EP4284166A1 - Down-regulation of endogenous genes - Google Patents
Down-regulation of endogenous genesInfo
- Publication number
- EP4284166A1 EP4284166A1 EP22703583.9A EP22703583A EP4284166A1 EP 4284166 A1 EP4284166 A1 EP 4284166A1 EP 22703583 A EP22703583 A EP 22703583A EP 4284166 A1 EP4284166 A1 EP 4284166A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- mir
- human animal
- plant
- mice
- microrna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
- A01K67/0276—Knock-out vertebrates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
- A01K67/0278—Knock-in vertebrates, e.g. humanised vertebrates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
- A01K2217/054—Animals comprising random inserted nucleic acids (transgenic) inducing loss of function
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/072—Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/20—Animal model comprising regulated expression system
- A01K2217/206—Animal model comprising tissue-specific expression system, e.g. tissue specific expression of transgene, of Cre recombinase
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/103—Ovine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/035—Animal model for multifactorial diseases
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/035—Animal model for multifactorial diseases
- A01K2267/0362—Animal model for lipid/glucose metabolism, e.g. obesity, type-2 diabetes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
Definitions
- aspects and embodiments decribed herein relate to the field of biotechnology, particularly genetically modified plants and non-human animals.
- phenotypes including traits, diseases and disorders, are largely determined by a single or multiple genes and may be denoted as genetic traits, diseases and disorders. In case the phenotype is attributable to a single gene it is often referred to as a monogenic trait, disease or disorder. In many cases, mutations in genes are partial or complete loss-of-function mutations, meaning that the resulting gene product has less or no function.
- ES embryonic stem
- knockdown approaches such as embryonic stem (ES)-cell based gene targeting, gene editing (by employing e.g.
- RNA interference RNA interference
- ENU N-ethyl-N-nitrosourea
- Some methods have been developed for the generation of tissue-specific downregulation or knock-out of genes, such as the Cre/loxP, Flp/FRT or the Dre/rox systems.
- these existing methods have the drawback that they require the insertion of exogenous sequences (recombination sites and/or selection markers), which can unintentionally deregulate transcription and splicing.
- exogenous sequences recombination sites and/or selection markers
- one of the recombinase-specific sites is maintained in the edited genome.
- the selection marker gene is not properly removed, its maintenance in the genetically modified genome may lead to potential off-target effects such as unwanted splicing effects or hypomorphic alleles not only in the target tissue but in the rest of tissues in which the gene of interest is endogenously expressed.
- Examples of a genetic, more specifically a monogenic, disease or disorder are diseases known as maturity-onset diabetes of the young (MODY), which comprises a heterogeneous group of monogenic disorders characterized by beta-cell dysfunction (impaired insulin secretion) with minimal or no defects in insulin action.
- MODYs are a rare cause of diabetes (1-2% of all cases of diabetes) (Fajans, S.S. et al. (2011). Diabetes Care, 34, 1878-84), with onset of hyperglycemia at an early age (generally before 25 years) (American Diabetes Association (2014). Diabetes Care, 37 Suppl 1 , S81-90).
- MODY3 is the most common cause of MODY and is caused by mutations in the gene encoding for the transcription factor hepatocyte nuclear factor (HNF) 1A (Amk. A (2015). J. Pediatr. Endocrinol. Metab. 28, 251-63).
- HNF hepatocyte nuclear factor
- MODY3 patients are typically normoglycemic in childhood, but mutations in the HNF1 A gene cause progressive pancreatic beta-cell dysfunction that results in hyperglycemia, which is usually diagnosed between the second and fifth decades of life (Thanabalasingham, G. et al. (2011). BMJ, 343, d6044). Consequently, MODY3 patients are at risk of development of the full spectrum of microvascular and macrovascular complications associated with diabetes (Amk. A (2015). J. Pediatr.
- HNF4A hepatic nuclear factor 4A (Yamagata K. (1996). Nature 384, 458-460).
- HNF4A similar to HNF1A, is also a transcription factor and was shown to be essential for beta-cell function and maintaining glucose homeostasis. It is involved in the regulation of genes involved in insulin secretion such as glucokinase (GCK), SLC2A2 (encoding for GLUT2) or also HNF1A.
- GCK glucokinase
- SLC2A2 encoding for GLUT2
- HNF1A glucokinase
- MODY1 patients often show transient neonatal hypoglycemia that later evolves to decreased insulin secretion and diabetes (Pearson E.R. et al. (2007). Macrosomia and hyperinsulinaemic hypogylcaemia in patients with heterozygous mutations in the HNF4 gene. PLoS Med. 4, e118). Due to the early onset of hyperglycemia usually before 25 years of age, MODY1 patients are equally at risk for diabetes- associated complications as MODY3 patients.
- MODY mouse models that reproduce the phenotype observed in patients are required.
- MODY3 there do exist two different global HNF1A knockout mouse models. Although these animals display a diabetic phenotype, they also show multiple organ manifestations that are not observed in MODY3 patients.
- the beta-cell-specific overexpression of dominant negative mutants of HNF1A in two different lines of transgenic mice closely recapitulates the beta-cell dysfunction and diabetes observed in MODY3, without an extra-pancreatic phenotype.
- the invention relates to a genetically modified plant or non-human animal having reduced expression of an endogenous target gene, wherein the genome of the plant or non-human animal is modified by ectopic integration of at least one copy of a target sequence of a microRNA.
- the genetically modified plant or non-human animal is such that the ectopic integration site is located:
- the ectopic integration site is located in the 3’ UTR of the target gene or in the region between the last exon and the 3’ UTR of the target gene.
- the genetically modified plant or non-human animal is such that the genome comprises one, two, three, four, five, six, seven, eight or more copies, preferably two, three or four copies, more preferably two copies of the target sequence of a microRNA.
- the genetically modified plant or non-human animal is such that the reduced expression is specifically in one or more target cells, tissues and/or organs of an organism, and wherein the target sequence is of a microRNA expressed specifically in said one or more target cells, tissues and/or organs.
- the reduced expression is specifically in one or more target cells, tissues and/or organs of an organism, and the target sequence is of a microRNA expressed specifically in said one or more target cells, tissues and/or organs.
- a genetically modified plant or non-human animal is a non-human animal, preferably a mammal such as a rodent, more preferably a rat or a mouse, most preferably a mouse.
- the genetically modified plant or non-human animal is such that the reduced expression is specifically in the pancreas and the target sequence is of a microRNA expressed specifically in the pancreas, preferably wherein the microRNA is selected from the group consisting of: mir-200a, mir-96, mir-1839-1 , mir-34a, mir-7b, mir-7-1 , mir-7-2, mir-184, mir-375, mir-219a-1 , mir-574, mir-802, mir-152 and mir-148a, more preferably wherein the microRNA is mir-375.
- the genetically modified plant or non-human animal is such that the target gene as described herein is selected from the group consisting of: HNF4A, GCK, HNF1 A, PDX1 , HNF1 B, NEUROD1 , KLF11 , CEL, PAX4, INS, BLK, ABCC8, APPL1 and KCNJ1 1 , preferably the target gene is HNF1A or HNF4A.
- the genetically modified plant or non-human animal is a plant or non-human animal disease model, preferably a model for a disease associated with or caused by mutations in the target gene, more preferably wherein the disease is a monogenic disease.
- the disease is maturity onset diabetes of the young type 3 (MODY3) and the target gene is HNF1A, or the disease is maturity onset diabetes of the young type 1 (MODY1) and the target gene is HNF4A.
- the invention relates to a method for obtaining a genetically modified plant or non- human animal of the invention, comprising:
- the method for obtaining a genetically modified plant or non-human animal of the invention further comprises the step of back-crossing the genetically modified plant or non-human animal with non-genetically modified wildtype plant or non-human animal.
- the invention in another aspect relates to a method for identifying and/or evaluating therapeutic efficacy of a candidate agent for treating, inhibiting or preventing a disease, comprising administering the candidate agent to a plant or non-human animal of the invention which is a plant or non-human animal disease model, more preferably a model for a disease associated with or caused by mutations in the target gene, or a cell, tissue or organ derived thereof.
- the invention in another aspect relates to a method for identifying and/or evaluating therapeutic efficacy of a candidate agent for treating, inhibiting or preventing MODY3 or MODY1 , comprising administering the agent to a plant or non-human animal of the invention which is a plant or non-human animal disease model, more preferably a model for a disease associated with or caused by mutations in the target gene, wherein the disease is maturity onset diabetes of the young type 3 (MODY3) and the target gene is HNF1A, or wherein the disease is maturity onset diabetes of the young type 1 (MODY1) and the target gene is HNF4A, or a cell, tissue or organ derived thereof.
- a plant or non-human animal of the invention which is a plant or non-human animal disease model, more preferably a model for a disease associated with or caused by mutations in the target gene, wherein the disease is maturity onset diabetes of the young type 3 (MODY3) and the target gene is HNF1A, or wherein the disease is maturity onset diabetes of
- the present inventors have developed an efficient and highly specific method to obtain reduced expression of an endogenous target gene in any plant or animal species, preferably in specific cells, tissues, and/or organs.
- the method is based on knocking in one or more target sites for a microRNA near the target gene.
- the target gene transcript will comprise one or more microRNA target sites that will prevent translation in any cell, tissue or organ where the corresponding microRNA is expressed.
- the introduction of target sequences of a microRNA for example a microRNA expressed in the pancreas or pancreatic islets, upstream of the 3’ UTR leads to specific downregulation of expression in tissues where the corresponding microRNA is expressed, for example the pancreas or pancreatic islets.
- this kind of models can be used for the evaluation of gene therapy approaches.
- plants and non-human animals, particularly non-human animals according to the invention have an increased usefulness to civilization while having fewer undesired side effects.
- RNAi based methods including overexpression of an artificial RNA (e.g. shRNA)
- shRNA an artificial RNA
- a genetically modified plant or non-human animal having reduced expression of an endogenous target gene, wherein the genome of the plant or non-human animal is modified by ectopic integration of at least one copy of a target sequence of a microRNA.
- a genetically modified plant or non-human animal having reduced expression of an endogenous target gene as used herein encompasses a genetically modified plant or non-human animal having reduced expression of one, two, three, or more endogenous target genes.
- an endogenous target gene may be replaced with “one or more endogenous target genes”.
- Ectopic integration refers to the integration of a stretch of DNA, particularly at least one copy of a target sequence of a microRNA, at a site other than its usual locus.
- a genetically modified plant or non-human animal as described herein is such that the unmodified or wildtype or reference or control or parental genome thereof does not comprise the target sequence of a microRNA at that integration site.
- An “endogenous target gene” may be any gene or coding sequence that is naturally present in the plant or non-human animal.
- genetically modified may be understood to refer to any alteration in an organism’s genetic material by genetic engineering techniques, i.e. including other steps than merely mating/crossing and selection.
- microRNA and “target sequence of a microRNA” are further described elsewhere herein.
- “having reduced expression of an endogenous target gene” may be replaced with “wherein an endogenous target gene is silenced”, “wherein an endogenous target gene is knocked down”, “wherein an endogenous target gene is knocked out”, “wherein the expression of an endogenous target gene is prevented”, “wherein the expression of an endogenous target gene is limited”, “wherein the expression of an endogenous target gene is decreased”, or “wherein the expression of an endogenous target gene is inhibited” or similar phrases.
- reduced expression is to be seen relative to an unmodified or wildtype or reference or control or parental plant or non-human animal.
- reduced expression may mean at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or 100% reduction relative to the expression level in an unmodified or wildtype or reference or control or parental plant or non-human animal, preferably at least 60%, more preferably at least 70%, most preferably at least 80%.
- reduced expression may mean at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or 100% reduction in mRNA level relative to the mRNA level in an unmodified or wildtype or reference or control or parental plant or non-human animal, preferably at least 60%, more preferably at least 70%, most preferably at least 80%.
- reduced expression may mean at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or 100% reduction in protein level relative to the protein level in an unmodified or wildtype or reference or control or parental plant or non-human animal, preferably at least 60%, more preferably at least 70%, most preferably at least 80%.
- reduced expression may mean that expression is no longer detectable. “Expression” may be assessed as described elsewhere herein, including by the methods described in the examples section.
- an unmodified or wildtype or reference or control or parental plant or non-human animal or genome may be understood to be a wild type or parental plant or non-human animal from which the genetically modified plant or non-human animal of the invention was derived.
- a suitable unmodified or wildtype or reference or control or parental plant or non-human animal is any plant or non- human animal having the same or essentially the same genotype as the genetically modified plant or non-human animal of the invention, except for the ectopic integration of the at least one copy of a target sequence of a microRNA.
- non-human animal as used herein includes all multicellular eukaryotic organisms that together form the biological kingdom Animalia, with the exception of humans.
- plant as used herein includes all organisms in the biological kingdom Plantae.
- a genetically modified plant or non-human animal as described herein is a genetically modified non-human animal.
- a non-human animal is selected from an invertebrate animal and a vertebrate animal, preferably a vertebrate animal.
- Invertebrates may be understood to encompass all animal groups not included in the subphylum Vertebrata. Invertebrates include for example arthropods (including insects, arachnids, crustaceans, and myriapods), mollusks (including chitons, snail, bivalves, squids, and octopuses), annelid (including earthworms and leeches), Platyhelminthes, Nematoda, Echinodermata, and cnidarians (including hydras, jellyfishes, sea anemones, and corals). Preferred invertebrates are insects.
- arthropods including insects, arachnids, crustaceans, and myriapods
- mollusks including chitons, snail, bivalves, squids, and octopuses
- annelid including earthworms and leeches
- Platyhelminthes Nematoda,
- Vertebrate animals may be selected from the group consisting of: amphibians, reptiles, birds and mammals. Mammals are preferred.
- a genetically modified plant or non- human animal as described herein is a mammal such as a rodent, more preferably a rat or mouse, most preferably a mouse.
- a mammal is selected from the group consisting of rodents (including mice, rats, squirrels, prairie dogs, porcupines, beavers, guinea pigs, hamsters, and gerbils), cats, dogs, cows, pigs, horses, sheep, goats and non-human primates (including rhesus macaques, crab-eating macaques, stump-tailed macaques, pig-tailed macaques, squirrel monkeys, owl monkeys, baboons, chimpanzees, marmosets and spider monkeys).
- rodents including mice, rats, squirrels, prairie dogs, porcupines, beavers, guinea pigs, hamsters, and gerbils
- cats dogs, cows, pigs, horses, sheep, goats and non-human primates (including rhesus macaques, crab-eating macaques, stump-tailed macaques, pig-tailed macaques, squirrel monkeys,
- a genetically modified plant or non-human animal is a model organism, which may be a plant model organism, an invertebrate animal model organism or a vertebrate animal model organism.
- a model organism is a non-human organism that has been widely studied, usually because it is easy to maintain and breed in a laboratory setting and because it has particular experimental advantages. For example, methods for genetic engineering are usually well-developed in model organisms.
- Suitable model organisms which are plants are selected from the group consisting of: Amborella trichopoda, Antheroceros agresis, Arabidopsis thaliana, Arabidopsis halleri, Arabidopsis lyrata, Aquilegia caerulea, Azolla filiculoides, Boechera spp., Brachypodium distachyon, Cardamine hirsute, Ceratodon purpureus, Ceratopteris richardii, Eucalyptus globulus, Eucalyptus grandis, Eutrema salsugineum, Fragaria vesca, Klebsormidium flaccidum, Lemna gibba, Lemna minor, Lotus japonicas, Marchantia polymorpha, Medicago truncatula, Mimulus guttatus, Miscanthus sinensis, Nicotiana benthamiana, Nicotiana tabacum, Oropetium thomameum, Or
- a preferred model organism which is a plant is an Arabidopsis species, preferably Arabidopsis thaliana.
- Suitable model organisms which are non-human invertebrate animals are selected from the group consisting of: Amphimedon queenslandica, Arbacia rcisata, Aplysia, Branchiostoma floridae, Caenorhabditis elegans, Caledia captiva, Callosobrochus maculatus, Chorthippis parallels, Ciona intestinalis, Daphnia spp. such as Daphnia magna and Daphnia pulex, Coelopidae, Diposidae, Drosophila spp.
- Suitable model organisms which are non-human vertebrate animals are selected from the group consisting of: Ambystoma mexicanum, Anolis carolinensis, Bombina bombina, Bombina variegate, Canis lupus familiaris, Cavia porcellus, Columba livia domestica, Danio rerio, Fells sylvestris catus, Fundulus heteroclitus, Gallus gallus domesticus, Gasterosteus aculeatus, Heterocephalus glaber, Macaca mulatta, Mesocricetus auratus, Mus musculus, Myotis lucifugus, Nothobranchius furzer, Oryzias latipes, Pan troglodytes, Petromyzon marines, Poecilia reticulate, Rattus norvegicus, Sigmodon hispidus, Taeniopygia guttata, Takifufu rubripes, Xen
- the ectopic integration site is located:
- an “ectopic integration site” as used herein can be understood as referring to the site in the genome where the at least one copy of a target sequence of a microRNA is integrated. Downregulation of expression of the endogenous target gene can be obtained regardless of whether the ectopic integration site is located in the 5’ UTR of the target gene (or in the region between the 5’ UTR and the first exon of the target gene); or in the 3’ UTR of the target gene (or in the region between the last exon and the 3’ UTR of the target gene).
- the ectopic integration site is located in the 3’ UTR of the target gene or in the region between the last exon and the 3’ UTR of the target gene. More preferably, the ectopic integration site is located in the region between the last exon and the 3’ UTR of the target gene.
- the modified genome comprises one, two, three, four, five, six, seven, eight or more copies, preferably two, three or four copies, more preferably two copies of the target sequence of a microRNA.
- a genetically modified plant or non-human animal as described herein does not comprise a selection marker in its genome. In some embodiments, a genetically modified plant or non- human animal as described herein does not comprise an exogenous recombination site in its genome, such as a LoxP site or an Frt site. This will typically be the case when the genetically modified plant or non-human animal is generated according to preferred methods of the invention involving the use of CRISPR-mediated homology-directed repair (HDR) (as described later herein).
- HDR CRISPR-mediated homology-directed repair
- a target sequence of a microRNA as described herein is preferably a target sequence of an endogenous microRNA.
- a target sequence of a microRNA as described herein includes target sequences for one, two, three, four or more microRNAs.
- the modified genome comprises at least one copy of a target sequence of a first microRNA, and at least one copy of a target sequence of a second microRNA.
- the modified genome comprises at least one copy of a target sequence of a first microRNA, at least one copy of a target sequence of a second microRNA, and at least one copy of a target sequence of a third microRNA.
- the modified genome comprises at least one copy of a target sequence of a first microRNA, at least one copy of a target sequence of a second microRNA, at least one copy of a target sequence of a third microRNA, and at least one copy of a sequence of a fourth mircroRNA.
- target sequence of a second, third and/or fourth microRNA may be present in two, three, four, five, six or more, preferably two copies.
- a genetically modified plant or non-human animal having reduced expression of an endogenous target gene as described herein includes genetically modified plants or non-human animals having reduced expression of one, two, three or more endogenous target genes. This may be achieved by ectopic integration of at least one copy of a target sequence of a microRNA at a corresponding number of ectopic integration sites.
- a genetically modified plant or non-human animal as described herein may have reduced expression of a first and a second endogenous target gene wherein the genome of the plant or non-human animal is modified by ectopic integration of at least one copy of a target sequence of a microRNA at a first ectopic integration site and by ectopic integration of at least one copy of a target sequence of a microRNA at a second ectopic integration site.
- the first ectopic integration site may be located:
- the second ectopic integration site may be located:
- a genetically modified plant or non-human animal as described herein may have reduced expression of a first, a second and a third endogenous target gene wherein the genome of the plant or non-human animal is modified by ectopic integration of at least one copy of a target sequence of a microRNA at a first ectopic integration site and by ectopic integration of at least one copy of a target sequence of a microRNA at a second ectopic integration site and by ectopic integration of at least one copy of a target sequence of a microRNA at a third ectopic integration site.
- the first and second ectopic integration sites may be located as described herein.
- the third ectopic integration site may be located:
- MicroRNAs or miRNAs are small non-coding RNA molecules found in plants, animals and some viruses, that may function in RNA silencing and post-transcriptional regulation of gene expression.
- a portion of a microRNA means a nucleotide sequence of at least four, at least five, at least six or at least seven consecutive nucleotides of said microRNA.
- the binding site sequence can have perfect complementarity to at least a portion of an expressed microRNA, meaning that the sequences are a perfect match without any mismatch occurring.
- the binding site sequence can be partially complementary to at least a portion of an expressed microRNA, meaning that one mismatch in four, five, six or seven consecutive nucleotides may occur.
- Partially complementary binding sites preferably contain perfect or near perfect complementarity to the seed region of the microRNA, meaning that no mismatch (perfect complementarity) or one mismatch per four, five, six or seven consecutive nucleotides (near perfect complementarity) may occur between the seed region of the microRNA and its binding site.
- the seed region of the microRNA consists of the 5’ region of the microRNA from about nucleotide 2 to about nucleotide 8 of the microRNA.
- the portion of a microRNA as described herein is preferably the seed region of said microRNA.
- Degradation of the messenger RNA (mRNA) containing the target sequence for a microRNA may be through the RNA interference pathway or via direct translational control (inhibition) of the mRNA.
- This invention is in no way limited by the pathway ultimately utilized by the miRNA in inhibiting expression of the transgene or encoded protein.
- miRNAs there are marked cell-, tissue-, and organ-specific differences in the expression of miRNAs. For example, in mice, about 30% of total noncoding small RNAs are expressed in a tissue specific manner, and about 17% of total noncoding small RNAs are expressed uniquely in a single tissue (Isakova et al. A mouse tissue atlas of small noncododing RNA. PNAS 2020;117(41 ):25634- 25645, incorporated herein by reference). In addition, some miRNAs may have a specific expression pattern over time, optionally in combination with cell-, tissue-, and organ-specific expression. For example, a miRNA may be expressed in specific developmental stages.
- miRBase comprises miRNA sequences from more than 270 organisms across invertebrates, vertebrates and plants.
- miRBase is the primary public repository and online resource for microRNA sequences and annotation.
- the miRBase website provides a wide-range of information on published microRNAs, including their sequences, their biogenesis precursors, genome coordinates and context, literature references, deep sequencing expression data and community-driven annotation.
- miRBase is available at http://www.mirbase.org, described in Kozomara et al. miRBase: from microRNA sequences to function, Nucleic Acids Research, Volume 47, Issue D1 , 08 January 2019, Pages D155-D162, incorporated herein by reference.
- sequences and expression information for miRNAs such as:
- miRBase available at http://www.mirbase.org, described in Kozomara et al. miRBase: from microRNA sequences to function, Nucleic Acids Research, Volume 47, Issue D1 , 08 January 2019, Pages D155-D162, incorporated herein by reference.
- PMRD plant microRNA database, Nucleic Acids Research, Volume 38, Issue suppl_1 , 1 January 2010, Pages D806-D813, incorporated herein by reference.
- miRNEST available at http://rhesus.amu.edu.pl/mirnest/copy/, described in Szczesniak MW, Makalowska I (2014) miRNEST 2.0: a database of plant and animal microRNAs. Nucleic Acids Res. 42:D74-D77, incorporated herein by reference.
- PmiRKB available at http://bis.zju.edu.cn/pmirkb/, described in Yijun Meng et al. PmiRKB: a plant microRNA knowledge base, Nucleic Acids Research, Volume 39, Issue suppl_1 , 1 January 2011 , Pages D181-D187, incorporated herein by reference.
- PNRD PNRD
- MepmiRDB available at http://mepmirdb.cn/mepmirdb/index.html, described in Dongliang Yu et al. MepmiRDB: a medicinal plant microRNA database, Database, Volume 2019, 2019, apel070, incorporated herein by reference.
- PmiREN available at http://www.pmiren.com, described in Zhonglong Guo et al. PmiREN: a comprehensive encyclopedia of plant miRNAs, Nucleic Acids Research, Volume 48, Issue D1 , 08 January 2020, Pages D1114-D1121 , incorporated herein by reference.
- miRBase available at http://www.mirbase.org, described in Kozomara et al. miRBase: from microRNA sequences to function, Nucleic Acids Research, Volume 47, Issue D1 , 08 January 2019, Pages D155-D162, incorporated herein by reference.
- miRNEST available at http://rhesus.amu.edu.pl/mirnest/copy/, described in Szczesniak MW, Makalowska I (2014) miRNEST 2.0: a database of plant and animal microRNAs. Nucleic Acids Res. 42:D74-D77, incorporated herein by reference.
- RATEmiRs available at https://connect.niehs.nih.gov/ratemirs/, described in Bushel, P.R., Caiment, F., Wu, H. et al.
- RATEmiRs the rat atlas of tissue-specific and enriched miRNAs database. BMC Genomics 19, 825 (2018), incorporated herein by reference.
- microRNAs as well as their sequence and information about their expression across time and in different cells, tissues and organs as disclosed in the above publications and databases is expressly incorporated herein by reference.
- a skilled person could identify further miRNAs including cell-, tissue- and organspecific miRNAs in any desired plant or non-human animal organism based on available methods and techniques, such as RNASeq. See for example the methods, in particular RNASeq-based methods, described in any of the publications cited above.
- the present invention allows a skilled person to exploit the available miRNA knowledge to design genetically modified plant or non-human animals as described herein. Indeed, it is possible to identify desired miRNA target sequences binding miRNAs that are expressed in a specific type of cell, tissue or organ, or during a specific time such as a developmental stage, to generate a genetically modified plant or non-human animal as described herein.
- a genetically modified plant or non-human animal as described herein wherein the reduced expression is specifically in one or more target cells, tissues and/or organs of an organism and wherein the target sequence is of a microRNA expressed specifically in said one or more target cells, tissues and/or organs.
- each of the first, second, third and/or fourth microRNA may be expressed in the same cell, organ and/or tissue (or developmental stage), or in two, three, four, or more different cells, organs and/or tissues (or developmental stages).
- a cell, tissue or organ may belong to the root system or the shoot system and may belong to the dermal, ground or vascular tissue types.
- a cell, tissue or organ may be selected from the group consisting of: roots (including primary roots and secondary roots), leaves (including petiole, blade), buds, stems (including primary stems and secondary stems, nodes and internodes), flowers (including petals, stamens and carpels), fruits, seeds, tubers, rhizomes, cotyledons, and tissues and cells thereof.
- a cell, tissue or organ may be selected from the group consisting of: epidermis, parenchyma, collenchyma, sclerenchyma, xylem (including primary xylem and secondary xylem), phloem (including primary phloem and secondary phloem), cambium and cells and tissues thereof.
- a cell, tissue or organ may be selected from the group consisting of: adipose tissue, adrenal glands, anus, appendix, bladder, bones, bone marrow, brain, bronchi, diaphragm, ears, eyes, fallopian tubes, gallbladder, olfactory epithelium, heart, hypothalamus, joints, kidneys, large intestine, larynx, liver, lungs, lymph nodes, mammary glands, mesentery, mouth, nasal cavity, nose, ovary, pancreas, pineal gland, parathyroid glands, pharynx, pituitary gland, prostate, rectum, salivary glands, skeletal muscles, skin, small intestine, spinal cord, spleen, stomach, teeth, thymus gland, thyroid, trachea, tongue, ureters, urethra, uterus, nerves, ligaments, tendons, clitoris,
- Preferred cells, organs or tissues are: adipose tissue, bone marrow, brain, ears, eyes, heart, hypothalamus, kidneys, large intestine, liver, lungs, lymph nodes, pancreas, prostate, skeletal muscles, skin, small intestine, spinal cord, spleen, stomach and cerebellum, and tissues and cells thereof. More preferred cells, organs or tissues are selected from the group consisting of: muscle, heart, pancreas, brain, kidney, testis, lung, bone marrow, spleen, intestine and liver, and tissues and cells thereof, preferably the pancreas and tissues and cells thereof.
- a genetically modified plant or non-human animal as described herein, wherein the reduced expression is specifically in the muscle, heart, pancreas, brain, kidney, testis, lung, bone marrow, spleen, intestine and/or liver, and wherein the target sequence is of a microRNA expressed specifically in the muscle, heart, pancreas, brain, kidney, testis, lung, bone marrow, spleen, intestine and/or liver.
- the target sequence is of a microRNA expressed specifically in the muscle, heart, pancreas, brain, kidney, testis, lung, bone marrow, spleen, intestine and/or liver.
- the target sequence of a microRNA expressed specifically in the muscle, heart, pancreas, brain, kidney, testis, lung, bone marrow, spleen, intestine and/or liver as described herein is a target sequence of a microRNA selected from Fig. S3 or Dataset S3 in Isakova et al. A mouse tissue atlas of small noncododing RNA. PNAS 2020;117(41):25634-25645, incorporated herein by reference.
- the target sequence of a microRNA expressed specifically in the muscle, heart, pancreas, brain, kidney, testis, lung, bone marrow, spleen, intestine and/or liver is selected from target sequences of the following microRNAs:
- microRNA expressed in the muscle mir-149, mir-378d, mir-378a, mir-193b, mir-10b, mir-196b, mir-615, mir-169a-1 , mir-196a-2, mir-133b, mir-1 a-1 , mir-1 a-2, mir-133a-2, mir-133a-1 , mir- 7068, mir-3061 and mir-299a
- microRNA expressed in the heart mir-499, mir-208a, mir-490, mir-149, mir-378d, mir-378a, mir- 133a, mir-206, mir-1 , mir-499
- microRNA expressed in the pancreas mir-200a, mir-96, mir-1839-1 , mir-34a, mir- 7b, mir-7-1 , mir-7-2, mir-184, mir-375, mir-219a-1 , mir-574, mir-802, mir-152 and mir-148a, preferably mir-375
- microRNA expressed in the brain mir-299a, mir-376c, mir-134, mir-182, mir-708, mir-let7e, mir- 1298, mir-764, mir-879, mir-6540, mir-135b, mir-9-2, mir-9-1 , mir-9-3, mir-124a-3, mir-124a-1 , mir-124a-2, mir-384, mir-344, mir-488, mir-323, mir-758, mir-138-2, mir-132, mir-137, mir-212, mir-3099, mir-433, mir-487b, mir-667, mir-666, mir-380, mir-128-2, mir-128-1 , mir-300, mir-410, mir-485, mir-369, mir-381 , mir-543, mir-127, mir-541 , mir-1249, mir-338, mir-329, mir-376b, mir- 434, mir-136, mir-673, mir-411 , mir-540, mir-377, mir-337, mir-379, mir-382, mir-496a
- microRNA expressed in the testis mir-203, mir-147, mir-193b, mir-10b
- microRNA expressed in the lung mir-34b, mir-92b, mir-34c, mir-449a, mir-449c, mir-351
- microRNA expressed in the bone marrow mir-351 , mir-223, mir-130b, mir-142, mir-92-2, mir363, mir-20b, mir-106a
- microRNA expressed in the spleen mir-142, mir-92-2, mir-363, mir-20b, mir-106a, mir-150, mir- 155
- microRNA expressed in the intestine mir-145a, mir-215, mir-194-1 , mir-194-2, mir-31 , mir-200a
- microRNA expressed in the liver mir-107, mir-148a, mir-3105, mir-192, mir-122 and mir-1948, mir-152, mir-199a, mir-215, mir-192, mir-194
- a target sequence of mir-375 has the sequence of SEQ ID NO: 7, or a sequence having 60%, 70%, 80%, 90%, 95%, 98%, 99%, or 100% sequence identity therewith.
- a particularly preferred cell, tissue or organ is the pancreas and tissues and cells thereof.
- a particularly preferred cell is a pancreatic islet cell, preferably a beta cell.
- microRNAs that are expressed specifically in the pancreas, pancreatic islet cells, and/or beta-cells are particularly preferred.
- a genetically modified plant or non-human animal as described herein, wherein the reduced expression is specifically in the pancreas, preferably in the pancreatic islet cells, more preferably in the beta-cells of the pancreas, and wherein the target sequence is of a microRNA expressed specifically in the pancreas, preferably in the pancreatic islet cells, more preferably in the beta-cells of the pancreas.
- the target sequence is of a microRNA expressed specifically in the pancreas, preferably in the pancreatic islet cells, more preferably in the beta-cells of the pancreas.
- the target sequence of a microRNA expressed specifically in the pancreas, preferably in the pancreatic islet cells, more preferably in the beta-cells of the pancreas as described herein is a target sequence of a microRNA listed in Fig. S3 or Dataset S3 in Isakova et al. A mouse tissue atlas of small noncododing RNA. PNAS 2020;117(41):25634-25645, incorporated herein by reference.
- a microRNA expressed specifically in the pancreas, preferably in the pancreatic islet cells, more preferably in the beta-cells of the pancreas as described herein is selected from the group consisting of: mir-200a, mir-96, mir-1839-1 , mir-34a, mir-7b, mir-7-1 , mir-7-2, mir-184, mir-375, mir-219a-1 , mir-574, mir-802, mir-152 and mir-148a.
- the target sequence is a microRNA-375 target sequence.
- the invention is not limited to any particular target gene or coding sequence.
- a suitable target gene and a suitable organ, tissue and/or cell can be selected.
- genes which have a direct connection to a phenotype may be preferred.
- Such phenotypes are also called monogenic phenotypes and include monogenic traits, monogenic diseases and monogenic disorders. Even more preferred are genes exerting their effects in particular cells, tissues or organs.
- the target gene as described herein is a gene associated with the development of a disease, preferably a monogenic disease. In some embodiments, the target gene as described herein is a gene associated with the development of a disease of the pancreas, preferably a monogenic disease of the pancreas.
- the target gene as described herein encodes a transcription factor.
- the target gene as described herein encodes a pancreatic transcription factor, for example as described in Dassaye R, Naidoo S, Cerf ME. Transcription factor regulation of pancreatic organogenesis, differentiation and maturation. Islets. 2016;8(1 ):13-3, incorporated herein by reference.
- the target gene as described herein is a gene associated with the development of monogenic diabetes, such as maturity-onset diabetes of the young (MODY) and neonatal diabetes, preferably MODY.
- monogenic diabetes such as maturity-onset diabetes of the young (MODY) and neonatal diabetes, preferably MODY.
- a monogenic diabetes as described herein may be selected from the group consisting of: MODY1 , MODY2, MODY3, MODY4, MODY5, MODY6, MODY7, MODY8, MODY9, MODY10, MODY11 , MODY12, MODY13, MODY14, permanent neonatal diabetes mellitus and transient neonatal diabetes mellitus, preferably MODY1-14, more preferably MODY1 and MODY3.
- MODY1 is a MODY associated with mutations in the gene HNF4A (hepatocyte nuclear factor 4A).
- MODY2 is a MODY associated with mutations in the gene GCK (glucokinase).
- MODY3 is a MODY associated with mutations in the gene HNF1A (hepatocyte nuclear factor 1A).
- MODY4 is a MODY associated with mutations in the gene PDX1 (insulin promoter factor-1).
- MODY5 is a MODY associated with mutations in the gene HNF1 B (hepatocyte nuclear factor 1 B).
- MODY6 is a MODY associated with mutations in the gene NEUROD1 (neurogenic differentiation 1).
- MODY7 is a MODY associated with mutations in the gene KLF11 (Kruppel-like factor 11).
- MODY8 is a MODY associated with mutations in the gene CEL (bile salt dependent lipase).
- MODY9 is a MODY associated with mutations in the gene PAX4 (paired box gene 4).
- MODY10 is a MODY associated with mutations in the gene INS (insulin).
- MODY11 is a MODY associated with mutations in the gene BLK (B-lymphocyte tyrosin kinase).
- MODY12 is a MODY associated with mutations in the gene ABCC8 (ATP-binding cassette transporter sub-family C member 8).
- MODY13 is a MODY associated with mutations in the gene KCNJ11 (K ir 6.2).
- MODY14 is a MODY associated with mutations in the gene APPL1 (Adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1).
- a target gene as described herein is selected from the group consisting of: HNF4A, GCK, HNF1 A, PDX1 , HNF1 B, NEUROD1 , KLF11 , CEL, PAX4, INS, BLK, ABCC8, APPL1 and KCNJ11 , preferably the target gene is HNF1 A or HNF4A.
- a target gene as described herein is a hepatocyte nuclear factor (HNF), preferably HNF1 A or HNF4A.
- HNF hepatocyte nuclear factor
- an HNF1 A or HNF4A gene as described herein may be any nucleotide sequence encoding a hepatocyte nuclear factor 1A (HNF1A) or hepatocyte nuclear factor 4A (HNF4A).
- HNF1A or HNF4A gene as described herein may be an HNF1 A or HNF4A gene of any vertebrate non-human animal as described elsewhere herein.
- an HNF1 A or HNF4A gene as described herein may comprise, consist essentially of or consist of the nucleotide sequence of any one of SEQ ID NOs: 1-6, or a nucleotide sequence having at least 60%, at least 61 %, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71 %, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%,
- SEQ ID NO: 1 represents a nucleotide sequence of a human HNF1A.
- SEQ ID NO: 2 represents a nucleotide sequence of a human HNF4A.
- SEQ ID NO: 3 represents a nucleotide sequence of a murine HNF1A.
- SEQ ID NO: 4 represents a nucleotide sequence of a murine HNF4A.
- SEQ ID NO: 5 represents a nucleotide sequence of a canine HNF1A.
- SEQ ID NO: 6 represents a nucleotide sequence of a canine HNF4A.
- SEQ ID NO: 3-6 are preferred, SEQ ID NO’s: 3-4 are more preferred.
- a level of sequence identity or similarity as used herein is preferably 70%. Another preferred level of sequence identity or similarity is 80%. Another preferred level of sequence identity or similarity is 90%. Another preferred level of sequence identity or similarity is 95%. Another preferred level of sequence identity or similarity is 99%.
- a genetically modified plant or non-human animal as described herein may be a plant or non-human animal disease model, more preferably a model for a disease associated with or caused by mutations in the target gene.
- a monogenic disease as described herein is a monogenic disease of the pancreas.
- a monogenic disease as described herein is a monogenic diabetes, such as a maturity-onset diabetes of the young (MODY) and a neonatal diabetes, preferably MODY.
- a monogenic diabetes as described herein may be selected from the group consisting of: MODY1 , MODY2, MODY3, MODY4, MODY5, MODY6, MODY7, MODY8, MODY9, MODY10, MODY11 , MODY12, MODY13, MODY14, permanent neonatal diabetes mellitus and transient neonatal diabetes mellitus, preferably MODY1-14, more preferably MODY1 and MODY3. Genes associated with each of these types of monogenic diabetes are described earlier herein.
- non-human animal disease model comprising a genetically- modified non-human animal as described herein, wherein:
- the disease is MODY1 and the target gene is HNF4A;
- the disease is MODY2 and the target gene is GCK;
- the disease is MODY3 and the target gene is HNF1 A;
- the disease is MODY4 and the target gene is PDX1 ;
- the disease is MODY5 and the target gene is HNF1 B;
- the disease is MODY6 and the target gene is NEUROD1 ;
- the disease is MODY7 and the target gene is KLF11 ;
- the disease is MODY10 and the target gene is INS;
- the disease is MODY11 and the target gene is BLK;
- the disease is MODY13 and the target gene is KCNJ11 ;
- the disease is MODY14 and the target gene is APPL1 ;
- the disease is permanent neonatal diabetes mellitus and the target gene is ABCC8, INS and/or KCNJ11 ; or
- the disease is transient neonatal diabetes mellitus and the target gene is ABCC8.
- non-human animal disease model comprising a genetically-modified non-human animal as described herein, wherein:
- the disease is MODY1 and the target gene is HNF4A;
- the disease is MODY3 and the target gene is HNF1 A.
- a non-human animal disease model as described herein may display at least one phenotype that is associated with said disease.
- Phenotypes as used herein, may be selected from molecular, physiological, histological, morphological and behavioral phenotypes, depending on the phenotypes that are known in the art to be associated with said disease.
- a phenotype that is associated with a monogenic diabetes as described herein may be selected from the group consisting of:
- hyperglycemia preferably mild hyperglycemia
- Laboratory tests may include both macroscopic and microscopic methods, molecular methods, radiographic methods such as X-rays, biochemical methods, immunohistochemical methods and others. Suitable methods are known to the person skilled in the art and for example described in the experimental section.
- “decrease”, “increase” or “reduction” means at least a detectable decrease, increase or reduction using an assay known to a person of skill in the art, such as assays as carried out in the experimental part.
- the decrease, increase or reduction may be a decrease, increase or reduction of at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95% or at least about 100%.
- Hyperglycemia and glucose tolerance could be assessed using techniques known to a person of skill in the art, for example as done in the experimental part.
- An exemplary marker that could be used in this regard is the blood glucose level.
- a preferred ectopic integration site is between the last exon and the 3’ UTR.
- the last exon of HNF1A is exon 10 (see SEQ ID NO: 3).
- a preferred ectopic integration site is between the last exon and the 3’ UTR.
- the last exon of HNF4A is exon 10 (see SEQ ID NO: 4).
- a non-human animal disease model comprising a genetically- modified non-human animal as described herein, wherein the disease is Mitchell-Riley syndrome and the target gene is RFX6 (regulatory factor X6).
- the reduced expression is preferably specifically in the pancreas and/or the kidney and the target sequence is preferably of a microRNA expressed specifically in the pancreas and/or the kidney.
- Offspring of the genetically modified plant or non-human animal as described herein constitutes an additional aspect of the present invention.
- Offspring can be obtained by any suitable methods, including sexual and nonsexual reproduction, for example natural mating and crossing, in vitro fertilization, cloning, vegetative propagation, parthenogenesis, and the like.
- “Offspring” as used herein encompasses all generations of offspring generated from the genetically modified plant or non-human animal of the invention.
- such cells may be used to prepare immortalized cell lines using conventional techniques known in the art.
- the invention provides an isolated cell line derived from the genetically modified plant or non-human animal of the invention.
- the cell line is a pancreatic cell line, such as a murine pancreatic cell line, preferably a mouse pancreatic cell line.
- the pancreatic cell line is a pancreatic beta cell line.
- the cells derived from a genetically modified plant or non-human animal as described herein may be present in an organoid or an artificial organ, preferably a pancreas organoid or an artificial pancreas.
- An “organoid” as defined herein is a miniaturized and simplified version of an organ produced in vitro in three dimensions that shows realistic micro-anatomy. The skilled person is able to arrive at such artificial organs and/or organoids using the cell, tissue or organ derived from a genetically modified plant or non-human animal as described herein by applying generally known procedures in the art.
- a genetically modified plant or non-human animal as described herein can be obtained by methods known in the art. More information can be found in handbooks such as Mouse Genetics: Methods and Protocols. Methods in Molecular Biology 2014, Singh and Coppola (Eds.), Springer, ISBN: 978-1-4939- 1214-8; Principles of Plant Genetics and Breeding, 2 nd Edition (2012), George Acquaah, Wile- Blackwell; From plant genomics to plant biotechnology, 1st edition, 2013, Poltronieri, Burbulis, Fogher (Eds.), Woodhead Publishing; Sambrook and Green, Molecular Cloning. A Laboratory Manual, 4 th Edition (2012) Cold Spring Harbor Laboratory Press; Transgenic animal technology: a laboratory handbook, 3rd edition 2014, Carl Pinkert (Ed.), Elsevier; all of which are incorporated herein by reference.
- a method for obtaining a genetically modified plant or non- human animal as described herein comprising:
- a cell as recited in step (a) above may be any type of cell.
- the cell is a pluripotent cell, such as an embryonic stem cell or an induced pluripotent stem cell, or a zygote.
- Embryonic stem cells can be obtained by suitable methods known in the art, including by isolating them from the inner cell mass of a blastocyst. It is also possible to use induced pluripotent stem cells. More information about induction of pluripotent stem cells can be found in Liu, G., David, B.T., Trawczynski, M. et al.
- Zygotes may be harvested by methods known in the art, for example as described by Cho A, Haruyama N, Kulkarni AB. Generation of transgenic mice. CurrProtoc Cell Biol. 2009;Chapter 19:Unit-19.11 , incorporated herein by reference.
- the cell is a pluripotent cell.
- Many plant cells are pluripotent or even totipotent, meaning that most or all cells isolated from a mature plant are suitable and can be used to form a new plant.
- Step (b) encompasses the introduction of the DNA comprising the at least one copy of a target sequence of a microRNA in the cell of step (a) and the stable integration thereof in the cell’s genome.
- the DNA comprising the at least one copy of a target sequence of a microRNA is introduced into the cell of step (a) using a nonviral method or a viral method (transduction).
- Non-viral methods may be selected from the group consisting of chemical-based transfection and non-chemical-based transfection.
- Chemicalbased transfection methods include transfection based on calcium phosphate, cationic polymers such as DEAE-dextran or polyethylenimine (PEI), liposomes (lipofection), fugene and dendrimers.
- Nonchemical methods include electroporation, cell squeezing, microinjection, sonoporation, optical transfection, protoplast fusion, impalefection, hydrodynamic delivery. In some embodiments, microinjection is preferred.
- Viral methods utilize the ability of a virus to inject its DNA inside a host cell. Suitable viruses include retrovirus, lentivirus, adenovirus, adeno-associated virus, and herpes simplex virus.
- microinjection is preferred, for example as described in Cho A, Haruyama N, Kulkarni AB. Generation of transgenic mice. Curr Protoc Cell Biol. 2009;Chapter 19:Unit-19.11 , incorporated herein by reference.
- the DNA comprising the at least one copy of a target sequence of a microRNA is introduced into the cell of step (a) by electroporation, microinjection, gene gun, or Agrobacterium-mediated transformation.
- stable integration of the DNA comprising the at least one copy of a target sequence of a microRNA may be obtained by homologous recombination. Regions of homology direct the genetic modification to the desired site.
- the at least one copy of a target sequence of a microRNA is introduced by homology-directed repair (HDR).
- HDR homology-directed repair
- homology-directed repair (HDR) is CRISPR-mediated HDR. CRISPR-mediated HDR increases the efficiency of standard HDR and relies on the repair of site-specific DNA double-strand breaks (DSBs) induced by RNA-guided endonucleases such as the Cas9 endonuclease.
- step (b) involves the administration of:
- RNA-guided endonuclease such as Cas9 mRNA
- the gRNA has the sequence of SEQ ID NO: 8 or 9, or a sequence having at least 60%, at least 61 %, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71 %, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity therewith.
- SEQ ID NO: 8 is a sgRNA targeting the region adjacent to exon 10 and the 3’ UTR of the HNF1A and can be used in generating a MODY 3 disease model.
- SEQ ID NO: 9 is a sgRNA targeting the region adjacent to exon 10 and the 3’ UTR of the HNF4A gene and can be used in generating a MODY1 disease model.
- a positive selection marker gene may be co-transfected, which gives the cell some selectable advantage, such as resistance towards a certain toxin.
- toxin If the toxin is added, only those cells with the marker gene (and, hence, the at least one copy of a target sequence of a microRNA) integrated into their genomes will be able to proliferate, while other cells will die. After applying this selective stress (selection pressure) for some time, only the cells with a stable transfection remain and can be cultivated further.
- Common marker genes are genes encoding resistance against toxins such as geneticin (G418), puromycin, zeocin, hygromycin B and blasticidin S.
- a negative selective marker may be used as well, such as a TK gene, the presence of which can be selected against by growing cells in ganciclovir. Negative markers can be used to select for cells that integrated the at least one copy of a target sequence of a microRNA by homologous recombination rather than random insertion.
- step (c) in order to generate an embryo from a cell obtained in step (b), a skilled person may rely on any suitable method that is known in the art.
- plant tissue culture techniques allow to grow an embryo and a whole new plant from the cell obtained in step (b).
- Plant tissue culture is a collection of techniques used to maintain or grow plant cells, tissues or organs under sterile conditions on a nutrient culture medium of known composition. Plant tissue culture relies on the fact that many plant cells have the ability to regenerate a whole plant (i.e., they are pluripotent or totipotent) as described above. More information can be found in Sathyanarayana, B.N. (2007). Plant Tissue Culture: Practices and New Experimental Protocols. I. K. International.
- step (c) may involve the insertion of the cell obtained in step (b) in a blastocyst to generate an early-stage embryo.
- step (c) may involve implantation of a microinjected zygote of step (b) into a recipient non-human animal, preferably a pseudo-pregnant recipient non-human animal, for example as described in Cho A, Haruyama N, Kulkarni AB. Generation of transgenic mice. CurrProtoc Cell Biol. 2009;Chapter 19:Unit- 19.11 , incorporated herein by reference.
- the zygote will develop into an embryo in the recipient organism.
- step (d) in order to grow the embryo obtained in step (c) into a genetically modified plant or non- human animal, a skilled person may rely on any suitable method that is known in the art.
- plant tissue culture techniques allow to grow a plant from the embryo obtained in step (c).
- the blastocyst may be implanted into the uterus of a female non-human animal, where they will develop into a new non-human animal.
- the embryo that had developed from the zygote implanted into a recipient non-human animal in step (c) may grow further into a genetically modified plant or non-human animal in said recipient non-human animal.
- a plant or non-human animal obtained in step (d) described above is typically referred to as the F0 generation.
- a method for obtaining a genetically modified plant or non-human animal as described herein may further comprise a step (step (e)) of back-crossing the genetically modified plant or non-human animal obtained in step (d) with unmodified or wildtype or reference or control or parental plant or non-human animal as described herein.
- step (e) gives rise to a genetically modified plant or non-human animal typically referred to as the F1 generation.
- the optional additional step (e) may be repeated one or more additional times.
- the F1 generation may be backcrossed again with non-genetically modified plant or non-human animal, the resulting progeny may be backcrossed again with unmodified or wildtype or reference or control or parental plant or non-human animal, and so on.
- the genetically modified plant or non-human animal obtained in step (d), i.e. the F0 generation is backcrossed twice.
- Such backcrossing as described herein is useful for reducing the number and effects of possible off-target mutations that may have been introduced as a side effect of step (b).
- a method for obtaining a genetically modified plant or non- human animal as described herein comprising:
- step (e) back-crossing the genetically modified plant or non-human animal obtained in step (d) with non-genetically modified plant or non-human animal.
- Genotyping may be used to assist in the selection of cells, embryos or animals in which the at least one copy of a target sequence of a microRNA is introduced at the desired ectopic integration site. Genotyping may be performed by any suitable method known in the art, including restriction fragment length polymorphism identification (RFLPI) of genomic DNA, random amplified polymorphic detection (RAPD) of genomic DNA, amplified fragment length polymorphism detection (AFLPD), polymerase chain reaction (PCR), DNA sequencing, allele specific oligonucleotide (ASO) probes, and hybridization to DNA microarrays or beads.
- RFLPI restriction fragment length polymorphism identification
- RAPD random amplified polymorphic detection
- AFLPD amplified fragment length polymorphism detection
- PCR polymerase chain reaction
- ASO allele specific oligonucleotide
- genotyping will be performed with PCR.
- genotyping was done by PCR using primers of SEQ ID NO: 18 and 19 targeting exon 10 and the 3’ UTR of the HNF4A gene for a MODY1 model, and SEQ ID NO: 20 and 21 targeting exon 10 and the 3’ UTR of the HNF1A gene for a MODY 3 model.
- Wholegenome sequencing may be used as well, and has the additional advantage that the extent of possible off-target mutations can be assessed.
- this invention in some aspects relates to a genetically modified plant or non- human animal which is a plant or non-human animal disease model, more preferably a model for a disease associated with or caused by mutations in the target gene. Accordingly, in another aspect, there is provided a method for identifying and/or evaluating therapeutic efficacy of a candidate agent for treating, inhibiting or preventing a disease, comprising administering the candidate agent to a plant or non-human animal disease model, or a cell, tissue or organ derived thereof, as described herein.
- Candidate agents encompass both existing drugs and new drugs.
- Existing drugs may be researched for new indications, and may be selected for example from the Drug Repurposing Hub of the Broad Institute, a curated and annotated collection of FDA-approved drugs, clinical trial drugs, and pre-clinical tool compounds with a companion information resource (available et https://clue.io/repurposinq, described in Corsello et al.
- the Drug Repurposing Hub a next-generation drug library and information resource. Nature Medicine. 23, 405-408 (2017), incorporated herein by reference).
- Candidate agents encompass small molecules as well as biological drugs, including gene therapy.
- Candidate agents may be administered as compositions, preferably as pharmaceutical compositions.
- Such composition comprises the candidate agent and optionally further comprises one or more pharmaceutically acceptable ingredients.
- pharmaceutically acceptable ingredients include pharmaceutically acceptable carriers, fillers, preservatives, solubilizers, vehicles, diluents and/or excipients.
- the one or more pharmaceutically acceptable ingredients may be selected from the group consisting of pharmaceutically acceptable carriers, fillers, preservatives, solubilizers, vehicles, diluents and/or excipients.
- Such pharmaceutically acceptable carriers, fillers, preservatives, solubilizers, vehicles, diluents and/or excipients may for instance be found in Remington: The Science and Practice of Pharmacy, 23rd edition. Elsevier (2020), incorporated herein by reference.
- this invention in some aspects relates to a genetically modified plant or non- human animal which is a plant or non-human animal disease model, more preferably a model for a disease associated with or caused by mutations in the target gene, wherein the disease is maturity onset diabetes of the young type 3 (MODY3) and the target gene is HNF1 A, or wherein the disease is maturity onset diabetes of the young type 1 (MODY1) and the target gene is HNF4A.
- a method for identifying and/or evaluating therapeutic efficacy of a candidate agent for treating, inhibiting or preventing MODY3 or MODY1 comprising administering the candidate agent to a plant or non-human animal which is a MODY3 or MODY1 model as described herein, or a cell, tissue or organ derived thereof.
- a method for identifying and/or evaluating therapeutic efficacy of a candidate agent comprising administering the candidate agent to a plant or non-human animal disease model, or a cell, tissue or organ derived thereof, as described herein, may comprise an additional step of assessing at least one phenotype that is associated with said disease.
- assessing at least one phenotype may mean assessing symptoms of disease progression or regression. This can be done by using diagnostic tests known for the skilled person in the art.
- Phenotypes and phenotypes that are associated with a monogenic diabetes are described elsewhere herein.
- the candidate compound can be administered before, during or after a specific phenotype appears. This may depend, among others, on whether a candidate agent is evaluated for preventive and/or curative efficacy.
- pancreas refers the organ of the digestive system and endocrine system of vertebrates as customarily and ordinarily understood by the skilled person.
- Pancreatic islets also known as “pancreatic islands” or “islets of Langerhans” refer to the regions of the pancreas that contain its endocrine (hormone-producing) cells as as customarily and ordinarily understood by the skilled person.
- Pancreatic islets typically comprise alpha-cells, producing glucagon, beta-cells, producing insulin and amylin, delta-cells, producing somatostatin, epsilon-cells, producing ghrelin and PP cells (gammacells or F-cells), producing pancreatic polypeptide.
- Beta-cells are of particurlar importance for maintenance of blood sugar homeostasis.
- a nucleic acid molecule such as a nucleic acid molecule encoding an HNF1A or HNF4A
- a nucleic acid or nucleotide sequence which encodes a protein fragment or a polypeptide or a peptide or a derived peptide.
- a protein fragment or a polypeptide or a peptide or a derived peptide such as from HNF1A or HNF4A is represented by an amino acid sequence.
- each nucleic acid molecule or protein fragment or polypeptide or peptide or derived peptide or construct as identified herein by a given sequence identity number is not limited to this specific sequence as disclosed.
- Each coding sequence as identified herein encodes a given protein fragment or polypeptide or peptide or derived peptide or construct or is itself a protein fragment or polypeptide or construct or peptide or derived peptide.
- Another preferred level of sequence identity or similarity is 70%. Another preferred level of sequence identity or similarity is 80%. Another preferred level of sequence identity or similarity is 90%. Another preferred level of sequence identity or similarity is 95%. Another preferred level of sequence identity or similarity is 99%.
- Each nucleotide sequence or amino acid sequence described herein by virtue of its identity or similarity percentage with a given nucleotide sequence or amino acid sequence respectively has in a further preferred embodiment an identity or a similarity of at least 60%, at least 61 %, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71 %, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at
- Each non-coding nucleotide sequence i.e. of a promoter or of another regulatory region
- a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity or similarity with a specific nucleotide sequence SEQ ID NO (take SEQ ID NO: A as example).
- a preferred nucleotide sequence has at least 60%, at least 61 %, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71 %, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity with SEQ ID NO: A.
- such non-coding nucleotide sequence such as a promoter exhibits or exerts at least an activity of such a non-coding nucleotide sequence such as an activity of a promoter as known to a person of skill in the art.
- sequence identity is described herein as a relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. In a preferred embodiment, sequence identity is calculated based on the full length of two given SEQ ID NO’s or on a part thereof. Part thereof preferably means at least 50%, 60%, 70%, 80%, 90%, or 100% of both SEQ ID NO’s. In the art, “identity” also refers to the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences.
- Similarity between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.
- Identity and “similarity” can be readily calculated by known methods, including but not limited to those described in Bioinformatics and the Cell: Modern Computational Approaches in Genomics, Proteomics and transcriptomics, Xia X., Springer International Publishing, New York, 2018; and Bioinformatics: Sequence and Genome Analysis, Mount D., Cold Spring Harbor Laboratory Press, New York, 2004, each incorporated herein by reference.
- Sequence identity and “sequence similarity” can be determined by alignment of two peptide or two nucleotide sequences using global or local alignment algorithms, depending on the length of the two sequences. Sequences of similar lengths are preferably aligned using a global alignment algorithm (e.g. Needleman-Wunsch) which aligns the sequences optimally over the entire length, while sequences of substantially different lengths are preferably aligned using a local alignment algorithm (e.g. Smith- Waterman). Sequences may then be referred to as "substantially identical” or “essentially similar” when they (when optimally aligned by for example the program EMBOSS needle or EMBOSS water using default parameters) share at least a certain minimal percentage of sequence identity (as described below).
- a global alignment algorithm e.g. Needleman-Wunsch
- sequences of substantially different lengths are preferably aligned using a local alignment algorithm (e.g. Smith- Waterman). Sequences may then be referred to as "substantially identical”
- a global alignment is suitably used to determine sequence identity when the two sequences have similar lengths.
- local alignments such as those using the Smith-Waterman algorithm, are preferred.
- EMBOSS needle uses the Needleman-Wunsch global alignment algorithm to align two sequences over their entire length (full length), maximizing the number of matches and minimizing the number of gaps.
- EMBOSS water uses the Smith-Waterman local alignment algorithm.
- the default scoring matrix used is DNAfull and for proteins the default scoring matrix is Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919, incorporated herein by reference).
- nucleic acid and protein sequences of some embodiments of the present invention can further be used as a “query sequence” to perform a search against public databases to, for example, identify other family members or related sequences.
- search can be performed using the BLASTn and BLASTx programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10, incorporated herein by reference.
- Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17): 3389-3402, incorporated herein by reference.
- BLASTx and BLASTn the default parameters of the respective programs (e.g., BLASTx and BLASTn) can be used. See the homepage of the National Center for Biotechnology Information accessible on the world wide web at www.ncbi.nlm.nih.gov/.
- conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. Examples of classes of amino acid residues for conservative substitutions are given in the Tables below.
- a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulphur-containing side chains is cysteine and methionine.
- Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagineglutamine.
- Substitutional variants of the amino acid sequence disclosed herein are those in which at least one residue in the disclosed sequences has been removed and a different residue inserted in its place.
- the amino acid change is conservative.
- Preferred conservative substitutions for each of the naturally occurring amino acids are as follows: Ala to Ser; Arg to Lys; Asn to Gin or His; Asp to Glu; Cys to Ser or Ala; Gin to Asn; Glu to Asp; Gly to Pro; His to Asn or Gin; He to Leu or Vai; Leu to He or Vai; Lys to Arg; Gin or Glu; Met to Leu or lie; Phe to Met, Leu or Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp or Phe; and, Vai to lie or Leu.
- gene means a DNA fragment comprising a region (transcribed region), which is transcribed into an RNA molecule (e.g. an mRNA) in a cell, operably linked to suitable regulatory regions (e.g. a promoter).
- a gene will usually comprise several operably linked fragments, such as a promoter, a 5' leader sequence (5’ UTR), a coding region and a 3'-nontranslated sequence (3'-end) (3’ UTR) e.g. comprising a polyadenylation- and/or transcription termination site.
- a chimeric or recombinant gene (such as an HNF1 A or HNF4A gene) is a gene not normally found in nature, such as a gene in which for example the promoter is not associated in nature with part or all of the transcribed DNA region. "Expression of a gene” refers to the process wherein a DNA region which is operably linked to appropriate regulatory regions, particularly a promoter, is transcribed into an RNA, which is biologically active, i.e. which is capable of being translated into a biologically active protein or peptide.
- transgene is herein described as a gene or a coding sequence or a nucleic acid molecule that has been newly introduced into a cell, i.e. a gene that may be present but may normally not be expressed or expressed at an insufficient level in a cell.
- insufficient means that although said HNF is expressed in a cell, a condition and/or disease as described herein could still be developed.
- the invention allows the over-expression of an HNF.
- the transgene may comprise sequences that are native to the cell, sequences that naturally do not occur in the cell and it may comprise combinations of both.
- promoter or “transcription regulatory sequence” refers to a nucleic acid fragment that functions to control the transcription of one or more coding sequences, and is located upstream with respect to the direction of transcription of the transcription initiation site of the coding sequence, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter.
- a “constitutive” promoter is a promoter that is active in most tissues under most physiological and developmental conditions.
- An “inducible” promoter is a promoter that is physiologically or developmentally regulated, e.g. by the application of a chemical inducer.
- a “ubiquitous promoter” is active in substantially all tissues, organs and cells of an organism.
- Organ-specific or tissue-specific promoter is a promoter that is active in a specific type of organ or tissue, respectively.
- Organ-specific and tissue-specific promoters regulate expression of one or more genes (or coding sequence) primarily in one organ or tissue, but can allow detectable level (“leaky”) expression in other organs or tissues as well.
- Leaky expression in other organs or tissues means at least one-fold, at least two-fold, at least three-fold, at least four-fold or at least five-fold lower, but still detectable expression as compared to the organ-specific or tissue-specific expression, as evaluated on the level of the mRNA or the protein by standard assays known to a person of skill in the art (e.g. qPCR, Western blot analysis, ELISA).
- the maximum number of organs or tissues where leaky expression may be detected is five, six, seven or eight.
- any expression vector comprising any of the gene construct as described herein, wherein the HNF nucleotide sequence has been replaced by a nucleotide sequence encoding for GFP, can be produced. Cells transduced as described herein can then be assessed for fluorescence intensity according to standard protocols.
- operably linked refers to a linkage of polynucleotide elements in a functional relationship.
- a nucleic acid is “operably linked” when it is placed into a functional relationship with another nucleic acid sequence.
- a transcription regulatory sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence.
- Operably linked means that the DNA sequences being linked are typically contiguous and, where necessary to join two protein encoding regions, contiguous and in reading frame. Linking can be accomplished by ligation at convenient restriction sites or at adapters or linkers inserted in lieu thereof, or by gene synthesis.
- protein or “polypeptide” or “amino acid sequence” are used interchangeably and refer to molecules consisting of a chain of amino acids, without reference to a specific mode of action, size, 3- dimensional structure or origin.
- amino acids or “residues” are denoted by three-letter symbols.
- a residue may be any protein
- microRNA or “miRNA” or “miR” has its customary and ordinary meaning as understood by one of skill in the art in view of this disclosure.
- a microRNA is a small non-coding RNA molecule found in plants, animals and some viruses, that may function in RNA silencing and post-transcriptional regulation of gene expression.
- a target sequence of a microRNA may be denoted as “miRT”.
- miRT-1 a target sequence of microRNA-1 or miRNA-1 or miR-1 may be denoted as miRT-1 .
- Expression may be assessed by any method known to a person of skill in the art. For example, expression may be assessed by measuring the levels of transgene expression in the transduced tissue on the level of the mRNA or the protein by standard assays known to a person of skill in the art, such as qPCR, RNA sequencing, Northern blot analysis, Western blot analysis, mass spectrometry analysis of protein-derived peptides or ELISA.
- Expression may be assessed at any time after administration of the gene construct, expression vector or composition as described herein. In some embodiments herein, expression may be assessed after 1 week, 2 weeks, 3 weeks, 4, weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9, weeks, 10 weeks, 11 weeks, 12 weeks, 14 weeks, 16 weeks, 18 weeks, 20 weeks, 22 weeks, 24 weeks, 28 weeks, 32 weeks, 36 weeks, 40 weeks, or more.
- pancreas- and/or pancreatic islet- and/or beta-cell-specific expression refers to the preferential or predominant (at least 10% higher, at least 20% higher, at least 30% higher, at least 40% higher, at least 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 150% higher, at least 200% higher or more) expression of HNF, preferably an HNF1 A, more preferably an HNF1 A isoform a, in the pancreas and/or pancreatic islets and/or beta-cells as compared to other organs or tissues.
- organs or tissues may be the CNS, brain, liver, adipose tissue, skeletal muscle, heart, kidney, colon, hematopoietic tissue, lung, ovary, spleen, stomach, testis and others.
- other organs are the liver and/or the heart.
- expression is not detectable in the liver, CNS, brain, adipose tissue, skeletal muscle and/or heart.
- expression is not detectable in at least one, at least two, at least three, at least four or all organs selected from the group consisting of the liver, CNS, brain, adipose tissue, skeletal muscle, heart, kidney, colon, hematopoietic tissue, lung, ovary, spleen, stomach and testis. Expression may be assessed as described above.
- Codon optimization refers to the processes employed to modify an existing coding sequence, or to design a coding sequence, for example, to improve translation in an expression host cell or organism of a transcript RNA molecule transcribed from the coding sequence, or to improve transcription of a coding sequence. Codon optimization includes, but is not limited to, processes including selecting codons for the coding sequence to suit the codon preference of the expression host organism. For example, to suit the codon preference of mammalians, preferably of murine, canine or human expression hosts. Codon optimization also eliminates elements that potentially impact negatively RNA stability and/or translation (e. g.
- codon-optimized sequences show at least 3%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more increase in gene expression, transcription, RNA stability and/or translation compared to the original, not codon-optimized sequence.
- the verb "to comprise” and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded.
- the verb “to consist” may be replaced by “to consist essentially of’ meaning that a composition as described herein may comprise additional component(s) than the ones specifically identified, said additional component(s) not altering the unique characteristic of the invention.
- the verb “to consist” may be replaced by “to consist essentially of’ meaning that a method as described herein may comprise additional step(s) than the ones specifically identified, said additional step(s) not altering the unique characteristic of the invention.
- references to an element by the indefinite article “a” or “an” does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements.
- the indefinite article “a” or “an” thus usually means “at least one”.
- at least a particular value means that particular value or more.
- at least 2 is understood to be the same as “2 or more” i.e., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15 etc.
- the word “about” or “approximately” when used in association with a numerical value preferably means that the value may be the given value (of 10) more or less 1 % of the value.
- the term “and/or” indicates that one or more of the stated cases may occur, alone or in combination with at least one of the stated cases, up to with all of the stated cases.
- FIG. 1 Generation of a MODY3 mouse model.
- A CRISPR/Cas9 strategy to generate MODY3 knock-in (KI) mice.
- Single guided RNA sgRNA was designed to target between exon 10 and 3’ UTR of HNF1 a gene to introduce two copies of microRNA 375 target sequence (miRT375), contained in donor DNA, by homology directed repair (HDR). Resultant knock-in allele is represented (bottom).
- B Genotyping of offspring by PCR and subsequent digestion of the PCR amplicon with EcoRV. ND, not digested; WT, wild-type; KI, miRT375 knock-in.
- Hnfla Hepatocyte Nuclear Factor 1 -Alpha
- FIG. 3 Downregulation of HNF1A production in islets of MODY3 mice.
- a cohort of WT/WT (wild-type), WT/KI (heterozygous) and KI/KI (homozygous) animals were analyzed at 14-16 weeks of age.
- FIG. 9 MODY3 young mice presented impaired glucose tolerance.
- FIG. 10 MODY3 adult mice exhibit impaired glucose tolerance.
- FIG. 14 Generation of a MODY1 mouse model.
- A CRISPR/Cas9 strategy to generate MODY1 knock-in (KI) mice.
- a single guided RNA (sgRNA) was designed to target between exon 10 and the 3’ UTR of the HNF4A gene to introduce two copies of the microRNA 375 target sequence (miRT375), contained in donor DNA, by homology directed repair (HDR). The wild-type and the resultant knock-in allele is represented.
- B Genotyping of offspring by PCR and subsequent digestion of the PCR amplicon with EcoRV.
- #47, #49, #50 “horn” homozygous KI (2 fragments after EcoRV digestion: 267 bp, 335bp); #44: “het” heterozygous KI (WT allele (547 bp) and 2 fragments after digestion (267 bp, 335bp)); #45, #46, #48, #51 : WT (only WT allele: 547 bp).
- FIG. 15 Intraductal administration of AAV8 vectors encoding GFP.
- Nine weeks-old wildtype male mice were intraductally administered with 1x10 A 12 vg/animal of AAV8-RIPI-GFP, AAV8-RIPII- GFP, AAV8-hlNS1 .9-GFP or AAV8-hlNS385-GFP vectors.
- FIG. 16 Intraductal administration of AAV8 vectors encoding mmHNF1A_a under the control of rat insulin promoters.
- Nine weeks-old wild-type male mice were intraductally administered with 1x10 A 12 vg/animal of AAV8-RIPI-mmHNF1 a_a or AAV8-RIPII-mmHNF1 a_a vectors.
- Wild-type mice intraductally administered with PBS served as controls.
- Relative expression of (A) endogenous and AAV-derived Hnfla (Hepatocyte Nuclear Factor 1 -Alpha) gene, or (B) endogenous Hnfla gene. Results are expressed as the mean ⁇ SEM. n 6- 7. *** p ⁇ 0.001 vs. PBS.
- FIG. 17 Evaluation of islet number and beta-cell mass in mice treated with AAV8-RIPI- mmHNF1a_a or AAV8-RIPII-mmHNF1a_a vectors.
- Nine weeks-old wild-type male mice were intraductally administered with 1x10 A 12 vg/animal of AAV8-RIPI-mmHNF1 a_a or AAV8-RIPII- mmHNF1a_a vectors. Wild-type mice intraductally administered with PBS served as controls.
- Immunohistochemical detection of insulin in pancreas of 17-weeks-old mice. Quantification of (A) islet number, (B) percentage of p-cell area relative to pancreas area. Results are expressed as the mean ⁇ SEM. n 3. *** p ⁇ 0.001 vs. PBS.
- FIG. 18 Intraductal administration of AAV8 vectors encoding mmHNF1A_a under the control of human insulin promoters.
- Nine weeks-old wild-type male mice were intraductally administered with 1x10 A 12 vg/animal of AAV8-hlNS1 .9-mmHNF1a_a or AAV8-hlNS385-mmHNF1a_a vectors.
- Wild-type mice intraductally administered with PBS served as controls.
- Relative expression of (A) all endogenous and exogenous Hnfla (Hepatocyte Nuclear Factor 1 -Alpha) gene, or (B) only endogenous Hnfla gene. Results are expressed as the mean ⁇ SEM. n 6-7. *** p ⁇ 0.001 vs. PBS.
- FIG. 19 Evaluation of islet number and beta-cell mass in mice treated with AAV8- hlNS1.9-mmHNF1a_a or AAV8-hlNS385-mmHNF1a_a vectors.
- Nine-weeks-old wild-type male mice were intraductally administered with 1x10 A 12 vg/animal of AAV8-hlNS1 .9-mmHNF1a_a or AAV8- hlNS385-mmHNF1a_a vectors. Wild-type mice intraductally administered with PBS served as controls.
- Immunohistochemical detection of insulin in pancreas of 13-weeks-old mice. Quantification of (A) islet number, (B) p-cell mass. Results are expressed as the mean ⁇ SEM. n 3. ** p ⁇ 0.01 vs. PBS.
- FIG. 21 AAV -mediated improvement of glucose tolerance in MODY3 mice.
- FIG. 23 MODY3 male adult mice exhibit impaired insulin secretion in vitro.
- FIG. 24 MODY3 male adult mice exhibit impaired insulin secretion in vivo.
- FIG. 25 Increased HNF1 A expression levels in islets of MODY3 mice treated with AAV8- hlNS385-mmHNF1a_a vectors.
- FIG. 26 Normalization of HNF1 A production in islets of MODY3 mice treated with AAV8- hlNS385-mmHNF1a_a vectors.
- HNF1a protein content was evaluated by Western-blot in islets from 14-16-week-old WT/WT (wild-type), KI/KI (homozygous) and KI/KI mice treated with AAV8-hlNS385- mmHNF1a_a vectors.
- A A representative immunoblot of HNF1a protein and the normalized tubulin protein is shown.
- FIG. 27 AAV treatment increases HNF1 a target genes expression.
- Hnfla target genes Slc2a2 encoding for glucose transporter 2, GLUT2
- L-pk L-pyruvate kinase
- Hnf4a hepatocyte nuclear factor 4 alpha
- FIG. 29 Counteraction of hyperglycemia in MODY3 mice treated with a low dose of AAV vectors.
- Eight-week-old male KI/KI (homozygous) mice were intraductally administered with 10 A 11 vg/animal of AAV8-hlNS385-mmHNF1a_a vectors.
- FIG. 30 Downregulation of Hnf4a expression levels in islets of MODY1 mice.
- Relative gene expression of Hnf4a hepatic nuclear factor 4, alpha
- WT/WT wild-type
- KI/KI homozygous miRT375 knock-in
- FIG. 31 MODY1 mice presented similar HNF4A production in liver than wild-type mice.
- FIG. 32 MODY1 knock-in mice did not exhibit changes in body weight.
- Body weight evolution of WT/WT (wild-type) and KI/KI (homozygous) mice from 6-24 weeks of age in male and female mice. Results are expressed as the mean ⁇ SEM. n 13-15.
- MODY3 mice were generated using CRISPR/Cas9 technology.
- the gRNA, donor DNA, and Cas9 mRNA were pronuclearly microinjected in one-cell mice embryos. After Cas9-mediated double strand break and homologous recombination with the donor DNA, the two copies of miRT375 were introduced between the exon 10 and the 3’ UTR of the mouse HNF1A gene.
- GGACTTGGCCAACAGCTAGT SEQ ID NO: 20
- reverse GGAGGAGCAGCAGTGTCAAT, SEQ ID NO: 21
- primers targeting exon 10 and the 3’ UTR of the HNF1A gene were used for genotyping of the offspring.
- PCR reaction generated a 392 bp amplicon that was subsequently digested with the EcoRV restriction enzyme.
- EcoRV digestion generated fragments of 257 and 80 bp in the WT allele; and of 202, 110 and 80 bp in the allele comprising the two miRT375 copies.
- MODY1 mice were generated using CRISPR/Cas9 technology.
- the gRNA, donor DNA, and Cas9 mRNA were pronuclearly microinjected in one-cell mice embryos of the genetic background C57BL/6NCrl. After Cas9-mediated double strand break and homologous recombination with the donor DNA, the two copies of miRT375 were introduced between exon 10 and the 3’ UTR of the mouse HNF4A gene.
- PCR reaction generated a 602 bp amplicon for the knock-in allele and a 547 bp amplicon for the wild-type allele. Subsequent digestion with EcoRV of the wild-type allele revealed no further fragmentation. Subsequent digestion with EcoRV of the knock-in allele with the two miRT375 copies revealed fragments of 335 and 267 bp.
- mice and MODY3 mice Male C57BI/6J mice and MODY3 mice were used. Mice were fed ad libitum with a standard diet (2018S Teklad Global Diets®, Harlan Labs., Inc., Madison, Wl, US) and kept under a light-dark cycle of 12 h (lights on at 8:00 a.m.) and stable temperature (22°C ⁇ 2). Mice were weighted weekly after weaning. Blood glucose levels were measured with a Glucometer EliteTM analyzer (Bayer, Leverkusen, Germany). For tissue sampling, mice were anesthetized by means of inhalational anesthetic isoflurane (IsoFlo®, Abbott Laboratories, Abbott Park, IL, US) and decapitated. Tissues of interest were excised and kept at -80°C or with formalin until analysis. All experimental procedures were approved by the Ethics Committee for Animal and Human Experimentation of the Universitat Autonoma de Barcelona.
- mice were kept under specific-pathogen free (SPF) conditions in individually- ventilated cages systems (IVC).
- Mice were fed ad libitum with a standard chow diet (Altromin 1314, Altromin Spezialfutter GmbH & Co. KG, Germany) and kept under a light-dark-cycle of 12 h (lights on at 6:00 am), stable temperature (22°C ⁇ 2°C) and humidity (55% ⁇ 10%).
- Body weight was measured weekly using a standard laboratory balance (Sartorius, Germany). For tissue collection, mice were sacrificed by decapitation. All experimental procedures were approved by state ethics committee by the government of Upper Bavaria.
- Single-stranded AAV vectors of serotype 8 were produced by triple transfection of HEK293 cells according to standard methods (Ayuso, E. et aL, 2010. Curr Gene Ther. 10(6):423-36). Cells were cultured in 10 roller bottles (850 cm2, flat; CorningTM, Sigma-Aldrich Co., Saint Louis, MO, US) in DMEM 10% FBS to 80% confluence and co-transfected by calcium phosphate method with a plasmid carrying the expression cassette flanked by the AAV2 ITRs, a helper plasmid carrying the AAV2 rep gene and the AAV of serotypes 8 cap gene, and a plasmid carrying the adenovirus helper functions.
- Transgenes used were: GFP or mouse HNF1A isoform A coding-sequence driven by 1) the rat insulin promoter 1 (RIPI); 2) the rat insulin promoter 2 (RIPII); 3) the human full length insulin promoter (hlNS1 .9); or 4) a shortened version of the human insulin promoter (hlNS385).
- AAV were purified with an optimized method based on a polyethylene glycol precipitation step and two consecutive cesium chloride (CsCI) gradients. This second-generation CsCI-based protocol reduced empty AAV capsids and DNA and protein impurities dramatically (Ayuso, E. et aL, 2010. Curr Gene Ther. 10(6):423-36).
- AAV vectors were dialyzed against PBS, filtered and stored at -80°C. Titers of viral genomes were determined by quantitative PCR following the protocol described for the AAV2 reference standard material using linearized plasmid DNA as standard curve (Lock M, et aL, Hum. Gene Ther. 2010; 21 :1273-1285). The vectors were constructed according to molecular biology techniques well known in the art.
- the retrograde injection via the pancreatic biliary duct was conducted as previously described (Jimenez et aL, Diabetologia. 2011 May;54(5):1075-86).
- the animals were anesthetized by an intraperitonial injection of ketamine (100 mg/kg) and xylazine (10 mg/kg). Once the area was shaved and an incision of 2-3 cm was made, the abdomen was opened by an incision through the alba line and an abdominal separator was placed.
- the bile duct was identified. The liver lobes were separated and the bile duct was clamped in the bifurcation of the hepatic triad to prevent spreading of viral vectors to the liver.
- a 30G needle was then inserted in the Vater papilla and advanced retrogrally through the biliary duct.
- the needle was fixed by clamping the duct at the tip of the intestine to secure its position and prevent the escape of viral vectors into the intestine.
- the solution of the appropriate dose of viral vectors was slowly injected.
- the clip that fixed the needle in place was pulled off and a drop of surgical veterinary adhesive Histoacryl (Braun, TS1050044FP) was applied to the puncture site of the needle.
- the clip on the biliary duct was removed and the abdominal wall and skin were sutured. The mice were left on a heating meadow to recover from anesthesia and to prevent heat loss.
- Tissues were fixed for 24 h in formalin (Panreac Quimica), embedded in paraffin, and sectioned. Pancreas sections were incubated overnight at 4°C with guinea pig anti-insulin (1 :100; 1-8510; Sigma- Aldrich). Rabbit anti-guinea pig coupled to peroxidase (1 :300; P0141 ; Dako) was used as secondary antibody.
- the ABC peroxidase kit (Pierce) was used for immunodetection, and sections were counterstained in Mayer’s hematoxylin. Images were taken at 2X magnification for the pancreatic area and 10X or 20X magnifications for islets using a Nikon Eclipse E800 microscope (Nikon, Tokyo, Japan).
- Image analysis and quantification of areas in pm 2 were performed using an image analysis software (analysis 3.0; Soft Imaging System, Center Valley, PA, EEUU).
- the percentage of the p-cell area in the pancreas was calculated based on two insulin-stained sections separated by 200 pm by dividing the area of all insulin-positive cells per section by the total pancreatic area of that section.
- the p-cell mass was calculated by multiplying the pancreas weight by the percentage of p-cell area as previously described (Jimenez et al, Diabetologia. 2011 May;54(5):1075-86).
- pancreatic islets were extracted by pancreas digestion and subsequent isolation of pancreatic islets.
- mice were sacrificed, the abdominal cavity was exposed and 3 ml of a solution of Liberase (Roche, 0104 mg/ml medium without serum M199 (Gibco-Life Technologies 10012- 037)) was perfused to the pancreas via the common bile duct.
- Liberase Roche, 0104 mg/ml medium without serum M199 (Gibco-Life Technologies 10012- 037)
- circulation through the Vater ampoule was blocked by placing a clamp. Once perfused, the pancreas was isolated from the animal and kept on ice before being digested at 37 °C for 19 min.
- the pellet was resuspended in 13 ml of Histopaque-1077 (Sigma 10771) and M199 medium without serum was added to a volume of 25 ml avoiding mixing the two phases. Then it was centrifuged (Eppendorf 581 OR) at 1000xg for 24 min at 4 °C to obtain the pancreatic islets at the interface between the medium and the Histopaque and thus, they were collected with the pipette. Once isolated, the islets were washed twice with 40 ml of medium with serum and centrifuged at 1400 rpm, 2.5 min at room temperature.
- the pellet with islets was resuspended in 15 ml of M199 medium.
- the islets were stained by adding a solution of 200 ml Dithizone to the medium (for 10 ml volume: 30 mg Dithizone (Fluka 43820), 9 ml absolute EtOH, 150 pl NH4OH and 850 pl H20). After 5 min of incubation, islets were transferred to a petri dish and were hand-picked under the binocular microscope.
- the common bile duct was exposed by dislocating the gut and liver.
- a bulldog microclamp Robot Surgical Instruments Co., Inc., Gaithersburg, MD, USA
- a 30G1/2 needle was then used to enter the common bile duct and 3-4 ml of collagenase solution was perfused into the pancreas.
- the pancreas was then removed from the cadaver and immediately placed on ice in a 15 ml reaction tube containing 3.5 ml collagenase solution for a maximum of 60 min.
- pancreas was further digested in a water bath at 37°C for 15 min with a gentle shaking step after 7.5 min.
- 10 ml of ice-cold G-solution was added to stop the reaction, then samples were centrifuged at 290xg for 2 min at RT. The supernatant was carefully decanted.
- the remaining pancreatic digest was dissolved by repeated vigorous pipetting.
- the solution was filtered through a metal mesh (pore size approx. 1 mm) into a 50 ml reaction tube in order to remove larger undigested pieces.
- Another 10 ml of G-solution, used to rinse the 15 ml tube was also filtered through the metal mesh.
- the metal mesh was rinsed with a further 20 ml of G-solution to avoid loss of islets.
- the complete filtrate was centrifuged at 290xg for 2 min at RT. After decanting the supernatant, the pellet was resuspended in 5.5 ml of Optiprep-RPMI solution. This resuspension was slowly pipetted along the wall into a new 15 ml tube with 2.5 ml Optiprep-RPMI, creating a gradient, which was then overlaid with 6 ml of G-solution to obtain a third layer.
- the samples were allowed to incubate an additional 10 min at RT to improve gradient formation before centrifuging at 290xg for 15 min at RT with an adjusted slow acceleration and without break to avoid mixing of the gradients.
- Islets accumulate between the second and the third layer of the gradient. They were carefully collected with a serological pipet and then filtered through a 70 pm cell strainer to remove any remaining acinar tissue. Islets were captured from the cell strainer by turning the strainer and rinsing it with G-solution into an untreated suspension culture dish. The islets were then picked by hand under a stereomicroscope and placed in a new suspension culture dish with 12 ml islet culture medium (a maximum of 60-80 islets per dish were allowed). Islets were left to rest and recover overnight in an incubator at 37°C with 5% CO 2 infusion and humidified air before a subsequent islet lysis, RNA isolation or protein isolation was carried out.
- islets were cultured O/N at 37 °C in RPMI 1640 medium (11 mM glucose), supplemented with 1 % BSA, 2 mM glutamine, and penicillin/streptomycin in an atmosphere of 95% humidified air, 5% CO2, to allow recovery from islet isolation stress.
- RPMI 1640 medium 11 mM glucose
- BSA bovine serum
- 2 mM glutamine glutamate
- penicillin/streptomycin in an atmosphere of 95% humidified air, 5% CO2
- 120 islets of similar size isolated from mice of each experimental group were washed in KRBG30 buffer twice and then were handpicked and seeded in a 6-well plate containing KRB G30 for pre-culture during 2 hours at 37°C in an atmosphere of 95% humidified air, 5% CO2.
- KRB G30 low glucose
- KRB G300 high glucose
- 150ul of KRB G30 low glucose
- 20 pre-cultured islets per well were loaded in the new 96-well plate containing low or high glucose medium and were incubated during 1 hour at 37 °C. After this incubation, medium and (120 pl/well) islets were collected separately. Medium was subsequently stored at -80 °C. After collection of islets, acetic acid lysis buffer was added and the mixture was frozen O/N at -80 °C. For islet lysis, islets and acetic acid were boiled at 100 °C for 10min, then spined at 4 °C for 10 min at 12000 rpm. The supernatant was collected and stored at -80 °C. Insulin content in islets and insulin concentration in culture medium were measured by ELISA.
- RNA concentration and purity of the obtained RNA was determined using a device Nanodrop (ND-1000, ThermoScientific).
- ND-1000 ThermoScientific
- RT-PCR 1 pg of RNA samples was reverse-transcribed using Transcriptor First Strand cDNA Synthesis Kit (04379012001 , Roche, California, USA).
- Real-time quantitative PCR was performed in a SmartCyclerll® (Cepheid, Sunnyvale, USA) using EXPRESS SYBRGreen qPCR supermix (InvitrogenTM, Life Technologies Corp., Carslbad, CA, US). Data was normalized with RpIpO values and analyzed as previously described (Pfaffl, M., Nucleic Acids Res. 2001 ; 29(9):e45).
- Hormone detection Insulin concentrations were determined by Rat Insulin ELISA sandwich assay (90010, Crystal Chem INC. Downers Grove, IL 60515, USA).
- mice were fasted overnight (16 h) and administered with an intraperitoneal injection of glucose (1 or 2 g/kg body weight). Glycemia was measured in tail vein blood samples at the indicated time points.
- mice were fasted overnight (16 h) and administered with an intraperitoneal injection of glucose (3 g/kg body weight). Venous blood was collected from tail vein in tubes at the indicated time points and immediately centrifuged to separate serum, which was used to measure insulin levels.
- Islets or liver were homogenized in Lysis Buffer. Proteins were separated by 10% SDS-PAGE, and analyzed by immunoblotting with rabbit monoclonal anti-HNF1A (D7Z2Q; Cell signaling) and rabbit polyclonal anti-a-tubulin (ab4074; Abeam) antibodies. Detection was performed using ECL Plus detection reagent (Amersham Biosciences).
- Liver tissue was dissected into small pieces and protein was extracted using a Precellys Evolution instrument equipped with a Cryolys Evolution cooling unit (Bertin GmbH, Germany) following the manufacturer’s instructions. Protein concentrations were determined using the Pierce BCA Assay Kit (Thermo Fisher) according to the manufacturer’s instructions.
- reduced samples 40 pg protein per sample
- BOLT reagents Life technologies
- Denatured samples were loaded onto BOLT 4-12% gradient gels (Life technologies).
- the Chameleon Duo Ladder (LI-COR Biotechnology GmbH, Germany) was used to visualize protein separation during electrophoresis and to estimate the molecular weight of proteins.
- a new p-cell specific mouse model for MODY3 by means of the CRISPR/Cas9 technology was generated.
- siRT375 beta-cell specific miRNA375
- HDR homology directed repair
- miRNAs are small non-coding RNAs that bind specifically to certain mRNAs preventing their translation. Incorporation of target sequences of tissue-specific miRNAs in expression cassettes has been widely used in gene therapy approaches to de-target transgene expression from undesired tissues (Jimenez, V. et al. (2016) EMBO Mol Med 10(8):8791 ) but to the best of our knowledge nobody has used this approach to generate disease animal models.
- the specific gRNA, the donor DNA, and the Cas9 mRNA were pronuclearly microinjected into one-cell embryos that were subsequently transferred into recipient female mice.
- F0 generation was genotyped by PCR analysis using specific primers located in the flanking sequences of the knock-in site. Next, the PCR products were digested with EcoRV, leading to different patterns depending on the mice genotype ( Figure 1 B).
- Knock in (KI) mice were backcrossed with control (C57BL6) mice in order to segregate possible CRISPR/Cas9 off-target mutations.
- Heterozygous mice from the F1 generation were mated again with new control (C57BL6) mice to further segregate off-targets and obtain the F2 generation.
- F2 heterozygous mice were mated between each other to generate the F3 in which phenotyping of the model was performed. The most important results were:
- Example 3 MODY3 mice exhibited mild hyperglycemia and impaired glucose tolerance
- pancreas phenotype in MODY3 mice pancreatic sections were immunostained against insulin and morphometric analyses were performed. No striking differences in islet morphology and number of islets were detected between MODY3 and VVT mice ( Figure 12A). Nevertheless, MODY3 mice showed reduced mean islet area (Figure 12B) and p-cell mass in comparison to WT mice ( Figure 12C). In agreement, both male and female homozygous MODY3 mice showed reduced insulinemia ( Figure 11). Thus, the pancreas phenotype of homozygous MODY3 mice resembles that of MODY3 patients, with defects in p-cells and insulopenia (Sanchez Malo, M.J. et al. (2019) Endocrinol Diabetes Nutr;66(4):271-272.).
- Example 5 MODY3 mice showed downregulation of HNF1A target-genes and P-cell transcriptional regulatory network
- HNF1 A has been reported to regulate expression of insulin and p-cell transcription factors as well as expression of proteins involved in glucose transport and metabolism and mitochondrial function, all of which are involved in insulin secretion (Fajans, S.S. et al. (2001). N. Engl. J. Med., 345, 971-80). Both male and female MODY3 mice showed markedly reduced expression of all HNFIA gene targets examined ( Figures 13).
- a new beta-cell specific mouse model for MODY1 by means of the CRISPR/Cas9 technology was generated.
- To preclude production of HNF4A specifically in beta-cells we introduced two copies of the target sequence for the beta-cell specific miRNA375 (miRT375) (SEQ ID NO: 7) upstream the 3’ UTR of the HNF4A gene.
- sgRNA single guided RNA
- HDR homology directed repair
- the specific gRNA, the donor DNA, and the Cas9 mRNA were pronuclearly microinjected into one-cell C57BL/6NCrl embryos that were subsequently transferred into recipient female mice.
- the F0 generation was genotyped by PCR analysis using specific primers located in the flanking sequences of the knock- in site. Next, the PCR products were digested with EcoRV, leading to different patters depending on the mice genotype ( Figure 14B). Knock in (KI) mice were backcrossed with control (C57BL/6NCrl) mice in order to segregate possible CRISPR/Cas9 off-target mutations.
- mice from the F1 generation were mated again with new control (C57BL/6NCrl) mice to further segregate off-targets and obtain the F2 generation.
- F2 heterozygous mice were mated between each other to generate the F3 generation, which will be used for phenotyping of the model.
- the MODY3 mouse model developed in Example 1 was used to design a suitable gene therapy approach.
- AAV8 vectors encoding GFP under the control of four candidate promoters were generated.
- the selected promoters were the rat insulin promoter I (RIPI, SEQ ID NO: 10), rat insulin promoter II (RIPII, SEQ ID NO: 11), the full-length human insulin promoter (hlNS1 .9, SEQ ID NO: 12), and a 385 bp fragment of the human insulin promoter (hlns385, SEQ ID NO: 13).
- AAV8-GFP vectors (AAV8-RIPI-GFP, AAV8-RIPII-GFP, AAV8-hlNS1 ,9-GFP and AAV8- hlns385-GFP) were produced by triple transfection in HEK293 cells.
- HNF1A_a Mus musculus hepatocyte nuclear factor 1A isoform A
- ITRs inverted terminal repeats
- mice were administered intraductally with AAV8-RIPI-HNF1 A_a or AAV8-RIPII-HNF1A_a vectors.
- a control group administered intraductally with PBS served as control.
- both vectors promoted specific HNF1A overexpression in islets (Figure 16)
- animals treated with AAV8-RIPI-HNF1A_a or AAV8-RIPII-HNF1 A_a vectors showed reduced islet number and beta cell mass in comparison with control mice ( Figure 17).
- HNF1A_a Mus musculus hepatocyte nuclear factor 1A isoform A
- ITRs inverted terminal repeats
- Wild type mice were administered intraductally with AAV8-hlNS1 .9-HNF1 A_a or AAV8-hlns385-HNF1 A_a vectors.
- a control group administered intraductally with PBS served as control.
- Mice treated intraductally with AAV8-hlNS1 .9-HNF1A_a or AAV8-hlns385-HNF1 A_a vectors showed increased expression levels of HNF1A in islets ( Figure 18).
- mice treated intraductally with AAV8-hlNS1 .9-HNF1A_a vectors showed decreased number of islets and p-cell mass (Figure 19).
- Antidiabetic therapeutic efficacy of AAV8-hlns385-HNF1 A_a vectors was evaluated in the MODY3 KI mouse model.
- Wild type (WT) mice were used as healthy controls, and homozygous KI mice administered with PBS served as MODY3 disease controls.
- KI MODY3 mice treated with AAV8-hlns385-HNF1A_a vectors showed counteraction of the mild hyperglycemia characteristic of the disease model ( Figure 20).
- MODY3 mice treated with the therapeutic vector also showed improvement of glucose tolerance (Figure 21). No changes in body weight were observed among experimental groups (Figure 22).
- Example 9 MODY3 mice exhibited reduced islet insulin content and impaired insulin secretion
- Example 10 Increased HNF1 A expression and protein content in islets from MODY3 mice treated with AAV8-hlns385-HNF1 A a vectors
- HNF1A expression levels and protein content were analyzed in islet samples from 14 to 16-week-old male wild-type, MODY3 and MODY3 mice treated with AAV8-hlNS385-mmHNF1 a vectors.
- MODY3 mice treated with AAV8-hlns385-HNF1 A_a vectors showed markedly increased HNF1A expression levels and HNF1 A protein content in islets compared with MODY3 mice treated intraductally with PBS ( Figures 25 and 26). Noticeably, HNF1 A protein content in islets was normalized by the AAV treatment ( Figure 26).
- HNF1A gene targets Slc2a2 (encoding for glucose transporter 2, GLUT2), L-pk (L-pyruvate kinase) and Hnf4a (hepatocyte nuclear factor 4 alpha), was also increased in MODY3 mice treated with AAV8-hlns385-HNF1 A_a vectors ( Figure 27).
- Example 11 MODY3 mice treated with AAV8-hlns385-HNF1 A a vectors exhibited improved fasted mild hyperglycemia
- Hnf4a expression levels were analyzed using two different primer pairs in islet samples from 12-14-week- old MODY1 mice. Homozygous MODY1 mice showed significantly reduced Hnf4a expression levels in islets ( Figure 30), whereas HNF4A protein content in the liver of MODY1 mice was not changed ( Figure 31).
- Example 15 MODY1 mice showed downregulation of HNF4A target gene Slc2a2 in islets
- HNF4A was shown to regulate the expression of genes involved p-cell function, among them Slc2a2, which encodes for the glucose transporter 2 (Wang H. et al. (2000), J. Biol. Chem. 275(47), 35953- 35959).
- Slcs2a2 was significantly downregulated in islets from homozygous MODY1 (KI/KI) compared to islets from wild-type (WT/WT) littermates (Figure 33).
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Environmental Sciences (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Veterinary Medicine (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Mycology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Crystallography & Structural Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP21382080 | 2021-01-30 | ||
| PCT/EP2022/051917 WO2022162072A1 (en) | 2021-01-30 | 2022-01-27 | Down-regulation of endogenous genes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4284166A1 true EP4284166A1 (en) | 2023-12-06 |
Family
ID=74732818
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP22703583.9A Withdrawn EP4284166A1 (en) | 2021-01-30 | 2022-01-27 | Down-regulation of endogenous genes |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US20240107988A1 (en) |
| EP (1) | EP4284166A1 (en) |
| WO (1) | WO2022162072A1 (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018011590A1 (en) * | 2016-07-14 | 2018-01-18 | Oxford University Innovation Limited | Method for modifying genes |
-
2022
- 2022-01-27 WO PCT/EP2022/051917 patent/WO2022162072A1/en not_active Ceased
- 2022-01-27 US US18/262,018 patent/US20240107988A1/en active Pending
- 2022-01-27 EP EP22703583.9A patent/EP4284166A1/en not_active Withdrawn
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018011590A1 (en) * | 2016-07-14 | 2018-01-18 | Oxford University Innovation Limited | Method for modifying genes |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2022162072A1 (en) | 2022-08-04 |
| US20240107988A1 (en) | 2024-04-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| TWI820034B (en) | Cellular models of and therapies for ocular diseases | |
| Liu et al. | Muscle developmental defects in heterogeneous nuclear Ribonucleoprotein A1 knockout mice | |
| Yin et al. | Dosage effect of multiple genes accounts for multisystem disorder of myotonic dystrophy type 1 | |
| JP2020108409A (en) | non-human animal lacking linc RNA | |
| US20110107445A1 (en) | Efficient Insertion of DNA Into Embryonic Stem Cells | |
| WO2019134561A1 (en) | High efficiency in vivo knock-in using crispr | |
| US20240107988A1 (en) | Down-regulation of endogenous genes | |
| Zhang et al. | Genome writing to dissect consequences of SVA retrotransposon disease X-Linked Dystonia Parkinsonism | |
| CN111500589A (en) | Pig SOX10 mutant gene causing inner ear hypoplasia and application thereof | |
| JP7097440B2 (en) | Non-human animals containing the SLC30A8 mutation and usage | |
| CN116004641B (en) | Method for constructing Lrp 5A 241T gene point mutation high bone mass mouse model | |
| US20250345463A1 (en) | Gene therapy for monogenic diabetes | |
| CN115873935B (en) | Application of Hilnc or its signaling pathways as targets for regulating lipid metabolism | |
| CN118956871B (en) | A gRNA for constructing an osteopetrosis mouse model, a construction method and an application thereof | |
| CN118421703B (en) | Method for constructing non-human mammal model with spontaneous emotion abnormal fluctuation and application thereof | |
| CN117230077B (en) | Application of Hakai gene in RP disease model construction and construction method | |
| CN110218743A (en) | A kind of construction method of the taurine transporter knockout rat model based on CRISPR/Cas9 technology | |
| Osterhof | Functional and expression analysis of androglobin in different branches of the metazoan tree | |
| Buglo | Establishing CRISPR Models of Rare Hereditary Neurodegenerative Diseases | |
| JP4382861B2 (en) | Novel gene involved in neuralization induction, protein thereof, and method of use thereof | |
| Yamazaki et al. | Enhanced osteoblastic differentiation of parietal bone in a novel murine model of mucopolysaccharidosis type II | |
| JP4166496B2 (en) | Novel gene involved in neuralization induction, protein thereof, and method of use thereof | |
| Idigo | Investigating the role of eef1a2 in zebrafish as a potential disease model | |
| Massoz et al. | Zebra-Fishing for Regenerative Awakening in Mammals. Biomedicines 2021, 9, 65 | |
| HK40114228A (en) | Cellular models of and therapies for ocular diseases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20230817 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: EXAMINATION IS IN PROGRESS |
|
| 17Q | First examination report despatched |
Effective date: 20241126 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20250527 |