EP4395899A1 - Mixed lineage kinase inhibitors and methods of use - Google Patents

Mixed lineage kinase inhibitors and methods of use

Info

Publication number
EP4395899A1
EP4395899A1 EP22777538.4A EP22777538A EP4395899A1 EP 4395899 A1 EP4395899 A1 EP 4395899A1 EP 22777538 A EP22777538 A EP 22777538A EP 4395899 A1 EP4395899 A1 EP 4395899A1
Authority
EP
European Patent Office
Prior art keywords
compound
lzk
cell
mlk
cancer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP22777538.4A
Other languages
German (de)
French (fr)
Inventor
John F. BROGNARD
Rolf E. Swenson
Amy L. FUNK
Carolyn W. HITKO
Katherine M. NYSWANER
Knickole L. BERGMAN
Venkatareddy SABBASANI
Eric Lindberg
Steven D. CAPPELL
Meghri KATERJI
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
US Department of Health and Human Services
Original Assignee
US Department of Health and Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by US Department of Health and Human Services filed Critical US Department of Health and Human Services
Publication of EP4395899A1 publication Critical patent/EP4395899A1/en
Pending legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445Non condensed piperidines, e.g. piperocaine
    • A61K31/4523Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/4545Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring hetero atom, e.g. pipamperone, anabasine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/498Pyrazines or piperazines ortho- and peri-condensed with carbocyclic ring systems, e.g. quinoxaline, phenazine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/04Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/12Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/14Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D403/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
    • C07D403/04Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D405/00Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/14Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing three or more hetero rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D471/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04Ortho-condensed systems
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D471/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/08Bridged systems
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D487/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/04Ortho-condensed systems
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D487/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/08Bridged systems

Definitions

  • Y 3 is C(R 3 ) or N.
  • Y 4 is N or C(R 6 ).
  • Y 5 is C(R 7 ) or N.
  • Y 6 is C(R 8 ) or N.
  • One or two of Y ⁇ Y 6 are N, and at least one of Y 1 - Y 3 or Y 6 is other than C(H).
  • Two, three, or four of Y 7 -Y 10 independently are N or N(R 9 ), and the others of Y 7 -Y 10 are C(R 10 ).
  • R 1 is cyano, perhaloalkyl, H, alkyl, or perhaloalkoxy.
  • the cell is a head and neck squamous cell carcinoma (HNSCC) cell, a lung squamous cell carcinoma (LSCC) cell, a hepatocellular carcinoma cell, an ovarian cancer cell, a small cell lung cancer cell, a neuroendocrine prostate cancer cell, an esophageal cancer cell, or a breast cancer cell.
  • HNSCC head and neck squamous cell carcinoma
  • LSCC lung squamous cell carcinoma
  • hepatocellular carcinoma cell an ovarian cancer cell
  • small cell lung cancer cell a neuroendocrine prostate cancer cell
  • an esophageal cancer cell an esophageal cancer cell
  • breast cancer cell breast cancer cell.
  • FIG. 2C is a graphical representation of the data.
  • FIG. 4 shows that GNE-3511 250 nM, inhibited LZK activity toward JNK within 15 minutes.
  • FIG. 8 is a graph showing that GNE-3511 treatment significantly reduced cell viability in CAL33 and BICR56 cells for 72 hours.
  • FIG. 11 shows that GNE-3511 suppressed HNSCC viability in a 72-hour MTS assay in CAL33 and BICR56 cell lines that harbor amplified MAP3K13 and viability was rescued by expression of LZK Q240S .
  • FIG. 12A is a graph of mean tumor volume ⁇ SEM;
  • FIG. 12B is a bar graph showing average tumor volume at the end of treatment, mean tumor volume ⁇ SEM, Student’s /-test, *p ⁇ 0.05;
  • FIG. 12C is tumor images at the end of the study.
  • FIG. 19 shows a boxplot of MAP3K13 gene expression in fifty-eight PDX models with different MAP 3 KI 3 copy numbers.
  • FIG. 28 shows that LZK inhibitor 2 maintained JNK pathway inactivation for 72 hours at 250 nM.
  • FIG. 34 is a Western blot showing that LZK Q240S drug-resistant mutant expression during treatment with LZK inhibitor 2 (250 nM) rescued JNK signaling.
  • FIG. 45 is images of a colony formation assay confirming that ESCC cells with the 3q amplicon are sensitive to GNE-3511.
  • FIG. 46 is images of a colony formation assay showing that ESCC cells with a drug resistant mutant form of LZK are resistant to GNE-3511.
  • SEQ ID NO: 1 is an exemplary nucleotide sequence for an LZK Q240S forward primer.
  • SEQ ID NO: 2 is an exemplary nucleotide sequence for an LZK Q240S verse primer.
  • SEQ ID NO: 3 is an exemplary nucleotide sequence for an LZK K195M forward primer.
  • SEQ ID NO: 5 is an exemplary nucleotide sequence for a Xbal to start of LZK forward primer.
  • SEQ ID NO: 6 is an exemplary nucleotide sequence for a Notl to end of LZK reverse primer.
  • SEQ ID NO: 7 is an exemplary nucleotide sequence for a T7 promoter primer.
  • SEQ ID NO: 8 is an exemplary nucleotide sequence for a BGH reverse primer.
  • SEQ ID NO: 9 is an exemplary nucleotide sequence for a Xbal to LZK kinase domain forward primer.
  • SEQ ID NO: 11 is an exemplary nucleotide sequence for a Notl to LZK end zipper domain reverse primer.
  • SEQ ID NO: 13 is an exemplary nucleotide sequence for a MAP3K13 forward primer
  • SEQ ID NO: 14 is an exemplary nucleotide sequence for a MAP3K13 reverse primer
  • SEQ ID NO: 15 is an exemplary nucleotide sequence for an ACTB forward primer
  • SEQ ID NO: 16 is an exemplary nucleotide sequence for an ACTB reverse primer
  • SEQ ID NO: 17 is an exemplary nucleotide sequence for a GAPDH forward primer
  • SEQ ID NO: 18 is an exemplary nucleotide sequence for a GAPDH reverse primer
  • SEQ ID NO: 19 is an exemplary DNA sequence encoding an shRNA.
  • SEQ ID NO: 20 is an exemplary DNA sequence encoding an shRNA.
  • MLKs are implicated in head and neck squamous cell carcinoma (HNSCC), lung squamous cell carcinoma (LSCC), hepatocellular carcinoma, ovarian cancer, small cell lung cancer, neuroendocrine prostate cancer, esophageal cancer, and breast cancer.
  • HNSCC head and neck squamous cell carcinoma
  • LSCC lung squamous cell carcinoma
  • HNSCC head and neck squamous cell carcinoma
  • LSCC lung squamous cell carcinoma
  • LZK Leucine zipper-bearing kinase
  • MAPK3K13 Leucine zipper-bearing kinase
  • DLK MAPK3K12
  • LZK can directly phosphorylate the MAP2Ks (MAP kinase kinases) MKK7 and MKK4, leading to JNK (c-Jun N-terminal kinase) pathway activation (Ikeda et al., J Biochem 2001, 130:773-781).
  • Amplified endogenous LZK does not activate the JNK pathway in HNSCC (Edwards et al., Cancer Res 2017, 77:4961-4972; Ikeda et al.).
  • overexpressed LZK leads to JNK pathway activation, which can be used as a readout to assess catalytic inhibitors of LZK (Edwards et al.).
  • MLK4 is a serine- threonine kinase that phosphorylates JNK, p38 MAPK, and extracellular signal-regulated kinase (ERK) signaling pathways (Marusiak et al., Oncogene 2019, 38:2860-2875). MLK4 can directly phorphorylate MEK, leading to activation of the ERK pathway (Id). MLK4 also regulates activation of transcription factor NF-KB (Id). MLK4 is overexpressed in 23% of invasive breast cancers, particularly triple-negative breast cancer (TNBC) (Id). MLK4 also promotes TNBC chemoresistance by regulating the pro-survival response to DNA-damaging therapies (Mehlich et al. , Cell Death and Disease 2021, 12:1111).
  • TNBC triple-negative breast cancer
  • MLK3 is another serine-threonine kinase, which is implicated in the NF-KB, ERK, JNK, and p38 MAP kinase pathways (Brancho et al., Mol Cell Biol 2005, 3670-3681). MLK3 signaling is implicated in several cancers, such as head and neck cancers harboring the llq amplicon.
  • exemplary routes of administration include, but are not limited to, oral, injection (such as subcutaneous, intramuscular, intradermal, intraperitoneal, intravenous, intraosseous, intracerebroventricular, intrathecal, and intratumoral), sublingual, rectal, transdermal, intranasal, vaginal and inhalation routes.
  • Aliphatic A substantially hydrocarbon-based compound, or a radical thereof (e.g., C6Hn, for a hexane radical), including alkanes, alkenes, alkynes, including cyclic (monocyclic, bicyclic, and polycyclic) versions thereof, and further including straight- and branched-chain arrangements, and all stereo and position isomers as well.
  • an aliphatic group contains from one to twenty-five carbon atoms; for example, from one to fifteen, from one to ten, from one to six, or from one to four carbon atoms.
  • An aliphatic chain may be substituted or unsubstituted.
  • Alkyl A hydrocarbon radical or substituent having a saturated carbon chain.
  • the chain may be cyclic, branched or unbranched.
  • an alkyl group can either be unsubstituted or substituted. Examples, without limitation, of alkyl groups include methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl and decyl.
  • the term lower alkyl means the chain includes 1-10 carbon atoms.
  • alkenyl and alkynyl refer to hydrocarbon groups having carbon chains containing one or more double or triple bonds, respectively.
  • Alkylaryl An alkyl-substituted aryl group.
  • Amino A chemical functional group -N(R)R' where R and R' are independently hydrogen, alkyl, heteroalkyl, haloalkyl, aliphatic, heteroaliphatic, aryl (such as optionally substituted phenyl or benzyl), heteroaryl, alkylsulfano, or other functionality.
  • a “primary amino” group is -NH2.
  • “Mono-substituted amino” or “secondary amino” means a radical -N(H)R substituted as above and includes, e.g., methylamino, (l-methylethyl)amino, phenylamino, and the like.
  • Di-substituted amino or “tertiary amino” means a radical -N(R)R' substituted as above and includes, e.g., dimethylamino, methylethylamino, di(l-methylethyl)amino, and the like.
  • Excipient A physiologically inert substance that is used as an additive in a pharmaceutical composition.
  • an excipient may be incorporated within particles of a pharmaceutical composition, or it may be physically mixed with particles of a pharmaceutical composition.
  • An excipient can be used, for example, to dilute an active agent and/or to modify properties of a pharmaceutical composition.
  • excipients include but are not limited to polyvinylpyrrolidone (PVP), tocopheryl polyethylene glycol 1000 succinate (also known as vitamin E TPGS, or TPGS), dipalmitoyl phosphatidyl choline (DPPC), trehalose, sodium bicarbonate, glycine, sodium citrate, and lactose.
  • PVP polyvinylpyrrolidone
  • DPPC dipalmitoyl phosphatidyl choline
  • trehalose sodium bicarbonate
  • glycine sodium citrate
  • lactose lactose
  • Heteroaliphatic An aliphatic compound or group having at least one carbon atom in the chain and at least one heteroatom, i.e., one or more carbon atoms has been replaced with a non-carbon atom, typically nitrogen, oxygen, phosphorus, silicon, or sulfur.
  • Heteroaliphatic compounds or groups may be substituted or unsubstituted, branched or unbranched, cyclic or acyclic, and include "heterocycle", “heterocyclyl”, “heterocycloaliphatic", or "heterocyclic” groups.
  • Heterocyclic refers to a closed-ring compound, or radical thereof as a substituent bonded to another group, particularly other organic groups, where at least one atom in the ring structure is other than carbon, and typically is oxygen, sulfur and/or nitrogen. Unless expressly referred to as “unsubstituted heterocyclic,” a heterocyclic group can either be unsubstituted or substituted.
  • IAP Inhibitor of apoptosis protein. Includes cIAP - cellular IAP 1, and xIAP - X-linked IAP.
  • LSCC Lung squamous cell carcinoma.
  • Pharmaceutically acceptable base addition salts include those derived from inorganic bases such as sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like.
  • Exemplary salts are the ammonium, potassium, sodium, calcium, and magnesium salts.
  • substituents include, for instance, alkyl, alkenyl, alkynyl, alkoxy, alkylamino, alkylthio, acyl, aldehyde, amido, amino, aminoalkyl, aryl, arylalkyl, arylamino, carbonate, carboxyl, cyano, cycloalkyl, dialkylamino, halo, haloaliphatic (e.g., haloalkyl), haloalkoxy, heteroaliphatic, heteroaryl, heterocycloaliphatic, hydroxyl, oxo, sulfonamide, sulfhydryl, thio, and thioalkoxy groups. Substituents can be further substituted, unless expressly stated otherwise or context dictates otherwise.
  • a long-chain hydrocarbon may have a hydroxyl group bonded thereto.
  • Tautomers Constitutional isomers of organic compounds that differ only in the position of the protons and electrons, and are interconvertible by migration of a hydrogen atom. Tautomers ordinarily exist together in equilibrium.
  • Therapeutically effective amount or dose An amount sufficient to provide a beneficial, or therapeutic, effect to a subject or a given percentage of subjects.
  • ZAK Zipper sterile-a motif kinase
  • R 3 is H, amino, alkylamino, aminoalkyl, alkoxy, or -N(H)C(O)R' where R' is alkyl, or R 2 and R 3 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring.
  • R 4 is aliphatic, azaalkyl, aryl, or amino.
  • R 5 is aliphatic, heteroaliphatic, or alkylamino.
  • R 6 and R 7 independently are H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano.
  • R 1 is cyano, perhaloalkyl, H, alkyl, or perhaloalkoxy.
  • exemplary R 1 groups include, but are not limited to, cyano, -H, -OCF3, or -CF3.
  • R 1 is cyano, -H, or -OCF3.
  • At least a portion of the alkyl portion of R 2 is cycloalkyl, such as cyclopropyl or bicyclo [l.l.l]pentyl.
  • the alkyl or alkoxy portion may be halogenated.
  • R 2 is fluorinated.
  • Exemplary R 2 groups include, but are not limited to -CH3, -OCH3, -OCF3, -CF3,-CN, -H, -OCHF2,
  • R 3 is H, amino, alkylamino, aminoalkyl, alkoxy, or -N(H)C(O)R' where R' is alkyl, or R 2 and
  • the compound has formula IC, R 1 is cyano or perhaloalkyl, and R 2 and R 3 are H. R 1 may be cyano or trifluoromethyl. In certain aspects, R 1 is cyano. In certain implementations, the compound has formula IC, R 1 is H, and R 1 and R 2 together with the atoms to which they are bound form a 5- or 6-membered aryl or heteroaryl ring.
  • the compound has formula ID, R 3 is H and R 2 is other than H. In some aspects, the compound has formula ID, and R 2 and R 3 are other than H. In some aspects, the compound has formula ID, R 2 is H, and R 3 is other than H. In certain implementations, the compound has formula ID, and R 2 and R 3 together with the atoms to which they are bound form a 5- or 6-membered aryl or heteroaryl ring.
  • R 5 is ” ⁇ NHZ where Z is -C(O)CH3. In another implementation, R 5 is where Z is -C(O)CH3. In some implementations, R 5 is , -(CH 2 )3N(CH 3 )2, or
  • R 4 is isopropyl, -C(H)(OH)-C(CH3)2, cyclopropyl, or
  • Exemplary cycloaliphatic and heterocycloaliphatic R 4 groups include, but are not limited to fused and spiro is N(H), or (ii) R 3 is H, aminoalkyl, alkoxy, ; or R'C(O)N(H)- where R' is alkyl, or (iii) R 2 is alkoxy, cyanoalkyl, amino, or heteroarylalkoxy, or (iv) one of R 1 and R 7 is other than -H, or (v) only one of X'-X 4 comprises N, or (vi) X 3 is C(H), or (vii) X 4 is S, or (vi) -X ⁇ R 5 )- is -C(R 5 )-C(H)-, -C(H)-C(R 5 )-, -C(R 5 )-N-, or -N-C(R 5 )-, or (viii) R 1 and R 2 together with the atoms to which they are
  • X 5 is N(H) an or (ii) Y 4 is not N, or (iii) R 2 is not -H, -CN, or -CF3, or (iv) R 1 is not -H, -CN, or -CF3.
  • R 4 is not cycloalkyl or heterocycloalkyl
  • Y 4 is not N
  • R 1 is not -CN, or (iv) one of R 2 , R 3 , and R 8 is other than
  • Ring A is and X 5 is N(H)
  • R 5 is not
  • Exemplary MLK inhibitors include the compounds shown in Tables 1-17, as well as other stereoisomers, tautomers, and pharmaceutically acceptable salts thereof. Table 1
  • the MLK inhibitor may exhibit membrane permeability and/or water solubility. Permeability and solubility are related to the topological polar surface area (TPSA) and molecular weight of the MLK inhibitor.
  • TPSA topological polar surface area
  • a desirable solubility may be provided by molecules having a TPSA of > 0.1 x MW (or TPSA/MW ratio > 0.1) (see, e.g., Maple et al., Med Chem Commun 2019, 10:1755-1764).
  • water solubility is enhanced by forming the MLK inhibitor as a common salt (e.g., acetates, oxalates, methane sulfonates), or from common acids such as hydrochloric acid or sulfuric acid.
  • a common salt e.g., acetates, oxalates, methane sulfonates
  • common acids such as hydrochloric acid or sulfuric acid.
  • a desirable permeability may be provided by molecules having a TPSA of ⁇ 140 (Ibid.).
  • the MLK inhibitor has a TPSA of from 0.1 x MW to 140.
  • the MLK inhibitor may have an MLK dissociation constant KD of less than 200 nM, less than 150 nM, less than 100 nM, less than 75 nM, less than 50 nM, less than 25 nM, less than 10 nM, or even less than 5 nM .
  • the MLK inhibitor may be an LZK inhibitor that selectively binds to LZK over dual leucine zipper kinase (DLK).
  • DLK dual leucine zipper kinase
  • the LZK inhibitor may exhibit at least 2-fold selectivity towards LZK over DLK, as evidenced by the ratio of the LZK and DLK dissociation constants KD.
  • the LZK inhibitor exhibits at least 2-fold selectivity, at least 3-fold selectivity, at least 5-fold selectivity, at least 10-fold selectivity, at least 25-fold selectivity, at least 50-fold selectivity, at least 100-fold selectivity, or even at least 150-fold selectivity for LZK over DLK.
  • compound 207 has an LZK KD of ⁇ 1 nM and exhibits 180-fold selectivity for LZK over DLK.
  • compositions comprising one or more of the disclosed MLK inhibitors.
  • a pharmaceutical composition comprises a compound as disclosed herein and a pharmaceutically acceptable excipient.
  • the compounds described herein can be used to prepare therapeutic pharmaceutical compositions.
  • the compounds may be added to the compositions in the form of a salt or solvate.
  • administration of the compounds as salts may be appropriate.
  • pharmaceutically acceptable salts are organic acid addition salts formed with acids that form a physiological acceptable anion, for example, tosylate, methanesulfonate, acetate, citrate, malonate, tartrate, succinate, benzoate, ascorbate, a-ketoglutarate, and b-glycerophosphate.
  • Suitable inorganic salts may also be formed, including hydrochloride, halide, sulfate, nitrate, bicarbonate, and carbonate salts.
  • compositions may be obtained using procedures known to persons of ordinary skill in the art, for example by reacting a sufficiently basic compound, such as an amine, with a suitable acid to provide a physiologically acceptable ionic compound.
  • a sufficiently basic compound such as an amine
  • the compounds of the formulas described herein can be formulated as pharmaceutical compositions and administered to a mammalian host, such as a human or veterinary patient, in a variety of forms.
  • the forms can be specifically adapted to a chosen route of administration, e.g., oral or parenteral administration, by intravenous, intramuscular, topical or subcutaneous routes.
  • the compounds described herein may be systemically administered in combination with a pharmaceutically acceptable vehicle, such as an inert diluent or an assimilable edible carrier.
  • a pharmaceutically acceptable vehicle such as an inert diluent or an assimilable edible carrier.
  • compounds can be enclosed in hard or soft shell gelatin capsules, compressed into tablets, or incorporated directly into the food of a patient's diet.
  • Compounds may also be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
  • Such compositions and preparations typically contain at least 0.1% of active compound.
  • the percentage of the compositions and preparations can vary and may conveniently be from about 2% to about 60% of the weight of a given unit dosage form.
  • the amount of active compound in such therapeutically useful compositions is such that an effective dosage level can be obtained.
  • the tablets, troches, pills, capsules, and the like may also contain one or more of the following excipients: binders such as gum tragacanth, acacia, com starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as com starch, potato starch, alginic acid and the like; and a lubricant such as magnesium stearate.
  • binders such as gum tragacanth, acacia, com starch or gelatin
  • excipients such as dicalcium phosphate
  • a disintegrating agent such as com starch, potato starch, alginic acid and the like
  • a lubricant such as magnesium stearate.
  • a sweetening agent such as sucrose, fmctose, lactose or aspartame; or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring, may be added.
  • the proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions, or by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thiomersal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers, or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by agents delaying absorption, for example, aluminum monostearate and/or gelatin.
  • Useful dosages of the compounds described herein can be determined by comparing their in vitro activity, and in vivo activity in animal models. Methods for the extrapolation of effective dosages in mice, and other animals, to humans are known to the art; for example, see U.S. Patent No. 4,938,949 (Borch et al.).
  • the amount of a compound, or an active salt or derivative thereof, required for use in treatment will vary not only with the particular compound or salt selected but also with the route of administration, the nature of the condition being treated, and the age and condition of the patient, and will be ultimately at the discretion of an attendant physician or clinician. IV. Methods of Use
  • the cell is an HNSCC cell, an LSCC cell, a hepatocellular carcinoma cell, an ovarian cancer cell, a small cell lung cancer cell, a neuroendocrine prostate cancer cell, an esophageal cancer cell (e.g., an esophageal squamous cell carcinoma (ESCC) cell or an esophageal adenocarcinoma cell), or a breast cancer cell (e.g., a triple negative breast cancer (TNBC) cell).
  • the cell is an HNSCC, LSCC, ESCC, or TNBC cell.
  • an effective amount or effective dose of the agents may simply inhibit or enhance one or more selected biological activities correlated with a disease or condition, as set forth herein, for either therapeutic or diagnostic purposes.
  • the actual dosages of the agents will vary according to factors such as the disease indication and particular status of the subject (for example, the subject’s age, size, fitness, extent of symptoms, susceptibility factors, and the like), time and route of administration, other drugs or treatments being administered concurrently, as well as the specific pharmacology of the agent for eliciting the desired activity or biological response in the subject. Dosage regimens can be adjusted to provide an optimum prophylactic or therapeutic response.
  • a therapeutically effective amount is also one in which any toxic or detrimental side effects of the agent is outweighed in clinical terms by therapeutically beneficial effects.
  • R 2 and R 3 together with the atoms to which they are attached form a 5- or 6-membered substituted or unsubstituted aryl or substituted or unsubstituted heteroaryl ring,
  • R 11 and R 12 are H, alkyl, perhaloalkyl, alkoxy, perhaloalkoxy, cyano, or amino.
  • Z is alkoxy, H, aliphatic, or heteroaliphatic.
  • oligonucleotides are listed below in Table 18. 293T cells were transiently transfected using Lipofectamine 2000 (Invitrogen), according to the manufacturer’s protocol, with OptiMEM (Gibco). ApcDNA3.1(+) vector (Invitrogen) was used as an empty vector control where required.
  • the CDK2 sensor vector CSII-pEFla-DHB(aa994-1087)-mVenus and the nuclear marker vector CSII-pEFla-H2B-mTurquoise were described previously (Spencer et al., Cell 2013, 155:369-383).
  • CAL33 German Collection of Microorganisms and Cell Cultures [DSMZ], obtained Oct. 2012) and 293T (American Type Culture Collection [ATCC], July 2012) cells were maintained in DMEM (Sigma- Aldrich) supplemented with 10% tetracycline-tested fetal bovine serum (FBS) (Atlanta Biologicals), 1% penicillin-streptomycin (Gibco), and 2 mM GlutaMAX (Gibco).
  • FBS tetracycline-tested fetal bovine serum
  • Ibco penicillin-streptomycin
  • 2 mM GlutaMAX Gibco
  • the lentiviral expression plasmid was pCLVi(3G)-MCS-Puro, which expresses a doxycycline-responsive transactivator and the shRNA from the same vector. Expression of the transactivator is constitutive, while shRNA expression depends on a doxycycline-inducible promoter. Binding doxycycline to the transactivator allows it to bind the doxycycline-inducible promoter and promote shRNA expression. Doxycycline (Sigma- Aldrich) was used at 1 pg/mL to induce LZK knockdown.
  • the ViraPower HiPerform T-REx Gateway Expression System (Invitrogen) was used to generate cells with tetracycline-inducible expression of LZK.
  • wild-type (WT) or drug-resistant mutant (Q240S) LZK (cloned into pLenti6.3/TO/V5-DEST vector) and pLenti3.3/TR (for tetracycline repressor expression) were transfected into 293FT cells using Lipofectamine 2000 to generate lentiviral stock.
  • Cell lines were generated by antibiotic selection (blasticidin [Gibco] and geneticin [Gibco]).
  • Doxycycline Sigma- Aldrich was used at 1 pg/mL to induce LZK expression.
  • RT-PCR was performed using a SuperScript III One-Step RT-PCR kit (Invitrogen). Primers used were as follows: AACTGATTCGAAGGCGCAGA (LZK forward; SEQ ID NO: 13), GGGCGTTTTCCAAGAGAGGA (LZK reverse; SEQ ID NO: 14), GGCACCACACCTTCTACAATG (p-actin forward; SEQ ID NO: 15), GTGGTGGTGAAGCTGTAGCC (p-actin reverse; SEQ ID NO: 16), CCATGGAGAAGGCTGGGG (GAPDH forward; SEQ ID NO: 17), GTCCACCACCCTGTTGCTGTA (GAPDH reverse; SEQ ID NO: 18).
  • the cycling conditions for PCR were as follows: cDNA synthesis and pre-denaturation (one cycle at 55 °C for 30 minutes followed by 94 °C for two minutes), PCR amplification (25 cycles of denaturing at 94 °C for 15 seconds, annealing at 55 °C for 30 seconds, and extension at 68 °C for 60 seconds), and a final extension at 68 °C for five minutes using C1000 TOUCH CYCLER w/48W FS RM (Bio-Rad). PCR products were resolved on 2% agarose gel and visualized with Nancy-520 (Sigma- Aldrich) DNA gel stain under ultraviolet light using ChemiDocTM MP Imaging System (Bio-Rad).
  • GNE-3511 (#19174) was purchased from Cayman Chemical or from Synnovator (#SYNNAA108230) in large quantities for the mouse studies.
  • MG132 (#S2619) was purchased from Selleck Chemicals.
  • Pevonedistat or MLN4924 (#HY-70062) was purchased from MedChemExpress. All compounds were dissolved in DMSO (Fisher), and DMSO was used as the vehicle control in the cell-based assays.
  • cells were plated in six-well or 35-mm plates for 24 hours, after which doxycycline was added or treatment with specific inhibitor was administered using 5% FBS media for 48 hours. After appropriate treatment time, cells were washed with ice-cold phosphate-buff ered saline without Ca and Mg (Quality Biological) and then lysed on ice with RIPA buffer (50 mM NaCl, 1.0% IGEPAL® CA-630, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, pH 8.0) (Sigma- Aldrich) supplemented with protease inhibitor tablet (Sigma- Aldrich) and phosphatase inhibitor cocktails 2 and 3 (Sigma- Aldrich) followed by centrifugation at 15,000 rpm for 10 minutes at 4 °C.
  • RIPA buffer 50 mM NaCl, 1.0% IGEPAL® CA-630, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, pH 8.0
  • Protein concentrations were determined from the cell lysate by using 660 nm Protein Assay Reagent (Pierce). Cell extracts were denatured, subjected to SDS- PAGE, transferred to PVDF membranes (Bio-Rad) and blocked for 2 hours using 5% bovine serum albumin (BSA) in phosphate-buffered saline and 0.1% Tween® 20 (PBS-T). The membranes were incubated with the specific antibodies overnight in 5% BSA/PBST at 4 °C followed by a 1 hour incubation with the appropriate horseradish peroxidase-conjugated secondary antibodies and signal was detected by chemiluminescence (Thermo Fisher). The antibodies are listed in Table 19.
  • Cells were seeded in 10 cm dishes, at 6 x 10 5 for CAL33 and BICR56, and 6.25 x 10 5 for MSK921, before addition of doxycycline (to induce LZK knockdown) the following day.
  • Cells were lysed on ice with lx Triton X-100 cell lysis buffer (#9803, Cell Signaling Technology) supplemented with protease and phosphatase inhibitors (Roche Applied Science, #05056489001 and 04906837001, respectively) and 1.5 mM MgCh, 48 hours after induction with doxycycline. Cell lysates were centrifuged, and the supernatant was collected.
  • Protein concentration was measured using 660 nm Protein Assay Reagent (Pierce), and adjusted to 2 mg/mL. Then 4x reducing sodium dodecyl sulfate (SDS) sample buffer was added (40% glycerol, 8% SDS, and 0.25 M Tris HC1, pH 6.8, with 10% P-mercaptoethanol added before use), and the samples were incubated at 80 °C for three minutes. Lysates from three independent experiments were sent for RPPA analysis.
  • SDS sodium dodecyl sulfate
  • a Cell Titer 96 AQueous One Solution Cell Proliferation Assay (Promega) was used for MTS assays following the manufacturer’s protocol. In brief, 5,000 cells were plated in triplicate in 96-well plates and treated with drug compounds 24 hours later using 5% FBS media. Doxycycline was added where appropriate, and cells were incubated for 72 hours. MTS was added, cells were incubated for two hours, and absorbance was measured at 490 nm using iMarkTM Microplate Absorbance Reader (Bio-Rad). Graphs display percent cell viability relative to the DMSO-treated control sample. EC50 values were determined using GraphPad Prism 8.
  • Crystal violet assays were used to assess relative cell growth and survival after treatment with specific compounds.
  • cells were plated in triplicate in 12-well plates for 24 hours before drug treatments were added using 10% FBS media. The plates were incubated for 14 days, with the media and drug being replaced every 48 hours. The cells were then washed with phosphate-buffered saline and fixed in ice-cold methanol before being stained with 0.5% crystal violet (Sigma- Aldrich) in 25% methanol.
  • GST glutathione S-transferase
  • MKK7 human inactive MKK7 pure protein
  • SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis
  • a PathScan® Phospho-SAPK/JNK (Thrl83/Tyrl85) Sandwich ELISA Assay was used for ELISA assays following the manufacturer’s protocol. In general, 500,000 cells were plated and treated with doxycycline the following day where appropriate and incubated at 37 °C for 48 hours. Cells were treated with the drug compound or control in 5% FBS media for 1 hour. After appropriate treatment time, cells were lysed on ice with lx Cell Lysis Buffer (Cell Signaling Technology) supplemented with phosphatase and protease inhibitors (Sigma).
  • Tumor pieces at approximately 2 x 2 x 2 mm 3 from an HNSCC patient containing amplified MAP3K13 were implanted subcutaneously with Matrigel (Coming) in the mice according to the SOP50101 Implantation and Cry opreservation of Tissue for PDX Generation protocol from the NIH Patient-Derived Models Repository (PDMR).
  • PDMR NIH Patient-Derived Models Repository
  • Five NSG mice were used for initial implantation of the cryopreserved tumor fragments. Body weights and tumor size were measured twice weekly. The tumors were harvested when they reached approximately 1 ,000 mm 3 and were used to generate the PDX mouse model to test GNE-3511.
  • passage one of the fresh PDX tumor fragments were implanted into NSG mice using the protocol stated previously.
  • mice Twenty NSG mice were used (10 for vehicle control and 10 for GNE-3511 treatment). Body weights and tumor sizes were measured twice weekly until tumors reached approximately 150-200 mm 3 , at which point the mice were randomly assigned to treatment cohorts with control or GNE-3511 for approximately 4-8 weeks. The study endpoints were over 20% body weight loss, tumor volume exceeding 2.0 cm 3 in diameter, or significant (greater than 80%) tumor regression observed with treatment.
  • the GNE- 3511 was dissolved with 60% PEG 300 MW, 3 eq of 0.1 M HC1, saline (vehicle) and administered daily via intratumoral injection at 50 mg/kg. Body weights and tumor sizes were measured twice weekly. At the endpoint of each study, tumors were harvested, cleaned, weighed, and photographed for analysis.
  • RNA-seq data was processed to get gene expression data (Li et al. , BMC Bioinformatics 2011, 12( 1 ) : 323).
  • fifty-eight PDX head and neck models were performed by WES and RNA-seq bioinformatics analysis.
  • each PDX model it includes multiple (4 > PDX) samples.
  • FPKM Fragments Per Kilobase Million
  • Method A A 4-substituted 2,6-dichloropyridine (3 mmol) is combined with 5.25 mmol (1.75 equiv) of 3,3-difluoropyrrolidine hydrochloride in dioxane (e.g., 8 mL) in a microwave vial. Diisopropylethylamine (9 mmol, 3 equiv) is added and the sealed vial is heated with stirring at 130 °C for 16 h. The cooled reaction is then diluted with 50 mL water and extracted with 3 x 35 mL ethyl acetate. The combined organic layers are dried over Na2SC>4 and concentrated under reduced pressure. The resulting residue is purified by flash chromatography eluting with a gradient of ethyl acetate in dichloromethane.
  • R groups include, but are not limited to, l-acetylpiperidin-4-yl, piperidin-4-yl, l-ethylpiperidin-4-yl, l-oxetan-3-ylpiperidin-4-yl, 1 -(polyethylene glycol)piperidin-4-yl, l-isopropylpiperidin-4-yl, l-cyclopentylpiperdin-4-yl, 4-(l-cyclopropylmethyl)piperidin-4-yl, azetidin-3-yl, l-acetylazetidin-3-yl, l-ethylazetidin-3-yl, N-oxetan-3-yl-3-azetidinyl, l-(polyethyleneglycol-azetidin-3-yl, l-isopropylazetidin-3-yl, l-cyclopentylazetidin-3-
  • a dual leucine zipper kinase (DLK) inhibitor, GNE-3511 was evaluated for inhibition of LZK catalytic activity.
  • LZK and DLK have greater than 90% homology within their kinase domains, and GNE-3511 was also reported to inhibit the catalytic activity of LZK (Patel et al. , J Med Chem 2015, 58:401-418).
  • GNE-3511 FIG. 1
  • dox doxycycline
  • GNE-3511 is a potent LZK inhibitor in cells, as measured by inhibition of downstream JNK pathway activation (FIGS. 2A-C, 3, 4). Similar results were observed in vitro (FIG. 5).
  • LK2 and NCI-H520 lung squamous cell carcinoma (LSCC) cells were treated with 500 nM GNE-3511. A 45% and 55% reduction in colony formation was observed, respectively, which indicates that additional squamous cell carcinomas rely upon LZK to maintain viability (FIG. 7). A significant decrease in viability in the CAL33 and BICR56 cells in short-term MTS assays was also observed, with an IC50 of 687.7 ⁇ 114.1 nM and 410.5 ⁇ 59.6 nM, respectively (FIG. 8). IC50 values were calculated with GraphPad Prism 8.
  • kinase inhibitors are promiscuous compounds that will often target additional kinases, and GNE-3511 was initially developed as a DLK inhibitor.
  • a drug-resistant mutant form of LZK Q240S was generated that maintains catalytic activity in the presence of the drug, as assessed by JNK pathway activation (FIGS. 9, 10).
  • Q240S maintains catalytic activity in the presence of GNE-3511, as assessed by downstream JNK phosphorylation.
  • FIG. 10 shows that one-hour GNE-3511 treatment specifically inhibits LZK, as observed with the rescue of JNK signaling by the overexpression of the LZK Q240S drug-resistant mutant in 293T cells.
  • the subject may be administered the therapeutically effective amount of the pharmaceutical composition at periodic intervals for an effective period of time to mitigate at least one sign or symptom of the disease or condition.
  • the subject may be administered the therapeutically effective amount of the pharmaceutical composition once daily or in divided doses over the course of a day, such as 2-3 divided doses per day.
  • the pharmaceutical composition is administered by any suitable route including, but not limited to, parenterally (e.g., intravenously, intramuscularly, subcutaneously), orally, or topically.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Mixed lineage kinase (MLK) inhibitors are disclosed. The compounds inhibit kinase activity. The compounds may be used to treat diseases or conditions characterized at least in part by overexpression of one or more MLKs. The compounds have a structure according to formula I, or a stereoisomer, tautomer, or pharmaceutically acceptable salt thereof.

Description

MIXED LINEAGE KINASE INHIBITORS AND METHODS OF USE
CROSS-REFERENCE TO RELATED APPLICATION
This application claims the benefit of the earlier filing date of U.S. Provisional Application No. 63/239,797, filed September 1, 2021, which is incorporated by reference in its entirety herein.
ACKNOWLEDGMENT OF GOVERNMENT SUPPORT
This invention was made with government support under Project No. Z01 600.129.15.01.024.001.0021.012 awarded by the National Institutes of Health. The government has certain rights in the invention.
FIELD
This invention concerns mixed lineage kinase inhibitors, and methods for using the inhibitors.
BACKGROUND
The worldwide frequency of head and neck squamous cell carcinoma (HNSCC) is approximately 800,000 new cases per year, with 430,000 deaths annually, statistics that have remained unchanged for several decades. Treatment options for HNSCC patients are primarily limited to surgery, radiotherapy, platinum-based chemotherapy, or combinations thereof. Cetuximab, a monoclonal antibody targeting EGFR, is the only approved targeted therapy for HNSCC (Bonner et al. , NEJM 2006, 364:567-578; Vermorken et al. , NEJM 2008, 359: 1116-1127). However, only a subset (13%) of HNSCC patients respond to cetuximab (Vermorken et al. , J Clin Oncol 2007, 25:2171-2177); therefore, there is an urgent need for new therapies.
Lung squamous cell carcinoma (LSCC) accounts for one-third of all lung cancer cases. Despite extensive genomic sequencing, the identification of oncogenic drivers in LSCC has remained challenging, and actionable alterations are unknown in the majority of LSCC patients (Gold et al., Clin Cancer Res 2012, 18(11):3002-7; Gandara et al., Clin Cancer Res 2015, 21 (10):2236-43). As a result, no targeted therapies have been approved to treat LSCC, and treatment still relies on chemotherapy or radiotherapy. Genomic characterization of LSCC tumors shows that distal chromosome 3q amplification (3q26-29) is the most prevalent genomic alteration in LSCC, occurring in approximately 50% of LSCC patients (Cancer Genome Atlas Research Network, “Comprehensive genomic characterization of squamous cell lung cancers,” Nature 2012, 489(7417):519-25.). Triple-negative breast cancer (TNBC) accounts for 10-20% of all invasive breast cancers and has an inferior prognosis compared to other breast cancers (Mehlich et al. , Cell Death and Disease 2021, 12:1111; Marusiak et al. , Oncogene 2019, 38:2860-2875). TNBC is characterized by an absence of estrogen and progesterone receptors, as well as a lack of HER2 overexpression. Intrinsic and acquired resistance to chemotherapy leads to high rates of relapse and poor outcomes (Mehlich et al.). Hence, there is a need for new therapies.
SUMMARY
This disclosure concerns mixed lineage kinase (MLK) inhibitors, and methods for using the inhibitors. In some aspects, the disclosed inhibitor is a compound, or a stereoisomer, tautomer, or pharmaceutically acceptable salt thereof, having a general formula I:
With respect to formula I, each bond represented by - is a single or double bond as needed to satisfy valence requirements. The -X^R5)- moiety is -C(R5)-, -C(R5)-C(H)-, -C(H)-C(R5)-, -C(R5)-N-, -N-C(R5)-, or -N(R5)-. X2 is N or C. X3 is N or CH. One or two of X1X3 comprises N. X4 is CH or S. X5 is -N(H)- or absent. Y1 is CR1) or N. Y2 is C(R2) or N. Y3 is C(R3) or N. Y4 is N or C(R6). Y5 is C(R7) or N. Y6 is C(R8) or N. One or two of Y^Y6 are N, and at least one of Y1 - Y3 or Y6 is other than C(H). Two, three, or four of Y7-Y10 independently are N or N(R9), and the others of Y7-Y10 are C(R10). R1 is cyano, perhaloalkyl, H, alkyl, or perhaloalkoxy. R2 is H, alkoxy, perhaloalkyl, perhaloalkoxy, haloalkoxy, haloalkyl, cyano, alkyl, cyanoalkyl, amino, heteroarylalkoxy, heteroalkyl, amido, halo, alkenyl, or haloalkenyl, or R1 and R2 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring. R3 is H, amino, alkylamino, aminoalkyl, alkoxy, or -N(H)C(O)R' where R' is alkyl, or R2 and R3 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring. R4 is aliphatic, azaalkyl, aryl, or amino. R5 is aliphatic, heteroaliphatic, or alkylamino. R6 and R7 independently are H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano. R8 is H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano or R8 and R1 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring. Each R9 independently is H or alkyl. Each R10 independently is H, alkyl, or cyano.
This disclosure further includes pharmaceutical compositions. A pharmaceutical composition includes at least one compound as disclosed herein, and at least one pharmaceutically acceptable carrier.
Methods of using the disclosed compounds are disclosed. In some aspects, a method of inhibiting MLK activity includes contacting a cell expressing an MLK with an effective amount of a compound disclosed herein, thereby inhibiting MLK activity. The MLK may be MLK1 (MAP3K9), MLK2 (MAP3K10), MLK3 (MAP3K11), MLK4 (MAP3K21), DLK (MAP3K12), LZK (MAP3K13), ZAK1 (MAP3K20), or any combination thereof. In some aspects, inhibiting MLK activity inhibits cell cycle progression, reduces c-MYC expression, inhibits c-Jun N-terminal kinase (JNK) pathway signaling, inhibits PI3K/AKT pathway signaling, inhibits cyclin dependent kinase 2 (CDK2) activity, or any combination thereof. In any of the foregoing or following implementations, the cell may be characterized by amplification of chromosome 3q, amplification of chromosome llq, overexpression of a mitogen-activated protein kinase kinase kinase (MAP3K), overexpression of an extracellular signal-regulated kinase (ERK), or any combination thereof. In some examples, the cell is a head and neck squamous cell carcinoma (HNSCC) cell, a lung squamous cell carcinoma (LSCC) cell, a hepatocellular carcinoma cell, an ovarian cancer cell, a small cell lung cancer cell, a neuroendocrine prostate cancer cell, an esophageal cancer cell, or a breast cancer cell.
In some implementations, contacting the cell with the compound comprises administering a therapeutically effective amount of the compound, or an amount of a pharmaceutical composition comprising the therapeutically effective amount of the compound, to a subject. The subject may have a disease or condition characterized at least in part by MLK overexpression. In some implementations, the disease or condition is cancer, such as HNSCC, LSCC, hepatocellular carcinoma, ovarian cancer, small cell lung cancer, neuroendocrine prostate cancer, esophageal cancer, or breast cancer. Administering the therapeutically effective amount of the compound, or the amount of the pharmaceutical composition, may decrease viability of the cancer cells, inhibit tumor growth, or a combination thereof.
The foregoing and other objects, features, and advantages of the disclosure will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures. BRIEF DESCRIPTION OF THE DRAWINGS
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
FIG. 1 is the structure of GNE-3511.
FIGS. 2A-2C show that GNE-3511 inhibited LZK activity, as monitored by downstream JNK phosphorylation from 100 nM to 5 pM at 24 hours (2A) and at 250 nM for up to 72 hours (2B);
FIG. 2C is a graphical representation of the data.
FIG. 3 shows RT-PCR analysis of CAL33 TR LZK WT or 240S cell lines with tetracycline-inducible expression of LZK.
FIG. 4 shows that GNE-3511 250 nM, inhibited LZK activity toward JNK within 15 minutes.
FIG. 5 shows that GNE-3511 decreased in vitro phosphorylation of MKK7, a direct downstream target of LZK.
FIGS. 6A and 6B are a series of images (6A) and a bar graph (6B) showing that GNE-3511 suppressed clonogenic growth after 14 days in head and neck squamous cell carcinoma (HNSCC) cell lines with amplified MAP3K13 (CAL33 and BICR56) with only mild effects on clonogenic growth in the control HNSCC cell line (MSK921) or the immortalized normal human bronchial epithelial cell line (BEAS-2B).
FIGS. 7A and 7B are a bar graph (7 A) and images (7B) showing that LZK inhibition with GNE-3511 at 500 nM reduced clonogenic growth of lung squamous cell carcinoma (LSCC) cell lines with 3q amplification (LK2 and NCLH520).
FIG. 8 is a graph showing that GNE-3511 treatment significantly reduced cell viability in CAL33 and BICR56 cells for 72 hours.
FIG. 9 shows that a drug-resistant mutant form of LZK, Q240S, maintained catalytic activity in the presence of GNE-3511, as assessed by downstream JNK phosphorylation.
FIG. 10 shows that one-hour GNE-3511 treatment specifically inhibited LZK activity, as observed with the rescue of JNK signaling by the overexpression of the LZKQ240S drug-resistant mutant in 293 T cells.
FIG. 11 shows that GNE-3511 suppressed HNSCC viability in a 72-hour MTS assay in CAL33 and BICR56 cell lines that harbor amplified MAP3K13 and viability was rescued by expression of LZKQ240S. FIGS. 12A-12C show suppression of tumor growth in mice (n=10) treated with GNE-3511 (50 mg/kg, q.d., five days on/two days off) compared to the vehicle control group in an in vivo HNSCC PDX mouse model; FIG. 12A is a graph of mean tumor volume ± SEM; FIG. 12B is a bar graph showing average tumor volume at the end of treatment, mean tumor volume ± SEM, Student’s /-test, *p<0.05; FIG. 12C is tumor images at the end of the study.
FIGS. 13A-13D show that tumor growth was significantly suppressed in mice (n=10) treated with GNE-3511 (50 mg/kg, q.d., five days on/two days off) compared to the vehicle control group in two in vivo HNSCC PDX mouse models (50 mg/kg, q.d., five days on/two days off) with amplified LZK (FIGS. 13A, 13B), whereas there was no decrease in tumor volumes in HNSCC PDX models that that lack amplified LZK (FIGS. 13C, 13D). Mean tumor volumes ± SEM are shown. Average tumor volume at the end of treatment. Mean ± SEM; Student’s /-test; *p < 0.05.
FIG. 14 shows that tumor growth was suppressed in mice (n = 10) treated with 100 mg/kg GNE-3511 compared to the vehicle control group in an in vivo HNSCC CAL33 xenograft mouse model.
FIGS. 15A and 15B are images of immunohistochemistry (IHC) staining of an apoptotic marker, cleaved caspase 3, in CAL33 xenografts for teach treatment group (15A), and quantification of the cleaved caspase-3 staining revealing an increase in the apoptotic marker with GNE-3511 treatment compared to the control in tumors (15B).
FIG. 16 is a graph representing percentage of the HNSCC PDX models with amplification of each gene on chromosome 3; the genes were ordered by gene start point along chromosome 3; MAP3K13 is marked with a cross; the line is the regression line by loss method.
FIG. 17 shows RT-PCR analysis of the CAL33, BICR56, and MSK921 cell lines with dox-inducible knockdown of LZK.
FIG. 18 shows copy number (CN) profiles of fifty-eight HNSCC PDX mouse models on chromosome 3 obtained from the NCI PDMR; the heatmap color indicates the log2 ratio of copy numbers.
FIG. 19 shows a boxplot of MAP3K13 gene expression in fifty-eight PDX models with different MAP 3 KI 3 copy numbers.
FIG. 20 is RPPA assay results identifying decreased c-MYC levels in CAL33 and BICR56 cells depleted of LZK for 48 hours.
FIG. 21 is a series of Western blots of c-MYC abundance in CAL33 and BICR56 cells depleted of LZK for 48 hours. FIG. 22 is a series of Western blots of cell cycle component abundance in CAL33 cells depleted of LZK for 48 hours
FIG. 23 is a Western blot showing that treatment with MG132 (10 pM) for six hours rescued decreases in c-MYC levels in CAL33 and BICR56 cells depleted of LZK for 48 hours.
FIG. 24 is a Western blot showing that treatment of CAL33 cells with GNE-3511 decreased c-MYC abundance for up to 72 hours.
FIG. 25 is a Western blot showing that LZKQ240S expression rescued loss in c-MYC levels in CAL33 cells treated with GNE-3511.
FIG. 26 is a graph showing inhibition of LZK activity by several disclosed analogs, as monitored by downstream JNK phosphorylation.
FIG. 27 is a Western blot comparison of GNE-3511 and LZK inhibitor 2 showing that LZK inhibitor 2 is a potent LZK inhibitor at 100 nM.
FIG. 28 shows that LZK inhibitor 2 maintained JNK pathway inactivation for 72 hours at 250 nM.
FIG. 29 shows that LZK signaling activity was suppressed with LZK inhibitor 2 (250 nM) at five minutes.
FIG. 30 shows that LZK inhibitor 2 inhibited JNK signaling at lower concentrations than GNE-3511 for one hour.
FIGS. 31A and 3 IB are images showing that LZK inhibitor 2 suppressed clonogenic growth of HNSCC cells harboring amplified MAP3K13 (CAL33, BICR56, and Detroit 562) FIG. 31A) and quantification revealing a significant decrease in growth in all three cell lines. Mean ± SEM; Student’s /-test; **p < 0.01, *p < 0.05 (FIG. 3 IB).
FIG. 32 is images showing that LZK inhibitor 2 (1 pM) significantly decreased LSCC cell growth in LK2 and NCLH520 cell lines.
FIG. 33 is a graph showing that LZKQ240S drug-resistant mutant expression rescued decreases in viability in CAL33 cells treated with LZK inhibitor 2.
FIG. 34 is a Western blot showing that LZKQ240S drug-resistant mutant expression during treatment with LZK inhibitor 2 (250 nM) rescued JNK signaling.
FIGS. 35-39 are bar graphs showing that several disclosed MLK inhibitors (1 pM, 1 hour) decreased phospho- JNK levels in CAL33 cells with induced expression of LZK with doxycycline using an ELISA assay. Inhibitors are initially screened for efficacy compared to GNE-3511 control.
FIGS. 40-42 are graphs showing dose-dependent inhibition of LZK by three disclosed MLK inhibitors. FIG. 43 is a graph showing that esophageal squamous cell carcinoma (ESCC) cells with the 3q amplicon are sensitive to GNE-3511.
FIG. 44 is images of a soft agar assay confirming that ESCC cells with the 3q amplicon are sensitive to GNE-3511.
FIG. 45 is images of a colony formation assay confirming that ESCC cells with the 3q amplicon are sensitive to GNE-3511.
FIG. 46 is images of a colony formation assay showing that ESCC cells with a drug resistant mutant form of LZK are resistant to GNE-3511.
FIG. 47 is images of a colony formation assay confirming that ESCC cells with the 3q amplicon are sensitive to two disclosed MLK inhibitors.
FIG. 48 is a Western blot showing that ESCC cells with a drug resistant mutant form of LZK are resistant to a disclosed MLK inhibitor.
FIG. 49 is images of a colony formation assay showing that ESCC cells with a drug resistant mutant form of LZK are resistant to a disclosed MLK inhibitor.
FIG. 50 is images of a colony formation assay showing that ESCC cells are very sensitive to two disclosed MLK inhibitors.
SEQUENCE LISTING
A Sequence Listing XML (submitted under 37 C.F.R. § 1.831(a) in compliance with §§ 1.832 through 1.834) is submitted herewith as “Sequence.xml,” created on August 18, 2022, 20,480 bytes, which is incorporated by reference herein.
Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. In the accompanying sequence listing:
SEQ ID NO: 1 is an exemplary nucleotide sequence for an LZK Q240S forward primer.
SEQ ID NO: 2 is an exemplary nucleotide sequence for an LZK Q240S verse primer.
SEQ ID NO: 3 is an exemplary nucleotide sequence for an LZK K195M forward primer.
SEQ ID NO: 4 is an exemplary nucleotide sequence for an LZK K195M reverse primer.
SEQ ID NO: 5 is an exemplary nucleotide sequence for a Xbal to start of LZK forward primer.
SEQ ID NO: 6 is an exemplary nucleotide sequence for a Notl to end of LZK reverse primer.
SEQ ID NO: 7 is an exemplary nucleotide sequence for a T7 promoter primer. SEQ ID NO: 8 is an exemplary nucleotide sequence for a BGH reverse primer.
SEQ ID NO: 9 is an exemplary nucleotide sequence for a Xbal to LZK kinase domain forward primer.
SEQ ID NO: 10 is an exemplary nucleotide sequence for a Xbal to LZK end kinase domain reverse primer.
SEQ ID NO: 11 is an exemplary nucleotide sequence for a Notl to LZK end zipper domain reverse primer.
SEQ ID NO: 12 is an exemplary nucleotide sequence for a Notl to LZK end stop codon reverse primer.
SEQ ID NO: 13 is an exemplary nucleotide sequence for a MAP3K13 forward primer, SEQ ID NO: 14 is an exemplary nucleotide sequence for a MAP3K13 reverse primer, SEQ ID NO: 15 is an exemplary nucleotide sequence for an ACTB forward primer, SEQ ID NO: 16 is an exemplary nucleotide sequence for an ACTB reverse primer. SEQ ID NO: 17 is an exemplary nucleotide sequence for a GAPDH forward primer, SEQ ID NO: 18 is an exemplary nucleotide sequence for a GAPDH reverse primer. SEQ ID NO: 19 is an exemplary DNA sequence encoding an shRNA.
SEQ ID NO: 20 is an exemplary DNA sequence encoding an shRNA.
DETAILED DESCRIPTION
This disclosure concerns mixed lineage kinase (MLK) inhibitors, as well as methods of making and using the inhibitors. MLKs are implicated in head and neck squamous cell carcinoma (HNSCC), lung squamous cell carcinoma (LSCC), hepatocellular carcinoma, ovarian cancer, small cell lung cancer, neuroendocrine prostate cancer, esophageal cancer, and breast cancer. For example, LZK is implicated in both head and neck squamous cell carcinoma (HNSCC) and lung squamous cell carcinoma (LSCC). LZK has also been shown to regulate c-MYC protein stability in hepatocellular carcinoma and is required to maintain growth of hepatocellular carcinoma cells (Zhang et al., Cell Death & Differentiation 2020, 27:420-433). Furthermore, LZK is amplified in 20% of ovarian cancers, 25% of small cell lung cancers, 20% of neuroendocrine prostate cancer, and 20% of esophageal adenocarcinomas, implicating LZK as a driver in these additional cancers. MLK3 is amplified in 10% of head and neck cancers harboring the llq amplicon. MLK4 is a driver in 25% of triple- negative breast cancers harboring MAP3K21 (MLK4) amplification.
Kinase signaling pathways are integral to cell survival and proliferation, and kinase inhibition is an established approach to treating many forms of cancer. Leucine zipper-bearing kinase (LZK, MAPK3K13) is a serine/threonine kinase with high homology to MAPK3K12 (DLK) (Patel et al., J Med Chem 2015, 58:8182-8199). LZK has been shown to be amplified or to have copy-number gain in a majority of HNSCC tumors, making it an attractive target for therapy. LZK regulates c-MYC (Soth et 2018/0057507 Al; Soth et al., US 10,093,664 B2) and PI3K/AKT pathways in a kinase-dependent manner. Moreover, the c-MYC and PI3K/AKT pathways are implicated in a wide variety of cancers. Preventing the upregulation of these pathways by LZK inhibition is of broad interest to cancer researchers.
LZK can directly phosphorylate the MAP2Ks (MAP kinase kinases) MKK7 and MKK4, leading to JNK (c-Jun N-terminal kinase) pathway activation (Ikeda et al., J Biochem 2001, 130:773-781). Amplified endogenous LZK does not activate the JNK pathway in HNSCC (Edwards et al., Cancer Res 2017, 77:4961-4972; Ikeda et al.). However, overexpressed LZK leads to JNK pathway activation, which can be used as a readout to assess catalytic inhibitors of LZK (Edwards et al.). Copy-number alterations are frequently observed in HNSCC, the most common being distal amplification of chromosome 3 (3q26-3q29, the 3q amplicon) (TCGA, Nature 2012, 489:519-525), which includes the protein LZK, encoded by MAP3K13. This amplification occurs in 20% of HNSCC patients, with another 50% presenting with gains of chromosome 3q (Edwards et al., Cancer Res 2017, 77:4961-4972).
MLK4 is a serine- threonine kinase that phosphorylates JNK, p38 MAPK, and extracellular signal-regulated kinase (ERK) signaling pathways (Marusiak et al., Oncogene 2019, 38:2860-2875). MLK4 can directly phorphorylate MEK, leading to activation of the ERK pathway (Id). MLK4 also regulates activation of transcription factor NF-KB (Id). MLK4 is overexpressed in 23% of invasive breast cancers, particularly triple-negative breast cancer (TNBC) (Id). MLK4 also promotes TNBC chemoresistance by regulating the pro-survival response to DNA-damaging therapies (Mehlich et al. , Cell Death and Disease 2021, 12:1111).
MLK3 is another serine-threonine kinase, which is implicated in the NF-KB, ERK, JNK, and p38 MAP kinase pathways (Brancho et al., Mol Cell Biol 2005, 3670-3681). MLK3 signaling is implicated in several cancers, such as head and neck cancers harboring the llq amplicon.
Some examples of the disclosed compounds inhibit MLK activity, thereby decreasing the viability of cancer cells and/or suppressing tumor growth in vivo. For example, inhibiting LZK activity, decreases the viability of cancer cells with amplified MAP3K13 and/or suppresses tumor growth in vivo. The oncogene c-MYC identified as a downstream target that is regulated by catalytic activity of LZK. Advantageously, some implementations of the disclosed compounds may suppress LZK kinase-dependent stabilization of MYC and activation of the PI3K/AKT pathway. Additionally, some examples of the disclosed compounds promote almost complete cell death in cell line-based models of head and neck squamous cell carcinoma (HNSCC) and significant levels of cell death in lung squamous cell carcinoma (LSCC) models.
I. Terms and Abbreviations
The following explanations of terms and abbreviations are provided to better describe the present disclosure and to guide those of ordinary skill in the art in the practice of the present disclosure. As used herein, “comprising” means “including” and the singular forms “a” or “an” or “the” include plural references unless the context clearly dictates otherwise. The term “or” refers to a single element of stated alternative elements or a combination of two or more elements, unless the context clearly indicates otherwise.
Unless explained otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. The materials, methods, and examples are illustrative only and not intended to be limiting. Other features of the disclosure are apparent from the following detailed description and the claims.
The disclosure of numerical ranges should be understood as referring to each discrete point within the range, inclusive of endpoints, unless otherwise noted. Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, percentages, temperatures, times, and so forth, as used in the specification or claims are to be understood as being modified by the term “about.” Accordingly, unless otherwise implicitly or explicitly indicated, or unless the context is properly understood by a person of ordinary skill in the art to have a more definitive construction, the numerical parameters set forth are approximations that may depend on the desired properties sought and/or limits of detection under standard test conditions/methods as known to those of ordinary skill in the art. When directly and explicitly distinguishing aspects from discussed prior art, the aspect numbers are not approximates unless the word “about” is recited.
Although there are alternatives for various components, parameters, operating conditions, etc. set forth herein, that does not mean that those alternatives are necessarily equivalent and/or perform equally well. Nor does it mean that the alternatives are listed in a preferred order unless stated otherwise. Definitions of common terms in chemistry may be found in Richard J. Lewis, Sr. (ed.), Hawley’s Condensed Chemical Dictionary, published by John Wiley & Sons, Inc., 2016 (ISBN 978-1-118-13515-0).
In order to facilitate review of the various aspects of the disclosure, the following explanations of specific terms are provided:
Administration: To provide or give a subject an agent, such as one or more compounds provided herein, by any effective route. Exemplary routes of administration include, but are not limited to, oral, injection (such as subcutaneous, intramuscular, intradermal, intraperitoneal, intravenous, intraosseous, intracerebroventricular, intrathecal, and intratumoral), sublingual, rectal, transdermal, intranasal, vaginal and inhalation routes.
Aliphatic: A substantially hydrocarbon-based compound, or a radical thereof (e.g., C6Hn, for a hexane radical), including alkanes, alkenes, alkynes, including cyclic (monocyclic, bicyclic, and polycyclic) versions thereof, and further including straight- and branched-chain arrangements, and all stereo and position isomers as well. Unless expressly stated otherwise, an aliphatic group contains from one to twenty-five carbon atoms; for example, from one to fifteen, from one to ten, from one to six, or from one to four carbon atoms. An aliphatic chain may be substituted or unsubstituted. Unless expressly referred to as an “unsubstituted aliphatic,” an aliphatic group can either be unsubstituted or substituted. An aliphatic group can be substituted with one or more substituents (up to two substituents for each methylene carbon in an aliphatic chain, or up to one substituent for each carbon of a -C=C- double bond in an aliphatic chain, or up to one substituent for a carbon of a terminal methine group). A substituted aliphatic group includes at least one sp3 -hybridized carbon or two sp2-hybridized carbons bonded with a double bond or at least two sp-hybridized carbons bonded with a triple bond. Exemplary substituents include, but are not limited to, alkyl, alkenyl, alkynyl, alkoxy, alkylamino, alkylthio, acyl, aldehyde, amide, amino, aminoalkyl, aryl, arylalkyl, carboxyl, cyano, cycloalkyl, dialkylamino, halo, haloaliphatic, heteroaliphatic, heteroaryl, heterocycloaliphatic, hydroxyl, oxo, sulfonamide, sulfhydryl, thioalkoxy, or other functionality.
Alkoxy: A radical (or substituent) having the structure -OR, where R is a substituted or unsubstituted aliphatic group. Methoxy (-OCH3) is an exemplary alkoxy group. In a substituted alkoxy, R is alkyl substituted with a non-interfering substituent. R may be linear, branched, cyclic, or a combination thereof (e.g., cyclopropylmethoxy).
Alkyl: A hydrocarbon radical or substituent having a saturated carbon chain. The chain may be cyclic, branched or unbranched. Unless expressly referred to as an “unsubstituted alkyl,” an alkyl group can either be unsubstituted or substituted. Examples, without limitation, of alkyl groups include methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl and decyl. The term lower alkyl means the chain includes 1-10 carbon atoms. The terms alkenyl and alkynyl refer to hydrocarbon groups having carbon chains containing one or more double or triple bonds, respectively.
Alkylamino: A an amino group with an alkyl substituent, e.g., -N(H)R or -N(R)R', where R and R' are alkyl groups, and the bond to the remainder of the molecule is through the nitrogen atom. The alkyl portion may be straight, branched, or cyclic.
Alkylaryl: An alkyl-substituted aryl group.
Amino: A chemical functional group -N(R)R' where R and R' are independently hydrogen, alkyl, heteroalkyl, haloalkyl, aliphatic, heteroaliphatic, aryl (such as optionally substituted phenyl or benzyl), heteroaryl, alkylsulfano, or other functionality. A “primary amino” group is -NH2. “Mono-substituted amino” or “secondary amino” means a radical -N(H)R substituted as above and includes, e.g., methylamino, (l-methylethyl)amino, phenylamino, and the like. “Di-substituted amino” or “tertiary amino” means a radical -N(R)R' substituted as above and includes, e.g., dimethylamino, methylethylamino, di(l-methylethyl)amino, and the like.
Amino acid: An organic acid containing both a basic amino group (-NH2) and an acidic carboxyl group (-COOH). The 25 amino acids that are protein constituents are a-amino acids, i.e., the -NH2 group is attached to the carbon atom next to the -COOH group. As used herein, the term amino acid also encompasses D-amino acids and non-naturally occurring amino acids, e.g., amino acids such as ornithine and 2,4-diaminobutyric acid.
Aminoalkyl: A alkyl group including at least one amino substituent, wherein the bond to the remainder of the molecule is through a carbon atom of the alkyl group. The alkyl portion may be straight, branched, or cyclic.
Aryl: A monovalent aromatic carbocyclic group of, unless specified otherwise, from 6 to 15 carbon atoms having a single ring (e.g., phenyl) or multiple fused rings in which at least one ring is aromatic (e.g., quinoline, indole, benzodioxole, pyridine, pyrimidine, pyrazole, benzopyrazole, thiazole, isoxazole, oxazole, triazole, and the like), provided that the point of attachment is through an atom of an aromatic portion of the aryl group and the aromatic portion at the point of attachment contains only carbons in the aromatic ring. If any aromatic ring portion contains a heteroatom, the group is a heteroaryl and not an aryl. Aryl groups are monocyclic, bicyclic, tricyclic or tetracyclic. Unless expressly referred to as “unsubstituted aryl,” an aryl group can either be unsubstituted or substituted. Arylalkyl: An aryl-substituted alkyl group, e.g., benzyl, wherein the bond to the remainder of the molecule is through a carbon atom of the alkyl group.
Azaalkyl: A heteroalkyl group including a nitrogen heteroatom. The heteroalkyl group may be straight, branched, or cyclic. An azaalkyl group is attached to the remainder of the molecule via the nitrogen heteroatom. Unless expressly referred to as “unsubstituted azaalkyl,” an azaalkyl group can either be unsubstituted or substituted.
Derivative: A compound that is derived from a similar compound or a compound that can be imagined to arise from another compound, for example, if one atom is replaced with another atom or group of atoms. The latter definition is common in organic chemistry. In biochemistry, the word is used for compounds that at least theoretically can be formed from the precursor compound.
Dissociation constant (KD): A measure of binding affinity. KD is the molar concentration of ligand at which half the binding sites on the target protein are occupied by the ligand at equilibrium. A smaller Kd indicates increased binding affinity.
DLK: Dual leucine zipper-bearing kinase.
ESCC: Esophageal squamous cell carcinoma.
Excipient: A physiologically inert substance that is used as an additive in a pharmaceutical composition. As used herein, an excipient may be incorporated within particles of a pharmaceutical composition, or it may be physically mixed with particles of a pharmaceutical composition. An excipient can be used, for example, to dilute an active agent and/or to modify properties of a pharmaceutical composition. Examples of excipients include but are not limited to polyvinylpyrrolidone (PVP), tocopheryl polyethylene glycol 1000 succinate (also known as vitamin E TPGS, or TPGS), dipalmitoyl phosphatidyl choline (DPPC), trehalose, sodium bicarbonate, glycine, sodium citrate, and lactose.
Heteroaliphatic: An aliphatic compound or group having at least one carbon atom in the chain and at least one heteroatom, i.e., one or more carbon atoms has been replaced with a non-carbon atom, typically nitrogen, oxygen, phosphorus, silicon, or sulfur. Heteroaliphatic compounds or groups may be substituted or unsubstituted, branched or unbranched, cyclic or acyclic, and include "heterocycle", "heterocyclyl", "heterocycloaliphatic", or "heterocyclic" groups. Heteroalkyl refers to an alkyl or cycloalkyl radical having at least one carbon atom in the chain and containing at least one heteroatom, such as N, O, S, or S(O)n (where n is 1 or 2). Unless expressly referred to as “unsubstituted aliphatic,” an aliphatic group can either be unsubstituted or substituted. Heteroaryl: An aromatic compound or group having at least one heteroatom, i.e., one or more carbon atoms in the ring has been replaced with a non-carbon atom, typically nitrogen, oxygen, phosphorus, silicon, or sulfur. Unless expressly referred to as “unsubstituted heteroaryl,” a heteroaryl group can either be unsubstituted or substituted.
Heterocyclic: Refers to a closed-ring compound, or radical thereof as a substituent bonded to another group, particularly other organic groups, where at least one atom in the ring structure is other than carbon, and typically is oxygen, sulfur and/or nitrogen. Unless expressly referred to as “unsubstituted heterocyclic,” a heterocyclic group can either be unsubstituted or substituted.
HNSCC: Head and neck squamous cell carcinoma.
IAP: Inhibitor of apoptosis protein. Includes cIAP - cellular IAP 1, and xIAP - X-linked IAP.
LSCC: Lung squamous cell carcinoma.
LZK: Leucine zipper-bearing kinase, a regulator of neuronal degeneration, e.g., following neuronal injury and/or in neurodegenerative diseases.
MAP3K: Mitogen-activated kinase kinase kinase
MDM2: Mouse double minute 2 homolog
MLK: Mixed lineage kinase, a family of serine/threonine protein kinases that regulate signaling by p38 mitogen-activated protein kinase (MAPK) and c-Jun amino-terminal kinase (JNK) pathways. MLKs include MLK1 (MAP3K9), MLK2 (MAP3K10), MLK3 (MAP3K11), DLK (MAP3K12), LZK (MAP3K13), and ZAK1 (MAP3K20), among others.
Pharmaceutically acceptable: A substance that can be taken into a subject without significant adverse toxicological effects on the subject. The term "pharmaceutically acceptable form" means any pharmaceutically acceptable derivative or variation, such as stereoisomers, stereoisomer mixtures, enantiomers, solvates, hydrates, isomorphs, polymorphs, pseudomorphs, neutral forms, salt forms, and prodrug agents.
Pharmaceutically acceptable carrier: The pharmaceutically acceptable carriers (vehicles) useful in this disclosure are conventional. Remington: The Science and Practice of Pharmacy, The University of the Sciences in Philadelphia, Editor, Lippincott, Williams, & Wilkins, Philadelphia, PA, 21st Edition (2005), describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compositions and additional pharmaceutical agents. In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. In some examples, the pharmaceutically acceptable carrier may be sterile to be suitable for administration to a subject (for example, by parenteral, intramuscular, or subcutaneous injection). In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate. In some examples, the pharmaceutically acceptable carrier is a non-naturally occurring or synthetic carrier. The carrier also can be formulated in a unit-dosage form that carries a preselected therapeutic dosage of the active agent, for example in a pill, vial, bottle, or syringe.
Pharmaceutically acceptable salt: A biologically compatible salt of a compound that can be used as a drug, which salts are derived from a variety of organic and inorganic counter ions well known in the art and include, by way of example only, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, and the like; and when the molecule contains a basic functionality, salts of organic or inorganic acids, such as hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate, oxalate, and the like. Pharmaceutically acceptable acid addition salts are those salts that retain the biological effectiveness of the free bases while formed by acid partners that are not biologically or otherwise undesirable, e.g., inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, as well as organic acids such as acetic acid, trifluoroacetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, benzene sulfonic acid (besylate), cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-loluenesul Ionic acid, salicylic acid and the like. Pharmaceutically acceptable base addition salts include those derived from inorganic bases such as sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like. Exemplary salts are the ammonium, potassium, sodium, calcium, and magnesium salts. Salts derived from pharmaceutically acceptable organic non-toxic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, ethylenediamine, glucosamine, methylglucamine, theobromine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins, and the like. Exemplary organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine. (See, for example, S. M. Berge, et al., “Pharmaceutical Salts,” J. Pharrn. Sci., 1977; 66:1-19, which is incorporated herein by reference.) Stereoisomers: Isomers that have the same molecular formula and sequence of bonded atoms, but which differ only in the three-dimensional orientation of the atoms in space.
Subject: An animal (human or non-human) subjected to a treatment, observation or experiment. Includes both human and veterinary subjects, including human and non-human mammals, such as rats, mice, cats, dogs, pigs, horses, cows, and non-human primates. In some aspects, the subject has cancer, such as head and neck squamous cell carcinoma or lung squamous cell carcinoma.
Substituent: An atom or group of atoms that replaces another atom in a molecule as the result of a reaction. The term "substituent" typically refers to an atom or group of atoms that replaces a hydrogen atom, or two hydrogen atoms if the substituent is attached via a double bond, on a parent hydrocarbon chain or ring. The term “substituent” may also cover groups of atoms having multiple points of attachment to the molecule, e.g., the substituent replaces two or more hydrogen atoms on a parent hydrocarbon chain or ring. In such instances, the substituent, unless otherwise specified, may be attached in any spatial orientation to the parent hydrocarbon chain or ring. Exemplary substituents include, for instance, alkyl, alkenyl, alkynyl, alkoxy, alkylamino, alkylthio, acyl, aldehyde, amido, amino, aminoalkyl, aryl, arylalkyl, arylamino, carbonate, carboxyl, cyano, cycloalkyl, dialkylamino, halo, haloaliphatic (e.g., haloalkyl), haloalkoxy, heteroaliphatic, heteroaryl, heterocycloaliphatic, hydroxyl, oxo, sulfonamide, sulfhydryl, thio, and thioalkoxy groups. Substituents can be further substituted, unless expressly stated otherwise or context dictates otherwise.
Substituted: A fundamental compound, such as an aryl or aliphatic compound, or a radical thereof, having coupled thereto one or more substituents, each substituent typically replacing a hydrogen atom on the fundamental compound. A person of ordinary skill in the art will recognize that compounds disclosed herein may be described with reference to particular structures and substituents coupled to such structures, and that such structures and/or substituents also can be further substituted, unless expressly stated otherwise or context dictates otherwise. Solely by way of example and without limitation, a substituted aryl compound may have an aliphatic group coupled to the closed ring of the aryl base, such as with toluene. Again solely by way of example and without limitation, a long-chain hydrocarbon may have a hydroxyl group bonded thereto. Tautomers: Constitutional isomers of organic compounds that differ only in the position of the protons and electrons, and are interconvertible by migration of a hydrogen atom. Tautomers ordinarily exist together in equilibrium.
Therapeutically effective amount or dose: An amount sufficient to provide a beneficial, or therapeutic, effect to a subject or a given percentage of subjects.
Treating or treatment: With respect to disease, either term includes (1) preventing the disease, e.g., causing the clinical symptoms of the disease not to develop in an animal that may be exposed to or predisposed to the disease but does not yet experience or display symptoms of the disease, (2) inhibiting the disease, e.g., arresting the development of the disease or its clinical symptoms, or (3) relieving the disease, e.g., causing regression of the disease or its clinical symptoms.
ZAK: Zipper sterile-a motif kinase
II. Mixed Lineage Kinase Inhibitors
The disclosed mixed lineage kinase (MLK) inhibitors include compounds, or stereoisomers, tautomers, or pharmaceutically acceptable salts thereof, having a general formula I: where each bond represented by - is a single or double bond as needed to satisfy valence requirements. Ring A is a monocyclic or bicyclic heteroaryl ring. In some aspects, Ring A is , where each bond represented by s a single or double bond as needed to satisfy valence requirements. The - X1 ( R5 )- moiety is -C(R5)-, -C(R5)-C(H)-, -C(H)-C(R5)-, -C(R5)-N-, -N-C(R5)-, or -N(R5)-. X2 is N or C. X3 is N or C(H). One or two of X^X3 comprises N. X4 is C(H) or S. X5 is -N(H)- or absent. Y1 is QR1) or N. Y2 is C(R2) or N. Y3 is C(R3) or N. Y4 is N or C(R6). Y5 is C(R7) or N. Y6 is C(R8) or N. One or two of Y1 - Y6 are N. If two of Y 1 -Y6 are N, the nitrogens may not be immediately adjacent to one another. At least one of Y1 -Y3 or Y6 is other than C(H). Two, three or four of Y7-Y10 independently are N or N(R9) and the others of Y7-Y10 are C(R10); the nitrogen atoms may be immediately adjacent one another or separated by at least one carbon atom. In some aspects, two of Y7-Y10 independently are N or N(R9), and the other two of Y7-Y10 are C(R10). R1 is cyano, perhaloalkyl, H, alkyl, or perhaloalkoxy. R2 is H, alkoxy, perhaloalkyl, perhaloalkoxy, haloalkoxy, haloalkyl, cyano, alkyl, cyanoalkyl, amino, heteroarylalkoxy, heteroalkyl, amido, halo, alkenyl, or haloalkenyl, or R1 and R2 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring. R3 is H, amino, alkylamino, aminoalkyl, alkoxy, or -N(H)C(O)R' where R' is alkyl, or R2 and R3 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring. R4 is aliphatic, azaalkyl, aryl, or amino. R5 is aliphatic, heteroaliphatic, or alkylamino. R6 and R7 independently are H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano. R8 is H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano or R8 and R1 together with the atoms to which they are attached form a 5- or 6-membered aryl heteroaryl ring. Each R9 independently is H or alkyl. Each R10 independently is H, alkyl, or cyano. In any of the foregoing or following aspects, the halogen may be fluorine. In any of the foregoing or following implementations, each substituent may be substituted or unsubstituted unless otherwise specified or unless context indicates otherwise (e.g., a cyano group is not substituted).
In some aspects, the compound has a general formula I A or IB: where each bond represented by - is a single or double bond as needed to satisfy valence requirements.
In any of the foregoing or following aspects, Y4 may be N. In some aspects, Y1 and Y4 are N. In any of the foregoing or following aspects, at least one of Y1 -Y3 or Y6 may be other than C(H).
R1 is cyano, perhaloalkyl, H, alkyl, or perhaloalkoxy. Exemplary R1 groups include, but are not limited to, cyano, -H, -OCF3, or -CF3. In particular implementations, R1 is cyano, -H, or -OCF3.
R2 is H, alkoxy, perhaloalkyl, perhaloalkoxy, haloalkoxy, haloalkyl, cyanoalkyl, alkyl, cyano, amino, heteroarylalkoxy, heteroalkyl, amido, halo, alkenyl, or haloalkenyl, or R1 and R2 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring. In some aspects, the alkyl or alkoxy portion of R2 is C1-C6 alkyl or alkoxy. For example, R2 may be methoxy, fluoromethoxy, or trifluoromethoxy. In some implementations, at least a portion of the alkyl portion of R2 is cycloalkyl, such as cyclopropyl or bicyclo [l.l.l]pentyl. The alkyl or alkoxy portion may be halogenated. In certain implementations, R2 is fluorinated. Exemplary R2 groups include, but are not limited to -CH3, -OCH3, -OCF3, -CF3,-CN, -H, -OCHF2,
, or . In some implementations, R1 and R2 together with the atoms to which they are attached form a 5- or 6-membered aryl heteroaryl ring. In one non-limiting example, ring A is
R3 is H, amino, alkylamino, aminoalkyl, alkoxy, or -N(H)C(O)R' where R' is alkyl, or R2 and
R3 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring. In some aspects, R3 is H, -NH2, -N(H)C(O)CH3, methyl, , or In some implementations, R2 and R3 together with the atoms to which they are attached form a 5- or
6-membered aryl or heteroaryl ring. In one example, ring A is
In some aspects, ring A is where Y1 is C(H) or N, Y2 is C(R2), Y3 is C(R3), Y4 is
N, and Y6 is C(H). In certain aspects, Y1 and Y4 are N. In some aspects, ring A is where Y1 is C(H) or N, Y2 is C(R2), Y3 is C(R3), Y4 is N, and Y5 is C(H). In some implementations, R2 is alkyl, H, alkoxy, perhaloalkyl, perhaloalkoxy, haloalkoxy, haloalkyl, cyano, or cyanoalkyl, and R3 is H, amino, alkylamino, or aminoalkyl. In particular examples, the halogen is fluorine. R6-R8 independently are H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano. In some aspects, R6-R8 are H, methyl, -OCH3, -CF3, -OCF3, or -CN. In certain implementations, R6-R8 are H. In some implementations, Y4 is N and R6 is therefore absent. Ring A binds to remainder of the compound through Y5 or Y6. Thus, either R7 or R8 will be absent.
Each R9 independently is H or alkyl. In some aspects, each R9independently is H or methyl. Each R10 independently is H, alkyl, or cyano. In some implementations, R10 independently is H, methyl, or cyano.
In any of the foregoing or following aspects, unless otherwise specified, the aliphatic, heteroaliphatic, or azaalkyl groups may be straight, branched, cyclic, or any combination thereof. In some aspects, ring A is: where R11 and R12 are H, alkyl, perhaloalkyl, alkoxy, perhaloalkoxy, cyano, or amino.
In certain examples, ring A is:
-H.
In some implementations, the compound has a structure according to formula IC, ID, IE, or
IF:
In any of the foregoing or following aspects, -X^R5)- is -C(R5)-, -C(R5)-C(H)-, -C(H)-C(R5)-, -C(R5)-N-, -N-C(R5)-, or -N(R5)-. In some aspects, -X^R5)- is -C(H)-C(R5)-.
In some aspects, the compound has formula IC, R1 is cyano or perhaloalkyl, and R2 and R3 are H. R1 may be cyano or trifluoromethyl. In certain aspects, R1 is cyano. In certain implementations, the compound has formula IC, R1 is H, and R1 and R2 together with the atoms to which they are bound form a 5- or 6-membered aryl or heteroaryl ring.
In some aspects, the compound has formula ID, R3 is H and R2 is other than H. In some aspects, the compound has formula ID, and R2 and R3 are other than H. In some aspects, the compound has formula ID, R2 is H, and R3 is other than H. In certain implementations, the compound has formula ID, and R2 and R3 together with the atoms to which they are bound form a 5- or 6-membered aryl or heteroaryl ring.
In some aspects, the compound has formula IE, R2 is H, alkyl, alkoxy, amino, or cyano, R3 is
H, amino, or alkyl, and R8 is H or alkyl. In some examples, the alkyl or alkoxy is methyl or methoxy, respectively.
In some aspects, the compound has formula IF, R2 is haloalkyl, perhaloalkyl, alkoxy, haloalkoxy, perhaloalkoxy, cyano, or H, R3 is amino, aminoalkyl, or alkylamino, and R7 is H or alkyl. In certain implementations, R7 is H, R3 is -NH2, and R2 is -CF3, -CN,
-H, -OCH3, -OCHF2, OCF3,
In any of the foregoing or following embodiments, R3 may be H, amino, aminoalkyl, or alkylamino, and R2 may be alkyl, alkoxy, haloalkoxy, perhaloalkoxy, perhaloalkyl, haloalkyl, or cyano. In certain examples, R2 is -CH3 and R3 is -H. In some aspects, R3 is -NH2, or where R4 is aliphatic, azaalkyl, aryl, or amino. R5 is aliphatic, heteroaliphatic, aminoalkyl, or alkylamino.
In some aspects, R4 is C1-C5 alkyl, azacycloalkyl, heterocycloalkyl, or -N(R)R' where R and R' are independently hydrogen, alkyl, or heteroalkyl. In some implementations, the azacycloalkyl or heterocycloalkyl is fused or spiro azabicycloalkyl or heterobicycloalkyl. For example, the azabicycloalkyl may be an azabicyclo[3.2.0]heptan-3-yl or azabicyclo[3.1.0]hexan-3-yl. In certain implementations, R4 is 3, 3 -difluoro- 1-pyrrolidinyl, isopropyl, 2-methylpropyl, cyclopropylmethyl, or
In some aspects, R5 is alkyl, heteroalkyl, alkylamino, or azaalkyl. In certain implementations, R5 comprises a cycloalkyl moiety, a cycloheteroalkyl moiety, a azacycloalkyl moiety, or any combination thereof. In some examples, R5 is fused or spiro bicycloalkyl, aliphatic, or heteroaliphatic. In certain aspects, Z is -C(O)CH3, H, methyl, ethyl, isopropyl, 2-methylpropyl, cyclopropyl, cyclopropylmethyl, cyclobutyl, cyclopentyl, cyclohexyl,
-(CH2)2(OCH2CH2)nOCH3 where n is an integer from 1 to 10, some
H implementations, Z is -C(O)CH3. In some aspects, has a stereochemistry
In one implementation, R5 is ”^^NHZ where Z is -C(O)CH3. In another implementation, R5 is where Z is -C(O)CH3. In some implementations, R5 is , -(CH2)3N(CH3)2, or
-CH2OH.
In some aspects, the compound is:
, where R'-R4 and R8 are as previously defined, and R11 and R12 are H, alkyl, perhaloalkyl, alkoxy, perhaloalkoxy, or cyano. In some aspects, R4 is isopropyl, -C(H)(OH)-C(CH3)2, cyclopropyl, or
. In certain implementations, R1 is -CN or -CF3; R2 is -OCH3, -OCF3, -CF3,-CN, -OCHF2,
-CN, -CH3, or H; R11 and R12 independently are -CF3, -CN, -H, -OCH3, or -OCF3. and Z are as previously defined. In particular implementations, the compound is
where Z is aliphatic; and R4 is where Ra and Rb together with the atoms to which they are bound form a fused cycloaliphatic or heterocycloaliphatic ring, or Ra is cycloaliphatic and Rb is -H, or R4 is or where Ra is cycloaliphatic or heterocycloaliphatic. In some implementations, R2 is alkyl, such as methyl. Exemplary cycloaliphatic and heterocycloaliphatic R4 groups include, but are not limited to fused and spiro is N(H), or (ii) R3 is H, aminoalkyl, alkoxy, ; or R'C(O)N(H)- where R' is alkyl, or (iii) R2 is alkoxy, cyanoalkyl, amino, or heteroarylalkoxy, or (iv) one of R1 and R7 is other than -H, or (v) only one of X'-X4 comprises N, or (vi) X3 is C(H), or (vii) X4 is S, or (vi) -X^R5)- is -C(R5)-C(H)-, -C(H)-C(R5)-, -C(R5)-N-, or -N-C(R5)-, or (viii) R1 and R2 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring. In some aspects, if ring A is where R3 is amino or alkylamino and is , then (i) X5 is N(H), or (ii) R1 is cyano, perhaloalkyl, or perhaloalkoxy, or (iii) R2 is cyano, cyanoalkyl, amino, or heteroalkylalkoxy, or (iv) R7 is perhaloalkyl, perhaloalkoxy, or cyano, or (v) R4 is aryl, or (vi) R1 and R2 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring, or (viii) R2 and R3 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring.
In some aspects, if X5 is N(H) and then R5 is not
, or (ii) R4 is not methyl or azacycloalkyl, or (iii) R5 is In some aspects, if X5 is N(H), and ring A is
In some aspects, if X5 is absent and then R5 is not In some aspects, if X5 is absent and
In some aspects, if X5 is N(H) an or (ii) Y4 is not N, or (iii) R2 is not -H, -CN, or -CF3, or (iv) R1 is not -H, -CN, or -CF3. In some aspects, if X5 is N(H) and , then (i) R4 is not cycloalkyl or heterocycloalkyl, or (ii) Y4 is not N, or (iii) R1 is not -CN, or (iv) one of R2, R3, and R8 is other than In some aspects, if Ring A is and X5 is N(H), then R5 is not
Exemplary MLK inhibitors include the compounds shown in Tables 1-17, as well as other stereoisomers, tautomers, and pharmaceutically acceptable salts thereof. Table 1
Table 2
Table 3
Table 4 Table 5
Table 6
Table 7 Table 8
Table 10
Table 11 Table 12
Table 13
Table 14
Table 15
Table 16
RECTIFIED SHEET (RULE 91)
In any of the foregoing or following implementations, the MLK inhibitor may exhibit membrane permeability and/or water solubility. Permeability and solubility are related to the topological polar surface area (TPSA) and molecular weight of the MLK inhibitor. A desirable solubility may be provided by molecules having a TPSA of > 0.1 x MW (or TPSA/MW ratio > 0.1) (see, e.g., Maple et al., Med Chem Commun 2019, 10:1755-1764). In some aspects, water solubility is enhanced by forming the MLK inhibitor as a common salt (e.g., acetates, oxalates, methane sulfonates), or from common acids such as hydrochloric acid or sulfuric acid. Advantageously, because some examples of the MLK inhibitors are catalytic in nature, a relatively low aqueous solubility may not be a deterrent. A desirable permeability may be provided by molecules having a TPSA of < 140 (Ibid.). Thus, in some aspects, the MLK inhibitor has a TPSA of from 0.1 x MW to 140.
In any of the foregoing or following aspects, the MLK inhibitor may have an MLK dissociation constant KD of less than 200 nM, less than 150 nM, less than 100 nM, less than 75 nM, less than 50 nM, less than 25 nM, less than 10 nM, or even less than 5 nM . In any of the foregoing or following aspects, the MLK inhibitor may be an LZK inhibitor that selectively binds to LZK over dual leucine zipper kinase (DLK). For example, the LZK inhibitor may exhibit at least 2-fold selectivity towards LZK over DLK, as evidenced by the ratio of the LZK and DLK dissociation constants KD. In some aspects, the LZK inhibitor exhibits at least 2-fold selectivity, at least 3-fold selectivity, at least 5-fold selectivity, at least 10-fold selectivity, at least 25-fold selectivity, at least 50-fold selectivity, at least 100-fold selectivity, or even at least 150-fold selectivity for LZK over DLK. For example, compound 207 has an LZK KD of ~ 1 nM and exhibits 180-fold selectivity for LZK over DLK.
- 52 -
SUBSTITUTE SHEET ( RULE 26)
III. Pharmaceutical Compositions
The disclosure also encompasses pharmaceutical compositions comprising one or more of the disclosed MLK inhibitors. A pharmaceutical composition comprises a compound as disclosed herein and a pharmaceutically acceptable excipient.
The compounds described herein can be used to prepare therapeutic pharmaceutical compositions. The compounds may be added to the compositions in the form of a salt or solvate. For example, in cases where compounds are sufficiently basic or acidic to form stable nontoxic acid or base salts, administration of the compounds as salts may be appropriate. Examples of pharmaceutically acceptable salts are organic acid addition salts formed with acids that form a physiological acceptable anion, for example, tosylate, methanesulfonate, acetate, citrate, malonate, tartrate, succinate, benzoate, ascorbate, a-ketoglutarate, and b-glycerophosphate. Suitable inorganic salts may also be formed, including hydrochloride, halide, sulfate, nitrate, bicarbonate, and carbonate salts.
Pharmaceutically acceptable salts may be obtained using procedures known to persons of ordinary skill in the art, for example by reacting a sufficiently basic compound, such as an amine, with a suitable acid to provide a physiologically acceptable ionic compound. Alkali metal (for
- 53 -
SUBSTITUTE SHEET ( RULE 26) example, sodium, potassium or lithium) or alkaline earth metal (for example, calcium) salts of carboxylic acids can also be prepared by analogous methods.
The compounds of the formulas described herein can be formulated as pharmaceutical compositions and administered to a mammalian host, such as a human or veterinary patient, in a variety of forms. The forms can be specifically adapted to a chosen route of administration, e.g., oral or parenteral administration, by intravenous, intramuscular, topical or subcutaneous routes.
The compounds described herein may be systemically administered in combination with a pharmaceutically acceptable vehicle, such as an inert diluent or an assimilable edible carrier. For oral administration, compounds can be enclosed in hard or soft shell gelatin capsules, compressed into tablets, or incorporated directly into the food of a patient's diet. Compounds may also be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations typically contain at least 0.1% of active compound. The percentage of the compositions and preparations can vary and may conveniently be from about 2% to about 60% of the weight of a given unit dosage form. The amount of active compound in such therapeutically useful compositions is such that an effective dosage level can be obtained.
The tablets, troches, pills, capsules, and the like may also contain one or more of the following excipients: binders such as gum tragacanth, acacia, com starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as com starch, potato starch, alginic acid and the like; and a lubricant such as magnesium stearate. A sweetening agent such as sucrose, fmctose, lactose or aspartame; or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring, may be added. When the unit dosage form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier, such as a vegetable oil or a polyethylene glycol. Various other materials may be present as coatings or to otherwise modify the physical form of the solid unit dosage form. For instance, tablets, pills, or capsules may be coated with gelatin, wax, shellac or sugar and the like. A symp or elixir may contain the active compound, sucrose or fmctose as a sweetening agent, methyl and propyl parabens as preservatives, a dye and flavoring such as cherry or orange flavor. Any material used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non-toxic in the amounts employed. In addition, the active compound may be incorporated into sustained-release preparations and devices.
The active compound may be administered intravenously or intraperitoneally by infusion or injection. Solutions of the active compound or its salts can be prepared in water, optionally mixed with a nontoxic surfactant. Dispersions can be prepared in glycerol, liquid polyethylene glycols, triacetin, or mixtures thereof, or in a pharmaceutically acceptable oil. Under ordinary conditions of storage and use, preparations may contain a preservative to prevent the growth of microorganisms.
Pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions, dispersions, or sterile powders comprising the active ingredient adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. The ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage. The liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions, or by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thiomersal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers, or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by agents delaying absorption, for example, aluminum monostearate and/or gelatin.
Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation can include vacuum drying and freeze drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile-filtered solutions.
Useful dosages of the compounds described herein can be determined by comparing their in vitro activity, and in vivo activity in animal models. Methods for the extrapolation of effective dosages in mice, and other animals, to humans are known to the art; for example, see U.S. Patent No. 4,938,949 (Borch et al.). The amount of a compound, or an active salt or derivative thereof, required for use in treatment will vary not only with the particular compound or salt selected but also with the route of administration, the nature of the condition being treated, and the age and condition of the patient, and will be ultimately at the discretion of an attendant physician or clinician. IV. Methods of Use
The disclosed compounds are MLK inhibitors. In some aspects, a method of inhibiting MLK activity includes contacting a cell expressing an MLK with an effective amount of a compound as disclosed herein, thereby inhibiting MLK activity. In some implementations, the MLK is MLK1 (MAP3K9), MLK2 (MAP3K10), MLK3 (MAP3K11), MLK4 (MAP3K21), DLK (MAP3K12), LZK (MAP3K13), ZAK1 (MAP3K20), or any combination thereof. In certain implementations, the MLK is LZK, MLK3, or MLK4. In particular examples, the MLK is LZK.
Contacting may be performed in vivo, in vitro, or ex vivo. In any of the foregoing or following aspects, inhibiting MLK activity may further inhibit cell cycle progression, reduce c-MYC expression, inhibit c-Jun N-terminal kinase (JNK) pathway signaling, inhibit PI3K/AKT pathway signaling, inhibit cyclin dependent kinase 2 (CDK2) activity, inhibit extracellular signal-regulated kinase (ERK) pathway signaling, NF-KB signaling, or any combination thereof. In some aspects, the inhibition or reduction is at least 10%, at least 25%, at least 50%, or at least 75% compared to the cell cycle progression, c-MYC expression, JNK pathway signaling, PI3K/AKT pathway signaling, CDK2 activity, ERK pathway signaling, or NF-KB signaling in the absence of the MLK inhibitor. In any of the foregoing or following aspects, the cell may be characterized by amplification of chromosome 3q, amplification of chromosome llq, overexpression of a mitogen-activated protein kinase kinase kinase (MAP3K), or any combination thereof. In some implementations, the MAP3K is MAP3K13 or MAP3K21.
In any of the foregoing or following aspects, the cell may be a cancer cell. Several cancers are driven by MLKs. For example, LZK has been implicated in head and neck squamous cell carcinoma (HNSCC), a lung squamous cell carcinoma (LSCC), esophageal squamous cell carcinoma (ESCC), hepatocellular carcinoma , ovarian cancer, small cell lung cancer, and neuroendocrine prostate cancer. MLK3 is an amplified driver in about 10% of head and neck cancers harboring the 1 Iq amplicon. MLK4 has been described as a novel driver in 25% of triple negative breast cancers harboring amplification in MAP3K21. In some aspects, the cell is an HNSCC cell, an LSCC cell, a hepatocellular carcinoma cell, an ovarian cancer cell, a small cell lung cancer cell, a neuroendocrine prostate cancer cell, an esophageal cancer cell (e.g., an esophageal squamous cell carcinoma (ESCC) cell or an esophageal adenocarcinoma cell), or a breast cancer cell (e.g., a triple negative breast cancer (TNBC) cell). In certain aspects, the cell is an HNSCC, LSCC, ESCC, or TNBC cell.
In any of the foregoing aspects, contacting the cell with the compound may comprise administering a therapeutically effective amount of the compound, or an amount of a pharmaceutical composition comprising the therapeutically effective amount of the compound, to a subject. The subject may be identified as a subject that may benefit from MLK inhibition. In some aspects, the subject has a disease or condition characterized at least in part by MLK overexpression. In some implementations, the MLK is LZK, MLK3, or MLK4. In particular examples, the MLK is LZK. In certain aspects, the disease or condition is cancer. In some examples, the cancer is HNSCC, LSCC, hepatocellular carcinoma, ovarian cancer, small cell lung cancer, neuroendocrine prostate cancer, esophageal cancer (e.g., esophageal squamous cell carcinoma or esophageal adenocarcinoma), or breast cancer (e.g., TNBC). In certain aspects, the cancer is HNSCC, LSCC, ESCC, or TNBC. In any of the foregoing implementations, administering the therapeutically effective amount of the compound, or the amount of the pharmaceutical composition, may decrease viability of the cancer cells, inhibit tumor growth, or a combination thereof. In some aspects, the viability is decreased or the tumor growth is inhibited by at least 10%, at least 25%, at least 50%, or at least 75% compared to viability or tumor growth in the absence of the MLK inhibitor.
The compound or pharmaceutical composition may be administered to the subject through any suitable route. In some aspects, the compound or pharmaceutical composition is administered to the subject by the oral route or in a single bolus delivery, via continuous delivery (for example, continuous transdermal, mucosal or intravenous delivery) over an extended time period, or in a repeated administration protocol (for example, by an hourly, daily or weekly, repeated administration protocol). In some aspects, the compound or pharmaceutical composition is administered to the subject by injection. The therapeutically effective dosages of the agents can be provided as repeated doses within a prolonged prophylaxis or treatment regimen that will yield clinically significant results to alleviate one or more symptoms or detectable conditions associated with a targeted condition as set forth herein. Determination of effective dosages in this context is typically based on animal model studies followed up by human clinical trials and is guided by administration protocols that significantly reduce the occurrence or severity of targeted disease symptoms or conditions in the subject. Suitable models in this regard include, for example, murine, rat, avian, porcine, feline, non-human primate, and other accepted animal model subjects known in the art. Alternatively, effective dosages can be determined using in vitro models. Using such models, only ordinary calculations and adjustments are required to determine an appropriate concentration and dose to administer a therapeutically effective amount of the compound (for example, amounts that are effective to elicit a desired immune response or alleviate one or more symptoms of a targeted disease). In alternative aspects, an effective amount or effective dose of the agents may simply inhibit or enhance one or more selected biological activities correlated with a disease or condition, as set forth herein, for either therapeutic or diagnostic purposes. The actual dosages of the agents will vary according to factors such as the disease indication and particular status of the subject (for example, the subject’s age, size, fitness, extent of symptoms, susceptibility factors, and the like), time and route of administration, other drugs or treatments being administered concurrently, as well as the specific pharmacology of the agent for eliciting the desired activity or biological response in the subject. Dosage regimens can be adjusted to provide an optimum prophylactic or therapeutic response. A therapeutically effective amount is also one in which any toxic or detrimental side effects of the agent is outweighed in clinical terms by therapeutically beneficial effects. A non-limiting range for a therapeutically effective amount of a compound according to any one of formulas I- IV within the methods and formulations of the disclosure is 0.001 mg/kg body weight to 100 mg/kg body weight, such as 0.01 mg/kg body weight to 20 mg/kg body weight, 0.01 mg/kg body weight to 10 mg/kg body weight 0.05 mg/kg to 5 mg/kg body weight, or 0.1 mg/kg to 2 mg/kg body weight. Dosage can be varied by the attending clinician to maintain a desired concentration at a target site (for example, systemic circulation). Higher or lower concentrations can be selected based on the mode of delivery, for example, trans -epidermal or oral delivery versus intravenous or subcutaneous delivery. Dosage can also be adjusted based on the release rate of the administered formulation, for example, of sustained release oral versus injected particulate or transdermal delivery formulations, and so forth.
In any of the foregoing or following implementations, the therapeutically effective amount may be administered at intervals for a period of time effective to provide a therapeutic effect, e.g., decreased cancer cell viability and/or tumor growth inhibition. In some aspects, the intervals are once daily. In other implementations, the therapeutically effective amount may be divided into two or more doses administered at intervals in a 24-hour period. In some aspects, the effective period of time is from one day to several months, such as from one day to 12 months, three days to six months, seven days to three months, 7-30 days, or 7-14 days. In certain aspects, the effective period of time may be even longer than 12 months, such as a period of years.
V. Representative Aspects
Certain representative aspects are exemplified in the following numbered clauses.
1. A compound, or a stereoisomer, tautomer, or pharmaceutically acceptable salt thereof, having a general formula I: or wherein each bond represented by is a single or double bond as needed to satisfy valence requirements; -X^R5)- is -C(R5)-, -C(R5)-C(H)-, -C(H)-C(R5)-, -C(R5)-N-, -N-C(R5)-, or -N(R5)-; X2 is N or C; X3 is N or CH, wherein one or two of X^X3 comprises N; X4 is CH or S; X5 is -N(H)- or absent; Y1 is QR1) or N; Y2 is C(R2) or N; Y3 is C(R3) or N; Y4 is N or C(R6); Y5 is C(R7) or N; Y6 is C(R8) or N; one or two of Y^Y6 are N, and at least one of Y^Y3 or Y6 is other than C(H); two, three, or four of Y7-Y10 independently are N or N(R9), and the others of Y7-Y10 are C(R10); R1 is cyano, perhaloalkyl, H, alkyl, or perhaloalkoxy; R2 is H, alkoxy, perhaloalkyl, perhaloalkoxy, haloalkoxy, haloalkyl, cyano, alkyl, cyanoalkyl, amino, or heteroarylalkoxy, or R1 and R2 together with the atoms to which they are attached form a 5- or 6-membered substituted or unsubstituted aryl or substituted or unsubstituted heteroaryl ring; R3 is H, amino, alkylamino, aminoalkyl, alkoxy, or R'C(O)N(H)- where R' is alkyl, or R2 and R3 together with the atoms to which they are attached form a 5- or 6-membered substituted or unsubstituted aryl or substituted or unsubstituted heteroaryl ring; R4 is substituted or unsubstituted aliphatic, substituted or unsubstituted azaalkyl, or aryl; R5 is substituted or unsubstituted aliphatic, substituted or unsubstituted heteroaliphatic, or substituted or unsubstituted alkylamine; R6 and R7 independently are H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano; R8 is H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano or R8 and R1 together with the atoms to which they are attached form a 5- or 6-membered substituted or unsubstituted aryl or substituted or unsubstituted heteroaryl ring; each R9 independently is H or alkyl; and each R10 independently is H, alkyl, or cyano, with the following provisos:
(a) if ring A is
(ii) R3 is H, aminoalkyl, alkoxy, , or R'C(O)N(H)- where R' is alkyl, or (iii) R2 is alkoxy, cyanoalkyl, amino, or heteroarylalkoxy, or (iv) one of R1 and R7 is other than -H, or (v) only one of X^X4 comprises N, or (vi) X3 is C(H), or (vii) X4 is S, or (vi) -X^R5)- is -C(R5)-C(H)-, -C(H)-C(R5)-, -C(R5)-N-, or -N-C(R5)-, or (viii) R1 and R2 together with the atoms to which they are attached form a 5- or 6-membered substituted or unsubstituted aryl or substituted or unsubstituted heteroaryl ring,
(b) if ring A is where R3 is amino or alkylamino and then (i) X5 is N(H), or (ii) R1 is cyano, perhaloalkyl, or perhaloalkoxy, or (hi) R2 is cyano, cyanoalkyl, amino, or heteroalkylalkoxy, or (iv) R7 is perhaloalkyl, perhaloalkoxy, or cyano, or (v) R4 is aryl, or (vi) R1 and R2 together with the atoms to which they are attached form a 5- or
6-membered substituted or unsubstituted aryl or substituted or unsubstituted heteroaryl ring, or (viii)
R2 and R3 together with the atoms to which they are attached form a 5- or 6-membered substituted or unsubstituted aryl or substituted or unsubstituted heteroaryl ring,
(ii) R4 is not methyl or substituted or unsubstituted azacycloalkyl, or (hi) R5 i
(f) if X5 is N(H), and ring A is then R5 is not
(h) if X5 is absent an , then (i) R5 is no not N, or (hi) R2 is not -H, -CN, or -CF3, or (iv) R1 is not -H, -CN, or -CF3, (j) if X5 is N(H) and , then (i) R4 is not cycloalkyl or heterocycloalkyl, or (ii) Y4 is not N, or (iii) R1 is not -CN, or (iv) one of R2, R3, and R8 is other than
H, or (v) R5 is substituted or unsubstituted alkyl
where R11 and R12 are H, alkyl, perhaloalkyl, alkoxy, perhaloalkoxy, cyano, or amino.
3. The compound of clause 1, wherein ring A is:
where R2 is -CF3, -OCF3, -OCHF2, -OCH3, -CN, or -H, and R11 is -CF3, -OCF3, -CN, or -H. isopropyl, 2-methylpropyl, cyclopropyl, cyclopropylmethyl, or -C(H)(OH)-C(CH3)2.
, where Z is alkoxy, H, aliphatic, or heteroaliphatic.
7. The compound of clause 6, wherein Z is C1-C3 alkoxy, H, Ci-Ce alkyl, or heteroalkyl. 8. The compound of clause 6, wherein Z is -C(O)CH3, H, methyl, ethyl, isopropyl,
2-methylpropyl, cyclopropyl, cyclopropylmethyl, cyclobutyl, cyclopentyl, cyclohexyl,
-(CH2)2(OCH2CH2)nOCH3 where n is an integer from 1 to 10,
9. The compound of any one of clauses 6-8, wherein the compound is:
where R11 and R12 are H, alkyl, perhaloalkyl, alkoxy, perhaloalkoxy, cyano, or amino.
10. The compound of clause 9, wherein: R1 is -CN, -OCF3, or -CF3; R2 is -OCH3, -OCF3,
-CF3,-CN, -OCHF2, , or H; R8 is -OCF3, -CN, -CH3, or H; and R11 and R12 independently are -CF3, -CN, -H,
-OCH3, or -OCF3.
11. The compound of clause 1, wherein the compound is: , where R2 is -CF3, -CN, -H, -OCH3, -OCHF2, -OCF3, or
-CF3, -CN, -H, -OCH3, -OCHF2, -OCF3, and R4 is
-CN, -H, -OCH3, -OCHF2, -OCF3, and R4 is
(vii) , where R2 is -CF3, -CN, -H, -OCH3, -OCHF2, -OCF3, and
12. A pharmaceutical composition comprising a compound according to any one of clauses 1-11 and at least one pharmaceutically acceptable carrier.
13. A method of inhibiting leucine zipper-bearing kinase (LZK) activity, comprising: contacting a cell expressing LZK with an effective amount of a compound according to any one of clauses 1-11, thereby inhibiting LZK activity.
14. The method of clause 13, wherein inhibiting LZK activity inhibits cell cycle progression, reduces c-MYC expression, inhibits c-Jun N-terminal kinase (JNK) pathway signaling, inhibits PI3K/AKT pathway signaling, inhibits cyclin dependent kinase 2 (CDK2) activity, or any combination thereof.
15. The method of clause 13 or clause 14, wherein the cell is characterized by amplification of chromosome 3q, overexpression of mitogen-activated protein kinase kinase kinase 13 (MAP3K13), or both.
16. The method of any one of clauses 13-15, wherein the cell is a head and neck squamous cell carcinoma (HNSCC) cell, a lung squamous cell carcinoma (LSCC) cell, a hepatocellular carcinoma cell, an ovarian cancer cell, a small cell lung cancer cell, a neuroendocrine prostate cancer cell, or an esophageal cancer cell.
17. The method of any one of clauses 13-16, wherein contacting the cell with the compound comprises administering a therapeutically effective amount of the compound, or an amount of a pharmaceutical composition comprising the therapeutically effective amount of the compound, to a subject. 18. The method of clause 17, wherein the subject has a disease or condition characterized at least in part by LZK overexpression.
19. The method of clause 18, wherein the disease or condition is cancer.
20. The method of clause 17, wherein the cancer is HNSCC, LSCC, hepatocellular carcinoma, ovarian cancer, small cell lung cancer, neuroendocrine prostate cancer, or esophageal cancer.
21. The method of clause 20, wherein the cancer is HNSCC or LSCC.
22. The method of any one of clauses 19-21, wherein administering the therapeutically effective amount of the compound, or the amount of the pharmaceutical composition, decreases viability of the cancer cells, inhibits tumor growth, or a combination thereof.
23. The method of any one of clauses 17-22, wherein administering is performed parenterally, orally, or topically.
24. Use of a compound according to any one of clauses 1-11 for inhibiting leucine zipper-bearing kinase (LZK) activity, wherein inhibiting LZK activity comprises contacting a cell expressing LZK with an effective amount of the compound, thereby inhibiting LZK activity.
25. Use of a compound according to any one of clauses 1-11 for treating a disease or condition characterized at least in part by leucine zipper-bearing kinase (LZK) overexpression, wherein treating comprises administering a therapeutically effective amount of the compound, or an amount of a pharmaceutical composition comprising the therapeutically effective amount of the compound, to a subject having a disease or condition characterized at least in part by LZK overexpression.
26. Use of a compound according to any one of clauses 1-11 in the manufacture of a medicament for the treatment of a disease or condition characterized at least in part by leucine zipper-bearing kinase (LZK) overexpression.
27. The use of clause 25 or clause 26, wherein the disease or condition is cancer.
28. The use of clause 27, wherein the cancer is HNSCC, LSCC, hepatocellular carcinoma, ovarian cancer, small cell lung cancer, neuroendocrine prostate cancer, or esophageal cancer. VI. Examples
Methods
Plasmids and transfections
LZK cDNA was prepared from RNA extracted from 293T cells, attB flanking regions were added by PCR, and the BP Clonase reaction was used to insert LZK into pDONR221. From here, the Invitrogen Gateway system was used for cloning into destination vectors. FLAG-tagged (pReceiver-M12, GeneCopoeia) destination vector was converted into Gateway destination vector for use in transient overexpression assays. The pLenti6.3/TO/V5-DEST vector was used to generate stable overexpression. The drug-resistant construct for LZK was a Q240S mutation that was introduced using a Site-Directed Mutagenesis Kit (Stratagene). The oligonucleotides are listed below in Table 18. 293T cells were transiently transfected using Lipofectamine 2000 (Invitrogen), according to the manufacturer’s protocol, with OptiMEM (Gibco). ApcDNA3.1(+) vector (Invitrogen) was used as an empty vector control where required. The CDK2 sensor vector CSII-pEFla-DHB(aa994-1087)-mVenus and the nuclear marker vector CSII-pEFla-H2B-mTurquoise were described previously (Spencer et al., Cell 2013, 155:369-383).
Table 18
Cell Culture
CAL33 (German Collection of Microorganisms and Cell Cultures [DSMZ], obtained Oct. 2012) and 293T (American Type Culture Collection [ATCC], July 2012) cells were maintained in DMEM (Sigma- Aldrich) supplemented with 10% tetracycline-tested fetal bovine serum (FBS) (Atlanta Biologicals), 1% penicillin-streptomycin (Gibco), and 2 mM GlutaMAX (Gibco). BICR56 cells (Public Health England, Nov. 2012 and Apr. 2014) were grown in DMEM with 10% tetracycline-tested FBS, 1% penicillin-streptomycin, 0.4 pg/mL hydrocortisone (Sigma- Aldrich), and 2 mM GlutaMAX. MSK921 (Memorial Sloan Kettering Cancer Center, July 2014), BEAS-2B (ATCC, Oct. 2012), LK2 (Japanese Collection of Research Bioresources [JCRB] Cell Bank, Feb. 2015), and NCI-H520 (ATCC) cells were maintained in RPMI 1640 (Quality Biological) with 10% tetracycline-tested FBS, 2 mM GlutaMAX, and 1% penicillin-streptomycin. Detroit 562 cells (ATCC, Nov. 2014) were maintained in EMEM (Sigma- Aldrich) with 10% tetracycline-tested FBS, 2 mM GlutaMAX, and 1% penicillin-streptomycin. 293FT cells (Invitrogen, Nov. 2011) were maintained in DMEM with 10% tetracycline-tested FBS, 4 mM GlutaMAX, 1 mM sodium pyruvate (Gibco), and 0.1 mM NEAA (Gibco). SCC-15 cells (ATCC, 2019) were maintained in DMEM (Gibco) with bicarbonate buffer (3.7 g/L), 10% FBS, and 1% penicillin-streptomycin. All cells were incubated at 37 °C and 5% CO2. Cell lines in regular use were subject to authentication by yearly Short Tandem Repeat (STR) profiling (conducted by multiplex PCR assay by an Applied Biosystems AmpFLSTR system). STR profiles were compared to ATCC and DSMZ databases. However, no profile was available for MSK921. The 3q status of all HNSCC and immortalized control cell lines was verified in-house. All cell lines were used in experiments for fewer than 20 passages (10 weeks) after thawing, before a fresh vial was taken from freeze. Cell lines in use were confirmed to be mycoplasma-negative using a Visual-PCR Mycoplasma Detection Kit (GM Biosciences). Generation of doxycycline-inducible knockdown cell lines
CAL33 and BICR56 inducible knockdown cells were generated by SIRION Biotech. MSK921 was generated in-house using lentiviral particles provided by SIRION (generated by transfection of 293TN cells with expression vectors and lentiviral packaging plasmids). Transduction occurred at MOI 5 with 8 pg/mL polybrene. After 24 hours, medium was replaced with fresh medium containing puromycin (Invitrogen) to select for cells that had been effectively transduced. shRNA sequences were CGGAATGAACCTGTCTCTGAA (shl) and GATGTAGATTCTTCAGCCATT (sh2). The lentiviral expression plasmid was pCLVi(3G)-MCS-Puro, which expresses a doxycycline-responsive transactivator and the shRNA from the same vector. Expression of the transactivator is constitutive, while shRNA expression depends on a doxycycline-inducible promoter. Binding doxycycline to the transactivator allows it to bind the doxycycline-inducible promoter and promote shRNA expression. Doxycycline (Sigma- Aldrich) was used at 1 pg/mL to induce LZK knockdown.
Generation of tetracycline-inducible expression cell lines
The ViraPower HiPerform T-REx Gateway Expression System (Invitrogen) was used to generate cells with tetracycline-inducible expression of LZK. In brief, wild-type (WT) or drug-resistant mutant (Q240S) LZK (cloned into pLenti6.3/TO/V5-DEST vector) and pLenti3.3/TR (for tetracycline repressor expression) were transfected into 293FT cells using Lipofectamine 2000 to generate lentiviral stock. Cell lines were generated by antibiotic selection (blasticidin [Gibco] and geneticin [Gibco]). Doxycycline (Sigma- Aldrich) was used at 1 pg/mL to induce LZK expression.
RNA preparation
Cells were lysed using Buffer RLT (Qiagen) with 1% v/v 2-mercaptoethanol (Bio-Rad) 48 hours after treatment (tetracycline-induced overexpression or doxycycline-induced knockdown). Genomic DNA was removed and RNA was prepared using an RNeasy kit (Qiagen) according to the manufacturer’s protocol. The RNA quantity was determined using a NanoDrop™ One Spectrophotometer (Thermo Scientific).
RT-PCR
RT-PCR was performed using a SuperScript III One-Step RT-PCR kit (Invitrogen). Primers used were as follows: AACTGATTCGAAGGCGCAGA (LZK forward; SEQ ID NO: 13), GGGCGTTTTCCAAGAGAGGA (LZK reverse; SEQ ID NO: 14), GGCACCACACCTTCTACAATG (p-actin forward; SEQ ID NO: 15), GTGGTGGTGAAGCTGTAGCC (p-actin reverse; SEQ ID NO: 16), CCATGGAGAAGGCTGGGG (GAPDH forward; SEQ ID NO: 17), GTCCACCACCCTGTTGCTGTA (GAPDH reverse; SEQ ID NO: 18). The cycling conditions for PCR were as follows: cDNA synthesis and pre-denaturation (one cycle at 55 °C for 30 minutes followed by 94 °C for two minutes), PCR amplification (25 cycles of denaturing at 94 °C for 15 seconds, annealing at 55 °C for 30 seconds, and extension at 68 °C for 60 seconds), and a final extension at 68 °C for five minutes using C1000 TOUCH CYCLER w/48W FS RM (Bio-Rad). PCR products were resolved on 2% agarose gel and visualized with Nancy-520 (Sigma- Aldrich) DNA gel stain under ultraviolet light using ChemiDoc™ MP Imaging System (Bio-Rad).
Inhibitor treatment
GNE-3511 (#19174) was purchased from Cayman Chemical or from Synnovator (#SYNNAA108230) in large quantities for the mouse studies. MG132 (#S2619) was purchased from Selleck Chemicals. Pevonedistat or MLN4924 (#HY-70062) was purchased from MedChemExpress. All compounds were dissolved in DMSO (Fisher), and DMSO was used as the vehicle control in the cell-based assays.
Protein lysate preparation and immunoblots
Generally, cells were plated in six-well or 35-mm plates for 24 hours, after which doxycycline was added or treatment with specific inhibitor was administered using 5% FBS media for 48 hours. After appropriate treatment time, cells were washed with ice-cold phosphate-buff ered saline without Ca and Mg (Quality Biological) and then lysed on ice with RIPA buffer (50 mM NaCl, 1.0% IGEPAL® CA-630, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, pH 8.0) (Sigma- Aldrich) supplemented with protease inhibitor tablet (Sigma- Aldrich) and phosphatase inhibitor cocktails 2 and 3 (Sigma- Aldrich) followed by centrifugation at 15,000 rpm for 10 minutes at 4 °C. Protein concentrations were determined from the cell lysate by using 660 nm Protein Assay Reagent (Pierce). Cell extracts were denatured, subjected to SDS- PAGE, transferred to PVDF membranes (Bio-Rad) and blocked for 2 hours using 5% bovine serum albumin (BSA) in phosphate-buffered saline and 0.1% Tween® 20 (PBS-T). The membranes were incubated with the specific antibodies overnight in 5% BSA/PBST at 4 °C followed by a 1 hour incubation with the appropriate horseradish peroxidase-conjugated secondary antibodies and signal was detected by chemiluminescence (Thermo Fisher). The antibodies are listed in Table 19.
Table 19 Reverse phase protein arrays
Cells were seeded in 10 cm dishes, at 6 x 105 for CAL33 and BICR56, and 6.25 x 105 for MSK921, before addition of doxycycline (to induce LZK knockdown) the following day. Cells were lysed on ice with lx Triton X-100 cell lysis buffer (#9803, Cell Signaling Technology) supplemented with protease and phosphatase inhibitors (Roche Applied Science, #05056489001 and 04906837001, respectively) and 1.5 mM MgCh, 48 hours after induction with doxycycline. Cell lysates were centrifuged, and the supernatant was collected. Protein concentration was measured using 660 nm Protein Assay Reagent (Pierce), and adjusted to 2 mg/mL. Then 4x reducing sodium dodecyl sulfate (SDS) sample buffer was added (40% glycerol, 8% SDS, and 0.25 M Tris HC1, pH 6.8, with 10% P-mercaptoethanol added before use), and the samples were incubated at 80 °C for three minutes. Lysates from three independent experiments were sent for RPPA analysis. The Host and Tumour Profiling Unit at Cancer Research UK Edinburgh Centre (MRC Institute of Genetics and Molecular Mechanism, The University of Edinburgh) performed a nitrocellulose slide format RPPA with a panel of 60 antibodies according to established protocols (Sriskandarajah et al., BMC Cancer 2020, 20:269). Results were compared to samples without dox-induction of LZK knockdown.
MTS cell viability assays
A Cell Titer 96 AQueous One Solution Cell Proliferation Assay (Promega) was used for MTS assays following the manufacturer’s protocol. In brief, 5,000 cells were plated in triplicate in 96-well plates and treated with drug compounds 24 hours later using 5% FBS media. Doxycycline was added where appropriate, and cells were incubated for 72 hours. MTS was added, cells were incubated for two hours, and absorbance was measured at 490 nm using iMark™ Microplate Absorbance Reader (Bio-Rad). Graphs display percent cell viability relative to the DMSO-treated control sample. EC50 values were determined using GraphPad Prism 8.
Colony formation assays
Crystal violet assays were used to assess relative cell growth and survival after treatment with specific compounds. In general, cells were plated in triplicate in 12-well plates for 24 hours before drug treatments were added using 10% FBS media. The plates were incubated for 14 days, with the media and drug being replaced every 48 hours. The cells were then washed with phosphate-buffered saline and fixed in ice-cold methanol before being stained with 0.5% crystal violet (Sigma- Aldrich) in 25% methanol. Images were taken using a ChemiDoc MP Imaging System (Bio Rad), and for quantification, the crystal violet stain was dissolved in 33% acetic acid, incubated for 20 minutes with shaking, and read at 595 nm using iMark™ Microplate Absorbance Reader (Bio-Rad). Graphs display percent colony formation relative to the DMSO-treated control sample. In vitro kinase assay
One hundred nanograms of glutathione S-transferase (GST)-tagged human LZK pure protein (Carna Biosciences, #09-114) was incubated with 100 ng of GST-tagged human inactive MKK7 pure protein (Cama Biosciences, #07-147-10) in kinase buffer (Cell Signaling Technology, #9802). The assay was performed with 100 |1M ATP at 37 °C for 30 minutes. Following the addition of 4x reducing SDS sample buffer, proteins were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblot analysis was performed as stated previously.
ELISA assay
A PathScan® Phospho-SAPK/JNK (Thrl83/Tyrl85) Sandwich ELISA Assay (Cell Signaling Technology) was used for ELISA assays following the manufacturer’s protocol. In general, 500,000 cells were plated and treated with doxycycline the following day where appropriate and incubated at 37 °C for 48 hours. Cells were treated with the drug compound or control in 5% FBS media for 1 hour. After appropriate treatment time, cells were lysed on ice with lx Cell Lysis Buffer (Cell Signaling Technology) supplemented with phosphatase and protease inhibitors (Sigma). Each diluted cell lysate was added to Phospho-SAPK/JNK (Thrl83/Tyrl85)Rabbit mAb Coated microwells in triplicate and incubated overnight at 4 °C. Samples were treated with the following antibodies and incubated at 37 °C for 1 hour and 30 minutes, respectively: Detection Antibody and HRP-Linked secondary antibody. Samples were washed between treatments using lx Wash Buffer according to the manufacturer’s protocol. TMB substrate was added to each well and incubated at 37 °C for 10 minutes. Following this, STOPsolution was added to each well and absorbance was measured at 450 nm using iMark™ Microplate Absorbance Reader (Bio-Rad). Graphs display relative phospho-JNK levels.
Quantification and statistical analysis
All samples represent biological replicates. Data are presented as the mean with error bars shown on graphs representing ± SEM unless otherwise noted. Two-tailed Student’s /-test was used to assess significance of differences between groups for assays and used to measure significance of the mouse tumor volumes at the last day of treatment. Values of p < 0.05 were considered as significantly different. Human samples
Tumor fragments from HNSCC patients containing amplified MAP3K13 were obtained from theNIH PDMR, #391396-364-R, or from Crown Biosciences San Diego, #HN5120.
PDX Mouse Model
Tumor pieces at approximately 2 x 2 x 2 mm3 from an HNSCC patient containing amplified MAP3K13 were implanted subcutaneously with Matrigel (Coming) in the mice according to the SOP50101 Implantation and Cry opreservation of Tissue for PDX Generation protocol from the NIH Patient-Derived Models Repository (PDMR). Five NSG mice were used for initial implantation of the cryopreserved tumor fragments. Body weights and tumor size were measured twice weekly. The tumors were harvested when they reached approximately 1 ,000 mm3 and were used to generate the PDX mouse model to test GNE-3511. For the efficacy study, passage one of the fresh PDX tumor fragments were implanted into NSG mice using the protocol stated previously. Twenty NSG mice were used (10 for vehicle control and 10 for GNE-3511 treatment). Body weights and tumor sizes were measured twice weekly until tumors reached approximately 150-200 mm3, at which point the mice were randomly assigned to treatment cohorts with control or GNE-3511 for approximately 4-8 weeks. The study endpoints were over 20% body weight loss, tumor volume exceeding 2.0 cm3 in diameter, or significant (greater than 80%) tumor regression observed with treatment. The GNE- 3511 was dissolved with 60% PEG 300 MW, 3 eq of 0.1 M HC1, saline (vehicle) and administered daily via intratumoral injection at 50 mg/kg. Body weights and tumor sizes were measured twice weekly. At the endpoint of each study, tumors were harvested, cleaned, weighed, and photographed for analysis.
Bioinformatic analyses of HNSCC PDX mouse models of NCI PDMR
For nucleic acid extraction, library prep, whole-exome sequencing, and whole-transcriptome sequencing, please see the documents from the NIH PDMR SOPs. An in-house bioinformatics pipeline was used to process WES and RNA-seq data. FASTQ data were generated using the bcl2fastq tool (Illumina, v2.18) and then run through FASTQC for quality confirmation. For WES , reads were mapped to the human hgl9 reference genome by the Burrows -Wheeler Alignmenttool. The resulting bam files were processed using GATK best practice workflow (32). Copy number data was inferred from WES data through use of the CNVKit algorithm, using a pool ofnormal HapMap cell line samples as reference (30). The RSEM pipeline using STAR aligner was implemented to process RNA-seq data to get gene expression data (Li et al. , BMC Bioinformatics 2011, 12( 1 ) : 323). In current cohort, fifty-eight PDX head and neck models were performed by WES and RNA-seq bioinformatics analysis. In each PDX model, it includes multiple (4 > PDX) samples. For copy number data, consensus copy number status (2 = diploid, > 2 and < 5 = gain, and > 5 = amplification) was called using majority voting among multiple PDX samples from same model. For gene expression data, average of Fragments Per Kilobase Million (FPKM) was taken to getgene expression at model level.
Example 1
Chemical Syntheses and Characterization
A general synthesis scheme for 3,3,-fluoropyrrolidin-l-yl analogs is shown below:
Method A. A 4-substituted 2,6-dichloropyridine (3 mmol) is combined with 5.25 mmol (1.75 equiv) of 3,3-difluoropyrrolidine hydrochloride in dioxane (e.g., 8 mL) in a microwave vial. Diisopropylethylamine (9 mmol, 3 equiv) is added and the sealed vial is heated with stirring at 130 °C for 16 h. The cooled reaction is then diluted with 50 mL water and extracted with 3 x 35 mL ethyl acetate. The combined organic layers are dried over Na2SC>4 and concentrated under reduced pressure. The resulting residue is purified by flash chromatography eluting with a gradient of ethyl acetate in dichloromethane.
Method B. The 4-substituted 2-(difluoropyrrolidin-l-yl)-6-chloropyridine (e.g., 145 pmol) is combined with the desired 2-aminoheterocycle (1.77 pmol, 1.22 equiv), 2-dicyclohexylphosphino-2',6'-di-isopropoxy-l,l'-biphenyl palladium (II) phenethylamine chloride (8.5 mg, 11.6 pmol, 0.08 equiv), and potassium tert-butoxide (24.5 mg, 218 pmol, 1.5 equiv). The reaction vial is sealed, then evacuated and back-filled with argon 3 x. Dioxane (2 mL) is added, and the reaction is heated at 145 °C for 45 min. The cooled reaction is adsorbed directly onto Celite and the desired material is obtained by flash chromatography eluting with a gradient of methanol in dichloromethane. 2-chloro-6-(3,3-difluoropyrrolidin-l-yl)piperidin-4-yl)pyridine trifluoroacetate. tert-Butyl 4-(2-chloro-6-(3,3-difluoropyrrolidin-l-yl)pyridin-4-yl)piperidine-l-carboxylate (550 mg, 1.37 mmol) was dissolved in 3 mL of dichloromethane and the solution was stirred in an ice bath. Trifluoroacetic acid (3.0 mL) was added, and stirring was continued for 20 min. The volatiles were then removed under reduced pressure and the resulting residue was used without further purification.
2-Chloro-6-(3,3-difluoropyrrolidin-l-yl)piperidin-4-yl)pyridine trifluoroacetate (1 mmol) is dissolved in 25 mL of dichloromethane and washed with 50 mL of saturated NaHCCfl. The organic layer is dried over Na2SC>4 and concentrated under reduced pressure. The resulting residue is taken up in 5 mL of tetrahydrofuran and treated sequentially with ketone or aldehyde (2 mmol, 2 equiv) and sodium triacetoxyborohydride (371 mg, 1.75 mmol, 1.75 equiv). The reaction is monitored by chromatography. Upon completion, the reaction is diluted with 25 mL of ethyl acetate and washed with 40 mL of NH4CI. The aqueous layer is extracted with 2 x 25 mL of ethyl acetate; the combined organic layers are dried over Na2SC>4 and concentrated under reduced pressure. The desired material is purified by flash chromatography eluting with a gradient of methanol in dichloromethane and used in Method B.
Exemplary R groups include, but are not limited to, l-acetylpiperidin-4-yl, piperidin-4-yl, l-ethylpiperidin-4-yl, l-oxetan-3-ylpiperidin-4-yl, 1 -(polyethylene glycol)piperidin-4-yl, l-isopropylpiperidin-4-yl, l-cyclopentylpiperdin-4-yl, 4-(l-cyclopropylmethyl)piperidin-4-yl, azetidin-3-yl, l-acetylazetidin-3-yl, l-ethylazetidin-3-yl, N-oxetan-3-yl-3-azetidinyl, l-(polyethyleneglycol-azetidin-3-yl, l-isopropylazetidin-3-yl, l-cyclopentylazetidin-3-yl, l-(cyclopropylmethyl)azetidine-3-yl, (6-azabicyclo[3.1.0]-hexan-3-yl), (6-acetyl-6-azabicyclo[3.1.0]-hexan-3-yl), (6-ethyl-6-azabicyclo[3.1.0]-hexan-3-yl), (6-oxetan-3 -yl-6-azabicyclo [3.1.0] -hexan-3 -yl) , (6-poly ethylene glycol)-6-azabicyclo[3.1.0]-hexan-3-yl), (6-isopropyl-6-azabicyclo[3.1.0]-hexan-3-yl), (6-cyclopentyl-6-azabicyclo[3.1.0]-hexan-3-yl),
(6-(cyclopropylmethyl)-6-azabicyclo[3.1.0]-hexan-3-yl), 4-(tetrahydro-2H-pyran-4-yl):
Het Exemplary heterocycles (Hets) include, but are not limited to, pyridin-2-amine, pyrimidin-2-amine, pyrimidin-4-amine, pyrazin-2-amine, quinoxaline-2-amine, lH-pyrrolo-[3,2-c]pyridin-6-amine, 5-methoxypyrazin-2-amine, 5-methylpyrazin-2-amine, 6-methylpyrazin-2-amine, 3-methylpyrazin-2-amine, 5-cyanopyrazin-2-amine, l-methyl-lH-imidazole-4-carbonitrile 1 -methyl- lH-pyrazol-3-yl, lH-pyrazol-3-yl, and l-methyl-lH-imidazol-5-yl: l-(4-(2-Chloro-6-(3,3-difluoropyrrolidin-l-yl)pyridin-4-yl)piperidin-l-yl)ethan-l-one. tert-Butyl 4-(2-chloro-6-(3,3-difluoropyrrolidin-l-yl)pyridin-4-yl)piperidine-l-carboxylate (0.55 g, 1.37 mmol) was dissolved in 3 mL of DCM and the solution was cooled in an ice bath and treated with 3 mL of TFA. After 20 min the reaction was concentrated under reduced pressure. The resulting residue was taken up in 15 mL of DCM and treated with N-methylmorpholine (754 pL, 693 mg, 5 equiv) and acetic anhydride (136 pL, 147 mg, 1.05 equiv) and stirred at RT for 1 h. The reaction was then diluted with DCM and washed with 50 mL H2O. The aqueous layer was extracted with 2 x 40 mL DCM and the combined organic layers were dried over Na2SC>4 and evaporated to yield the desired material, which was used in Method B.
Compound 100
LCMS: 99.3% at 254 nm; m/z = 403.0
NMR (400 MHz, cdcl3) δ 9.23 (s, 1H), 8.17 (dd, 7= 2.7, 1.5 Hz, 1H), 8.11 (d, 7= 2.7 Hz, 1H), 7.08 (s, 1H), 6.45 (s, 1H), 5.80 (d, 7= 1.1 Hz, 1H), 4.86 - 4.77 (m, 1H), 3.95 (d, 7 = 13.8 Hz, 1H), 3.87 (t, 7= 13.1 Hz, 2H), 3.73 (s, 2H), 3.17 (td, 7 = 13.1, 2.6 Hz, 1H), 2.73 - 2.57 (m, 2H), 2.50 (tt,
7= 13.8, 7.2 Hz, 2H), 2.15 (s, 3H), 1.87 (t, 2H), 1.64 (qd, 7= 12.7, 4.3 Hz, 3H).
Compound 116
LCMS: 99.2% at 254 nm; m/z = 403.2
Compound 117
LCMS: 100% at 254 nm, m/z = 403.2 Compound 118
LCMS: 98.7% (254 nm). Calculated for C2iH26F2N5O+ 402.2 found 402.2 Compound 103
LCMS: 94% (254 nm). Calculated for C2iH24F2N7O+ 428.2; found 428.2
LCMS: 100% (254 nm). Calculated for C21H26F2N7OL 430.2; found 430.2 Compound 114
LCMS: 100% (254 nm). Calculated for C2oH27F2N60+ 405.2; found 405.2
Compound 119
LCMS: 100% (254 nm). Calculated for C23H27F2N6O+ 441.2, found 441.2
LCMS: 100% (254 nm). Calculated for C2oH27F2N60+ 405.2, found 405.2
LCMS: 100% (254 nm). Calculated for Ci9H25F2N6O+ 391.2, found 391.2
Compound 107
LCMS: 94.9% (254 nm). Calculated for C21H27F2N6CF 417.2, found 417.2
LCMS: 98.5% (254 nm). Calculated for C2iH27F2NeO+ 417.2, found 417.2
Compound 109
LCMS: 99.2% (254 nm). Calculated for C21H27F2N6CF 417.2, found 417.2
LCMS: 95.0% (254 nm). Calculated for C2oH26F2N70+ 418.2, found 418.2
Compound 111 LCMS: 98.7% (254 nm). Calculated for C20H26F2N7O+ 418.2, found 418.2
Compound 112
LCMS: 99.4% (254 nm). Calculated for C24H27F2N6O+ 453.2, found 453.2
LCMS: 98.6% (254 nm). Calculated for C2IH27F2N6O2 + 433.2, found 433.2
Example 2 LZK Inhibition in Squamous Cell Carcinomas with the 3q Amplicon
A dual leucine zipper kinase (DLK) inhibitor, GNE-3511, was evaluated for inhibition of LZK catalytic activity. LZK and DLK have greater than 90% homology within their kinase domains, and GNE-3511 was also reported to inhibit the catalytic activity of LZK (Patel et al. , J Med Chem 2015, 58:401-418). To verify that GNE-3511 (FIG. 1), would inhibit LZK catalytic activity in cells, expression of doxycycline (dox) -inducible LZK was induced in the 3q amplicon-positive CAL33 HNSCC cell line. GNE-3511 is a potent LZK inhibitor in cells, as measured by inhibition of downstream JNK pathway activation (FIGS. 2A-C, 3, 4). Similar results were observed in vitro (FIG. 5).
Treatment of HNSCC cells harboring amplified MAP3K13 (CAL33 and BICR56) with 200 nM of GNE-3511 resulted in an 80% or greater reduction in colony formation, phenocopying results observed when LZK was depleted from these cells (Edwards et al., Cancer Res 2017, 77:4961-4972), while there was only a minor reduction in colony formation in cells lacking amplified MAP3K13 (BEAS-2B and MSK921) (FIGS. 6A and 6B). Quantification reveals a significant decrease in growth in the CAL33 and BICR56 cell lines. *p < 0.05, Student’s /-test. To determine whether other squamous cell carcinomas harboring the 3q amplicon are sensitive to LZK inhibition, LK2 and NCI-H520 lung squamous cell carcinoma (LSCC) cells were treated with 500 nM GNE-3511. A 45% and 55% reduction in colony formation was observed, respectively, which indicates that additional squamous cell carcinomas rely upon LZK to maintain viability (FIG. 7). A significant decrease in viability in the CAL33 and BICR56 cells in short-term MTS assays was also observed, with an IC50 of 687.7 ± 114.1 nM and 410.5 ± 59.6 nM, respectively (FIG. 8). IC50 values were calculated with GraphPad Prism 8.
Kinase inhibitors are promiscuous compounds that will often target additional kinases, and GNE-3511 was initially developed as a DLK inhibitor. To validate that the drug-induced toxicity was specifically due to LZK inhibition, a drug-resistant mutant form of LZK (Q240S) was generated that maintains catalytic activity in the presence of the drug, as assessed by JNK pathway activation (FIGS. 9, 10). As shown in FIG. 9, Q240S maintains catalytic activity in the presence of GNE-3511, as assessed by downstream JNK phosphorylation. FIG. 10 shows that one-hour GNE-3511 treatment specifically inhibits LZK, as observed with the rescue of JNK signaling by the overexpression of the LZKQ240S drug-resistant mutant in 293T cells. Expression of LZKQ240S in CAL33 and BICR56 cells resulted in an almost complete rescue of GNE-3511 -induced toxicity, indicating that GNE-3511 suppresses HNSCC cell viability specifically through LZK inhibition, and confirming LZK as a drug target in HNSCC (FIG. 11; ***p < 0.001, **p < 0.01, Student’s /-test).
Evaluation of GNE-3511 in a patient-derived xenograft mouse model of 3q-amplified HNSCC demonstrated that 50 mg/kg GNE-3511 can significantly suppress HNSCC tumor growth in vivo with almost complete tumor regression and no detectable tumors in 3 mice (FIGS. 12A-12C; ****p < 0.0001, two-way ANOVA.). FIGS. 13A-13D show that tumor growth was significantly suppressed in mice (n=10) treated with GNE-3511 (50 mg/kg, q.d., five days on/two days off) compared to the vehicle control group in two in vivo HNSCC PDX mouse models (50 mg/kg, q.d., five days on/two days off) with amplified LZK (FIGS. 13A, 13B), whereas there was no decrease in tumor volumes in HNSCC PDX models that that lack amplified LZK (FIGS. 13C, 13D). Mean tumor volumes ± SEM are shown. Average tumor volume at the end of treatment. Mean ± SEM; Student’s /-test; *p < 0.05. Similar results were observed with 100 mg/kg GNE-3511 treatment in a CAL33-based xenograft mouse model of HNSCC (FIG. 14; mean ± SEM, ****p < 0.0001, two-way ANOVA).
Immunohistochemistry (IHC)staining revealed an increase in cleaved caspase-3 expression in the GNE-3511 treated tumors compared to control (FIGS. 15A and 15B; mean ± SEM, Student’s t-test, *p < 0.001). The study was terminated early due to toxicity at this concentration and dosing regimen (100 mg/kg, b.i.d., five days on/two days off) and decreases in body weight of the inhibitor treated mice were observed. GNE- 3511 was further evaluated in vivo utilizing a daily administration of a lower dose (50 mg/kg, q.b.)in a patient-derived xenograft mouse model of 3q-amplified HNSCC (PDX model: 391396-364-R. GNE-3511 significantly suppressed HNSCC PDX tumor growth in vivo with almost complete tumor regression and no detectable tumors in three mice (FIGS. 12A-12C), with no effect on body weights of the mice.
The expression and amplification of LZK in additional HNSCC PDX models from the NCI Patient- Derived Models Repository (PDMR) was further examined. Utilizing Next-Generation Sequencing (NGS) and RNA- sequencing data from fifty-eight HNSCC PDX mouse models, amplification of MAP3K13 in five samples was revealed, including PDX 391396-364-R, with an additional 31 containing gains of LZK. MAP3K13 was identified as one of the top genes amplified within chromosome 3 in these patient samples. Finally, increased copy number of MAP3K13 was highly associated with an increase in mRNA expression levels (FIG. 16).
A reverse phase protein array (RPPA) was performed to identify targets downstream of amplified MAP3K13. Dox-inducible depletion of LZK in CAL33, BICR56, and MSK921 cell lines with two unique LZK shRNAs (as described in Edwards et al. and FIG. 17) reduced c-MYC abundance in 3q amplicon-positive HNSCC cells (CAL33 and BICR56), but not control cells (MSK921); this was confirmed by Western blot analysis. FIG. 18 shows copy number (CN) profiles of fifty-eight HNSCC PDX mouse models on chromosome 3 obtained from the NCI PDMR. Each row indicates the copy number profile of one PDX model. Models were ordered by MAP3K13 copy number data (highlighted as yellow line). The heatmap color indicates the log2 ratio of copy numbers. FIG. 19 shows a boxplot of MAP3K13 gene expression in fifty-eight PDX models with different MAP3K13 copy numbers. X-axis indicates the copy number status of MAP3K13 where 2 = diploid, > 2 and < 5 = gain, and > 5 = amplification. Y-axis indicates the MAP3K13 gene expression in average fragments per kilobase million (FPKM). Each black dot indicates one PDX model. Copy number of MAP3K13 is highly correlated with gene expression (ANOVA, p = 1.34e-6). FIG. 20 is RPAA assay results identifying decreased c-MYC levels in CAL33 and BICR56 cells depleted of LZK for 48 hours. FIG. 21 is Western blots of c-MYC abundance in cells depleted of LZK for 48 hours. FIG. 22 is Western blots showing expression levels of several cell cycle components (Myc, CKD4, CDK6, Cyclin DI, CDK2, Cyclin El, Cyclin A2, Cyclin Bl, CDK1, p27, and GAPDH) in CAL33 cells depleted of LZK for 48 hours. These results corroborate a recent high-throughput siRNA screen identifying MAP3K13 as a required gene for cell survival specifically with c-MYC overexpression (Toyoshima et al., PNAS USA 2012, 109:9545-9550). Loss of c-MYC expression was dependent on proteasome-mediated degradation, as addition of the proteasome inhibitor MG132 (10 pM for six hours) suppressed this loss and rescued decreases in the c-MYC levels (FIG. 23). This observation is consistent with a previous report that LZK phosphorylates and stabilizes expression of the E3 ubiquitin ligase TRIM25, which ubiquitinates FBXW7, a subunit of the SKPl-Cullin-F-Box (SCF) complex that directly regulates c-MYC stability (Zhang et al., Cell Death Differ 2020, 27:420-433). Loss of TRIM25 phosphorylation through depletion or catalytic inhibition of LZK leads to the degradation of the ligase, increased stability of FBXW7, and degradation of c-MYC (Ibid.).
To determine if LZK catalytic inhibition would suppress c-MYC expression, CAL33 cells were treated with 500 nM GNE-3511 and c-MYC expression was monitored over time. Within the first hour, the LZK inhibitor resulted in a reduction in c-MYC levels that was subsequently maintained for 72 hours (FIG. 24). Importantly, expression of the LZKQ240S drug-resistant mutant rescued the loss of c-MYC expression, indicating that LZK catalytic activity is essential to maintain c-MYC stability in HNSCC cells with amplified MAP3K13 (FIG. 25). Thus, LZK has both kinase-dependent and kinase-independent functions that promote cancer.
Example 3
MLK Inhibition ofHNSCC and LSCC
A set of 8 inhibitors was prepared and evaluated for efficacy. The compounds had a general structure: where the heterocycle was (compound 98, Analog (compound 99, Analog 5), (Analog 8).
Another inhibitor included as the heterocycle and included -N(CH3)- in place of the
-N(H)- group of the parent structure. Inhibition of downstream JNK pathway activation by Analogs
1-8 was evaluated by an ELISA assay as described. The results (FIG. 26) showed that tolerance for substitution on the aminopyridine ring is narrow, with only compound 99 (Analog 5) providing successful inhibition. Methylation of the connecting amine was not tolerated.
A subsequent set of inhibitors to evaluate the effects of an additional nitrogen in the heterocycle was prepared. The heterocycles were p , Only compound 100 was an effective inhibitor. compound 98)
A comparison of GNE-3511 and LZK inhibitor 1 shows that LZK inhibitor 1 is a poor LZK inhibitor in cells. However, LZK inhibitor 2 was a potent LZK inhibitor that suppressed LZK activity at 100 nM, similar to treatment with GNE-3511, out to 72 hours (FIGS. 27-30). In addition, LZK inhibitor 2 suppressed colony formation in 3q amplicon-positive HNSCC cells - CAL33, BICR56, and Detroit 562 cells (FIGS. 31A, 3 IB), and LSCC cells - LK2 and NCI-H520 cells (FIG. 32). Drug-induced reductions in CAL33 cell viability were rescued by LZKQ240S drug-resistant mutant expression (FIG. 33; ***p < 0.001, **p < 0.01, Student’s /-test). FIG. 34 shows that LZKQ240S drug-resistant mutant expression during treatment with LZK inhibitor 2 (250 nM) also rescued JNK signaling. Several additional LZK inhibitors were prepared where the heterocycle was determined after incubation of doxycycline-induced CAL33 cells with 1 pM LZK inhibitor for 1 hour. The results are shown in FIGS. 35-37. Compound 107 was particularly effective. Three additional analogs also were evaluated:
Phospho-JNK levels were determined after incubation of doxycycline-induced CAL33 cells with 1 pM LZK inhibitor for 1 hour. The results are shown in FIGS. 38 and 39. Compound 164 was more effective than GNE-3511, while compound 161, compound 162, compound 159 had similar activity. The Kd values were as follows: 44 - 94 nM, 45 - 440 nM, and 46 - > 10,000 nM, 159 - 7.7 nM (+4.5 from GNE-3511), 160 - 9.6 nM, 161 - 3.3 nM (+0.1 from GNE-3511), 162 - 5.8 nM (+2.6 from GNE 35-11), 163 - 19 nM, 164 - 2.3 nM (-0.9 from GNE-3511). FIGS. 40-42 show dose-dependent inhibition of LZK by compound 164, compound 161, and compound 162, respectively. Several of the compounds were evaluated for LZK activity as well as LZK specificity over
DLK. The results are summarized in Table 20. The results show that compound 164 has the highest affinity for LZK and relatively strong inhibition of LZK with an IC50 of ~ 100 nM.
Table 20 PAMPA (parallel artificial membrane permeability assay) results of several LZK inhibitors
(see Tables 1-10 for structures) are shown in Table 21. The structures of known compounds DLK-IN2 and DLK-IN3 (Patel et al., J Med. Chem. 2015, 58:8182-8199; US 2018/0057507 Al; US 10,093,664 B2) are shown below.
OLK-1N-2 DLK4N-3
Table 21 Example 4
Additional Compound Syntheses
Reagents were purchased from commercial sources and used without further purification. Various intermediates were prepared as previously (Patel et al., J Med. Chem. 2015, 58:8182-8199). Microwave reactions were performed on a Biotage Initiator-i-. Compound purity was >95% by LCMS unless otherwise specified. NMR spectra were obtained on a 400 MHz Varian NMR and processed using MestReNova software. LCMS data were acquired on an Agilent Technologies 1290 Infinity HPLC system using an Agilent InfinityLab LC/MS detector and a Poroshell 120 SB-C18 2.7 um column (4.6 x 50 mm). Preparative HPLC was performed using an Agilent 1200 series system and a 30 mm x 150 mm Xbridge C18 column (Waters), eluting with gradients of 20->80% solvent B (MeCN, 0.05% TFA) in solvent A (water, 0.05%TFA). Flash chromatography was performed on a Teledyne Isco Combiflash Rf+. HRMS data was acquired on a Waters XEVO G2-XS QTOF running MassLynx version 4.1. tert-Butyl 4-(2-chloro-6-(3 ,3-difluoropyrrolidin- 1 -yl)pyridin-4-yl)piperidine- 1 -carboxylate (704 mg, 1.75 mmol) was combined with 2-amino-5 -methylpyrazine (233 mg, 2.14 mmol, 1.22 equiv), Pd-RuPHOS (51 mg, 70 pmol, 0.04 equiv) and potassium t-butoxide (590 mg, 5.25 mmol, 3 equiv) in a 20 mL microwave vial. The vial was sealed and evacuated and back-filled with Ar 3x, then 10 mL of dioxane was added. The reaction was heated in the microwave at 140 C for 45 min, then cooled to RT and filtered through Celite. The pad was washed with 3 x ethyl acetate; the combined filtrates were concentrated under reduced pressure, and the product was isolated by flash chromatography (0->15 % MeOH in DCM gradient). 734 mg yellow solid, 1.55 pmol, 88.3% yield.
NMR (400 MHz, cdcl3) δ 9.29 (d, J= 1.5 Hz, 1H), 8.06 - 8.01 (m, 1H), 6.96 (s, 1H), 6.28 (s, 1H), 5.80 (s, 1H), 3.86 (t, J= 13.2 Hz, 2H), 3.71 (t, 7 = 7.2 Hz, 2H), 3.31 (d, 7= 12.0 Hz, 2H), 2.80 (td, 7 = 12.1, 2.9 Hz, 2H), 2.61 - 2.40 (m, 6H), 1.93 - 1.69 (m, 4H). TFA deprotection: extract 734 mg ->530 mg product (free amine). tert-butyl 4-(2-chloro-6-(3,3-difluoropyrrolidin-1 -yl)pyridin-4- yl)piperidine-1 -carboxylate
(Patel et al., J Med. Chem. 2015,
To an ice-cooled solution of tert-butyl 4-(2-chloro-6-(3,3-difluoropyrrolidin-l-yl)pyridin-4-yl)piperidine-l-carboxylate (502 mg, 1.25 mmol) was added 2 mL of TFA. LCMS analysis suggested the reaction was complete after 20 min, and the volatiles were removed under reduced pressure. The resulting residue was taken up in 50 mL of DCM and washed with 100 mL of saturated NaHCCL. The layers were separated; the aqueous layer was extracted with an additional 2 x 50 mL of DCM, and the combined organic layers were dried over Na2SC>4 and concentrated under reduced pressure. The residue thus obtained was dissolved in 10 mL of DCM and treated with N-methyl morpholine (206 pL, 1.87 mmol, 1.5 equiv) and acetic anhydride (130 pL, 1.37 mmol, 1.1 equiv) at RT. After 30 min, the reaction was concentrated under reduced pressure, then taken up in 50 mL of DCM. The solution was washed with 1 x 50 mL water, 1 x 50 mL saturated NH4CI, then 1 x 50 mL saturated NaHCCL, then dried over Na2SC>4 and concentrated under reduced pressure to afford the product (413 mg, 1.20 mmol, 96%) as an off-white foam. The crude material was used without further purification. HRMS: Calculated for C16H21CIF2N3O+ 344.1341, found 344.1339. (400 MHz, cdcl3) δ 8.67 (d, J = 1.4 Hz, 1H), 8.09 (dd, J = 1.5, 0.7 Hz, 1H), 7.54 - 7.49 (m, 1H), 6.77 (d, 7 = 1.1 Hz, 1H), 4.82 (dq, 7 = 13.4, 2.2 Hz, 1H), 4.01 - 3.92 (m, 1H), 3.18 (td, J= 13.1, 2.6 Hz, 1H), 2.75 (tt, 7 = 12.1, 3.6 Hz, 1H), 2.63 (td, 7 = 12.9, 2.7 Hz, 1H), 2.51 (s, 3H), 2.15 (s, 3H), 2.01 - 1.87 (m, 2H), 1.63 (qt, 7 = 12.6, 4.1 Hz, 2H).
( m. 2015, 58:8182-8199)
R = anything but Bee or exetane
In general, a 4-acetylpiperidine substituted dichloropyridine was subjected to SnAr reaction with 3,3’-difluoropyrrolidine, followed by palladium-catalyzed cross coupling with the amino-substituted heterocycle of choice (Route A). This route was effective but less efficient for exploring modifications to difluoropyrrolidine, especially for volatile amines. Accordingly, an alternate route was employed wherein the heterocyclic amine substituent was installed first, followed by the aliphatic amine (Route B). Initial studies were performed with an acetylated piperidine substituent, which was installed at the beginning of the sequence. Subsequently, alkylation of the piperidine nitrogen was accomplished by reductive amination with NaBHaCN which could be performed at any step in the process after first removing the Boc protecting group. Manipulations with an azetidine substituent followed an analogous path. Alternative substituents at the 4-position of the central pyridine were typically purchased or pre-installed prior to the SnAr/RuPHOS coupling or Xantphos/RuPHOS route.
Route A
1. SnAr General Procedure: A 4-substituted 2,6-dichloropyridine (0.366 mmol) was combined in a microwave vial with the amine hydrochloride salt (0.65 mmol, 1.75 equiv) and DIPEA (1.10 mmol, 3 equiv) in 1 mL of DMA. The stirred reaction was heated at 130 C for 16 h, then cooled and partitioned between 50 mL ethyl acetate and 100 mL saturated aqueous NH4CI. The aqueous layer was extracted with an additional 2 x 50 mL ethyl acetate and the combined organic layers were dried over Na2SC>4 and concentrated under reduced pressure. The resulting residue was subjected to flash chromatography (hexane:ethyl acetate gradients) to yield the desired adduct.
2.RuPHOS General Procedure: A 4,6-substituted 2-chloropyridine (72.7 pmol) was combined with a 2-amino substituted heterocycle (80 pmol, 1.1 equiv), Chloro{[RuPhos][2-(2-aminoethylphenyl]-palladium(II)}/[RuPhos] admixture (molar PdP/P = 1:1) (2.9 pmol, 0.04 equiv) and potassium t-butoxide (109 pmol, 1.5 equiv) in a microwave vial equipped with a stir bar. The vial was sealed and evacuated and backfilled with Ar 3x. 1 mL of dry dioxane was added, and the reaction was heated at 140 C for 30 min in the microwave. After cooling, the reaction was filtered through Celite. The residue was rinsed with 3 x 5 mL of ethyl acetate, and the combined filtrates were concentrated under reduced pressure. The desired product was isolated by preparative HPLC (20->80% MeCN, 0.05% TFA) or flash chromatography (DCM:MeOH gradients).
Route B
1. Xantphos. l-(4-(2,6-dichloropyridin-4-yl)piperidin-l-yl)ethan- 1-one (350 mg, 1.28 mmol) was combined with 2- amino- 5 -methylpyrazine (143 mg, 1.31 mmol, 1.02 equiv), Xantphos (47.5 mg, 82 pmol, 0.06 equiv), tris(dibenzylideneacetone)dipalladium(0) (Pd2dba3, 27 mg, 29.5 pmol) and CS2CO3 (585 mg, 1.79 mmol, 1.4 equiv) in a microwave vial equipped with a stir bar. The vial was sealed, then evacuated and backfilled with Ar 3 x. Dioxane (4 mL) was added and the reaction was heated in the microwave at 80 C for 20 h. The cooled reaction was filtered through Celite, rinsed with 3 x 5 mL DCM, and the combined filtrates were concentrated under reduced pressure. The residue was subjected to flash chromatography eluting with a gradient of 0->10% MeOH in DCM to yield 319 mg (92.5 pmol, 72.2% yield) of the product l-(4-(2-chloro-6-((5-methylpyrazin-2-yl)amino)pyridin-4-yl)piperidin-l-yl)ethan-l-one as an off-white solid. 2. RuPHOS. l-(4-(2-Chloro-6-((5-methylpyrazin-2-yl)amino)pyridin-4-yl)piperidin-l-yl)ethan-l-one (25 mg, 72.3 pmol) was combined with chloro{[RuPhos][2-(2-aminoethylphenyl]-palladium(II)}/[RuPhos] admixture (molar PdP/P = 1:1) (5.3 mg, 7.2 pmol, 0.10 equiv), 3, 3 ’-difluoroazetidine hydrochloride (28.1 mg, 217 pmol, 3 equiv) and potassium t-butoxide (48.7 mg, 434 pmol, 6 equiv) in a microwave vial equipped with a stir bar. The vial was sealed, then evacuated and backfilled with Ar 3x. Dry dioxane (1.5 mL) was added, and the reaction was heated at 90 C for 20 h in the micro wave. The reaction was filtered through Celite, the residue was rinsed with 3 x 2 mL ethyl acetate, and the filtrate was concentrated under reduced pressure. Preparative HPLC afforded 35.5 mg of the desired product l-(4-(2-(3,3-difluoroazetidin-l-yl)-6-((5-methylpyrazin-2-yl)amino)pyridin-4-yl)piperidin-l-yl)ethan -l-one as the TFA salt (68.7 pmol, 95% yield). Compound 160
Reductive amination example: N-(6-(3,3-difluoropyrrolidin-l-yl)-4-(piperidin-4-yl)pyridin-2-yl)-5-methylpyrazin-2-amine (25 mg, 66.8 pmol) was dissolved in 1 mL of MeOH and stirred with 7.8 mg (134 pmol, 2 equiv) acetone at RT for 3 h. NaBHaCN (8.4 mg, 134 pmol, 2 equiv) was added and the reaction was monitored by LCMS. Upon completion the reaction was concentrated under reduced pressure and the residue was treated with 10 mL of saturated NaHCOs and extracted with 3 x 5 mL DCM. The combined organics were dried over Na2SC>4 and concentrated, and the product was isolated by flash chromatography eluting with 0->40% MeOH in DCM to yield 13.2 mg of a yellowish residue (31.7 pmol, 47.5% yield). Compound 233 131 mg, not TFA salt, 408 gmol, quant. NMR (400 MHz, DMSO) 59.48 (s, 1H), 9.20 (d, J = 1.5 Hz, 1H), 8.10 - 8.05 (m, 1H), 6.65 (d, J = 1.0 Hz, 1H), 5.98 (d, J = 1.0 Hz, 1H), 5.23 (t, J= 5.7 Hz, 1H), 4.38 (d, J = 5.7 Hz, 2H), 3.82 (t, J = 13.3 Hz, 2H), 3.61 (t, J = 7.2 Hz, 2H), 2.55 (dt, J = 14.4, 7.2 Hz, 2H), 2.36 (s, 3H).
3.3 mg, TFA2 salt presumed, 5.2 pmol, 7.2% yield. 1 H NMR (400 MHz, CD3OD) 5 8.87 (s, 1H), 8.22 (s, 1H), 6.54 (s, 1H), 6.18 (s, 1H), 4.97 (dd, 7 = 8.6, 6.2 Hz, 2H), 4.92 - 4.85 (m, 2H), 4.65 - 4.55 (m, 3H), 4.43 (s, 2H), 4.32 - 4.18 (m, 1H), 3.98 (t, 7 = 12.8 Hz, 2H), 3.84 (t, 7 = 7.3 Hz, 2H),
2.62 (tt, 7= 13.8, 7.3 Hz, 2H), 2.50 (s, 3H).
Reductive amination route. 6.7 mg TFA3 salt, 9.5 pmol, 13.2% yield. 1 H NMR (400 MHz, DMSO+NaOD) 59.16 (d, 7= 1.4 Hz, 1H), 8.10 (d, 7= 1.8 Hz, 1H), 6.55 (d, 7= 2.8 Hz, 1H), 6.17 - 5.95 (m, 1H), 4.50 - 4.40 (m, 1H), 4.31 (dd, 7= 10.9, 7.2 Hz, 1H), 4.21 (t, 7= 10.0 Hz, 1H), 4.10 -
4.01 (m, 2H), 3.87 (q, 7 = 12.7 Hz, 3H), 3.65 (t, 7 = 7.2 Hz, 2H), 2.96 - 2.79 (m, 3H), 2.60 - 2.51 (m, 1H), 2.37 (s, 3H).
12.2 mg TFA salt, 22.2 pmol, 41.3% yield of major diastereomer, +3.4 mg mixed. !H NMR (400 MHz, CD3OD) 5 8.41 (s, 1H), 8.25 (dd, J = 1.4, 0.8 Hz, 1H), 6.37 (s, 2H), 4.38 (q, 7= 7.8 Hz, 1H), 4.28 (dd, 7= 11.1, 3.3 Hz, 1H), 3.82 (d, 7 = 12.2 Hz, 2H), 3.70 (d, 7= 10.3 Hz, 1H), 3.65 - 3.56 (m, 2H), 3.39 (s, 1H), 3.21 - 3.05 (m, 4H), 3.04 - 2.94 (m, 1H), 2.89 (p, 7 = 7.3 Hz, 1H), 2.69 (dtd, 7 = 11.8, 8.0, 3.5 Hz, 1H), 2.52 (s, 3H), 2.21 (d, 7 = 14.2 Hz, 2H), 2.14 - 1.99 (m, 2H), 1.71 (dt, 7 = 12.4, 7.8 Hz, 1H), 1.17 (ddd, 7 = 12.5, 8.0, 4.8 Hz, 1H), 0.85 - 0.76 (m, 2H), 0.47 (dt, 7= 6.2, 4.7 Hz, 2H).
32 mg, TFA salt, 60.1 pmol, 87% yield. ' H NMR (400 MHz, cd3od) 5 8.37 (d, 7= 1.5 Hz, 1H), 8.24 (dd, 7= 1.5, 0.8 Hz, 1H), 6.33 (d, 7= 1.2 Hz, 1H), 6.27 (s, 1H), 3.82 (d, 7 = 14.7 Hz, 4H), 3.56 (s,
2H), 3.20 - 3.06 (m, 4H), 2.98 (tt, 7 = 12.2, 3.6 Hz, 1H), 2.53 (s, 3H), 2.30 - 1.95 (m, 6H), 1.17 (ddt,
7 = 10.7, 7.6, 3.8 Hz, 1H), 0.86 - 0.75 (m, 6H), 0.47 (dt, 7 = 6.2, 4.7 Hz, 2H). Calculated for C25H35N6+ 419.2923, found 419.2925. Compound 167
5.2 mg, not TFA salt, 13 pmol, 21.9% yield. Reductive amination. 1 H NMR (400 MHz, cdcl3) δ
9.29 (d, 7 = 1.5 Hz, 1H), 8.03 (dd, 7= 1.5, 0.7 Hz, 1H), 6.99 (s, 1H), 6.31 (s, 1H), 5.79 (s, 1H), 3.98
- 3.77 (m, 4H), 3.70 (m, 3H), 3.19 (t, 7 = 7.4 Hz, 2H), 2.55 - 2.41 (m, 5H), 2.38 (d, 7 = 6.8 Hz, 2H), 0.90 - 0.76 (m, 1H), 0.54 - 0.43 (m, 2H), 0.15 (dt, 7= 5.9, 4.5 Hz, 2H). Calculated for C2iH27F2N6+ 401.2265, found 401.2263.
12.5 mg TFA salt, 24.6 pmol, 46.3% yield. ' H NMR (400 MHz, cd3od) 5 8.34 (d, 7= 1.5 Hz, 1H),
8.20 (dd, J= 1.5, 0.7 Hz, 1H), 6.50 (d, 7 = 1.2 Hz, 1H), 6.27 (d, 7 = 1.2 Hz, 1H), 4.75 - 4.67 (m, 1H),
4.08 (d, 7 = 13.8 Hz, 1H), 3.57 (d, 7= 6.8 Hz, 2H), 3.35 (s, 3H), 3.27 - 3.19 (m, 1H), 2.96 - 2.86 (m, 1H), 2.77 - 2.67 (m, 1H), 2.53 (s, 3H), 2.14 (s, 3H), 1.93 (t, 7= 15.2 Hz, 2H), 1.80 - 1.54 (m, 2H),
1.21 (dd, 7= 9.6, 4.5 Hz, 1H), 0.70 - 0.61 (m, 2H), 0.48 - 0.40 (m, 2H). Calculated for C22H3iN6O+
395.2559, found 395.2557.
Compound 166
8.3 mg, TFA salt, 16.5 pmol, 28.6% yield. 1 H NMR (400 MHz, cd3od+10pL 40wt% NaOD) 59.28 (d, 7 = 1.5 Hz, 1H), 8.11 (dd, 7= 1.5, 0.7 Hz, 1H), 6.49 (d, 7= 0.9 Hz, 1H), 5.93 (t, 7 = 0.9 Hz, 1H), 3.86 (t, 7= 13.2 Hz, 2H), 3.79 - 3.66 (m, 4H), 3.58 (p, 7 = 8.1 Hz, 1H), 3.24 - 3.15 (m, 2H), 2.59 - 2.45 (m, 3H), 2.44 (s, 3H), 0.99 (d, 7= 6.3 Hz, 6H). Calculated for C2oH27F2N6+389.2265, found
389.2264.
Compound 220
9.1 mg TFA salt, 17.1 pmol, 36.8% yield. 1 H NMR (400 MHz, cd3od) 5 8.40 (s, 1H), 8.24 (s, 1H), 6.42 - 6.35 (m, 2H), 3.89 - 3.79 (m, 6H), 3.22 - 2.93 (m, 4H), 2.76 (br s, 3H), 2.52 (s, 3H), 2.41 (d, 7= 7.3 Hz, 2H), 2.23 (d, 7= 14.3 Hz, 2H), 2.12 - 2.01 (m, 2H), 1.56 (dd, 7 = 7.3, 2.9 Hz, 2H), 1.26 - 1.09 (m, 1H), 0.86 - 0.76 (m, 2H), 0.47 (q, 7 = 4.8 Hz, 2H). Calculated for C25H35N6 + 419.2923, found 419.2923.
Compound 168
3.7 mg TFA salt, 7.2 pmol, 24.9% yield. NMR (400 MHz, cd3od) 59.00 (s, 1H), 8.18 (s, 1H),
6.56 (m, 1H), 6.21 - 5.97 (m, 1H), 4.50 (m, 1H), 4.45 - 4.29 (m, 2H), 4.14 (dt, 7= 17.5, 9.7 Hz, 2H),
3.93 (t, 7= 13.0 Hz, 3H), 3.78 (t, 7= 7.3 Hz, 2H), 2.79 (s, 1H), 2.58 (tt, 7 = 14.1, 7.2 Hz, 1H), 2.47 (s, 3H), 2.36 (s, 2H), 2.20 - 2.11 (m, 2H), 1.95 (br s, 2H). Calculated for C21H27F2N6UO 1.2265, found 401.2263.
Compound 169
2.4 mg, TFA salt, 4.5 pmol, 15.8% yield. 1 H NMR (400 MHz, cd3od) 59.06 (s, 1H), 8.16 (s, 1H),
6.70 - 6.42 (m, 1H), 6.21 - 5.96 (m, 1H), 4.52 (t, 7 = 9.5 Hz, 1H), 4.44 (d, 7 = 8.2 Hz, 1H), 4.23 (t, 7 = 9.9 Hz, 1H), 4.17 - 4.00 (m, 1H), 3.95 - 3.67 (m, 5H), 2.78 (s, 1H), 2.56 (dt, 7 = 13.9, 7.0 Hz, 2H),
2.46 (s, 3H), 2.09 (d, 7 = 16.4 Hz, 2H), 1.89 - 1.68 (m, 4H)*, 1.59 (s, 2H). Calculated for
C22H29F2N6+ 415.2422, found 415.2419.
Compound 214
62.3 mg, TFA2 salt, 94.3 pmol, 89.8% yield. 1 H NMR (400 MHz, cd3od) 5 8.37 (s, 1H), 8.28 (dd, 7 = 1.5, 0.7 Hz, 1H), 6.33 (d, 7= 1.3 Hz, 1H), 6.22 (t, 7= 0.8 Hz, 1H), 3.81 (d, 7= 12.7 Hz, 3H), 3.60
(s, 2H), 3.15 (d, 7 = 11.5 Hz, 2H), 3.08 (d, 7= 7.5 Hz, 2H), 3.02 - 2.92 (m, 1H), 2.54 (s, 3H), 2.29 - 1.94 (m, 5H), 1.79 (d, 7 = 3.6 Hz, 2H), 1.15 (m, 4H), 0.96 (s, 3H), 0.85 - 0.76 (m, 2H), 0.51 - 0.42 (m, 2H). Calculated for C26H3?N6+ 433.3080, found 433.3078.
, , MR (400 MHz, cd3od) 5 8.36 (d, J= 1.4 Hz, 1H), 8.28 (dd, J = 1.5, 0.7 Hz, 1H), 6.49 - 6.44 (m, 1H), 6.37 (d, 7 = 1.4 Hz, 1H), 4.70 - 4.61 (m, 1H), 4.42 (t, 7 =
9.4 Hz, 1H), 4.31 (dd, 7 = 8.9, 5.9 Hz, 1H), 4.05 (dd, 7= 10.0, 6.0 Hz, 1H), 3.94 (tt, 7 = 8.8, 5.9 Hz, 1H), 3.87 - 3.79 (m, 2H), 3.74 (dd, 7 = 10.6, 6.8 Hz, 2H), 2.53 (d, 7 = 0.6 Hz, 3H), 2.45 - 2.34 (m,
2H), 1.93 (s, 3H), 1.91 (s, 2H). *one buried under MeOH peak. Calculated for C2iH27NeO+ 379.2246, found 379.2246.
10.8 mg TFA salt, 21.4 pmol, 78.3% yield. ' H NMR (400 MHz, cd3od) 5 8.47 (s, 1H), 8.27 (t, 7 = 1.1 Hz, 1H), 6.59 - 6.12 (m, 2H), 4.70 - 4.43 (m, 4H), 4.27 (td, 7= 17.1, 9.3 Hz, 3H), 3.83 (d, 7 =
11.2 Hz, 2H), 3.72 (br s, 2H), 3.17 (d, 7 = 7.4 Hz, 1H), 2.53 (s, 3H), 2.45 - 2.35 (m, 2H), 1.90 (s, 2H), 1.07 (s, 1H), 0.77 - 0.66 (m, 2H), 0.44 (d, 7 = 5.1 Hz, 2H). Calculated for C23H3IN6 + 391.2610, found 391.2607. 17.3 mg TFA salt 32.6 pmol, 93.7% yield. 1 H NMR (400 MHz, cd3od) 5 8.45 (s, 1H), 8.29 (d, 7 =
1.5 Hz, 1H), 6.55 - 6.19 (m, 2H), 4.61 (s, 2H), 4.52 (s, 2H), 4.28 (dt, 7 = 17.8, 9.7 Hz, 3H), 3.84 (d, 7 = 10.9 Hz, 2H), 3.71 (br s, 2H), 3.17 (d, 7 = 7.5 Hz, 2H), 2.46 - 2.34 (m, 2H), 2.16 (ddd, 7 = 12.9, 8.2, 4.9 Hz, 1H), 1.91 (s, 2H), 1.10 - 0.95 (m, 4H), 0.78 - 0.69 (m, 2H), 0.45 (s, 2H). Calculated for C25H33N6+ 417.2767, found 417.2769.
, , , NMR (400 MHz, cd3od) 5 8.30 (s, 2H), 6.43 (d, J = 1.4 Hz, 1H), 6.35 (d, J= 1.3 Hz, 1H), 4.64 (t, J = 9.0 Hz, 1H), 4.41 (t, J= 9.4 Hz, 1H), 4.30 (dd, J = 8.9, 5.8 Hz, 1H), 4.04 (dd, J = 10.0, 5.9 Hz, 1H), 3.99 - 3.87 (m, 1H), 3.83 (d, J = 10.9 Hz, 2H), 3.73 (dd, J = 10.4, 6.3 Hz, 2H), 3.33 - 3.32 (m, 1H), 2.39 (dt, J = 9.9, 6.0 Hz, 2H), 2.21 - 2.10 (m, 1H), 1.93 (s, 3H), 1.92 - 1.86 (m, 2H), 1.10 - 0.95 (m, 4H). Calculated for C23H29N6O+ 405.2403, found 405.2401.
19.6 mg, TFA2 salt, 30 (imol, 84.5% yield. Acetylation. 1 H NMR (400 MHz, cd3od) 5 8.28 (s, 2H), 6.38 (d, 7 = 1.4 Hz, 1H), 6.27 (d, 7 = 1.2 Hz, 1H), 4.75 - 4.66 (m, 1H), 4.08 (d, 7 = 13.8 Hz, 1H),
3.80 (d, 7 = 11.2 Hz, 2H), 3.70 (dd, 7 = 10.7, 7.0 Hz, 2H), 3.29 - 3.20 (m, 1H), 2.90 (ddd, 7 = 12.1, 8.6, 3.6 Hz, 1H), 2.78 - 2.67 (m, 1H), 2.45 - 2.33 (m, 1H), 2.14 (s, 5H), 2.00 - 1.86 (m, 5H), 1.80 - 1.54 (m, 2H), 1.09 - 0.95 (m, 5H). Calculated for C25H33N6O+ 433.2716, found 433.2715. 5.8 mg, TFA salt, 10.4 (imol, 44.6% yield. Reductive amination. 1 H NMR (400 MHz, cd3od) 5 8.34
- 8.27 (m, 2H), 6.39 - 6.33 (m, 2H), 3.88 - 3.78 (m, 3H), 3.73 (dd, 7 = 10.4, 6.6 Hz, 2H), 3.20 - 2.90 (m, 6H), 2.46 - 2.35 (m, 2H), 2.25 - 2.00 (m, 6H), 1.97 - 1.87 (m, 3H), 1.18 (ddt, 7= 12.6, 7.9, 3.9 Hz, 1H), 1.10 - 0.96 (m, 5H), 0.85 - 0.76 (m, 2H), 0.47 (dt, 7 = 6.3, 4.7 Hz, 2H). C27H37N6 +.
Reductive amination. 11.2 mg, TFA salt, 21 pmol, 91.4% yield. ' H NMR (400 MHz, cd3od) 5 8.38
(d, J = 1.4 Hz, 1H), 8.27 (dd, 7= 1.5, 0.7 Hz, 1H), 6.41 - 6.35 (m, 2H), 3.87 - 3.77 (m, 4H), 3.73
(dd, 7= 10.5, 6.7 Hz, 3H), 3.20 - 3.11 (m, 2H), 3.09 (d, 7 = 7.3 Hz, 2H), 2.99 (ddt, 7= 12.3, 7.4, 3.8
Hz, 1H), 2.53 (s, 3H), 2.46 - 2.36 (m, 1H), 2.21 (d, 7 = 14.1 Hz, 3H), 2.07 (qd, 7= 13.4, 3.7 Hz, 2H), 1.96 - 1.86 (m, 3H), 1.17 (ddd, 7 = 12.5, 7.9, 4.8 Hz, 1H), 0.85 - 0.76 (m, 2H), 0.47 (dt, 7 = 6.2, 4.7 Hz, 2H). Calculated for C25H35N6+ 419.2923, found 419.2921. Compound 170
36.7 mg TFA salt 87.5 pmol, 81.4% yield. ' H NMR (400 MHz, cd3od) 5 8.39 (d, 7= 1.5 Hz, 1H), 8.27 (dd, 7= 1.4, 0.7 Hz, 1H), 6.34 (s, 1H), 6.32 (s, 1H), 4.06 (t, 7= 12.3 Hz, 2H), 3.94 (t, 7= 7.4 Hz, 2H), 2.70 (tt, 7= 13.9, 7.4 Hz, 2H), 2.54 (d, 7= 0.7 Hz, 3H), 2.42 (d, 7 = 0.6 Hz, 3H).
Calculated for CisHi8F2N5+ 306.1530, found 306.1532.
31.7 mg, no TFA salt despite prep, 74.1% yield, 88.2 pmol. 1 H NMR (400 MHz, cd3od) 59.12 (d, 7 = 1.5 Hz, 1H), 8.17 (dd, 7= 1.5, 0.7 Hz, 1H), 6.97 (s, 1H), 6.21 (s, 1H), 3.91 (t, 7= 13.1 Hz, 2H),
3.74 (t, 7= 7.3 Hz, 2H), 2.56 (tt, 7= 14.1, 7.3 Hz, 2H), 2.46 (d, 7 = 0.6 Hz, 3H). Calculated for CI5HI5F5N5 + 360.1248, found 360.1248.
, , , NMR (400 MHz, DMSO) 5 10.04 (br s, 1H), 9.80 (s, 1H), 9.14 (d, 7 = 1.5 Hz, 1H), 8.14 (dd, 7 = 1.5, 0.7 Hz, 1H), 6.76 (d, 7= 1.1 Hz, 1H), 6.16 (d, 7= 1.1 Hz, 1H), 4.22 (s, 2H), 3.97 (d, 7 = 12.7 Hz, 2H), 3.87 (t, 7 = 13.1 Hz, 2H), 3.66 (dd, 7 = 9.4, 5.1 Hz, 4H), 3.32 (m, 2H), 3.15 (m, 2H), 2.59 (tt, 7= 14.3, 7.2 Hz, 2H), 2.42 - 2.38 (m, 3H). Calculated for
CI9H25F2N6O+ 391.2058, found 391.2056.
27.6 mg TFA salt, 51.6 (imol, 89.8% yield. HRMS: Calculated for C24H33N6CF: 421.2716, found 421.2716.
32.6 mg TFA salt, 58.8 (imol, 80.9% yield. HRMS: Calculated for C23H27F2N6CF: 441.2214, found 441.2213.
34.6 mg TFA salt, 62.3 (imol, 85.7% yield. HRMS: Calculated for C24H30F2N5CF: 442.2418, found 442.2416.
5.2 mg TFA salt, 9 pmol, 14.2% yield. Calculated for C25H34N?O2+: 464.2774; found 464.2772.
6.8 mg TFA salt, 13.1 pmol, 18.1% yield. NMR (400 MHz, cd3od) 5 8.34 (d, 7= 1.5 Hz, 1H), 8.26 (d, 7= 1.0 Hz, 1H), 6.41 (d, 7= 1.3 Hz, 1H), 6.29 (d, 7= 1.3 Hz, 1H), 4.75 - 4.67 (m, 1H), 4.09
(d, 7= 13.6 Hz, 1H), 3.80 (d, 7 = 10.9 Hz, 2H), 3.71 (dd, 7= 10.4, 6.5 Hz, 2H), 3.28 - 3.20 (m, 3H),
2.97 - 2.86 (m, 1H), 2.78 - 2.68 (m, 1H), 2.53 (s, 3H), 2.45 - 2.33 (m, 1H), 2.15 (s, 3H), 1.98 - 1.86
(m, 5H), 1.81 - 1.55 (m, 2H). Calculated for C23H3IN6O+: 407.2559; found 407.2556. 21.9 mg TFA salt, 40.8 pmol, 56.5% yield. Calculated for C23H3iNeO2+: 423.2508; found 423.2505.
Compound 204
8.3 mg TFA salt, 15.9 pmol, 22.1% yield. ' H NMR (400 MHz, cd3od) 5 8.35 (d, 7= 1.4 Hz, 1H),
8.24 (s, 1H), 6.44 (s, 1H), 6.33 (d, 7= 1.2 Hz, 1H), 4.72 (d, 7= 13.2 Hz, 1H), 4.09 (d, 7 = 13.7 Hz,
1H), 3.87 (s, 4H), 3.28 - 3.20 (m, 1H), 2.93 (ddd, 7 = 12.1, 8.6, 3.6 Hz, 1H), 2.75 (d, 7= 10.3 Hz, 3H), 2.53 (s, 3H), 2.40 (dt, 7= 8.5, 5.8 Hz, 2H), 2.15 (s, 3H), 1.95 (t, 7 = 15.2 Hz, 2H), 1.81 - 1.60 (m, 2H), 1.55 (dt, 7= 7.8, 3.9 Hz, 2H). Calculated for C23H3IN6O: 407.2559; found 407.2556. Compound 197
2.9 mg TFA salt, 5.7 pmol, 7.9% yield. NMR (400 MHz, cd3od) 5 8.33 (d, J= 1.3 Hz, 1H), 8.23 - 8.18 (m, 1H), 6.35 (s, 1H), 6.31 (d, 7 = 1.3 Hz, 1H), 4.70 (d, 7 = 13.7 Hz, 1H), 4.08 (d, 7 = 14.0 Hz, 1H), 3.24 (d, 7 = 12.1 Hz, 1H), 2.98-2.73 (m, 1H), 2.70 (s, 1H), 2.54 (s, 3H), 2.33 (s, 6H), 2.14 (s, 3H), 1.94 (t, 7= 15.5 Hz, 3H), 1.70 - 1.51 (m, 2H). Calculated for C22H29N6O+ 393.2403; found 393.2398.
Compound 200
146 9.3 mg, 17 pmol, 23.5% yield. ' H NMR (400 MHz, cd3od) 5 8.39 (s, 1H), 8.28 (dd, 7= 1.5, 0.7 Hz, 1H), 6.34 (d, 7 = 1.2 Hz, 1H), 6.30 (d, 7 = 1.2 Hz, 1H), 4.75 - 4.66 (m, 1H), 4.16 - 3.87 (m, 5H), 3.29 - 3.18 (m, 1H), 2.91 (tt, 7= 12.1, 3.6 Hz, 1H), 2.83 - 2.67 (m, 3H), 2.54 (d, 7 = 0.7 Hz, 3H), 2.15 (s, 3H), 1.93 (t, 7 = 15.3 Hz, 2H), 1.80 - 1.54 (m, 2H). Calculated for C22H27F2N6O+ 429.2214, found 429.2211.
Compound 206
30.4 mg TFA salt, 56.9 pmol, 54.8% yield. ' H NMR (400 MHz, cd3od) 5 8.34 (d, 7= 1.5 Hz, 1H), 8.25 (dd, 7= 1.5, 0.7 Hz, 1H), 6.53 (d, 7 = 1.2 Hz, 1H), 6.32 (d, 7 = 1.2 Hz, 1H), 4.75 - 4.67 (m, 1H), 4.12 - 4.04 (m, 1H), 3.77 (dd, 7= 11.2, 2.6 Hz, 2H), 3.37 (dd, 7= 11.2, 2.6 Hz, 2H), 3.30 - 3.19 (m, 1H), 2.91 (tt, 7= 12.1, 3.5 Hz, 1H), 2.78 - 2.67 (m, 1H), 2.58 (s, 2H), 2.53 (d, 7= 0.7 Hz, 3H), 2.15 (s, 3H), 1.99 - 1.85 (m, 4H), 1.82 - 1.54 (m, 6H). C24H33N6O+. Exact Mass: 421.2716, found 421.2709. Compound 189
16.9 mg TFA salt, 35.2 pmol, 48.7% yield. ' H NMR (400 MHz, cd3od) 5 8.33 (d, 7= 1.4 Hz, 1H),
8.22 (dd, 7= 1.5, 0.7 Hz, 1H), 6.25 (d, 7 = 1.3 Hz, 1H), 6.13 (d, 7 = 1.6 Hz, 1H), 4.74 - 4.65 (m, 1H),
4.40 - 4.32 (m, 4H), 4.07 (dd, 7= 12.2, 2.5 Hz, 1H), 3.24 (td, 7 = 13.2, 2.7 Hz, 1H), 2.87 (tt, 7 =
12.1, 3.6 Hz, 1H), 2.77 - 2.56 (m, 3H), 2.53 (d, 7 = 0.7 Hz, 3H), 2.14 (s, 3H), 1.92 (t, 7 = 15.3 Hz, 2H), 1.77 - 1.51 (m, 2H). C2oH27N60+. Exact Mass: 367.2246, found 367.2241. Compound 190
35.5 mg TFA salt, 68.7 pmol, 95% yield. 1 H NMR (400 MHz, cd3od) 5 8.61 (s, 1H), 8.24 (dd, 7 = 1.5, 0.8 Hz, 1H), 6.51 (d, 7= 1.2 Hz, 1H), 6.23 (d, 7= 1.2 Hz, 1H), 4.74 - 4.60 (m, 5H), 4.07 (d, 7 = 13.8 Hz, 1H), 3.30 - 3.19 (m, 1H), 2.93 - 2.81 (m, 1H), 2.72 (td, 7 = 13.1, 2.9 Hz, 1H), 2.52 (d, 7 = 0.7 Hz, 3H), 2.14 (s, 3H), 1.93 (t, 7= 15.5 Hz, 2H), 1.78 - 1.53 (m, 2H). C2oH25F2N60+. Exact Mass: 403.2058, found 403.2057. 19F NMR (376 MHz, cd3od) 5 -77.17, -77.43, -77.49, -77.94, -101.62, -101.65, -101.68, -101.71, -101.74. Compound 203
Xantphos route. 4.2 mg. !H NMR (400 MHz, cd3od) 5 8.32 (d, J = 1.4 Hz, 1H), 8.24 (dd, 7 = 1.4, 0.8 Hz, 1H), 6.25 (s, 1H), 6.14 (d, 7= 1.3 Hz, 1H), 4.70 (d, 7= 12.7 Hz, 1H), 4.17 (s, 4H), 4.07 (d, 7 = 13.6 Hz, 1H), 3.23 (d, 7= 12.0 Hz, 1H), 2.94-2.81 (m, 1H), 2.70 (td, 7 = 12.4 Hz, 2.4 Hz, 1H), 2.53 (d, 7= 0.7 Hz, 3H), 2.14 (s, 3H), 2.01 - 1.93 (m, 5H), 1.90 (d, 7 = 15.2 Hz, 2H), 1.79 - 1.70 (m, 4H), 1.69 - 1.51 (m, 1H). C24H33N6O+. Exact Mass: 421.2716, found 421.2713.
Compound 201
21 mg TFA salt, 40.3 pmol, 39.9% yield. NMR (400 MHz, cd3od) 5 8.33 (d, J = 1.4 Hz, 1H), 8.23 (dd, J= 1.5, 0.7 Hz, 1H), 6.28 (s, 1H), 6.25 (d, 7= 1.3 Hz, 1H), 4.75 - 4.66 (m, 1H), 4.12 - 4.04 (m, 1H), 3.84 (t, J = 6.9 Hz, 2H), 3.55 (s, 2H), 3.29 - 3.19 (m, 1H), 2.89 (tt, J = 12.2, 3.6 Hz, 1H), 2.72 (td, 7= 13.0, 2.8 Hz, 1H), 2.52 (d, 7 = 0.6 Hz, 3H), 2.14-2.10 (m, 6H), 2.01 - 1.86 (m, 1H), 1.79 - 1.54 (m, 2H), 0.86 - 0.74 (m, 4H). C23H3IN6O+. Exact Mass: 407.2559 Found 407.2553.
Compound 219
Reductive amination route. 22.7 mg, 65.1 pmol (SM) was stirred with cyclopropane carboxaldehyde (9.1 mg, 9.7 pL, 2 equiv) in 1 mL of MeOH overnight. Sodium cyanoborohydride (8.2 mg, 2 equiv) was added, and stirring was continued at RT. After 20 h, the reaction was diluted with DCM (30 mL), washed with saturated NaHCO3, dried over Na2SO4 and concentrated under reduced pressure. Preparative HPLC followed by lyophilization yielded the product as a fluffy yellow solid (TFA salt, 12.7 mg, 23.3 pmol, 35.8% yield). C24H3iNe+. Exact Mass: 403.2610 Found 403.2606. Compound 218
21 mg TFA salt, 38.6 pmol, 49.4% yield. 1 H NMR (400 MHz, cd3od) 5 8.32 (d, 7 = 1.5 Hz, 1H), 8.30 (d, 7 = 1.5 Hz, 1H), 6.33 (q, 7 = 1.4 Hz, 2H), 4.67 - 4.58 (m, 1H), 4.39 (t, 7 = 9.4 Hz, 1H), 4.27 (dd, 7= 9.0, 5.9 Hz, 1H), 4.02 (dd, 7 = 10.0, 5.9 Hz, 1H), 3.97 - 3.84 (m, 2H), 3.82 (s, 3H), 2.18 (tt, 7 = 8.0, 4.9 Hz, 1H), 1.98-1.93 (m, 2H), 1.93 (s, 4H), 1.11 - 0.94 (m, 6H), 0.35 (q, 7 = 4.4 Hz, 1H).
C22H27N6OT Exact Mass: 391.2246 Found 391.2242. Compound 217
26.3 mg (69.9 pmol ) of starting material was dissolved in 3 mL of DCM and treated with acetic anhydride (7.3 pL, 7.8 mg, 1.1 equiv) and N-methyl morpholine (14.1 mg, 3 equiv). After 20 min at RT the reaction was judged complete by LCMS. The reaction was diluted with DCM 15 mL and washed sequentially with water (30 mL) and saturated NaHCOa (30 mL). The organic layer was dried over Na2SC>4, concentrated under reduced pressure and subjected to flash chromatography (gradient 0->20% MeOH in DCM) to yield a yellow residue (19.9 mg, 47.5 pmol, 68% yield). !H NMR (400 MHz, cdcl3) δ 9.25 - 9.20 (m, 1H), 8.04 (d, 7 = 1.5 Hz, 1H), 6.90 (s, 1H), 6.14 (s, 1H), 5.72 (s, 1H), 4.79 (d, 7 = 13.6 Hz, 1H), 3.93 (d, 7 = 13.5 Hz, 1H), 3.72 (d, 7= 9.8 Hz, 2H), 3.45 (d, 7 = 10.0 Hz, 2H), 3.20 - 3.07 (m, 1H), 2.66 - 2.55 (m, 2H), 2.14 (s, 4H), 2.05 - 1.97 (m, 1H), 1.88 (t, 7= 13.7 Hz, 3H), 1.62 (tdd, 7= 16.8, 10.6, 4.5 Hz, 3H), 1.05 - 0.95 (m, 5H), 0.75 (q, 7 = 7.8 Hz, 1H), 0.29 (q, 7 = 4.2 Hz, 1H). Calculated for C24H3IN6O+ 419.2559, found 419.2557. Compound 216
49.3 mg TFA salt, 90.5 pmol, 87.4% yield. 1 H NMR (400 MHz, cd3od) 5 8.31 (s, 2H), 6.34 (d, 7 =
1.3 Hz, 1H), 6.24 (d, 7= 1.4 Hz, 1H), 3.81 (d, 7= 11.9 Hz, 7H), 3.18 - 3.06 (m, 4H), 2.96 (tt, 7 = 12.2, 3.7 Hz, 1H), 2.26 - 1.98 (m, 5H), 1.98-1.92 (m, 1H), 1.24 - 1.11 (m, 1H), 1.11 - 0.94 (m, 5H), 0.85 - 0.74 (m, 2H), 0.47 (dt, 7= 6.2, 4.7 Hz, 2H), 0.35 (q, 7= 4.5 Hz, 1H). HRMS: Calculated for C26H35N6 +: 431.2923, found 431.2924.
Compound 215
Yield 33.6 mg TFA salt, 63.3 pmol, 76%. NMR (400 MHz, cd3od) 5 8.30 (d, 7= 1.5 Hz, 1H),
8.28 (d, 7 = 1.5 Hz, 1H), 6.24 (t, 7 = 2.0 Hz, 2H), 4.76 - 4.64 (m, 1H), 4.07 (d, 7= 14.2 Hz, 1H),
3.85 (br s, 2H), 3.59 (s, 2H), 2.88 (tt, 7 = 12.2, 3.8 Hz, 1H), 2.78 - 2.61 (m, 1H), 2.22 - 2.12 (m, 4H), 1.90 (q, 7= 16.0 Hz, 3H), 1.78 (d, 7 = 3.8 Hz, 2H), 1.76 - 1.52 (m, 2H), 1.16 (s, 3H), 1.13 - 0.97 (m,
4H), 0.97 (s, 3H). C26H35N6O+ 447.2872 Found 447.2868 100% at 220 nm.
Compound 199
Yield 43 mg TFA salt, 80.5 pmol, 89% yield. 1 H NMR (400 MHz, CD3OD) 5 8.33 (d, 7 = 1.5 Hz,
1H), 8.27 (dd, 7 = 1.5, 0.7 Hz, 1H), 6.26 (q, 7= 1.4 Hz, 2H), 4.70 (dt, 7= 13.2, 2.2 Hz, 1H), 4.15 - 4.03 (m, 1H), 3.85 (s, 3H), 3.59 (d, 7 = 10.4 Hz, 2H), 3.24 (td, 7 = 13.2, 2.7 Hz, 4H), 2.89 (tt, 7 =
12.1, 3.6 Hz, 1H), 2.72 (td, 7= 13.0, 2.8 Hz, 1H), 2.54 (d, 7= 0.7 Hz, 3H), 2.14 (s, 3H), 1.93 (t, 7 =
15.3 Hz, 2H), 1.81 - 1.76 (m, 2H), 1.76 - 1.53 (m, 2H), 1.15 (s, 3H), 0.96 (s, 3H). LCMS: 100% at
220 nm; Calculated for C25H34N5O+ 421.2716, found 421.2711.
Compound 193 TFA salt, 8.7 mg, 17 pmol, 20.5% yield. NMR (400 MHz, cd3od) 5 8.31 (d, 7= 1.4 Hz, 1H), 8.21
(dq, 7 = 1.3, 0.6 Hz, 1H), 6.51 - 6.46 (m, 1H), 6.28 (dd, 7 = 1.2, 0.4 Hz, 1H), 4.75 - 4.66 (m, 1H),
4.16 - 4.01 (m, 1H), 3.78 (s, 2H), 3.14 - 3.06 (m, 2H), 2.89 (ddd, 7= 12.1, 8.6, 3.5 Hz, 1H), 2.72 (td, 7= 13.1, 2.8 Hz, 1H), 2.52 (d, 7 = 0.7 Hz, 3H), 2.15 (d, 7= 0.4 Hz, 3H), 2.03 - 1.53 (m, 9H). C2IH30N7O+. Exact Mass: 396.2506.
10.2 mg TFA salt, 19.6 pmol, 24.9%. NMR (400 MHz, cd3od) 5 8.33 (d, J= 1.4 Hz, 1H), 8.26 (dq, J= 1.5, 0.8 Hz, 1H), 6.25 (d, J= 1.3 Hz, 1H), 6.12 (dd, J= 1.4, 0.5 Hz, 1H), 4.74 - 4.65 (m, 1H), 4.29 (s, 4H), 4.11 - 4.03 (m, 1H), 3.26 - 3.19 (m, 1H), 2.92 - 2.81 (m, 1H), 2.77 - 2.66 (m, 1H), 2.54 (t, J = 0.8 Hz, 3H), 2.35 (t, J = 7.6 Hz, 4H), 2.14 (d, J = 0.5 Hz, 3H), 2.01 - 1.85 (m, 4H),
1.76 - 1.51 (m, 2H). C23H3IN6O+. Exact Mass: 407.2554
39.2 mg TFA salt, 78 pmol, 47.8% yield. 1 H NMR (400 MHz, cd3od) 5 8.48 (s, 1H), 8.28 (s, 1H), 6.47 (s, 1H), 6.38 (s, 1H), 4.64 (t, 7 = 8.9 Hz, 1H), 4.40 (t, 7= 9.4 Hz, 1H), 4.29 (dd, 7= 8.9, 5.9 Hz, 1H), 4.14 - 4.00 (m, 3H), 4.00 - 3.88 (m, 3H), 2.70 (tt, 7 = 14.0, 7.3 Hz, 2H), 2.54 (s, 3H), 1.92 (s 3H) HRMS: Calculated for Ci9H23F2N6O+: 389.1901, found 389.1893. Compound 188
Hashed. 26 mg, 62.7 pmol, 81.5% yield. ' H NMR (400 MHz, cdcl3) δ 8.78 (s, 1H), 8.05 (dd, 7 =
1.5, 0.7 Hz, 1H), 6.56 (s, 1H), 6.01 (s, 1H), 4.78 (dt, 7= 13.4, 2.2 Hz, 1H), 3.92 (t, 7 = 5.1 Hz, 4H), 3.77 - 3.68 (m, 4H), 3.14 (td, 7= 13.1, 2.6 Hz, 1H), 2.69 - 2.54 (m, 2H), 2.47 (d, 7 = 0.6 Hz, 3H),
2.13 (s, 3H), 1.92 - 1.80 (m, 1H), 1.68 - 1.53 (m, 4H). HRMS: Calculated for C2IH3IN6O3 +:
415.2458, found 415.2454.
DEA. 51.9 mg TFA salt, 105 pmol, 89.3% yield. 1 H NMR (400 MHz, cd3od) 5 8.35 (d, 7 = 1.4
Hz, 1H), 8.21 (dt, J= 1.5, 0.7 Hz, 1H), 6.45 (dd, 7 = 1.2, 0.5 Hz, 1H), 6.26 (dd, 7= 1.2, 0.4 Hz,
1H), 4.71 (ddd, 7 = 13.3, 4.4, 2.3 Hz, 1H), 4.13 - 4.04 (m, 1H), 3.69 (q, 7 = 7.2 Hz, 4H), 3.29 - 3.18 (m, 1H), 2.91 (tt, 7 = 12.1, 3.6 Hz, 1H), 2.72 (td, 7 = 13.0, 2.7 Hz, 1H), 2.53 (d, 7= 0.7 Hz, 3H), 2.15 (d, 7 = 0.4 Hz, 3H), 1.91 (d, 7= 15.5 Hz, 2H), 1.80 - 1.54 (m, 2H), 1.41 - 1.33 (m, 6H). Calculated for C2iH3iNeO+ 383.2559, found 383.2558.
Hashed. 17.5 mg, 43.9 qmol, 55.7% yield. ' H NMR (400 MHz, cdcl3) δ 9.13 (d, 7= 1.5 Hz, 1H), 8.04 (dt, 7= 1.4, 0.6 Hz, 1H), 7.27 (s, 2H), 7.10 (s, 1H), 6.35 (s, 1H), 5.82 (dd, 7= 1.1, 0.5 Hz, 1H),
4.83 - 4.75 (m, 1H), 4.63 (s, 1H), 3.93 (d, 7 = 13.8 Hz, 1H), 3.73 (t, 7 = 5.9 Hz, 2H), 3.37 (q, 7 = 6.5 Hz, 2H), 3.15 (td, 7= 13.1, 2.6 Hz, 1H), 2.61 (td, 7= 12.1, 5.6 Hz, 2H), 2.48 (s, 3H), 2.14 (s, 3H), 1.88 (t, 7 = 14.3 Hz, 2H), 1.83 - 1.53 (m, 6H). HRMS: Calculated for C2iH3iN6O2 +: 399.2508, found 399.2507.
Hash 0->30% MeOH in DCM; 20 mg, 45.7qmol, 53.8%. JH NMR (400 MHz, cdcl3) δ 9.00 (s, 1H), 8.06 (s, 1H), 7.27 (s, 2H), 6.99 (s, 1H), 6.44 (s, 1H), 6.29 (s, 1H), 6.12 (s, 1H), 5.39 (s, 1H), 4.80 (d, 7 = 13.4 Hz, 1H), 3.96 (t, 7 = 13.6 Hz, 2H), 3.76 (d, 7= 10.5 Hz, 1H), 3.25 (t, 7 = 10.9 Hz, 1H), 3.16 (dd, 7 = 13.7, 11.3 Hz, 1H), 2.70 - 2.55 (m, 3H), 2.49 (s, 3H), 2.15 (s, 3H), 2.08 - 1.83 (m, 5H), 1.77 (s, 1H), 1.63 (q, 7= 12.4 Hz, 5H). Calculated for C23H32N7O2+: 438.2617, found 438.2613. Compound 196
Hashed. 24.8 mg, 58.5 pmol, 88.9% yield. Flash 0->30% MeOH in DCM. 1 H NMR (400 MHz, cdcl3) δ 9.30 (s, 1H), 8.03 (s, 1H), 7.27 (s, 3H), 6.92 (s, 1H), 6.20 (s, 1H), 5.76 (s, 1H), 4.80 (d, 7 = 13.3 Hz, 1H), 3.94 (d, 7 = 13.5 Hz, 1H), 3.80 - 3.66 (m, 2H), 3.49 (q, 7 = 9.5 Hz, 1H), 3.27 (s, 1H), 3.21 - 3.10 (m, 1H), 2.69 - 2.56 (m, 2H), 2.48 (s, 3H), 2.35 (s, 6H), 2.22 (dt, 7= 12.5, 6.8 Hz, 1H), 2.15 (s, 3H), 1.90 (t, 7 = 14.0 Hz, 2H), 1.75 - 1.56 (m, 4H). Calculated for C23H34N7O+: 424.2825, found 424.2821.
A Compound 198
NMR (400 MHz, cd3od) 5 8.34 (d, 7 = 1.5 Hz, 1H), 8.28 (dd, 7= 1.5, 0.8 Hz, 1H), 6.29 (d, 7 =
1.4 Hz, 1H), 6.27 (d, 7 = 1.3 Hz, 1H), 4.75 - 4.66 (m, 1H), 4.08 (d, 7 = 14.1 Hz, 1H), 3.84 - 3.73 (m, 4H), 3.24 (td, 7 = 13.2, 2.7 Hz, 3H), 2.89 (tt, 7 = 12.2, 3.6 Hz, 1H), 2.77 - 2.66 (m, 1H), 2.54 (d, 7= 0.7 Hz, 3H), 2.14 (s, 3H), 1.96 - 1.86 (m, 2H), 1.78 - 1.53 (m, 2H), 0.98 (td, 7= 8.0, 5.2 Hz, 1H), 0.34 (q, 7 = 4.4 Hz, 1H). Calculated for C22H29N6O+ 393.2403, found 393.2398.
A
Compound 195
Hashed. 24.3 mg, 61.2 pmol, 72.9% yield. 1 H NMR (400 MHz, cdcl3) δ 9.41 (s, 1H), 8.05 - 8.00 (m, 1H), 6.96 (s, 1H), 6.13 (s, 1H), 5.78 (s, 1H), 4.79 (d, 7= 13.2 Hz, 1H), 4.62 (s, 1H), 3.94 (d, 7 = 13.5 Hz, 1H), 3.74 - 3.44 (m, 3H), 3.16 (td, 7 = 13.1, 2.6 Hz, 1H), 2.62 (ddd, 7= 13.4, 9.5, 4.2 Hz, 2H), 2.48 (s, 3H), 2.14 (s, 4H), 1.89 (t, J = 14.4 Hz, 3H), 1.70 - 1.55 (m, 4H). HRMS: Calculated for C21H29N6CV: 397.2352, found 397.2348.
A Compound 185
Flashed. 12.1 mg, 31.8 [imol, 36% yield. HRMS: Calculated for C21H29N6CF: 381.2403, found 381.2400.
Hashed. 59 mg, 137 qmol, 89.2% yield. ' H NMR (400 MHz, cdcl3) δ 9.10 (d, 7 = 1.5 Hz, 1H),
8.05 (dd, J= 1.5, 0.7 Hz, 1H), 7.02 (s, 1H), 6.39 (t, J = 0.6 Hz, 1H), 6.06 (d, J = 1.0 Hz, 1H), 4.84 -
4.76 (m, 1H), 3.87 - 3.80 (m, 4H), 3.54 - 3.46 (m, 5H), 3.16 (td, 7 = 13.0, 2.6 Hz, 1H), 2.72 - 2.56
(m, 3H), 2.49 (s, 3H), 2.15 (s, 3H), 1.90 (t, J = 14.0 Hz, 2H), 1.63 (qd, J = 12.7, 4.3 Hz, 2H).
HRMS C l l d f C iH29N6O2 +: 397.2352, found 397.2351.
Hashed. 23.9 mg, 60.3 qmol, 82% yield. 1 H NMR (400 MHz, cd3od) 5 8.46 (s, 1H), 8.28 (s, 1H), 6.68 (d, J = 1.2 Hz, 1H), 6.43 (d, J = 1.3 Hz, 1H), 4.71 (d, J = 13.4 Hz, 1H), 4.15 - 4.04 (m, 1H), 3.83 (t, J= 5.9 Hz, 4H), 3.29 - 3.20 (m, 1H), 2.96 - 2.86 (m, 1H), 2.78 - 2.67 (m, 1H), 2.54 (s, 3H), 2.22 (tt, 7= 13.0, 5.8 Hz, 4H), 2.15 (s, 3H), 2.04 - 1.87 (m, 2H), 1.81 - 1.55 (m, 2H).
HRMS: Calculated for C22H29F2N6O+: 431.2371, found 431.2368.
- 116 -
SUBSTITUTE SHEET ( RULE 26)
15.8 mg, 35.5 (imol, 46.7% yield. HRMS: Calculated for C2iH26F2N?O2+: 446.2116, found
446.2109. , , NMR (400 MHz, cd3od) 5 8.43 (d, J = 1.4 Hz, 1H), 8.28 (dd, J= 1.4, 0.7 Hz, 1H), 6.39 (d, 7 = 1.2 Hz, 1H), 6.34 (d, 7 = 1.4 Hz, 1H), 4.70 (ddd, 7 = 11.2, 4.4, 2.2 Hz, 1H), 4.12 - 4.02 (m, 3H), 3.95 (t, 7 = 7.4 Hz, 2H), 3.29 - 3.20 (m, 1H), 2.92 (tt, 7 = 12.2, 3.6 Hz, 1H), 2.84 (q, 7= 7.6 Hz, 2H), 2.70 (ddt, 7 = 14.7, 13.5, 7.4 Hz, 3H), 2.14 (s, 3H), 2.00 - 1.87 (m, 2H), 1.80 - 1.54 (m, 2H), 1.32 (t, 7 = 7.6 Hz, 3H). HRMS: Calculated for C22H29F2N6CV: 431.2371, found 431.2365. , , NMR (400 MHz, cd3od) 5 8.44 (s, 1H), 8.27 (s, 1H), 6.37 (s, 1H), 6.27 (s, 1H), 4.70 (d, 7 = 13.7 Hz, 1H), 4.14 - 3.99 (m, 3H), 3.91 (t, 7 = 7.3 Hz, 2H), 3.23 (d, 7 = 12.8 Hz, 1H), 2.88 (s, 1H), 2.77 - 2.62 (m, 3H), 2.14 (s, 3H), 1.93 (t, 7 = 15.4 Hz, 2H), 1.78 - 1.57 (m, 2H), 1.23 (t, 7 = 7.1 Hz, 1H), 1.09 - 0.94 (m, 4H).
HRMS: Calculated for C23H29F2N6O+: 443.2371, found 443.2368.
TFA salt 28.8 mg, 49.3 pmol, 66% yield. H NMR (400 MHz, cd3od) 8 8.94 (s, 1H), 8.68 (s, 1H),
6.62 (s, 1H), 6.28 (s, 1H), 4.74 - 4.66 (m, 1H), 4.07 (d, 7 = 13.6 Hz, 1H), 3.99 (t, 7 = 12.7 Hz, 2H),
3.85 (t, J= 7.3 Hz, 2H), 3.29 - 3.20 (m, 1H), 2.92 - 2.82 (m, 1H), 2.77 - 2.71 (m, 1H), 2.71 - 2.60
(m, 2H), 2.15 (d, 7 = 0.5 Hz, 3H), 1.93 (t, 7 = 15.6 Hz, 2H), 1.80 - 1.55 (m, 2H). HRMS: Calculated for C2IH25F5N6O+: 471.1932, found 471.1932.
1.59 g TFA3 salt, 2.06 mmol, 64.9%. (NMR of TFA salt) ' H NMR (400 MHz, cd3od) 8 8.61 (s, 1H), 8.25 (d, 7 = 1.3 Hz, 1H), 6.52 (d, 7= 1.2 Hz, 1H), 6.24 (s, 1H), 4.04 (t, 7 = 12.5 Hz, 2H), 3.91
(t, J = 7.3 Hz, 2H), 3.80 (s, 1H), 3.20 - 3.08 (m, 4H), 2.96 (ddt, 7 = 12.2, 7.4, 3.9 Hz, 1H), 2.67 (tt,
7 = 14.0, 7.3 Hz, 2H), 2.52 (s, 3H), 2.19 (d, 7 = 14.1 Hz, 2H), 2.15 - 2.00 (m, 2H), 1.24 - 1.10 (m, 1H), 0.85 - 0.74 (m, 2H), 0.47 (dt, 7 = 6.4, 4.7 Hz, 2H). C23H3IF2N6 +. Exact Mass: 429.2573.
Compound 159
- 118 -
SUBSTITUTE SHEET ( RULE 26) Hashed. 17.9 mg, 46.1 pmol, 64.3% yield. ' H NMR (400 MHz, cdcl3) δ 9.29 (d, 7= 1.5 Hz, 1H), 8.03 (dd, 7= 1.6, 0.7 Hz, 1H), 6.93 (s, 1H), 6.28 (d, 7= 1.0 Hz, 1H), 5.81 (dd, 7= 1.1, 0.5 Hz, 1H), 3.85 (t, 7= 13.2 Hz, 2H), 3.70 (t, 7= 7.2 Hz, 2H), 3.00 (d, 7= 11.3 Hz, 2H), 2.55 - 2.29 (m, 9H), 2.15 - 1.98 (m, 2H), 1.83 (s, 4H). C20H27F2N6+. Exact Mass: 389.2260. Compound 162
15.4 mg, 36 pmol, 71.4% . NMR (400 MHz, cdcl3) δ 9.29 (d, 7 = 1.5 Hz, 1H), 8.03 (s, 1H), 6.91 (s, 1H), 6.28 (s, 1H), 5.82 (s, 1H), 3.85 (t, 7 = 13.2 Hz, 2H), 3.69 (t, 7 = 7.3 Hz, 2H), 3.01 (s, 2H), 2.73 (s, 1H), 2.54 - 2.39 (m, 5H), 2.06 (br s, 2H), 1.91 (br s, 2H), 1.71 (d, 7 = 9.3 Hz, 5H), 1.61 (s, 4H). C23H3IF2N6+. Exact Mass: 429.2573. Compound 163
Hashed. 17.1 mg, 39.8 pmol, 61.7%. JH NMR (400 MHz, cdcl3) δ 9.28 (d, 7= 1.5 Hz, 1H), 8.03 (dd, 7= 1.5, 0.7 Hz, 1H), 6.93 (s, 1H), 6.29 (d, 7 = 1.0 Hz, 1H), 5.81 (dd, 7 = 1.1, 0.4 Hz, 1H), 4.72 - 4.61 (m, 4H), 3.85 (t, 7 = 13.2 Hz, 2H), 3.70 (t, 7 = 7.2 Hz, 2H), 3.50 (p, 7 = 6.5 Hz, 1H), 2.87 (d, 7 = 10.7 Hz, 2H), 2.57 - 2.34 (m, 5H), 1.97 - 1.74 (m, 7H). C22H29F2N6O+. Exact Mass: 431.2365 Compound 164
Hashed. 19.1 mg, 43.2 pmol, 70.3%. ' H NMR (400 MHz, cdcl3) δ 9.30 (d, 7= 1.5 Hz, 1H), 8.03 (dd, 7= 1.6, 0.7 Hz, 1H), 6.93 (s, 1H), 6.28 (s, 1H), 5.83 (d, 7= 1.0 Hz, 1H), 3.85 (t, 7 = 13.2 Hz, 2H), 3.69 (t, J = 7.2 Hz, 2H), 3.17 (s, 2H), 2.54 - 2.39 (m, 5H), 2.15 - 1.64 (m, 12H), 1.63 - 1.50 (m, 2H), 1.45 (s, 2H). HRMS: Calculated for C24H33F2N6 + : 443.2735, found 443.2729.
Hashed. 29 mg, 70 pmol, 88.7% yield. H NMR (400 MHz, cdcl3) 8 9.30 (d, J = 1.5 Hz, 1H), 8.02
(dd, J= 1.5, 0.7 Hz, 1H), 6.96 (s, 1H), 6.28 (d, J = 1.0 Hz, 1H), 5.83 (d, J = 1.0 Hz, 1H), 3.84 (t, J
= 13.2 Hz, 2H), 3.69 (t, J = 7.2 Hz, 2H), 3.04 (d, J = 11.1 Hz, 2H), 2.84 - 2.76 (m, 1H), 2.54 - 2.35 (m, 5H), 2.26 (br s, 2H), 1.84 (q, J = 5.6 Hz, 4H), 1.10 (d, J = 6.5 Hz, 6H). HRMS: Calculated for C22H30F2N6 + : 417.2578, found 417.2574. Compound 111
Cross-coupling followed by TFA deprotection of crude. 15.8 mg, tris-TFA salt, 18.4 pmol, 25.3% yield. ’ H NMR (400 MHz, cd3od) 5 8.79 (t, J = 1.5 Hz, 1H), 7.71 (d, J = 1.6 Hz, 1H), 6.21 (s, 1H), 5.81 (s, 1H), 4.70 - 4.61 (m, 1H), 4.06 - 3.98 (m, 1H), 3.82 (t, J = 13.3 Hz, 2H), 3.65 (t, J = 7.2 Hz, 2H), 3.21 (td, J = 13.1, 2.7 Hz, 1H), 2.74 - 2.63 (m, 2H), 2.49 (tt, J= 14.1, 7.2 Hz, 2H), 2.13 (s, 3H), 1.88 (t, J = 15.9 Hz, 2H), 1.75 - 1.51 (m, 2H). HRMS: Calculated for C2oH26F2N70+: 418.2167, found 418.2160. Exact Mass: 418.2161. Compound 127
- 120 -
SUBSTITUTE SHEET ( RULE 26) NMR (400 MHz, cd3od) 5 8.38 (s, 1H), 7.38 (s, 1H), 6.49 (s, 1H), 5.95 (s, 1H), 4.71 - 4.63 (m, 1H), 4.04 (d, J = 13.7 Hz, 1H), 3.86 (t, J = 13.2 Hz, 2H), 3.71 (t, J = 7.2 Hz, 2H), 3.28 - 3.13 (m, 1H), 2.80 - 2.65 (m, 1H), 2.52 (tt, J = 14.0, 7.2 Hz, 2H), 2.13 (d, J = 0.5 Hz, 3H), 1.90 (t, J = 15.4 Hz, 2H), 1.77 - 1.53 (m, 2H). HRMS: Calculated for C20H26F2N7O+: 418.2167, found 418.2166. Compound 115
39.8 mg TFA2 salt, 60.3 pmol, 82.9% yield. ’ H NMR (400 MHz, cd3od) 5 8.19 - 8.06 (m, 2H),
6.32 (d, J = 1.3 Hz, 1H), 6.26 (d, J = 1.4 Hz, 1H), 4.75 - 4.66 (m, 1H), 4.14 - 4.01 (m, 3H), 3.99 (s, 3H), 3.94 (t, J = 7.4 Hz, 2H), 3.30 - 3.19 (m, 1H), 2.90 (tt, J = 12.1, 3.6 Hz, 1H), 2.78 - 2.62 (m, 3H), 2.15 (s, 3H), 1.94 (t, 7 = 15.7 Hz, 2H), 1.80 - 1.55 (m, 2H). HRMS: Calculated for C2IH27F2N6O2 + : 433.2164, found 433.2159. Compound 112
NMR (400 MHz, cd3od) 5 8.76 (s, 1H), 8.07 (d, J = 8.2 Hz, 1H), 7.91 - 7.79 (m, 2H), 7.73 (t, J = 7.3 Hz, 1H), 6.63 (s, 1H), 6.45 (s, 1H), 4.77 - 4.69 (m, 1H), 4.23 - 4.11 (m, 2H), 4.09 (s, 4H), 3.26 (dd, J = 13.4, 2.7 Hz, 1H), 2.96 (ddd, J= 12.2, 8.6, 3.7 Hz, 1H), 2.77 (td, J = 13.3, 8.2 Hz, 3H), 2.16 (s, 3H), 1.98 (t, J = 15.3 Hz, 2H), 1.84 - 1.59 (m, 2H). Calculated for C24H27F2N6O+ 453.2214, found 453.2210 Compound 107
SUBSTITUTE SHEET ( RULE 26) TFA salt, 33.6 mg, 63.4 pmol, 87.2% yield. ' H NMR (400 MHz, cd3od) 5 8.43 (s, 1H), 8.27 (t, 7 = 1.2 Hz, 1H), 6.38 (d, 7= 1.2 Hz, 1H), 6.33 (s, 1H), 4.75 - 4.67 (m, 1H), 4.07 (t, 7= 12.4 Hz, 3H), 3.94 (t, 7 = 7.4 Hz, 2H), 3.29 - 3.21 (m, 1H), 2.97 - 2.86 (m, 1H), 2.78 - 2.62 (m, 3H), 2.54 (s, 3H), 2.15 (s, 3H), 1.94 (t, 7= 15.1 Hz, 2H), 1.81 - 1.55 (m, 2H). C2IH27F2N6O+. Exact Mass: 417.2214 found 417.2211. Compound 108
TFA salt, 24.3 mg, 45.8 pmol, 63% yield. NMR (400 MHz, cd3od) 5 8.29 (s, 1H), 8.23 (s, 1H), 6.39 (d, J = 1.3 Hz, 1H), 6.38 (d, J = 1.3 Hz, 1H), 4.75 - 4.67 (m, 1H), 4.15-4.08 (m, 3H), 4.00 (t, J = 7.4 Hz, 2H), 3.29 - 3.21 (m, 1H), 2.98 - 2.87 (m, 1H), 2.79 - 2.64 (m, 3H), 2.58 (d, J = Q.l Hz, 3H), 2.15 (s, 3H), 1.95 (t, 7= 15.3 Hz, 2H), 1.81 - 1.55 (m, 2H). C2iH27F2N6O+. Exact Mass: 417.2214 found 417.2209.
TFA salt, 36 mg, 67.9 pmol, 93.4% yield. 1 H NMR (400 MHz, cd3od) 5 8.27 - 8.21 (m, 2H), 6.81 (d, 7 = 1.3 Hz, 1H), 6.42 (d, 7 = 1.3 Hz, 1H), 4.72 (d, 7= 13.4 Hz, 1H), 4.08 (t, 7 = 12.3 Hz, 3H), 3.96 (t, 7 = 7.4 Hz, 2H), 3.29 - 3.21 (m, 1H), 2.94 (ddd, 7 = 12.2, 8.5, 3.7 Hz, 1H), 2.79 - 2.63 (m, 6H), 2.15 (s, 3H), 1.96 (t, 7= 15.7 Hz, 2H), 1.81 - 1.56 (m, 2H). C2IH27F2N6O+. Exact Mass: 417.2214, found 417.2208.
Compound 101 26.6 mg TFA salt, 51.3 pmol, 70.5% yield. ' H NMR (400 MHz, cd3od) 57.63 (d, 7= 2.4 Hz, 1H), 6.24 (d, 7 = 1.4 Hz, 1H), 6.15 (d, 7 = 1.3 Hz, 1H), 5.99 (d, 7= 2.4 Hz, 1H), 4.75 - 4.66 (m, 1H), 4.11-4.03 (m, 3H), 3.97 (t, 7 = 7.4 Hz, 2H), 3.93 (s, 3H), 3.24 (td, 7 = 13.2, 2.6 Hz, 1H), 2.88 (tt, 7 = 12.2, 3.6 Hz, 1H), 2.77 - 2.63 (m, 3H), 2.14 (s, 3H), 1.93 (t, 7= 15.5 Hz, 2H), 1.79 - 1.54 (m, 2H). HRMS: Calculated for C20H27F2N6O+: 405.2214, found 405.2212. MHz, cdcl3) δ 7.46 (d, 7 = 2.3 Hz, 1H), 6.14 (d, 7 =
2.2 Hz, 1H), 5.66 (s, 1H), 4.78 (d, 7 = 13.4 Hz, 1H), 3.89 (q, 7= 13.8 Hz, 3H), 3.78 (s, 2H), 3.71 (br s, 7= 7.2 Hz, 1H), 3.14 (t, 7= 12.6 Hz, 1H), 2.69 - 2.44 (m, 4H), 2.13 (s, 3H), 2.10 (d, 7 = 3.0 Hz, 1H), 1.83 (s, 2H), 1.60 (qd, 7= 12.7, 4.4 Hz, 2H). Ci9H25F2N6O+. Exact Mass: 391.2052. Compound 104
9.6 mg, 21.8 pmol, 15% yield. ' H NMR (400 MHz, cdcl3) δ 8.18 (d, 7= 1.0 Hz, 1H), 7.59 (d, 7 =
3.7 Hz, 1H), 7.40 (t, 7 = 0.9 Hz, 1H), 6.66 (dd, 7 = 3.7, 0.8 Hz, 1H), 6.54 (d, 7= 1.0 Hz, 1H), 6.49 (br s, 2H), 6.11 (t, 7= 0.7 Hz, 1H), 4.88 - 4.79 (m, 1H), 4.02 - 3.94 (m, 1H), 3.90 (t, 7= 12.9 Hz,
2H), 3.77 (t, 7 = 7.3 Hz, 2H), 3.20 (td, 7 = 13.1, 2.6 Hz, 1H), 2.78 (tt, 7 = 12.2, 3.6 Hz, 1H), 2.70 -
2.48 (m, 3H), 2.15 (s, 3H), 2.01 - 1.86 (m, 2H), 1.67 (qd, 7= 12.7, 4.3 Hz, 2H). C23H27F2N6O+.
Exact Mass: 441.2209 p
34.3, 80 pmol, 54.9% yield. NMR (400 MHz, DMSO) 5 9.16 (s, 1H), 7.74 (d, J = 0.6 Hz, 1H), 6.19 (d, J = 1.1 Hz, 1H), 5.81 (d, J = 1.1 Hz, 1H), 4.51 (d, J = 12.8 Hz, 1H), 3.89 (t, J = 13.5 Hz,
3H), 3.68 (d, J = 0.7 Hz, 3H), 3.62 (t, J = 7.3 Hz, 2H), 3.20 - 3.03 (m, 1H), 2.64 - 2.53 (m, 2H), 2.44 (dd, J= 14.4, 7.2 Hz, 2H), 2.02 (s, 3H), 1.75 (t, J = 13.8 Hz, 2H), 1.55 (qd, J = 12.5, 4.2 Hz, 1H), 1.41 (qd, J = 12.6, 4.3 Hz, 1H). C2IH26F2N7O+. Exact Mass: 430.2161. Compound 103 20.8 mg, 48.7 pmol, 33.5% yield. ' H NMR (400 MHz, DMSO) 8 10.41 (s, 1H), 9.25 (d, J = 1.5
Hz, 1H), 8.72 (d, J = 1.4 Hz, 1H), 6.78 (s, 1H), 6.12 (s, 1H), 4.50 (d, J = 13.0 Hz, 1H), 4.00 - 3.75 (m, 3H), 3.71 - 3.51 (m, 2H), 3.21 - 3.01 (m, 1H), 2.69 (d, J = 12.0 Hz, 1H), 2.55 (dt, J = 14.5, 8.4 Hz, 3H), 2.01 (s, 3H), 1.75 (t, J = 13.4 Hz, 2H), 1.65 - 1.35 (m, 1H). C2iH24F2N7O+. Exact Mass: 428.2005.
- 124 -
SUBSTITUTE SHEET ( RULE 26)
, , 00 MHz, cdcl3) δ 8.48 (d, J = 4.8 Hz, 2H), 7.68 (s, 1H), 7.64 (s, 1H), 6.78 (t, 7= 4.8 Hz, 1H), 5.85 (d, 7 = 1.1 Hz, 1H), 4.85 - 4.76 (m, 1H), 3.98 - 3.90 (m, 1H), 3.81 (t, 7 = 13.3 Hz, 2H), 3.64 (t, 7= 7.2 Hz, 2H), 3.17 (td, 7 = 13.0, 2.6 Hz, 1H), 2.79 - 2.57 (m, 2H), 2.46 (tt, 7 = 13.9, 7.2 Hz, 2H), 2.14 (s, 3H), 1.92 (t, 7 = 14.0 Hz, 2H), 1.77 -
1.59 (m, 3H). C2OH25F2N60+. Exact Mass: 403.2052. Compound 116
31.8 mg, 79 pmol, 54.3% yield. ' H NMR (400 MHz, cdcl3) δ 8.75 (s, 1H), 8.44 (d, 7= 5.7 Hz, 1H), 7.91 - 7.85 (m, 1H), 6.45 (s, 1H), 5.84 (dd, 7 = 1.0, 0.5 Hz, 1H), 4.85 - 4.76 (m, 1H), 3.99 - 3.91 (m, 1H), 3.86 (t, 7 = 13.1 Hz, 2H), 3.71 (t, 7= 7.2 Hz, 2H), 3.22 - 3.11 (m, 1H), 2.74 - 2.58
(m, 2H), 2.58 - 2.44 (m, 2H), 2.15 (s, 3H), 1.91 (d, 7= 14.9 Hz, 2H), 1.70 - 1.55 (m, 2H). C2OH25F2N60+. Exact Mass: 403.2052. Compound 100
45.9 mg, 114 pmol, 78.4% yield. 1 H NMR (400 MHz, cdcl3) δ 9.22 (br s, 1H), 8.16 (dd, 7 = 2.7, 1.5 Hz, 1H), 8.10 (d, 7= 2.7 Hz, 1H), 7.07 (br s, 1H), 6.44 (br s, 1H), 5.79 (d, 7= 1.1 Hz, 1H), 4.85
- 4.76 (m, 1H), 3.94 (d, 7 = 13.8 Hz, 1H), 3.86 (t, 7 = 13.1 Hz, 2H), 3.72 (s, 2H), 3.16 (td, 7= 13.1, 2.6 Hz, 1H), 2.72 - 2.56 (m, 2H), 2.49 (tt, 7 = 13.8, 7.2 Hz, 2H), 2.14 (s, 3H), 1.91 (d, 7= 14.1 Hz, 2H), 1.63 (qd, 7 = 12.7, 4.3 Hz, 2H). HRMS: Calculated for C2oH25F2N60+ : 403.2058, found 403.2058. Compound 118
30.7 mg TFA salt, 59.6 pmol, 81.9% yield. ' H NMR (400 MHz, cd3od) 5 8.33 (ddd, 7= 6.1, 1.7, 0.9 Hz, 1H), 8.12 (ddd, 7 = 8.9, 7.3, 1.8 Hz, 1H), 7.29 - 7.19 (m, 2H), 6.32 (d, 7 = 1.2 Hz, 1H), 6.28 (d, 7 = 1.1 Hz, 1H), 4.74 - 4.65 (m, 1H), 4.11 - 3.96 (m, 3H), 3.86 (t, 7 = 7.3 Hz, 2H), 3.29 - 3.20 (m, 1H), 2.86 (tt, 7 = 12.1, 3.6 Hz, 1H), 2.72 (td, 7 = 13.2, 3.0 Hz, 1H), 2.62 (dq, 7 = 14.1, 7.0 Hz, 2H), 2.15 (s, 3H), 1.99 - 1.86 (m, 2H), 1.78 - 1.54 (m, 2H). HRMS: Calculated for C2IH26F2N5O+ : 402.2105, found 402.2103.
Example 5 Substituent Effects
Substituents were varied to improve binding affinity to LZK and selectivity over DLK. KD values were measured by Eurofins DiscoveRx using the Kd- Elect system. Parallel artificial membrane permeability assay (PAMPA) values were measured by Cyprotex.
For the KD evaluation, an 11 -point 3 -fold serial dilution of each test compound was prepared in 100% DMSO at lOOx final test concentration and subsequently diluted to lx in the assay (final DMSO concentration = 1%). Most KD’S were determined using a concentration of 30,000 nM. If the initial KD was < 0.5 nM, the measurement was repeated with a serial dilution starting at a lower top concentration. A reported KD of 40,000 nM indicated a KD > 30,000 nM. KD values were calculated with a standard dose-response curve using the Hill equation:
Signal - Background
Response = Background *
The Hill Slope was set to -1. Curves were fitted using a non-linear least square fit with the Levenberg-Marquardt algorithm.
Initially, the tolerance of LZK for structural variation at the 4-aminocyanopyridine of GNE-3511 was evaluated. As shown in Table 22, neither contracting the ring to a five-membered
SUBSTITUTE SHEET (RULE 26) heterocycle nor expansion of the ring to a fused system offered any advantage. On the contrary, these modifications were generally detrimental. Returning to the original six-membered heterocycle, the feasibility of incorporating an additional nitrogen into the ring was investigated. Intriguingly, the results indicated a clear path forward: a pyrazine substituent (2-pyrazine 100) was significantly better than either pyrimidine (2- , 4-pyrimidine 116, 117) or an unsubstituted parent pyridine (2-pyridine 118). In addition, a PAMPA membrane permeability assessment indicated a much higher permeability value for (100) than either the parent GNE-3511 or the intermediate acetylated form
(98).
Table 22. Effect of various heterocycles
Next the tolerance of LZK to substitution on the pyrazine was explored (Table 23), beginning with a simple methyl scan. Once again, the path was clear: 3- or 6- substitution (108, 109) was not tolerated, while the 5 -methylpyrazine (107) was roughly twice as potent as the unsubstituted (100). This pattern was seen again with amine substituents, as the 6-amino (110) was tenfold less potent than 5-amino (111). Having established the substitution position, the effect of various substituents at the 5 -position of the pyrazine was investigated. Of the various substituents explored, only the cyclopropyl (150) offered a notable increase in potency, with the added benefit of roughly equal affinity for LZK and DLK, whereas nearly all previous compounds had shown at least mild selectivity for DLK.
Table 23. Effect of substituents on the 2-aminopyrazine
Next, modifications to the acetylpiperidine ring were explored (Table 24). First, the acetyl group was replaced with a variety of small alkyl substituents via reductive amination. These modifications resulted in an enhancement of potency of 2-10 fold over the parent (107). The ring-contracted acetylazetidine substituent of (165) also was explored, which had a neutral effect on LZK binding but notably increased the Kd for DLK by 6 fold over the parent (107). Alkylazetidine substituents (166, 167, 168, 169) maintained a roughly threefold selectivity for LZK over DLK, but the affinity was slightly worse than the corresponding piperidine derivatives. Truncation of the piperidine to a methyl (170) or trifluoromethyl (171) was not advantageous, although the addition of a morpholino substituent to the methyl (210) rescued binding to some extent. Table 24.
With these results in hand, alternatives to the 3,3’-difluoropyrrolidine substituent were screened (Table 25). In general, it was found that fused or constricted ring systems, particularly those connected via pyrrolidine rings, were preferred over open chains, and azetidine or piperidine systems tended to be less potent than the corresponding pyrrolidines. Polar groups or secondary rather than tertiary connecting amines were generally less potent. Interestingly, fusion of the pyrrolidine ring to a bicyclic system was strongly preferred, both for LZK affinity and for selectivity over DLK. Specifically, the 3.1.0 compound (198) was not quite twice as potent as the parent (107) for LZK; however, (198) also demonstrated twofold selectivity for LZK over DLK, which is a four-fold increase in selectivity over (107). The dimethyl analog (199) did not show particularly enhanced potency but was selective for LZK over DLK by more than tenfold.
At this point, the effects of combining some of the preferred substituents were explored (Table 26). While the presence of a 5-cyclopropyl substituent in place of a methyl on the aminopyrazine had previously enhanced LZK affinity and selectivity, it was not tolerated well for the 3.1.0 dimethyl compound (215), and did not significantly affect binding of the parent 3.1.0 core
(217). Replacement of the acetyl group on the piperidine ring with an alkyl substituent, however, yielded a significant improvement in potency and an overall 10-fold selectivity for LZK over DLK (216).
- 134 -
RECTIFIED SHEET (RULE 91)
Continuing exploration of alternatives to difluoropyrrolidine on the same core yielded a few intriguing candidates for further study. In particular, replacement of the two fluorines with a spiro-cyclopropyl substituent yielded compound 201, a compound with good binding affinity and
3-fold selectivity, while the 3.1.1 bicyclic system of compound 204 had similar affinity and 5-fold selectivity. Most excitingly, compound 207 had a Kd measured at just under 1 nM and 180-fold selectivity for LZK over DLK. This 3.2.0 bicyclic substituent was investigated in combination with various other modifications (222, 223, 224, 225, 226, 227, 228) but was unable to improve on the combination of selectivity and affinity demonstrated by compound 207. Surprisingly, even substitution of the acyl piperidine with an N-alkyl piperidine did not enhance binding or selectivity, despite the trend seen previously and validated in modifications 220 and 221 to 201 and 204.
Conclusion: Beginning with a known DLK inhibitor with roughly twofold specificity for DLK over LZK, the substituents were systematically varied to develop a novel inhibitor for LZK with subnanomolar potency and excellent selectivity. Not all modifications are synergistic, and the combination of modifications is somewhat unpredictable. A 2-pyrazine substituent confers unexpectedly high membrane permeability, while an N-alkylated piperidine substituent at the
4-position of the central pyridine frequently enhances both LZK binding and selectivity over DLK. The 2-position of the central pyridine is preferentially substituted with a pyrrolidine, especially with fused bicyclo- or spiro-ring systems. The 3.2.0 bicyclic substituent in this position afforded excellent potency and 180-fold selectivity over DLK. Example 6
MLK Inhibition ofESCC
An MTS assay (FIG. 43) showed that ESCC with the 3q amplicon (OVCAR5, KYSE30, and KYSE70 cells) are sensitive to the known LZK inhibitor GNE-3511, compared to control ESCC cells lacking amplified LZK (KYSE410 and OE19 cells). The results were confirmed with a soft agar assay (FIG. 44) and a colony formation assay (FIG. 45). ESCC cells expressing a drug resistant mutant form of LZK (LZKQ240S) were resistant to GNE-3511, as shown in a colony formation assay (FIG. 46).
Several of the disclosed MLK inhibitors also were evaluated for their ability to inhibit ESCC. ESCC cells (OVCAR5) were sensitive to compounds 161 and 164 as shown in a colony formation assay (FIG. 47). ESCC cells expressing the drug resistant mutant LZKQ240S were resistant to compound 161, as shown in the Western blot and colony formation assay of FIGS. 48 and 49. A colony formation assay with compounds 207, 216, and 219 showed that ESCC cells (OVCAR5 and KYSE70) were exquisitely sensitive to treatment with compounds 216 and 219 (FIG. 50).
Example 7 Therapeutic Uses
A subject identified as having a disease or condition characterized at least in part by overexpression of LZK is administered a therapeutically effective amount of a pharmaceutical composition comprising an LZK inhibitor as disclosed herein. In some examples, the subject is identified as having cancer, such as HNSCC, LSCC, ESCC, hepatocellular carcinoma, ovarian cancer, small cell lung cancer, neuroendocrine prostate cancer, or esophageal cancer cell (e.g., esophageal adenocarcinoma). In one example, the subject has cancer and identified as having upregulated levels of LZK expression. In any of the foregoing examples, the subject may be administered the therapeutically effective amount of the pharmaceutical composition at periodic intervals for an effective period of time to mitigate at least one sign or symptom of the disease or condition. For example, the subject may be administered the therapeutically effective amount of the pharmaceutical composition once daily or in divided doses over the course of a day, such as 2-3 divided doses per day. The pharmaceutical composition is administered by any suitable route including, but not limited to, parenterally (e.g., intravenously, intramuscularly, subcutaneously), orally, or topically. In view of the many possible aspects to which the principles of the disclosed invention may be applied, it should be recognized that the illustrated aspects are only preferred examples of the invention and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Claims

We claim:
1. A compound, or a stereoisomer, tautomer, or pharmaceutically acceptable salt thereof, having a general formula I: wherein each bond represented by - is a single or double bond as needed to satisfy valence requirements;
-X1 ( R5 )- is -C(H)-C(R5)-, -C(R5)-, -C(R5)-C(H)-, -C(R5)-N-, -N-C(R5)-, or -N(R5)-;
X2 is C or N;
X3 is N or CH, wherein one or two of X'-X3 comprises N;
X4 is CH or S;
X5 is -N(H)- or absent;
Y1 is N or QR1);
Y2 is C(R2) or N;
Y3 is C(R3) or N;
Y4 is N or C(R6);
Y5 is C(R7) or N;
Y6 is C(R8) or N; one or two of Y^Y6 are N, and at least one of Y^Y3 or Y6 is other than C(H); two, three, or four of Y7-Y10 independently are N or N(R9), and the others of Y7-Y10 are C(R10);
R1 is cyano, perhaloalkyl, H, alkyl, or perhaloalkoxy;
R2 is alkyl, H, alkoxy, perhaloalkyl, perhaloalkoxy, haloalkoxy, haloalkyl, cyano, cyanoalkyl, amino, heteroarylalkoxy, heteroalkyl, amido, halo, alkenyl, or haloalkenyl, or R1 and R2 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring;
R3 is H, amino, alkylamino, aminoalkyl, alkoxy, or R'C(O)N(H)- where R' is alkyl, or R2 and R3 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring; R4 is azaalkyl, aliphatic, aryl, or amino;
R5 is heteroaliphatic, aliphatic, , or alkylamino, or;
R6 and R7 independently are H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano;
R8 is H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano or R8 and R1 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring; each R9 independently is H or alkyl; and each R10 independently is H, alkyl, or cyano, with the following provisos:
(a) if ring A is aliphatic, or heteroaliphatic, then (i) X5 is N(H), or (ii) R3 is H, aminoalkyl, alkoxy , or
R'C(O)N(H)- where R' is alkyl, or (iii) R2 is alkoxy, cyanoalkyl, amino, or heteroarylalkoxy, or (iv) one of R1 and R7 is other than -H, or (v) only one of X 1 -X4 comprises N, or (vi) X3 is C(H), or (vii) X4 is S, or (vi) -X1 ( R5 )- is -C(R5)-C(H)-, -C(H)-C(R5)-, -C(R5)-N-, or -N-C(R5)-, or (viii) R1 and R2 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring,
(b) if ring A is where R3 is amino or alkylamino and , then (i) X5 is N(H), or (ii) R1 is cyano, perhaloalkyl, or perhaloalkoxy, or (iii) R2 is cyano, cyanoalkyl, amino, or heteroalkylalkoxy, or (iv) R7 is perhaloalkyl, perhaloalkoxy, or cyano, or (v) R4 is aryl, or (vi) R1 and R2 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring, or (viii) R2 and R3 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring,
(f) if X5 is N(H), and ring A is then R5 is not (g) if X5 is absent , then R5 is not r ring
A is not
(h) if X5 is absent and , , or (ii) ring
A is not not N, or (iii) R2 is not -H, -CN, or -CF3, or (iv) R1 is not -H, -CN, or -CF3, , then (i) R4 is not cycloalkyl or heterocycloalkyl, or (ii) Y4 is not N, or (iii) R1 is not -CN, or (iv) one of R2, R3, and R8 is other than
SUBSTITUTE SHEET (RULE 26) The compound of claim 1 , wherein ring where R11 and R12 are H, alkyl, perhaloalkyl, alkoxy, perhaloalkoxy, cyano, or amino.
3. The compound of claim 1, wherein ring A is: -
-difluoro-l-pyrrolidinyl, isopropyl, 2-methylpropyl, cyclopropyl,
The compound of any one of claims 1-5, wherein R5 is 5 -(CH2)3N(CH3)2, or -CH2OH, where Z is aliphatic, alkoxy, H, or heteroaliphatic.
7. The compound of claim 6, wherein Z is -C(O)CH3, H, methyl, ethyl, isopropyl, 2-methylpropyl, cyclopropyl, cyclopropylmethyl, cyclobutyl, cyclopentyl, cyclohexyl,
-(CH2)2(OCH2CH2)nOCH3 where n is an integer from 1 to 10,
8. The compound of claim 6, wherein Z is C1-C3 alkoxy, H, Ci-Ce alkyl, or heteroalkyl.
9. The compound of any one of claims 6-8, wherein the compound is:
where R11 and R12 are H, alkyl, perhaloalkyl, alkoxy, perhaloalkoxy, cyano, or amino. 10. The compound of claim 9, wherein:
R1 is -CN, -OCF3, or -CF3;
R11 and R12 independently are -CF3, -CN, -H, -OCH3, or -OCF3.
11. The compound of claim 9 or claim 10, wherein
The compound of claim 11, wherein the compound where: Z is aliphatic; and together with the atoms to which they are bound form a fused cycloaliphatic or heterocycloaliphatic ring, or Ra is cycloaliphatic and Rb is -H, or R4 is cycloaliphatic.
13. The compound of claim 1, wherein the compound is:
or
14. A pharmaceutical composition comprising a compound according to any one of claims 1-13 and at least one pharmaceutically acceptable carrier.
15. A method of inhibiting mixed lineage kinase (MLK) activity, comprising: contacting a cell expressing an MLK with an effective amount of a compound according to any one of claims 1-13, thereby inhibiting MLK activity.
16. The method of claim 15, wherein the MLK is MLK1 (MAP3K9), MLK2 (MAP3K10), MLK3 (MAP3K11), MLK4 (MAP3K21), DLK (MAP3K12), LZK (MAP3K13), ZAK1 (MAP3K20), or any combination thereof.
17. The method of claim 16, wherein the MLK is LZK, MLK3, or MLK4.
18. The method of any one of claims 15-17, wherein inhibiting MLK activity inhibits cell cycle progression, reduces c-MYC expression, inhibits c-Jun N-terminal kinase (JNK) pathway signaling, inhibits PI3K/AKT pathway signaling, inhibits cyclin dependent kinase 2 (CDK2) activity, inhibits extracellular signal-regulated kinase (ERK) pathway signaling, NF-KB signaling, or any combination thereof.
19. The method of any one of claims 15-18, wherein the cell is characterized by amplification of chromosome 3q, amplification of chromosome 1 Iq, overexpression of a mitogen-activated protein kinase kinase kinase (MAP3K), or any combination thereof.
20. The method of any one of claims 15-19, wherein the cell is a head and neck squamous cell carcinoma (HNSCC) cell, a lung squamous cell carcinoma (LSCC) cell, an esophageal cancer cell, a hepatocellular carcinoma cell, an ovarian cancer cell, a small cell lung cancer cell, a neuroendocrine prostate cancer cell, or a breast cancer cell.
21. The method of any one of claims 15-20, wherein contacting the cell with the compound comprises administering a therapeutically effective amount of the compound, or an amount of a pharmaceutical composition comprising the therapeutically effective amount of the compound, to a subject.
22. The method of claim 21, wherein the subject has a disease or condition characterized at least in part by MLK overexpression.
23. The method of claim 22, wherein the disease or condition is cancer.
24. The method of claim 23, wherein the cancer is HNSCC, LSCC, esophageal squamous cell carcinoma (ESCC), hepatocellular carcinoma, ovarian cancer, small cell lung cancer, neuroendocrine prostate cancer, esophageal adenocarcinoma, or breast cancer.
25. The method of claim 24, wherein the cancer is HNSCC, LSCC, ESCC, or triplenegative breast cancer.
26. The method of any one of claims 23-25, wherein administering the therapeutically effective amount of the compound, or the amount of the pharmaceutical composition, decreases viability of the cancer cells, inhibits tumor growth, or a combination thereof.
27. The method of any one of claims 21-26, wherein administering is performed parenterally, orally, or topically.
28. Use of a compound according to any one of claims 1-13 for inhibiting MLK activity, wherein inhibiting MLK activity comprises contacting a cell expressing an MLK with an effective amount of the compound, thereby inhibiting MLK activity.
29. Use of a compound according to any one of claims 1-13 for treating a disease or condition characterized at least in part by MLK overexpression, wherein treating comprises administering a therapeutically effective amount of the compound, or an amount of a pharmaceutical composition comprising the therapeutically effective amount of the compound, to a subject having a disease or condition characterized at least in part by MLK overexpression.
30. Use of a compound according to any one of claims 1-13 in the manufacture of a medicament for the treatment of a disease or condition characterized at least in part by MLK overexpression.
31. The use of any one of claims 28-30, wherein the MLK is MLK1 (MAP3K9), MLK2 (MAP3K10), MLK3 (MAP3K11), MLK4 (MAP3K21), DLK (MAP3K12), LZK (MAP3K13), ZAK1 (MAP3K20), or any combination thereof.
32. The use of claim 31, wherein the MLK is LZK, MLK3, or MLK4.
33. The use of any one of claims 29-32, wherein the disease or condition is cancer.
34. The use of claim 33, wherein the cancer is HNSCC, LSCC, ESCC, hepatocellular carcinoma, ovarian cancer, small cell lung cancer, neuroendocrine prostate cancer, esophageal adenocarcinoma, or breast cancer.
EP22777538.4A 2021-09-01 2022-08-30 Mixed lineage kinase inhibitors and methods of use Pending EP4395899A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163239797P 2021-09-01 2021-09-01
PCT/US2022/075678 WO2023034808A1 (en) 2021-09-01 2022-08-30 Mixed lineage kinase inhibitors and methods of use

Publications (1)

Publication Number Publication Date
EP4395899A1 true EP4395899A1 (en) 2024-07-10

Family

ID=83447780

Family Applications (1)

Application Number Title Priority Date Filing Date
EP22777538.4A Pending EP4395899A1 (en) 2021-09-01 2022-08-30 Mixed lineage kinase inhibitors and methods of use

Country Status (8)

Country Link
US (1) US20250032489A1 (en)
EP (1) EP4395899A1 (en)
JP (1) JP2024533121A (en)
KR (1) KR20240055041A (en)
CN (1) CN118251387A (en)
AU (1) AU2022340743A1 (en)
CA (1) CA3229861A1 (en)
WO (1) WO2023034808A1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024238570A1 (en) * 2023-05-15 2024-11-21 Aleksia Therapeutics, Inc. Cdk2 inhibitor pyrazolopyrimidine compounds
WO2025188848A1 (en) * 2024-03-06 2025-09-12 Uereka Biosciences, Inc. Lzk inhibitors
WO2026024674A1 (en) 2024-07-22 2026-01-29 Genesis Therapeutics, Inc. Methods of treating skp2-associated cancers

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4938949A (en) 1988-09-12 1990-07-03 University Of New York Treatment of damaged bone marrow and dosage units therefor
JPWO2012020786A1 (en) * 2010-08-11 2013-10-28 日本新薬株式会社 Pharmaceutical composition
BR112014026176A2 (en) * 2012-05-22 2017-06-27 Hoffmann La Roche substituted dipyridylamines and their uses
MX2015009270A (en) * 2013-01-18 2015-10-30 Hoffmann La Roche 3-substituted pyrazoles and use as dlk inhibitors.
PE20161063A1 (en) * 2013-05-01 2016-10-22 Hoffmann La Roche BIHETEROARIL COMPOUNDS AND USES OF THEM
WO2014177524A1 (en) * 2013-05-01 2014-11-06 F. Hoffmann-La Roche Ag C-linked heterocycloalkyl substituted pyrimidines and their uses
MX2016008110A (en) * 2013-12-20 2016-08-19 Hoffmann La Roche Pyrazole derivatives and uses thereof as inhibitors of dlk.
BR112019004243A2 (en) * 2016-08-29 2019-06-04 Univ Texas compound, pharmaceutical composition, method for inhibiting double leucine zipper kinase, method for treating a double leucine zipper kinase mediated disease and method for obtaining an effect on a patient
BR112019011801A2 (en) * 2016-12-08 2019-10-29 Univ Texas compound, pharmaceutical composition and dlk inhibition method, method of treating a dlk-mediated disease, method of treating cancer and reducing the development of a chemotherapy-induced neurological disorder and method for achieving an effect in a patient

Also Published As

Publication number Publication date
WO2023034808A1 (en) 2023-03-09
AU2022340743A1 (en) 2024-03-14
KR20240055041A (en) 2024-04-26
JP2024533121A (en) 2024-09-12
CA3229861A1 (en) 2023-03-09
US20250032489A1 (en) 2025-01-30
CN118251387A (en) 2024-06-25

Similar Documents

Publication Publication Date Title
KR20250021402A (en) Heterocyclic compounds and their uses
CN109970614B (en) Compounds as TRKA kinase inhibitors and uses thereof
AU2011311814B2 (en) Substituted pyridazine carboxamide compounds
WO2023034808A1 (en) Mixed lineage kinase inhibitors and methods of use
KR102603153B1 (en) C5-anilinoquinazoline compounds and their use in the treatment of cancer
RU2581834C1 (en) New piperidine compound or salt thereof
US20220306621A9 (en) SUBSTITUTED IMIDAZO[1,2-a]PYRIDINES AS IRAK 1/4 AND FLT3 INHIBITORS
CN115996907B (en) Inhibitors of MLH1 and/or PMS2 for cancer treatment
BR112021005513A2 (en) quinazoline derivatives as a tyrosine kinase inhibitor, compositions, manufacturing methods and use thereof
WO2018137639A1 (en) Histone methyltransferase ezh2 inhibitor, preparation method and pharmaceutical use thereof
JP2020532561A (en) Inhibitor of WDR5 protein-protein binding
CN111527078A (en) Pyridine carbonyl derivatives and their therapeutic use as TRPC 6 inhibitors
US20240190838A1 (en) Lzk-targeting degraders and methods of use
CN106536524B (en) [1,2,4]Triazolo[4,3-B]pyridazine for use in the treatment of proliferative diseases
KR20190129923A (en) Deuterated imidazo [4,5-C] quinolin-2-one compounds and their use in treating cancer
TW201808948A (en) Imidazo[4,5-c]quinolin-2-one compounds and their use in treating cancer
CN117693507A (en) Inhibitor compounds
WO2023008577A1 (en) Ras/raf binding inhibitor compound
EP4729515A1 (en) New acylsulfonamide derivatives and their use for the treatment of cancer
KR20250034312A (en) WEE1 inhibitor, its preparation method and its use
WO2025255442A1 (en) Trim21-targeted compounds and uses thereof
CN118772113A (en) Nitrogen-containing heterocyclic compounds as inhibitors of DNA polymerase Theta
HK1188216B (en) Substitututed 6-amino-pyridazin-3-yl-carboxamide compounds as protein kinase modulators
BR112016026672B1 (en) COMPOUND 1-((3S,4R)-4-(3-FLUOROPHENYL)-1-(2-METHOXYETHYL)PYRROLIDIN-3-IL)-3-(4-METHYL-3-(2-METHYLPYRIMIDIN-5-IL) -1-PHENYL-1H-PYRAZOL-5-YL)UREA, ITS USE, PROCESSES FOR THE PREPARATION OF THE SAME AND ITS RACEMIC MIXTURE AND PHARMACEUTICAL COMPOSITION THAT COMPRISES IT

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20240319

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)