NEURODEGENERATIVE TREATMENT
Field of the Invention
The invention relates to an isolated polysaccharide and a composition comprising the polysaccharide for use in treating a neurodegenerative disease or a medical condition, and a method of treatment using the isolated polysaccharide or the composition thereof.
Background
Alzheimer’s Disease (AD) is the most common cause of dementia and contributes to 60-70% of cases. AD is an incurable, neurodegenerative disease and its worldwide prevalence is expected to double every twenty years reaching well over 100 million by 2050. It is estimated that there will be approximately 14.8 million prevalent cases of AD in the US, Japan, and five major EU markets by 2034. Within the UK, there are approximately 850,000 sufferers which contribute an economic cost to society in the region of £23bn. This is greater than heart disease and cancer combined. Drug development for AD has proven to be very difficult. The high-profile failure of clinical trials in AD, which primarily focus on the amyloid cascade hypothesis, strengthens the case for developing drugs with an alternative mechanism of action. Nevertheless, five drugs are currently approved for the treatment of AD including cholinesterase inhibitors (donepezil, rivastigmine, galantamine) and an N-methyl-D-aspartate (NMDA) receptor AD antagonist (memantine). These drugs alleviate some of the symptoms of the disease, but are not curative, or disease modifying, and only work in certain individuals for a relatively short period of time. No new treatments have been approved for AD since 2003. It is clear, therefore, that there is a significant unmet need for alternative, more effective, treatments for AD. There is therefore a need for a novel treatment of neurodegenerative diseases, such as Alzheimer’s disease.
Statements of the Invention
Thus, according to a first aspect of the invention, there is provided an isolated polysaccharide comprising “n” repeating units; or a composition comprising an isolated polysaccharide comprising “n” repeating units, wherein each of the “n” repeating units comprises a backbone of alpha-(1-5)- linked arabinofuranose residues, a first side chain of a single alpha-arabinofuranose residue (l-2)-linked to an arabinofuranose residue of the backbone, and a second side
chain of a single alpha-arabinofuranose residue (l-3)-linked to the same arabinofuranose residue of the backbone, for use in treating, preventing or ameliorating a neurodegenerative disease and/or symptoms thereof in a subject, optionally wherein the composition is a pharmaceutical composition and a pharmaceutically acceptable carrier or such like, or an edible composition.
According to another aspect, there is provided a method of treating, preventing or ameliorating a neurodegenerative disease and/or symptoms thereof in a subject, the method comprising administering to the subject an isolated polysaccharide referred to herein, a composition referred to herein, or a plant of the Malvales order or a part thereof.
Advantageously, the polysaccharide referred to herein is non-toxic and does not induce anaphylaxis in animals or humans. More importantly, however, the polysaccharide is edible and capable of crossing the blood brain barrier after oral consumption. Therefore, it can be administered orally to treat neurodegenerative diseases.
The method may comprise administering a therapeutically effective amount of the isolated polysaccharide, the composition or the plant to treat a neurodegenerative disease.
According to another aspect of the invention there is provided a plant of the Malvales order for use in treating, preventing or ameliorating a neurodegenerative disease and/or symptoms thereof in a subject.
The polysaccharide of the invention may be isolated from a Malvales plant. The plant may be a Malvales plant or a part thereof. Similarly, the polysaccharide may be isolated from a plant of the Malvales order. The Malvales order comprises the Bixaceae family, the Cistaceae family, the Cytinaceae family, the Dipterocarpaceae family, the Muntingiaceae family, the Neuradaceae family, the Sarcloaenaceae family, the Sphaerosepalaceae family, the Thymelaeceae family and the Malvaceae family. Preferably the plant is a member of the Malvaceae family. The family Malvaceae comprises the subfamilies Bombacoideae, Brownlowioideae, Bytnnerioideae, Byttnerioideae, Dombeyoideae, Grewioideae,
Helicteroideae, Malvoideae, Sterculioideae and Tiliodeae. Preferably the plant is a Malvoideae. The Malvoideae comprises the tribes Malveae, Gossypieae, Hibisceae, Kydieae. Preferably the plant is from the Malveae tribe. The plant may be from the Sida genus or the Malva genus or the Malvastrum genus or the Sidalcea genus or the Abutilon genus or the Althea genus or the Sphaeralcea genus or the Lavatera genus. Most preferably the plant of the Sida genus is Sida cordifolia (also referred to as ilima, flannel weed, bala, country mallow or heartleaf sida). Most preferably the plant of the Malva genus is Malva sylvestris. Most preferably the plant of the Malvastrum genus is Malvastrum lateritium. Most preferably the plant of the Sidalcea genus is Sidalcea malviflora. Most preferably plant of the Abutilon genus is Abutilon theophrasti. Most preferably the plant of Althea genus is Althea officinalis . Most preferably the plant of Sphaeralcea genus is Sphaeralcea coccinea. Most preferably the plant of Lavatera genus is Lavatera arborea. Most preferably the plant is Sida cordifolia.
Thus, the polysaccharide may be from a plant of the Sida genus (e.g. Sida cordifolia) or the Malva genus (e.g. Malva sylvestris) or the Malvastrum genus (e.g. Malvastrum lateritium) or the Sidalcea genus (e.g. Sidalcea malviflora) or the Althea genus (e.g. Althea officinalis), or the Sphaeralcea genus (e.g. Sphaeralcea coccinea), or the Lavatera genus (e.g. Lavatera arborea). Similarly, the plant may be a plant of the Sida genus (e.g. Sida cordifolia) or the Malva genus (e.g. Malva sylvestris) or the Malvastrum genus (e.g. Malvastrum lateritium) or the Sidalcea genus (e.g. Sidalcea malviflora) or the Althea genus (e.g. Althea officinalis), or the Sphaeralcea genus (e.g. Sphaeralcea coccinea), or the Lavatera genus (e.g. Lavatera arborea).
Preferably the polysaccharide is from Sida cordifolia. Preferably the plant is Sida cordifolia. The polysaccharide may be isolated from part of a plant of the Malvales order, such as the leaves, the flower, the stem and/or the roots of the plant. The plant may be part of the plant, such as the leaves, the flower, the stem and/or the roots of the plant. Preferably the part of the plant is the roots. Therefore, the polysaccharide may be isolated from the roots of a plant of the Malvales order. The polysaccharide may be from the roots of a Sida spp. (e.g. Sida cordifolia) or a Malva spp. (e.g. Malva sylvestris) or a Malvastrum spp. (e.g. Malvastrum lateritium) or a Sidalcea spp. (e.g. Sidalcea malviflora). The plant may be the roots of a Sida spp. (e.g. Sida cordifolia) or a Malva spp. (e.g. Malva sylvestris) or a Malvastrum spp. (e.g. Malvastrum lateritium) or a Sidalcea spp. (e.g. Sidalcea
malviflora). Most preferably the polysaccharide is isolated from the roots of Sida cordifolia. Thus, the plant may be the roots of Sida cordifolia.
The polysaccharide may be a homopolysaccharide or a heteropolysaccharide. The polysaccharide may be an arabinan polysaccharide. The polysaccharide may be an arabinan homopolysaccharide. The residues of the homopolysaccharide may be L- arabinofuranose residues or be D-arabinofuranose residues. Preferably the residues are L-arabinofuranose residues.
Each repeating unit of the backbone of the polysaccharide referred to within the first aspect may further comprise 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more or 10 additional residues (glycosidic) linked to a terminal residue of the backbone. Preferably the additional residues of the backbone are alpha-(1-5)- linked arabinofuranose residues. More preferably the additional residues of the backbone are alpha-L-(1-5)-linked arabinofuranose residues. One or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more or nine or more of the additional alpha-(1-5)-linked arabinofuranose residues may or may not comprise any side chains. One or more of the additional alpha-(1-5)- linked arabinofuranose residues may comprise a side chain of a single alpha-(l-2)- linked arabinofuranose residue. One or more of the additional alpha-(1-5)-linked arabinofuranose residues may comprise a side chain of a single alpha-(l-3)-linked arabinofuranose residue. One, two or three of the additional alpha-(1-5)-linked arabinofuranose residues may comprise a side chain of a single alpha-(l-2)-linked arabinofuranose residue and a side chain of a single alpha-arabinofuranose residue (1- 3)-linked to the same additional arabinofuranose residue of the backbone.
Each of the repeating units may independently be branched or unbranched. Thus, at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or about 100% of the repeating units may be branched. Thus, less than about 100%, about 90%, about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55%, about 50%, about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10% or about 5% of the repeating units may be branched.
Each of the repeating units may be directly or indirectly linked to each other. Preferably each of the repeating units is directly linked to each other via a glycosidic bond, such as an alpha-(1-5) glycosidic bond or an alpha-L-(1-5) glycosidic bond.
The first side chain and the second side chain of the polysaccharide according to the invention may be linked to the same arabinofuranose residue of the backbone.
In one embodiment, the repeating unit comprises or consists of Formula (I) (which may also be referred to herein as block “A”), defined herein as follows:
The repeating units of the polysaccharide according to the invention may comprise or consist of blocks referred to herein as blocks “A”, “E” and “F”. Block A (Formula I) is an essential block of the polysaccharide according to the invention. However, the repeating units of the polysaccharide may further comprise block E and/or block F.
Block E may be represented by Formula II, as follows:
Block F may be represented by Formula III, as follows:
Each block (i.e. block A, block E and block F) comprises a backbone. Each block may be linked by an alpha-(1-5)-glycosidic bond, specifically the backbone of each block. Thus, the repeating units may comprise Formula (I) linked to Formula (II) by an alpha-(1-5)-glycosidic bond. The repeating units may comprise Formula (I) linked to Formula (III) by an alpha-(1-5)-glycosidic bond. The repeating units may comprise Formula (II) linked to Formula (III) by an alpha-(1-5)-glycosidic bond.
Preferably block A is about three, about four or about five times more abundant than block E and/or block F (if E or F is present) in the repeating unit of the polysaccharide. Thus, the ratio of A:E:F in the repeating units may be 3-5 : 1 : 1. Most preferably the ratio of A:E:F is 4: 1 : 1.
Preferably block F (if present in the repeating unit) is the least abundant block of A, E and F. Preferably block A is the most abundant block of A, E and F. Block F (if present in the repeating unit) may be about two, about three, about four, about five, about six, about seven or about less abundant than block A. Block F (if present) may be between about one and about two times less abundant than block A. Preferably for every occurrence of F there is between about 4 and about 6 occurrences of A, and for every occurrence of F there is between about 1 and about 2 occurrences of E. Thus, the ratio of A:E:F in the repeating units may be about 2-8: 1-3: 1 or 3-7: 1-2: 1 or 4-6: 1- 2: 1. Most preferably the ratio of A:E:F is 4-6: 1-2: 1.
Thus, the repeating unit may comprise Formula (II), defined herein as follows:
[Formula IV] wherein each star of Formula (IV) corresponds to an arabinofuranose, preferably an L-arabinofuranose, more preferably an alpha-arabinofuranose, most preferably an alpha-L-arabinofuranose.
The repeating unit of the polysaccharide may be represented by any one of the combinations shown in Table 1, as follows:
Each cell of Table 1 above represents an embodiment of a repeating unit of the polysaccharide according to the invention. Thus the repeating unit of the polysaccharide may be represented by any one of the 48 examples shown in Table 1. The polysaccharide may comprise “n” repeating units, e.g. “n” repeating units of Formula (I) or Formula (II) or any of the 48 examples shown in Table 1. “n” may be 2 or more, 3 or more, 4 or more, 5 or more 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 15 or more, 20 or more, 25 or more, 30 or more, 35 or more, or 40 or more, 50 or more, 100 or more, 200 or more, 300 or more, 500 or more, or 1000 or more, “n” may be about 5 to about 1000, about 10 to about 500, or about 15 to about 250, or about 15 to about 230, or about 15 to about 220. Preferably “n” is about 15 to about 220 or about 15 to about 230.
The polysaccharide according to the invention may or may not be a rhamnogalacturonan, such as rhamnogalacturonan-I of rhamnogalacturonan-II.
The polysaccharide or composition referred to herein may be administered several different routes, including, for example, oral, rectal, nasal, pulmonary, topical (including buccal and sublingual), transdermal, intracisternal, intraperitoneal, vaginal and parenteral (including subcutaneous, intramuscular, intrathecal, intravenous and intradermal) route. The polysaccharide or composition referred to herein may be administered orally. The polysaccharide or composition referred to herein may be administered rectally. The polysaccharide or composition referred to herein may be administered nasally. The polysaccharide or composition referred to herein may be administered via the pulmonary route. The polysaccharide or composition referred to herein may be administered topically (e.g. buccally or sublingually). The polysaccharide or composition referred to herein may be administered transdermally. The polysaccharide or composition referred to herein may be administered intracisternally. The polysaccharide or composition referred to herein may be administered intraperitoneally. The polysaccharide or composition referred to herein may be administered via the vaginal. The polysaccharide or composition referred to herein may be administered parenterally (e.g. subcutaneously, intramuscularly, intrathecally, intravenously or intradermally). Preferably the polysaccharide or composition is administered orally.
As mentioned above, a polysaccharide or a composition referred to herein for use according to the invention may be used to treat, prevent and/or ameliorate a neurodegenerative disease and/or symptoms thereof.
A neurodegenerative disease is any medical disease or medical condition that is caused by the death of neurons of the central nervous system (e.g. the brain) and/or the peripheral nervous system. The death of the neurons results in symptoms which may affect speech, movement, memory, intelligence and/or more.
The neurodegenerative disease referred to herein may be a disease selected from the group comprising or consisting of Alzheimer’s disease (AD) and/or related dementias, such as vascular dementia, frontotemporal dementia and/or lewy body dementia; Parkinson’s disease (PD) and/or PD-related disorders; Huntington’s disease (HD); dementia; Motor neurone diseases (MND) (also referred to as amyotrophic lateral sclerosis (ALS)); Spinocerebellar ataxia (SCA); Spinal muscular atrophy (SMA); prion disease; autism spectrum disorders and/or the neurodegenerative process associated with autism spectrum disorders; depression; and schizophrenia. Preferably, the neurodegenerative disease is Alzheimer’s disease or Parkinson’s disease.
The neurodegenerative disease referred to herein may be one or more diseases selected from the group comprising or consisting of Alzheimer’s disease; ALS; and Huntington’s disease.
Thus, in one embodiment, there is a polysaccharide comprising “n” repeating units of Formula (I), Formula (IV) or any of the 48 examples shown in Table 1, for use in treating, preventing and/or ameliorating a selection of one or more diseases from the group comprising/consisting of Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, motor neuron disease, prion disease, and/or symptoms thereof in a subject.
In another embodiment, there is a polysaccharide comprising “n” repeating units of Formula (I), Formula (IV) or any of the 48 examples shown in Table 1, for use in treating, preventing and/or ameliorating Alzheimer’s disease and/or symptoms thereof in a subject.
In another embodiment, there is a polysaccharide comprising “n” repeating units of Formula (I), Formula (IV) or any of the 48 examples shown in Table 1, for use in treating, preventing and/or ameliorating Parkinson’s disease and/or symptoms thereof in a subject.
In another embodiment, there is a polysaccharide comprising “n” repeating units of Formula (I), Formula (IV) or any of the 48 examples shown in Table 1, for use in treating, preventing and/or ameliorating Huntington’s disease and/or symptoms thereof in a subject.
In another embodiment, there is a polysaccharide comprising “n” repeating units of Formula (I), Formula (IV) or any of the 48 examples shown in Table 1, for use in treating, preventing and/or ameliorating motor neuron disease and/or symptoms thereof in a subject.
In another embodiment, there is a polysaccharide comprising “n” repeating units of Formula (I), Formula (IV) or any of the 48 examples shown in Table 1, for use in treating, preventing and/or ameliorating prion disease and/or symptoms thereof in a subject.
The inventors believe, but do not wish to be bound by the theory that the neuroinflammatory response is subjects with a neuroinflammatory disorder is hyporesponsive. This hyporesponsiveness is believed to have detrimental effects on the brain and contribute to the progression of neurodegenerative diseases. Given that the polysaccharide according to the invention may be used to enhance neuroinflammation in a subject with a neurodegenerative disorder (see Example 7), the polysaccharide according to the invention may be used to treat a neurodegenerative disorder and/or the symptoms thereof.
Symptoms of Alzheimer’s disease include chronic and progressive memory loss (recognition and spatial memory, visuo-spatial dysfunction), disorientation to time and place, impairments in social and occupational functioning (executive function difficulties), deficits in motor function and speech, nominal dysphasia, apathy, personality changes and behavioural and psychological disturbances. Pathological brain changes include beta amyloid plaques, neurofibrillary tangles, marked
neuroinflammation and neurodegeneration. A selection of one or more of these symptoms may be treated by a polysaccharide according to the invention.
Symptoms of Parkinson’s disease include cardinal features of resting tremor, rigidity, bradykinesia and postural instability. Other common symptoms include masked facies, hypophonia, hypokinetic dysarthria, micrographia, shuffling gait, stooped posture, fatigue, constipation, depression, anxiety, dementia. Pathological brain changes include loss of dopaminergic neurons in the substantia nigra pars compacta (SNc) and accumulation of Lewy bodies (cytoplasmic protein inclusions composed of alpha synuclein protein) as well as mitochondrial dysfunction, neuroinflammation and neurodegeneration. A selection of one or more of these symptoms may be treated by a polysaccharide referred to herein.
Symptoms of Huntington’s disease include chorea, incoordination, cognitive decline, personality changes, and psychiatric symptoms, culminating in immobility, mutism, and inanition. Other common symptoms include cognitive dysfunction, impaired social and occupational functioning, irritability and impulsivity, twitching or restlessness, loss of coordination, deficits in motor coordination, impaired concentration, disinhibition or unusually anxious behaviour, depression, obsessions and compulsions. Huntington's disease is caused by an expanded CAG repeat at the N-terminus of the gene that encodes the huntingtin protein, which generates an elongated polyglutamine tail that promotes aggregation. Aggregates interfere with normal cellular functions, such as mitochondrial function, transcriptional regulation, axonal and vesicular transport, apoptosis, proteasome function, and cell-cell interactions. A selection of one or more of these symptoms may be treated by a polysaccharide referred to herein.
Symptoms of motor neuron disease may comprise upper extremity weakness, stiffness with poor coordination and balance, spastic, unsteady gait, painful muscle spasms, difficulties arising from chairs and climbing stairs, foot drop, progressive difficulties in maintaining posture, muscle atrophy, hyper reflexia, dysponea, coughing and choking on liquids and food, strained slow speech, propensity for falls, sialorrhoea and drooling, inappropriate emotional outbursts, cognitive impairment, features of frontotemporal dementia. Pathological mechanisms involved include protein misfolding, glutamate toxicity, oxidative stress, microglial activation, mitochondrial dysfunction, disrupted
axonal transport, RNA metabolism dysregulation. A selection of one or more of these symptoms may be treated by a polysaccharide referred to herein.
Symptoms of prion disease may comprise cognitive impairment, ataxia, myoclonus, parkisnsonism, agitation, depression and other psychiatric features, visual changes, insomnia, dysautomia, dizziness and non-specific or constitutional symptoms, sensory symptoms and movement disorders. Pathologically, prion diseases are characterized by presence of pathogenic prion proteins or PrPSc, vacuoles, neutron loss and astrogliosis. A selection of one or more of these symptoms may be treated by a polysaccharide referred to herein.
Symptoms of Lewy body dementia may comprise cognitive fluctuations, visual hallucinations, auditory hallucinations, olfactory hallucinations, tactile hallucinations, movement disorders, parkinsonian symptoms (such as slowed movement, rigid muscles, tremor or shuffling when walking), rapid eye movement (REM) sleep behavioural disturbance, dizziness, poor regulation of body functions (dysregulated blood pressure, pulse, sweating and the digestive processes and constipation), cognitive dysfunction, confusion, poor attention, visual-spatial problems and memory loss, sleep disorders, fluctuating attention, drowsiness, disorganized speech, depression and apathy. Pathologically, lewy body dementia is characterized by the presence of lewy bodies, composed of alpha-synuclein protein. Mitochondrial dysfunction, neuroinflammation and neurodegeneration are also apparent. A selection of one or more of these symptoms may be treated by a polysaccharide referred to herein.
Symptoms of frontotemporal dementia may comprise inappropriate social behaviour, loss of empathy, poor judgment, loss of inhibition, apathy, repetitive compulsive behaviour (such as tapping, clapping or smacking lips), altered eating habits (usually overeating or developing a preference for sweets and carbohydrates), eating inedible objects, speech and language problems (such as primary progressive aphasia, semantic dementia and progressive agrammatic (nonfluent) aphasia), movement-related problems (including tremor, rigidity, muscle spasms, poor coordination, difficulty swallowing, and muscle weakness). Pathologically, frontotemporal dementia is associated with focal degeneration of frontal and temporal lobes, associated with intra-neuronal and glial cell inclusions composed of tau protein or ubiquitin. Mitochondrial dysfunction, neuroinflammation and neurodegeneration are also
apparent. A selection of one or more of these symptoms may be treated by a polysaccharide referred to herein.
Symptoms of vascular dementia may comprise difficulties in problem solving, disinhibition, apathy, slowed processing of information, inability to maintain attention, frontal release reflexes, focal neurological signs, impaired balance and gait, cognitive dysfunction, particular difficulties in executive function, motor impairment. Pathologically damage is observed in both grey and white matter from vascular causes: smallvessel changes, infarction, ischaemia and haemorrhage. Mitochondrial dysfunction, neuroinflammation and neurodegeneration are also apparent. A selection of one or more of these symptoms may be treated by a polysaccharide referred to herein.
Symptoms of Autism spectrum disorders include social communication and interaction impairments and restricted, repetitive, and stereotyped patterns of behaviors, interests, or activities, language delays or regression, verbal and non-verbal communication impairments, unusual posturing, motor stereotypes, sensory interests, macrocephaly. Mitochondrial dysfunction, neuroinflammation and neurodegeneration are also apparent. A selection of one or more of these symptoms may be treated by a polysaccharide referred to herein.
Symptoms of depression include low mood, anhedonia, weight changes, sleep disturbance, libido changes, low energy, psychomotor problems, excessive guilt, poor concentration, and suicidal ideation. Mitochondrial dysfunction, neuroinflammation and neurodegeneration are also apparent. A selection of one or more of these symptoms may be treated by a polysaccharide referred to herein.
Symptoms of schizophrenia include delusions, hallucinations, disorganised speech, disorganised/catatonic behaviour, asocial behavior, affective flattening, avolition, anhedonia, attention deficits, alogia, cognitive deficits, somatisation, depression, anxiety, motor coordination deficits. Mitochondrial dysfunction, neuroinflammation and neurodegeneration are also apparent. A selection of one or more of these symptoms may be treated by a polysaccharide referred to herein.
A symptom may be treated and/or ameliorated so that it is equal to or better than that of the average of a population of “m” age- and/or gender-matched subjects without a
neurodegenerative disease, or improved compared to the subject’s symptom before treatment with the plant or polysaccharide. Treatment of a symptom may be preventing its progression. A symptom may be treated by preventing or reversing its progression within a subject.
As shown, in the Examples, an extract from a plant (i.e. the roots of Sida cordifolia) comprising a polysaccharide of Formula (I) or any one of the 48 examples shown in Table 1 may be used to:
• treat/improve impaired memory in a subject with a neurodegenerative disease, such as Alzheimer’s disease (e.g. treat/improve impaired memory (such as recognition memory, spatial learning and memory and/or reversal learning and memory) in a subject with a neurodegenerative disease, such as Alzheimer’s disease, compared to the average recognition memory, spatial learning and memory and/or reversal learning and memory performance of a population of “m” age- and/or gender matched subjects with the same neurodegenerative disease before treatment with the plant or polysaccharide, or compared to the subject’s recognition memory, spatial learning and memory and/or reversal learning and memory performance before treatment with the plant or polysaccharide);
• treat or reduce beta amyloid plaque load in the cortex of a subject with a neurodegenerative disease, such as Alzheimer’s disease (e.g. reduce beta amyloid plaque load in the cortex of a subject with a neurodegenerative disease, such as Alzheimer’s disease, compared to the average beta amyloid plaque load of a population of “m” age- and/or gender matched plant polysaccharide treatment naive subjects with the same neurodegenerative disease before treatment with the plant or polysaccharide, or compared to the average beta amyloid plaque load in the subject before treatment with the plant or polysaccharide);
• treat or reduce the levels of astrocytes in the cerebral cortex of a subject with a neurodegenerative disease, such as Alzheimer’s disease (e.g. treat or reduce the levels of astrocytes in the cerebral cortex of a subject with a neurodegenerative disease, such as Alzheimer’s disease, compared to the levels of astrocytes in the cerebral cortex of the subject before treatment with the
plant or polysaccharide, or compared to the average levels of astrocytes in a population of “m” age- and/or gender matched plant polysaccharide treatment naive subjects with the same neurodegenerative disease);
• reduce levels of microglia in the cerebral cortex of a subject with a neurodegenerative disease, such as Alzheimer’s disease (e.g. reduce levels of microglia in the cerebral cortex of a subject with a neurodegenerative disease, such as Alzheimer’s disease, compared to the levels of microglia in the cerebral cortex of the subject before treatment with the plant or polysaccharide, or compared to the average levels of microglia in a population of “m” age- and/or gender matched plant polysaccharide treatment naive subjects with the same neurodegenerative disease); and/or
• reduce levels of oxidative stress in the cerebral cortex of a subject with a neurodegenerative disease, such as Alzheimer’s disease (e.g. reduce levels of oxidative stress in the cerebral cortex of a subject with a neurodegenerative disease, such as Alzheimer’s disease, compared to the level of oxidative stress in the cerebral cortex of the subject before treatment with the plant or polysaccharide, or compared to the average levels of oxidative stress in a population of “m” age- and/or gender matched plant polysaccharide treatment naive subjects with the same neurodegenerative disease).
“m” may be about 5 or more, about 10 or more, about 20 or more, about 30 or more, about 40 or more, about 50 or more, about 60 or more, about 70 or more, about 80 or more, about 90 or more, about 100 or more, about 110 or more, about 120 or more, about 130 or more, about 140 or more, or about 150 or more subjects.
Pharmaceutical compositions according to the invention may further comprise a pharmaceutically acceptable salt or other form thereof. Pharmaceutical compositions according to the invention may comprise one or more pharmaceutically acceptable excipients, such as carriers, diluents, fillers, disintegrants, lubricating agents, binders, colorants, pigments, stabilizers, preservatives, antioxidants, and/or solubility enhancers. Pharmaceutical compositions according to the invention may comprise a pharmaceutically acceptable salt and optionally one or more pharmaceutically acceptable excipients.
The pharmaceutical compositions can be formulated by techniques known in the art. The pharmaceutical compositions can be formulated as dosage forms for oral, parenteral, such as topical, transdermal, intramuscular, intravenous, subcutaneous, intradermal, intraarterial, intracardial, nasal or aerosol administration. The pharmaceutical composition may be formulated as a dosage form for oral administration.
In the present context, the term "pharmaceutically acceptable salt" is intended to indicate salts which are not harmful to a patient. Such salts include pharmaceutically acceptable acid addition salts, pharmaceutically acceptable metal salts, ammonium and alkylated ammonium salts. Acid addition salts include salts of inorganic acids as well as organic acids. Representative examples of suitable inorganic acids include hydrochloric, hydrobromic, hydroiodic, phosphoric, sulfuric, nitric acids and the like. Representative examples of suitable organic acids include formic, acetic, trichloroacetic, trifluoroacetic, propionic, benzoic, cinnamic, citric, fumaric, glycolic, lactic, maleic, malic, malonic, mandelic, oxalic, picric, pyruvic, salicylic, succinic, methanesulfonic, ethanesulfonic, tartaric, ascorbic, pamoic, bismethylene salicylic, ethanedisulfonic, gluconic, citraconic, aspartic, stearic, palmitic, EDTA, glycolic, p- aminobenzoic, glutamic, benzenesulfonic, p-toluenesulfonic acids and the like. Further examples of pharmaceutically acceptable inorganic or organic acid addition salts include the pharmaceutically acceptable salts listed in J. Pharm. Sci. 1977, volume 66, issue 2. Examples of metal salts include lithium, sodium, potassium, magnesium salts and the like. Examples of ammonium and alkylated ammonium salts include ammonium, methylammonium, dimethylammonium, trimethylammonium, ethylammonium, hydroxyethylammonium, diethylammonium, butylammonium, tetramethylammonium salts and the like.
The pharmaceutical composition according to the invention may be formulated with pharmaceutically acceptable carriers or diluents as well as any other known adjuvants and excipients in accordance with conventional techniques such as those disclosed in Remington: The Science and Practice of Pharmacy, 19th Edition, Gennaro, Ed., Mack Publishing Co., Easton, PA, 1995.
Suitable pharmaceutical carriers include inert solid diluents or fillers, sterile aqueous solutions and various organic solvents. Examples of solid carriers are lactose, terra
alba, sucrose, cyclodextrin, talc, gelatine, agar, pectin, acacia, magnesium stearate, stearic acid and lower alkyl ethers of cellulose. Examples of liquid carriers are syrup, peanut oil, olive oil, phospholipids, fatty acids, fatty acid amines, polyoxyethylene and water. In addition, the compounds of the invention may form solvates with water or common organic solvents. Such solvates are also encompassed within the scope of the present invention.
The composition may further comprise a buffer system, preservative(s), tonicity agent(s), chelating agent(s), stabilizers and surfactants, which is well known to the skilled person. For convenience reference is made to Remington: The Science and Practice of Pharmacy, 20th edition, 2000. The composition may also further comprise one or more therapeutic agents active against the same disease state.
Methods to produce controlled release systems useful for compositions of the current invention include, but are not limited to, crystallization, condensation, cocrystallization, precipitation, co-precipitation, emulsification, dispersion, high pressure homogenisation, encapsulation, spray drying, microencapsulating, coacervation, phase separation, solvent evaporation to produce microspheres, extrusion and supercritical fluid processes. General reference is made to Handbook of Pharmaceutical Controlled Release (Wise, D. L., ed. Marcel Dekker, New York, 2000) and Drug and the Pharmaceutical Sciences vol. 99: Protein Composition and Delivery (MacNally, E.J., ed. Marcel Dekker, New York, 2000).
Administration of pharmaceutical compositions according to the invention may be through several routes of administration, for example, oral, rectal, nasal, pulmonary, topical (including buccal and sublingual), transdermal, intracisternal, intraperitoneal, vaginal and parenteral (including subcutaneous, intramuscular, intrathecal, intravenous and intradermal) route. It will be appreciated that the preferred route will depend on the general condition and age of the subject to be treated, the nature of the condition to be treated and the active ingredient chosen.
For topical use, sprays, creams, ointments, jellies, gels, inhalants, dermal patches, implants, solutions of suspensions, etc., containing the compounds of the present invention are contemplated. For the purpose of this application, topical applications shall include mouth washes and gargles. Compounds of the invention may be used in
wafer technology, wafer technology, such as the biodegradable Gliadel polymer wafer, is useful for brain cancer chemotherapy.
Pharmaceutical compositions for oral administration include solid dosage forms such as hard or soft capsules, tablets, troches, dragees, pills, lozenges, powders and granules and liquid dosage forms for oral administration include solutions, emulsions, aqueous or oily suspensions, syrups and elixirs, each containing a predetermined amount of the active ingredient, and which may include a suitable excipient.
Compositions intended for oral use may be prepared according to any known method, and such compositions may contain one or more agents selected from the group consisting of sweetening agents, flavouring agents, colouring agents, and preserving agents in order to provide pharmaceutically elegant and palatable preparations.
Tablets may contain the active ingredient in admixture with non-toxic pharmaceutically-acceptable excipients which are suitable for the manufacture of tablets. These excipients may be for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example corn starch or alginic acid; binding agents, for example, starch, gelatin or acacia; and lubricating agents, for example magnesium stearate, stearic acid or talc.
The tablets may be uncoated or they may be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monostearate or glyceryl distearate may be employed. They may also be coated by the techniques described in U.S. Patent Nos. 4,356, 108; 4, 166,452; and 4,265,874 to form osmotic therapeutic tablets for controlled release.
Formulations for oral use may also be presented as hard gelatine capsules where the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatine capsules wherein the active ingredient is mixed with water or an oil medium, for example peanut oil, liquid paraffin, or olive oil.
Aqueous suspensions may contain the active compounds in admixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents may be a naturally-occurring phosphatide such as lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example, heptadecaethyl-eneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate. The aqueous suspensions may also contain one or more colouring agents, one or more flavouring agents, and one or more sweetening agents, such as sucrose or saccharin.
Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as a liquid paraffin. The oily suspensions may contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and flavouring agents may be added to provide a palatable oral preparation. These compositions may be preserved by the addition of an anti-oxidant such as ascorbic acid.
Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active compound in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example, sweetening, flavouring, and colouring agents may also be present.
The pharmaceutical compositions of the present invention may also be in the form of oil-in-water emulsions. The oily phase may be a vegetable oil, for example, olive oil or arachis oil, or a mineral oil, for example a liquid paraffin, or a mixture thereof. Suitable emulsifying agents may be naturally-occurring gums, for example gum acacia or gum tragacanth, naturally-occurring phosphatides, for example soy bean, lecithin,
and esters or partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan monooleate, and condensation products of said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate. The emulsions may also contain sweetening and flavouring agents.
Syrups and elixirs may be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, a preservative, a flavouring agent and a colouring agent. The pharmaceutical composition may be in the form of a sterile injectable aqueous or oleaginous suspension. This suspension may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents described above. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils are conveniently employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed using synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables.
Parenteral administration may be performed by subcutaneous, intramuscular, intraperitoneal or intravenous injection by means of a syringe, optionally a pen-like syringe. Alternatively, parenteral administration can be performed by means of an infusion pump. A further option is a composition which may be a solution or suspension for the administration of the prolactin receptor antagonist in the form of a nasal or pulmonal spray. As a still further option, the pharmaceutical compositions containing the compound of the invention can also be adapted to transdermal administration, e.g. by needle-free injection or from a patch, optionally an iontophoretic patch, or transmucosal, e.g. buccal, administration.
Pharmaceutical compositions for parenteral administration include sterile aqueous and non-aqueous injectable solutions, dispersions, suspensions or emulsions as well as sterile powders to be reconstituted in sterile injectable solutions or dispersions prior to use.
A medicament includes but is not limited to a composition, such as an composition (e.g. a pharmaceutical composition or an edible composition), a prescription drug, a non-prescription drug, an over the counter medicine, a dietary supplement, a dietary food, a clinical food, an edible product, a tablet, a capsule, a pill, and food products such as beverages or any other suitable food product, and any other composition which is commonly known to the skilled person. Alternatively, the medicament may be an injectable substance or an inhalable substance, such as a nasal spray.
The polysaccharide may be added to an edible composition or pharmaceutical composition in a specific salt form. The edible composition according to the present invention may take any physical form. In particular, it may be a food product, a beverage, a dietary food product, or a clinical food product. It may also be a dietary supplement, in the form of a beverage, a tablet, a capsule, a liquid (e.g. a soup or a beverage, a spread, a dressing or a dessert) or any other suitable form for a dietary supplement. The edible composition may be in a liquid or a spreadable form, it may be a spoonable solid or soft-solid product, or it may be a food supplement. Preferably the edible composition is a liquid product. The edible composition may suitably take the form of e.g. a soup, a beverage, a spread, a dressing, a dessert, a bread. The term “spread” as used herein encompasses spreadable products such as margarine, light margarine, spreadable cheese based products, processed cheese, dairy spreads, and dairy- alternative spreads. Spreads as used herein (oil-in-water or water-in-oil emulsions) may have a concentration of oil and/or fat of between about 5% and 85% by weight, preferably between 10% and 80% by weight, more preferred between 20% and 70% by weight. Preferably the oil and/or fat are from vegetable origin (such as but not limited to sunflower oil, palm oil, rapeseed oil); oils and/or fats of nonvegetable origin may be included in the composition as well (such as but not limited to dairy fats, fish oil).
The term "aqueous composition" is defined as a composition comprising at least 50% w/w water. Likewise, the term "aqueous solution" is defined as a solution comprising at least 50% w/w water, and the term "aqueous suspension" is defined as a suspension comprising at least 50% w/w water. Such aqueous solutions should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. The aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. The sterile aqueous
media employed are all readily available by standard techniques known to those skilled in the art. Depot injectable formulations are also contemplated as being within the scope of the present invention.
The isolated polysaccharide, or the composition may be administered through several routes of administration, for example, oral, rectal, nasal, pulmonary, topical (including buccal and sublingual), transdermal, intracisternal, intraperitoneal, vaginal and parenteral (including subcutaneous, intramuscular, intrathecal, intravenous and intradermal) route. It will be appreciated that the preferred route will depend on the general condition and age of the subject to be treated, the nature of the condition to be treated and the active ingredient chosen. Preferably the isolated polysaccharide or fragment thereof, or the composition is administered orally.
Abbreviations: kDa - kilo Dalton; Gal - D-Galactose; GalA - D-Galacturonic acid; Rha - L-Rhamnose; Ara - L-Arabinose; Fuc - L-Fucose; Glc - D-Glucose; GlcA - D- Glucuronic acid. The L- and D- forms of these monomers and the corresponding polymers (e.g. polysaccharides) as indicated here also apply to the monomers and polymers (e.g. polysaccharides) as indicated in the rest of this specification (which may not be abbreviated but written in full).
Furthermore, the skilled person will appreciate that each star of Formula (I) and Formula (II) corresponds to an arabinofuranose, preferably an L-arabinofuranose, more preferably an alpha-arabinofuranose, most preferably an alpha-L- arabinofuranose.
The term “average ” may be the arithmetic mean, the mode or the median. Preferably the average refers to the arithmetic mean.
The term “isolated” can refer to a polysaccharide that is no longer in its natural environment. Thus, the term “isolated” can refer to a polysaccharide that has been separated from Malvaceae/Malvoideae/Malveae plant tissue and cells (such as Sida Cordifolia tissue and Sida Cordifolia cells).
A “subject” may be a vertebrate, a mammal, a non-human animal or a domestic animal. Hence, polysaccharide, the adjuvant, the vaccine, the composition and the
medicament according to the invention may be used to treat any mammal, for example livestock (e.g. a horse), pets, or maybe used in other veterinary applications. Livestock may be bovine, cow, cattle, sheep, horse, chicken, goat, pig, calf, deer, goose, turkey or rabbit. A domestic animal may be a dog or a cat. Preferably the subject is a mammal. Most preferably the mammal is a human being. An organism can refer to a subject.
It will be appreciated that the term "treatment" and "treating" as used herein means the management and care of a subject for the purpose of combating a condition, such as a disease or a disorder. The term is intended to include the full spectrum of treatments for a given condition from which the subject is suffering, including alleviating symptoms or complications, delaying the progression of the disease, disorder or condition, alleviating or relieving the symptoms and complications, and/or to cure or eliminating the disease, disorder or condition as well as to prevent the condition, wherein prevention is to be understood as the management and care of a subject for the purpose of combating the disease, condition, or disorder and includes the administration of the ligand to prevent the onset of the symptoms or complications.
The term “comprising” can refer to “consisting of” or “consisting essentially of”.
All of the embodiments and features described herein (including any accompanying claims, abstract and drawings), and/or all of the steps of any method or process so disclosed, may be combined with any of the above aspects or embodiments in any combination, unless stated otherwise with reference to a specific combinations, for example, combinations where at least some of such features and/or steps are mutually exclusive.
For a better understanding of the invention, and to show embodiments of the invention may be put into effect, reference will now be made, by way of example, to the accompanying drawings, in which: -
Figure 1 is a bar graph showing the effect of the PP on the locomotor function of APP/PS 1 mice. APP/PS 1 and wild-type mice were subjected to assessment in an open
field task, which measured path length (A), speed (B) and linearity (C) as measures of locomotor function. Data represent mean ± SEM for 10-12 mice.
Figure 2 is a bar graph showing the effect of the PP on the anxiety levels of APP/PS 1 mice. APP/PS 1 and wild-type mice aged 7 months were subjected to assessment in an open field task, which measured rearing (A), grooming (B), defecation (C) and time spent in the centre of the arena (D) as measures of anxiety. Data represent mean ± SEM for 10-12 mice.
Figure 3 is a bar graph showing that impaired recognition memory in APP/PS 1 mice is restored by PP treatment. Twenty-four hours following exposure to the open field arena, a novel object recognition task (ORT) was conducted using the same arena. Recognition index, a measure of the percentage of time spent exploring either object, is illustrated in the acquisition phase (A) during exposure to two identical objects, and the test phase (B), in the presence of one familiar and one novel object. ***p<0.001, multiple t-test s with Holm-Sidak’s multiple comparisons post-hoc test. Data represent mean ± SEM for 10-12 mice.
Figure 4 shows that spatial learning and memory are improved by PP treatment in APP/PS 1 mice. The acquisition training phase involved four training sessions per day over four consecutive days. Illustrated are escape latency (A), path length (B) and swim speed (C) for APP/PS 1 mice treated with saline or PP during acquisition training. A probe trial was conducted on the fifth day, 24 hours following the final training session as a measure of spatial memory. Time spent in the exact target area is shown (D), as is the proportion of time spent in each quadrant during the probe trial by saline-treated (E) and PP-treated (F) APP/PS 1 mice. *p<0.05, two-way repeated measures ANOVA with Bonferroni’s post-hoc test (A-C), Student’s t test (D), p<0.05 vs. target, ordinary one-way ANOVA with Dunnett’s post-hoc test (E, F). Data represent mean ± SEM for 10-12 mice per group.
Figure 5 shows that reversal learning is improved by PP treatment in APP/PS 1 mice. Reversal water maze training began 24 hours following the Morris water maze probe trial and consisted of four consecutive days with four training sessions per day. Illustrated are escape latency (A), path length (B) and swim speed (C) for APP/PS 1 treated with saline or PP during reversal acquisition training. A probe trial was
conducted on the fifth day, 24 hours following the final training session as a measure of reversal spatial memory. Time spent in the exact target area is shown (D), as is the proportion of time spent in each quadrant during the reversal probe trial by saline- treated (E) and PP-treated (F) APP/PS 1 mice. Two-way repeated measures ANOVA with Bonferroni’s post-hoc test (A-C), Student’s t test (D), +p<0.05, ++p<0.01 vs. target, ordinary one-way ANOVA with Dunnett’s post-hoc test (E, F). Data represent mean ± SEM for 10-12 mice per group.
Figure 6 shows that sensorimotor function in APP/PS 1 mice is unaffected by PP treatment. Subsequent to the reversal water maze probe trial, sensorimotor function was assessed in saline-treated and PP-treated APP/PS 1 mice in 3 visual water maze trials. Illustrated are escape latency (A), path length (B) and swim speed (C). Data represent mean ± SEM for 10-12 mice per group.
Figure 7 shows that PP treatment reduces Aβ deposition in the brains of APP/PS 1 mice. Representative images (lOx magnification) are shown that depict the cerebral cortex (A) and dentate gyrus (D) of APP/PS 1 mice treated with saline and the cerebral cortex (B) and dentate gyrus (E) of PP-treated APP/PS 1 mice. Also shown in the upper right corner of each image, is an exemplary magnified image (20x magnification). Quantification of Aβ immunopositivity in the cortex (C) and dentate gyrus (F) of saline- and PP-treated APP/PS 1 mice is also shown. ***p<0.001, Student’s t-test. Data represent mean ± SEM for 6 per group.
Figure 8 shows that PP treatment reduces levels of astrocytes in the cerebral cortex of APP/PS 1 mice. Representative images (lOx magnification) are shown that depict the cerebral cortex (A) and dentate gyrus (D) of APP/PS 1 mice treated with saline and the cerebral cortex (B) and dentate gyrus (E) of PP-treated APP/PS1 mice. Also illustrated are exemplary magnified images (20x magnification) of GFAP staining in the cortex of saline- (G) and PP- (H) treated APP/PS1 mice, as well as representative 40x images in the upper right corner (G, H). Quantification of GFAP immunopositivity in the cortex (C) and dentate gyrus (F) of saline- and PP-treated APP/PS 1 mice is also shown. *p<0.05, Student’s t-test . Data represent mean ± SEM for 6 per group.
Figure 9 shows that PP treatment reduces levels of microglia in the cerebral cortex of APP/PS 1 mice. Representative images (lOx magnification) are shown that depict the
cerebral cortex (A) and dentate gyrus (D) of APP/PS 1 mice treated with saline and the cerebral cortex (B) and dentate gyrus (E) of PP-treated APP/PS1 mice. Also illustrated are exemplary magnified images (20x) of Ibal staining in the cortex of saline- (G) and PP- (H) treated APP/PS1 mice, as well as representative 40x images in the upper right corner (G, H). Quantification of Ibal immunopositivity in the cortex (C) and dentate gyrus (F) of saline- and PP-treated APP/PS1 mice is also shown. *p<0.05, Student’s t- test. Data represent mean ± SEM for 6 per group.
Figure 10 shows that PP treatment reduces levels of oxidative stress in the cerebral cortex of APP/PS 1 mice. Representative images (lOx magnification) are shown that depict the cerebral cortex (A) and dentate gyrus (D) of APP/PS 1 mice treated with saline and the cerebral cortex (B) and dentate gyrus (E) of PP-treated APP/PS 1 mice. Also illustrated are exemplary magnified images (20x magnification) of Ibal staining in the cortex of saline- (G) and PP- (H) treated APP/PS 1 mice, as well as representative 40x images in the upper right comer (G, H). *p<0.05, Student’s t-test. Data represent mean ± SEM for 6 per group.
Figure 11 shows that PP treatment has no effect on levels of IRS-1 pSer616 in the brains of APP/PS 1 mice. Representative images (lOx magnification) are shown that depict the cerebral cortex (A) and dentate gyrus (D) of APP/PS 1 mice treated with saline and the cerebral cortex (B) and dentate gyrus (E) of PP-treated APP/PS 1 mice. Also illustrated are exemplary magnified images (20x) of Ibal staining in the cortex of saline- (G) and PP- (H) treated APP/PS1 mice, as well as representative 40x images in the upper right corner (G, H). Data represent mean ± SEM for 6 per group.
Figure 12 is a bar graph showing that PP treatment has no effect on spleen weight in APP/PS 1 mice. Average weights of spleens from PP-treated APP/PS 1 mice are illustrated (A). Data represent mean ± SEM for 6 per group.
Figure 13 shows, at the phyla level, the effect of the effect of an isolated polysaccharide according to the invention on the faecal bacterial biodiversity of wildtype and APP/PS 1 mice.
Figure 14 shows the effect of the effect of an isolated polysaccharide according to the invention on the faecal bacterial biodiversity of wild-type and APP/PS 1 mice at the phyla and species level.
Figure 15 shows the plasma IL-27 concentration in APP and wild-type mice treated with saline and the polysaccharide (PP) according to the invention for 7 days.
Figure 16 shows the plasma TNF alpha concentration in APP and wild-type mice treated with saline and the polysaccharide (PP) according to the invention for 7 days.
Figure 17 shows that the polysaccharide potentiates cytokine response after an LPS challenge in APP/PS 1 mice.
Figure 18 is a concentration-effect curve in SIM-A9 microglia treated with the polysaccharide according to the invention or LPS. The measured effect is NO production.
Figure 19 shows the effect of the polysaccharide according to the invention on cytokine production by microglia.
Examples
Materials and Methods
Animals
Male APPswe/PS1Δe9 (APP/PS1) mice with a C57B1/6J background were bred with wild-type C57B1/6J females at the Biomedical and Behavioural Research Unit at Ulster University in Coleraine. Offspring were ear punched and positivity for the APPswe/PS1Δe9 transgene, or lack thereof was confirmed by polymerase chain reaction, using primers specific for the APP sequence of the APP/PS1 construct (Forward "GAATTCCGACATGACTCAGG”, Reverse: "GTTCTGCTGCATCTTGGACA”). At 7 months of age, offspring males heterozygous for the APPswe/PS1Δe9 transgenic construct were then age-matched and divided into two treatment groups. Mice in both groups were caged individually and allowed access to food and water ad libitum. Animals were maintained on a 12: 12 light-dark cycle (lights on at 08h00, lights off at 20h00), within a temperature-controlled room (T: 21.5°C ± 1°C). All tests were
performed during the light cycle. All experiments were licensed according to UK Home Office regulations (UK Animals Scientific Procedures Act 1986) and EU laws.
Treatment
Seven month-old APP/PS 1 mice were treated with saline (0.9% w/v) or a plant polysaccharide (PP) isolated from Sida cordifolia (300 mg/kg bw) once-daily by oral gavage for 3 weeks prior to commencement of a 12 day period of behavioural testing, during which time treatment was maintained. Mice in both groups were treated for a total of 33 days before sacrifice.
Behavioural analysis
Behavioural testing took place during the final 12 days of the study. Mice were subjected to open field, novel object recognition, Morris water maze and reversal water maze behavioural tests to assess locomotor function, anxiety and cognition in 7 month-old APP/PS 1 mice treated with saline and PP.
Immunohistochemistry
At the end of the study, subsequent to behavioural testing, mice were sacrificed and their brains were harvested and processed for immunohistochemical analysis, as described in. In both groups, brain sections were stained with GFAP, Ibal, 8- oxoguanine and IRS-lpSer616 and levels of immunopositivity were quantified.
Statistical Analysis
Data were analysed using Graphpad Prism (V6.0h) software (La Jolla, CA, USA). Statistical comparisons were made between 7 month-old APP/PS 1 mice treated with PP and age-matched saline-treated APP/PS 1 mice. Statistical tests used to generate the results presented in the following chapter include, ordinary one-way analysis of variance (ANOVA), ordinary and repeated measures two-way ANOVA and unpaired Student’s t tests. Corrections for multiple comparisons were performed using Holm- Sidak’s, Bonferroni’s and Dunnett’s post-hoc tests, where appropriate. P values smaller than 0.05 were considered statistically significant and data are expressed as means ± SEM.
Results
Seven month old APP/PS1 mice were administered either saline (0.9% w/v) or a plant polysaccharide (PP) (300 mg/kg bw) by oral gavage, once daily (at 15:00h) for 3
weeks prior to the commencement of a 12-day battery of behavioural tests, during which time, dosing was continued.
Locomotor function in APP/PS1 mice treated with plant polysaccharide
Assessment of spontaneous locomotor activity in the open field task showed that path length (Figure 1A; t=0.03787, df=20, p=0.9702), speed (Figure IB; t=0.02828, df=20, p=0.9777) and linearity (Figure 1C; t=0.3294, df=20, p=0.7453) were not significantly different in APP/PS 1 mice that received PP, compared to those that were treated with saline, indicating a similar level of locomotor function between treatment groups.
Anxiety levels in APP/PS1 mice treated with plant polysaccharide
Similarly, defecation (Figure 2C; t=0.6904, df=20, p=0.4979), rearing (Figure 2A; t=0.1495, df=20, p=0.8826) and grooming (Figure 2B; t=0.4201, df=20, p=6789) behaviour was not significantly different in treated with PP, compared to saline controls. Ordinary two-way ANOVA showed time spent in the centre of the arena was not significantly different in PP-treated APP/PS 1 mice, compared to saline-treated controls (Figure 2E; t=0.7122, df=86, p=0.4783). Together, this suggests that PP treatment had no effect on anxiety levels in APP/PS 1 mice.
Impaired recognition memory in APP/PS1 mice is restored by PP treatment
In the acquisition phase of the novel object recognition task, multiple t tests with Holm-Sidak’s multiple comparisons test showed that the recognition indices for the identical objects were not significantly different in APP/PS 1 mice treated with either saline (t=0.252671, df=22.0, p=0.8029) or PP (Figure 3A; t=0.0558405, df=18.0, p=0.9561), indicating an absence of place preference in both treatment groups. In the test phase, multiple t tests with Holm-Sidak’s post-hoc test demonstrated that saline- treated APP/PS 1 mice spent a similar amount of time exploring the two objects and the recognition index for the novel object was not significantly different from the familiar (Figure 3B; t=0.559631, df=22.0, p=0.5814). In APP/PS1 mice that received PP, the recognition index for the novel object was significantly higher than the familiar (Figure 3B; t=4.20958, df=18.0, p=0.0005), indicated by ordinary multiple t tests with Holm-Sidak’s multiple comparisons test. This suggests that although recognition memory is impaired in saline-treated control mice, treatment of APP/PS 1 mice for 3 weeks with PP effectively restored this deficit.
Spatial learning and memory are improved by plant polysaccharide treatment in APP/PS1 mice
The acquisition phase of the Morris water maze task took place over 4 consecutive days within the final 12 days of the study. Two-way repeated measures ANOVA showed that escape latency significantly decreased over time (F(3,258)= 19.69, p<0.0001) and there was also a significant effect of treatment on escape latency, with an overall decrease detected in APP/PS 1 mice treated with PP (F(1,86)=0.1867, p=0.0122; Figure 4A). Although, Bonferroni’s multiple comparisons test indicated that average escape latency was not significantly different treatment groups, however there was a trend towards a decrease in escape latency on day 3 in PP-treated APP/PS 1 mice, compared to saline-treated controls (Figure 4A; p=0.0630). Two-way ANOVA found that path length decreased significantly over time (F(3,344)=6.644, p=0.0002), but was not affected significantly by treatment (F(i,344)=0.8869, p=0.3470; Figure 4B). Bonferroni’s multiple comparisons post-hoc test confirmed that path length was not significantly different between saline- and PP-treated APP/PS 1 mice on any of the Morris water maze trials days (Figure 4B). Two-way repeated measures ANOVA showed that swim speed was significantly influenced by both time (F(3,344)=5.047, p=0.0020) and treatment (F(1,344)=5.491, p=0.0197), however Bonferroni’s post-hoc test showed that swim speed did not differ significantly between treatment groups on any of the training days (Figure 4C).
In the probe trial, PP-treated mice spent more time in the exact target area than saline controls, although this failed to reach significance (Figure 4D; t= 1.406, df=20, p=0.1751). Ordinary one-way ANOVA revealed that time spent in each of the probe quadrants by saline-treated APP/PS 1 mice was significantly different (Figure 4E; F(3,44)=4.089, p=0.0121) and Dunnett’s post-hoc test demonstrated that time in the target quadrant was significantly higher than the CCW quadrant (Figure 4E; p<0.05). In mice that received PP, time spent in each of the probe quadrants was not significantly different (Figure 4F; F(3,36)=2.256, p=0.0985). These results suggest that PP treatment had minimal effects on spatial learning and memory in APP/PS1 mice in the Morris water maze task.
Reversal learning and memory is slightly improved by plant polysaccharide treatment in APP/PS1 mice
In the acquisition phase of the reversal water maze, two-way repeated measures ANOVA showed that there was a significant effect of time on escape latency (F(3,258)=5.688, p=0.0009). Although significant differences in escape latency between treatment groups were not detected by Bonferroni’s multiple comparisons test on any of the reversal training days, two-way repeated measures ANOVA showed that overall, escape latency in the reversal acquisition phase was significantly lower in PP- treated APP/PS 1 mice (Figure 5A; F(1,86)=4.375, p=0.0394). A significant overall effect of time (F(3,258)=6.189, p=0.0004) and treatment (F(1,86)=6.469, p=0.0128) on path length was detected by two-way ANOVA in the reversal acquisition phase. Bonferroni’s post-hoc test however showed that path length did not differ significantly in PP-treated, compared to saline-treated APP/PS 1 mice (Figure 5B). Two-way repeated measures ANOVA showed that neither time (F(3,258)=0.4865, p=0.6920) nor treatment (F(1,86)=1.689, p=0.1972) had a significant overall effect on swim speed in the reversal acquisition phase (Figure 5C).
In the probe trial of the reversal water maze task, time in the exact target area was not significantly different between treatment groups (Figure 5D; t=0.9123, df=20, p=0.3725). Ordinary one-way ANOVA showed that saline-treated APP/PS 1 mice spent a significantly different amount of time in each of the reversal probe quadrants (F(3,44)=3.359, p=0.0271) and Dunnett’s multiple comparisons test showed that time in the target quadrant was significantly greater than the CW quadrant (Figure 5E; p<0.05). Time spent by PP-treated mice in each of the reversal probe quadrants was also significantly different, as shown by one-way ANOVA (F(3,36)=3.292, p=0.0314), however Dunnett’s post-hoc test revealed that time in the target quadrant was not significantly different from the other quadrants (Figure 5F).
Sensorimotor function in APP/PS1 mice is unaffected by PP treatment
On the final day of behavioural assessment, a marker was attached to the escape platform, which had been relocated to the quadrant opposite quadrant used for the reversal water maze and counterclockwise to the quadrant used in the Morris water maze and three visual trials were performed. Two-way repeated measures ANOVA indicated that visual escape latency (Figure 6A; F(1,20)=0.03816, p=0.8471), path length (Figure 6B; F(1,60)=0.006323, p=0.9369) and swim speed (Figure 6C; F(1,60)=0.01586, p=0.9002) were not significantly affected by treatment and Bonferroni’s multiple comparisons tests detected no differences in escape latency,
path length or speed between saline- and PP-treated groups in any of the 3 trials (Figures 6A-C). This suggests that sensorimotor function in APP/PS 1 mice was unaffected by PP treatment.
Plant polysaccharide treatment reduces Aβ deposition in the brains of APP/PSI mice Figures 7A, B, D and E illustrate a reduction of Aβ deposition in the cerebral cortex and dentate gyrus of PP-treated APP/PS 1 mice, compared to saline controls. Quantitative analysis revealed this reduction of Aβ immunopositivity to be significant in both the cortex (Figure 7C; t=5.625, df=10, p=0.0002; 47% reduction) and dentate gyrus (Figure 7F; t=2.995, df=10, p=0.0135; 65% reduction) of APP/PS1 mice treated with PP.
Plant polysaccharide treatment reduces levels of astrocytes in the cerebral cortex of APP/PS1 mice
A reduction in levels of GFAP-positive astrocytes was seen in the cortex of PP-treated APP/PS 1 mice, as illustrated by representative micrographs (Figures 8A and B). Quantification revealed a significant 25% reduction of cortical GFAP immunopositivity in comparison to saline-treated APP/PS 1 mice (Figure 8C; t=2.649, df=10, p=0.0244). GFAP levels in the dentate gyrus, however were similar between PP- and saline-treated mice (Figures 8D and E) and quantification demonstrated that astrocyte levels in the dentate gyrus of PP-treated APP/PS 1 mice were not significantly different from saline-treated control mice (Figure 8F; t=0.2331, df=10, p=0.8204).
Plant polysaccharide treatment reduces levels of microglia in the cerebral cortex of APP/PS1 mice
Similarly, levels of Ibal -positive microglia were lower in the cerebral cortex of APP/PS 1 mice treated with PP (Figures 9A and B) and, again quantitative analysis demonstrated that this reduction was significant in the cortex (Figure 9C; t=2.604, df=10, p=0.0263; 16% reduction). Microglial levels were also similar in the dentate gyrus of PP-treated APP/PS 1 mice, in comparison to saline controls (Figures 9D and E) and quantification was unable to detect a significant difference in Ibal immunopositivity between PP- and saline-treated APP/PS 1 mice in the dentate gyrus (Figure 9F; t=1.600, df=10, p=0.1408).
Plant polysaccharide treatment reduces levels of oxidative stress in the cerebral cortex of APP/PS1 mice
Representative micrographs show that while a reduction of oxidative stress was seen in the cortex of APP/PS1 mice treated with PP (Figures 10A and B), 8-oxoguanine levels were similar between treatment groups in the dentate gyrus (Figures 10D and E). Quantification demonstrated that 8-oxoguanine levels were indeed significantly reduced by 24% in the cortex of PP-treated APP/PS 1 mice, compared to saline controls (Figure 10C; t=3.081, df=10, p=0.0116), while 8-oxoguanine immunopositivity was not significantly different in the dentate gyrus of PP-treated mice, compared to APP/PS1 mice that received saline (Figure 10F; t=0.3781 df=10, p=0.7133).
Plant polysaccharide treatment has no effect on levels of IRS-1 pSer616 in the brains of APP/PS1 mice
Representative micrographs show that IRS-lpSer616 levels were similar between treatment groups in both the cerebral cortex (Figures 11A and B) and dentate gyrus (Figures 11D and E). Quantification demonstrated that IRS-lpSer616 immunopositivity was not significantly different in the cortex (Figure 10C; t=1.117, df=10, p=0.2902) or dentate gyrus (Figure 10F; t=1.431, df=10, p=0.1830) of PP- treated APP/PS 1 mice, compared to those that received saline.
Plant polysaccharide treatment has no effect on spleen weight in APP/PS1 mice Spleens were dissected from mice at the end of the study and weighed. Splenic weights in PP-treated APP/PS 1 mice did not differ significantly from saline controls (Figure 12; t=0.05859, df=20, p=0.9539), demonstrating that there was no spleen enlargement or inflammation as a result of treatment with PP in APP/PS 1 mice.
Example 5 - The effect of the polysaccharide on faecal bacterial diversity
Perturbations in the microbiota-gut-brain (MGB) axis have been linked to the development neuroinflammation, in the context of neurodegenerative disease, and decreased microbial diversity has been observed. As it is known that certain polysaccharides can increase beneficial gut microbiota, the effect of the isolated polysaccharide on microbial diversity was tested in wild-type and APP/PS 1 mice.
Faecal matter of wild-type and APP/PS 1 mice was assessed to determine bacterial diversity. Twelve-month-old APP/PS 1 and wild-type mice were fed 300 pg of the polysaccharide, which had been isolated from Sida cordifolia, for 7 days. Figure 13 shows the % composition of faecal microbiota in mice at the baseline and after 7 days of treatment with the polysaccharide. Figure 14 is a summary of the data shown in Figure 13 and also a summary of data in which bacterial diversity was analysed at the species level (Alpha diversity was calculated using the Shannon index). Figures 13 and 14 clearly show that the polysaccharide according to the invention increases bacterial faecal diversity at the phylum level and species level in both wild-type and APP/PS 1 mice. Thus, the polysaccharide according to the invention can be used to treat neurodegenerative diseases and/or neuroinflammation by increasing microbial diversity in the gut.
Example 6 - The polysaccharide increases plasma levels of IL-27 in wild-type and APP/PS1 mice and reduces plasma TNFα levels in the same mice
Isolated plant polysaccharide (300mg/kg) or saline vehicle control was orally administered to 8-month-old APP/PS 1 mice for 7 days. Cytokine levels of IL-27 were significantly increased in wild-type (p<0.05) and APP/PS 1-polysaccharide-treated mice (p<0.05) compared to their respective controls. Furthermore, circulating IL-27 concentration in APP/PS 1 polysaccharide-treated mice was significantly increased compared to wild-type saline animals (p<0.05). *p<0.05. TNF-α levels of were significantly reduced in wild-type PP-treated mice compared to saline-treated wild- types, and significantly reduced compared to saline (p<0.05), but not PP-treated APP/PS1 animals. *p<0.05 **p<0.001.
Given that decreased plasma concentrations of IL-27 in combination with increased plasma concentrations of TNFa correlate with increased disease severity in Parkinson’s disease, and that the PP reverses the change in concentration of both cytokines (i.e., increases plasma IL-27 and decreases plasma TNF), the PP may be used to treat Parkinson’s disease.
Example 7 - The polysaccharide potentiates cytokines responses to LPS challenge Neuroinflammation resulting from systemic infections has been shown to play an important role in neurodegenerative disease. LPS hypo-responsiveness has been associated with detrimental effects in brain, by inhibiting microglial protective
properties thereby exacerbating neurodegenerative disease processes. Furthermore, systemic inflammation enhances the risk and progression of Alzheimer’s disease, systemic infections are associated with a significant percentage of clinical relapses in multiple sclerosis, and systemic infections in PD enhance motor symptoms. The inventors therefore decided to investigate whether the polysaccharide according to the invention may has an effect on cytokine responses to intravenously administered LPS.
Isolated plant polysaccharide (PP) (300mg/kg) or saline vehicle control was orally administered to 8-month-old APP/PS 1 mice for 7 days. Cytokine levels of IL-10 (A), IL-27 (B), MCP-1 (C), IL-12p70 (D), IL-6 (E), GM-CSF (F), TNF-α(G) and I1-1β (H) and were measured on day 7, before administration of LPS (Img/kg; Pre-LPS), and 2.5 hours after administration of LPS (2.5h post-LPS). In APP/PS 1 polysaccharide-treated mice, IL-10, MCP-1, IL-12p7, IL-6, GM-CSF TNF-α and I1-1β responses were significantly enhanced compared to saline-treated APP/PS 1 mice (P<0.05-P<0.01). In wild-type controls, PP administration potentiated MCP-1, IL-6 and TNF-α compared to saline-treated WT littermates (p<0.05-p<0.01). Increases in IL-10, IL-27, IL-12P70, GM-CSF and I1-1β were unique to APP/PS 1 levels after administration of PP were unique to the APP/PS 1 model. *p<0.05, **p<0.01 and ***p<0.00I.
In summary, this data shows that treatment with polysaccharide leads to much greater LPS responsiveness in the APP/PS 1, and this represents a protective mechanism for the brain. Thus, the polysaccharide according to the invention can be used to potentiate neuroinflammatory responses and/or treat neurodegenerative disorders.
Example 8 - The effect of the polysaccharide on cytokine production by microglia The polysaccharide also causes microglia to produce NO in a concentration-dependent manner (see Figure 18). Microglia produce IL-6 and IL- 12 in a concentration-dependent manner in response to contact with the polysaccharide according to the invention but do not produce any detectable levels of TNFa (see Figure 19).