EP4065688A1 - Means and methods to modulate acetic acid tolerance in industrial fermentations - Google Patents
Means and methods to modulate acetic acid tolerance in industrial fermentationsInfo
- Publication number
- EP4065688A1 EP4065688A1 EP20808480.6A EP20808480A EP4065688A1 EP 4065688 A1 EP4065688 A1 EP 4065688A1 EP 20808480 A EP20808480 A EP 20808480A EP 4065688 A1 EP4065688 A1 EP 4065688A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- acetic acid
- snf4
- yeast
- allele
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/16—Yeasts; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
- C12P7/06—Ethanol, i.e. non-beverage
- C12P7/08—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate
- C12P7/10—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate substrate containing cellulosic material
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Definitions
- the present invention relates to the field of fermentation, more particularly to ethanol production. Even more particularly the present invention relates to mutant alleles and chimeric genes useful to engineer the acetic acid tolerance in yeast. These yeast strains are particularly useful in the production of bioethanol based on both first- and second-generation substrates.
- Acetic acid is commonly used in the food industry as an antimicrobial preservative (Piper 2011 Adv Appl Microbiol 77). At low pH, the protonated form can easily diffuse through membranes and drastically lower the internal pH of cells and organelles, causing wide-spread inhibition of many cellular functions (Ullah et al 2012 Appl Environ Microbiol 78; Fernandez-Nino et al 2015 Appl Environ Microbiol 81). However, acetic acid is also a side-product in the microbial production of ethanol. Because of its antimicrobial activity, acetic acid accumulation may lead to fermentation arrests and reduced ethanol volumetric production.
- Acetic acid is a very efficient inhibitor of the microbial fermentation of so-called second-generation substrates, i.e. hydrolysates of lignocellulosic biomass derived from waste streams or bioenergy crops (Deparis et al 2017 FEMS Yeast Res 17; Jonsson et al 2013 Biotechnol Biofuels 6).
- (Ligno)cellulose fibrils contain large numbers of acetyl groups, which are released during pretreatment and enzymatic hydrolysis and accumulate to high levels in the medium. Together with the ethanol produced, the acetic acid inhibits the fermentation process, and especially the artificially engineered capacity of yeasts optimized for xylose fermentation (Bellissimi et al 2009 FEMS Yeast Res 9).
- acetic acid produced by contaminating acetic acid bacteria can accumulate to high levels, especially by water recycling practices, and cause significant inhibition of yeast fermentation (Graves et al 2006 J Ind Microbiol Biotechnol 33). Acetic acid tolerance is therefore a trait of major importance in the field of industrial yeast fermentation.
- WHT whole genome transformation
- Snf4 Sucrose non-fermenting 4
- Snf4 is an activating subunit of the Snfl protein kinase essential for sucrose utilization. Therefore, it was even more surprisingly found that mutating Snf4 has only a slight negative effect on growth in industrial strain backgrounds.
- Snf4 mutation or deletion even further enhances acetic acid tolerance of industrial yeasts already engineered for increased acetic acid tolerance by the HAA1 allele.
- Current application therefore provides a novel tool to solve the problem of acetic acid accumulation in industrial microbiological processes.
- the application provides a mutant SNF4 yeast allele comprising a nonsense mutation on nucleic acid position 805.
- Other SNF4 mutations leading to a loss of Snf4 function can also increase acetic acid tolerance in yeast. Therefore, a chimeric gene construct is provided comprising a promoter which is active in a eukaryotic cell operably linked to a CRISPR guide RNA targeting the SNF4 allele.
- a yeast strain comprising a homozygous or hemizygous mutantSA/F4 allele, said allele being the above SNF4 allele or comprising the above chimeric gene construct. Since the art is completely silent about Snf4 and acetic acid tolerance in yeast, the invention extends to industrial yeast strains in which the SNF4 allele has been disrupted or deleted.
- said yeast is a xylose fermenting yeast strain or is industrially optimized to ferment second-generation substrates.
- an acetic acid tolerant yeast strain is provided devoid of a functional SNF4 allele.
- said yeast strains comprises the above described chimeric gene construct.
- the recessive SNF4 mutation can further enhance the acetic acid tolerance in yeasts which are already engineered to tolerate acetic acid. Therefore, the application also provides the herein disclosed yeast strains further comprising an allele of one or more of the GLOl, DOTS, CUP2 and HAA1 genes that confers increased tolerance to acetic acid as described in WO2015/181169 and WO2016/083397.
- any of the mutant SNF4 alleles herein disclosed or of any of the chimeric gene construct herein disclosed is provided to increase acetic acid tolerance in a culture of yeast cells.
- any of the yeast strains herein disclosed is provided to increase the production of ethanol.
- a method of producing ethanol comprising the step of fermenting a medium with any of the yeast strains of current application.
- FIG. 1 Fermentation performance of the parent strain ER18, whole-genome transformant MS164 and the gDNA donor strain Kll in the presence of acetic acid. Fermentations were performed with constant stirring at 120 rpm, at 35°C and pH 4.7 in YPD medium with 40g/l glucose and supplemented with 8g/l (left) or lOg/l (right) acetic acid.
- FIG. 1 Fermentation performance of the original ER18 parent strain, ER18 derivatives engineered for SNP1 (A) or SNP5 (B), MS164 transformant and MS164 derivatives reverse engineered for SNP1 (A) or SNP5 (B) in the presence of acetic acid.
- the control strains are indicated with dashed lines, ER18 (blue) and MS164 (red). All SNP-engineered strains are indicated with full lines. Fermentations were performed at 35°C, constant stirring at 120 rpm, pH 4.7 in 50 ml YPD medium with 40g/l glucose and supplemented with lOg/l acetic acid.
- the downgraded derivatives of MS164 are shown with open symbols (red, ⁇ , D, V, 0), while the upgraded derivatives of ER18 are shown with closed symbols (blue, ⁇ , A, ⁇ , ⁇ ).
- FIG. 3 Fermentation performance of the original ER18 parent strain, ER18 derivatives engineered for SNP1 (A) or SNP5 (B), MS164 transformant and MS164 derivatives reverse engineered for SNP1 (A) orSNP5 (B) in the absence of acetic acid.
- the control strains are indicated with dashed lines, ER18 (blue) and MS164 (red). All SNP-engineered strains are indicated with full lines. Fermentations were performed at 35°C, constant stirring at 120 rpm, in 50 ml YPD medium with 40 g/l glucose (and no acetic acid addition).
- the downgraded derivatives of MS164 are shown with open symbols (red, ⁇ , D, V, 0), while the upgraded derivatives of ER18 are shown with closed symbols (blue, ⁇ , A, ⁇ , ⁇ ).
- FIG. 4 Fermentation performance of the strains ER18 and ER18 derivatives (A) or PE2 and PE2 derivatives (B) with engineered SNP1 (sn/4 E269* ) or sn/421 in all SNF4 alleles present, in the presence of acetic acid.
- the strains are indicated with different colours, ER18 and PE2 (green, ⁇ ), ER18 and PE2 derivatives with engineered SNP1 (sn/4 E269* ) in all SNF4 alleles present (blue, ⁇ , A, ⁇ , ⁇ ) and ER18 eh 4D and PE2 snf4AA strains (blue, ⁇ , D, V, 0).
- Fermentations were performed at 35°C, constant stirring at 120 rpm, pH 4.7 in 50 ml YPD medium with 40 g/l glucose and supplemented with 10 g/l (ER18) or 11 g/l (PE2) acetic acid.
- FIG. 5 Glucose consumption, ethanol production and acetic acid consumption during semi- anaerobic fermentation or aerobic growth of the strains ER18 and ER18 derivatives with engineered SNP1 (sn/4 E269* ) in SNF4 or snf4l 1 in the presence of acetic acid.
- the strains are indicated with different colours, ER18 (green, ⁇ ), ER18 derivatives with engineered SNP1 (sn/4 E269* ) in SNF4 (blue, ⁇ , A, ⁇ , ⁇ ) and ER18 snf4A (blue, ⁇ , D, V, 0).
- Semi-anaerobic fermentations were performed at 35°C, constant stirring at 120 rpm, pH 4.7 in 50 ml YPD medium with 40 g/l glucose and supplemented with 10 g/l acetic acid.
- Growth assays under aerobic conditions were performed at 30°C, constant shaking at 200 rpm, pH 4.7 in 50 ml YPD medium with 40 g/l glucose and supplemented with 10 g/l acetic acid.
- Figure 6 Growth assays in microtiter plate format using different carbon sources of the strains ER18, PE2, MS488, and ER18, PE2 or MS488 derivatives with engineered SNP1 (sn/4 E269* ) or snf4A in all SNF4 alleles present in the absence of acetic acid.
- strains are indicated with different colours, ER18, PE2 and MS488 (green, ⁇ ), ER18, PE2 and MS488 derivatives with engineered SNP1 (sn/4 E269* ) in SNF4 (blue, ⁇ , A, ⁇ , ⁇ ) and ER18 snf4A, PE2 snf4AA and MS488 snf4AA strains (blue, ⁇ , D, V, 0).
- Growth assays were performed in microtiter plates in a Multiskan apparatus at 30°C, with intermittent shaking, in 200 pL YP medium with 40g/l glucose, sucrose or maltose (and absence of acetic acid).
- FIG. 7 Growth of the strains MS488, MS488 with engineered SNP1 (sn/4 E269* ) or snf4A in all SNF4 alleles present, in four different concentrations of sugar cane molasses.
- the strains are indicated with different colours, MS488 (green, ⁇ ) and MS488 derivatives with engineered SNP1 (sn/4 E269* ) in all SNF4 alleles present (blue, ⁇ , A, ⁇ , ⁇ ) and MS488 snf4AA (blue, ⁇ , D).
- Growth assays were performed under aerobic conditions in shake flasks at 200 rpm, 30°C, in 25 ml in media with different concentrations of molasses (and absence of acetic acid).
- the strains are indicated with different colours, JT28541 (black, ⁇ ), MS488 (JT28541 HAA1 S506N ) (green, ⁇ ) and MS488 (JT28541 HAA1 S506N ) derivatives with engineered SNP1 (sn/4 E269* ) (blue, ⁇ , A, ⁇ , ⁇ ) and MS488 (JT28541 HAA1 S506N ) snf4AA (blue, ⁇ , D). Fermentations were performed at 35°C, constant stirring at 120 rpm, pH 4.7 in 50 ml YPD medium with 40 g/l glucose and supplemented with lOg/l acetic acid.
- yeasts are eukaryotic, single-celled microorganisms classified as members of the fungus kingdom and like all fungi, yeast may have asexual and sexual reproductive cycles.
- the most common mode of vegetative growth in yeast is asexual reproduction by budding.
- a small bud or daughter cell is formed on the parent cell.
- the nucleus of the parent cell splits into a daughter nucleus and migrates into the daughter cell.
- the bud continues to grow until it separates from the parent cell, forming a new cell.
- This reproduction cycle is independent of the yeast's ploidy, thus both haploid and diploid yeast cells can duplicate as described above.
- Haploid cells have in general a lower fitness and they often die under high-stress conditions such as nutrient starvation, while under the same conditions, diploid cells can undergo sporulation, entering sexual reproduction (meiosis) and producing a variety of haploid spores or haploid segregants, which can go on to mate (conjugate), reforming the diploid.
- the budding yeast Saccharomyces cerevisiae reproduces by mitosis as diploid cells when nutrients are abundant, but when starved, this yeast undergoes meiosis to form haploid spores. Haploid cells may then reproduce asexually by mitosis.
- Yeast as used in current application, can be any yeast useful for industrial applications.
- said yeast is useful for ethanol production, including, but not limited to Saccharomyces, Zygosaccharomyces, Brettanomyces and Kluyveromyces.
- said yeast is a Saccharomyces sp., even more preferably it is a Saccharomyces cerevisiae sp.
- the Applicants report on a whole genome transformation experiment set up to identify acetic acid tolerance alleles in the sake yeast strain Kll.
- the most tolerant transformants showed an improved tolerance to lOg/l acetic acid compared to 6g/l of the sensitive host strain before transformation.
- Whole genome sequencing of the most promising transformants revealed 7 SNPs among which the recessive SNF4 G805T mutation.
- the SNF4 mutation causative to the increased acetic acid tolerance of the transformants was induced by the transformation event itself and was not present in the donor strain Kll.
- SNF4 or Sucrose Non-Fermenting 4 (also known as YGL115W, SGD:S000003083, CAT3 or SCI 1) is the activating gamma subunit of the AMP-activated Snfl protein kinase complex, that plays a central role in the response to glucose starvation in the yeast Saccharomyces cerevisiae (Jiang and Carlson 1997 Mol Cell Biol 17).
- the SNF4 gene is required for expression of glucose-repressible genes in response to glucose deprivation in S. cerevisiae.
- the mutant SNF4 allele as herein disclosed is provided in SEQ ID No. 1.
- the G805T mutation is underlined, indicate in bold and highlighted in bigger font.
- the truncated Snf4 protein encoded by SEQ ID No. 1 is shown in SEQ ID No. 2.
- the corresponding wild-type sequences are shown in SEQ ID No. 3 and 4.
- the application provides a mutant SNF4 yeast allele comprising a mutation on nucleic acid position 805.
- said mutant SNF4 allele is an isolated mutant SNF4 yeast allele.
- said mutation is a nonsense or missense mutation, more particularly on nucleic acid position 805.
- said mutant allele is a snf4E269* allele or encodes a Snf4 protein comprising a E269* mutation.
- said mutant allele comprises a G805T mutation.
- said mutant allele is the allele as depicted in SEQ ID No. 1.
- mutant SNF4 yeast alleles will be referred to as "one of the mutant SNF4 alleles of the application".
- the allele depicted in SEQ ID No. 1 encodes the truncated Snf4 yeast protein of which the amino acid sequence is depicted in SEQ ID No 2.
- a "nonsense mutation” as used herein refers to a point mutation in a sequence of DNA that results in a premature stop codon (herein illustrated as or a nonsense codon in the transcribed mRNA, and hence in a truncated (more particularly a C-terminal truncated), incomplete, and nonfunctional protein product.
- a "missense mutation” means a point mutation where a single nucleotide is changed to cause substitution of a different amino acid.
- a “mutation on nucleic acid position 805" is equivalent as saying that the nucleobase on position 805 is mutated. With “mutation on nucleic acid position 805" as used herein, it is thus meant that nucleobase 805 from the wild-type SNF4 gene as depicted in SEQ ID No. 3 is mutated.
- “Position 805" or “nucleobase 805" as used herein refers to the nucleobase that is 804 positions removed downstream from the first nucleobase (i.e. adenosine) from the start codon. This nucleobase 805 is a guanine (G), see SEQ ID No. 3.
- said G is replaced by a thymine (T).
- T thymine
- said mutation can also be referred to as a G805T mutation.
- said mutation changes a glutamic acid (E) codon into a premature stop codon (*)
- said SNF4 allele can also be referred to as a snf4E269* allele or an allele that encodes a E269* mutation.
- mutant SNF4 alleles of the application as well as the mutant Snf4 proteins which they encode may have additional mutations (besides G805T or E269*) and are also envisaged in this application as long as the additional Snf4 mutations do not restore Snf4 function.
- the mutant SNF4 allele or mutant Snf4 yeast protein which are provided herein comprise at least a G805T or at least an E269* mutation.
- Nucleobases are nitrogen-containing biological compounds that form nucleosides, which in turn are components of nucleotides; all which are monomers that are the basic building blocks of nucleic acids. Often simply called bases, as in the field of genetics, the ability of nucleobases to form base-pairs and to stack one upon another leads directly to long-chain helical structures such as ribonucleic acid (RNA) and deoxyribonucleic acid (DNA). There are four so-called DNA-bases: adenine (A), cytosine (C), guanine (G) and thymine (T).
- A adenine
- C cytosine
- G guanine
- T thymine
- nucleic acid includes reference to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, encompasses known analogues having the essential nature of natural nucleotides in that they hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides (e.g. peptide nucleic acids).
- encoding or “encodes” or “encoded”, with respect to a specified nucleic acid, is meant comprising the information for transcription into an RNA molecule and in some embodiments, translation into the specified protein or amino acid sequence.
- a nucleic acid encoding a protein may comprise non-translated sequences (e.g., introns) within translated regions of the nucleic acid, or may lack such intervening non- translated sequences (e.g., as in cDNA).
- the information by which a protein is encoded is specified by the use of codons.
- the amino acid sequence is encoded by the nucleic acid using the "universal" genetic code.
- the disclosed SNF4 mutant alleles have a loss-of-function effect and are recessive, meaning that the mutation has to be homozygous (for a diploid organism) or hemizygous to lead to the mutant phenotype, i.e. increased acetic acid tolerance.
- "Homozygous” refers to having identical alleles for a single trait.
- An "allele” represents one particular form of a gene. Alleles can exist in different forms and diploid organisms typically have two alleles for a given trait. A homozygous mutant SNF4 allele thus means that all SNF4 alleles are identical.
- Hemizygous refers to having only one allele for a single trait or gene.
- a yeast strain comprising a homozygous or hemizygous mutant SNF4 allele, said allele being on of the SNF4 alleles of the application as described above.
- a haploid yeast segregant comprising a disrupted, partially deleted or completely deleted SNF4 allele is provided.
- said haploid segregant comprises a mutant SNF4 yeast allele according to the application.
- Haploid cells contain one set of chromosomes, while diploid cells contain two.
- a haploid segregant as used herein is equivalent as a haploid spore, the result of sporulation.
- an industrial yeast strain comprising a homozygous or hemizygous mutant SNF4 allele compromising, partially abolishing or completely abolishing Snf4 function.
- An allele that compromises, partially abolishes or completely abolishes Snf4 function is equivalent to a disrupted, partially deleted or completely deleted SNF4 allele.
- a yeast strain or more particularly an industrial yeast strain is provided comprising a homozygous or hemizygous mutant SNF4 allele, wherein said mutant allele comprises a nonsense or missense mutation on nucleic acid position 805.
- said mutant SNF4 allele is a snf4E269* allele or encodes a Snf4 protein comprising a E269* mutation.
- said mutant SNF4 allele comprises a G805T mutation.
- said mutant SNF4 allele is the allele as depicted in SEQ ID No. 1.
- Disrupted, partially deleted or completely deleted function or “disrupting, partially deleting or completely deleting the functional expression” is equivalent as saying partially or completely inhibiting the formation of a functional mRNA molecule encoding Snf4.
- Means and methods to disrupt, partially delete or completely delete a gene or protein are well known in the art. In order to disrupt the SNF4 allele, any site may be disrupted, for example, a promoter site of SNF4, an open reading frame (ORF) site, and a terminator site, or combination thereof may be disrupted.
- ORF open reading frame
- the skilled person can select from a plethora of techniques to affect the expression or function of Snf4. The particular method used to reduce or abolish the expression of SNF4 is not critical to the invention.
- disruption can be accomplished by homologous recombination (as was demonstrated in the Experimental part of current application), whereby the gene to be disrupted is interrupted (e.g., by the insertion of a selectable marker gene) or made inoperative (e.g., "gene knockout”).
- a "knock-out” can be a gene knockdown (leading to reduced gene expression) or the gene can be knocked out by a mutation such as, a point mutation, an insertion, a deletion, a frameshift, or a missense mutation by techniques known in the art.
- the lack of transcription can e.g. be caused by epigenetic changes (e.g. DNA methylation) or by loss-of-function mutations.
- a "loss-of-function” or "LOF” mutation as used herein is a mutation that prevents, reduces or abolishes the function of a gene product as opposed to a gain-of-function mutation that confers enhanced or new activity on a protein. Disruption, partial deletion or complete deletion at the DNA level can also be achieved by inducing mutations in the promoter of a gene encoding Snf4. Also gain-of-function mutations can inhibit the formation of a functional mRNA molecule for example through gene silencing, whereas dominant negative mutations can disrupt the functional expression of a gene.
- Both dominant negative or LOF mutations can be caused by a wide range of mutation types, including, but not limited to, a deletion of the entire gene or part of the gene, splice site mutations, frame-shift mutations caused by small insertions and deletions, nonsense mutations, missense mutations replacing an essential amino acid and mutations preventing correct cellular localization of the product.
- nucleases such as zinc-finger nucleases (ZFNs), Transcription Activator-Like Effector Nucleases (TALENs), meganucleases but especially the CRISPR-Cas system.
- ZFNs zinc-finger nucleases
- TALENs Transcription Activator-Like Effector Nucleases
- meganucleases but especially the CRISPR-Cas system.
- Nucleases as used herein are enzymes that cut nucleotide sequences. These nucleotide sequences can be DNA or RNA. If the nuclease cleaves DNA, the nuclease is also called a DNase. If the nuclease cuts RNA, the nuclease is also called an RNase.
- ZFN are artificial restriction enzymes generated by fusing a zinc finger DNA-binding domain to a DNA cleavage domain.
- Zinc finger domains can be engineered to target desired DNA sequences, which enables zinc-finger nucleases to target a unique sequence within a complex genome.
- a TALEN is composed of a TALE DNA binding domain for sequence- specific recognition fused to the catalytic domain of an endonuclease that introduces double strand breaks (DSB).
- the DNA binding domain of a TALEN is capable of targeting with high precision a large recognition site (for instance 17bp).
- Meganucleases are sequence-specific endonucleases, naturally occurring "DNA scissors", originating from a variety of single-celled organisms such as bacteria, yeast, algae and some plant organelles. Meganucleases have long recognition sites of between 12 and 30 base pairs. The recognition site of natural meganucleases can be modified in order to target native genomic DNA sequences (such as endogenous genes).
- CRISPR interference is a genetic technique which allows for sequence-specific control of gene expression in prokaryotic and eukaryotic cells. It is based on the bacterial immune system-derived CRISPR (clustered regularly interspaced palindromic repeats) pathway and has been modified to edit basically any genome.
- the cell's genome can be cut at a desired location depending on the sequence of the gRNA, allowing existing genes to be removed and/or new one added and/or more subtly removing, replacing or inserting single nucleotides (e.g. DiCarlo et al 2013 Nucl Acids Res 41:4336-4343; Sander & Joung 2014 Nat Biotech 32:347-355). Therefore, also a yeast strain is provided in which the SNF4 allele has been disrupted or deleted by using nuclease technology, more particularly by means of the CRISPR- Cas technology.
- gRNA synthetic guide RNA
- a synthetic guide RNA targeting the SNF4 allele should be expressed in the industrial yeast strains of the application. Therefore, the application provides also a chimeric gene construct comprising a promoter which is active in a eukaryotic cell, more particularly in a yeast cell, operably linked to a CRISPR guide RNA targeting the SNF4 allele.
- “Targeting” as used herein is equivalent to "annealing” or “binding” to the SNF4 allele.
- the CRISPR gRNA is complementary to a part of the SNF4 allele.
- said promoter of said chimeric gene construct is also operably linked to a nucleic acid molecule encoding a Cas endonuclease, more particularly a Cas9 endonuclease.
- the chimeric gene comprising the SNF4 targeting gRNA is expressed together with the chimeric gene comprising the Cas encoding nucleic acid molecule.
- Said chimeric gene construct(s) is/are expressed in yeast according to standard methods known to the skilled person.
- the chimeric gene constructs from current application additionally comprise a 3' end region involved in transcription termination and/or polyadenylation.
- CRISPR gRNA molecules are designed.
- the most commonly used gRNA is about 100 base pairs in length.
- the CRISPR-Cas9 system can be targeted towards any genomic region complementary to that sequence, e.g. towards the yeast SNF4 allele.
- the accompanying Cas endonuclease induces DSB which upon incorrect repair leads to a mutant SNF4.
- a specific mutation in theSNF4 allele can be introduced via the CRISPR-Cas system as explained in the Experimental details herein.
- a “chimericgene” or “chimeric construct” as used herein is a recombinant nucleic acid sequence in which a promoter or regulatory nucleic acid sequence is operably linked to, or associated with, a nucleic acid sequence that codes for a mRNA and encodes an amino acid sequence, such that the regulatory nucleic acid sequence is able to regulate transcription or expression of the associated nucleic acid coding sequence.
- the regulatory nucleic acid sequence of the chimeric gene is not operably linked to the associated nucleic acid sequence as found in nature.
- a “promoter” comprises regulatory elements, which mediate the expression of a nucleic acid molecule.
- the nucleic acid molecule must be linked operably to or comprise a suitable promoter which expresses the gene at the right point in time and with the required spatial expression pattern.
- operably linked refers to a functional linkage between the promoter sequence and the gene of interest, such that the promoter sequence is able to initiate transcription of the gene of interest.
- a promoter that enables the initiation of gene transcription in a eukaryotic cell is referred to as being "active".
- the promoter can be operably linked to a reporter gene after which the expression level and pattern of the reporter gene can be assayed.
- Suitable well-known reporter genes include for example beta- glucuronidase, beta-galactosidase or any fluorescent or luminescent protein.
- the promoter activity is assayed by measuring the enzymatic activity of the beta-glucuronidase or beta-galactosidase.
- promoter strength may also be assayed by quantifying mRNA levels or by comparing mRNA levels of the nucleic acid, with mRNA levels of housekeeping genes such as 18S rRNA, using methods known in the art, such as Northern blotting with densitometric analysis of autoradiograms, quantitative real-time PCR or RT-PCR (Heid et al., 1996 Genome Methods 6: 986-994).
- a 3' end region involved in transcription termination or polyadenylation encompasses a control sequence which is a DNA sequence at the end of a transcriptional unit which signals 3' processing or polyadenylation of a primary transcript and is involved in termination of transcription.
- the control sequence for transcription termination or terminator can be derived from a natural gene or from a variety of genes.
- the terminator to be added may be derived from, for example, the TEF or CYC1 genes or alternatively from another yeast gene or less preferably from any other eukaryotic or viral gene.
- the promoter in the chimeric gene of the invention is active in yeast.
- said promoter is selected from the list comprising pTEFl (Translation Elongation Factor 1); pTEF2; pFIXTl (Flexose Transporter 1); pHXT2; pHXT3; pHXT4; pTDH3 (Triose-phosphate Dehydrogenase) also known in the art as pGADPH (Glyceraldehyde-3-phosphate dehydrogenase) or pGDP or pGLDl or pHSP35 or pHSP36 or pSSS2; pTDH2 also known in the art as pGLD2; pTDHl also known in the art as pGLD3; pADHl (Alcohol Dehydrogenase) also know in the art as pADCl; pADH2 also known in the art as pADR2; pADH3; pADH4 also known in the art as pZRG5 or pNRC465;
- promoters are widely used in the art.
- the skilled person will have no difficulty identifying them in databases.
- the skilled person will consult the Saccharomyces genome database website (http://www.yeastgenome.org/) or the Promoter Database of Saccharomyces cerevisiae (http://rulai.cshl.edu/SCPD/) for retrieving the yeast promoters' sequences.
- a vector comprising one of the chimeric genes of the application.
- a yeast or an industrial yeast strain is provided comprising said vector or one of the chimeric gene constructs described herein.
- the term "vector” refers to any linear or circular DNA construct comprising one of the above described chimeric gene constructs.
- the vector can refer to an expression cassette or any recombinant expression system for the purpose of expressing one of the chimeric gene constructs of the application in vitro or in vivo, constitutively or inducibly, in any cell, including, in addition to plant cells, prokaryotic, yeast, fungal, insect or mammalian cells.
- the vector can remain episomal or integrate into the host cell genome.
- the vector can have the ability to self-replicate or not (i.e., drive only transient expression in a cell).
- the term includes recombinant expression cassettes that contain only the minimum elements needed for transcription of the recombinant nucleic acid.
- the vector of the application is a "recombinant vector" which is by definition a man-made vector.
- yeasts or industrial yeast strains envisaged in current application are yeasts useful for ethanol production, including, but not limited to Saccharomyces, Zygosaccharomyces, Brettanomyces and Kluyveromyces.
- said yeast is a Saccharomyces sp., even more preferably it is a Saccharomyces cerevisiae sp.
- said yeast or said industrial yeast is not S288C, CEN.PK, MCY1830, MCY1853 or MCY2634.
- Industrial yeast strains are often diploid, polyploid or aneuploid and have proven capabilities for application in large scale industrial fermentation. Suitable industrial yeast strains include but are not limited to e.g. the commercial strains Gert Strand Turbo yeasts, Alltech SuperStart TM, Fermiol Super HATM, ThermosaccTM and Ethanol RedTM. Also suitable are yeast cells derived from any of these strain by modifications as described herein.
- the yeast or industrial yeast herein disclosed is a xylose fermenting yeast.
- the yeasts or industrial yeasts herein disclosed are acetic acid tolerant yeasts. Therefore, also yeast or industrial yeast strains are provided that are metabolically active, actively dividing, actively fermenting first- and/or second generation substrates, and/or producing ethanol at a concentration of at least 8 g/l, 9 g/l or 10 g/l acetic acid or between 7 g/l and 10.5 g/l or between 8.5 g/l and 11 g/l acetic acid.
- yeasts are provided that are actively fermenting in the presence of at least 8, 9 or 10 g/l acetic acid and pH between 4.3 and 4.8, or 4.4 and 4.9 or between 4.5 and 4.7 or a pH of 4.6 or 4.7. Even more particularly, yeasts are provided that actively ferment in the presence of 8 g/l and pH 4.7 or in the presence of 10 g/l acetic acid and pH 4.7 Said yeasts are actively fermenting at a rate of at least 90%, at least 92% or at least 95% of the rate of fermentation in the absence of acetic acid. "Actively fermenting" as used herein refers to a situation wherein the yeast are metabolically active, more particularly producing metabolites such as carbon dioxide and ethanol.
- said yeast strains are devoid of or deficient in a functional Snf4 protein or functional Snf4 protein production.
- said yeast strains comprise any of the chimeric gene constructs disclosed herein or a homozygous or hemizygous SNF4 mutation, the SNF4 mutation leading to a loss-of-Snf4 function.
- the yeast strains as disclosed herein are industrial yeast strains engineered for increased acetic acid tolerance.
- said yeasts can comprise additional genetic modifications that independent of Snf4 result in increased tolerance to acetic acid. More particularly said modifications are for example those as described in WO2015/181169 and WO2016/083397, even more particularly modifications that introduces an allele of one or more of the GLOl, DOT5, CUP2 and HAA1 genes that confers increased tolerance to acetic acid.
- any of the mutant SNF4 alleles or proteins herein described or of any of the chimeric gene constructs herein described is provided to increase acetic acid tolerance in a culture of yeast cells. Said use is also provided to increase the production of ethanol in a culture of yeast cells.
- any of the yeast strains or industrial yeast strains herein described is provided to increase the production of ethanol.
- Increasing or “increase” as used herein means an at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90, at least 95% or 100% increase or a 2-fold, 3-fold, 5-fold or 10-fold increase in the tolerance of acetic acid or in the production of ethanol compared to the same situation where the mutant SNF4 allele or protein or the chimeric gene constructs of the application are not present, or alternatively phrased compared to a situation wherein the yeasts have at least one functional SNF4 allele.
- the envisaged increase in acetic acid tolerance or production of ethanol can also be between 10% and 50%, between 20% and 60%, between 30% and 70%, between 40% and 80% or between 60% and 150% more compared to a situation wherein the yeasts comprise at least one functional Snf4 protein.
- a method of producing ethanol comprising the step of fermenting a medium with one of the yeast strains herein disclosed.
- said medium comprises first- generation and/or second-generation carbon substrates.
- First generation substrates refer to carbon sources like starch, sugar, animal fats and vegetable oil.
- Second generation substrates refer to lignocellulosic biomass for example the residual non-food parts of current crops, such as stems, leaves and husks that are left behind once the food crop has been extracted, as well as other crops that are not used for food purposes, such as switch grass, cereals that bear little grain and more fibre, and also industry waste such as wood chips, skins and pulp from fruit pressing etc. Fermentation of the first- and second-generation substrates by the yeasts of current application leads respectively to first- and second generation bioethanol. Therefore, in yet another aspect a fermented solution, more particularly bio ethanol, is provided comprising any of the yeast described in current application.
- Example 2 Whole-genome sequence analysis of SNPs in transformant MS164 Transformant MS164 was submitted to whole-genome sequence analysis to identify the genetic changes introduced by transformation of the host strain ER18. Unexpectedly, MS164 and ER18 only differed in 12 single nucleotide polymorphisms (SNPs), of which five were synonymous while the other seven were non-synonymous mutations (Table 1). Surprisingly, none of the seven non-synonymous SNPs was present in the genome of donor strain Kll. Also none of these SNPs was present in 1011 whole-genome sequenced S. cerevisiae strains (Peter et al 2018 Nature 556), except for SNP3, which was present in 7 strains (Table 1).
- SNPs single nucleotide polymorphisms
- Table 1 The seven non-synonymous and intergenic SNPs introduced during whole genome transformation in the ER18 host strain. Chr, chromosome; ER18, ER18 parent; MS164, MS164 transformant; Kll, Kll gDNA donor
- SNP1 is located in theSA/F40RF at position 805 for which the host strain ER18, as well as the gDNA donor strain Kll contain guanine (G) while the transformant MS164 has thymine (T).
- G guanine
- T thymine
- the modification from G to T leads to a change from glutamic acid at position 269 of the encoded protein into a stop codon resulting in a truncated SNF4 gene product.
- the wild type Snf4 protein (SEQ ID No. 4) contains 323 amino acids and the early stop codon results in a 54 amino acids shorter protein.
- Example 5 Effect of snf4 E269* and snf4A on growth in different conditions
- Snf4 is an activating subunit of the Snfl protein kinase ('sucrose nonfermenting') which is essential for sucrose utilization.
- SNF1 Snfl protein kinase
- Flowever mutations in SNF1 were found to have pleiotropic effects also on utilization of other sugars like galactose, raffinose and maltose (Carlson et al 1981 Genetics 98).
- SNF4-319 mutant pleiotropic defects are reported on the utilization of carbon sources controlled by glucose repression.
- the SNF4-139 mutant was also compromised in producing secreted invertase (Neigeborn and Carlson 1984 Genetics 108).
- Ethanol Red (ER) first generation bioethanol production strain; source: Fermentis
- ER18 segregant of ER; Meijnen et al 2016 Biotechnol Biofuels 9
- Kll sake production strain; lab strain collection
- JT28541 molasses bioethanol production strain; lab strain collection
- PE2 Brainzilian bioethanol production strain; lab strain collection
- MS488 JT28541 HAA1 S506N ; Meijnen et al 2016 Biotechnol Biofuels 9
- MS164 ER18
- MS 488 JT28541 HAA1*
- ER18-, MS164-, PE- and MS488-derivatives are shown in Table 2.
- YP medium (10 g/l yeast extract, 20 g/l bacteriological peptone) was used, supplemented with different concentrations of glucose. In addition, media with different concentrations of molasses were used, as indicated.
- Yeast propagation was done in YP with 20 g/l glucose, while fermentation and growth assays were done in YP supplemented with 40 g/l glucose. Propagation was performed in a shaking incubator at 30°C with constant shaking of 200 rpm.
- solid YP medium was used, containing 20g/l glucose and 15 g/l bacto agar and supplemented with different concentrations of acetic acid without or with pH correction to 4.7 using 4M KOH. The pH was corrected to 4.7, which is just below the pKa of acetic acid (4.76) to assure stringent conditions.
- ER18 a haploid segregant derived from Ethanol Red, an industrial yeast strain used in commercial first-generation bioethanol production.
- the strain has a high robustness and fermentation capacity, yet relatively low tolerance to acetic acid.
- Kll a sake strain with high acetic acid tolerance.
- PE2 an industrial strain used in Brazil for bioethanol production with sugar cane and MS488, an industrial strain developed for bioethanol production with molasses.
- High-quality gDNA was extracted using the MasterPureTM Yeast DNA purification kit from Epicentre according to the manufacturer's instructions. The gDNA fragments obtained were not cut further into smaller pieces for whole-genome transformation.
- An overnight culture of the host strain ER18 was transformed with 2 pg of donor gDNA using the LiAc/SS-DNA/PEG method (Gietz and Schiestl 2007 Nat Protoc 2; Gietz et al 1995 Yeast 11). The transformed culture was plated on solid YPD medium containing a range of acetic acid concentrations from 5 g/l to 8 g/l, with pH corrected to 4.7 using 4M KOH, and grown for two days at 30°C.
- the gDNA was extracted and sent to the Beijing Genomics Institute (BGI, Hong Kong) for whole-genome sequence analysis with the lllumina (HiSeq2500) platform.
- the libraries contained 500bp inserts and sequencing was done with pair-end reads of 125bp.
- the genomic sequence of the transformant MS164 was compared with that of the host strain ER18 to identify all genetic changes introduced by whole genome transformation.
- the gDNA of MS164 and ER18 was extracted with the MasterPure Yeast DNA Purification Kit (Epicentre) and sent to the Beijing Genomics Institute (BGI, Hong Kong) for whole- genome sequence analysis.
- a library of 125 pair-end reads with an average insert length of 500bp was generated with the lllumina HiSeq2500 platform.
- strain Kll were obtained from NCBI (SRR1568238). All reads were mapped against the S288C reference genome (version R64-2-1; SGD) with bowtie2 using parameters -I 0 -X 600 -a -t. Variant detection was performed using NGSEP (Duitama et al 2014 Nucleic Acids Res 42) using parameters -maxBaseQS 30 -minQuality 40 -maxAlnsPerStartPos 2. Repetitive regions were masked using Tandem Repeats Finder (Benson 1999 Nucleic Acids Res 27). The final VCF file was filtered with parameter -q 40 and annotated.
- Custom in-house scripts were used to extract variants introduced in MS164 that did not occur in ER18. These variants were then compared to the corresponding sequence in Kll to determine whether these variants could have been derived from Kll or were novel mutations introduced during the transformation of ER18 with the gDNA from Kll.
- Non-mapped reads were collected and de novo assembled using CLC Genomics Workbench (QIAGEN Bioinformatics) with default parameters. These contigs were used as a reference and a similar mapping strategy was followed after which the variants of MS164 and ER18 were compared again. All contigs of MS164 were blasted against the Kll genome to identify possible large-scale insertions. Additionally, copy number variations were analysed with in-house scripts to identify possible duplications/deletions or large-scale genome rearrangements.
- CRISPR clustered regularly interspaced short palindromic repeat
- Cas9 clustered regularly interspaced short palindromic repeat
- Cas9 plasmid transformation was done with the P51 (pTEF-Cas9-KANMX) single copy plasmid derived from the p414-TEFlp-Cas9-CYClt plasmid (DiCarlo et al). Transformants were selected on YPD plates containing geneticin. Transformation was done with 1 pg of Cas9 plasmid using the LiAc/SS-DNA/PEG method.
- gRNA plasmid transformation a specific gRNA targeting SNP1 was designed. gRNA was flanked by GCAGTGAAAGATAAATGATC (promoter) and GTTTTAGAGCTAGAAATAG (terminator) and without a protospacer adjacent motif (PAM) site. Both, forward and reverse oligomers were ordered, duplexed and assembled by Gibson Assembly kit in the Xhol-EcoRV-digested P58 vector. P58 contains the HPH marker in the p426-SNR52p-gRNA.CANl.Y-SUP4t backbone (DiCarlo et al).
- oligos were duplexed using the same protocol as described for gRNAs.
- a successful Cas9 transformant was afterwards transformed with 1 pg of gRNA plasmid and 2 pg of donor DNA using LiAc/SS-DNA/PEG method. Transformation mix was plated on solid YP medium with 20 g/l glucose supplemented with 200 pg/ml geneticin and 300 pg/ml hygromycin B.
- the gRNA plasmids for application of the CRISPR-Cas9 technology were amplified in Escherichia coli cells grown overnight at 37°C on solid Luria broth (LB) medium with 15 g/l bacto agar and the respective antibiotic.
- the SNF4 gene was deleted in one or two copies.
- Deletion cassettes were amplified using the plasmids with NATMX and KANMX antibiotic markers with 60bp flanking regions for homologous recombination. The amplification was done by PCR using Q5 enzyme. Two different PCRs were performed to verify whether the SNF4 gene deletion was correct, the first PCR comprised primers binding inside the antibiotic marker and outside the gene, while the second PCR comprised primers inside and outside the gene. If we got a positive result for the first and a negative for the second PCR reaction, we concluded that deletion of the gene was correct.
- the forward primer differed in a desired SNP at the 3' end, one being specific for ER18 (ATGAGGAGAAGTGATGATTATG) and the other for MS164 SNP (ATGAGGAGAAGTGATGATTATT). Both primers contained an extra mismatch at the third nucleotide position from the 3' end to increase specificity.
- the reverse primer (GCCTGTACCTTTTTGATG) was common for both PCR reactions and was designed to be at a distance of about 500bp. Depending on whether SNP1 was present, only one of the two PCRs gives a positive result.
- Fermentations were performed in 50 mL volume at 35°C with continuous stirring at 120 rpm. Fermentation performance was assessed by measuring the weight loss which corresponds to CO2 release. Due to the differences in strain sensitivity the ER18 and MS488 strains were tested at 10 g/l acetic acid, while for PE2 we used 11 g/l acetic acid, both at pH 4.7. Under our conditions (50ml, 40 g/l glucose) the maximum weight loss was lg.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Mycology (AREA)
- Botany (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP19211385 | 2019-11-26 | ||
| PCT/EP2020/083371 WO2021105212A1 (en) | 2019-11-26 | 2020-11-25 | Means and methods to modulate acetic acid tolerance in industrial fermentations |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4065688A1 true EP4065688A1 (en) | 2022-10-05 |
Family
ID=68696268
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP20808480.6A Pending EP4065688A1 (en) | 2019-11-26 | 2020-11-25 | Means and methods to modulate acetic acid tolerance in industrial fermentations |
Country Status (2)
| Country | Link |
|---|---|
| EP (1) | EP4065688A1 (en) |
| WO (1) | WO2021105212A1 (en) |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090081793A1 (en) | 2007-06-06 | 2009-03-26 | Tate & Lyle Americas, Inc. | Method for improving acid and low pH tolerance in yeast |
| JP6236634B2 (en) | 2012-08-24 | 2017-11-29 | 国立大学法人神戸大学 | Production method of ethanol from biomass |
| BR112016027437A2 (en) | 2014-05-26 | 2017-10-17 | Univ Leuven Kath | causative genes that confer tolerance to acetic acid in yeast |
| WO2016083397A1 (en) | 2014-11-24 | 2016-06-02 | Vib Vzw | Causative genes conferring acetic acid tolerance in yeast |
-
2020
- 2020-11-25 WO PCT/EP2020/083371 patent/WO2021105212A1/en not_active Ceased
- 2020-11-25 EP EP20808480.6A patent/EP4065688A1/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| WO2021105212A1 (en) | 2021-06-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9862974B2 (en) | Cyanobacterium sp. host cell and vector for production of chemical compounds in cyanobacterial cultures | |
| US20170088845A1 (en) | Vectors and methods for fungal genome engineering by crispr-cas9 | |
| KR102345899B1 (en) | Methods for generating bacterial hemoglobin libraries and uses thereof | |
| JP7715636B2 (en) | Metabolic engineering for simultaneous consumption of xylose and glucose to produce chemicals from second-generation sugars | |
| KR102345898B1 (en) | Methods for generating glucose permeabilization enzyme libraries and uses thereof | |
| JP2020520645A (en) | Genomic engineering of biosynthetic pathways leading to increased NADPH | |
| EP3224364B1 (en) | Causative genes conferring acetic acid tolerance in yeast | |
| Stojiljković et al. | Whole-genome transformation of yeast promotes rare host mutations with a single causative SNP enhancing acetic acid tolerance | |
| US9309542B2 (en) | Recombinant Caldicellulosiruptor bescii and methods of use | |
| WO2021105212A1 (en) | Means and methods to modulate acetic acid tolerance in industrial fermentations | |
| US8927254B2 (en) | Pyrococcus furiosus strains and methods of using same | |
| KR102683624B1 (en) | Microorganisms with stabilized copy numbers of functional DNA sequences and related methods | |
| CN111548980A (en) | A kind of recombinant erythromycin engineering bacteria and its construction method and screening method and application | |
| KR101863239B1 (en) | Microorganism Capable of Using Acetic Acid as Sole Carbon Source | |
| CN109929853B (en) | Application of heat shock protein gene derived from thermophilic bacteria | |
| Freer | Fungal Nucleic Acids | |
| US20240309313A1 (en) | Yeast Single Nucleotide Polymorphisms for Industrially Relevant Phenotypes | |
| Ganguly et al. | Breaking the restriction barriers and applying CRISPRi as a gene silencing tool in Pseudoclostridium thermosuccinogenes. Microorganisms 2022; 10: 698 | |
| US12584096B2 (en) | Oleaginous yeast strain and use thereof for the production of lipids | |
| US20230227769A1 (en) | Means and Methods to Improve Yeast Fermentation Efficiency | |
| US20110124075A1 (en) | Construction of genetically tractable industrial yeast strains | |
| Berg | Towards Optimizing Acetic Acid Utilization In Saccharomyces cerevisiae Through gRNA-Landing Pads | |
| CN116064596A (en) | Saccharomyces cerevisiae multidrug resistance transcription factor gene YRR mutant YRR1 T185A And applications thereof | |
| CN119464351A (en) | A method to improve the efficiency of yeast CRISPR-Cas gene editing | |
| Zhou et al. | Efficient and markerless gene integration with SlugCas9-HF in Kluyveromyces |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20220624 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| RAP3 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: KATHOLIEKE UNIVERSITEIT LEUVEN, K.U.LEUVEN R&D Owner name: VIB VZW |