EP3873932A1 - Methods and compositions for imaging amyloid deposits - Google Patents
Methods and compositions for imaging amyloid depositsInfo
- Publication number
- EP3873932A1 EP3873932A1 EP19880738.0A EP19880738A EP3873932A1 EP 3873932 A1 EP3873932 A1 EP 3873932A1 EP 19880738 A EP19880738 A EP 19880738A EP 3873932 A1 EP3873932 A1 EP 3873932A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- antibody
- seq
- patient
- amyloid deposits
- chimeric
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K51/00—Preparations containing radioactive substances for use in therapy or testing in vivo
- A61K51/02—Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
- A61K51/04—Organic compounds
- A61K51/08—Peptides, e.g. proteins, carriers being peptides, polyamino acids, proteins
- A61K51/10—Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody
- A61K51/1027—Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody against receptors, cell-surface antigens or cell-surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K51/00—Preparations containing radioactive substances for use in therapy or testing in vivo
- A61K51/02—Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
- A61K51/04—Organic compounds
- A61K51/08—Peptides, e.g. proteins, carriers being peptides, polyamino acids, proteins
- A61K51/10—Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody
- A61K51/1018—Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody against material from animals or humans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
- G01N2333/4701—Details
- G01N2333/4709—Amyloid plaque core protein
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Definitions
- the present disclosure relates to humanized and chimeric (e.g ., mouse-human) antibodies and antigen-binding fragments thereof having a detectable molecule linked or conjugated thereto and to methods of using the same to detect and image amyloid deposits.
- humanized and chimeric (e.g ., mouse-human) antibodies and antigen-binding fragments thereof having a detectable molecule linked or conjugated thereto and to methods of using the same to detect and image amyloid deposits.
- Native antibodies are usually heterotetrameric glycoproteins of about 150,000 daltons composed of two identical light chains and two identical heavy chains. Each light chain is linked to a heavy chain by one disulfide bond, while the number of additional disulfide linkages between the heavy chains varies with different antibody isotypes.
- the simplest isotype is IgG, which comprises just two light chains and two heavy chains, in which the two heavy chains are linked by two disulfide linkages.
- Each heavy chain has a variable domain (VH) at one end with a number of adjacent constant domains.
- Each light chain has a variable domain (VL) at one end and a constant domain at its other end.
- Each variable domain of the light and heavy chain in an antibody comprises three segments called complementarity-determining regions (“CDR”) or hypervariable regions.
- CDR complementarity-determining regions
- Light chains are of two major types, k and l, depending on their constant region. Both k and l light chains may combine with any of the different heavy chain types.
- Amyloid light-chain amyloidosis (AL amyloidosis, AL, or ALA), also called primary amyloidosis, is the most common form of systemic amyloidosis in the United States.
- the term“amyloidosis” refers to a cluster of diseases which share a common feature, i.e., the extracellular deposition of pathologic insoluble fibrillar proteins in organs and tissues (Rodney, et al. - NEJM, 25:898).
- Amyloidosis is caused by malfunction of a person’s antibody- producing cells causing production of abnormal protein fibers which aggregate to form insoluble amyloid deposits in organs and tissues.
- amyloidosis is determined by the nature of the precursor proteins which form the fibril deposit.
- the fibrils comprise fragments of immunoglobulin light chains and in secondary amyloidosis, the fibrils comprise amyloid A protein.
- Modern classification of amyloidosis is based on the nature of the precursor plasma proteins which form the fibril deposit.
- amyloidosis The precursor plasma proteins are diverse and unrelated. Nevertheless, all precursor deposits produce amyloid deposits that share a common typical b-pleated-sheet configuration, which is responsible for the typical staining properties of the fibrillar deposits. The final stage in the development of amyloidosis is the deposit of amyloid fibrils in the organs of the sufferer. Amyloidosis mortality is high, with current five-year survival rates of about 28%.
- compositions and methods disclosed herein fulfill this need for detecting such presence and location.
- compositions and methods for detecting the presence, location, and amount of amyloid deposits comprising those resulting from primary (AL) amyloidosis.
- the disclosed compositions comprise a humanized or chimeric antibody or fragment thereof (“antigen-binding fragment”) that specifically binds to amyloid deposits (e.g ., amyloid light chain fibrils) and to which is linked a detectable molecule.
- the disclosed method comprises administering to a subject suspected of having amyloid deposits the above-described composition and detecting the presence, quantity, and/or location of the amyloid deposits by detection of the detectable molecule by diagnostic imaging.
- the present methods also include a method of stratifying patients for therapy with the disclosed humanized or chimeric antibody based on the affinity of the diagnostic composition for the amyloid deposits.
- the present methods also include determining the appropriate dosage of the disclosed humanized or chimeric antibody for therapy based on the affinity of the diagnostic compositions for the amyloid deposits. That is, one may determine the appropriate dosing of a patient based on the detected affinity (uptake) of the labeled antibody or antibody fragment.
- a patient showing strong affinity for the labeled antibody or antigen-binding antibody fragment may require a smaller amount of therapeutic antibody or antigen-binding antibody fragment than a patient showing a weaker affinity for the labeled antibody or antigen-binding antibody fragment.
- the present disclosure therefore provides a method of determining the appropriate dosage of the disclosed humanized or chimeric antibody for therapy comprising the steps of administering to the patient a labeled antibody or antibody fragment disclosed herein, determining the affinity of the labeled antibody or antibody fragment for the amyloid deposits, and administering a dose or series of doses of chimeric or humanized antibody or antibody fragment based on the strength of the affinity.
- the disclosed antibody in the diagnostic compositions comprises a VK region comprising SEQ ID NO: 47 and a VH region comprising SEQ ID NO: 48.
- the antibody comprises a constant region derived from a human lgG1.
- the antibody binds to amyloid fibrils with a higher affinity than its murine equivalent.
- the antibody binds to an epitope expressed by the b-pleated sheet configuration of amyloid fibrils with higher affinity than a mouse antibody comprising a VK region of SEQ ID NO: 36 and a VH region of SEQ ID NO: 35.
- the antibody binds to kappa and lambda amyloid fibrils in vivo.
- compositions comprising the disclosed humanized or chimeric antibody linked to a detectable label or molecule and a pharmaceutically acceptable carrier.
- a chimeric antibody useful in the subject methods and compositions may be produced by co-transfection in mammalian cells of the vector constructs 11-1 F4VK.pKN100 and 11-F4VH.pG1 D200 or transfection in mammalian cells of the supervector construct pG1 KD200-11-1 F4.
- the co-transfection of the vector constructs 11-1 F4VK.pKN100 and 11-F4VH.pG1 D200 or transfection of a supervector construct pG1 KD200- 11-1 F4 takes place in COS cells.
- the antibody thus produced is designated “chimeric 11-1 F4 antibody”.
- fragments of the chimeric 11-1 F4 antibody are also useful in the subject methods and compositions.
- the amyloid deposits detected result from primary amyloidosis.
- the primary amyloidosis comprises involvement of at least one organ or tissue selected from the group consisting of heart, kidneys, liver, lung, gastrointestinal tract, nervous system, muscular skeletal system, soft tissue, and skin and the deposits are detected in one or more of those organs.
- the present disclosure provides methods of detecting or imaging amyloid deposits comprising administering to a patient diagnosed with or suspected of having an amyloid deposition disease a diagnostically effective amount of a humanized or chimeric antibody or an antigen-binding fragment thereof having a detectable label or marker linked thereto and detecting the presence, location, and/or quantity of the detectable label bound to amyloid deposits in the patient’s body by diagnostic imaging.
- the antibody or antigen-binding fragment may comprise: a variable heavy chain (VH) comprising: a complementarity determining region (CDR) H1 comprising SEQ ID NO: 52; a CDRH2 comprising SEQ ID NO: 53; and a CDRH3 comprising SEQ ID NO: 54; and a variable light chain (VK) comprising a CDRL1 comprising SEQ ID NO: 49; a CDRL2 comprising SEQ ID NO: 50; and a CDRL3 comprising SEQ ID NO: 51.
- VH variable heavy chain
- CDR complementarity determining region
- VK variable light chain
- the present disclosure provides compositions of the aforementioned antibody or antibody fragment linked to a detectable molecule and a pharmaceutically-acceptable carrier.
- the antibody or antigen-binding fragment thereof may be a humanized antibody, while in some embodiments, the antibody or antigen-binding fragment thereof may be a chimeric antibody.
- the VK region of the antibody or antigen-binding fragment may comprise SEQ ID NO: 47 and the VH region may comprise SEQ ID NO: 48.
- the antibody or antigen-binding fragment may comprise a constant region that is derived from a human lgG1.
- the antibody may be chimeric 11 -1 F4 antibody.
- the present disclosure provides methods of detection of an amyloid deposition disease in a patient suspected of having such disease by administering a labeled antibody or an antigen-binding fragment thereof and detecting the presence of the label in the patient by diagnostic imaging.
- the humanized or chimeric 11-1 F4 antibody comprises a constant region is derived from a human lgG1.
- the present disclosure provides an in vivo method of detecting the presence, location, and/or amount of amyloid deposits in a patient suspected of having amyloid deposits which comprises administering to the patient an antibody or antigen binding fragment having a detectable molecule linked thereto, the antibody or antigen-binding fragment comprising: a variable heavy chain (VH) comprising: a complementarity determining region (CDR) H1 comprising SEQ ID NO: 53; a CDRH2 comprising SEQ ID NO: 53; and a CDRH3 comprising SEQ ID NO: 54; and a variable light chain (VK) comprising a CDRL1 comprising SEQ ID NO: 49; a CDRL2 comprising SEQ ID NO: 50; and a CDRL3 comprising SEQ ID NO: 51 ; and detecting the presence, location, and/or quantity of amyloid deposits by detection of the detectable label bound to the amyloid deposits by diagnostic imaging.
- VH variable heavy chain
- CDR complementarity determining region
- VK variable
- the disclosure provides an in vivo method of detecting the presence, location, and/or quantity of amyloid deposits in a patient suspected of having amyloid deposits which comprises administering to the patient an antibody or antigen binding fragment having a detectable molecule linked thereto, the antibody or antigen-binding fragment comprising: a VK region comprising SEQ ID NO: 47 and a VH region comprising SEQ ID NO: 48; and detecting the presence, location, and/or quantity of amyloid deposits bound to the amyloid deposits by detection of the detectable label by diagnostic imaging.
- the disclosure provides the above-described methods wherein the method of detection is positron emission spectroscopy (PET).
- PET positron emission spectroscopy
- the detectable label may be 124 l or 89 Zr.
- the antibody is selected from a chimeric or humanized 11 - 1 F4, antigen-binding fragments thereof, and the antibody CAEL-101.
- the amyloid deposits are in the heart.
- the present disclosure provides a composition for detecting the presence of amyloid deposits in a subject which comprises an antibody or antigen binding fragment having a detectable molecule linked thereto, the antibody or antigen-binding fragment comprising: a variable heavy chain (VH) comprising: a complementarity determining region (CDR) H1 comprising SEQ ID NO: 53; a CDRH2 comprising SEQ ID NO: 53; and a CDRH3 comprising SEQ ID NO: 54; and a variable light chain (VK) comprising a CDRL1 comprising SEQ ID NO: 49; a CDRL2 comprising SEQ ID NO: 50; and a CDRL3 comprising SEQ ID NO: 51.
- VH variable heavy chain
- CDR complementarity determining region
- VK variable light chain
- the present disclosure provides a composition for detecting the presence of amyloid deposits in a subject which comprises an antibody or antigen binding fragment having a detectable molecule linked thereto, the antibody or antigen-binding fragment comprising: a VK region comprising SEQ ID NO: 47 and a VH region comprising SEQ ID NO: 48.
- the detectable molecule is selected from 124 l and 89 Zr.
- the antibody is selected from chimeric or humanized 1 1 -1 F4 or antigen-binding fragments thereof and the antibody CAEL-101 .
- the amyloid deposits are in the heart.
- the present disclosure provides a method of monitoring disease progression in a patient diagnosed with an amyloid deposition disease and having amyloid deposits comprising the steps of: a) administering to said patient a composition described in the previous paragraphs and conducting diagnostic imaging on the patient to detect the amount of detectable molecule bound to the amyloid deposits, b) treating the patient with a therapy intended to remove amyloid deposits, c) administering to said patient a composition described in the previous paragraphs, d) conducting diagnostic imaging on the patient to detect the amount of detectable molecule bound to the amyloid deposits, and e) comparing the detected amount of detectable molecule in step d to the detected amount of detectable molecule in step a.
- the patient may be treated in step b) with an antibody selected from a humanized or chimeric 11 -1 F4 antibody or antigen-binding fragment thereof and the antibody CAEL-101 .
- the composition may be any of the compositions described above.
- the method of detection may be PET.
- the detectable label is selected from 124 l and 89 Zr.
- the antibody is selected from humanized or chimeric 1 1 -1 F4 or antigen-binding fragments thereof and CAEL-101 .
- the amyloid deposits are in the heart.
- the present disclosure provides a method of determining the effectiveness of treatment to remove amyloid deposits in a patient comprising a) treating the patient with a therapeutically- effective dose of the humanized or chimeric 11-F4 antibody or antibody fragment thereof, b) administering to the patient a diagnostically-effective amount of one of the above-described compositions, and c) measuring by diagnostic imaging the amount of detectable molecule from the diagnostic composition in the lymph nodes of the patient, wherein the higher the amount of detectable molecule detected in the lymph nodes, the more effective the treatment.
- the amyloid deposits are in the heart.
- the chimeric 11-1 F4 antibody is CAEL-101 , the antibody produced by the CHO cells deposited with the ATCC as ACC No. PTA-125146.
- the primary amyloidosis consists of lambda light chain fibril aggregate deposits, while in some embodiments, the primary amyloidosis consists of kappa light chain fibril aggregate deposits, and in still other embodiments, the primary amyloidosis consists of kappa and lambda light chain fibril aggregate deposits.
- Figure 1 outlines the strategy used to clone the murine VH and VK genes from a hybridoma cell line.
- Figure 2 is a listing of DNA and amino acid sequences of the murine 11-1 F4 antibody VH region gene, SEQ ID NO: 39 and NO: 35, respectively.
- Figure 3 is a listing of DNA and amino acid sequences of the murine 11-1 F4 antibody VK region gene, SEQ ID NO: 40 and NO: 36, respectively.
- Figure 4 is a map of the immunoglobulin kappa light chain expression vector pKN100. It consists of a pSV2 vector fragment, which has the SV40 early and crippled SV40 late promoter, the SV40 origin and the Co1 E1 origin. It also has the ampicillin resistance and neo genes. The crippled SV40 late promoter drives the neo genes.
- HCMVi promoter a multiple cloning site (containing the BamH ⁇ and Hind III restriction sites) for the insertion of an immunoglobulin variable region gene, and cDNA for the human kappa constant region gene terminated by a spaC2 termination signal sequence ("Arnie"), which is in the same orientation as the kappa light chain expression cassette.
- Figure 5 is a map of the immunoglobulin gamma 1 heavy chain expression vector pG1 D200. It consists of a pSV2dhfr vector fragment, which has the SV40 early and crippled SV40 late promoter, the SV40 origin, and the Co1 E1 origin. It also has the ampicillin resistance and dhfr genes. The crippled SV40 late promoter drives the dhfr gene. Consequently, expression is poor, allowing for the selection of multigene/high expression level clones using comparatively low levels of methotrexate. It also has the HCMVi promoter fragment, a multiple cloning site, cDNA for a human gamma 1 constant region gene (intron minus) which is followed by a spaC2 termination signal sequence ("Amie").
- Figure 6 is a listing of the DNA and amino acid sequences of the modified murine 11-1 F4 antibody VK region gene (SEQ ID NO: 42 and NO: 47, respectively) and the sequences of the oligonucleotide primers used to modify the VK gene (SEQ ID NO: 41 and NO: 43, respectively).
- Figure 7 is a listing of the DNA and amino acid sequences of the modified murine 11-1 F4 antibody VH region gene (SEQ ID NO: 45 and NO: 48, respectively) and the sequences of the oligonucleotide primers used to modify the VH gene (SEQ ID NO: 44 and NO: 46, respectively).
- Figure 8 is a graphical representation of the result of the amyloid fibril binding ELISA assay.
- the cos cell supernatants containing chimeric 11 - 1 F4 antibody were tested separately on the same ELISA plate along with purified murine 11-1 F4 antibody. The absorbance was read at OD405.
- New sv pG1 KD200-11-1 F4.
- New co-transfection 11-1 F4VHpG1 D200 plus 11- 1 F4VK.pKN100.
- Figure 9 is a PET image of a mouse implanted with human cardiac derived amyloidoma which was injected with [ 124 I]CAEL-101 and imaged at day 4 after injection.
- compositions comprising humanized antibodies, chimeric antibodies (e.g ., mouse-human antibodies) or antigen-binding fragments thereof to which in each case is linked a detectable molecule are provided that are useful for detecting the presence, location, and amount of amyloid deposits in vivo.
- chimeric antibodies e.g ., mouse-human antibodies
- antigen-binding fragments thereof to which in each case is linked a detectable molecule are provided that are useful for detecting the presence, location, and amount of amyloid deposits in vivo.
- HAMA human anti-mouse antibody
- compositions comprising at least one of said antibodies or antibody fragments linked to a detectable marker and a pharmaceutically acceptable carrier and methods of detecting the location and amount of amyloid deposits by administering to a patent an amount of said marker-linked antibody or antibody fragment effective to allow detection of amyloid deposits if such deposits are present and detecting the presence, amount, and/or location of the detectable marker bound to the amyloid deposits by diagnostic imaging.
- the method of monitoring disease progression in a patient diagnosed with an amyloid deposition disease and having amyloid deposits comprises the steps of:
- step d comparing the detected amount of detectable molecule in step c to the detected amount of detectable molecule in step a.
- the present disclosure is directed towards measuring the extent of change in the amount of amyloid deposits of a patient (if any) by administering to said patient the marker-linked antibody or antibody fragment as described herein both prior to and after a treatment intended to remove amyloid deposits and measuring the difference in the size and extent of the detected amyloid deposits after the treatment compared to the size and extent measured prior to the treatment.
- an in vivo method of detecting amyloid deposits in a subject comprising: a) administering to the subject a composition comprising one or more than one antibody or antigen-binding fragment thereof as described herein linked to a detectable molecule; and b) detecting by diagnostic imaging the detectable agent linked to the antibody or antigen-binding fragment thereof bound to the amyloid deposits.
- the step of detecting may be performed using PET (positron emission tomography), SPECT (single- photon emission computed tomography), MRI, fluorescence imaging, or any other suitable diagnostic imaging method.
- PET is the preferred imaging method.
- This preparation of diagnostic imaging agents and their use in PET are described, for example, in Bailly, et al. - Int. J. Mol. Sci. 2017, 18, 57 ; Boerman, et al. -J Nucl Med, 2011; 52:1171-1172] and Mayer, et al. - J Nucl Med 2017; 58:538-546, all of which are incorporated herein by reference in their entirety.
- these references are directed mainly at cancerous tumor detection, the materials and methods disclosed therein are equally useful for detecting amyloid deposits.
- the in vivo imaging step in the methods described above may be whole body imaging for diagnostic purposes or local imaging at specific sites, such as but not limited to heart, kidney, liver, spleen, nervous system, or digestive system in a quantitative manner to assess the progression of disease or patient response to a treatment regimen.
- the detection step in the methods as described above may be any diagnostic imaging technology including, but not limited to: positron emission tomography (PET), wherein the detectable agent is an isotope such as 11 C, 13 N, 15 0, 18 F, 64 Cu, 62 Cu, 124 l, 76 Br, 82 Rb, 89 Zr, or 68 Ga; single photon emission computed tomography (SPECT), wherein the detectable agent is a radiotracer such as 99m Tc, 111 1n, 123 l, 201 TI, or 133 Xe, depending on the specific application; magnetic resonance imaging (MRI), wherein the detectable agent may be, for example and not limited to, gadolinium, iron oxide nanoparticles and carbon-coated iron-cobalt nanoparticles.
- PET positron emission tomography
- SPECT single photon emission computed tomography
- MRI magnetic resonance imaging
- antibodies are labeled with 124 l or 89 Zr.
- the detectable molecule (sometimes described herein as a “label”, “marker”, or “agent”) as described herein may be linked, also sometimes referred to herein as "conjugated", to the antibody or fragment thereof by any suitable method known in the art.
- the detectable agent may be linked to the antibody or antibody fragment by a covalent bond or ionic interaction.
- the linkage may be achieved through a chemical cross-linking reaction, or through fusion using recombinant DNA methodology combined with any peptide expression system, such as bacteria, yeast or mammalian cell-based systems.
- a method of determining the appropriate dosage of the disclosed humanized or chimeric antibody for therapy based on the affinity of the diagnostic compositions for the amyloid deposits as determined by the uptake of the diagnostic composition by the amyloid deposits of the patient. That is, one may determine the dosing of a patient based on the detected uptake of the labeled antibody or antibody fragment. A patient showing higher uptake of the labeled antibody or antibody fragment may require a smaller amount of therapeutic antibody or antibody fragment than a patient showing a lower uptake of the labeled antibody or antibody fragment.
- the present disclosure therefore provides a method of determining the appropriate dosage of the disclosed humanized or chimeric antibody for therapy comprising the steps of administering to the patient a labeled antibody or antibody fragment disclosed herein, determining the uptake of the labeled antibody or antibody fragment by the amyloid deposits, and administering a dose or series of doses of chimeric or humanized antibody or antibody fragment based on the detected amount of uptake.
- a method of determining the effectiveness of a treatment with the chimeric or humanized antibody or antibody fragment disclosed herein to remove amyloid deposits comprises: a) treating the patient with a therapeutically-effective dose of a therapy intended to remove amyloid deposits, such as the chimeric or humanized antibody or antibody fragment disclosed herein, b) administering to the patient a diagnostically-effective amount of the diagnostic composition disclosed herein, and c) measuring the amount of detectable molecule from the diagnostic composition in the lymph nodes of the patient, wherein the higher the amount of detectable molecule detected in the lymph nodes, the more effective the treatment.
- compositions and methods include the recited elements, but not excluding others.
- Consisting essentially of when used to define compositions and methods shall mean excluding other elements of any essential significance to the composition or method.
- Consisting of shall mean excluding more than trace elements of other ingredients for claimed compositions and substantial method steps. Embodiments defined by each of these transition terms are within the scope of this disclosure. Accordingly, it is intended that the methods and compositions can include additional steps and components (comprising) or alternatively including steps and compositions of no significance (consisting essentially of) or alternatively, intending only the stated method steps or compositions (consisting of).
- “about” means plus or minus 10%.
- the terms“individual”,“patient”, or“subject” can be an individual organism, a vertebrate, a mammal (e.g ., a bovine, a canine, a feline, or an equine), or a human.
- the individual, patient, or subject is a human.
- an“isolated antibody” is intended to refer to an antibody which is substantially free of other antibodies having different antigenic specificities ⁇ e.g., an isolated antibody that specifically binds to an amyloid fibril is substantially free of antibodies that do not bind to amyloid fibrils).
- An isolated antibody that specifically binds to an epitope of an amyloid light chain fibril ⁇ e.g., a kappa and/or lambda fibril) may, however, have cross- reactivity to other proteins, such as amyloid A fibrils. However, the antibody preferably always binds to human amyloid light chain fibrils.
- an isolated antibody is typically substantially free of other cellular material and/or chemicals.
- the phrase “diagnostically effective amount” means the amount of detectable marker-linked antibody or antibody fragment which, when administered to a patient or subject, permits in vivo detection, localization, and/or quantification by diagnostic imaging of amyloid deposits in the patient or subject if any such deposits are present. It is emphasized that a diagnostically effective amount will not always be effective to detect amyloid deposits, even though such amount is deemed to be a diagnostically effective amount by those of skill in the art. The diagnostically effective amount may vary based on the route of administration and dosage form, the age and weight of the subject, and/or the subject’s condition, including the type and stage of the amyloidosis at the time that diagnosis commences, among other factors.
- humanized antibody refers to an antibody that comprises the CDRs of antibodies derived from mammals other than human, and the framework region (FR) and the constant region of a human antibody.
- a humanized antibody is useful as a component in a diagnostic composition according to the present disclosure since antigenicity of the humanized antibody in human body is lowered.
- the term“antibody fragment” refers to a part of an antibody that comprises a CDR of the antibody but has been engineered to delete some of the structure of the intact antibody.
- Engineering antibody fragments is well known in the art, as shown (for example) in Holliger, et al. - Nature Biotechnology: 23 (9), 1126-1135 (2005), incorporated herein by reference in its entirety.
- the term“antigen-binding fragment” as used herein means an antibody fragment that binds to amyloid deposits.
- the term “pharmaceutically-acceptable carrier” means a material for admixture with a pharmaceutical or diagnostic compound (e.g., a chimeric antibody linked to a detectable molecule) for administration to a patient as described, for example, in“Ansel’s Pharmaceutical Dosage Forms and Delivery Systems”, Tenth Edition (2014).
- detecttable marker refers to substances that may be detected in vivo by diagnostic imaging techniques, such as (but not limited to) PET, SPECT, and MRI.
- the terms“diagnostic imaging” or“imaging” mean methods of in vivo imaging of a detectable molecule in a patient or subject to determine the presence, location and/or amount of a tissue or substance (such as an amyloid deposit) in the patient or subject to which the detectable molecule has been localized, such as by being linked to an antibody or antibody fragment that binds to the tissue or substance to be detected.
- a tissue or substance such as an amyloid deposit
- Murine antibodies are generally unsuitable for administration to other animal species (such humans) because the receiving species will recognize the murine antibody as antigenic and will produce antibodies against it.
- the antigenicity of an antibody from one species when injected into another species is normally caused by a portion of a constant domain. Such an antigenic response will impede or prevent the desired therapeutic or diagnostic effect of the murine antibody.
- this antigenic response is called human anti-mouse antibody (HAMA).
- HAMA human anti-mouse antibody
- the antibodies described in the‘594 patent have the potential to be highly immunogenic in humans via the human anti-mouse antibody (HAMA) response. Since the HAMA response usually results in the rapid clearance of a mouse antibody from the human recipient, HAMA would severely limit any potential human therapeutic or diagnostic benefit a murine antibody could have.
- the present disclosure provides compositions and methods for detecting and/or monitoring amyloid deposition diseases that is less likely to produce an immunogenic HAMA response in a patient following administration.
- compositions comprising humanized and chimeric antibodies or antigen-binding fragments thereof having linked thereto a detectable molecule.
- the disclosed compositions are useful for imaging the location and amount of amyloid deposits in a subject.
- an antibody consists of four polypeptides: two identical copies of a heavy (H) chain polypeptide and two copies of a light (L) chain polypeptide.
- each heavy chain contains one N-terminal variable (VH) region and three C-terminal constant (CH1 , CH2 and CH3) regions
- each light chain contains one N-terminal variable (VL or VK) region and one C-terminal constant (CL) region.
- Each variable domain of the light and heavy chain in an antibody also comprises three segments called complementarity-determining regions (“CDR”) or hypervariable regions.
- CDR complementarity-determining regions
- the variable regions of each pair of light and heavy chains form the antigen binding site of an antibody, whereas the constant region provides structural support and modulates the immune response initiated by the antigen binding.
- Chimeric antibodies incorporate the variable region of a non-human antibody into the constant region of a human antibody.
- a chimeric 11-1 F4 antibody may be created by expressing the murine variable region with the Fc region of a human antibody, such as a human lgG1.
- Humanized forms of non-human (e.g ., murine) antibodies can be obtained, which contain minimal sequences derived from non-human immunoglobulin.
- a humanized antibody may comprise one or two or more variable domains in which variable regions are derived from non-human immunoglobulin and framework regions (FR) correspond to a human immunoglobulin sequence.
- FR framework regions
- a humanized anti-AL antibody comprises a human antibody framework region.
- Such antibodies can be prepared by known techniques.
- the murine 11-1 F4 monoclonal antibody is an anti-AL antibody produced by the SP2/0 hybridoma cell deposited by Alan Solomon, MD (University of Tennessee Medical Center at Knoxville, TN).
- the hybridoma cell line is available from the American Type Culture Collection (ATCC access PTA- 105).
- the V K region (SEQ ID NO: 36) and the V H region (SEQ ID NO: 35) of the 11-1 F4 antibody are shown in Table 1 below.
- the CDR sequences for the heavy and light chains and provided in Table 2.
- the chimeric 11-1 F4 antibody binds to an epitope expressed by the b-pleated sheet configuration of amyloids, just as its murine counterpart does, but surprisingly, as shown in Example 6 below, the chimeric antibody binds to AL amyloid fibrils with higher affinity than the 11-1 F4 mouse antibody from which it was derived.
- the humanized form may also have a binding affinity for amyloid fibrils that is higher than that of the murine counterpart.
- the disclosed humanized and chimeric antibodies may utilize all different types of human constant regions and/or framework regions.
- the disclosed humanized and chimeric antibodies may comprise the constant regions and/or framework regions of a human IgG (including lgG1 , lgG2, lgG3, and lgG4), IgA, IgE, IgH, or IgM.
- the disclosed humanized or chimeric 11-1 F4 antibody comprises a human lgG1 constant region.
- the disclosed antibodies may comprise one or more substitutions, insertions, or deletions, so long as the antibody maintains the ability to bind to amyloid fibrils (e.g ., kappa and/or lambda light chain fibrils).
- amyloid fibrils e.g ., kappa and/or lambda light chain fibrils.
- a chimeric 11 -1 F4 antibody of the present disclose may comprise heavy and light chains with about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity compared to the corresponding heavy and light chain sequences disclosed herein, so long as the antibody maintains the ability to bind to amyloid fibrils.
- a humanized 11 -1 F4 antibody of the present disclose may comprise CDRs that have about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity compared to the corresponding CDR sequences disclosed herein, so long as the antibody maintains the ability to bind to amyloid fibrils.
- DMEM Dulbecco's Modified Eagles Medium
- FBS Fetal Bovine Serum
- RNA ribonucleic acid
- mRNA messenger RNA
- DNA deoxyribonucleic acid
- cDNA copy DNA
- PCR polymerase chain reaction
- min minute
- sec second
- Amino acids are represented by the IUPAC abbreviations, as follows: Alanine (Ala), Arginine (Arg), Asparagine (Asn), Aspartic acid (Asp), Cysteine (Cys), Glutamine (Gin), Glutamic acid (Glu), Glycine (Gly), Histidine (His), Isoleucine (lie), Leucine (Leu), Lysine (Lys), Methionine (Met), Phenylalanine (Phe), Proline (Pro), Serine (Ser), Threonine (Thr), Tryptophan (Trp), Tyrosine (Tyr), Valine (Val).
- nucleotides Adenine (A), Cytosine (C), Guanine (G), Thymine (T), Uracil (U), Adenine or Guanine (R), Cytosine or Thymine (Y), Guanine or Cytosine (S), Adenine or Thymine (W), Guanine or Thymine (K), Adenine or Cytosine (M), Cytosine or Guanine or Thymine (B), Adenine or Guanine or Thymine (D), Adenine or Cytosine or Thymine (H), Adenine or Cytosine or Guanine (V), and any base (N).
- the murine 11-1 F4 monoclonal antibody heavy and kappa light chain variable region genes described in United States patent 8,105,594 were PCR modified to facilitate the expression of the chimeric 11-1 F4 antibody in mammalian cells.
- modified variable region genes were cloned into the appropriate mammalian expression vectors, creating the constructs 11 - 1 F4VHpG1 D200 and 11 -1 F4VK.pKN100.
- a single supervector construct, pG1 KD200-11-1 F4 was made from the 11-1 F4VHpG1 D200 and 11 - IF4VK.pKN100 constructs by EcoRI restriction enzyme digest and ligation.
- the chimeric 11 -1 F4 antibody was transiently expressed in COS cells by both cotransfection and single supervector transfection.
- an antibody consists of four polypeptides: two identical copies of a heavy (FI) chain polypeptide and two copies of a light (L) chain polypeptide.
- each heavy chain contains one N-terminal variable (VH) region and three C-terminal constant (CH1 , CH2 and CH3) regions
- each light chain contains one N-terminal variable (VL or VK) region and one C- terminal constant (CL) region.
- the variable regions of each pair of light and heavy chains form the antigen binding site of an antibody.
- An antibody useful in the compositions and methods of the invention may be a chimeric mouse-human monoclonal antibody comprising the VK region of SEQ ID NO: 47 and the VH region of SEQ ID NO: 48 or a humanized monoclonal antibody comprising CDR sequences of SEQ ID NOs: 49-54.
- These antibodies bind to an epitope expressed by the b-pleated sheet configuration of amyloid fibrils.
- the antibodies bind to this epitope with higher affinity than the 11-1 F4 mouse antibody from which they were derived, which comprises the VK region of SEQ ID NO: 36 and the VH region of SEQ ID NO: 35.
- the invention includes methods of detecting amyloid deposits in a human patient which comprises administering to the patient a diagnostically effective dose of one of the above antibodies linked to a detectable molecule in a pharmaceutically-acceptable carrier.
- the antibody composition may be administered by any conventional route of administration, but parenteral administration (such as intravenous) is preferred.
- Pharmaceutically-acceptable carriers are well-known in the art and a suitable one can be selected by one of skill in the medical field.
- Materials useful to make the subject antibody include vector constructs selected from the group consisting of 11-1 F4VK.pKN100 and 11-F4VH.pG1 D200, shown in Figures 5 and 6, respectively, and the superconstruct pG.1 KD20011-1 F4 made from the two above vector constructs.
- Other useful materials include the modified murine 11-1 F4 antibody VK region gene (SEQ ID NO: 42) and the modified 11- 1 F4 antibody VH region gene (SEQ ID NO: 45), as well as the respective primers SEQ ID NO: 41 , 43, 44, and 46.
- the subject antibody may be made by co-transfection of the vector constructs 11 -1 F4VK.pKN100 and 11 - F4VFI.pG1 D200 or the superconstruct pG.1 KD20011 -1 F4 in a suitable mammalian host cell, such as COS (Chinese hamster ovary) cells.
- a suitable mammalian host cell such as COS (Chinese hamster ovary) cells.
- Diagnostic compositions suitable for use in the methods described herein can include the disclosed humanized or chimeric 11-1 F4 antibodies, humanized antibodies, or antigen-binding antibody fragments linked in each case to a detectable marker, and a pharmaceutically acceptable carrier or diluent.
- the composition may be formulated for intravenous, subcutaneous, intraperitoneal, or intramuscular administration, although intravenous administration is preferred.
- Pharmacologically acceptable carriers for various dosage forms are known in the art.
- solvents, solubilizing agents, suspending agents, isotonicity agents, buffers, and soothing agents for liquid preparations are known.
- the pharmaceutical compositions include one or more additional components, such as one or more preservatives, antioxidants, stabilizing agents and the like.
- Sterile injectable solutions can be prepared by incorporating the marker-linked antibody or antibody fragment in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by sterilization microfiltration.
- dispersions are prepared by incorporating the diagnostic composition into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
- amyloidosis is caused by the buildup of an abnormal protein called amyloid.
- Amyloid is produced in the bone marrow and can be deposited in any tissue or organ. The specific cause of the condition depends on the type of amyloidosis.
- amyloidosis or amyloid diseases There are several types of amyloidosis or amyloid diseases, including AL amyloidosis, AA amyloidosis, and hereditary amyloidosis.
- AL amyloidosis is the most common type and can affect the heart, kidneys, skin, nerves and liver. Previously known as primary amyloidosis, AL amyloidosis occurs when the bone marrow produces abnormal antibodies that cannot be broken down. The antibodies are deposited in various tissues as amyloid plaques (amyloid deposits), which interfere with normal function of the tissue or organ.
- AA amyloidosis generally affects the kidneys but occasionally also affects the digestive tract, liver or heart. It was previously known as secondary amyloidosis. It often occurs along with chronic infectious or inflammatory diseases, such as rheumatoid arthritis or inflammatory bowel disease.
- Hereditary amyloidosis is an inherited disorder that usually often affects the liver, nerves, heart, and/or kidneys. Many different types of gene abnormalities present at birth are associated with an increased risk of amyloid disease or hereditary amyloidosis. The type and location of an amyloid gene abnormality can affect the risk of certain complications, the age at which symptoms first appear, and the way the disease progresses over time.
- Amyloid deposits or plaques reduce the heart’s ability to fill with blood between heartbeats. Less blood is pumped with each beat, and this may lead to shortness of breath. Amyloid deposits or plaques in or around the heart may also cause irregular heartbeats and congestive heart failure, among other organ dysfunctions
- kidneys When an amyloid disease affects the kidneys, it will often harm the kidneys’ filtration ability, allowing protein to leak from the blood into the urine (i.e., proteinuria). Moreover, the kidneys’ ability to remove waste products from your body is lowered, which may eventually lead to kidney failure.
- amyloid deposition disease such as primary (AL) amyloidosis
- a patient e.g ., a human patient
- a humanized or chimeric 11-1 F4 antibody or an antigen-binding fragment thereof linked to a detectable marker together with a pharmaceutically acceptable carrier, in an amount effective to detect, locate, and/or quantify amyloid deposits if such are present, followed by detecting the detectable molecule bound to the amyloid deposits in the patient by diagnostic imaging to determine the extent, location, and/or amount of the amyloid deposits if such are present.
- Also provided herein is a method of monitoring disease progression in a patient diagnosed with an amyloid deposition disease and having amyloid deposits comprising the steps of:
- a therapy intended to remove amyloid deposits such as a humanized or chimeric 11 -1 F4 antibody or antigen-binding fragment thereof
- step d comparing the detected amount of detectable molecule in step c to the detected amount of detectable molecule in step a.
- the above monitoring method can be conducted starting before any treatment has taken place or can be used in the midst of a treatment regimen. That is, step a) above can be performed prior to any treatment of the patient to determine a baseline amount of amyloid deposit or step a) above can be conducted after one or more courses of treatment to determine the effect of the next succeeding course of treatment.
- the amyloid deposition disease e.g ., primary amyloidosis
- the disclosed methods comprise monitoring the treatment of a patient suffering from relapse or refractory ALA.
- the patient may have kappa ALA.
- the patient may have lambda ALA.
- Exemplary diagnostic amounts can vary according to the size and health of the individual being treated, as well as the condition being diagnosed.
- the diagnostically effective amount of a radiolabeled humanized or chimeric 11 -1 F4 antibody for PET is about 1-10 mCi.
- the dose may be higher or lower.
- One of skill in the diagnostic imaging art would know how to select an appropriate amount of labeled antibody or antibody fragment, as described (for example) in the references listed above.
- the murine 11-1 F4 monoclonal antibody heavy and light chain variable region genes were PCR cloned and a detailed sequence analysis of all variable region genes isolated (both pseudo and functional) was performed. Detailed DNA and amino acid sequences of the murine 11-1 F4 antibody heavy and light chain variable region genes were obtained. Materials
- RNA solution kit was obtained from Stratagene (USA), while the first strand cDNA synthesis kit was purchased from Pharmacia (UK). All the constituents and equipment for the RCR-reaction, including AmpliTaq® DNA polymerase, were purchased from Perkin Elmer (USA).
- the TOPO TA Cloning ® kit was obtained from Invitrogen (USA). Agarose (UltraPureTM) was obtained from Life Technologies (UK).
- the ABI PRISM® Big DyeTM terminator cycle sequencing ready reaction kit pre-mixed cycle sequencing kit and the ABI PRISM® 310 sequencing machine were both purchased from PE Applied Biosystems (USA). All other molecular biological products were obtained from New England Biolabs (USA) and Promega (USA).
- B2C4 and B2D6 Two clones (B2C4 and B2D6) of the SP2/0 hybridoma cell line producing the ct-human light chain monoclonal antibody 11 -1 F4, were kindly provided by Alan Solomon, MD (University of Tennessee Medical Center at Knoxville, TN).
- the hybridoma cell line is available from the American Type Culture Collection (ATCC access PTA-105).
- the cell lines were cultured using DMEM media supplemented with 20% (v/v) FBS, penicillin/streptomycin and L- Glutamine. Cells were cultured until a total viable cell count of 10 8 cells was reached.
- the cells were harvested separately from each clone as follows.
- the mouse hybridoma cell line was grown in suspension in an appropriate culture medium and in sufficient quantities to provide a total viable cell count of about 10 8 cells.
- the culture supernatant was harvested and the hybridoma cells pelleted in a bench top centrifuge (250 g, 5 min). The cells were gently re-suspended in 20 ml PBS and a 100 pi aliquot was taken for a viable cell count.
- the cells in the aliquot were pelleted once more and 200 mI of PBS and 200 mI of trypan blue were added to the 100 mI of cells and mixed gently.
- RNA was then isolated separately from the cells of each clone using a Stratagene RNA isolation kit, according to the manufacturer’s instructions.
- One ml of 2 M sodium acetate (pH 4.0) was added to the sample and the contents of the tube were thoroughly mixed by repeatedly inverting the tube.
- To the tube was added 10.0 ml of phenol (pH 5.3-5.7) and the contents again mixed thoroughly by inversion.
- To the mixture was added 2.0 ml of chloroform-isoamyl alcohol mixture, the tube was capped and vigorously shaken for 10 seconds, and the tube was incubated in ice for 15 minutes.
- the sample was transferred to a 50-ml thick-walled, round-bottom centrifuge tube that had been pre-chilled on ice and the tube was spun in a centrifuge at 10,000 x g for 20 minutes at 4°C. Two phases were visible in the tube after centrifugation.
- the upper, aqueous phase contained the RNA, while the lower phenol phase and interphase contained DNA and proteins.
- the RNA- containing upper, aqueous phase was transferred to a fresh centrifuge tube and the lower phenol phase was discarded.
- An equal volume of isopropanol was added to the aqueous phase and the contents mixed by inversion, following which the tube was incubated for 1 hour at -20°C to precipitate the RNA.
- the tube was spun in a centrifuge at 10,000 x g for 20 minutes at 4°C. After centrifugation, the pellet at the bottom of the tube, which contains the RNA, was removed and the supernatant discarded. The pellet was dissolved in 3.0 ml of solution D, 3.0 ml of isopropanol was added to the tube and the contents mixed well. After incubating the tube for 1 hour at -20°C, it was again spun in a centrifuge at 10,000 x g for 10 minutes at 4°C and the supernatant removed from the tube and discarded.
- RNA had been protected from ribonucleases by the presence of guanidine isothiocyanate but was now no longer protected.
- the pellet was washed with 75% (v/v) ethanol (DEPC-treated water (25%)) and the pellet was dried under vacuum for 2-3 minutes. The RNA pellet is re-suspended in 0.5-2 ml of DEPC-treated water.
- an Amersham Pharmacia Biotech first strand cDNA synthesis kit was employed to produce a single- stranded DNA copy of the 11-1 F4 hybridoma mRNA using the Not I- d(T) 18 primer supplied with the kit.
- One reaction was performed for each of the two RNA samples isolated, as follows.
- the components used were: Bulk first strand cDNA reaction mix, Cloned FPLCpureTM Murine Reverse Transcriptase, RNAguardTM, BSA, dATP, dCTP, dGTP, and dTTP, 200 mM DIT aqueous solution, Not l-d(T) 18 primer: 5' d[AACTGGAAGAATTCGCGGCCGCAGGAAi 8 ]-3', and DEPC treated water.
- RNA in 20 pi DEPC water was heated to 65 'C for I0 min and then chilled on ice.
- the bulk first strand cDNA reaction mix was pipetted gently to obtain a uniform suspension and the reaction set up in a 0.5 ml microcentrifuge tube as below.
- the reactants were mixed gently by pipetting and incubated 37°C for 1 hour.
- VH genes and VK genes were then PCR amplified from the ssDNA template using the method described by Jones and Bendig (Bio/Technology 9:88).
- each tube a 100 pi reaction mixture was prepared, each reaction mixture containing 69.3 mI of sterile water, 10 mI of 10 X PCR buffer II, 6 mI of 25 mM MgC , 2 mI each of the 10 mM stock solutions of dNTPs, 2.5 mI of 10 mM MKC primer, 2.5 mI of one of the 10 mM MKV primers and 1 mI of RNA-cDNA template mix. To each of the tubes was then added 0.7 mI of AmpliTaq® DNA polymerase and the completed reaction mix overlaid with 50 mI of mineral oil.
- a similar series of reaction mixes was prepared as described above to PCR-clone the mouse heavy chain variable region gene. However, this time twelve reaction tubes were labeled and one of the twelve MHV primers and the appropriate MHC primer were added to each. That is, to PCR-amplify the variable domain gene of a mouse y1 heavy chain, for example, the MHC G1 primer was used.
- reaction tubes were loaded into a DNA thermal cycler and cycled (after an initial melt at 94 °C for 1.5 min) at 94 °C for 1 min, 50 °C for I min and 72 °C for 1 min over 25 cycles. The last cycle was followed by a final extension step at 72 °C for 10 min before cooling to 4 °C. Except for between the annealing (50 °C) and extension (72 °C) steps when an extended ramp time of 2.5 min was used, a 30 sec ramp time was used between each step of the cycle.
- Table 1 - PCR primers for cloning mouse kappa light chain variable region genes
- Those putative positive clones so identified were double-stranded plasmid DNA sequenced using the ABI PRISM 310 Genetic Analyzer and the ABI PRISM BigDyeTM terminator.
- Three positive clones each of the VH and VK genes from the B2C4 hybridoma cell line clone were sequenced, as were four positive clones of the V K gene and six of the VH gene from the B2D6 hybridoma cell line clone.
- the degenerate leader sequence primer MHV7 in combination with a mix of the MHCGI-3 constant region primers (Table 1 ), yielded a PCR product of about 600 bp from template cDNAs derived from both the B2C4 and B2D6 hybridoma cell lines. Since this band was larger than the expected size for an average V hi gene (450 bp), it was not investigated further.
- the degenerate leader sequence primer MHV6 in combination with a mix of the MHCGI-3 constant region primers (Table 1 ), yielded a PCR product of the expected size (450 bp) for a VH gene from template cDNA derived from both the B2C4 and B2D6 hybridoma cell lines.
- Table 4 shows the results of the PCR amplifications performed to clone the murine 11-1 F4 monoclonal antibody variable region heavy (a) and light (b) chain genes from the SP2/0 hybridoma cell lines B2C4 and B2D6. Column three contains a record of the actual PCR results. Where a band was observed for a particular combination of primers its size in base pairs (bp) was recorded in the appropriate space.
- the degenerate leader sequence primer MKV2 in combination with the MKC constant region primer (Table 2), produced a PCR product which was smaller than the expected 450 bp band (when viewed on an agarose gel) from template cDNA derived from both the B2C4 and B2D6 hybridoma cell lines.
- the MKV2 primer amplified a well known kappa light chain pseudogene. Therefore, sequence analysis of one clone of each PCR product was performed in order to confirm that this product was a pseudogene and not the murine 11-1 F4 antibody VK gene. This sequence analysis revealed that this PCR clone was indeed the pseudogene.
- the degenerate leader sequence primer MKV1 in combination with the MKC constant region primer (Table 1 ), produced a PCR product of about the expected size (450 bp) for a VK gene, from template cDNA derived from both the B2C4 and B2D6 hybridoma cell lines.
- the 11-1 F4 antibody heavy chain variable region gene was cloned (using constant region specific and leader sequence specific primers) from the hybridoma mRNA and sequenced.
- the murine 11-1 F4 antibody variable region kappa light chain gene was also successfully cloned and sequenced, as was a non-functional VK pseudogene gene.
- This pseudogene was first identified by Carroll et al (Molecular Immunology (1988) 25:991 ). The sequence arises from an aberrent mRNA transcript which is present in all standard fusion partners derived from the original MOPC-21 tumor (including SP2/0). As a result of the aberrant mRNA, the invariant cysteine at position 23 is replaced by a tyrosine residue, and the VJ joint is out of frame, resulting in a stop codon at position 105.
- the back (BAK) primers F39836 and F39835 introduced a Hind ⁇ restriction site, a Kozak translation initiation site, and an immunoglobulin leader sequence to the 5' ends of the VK and VH genes respectively.
- the forward (FOR) oligonucleotide primer F39837 introduced a splice donor site and a BamH ⁇ restriction site to the 3' end of the VK gene while the forward (FOR) oligonucleotide primer F58933 appended the first 22 base pairs of the gamma-1CHi gene including an Apa ⁇ restriction site to the 3' end of the VH gene.
- Table 5 - Oligonucleotide primers used to PCR modify the 11 -1 F4 heavy and kappa light chain variable region genes
- the Kozak consensus sequence is crucial to the efficient translation of a variable region sequence (Kozak - J Mol Bio 196:947). It defines the correct AUG codon from which a ribosome commences translation, and the single most critical base is the adenine (or less preferably, a guanine) at position -3, upstream of the AUG start.
- the immunoglobulin leader sequence ensures that the expressed antibody is secreted into the medium and therefore is easily harvested and purified.
- the leader sequences used in this instance were the murine 1 1 -1 F4 ⁇ A ⁇ and VH leader sequences cloned from the hybridoma cDNA during the VH and VK cloning process.
- the splice donor sequence is important for the correct in-frame attachment of the light chain variable region to its appropriate constant region, thus splicing out the 130 bp VK:CK intron.
- the heavy chain variable region was attached directly to its appropriate constant region gene via the Apa ⁇ site, thus eliminating the need for a splice donor site.
- PCR reactions were prepared as follows, one for each variable region gene.
- the plasmids 11-1 F4 VH.PCR2.1 and 11 -1 F4 VK.PCR2.1 described above were used as templates.
- a 100 pi reaction mixture was prepared in each PCR tube, each mixture containing up to 41 pi of sterile water, 10 mI of 10 x PCR buffer I, 8 mI of the 10 mM stock solution of dNTPs, 1 m I of 10 mM of 5' forward primer, 1 mI of the 10 mM 3' Reverse primer, and 1 m I of a 1/10 dilution of template DNA.
- Colonies containing the plasmid with a correctly sized insert were identified by PCR-screening the colonies using the 1212 and 1233 oligonucleotide primers (Table 3) according to the method of Gilssow and Clackson. Those putative positive clones so identified were double-stranded plasmid DNA sequenced using the ABI PRISM 310 Genetic Analyzer and the ABI PRISM BigDyeTM terminator. Two positive clones each of the Topo TA cloned V hi and V K genes were sequenced.
- the modified 11-1 F4 VH gene was also subcloned as a Hind ⁇ -Apa ⁇ fragment into the expression vector pG1 D200 (Figure 5); this vector contained a human y1 constant region gene (allotype: G1 m (-1 Glu377, Met38l, -2 Ala462, 3 Arg222, Ser229)). Both the kappa and y1 constant region allotypes used are commonly found in the Caucasian population.
- the ligated expression constructs, 11-1 F4VK.pKN100 and 11- 1 F4VH.pG1 D200, were then used to transform DH5ct competent cells, and positive clones were identified using the PCR screening method discussed above with the original PCR modification primers (Table 4). The expression vectors are readily available.
- a single supervector expressing both immunoglobulin chains of the chimeric 11-1 F4 antibody was constructed as follows.
- the 11-1 F4 kappa light chain expression cassette (which contained the HCMVi promoter, the 11- 1 F4 kappa light chain variable region gene, and the kappa light chain constant region gene) was restriction enzyme digested (EcoRI at positions 1 and 2490) out of the 11-1 F4VK.pKN100 construct ( Figure 4) and subsequently ligated into the 11-1 F4VHpG1 D200 construct via the unique EcoRI (position 4297, Figure 5). This ligation resulted in the construction of a supervector construct, pG1 KD200-11-1 F4, containing both the heavy and kappa light chains of the 11 -1 F4 chimeric antibody.
- the chimeric 11-IF4 antibody was transiently expressed in COS cells from the European Collection of Cell Cultures (ECACC) in two ways:
- the following transfection method was used.
- the COS cell line was grown in DMEM supplemented with 10% (v/v) FCS, 580 pg/ml L- glutamine and 50 Units/ml penicillin/ 50 pg/ml streptomycin (“media”) in a 150 cm 2 flask until confluent.
- the cells were trypsinized, spun down in a bench top centrifuge (250 g for 5 min), then re-suspended in 6 ml of media before dividing them equally between three 150 cm 2 flasks, each containing 25 ml of fresh, pre-warmed media.
- the cells were incubated overnight at 37 °C in 5% CO2 and then harvested the next day while they are still growing exponentially.
- Each flask contained approximately 1 x 10 7 cells.
- the cells were trypsinized again, pelleted as before, and washed in 20 ml of PBS, following which they were re-suspend in sufficient PBS to create a cell concentration of 1 x I0 7 cells/ml.
- 700 pi of these washed COS cells were pipetted into a Gene Pulser® cuvette, to which was then added 1 mI of both the heavy chain and kappa light chain expression vector DNA (each at 10 pg) or 13 pg of the super-vector construct.
- a 1900 Volt, 25 pFarad capacitance pulse was delivered to the mixture using the Bio-Rad Gene Pulser® apparatus.
- the pulsing was repeated for each experimental transfection and a "no DNA" control (in which the COS cells were electroporated in the absence of any DNA).
- a positive control of a previously-expressed antibody was also carried out to test the efficiency of the COS cells.
- the COS cells were allowed to recover at room temperature for 10 min, then gently pipetted the into a 10 cm diameter tissue culture dish containing 8 ml of pre- warmed DMEM supplemented with 10% (v/v) y - globulin free FBS, 580 pg/ml L- glutamine and 50 Units/ml penicillin / 50 pg/ml streptomycin, and incubated in 5% CO2 at 37 °C for 72 hours before harvesting the COS cell supernatant for analysis. After incubation for 72 hours the medium was collected, spun to remove cell debris and analyzed by ELISA for chimeric antibody production and antigen binding of the c11-1 F4 antibody.
- IgG molecules present in the COS cell supernatant were quantified using a capture ELISA assay.
- IgG molecules were captured on a Nunc-lmmuno MaxiSorbTM plate via an immobilized goat anti-human IgG, Fey fragment - specific antibody, and detected via an anti-human kappa light chain peroxidase conjugated antibody.
- a standard curve was generated by capturing and detecting known concentrations of a standard IgG antibody on the same plate in the same way as follows. Each well of a 96-well immunoplate was coated with 100 mI aliquots of 0.4 pg/ml goat anti-human IgG antibody diluted in PBS and incubated overnight at 4 °C.
- the chimeric 11-1 F4 antibody was tested for binding to amyloid fibrils using a direct binding ELISA assay.
- Synthetic fibrils were formed from an immunoglobulin light chain protein and used to monitor the reactivity of the antibody in a solid-state ELISA-based assay using a "low- binding" polystyrene plates (Costar,# 3474).
- coating buffer 0.1 % bovine serum albumin in phosphate buffered saline pH 7.5.
- the sample was then sonicated for 20 sec using a Tekmar Sonic Disruptor sonicating probe, with the power set to 40% of maximum, resulting in a solution of short fibrils composed of up to 2-5 protofiliments each.
- This solution was then diluted to 5 ml, mixed well by vortex, and aliquoted into the wells of the plate. This process yielded 50 pi of fibril solution having a concentration of 50 pg/ ml in each well.
- the plate was then dried overnight by placing it uncovered in a 37 °C incubator.
- the ELISA assay was then performed as follows within 48 hours of preparing the plate.
- the wells were blocked by the addition of 100 pi of l% BSA in PBS and incubated for 1 hour at room temperature on a shaker.
- the plate was washed x3 in PBS, 0.05% Tween 20 (v/v).
- To each well of the plate was added 50 pi of a solution of c11-1 F4 (3pg/ml antibody in 0.1% BSA/PBS) and the plate incubated at room temperature for 1 hour on a shaker.
- the plate was again washed x3 (as before) and detection of bound antibody was accomplished using a biotinylated goat anti-mouse IgG antibody (Sigma# B- 8774, anti-heavy and light-chain).
- the 11-1 F4VK.pKN100 and 11-1 F4VHpG1 D200 constructs were also subsequently used to construct a single supervector (pG1 KD200-11-1 F4), which expressed the chimeric 11 - 1 F4 antibody in mammalian cells.
- the chimeric 11-1 F4 antibody expression levels, from both cotransfections and supervector transfections of ECACC COS cells were assayed.
- the chimeric 11-1 F4 antibody was tested for binding to target antigen (amyloid fibrils kindly supplied by the NCI) by direct binding ELISA.
- target antigen amyloid fibrils kindly supplied by the NCI
- the results of the binding ELISA are presented in Figure 8. Supenatants from the two best individual pG1 KD200- 11-1 F4 supervector transfections were assayed in parallel with one supernatant from the corresponding co-transfection.
- cGMP grade CAEL-101 was radiolabeled with 124 l, a positron emitting radioisotope used for PET imaging, with the standard iodegen reaction. (Fraker, et al. - Biochem Biophys Res Commun 80(4): 849-57; Markwell et at. - Biochem 17:4807-17) Approximately 5 days after human amyloid extract was implanted to form subcutaneous amyloidomas, the mice were injected with 50-200pCi of [ 124 l ]CAEL-101 and imaged 1 , 4 and 7 days post injection using an Inveon microPET scanner. SUVmax for amyloidomas and contralateral background were obtained by drawing regions of interest in the PMOD software package and calculating tumor-to-background (amyloid deposit-to-background) (T:B) ratios at 1 and 4 days post tracer infusion.
- T:B tumor-to-background ratios at 1 and 4 days post tracer infusion.
- [00153] [ 124 I]CAEL-101 successfully imaged 100% of mice bearing human amyloid extracts (k1 , A1 and A6 subtypes derived from heart, liver, spleen, and kidney). We demonstrated for the first time imaging of cardiac derived amyloidosis (shown in Figure 9), which was reported to not work in prior literature. (Wall, et at. - Blood. 2010 116:2241 ). Human amyloidomas were visualized at both 1 and 4 days post tracer infusion, with significantly increasing T:B ratio by day 4. T:B ratios ranged from 2.1 to 4.2 at 4 days. We found heterogeneous uptake among various amyloidomas.
- mice implanted with k subtypes demonstrated significantly better in vivo T:B ratios (4.1 +/- 0.20), compared to l subtypes (2.8 +/- 0.46), although all amyloidomas exhibited T:B uptake > 2.1 , which would be clinically significant.
- This result of heterogeneous uptake among the various amyloidomas supports using real time PET imaging to stratify patients for therapy with the chimeric or humanized antibody described herein as well as to determine the appropriate dose of the antibody therapy. That is, one may determine the dosing of a patient based on the detected uptake of the labeled antibody or antibody fragment.
- a patient showing strong uptake (affinity) for the labeled antibody or antibody fragment may require a smaller amount of therapeutic antibody or antibody fragment than a patient showing a weaker uptake (affinity) for the labeled antibody or antibody fragment.
- the present disclosure therefore provides a method of determining the appropriate dosage of the disclosed humanized or chimeric antibody for therapy comprising the steps of administering to the patient a labeled antibody or antibody fragment disclosed herein, determining the uptake of the labeled antibody or antibody fragment by the amyloid deposits of the patient, and administering a dose or series of doses of chimeric or humanized antibody or antibody fragment to the patient based on the determined amount of uptake of the labeled antibody or antibody fragment.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Animal Behavior & Ethology (AREA)
- Hematology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biochemistry (AREA)
- Urology & Nephrology (AREA)
- Epidemiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Organic Chemistry (AREA)
- Optics & Photonics (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Cell Biology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Food Science & Technology (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201862753410P | 2018-10-31 | 2018-10-31 | |
| PCT/US2019/058720 WO2020092474A1 (en) | 2018-10-31 | 2019-10-30 | Methods and compositions for imaging amyloid deposits |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP3873932A1 true EP3873932A1 (en) | 2021-09-08 |
| EP3873932A4 EP3873932A4 (en) | 2022-11-23 |
Family
ID=70462389
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP19880738.0A Pending EP3873932A4 (en) | 2018-10-31 | 2019-10-30 | Methods and compositions for imaging amyloid deposits |
Country Status (3)
| Country | Link |
|---|---|
| EP (1) | EP3873932A4 (en) |
| JP (2) | JP7337922B2 (en) |
| WO (1) | WO2020092474A1 (en) |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100427505C (en) * | 2004-08-19 | 2008-10-22 | 中国医学科学院基础医学研究所 | Anti-human tumor necrosis factor-related apoptosis-inducing ligand receptor DR5 monoclonal antibody (AD5-10) and its preparation method and use |
| US20090297439A1 (en) * | 2008-06-02 | 2009-12-03 | Metheresis Translational Research Sa, | Anti-met monoclonal antibody, fragments and derivatives thereof for use in tumor diagnosis, corresponding compositions and kits |
| US10213506B2 (en) * | 2014-08-26 | 2019-02-26 | University Of Tennessee Research Foundation | Targeting immunotherapy for amyloidosis |
| EP3544999A1 (en) * | 2016-11-23 | 2019-10-02 | Eisai R&D Management Co., Ltd. | Anti-folate receptor alpha antibodies and uses thereof |
| US11530257B2 (en) * | 2017-06-29 | 2022-12-20 | The Trustees Of Columbia University In The City Of New York | Chimeric antibodies for treatment of amyloid deposition diseases |
-
2019
- 2019-10-30 EP EP19880738.0A patent/EP3873932A4/en active Pending
- 2019-10-30 WO PCT/US2019/058720 patent/WO2020092474A1/en not_active Ceased
- 2019-10-30 JP JP2021523841A patent/JP7337922B2/en active Active
-
2023
- 2023-04-24 JP JP2023071033A patent/JP7654710B2/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| JP7654710B2 (en) | 2025-04-01 |
| JP2022512892A (en) | 2022-02-07 |
| WO2020092474A1 (en) | 2020-05-07 |
| EP3873932A4 (en) | 2022-11-23 |
| JP7337922B2 (en) | 2023-09-04 |
| JP2023093673A (en) | 2023-07-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230114726A1 (en) | Methods and compositions for treatment of amyloid deposition diseases | |
| US20240301047A1 (en) | Methods and compositions for imaging amyloid deposits | |
| US20230212273A1 (en) | Chimeric antibodies for treatment of amyloid deposition diseases | |
| EA013677B1 (en) | HUMAN MONOCLONAL ANTIBODIES AGAINST CD25 AND THEIR USE | |
| MX2010011955A (en) | Dual variable domain immunoglobulins and uses thereof. | |
| CN111108120A (en) | Antibody against human vascular endothelial growth factor receptor and application thereof | |
| JP7654710B2 (en) | System for detecting the presence, location and/or amount of amyloid deposits in the heart, system for determining the effectiveness of removal of amyloid deposits in the heart and system for monitoring disease progression of amyloid deposits in the heart - Patents.com | |
| US20230391873A1 (en) | Methods for treating mismatch repair deficient locally advanced rectal cancer using dostarlimab | |
| JP2025503176A (en) | Bispecific antibodies against CD3 and CD20 in combination therapy for treating diffuse large B-cell lymphoma - Patents.com | |
| CA3208566A1 (en) | Antibodies to igf2r and methods | |
| HK40035170A (en) | Methods and compositions for treatment of amyloid deposition diseases | |
| HK40028231A (en) | Chimeric antibodies for treatment of amyloid deposition diseases | |
| CN110498855A (en) | A kind of TIM-3 antibody and application thereof | |
| TW201305211A (en) | Novel homogeneous humanized antiproliferation antibodies |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20210528 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: DE Ref document number: 40059059 Country of ref document: HK |
|
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R079 Free format text: PREVIOUS MAIN CLASS: C07K0016180000 Ipc: A61K0051100000 |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20221024 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: A61K 103/00 20060101ALI20221018BHEP Ipc: A61K 101/02 20060101ALI20221018BHEP Ipc: A61K 39/395 20060101ALI20221018BHEP Ipc: C07K 16/18 20060101ALI20221018BHEP Ipc: A61K 51/10 20060101AFI20221018BHEP |
|
| P01 | Opt-out of the competence of the unified patent court (upc) registered |
Effective date: 20230314 |