69102-69117, 69105-69120, 69115-69130, 69117-69132, 69118-69133, 69119-69134, 69124-69139, 69125-69140, 69126- 69141, 69127-69142, 69137-69152, 69149-69164, 69166-69181, 69186-69201, 69187-69202, 69188-69203, 69193-69208, 69221-69236, 69242-69257, 69248-69263, 69309-69324, 69323-69338, 69324-69339, 69352- 69367, 69353-69368, 69355-69370, 69356-69371, 69357-69372, 69369-69384, 69370-69385, 69371-69386, 69372-69387, 69374-69389, 69381-69396, 69383-69398, 69384-69399, 69385-69400, 69447-69462, 69448- 69463, 69479-69494, 69482-69497, 69496-69511, 69544-69559, 69604-69619, 69605-69620, 69614-69629, 69629-69644, 69630-69645, 69631-69646, 69632-69647, 69633-69648, 69634-69649, or 69635-69650 of SEQ ID NO: l; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
In certain embodiments, an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 39-54, 171-186, 206-221, 236-251, 240-255, 241- 256, 242-257, 243-258, 244-259, 341-356, 342-357, 343-358, 361-376, 376-391, 499-514, 501-516, 504-519, 572-587, 574-589, 576-591, 578-593, 579-594, 580-595, 581-596, 582-597, 583-598, 584-599, 586-601, 587- 602, 588-603, 589-604, 602-617, 617-632, 623-638, 624-639, 626-641, 628-643, 630-645, 669-684, 670-685, 703-718, 704-719, 705-720, 707-722, 709-724, 711-726, 713-728, 714-729, 715-730, 716-731, 717-732, 718- 733, 719-734, 725-740, 727-742, 735-750, 737-752, 738-753, 739-754, 741-756, 756-771, 824-839, 829-844, 833-848, 855-870, 860-875, 861-876, 862-877, 879-894, 880-895, 897-912, 908-923, 909-924, 923-938, 928- 943, 943-958, 944-959, 945-960, 946-961, 947-962, 948-963, 969-984, 977-992, 978-993, 979-994, 981-996, 983-998, 985-1000, 987-1002, 988-1003, 989-1004, 990-1005, 991-1006, 993-1008, 1044-1059, 1089-1104, 1093-1108, 1094-1109, 1095-1110, 1097-1112, 1122-1137, 1123-1138, 1124-1139, 1125-1140, 1126-1141,
1127-1142, 1128-1143, 1133-1148, 1134-1149, 1135-1150, 1137-1152, 1138-1153, 1139-1154, 1141-1156,
1143-1158, 1144-1159, 1145-1160, 1146-1161, 1150-1165, 1151-1166, 1153-1168, 1156-1171, 1157-1172,
1158-1173, 1163-1178, 1173-1188, 1176-1191, 1177-1192, 1178-1193, 1182-1197, 1191-1206, 1194-1209,
1196-1211, 1198-1213, 1200-1215, 1201-1216, 1202-1217, 1203-1218, 1204-1219, 1213-1228, 1214-1229,
1215-1230, 1216-1231, 1222-1237, 1223-1238, 1224-1239, 1233-1248, 1243-1258, 1263-1278, 1265-1280,
1266-1281, 1271-1286, 1273-1288, 1275-1290, 1278-1293, 1312-1327, 1315-1330, 1324-1339, 1325-1340,
1326-1341, 1327-1342, 1328-1343, 1380-1395, 1381-1396, 1383-1398, 1398-1413, 1400-1415, 1401-1416,
1521-1536, 1569-1584, 1602-1617, 1606-1621, 1607-1622, 1608-1623, 1610-1625, 1612-1627, 1613-1628,
1616-1631, 1649-1664, 1650-1665, 1653-1668, 1663-1678, 1665-1680, 1667-1682, 1669-1684, 1670-1685, 1671-1686, 1672-1687, 1673-1688, 1674-1689, 1675-1690, 1677-1692, 1693-1708, 1694-1709, 1715-1730,
1764-1779, 1768-1783, 1791-1806, 1804-1819, 1869-1884, 1871-1886, 1872-1887, 1908-1923, 1932-1947,
1996-2011, 2025-2040, 2026-2041, 2027-2042, 2028-2043, 2029-2044, 2030-2045, 2069-2084, 2073-2088,
2085-2100, 2103-2118, 2106-2121, 2108-2123, 2121-2136, 2122-2137, 2250-2265, 2251-2266, 2252-2267,
2262-2277, 2265-2280, 2266-2281, 2269-2284, 2288-2303, 2289-2304, 2368-2383, 2371-2386, 2381-2396,
2395-2410, 2396-2411, 2397-2412, 2398-2413, 2406-2421, 2408-2423, 2410-2425, 2411-2426, 2412-2427,
2413-2428, 2415-2430, 2416-2431, 2417-2432, 2418-2433, 2421-2436, 2422-2437, 2423-2438, 2424-2439,
2426-2441, 2433-2448, 2435-2450, 2436-2451, 2438-2453, 2439-2454, 2440-2455, 2441-2456, 2442-2457,
2443-2458, 2444-2459, 2445-2460, 2447-2462, 2449-2464, 2451-2466, 2453-2468, 2458-2473, 2461-2476,
2463-2478, 2467-2482, 2471-2486, 2472-2487, 2483-2498, 2488-2503, 2489-2504, 2492-2507, 2493-2508,
2494-2509, 2495-2510, 2497-2512, 2498-2513, 2499-2514, 2500-2515, 2501-2516, 2502-2517, 2503-2518,
2505-2520, 2506-2521, 2507-2522, 2508-2523, 2509-2524, 2510-2525, 2511-2526, 2513-2528, 2514-2529,
2515-2530, 2517-2532, 2519-2534, 2528-2543, 2529-2544, 2532-2547, 2554-2569, 2556-2571, 2564-2579,
2612-2627, 2615-2630, 2637-2652, 2639-2654, 2641-2656, 2643-2658, 2657-2672, 2665-2680, 2666-2681,
2684-2699, 2693-2708, 2718-2733, 2719-2734, 2731-2746, 2732-2747, 2734-2749, 2755-2770, 2756-2771,
2766-2781, 2767-2782, 2768-2783, 2770-2785, 2805-2820, 2813-2828, 2815-2830, 2819-2834, 2820-2835,
2827-2842, 2828-2843, 2829-2844, 2830-2845, 2842-2857, 2856-2871, 2858-2873, 2863-2878, 2881-2896,
2887-2902, 2938-2953, 2971-2986, 2973-2988, 2986-3001, 3001-3016, 3002-3017, 3007-3022, 3015-3030,
3019-3034, 3029-3044, 3073-3088, 3077-3092, 3078-3093, 3100-3115, 3102-3117, 3106-3121, 3107-3122,
3108-3123, 3130-3145, 3132-3147, 3133-3148, 3135-3150, 3138-3153, 3160-3175, 3171-3186, 3202-3217,
3207-3222, 3208-3223, 3209-3224, 3212-3227, 3248-3263, 3280-3295, 3283-3298, 3303-3318, 3304-3319,
3314-3329, 3316-3331, 3317-3332, 3321-3336, 3333-3348, 3335-3350, 3338-3353, 3339-3354, 3359-3374,
3395-3410, 3396-3411, 3735-3750, 3736-3751, 3737-3752, 3748-3763, 3749-3764, 3751-3766, 3752-3767,
3753-3768, 3756-3771, 3767-3782, 3769-3784, 3779-3794, 3784-3799, 3799-3814, 3805-3820, 3838-3853,
3842-3857, 3860-3875, 3884-3899, 3889-3904, 3891-3906, 3895-3910, 3912-3927, 3969-3984, 3980-3995,
3981-3996, 3982-3997, 4013-4028, 4017-4032, 4027-4042, 4028-4043, 4029-4044, 4030-4045, 4031-4046,
4033-4048, 4035-4050, 4065-4080, 4103-4118, 4106-4121, 4109-4124, 4119-4134, 4121-4136, 4122-4137,
4123-4138, 4128-4143, 4129-4144, 4130-4145, 4131-4146, 4141-4156, 4153-4168, 4170-4185, 4190-4205,
4191-4206, 4192-4207, 4197-4212, 4225-4240, 4246-4261, 4252-4267, 4313-4328, 4327-4342, 4328-4343,
4356-4371, 4357-4372, 4359-4374, 4360-4375, 4361-4376, 4373-4388, 4374-4389, 4375-4390, 4376-4391,
4378-4393, 4385-4400, 4387-4402, 4388-4403, 4389-4404, 4451-4466, 4452-4467, 4483-4498, 4486-4501,
4500-4515, 4548-4563, 4608-4623, 4609-4624, 4618-4633, 4633-4648, 4634-4649, 4635-4650, 4636-4651,
4637-4652, 4638-4653, or 4639-4654 of SEQ ID NO: 2; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
In certain embodiments, an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 12-2607, wherein each thymine is replaced by uracil; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.
In certain embodiments, an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 16 to 80 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 12-2607, wherein each thymine is replaced by uracil; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 16 to 80 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 16 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.
In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a modified sugar moiety. Examples of suitable modified sugar moieties include, but are not limited to, a bicyclic sugar moiety, such as a 2 ’-4’ bridge selected from -O-CH2-; and -O- CH(CH3)-, and a non-bicyclic sugar moiety, such as a 2’-MOE sugar moiety, a 2’-F sugar moiety, a 2’-OMe sugar moiety, or a 2’-NMA sugar moiety. In certain embodiments, at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and/or the second modified oligonucleotide comprises a modified sugar moiety selected from 2’-F and 2’-OMe.
In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a sugar surrogate. Examples of suitable sugar surrogates include, but are not limited to, morpholino, peptide nucleic acid (PNA), glycol nucleic acid (GNA), and unlocked nucleic acid (UNA). In certain embodiments, at least one nucleoside of the first modified oligonucleotide comprises a sugar surrogate, which can be a GNA.
In any of the oligomeric duplexes described herein, at least one intemucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a modified intemucleoside linkage. In certain embodiments, the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage. In certain embodiments, at least one of the first, second, or third intemucleoside linkages from the 5’ end and/or the 3’ end of the first modified oligonucleotide comprises a phosphorothioate linkage. In certain embodiments, at least one of the first, second, or third intemucleoside linkages from the 5’ end and/or the 3’ end of the second modified oligonucleotide comprises a phosphorothioate linkage.
In any of the oligomeric duplexes described herein, at least one intemucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a phosphodiester intemucleoside linkage.
In any of the oligomeric duplexes described herein, each intemucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can be independently selected from a phosphodiester or a phosphorothioate intemucleoside linkage.
In any of the oligomeric duplexes described herein, at least one nucleobase of the first modified oligonucleotide and/orthe second modified oligonucleotide can be modified nucleobase. In certain embodiments, the modified nucleobase is 5-methylcytosine.
In any of the oligomeric duplexes described herein, the first modified oligonucleotide can comprise a stabilized phosphate group attached to the 5’ position of the 5 ’-most nucleoside. In certain embodiments, the stabilized phosphate group comprises a cyclopropyl phosphorate or an /EJ-vinyl phosphorate.
In any of the oligomeric duplexes described herein, the first modified oligonucleotide can comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 5 ’-end of the first modified oligonucleotide. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 3’- end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises N-acetyl galactosamine. In certain embodiments, the conjugate group is a GalNAci. In certain embodiments, the conjugate group comprises a celltargeting moiety having an affinity for transferrin receptor (TfR), also known as TfRl and CD71. In certain embodiments, the conjugate group comprises an anti-TfRl antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfRl. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfRl.
In certain embodiments, conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cll alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, Cll alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. In certain embodiments, conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cll alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.
In certain embodiments, an antisense agent comprises an antisense compound, which comprises an oligomeric compound or an oligomeric duplex described herein. In certain embodiments, an antisense agent, which can comprise an oligomeric compound or an oligomeric duplex described herein, is an RNAi agent capable of reducing the amount of DNM1L nucleic acid through the activation of RISC/Ago2.
Certain embodiments provide an oligomeric agent comprising two or more oligomeric duplexes. In certain embodiments, an oligomeric agent comprises two or more of any of the oligomeric duplexes described herein. In certain embodiments, an oligomeric agent comprises two or more of the same oligomeric duplex, which can be any of the oligomeric duplexes described herein. In certain embodiments, the two or more oligomeric duplexes are linked together. In certain embodiments, the two or more oligomeric duplexes are covalently linked together. In certain embodiments, the second modified oligonucleotides of two or more oligomeric duplexes are covalently linked together. In certain embodiments, the second modified oligonucleotides of two or more oligomeric duplexes are covalently linked together at their 3 ’ ends. In certain embodiments, the two or more oligomeric duplexes are covalently linked together by a glycol linker, such as a tetraethylene glycol linker. Certain such compounds are described in, e.g., Alterman, et al., Nature Biotech., 37:844-894, 2019.
I. Certain Oligonucleotides
In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified intemucleoside linkage. Certain modified nucleosides and modified intemucleoside linkages suitable for use in modified oligonucleotides are described below.
A. Certain Modified Nucleosides
Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase. In certain embodiments, modified nucleosides comprising the following modified sugar moieties and/or the following modified nucleobases may be incorporated into modified oligonucleotides.
1. Certain Sugar Moieties
In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties. In certain embodiments, the modified sugar moiety is a ribosyl modified sugar moiety.
In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2’, 3’, 4’, and/or 5’ positions. In certain embodiments one or more non-bridging substituent of non- bicyclic modified sugar moieties is branched. Examples of 2 ’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2’-F, 2'-OCH3 (“OMe” or “O-methyl”), and 2'-O(CH2)2OCH3 (“MOE” or “O- methoxy ethyl”). In certain embodiments, 2’-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-Ci-Cio alkoxy, O-Ci-Cw substituted alkoxy, O-Ci-Cw alkyl, O-Ci-Cw substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, 0(CH2)2ON(Rm)(Rn) or OCH2C(=O)-N(Rm)(Rn), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted Ci-Cio alkyl, -O(CH2)2ON(CH3)2 (“DMAOE”), 2’-O(CH2)2O(CH2)2N(CH3)2 (“DMAEOE”), and the 2 ’-substituent groups described in Cook et al., U.S. 6,531,584; Cook et al., U.S. 5,859,221; and Cook et al., U.S. 6,005,087. Certain embodiments of these 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 3 ’-position. Examples of substituent groups suitable for the 3 ’-position of modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl). In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 4’-position. Examples of 4’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128. Examples of 5 ’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5’-methyl (R or S), 5'-vinyl, ethyl, and 5 ’-methoxy. In certain embodiments, non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836).
In certain embodiments, a 2 ’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2 ’-substituent group selected from: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(Rm)(R„), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(Rm)(Rn)), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl.
In certain embodiments, a 2 ’-substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2 ’-substituent group selected from: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, O(CH2)2ON(CH3)2 (“DMAOE”), O(CH2)2O(CH2)2N(CH3)2
(“DMAEOE”) and OCH2C(=O)-N(H)CH3 (“NMA”).
In certain embodiments, a 2 ’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2’-substituent group selected from: F, OCH3, and OCH2CH2OCH3.
In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration. For example, a 2’-deoxyfuranosyl sugar moiety may be in seven isomeric configurations other than the naturally occurring p-D-deoxyribosyl configuration. Such modified sugar moieties are described in, e.g., WO 2019/157531, incorporated by reference herein. A 2’-modified sugar moiety has an additional stereocenter at the 2’-position relative to a 2’-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations. 2’-modified sugar moieties described herein are in the P-D-ribosyl isomeric configuration unless otherwise specified.
In naturally occurring nucleic acids, sugars are linked to one another 3’ to 5’. In certain embodiments, oligonucleotides include one or more nucleoside or sugar moiety linked at an alternative position, for example at the 2’ or inverted 5’ to 3’. For example, where the linkage is at the 2’ position, the 2’-substituent groups may instead be at the 3’- position.
Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. Nucleosides comprising such bicyclic sugar moieties have been referred to as bicyclic nucleosides (BNAs), locked nucleosides, or conformationally restricted nucleotides (CRN). Certain such compounds are described in US Patent Publication No. 2013/0190383; and PCT publication WO 2013/036868. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. Examples of such 4’ to 2’ bridging sugar substituents include but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' (“LNA”), 4'-CH2-S-2', 4'-(CH2)2-O-2' (“ENA”), 4'- CH(CH3)-O-2' (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4’-CH2-O-CH2-2’, 4’-CH2-N(R)- 2’, 4'-CH(CH2OCH3)-O-2' (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S. 7,399,845, Bhat et al., U.S. 7,569,686, Swayze et al., U.S. 7,741,457, and Swayze et al., U.S. 8,022,193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., U.S. 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., U.S. 8,278,425), 4'-CH2-O-N(CH3)-2' (see, e.g., Allerson et al., U.S. 7,696,345 and Allerson et al., U.S. 8,124,745), 4'- CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see e.g., Seth et al., U.S. 8,278,426), 4’-C(RaRb)-N(R)-O-2’, 4’-C(RaRb)-O-N(R)-2’, 4'-CH2-O-N(R)-2', and 4'-CH2-N(R)-O- 2’, wherein each R, Ra, and Rb is, independently, H, a protecting group, or C1-C12 alkyl (see, e.g. Imanishi et al., U.S. 7,427,672).
In certain embodiments, such 4’ to 2’ bridges independently comprise from 1 to 4 linked groups independently selected from: -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]n-O-, C(Ra)=C(Rb)-, C(Ra)=N-, C(=NRa)-, -C(=O)-, -C(=S)-, -O-, - Si(Ra)2-, -S(=O)x-, and N(Ra)-; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2- C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); and each JI and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5- C20 aryl, acyl (C(=O)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group.
Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455- 456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U. S. A., 2000, 97, 5633- 5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558- 561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Then, 2001, 3, 239-243; Wengel et al., U.S. 7,053,207, Imanishi et al., U.S. 6,268,490, Imanishi et al. U.S. 6,770,748, Imanishi et al., U.S. RE44,779; Wengel et al., U.S. 6,794,499, Wengel et al., U.S. 6,670,461; Wengel et al., U.S. 7,034,133, Wengel et al., U.S. 8,080,644; Wengel et al., U.S. 8,034,909; Wengel et al., U.S. 8,153,365; Wengel et al., U.S. 7,572,582; and Ramasamy et al., U.S. 6,525,191, Torsten et al., WO 2004/106356, Wengel et al., WO 1999/014226; Seth et al., WO 2007/134181; Seth et al., U.S. 7,547,684; Seth et al., U.S. 7,666,854; Seth et al., U.S. 8,088,746; Seth et al., U.S. 7,750,131; Seth et al., U.S. 8,030,467; Seth et al., U.S. 8,268,980; Seth et al., U.S. 8,546,556; Seth et al., U.S. 8,530,640; Migawa et al., U.S. 9,012,421; Seth et al., U.S. 8,501,805; Allerson et al., US2008/0039618; and Migawa et al., US2015/0191727.
In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the a-L configuration or in the -D configuration. a-L-methyleneoxy (4’-CH2-O-2’) or a-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(l):439-447; Mook, OR. et al., (2007) Mai Cane Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the -D configuration, unless otherwise specified.
In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 ’-substituted and 4’-2’ bridged sugars).
In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'-position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,939,677) and/or the 5’ position.
In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MN A”) (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:
(“F-HNA”, see e.g. Swayze et al., U.S. 8,088,904; Swayze et al., U.S. 8,440,803; Swayze et al., U.S. 8,796,437; and Swayze et al., U.S. 9,005,906; F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula: wherein, independently, for each of said modified THP nucleoside:
Bx is a nucleobase moiety;
T3 and T4 are each, independently, an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3 and T4 is an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group; qi, c|2. q3, q4, c|s. qe and q7 are each, independently, H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and each of Ri and R2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJi, N3, OC(=X)Ji, OC(=X)NJIJ2, NJ3C(=X)NJIJ2, and CN, wherein X is O, S or NJi, and each Ji, J2, and J3 is, independently, H or C1-C6 alkyl.
In certain embodiments, modified THP nucleosides are provided wherein q 1, q2, q3, q4, q5, qe and q7 are each H. In certain embodiments, at least one of qi, q2, q3, q4, qs, qe and q7 is other than H. In certain embodiments, at least one of qi, q7, q3, q4, qs, qe and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of Ri and R2 is F. In certain embodiments, Ri is F and R2 is H, in certain embodiments, Ri is methoxy and R2 is H, and in certain embodiments, Ri is methoxyethoxy and R2 is H.
In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. 5,698,685; Summerton et al., U.S. 5,166,315; Summerton et al., U.S. 5,185,444; and Summerton et al., U.S. 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following structure:
In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.”
In certain embodiments, sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262. Additional PNA compounds suitable for use in the oligonucleotides of the invention are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500. In certain embodiments, sugar surrogates are the “unlocked” sugar structure of UNA (unlocked nucleic acid) nucleosides. UNA is an unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked sugar surrogate. Representative U.S. publications that teach the preparation of UNA include, but are not limited to, US Patent No. 8,314,227; and US Patent Publication Nos. 2013/0096289; 2013/0011922; and 2011/0313020, the entire contents of each of which are hereby incorporated herein by reference.
In certain embodiments, sugar surrogates are the glycerol as found in GNA (glycol nucleic acid) nucleosides as depicted below:
(S)-GNA where Bx represents any nucleobase.
Many other bicyclic and tricyclic sugar and sugar surrogates are known in the art that can be used in modified nucleosides.
2. Certain Modified Nucleobases
In certain embodiments, modified oligonucleotides comprise one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleosides that does not comprise a nucleobase, referred to as an abasic nucleoside. In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides comprising a hypoxanthine nucleobase).
In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 5-methylcytosine, 2-aminopropyladenine, 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine , 2- thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C.=C-CHi) uracil, 5-propynylcytosine, 6-azouracil, 6- azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7- methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3 -deazaguanine, 3- deazaadenine, 6-N -benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N- benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine- 2-one, l,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J.I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S.T. and Lebien, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and \5, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443.
Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manoharan et al., US2003/0158403; Manoharan et al., US2003/0175906; Dinh et al., U.S. 4,845,205; Spielvogel et al., U.S. 5,130,302; Rogers et al., U.S. 5,134,066; Bischofberger et al., U.S. 5,175,273; Urdea et al., U.S. 5,367,066; Benner et al., U.S. 5,432,272; Matteucci et al., U.S. 5,434,257; Gmeiner et al., U.S. 5,457,187; Cook et al., U.S. 5,459,255; Froehler et al., U.S. 5,484,908; Matteucci et al., U.S. 5,502,177; Hawkins et al., U.S. 5,525,711; Haralambidis et al., U.S. 5,552,540; Cook et al., U.S. 5,587,469; Froehler et al., U.S. 5,594,121; Switzer et al., U.S. 5,596,091; Cook et al., U.S. 5,614,617; Froehler et al., U.S. 5,645,985; Cook et al., U.S. 5,681,941; Cook et al., U.S. 5,811,534; Cook et al., U.S. 5,750,692; Cook et al., U.S. 5,948,903; Cook et al., U.S. 5,587,470; Cook et al., U.S. 5,457,191; Matteucci et al., U.S. 5,763,588; Froehler et al., U.S. 5,830,653; Cook et al., U.S. 5,808,027; Cook et al., U.S. 6,166,199; and Matteucci et al., U.S. 6,005,096.
3. Certain Modified Intemucleoside Linkages
The naturally occurring intemucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. In certain embodiments, nucleosides of modified oligonucleotides may be linked together using one or more modified intemucleoside linkages. The two main classes of intemucleoside linking groups are defined by the presence or absence of a phosphoms atom. Representative phosphorus-containing intemucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P=O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P=S”), and phosphorodithioates (“HS-P=S”). Representative non-phosphoms containing intemucleoside linking groups include but are not limited to methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-O-C(=O)(NH)-S-); siloxane (-O-SiH2-O- ); and N,N' -dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified intemucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, intemucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing intemucleoside linkages are well known to those skilled in the art.
In certain embodiments, a modified intemucleoside linkage is any of those described in WO/2021/030778, incorporated by reference herein. In certain embodiments, a modified intemucleoside linkage comprises the formula: wherein independently for each intemucleoside linking group of the modified oligonucleotide: X is selected from O or S; Ri is selected from H, C1-C6 alkyl, and substituted C1-C6 alkyl; and
T is selected from SO2R2, C(=O)R3, and P(=O)R4R5, wherein:
R2 is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, a C1-C6 alkoxy, C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C1-C6 alkenyl substituted C1-C6 alkynyl, and a conjugate group;
Rs is selected from an aryl, a substituted aryl, CH3, N(CH3)2, OCH3 and a conjugate group;
R4 is selected from OCH3, OH, C1-C6 alkyl, substituted C1-C6 alkyl and a conjugate group; and
R5 is selected from OCH3, OH, C1-C6 alkyl, and substituted C1-C6 alkyl.
In certain embodiments, a modified intemucleoside linkage comprises a mesyl phosphoramidate linking group having a formula:
In certain embodiments, a mesyl phosphoramidate intemucleoside linkage may comprise a chiral center. In certain embodiments, modified oligonucleotides comprising (7?p) and/or (.S'p) mesyl phosphoramidates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
Representative intemucleoside linkages having a chiral center include but are not limited to alkylphosphonates, mesyl phosphoramidates, and phosphorothioates. Modified oligonucleotides comprising intemucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom intemucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate or other linkages containing chiral centers in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate intemucleoside linkages wherein all of the phosphorothioate intemucleoside linkages are stereorandom. In certain embodiments, populations of modified oligonucleotides comprise mesyl phosphoramidate intemucleoside linkages wherein all of the mesyl phosphoramidate intemucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate or mesyl phosphoramidate linkage. Nonetheless, each individual phosphorothioate or mesyl phosphoramidate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate or mesyl phosphoramidate intemucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate or mesyl phosphoramidate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate or mesyl phosphoramidate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate or mesyl phosphoramidate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate or mesyl phosphoramidate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate or mesyl phosphoramidate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate or mesyl phosphoramidate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate or mesyl phosphoramidate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
Unless otherwise indicated, chiral intemucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
Neutral intemucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3'- CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research', Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.
In certain embodiments, modified oligonucleotides comprise one or more inverted nucleoside, as shown below:
wherein each Bx independently represents any nucleobase.
In certain embodiments, an inverted nucleoside is terminal (i.e., the last nucleoside on one end of an oligonucleotide) and so only one intemucleoside linkage depicted above will be present. In certain such embodiments, additional features (such as a conjugate group) may be attached to the inverted nucleoside. Such terminal inverted nucleosides can be attached to either or both ends of an oligonucleotide.
In certain embodiments, such groups lack a nucleobase and are referred to herein as inverted sugar moieties. In certain embodiments, an inverted sugar moiety is terminal (i.e., attached to the last nucleoside on one end of an oligonucleotide) and so only one intemucleoside linkage above will be present. In certain such embodiments, additional features (such as a conjugate group) may be attached to the inverted sugar moiety. Such terminal inverted sugar moieties can be attached to either or both ends of an oligonucleotide.
In certain embodiments, nucleic acids can be linked 2’ to 5’ rather than the standard 3’ to 5’ linkage. Such a linkage is illustrated below. wherein each Bx represents any nucleobase.
B. Certain Motifs In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified intemucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or intemucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and intemucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
1. Certain Sugar Motifs
In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.
Uniformly Modified Oligonucleotides
In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified nucleotide comprises the same 2 ’-modification.
Gapmer Oligonucleotides
In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.” The three regions of a gapmer motif (the 5 ’ -wing, the gap, and the 3 ’ -wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3 ’-most nucleoside of the 5’-wing and the 5’-most nucleoside of the 3 ’-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5'-wing differs from the sugar motif of the 3'-wing (asymmetric gapmer).
In certain embodiments, the wings of a gapmer comprise 1-6 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least three nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least four nucleosides of each wing of a gapmer comprises a modified sugar moiety.
In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer comprises a 2’-(3-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety.
In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, the nucleosides on the gap side of each wing/gap junction comprise 2’- deoxyribosyl sugar moieties and the nucleosides on the wing sides of each wing/gap junction comprise modified sugar moieties. In certain embodiments, each nucleoside of the gap comprises a 2’- (3-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety. In certain embodiments, one nucleoside of the gap comprises a modified sugar moiety and each remaining nucleoside of the gap comprises a 2’-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a 2’-OMe sugar moiety.
Herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5’-wing] - [# of nucleosides in the gap] - [# of nucleosides in the 3’-wing], Thus, a 3-10-3 gapmer consists of 3 linked nucleosides in each wing and 10 linked nucleosides in the gap. Where such nomenclature is followed by a specific modification, that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprise 2’-p-D-deoxyribosyl sugar moieties. A 5-10-5 MOE gapmer consists of 5 linked 2’-MOE nucleosides in the 5’- wing, 10 linked 2’- p-D-deoxynucleosides in the gap, and 5 linked 2’-MOE nucleosides in the 3 ’-wing. A 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5’-wing, 10 linked 2’-p-D-deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3 ’-wing. In certain embodiments, the gap consists of 2’-p-D-deoxyribosyl sugar moieties (e.g., nine 2’-p-D-deoxyribosyl sugar moieties) and one 2’-OMe sugar moiety. In certain embodiments, modified oligonucleotides have a sugar motif selected from the following (5’ to 3’): kkkddddddddddkkk, kkkdddddddddkkke, or kkkdyddddddddkkk, wherein ‘d’ represents a 2’-deoxyribosyl sugar moiety, ‘e’ represents a 2’-MOE sugar moiety, ‘k’ represents a cEt sugar moiety, and ‘y’ represents a 2’-OMe sugar moiety.
In certain embodiments, modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 BNA gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 cEt gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 LNA gapmers. In certain embodiments, modified oligonucleotides have a sugar motif selected from the following (5’ to 3’): kkkddddddddddkkk, kkkdddddddddkkke, or kkkdyddddddddkkk, wherein ‘d’ represents a 2’-deoxyribosyl sugar moiety, ‘e’ represents a 2’-MOE sugar moiety, ‘k’ represents a cEt sugar moiety, and ‘y’ represents a 2’-OMe sugar moiety.
2. Certain Nucleobase Motifs
In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines. In certain embodiments, all of the cytosine nucleobases are 5-methyl cytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.
In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3 ’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3’-end of the oligonucleotide. In certain embodiments, the block is at the 5’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5 ’-end of the oligonucleotide.
In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2’- deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from: a 2-thiopyrimidine and a 5 -propynepyrimidine .
3. Certain Internucleoside Linkage Motifs
In certain embodiments, oligonucleotides comprise modified and/or unmodified intemucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each intemucleoside linking group is a phosphodiester intemucleoside linkage (P=O). In certain embodiments, each intemucleoside linking group of a modified oligonucleotide is a phosphorothioate intemucleoside linkage (P=S). In certain embodiments, each intemucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate intemucleoside linkage and phosphodiester intemucleoside linkage. In certain embodiments, each phosphorothioate intemucleoside linkage is independently selected from a stereorandom phosphorothioate a (.S'p) phosphorothioate, and a (ftp) phosphorothioate.
In certain embodiments, each intemucleoside linkage is a phosphorothioate linkage.
In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the intemucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the intemucleoside linkages in the wings are unmodified phosphodiester intemucleoside linkages. In certain embodiments, the terminal intemucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the intemucleoside linkage motif comprises at least one phosphodiester intemucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal intemucleoside linkage, and the remaining intemucleoside linkages are phosphorothioate intemucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such intemucleoside linkage motifs.
C. Certain Lengths
It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.
In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X<Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18,
12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14,
13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27,
13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24,
14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22,
15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21,
16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21,
17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22,
18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24,
19 to 25, 19 to 26, 19 to 27, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27,
20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23,
22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29,
23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27,
26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.
In certain embodiments, a modified oligonucleotide consists of 16 linked nucleosides.
D. Certain Modified Oligonucleotides
In certain embodiments, the above modifications (sugar, nucleobase, intemucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each intemucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the intemucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the intemucleoside linkages of the gap region of the sugar motif. Likewise, such sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.
E. Certain Populations of Modified Oligonucleotides
Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for -D ribosyl sugar moieties, and all of the phosphorothioate intemucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for both -D ribosyl sugar moieties and at least one, particular phosphorothioate intemucleoside linkage in a particular stereochemical configuration.
F. Nucleobase Sequence
In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain such embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.
II. Certain Oligomeric Compounds
In certain embodiments, provided herein are oligomeric compounds, which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3’ and/or 5 ’-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3 ’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3 ’-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5 ’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5 ’-end of oligonucleotides.
Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
A. Certain Terminal Groups
In certain embodiments, oligomeric compounds comprise one or more terminal groups. In certain such embodiments, oligomeric compounds comprise a stabilized 5 ’-phosphate. Stabilized 5’-phosphates include, but are not limited to 5 ’-phosphorates, including, but not limited to 5’-vinylphosphorates. In certain embodiments, terminal groups comprise one or more abasic sugar moieties and/or inverted nucleosides. In certain embodiments, terminal groups comprise one or more 2 ’-linked nucleosides or sugar moieties. In certain such embodiments, the 2 ’-linked group is an abasic sugar moiety. III. Antisense Activity
In certain embodiments, oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity when they reduce or inhibit the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity. In certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
In certain antisense activities, an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense compounds result in cleavage of the target nucleic acid by Argonaute. Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA).
In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.
Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or animal.
IV. Certain Target Nucleic Acids
In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron. A. Complementaritv/Mismatches to the Target Nucleic Acid and Duplex Complementarity
In certain embodiments, oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20, 10 to 18, or 18 to 20 nucleobases in length.
It is possible to introduce mismatch bases without eliminating activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of bothbcl-2 andbcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, and 28 and 42 nucleobase oligonucleotides comprised of the sequence of two or three of the tandem oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase oligonucleotides.
In certain embodiments, oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain embodiments selectivity of the oligonucleotide is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5’-end of the gap region. In certain embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3 ’-end of the gap region. In certain embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5’-end of the wing region. In certain embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3 ’-end of the wing region.
B. DNM1L
In certain embodiments, oligomeric agents or oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is DNM1L. In certain embodiments, DNM1L nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NC 000012.12, truncated from nucleosides 32676001 to 32749000) or SEQ ID NO: 2 (GENBANK Accession No. NM 001278464.1). In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NOs: 1 or 2 reduces the amount of DNM1L RNA, and in certain embodiments reduces the amount of DNM1L protein. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide and a conjugate group.
C. Certain Target Nucleic Acids in Certain Tissues In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissues are the kidney cells and tissues.
V. Certain Methods and Uses
Certain embodiments provided herein relate to methods of inhibiting DNM1L expression, which can be useful for treating a disease associated with DNM1L or DRP1 in a subject, by administration of an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex, any of which comprising a modified oligonucleotide having a nucleobase sequence complementary to a DNM1L nucleic acid.
Examples of diseases associated with DNM1L treatable with the oligomeric agents, oligomeric compounds, modified oligonucleotides, oligomeric duplexes, and methods provided herein include a disorder associated with mitochondrial equilibrium, for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD). Generally it is accepted that if an acute loss of kidney function extends beyond seven days, the episode is reclassified as acute kidney disease (AKD). If a condition persists for more than three months it is again reclassified as chronic kidney disease or CKD. CKD, also referred to as chronic kidney failure, is a gradual loss of kidney function that can progress to end stage renal disease (ESRD). The kidney disorder may be associated with diabetes, sepsis, cardiovascular surgery, exposure to nephrotoxic drugs, and/or trauma.
In certain embodiments, a method comprises administering to a subject an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex, any of which having a nucleobase sequence complementary to a DNM1L nucleic acid. In certain embodiments, the subject has a disorder associated with mitochondrial equilibrium, for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD). The kidney disorder may be associated with diabetes, sepsis, cardiovascular surgery, exposure to nephrotoxic drugs, and/or trauma.
In certain embodiments, a method of treating a disorder associated with mitochondrial equilibrium, for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD). The kidney disorder may be associated with sepsis, cardiovascular surgery, exposure to nephrotoxic drugs, and/or trauma in a subject comprises administering to the subject a therapeutically effective amount of an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex, any of which having a nucleobase sequence complementary to a DNM1L nucleic acid, thereby treating the subject. In certain embodiments, administering the therapeutically effective amount of the oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex improves a marker of kidney health or kidney function. Plasma markers include ALT/AST, creatinine, BUN, cystatin-c, proteinuria, and eGFR; genetic markers include DRP1, KIM-1, FABP1, and NGAL; histopathological markers include hematoxylin and eosin (H&E) staining; urine markers include cytochrome-c, KIM-1, NGAL, TIMP-2 and IGFBP-7. Renal scores (e.g., RIFLE and/or AKI-KDIGO) may also be determined in the subject.
In certain embodiments, a method of inhibiting expression of DNM1L nucleic acid, such as RNA, in a subject having a disease associated with DNM1L comprises administering to the subject an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex, any of which having a nucleobase sequence complementary to a DNM1L nucleic acid, thereby inhibiting expression of DNM1L nucleic acid in the subject. In certain embodiments, administering the oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex inhibits expression of DNM1L in the kidney. In certain embodiments, the subject has a disorder associated with mitochondrial equilibrium, for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD). The kidney disorder may be associated with diabetes, sepsis, cardiovascular surgery, exposure to nephrotoxic drugs, and/or trauma.
In certain embodiments, a method of inhibiting expression of DNM1L nucleic acid in a cell comprises contacting the cell with an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex, any of which having a nucleobase sequence complementary to a DNM1L nucleic acid, thereby inhibiting expression of DNM1L nucleic acid in the cell. In certain embodiments, the cell is a kidney cell. In certain embodiments, the cell is in a subject having a disorder associated with mitochondrial equilibrium, for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
Certain embodiments are drawn to an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex, any of which having a nucleobase sequence complementary to a DNM1L nucleic acid, for use in treating a disease associated with DNM1L. In certain embodiments, the disease is a disorder associated with mitochondrial equilibrium, for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD). In certain embodiments, an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex is for use in improving a marker of kidney health or kidney function associated with a disorder associated with mitochondrial equilibrium, for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
Certain embodiments are drawn to an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex, any of which comprising a modified oligonucleotide having a nucleobase sequence complementary to a DNM1L nucleic acid, for the manufacture or preparation of a medicament for treating a disease associated with DNM1L. In certain embodiments, the disease is a disorder associated with mitochondrial equilibrium, for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD). In certain embodiments, an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex is for the manufacture or preparation of a medicament for improving a marker of kidney health or kidney function, associated with a disorder associated with mitochondrial equilibrium, for example, a kidney disorder such as acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
In any of the methods or uses described herein, the oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex can be any described herein.
VI. Certain Pharmaceutical Compositions
In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds or modified oligonucleotides. In certain embodiments, the one or more oligomeric compounds each consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises or consists of a saline solution and one or more oligomeric compound or modified oligonucleotide. In certain embodiments, a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound or modified oligonucleotide. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound or modified oligonucleotide and water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound or modified oligonucleotide and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound or modified oligonucleotide and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS.
In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compound or modified oligonucleotide and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
In certain embodiments, oligomeric compounds or modified oligonucleotides may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
In certain embodiments, pharmaceutical compositions comprising an oligomeric compound or modified oligonucleotide encompass any pharmaceutically acceptable salts of the oligomeric compound or modified oligonucleotide, esters of the oligomeric compound or modified oligonucleotide, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide, upon administration to an animal, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds or modified oligonucleotide, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.
Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid, such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.
In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80™ and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or a salt thereof’ expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with a cation. In certain instances, one or more specific cation is identified.
In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with potassium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in PBS. In certain embodiments, modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HC1 to achieve a desired pH. VII. Certain Compositions
Compound No. 1424075
In certain embodiments, Compound No. 1424075 is characterized as a 3-10-3 cEt gapmer. Compound 1424075 has a sequence (from 5’ to 3’) of CGTAGATAACAAGTTG (SEQ ID NO: 2610), wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
In certain embodiments, Compound No. 1424075 is represented by the following chemical notation: wherein:
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase,
T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage. In certain embodiments, Compound No. 1424075 is represented by the following chemical structure:
(SEQ ID NO: 2610). In certain embodiments, Compound No. 1424075 is a sodium salt or a potassium salt. In certain embodiments, Compound No. 1424075 is represented by the following chemical stmcture:
(SEQ ID NO: 2610).
Compound No. 1424132
In certain embodiments, Compound No. 1424132 is characterized as a 3-10-3 cEt gapmer. Compound 1424132 has a sequence (from 5’ to 3’) of CAGTATTACATAGTTC (SEQ ID NO: 2611), wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine. In certain embodiments Compound No 1424132 is represented by the following chemical notation: wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase,
G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage. In certain embodiments, Compound No. 1424132 is represented by the following chemical structure:
In certain embodiments, Compound No. 1424132 is represented by the following chemical structure:
(SEQ ID NO: 2611). Compound No. 1424230
In certain embodiments, Compound No. 1424230 is characterized as a 3-10-3 cEt gapmer. Compound 1424230 has a sequence (from 5’ to 3’) of TTGAATATCAAGTGGC (SEQ ID NO: 2612), wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
In certain embodiments, Compound No. 1424230 is represented by the following chemical notation: TksTksGksAdsAdsTdsAdsTdsmCdsAdsAdsGdsTdsGksGksmCk (SEQ ID NO: 2612), wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase,
G = a guanine nucleobase,
T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
In certain embodiments, Compound No. 1424230 is represented by the following chemical structure:
In certain embodiments, Compound No. 1424230 is represented by the following chemical structure:
Compound No. 1461395
In certain embodiments, Compound No. 1461395 is characterized as a 3-9-4 cEt/MOE mixed wing gapmer. Compound 1461395 has a sequence (from 5’ to 3’) of TTGAATATCAAGTGGC (SEQ ID NO: 2615), wherein nucleosides 1-3 have sugar modifications ofk-k-k (from 5’ to 3’), wherein nucleosides 13-16 have sugar modifications of k-k-k-e, wherein each ‘e’ represents a 2'- MOE sugar moiety, and each ‘k’ refers to a cEt sugar moiety; and each of nucleosides 4-12 are 2’-p-D-deoxynucleosides, wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
In certain embodiments, Compound No. 1461395 is represented by the following chemical notation: TksTksGksAdsAdsTdsAdsTdsmCdsAdsAdsGdsTksGksGksmCe (SEQ ID NO: 2615), wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase,
G = a guanine nucleobase,
T = a thymine nucleobase, k = a cEt sugar moiety, e = a 2’-OCH2CH2OCH3 ribosyl sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage. In certain embodiments, Compound No. 1461395 is represented by the following chemical structure: In certain embodiments, Compound No. 1461395 is represented by the following chemical structure: Compound No. 1461496
In certain embodiments, Compound No. 1461496 is characterized as a 3-9-4 cEt/MOE mixed wing gapmer. Compound 1461496 has a sequence (from 5’ to 3’) of AAATTTATGAGGTTCC (SEQ ID NO: 2617), wherein nucleosides 1-3 have sugar modifications ofk-k-k (from 5’ to 3’), wherein nucleosides 13-16 have sugar modifications of k-k-k-e, wherein each ‘e’ represents a 2'- MOE sugar moiety, and each ‘k’ refers to a cEt sugar moiety; and each of nucleosides 4-12 are 2’-p-D-deoxynucleosides, wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
In certain embodiments, Compound No. 1461496 is represented by the following chemical notation:
AksAksAksTdsTdsTdsAdsTdsGdsAdsGdsGdsTksTksmCksmCe (SEQ ID NO: 2617), wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase,
G = a guanine nucleobase,
T = a thymine nucleobase, k = a cEt sugar moiety, e = a 2’-OCH2CH2OCH3 ribosyl sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
In certain embodiments, Compound No. 1461496 is represented by the following chemical structure:
In certain embodiments, Compound No. 1461496 is represented by the following chemical structure:
(SEQ ID NO: 2617). Compound No. 1462196
In certain embodiments, Compound No. 1462196 is characterized as a 3-9-4 cEt/MOE mixed wing gapmer. Compound 1462196 has a sequence (from 5’ to 3’) of AAATGGTAGTTTGAGG (SEQ ID NO: 2618), wherein nucleosides 1-3 have sugar modifications ofk-k-k (from 5’ to 3’), wherein nucleosides 13-16 have sugar modifications of k-k-k-e, wherein each ‘e’ represents a 2'- MOE sugar moiety, and each ‘k’ refers to a cEt sugar moiety; and each of nucleosides 4-12 are 2’-p-D-deoxynucleosides, and wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage.
In certain embodiments, Compound No. 1462196 is represented by the following chemical notation: AksAksAksTdsGdsGdsTdsAdsGdsTdsTdsTdsGksAksGksGe (SEQ ID NO: 2618), wherein
A = an adenine nucleobase, G = a guanine nucleobase,
T = a thymine nucleobase, k = a cEt sugar moiety, e = a 2’-OCH2CH2OCH3 ribosyl sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage. In certain embodiments, Compound No. 1462196 is represented by the following chemical structure:
In certain embodiments, Compound No. 1462196 is represented by the following chemical structure: Compound No. 1273321
In certain embodiments, Compound No. 1273321 is characterized as a 3-10-3 cEt gapmer. Compound 1273321 has a sequence (from 5’ to 3’) of GATTACTGATGAACCG (SEQ ID NO: 2608), wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
In certain embodiments, Compound No. 1273321 is represented by the following chemical notation: GksAksTksTdsAdsmCdsTdsGdsAdsTdsGdsAdsAdsmCksmCksGk (SEQ ID NO: 2608), wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase,
G = a guanine nucleobase,
T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage. In certain embodiments, Compound No. 1273321 is represented by the following chemical stmcture: Compound No. 1423984
In certain embodiments, Compound No. 1423984 is characterized as a 3-10-3 cEt gapmer. Compound 1423984 has a sequence (from 5’ to 3’) of ATGTATTAGTCTTGAC (SEQ ID NO: 2609), wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
In certain embodiments, Compound No. 1423984 is represented by the following chemical notation: AksTksGksTdsAdsTdsTdsAdsGdsTdsmCdsTdsTdsGksAksmCk (SEQ ID NO: 2609), wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase,
G = a guanine nucleobase,
T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage. In certain embodiments, Compound No. 1423984 is represented by the following chemical structure:
In certain embodiments, Compound No. 1423984 is represented by the following chemical structure:
(SEQ ID NO: 2609). Compound No. 1461222
In certain embodiments, Compound No. 1461222 is characterized as a 3-10-3 cEt gapmer. Compound 1461222 has a sequence (from 5’ to 3’) of TGGTAATAAGTTGGAG (SEQ ID NO: 2613), and wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage.
In certain embodiments, Compound No. 1461222 is represented by the following chemical notation: TkSGkSGkSTC|SAC|SAC|STC|SAC|SAC|SGC|STC|STC|SGC|SGkSAkSGk (SEQ ID NO: 2613), wherein
A = an adenine nucleobase,
G = a guanine nucleobase,
T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage. In certain embodiments, Compound No. 1461222 is represented by the following chemical structure:
In certain embodiments, Compound No. 1461222 is represented by the following chemical structure: Compound No. 1461267
In certain embodiments, Compound No. 1461267 is characterized as a 3-10-3 cEt gapmer. Compound 1461267 has a sequence (from 5’ to 3’) of CAATATTCTGTGGCAA (SEQ ID NO: 2614), wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
In certain embodiments, Compound No. 1461267 is represented by the following chemical notation: mCksAksAksTdsAdsTdsTdsmCdsTdsGdsTdsGdsGdsmCksAksAk (SEQ ID NO: 2614), wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase,
G = a guanine nucleobase,
T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage. In certain embodiments, Compound No. 1461267 is represented by the following chemical structure:
In certain embodiments, Compound No. 1461267 is represented by the following chemical structure:
Compound No. 1461396
In certain embodiments, Compound No. 1461396 is characterized as a 3-9-4 cEt/MOE mixed wing gapmer. Compound 1461396 has a sequence (from 5’ to 3’) of TTTGAATATCAAGTGG (SEQ ID NO: 2616), wherein nucleosides 1-3 have sugar modifications ofk-k-k (from 5’ to 3’), wherein nucleosides 13-16 have sugar modifications of k-k-k-e, wherein each ‘e’ represents a 2'- MOE sugar moiety, and each ‘k’ refers to a cEt sugar moiety; and each of nucleosides 4-12 are 2’-p-D-deoxynucleosides, wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
In certain embodiments, Compound No. 1461396 is represented by the following chemical notation: TksTksTksGdsAdsAdsTdsAdsTdsmCdsAdsAdsGksTksGksGe (SEQ ID NO: 2616), wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase,
G = a guanine nucleobase,
T = a thymine nucleobase, k = a cEt sugar moiety, e = a 2’-OCH2CH2OCH3 ribosyl sugar moiety, d = a 2’-P-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage. In certain embodiments, Compound No. 1461396 is represented by the following chemical structure:
In certain embodiments, Compound No. 1461396 is represented by the following chemical stmcture: Compound No. 1546021
In certain embodiments, Compound No. 1546021 is characterized as a 3-10-3 cEt gapmer. Compound 1546021 has a sequence (from 5’ to 3’) of CCATTACGAACTTTTC (SEQ ID NO: 2619), wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
In certain embodiments, Compound No. 1546021 is represented by the following chemical notation: “C^CksAksTdsTdsAds^CdsGdsAdsAds^CdsTdsTdsTksT^Ck (SEQ ID NO: 2619), wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase,
G = a guanine nucleobase,
T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage. In certain embodiments, Compound No. 1546021 is represented by the following chemical structure:
(SEQ ID NO: 2619). In certain embodiments, Compound No. 1546021 is a sodium salt or a potassium salt.
In certain embodiments, Compound No. 1546021 is represented by the following chemical structure: Compound No. 1546275
In certain embodiments, Compound No. 1546275 is characterized as a 3-10-3 cEt gapmer. Compound 1546275 has a sequence (from 5’ to 3’) of GTTTTTTACGAAGGTC (SEQ ID NO: 2620), wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage, and wherein each cytosine is a 5-methylcytosine.
In certain embodiments, Compound No. 1546275 is represented by the following chemical notation: GksTksTksTdsTdsTdsTdsAdsmCdsGdsAdsAdsGdsGksTksmCk (SEQ ID NO: 2620), wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase,
G = a guanine nucleobase,
T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
In certain embodiments, Compound No. 1546275 is represented by the following chemical structure:
In certain embodiments, Compound No. 1546275 is represented by the following chemical structure:
(SEQ ID NO: 2620).
Nonlimiting disclosure and incorporation by reference
Each of the literature and patent publications listed herein is incorporated by reference in its entirety.
While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, ENSEMBL identifiers, and the like recited in the present application is incorporated herein by reference in its entirety.
Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2’-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2 ’-OH in place of one 2’-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) in place of an uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, unless otherwise stated, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound or a modified oligonucleotide having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “ATmCGAUCG,” wherein mC indicates a cytosine base comprising a methyl group at the 5-position. Finally, for clarity, unless otherwise indicated, the phrase “nucleobase sequence of SEQ ID NO: X” refers only to the sequence of nucleobases in that SEQ ID NO. : X, independent of any sugar or intemucleoside linkage modifications also described in such SEQ ID.
Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or 0 such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise. Likewise, tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.
The compounds described herein include variations in which one or more atoms are replaced with a nonradioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 1 H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2H or 3H in place of 'H. 13C or 14C in place of 12C, 15N in place of 14N, 17O or 18O in place of 16O, and 33S, 34S, 35S, or 36S in place of 32S. In certain embodiments, nonradioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.
EXAMPLES
The following examples illustrate certain embodiments of the present disclosure and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated.
Example 1: Effect of 3-10-3 cEt uniform phosphorothioate modified oligonucleotides on human DNM1L RNA in vitro, single dose Modified oligonucleotides complementary to human DNM1L nucleic acid were designed and tested for their single dose effects on DNM1L RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
The modified oligonucleotides in the table below are 3-10-3 cEt modified oligonucleotides with uniform phosphorothioate intemucleoside linkages. The modified oligonucleotides are 16 nucleosides in length, wherein the central gap region consists of ten 2’-p-D-deoxynucleosides, and wherein the 5’ and 3’ wing regions each consist of three cEt nucleosides. The sugar motif for the modified oligonucleotides is (from 5’ to 3’): kkkddddddddddkkk; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, and each “k” represents a cEt modified sugar moiety. The intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): sssssssssssssss; wherein each “s” represents a phosphorothioate intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
“Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NC 000012.12, truncated from nucleosides 32676001 to 32749000), to SEQ ID NO: 2 (GENBANK Accession No. NM 001278464.1), or to both. “N/A” indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
Cultured A431 cells were treated with modified oligonucleotide at a concentration of 2000 nM by free uptake at a density of 10,000 cells per well. After a treatment period of approximately 48 hours, total RNA was isolated from the cells and DNM1L RNA levels were measured by quantitative real-time RTPCR. DNM1L RNA levels were measured by human primer-probe set RTS50433 (forward sequence TTCCATTATCCTCGCTGTCAC, designated herein as SEQ ID NO: 6; reverse sequence CCGCATCCATGAGATCAAGT, designated herein as SEQ ID NO: 7; probe sequence AGATCCAGATGGTCGCAGAACCCTA, designated herein as SEQ ID NO: 8). DNM1L RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DNM1L RNA is presented in the table below as percent DNM1L RNA relative to the amount in untreated control cells (% UTC). The values marked with a “f ” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer-probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region. N.D. in the table below refers to where the % UTC value was Not Defined.
Each separate experiment described in this example is identified by an Assay Identification letter in the table column labeled “AID”.
Table 1. Reduction of DNM1L RNA by 3-10-3 cEt modified oligonucleotides with uniform phosphorothioate intemucleoside linkages at a concentration of 2000 nM in A431 cells
“Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 3 (GENBANK Accession No. NM 001278465.1), to SEQ ID NO: 4 (GENBANK AccessionNo. NM 012063.3), orto SEQ ID NO: 5 (GENBANK Accession No. NM 001330380.1). “N/A” indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
Table 2. Reduction of DNM1L RNA by 3-10-3 cEt modified oligonucleotides with uniform phosphorothioate intemucleoside linkages at a concentration of 2000 nM in A431 cells
Example 2: Effect of mixed MOE and cEt, uniform phosphorothioate modified oligonucleotides on human DNM1L RNA in vitro, single dose
Modified oligonucleotides complementary to human DNM1L nucleic acid were designed and tested for their single dose effects on DNM1L RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
The modified oligonucleotides in the table below are 16 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): kkkdddddddddkkke; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, each “e” represents a 2’-MOE sugar moiety, and each “k” represents a cEt modified sugar moiety. The intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): sssssssssssssss; wherein each “s” represents a phosphorothioate intemucleoside linkage.
“Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (described herein above), or to both. “N/A” indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
Cultured A431 cells were treated with modified oligonucleotide at a concentration of 2000 nM by free uptake at a density of 10,000 cells per well. After a treatment period of approximately 48 hours, total RNA was isolated from the cells and DNM1L RNA levels were measured by quantitative real-time RTPCR. DNM1L RNA levels were measured by human primer-probe set RTS50433 (described herein above). DNM1L RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DNM1L RNA is presented in the table below as percent DNM1L RNA relative to the amount in untreated control cells (% UTC). The values marked with a “f ” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer-probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.
Each separate experiment described in this example is identified by an Assay Identification letter in the table column labeled “AID”.
Compound No. 1428386 (described herein above) was used as a control compound on multiple plates.
Table 3. Reduction of DNM1L RNA by modified oligonucleotides with a mixed MOE/cEt sugar motif and uniform phosphorothioate intemucleoside linkages at a concentration of 2000 nM in A431 cells
Example 3: Effect of mixed cEt and 2’-OMe, uniform phosphorothioate modified oligonucleotides on human DNM1L RNA in vitro, single dose
Modified oligonucleotides complementary to human DNM1L nucleic acid were designed and tested for their single dose effects on DNM1L RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
The modified oligonucleotides in the table below are 16 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): kkkdyddddddddkkk; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, each “y” represents a 2’-OMe sugar moiety, and each “k” represents a cEt modified sugar moiety. The intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): sssssssssssssss; wherein each “s” represents a phosphorothioate intemucleoside linkage. Each cytosine residue is a 5-methylcytosine unless otherwise marked; nonmethylated cytosine residues are indicated by a bold and underlined C.
“Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (described herein above), or to both. “N/A” indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
Cultured A431 cells were treated with modified oligonucleotide at a concentration of 2000 nM by free uptake at a density of 10,000 cells per well. After a treatment period of approximately 48 hours, total RNA was isolated from the cells and DNM1L RNA levels were measured by quantitative real-time RTPCR. DNM1L RNA levels were measured by human primer-probe set RTS50433 (described herein above). DNM1L RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DNM1L RNA is presented in the table below as percent DNM1L RNA relative to the amount in untreated control cells (% UTC). The values marked with a “f ” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer-probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.
Each separate experiment described in this example is identified by an Assay Identification letter in the table column labeled “AID”.
Compound No. 1428386 (described herein above) was used as a control compound on multiple plates.
Table 4. Reduction of DNM1L RNA by modified oligonucleotides with a mixed cEt/2’-OMe sugar motif and uniform phosphorothioate intemucleoside linkages at a concentration of 2000 n in A431 cells
Example 4: Dose-dependent inhibition of human DNM1L in A431 cells by modified oligonucleotides
Modified oligonucleotides selected from the examples above were tested at various doses in A431 cells. Cultured A431 cells at a density of 10,000 cells per well were treated by free uptake with various concentrations of modified oligonucleotide as specified in the tables below. After a treatment period of approximately 48 hours, total RNA was isolated from the cells, and DNM1L RNA levels were measured by quantitative real-time RTPCR. Human DNM1L primer-probe set RTS50433 (described herein above) was used to measure RNA levels as described above. DNM1L RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DNM1L RNA is presented in the tables below as percent DNM1L RNA, relative to the amount in untreated control cells (% UTC). The half maximal inhibitory concentration (IC50) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in Excel and is also presented in the tables below. Table 5. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Table 6. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Table 7. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Table 8. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Table 9. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Table 10. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Table 11. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Table 12. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Table 13. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Table 14. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Table 15. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides Table 16. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Example 5: Dose-dependent inhibition of human DNM1L in A431 cells by modified oligonucleotides
Modified oligonucleotides selected from the examples above were tested at various doses in A431 cells. Cultured A431 cells at a density of 10,000 cells per well were treated by free uptake with various concentrations of modified oligonucleotide as specified in the tables below. After a treatment period of approximately 48 hours, total RNA was isolated from the cells, and DNM1L RNA levels were measured by quantitative real-time RTPCR. Human DNM1L primer-probe set RTS50433 (described herein above) was used to measure RNA levels as described above. DNM1L RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DNM1L RNA is presented in the tables below as percent DNM1L RNA, relative to the amount in untreated control cells (% UTC). N.D. in the tables below refers to instances where the % UTC value was Not Defined.
The half maximal inhibitory concentration (IC50) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in Excel and is also presented in the tables below.
Table 17. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Table 18. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Table 19. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Table 20. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides Table 21. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Table 22. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides Table 23. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Table 24. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Example 6: Dose-dependent inhibition of human DNM1L in A431 cells by modified oligonucleotides
Modified oligonucleotides selected from the examples above were tested at various doses in A431 cells. Cultured A431 cells at a density of 20,000 cells per well were treated by free uptake with various concentrations of modified oligonucleotide as specified in the tables below. After a treatment period of approximately 48 hours, total RNA was isolated from the cells, and DNM1L RNA levels were measured by quantitative real-time RTPCR. Human DNM1L primer-probe set RTS50433 (described herein above) was used to measure RNA levels as described above. DNM1L RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DNM1L RNA is presented in the tables below as percent DNM1L RNA, relative to the amount in untreated control cells (% UTC). N.D. in the tables below refers to instances where the % UTC value was Not Defined.
The half maximal inhibitory concentration (IC50) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in Excel and is also presented in the tables below.
Table 25. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Table 26. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides Table 27. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Table 28. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides Table 29. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides Table 30. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Example 7: Dose-dependent inhibition of human DNM1L in A431 cells by modified oligonucleotides
Modified oligonucleotides selected from the examples above were tested at various doses in A431 cells. Cultured A431 cells at a density of 20,000 cells per well were treated by free uptake with various concentrations of modified oligonucleotide as specified in the tables below. After a treatment period of approximately 48 hours, total RNA was isolated from the cells, and DNM1L RNA levels were measured by quantitative real-time RTPCR. Human DNM1L primer-probe set RTS50433 (described herein above) was used to measure RNA levels as described above. DNM1L RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of DNM1L RNA is presented in the tables below as percent DNM1L RNA, relative to the amount in untreated control cells (% UTC). Modified oligonucleotides marked with a “f ” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.
The half maximal inhibitory concentration (IC50) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in Excel and is also presented in the tables below.
Table 31. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides Table 32. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides
Table 33. Dose-dependent reduction of human DNM1L RNA in A431 cells by modified oligonucleotides Example 8: Tolerability of modified oligonucleotides complementary to human DNM1L in wildtype mice
Wildtype BALB/c mice (Jackson Laboratory) were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.
STUDY 1
Treatment Groups of four male BALB/c mice each were injected subcutaneously once a week for five weeks (for a total of
6 treatments) with 100 mg/kg of modified oligonucleotides. One group of four male BALB/C mice was injected with PBS. The mice were euthanized seventy -two hours post the final administration of modified oligonucleotide.
Plasma chemistry markers
To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), total bilirubin (TBIL), Albumin (ALB), and Creatinine (CREA) were measured on the day the mice were sacrificed (day 38) using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results were averaged for each group of mice and are presented in the tables below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded from further studies. Table 34. Plasma chemistry markers in BALB/c mice
Hematology assays
Blood obtained from mice at week 5 were sent to IDEXX BioResearch for measurement of blood cell counts. Counts taken include red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), Mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC). Individual white blood cell counts, such as that of monocytes (MON), neutrophils (NEU), lymphocytes (LYM), eosinophils (EOS), basophils (BAS), reticulocytes (RETI), and platelets (PLT) were evaluated. The results are presented in the tables below. Modified oligonucleotides that caused changes in the blood cell count outside the expected range were excluded in further studies.
Table 35. Hematology Parameters in BALB/c mice
Table 36. Blood Cell Counts in BALB/c mice
Body and organ weights Body weights of BALB/c mice were measured on days 1 and 38, and the average body weight for each group is presented in the table below. Liver, kidney, and spleen weights were measured on the day the mice were sacrificed (day 38), and the average organ weights for each group are presented in the tables below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
Table 37. Body and organ weights (in grams)
STUDY 2
Treatment
Groups of four male BALB/c mice each were injected subcutaneously once a week for five weeks (for a total of 6 treatments) with 100 mg/kg of modified oligonucleotides. One group of four male BALB/C mice was injected with PBS.
The mice were euthanized seventy -two hours post the final administration of modified oligonucleotide.
Plasma chemistry markers
To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), total bilirubin (TBIL), Albumin (ALB), and Creatinine (CREA) were measured on the day the mice were sacrificed (day 38) using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results were averaged for each group of mice and are presented in the tables below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded from further studies.
Table 38. Plasma chemistry markers in BALB/c mice
Hematology assays
Blood obtained from mice at week 5 were sent to IDEXX BioResearch for measurement of blood cell counts.
Counts taken include red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), Mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC). Individual white blood cell counts, such as that of monocytes (MON), neutrophils (NEU), lymphocytes (LYM), eosinophils (EOS), basophils (BAS), reticulocytes (RETI), and platelets (PLT) were evaluated. The results are presented in the tables below. Modified oligonucleotides that caused changes in the blood cell count outside the expected range were excluded in further studies.
Table 39. Hematology Parameters in B ALB/c mice
Table 40. Blood Cell Counts in BALB/c mice Body and organ weights
Body weights of BALB/c mice were measured on days 1 and 38, and the average body weight for each group is presented in the table below. Liver, kidney, and spleen weights were measured on the day the mice were sacrificed (day 38), and the average organ weights for each group are presented in the tables below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
Table 41. Body and organ weights (in grams)
STUDY 3
Treatment Groups of four male BALB/c mice each were injected subcutaneously once a week for five weeks (for a total of
6 treatments) with 100 mg/kg of modified oligonucleotides. One group of four male BALB/C mice was injected with PBS. The mice were euthanized seventy -two hours post the final administration of modified oligonucleotide.
Plasma chemistry markers
To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), and Albumin (ALB) were measured on the day the mice were sacrificed (day 38) using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results were averaged for each group of mice and are presented in the tables below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded from further studies. Table 42. Plasma chemistry markers in BALB/c mice
J indicates that fewer than 4 samples were available
Hematology assays Blood obtained from mice at week 5 were sent to IDEXX BioResearch for measurement of blood cell counts.
Counts taken include red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), Mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC). Individual white blood cell counts, such as that of monocytes (MON), neutrophils (NEU), lymphocytes (LYM), eosinophils (EOS), basophils (BAS), reticulocytes (RETI), and platelets (PLT) were evaluated. The results are presented in the tables below. Modified oligonucleotides that caused changes in the blood cell count outside the expected range were excluded in further studies.
Table 43. Hematology Parameters in BALB/c mice
} indicates that fewer than 4 samples were available
Table 44. Blood Cell Counts in BALB/c mice
} indicates that fewer than 4 samples were available
Body and organ weights
Body weights of BALB/c mice were measured on days 1 and 38, and the average body weight for each group is presented in the table below. Liver, kidney, and spleen weights were measured on the day the mice were sacrificed (day 38), and the average organ weights for each group are presented in the tables below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
Table 45. Body and organ weights (in grams)
} indicates that fewer than 4 samples were available
STUDY 4
Treatment Groups of four male BALB/c mice each were injected subcutaneously once a week for five weeks (for a total of
6 treatments) with 100 mg/kg of modified oligonucleotides. One group of four male BALB/C mice was injected with PBS. The mice were euthanized seventy -two hours post the final administration of modified oligonucleotide.
Plasma chemistry markers
To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), total bilirubin (TBIL), Albumin (ALB), and Creatinine (CREA) were measured on the day the mice were sacrificed (day 38) using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results were averaged for each group of mice and are presented in the tables below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded from further studies. Table 46. Plasma chemistry markers in BALB/c mice
Hematology assays
Blood obtained from mice at week 5 were sent to IDEXX BioResearch for measurement of blood cell counts.
Counts taken include red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), Mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC). Individual white blood cell counts, such as that of monocytes (MON), neutrophils (NEU), lymphocytes (LYM), eosinophils (EOS), basophils (BAS), reticulocytes (RETI), and platelets (PLT) were evaluated. The results are presented in the tables below. Modified oligonucleotides that caused changes in the blood cell count outside the expected range were excluded in further studies.
Table 47. Hematology Parameters in B ALB/c mice
Table 48. Blood Cell Counts in BALB/c mice Body and organ weights
Body weights of BALB/c mice were measured on days 1 and 35, and the average body weight for each group is presented in the table below. Liver, kidney, and spleen weights were measured on the day the mice were sacrificed (day 35), and the average organ weights for each group are presented in the tables below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies. Table 49. Body and organ weights (in grams)
STUDY 5
Treatment Groups of four male BALB/c mice each were injected subcutaneously once a week for five weeks (for a total of
6 treatments) with 100 mg/kg of modified oligonucleotides. One group of four male BALB/C mice was injected with PBS. The mice were euthanized seventy -two hours post the final administration of modified oligonucleotide.
Plasma chemistry markers
To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), total bilirubin (TBIL), Albumin (ALB), and Creatinine (CREA) were measured on the day the mice were sacrificed (day 35) using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results were averaged for each group of mice and are presented in the tables below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded from further studies. Table 50. Plasma chemistry markers in BALB/c mice
Hematology assays
Blood obtained from mice at week 5 were sent to IDEXX BioResearch for measurement of blood cell counts.
Counts taken include red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), Mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC). Individual white blood cell counts, such as that of monocytes (MON), neutrophils (NEU), lymphocytes (LYM), eosinophils (EOS), basophils (BAS), reticulocytes (RETI), and platelets (PLT) were evaluated. The results are presented in the tables below. Modified oligonucleotides that caused changes in the blood cell count outside the expected range were excluded in further studies. Table 51. Hematology Parameters in BALB/c mice
Table 52. Blood Cell Counts in BALB/c mice
Body and organ weights
Body weights of BALB/c mice were measured on days 1 and 35, and the average body weight for each group is presented in the table below. Liver, kidney, and spleen weights were measured on the day the mice were sacrificed (day 35), and the average organ weights for each group are presented in the tables below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
Table 53. Body and organ weights (in grams)
STUDY 6 Treatment
Groups of four male BALB/c mice each were injected subcutaneously once a week for five weeks (for a total of 6 treatments) with 100 mg/kg of modified oligonucleotides. One group of four male BALB/C mice was injected with PBS. The mice were euthanized seventy -two hours post the final administration of modified oligonucleotide.
Plasma chemistry markers
To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), and total bilirubin (TBIL), and Albumin (ALB) were measured on the day the mice were sacrificed (day 35) using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results were averaged for each group of mice and are presented in the tables below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded from further studies.
Table 54. Plasma chemistry markers in BALB/c mice
Hematology assays
Blood obtained from mice at week 5 were sent to IDEXX BioResearch for measurement of blood cell counts. Counts taken include red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), Mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC). Individual white blood cell counts, such as that of monocytes (MON), neutrophils (NEU), lymphocytes (LYM), eosinophils (EOS), basophils (BAS), reticulocytes (RETI), and platelets (PLT) were evaluated. The results are presented in the tables below. Modified oligonucleotides that caused changes in the blood cell count outside the expected range were excluded in further studies. Table 55. Hematology Parameters in B ALB/c mice
Table 56. Blood Cell Counts in BALB/c mice Body and organ weights
Body weights of BALB/c mice were measured on days 1 and 35, and the average body weight for each group is presented in the table below. Liver, kidney, and spleen weights were measured on the day the mice were sacrificed (day 35), and the average organ weights for each group are presented in the tables below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies. Table 57. Body and organ weights (in grams)
STUDY 7
Treatment Groups of four male BALB/c mice each were injected subcutaneously once a week for five weeks (for a total of
6 treatments) with 100 mg/kg of modified oligonucleotides. One group of four male BALB/C mice was injected with PBS. The mice were euthanized seventy -two hours post the final administration of modified oligonucleotide.
Plasma chemistry markers
To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), total bilirubin (TBIL), Albumin (ALB), and Creatinine (CREA) were measured on the day the mice were sacrificed (day 35) using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results were averaged for each group of mice and are presented in the tables below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded from further studies. Table 58. Plasma chemistry markers in BALB/c mice
Hematology assays
Blood obtained from mice at week 5 were sent to IDEXX BioResearch for measurement of blood cell counts.
Counts taken include red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), Mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC). Individual white blood cell counts, such as that of monocytes (MON), neutrophils (NEU), lymphocytes (LYM), eosinophils (EOS), basophils (BAS), reticulocytes (RETI), and platelets (PLT) were evaluated. The results are presented in the tables below. Modified oligonucleotides that caused changes in the blood cell count outside the expected range were excluded in further studies. Table 59. Hematology Parameters in B ALB/c mice
Table 60. Blood Cell Counts in BALB/c mice
Body and organ weights
Body weights of BALB/c mice were measured on days 1 and 35, and the average body weight for each group is presented in the table below. Liver, kidney, and spleen weights were measured on the day the mice were sacrificed (day 35), and the average organ weights for each group are presented in the tables below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
Table 61. Body and organ weights (in grams) STUDY 8
Treatment
Groups of four male BALB/c mice each were injected subcutaneously once a week for five weeks (for a total of 6 treatments) with 100 mg/kg of modified oligonucleotides. One group of four male BALB/C mice was injected with PBS. The mice were euthanized seventy -two hours post the final administration of modified oligonucleotide. Plasma chemistry markers To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), total bilirubin (TBIL), Albumin (ALB), and Creatinine (CREA) were measured on the day the mice were sacrificed (day 35) using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results were averaged for each group of mice and are presented in the tables below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded from further studies.
Table 62. Plasma chemistry markers in BALB/c mice
Hematology assays Blood obtained from mice at week 5 were sent to IDEXX BioResearch for measurement of blood cell counts.
Counts taken include red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), Mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC). Individual white blood cell counts, such as that of monocytes (MON), neutrophils (NEU), lymphocytes (LYM), eosinophils (EOS), basophils (BAS), reticulocytes (RETI), and platelets (PLT) were evaluated. The results are presented in the tables below. Modified oligonucleotides that caused changes in the blood cell count outside the expected range were excluded in further studies.
Table 63. Hematology Parameters in BALB/c mice
Table 64. Blood Cell Counts in BALB/c mice
Body and organ weights Body weights of BALB/c mice were measured on days 1 and 35, and the average body weight for each group is presented in the table below. Liver, kidney, and spleen weights were measured on the day the mice were sacrificed (day 35), and the average organ weights for each group are presented in the tables below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
Table 65. Body and organ weights (in grams)
Example 9: Tolerability of modified oligonucleotides complementary to human DNM1L in Sprague-Dawley rats
Sprague-Dawley rats (Charles River) are a multipurpose model used for safety and efficacy evaluations. The rats were treated with modified oligonucleotides and evaluated for changes in the levels of various plasma chemistry markers.
STUDY 1
Treatment
Groups of four Sprague-Dawley rats each were injected subcutaneously once a week for six weeks (for a total 7 treatments) with 50 mg/kg of modified oligonucleotide. One group of four rats were injected subcutaneously with PBS. The rats were euthanized seventy-two hours post final administration of modified oligonucleotide. Organs, urine, and plasma were harvested for further analysis.
Plasma chemistry markers
To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), albumin (ALB), creatinine (CREA), and total bilirubin (TBIL) were measured on the day the rats were sacrificed (day 42) using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results were averaged for each group of rats and are presented in the tables below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded from further studies.
Table 66. Plasma chemistry markers in Sprague -Dawley rats
Kidney function
To evaluate the effect of modified oligonucleotides on kidney function, urinary levels of total protein and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The ratios of total protein to creatinine (P/C ratio) are presented in the table below. Modified oligonucleotides that caused changes in the levels of the ratio outside the expected range for modified oligonucleotides were excluded in further studies.
Table 67. Total protein to creatinine ratio in Sprague -Dawley rats Body and organ weights
Body weights of the rats were measured on days 1 and 44 and the average body weight for each group is presented in the table below. Liver, kidney, and spleen weights were measured on the day the rats were sacrificed (day 44), and the average organ weights for each group are presented in the tables below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies. Table 68. Body and organ weights (in grams)
STUDY 2
Treatment
Groups of four Sprague-Dawley rats each were injected subcutaneously once a week for six weeks (total 7 treatments) with 50 mg/kg of modified oligonucleotide. One group of four rats were injected subcutaneously with PBS. The rats were euthanized seventy-two hours post final administration of modified oligonucleotide. Organs, urine, and plasma were harvested for further analysis.
Plasma chemistry markers
To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of alanine aminotransferase (ALT), blood urea nitrogen (BUN), albumin (ALB), creatinine (CREA), and total bilirubin (TBIL) were measured on the day the rats were sacrificed (day 42) using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results were averaged for each group of rats and are presented in the tables below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded from further studies.
Table 69. Plasma chemistry markers in Sprague -Dawley rats Kidney function
To evaluate the effect of modified oligonucleotides on kidney function, urinary levels of total protein and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The ratios of total protein to creatinine (P/C ratio) are presented in the table below. Modified oligonucleotides that caused changes in the levels of the ratio outside the expected range for modified oligonucleotides were excluded in further studies.
Table 70. Total protein to creatinine ratio in Sprague -Dawley rats
Body and organ weights Body weights of the rats were measured on days 1 and 42 and the average body weight for each group is presented in the table below. Liver, kidney, and spleen weights were measured on the day the rats were sacrificed (day 42), and the average organ weights for each group are presented in the tables below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
Table 71. Body and organ weights (in grams) STUDY 3
Treatment
Groups of four Sprague-Dawley rats each were injected subcutaneously once a week for six weeks (total 7 treatments) with 50 mg/kg of modified oligonucleotide. One group of four rats were injected subcutaneously with PBS. The rats were euthanized seventy-two hours post final administration of modified oligonucleotide. Organs, urine, and plasma were harvested for further analysis.
Plasma chemistry markers
To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), albumin (ALB), creatinine (CREA), and total bilirubin (TBIL) were measured on the day the rats were sacrificed (day 43) using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results were averaged for each group of rats and are presented in the tables below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded from further studies.
Table 72. Plasma chemistry markers in Sprague -Dawley rats
Kidney function
To evaluate the effect of modified oligonucleotides on kidney function, urinary levels of total protein and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The ratios of total protein to creatinine (P/C ratio) are presented in the table below. Modified oligonucleotides that caused changes in the levels of the ratio outside the expected range for modified oligonucleotides were excluded in further studies. Table 73. Total protein to creatinine ratio in Sprague -Dawley rats
Body and organ weights Body weights of the rats were measured on days 1 and 43 and the average body weight for each group is presented in the table below. Liver, kidney, and spleen weights were measured on the day the rats were sacrificed (day 44), and the average organ weights for each group are presented in the tables below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
Table 74. Body and organ weights (in grams)
Example 10: Activity of modified oligonucleotides complementary to human DNM1L in transgenic mice, single dose
A transgenic mouse model was developed using the RP11-262A21 BAC clone. The clone was digested at Nml restriction site to produce a fragment containing the DNM1L gene together with ~43 kb upstream and ~63 kb downstream of the genomic region of the DNM1L gene. The gene fragment was introduced into fertilized eggs from
C57BL/6NTac strain mice (Taconic Biosciences) by pronuclear injection to produce 2 founder lines. Mice from Lines 17903 and 17902 are used in the experiments described herein. Human DNM1L RNA expression is found in the kidney and liver in this model.
Treatment
Female human DNM1L transgenic mice Line 17903 were divided into groups of 2 mice each. Each mouse received a single subcutaneous injection of modified oligonucleotide at a dose of 25 mg/kg. One group of 3 mice received a single subcutaneous injection of PBS. The PBS or saline-injected group served as the control group to which modified oligonucleotide-treated groups were compared.
J NA analysis
72 hours post the final treatment, mice were sacrificed, and RNA was extracted from mouse liver and kidney for quantitative real-time RTPCR analysis of DNM1L RNA expression using human DNM1L primer probe set Hs00247147_ml (Thermofisher). DNM1L RNA levels were normalized to total RNA content, as measured by mouse GAPDH. Mouse GAPDH was amplified using mouse primer probe set mGapdh_LTS00102 (forward sequence GGCAAATTCAACGGCACAGT, designated herein as SEQ ID NO: 9 ; reverse sequence GGGTCTCGCTCCTGGAAGAT, designated herein as SEQ ID NO: 10; probe sequence AAGGCCGAGAATGGGAAGCTTGTCATC, designated herein as SEQ ID NO: 11). Results are presented as percent DNM1L RNA, relative to the amount in tissue from PBS treated mice (%control).
Table 75. Reduction of human DNM1L in female human DNM1L transgenic mice Line 17903 Example 11: Activity of modified oligonucleotides complementary to human DNM1L in transgenic mice, single dose
Human DNM1L transgenic mice Line 17902 (described herein above) were used to determine activity of modified oligonucleotides complementary to human DNM1L.
Treatment
Human DNM1L transgenic mice Line 17902 were divided into groups of 2 mice each. The mice were either male, or female as indicated in the tables below. Each mouse received a single subcutaneous injection of modified oligonucleotide at either 10 or 25 mg/kg, as indicated in the tables below. One group of 3 mice received a single subcutaneous injection of PBS. The PBS or saline-injected group served as the control group to which modified oligonucleotide-treated groups were compared.
J NA analysis
72 hours post the final treatment, mice were sacrificed, and RNA was extracted from mouse liver and kidney as indicated for quantitative real-time RTPCR analysis of DNM1L RNA expression using human DNM1L primer probe set Hs00247147_ml (Integrated DNA Technologies). DNM1L RNA levels were normalized to total RNA content, as measured by mouse GAPDH. Mouse GAPDH was amplified using mouse primer probe set mGapdh_LTS00102 (described herein above). Results from each separate experiment are presented in the tables below. Results are presented as percent DNM1L RNA, relative to the amount in tissue from PBS treated mice (%control).
Table 76. Reduction of human DNM1L in female human DNM1L transgenic mice Line 17902, 25mg/kg
Table 77. Reduction of human DNM1L in male human DNM1L transgenic mice Line 17902, lOmg/kg
Example 12: Activity of modified oligonucleotides complementary to human DNM1L in transgenic mice, single dose
Human DNM1L transgenic mice Line 17902 (described herein above) were used to determine activity of modified oligonucleotides complementary to human DNM1L.
Treatment Groups of 2 male human DNM1L transgenic mice Line 17902 were treated with modified oligonucleotides.
Each mouse received a single subcutaneous injection of modified oligonucleotide at doses indicated in the table below. One group of 3 male mice received a single subcutaneous injection of PBS. The PBS-injected group served as the control group to which oligonucleotide-treated groups were compared.
J NA analysis 72 hours post the final treatment, mice were sacrificed, and RNA was extracted from mouse liver and kidney, as indicated in the table below, for quantitative real-time RTPCR analysis of DNM1L RNA expression using human DNM1L primer probe set Hs00247147_ml (Integrated DNA Technologies). DNM1L RNA levels were normalized to total RNA content, as measured by mouse GAPDH. Mouse GAPDH was amplified using mouse primer probe set mGapdh_LTS00102 (described herein above). Results are presented as percent DNM1L RNA, relative to the amount in tissue from PBS treated mice (%control).
Table 78. Reduction of human DNM1L in male human DNM1L transgenic mice Line 17902
Example 13: Activity of modified oligonucleotides complementary to human DNM1L in transgenic mice, multiple dose
Human DNM1L transgenic mice Line 17902 (described herein above) were used to determine activity of modified oligonucleotides complementary to human DNM1L.
Treatment
Groups of 3 male human DNM1L transgenic mice Line 17902 were treated with modified oligonucleotides. Each mouse received a single subcutaneous injection of modified oligonucleotide at various doses indicated in the table below. One group of 4 male mice received a single subcutaneous injection of PBS. The PBS-injected group served as the control group to which oligonucleotide-treated groups were compared. RNA analysis
96 hours post the final treatment, mice were sacrificed and RNA was extracted from mouse liver and kidney for real-time RTPCR analysis of DNM1L RNA expression. Human DNM1L primer probe set Hs00247147_ml (Integrated DNA Technologies) was used to measure human DNM1L RNA levels. DNM1L RNA levels were normalized to total RNA content, as measured by GAPDH. Mouse GAPDH was amplified using mouse primer probe set mGapdh_LTS00102 (described herein above). Results are presented as percent DNM1L RNA, relative to the amount in PBS treated animals (%control). ED50s were calculated in Prism using nonlinear fit with variable slope (four parameter), top constrained to 100% (or 1), bottom constrained to 0. Y=Bottom + (Top- Bottom)/(l+(IC50/X)AHillSlope). Table 79. Reduction of human DNM1L in human DNM1L transgenic mice Line 17902
J indicates that fewer than 3 samples were available

Claims

CLAIMS:
1. An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of a DNM1L nucleic acid, and wherein at least one sugar moiety of the modified oligonucleotide is a modified sugar moiety and at least one intemucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage.
2. The oligomeric compound of claim 1, wherein the DNM1L nucleic acid has the nucleobase sequence of any of SEQ ID NOs: 1 or 2.
3. The oligomeric compound of claim 1 or 2, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 3238-3253, 3370-3385, 3405-3420, 3435-3450, 3439-3454, 3440-3455, 3441-3456, 3442-3457, 3443-3458, 3560-3575, 3561-3576, 3710-3725,
3711-3726, 3784-3799, 3788-3803, 3789-3804, 3836-3851, 3841-3856, 3845-3860, 3896-3911, 3996-4011, 4075-4090,
4080-4095, 4082-4097, 4083-4098, 4102-4117, 4111-4126, 4112-4127, 4113-4128, 4114-4129, 4115-4130, 4117-4132,
4121-4136, 4158-4173, 4159-4174, 4160-4175, 4161-4176, 4162-4177, 4289-4304, 4290-4305, 4292-4307, 4293-4308,
4295-4310, 4320-4335, 4384-4399, 4414-4429, 4415-4430, 4416-4431, 4447-4462, 4458-4473, 4467-4482, 4498-4513,
4499-4514, 4501-4516, 4504-4519, 4505-4520, 4587-4602, 4588-4603, 4590-4605, 4592-4607, 4632-4647, 4723-4738,
4725-4740, 4727-4742, 4729-4744, 4733-4748, 4734-4749, 4807-4822, 5145-5160, 5158-5173, 5159-5174, 5308-5323,
5310-5325, 5660-5675, 5746-5761, 5787-5802, 5798-5813, 5801-5816, 5802-5817, 5803-5818, 5804-5819, 5805-5820,
5806-5821, 5810-5825, 5811-5826, 5812-5827, 5813-5828, 5814-5829, 5815-5830, 6016-6031, 6529-6544, 6530-6545,
6531-6546, 6535-6550, 6536-6551, 6537-6552, 6539-6554, 6540-6555, 6541-6556, 6564-6579, 6566-6581, 6567-6582,
6568-6583, 6583-6598, 6584-6599, 6619-6634, 6623-6638, 6627-6642, 6940-6955, 6942-6957, 7053-7068, 7072-7087,
7073-7088, 7074-7089, 7082-7097, 7094-7109, 7095-7110, 7130-7145, 7282-7297, 7283-7298, 7402-7417, 7403-7418,
7404-7419, 7405-7420, 7406-7421, 7968-7983, 7969-7984, 8115-8130, 8117-8132, 8120-8135, 8163-8178, 8242-8257,
8243-8258, 8268-8283, 8269-8284, 8270-8285, 8274-8289, 8275-8290, 8276-8291, 8278-8293, 8279-8294, 8280-8295,
8303-8318, 8305-8320, 8306-8321, 8307-8322, 8322-8337, 8323-8338, 8753-8768, 9296-9311, 9550-9565, 9695-9710,
9705-9720, 9747-9762, 9807-9822, 10436-10451, 11181-11196, 12291-12306, 12548-12563, 12799-12814, 12838-
12853, 12995-13010, 13478-13493, 13479-13494, 13480-13495, 13481-13496, 13482-13497, 13483-13498, 13484-
13499, 13486-13501, 13487-13502, 13706-13721, 13940-13955, 13996-14011, 14015-14030, 14016-14031, 14018-
14033, 14019-14034, 14061-14076, 14066-14081, 14069-14084, 14147-14162, 14358-14373, 14409-14424, 14411-
14426, 14412-14427, 14413-14428, 14420-14435, 14464-14479, 14465-14480, 14468-14483, 14534-14549, 14544-
14559, 14569-14584, 14592-14607, 14608-14623, 14701-14716, 14725-14740, 14736-14751, 14739-14754, 14740-
14755, 14742-14757, 14743-14758, 14744-14759, 14745-14760, 14746-14761, 14968-14983, 14969-14984, 15643-
15658, 15665-15680, 15666-15681, 15667-15682, 15689-15704, 15690-15705, 15692-15707, 15700-15715, 15755-
15770, 15762-15777, 15811-15826, 15860-15875, 15897-15912, 15898-15913, 15903-15918, 15938-15953, 15976-
15991, 15977-15992, 16003-16018, 16011-16026, 16287-16302, 16288-16303, 16348-16363, 16415-16430, 16460-
16475, 16461-16476, 16462-16477, 16485-16500, 16487-16502, 16543-16558, 16591-16606, 16594-16609, 16620-
16635, 16621-16636, 16696-16711, 16722-16737, 16728-16743, 16776-16791, 16809-16824, 16828-16843, 16830- 16845, 16904-16919, 16905-16920, 16915-16930, 16916-16931, 16917-16932, 16926-16941, 16927-16942, 16970-
16985, 16972-16987, 17002-17017, 17003-17018, 17004-17019, 17005-17020, 17006-17021, 17007-17022, 17009-
17024, 17010-17025, 17011-17026, 17074-17089, 17095-17110, 17539-17554, 18061-18076, 18238-18253, 18379-
18394, 18433-18448, 18434-18449, 18486-18501, 18489-18504, 18490-18505, 18491-18506, 18492-18507, 18493-
18508, 18494-18509, 18495-18510, 18496-18511, 18554-18569, 18570-18585, 18571-18586, 18583-18598, 18616-
18631, 18716-18731, 18721-18736, 18761-18776, 18820-18835, 18821-18836, 18822-18837, 18823-18838, 18824-
18839, 18868-18883, 18870-18885, 18872-18887, 18920-18935, 18921-18936, 18976-18991, 19046-19061, 19048-
19063, 19049-19064, 19060-19075, 19187-19202, 19208-19223, 19211-19226, 19364-19379, 19395-19410, 19398-
19413, 19456-19471, 19861-19876, 19869-19884, 19983-19998, 20080-20095, 20083-20098, 20084-20099, 20130-
20145, 20146-20161, 21297-21312, 21298-21313, 21300-21315, 21438-21453, 21475-21490, 22008-22023, 22122-
22137, 22124-22139, 22139-22154, 22140-22155, 22151-22166, 22250-22265, 22324-22339, 22326-22341, 22327-
22342, 22328-22343, 22447-22462, 22464-22479, 22467-22482, 22646-22661, 22674-22689, 22676-22691, 22677-
22692, 22775-22790, 22776-22791, 22777-22792, 22783-22798, 22788-22803, 22789-22804, 22794-22809, 23071-
23086, 23072-23087, 23077-23092, 23100-23115, 23115-23130, 23116-23131, 23117-23132, 23228-23243, 23270-
23285, 23498-23513, 23499-23514, 23506-23521, 23507-23522, 23508-23523, 23639-23654, 23876-23891, 23878-
23893, 23908-23923, 23909-23924, 23911-23926, 23912-23927, 23950-23965, 23951-23966, 23971-23986, 24074-
24089, 24075-24090, 24076-24091, 24077-24092, 24079-24094, 24777-24792, 25489-25504, 25490-25505, 25491-
25506, 25509-25524, 25524-25539, 25655-25670, 25996-26011, 26259-26274, 26261-26276, 26262-26277, 26263-
26278, 26265-26280, 26268-26283, 26269-26284, 26270-26285, 26271-26286, 26272-26287, 26273-26288, 26274-
26289, 26275-26290, 26276-26291, 26277-26292, 26279-26294, 26280-26295, 26320-26335, 26351-26366, 26352-
26367, 26353-26368, 26359-26374, 26512-26527, 26594-26609, 26730-26745, 26762-26777, 26773-26788, 26913-
26928, 26915-26930, 27018-27033, 27023-27038, 27100-27115, 27193-27208, 27194-27209, 27195-27210, 27258-
27273, 27271-27286, 27286-27301, 27362-27377, 27392-27407, 27420-27435, 27421-27436, 27422-27437, 27423-
27438, 27424-27439, 27425-27440, 27567-27582, 27570-27585, 27676-27691, 27679-27694, 27693-27708, 27696-
27711, 27703-27718, 27705-27720, 27709-27724, 27748-27763, 27762-27777, 27936-27951, 28023-28038, 28024-
28039, 28025-28040, 28026-28041, 28027-28042, 28028-28043, 28034-28049, 28109-28124, 28125-28140, 28570-
28585, 28572-28587, 28579-28594, 28582-28597, 28643-28658, 28786-28801, 28803-28818, 28844-28859, 28967-
28982, 29480-29495, 29484-29499, 29485-29500, 29494-29509, 29496-29511, 29498-29513, 29499-29514, 29500-
29515, 29501-29516, 29502-29517, 29503-29518, 29504-29519, 29505-29520, 29564-29579, 29640-29655, 29642-
29657, 29644-29659, 29672-29687, 29676-29691, 29686-29701, 29734-29749, 29786-29801, 29921-29936, 30019-
30034, 30133-30148, 30189-30204, 30213-30228, 30216-30231, 30254-30269, 30256-30271, 30294-30309, 30318-
30333, 30350-30365, 30494-30509, 30495-30510, 30593-30608, 30754-30769, 30889-30904, 30890-30905, 30892-
30907, 30936-30951, 30938-30953, 31087-31102, 31130-31145, 31221-31236, 31243-31258, 31491-31506, 31596-
31611, 31653-31668, 31654-31669, 31656-31671, 32146-32161, 32151-32166, 32153-32168, 32156-32171, 32274-
32289, 32297-32312, 32299-32314, 32301-32316, 32302-32317, 32303-32318, 32304-32319, 32305-32320, 32309-
32324, 32311-32326, 32342-32357, 32344-32359, 32346-32361, 32347-32362, 32348-32363, 32349-32364, 32352-
32367, 32353-32368, 32362-32377, 32532-32547, 32533-32548, 32558-32573, 32559-32574, 32564-32579, 32633-
32648, 32637-32652, 32638-32653, 32641-32656, 32785-32800, 32797-32812, 32798-32813, 32960-32975, 32970-
32985, 32972-32987, 32974-32989, 32976-32991, 32977-32992, 32978-32993, 32979-32994, 32980-32995, 32981- 32996, 32982-32997, 32984-32999, 32986-33001, 32987-33002, 32988-33003, 32990-33005, 33012-33027, 33024
33039, 33071-33086, 33072-33087, 33080-33095, 33099-33114, 33144-33159, 33212-33227, 33219-33234, 33220
33235, 33223-33238, 33226-33241, 33253-33268, 33254-33269, 33255-33270, 33257-33272, 33264-33279, 33266
33281, 33520-33535, 33521-33536, 33522-33537, 33523-33538, 33538-33553, 33677-33692, 33722-33737, 33734
33749, 33740-33755, 33741-33756, 33742-33757, 33743-33758, 33744-33759, 33746-33761, 33748-33763, 33750
33765, 33752-33767, 33762-33777, 33803-33818, 33804-33819, 33813-33828, 33824-33839, 33834-33849, 33838
33853, 33840-33855, 33842-33857, 33843-33858, 33844-33859, 33845-33860, 33852-33867, 33875-33890, 33900
33915, 33920-33935, 33959-33974, 33977-33992, 33980-33995, 33981-33996, 33983-33998, 34003-34018, 34040
34055, 34043-34058, 34046-34061, 34051-34066, 34056-34071, 34057-34072, 34077-34092, 34084-34099, 34087
34102, 34088-34103, 34095-34110, 34139-34154, 34140-34155, 34183-34198, 34184-34199, 34189-34204, 34190
34205, 34194-34209, 34203-34218, 34210-34225, 34211-34226, 34212-34227, 34214-34229, 34216-34231, 34227
34242, 34228-34243, 34235-34250, 34237-34252, 34239-34254, 34242-34257, 34243-34258, 34244-34259, 34245
34260, 34246-34261, 34247-34262, 34249-34264, 34250-34265, 34252-34267, 34253-34268, 34254-34269, 34255
34270, 34256-34271, 34257-34272, 34258-34273, 34261-34276, 34262-34277, 34264-34279, 34265-34280, 34266
34281, 34278-34293, 34279-34294, 34280-34295, 34283-34298, 34287-34302, 34288-34303, 34290-34305, 34293
34308, 34294-34309, 34295-34310, 34296-34311, 34297-34312, 34298-34313, 34317-34332, 34318-34333, 34321
34336, 34323-34338, 34325-34340, 34327-34342, 34328-34343, 34329-34344, 34330-34345, 34331-34346, 34332
34347, 34334-34349, 34373-34388, 34374-34389, 34375-34390, 34376-34391, 34377-34392, 34406-34421, 34426
34441, 34427-34442, 34430-34445, 34432-34447, 34433-34448, 34434-34449, 34486-34501, 34487-34502, 34728
34743, 34732-34747, 34733-34748, 34735-34750, 34845-34860, 34928-34943, 34930-34945, 34932-34947, 34934
34949, 34935-34950, 34936-34951, 34937-34952, 34938-34953, 34939-34954, 34940-34955, 34942-34957, 34943
34958, 34944-34959, 34945-34960, 34958-34973, 34973-34988, 34979-34994, 34980-34995, 34982-34997, 34984
34999, 34986-35001, 35020-35035, 35063-35078, 35064-35079, 35069-35084, 35070-35085, 35117-35132, 35294
35309, 35365-35380, 35369-35384, 35371-35386, 35374-35389, 35376-35391, 35378-35393, 35380-35395, 35382
35397, 35383-35398, 35384-35399, 35385-35400, 35386-35401, 35387-35402, 35389-35404, 35396-35411, 35397
35412, 35398-35413, 35401-35416, 35404-35419, 35407-35422, 35408-35423, 35413-35428, 35415-35430, 35417
35432, 35419-35434, 35420-35435, 35421-35436, 35422-35437, 35423-35438, 35425-35440, 35426-35441, 35427
35442, 35458-35473, 35459-35474, 35460-35475, 35461-35476, 35463-35478, 35464-35479, 35465-35480, 35466
35481, 35467-35482, 35469-35484, 35475-35490, 35478-35493, 35479-35494, 35484-35499, 35490-35505, 35503
35518, 35523-35538, 35570-35585, 35574-35589, 35902-35917, 35926-35941, 35936-35951, 35943-35958, 35949
35964, 35999-36014, 36000-36015, 36004-36019, 36011-36026, 36013-36028, 36015-36030, 36017-36032, 36018
36033, 36019-36034, 36020-36035, 36021-36036, 36023-36038, 36024-36039, 36025-36040, 36027-36042, 36054
36069, 36061-36076, 36063-36078, 36088-36103, 36100-36115, 36102-36117, 36107-36122, 36108-36123, 36109
36124, 36110-36125, 36111-36126, 36155-36170, 36164-36179, 36260-36275, 36270-36285, 36359-36374, 36705
36720, 36733-36748, 36735-36750, 36741-36756, 36742-36757, 36743-36758, 36744-36759, 36745-36760, 36775
36790, 36776-36791, 36777-36792, 36778-36793, 36779-36794, 36780-36795, 36781-36796, 36782-36797, 36783
36798, 36784-36799, 36785-36800, 36797-36812, 36815-36830, 36838-36853, 36844-36859, 36846-36861, 36847
36862, 36889-36904, 36893-36908, 36903-36918, 36911-36926, 36917-36932, 36918-36933, 36919-36934, 36946
36961, 36947-36962, 36957-36972, 36961-36976, 36966-36981, 36969-36984, 36970-36985, 36971-36986, 36972 36987, 36973-36988, 36990-37005, 37031-37046, 37041-37056, 37043-37058, 37045-37060, 37051-37066, 37052
37067, 37123-37138, 37124-37139, 37125-37140, 37132-37147, 37134-37149, 37154-37169, 37158-37173, 37218
37233, 37219-37234, 37252-37267, 37253-37268, 37254-37269, 37256-37271, 37258-37273, 37260-37275, 37262
37277, 37263-37278, 37264-37279, 37265-37280, 37266-37281, 37267-37282, 37268-37283, 37274-37289, 37276
37291, 37284-37299, 37286-37301, 37287-37302, 37288-37303, 37290-37305, 37305-37320, 37413-37428, 37654
37669, 37833-37848, 37864-37879, 37873-37888, 38001-38016, 38003-38018, 38004-38019, 38022-38037, 38061
38076, 38063-38078, 38066-38081, 38096-38111, 38981-38996, 38983-38998, 38984-38999, 38986-39001, 38987
39002, 38988-39003, 39061-39076, 39252-39267, 39263-39278, 39265-39280, 39873-39888, 39876-39891, 39877
39892, 39879-39894, 39880-39895, 39881-39896, 39882-39897, 39883-39898, 39884-39899, 39986-40001, 40012
40027, 40014-40029, 40015-40030, 40025-40040, 40073-40088, 40074-40089, 40147-40162, 40152-40167, 40153-
40168, 40888-40903, 40922-40937, 40923-40938, 41011-41026, 41013-41028, 41018-41033, 41021-41036, 41022-
41037, 41024-41039, 41027-41042, 41519-41534, 41520-41535, 41522-41537, 41527-41542, 41530-41545, 41531-
41546, 41533-41548, 41536-41551, 41572-41587, 41575-41590, 41576-41591, 41577-41592, 41578-41593, 41603-
41618, 41605-41620, 41608-41623, 41609-41624, 41610-41625, 41611-41626, 41636-41651, 41638-41653, 41641-
41656, 41642-41657, 41643-41658, 41644-41659, 41669-41684, 41671-41686, 41674-41689, 41675-41690, 41676-
41691, 41677-41692, 41702-41717, 41704-41719, 41707-41722, 41708-41723, 41709-41724, 41710-41725, 41735-
41750, 41737-41752, 41740-41755, 41741-41756, 41742-41757, 41743-41758, 41770-41785, 41773-41788, 41774-
41789, 41775-41790, 41776-41791, 42491-42506, 42528-42543, 42570-42585, 42644-42659, 42649-42664, 42653-
42668, 42675-42690, 42680-42695, 42681-42696, 42682-42697, 42699-42714, 42700-42715, 42717-42732, 42728-
42743, 42729-42744, 42743-42758, 42748-42763, 42755-42770, 42760-42775, 42763-42778, 42772-42787, 42784-
42799, 42791-42806, 42797-42812, 42804-42819, 42866-42881, 42867-42882, 42868-42883, 42905-42920, 43032-
43047, 43305-43320, 43315-43330, 43316-43331, 43317-43332, 43319-43334, 43336-43351, 43338-43353, 43339-
43354, 43340-43355, 43344-43359, 43345-43360, 43347-43362, 43349-43364, 43350-43365, 43361-43376, 43365-
43380, 43410-43425, 43431-43446, 43438-43453, 43450-43465, 43451-43466, 43452-43467, 43454-43469, 43469-
43484, 43471-43486, 43483-43498, 43511-43526, 43529-43544, 43530-43545, 43531-43546, 43532-43547, 43533-
43548, 43535-43550, 43558-43573, 43559-43574, 43567-43582, 43573-43588, 43595-43610, 43621-43636, 43631-
43646, 43643-43658, 43671-43686, 43688-43703, 43689-43704, 43690-43705, 43691-43706, 43692-43707, 43695-
43710, 43697-43712, 43726-43741, 43728-43743, 43890-43905, 43893-43908, 43894-43909, 43895-43910, 43896-
43911, 43918-43933, 43920-43935, 43921-43936, 43923-43938, 43959-43974, 44001-44016, 44011-44026, 44012-
44027, 44212-44227, 44213-44228, 44215-44230, 44216-44231, 44222-44237, 44308-44323, 44333-44348, 44334-
44349, 44335-44350, 44337-44352, 44339-44354, 44341-44356, 44387-44402, 44390-44405, 44391-44406, 44392-
44407, 44405-44420, 44406-44421, 44434-44449, 44443-44458, 44561-44576, 44594-44609, 44598-44613, 44619-
44634, 44630-44645, 44631-44646, 44632-44647, 44634-44649, 44663-44678, 44664-44679, 44665-44680, 44666-
44681, 44667-44682, 44668-44683, 44689-44704, 44697-44712, 44698-44713, 44699-44714, 44701-44716, 44703-
44718, 44705-44720, 44707-44722, 44708-44723, 44709-44724, 44710-44725, 44711-44726, 44713-44728, 44764-
44779, 44961-44976, 45354-45369, 45355-45370, 45356-45371, 45357-45372, 45386-45401, 45389-45404, 45559-
45574, 45589-45604, 45590-45605, 45792-45807, 45807-45822, 45892-45907, 46208-46223, 46219-46234, 46220-
46235, 46221-46236, 46304-46319, 46318-46333, 46440-46455, 46444-46459, 46445-46460, 46446-46461, 46448-
46463, 46473-46488, 46474-46489, 46475-46490, 46476-46491, 46477-46492, 46478-46493, 46479-46494, 46484- 46499, 46485-46500, 46486-46501, 46488-46503, 46489-46504, 46490-46505, 46492-46507, 46494-46509, 46495-
46510, 46496-46511, 46497-46512, 46501-46516, 46502-46517, 46504-46519, 46507-46522, 46508-46523, 46509-
46524, 46514-46529, 46524-46539, 46527-46542, 46528-46543, 46529-46544, 46533-46548, 46542-46557, 46545-
46560, 46547-46562, 46549-46564, 46551-46566, 46552-46567, 46553-46568, 46554-46569, 46555-46570, 46564-
46579, 46565-46580, 46566-46581, 46567-46582, 46573-46588, 46574-46589, 46575-46590, 46584-46599, 46594-
46609, 46614-46629, 46616-46631, 46617-46632, 46627-46642, 46651-46666, 46661-46676, 46662-46677, 46705-
46720, 46706-46721, 46709-46724, 46774-46789, 46962-46977, 47178-47193, 47180-47195, 47316-47331, 47317-
47332, 47318-47333, 47751-47766, 47754-47769, 47789-47804, 47859-47874, 47863-47878, 47928-47943, 48006-
48021, 48024-48039, 48025-48040, 48041-48056, 48047-48062, 48065-48080, 48068-48083, 48088-48103, 48174-
48189, 48175-48190, 48178-48193, 48186-48201, 48197-48212, 48243-48258, 48246-48261, 48743-48758, 48744-
48759, 48793-48808, 48819-48834, 48862-48877, 48880-48895, 48884-48899, 48931-48946, 48946-48961, 49053-
49068, 49165-49180, 49166-49181, 49167-49182, 49169-49184, 49313-49328, 49324-49339, 49467-49482, 49470-
49485, 49499-49514, 49933-49948, 49934-49949, 49997-50012, 50047-50062, 50138-50153, 50213-50228, 50225-
50240, 50342-50357, 50359-50374, 50416-50431, 50424-50439, 50478-50493, 50522-50537, 50539-50554, 50544
50559, 50724-50739, 50765-50780, 50786-50801, 50788-50803, 50849-50864, 50896-50911, 50979-50994, 51018
51033, 51039-51054, 51234-51249, 51254-51269, 51255-51270, 51258-51273, 51327-51342, 51338-51353, 51537
51552, 51539-51554, 51554-51569, 51579-51594, 51609-51624, 51618-51633, 51619-51634, 51621-51636, 51622
51637, 51648-51663, 51650-51665, 51651-51666, 51652-51667, 51654-51669, 51677-51692, 51704-51719, 51707
51722, 51719-51734, 51772-51787, 51775-51790, 51776-51791, 51785-51800, 51959-51974, 51966-51981, 52002
52017, 52004-52019, 52124-52139, 52267-52282, 52279-52294, 52280-52295, 52281-52296, 52282-52297, 52283
52298, 52289-52304, 52295-52310, 52308-52323, 52318-52333, 52319-52334, 52321-52336, 52322-52337, 52326
52341, 52327-52342, 52328-52343, 52329-52344, 52407-52422, 52535-52550, 52536-52551, 52538-52553, 52741
52756, 53377-53392, 53752-53767, 53756-53771, 53881-53896, 53882-53897, 53946-53961, 53947-53962, 53948
53963, 54511-54526, 54512-54527, 54513-54528, 54561-54576, 54649-54664, 54657-54672, 54658-54673, 54865
54880, 54866-54881, 54922-54937, 54923-54938, 54924-54939, 54984-54999, 55009-55024, 55043-55058, 55046
55061, 55055-55070, 55056-55071, 55057-55072, 55058-55073, 55059-55074, 55111-55126, 55112-55127, 55114
55129, 55128-55143, 55129-55144, 55130-55145, 55131-55146, 55132-55147, 55133-55148, 55135-55150, 55143
55158, 55148-55163, 55172-55187, 55178-55193, 55184-55199, 55186-55201, 55187-55202, 55188-55203, 55189
55204, 55190-55205, 55473-55488, 55736-55751, 55777-55792, 55848-55863, 55849-55864, 55863-55878, 55896
55911, 55900-55915, 55901-55916, 55902-55917, 55904-55919, 55906-55921, 55907-55922, 55910-55925, 55943
55958, 55944-55959, 55945-55960, 55949-55964, 55950-55965, 55951-55966, 56019-56034, 56027-56042, 56029
56044, 56033-56048, 56038-56053, 56039-56054, 56040-56055, 56041-56056, 56056-56071, 56079-56094, 56123
56138, 56207-56222, 56208-56223, 56210-56225, 56211-56226, 56212-56227, 56213-56228, 56239-56254, 56240
56255, 56264-56279, 56266-56281, 56288-56303, 56289-56304, 56290-56305, 56298-56313, 56299-56314, 56300
56315, 56302-56317, 56303-56318, 56306-56321, 56311-56326, 56315-56330, 56317-56332, 56319-56334, 56320
56335, 56321-56336, 56323-56338, 56325-56340, 56337-56352, 56347-56362, 56348-56363, 56351-56366, 56360
56375, 56361-56376, 56368-56383, 56369-56384, 56372-56387, 56373-56388, 56374-56389, 56375-56390, 56376
56391, 56377-56392, 56380-56395, 56381-56396, 56382-56397, 56384-56399, 56385-56400, 56386-56401, 56387
56402, 56388-56403, 56389-56404, 56390-56405, 56392-56407, 56393-56408, 56403-56418, 56404-56419, 56405 56420, 56407-56422, 56448-56463, 56481-56496, 56482-56497, 56522-56537, 56523-56538, 56524-56539, 56525
56540, 56531-56546, 56534-56549, 56551-56566, 56570-56585, 56571-56586, 56572-56587, 56573-56588, 56574
56589, 56575-56590, 56576-56591, 56592-56607, 56597-56612, 56598-56613, 56601-56616, 56602-56617, 56620
56635, 56645-56660, 56649-56664, 56655-56670, 56659-56674, 56660-56675, 56668-56683, 56669-56684, 56670
56685, 56672-56687, 56679-56694, 56680-56695, 56681-56696, 56683-56698, 56720-56735, 56729-56744, 56752
56767, 56755-56770, 56756-56771, 56757-56772, 56758-56773, 56769-56784, 56770-56785, 56773-56788, 56789
56804, 57119-57134, 57122-57137, 57127-57142, 57128-57143, 57139-57154, 57140-57155, 57141-57156, 57187
57202, 57218-57233, 57219-57234, 57229-57244, 57230-57245, 57238-57253, 57248-57263, 57250-57265, 57251
57266, 57252-57267, 57253-57268, 57254-57269, 57255-57270, 57258-57273, 57261-57276, 57262-57277, 57263
57278, 57275-57290, 57296-57311, 57298-57313, 57299-57314, 57352-57367, 57354-57369, 57358-57373, 57366
57381, 57387-57402, 57413-57428, 57418-57433, 57424-57439, 57443-57458, 57444-57459, 57547-57562, 57548
57563, 57552-57567, 57553-57568, 57554-57569, 57584-57599, 57585-57600, 57593-57608, 57594-57609, 57596
57611, 57606-57621, 57607-57622, 57613-57628, 57616-57631, 57617-57632, 57619-57634, 57684-57699, 57685
57700, 57686-57701, 57687-57702, 57688-57703, 57689-57704, 57690-57705, 57691-57706, 57692-57707, 57711
57726, 57713-57728, 57714-57729, 57715-57730, 57718-57733, 57728-57743, 57730-57745, 57732-57747, 57734
57749, 57735-57750, 57736-57751, 57737-57752, 57738-57753, 57739-57754, 57740-57755, 57742-57757, 57758
57773, 57759-57774, 57780-57795, 57855-57870, 57857-57872, 57881-57896, 57884-57899, 57906-57921, 58154
58169, 58169-58184, 58482-58497, 58873-58888, 58901-58916, 58978-58993, 59017-59032, 59019-59034, 59101
59116, 59103-59118, 59105-59120, 59106-59121, 59107-59122, 59110-59125, 59111-59126, 59112-59127, 59113
59128, 59131-59146, 59135-59150, 59208-59223, 59259-59274, 59308-59323, 59361-59376, 59381-59396, 59397
59412, 59398-59413, 59399-59414, 59406-59421, 59408-59423, 59409-59424, 59971-59986, 60397-60412, 60410
60425, 60417-60432, 60418-60433, 60419-60434, 60421-60436, 60512-60527, 60551-60566, 60606-60621, 60615
60630, 60616-60631, 60617-60632, 60690-60705, 60773-60788, 60872-60887, 60997-61012, 60998-61013, 61002
61017, 61005-61020, 61011-61026, 61012-61027, 61013-61028, 61046-61061, 61048-61063, 61051-61066, 61058
61073, 61059-61074, 61061-61076, 61063-61078, 61064-61079, 61126-61141, 61130-61145, 61182-61197, 61186
61201, 61187-61202, 61188-61203, 61189-61204, 61193-61208, 61194-61209, 61211-61226, 61230-61245, 61231
61246, 61265-61280, 61266-61281, 61272-61287, 61281-61296, 61282-61297, 61294-61309, 61295-61310, 61429
61444, 61434-61449, 61435-61450, 61480-61495, 61481-61496, 61482-61497, 61521-61536, 61551-61566, 61560
61575, 61728-61743, 61844-61859, 61869-61884, 61938-61953, 61940-61955, 61952-61967, 61964-61979, 61966
61981, 61974-61989, 61976-61991, 61978-61993, 61980-61995, 61982-61997, 61983-61998, 61984-61999, 61985
62000, 61986-62001, 61987-62002, 62004-62019, 62011-62026, 62039-62054, 62054-62069, 62055-62070, 62059
62074, 62060-62075, 62061-62076, 62100-62115, 62119-62134, 62122-62137, 62130-62145, 62131-62146, 62132
62147, 62133-62148, 62134-62149, 62136-62151, 62138-62153, 62182-62197, 62183-62198, 62199-62214, 62200
62215, 62201-62216, 62202-62217, 62203-62218, 62204-62219, 62205-62220, 62318-62333, 62322-62337, 62323
62338, 62324-62339, 62325-62340, 62326-62341, 62328-62343, 62349-62364, 62355-62370, 62356-62371, 62357
62372, 62358-62373, 62372-62387, 62373-62388, 62374-62389, 62375-62390, 62382-62397, 62383-62398, 62384
62399, 62403-62418, 62426-62441, 62445-62460, 62472-62487, 62473-62488, 62502-62517, 62505-62520, 62615
62630, 62621-62636, 62622-62637, 62623-62638, 62624-62639, 62625-62640, 62628-62643, 62629-62644, 62630
62645, 62631-62646, 62632-62647, 62636-62651, 62654-62669, 62655-62670, 62658-62673, 62659-62674, 62661 62676, 62667-62682, 62668-62683, 62671-62686, 62672-62687, 62673-62688, 62674-62689, 62679-62694, 62680-
62695, 62681-62696, 62682-62697, 62683-62698, 62690-62705, 62693-62708, 62694-62709, 62705-62720, 62706-
62721, 62741-62756, 62750-62765, 62815-62830, 62816-62831, 62817-62832, 62818-62833, 62819-62834, 62820-
62835, 62821-62836, 62822-62837, 62824-62839, 62825-62840, 62826-62841, 62846-62861, 62880-62895, 62935-
62950, 62936-62951, 62937-62952, 62941-62956, 62942-62957, 62944-62959, 62945-62960, 62946-62961, 62947-
62962, 62949-62964, 62950-62965, 62951-62966, 62952-62967, 62953-62968, 62954-62969, 62955-62970, 62956-
62971, 62957-62972, 62958-62973, 62959-62974, 62960-62975, 62961-62976, 62965-62980, 62966-62981, 62969-
62984, 63032-63047, 63037-63052, 63038-63053, 63042-63057, 63043-63058, 63044-63059, 63126-63141, 63127-
63142, 63128-63143, 63129-63144, 63131-63146, 63137-63152, 63139-63154, 63175-63190, 63179-63194, 63185-
63200, 63186-63201, 63188-63203, 63191-63206, 63192-63207, 63198-63213, 63207-63222, 63208-63223, 63209-
63224, 63210-63225, 63211-63226, 63212-63227, 63213-63228, 63215-63230, 63216-63231, 63217-63232, 63219-
63234, 63220-63235, 63221-63236, 63222-63237, 63223-63238, 63224-63239, 63253-63268, 63283-63298, 63284-
63299, 63285-63300, 63341-63356, 63342-63357, 63343-63358, 63344-63359, 63345-63360, 63346-63361, 63371-
63386, 63381-63396, 63382-63397, 63383-63398, 63384-63399, 63385-63400, 63386-63401, 63387-63402, 63388-
63403, 63389-63404, 63391-63406, 63396-63411, 63397-63412, 63398-63413, 63399-63414, 63416-63431, 63417-
63432, 63418-63433, 63419-63434, 63420-63435, 63421-63436, 63423-63438, 63425-63440, 63427-63442, 63429-
63444, 63439-63454, 63442-63457, 63443-63458, 63444-63459, 63445-63460, 63446-63461, 63459-63474, 63462-
63477, 63463-63478, 63464-63479, 63465-63480, 63466-63481, 63467-63482, 63491-63506, 63493-63508, 63494-
63509, 63495-63510, 63496-63511, 63497-63512, 63498-63513, 63499-63514, 63501-63516, 63503-63518, 63509-
63524, 63512-63527, 63537-63552, 63540-63555, 63541-63556, 63542-63557, 63547-63562, 63548-63563, 63549-
63564, 63550-63565, 63567-63582, 63694-63709, 63723-63738, 63724-63739, 63725-63740, 63726-63741, 63727-
63742, 63728-63743, 63729-63744, 63784-63799, 63785-63800, 63787-63802, 63791-63806, 63795-63810, 63824-
63839, 63825-63840, 63826-63841, 63827-63842, 63829-63844, 63830-63845, 63838-63853, 63848-63863, 63849-
63864, 63850-63865, 63891-63906, 63893-63908, 63894-63909, 63895-63910, 63896-63911, 63907-63922, 63908-
63923, 63909-63924, 63913-63928, 63915-63930, 63940-63955, 63958-63973, 63959-63974, 63961-63976, 63962-
63977, 63963-63978, 63965-63980, 63967-63982, 63968-63983, 63969-63984, 63970-63985, 63971-63986, 63973-
63988, 63974-63989, 63975-63990, 63977-63992, 63979-63994, 63981-63996, 63982-63997, 64012-64027, 64021-
64036, 64025-64040, 64085-64100, 64149-64164, 64178-64193, 64179-64194, 64180-64195, 64181-64196, 64182-
64197, 64183-64198, 64222-64237, 64226-64241, 64231-64246, 64243-64258, 64245-64260, 64246-64261, 64250-
64265, 64257-64272, 64258-64273, 64261-64276, 64262-64277, 64263-64278, 64264-64279, 64273-64288, 64275-
64290, 64276-64291, 64277-64292, 64278-64293, 64279-64294, 64280-64295, 64320-64335, 64393-64408, 64424-
64439, 64427-64442, 64429-64444, 64442-64457, 64443-64458, 64510-64525, 64514-64529, 64515-64530, 64539-
64554, 64540-64555, 64541-64556, 64542-64557, 64543-64558, 64544-64559, 64546-64561, 64553-64568, 64619-
64634, 64632-64647, 64634-64649, 64639-64654, 64640-64655, 64641-64656, 64642-64657, 64643-64658, 64644-
64659, 64645-64660, 64646-64661, 64647-64662, 64649-64664, 64651-64666, 64652-64667, 64662-64677, 64665-
64680, 64669-64684, 64684-64699, 64685-64700, 64694-64709, 64695-64710, 64696-64711, 64698-64713, 64699-
64714, 64703-64718, 64707-64722, 64708-64723, 64756-64771, 64759-64774, 64835-64850, 64865-64880, 64870-
64885, 64871-64886, 64885-64900, 64888-64903, 64918-64933, 64939-64954, 64943-64958, 64944-64959, 64946-
64961, 64950-64965, 64951-64966, 64971-64986, 64973-64988, 64974-64989, 64975-64990, 64977-64992, 64978- 64993, 64981-64996, 64991-65006, 64992-65007, 64994-65009, 65001-65016, 65025-65040, 65026-65041, 65028-
65043, 65029-65044, 65074-65089, 65075-65090, 65096-65111, 65097-65112, 65098-65113, 65111-65126, 65113-
65128, 65115-65130, 65150-65165, 65192-65207, 65194-65209, 65196-65211, 65576-65591, 65577-65592, 65578-
65593, 65579-65594, 65580-65595, 65581-65596, 65600-65615, 65608-65623, 65609-65624, 65611-65626, 65618-
65633, 65619-65634, 65620-65635, 65621-65636, 65623-65638, 65668-65683, 65676-65691, 65677-65692, 65678-
65693, 65679-65694, 65680-65695, 65681-65696, 65682-65697, 65683-65698, 65684-65699, 65685-65700, 65686-
65701, 65711-65726, 65753-65768, 65754-65769, 65755-65770, 65756-65771, 65759-65774, 65760-65775, 65816-
65831, 65818-65833, 65821-65836, 65826-65841, 65827-65842, 65828-65843, 65830-65845, 65831-65846, 65832-
65847, 65875-65890, 65876-65891, 65912-65927, 65913-65928, 65914-65929, 65915-65930, 65918-65933, 65925-
65940, 65950-65965, 65952-65967, 65960-65975, 65961-65976, 65962-65977, 65987-66002, 66091-66106, 66401-
66416, 66402-66417, 66403-66418, 66439-66454, 66441-66456, 66445-66460, 66446-66461, 66447-66462, 66448-
66463, 66449-66464, 66450-66465, 66454-66469, 66455-66470, 66475-66490, 66477-66492, 66478-66493, 66483-
66498, 66488-66503, 66489-66504, 66513-66528, 66514-66529, 66515-66530, 66524-66539, 66527-66542, 66564-
66579, 66641-66656, 66642-66657, 66643-66658, 66653-66668, 66656-66671, 66657-66672, 66660-66675, 66679-
66694, 66680-66695, 66772-66787, 66778-66793, 67189-67204, 67190-67205, 67191-67206, 67192-67207, 67193-
67208, 67194-67209, 67217-67232, 67222-67237, 67262-67277, 67278-67293, 67279-67294, 67280-67295, 67281-
67296, 67282-67297, 67284-67299, 67285-67300, 67288-67303, 67289-67304, 67290-67305, 67364-67379, 67367-
67382, 67377-67392, 67391-67406, 67392-67407, 67393-67408, 67394-67409, 67402-67417, 67404-67419, 67406-
67421, 67407-67422, 67408-67423, 67409-67424, 67411-67426, 67412-67427, 67413-67428, 67414-67429, 67417-
67432, 67418-67433, 67419-67434, 67420-67435, 67422-67437, 67429-67444, 67431-67446, 67432-67447, 67434-
67449, 67435-67450, 67436-67451, 67437-67452, 67438-67453, 67439-67454, 67440-67455, 67441-67456, 67443-
67458, 67445-67460, 67447-67462, 67449-67464, 67454-67469, 67457-67472, 67459-67474, 67463-67478, 67467-
67482, 67468-67483, 67479-67494, 67484-67499, 67485-67500, 67488-67503, 67489-67504, 67490-67505, 67491-
67506, 67493-67508, 67494-67509, 67495-67510, 67496-67511, 67497-67512, 67498-67513, 67499-67514, 67501-
67516, 67502-67517, 67503-67518, 67504-67519, 67505-67520, 67506-67521, 67507-67522, 67509-67524, 67510-
67525, 67511-67526, 67513-67528, 67515-67530, 67524-67539, 67525-67540, 67528-67543, 67550-67565, 67552-
67567, 67560-67575, 67608-67623, 67611-67626, 67633-67648, 67635-67650, 67637-67652, 67639-67654, 67653-
67668, 67661-67676, 67662-67677, 67680-67695, 67689-67704, 67714-67729, 67715-67730, 67727-67742, 67728-
67743, 67730-67745, 67751-67766, 67752-67767, 67762-67777, 67763-67778, 67764-67779, 67766-67781, 67801-
67816, 67809-67824, 67811-67826, 67815-67830, 67816-67831, 67823-67838, 67824-67839, 67825-67840, 67826-
67841, 67838-67853, 67852-67867, 67854-67869, 67859-67874, 67877-67892, 67883-67898, 67934-67949, 67967-
67982, 67969-67984, 67982-67997, 67997-68012, 67998-68013, 68003-68018, 68011-68026, 68015-68030, 68025-
68040, 68069-68084, 68073-68088, 68074-68089, 68096-68111, 68098-68113, 68102-68117, 68103-68118, 68104-
68119, 68126-68141, 68128-68143, 68129-68144, 68131-68146, 68134-68149, 68156-68171, 68167-68182, 68198-
68213, 68203-68218, 68204-68219, 68205-68220, 68208-68223, 68244-68259, 68276-68291, 68279-68294, 68299-
68314, 68300-68315, 68310-68325, 68312-68327, 68313-68328, 68317-68332, 68329-68344, 68331-68346, 68334-
68349, 68335-68350, 68355-68370, 68391-68406, 68392-68407, 68731-68746, 68732-68747, 68733-68748, 68744-
68759, 68745-68760, 68747-68762, 68748-68763, 68749-68764, 68752-68767, 68763-68778, 68765-68780, 68775-
68790, 68780-68795, 68795-68810, 68801-68816, 68834-68849, 68838-68853, 68856-68871, 68880-68895, 68885- 68900, 68887-68902, 68891-68906, 68908-68923, 68965-68980, 68976-68991, 68977-68992, 68978-68993, 69009-
69024, 69013-69028, 69023-69038, 69024-69039, 69025-69040, 69026-69041, 69027-69042, 69029-69044, 69031-
69046, 69061-69076, 69099-69114, 69102-69117, 69105-69120, 69115-69130, 69117-69132, 69118-69133, 69119-
69134, 69124-69139, 69125-69140, 69126-69141, 69127-69142, 69137-69152, 69149-69164, 69166-69181, 69186-
69201, 69187-69202, 69188-69203, 69193-69208, 69221-69236, 69242-69257, 69248-69263, 69309-69324, 69323-
69338, 69324-69339, 69352-69367, 69353-69368, 69355-69370, 69356-69371, 69357-69372, 69369-69384, 69370-
69385, 69371-69386, 69372-69387, 69374-69389, 69381-69396, 69383-69398, 69384-69399, 69385-69400, 69447-
69462, 69448-69463, 69479-69494, 69482-69497, 69496-69511, 69544-69559, 69604-69619, 69605-69620, 69614-
69629, 69629-69644, 69630-69645, 69631-69646, 69632-69647, 69633-69648, 69634-69649, or 69635-69650 of SEQ ID NO: 1.
4. The oligomeric compound of any of claims 1-3, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 39-54, 171-186, 206-221, 236-251, 240-255, 241-256, 242-257, 243-258, 244-259, 341-356, 342-357, 343-358, 361-376, 376-391, 499-514, 501- 516, 504-519, 572-587, 574-589, 576-591, 578-593, 579-594, 580-595, 581-596, 582-597, 583-598, 584-599, 586-601, 587-602, 588-603, 589-604, 602-617, 617-632, 623-638, 624-639, 626-641, 628-643, 630-645, 669-684, 670-685, 703- 718, 704-719, 705-720, 707-722, 709-724, 711-726, 713-728, 714-729, 715-730, 716-731, 717-732, 718-733, 719-734, 725-740, 727-742, 735-750, 737-752, 738-753, 739-754, 741-756, 756-771, 824-839, 829-844, 833-848, 855-870, 860- 875, 861-876, 862-877, 879-894, 880-895, 897-912, 908-923, 909-924, 923-938, 928-943, 943-958, 944-959, 945-960, 946-961, 947-962, 948-963, 969-984, 977-992, 978-993, 979-994, 981-996, 983-998, 985-1000, 987-1002, 988-1003, 989-1004, 990-1005, 991-1006, 993-1008, 1044-1059, 1089-1104, 1093-1108, 1094-1109, 1095-1110, 1097-1112, 1122- 1137, 1123-1138, 1124-1139, 1125-1140, 1126-1141, 1127-1142, 1128-1143, 1133-1148, 1134-1149, 1135-1150, 1137-
1152, 1138-1153, 1139-1154, 1141-1156, 1143-1158, 1144-1159, 1145-1160, 1146-1161, 1150-1165, 1151-1166, 1153-
1168, 1156-1171, 1157-1172, 1158-1173, 1163-1178, 1173-1188, 1176-1191, 1177-1192, 1178-1193, 1182-1197, 1191-
1206, 1194-1209, 1196-1211, 1198-1213, 1200-1215, 1201-1216, 1202-1217, 1203-1218, 1204-1219, 1213-1228, 1214-
1229, 1215-1230, 1216-1231, 1222-1237, 1223-1238, 1224-1239, 1233-1248, 1243-1258, 1263-1278, 1265-1280, 1266-
1281, 1271-1286, 1273-1288, 1275-1290, 1278-1293, 1312-1327, 1315-1330, 1324-1339, 1325-1340, 1326-1341, 1327-
1342, 1328-1343, 1380-1395, 1381-1396, 1383-1398, 1398-1413, 1400-1415, 1401-1416, 1521-1536, 1569-1584, 1602-
1617, 1606-1621, 1607-1622, 1608-1623, 1610-1625, 1612-1627, 1613-1628, 1616-1631, 1649-1664, 1650-1665, 1653-
1668, 1663-1678, 1665-1680, 1667-1682, 1669-1684, 1670-1685, 1671-1686, 1672-1687, 1673-1688, 1674-1689, 1675-
1690, 1677-1692, 1693-1708, 1694-1709, 1715-1730, 1764-1779, 1768-1783, 1791-1806, 1804-1819, 1869-1884, 1871-
1886, 1872-1887, 1908-1923, 1932-1947, 1996-2011, 2025-2040, 2026-2041, 2027-2042, 2028-2043, 2029-2044, 2030-
2045, 2069-2084, 2073-2088, 2085-2100, 2103-2118, 2106-2121, 2108-2123, 2121-2136, 2122-2137, 2250-2265, 2251-
2266, 2252-2267, 2262-2277, 2265-2280, 2266-2281, 2269-2284, 2288-2303, 2289-2304, 2368-2383, 2371-2386, 2381-
2396, 2395-2410, 2396-2411, 2397-2412, 2398-2413, 2406-2421, 2408-2423, 2410-2425, 2411-2426, 2412-2427, 2413-
2428, 2415-2430, 2416-2431, 2417-2432, 2418-2433, 2421-2436, 2422-2437, 2423-2438, 2424-2439, 2426-2441, 2433-
2448, 2435-2450, 2436-2451, 2438-2453, 2439-2454, 2440-2455, 2441-2456, 2442-2457, 2443-2458, 2444-2459, 2445-
2460, 2447-2462, 2449-2464, 2451-2466, 2453-2468, 2458-2473, 2461-2476, 2463-2478, 2467-2482, 2471-2486, 2472-
2487, 2483-2498, 2488-2503, 2489-2504, 2492-2507, 2493-2508, 2494-2509, 2495-2510, 2497-2512, 2498-2513, 2499-
2514, 2500-2515, 2501-2516, 2502-2517, 2503-2518, 2505-2520, 2506-2521, 2507-2522, 2508-2523, 2509-2524, 2510- 2525, 2511-2526, 2513-2528, 2514-2529, 2515-2530, 2517-2532, 2519-2534, 2528-2543, 2529-2544, 2532-2547, 2554-
2569, 2556-2571, 2564-2579, 2612-2627, 2615-2630, 2637-2652, 2639-2654, 2641-2656, 2643-2658, 2657-2672, 2665-
2680, 2666-2681, 2684-2699, 2693-2708, 2718-2733, 2719-2734, 2731-2746, 2732-2747, 2734-2749, 2755-2770, 2756-
2771, 2766-2781, 2767-2782, 2768-2783, 2770-2785, 2805-2820, 2813-2828, 2815-2830, 2819-2834, 2820-2835, 2827-
2842, 2828-2843, 2829-2844, 2830-2845, 2842-2857, 2856-2871, 2858-2873, 2863-2878, 2881-2896, 2887-2902, 2938-
2953, 2971-2986, 2973-2988, 2986-3001, 3001-3016, 3002-3017, 3007-3022, 3015-3030, 3019-3034, 3029-3044, 3073-
3088, 3077-3092, 3078-3093, 3100-3115, 3102-3117, 3106-3121, 3107-3122, 3108-3123, 3130-3145, 3132-3147, 3133-
3148, 3135-3150, 3138-3153, 3160-3175, 3171-3186, 3202-3217, 3207-3222, 3208-3223, 3209-3224, 3212-3227, 3248-
3263, 3280-3295, 3283-3298, 3303-3318, 3304-3319, 3314-3329, 3316-3331, 3317-3332, 3321-3336, 3333-3348, 3335-
3350, 3338-3353, 3339-3354, 3359-3374, 3395-3410, 3396-3411, 3735-3750, 3736-3751, 3737-3752, 3748-3763, 3749-
3764, 3751-3766, 3752-3767, 3753-3768, 3756-3771, 3767-3782, 3769-3784, 3779-3794, 3784-3799, 3799-3814, 3805-
3820, 3838-3853, 3842-3857, 3860-3875, 3884-3899, 3889-3904, 3891-3906, 3895-3910, 3912-3927, 3969-3984, 3980-
3995, 3981-3996, 3982-3997, 4013-4028, 4017-4032, 4027-4042, 4028-4043, 4029-4044, 4030-4045, 4031-4046, 4033-
4048, 4035-4050, 4065-4080, 4103-4118, 4106-4121, 4109-4124, 4119-4134, 4121-4136, 4122-4137, 4123-4138, 4128-
4143, 4129-4144, 4130-4145, 4131-4146, 4141-4156, 4153-4168, 4170-4185, 4190-4205, 4191-4206, 4192-4207, 4197-
4212, 4225-4240, 4246-4261, 4252-4267, 4313-4328, 4327-4342, 4328-4343, 4356-4371, 4357-4372, 4359-4374, 4360-
4375, 4361-4376, 4373-4388, 4374-4389, 4375-4390, 4376-4391, 4378-4393, 4385-4400, 4387-4402, 4388-4403, 4389-
4404, 4451-4466, 4452-4467, 4483-4498, 4486-4501, 4500-4515, 4548-4563, 4608-4623, 4609-4624, 4618-4633, 4633-
4648, 4634-4649, 4635-4650, 4636-4651, 4637-4652, 4638-4653, or 4639-4654 of SEQ ID NO: 2.
5. The oligomeric compound of any of claims 1-4, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 31654-31669, 34257-34272, 34258-34273, 34298-34313, 34331-34346, 37266-37281, 38988-39003, 46554-46569, 46573-46588, 63191-63206, 63344-63359, or 67414-67429 of SEQ ID NO: 1.
6. The oligomeric compound of any of claims 1-5, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the DNM1L nucleic acid.
7. The oligomeric compound of claim 6, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of any of the nucleobase sequences of any of SEQ ID NOs: 12-2620.
8. The oligomeric compound of claim 7, wherein the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 12-2620.
9. The oligomeric compound of claim 8, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any of SEQ ID NOs: 12-2620.
10. The oligomeric compound of any of claims 7-9, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2608, 2609, 2610, 2611, 2612, 2613, 2614, 2615, 2617, 2618, 2619, or 2620.
11. The oligomeric compound of claim 10, wherein the nucleobase sequence of the modified oligonucleotide consists of 15 to 80 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 2608, 2609, 2610, 2611, 2612, 2613, 2614, 2615, 2617, 2618, 2619, or 2620.
12. The oligomeric compound of claim 11, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 2608, 2609, 2610, 2611, 2612, 2613, 2614, 2615, 2617, 2618, 2619, or 2620.
13. The oligomeric compound of any of claims 7-11, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of a DNM1L nucleic acid, wherein the DNM1L nucleic acid has the nucleobase sequence of SEQ ID NOs: 1 or 2.
14. The oligomeric compound of any of claims 1-13, wherein the modified oligonucleotide consists of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18,16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.
15. The oligomeric compound of any of claims 1-14, wherein the modified oligonucleotide comprises at least two modified nucleosides comprising a modified sugar moiety.
16. The oligomeric compound of any of claims 1-15, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.
17. The oligomeric compound of claim 16, wherein the bicyclic sugar moiety comprises a 2’-4’ bridge selected from -O-CH2-; and -O-CH(CH3)-.
18. The oligomeric compound of any of claims 1-15, wherein the modified sugar moiety comprises a non- bicyclic modified sugar moiety.
19. The oligomeric compound of claim 18, wherein the non-bicyclic modified sugar moiety is a 2’-M0E sugar moiety or 2’-OMe sugar moiety.
20. The oligomeric compound of any of claims 1-19, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.
21. The oligomeric compound of any of claims 1-20, wherein the modified oligonucleotide comprises at least one modified intemucleoside linkage.
22. The oligomeric compound of claim 21, wherein at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
23. The oligomeric compound of claim 21 or 22, wherein each intemucleoside linkage is a modified intemucleoside linkage.
24. The oligomeric compound of claim 23, wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage.
25. The oligomeric compound of any of claims 21-23, wherein at least one intemucleoside linkage of the modified oligonucleotide is a phosphodiester intemucleoside linkage.
26. The oligomeric compound of any of claims 1-21, wherein each intemucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester or a phosphorothioate intemucleoside linkage.
27. The oligomeric compound of any of claims 1-26, wherein at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 intemucleoside linkages of the modified oligonucleotide are phosphorothioate intemucleoside linkages.
28. The oligomeric compound of any of claims 1-27, wherein the modified oligonucleotide comprises at least one modified nucleobase.
29. The oligomeric compound of claim 28, wherein the modified nucleobase is 5-methylcytosine.
30. The oligomeric compound of claim 29, wherein each cytosine is a 5-methylcytosine.
31. The oligomeric compound of any of claims 1-30, wherein the modified oligonucleotide comprises a deoxy region consisting of 5-12 contiguous 2’-deoxynucleosides.
32. The oligomeric compound of claim 31, wherein each 2’-deoxynucleoside of the deoxy region is a 2’- - D -deoxy nucleoside .
33. The oligomeric compound of claim 31 or 32, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6- 10 linked nucleosides.
34. The oligomeric compound of any of claims 31-33, wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety.
35. The oligomeric compound of any of claims 31-34, wherein the deoxy region is flanked on the 5’-side by a 5 ’ -region consisting of 1 -6 linked 5 ’ -region nucleosides and on the 3 ’ -side by a 3 ’ -region consisting of 1 -6 linked 3 ’ - region nucleosides; wherein. the 3’-most nucleoside of the 5’ region comprises a modified sugar moiety; and the 5 ’-most nucleoside of the 3’ region comprises a modified sugar moiety.
36. The oligomeric compound of claim 35, wherein each nucleoside of the 3’ region comprises a modified sugar moiety.
37. The oligomeric compound of claim 35 or 36, wherein each nucleoside of the 5’ region comprises a modified sugar moiety.
38. The oligomeric compound of any of claims 31-37, wherein the modified oligonucleotide has: a 5’ region consisting of 3 linked nucleosides; a deoxy region consisting of 10 linked nucleosides; and a 3 ’ region consisting of 3 linked nucleosides; wherein each of the 5 ’-region nucleosides and each of the 3 ’-region nucleosides is a cEt nucleoside.
39. The oligomeric compound of any of claims 31-37, wherein the modified oligonucleotide has: a 5’ region consisting of 1-6 linked nucleosides; a deoxy region consisting of 6-10 linked nucleosides; and a 3’ region consisting of 1-6 linked nucleosides; wherein each of the 5 ’ region nucleosides and each of the 3 ’ region nucleosides is a cEt nucleoside or a 2 ’ -MOE nucleoside; and each of the deoxy region nucleosides is a 2’-p-D-deoxynucleoside.
40. The oligomeric compound of any of claims 31-37, wherein the modified oligonucleotide has: a 5’ region consisting of 5 linked nucleosides; a deoxy region consisting of 8 linked nucleosides; and a 3 ’ region consisting of 3 linked nucleosides; wherein three of the 5’ region nucleosides is a cEt nucleoside and one is a 2’-OMe nucleoside; each of the 3’ region nucleosides is a cEt nucleoside; and each of the deoxy region nucleosides is a 2’-p-D-deoxynucleoside.
41. The oligomeric compound of any of claims 31-37, wherein the modified oligonucleotide has a sugar motif comprising: a 5’ region consisting of 3-6 linked nucleosides; a deoxy region consisting of 7-8 linked nucleosides; and a 3’ region consisting of 3-6 linked nucleosides; wherein each of the 3’ region nucleosides is selected from a 2 ’-MOE nucleoside and a cEt nucleoside, and the 5’ region has the following formula:
(Nk)n(Nd)(Nx) wherein each Nk is a bicyclic nucleoside, Nx is a 2’-OMe nucleoside and Nd is a 2’-0-D- deoxynucleoside; and n is from 1-4.
42. An oligomeric compound of any of claims 1-30, wherein the modified oligonucleotide has a sugar motif (5’ to 3’) selected from: kkkddddddddddkkk, kkkdddddddddkkke, and kkkdyddddddddkkk, wherein ‘d’ represents a 2’-deoxyribosyl sugar moiety, ‘e’ represents a 2’-MOE sugar moiety, ‘k’ represents a cEt sugar moiety, and ‘y’ represents a 2’-OMe sugar moiety.
43. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: mCksGksTksAdsGdsAdsTdsAdsAds mCdsAdsAdsGdsTksTksGk (SEQ ID NO: 2610), wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase,
G = a guanine nucleobase,
T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
44. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: mCksAksGksTdsAdsTdsTdsAds mCdsAdsTdsAdsGdsTksTks mCk (SEQ ID NO: 2611), wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase,
G = a guanine nucleobase,
T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
45. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: TksTksGksAdsAdsTdsAdsTds mCdsAdsAdsGdsTdsGksGks mCk (SEQ ID NO: 2612), wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase,
G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
46. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: TkSTkSGksAdSAdSTdSAdSTdS mCdsAdSAdSGdsTkSGksGksmCe (SEQ ID NO: 2615), wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, e = a 2’-OCH2CH2OCH3 ribosyl sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
47. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: AkSAkSAkSTdSTdSTdSAdSTdSGdsAdSGdsGdsTkSTkS mCksmCe (SEQ ID NO: 2617), wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, e = a 2’-OCH2CH2OCH3 ribosyl sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
48. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: AksAksAksTdsGdsGdsTdsAdsGdsTdsTdsTdsGksAksGksGe (SEQ ID NO: 2618), wherein
A = an adenine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, e = a 2’-OCH2CH2OCH3 ribosyl sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
49. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: GksAkSTkSTdSAdS mCdsTdSGdsAdSTdSGdsAdSAdS mCksmCkSGk (SEQ ID NO: 2608), wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
50. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: AkSTkSGksTdSAdSTdSTdSAdSGdsTdS mCdsTdSTdSGkSAkS mCk (SEQ ID NO: 2609), wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
51. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: TksGksGksTdsAdsAdsTdsAdsAdsGdsTdsTdsGdsGksAksGk (SEQ ID NO: 2613), wherein
A = an adenine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
52. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: mCksAkSAkSTdSAdSTdSTdS mCdsTdSGdsTdSGdsGdsmCkSAkSAk (SEQ ID NO: 2614), wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
53. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: TkSTkSTkSGdsAdSAdSTdSAdSTdS mCdsAdSAdSGksTkSGksGe (SEQ ID NO: 2616), wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, k = a cEt sugar moiety, e = a 2’-OCH2CH2OCH3 ribosyl sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
54. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: mCksmCksAkSTdSTdSAdS mCdsGdsAdSAdS mCdsTdSTdSTkSTksmCk (SEQ ID NO: 2619), wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase,
G = a guanine nucleobase,
T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
55. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: GksTkSTkSTdSTdSTdSTdSAdS mCdsGdsAdSAdSGdsGkSTkS mCk (SEQ ID NO: 2620), wherein
A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase,
G = a guanine nucleobase,
T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, and s = a phosphorothioate intemucleoside linkage.
56. The oligomeric compound of any of claims 1-55, wherein the oligomeric compound comprises a conjugate group.
57. The oligomeric compound of claim 56, wherein the conjugate group comprises a cell-targeting moiety.
58. The oligomeric compound of any of claims 1 to 57, wherein the oligomeric compound comprises a terminal group.
59. The oligomeric compound of claim 58, wherein the terminal group is an abasic sugar moiety.
(SEQ ID NO: 2610), or a salt thereof.
61. The modified oligonucleotide of claim 60, which is the sodium salt or the potassium salt.
62. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2610).
(SEQ ID NO: 2611), or a salt thereof.
64. The modified oligonucleotide of claim 63, which is the sodium salt or the potassium salt.
65. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2611).
(SEQ ID NO: 2612), or a salt thereof.
67. The modified oligonucleotide of claim 66, which is the sodium salt or the potassium salt.
68. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2615), or a salt thereof.
70. The modified oligonucleotide of claim 69, which is the sodium salt or the potassium salt.
71. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2615).
(SEQ ID NO: 2617), or a salt thereof.
73. The modified oligonucleotide of claim 72, which is the sodium salt or the potassium salt.
74. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2617).
(SEQ ID NO: 2618), or a salt thereof.
76. The modified oligonucleotide of claim 75, which is the sodium salt or the potassium salt.
77. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2618).
(SEQ ID NO: 2608), or a salt thereof.
79. The modified oligonucleotide of claim 78, which is the sodium salt or the potassium salt.
(SEQ ID NO: 2608).
81. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2609), or a salt thereof.
82. The modified oligonucleotide of claim 81, which is the sodium salt or the potassium salt.
(SEQ ID NO: 2613), or a salt thereof.
85. The modified oligonucleotide of claim 84, which is the sodium salt or the potassium salt.
86. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2613).
(SEQ ID NO: 2614), or a salt thereof.
88. The modified oligonucleotide of claim 87, which is the sodium salt or the potassium salt.
89. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2614).
(SEQ ID NO: 2616), or a salt thereof.
91. The modified oligonucleotide of claim 90, which is the sodium salt or the potassium salt.
(SEQ ID NO: 2619), or a salt thereof.
94. The modified oligonucleotide of claim 93, which is the sodium salt or the potassium salt.

(SEQ ID NO: 2620), or a salt thereof.
97. The modified oligonucleotide of claim 96, which is the sodium salt or the potassium salt.
98. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 2620).
99. A chirally enriched population of oligomeric compounds of any of claims 1-59 or modified oligonucleotides of any of claim 60-98, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having a particular stereochemical configuration.
100. The chirally enriched population of claim 99, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having the (Sp) or (Rp) configuration.
101. The chirally enriched population of claim 100, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate intemucleoside linkage.
102. The chirally enriched population of claim 100, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate intemucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate intemucleoside linkages.
103. The chirally enriched population of claim 100, wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate intemucleoside linkages in the Sp, Sp, and Rp configurations, in the 5’ to 3’ direction.
104. A population of oligomeric compounds of any of claims 1-59 or modified oligonucleotides of any of claims 60-98, wherein all phosphorothioate intemucleoside linkages are stereorandom.
105. An oligomeric duplex, comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound of any of claims 1-59 or a modified oligonucleotide of any of claims 60-98.
106. An antisense agent comprising an antisense compound, wherein the antisense compound is the oligomeric compound of any of claims 1-59 or the modified oligonucleotide of any of claims 60-98.
107. The antisense agent of claim 106, wherein the antisense agent is the oligomeric duplex of claim 88.
108. The antisense agent of claim 106 or 107, wherein the antisense agent is: iii. an RNase H agent capable of reducing the amount of DNM1L nucleic acid through the activation of RNase H; or iv. an RNAi agent capable of reducing the amount of DNM1L nucleic acid through the activation of RISC/Ago2.
109. The antisense agent of any of claims 106-108, wherein the conjugate group is a cell-targeting moiety.
110. A pharmaceutical composition comprising the oligomeric compound of any of claims 1-59, the modified oligonucleotide of any of claims 60-98, the population of any of claims 99-104, the oligomeric duplex of claim 105, or the antisense agent of any of claims 106-109, and a pharmaceutically acceptable diluent or carrier.
111. The pharmaceutical composition of claim 110, wherein the pharmaceutically acceptable diluent is water or saline.
112. The pharmaceutical composition of claim 110, wherein the pharmaceutical composition consists essentially of the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, or the antisense agent, and water or saline.
113. A method comprising administering to a subject the oligomeric compound of any of claims 1-59, the modified oligonucleotide of any of claims 60-98, the population of any of claims 99-104, the oligomeric duplex of claim 105, the antisense agent of any of claims 106-109, or the pharmaceutical composition of any of claims 110-
112.
114. A method of treating a disease associated with DNM1L comprising administering to a subject having a disease associated with DNM1L a therapeutically effective amount of the oligomeric compound of any of claims 1- 59, the modified oligonucleotide of any of claims 60-98, the population of any of claims 99-104, the oligomeric duplex of claim 105, the antisense agent of any of claims 106-109, or the pharmaceutical composition of any of claims 110-112 and thereby treating the subject.
115. The method of claim 114, wherein the disease associated with DNM1L is acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
116. The method of claim 114 or 115, wherein administering the oligomeric compound of any of claims 1- 59, the modified oligonucleotide of any of claims 60-98, the population of any of claims 99-104, the oligomeric duplex of claim 105, the antisense agent of any of claims 106-109, or the pharmaceutical composition of any of claims 110-112 reduces a marker of kidney health or kidney function selected from ALT/AST, creatinine, BUN, cystatin-c, proteinuria, and eGFR, DRP1, KIM-1, FABP1, NGAL, hematoxylin and eosin (H&E) staining, cytochrome-c, TIMP- 2, IGFBP-7, RIFLE, and/or AKI-KDIGO in the subject.
117. A method of reducing expression of DNM1L in a cell comprising contacting the cell with the oligomeric compound of any of claims 1-59, the modified oligonucleotide of any of claims 60-98, the population of any of claims 99-104, the oligomeric duplex of claim 105, the antisense agent of any of claims 106-109, or the pharmaceutical composition of any of claims 110-112.
118. The method of claim 117, wherein the cell is a kidney cell.
119. Use of the oligomeric compound of any of claims 1-59, the modified oligonucleotide of any of claims 60-98, the population of any of claims 99-104, the oligomeric duplex of claim 105, the antisense agent of any of claims 106-109, or the pharmaceutical composition of any of claims 110-112 for treating a disease associated with DNM1L.
120. Use of the oligomeric compound of any of claims 1-59, the modified oligonucleotide of any of claims 60-98, the population of any of claims 99-104, the oligomeric duplex of claim 105, the antisense agent of any of claims 106-109, or the pharmaceutical composition of any of claims 110-112 in the manufacture of a medicament for treating a disease associated with DNM1L.
121. The use of claim 119 or 120, wherein the disease associated with DNM1L is acute kidney injury (AKI), acute kidney disease (AKD), or chronic kidney injury (CKD).
EP22870970.5A 2021-09-17 2022-09-16 Compounds and methods for reducing dnm1l or drp1 expression Withdrawn EP4402260A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163245636P 2021-09-17 2021-09-17
PCT/US2022/076535 WO2023044412A1 (en) 2021-09-17 2022-09-16 Compounds and methods for reducing dnm1l or drp1 expression

Publications (1)

Publication Number Publication Date
EP4402260A1 true EP4402260A1 (en) 2024-07-24

Family

ID=85603615

Family Applications (1)

Application Number Title Priority Date Filing Date
EP22870970.5A Withdrawn EP4402260A1 (en) 2021-09-17 2022-09-16 Compounds and methods for reducing dnm1l or drp1 expression

Country Status (2)

Country Link
EP (1) EP4402260A1 (en)
WO (1) WO2023044412A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024231559A1 (en) * 2023-05-11 2024-11-14 Astrazeneca Ab Methods of treatment of chronic kidney disease

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011120101A1 (en) * 2010-04-01 2011-10-06 The University Of Queensland Small rna molecules and methods of use
CA2954791C (en) * 2014-07-14 2025-11-18 The Regents Of The University Of California Crispr/cas transcriptional modulation
WO2019157531A1 (en) * 2018-02-12 2019-08-15 Ionis Pharmaceuticals, Inc. Modified compounds and uses thereof

Also Published As

Publication number Publication date
WO2023044412A1 (en) 2023-03-23

Similar Documents

Publication Publication Date Title
JP7289347B2 (en) Modulators of PCSK9 expression
JP7645301B2 (en) Modulators of APOL1 Expression
JP2025121956A (en) Compounds and methods for reducing LRRK2 expression
JP7110485B2 (en) Modulators of PNPLA3 expression
JP2024540537A (en) Compounds and methods for modulating progranulin expression
EP4355338A1 (en) Compounds and methods for reducing ifnar1 expression
AU2022219976A1 (en) Compounds and methods for reducing pln expression
JP7820374B2 (en) Compounds and methods for modulating angiotensinogen expression
EP4402260A1 (en) Compounds and methods for reducing dnm1l or drp1 expression
WO2022178146A1 (en) Compounds and methods for reducing nlrp3 expression
WO2022066956A1 (en) Compounds and methods for reducing apoe expression
EP4262822A2 (en) Compounds and methods for modulating factor xii
EP4054655A1 (en) Compounds and methods for reducing spdef expression
JP2023544162A (en) Compounds for modulating CHMP7
WO2025064815A1 (en) Compounds and methods for inhibiting lpa
AU2022377400A1 (en) Compounds and methods for reducing psd3 expression
WO2021102341A2 (en) Compounds for modulating beta globin expression

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20240416

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

P01 Opt-out of the competence of the unified patent court (upc) registered

Free format text: CASE NUMBER: APP_55092/2024

Effective date: 20241007

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20250106