EP3864030A1 - Compounds and methods for dcaf-mediated protein degradation - Google Patents
Compounds and methods for dcaf-mediated protein degradationInfo
- Publication number
- EP3864030A1 EP3864030A1 EP19871964.3A EP19871964A EP3864030A1 EP 3864030 A1 EP3864030 A1 EP 3864030A1 EP 19871964 A EP19871964 A EP 19871964A EP 3864030 A1 EP3864030 A1 EP 3864030A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- dcaf16
- residue
- conjugate
- seq
- substituted
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D495/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms
- C07D495/12—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms in which the condensed system contains three hetero rings
- C07D495/14—Ortho-condensed systems
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D211/00—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
- C07D211/04—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
- C07D211/06—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
- C07D211/36—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
- C07D211/60—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/55—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/555—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound pre-targeting systems involving an organic compound, other than a peptide, protein or antibody, for targeting specific cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07B—GENERAL METHODS OF ORGANIC CHEMISTRY; APPARATUS THEREFOR
- C07B59/00—Introduction of isotopes of elements into organic compounds ; Labelled organic compounds per se
- C07B59/002—Heterocyclic compounds
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D215/00—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems
- C07D215/02—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom
- C07D215/16—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
- C07D215/20—Oxygen atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
- C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
- C07D401/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
- C07D401/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D495/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms
- C07D495/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
- C07D495/04—Ortho-condensed systems
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07B—GENERAL METHODS OF ORGANIC CHEMISTRY; APPARATUS THEREFOR
- C07B2200/00—Indexing scheme relating to specific properties of organic compounds
- C07B2200/05—Isotopically modified compounds, e.g. labelled
Definitions
- Protein biosynthesis and degradation is a dynamic process which sustains normal cell metabolism.
- production of new proteins modulate proliferation and differentiation of cells and upon completion, these protein are degraded through one of two proteolytic mechanisms, the lysosome degradation system or the ubiquitin proteasome pathway.
- a majority of cellular proteins are degraded by the proteasome pathway, and the process is initiated via tagging of an ubiquitin.
- DCAFl6 DDB1- and CUL4-associated factor 16
- methods of modulating protein degradation based on a DCAF16- mediated process are also disclosed herein.
- a DDB1- and CUL4-associated factor 16 (DCAF16) conjugate comprising a DCAF16 protein covalently bound to a synthetic ligand at a cysteine residue, wherein the cysteine residue is at a position corresponding to residue 58, 100, 103, 119, 173, 177, 178, or 179 of SEQ ID NO: 1.
- a heterobifunctional degrader comprising a conjugated target protein biding moiety and a DDB1- and CUL4 -associated factor 16 (DCAF16) binding moiety.
- the target protein binding moiety and DCAF16 binding moiety are conjugated via a linker.
- CUL4-RBX1-DDB1 complex comprising: contacting CRL4 comprising a DCAF16 protein with a synthetic ligand for a time sufficient for the ligand to interact with a cysteine residue of the DCAF16 protein to form a CRL4-ligand complex, thereby modulating substrate selectivity of the CRL4 complex; wherein the synthetic ligand comprises a DCAF16-interacting portion linked to a substrate binding portion.
- Fig. IA-Fig. 1G illustrate an exemplary electrophilic bifunctional protein degrading compound that degrades nuclear FKBP12.
- Fig. 1A shows the structures of KB02-SLF, KB03- SLF, and KB05-SLF.
- Fig. 1A shows the structures of KB02-SLF, KB03- SLF, and KB05-SLF.
- IB shows the results of a Western blot using anti-FLAG antibody of cytosolic (FLAG-FKBP12) and nuclear (FLAG-FKBP12 NLS) FKBP12 proteins expressed by stable transduction in HEK293T cells following 8 hours or 24 hours of treatment with DMSO, KB02-SLF (2 mM), KB03-SLF (2 pM), or KB05-SLF (2 pM) and the bar graphs represent the quantification of the relative FKBP12 protein content, with DMSO-treated cells set to a value of 1. Data represent mean values ⁇ SEM for 3-10 biological replicates.
- Fig. 1C is a picture of immunofluorescent staining using anti-FLAG antibody of FLAG-FKBP12 NLS in HEK293T cells following treatment with DMSO or KB02- SLF (2 pM, 8 h).
- Fig. IE is the structure of non-electrophilic control compound (C-KB02-SLF).
- Fig. IF shows the results of a Western blot of FLAG-FKBP12 NLS in HEK293T cells treated with KB02-SLF or C-KB02-SLF (2 pM, 8 or 24 h).
- Fig 1G is a Western blot showing concentration-dependent degradation of FLAG-FKBP12 NLS by KB02- SLF in HEK293T cells (24 h treatment with indicated concentrations of KB02-SLF).
- FIG. 2A-Fig. 2F illustrate characterization of KB02-SLF-mediated degradation of nuclear FKBP12.
- Fig. 2A is a Western blot of anti-FLAG-immunoprecipitated FLAG-FKBP12 and FLAG-FKBP12 NLS proteins analyzed for ubiquitination using an anti-HA antibody.
- HEK293T cells stably expressing FLAG-FKBP12 or FLAG-FKBP12 NLS were transiently transfected with HA-Ubiquitin (HA-Ub) for 24 hours and then treated with DMSO or KB02- SLF (5 mM) in the presence of the proteasome inhibitor MG132 (10 mM) for 2 hours.
- the Western blotting shows KB02-SLF mediated polyubiquitination of nuclear (FLAG- FKBP12 NLS), but not cytosolic (FL AG-FKBP 12) in HEK293T cells.
- Fig. 2B is a Western blot showing KB02-SLF-mediated FLAG-FKBP12 NLS degradation is blocked by proteasome inhibitor MG132.
- Len-SLF is a bifunctional compound comprised of lenalidomide coupled to SLF and was used as a positive control.
- the bar graph represents quantification of the relative FKBP12 protein, with DMSO-treated cells set to a value of 1. Data represent mean values ⁇
- FIG. 2C is a Western blot showing KB02-SLF- mediated FLAG-FKBP12 NLS degradation is blocked by neddylation inhibitor MLN4924.
- HEK293T cells stably expressing FLAG-FKBP12 NLS were co-treated with KB02-SLF (1 mM) and MG132 (10 mM) or MLN4924 (1 mM) for 8 h.
- Len-SLF was used as a positive control.
- the bar graph represents quantification of the relative FKBP12 protein, with DMSO-treated cells set to a value of 1. Data represent mean values ⁇ SEM for 3-4 biological replicates. Statistical significance was calculated with unpaired two-tailed Student’s t-tests comparing DMSO- to KB02-SLF -treated samples with or without MLN4924. ***P ⁇ 0.001; ****P ⁇ 0.0001.
- Fig. 2D is a schematic for identifying KB02-SLF-recruited E3 ubiquitin ligases by anti-FLAG affinity enrichment coupled to mass spectrometry (MS)-based proteomics.
- HEK293T cells stably expressing FLAG-FKBP12 NLS were treated with DMSO or KB02-SLF (10 mM), respectively, for 2 hours in the presence of MG132 (10 mM).
- Light and heavy cells were then lysed, subject to anti-FLAG immunoprecipitation, and the affinity- enriched proteins combined, digested with trypsin, and analyzed by LC-MS/MS.
- Fig. 2E is a graph showing SILAC heavy/light (H/L) ratio values of proteins identified in anti-FLAG affinity enrichment experiments (outlined in part d), where a high ratio indicates proteins selectively enriched from cells treated with KB02-SLF.
- Fig. 2F is a picture of immunofluorescent staining using an anti-HA antibody showing nuclear localization of HA-DCAF16 (expressed by transient transfection in HEK293T cells). Scale bar, 10 pm.
- FIG. 3A-Fig. 3K illustrate DCAF16 mediated electrophilic bifunctional protein degrading compound-induced degradation of nuclear proteins.
- Fig. 3A is a Western blot of stably expressed FLAG-FKBP12 NLS in HEK293T cells transiently transduced with shRNAs targeting DCAF16 (sh_l and sh_2) or a control shRNA (shLuc) followed by treatment with KB02-SLF (2 mM, 8 h).
- Middle graph quantification of the relative FKBP12 protein content, with DMSO-treated cells expressing shLuc set to a value of 1. Data represent mean values ⁇ SEM for 4 biological replicates.
- Fig. 3B is a Western blot showing a concentration-dependent degradation of stably expressed FLAG-FKBP 12 NLS in DCAF16+/+ (clone 6) and DCAF16-/- (clone 3) HEK293 cells following treatment with KB02-SLF for 8 hours. Bar graphs represent the quantification of the relative FKBP12 protein content, with DMSO-treated cells set to a value of 1.
- FIG. 3C is a Western blot showing that expression of HA-DCAF16 in DCAF16-/- cells restored KB02-SLF-mediated degradation of FLAG-FKBP 12 NLS.
- DCAF16- /- cells were transiently transfected with FLAG-FKBP 12 NLS and either HA-DCAF16 or empty pRK5 vector as a control for 24 hours and then treated with KB02-SLF (1.5 mM, 8 hours).
- Bar graph represents the quantification of the relative FKBP12 protein content, with DMSO-treated cells set to a value of 1. Data represent mean values ⁇ SEM for 3 biological replicates. Statistical significance was calculated with unpaired two-tailed Student’s t-tests comparing DMSO- to KB02-SLF -treated samples. **P ⁇ 0.01. Fig.
- 3D is a Western blot showing a higher molecular weight (HMW) form of HA-DCAF16 is observed in HEK293T cells treated with KB02-SLF (0.4 or 2 pM, 2 h in the presence of 10 pM MG132), and this HMW form, but not the lower molecular weight (LMW) form of HA-DCAF16 co- immunoprecipitated with FLAG-FKBP 12 NLS.
- Fig. 3E is, on the left, a schematic
- Fig. 3F is a MS/MS spectrum of KB02-PEG0-SLF-modified, triply charged DCAF16 peptide (amino acids 168-184). The b- and y-ions are shown along with the peptide sequence.
- Fig. 3G shows the structure of covalent bifunctional protein degrading compound KB02-JQ1.
- Fig. 3H is a Western blot showing concentration-dependent degradation of endogenous BRD4 in HEK293T cells following treatment with KB02-JQ1 for 24 hours.
- the bar graph is a quantification of the relative BRD4 level.
- the BRD4 level from DMSO-treated cells is set to 1.
- Data represent mean values ⁇ SEM for 3 biological replicates.
- Statistical significance was calculated with unpaired two-tailed Student’s t-tests comparing DMSO- to KB02-JQ1 -treated samples. **P ⁇ 0.01; ****P ⁇ 0.0001.
- Fig. 31 is a Western blot showing KB02-JQ1 -mediated BRD4 degradation is blocked by proteasome inhibitor MG132 and neddylation inhibitor MLN4924.
- HEK293T cells were preincubated with 10 pM MG132 or 1 pM MLN4924 for 4 hours, followed by 20 hours of treatment with 20 pM KB02-JQ1 and 10 pM MG132 or 1 pM MLN4924.
- Fig. 3J is a Western blot of FLAG tagged BRD4 co-immunoprecipitated with HA-DCAF16 in the presence of KB02-JQ1.
- HEK293T cells were co-transfected with BRD4-FLAG and HA-DCAF16 or pRK5 vector for 24 h and treated with 10 mM KB02-JQ1 or DMSO and 10 mM MG132 for 2 hours.
- 3K is a Western blot showing degradation of BRD4 in HEK293 DCAF16+/+ (clone 6) and -/- (clone 3 and 4) cells following 24 hours of treatment with 40 mM KB02-JQ1.
- the bar graph represents quantification of the relative BRD4 protein content, with DMSO-treated cells set to a value of 1. Data represent mean values ⁇ SEM for 3 biological replicates. Statistical significance was calculated with unpaired two-tailed Student’s t-tests comparing DMSO- to KB02-JQ1- treated samples. ***P ⁇ 0.001.
- Fig. 4A-Fig. 4C illustrate stable expression of FLAG-FKBP12 and FLAG- FKBP12 NLS in HEK293T cells and characterization of a lenalidomide-SLF bifunctional protein degrading compound.
- Fig. 4A is a Western blot after subcellular fractionation of stably expressed FLAG-FKBP12 and FLAG-FKBP12 NLS in HEK293T cells and characterization of a lenalidomide-SLF bifunctional compound as a positive control.
- Fig. 4B shows the structure of lenalidomide-SLF.
- Fig. 4C is a Western blot showing the concentration-dependent degradation of stably expressed FLAG-FKBP12 and FL AG-FKBP 12 NLS in HEK 293T cells following treatment with lenalidomide-SLF for 4 hours or 24 hours.
- FIG. 5A-Fig. 5D illustrate characterization of KB02-SLF bifunctional protein degrading compound.
- Fig. 5A is a Western blot showing time-dependent degradation of FLAG- FKBP12 NLS in HEK293T cells treated with KB02-SLF (2 mM).
- Fig. 5B shows structures of KB02-PEG0-SLF, KB02-SLF, and KB02-PEG4-SLF and a Western blot of FLAG- FKBP12 NLS following treatment of HEK293T cells with KB02-PEG0-SLF, KB02-SLF, or KB02-PEG4-SLF (0.5-2 mM, 8 hours).
- Fig. 5A is a Western blot showing time-dependent degradation of FLAG- FKBP12 NLS in HEK293T cells treated with KB02-SLF (2 mM).
- Fig. 5B shows structures of KB02-PEG0-SLF, KB02
- FIG. 5C shows structures of SLF, KB02, and KB02- PEG2 and a Western blot of FL AG-FKBP 12 NLS in HEK293T cells following treatment of HEK293T cells with KB02, KB02-PEG2, SLF, or the combination of SLF and KB02 or KB02- PEG2 (1.5 mM, 8 hours).
- Fig. 5D is a Western blot showing that the degradation of FLAG- FKBP12 NLS by KB02-SLF (2 mM, 8 hours) is blocked by excess SLF (25 mM).
- FIG. 6 is a picture of a Western blot showing that KB02-SLF induced K48-linked polyubiquitination on FLAG-FKBP12 NLS.
- HEK293T cells stably expressing FLAG- FKBPl2_NLS were treated with KB02-SLF (5 mM) and MG132 (10 mM) for 2 hours, and FLAG-FKBP12 NLS was then immunoprecipitated and analyzed by western blotting for K48- linked ubiquitination.
- FIG. 7A-Fig. 7E illustrate KB02-SLF degradation of FL AG-FKBP 12 NLS in MDA- MB-231 cells.
- Fig. 7A is a picture of a Western blot showing that KB02-SLF degrades FLAG- FKBPl2_NLS in MDA-MB-231 cells.
- MDA-MB-231 cells were treated with 1 mM of KB02- PEG0-SLF, KB02-SLF or KB02-PEG4-SLF for 8 hours.
- FIG. 7B is a picture of a Western blot showing degradation of stably expressed FLAG-FKBP12 NLS in MDA-MB-231 cells following treatment with KB02-PEG0-SLF, KB02-SLF or KB02-PEG4-SLF (1 mM, 8 hours) is blocked by proteasome inhibitor MG132.
- Fig. 7C is a picture of a Western blot showing degradation of stably expressed FLAG-FKBP12 NLS in MDA-MB-231 cells following treatment with KB02-PEG0-SLF, KB02-SLF or KB02-PEG4-SLF (1 mM, 8 hours) is blocked by neddylation inhibitor MLN4924.
- FIG. 7D is a schematic for identifying KB02-SLF-recruited E3 ubiquitin ligases by anti-FLAG affinity enrichment coupled to mass spectrometry (MS)- based proteomics.
- Light and heavy amino acid-labeled MDA-MB-231 cells stably expressing FLAG-FKBP12 NLS were treated with DMSO or KB02-SLF (10 mM), respectively, for 2 hours in the presence of MG132 (10 mM).
- Light and heavy cells were then lysed, subject to anti-FLAG immunoprecipitation, and the affinity-enriched proteins combined, digested with trypsin, and analyzed by LC-MS/MS.
- Fig. 7E is a graph of the SILAC heavy/light (H/L) ratio values of proteins identified in anti-FLAG affinity enrichment experiments (outlined in part d). A high ratio indicates proteins selectively enriched from cells treated with KB02-SLF.
- FIG. 8A-Fig. 8D illustrate characterization of KB02-SLF-recruited E3 ubiquitin ligase(s) in HEK293T cells by anti-FLAG affinity enrichment coupled to mass spectrometry (MS)-based proteomics.
- Fig. 8A is a schematic for a control affmity-enrichment-MS-based proteomics experiment, where light and heavy amino acid-labeled HEK293T cells stably expressing pCDH empty vector were treated for 2 hours with DMSO or KB02-SLF (10 mM), respectively in the presence of 10 mM MG132 (10 mM).
- Fig. 8B is a chart of the SILAC H/L ratio and spectral count (SC) values for E3 ligase proteins and FKBP12 enriched by anti-FLAG immunoprecipitation from HEK239T cells stably expressing FLAG-FKBP12 NLS, but not enriched from control HEK293T cells expressing empty pCDH vector.
- SC SILAC H/L ratio and spectral count
- Fig 8D shows shRNA-mediated DCAF16 knockdown attenuated KB02-SLF-dependent polyubiquitination of FLAG-FKBP12 NLS in HEK293T cells stably expressing FLAG-FKBP12 NLS that were transiently transduced with an shRNA targeting DCAF16 (shDCAFl6) or a control shRNA (shLuc) and treated with KB02-SLF (5 mM) and MG132 (10 mM) for 2 hours.
- shDCAFl6 shRNA targeting DCAF16
- shLuc control shRNA
- FIG. 9A-Fig. 9H illustrate Generation of DC AF 16-/- HEK293 cells using CRISPR/Cas 9 and characterization of KB02-SLF -mediated degradation of FLAG-FKBP12 NLS in cells.
- Fig. 9A shows indel analysis of three DCAF16+/+ clones (clones 6, 17, and 18) and three DCAF16-/- clones (clones 3, 4, and 22) in HEK293 cells.
- Fig. 9A shows indel analysis of three DCAF16+/+ clones (clones 6, 17, and 18) and three DCAF16-/- clones (clones 3, 4, and 22) in HEK293 cells.
- FIG. 9B is a schematic for measuring DCAF16 content in DCAF16+/+ and DCAF16-/- clones by anti-FLAG affinity enrichment coupled to MS-based proteomics of KB02-SLF -treated HEK293 cells stably expressing FLAG- FKBP12 NLS.
- Light and heavy amino acid-labeled cells from clones shown in the schematic were treated with DMSO or KB02-SLF (10 mM), respectively, for 2 h in the presence of MG132 (10 pM).
- Light and heavy cells were then lysed, subject to anti-FLAG immunoprecipitation, and the affinity-enriched proteins combined, digested with trypsin, and analyzed by LC-MS/MS.
- Fig. 9C is a table and a graph showing SILAC heavy/light ratio and spectra count (SC) of DCAF16, DDB1 and FKBP12 content from indicated DCAF16+/+ and DCAF16-/- clones analyzed as described in Fig. 9B.
- SC SILAC heavy/light ratio and spectra count
- Fig. 9D through Fig. 9G show concentration-dependent degradation of stably expressed FLAG-FKBP 12 NLS in each of the six clones of DCAF16+/+ and DCAF16-/- HEK293 cells treated with KB02-SLF (0.2-5 pM, 8 h).
- Fig. 9H is a bar graph representing the quantification of the relative HA- DCAF16 content in Fig. 9C, where the HA-DCAF16 level with DMSO-treated cells set to a value of 1.
- Fig. IOA-Fig. 10F illustrate KB02-SLF mediation of a ternary complex interaction between FLAG-FKBP 12 NLS and HA-DCAF16.
- Fig. 10A is a Western blot showing KB02- SLF mediates a ternary complex interaction between FLAG-FKBP 12 NLS and HA-DCAF16.
- the higher molecular weight (HMW) form of FLAG-FKBP 12 NLS which was co- immunoprecipitated with HA-DCAF16 in the presence of KB02-PEG0-SLF, KB02-SLF or KB02-PEG4-SLF.
- HEK293T cells stably expressing FLAG-FKBP 12 NLS were transfected with HA-DCAF16 for 24 hours and then treated with KB02-PEG0-SLF, KB02-SLF or KB02- PEG4-SLF (5 pM) in the presence of MG132 (10 pM) for 2 hours.
- Fig. 10B is a picture of a Western blot showing concentration-dependent co-immunoprecipitation of the HMW form of FLAG-FKBP 12_NLS with HA-DCAF16 in HEK293T cells treated with KB02-SLF in the presence of MG132 (10 pM) for 2 hours.
- FIG. 10E are pictures of Western blots showing FLAG-FKBP 12 NLS co-immunoprecipitated with HA-DCAF16 in the presence of KB02-SLF, but not C-KB02-SLF, KB03-SLF, or KB05-SLF.
- HEK293T cells stably expressing FLAG-FKBP 12 NLS were transfected with HA-DCAF16 for 24 h and the treated with KB02- SLF, C-KB02-SLF, KB03-SLF or KB05-SLF (5 mM) in the presence of MG132 (10 mM) for 2 hours.
- Fig. 10F is a Western blot showing the higher molecular weight (FDVTW) form of FLAG- FKBP12 NLS co-immunoprecipitated with HA-DCAF16 in the presence of KB02-SLF.
- FDVTW higher molecular weight
- HEK293T cells stably expressing pCDH empty vector or FLAG-FKBP 12 NLS were transfected with HA-DCAF16 for 24 hours and then treated with DMSO or KB02-SLF (5 mM) in the presence of MG132 (10 mM) for 2 hours.
- Fig. llA-Fig. 11C illustrate MS analysis KB02-PEG9-SLF-modified cysteine(s) in DCAF16.
- Fig. 11A is an MS analysis of KB02-PEG0-SLF-modified cysteine(s) in DCAF16.
- EICs extracted ion chromatograms
- Bottom MS1 spectra of triply charged
- DCAF16 tryptic peptide (amino acids 168-184) and KB02-PEG0-SLF-modified, triply charged DCAF16 tryptic peptide (amino acids 168-184).
- Fig. 11B Top: extracted ion chromatograms (EICs) for DCAF16 tryptic peptide (amino acids 97-106) with or without the predicted KB02- PEG0-SLF modification.
- Bottom MS1 spectrum of triply charged DCAF16 tryptic peptide (amino acids 97-106).
- FIG. 12A-Fig. 12C illustrate analysis by site-directed mutagenesis of the contributions of cysteines on the KB02-SLF-modified DCAF16 peptide to KB02-SLF-mediated degradation of FLAG-FKBP 12 NLS .
- Fig. 12A is a picture of a Western blot of FLAG-FKBP 12_NLS in DCAF16-/- HEK293 cells expressing WT or C173S, C177S, C178S, or C179S mutants of HA- DCAF16 (or empty pRK5 vector control) following treatment with KB02-SLF (1.5 mM, 8 hours).
- Fig. 12B is a picture of a Western blot of FLAG-FKBP 12 NLS in DCAF16-/- HEK293 cells expressing WT or C58S mutant of HA-DCAF16 (or empty pRK5 vector control) following treatment with KB02-SLF (1.5 mM, 8 hours).
- Fig. 12B is a picture of a Western blot of FLAG-FKBP 12 NLS in DCAF16-/- HEK293 cells expressing WT or C58S mutant of HA-DCAF16 (or empty pRK5 vector control) following treatment with KB02-SLF (1.5 mM, 8 hours).
- FIG. 12C is a picture of a Western blot showing KB02-SLF-mediated interaction between the HMW form of WT or mutant HA-DCAF16 and FLAG-FKBP 12 NLS as determined by co-immunoprecipitation.
- the graph to the right represents quantification of the relative HA-DCAF16 protein content, with DMSO-treated cells set to a value of 1.
- Data represent mean values ⁇ SEM for 3 biological replicates. Statistical significance was calculated with unpaired two-tailed Student’ s t-tests comparing DCAF16 mutant to DCAF16 WT. ***P ⁇
- Fig. 13 is a graph representing cell viability of HEK293T cells treated with KB02-SLF, KB02, or KB02-JQ1 for 24 hours. Data represent mean values ⁇ SEM for 3 biological replicates.
- Fig. 14A- Fig. 14C represent a competitive activity -based protein profiling (ABPP) analysis of the fractional engagement of cysteines in DCAF16 by KB02-SLF and KB02-JQ1.
- ABPP competitive activity -based protein profiling
- Fig 14A is a schematic of quantifying the engagement of cysteines in endogenous DCAF16 in cells treated with KB02-SLF (2 mM) or KB02-JQ1 (20 mM) by competitive ABPP performed with tandem-mass tagging (TMT).
- Fig. 14B is a plot of relative cysteine reactivity
- 14C represents competitive ABPP results measuring relative reactivity (DMSO/KB02-bifunctional) of Cl 19- and Cl73/Cl77-l79-containing DCAF16 tryptic peptides from DMSO-, 2 pM KB02-SLF-, or 20 pM KB02-JQ1 -treated HEK293T cells, with the peptide signals from DMSO-treated cells set to a value of 1.
- IA- reactivity was variably assigned to Cl 73 or Cl 77, and these signals were integrated to provide the average engagement data.
- Fig. 15 shows loglO fold-change in protein abundance between heavy- and light- isotopically labeled HEK293T cells treated with, in the top plot, KB02-JQ1 (20 pM, heavy), and in the bottom plot KB02-SLF (2 pM, heavy), or DMSO (light), for 24 hours.
- the average relative loglO abundance of each protein is normalized to the average loglO abundance of proteins in control DMSO/DMSO samples (to account for slight deviations in heavy isotope incorporation).
- This targeted protein degradation approach leverages two types of small molecules - those that form tripartite complexes with specific E3 ubiquitin ligases and neosubstrate proteins (e.g., the IMiD class of therapeutics) and bifunctional compounds, e.g. proteolysis-targeting chimeras, which couple E3 ligase ligands to substrate ligands via a variably structured linker.
- targeted protein degradation acts in a catalytic manner (Bondeson, 2015) that lowers the drug concentrations required to produce a pharmacological effect and operate sub-stoichiometrically to avoid antagonizing the natural functions of the participating E3 ligase.
- DCAFl6 DDB1- and CUE4-associated factor 16
- methods of modulating protein degradation based on a DCAFl6-mediated process are also disclosed herein.
- the DDB1- and CUL4-associated factor (DCAF) protein class also known as DWD (DDB 1 -binding WD40) and CDW (Cul4-DDBl -associated WD40 repeat), is a group of cofactors which function as substrate receptors in the CUE4-RBX1-DDB1 complex (CRL4), an E3 ligase that falls under the CRL subgroup of the RING finger family.
- DCAF 16 DDB1- and CUL4-associated factor 16
- the CRL4 complex comprises the adaptor protein DDB1, which connects the substrate receptor DCAF to the Cullin 4 (CUE4) scaffold.
- the Cullin 4 scaffold further binds to RBX1.
- ETpon substrate binding the CUL4-RBX1-DDB1 complex bridges the substrate to the E2- ubiquitin to initiate a direct transfer of ubiquitin molecule onto the substrate.
- a DCAF 16 conjugate that comprises a DCAF 16 protein covalently bound to a synthetic ligand at a cysteine residue.
- the cysteine residue is at a position corresponding to residue 58, 100, 103, 119, 173, 177, 178, or 179 of SEQ ID NO: 1.
- the cysteine residue is at a position corresponding to residue 58, 173, 177, 178, or 179 of SEQ ID NO: 1.
- the cysteine residue is at a position corresponding to residue 173, 177, 178, or 179 of SEQ ID NO: 1.
- the cysteine residue is at a position corresponding to residue 177 or 179 of SEQ ID NO: 1. In some instances, the cysteine residue is at a position corresponding to residue 58, 100, 103, or 119 of SEQ ID NO: 1. In some instances, the cysteine residue is at a position corresponding to residue 100, 103, or 119 of SEQ ID NO: 1. In some instances, the cysteine residue is at a position corresponding to residue 173 or 178 of SEQ ID NO: 1.
- the synthetic ligand is covalently bound to DCAF16 residue C58, C100, C103, Cl 19, C173, C177, C178, or C179 of SEQ ID NO: 1. In some cases, the synthetic ligand is covalently bound to DCAF16 residue C58, C173, C177, C178, or C179 of SEQ ID NO: 1. In some cases, the synthetic ligand is covalently bound to DCAF16 residue C173, C177, C178, or C179 of SEQ ID NO: 1. In some cases, the synthetic ligand is covalently bound to DCAF16 residue C177 or C179 of SEQ ID NO: 1.
- the synthetic ligand is covalently bound to DCAF16 residue C58, C100, C103, or Cl 19 of SEQ ID NO: 1. In some cases, the synthetic ligand is covalently bound to DCAF16 residue C100, C103, or Cl 19 of SEQ ID NO: 1. In some cases, the synthetic ligand is covalently bound to DCAF16 residue C173 or C178 of SEQ ID NO: 1. In some cases, the synthetic ligand is covalently bound to DCAF16 residue C58 of SEQ ID NO: 1. In some cases, the synthetic ligand is covalently bound to DCAF16 residue C100 of SEQ ID NO: 1. In some cases, the synthetic ligand is covalently bound to DCAF16 residue C103 of SEQ ID NO: 1.
- the synthetic ligand is covalently bound to DCAF16 residue Cl 19 of SEQ ID NO: 1. In some cases, the synthetic ligand is covalently bound to DCAF16 residue C173 of SEQ ID NO: 1. In some cases, the synthetic ligand is covalently bound to DCAF16 residue C177 of SEQ ID NO: 1. In some cases, the synthetic ligand is covalently bound to DCAF16 residue C178 of SEQ ID NO: 1.
- the DCAF16 protein comprises a sequence identity that is about 80%, 85%, 90%, 95%, or 99% to SEQ ID NO: 1.
- the synthetic ligand is covalently bound to the DCAF16 protein comprising about 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 1.
- the synthetic ligand comprises a structure represented by Formula I:
- CRG-L is optional, and when present is a covalent reactive group comprising a Michael acceptor moiety, a leaving group moiety, or a moiety capable of forming a covalent bond to the thiol group of a cysteine residue, and L is a linker;
- MRE is a molecular recognition element that is capable of interacting with DCAF16; and R M is optional, and when present comprises a binding element that binds to a second protein or another compound.
- MRE is covalently bound to the cysteine residue at a position corresponding to residue 58, 173, 177, 178, or 179 of SEQ ID NO: 1. In some cases, MRE is covalently bound to the cysteine residue at a position corresponding to residue 173, 177, 178, or 179 of SEQ ID NO: 1. In some cases, MRE is covalently bound to the cysteine residue at a position corresponding to residue 177 or 179 of SEQ ID NO: 1. In some cases, MRE is covalently bound to the cysteine residue at a position corresponding to residue 58, 100, 103, or 119 of SEQ ID NO: 1.
- MRE is covalently bound to the cysteine residue at a position corresponding to residue 100, 103, or 119 of SEQ ID NO: 1. In some cases, MRE is covalently bound to the cysteine residue at a position corresponding to residue 173 or 178 of SEQ ID NO: 1.
- MRE is covalently bound to the cysteine residue of DCAF16 comprising about 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 1.
- DCAF16 proteins comprising a modification at cysteine Cl 73 of SEQ ID NO: 1, wherein the cysteine forms an adduct with a reactive compound.
- a DCAF16 homolog, active fragment, or variant thereof is modified at a cysteine position equivalent to C173 of SEQ ID NO: 1.
- one or more additional residues in DCAF16 forms a non-covalent interaction with a compound described herein.
- the non-covalent interaction is a hydrophobic interaction, charged interaction (e.g., either positively charged or negatively charged
- DCAF16 proteins comprising a modification at cysteine C177 of SEQ ID NO: 1, wherein the cysteine forms an adduct with a reactive compound.
- a DCAF16 homolog, active fragment, or variant thereof is modified at a cysteine position equivalent to C177 of SEQ ID NO: 1.
- one or more additional residues in DCAF16 forms a non-covalent interaction with a compound described herein.
- the non-covalent interaction is a hydrophobic interaction, charged interaction (e.g., either positively charged or negatively charged
- DCAF16 proteins comprising a modification at cysteine C178 of SEQ ID NO: 1, wherein the cysteine forms an adduct with a reactive compound.
- a DCAF16 homolog, active fragment, or variant thereof is modified at a cysteine position equivalent to C178 of SEQ ID NO: 1.
- one or more additional residues in DCAF16 forms a non-covalent interaction with a compound described herein.
- the non-covalent interaction is a hydrophobic interaction, charged interaction (e.g., either positively charged or negatively charged
- DCAF16 proteins comprising a modification at cysteine C179 of SEQ ID NO: 1, wherein the cysteine forms an adduct with a reactive compound.
- a DCAF16 homolog, active fragment, or variant thereof is modified at a cysteine position equivalent to C179 of SEQ ID NO: 1.
- one or more additional residues in DCAF16 forms a non-covalent interaction with a compound described herein.
- the non-covalent interaction is a hydrophobic interaction, charged interaction (e.g., either positively charged or negatively charged
- a heterobifunctional degrader comprising a DCAF16 protein binding moiety, a linker, and a target protein binding moiety.
- the heterobifunctional degrader modifies DCAF16 protein at cysteine Cl 73 of SEQ ID NO: 1 or corresponding cysteine of a cereblon homolog, active fragment, or variant thereof, wherein the cysteine forms an adduct with a reactive compound.
- one or more additional residues in DCAF16 forms a non-covalent interaction with a compound described herein.
- the non-covalent interaction is a hydrophobic interaction, charged interaction (e.g., either positively charged or negatively charged interaction), polar interaction, H-bonding, salt bridge, pi-pi stacking, or pi-cation interaction.
- the Michael acceptor moiety comprises an alkene or an alkyne moiety. In some cases, the Michael acceptor moiety comprises an alkene moiety.
- MRE comprises a small molecule compound, a polynucleotide, a polypeptide or fragments thereof, or a peptidomimetic.
- MRE is a small molecule compound.
- MRE is a polynucleotide.
- MRE is a polypeptide or fragments thereof.
- MRE is a peptidomimetic.
- the synthetic ligand has a structure represented by Formula (II A) or Formula (IIB):
- each R A and R B is independently selected from the group consisting of H, D, substituted or unsubstituted Ci-C 6 alkyl, substituted or unsubstituted Ci-C 6 fluoroalkyl, substituted or unsubstituted Ci-C 6 heteroalkyl, substituted or unsubstituted Cri-Cxcycloalkyl, substituted or unsubstituted C2-C 7 heterocycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted Ci-C 3 alkylene-aryl, substituted or unsubstituted heteroaryl, and substituted or unsubstituted Ci-C3alkylene-heteroaryl; or
- R 1 is H, D, substituted or unsubstituted Ci-C 6 alkyl, substituted or unsubstituted Ci-
- C 6 fluoroalkyl substituted or unsubstituted Ci-C 6 heteroalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.
- R A is H or D.
- R B is substituted or unsubstituted aryl or substituted or unsubstituted heteroaryl. In some embodiments, R B is substituted or unsubstituted aryl. In some embodiments, R B is substituted or unsubstituted heteroaryl.
- R B is substituted aryl.
- R B is aryl, substituted with one or more substituents selected from the group consisting of halogen, Ci- C 4 fluoroalkyl, -CN, and -N0 2.
- R A and R B together with the nitrogen to which they are attached form a substituted or unsubstituted 6 or 7-membered heterocyclic ring A.
- ring A is a 6-membered heterocyclic ring.
- ring A is 6-membered heterocyclic ring substituted with substituted or unsubstituted aryl or substituted or unsubstituted heteroaryl.
- ring A is 6-membered heterocyclic ring fused with substituted or unsubstituted aryl or substituted or unsubstituted heteroaryl.
- the synthetic ligand has a structure represented by Formula (III):
- the synthetic ligand is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
- L is a linker capable of positioning a neosubstrate (e.g., a substrate that is not the native substrate of a CUL4-RBX1-DDB1 complex described above) to be ubiquitinated by the E2 enzyme.
- L is a cleavable linker.
- L is a non-cleavable linker.
- L is a polymeric linker (e.g., a water-soluble polymeric linker).
- L is a polyethylene glycol (PEG) molecule.
- the PEG molecule is a discrete PEG, in which the discrete PEG is a polymeric PEG comprising more than one repeating ethylene oxide units.
- a discrete PEG (dPEG) comprises from 2 to 60, from 2 to 50, or from 2 to 48 repeating ethylene oxide units.
- a dPEG comprises about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 35, 40, 42, 48, 50 or more repeating ethylene oxide units.
- a dPEG comprises about 2 or more repeating ethylene oxide units.
- a dPEG comprises about 3 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 4 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 5 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 6 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 7 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 8 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 9 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 10 or more repeating ethylene oxide units.
- a dPEG comprises about 11 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 12 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 13 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 14 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 15 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 16 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 17 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 18 or more repeating ethylene oxide units.
- a dPEG comprises about 19 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 20 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 22 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 24 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 26 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 28 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 30 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 35 or more repeating ethylene oxide units.
- a dPEG comprises about 40 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 42 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 48 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 50 or more repeating ethylene oxide units. In some cases, a dPEG is
- a dPEG has a specific molecular weight, rather than an average molecular weight.
- a dPEG described herein is a dPEG from Quanta Biodesign, LMD.
- L is an alkyl group, e.g., a Ci-Cio alkyl group (e.g., a C9, C 8 , C 7 , C 6 , C5, C 4 , C 3 , C 2 , or Ci alkyl group).
- L is a homobifunctional cross linker.
- Exemplary homobifunctional linkers include, but are not limited to, Lomant's reagent dithiobis (succinimidylpropionate) DSP, 3'3'-dithiobis(sulfosuccinimidyl proprionate (DTSSP), disuccinimidyl suberate (DSS), bis(sulfosuccinimidyl)suberate (BS), disuccinimidyl tartrate (DST), disulfosuccinimidyl tartrate (sulfo DST), ethylene glycobis(succinimidylsuccinate) (EGS), disuccinimidyl glutarate (DSG), N,N'-disuccinimidyl carbonate (DSC), dimethyl adipimidate (DMA), dimethyl pimelimidate (DMP), dimethyl suberimidate (DMS), dimethyl-3, 3'-dithiobispropionimidate (DTBP), l,4-di- 3
- DFDNPS 4,4'-difluoro-3,3'-dinitrophenylsulfone
- BASED bis-[p-(4- azidosalicylamido)ethyl]disulfide
- formaldehyde glutaraldehyde
- l,4-butanediol diglycidyl ether adipic acid dihydrazide, carbohydrazide, o-toluidine, 3,3'-dimethylbenzidine, benzidine, a,a'-p-diaminodiphenyl, diiodo-p-xylene sulfonic acid, N,N'-ethylene- bis(iodoacetamide), or N,N'-hexamethylene-bis(iodoacetamide).
- L is a heterobifunctional cross linker.
- exemplary heterobifunctional linker include, but are not limited to, amine-reactive and sulfhydryl cross-linkers such as N- succinimidyl 3-(2-pyridyldithio)propionate (sPDP), long-chain N-succinimidyl 3-(2- pyridyldithio)propionate (LC-sPDP), water-soluble-long-chain N-succinimidyl 3-(2- pyridyldithio) propionate (sulfo-LC-sPDP), succinimidyloxycarbonyl-a-methyl-a-(2- pyridyldithio)toluene (sMPT), sulfosuccinimidyl-6-[a-methyl-a-(2- pyridyldithio)toluamido]hexanoate (sulfo-
- L is a peptide linker.
- the peptide linker comprises at least 2, 3, 4, 5, or 6 more amino acid residues. In some instances, the peptide linker comprises at most 2, 3, 4, 5, 6, 7, or 8 amino acid residues. In some instances, the peptide linker comprises about 2, about 3, about 4, about 5, or about 6 amino acid residues.
- the peptide linker is a cleavable peptide linker (e.g., either enzymatically or chemically). In some instances, the peptide linker is a non-cleavable peptide moiety.
- the peptide linker comprises Val-Cit (valine-citrulline), Gly-Gly-Phe-Gly, Phe-Lys, Val-Lys, Gly- Phe-Lys, Phe-Phe-Lys, Ala-Lys, Val-Arg, Phe-Cit, Phe-Arg, Leu-Cit, Ile-Cit, Trp-Cit, Phe-Ala, Ala-Leu- Ala-Leu, or Gly-Phe-Leu-Gly.
- Val-Cit valine-citrulline
- the compound of Formula (I), Formula (IIA), Formula (IIB), or Formula (III) possesses one or more stereocenters and each stereocenter exists independently in either the R or S configuration.
- the compounds presented herein include all diastereomeric, enantiomeric, and epimeric forms as well as the appropriate mixtures thereof.
- the compounds and methods provided herein include all cis, trans, syn, anti,
- E
- Z
- isomers as well as the appropriate mixtures thereof.
- compounds described herein are prepared as their individual stereoisomers by reacting a racemic mixture of the compound with an optically active resolving agent to form a pair of diastereoisomeric compounds/salts, separating the diastereomers and recovering the optically pure enantiomers.
- resolution of enantiomers is carried out using covalent diastereomeric derivatives of the compounds described herein.
- diastereomers are separated by separation/resolution techniques based upon differences in solubility.
- separation of stereoisomers is performed by chromatography or by the forming diastereomeric salts and separation by recrystallization, or chromatography, or any combination thereof. Jean Jacques, Andre Collet, Samuel H. Wilen,“Enantiomers, Racemates and Resolutions”, John Wiley And Sons, Inc., 1981.
- stereoisomers are obtained by stereoselective synthesis.
- the compounds described herein are labeled isotopically (e.g. with a radioisotope) or by another other means, including, but not limited to, the use of chromophores or fluorescent moieties, bioluminescent labels, or chemiluminescent labels.
- Compounds described herein include isotopically-labeled compounds, which are identical to those recited in the various formulae and structures presented herein, but for the fact that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number usually found in nature.
- isotopes that can be incorporated into the present compounds include isotopes of hydrogen, carbon, nitrogen, oxygen, sulfur, fluorine and chlorine, such as, for example, 2 H, 3 H, 13 C, 14 C, 15 N, 18 0, 17 0, 35 S, 18 F, 36 Cl.
- isotopically-labeled compounds described herein for example those into which radioactive isotopes such as 3 H and 14 C are incorporated, are useful in drug and/or substrate tissue distribution assays.
- substitution with isotopes such as deuterium affords certain therapeutic advantages resulting from greater metabolic stability, such as, for example, increased in vivo half-life or reduced dosage requirements.
- acceptable salts include, but are not limited to: (1) acid addition salts, formed by reacting the free base form of the compound with an acceptable: inorganic acid, such as, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, metaphosphoric acid, and the like; or with an organic acid, such as, for example, acetic acid, propionic acid, hexanoic acid, cyclopentanepropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, malic acid, maleic acid, fumaric acid, trifluoroacetic acid, tartaric acid, citric acid, benzoic acid, 3-(4-hydroxybenzoyl)benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, l,2-ethaned
- compounds described herein may coordinate with an organic base, such as, but not limited to, ethanolamine, diethanolamine, triethanolamine, tromethamine, N-methylglucamine, dicyclohexylamine, tris(hydroxymethyl)methylamine.
- compounds described herein may form salts with amino acids such as, but not limited to, arginine, lysine, and the like.
- Acceptable inorganic bases used to form salts with compounds that include an acidic proton include, but are not limited to, aluminum hydroxide, calcium hydroxide, potassium hydroxide, sodium carbonate, sodium hydroxide, and the like.
- a reference to a pharmaceutically acceptable salt includes the solvent addition forms, particularly solvates.
- Solvates contain either stoichiometric or non- stoichiometric amounts of a solvent, and may be formed during the process of crystallization with pharmaceutically acceptable solvents such as water, ethanol, and the like. Hydrates are formed when the solvent is water, or alcoholates are formed when the solvent is alcohol.
- Solvates of compounds described herein can be conveniently prepared or formed during the processes described herein.
- the compounds provided herein can exist in unsolvated as well as solvated forms.
- the solvated forms are considered equivalent to the unsolvated forms for the purposes of the compounds and methods provided herein.
- the synthesis of compounds described herein is accomplished using means described in the chemical literature, using the methods described herein, or by a combination thereof.
- solvents, temperatures and other reaction conditions presented herein may vary.
- the starting materials and reagents used for the synthesis of the compounds described herein are synthesized or are obtained from commercial sources, such as, but not limited to, Sigma-Aldrich, Fisher Scientific (Fisher Chemicals), and Acros Organics.
- the compounds described herein, and other related compounds having different substituents are synthesized using techniques and materials described herein as well as those that are recognized in the field, such as described, for example, in Fieser and Fieser’s Reagents for Organic Synthesis, Volumes 1-17 (John Wiley and Sons, 1991); Rodd’s Chemistry of Carbon Compounds, Volumes 1-5 and Supplementals (Elsevier Science
- described herein are methods of degrading a target protein using the compounds disclosed herein. In certain embodiments, described herein are methods of degrading a target nuclear protein using the compounds disclosed herein. In some instances, a compound of Formula (I), Formula (IIA), Formula (IIB), or Formula (III) is utilized to modulate the degradation of a target protein (e.g., a nuclear protein).
- a target protein e.g., a nuclear protein
- the target protein comprises a structural protein, a receptor, an enzyme, a cell surface protein, a protein pertinent to the integrated function of a cell, including a protein involved in catalytic activity, aromatase activity, motor activity, helicase activity, metabolic processes (anabolism and catabolism), antioxidant activity, proteolysis, biosynthesis, a protein with kinase activity, oxidoreductase activity, transferase activity, hydrolase activity, lyase activity, isomerase activity, ligase activity, enzyme regulator activity, signal transducer activity, structural molecule activity, binding activity (protein, lipid carbohydrate), receptor activity, cell motility, membrane fusion, cell communication, regulation of biological processes, development, cell differentiation, response to stimulus, a behavioral protein, a cell adhe
- the target protein comprises a protein from a eukaryote or a prokaryote, including a microbe, virus, fungus, or parasite.
- exemplary target proteins include, but are not limited to, BRIM, ERRa, AR, RIPK2, B7.1 and B7, TINFRlm, TNFR2, NADPH oxidase, BclIBax and other partners in the apoptosis pathway, C5a receptor, HMG-CoA reductase, PDE V
- phosphodiesterase type PDE IV phosphodiesterase type 4, PDE I, PDEII, PDEIII, squalene cyclase inhibitor, CXCR1, CXCR2, nitric oxide (NO) synthase, cyclo-oxygenase 1, cyclo oxygenase 2, 5HT receptors, dopamine receptors, G Proteins, i.e., Gq, histamine receptors, 5- lipoxygenase, tryptase serine protease, thymidylate synthase, purine nucleoside phosphorylase, GAPDH trypanosomal, glycogen phosphorylase, Carbonic anhydrase, chemokine receptors, JAW STAT, RXR and similar, HIV 1 protease, HIV 1 integrase, influenza, neuramimidase, hepatitis B reverse transcriptase, sodium channel, multi drug resistance (MDR), protein P- glycoprotein (and MRP), tyros
- Additional protein targets include, for example, ecdysone 20-monooxygenase, ion channel of the GABA gated chloride channel, acetylcholinesterase, voltage-sensitive sodium channel protein, calcium release channel, and chloride channels.
- Proteins of interest can include proteins from eukaryotes and prokaryotes including humans as targets for drug therapy, other animals, including domesticated animals, microbials for the determination of targets for antibiotics and other antimicrobials and plants, and even viruses, among numerous others.
- the target protein binding moiety of a hetero- bifunctional degrader may be any peptide or small molecule that bind protein targets such as FoxOl, HD AC, DP-l, E2F, ABL, AMPK, BRK, BRSK I, BRSK2, BTK, CAMKK1, CAMKK alpha, CAMKK beta, Rb, Suv39HI, SCF, pl9INK4D, GSK-3, pi 8 INK4, myc, cyclin E, CDK2, CDK9, CDG4/6, Cycline D, pl6 INK4A, cdc25A, BMI1, Akt, CHK1/2, C 1 delta, CK1 gamma, C 2, CLK2, CSK, DDR2, DYRK1 A/2/3, EF2K, EPH-A2/A4/B1/B2/B3/B4, EIF2A 3, Smad2, Smad3, Smad4, Smad7, p53, p2l Cipl, PAX, Fyn
- protein targets include Ras proteins, P13K, Ral-GDS, H-Ras, N-Ras, KRas4A, K-Ras4B, BRG1, RAF, BRAF, CRAF, and BET.
- the protein target is selected from the group consisting of EGFR, RAS, BRM, BRG1, MDM2, RAF (BRAF and CRAF), BET, and USP7.
- a number of drug targets for human therapeutics also represent protein targets to which a protein binding moiety may be bound and incorporated into compounds according to the present disclosure.
- proteins which may be used to restore function in numerous polygenic diseases including for example B7.1 and B7, TINFRlm, TNFR2, NADPH oxidase, BclIBax and other partners in the apotosis pathway, C5a receptor, HMG-CoA reductase, PDE V phosphodiesterase type, PDE IV phosphodiesterase type 4, PDE I, PDEII, PDEIII, squalene cyclase inhibitor, CXCR1, CXCR2, nitric oxide (NO) synthase, cyclo oxygenase 1, cyclo-oxygenase 2, 5HT receptors, dopamine receptors, G Proteins, i.e., Gq, histamine receptors, 5 -lipoxygenase, tryptase serine protease, thymidylate synthase, purine nucleoside phosphorylase, GAPDH trypanosomal, glycogen phosphorylase, Carbon
- Additional protein targets include, for example, ecdysone 20-monooxygenase, ion channel of the GABA gated chloride channel, acetylcholinesterase, voltage-sensitive sodium channel protein, calcium release channel, and chloride channels. Still further target proteins include Acetyl-CoA carboxylase,
- adenylosuccinate synthetase adenylosuccinate synthetase, protoporphyrinogen oxidase, and enolpyruvylshikimate-phosphate synthase.
- the target protein is a protein that is upregulated (e.g., overexpressed) in a disease or condition.
- the disease or condition is a cancer, e.g., a solid tumor or a hematologic malignancy such as a Hodgkin’s lymphoma or a non- Hodgkin’s lymphoma.
- the cancer is breast cancer, brain cancer, colorectal cancer, esophagus cancer, head and neck cancer, kidney cancer, lung cancer, ovarian cancer, prostate cancer, or stomach cancer.
- the cancer is chronic lymphocytic leukemia, small lymphocytic lymphoma, Burkitts lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, or Waldenstrom’s macrglobulinemia.
- the disease or condition is an autoimmune disease.
- the autoimmune disease is multiple sclerosis, Alzheimer’s disease, inflammatory bowel disease, Lou Gehrig’s disease, diabetes, psoriasis, rheumatoid arthritis, or graft-versus-host disease.
- the method comprises contacting CRL4 comprising a DCAF16 protein with a synthetic ligand for a time sufficient for the ligand to interact with a cysteine residue of the DCAF16 protein to form a CRL4-ligand complex, thereby modulating substrate selectivity of the CRL4 complex; wherein the synthetic ligand comprises a DCAF16-interacting portion linked to a substrate binding portion.
- cysteine residue is at a position corresponding to residue 58
- the cysteine residue is at a position corresponding to residue 58, 173, 177, 178, or 179 of SEQ ID NO: 1. In some cases, the cysteine residue is at a position corresponding to residue 173, 177, 178, or 179 of SEQ ID NO: 1. In some cases, the cysteine residue is at a position corresponding to residue 177 or 179 of SEQ ID NO: 1. In some cases, the cysteine residue is at a position corresponding to residue 58, 100, 103, or 119 of SEQ ID NO: 1. In some cases, the cysteine residue is at a position corresponding to residue 100, 103, or 119 of SEQ ID NO: 1. In some cases, the cysteine residue is at a position corresponding to residue 173 or 178 of SEQ ID NO: 1.
- the synthetic ligand comprises a structure represented by Formula I:
- CRG-L is optional, and when present is a covalent reactive group comprising a Michael acceptor moiety, a leaving group moiety, or a moiety capable of forming a covalent bond to the thiol group of a cysteine residue, and L is a linker;
- MRE is a molecular recognition element that is capable of interacting with DCAF16; and R M is optional, and when present comprises a binding element that binds to a second protein or another compound.
- the MRE is covalently bound to the cysteine residue at a position corresponding to residue 58, 100, 103, 119, 173, 177, 178, or 179 of SEQ ID NO: 1. In some cases, the MRE is covalently bound to the cysteine residue at a position corresponding to residue 58, 173, 177, 178, or 179 of SEQ ID NO: 1. In some cases, the MRE is covalently bound to the cysteine residue at a position corresponding to residue 173, 177, 178, or 179 of SEQ ID NO: 1.
- the MRE is covalently bound to the cysteine residue at a position corresponding to residue 177 or 179 of SEQ ID NO: 1. In some cases, the MRE is covalently bound to the cysteine residue at a position corresponding to residue 58, 100, 103, or 119 of SEQ ID NO: 1. In some cases, the MRE is covalently bound to the cysteine residue at a position corresponding to residue 100, 103, or 119 of SEQ ID NO: 1. In some cases, the MRE is covalently bound to the cysteine residue at a position corresponding to residue 173 or 178 of SEQ ID NO: 1.
- the Michael acceptor moiety comprises an alkene or an alkyne moiety.
- L is a cleavable linker
- L is a non-cleavable linker
- L is a polymeric linker.
- L is a polyethylene glycol (PEG) molecule.
- MRE comprises a small molecule compound, a polynucleotide, a polypeptide or fragments thereof, or a peptidomimetic.
- the synthetic ligand has a structure represented by Formula (IIA) or Formula (IIB):
- each R A and R B is independently selected from the group consisting of H, D, substituted or unsubstituted Ci-C 6 alkyl, substituted or unsubstituted Ci-C 6 fluoroalkyl, substituted or unsubstituted Ci-C 6 heteroalkyl, substituted or unsubstituted C 3 - Cxcycloalkyl, substituted or unsubstituted C2-C 7 heterocycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted Ci-C 3 alkylene-aryl, substituted or unsubstituted heteroaryl, and substituted or unsubstituted Ci-C 3 alkylene-heteroaryl; or R A and R B together with the nitrogen to which they are attached form a 5, 6, 7 or 8- membered heterocyclic ring A, optionally having one additional heteroatom moiety independently selected from NR 1 , O, or S; wherein A is optionally substituted; and R 1 is
- the synthetic ligand has a structure represented by Formula (III):
- the synthetic ligand is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
- the method is an in vitro method.
- the method is an in vivo method.
- the cell is from a subject having a cancer.
- the subject is a human.
- the methods comprising profiling a cell sample or a cell lysate from a DCAF16-expressing cell.
- the cell is obtained from an animal.
- the animal cell includes a cell from a marine invertebrate, fish, insects, amphibian, reptile, or mammal.
- the mammalian cell is a primate, ape, equine, bovine, porcine, canine, or feline.
- the mammalian cell is a primate, ape, equine, bovine, porcine, canine, feline, or rodent.
- the mammal is a primate, ape, dog, cat, rabbit, ferret, or the like.
- the rodent expresses DCAF16 through genetic engineering, e.g. CRISPR.
- the DCAF16 cell sample or cell lysate sample is obtained from a mammalian cell.
- the mammalian cell is an epithelial cell, connective tissue cell, hormone secreting cell, a nerve cell, a skeletal muscle cell, a blood cell, or an immune system cell.
- Exemplary mammalian cells include, but are not limited to, 293 A cell line, 293FT cell line, 293F cells , 293 H cells, HEK 293 cells, CHO DG44 cells, CHO-S cells, CHO-K1 cells, Expi293FTM cells, Flp-InTM T-RExTM 293 cell line, Flp-InTM-293 cell line, Flp-InTM-3T3 cell line, Flp-InTM-BHK cell line, Flp-InTM-CHO cell line, Flp-InTM-CV-l cell line, Flp-InTM-Jurkat cell line, FreeStyleTM 293-F cells, FreeStyleTM CHO-S cells, GripTiteTM 293 MSR cell line, GS- CHO cell line, HepaRGTM cells, T-RExTM Jurkat cell line, Per.C6 cells, T-RExTM-293 cell line, T-RExTM-CHO cell line, T-RExTM-HeLa cell line, NC-HI
- the DCAF16 cell sample or cell lysate sample is obtained from cells of a tumor cell line.
- the cell sample or cell lysate sample is obtained from cells of a solid tumor cell line.
- the solid tumor cell line is a sarcoma cell line.
- the solid tumor cell line is a carcinoma cell line.
- the sarcoma cell line is obtained from a cell line of alveolar rhabdomyosarcoma, alveolar soft part sarcoma, ameloblastoma, angiosarcoma, chondrosarcoma, chordoma, clear cell sarcoma of soft tissue, dedifferentiated liposarcoma, desmoid, desmoplastic small round cell tumor, embryonal rhabdomyosarcoma, epithelioid fibrosarcoma, epithelioid hemangioendothelioma, epithelioid sarcoma, esthesioneuroblastoma, Ewing sarcoma, extrarenal rhabdoid tumor, extraskeletal myxoid chondrosarcoma, extraskeletal osteosarcoma, fibrosarcoma, giant cell tumor, hemangiopericytoma, infantile fibrosarcoma, inflammatory myofibroblastic tumor
- mesenchymoma malignant peripheral nerve sheath tumor, mesenchymal chondrosarcoma, myxofibrosarcoma, yxoid liposarcoma, myxoinflammatory fibroblastic sarcoma, neoplasms with perivascular epitheioid cell differentiation, osteosarcoma, parosteal osteosarcoma, neoplasm with perivascular epitheioid cell differentiation, periosteal osteosarcoma, pleomorphic liposarcoma, pleomorphic rhabdomyosarcoma, PNET/extraskeletal Ewing tumor,
- rhabdomyosarcoma round cell liposarcoma, small cell osteosarcoma, solitary fibrous tumor, synovial sarcoma, telangiectatic osteosarcoma.
- the carcinoma cell line is obtained from a cell line of adenocarcinoma, squamous cell carcinoma, adenosquamous carcinoma, anaplastic carcinoma, large cell carcinoma, small cell carcinoma, anal cancer, appendix cancer, bile duct cancer (i.e., cholangiocarcinoma), bladder cancer, brain tumor, breast cancer, cervical cancer, colon cancer, cancer of Unknown Primary (CUP), esophageal cancer, eye cancer, fallopian tube cancer, gastroenterological cancer, kidney cancer, liver cancer, lung cancer, medulloblastoma, melanoma, oral cancer, ovarian cancer, pancreatic cancer, parathyroid disease, penile cancer, pituitary tumor, prostate cancer, rectal cancer, skin cancer, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, vaginal cancer, or vulvar cancer.
- adenocarcinoma squamous cell carcinoma, adenosquamous carcinoma, anaplastic carcinoma,
- the DCAF16 cell sample or cell lysate sample is obtained from cells of a hematologic malignant cell line.
- the hematologic malignant cell line is a T-cell cell line.
- B-cell cell line is a T-cell cell line.
- the hematologic malignant cell line is obtained from a T-cell cell line of: peripheral T-cell lymphoma not otherwise specified (PTCL-NOS), anaplastic large cell lymphoma, angioimmunoblastic lymphoma, cutaneous T-cell lymphoma, adult T-cell leukemia/lymphoma (ATLL), blastic NK-cell lymphoma, enteropathy-type T-cell lymphoma, hematosplenic gamma-delta T-cell lymphoma, lymphoblastic lymphoma, nasal NK/T-cell lymphomas, or treatment-related T-cell lymphomas.
- PTCL-NOS peripheral T-cell lymphoma not otherwise specified
- anaplastic large cell lymphoma angioimmunoblastic lymphoma
- ATLL adult T-cell leukemia/lymphoma
- blastic NK-cell lymphoma enteropathy-type T-cell lymphoma
- the hematologic malignant cell line is obtained from a B-cell cell line of: acute lymphoblastic leukemia (ALL), acute myelogenous leukemia (AML), chronic myelogenous leukemia (CML), acute monocytic leukemia (AMoL), chronic lymphocytic leukemia (CLL), high-risk chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), high-risk small lymphocytic lymphoma (SLL), follicular lymphoma (FL), mantle cell lymphoma (MCL), Waldenstrom’s macroglobulinemia, multiple myeloma, extranodal marginal zone B cell lymphoma, nodal marginal zone B cell lymphoma, Burkitt’ s lymphoma, non-Burkitt high grade B cell lymphoma, primary mediastinal B-cell lymphoma (PMBL), immunoblastic large cell lymph
- the DCAF16 cell sample or cell lysate sample is obtained from a tumor cell line.
- exemplary tumor cell line includes, but is not limited to, 600MPE, AU565, BT-20, BT-474, BT-483, BT-549, Evsa-T, Hs578T, MCF-7, MDA-MB-231, SkBr3, T-47D, HeLa, DU145, PC3, LNCaP, A549, H1299, NCI-H460, A2780, SKOV-3/Luc, Neuro2a, RKO, RKO-AS45-1, HT-29, SW1417, SW948, DLD-l, SW480, Capan-l, MC/9, B72.3, B25.2, B6.2, B38.1, DMS 153, SU.86.86, SNU-182, SNU-423, SNU-449, SNU-475, SNU-387, Hs 817.T, LMH, LMH/2A, SNU
- TMD8 MEC1, MEC2, 8E5, CCRF-CEM, MOLT-3, TALL- 104, AML- 193, THP-l, BDCM, HL-60, Jurkat, RPMI 8226, MOLT-4, RS4, K-562, KASUMI-l, Daudi, GA-10, Raji, JeKo-l, NK-92, and Mino.
- the DCAF16 cell sample or cell lysate sample is from any tissue or fluid from an individual.
- Samples include, but are not limited to, tissue (e.g. connective tissue, muscle tissue, nervous tissue, or epithelial tissue), whole blood, dissociated bone marrow, bone marrow aspirate, pleural fluid, peritoneal fluid, central spinal fluid, abdominal fluid, pancreatic fluid, cerebrospinal fluid, brain fluid, ascites, pericardial fluid, urine, saliva, bronchial lavage, sweat, tears, ear flow, sputum, hydrocele fluid, semen, vaginal flow, milk, amniotic fluid, and secretions of respiratory, intestinal or genitourinary tract.
- tissue e.g. connective tissue, muscle tissue, nervous tissue, or epithelial tissue
- whole blood e.g. connective tissue, muscle tissue, nervous tissue, or epithelial tissue
- dissociated bone marrow e.g. connective tissue, muscle tissue, nervous tissue,
- the cell sample or cell lysate sample is a tissue sample, such as a sample obtained from a biopsy or a tumor tissue sample.
- the cell sample or cell lysate sample is a blood serum sample.
- the cell sample or cell lysate sample is a blood cell sample containing one or more peripheral blood mononuclear cells (PBMCs).
- PBMCs peripheral blood mononuclear cells
- the cell sample or cell lysate sample contains one or more circulating tumor cells (CTCs).
- CTCs circulating tumor cells
- the cell sample or cell lysate sample contains one or more disseminated tumor cells (DTC, e.g., in a bone marrow aspirate sample).
- DTC disseminated tumor cells
- the DCAF16 cell sample or cell lysate sample is obtained from the individual by any suitable means of obtaining the sample using well-known and routine clinical methods. Procedures for obtaining tissue samples from an individual are well known.
- tissue sample such as from a needle aspiration biopsy
- a thin hollow needle is inserted into a mass such as a tumor mass for sampling of cells that, after being stained, will be examined under a microscope.
- a DCAF16 sample solution comprises a cell sample, a cell lysate sample, or a sample comprising isolated proteins.
- the sample solution comprises a solution such as a buffer (e.g. phosphate buffered saline) or a media.
- the media is an isotopically labeled media.
- the sample solution is a cell solution.
- the DCAF16 solution sample (e.g., cell sample, cell lysate sample, or comprising isolated proteins) is incubated with a compound of Formula (I), Formula (IIA), Formula (IIB), or Formula (III) for analysis of protein-probe interactions.
- the solution sample e.g., cell sample, cell lysate sample, or comprising isolated proteins
- the solution sample (e.g., cell sample, cell lysate sample, or comprising isolated proteins) is further incubated with a ligand, in which the ligand does not contain a photoreactive moiety and/or an alkyne group.
- the solution sample is incubated with a probe and a ligand for competitive protein profiling analysis.
- the DCAF16 cell sample or the cell lysate sample is compared with a control.
- a difference is observed between a set of probe protein interactions between the sample and the control.
- the difference correlates to the interaction between the small molecule fragment and the proteins.
- one or more methods are utilized for labeling a DCAF16 solution sample (e.g. cell sample, cell lysate sample, or comprising isolated proteins) for analysis of probe protein interactions.
- a method comprises labeling the sample (e.g. cell sample, cell lysate sample, or comprising isolated proteins) with an enriched media.
- the sample e.g. cell sample, cell lysate sample, or comprising isolated proteins
- isotope-labeled amino acids such as 13 C or 15 N-labeled amino acids.
- the labeled sample is further compared with a non-labeled sample to detect differences in probe protein interactions between the two samples.
- this difference is a difference of a target protein and its interaction with a small molecule ligand in the labeled sample versus the non-labeled sample. In some instances, the difference is an increase, decrease or a lack of protein-probe interaction in the two samples.
- the isotope-labeled method is termed SILAC, stable isotope labeling using amino acids in cell culture.
- a method comprises incubating a solution sample (e.g. cell sample, cell lysate sample, or comprising isolated proteins) with a labeling group (e.g., an isotopically labeled labeling group) to tag one or more proteins of interest for further analysis.
- a labeling group e.g., an isotopically labeled labeling group
- the labeling group comprises a biotin, a streptavidin, bead, resin, a solid support, or a combination thereof, and further comprises a linker that is optionally isotopically labeled.
- the linker can be about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more residues in length and might further comprise a cleavage site, such as a protease cleavage site (e.g., TEV cleavage site).
- the labeling group is a biotin-linker moiety, which is optionally isotopically labeled with 13 C and 15 N atoms at one or more amino acid residue positions within the linker.
- the biotin-linker moiety is a isotopically-labeled TEV-tag as described in Weerapana, et al .,“Quantitative reactivity profiling predicts functional cysteines in proteomes,” Nature 468(7325): 790-795.
- an isotopic reductive dimethylation (ReDi) method is utilized for processing a sample.
- the ReDi labeling method involves reacting peptides with formaldehyde to form a Schiff base, which is then reduced by cyanoborohydride. This reaction dimethylates free amino groups on N-termini and lysine side chains and monomethylates N-terminal prolines.
- the ReDi labeling method comprises methylating peptides from a first processed sample with a“light” label using reagents with hydrogen atoms in their natural isotopic distribution and peptides from a second processed sample with a“heavy” label using deuterated formaldehyde and cyanoborohydride. Subsequent proteomic analysis (e.g., mass spectrometry analysis) based on a relative peptide abundance between the heavy and light peptide version might be used for analysis of probe-protein interactions.
- proteomic analysis e.g., mass spectrometry analysis
- isobaric tags for relative and absolute quantitation (iTRAQ) method is utilized for processing a sample.
- the iTRAQ method is based on the covalent labeling of the N-terminus and side chain amines of peptides from a processed sample.
- reagent such as 4-plex or 8-plex is used for labeling the peptides.
- the probe-protein complex is further conjugated to a
- the probe-protein complex is separated and visualized utilizing an electrophoresis system, such as through a gel electrophoresis, or a capillary electrophoresis.
- an electrophoresis system such as through a gel electrophoresis, or a capillary electrophoresis.
- Exemplary gel electrophoresis includes agarose-based gels, polyacrylamide based gels, or starch based gels.
- the probe-protein is subjected to a native electrophoresis condition.
- the probe-protein is subjected to a denaturing electrophoresis condition.
- the probe-protein after harvesting is further fragmentized to generate protein fragments.
- fragmentation is generated through mechanical stress, pressure, or chemical means.
- the protein from the probe-protein complexes is fragmented by a chemical means.
- the chemical means is a protease.
- proteases include, but are not limited to, serine proteases such as chymotrypsin A, penicillin G acylase precursor, dipeptidase E, DmpA aminopeptidase, subtilisin, prolyl oligopeptidase, D-Ala-D-Ala peptidase C, signal peptidase I, cytomegalovirus assemblin, Lon-A peptidase, peptidase Clp, Escherichia coli phage K1F endosialidase CIMCD self-cleaving protein, nucleoporin 145, lactoferrin, murein tetrapeptidase LD-carboxypeptidase, or rhomboid- 1; threonine proteases such as ornithine acetyltransf erase; cysteine proteases such as TEV protease, amidophosphoribosyltransferase precursor, gamm
- the protein fragments are further analyzed by a proteomic method such as by liquid chromatography (LC) (e.g. high performance liquid chromatography), liquid chromatography-mass spectrometry (LC-MS), matrix-assisted laser desorption/ionization (MALDI-TOF), gas chromatography-mass spectrometry (GC-MS), capillary electrophoresis- mass spectrometry (CE-MS), or nuclear magnetic resonance imaging (NMR).
- LC liquid chromatography
- LC-MS liquid chromatography-mass spectrometry
- MALDI-TOF matrix-assisted laser desorption/ionization
- GC-MS gas chromatography-mass spectrometry
- CE-MS capillary electrophoresis- mass spectrometry
- NMR nuclear magnetic resonance imaging
- the LC method is any suitable LC methods well known in the art, for separation of a sample into its individual parts. This separation occurs based on the interaction of the sample with the mobile and stationary phases. Since there are many stationary/mobile phase combinations that are employed when separating a mixture, there are several different types of chromatography that are classified based on the physical states of those phases. In some embodiments, the LC is further classified as normal-phase chromatography, reverse-phase chromatography, size-exclusion chromatography, ion-exchange chromatography, affinity chromatography, displacement chromatography, partition chromatography, flash chromatography, chiral chromatography, and aqueous normal-phase chromatography.
- the LC method is a high performance liquid chromatography (HPLC) method.
- HPLC high performance liquid chromatography
- the HPLC method is further categorized as normal- phase chromatography, reverse-phase chromatography, size-exclusion chromatography, ion- exchange chromatography, affinity chromatography, displacement chromatography, partition chromatography, chiral chromatography, and aqueous normal-phase chromatography.
- the HPLC method of the present disclosure is performed by any standard techniques well known in the art.
- Exemplary HPLC methods include hydrophilic interaction liquid chromatography (HILIC), electrostatic repulsion-hydrophilic interaction liquid chromatography (ERLIC) and reverse phase liquid chromatography (RPLC).
- the LC is coupled to a mass spectroscopy as a LC-MS method.
- the LC-MS method includes ultra-performance liquid chromatography- electrospray ionization quadrupole time-of-flight mass spectrometry (UPLC-ESI-QTOF-MS), ultra-performance liquid chromatography-electrospray ionization tandem mass spectrometry (UPLC-ESI-MS/MS), reverse phase liquid chromatography-mass spectrometry (RPLC -MS), hydrophilic interaction liquid chromatography-mass spectrometry (HILIC-MS), hydrophilic interaction liquid chromatography-triple quadrupole tandem mass spectrometry (HILIC-QQQ), electrostatic repulsion-hydrophilic interaction liquid chromatography-mass spectrometry (ERLIC -MS), liquid chromatography time-of-flight mass spectrometry (LC-QTOF-MS), liquid chromatography-tandem mass spectrome
- the GC is coupled to a mass spectroscopy as a GC-MS method.
- the GC-MS method includes two-dimensional gas chromatography time- of-flight mass spectrometry (GC*GC-TOFMS), gas chromatography time-of-flight mass spectrometry (GC-QTOF-MS) and gas chromatography-tandem mass spectrometry (GC- MS/MS).
- CE is coupled to a mass spectroscopy as a CE-MS method.
- the CE-MS method includes capillary electrophoresis- negative electrospray ionization-mass spectrometry (CE-ESI-MS), capillary electrophoresis-negative electrospray ionization-quadrupole time of flight-mass spectrometry (CE-ESI-QTOF-MS) and capillary electrophoresis-quadrupole time of flight-mass spectrometry (CE-QTOF-MS).
- the nuclear magnetic resonance (NMR) method is any suitable method well known in the art for the detection of one or more cysteine binding proteins or protein fragments disclosed herein.
- the NMR method includes one dimensional (1D) NMR methods, two dimensional (2D) NMR methods, solid state NMR methods and NMR chromatography.
- Exemplary 1D NMR methods include 1 Hydrogen,
- Exemplary solid state NMR method include solid state 13 Carbon NMR, high resolution magic angle spinning (HR-MAS) and cross polarization magic angle spinning (CP -MAS) NMR methods.
- Exemplary NMR techniques include diffusion ordered spectroscopy (DOSY), DOSY-TOCSY and DOSY-HSQC.
- the protein fragments are analyzed by method as described in Weerapana et al.,“Quantitative reactivity profiling predicts functional cysteines in proteomes,” Nature , 468:790-795 (2010).
- the results from the mass spectroscopy method are analyzed by an algorithm for protein identification.
- the algorithm combines the results from the mass spectroscopy method with a protein sequence database for protein identification.
- the algorithm comprises ProLuCID algorithm, Probity, Scaffold, SEQUEST, or Mascot.
- a value is assigned to each of the protein from the probe-protein complex.
- the value assigned to each of the protein from the probe-protein complex is obtained from the mass spectroscopy analysis.
- the value is the area-under-the curve from a plot of signal intensity as a function of mass-to-charge ratio.
- the value correlates with the reactivity of a Lys residue within a protein.
- a ratio between a first value obtained from a first protein sample and a second value obtained from a second protein sample is calculated. In some instances, the ratio is greater than 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some cases, the ratio is at most 20.
- the ratio is calculated based on averaged values.
- the averaged value is an average of at least two, three, or four values of the protein from each cell solution, or that the protein is observed at least two, three, or four times in each cell solution and a value is assigned to each observed time.
- the ratio further has a standard deviation of less than 12, 10, or 8.
- a value is not an averaged value.
- the ratio is calculated based on value of a protein observed only once in a cell population. In some instances, the ratio is assigned with a value of 20.
- kits and articles of manufacture for use to generate a DCAF16 conjugate by a method described herein.
- described herein is a kit for detecting DCAF16 ligand interaction.
- such kit includes small molecule ligands described herein, small molecule fragments or libraries, compound probes described herein, and/or controls, and reagents suitable for carrying out one or more of the methods described herein.
- the kit further comprises samples, such as a cell sample, and suitable solutions such as buffers or media.
- the kit further comprises recombinant DCAF16 proteins for use in one or more of the methods described herein.
- additional components of the kit comprises a carrier, package, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements to be used in a method described herein.
- Suitable containers include, for example, bottles, vials, plates, syringes, and test tubes.
- the containers are formed from a variety of materials such as glass or plastic.
- the articles of manufacture provided herein contain packaging materials.
- packaging materials include, but are not limited to, bottles, tubes, bags, containers, and any packaging material suitable for a selected formulation and intended mode of use.
- the container(s) include probes, test compounds, and one or more reagents for use in a method disclosed herein.
- kits optionally include an identifying description or label or instructions relating to its use in the methods described herein.
- a kit typically includes labels listing contents and/or instructions for use, and package inserts with instructions for use. A set of instructions will also typically be included.
- a label is on or associated with the container.
- a label is on a container when letters, numbers or other characters forming the label are attached, molded or etched into the container itself; a label is associated with a container when it is present within a receptacle or carrier that also holds the container, e.g., as a package insert.
- a label is used to indicate that the contents are to be used for a specific therapeutic application. The label also indicates directions for use of the contents, such as in the methods described herein.
- ranges and amounts can be expressed as“about” a particular value or range. About also includes the exact amount. Hence“about 5 pL” means“about 5 pL” and also “5 pL.” Generally, the term“about” includes an amount that would be expected to be within experimental error.
- the terms“individual(s)”,“subject(s)” and“patient(s)” mean any mammal.
- the mammal is a human.
- the mammal is a non-human. None of the terms require or are limited to situations characterized by the supervision (e.g. constant or intermittent) of a health care worker (e.g. a doctor, a registered nurse, a nurse practitioner, a physician’s assistant, an orderly or a hospice worker).
- a health care worker e.g. a doctor, a registered nurse, a nurse practitioner, a physician’s assistant, an orderly or a hospice worker.
- Alkyl refers to a straight or branched hydrocarbon chain radical, having from one to twenty carbon atoms, and which is attached to the rest of the molecule by a single bond.
- An alkyl comprising up to 10 carbon atoms is referred to as a Ci-Cio alkyl, likewise, for example, an alkyl comprising up to 6 carbon atoms is a Ci-C 6 alkyl.
- Alkyls (and other moieties defined herein) comprising other numbers of carbon atoms are represented similarly.
- Alkyl groups include, but are not limited to, Ci-Cio alkyl, C1-C9 alkyl, Ci-C 8 alkyl, C1-C7 alkyl, Ci-C 6 alkyl, C1-C5 alkyl, C1-C4 alkyl, C1-C3 alkyl, C1-C2 alkyl, C 2 -C 8 alkyl, C 3 -C 8 alkyl and C 4 -C 8 alkyl.
- Representative alkyl groups include, but are not limited to, methyl, ethyl, «-propyl,
- the alkyl is methyl or ethyl. In some embodiments, the alkyl is -CH(CH 3 ) 2 or -C(CH 3 ) 3 . Unless stated otherwise specifically in the specification, an alkyl group may be optionally substituted as described below.“Alkylene” or“alkylene chain” refers to a straight or branched divalent hydrocarbon chain linking the rest of the molecule to a radical group. In some embodiments, the alkylene is -CH 2 -, -CH 2 CH 2 -, or -CH 2 CH 2 CH 2 -. In some embodiments, the alkylene is -CH 2 -. In some embodiments, the alkylene is -CH 2 CH 2 -. In some embodiments, the alkylene is - CH2CH2CH2-.
- Alkoxy refers to a radical of the formula -OR where R is an alkyl radical as defined. Unless stated otherwise specifically in the specification, an alkoxy group may be optionally substituted as described below. Representative alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, butoxy, pentoxy. In some embodiments, the alkoxy is methoxy. In some embodiments, the alkoxy is ethoxy.
- Heteroalkylene refers to an alkyl radical as described above where one or more carbon atoms of the alkyl is replaced with a O, N or S atom.“Heteroalkylene” or “heteroalkyl ene chain” refers to a straight or branched divalent heteroalkyl chain linking the rest of the molecule to a radical group. Unless stated otherwise specifically in the specification, the heteroalkyl or heteroalkylene group may be optionally substituted as described below.
- Representative heteroalkyl groups include, but are not limited to -OCH 2 OMe, -OCHiChhOMe, or -OCH2CH2OCH2CH2NH2.
- Representative heteroalkylene groups include, but are not limited to -OCH2CH2O-, -OCH2CH2OCH2CH2O-, or -OCH2CH2OCH2CH2OCH2CH2O-.
- Alkylamino refers to a radical of the formula -NHR or -NRR where each R is, independently, an alkyl radical as defined above. Unless stated otherwise specifically in the specification, an alkylamino group may be optionally substituted as described below.
- aromatic refers to a planar ring having a delocalized p-electron system containing 4n+2 p electrons, where n is an integer. Aromatics can be optionally substituted.
- aromatic includes both aryl groups ( e.g ., phenyl, naphthalenyl) and heteroaryl groups e.g ., pyridinyl, quinolinyl).
- Aryl refers to an aromatic ring wherein each of the atoms forming the ring is a carbon atom.
- Aryl groups can be optionally substituted. Examples of aryl groups include, but are not limited to phenyl, and naphthyl. In some embodiments, the aryl is phenyl. Depending on the structure, an aryl group can be a monoradical or a diradical (i.e., an aryl ene group). Unless stated otherwise specifically in the specification, the term“aryl” or the prefix“ar-“ (such as in “aralkyl”) is meant to include aryl radicals that are optionally substituted.
- Carboxy refers to -CO2H.
- carboxy moieties may be replaced with a“carboxylic acid bioisostere”, which refers to a functional group or moiety that exhibits similar physical and/or chemical properties as a carboxylic acid moiety.
- a carboxylic acid bioisostere has similar biological properties to that of a carboxylic acid group.
- a compound with a carboxylic acid moiety can have the carboxylic acid moiety exchanged with a carboxylic acid bioisostere and have similar physical and/or biological properties when compared to the carboxylic acid-containing compound.
- a carboxylic acid bioisostere would ionize at physiological pH to roughly the same extent as a carboxylic acid group.
- bioisosteres of a carboxylic acid include, but are not limited to:
- Cycloalkyl refers to a monocyclic or polycyclic non-aromatic radical, wherein each of the atoms forming the ring (i.e. skeletal atoms) is a carbon atom. Cycloalkyls may be saturated, or partially unsaturated. Cycloalkyls may be fused with an aromatic ring (in which case the cycloalkyl is bonded through a non-aromatic ring carbon atom). Cycloalkyl groups include groups having from 3 to 10 ring atoms.
- cycloalkyls include, but are not limited to, cycloalkyls having from three to ten carbon atoms, from three to eight carbon atoms, from three to six carbon atoms, or from three to five carbon atoms.
- Monocyclic cyclcoalkyl radicals include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl.
- the monocyclic cyclcoalkyl is cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl.
- the monocyclic cyclcoalkyl is cyclopentyl.
- Polycyclic radicals include, for example, adamantyl, norbornyl, decalinyl, and 3,4- dihydronaphthalen-l(2H)-one. Unless otherwise stated specifically in the specification, a cycloalkyl group may be optionally substituted.
- fused refers to any ring structure described herein which is fused to an existing ring structure.
- the fused ring is a heterocyclyl ring or a heteroaryl ring
- any carbon atom on the existing ring structure which becomes part of the fused heterocyclyl ring or the fused heteroaryl ring may be replaced with a nitrogen atom.
- Halo or“halogen” refers to bromo, chloro, fluoro or iodo.
- Haloalkyl refers to an alkyl radical, as defined above, that is substituted by one or more halo radicals, as defined above, e.g ., trifluoromethyl, difluoromethyl, fluoromethyl, trichlorom ethyl, 2,2,2-trifluoroethyl, l,2-difluoroethyl, 3-bromo-2-fluoropropyl,
- haloalkyl group may be optionally substituted.
- Haloalkoxy refers to an alkoxy radical, as defined above, that is substituted by one or more halo radicals, as defined above, e.g. , trifluoromethoxy, difluoromethoxy, fluorom ethoxy, trichlorom ethoxy, 2,2,2-trifluoroethoxy, l,2-difluoroethoxy, 3-bromo-2-fluoropropoxy,
- haloalkoxy group may be optionally substituted.
- Heterocycloalkyl or“heterocyclyl” or“heterocyclic ring” refers to a stable 3- to l4-membered non-aromatic ring radical comprising 2 to 10 carbon atoms and from one to 4 heteroatoms selected from the group consisting of nitrogen, oxygen, and sulfur.
- the heterocycloalkyl radical may be a monocyclic, or bicyclic ring system, which may include fused (when fused with an aryl or a heteroaryl ring, the heterocycloalkyl is bonded through a non-aromatic ring atom) or bridged ring systems.
- the nitrogen, carbon or sulfur atoms in the heterocyclyl radical may be optionally oxidized.
- the nitrogen atom may be optionally quatemized.
- the heterocycloalkyl radical is partially or fully saturated. Examples of such heterocycloalkyl radicals include, but are not limited to, dioxolanyl, thienyl[l,3]dithianyl, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl,
- 2-oxopiperidinyl 2-oxopyrrolidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, trithianyl,
- heterocycloalkyl also includes all ring forms of
- carbohydrates including but not limited to monosaccharides, disaccharides and
- heterocycloalkyls have from 2 to 10 carbons in the ring. In some embodiments, heterocycloalkyls have from 2 to 8 carbons in the ring. In some embodiments, heterocycloalkyls have from 2 to 8 carbons in the ring and 1 or 2 N atoms. In some embodiments, heterocycloalkyls have from 2 to 10 carbons, 0-2 N atoms, 0-2 O atoms, and 0-1 S atoms in the ring. In some embodiments, heterocycloalkyls have from 2 to 10 carbons, 1-2 N atoms, 0-1 0 atoms, and 0-1 S atoms in the ring.
- the number of carbon atoms in the heterocycloalkyl is not the same as the total number of atoms (including the heteroatoms) that make up the heterocycloalkyl (i.e. skeletal atoms of the heterocycloalkyl ring). Unless stated otherwise specifically in the specification, a heterocycloalkyl group may be optionally substituted.
- Heteroaryl refers to an aryl group that includes one or more ring heteroatoms selected from nitrogen, oxygen and sulfur.
- the heteroaryl is monocyclic or bicyclic.
- Illustrative examples of monocyclic heteroaryls include pyridinyl, imidazolyl, pyrimidinyl, pyrazolyl, triazolyl, pyrazinyl, tetrazolyl, furyl, thienyl, isoxazolyl, thiazolyl, oxazolyl, isothiazolyl, pyrrolyl, pyridazinyl, triazinyl, oxadiazolyl, thiadiazolyl, furazanyl, indolizine, indole, benzofuran, benzothiophene, indazole, benzimidazole, purine, quinolizine, quinoline, isoquinoline, cinnoline, phthalazine, quin
- monocyclic heteroaryls include pyridinyl, imidazolyl, pyrimidinyl, pyrazolyl, triazolyl, pyrazinyl, tetrazolyl, furyl, thienyl, isoxazolyl, thiazolyl, oxazolyl, isothiazolyl, pyrrolyl, pyridazinyl, triazinyl, oxadiazolyl, thiadiazolyl, and furazanyl.
- bicyclic heteroaryls include indolizine, indole, benzofuran, benzothiophene, indazole, benzimidazole, purine, quinolizine, quinoline, isoquinoline, cinnoline, phthalazine, quinazoline, quinoxaline, l,8-naphthyridine, and pteridine.
- heteroaryl is pyridinyl, pyrazinyl, pyrimidinyl, thiazolyl, thienyl, thiadiazolyl or furyl.
- a heteroaryl contains 0-4 N atoms in the ring.
- a heteroaryl contains 1-4 N atoms in the ring. In some embodiments, a heteroaryl contains 0-4 N atoms, 0-1 0 atoms, and 0- 1 S atoms in the ring. In some embodiments, a heteroaryl contains 1-4 N atoms, 0-1 0 atoms, and 0-1 S atoms in the ring. In some embodiments, heteroaryl is a Ci-Csheteroaryl. In some embodiments, monocyclic heteroaryl is a Ci-C heteroaryl In some embodiments, monocyclic heteroaryl is a 5-membered or 6-membered heteroaryl. In some embodiments, a bicyclic heteroaryl is a C 6 -C9heteroaryl.
- the term“optionally substituted” or“substituted” means that the referenced group may be substituted with one or more additional group(s) individually and independently selected from alkyl, haloalkyl, cycloalkyl, aryl, heteroaryl, heterocycloalkyl, -OH, alkoxy, aryloxy, alkylthio, arylthio, alkylsulfoxide, arylsulfoxide, alkylsulfone, arylsulfone, -CN, alkyne, Ci- C 6 alkylalkyne, halogen, acyl, acyloxy, -C0 2 H, -C0 2 alkyl, nitro, and amino, including mono- and di- substituted amino groups (e.g.
- optional substituents are independently selected from alkyl, alkoxy, haloalkyl, cycloalkyl, halogen, -CN, -NH 2 , -NH(CH 3 ), -N(CH 3 ) 2 , -OH, -C0 2 H, and - C0 2 alkyl.
- optional substituents are independently selected from fluoro, chloro, bromo, iodo, -CH 3 , -CH 2 CH 3 , -CF 3 , -OCH 3 , and -OCF 3.
- substituted groups are substituted with one or two of the preceding groups.
- heterofunctional degrader refers to proteolysis-targeting chimera molecules having generally three components, a ubiquitin ligase (E3) binding moiety, at least one linker moiety, and a protein binding moiety (PB moiety, also referred to herein as “D”).
- E3 binding moiety used herein is a DCAF16 ligand moiety.
- FLAG-tagged variants of FKBP12 FL AG-FKBP 12
- FLAG-FKBP12 NLS FKBP12 with a C-terminal nuclear localization sequence
- Fig. 4A shows subcellular fractionation followed by western blotting of the stably expressed FLAG-FKBP12 and FLAG-FKBP12-NLS in HEK293T cells.
- FIG. 5A Cell imaging studies confirmed the selective loss of nuclear-localized FKBP12 in KB02- SLF -treated cells (Fig. 1C). These imaging studies, along with western blotting experiments (Fig. 4A), pointed to a fraction of FKBP12 that remained cytoplasmically localized in FLAG-FKBPl2_NLS-transfected cells and was consequently unaffected by KB02-SLF treatment (Fig. 1C).
- CCL Cullin-RING ligase
- KB02-SLF would show low stoichiometry engagement of a CRL, which would then function catalytically to drive FKBP12 NLS degradation.
- Such low fractional occupancy ligand-protein interactions are not easily mapped by competitive profiling methods like isoTOP-ABPP.
- FLAG-mediated affinity enrichment was used to identify proteins that associated with FKBP12 NLS in a KB02-SLF-dependent manner (Fig. 2D).
- This experimental set up identified two substrate components of CRLs - DCAF16 and DTL - that were substantially enriched in HEK 293T cells treated with KB02-SLF compared to DMSO-treated control cells (Fig. 2E and Fig.
- DCAF16 and DTL are predicted to be nuclear proteins.
- DTL also known as CDT2 and DCAF2
- CDT2 and DCAF2 plays a key role in cell cycle control and DNA damage response
- KB02-SLF supported the degradation of FKBP12 NLS in all three DCAF16+/+ clones, but not in any of the three DCAF16-/- clones (Fig. 3B and Fig. 9D). Moreover, recombinant expression of HA-tagged DCAF16 restored KB02-SLF -induced FKBP12 NLS degradation in the DCAF16-/- cells (Fig. 3C). The degradation of HA-DCAF16 was not observed following treatment of KB02-SLF (Fig. 3C and Fig. 9E). These data, taken together, demonstrate that KB02-SLF-mediated degradation of FKBP12 NLS requires DCAF16.
- HA-DCAF16 and DDB1 co-immunoprecipitated with FLAG-FKBP12 NLS in the presence of KB02-SLF (Fig. 3D) or its linker analogues (Fig. 10A).
- KB02-SLF-treated cells showed a higher molecular weight (HMW) form of HA-DCAF16, consistent with covalent modification of this protein by KB02-SLF (Fig. 3D and Fig. IOA-Fig. 10F). Only a modest fraction of HA- DCAF16 was converted to this HMW in the presence of increasing concentrations of KB02-SLF (Fig. 3D and Fig.
- HMW-DCAF16 was exclusively co- immunoprecipitated with FKBP12 NLS (Fig. 3D and Fig. 10F), supporting a ternary complex model where KBO 2-SLF is covalently and non-covalently bound to DCAF16 and
- DCAF16 was not co- immunoprecipitated from cells treated with the non-electrophilic control compound C-KB02- SLF (Fig. 10C) or with the other two electrophilic bifunctional compounds (KB03-SLF and KB05-SLF) that did not support FKBP12 NLS degradation (Fig. 10D, Fig. 10E).
- Example 6 DCAF16 engagement
- DCAF 16 is a 216 aa protein that is highly conserved across mammals (e.g., human and rabbit DCAF 16 share 97% identity), but notably absent from rodents.
- the DCAF16 protein has eight cysteine residues, including a cluster of four cysteines between amino acids 173-179 (Fig. 3E).
- KB02-PEG0-SLF -reactive cysteine(s) in DCAF16 were mapped by treating HA-DCAF16- transfected HEK293T cells with DMSO or KB02-PEG0-SLF (10 mM, 2 h), affinity purifying HA-DCAF16, and subjecting the protein to trypsin digestion and LC-MS/MS analysis (Fig. 3E).
- the MS1 (parent ion) profiles were searched for the m/z values of unmodified and KB02-PEG0- SLF -modified DCAF16 tryptic peptides and identified a KB02-PEG0-SLF-modified form of the tryptic peptide (aa 168-184) containing C173 and 077-179 (Fig. 11A).
- KB02- PEGO-SLF-modified forms for tryptic peptides containing C100/C103 (aa 97-106) or Cl 19 (aa 107-133) (Fig. 11B, Fig. 11C) were not identified. No tryptic peptides containing C58 were detected, likely because it is a very small in length (four amino acids).
- BRD4 was selected as another nuclear protein for DCAF 16 mediated degradation.
- BRD4 has a potent and selective ligand JQ1 that has been successfully coupled to other E3 ligands to promote degradation (Winter, G.E. et al. Science 348, 1376-1381 (2015);
- Example 8 Methods for Examples 1-7
- the anti-HA (3724), FLAG (14793), DDB1 (6998), BRD4 (13440S), Lamin A/C (2032), K48-linked polyubiquitin (4289), HRP-linked rabbit IgG (7074) and HRP-linked mouse IgG (7076) antibodies were purchased from Cell Signaling Technology.
- the anti-FLAG HRP antibody (A8592), anti-FLAG affinity gel (A2220) and anti-HA agarose antibody (A2095) were purchased from Sigma-Aldrich.
- the anti-P-Actin antibody (sc-47778) was purchased from Santa Cruz Biotechnology.
- Alexa Fluor 488-conjugated goat anti-mouse IgG (H+L) secondary antibody (A-l 1001) and Alexa Fluor 568-conjugated goat anti-rabbit IgG (H+L) secondary antibody (A-l 1011) were purchased from Invitrogen.
- FuGene 6 (E2692) transfection reagent and sequencing grade modified trypsin (V5111) were purchased from Promega.
- Enzyme-linked chemiluminescence (ECL) (32106) and ECL plus (32132) western blotting detection reagents were purchased from Thermo Scientific. MG132 (S2619) was purchased from Selleck
- PEI Polyethylenimine
- TEV-tags were synthesized as described in Backus et ak, “Proteome-wide covalent ligand discovery in native biological systems”, Nature 534: 570-574 (2016).
- HEK 239T and MDA-MB-231 cells were obtained from ATCC and cultured in Dulbecco's Modified Eagle Medium (DMEM, Coming) with 10% (v/v) fetal bovine serum (FBS, Omega Scientific) and L-glutamine (2mM).
- DMEM Dulbecco's Modified Eagle Medium
- FBS fetal bovine serum
- L-glutamine (2mM) L-glutamine
- heavy and light labeled cell lines were cultured in DMEM medium with [ 13 C 6 , 15 N 2 ]-L-lysine and [ 13 C 6 , 15 N 4 ]-L-arginine (heavy labeled cells, 100 mg/mL each), or L-lysine and L-arginine (light labeled cells, 100 mg/mL each) for five generations.
- SILAC medium Both heavy and light SILAC medium were also supplemented with 10% (v/v) dialyzed FBS (Gemini), penicillin, streptomycin, and L- glutamine (2mM).
- FBS Gelar Component
- penicillin penicillin
- streptomycin and L- glutamine (2mM).
- Human Embryonic Kidney (HEK) 239 cells with DCAF16 gRNA CRISPR editing were purchased from Synthego and cultured in DMEM with 10% FBS and L-glutamine (2mM). All the cell lines were tested negative for mycoplasma contamination.
- Human FKBP1 A (FKBP12) cDNA with N-terminal FLAG tag or N-terminal FLAG tag and C-terminal nuclear localization sequence (NLS, PKKKRKV) was obtained by reverse transcription polymerase chain reaction (RT-PCR) amplification of a cDNA pool extracted from HEK293T cells and subcloned via EcoRI and BamHI sites into pCDH-CMV-MCS-EFl-Puro vector.
- Human DCAF16 cDNA with N-terminal HA tag was obtained by RT-PCR amplification of a cDNA pool extracted from HEK293T cells and subcloned via Sall and Notl sites into pRK5 vector.
- Human BRD4 with C-terminal FLAG tag was inserted into pRK5 vector by Gateway cloning technology.
- the expression vectors for DCAF16 mutants were generated by
- FLAG-FKBP12 or FLAG-FKBP12 NLS lentivirus was generated by co-transfection of FL AG-FKBP 12 or FL AG-FKBP 12_NL S , pCMV-dR8.2 and pMD2.G into HEK 293T cells using FuGene 6 transfection reagent (Promega). Virus-containing medium were collected 48h after transfection, filtered with 0.45 mM filter, and used to transduce HEK293T and MDA-MB- 231 cells in the presence of 10 pg/mL polybrene (Santa Cruz). 72h after transduction, puromycin (2 pg/mL) was added to cells.
- HEK293T cells stably expressing FLAG-FKBP12 or FLAG-FKBP12 NLS were obtained after puromycin selection for 7 days.
- HEK293T cells stably expressing pCDH empty vector were generated in parallel as control.
- shRNA lentivirus was generated by co-transfection of shRNA-containing vector, pCMV-dR8.2 and pMD2.G into HEK 293T cells using FuGene 6 transfection reagent
- Virus-containing medium were collected 48h after transfection and used to transiently transduce HEK293T cells stably expressing FLAG-FKBP12 NLS for 48h.
- Lentiviral shRNAs targeting human DCAF16 or DTL were in pLKO.1 vector and purchased from Sigma. The sequences of shRNAs is described below.
- DCAF16 CRISPR knockout HEK293 cell pools were generated by Synthego using nucleofection of Cas9-gRNA ribonucleoprotein (RNP) complex. Editing efficiency 48h post nucleofection of cell pool was 88%.
- HEK293 editing cell pools were subjected to single cell sorting in The Flow Cytometry Core Facility at Scripps Research. Individual cell clone was grown in 96-well plate until the cells were confluent. To confirm the editing in DCAF16 gene, genomic DNAs from each clone were extracted using PureLink Genomic DNA Mini Kit (Invitrogen). DCAF16 gene was amplified by PCR and confirmed by DNA sequencing. Indel analysis was performed using ICE analysis from Synthego.
- DCAF16 gRNA TC T G AC A AGT GGTC AGGAGA
- DCAF16 sequencing primer forward: TATTCAGGTATGGGAGTGGCTCTA
- DCAF16 sequencing primer reverse: GCCAGGATTTGAAGGAGATACTCT
- lentivirus containing FLAG- FKBP12 NLS was used to infect three wild type DCAF16 clones (clone 6, 17, 18) and three DCAF16 knockout clones (clone 3, 4, 22).
- Clone 6 stably expressing FLAG-FKBP12 NLS was grown in heavy SILAC DMEM medium for 5 generations.
- the other clones stably expressing FLAG-FKBP12 NLS were grown in light SILAC DMEM medium for 5 generations. All 6 clones were treated with 5 mM KB02-SLF and 10 pM MG132 for 2h.
- the membrane was blocked with 5% BSA in TBST buffer (0.1% Tween 20, 20 mM Tris-HCl 7.6, 150 mM NaCl) at room temperature for lh.
- the antibody was diluted with fresh 5% BSA in TBST buffer (1 : 10000 dilution for FLAG, HA and b-Actin, 1 : 1000 dilution for others) and incubated with membrane (lh room temperature for FLAG, HA and b-Actin, overnight 4 °C for others).
- Membrane was washed three times with TBST buffer and incubated with secondary antibody (1 :5000 dilution in 5% BSA in TBST) at room temperature for lh. Membrane was washed three times with TBST buffer. The chemiluminescence signal in membrane was recorded after developing in ECL or ECL plus western blotting detection reagent using CL-XPosure film (Thermo Scientific). Relative band intensities were quantified using ImageJ.
- HEK293T cells stably expressing FLAG-FKBP12 or FLAG-FKBP 12 NLS were harvested.
- Cell pellets were re-suspended in subcellular fraction buffer (250 mM Sucrose, 20 mM HEPES, pH 7.4, 10 mM KC1, 1.5 mM MgCl 2 , 1 mM EDTA, 1 mM EGTA, 1 mM DTT, protease inhibitor cocktail) and homogenized on ice by 20 passes through a 25-gauge syringe needle.
- the pellets after centrifugation (720 g, 5min) were homogenized on ice by 10 passes through a 25-gauge syringe needle.
- Nuclear fraction was collected as the pellets after centrifugaing at 720 g for 5 min. The supernatant was ultracentrifuged at 100,000 g for 1 h. The resulting supernatant was the cytosol fraction. Equivalent portions of the cytosol and nuclear fractions were then subjected to Western blot analyses.
- FLAG resin from light and heavy samples were combined and washed once with PBS.
- FLAG-FKBP12 NLS and its associating proteins were eluted by heating at 65 °C for 10 min with 8M urea in PBS, then reduced with 12.5 mM DTT at 65 °C for 15 min and alkylated with 25 mM iodoacetamide at 37 °C for 30 min.
- the protein solution was diluted with PBS to 2M urea and digested with 2 pg trypsin at 37 °C for 6h.
- Tryptic peptides were acidified with 5% formic acid and loaded onto a silica capillary column (250 pm) packed with 3 cm of Cl 8 resin (Aqua 5 pm, Phenomenex).
- Peptides were analyzed on LTQ-Orbitrap Elite mass spectrometer (Thermo Scientific) coupled with Thermo UltiMate 3000 UHPLC system. Peptides were separated on a capillary column packed with 3 cm of strong cation exchange (SCX) resin (Luna 5 pm, Phenomenex), 10 cm of C18 resin (Aqua 5 pm, Phenomenex) and a 5 pm tip.
- SCX strong cation exchange
- HEK293T cells were treated with DMSO or 10 mM KB02-SLF for 2h. Cells were collected and subjected to isoTOP-ABPP sample preparation using the same protocol as described in Backus et ak,“Proteome-wide covalent ligand discovery in native biological systems”, Nature 534: 570-574 (2016).
- HEK293T light and heavy SILAC cells were treated with DMSO and 5 mM of KB02- JQ1 for 24 h respectively.
- Light and heavy cells were collected and lysed in 1% NP-40 lysis buffer with cOmplete protease inhibitor cocktail. Cells were vortexed and sonicated for 5 pulses (40%, 4). The supernatant was collected after centrifugation at l6,000g for 10 min at 4 °C.
- Protein concentration was determined by DC assay. 50 pg proteome from light and heavy samples were mixed, followed by methanol/chloroform precipitation. Protein pellets were heated at 65 °C for 10 min with 8M urea in PBS, then reduced with 12.5 mM DTT at 65 °C for 15 min and alkylated with 25 mM iodoacetamide at 37 °C for 30 min. The protein solution was diluted with PBS to 2M urea and digested with 2 pg trypsin at 37 °C for 6h. Tryptic peptides were acidified with 5% formic acid. 5 pg peptides were loaded onto a silica capillary column (250 pm) packed with 3 cm of C18 resin. The same MudPIT method and CIMAGE software as described above were used to analyze the peptides. [0199] Immunofluorescence
- Triton X-100 v/v in 5% BSA in PBS
- the cells were incubated overnight (l4h) at 4°C with FLAG or HA antibody at 1/100 dilution (in 0.1% Triton X-l00/5% BSA in PBS).
- HEK293T cells were seeded in 96-well clear bottom white plate (Coming) at 3> ⁇ l0 4 cells per well in 100 pL of DMEM medium and grown for 24h.
- the cells were treated with 0.625, 1.25, 2.5, 5, 10, 20 and 40 pM of KB02-SLF or KB02-JQ1 (DMSO stock, final DMEM concentration is 0.1% (v/v)) in 100 pL of DMEM medium for 24h.
- 50 pL of Cell Titer Glo reagent Promega was added to each well and incubate for 10 min at room temperature. The luminescence was read on CLARIOstar (BMG LABTECH).
- DCAF16, DTL and GAPDH genes was performed using SYBR Select Master Mix (Applied Biosystems) on an ABI Real Time PCR System (Applied Biosystems). The sequences of qPCR primers are described below. Relative DCAF16 and DTL gene expression was normalized to the GAPDH gene.
- GAPDH primer forward: CTGGGCTACACTGAGCACC
- GAPDH primer reverse: AAGTGGTCGTTGAGGGC AATG
- DC AF 16 primer reverse: GGGACTTGTAAGAGGCTTTTGAA
- DTL primer forward: TCACTGGAATGCCGTCTTTGA
- DTL primer reverse: CTCACCAGCTTTTACGTCCC
- HEK293T cells were transfected with HA-DCAF16 plasmid by PEI transfection reagent for 24h and treated with DMSO or 10 mM KB02-PEG0-SLF for 2h. Cells were collected and lysed in 1% NP-40 lysis buffer with cOmplete protease inhibitor cocktail.
- HA-DCAF16 protein was eluted by heating at 65 °C for 10 min with 8M urea in PBS, then reduced with 12.5 mM DTT at 65 °C for 15 min and alkylated with 25 mM iodoacetamide at 37 °C for 30 min.
- the protein solution was diluted with PBS to 2M urea and digested with 2 pg trypsin at 37 °C for 6h.
- Tryptic peptides were acidified with 5% formic acid and loaded onto a silica capillary column (250 pm) packed with 3 cm of Cl 8 resin (Aqua 5 pm, Phenomenex).
- Peptides were analyzed on LTQ-Orbitrap Elite mass spectrometer (Thermo Scientific) coupled with a Thermo LTltiMate 3000 LIHPLC system. Peptides were separated on a capillary column packed with 10 cm of C18 resin (Aqua 5 pm, Phenomenex) and a 5 pm tip. The flow rate was 0.5 pL/min.
- the gradient was 5% acetonitrile with 0.1% formic acid from 0-15 min, 5-30% acetonitrile with 0.1% formic acid from 15-149 min, 30-95% acetonitrile with 0.1% formic acid from 149- l79min,95-5% acetonitrile with 0.1% formic acid from 179-180 min and 5% acetonitrile with 0.1% formic acid from 180-200 min.
- MS parameters were set as previously described 2 .
- the raw data was acquired in Xcalibur operation software.
- HEK293T cells were treated with DMSO (four biological replicates), 2 pM KB02- SLF (three biological replicates) or 20 pM KB02-JQ1 (three biological replicates) for 1.5 h (ten samples in total). Cells were collected, washed once with PBS and lysed in PBS by sonication (40%, 4, 20 pulses). Samples were clarified by centrifugation for 10 min at 8,000 g. Lysate was adjusted to 1.0 mg/mL in 500 pL.
- Protein pellets were resuspended in 90 pL of buffer containing 9 M urea, 10 mM DTT and 50 mM tetramethylammonium bicarbonate (pH 8.5), sonicated (40%, 4, 5 pulses) and heated at 65 °C for 20 min. Samples were cooled to room temperature and alkylated with 50 mM iodoacetamide (10 pL of 500 mM stock in H20) at 37 °C for 30 minutes. Samples were diluted with 350 pL of 50 mM tetramethylammonium bicarbonate (pH 8.5) and digested with 2 pg trypsin at 37 °C for 4 hours.
- Peptides were resuspended in 100 pL of 30% acetonitrile in 200 mM EPPS (pH 8) and labeled with TMTlOplex isobaric reagent following the manufacturer’s instructions. 0.15% of hydroxylamine (3 pL of 5% stock in H 2 0) was added to each sample to quench the reaction (incubate for 15 minutes). After adding 5 pL of formic acid to each sample, 10 peptide samples were combined and dried in vacuum concentrator. Peptides were further fractionated into 21 fractions using Pierce high pH reversed-phase peptide fractionation kit following the
- the 21 resulting fractions were pooled into 7 fractions by combining every 7th fraction (e.g. fraction 1, 8 and 15, fraction 2, 9 and 16, etc.) for subsequent mass spectrometry analysis.
- 7th fraction e.g. fraction 1, 8 and 15, fraction 2, 9 and 16, etc.
- the MS 2 data were acquired in the ion trap with the following parameter settings: 1) CID collision energy (%): 35, 2) AGC target: 1.8x 104, 3) Maximum injection time: 120 ms, 4) Activation Q: 0.25.
- the MS 3 data were acquired in the Orbitrap with the following parameter settings: 1) Orbitrap resolution: 50,000, 2) Number of SPS precursors: 10, 3) First mass: m/z 100, 4) HCD collision energy (%): 55, 5) AGC target: 1.5x 105, 6) maximum injection time: 120 ms.
- the raw data was acquired in Xcalibur operation software.
- MS 2 and MS 3 spectra data were extracted and analyzed in IP2 Integrated Proteomics Pipeline.
- mass spectrometry raw files were searched against a reverse-concatenated, nonredundant (gene-centric) database of the human proteome (Uniprot release -11/01/2012) and filtered using DTASelect 2.0 within the Scripps Goldfish Integrated Proteomics Pipeline (IP2) software. All cysteine residues were specified with a static
- Methionine residues were searched up to four differential modification for oxidation (+15.9949). MS3 quantification was performed using lOplex TMT analysis parameters (m/z 126.127726, 127.124761, 127.131081, 128.128116, 128.134436, 129.131471, 129.13779, 130.134825, 130.141145 and 131.13818) with the mass tolerance of 30 ppm.
- Example 10 Proteome-wide identification of KB02-JQ1- or KB02-SLF-induced protein degradation
- HEK293T light and heavy SILAC cells were treated with DMSO and KB02-JQ1 (20 mM) or KB02-SLF (2 mM) for 24 hours, respectively.
- Light and heavy cells were collected and lysed in 1% NP-40 lysis buffer with complete protease inhibitor cocktail. Cells were vortexed and sonicated for 5 pulses (40%, 4). The supernatant was collected after centrifugation at l6,000g for 10 min at 4 °C. Protein concentration was determined by DC assay. 50 pg proteome from light and heavy samples were mixed, followed by methanol/chloroform precipitation.
- Protein pellets were heated at 65 °C for 10 minutes with 8 M urea in PBS, then reduced with 12.5 mM DTT at 65 °C for 15 minutes and alkylated with 25 mM iodoacetamide at 37 °C for 30 minutes.
- the protein solution was diluted with PBS to 2 M urea and digested with 2 pg trypsin at 37 °C for 6 hours. Tryptic peptides were acidified with 5% formic acid. 5 pg peptides were loaded onto a silica capillary column (250 pm) packed with 3 cm of Cl 8 resin.
- a five-step MudPIT protocol was used in which 0%, 25%, 50%, 80% and 100% salt bumps of ammonium acetate (NH40Ac; 500 mM) were used to elute peptides stepwise from the SCX to the C18 resin followed by an increasing gradient of acetonitrile in each step (5%-l00% buffer B in buffer A; buffer A: 95% H20, 5% acetonitrile, 0.1% formic acid; buffer B: 5% H20, 95% acetonitrile,
- MS1 ion chromatograms ( ⁇ 10 ppm error tolerance of predicted m/z) were extracted from both Tight’ and‘heavy’ target peptide masses (m/z) that were generated using a retention time window ( ⁇ 10 min) centered on the time when the peptide ion was selected for MS/MS fragmentation, and subsequently identified.
- the ratio of the peak areas under the light and heavy signals (signal -to-noise ratio > 2.5) was calculated.
- Computational filters used to ensure that the correct peak-pair was used for quantification include a co-elution correlation score filter (R2 > 0.8), removing target peptides with bad co-elution profile, and an‘envelope correlation score’ filter (R2 > 0.8) that eliminates target peptides whose predicted pattern of the isotopic envelope distribution does not match the experimentally observed high-resolution MS1 spectrum.
- a co-elution correlation score filter R2 > 0.8
- an‘envelope correlation score’ filter R2 > 0.8
- the reaction mixture was diluted with ethyl acetate (20 mL), washed with 1N HC1 (30 mL), water (30 mL), and brine (30 mL). The organic layer was dried over anhydrous MgS0 4 and filtered. This solution was left overnight at 4 °C after which a white precipitate was found. The precipitate was filtered and dried to provide the title compound as a white amorphous solid (860 mg, 75%).
- SI-2 (118 mg, 0.25 mmol, 1 eq.), glutaric anhydride (31 mg, 0.27 mmol, 1.1 eq.) and N,N-diisopropylethylamine (97 mg, 0.75 mmol, 3 eq.) were dissolved in 0.5 mL DMF and stirred at room temperature for 4h. Upon completion, the reaction was diluted to 1 mL with water/acetonitrile/formic acid (50/50/0.1) and purified by preparative HPLC to afford the title compound as a white powder after lyophilization (55 mg, 47%).
- SI-3 14 mg, 0.029 mmol, 1.5 eq.
- COMU (12 mg, 0.028 mmol, 1.45 eq.
- N- methylmorpholine (6 pL, 0.057 mmol, 3 eq.) were dissolved in 150 pL of DMF and incubated for 1 min.
- SLF (10 mg, 0.019 mmol, 1 eq.) and catalytic 4-dimethylaminopyridine were added in 200 pL of DMF and the reaction was stirred at room temperature for 2h.
- reaction solution was diluted with ethyl acetate and acidified with 1M HC1, then extracted with ethyl acetate (2x30 mL), dried over anhydrous Na 2 S0 4 and concentrated under reduced pressure.
- the resultant residue was purified by column chromatography (10-30 % ethyl acetate/hexane) and dried under vacuum overnight. The product was yellow oil (774 mg, 34%). The residue was used in the next step without further purification.
- SI-5 (981 mg, 2.9 mmol) was dissolved in 2 mL of dichloromethane, 2 mL of trifluoroacetic acid and 40 pL of H 2 0. The reaction was stirred at room temperature for 2h.
- SI-6 100 mg, 0.35 mmol, 1.2 eq.
- COMU 159 mg, 0.37 mmol, 1.2 eq.
- N- methylmorpholine 102 pL, 0.93 mmol, 3 eq.
- Amino-PEG2-t-butyl ester 90mg, 0.39 mmol, 1.1 eq.
- 667 pL was added in 667 pL and the reaction was stirred for lh at room temperature.
- the reaction was diluted with ethyl acetate (10 mL) and water (10 mL).
- SI-7 (121 mg) was dissolved in 0.5 mL of dichloromethane, 0.5 mL of trifluoroacetic acid and 10 pL of H 2 0 and stirred room temperature for 2h. The solvent was removed under reduced pressure and the residue was dried under vacuum. The residue was used without further purification.
- SI-8 13 mg, 0.029 mmol, 1.5 eq.
- COMU (12 mg, 0.028 mmol, 1.45 eq.
- N- methylmorpholine (6 pL, 0.057 mmol, 3 eq.) were dissolved in 150 pL of DMF and incubated for 1 min.
- SLF (10 mg, 0.019 mmol, 1 eq.) and catalytic 4-dimethylaminopyridine were dissolved in 200 pL of DMF and added to the reaction. The reaction was stirred at room temperature for 2h. The reaction was diluted to 1 mL with water/acetonitrile/formic acid
- SI-6 (76 mg, 0.27 mmol, 1.2 eq.), COMU (115 mg, 0.27 mmol, 1.2 eq.), and N- methylmorpholine (74 pL, 0.67 mmol, 3 eq.) were dissolved in 333 pL of DMF and incubated for 1 min.
- Amino-PEG4-t-butyl ester 72 mg, 0.22 mmol, 1 eq. was added in 667 pL and the reaction was stirred for lh at room temperature. The reaction was then diluted with ethyl acetate (10 mL) and water (10 mL).
- SI-9 (119 mg) was dissolved in 0.5 mL of dichloromethane, 0.5 mL of trifluoroacetic acid and 10 pL of H 2 0 and stirred at room temperature for 2h. Upon consumption of the starting material, the reaction was concentrated under reduced pressure and dried under vacuum. The resulting residue was used without further purification.
- SI-10 13 mg, 0.025 mmol, 1.5 eq.
- COMU 10 mg, 0.024 mmol, 1.45 eq.
- N- methylmorpholine 6 pL, 0.057 mmol, 3 eq.
- SLF 9 mg, 0.017 mmol, 1 eq.
- the reaction was stirred at room temperature for 2h then the reaction was diluted to 1 mL with
- SI-6 (8 mg, 0.029 mmol, 1.5 eq.), COMU (12 mg, 0.028 mmol, 1.45 eq.), and N- methylmorpholine (6 pL, 0.057 mmol, 3 eq.) were dissolved in 150 pL of DMF and incubated for 1 min.
- SLF (10 mg, 0.019 mmol, 1 eq.) and catalytic 4-dimethylaminopyridine were added to the reaction in 200 pL of DMF.
- reaction was stirred at room temperature for 2h and then diluted to 1 mL with water/acetonitrile/formic acid (50/50/0.1) and purified by preparative HPLC and lyophilized to provide the title compound as a white powder (9.1 mg, 60%).
- SI-11 (239 mg, 0.72 mmol, 1 eq.) and N,N-diisopropylethylamine (250 pL, 1.44 mmol,
- SI-12 113 mg was dissolved in 1 mL of dichloromethane, 1 mL of trifluoroacetic acid and 20 pL of H 2 0. The reaction was stirred at room temperature for 2h then concentrated and dried under vacuum. The resulting residue was used without further purification.
- SI- 13 65 mg, 0.18 mmol, 1.2 eq.
- COMU 79 mg, 0.18 mmol, 1.2 eq.
- N- methylmorpholine 51 pL, 0.46 mmol, 3 eq.
- Amino-PEG2-t-butyl ester 36 mg, 0.35 mmol, 1 eq.
- the reaction was stirred at room temperature for lh. The reaction was diluted with ethyl acetate (10 mL) and washed with water (3x20 mL) and brine (20 mL).
- SI-14 (135 mg) was dissolved in 0.5 mL of dichloromethane, 0.5 mL of trifluoroacetic acid and 10 pL of H 2 0 and stirred at room temperature for 2h. The solvent was then removed under reduced pressure and dried under vacuum. The residue was used without further purification.
- SI- 15 13 mg, 0.025 mmol, 1.5 eq.
- COMU 10 mg, 0.024 mmol, 1.45 eq.
- N- methylmorpholine (6 pL, 0.057 mmol, 3 eq.) were dissolved in 150 pL of DMF and incubated for 1 min.
- SLF 9 mg, 0.017 mmol, 1 eq.
- catalytic 4-dimethylaminopyridine was added in 200 pL of DMF and the reaction was stirred for 2h at room temperature.
- SI- 16 (202 mg, 0.69 mmol, 1.2 eq.), COMU (296 mg, 0.69 mmol, 1.2 eq.), and N- methylmorpholine (190 pL, 1.7 mmol, 3 eq.) were dissolved in 1.5 mL DMF and incubated for 1 min.
- Amino-PEG3-t-butyl ester (160 mg, 0.58 mmol, 1 eq.) was added in 2.5 mL DMF and the reaction was stirred for 2h. The reaction was diluted with ethyl acetate (15 mL) and acidified with 1N HC1 to pH 3.
- SI- 17 200 mg, 0.36 mmol, 1 eq.
- N,N-diisopropylethylamine 127 pL, 0.73 mmol, 2 eq.
- Acryloyl chloride 88 pL, 1.1 mmol, 3 eq.
- 4-dimethylaminopyridine 13 mg, 0.11 mmol, 0.1 eq.
- the reaction was diluted with DCM (20 mL), washed with saturated NaHCCh (25 mL), 1M HC1 (25 mL), water (25 mL), dried over anhydrous MgSCL, and concentrated under reduced pressure. The residue was used without further purification.
- SI- 18 (221 mg) was dissolved in 1 mL of dichloromethane, 1 mL of trifluoroacetic acid, and 20 pL of H 2 0 and stirred at room temperature for 2h. The solvent was removed under reduced pressure and dried under vacuum. The residue was used without further purification.
- SI- 19 (10 mg, 0.019 mmol, 1.5 eq.), COMU (8 mg, 0.018 mmol, 1.45 eq.), and N- methylmorpholine (4 pL, 0.037 mmol, 3 eq.) were dissolved in 150 pL of DMF in stirred for 1 min.
- SLF (7 mg, 0.012 mmol, 1 eq.) and catalytic 4-dimethylaminopyridine were added in 200 pL of DMF and the reaction was stirred at room temperature for 4h.
- SI-20 (0.95 g, 4.6 mmol, 1 eq.) and CS2CO3 (2.3 g, 6.9 mmol, 1.5 eq.) were dissolved in 15 mL DMF.
- Tert-Butyl bromoacetate (0.78 mL, 5.8 mmol, 1.25 eq.) was added dropwise and the reaction was stirred at room temperature for 3h.
- the reaction was diluted with ethyl acetate (30 mL) and acidified with 1N HC1 to pH ⁇ 4.
- the organic layer was washed with water (3x40mL), dried over anhydrous Na 2 S0 4 , and concentrated under reduced pressure.
- SI-21 (442 mg) was dissolved in 2 mL of dichloromethane, 2 mL of trifluoroacetic acid and, 40 pL of H 2 0 and stirred at room temperature for 2h. The solvent was then removed and dried under vacuum. The resulting residue was used without further purification.
- SI-22 270 mg, 1.03 mmol, 1.2 eq.
- COMU 440 mg, 1.03 mmol, 1.2 eq.
- N- methylmorpholine (283 pL, 2.57 mmol, 3 eq.)
- Amino-PEG2-t-butyl ester 200 mg, 0.86 mmol, 1 eq.
- the reaction was stirred at room temperature for 1 h.
- the reaction was diluted with ethyl acetate (lOmL) and the organic phase washed with water (3xl5mL) and brine (lxl5mL).
- SI-23 (AMT) was dissolved in 0.5 mL of dichloromethane, 0.5 mL of trifluoroacetic acid, and 10 pL of H 2 0 and stirred at room temperature for 2h. The reaction was then concentrated under reduced pressure and dried under vacuum. The resulting residue was used without further purification.
- SI-24 (12 mg, 0.029 mmol, 1.5 eq.), COMU (12 mg, 0.028 mmol, 1.45 eq.), and N- methylmorpholine (6 pL, 0.057 mmol, 3 eq.) were dissolved in 150 pL of DMF and stirred for 1 min.
- SLF (10 mg, 0.019 mmol, 1 eq.) was added in 200 pL of DMF and the reaction was stirred for 4h at room temperature.
- the reaction was diluted to 1 mL with water/acetonitrile/formic acid (50/50/0.1) and purified via preparative HPLC then lyophilized to provide the title compound as a white powder (8.4 mg, 47%).
- SI-6 (lOOmg, 0.35 mmol, 1 eq.), t-Boc-N-amido-PEG2-amine (96 mg, 0.38 mmol, 1.1 eq.), EDCI (81 mg, 0.42, 1.2 eq.), N,N-diisopropylethylamine (122 pL, 0.7 mmol, 2 eq.), and catalytic 4-dimethylaminopyridine were dissolved in DCM (3 mL) and stirred at room temperature for 4 h. The reaction was diluted with DCM (10 mL) and washed with 1N HC1 (15 mL), saturated NaHCCh (15 mL), and brine (15 mL).
- (+)-JQl acid (4 mg, 0.01 mmol, 1 eq.), EDCI (3 mg, 0.01 mmol, 1.2 eq.), catalytic 4- dimethylaminopyridine, and N,N-diisopropyethyl amine (lOpL, 0.05 mmol, 5eq.) were added to a solution of SI-26 (9 mg, 0.02 mmol, 2 eq.) in DCM (0.5 mL) and stirred at room temperature for 2h. The reaction was diluted with DCM (10 mL) and washed with 1N HC1 (15 mL), saturated NaHCCh (15 mL), and brine (15 mL). The organic layer was then dried over anhydrous Na 2 S0 4 and concentrated. The residue was purified by prep TLC (DCM/MeOH;
- Table 1 illustrates the protein sequence of a DCAF16 described herein.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Molecular Biology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Toxicology (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201862745076P | 2018-10-12 | 2018-10-12 | |
| PCT/US2019/055958 WO2020077278A1 (en) | 2018-10-12 | 2019-10-11 | Compounds and methods for dcaf-mediated protein degradation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP3864030A1 true EP3864030A1 (en) | 2021-08-18 |
| EP3864030A4 EP3864030A4 (en) | 2022-09-21 |
Family
ID=70164896
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP19871964.3A Withdrawn EP3864030A4 (en) | 2018-10-12 | 2019-10-11 | COMPOUNDS AND METHODS FOR DCAF-MEDIATED PROTEIN DEGRADATION |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US11691984B2 (en) |
| EP (1) | EP3864030A4 (en) |
| WO (1) | WO2020077278A1 (en) |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102455171B1 (en) | 2013-12-18 | 2022-10-14 | 더 스크립스 리서치 인스티튜트 | Modified therapeutic agents, stapled peptide lipid conjugates, and compositions thereof |
| EP3737666A4 (en) | 2018-01-12 | 2022-01-05 | Kymera Therapeutics, Inc. | Protein degraders and uses thereof |
| EP3817822A4 (en) | 2018-07-06 | 2022-07-27 | Kymera Therapeutics, Inc. | PROTEIN DEGRADING AGENTS AND THEIR USES |
| WO2020077278A1 (en) | 2018-10-12 | 2020-04-16 | The Scripps Research Institute | Compounds and methods for dcaf-mediated protein degradation |
| CA3163507A1 (en) | 2019-12-04 | 2021-06-10 | The Scripps Research Institute | Peptide conjugates and methods of use |
| JP2023529099A (en) * | 2020-05-28 | 2023-07-07 | クルゲン(シャンハイ),インク. | Modified proteins and proteolysis inducers |
| US20240197694A1 (en) * | 2021-03-16 | 2024-06-20 | Cullgen (Shanghai), Inc. | Modified proteins and protein binders |
| IL309067A (en) | 2021-06-09 | 2024-02-01 | Scripps Research Inst | Long-range dual GIP/GLP-1 peptide conjugates and methods of use |
| AR130868A1 (en) * | 2022-10-25 | 2025-01-29 | Kymera Therapeutics Inc | PROTEIN DEGRADATORS AND THEIR USES |
| US12624035B2 (en) | 2024-09-06 | 2026-05-12 | Amphista Therapeutics Limited | Compounds for targeted protein degradation |
Family Cites Families (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9254311B2 (en) | 2012-04-02 | 2016-02-09 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins |
| US20180228907A1 (en) | 2014-04-14 | 2018-08-16 | Arvinas, Inc. | Cereblon ligands and bifunctional compounds comprising the same |
| WO2017007612A1 (en) | 2015-07-07 | 2017-01-12 | Dana-Farber Cancer Institute, Inc. | Methods to induce targeted protein degradation through bifunctional molecules |
| AU2016301196B2 (en) * | 2015-08-06 | 2022-09-08 | Dana-Farber Cancer Institute, Inc. | Tunable endogenous protein degradation |
| WO2017024317A2 (en) * | 2015-08-06 | 2017-02-09 | Dana-Farber Cancer Institute, Inc. | Methods to induce targeted protein degradation through bifunctional molecules |
| US9809603B1 (en) * | 2015-08-18 | 2017-11-07 | Deuterx, Llc | Deuterium-enriched isoindolinonyl-piperidinonyl conjugates and oxoquinazolin-3(4H)-yl-piperidinonyl conjugates and methods of treating medical disorders using same |
| US20190216893A1 (en) * | 2016-06-03 | 2019-07-18 | The Scripps Research Institute | Compositions and methods of modulating immune response |
| EP3558994A4 (en) * | 2016-12-23 | 2021-05-12 | Arvinas Operations, Inc. | COMPOUNDS AND METHODS FOR TARGETED DEGRADATION OF RAPIDLY ACCELERATED FIBROSARCOMA POLYPEPTIDES |
| US12023385B2 (en) * | 2017-02-08 | 2024-07-02 | Dana-Farber Cancer Institute, Inc. | Tunable endogenous protein degradation with heterobifunctional compounds |
| EP3580212A4 (en) * | 2017-02-08 | 2021-03-17 | Dana Farber Cancer Institute, Inc. | REGULATION OF CHIMERIC ANTIGEN RECEPTORS |
| KR20200003803A (en) | 2017-04-05 | 2020-01-10 | 레볼루션 메디슨즈, 인크. | Compounds Participating in Cooperative Bonds and Uses |
| CA3090417A1 (en) * | 2018-02-23 | 2019-08-29 | Dana-Farber Cancer Institute, Inc. | Small molecules for inducing selective protein degradation and uses thereof |
| WO2020077278A1 (en) | 2018-10-12 | 2020-04-16 | The Scripps Research Institute | Compounds and methods for dcaf-mediated protein degradation |
-
2019
- 2019-10-11 WO PCT/US2019/055958 patent/WO2020077278A1/en not_active Ceased
- 2019-10-11 US US16/600,326 patent/US11691984B2/en active Active
- 2019-10-11 EP EP19871964.3A patent/EP3864030A4/en not_active Withdrawn
Also Published As
| Publication number | Publication date |
|---|---|
| EP3864030A4 (en) | 2022-09-21 |
| US11691984B2 (en) | 2023-07-04 |
| WO2020077278A1 (en) | 2020-04-16 |
| US20200190105A1 (en) | 2020-06-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11691984B2 (en) | Compounds and methods for DCAF-mediated protein degradation | |
| Kawamura et al. | Highly selective inhibition of histone demethylases by de novo macrocyclic peptides | |
| CN113164495B (en) | Covalent targeting of E3 ligases | |
| US11964971B2 (en) | Methods and compositions for modulating splicing | |
| EP3891128A1 (en) | Substituted isoindolinones as modulators of cereblon-mediated neo-substrate recruitment | |
| ES2718900T3 (en) | Human EZH2 inhibitors and methods of use thereof | |
| CN114599366B (en) | Therapeutic conjugates | |
| WO2020073930A1 (en) | Targeted protease degradation platform | |
| Kim et al. | Antitumor activity of novel indirubin derivatives in rat tumor model | |
| DK2780326T3 (en) | PROCEDURE FOR INHIBITING DEUBIQUITINATION ACTIVITY | |
| CN112386604A (en) | Modulators of cGAS | |
| US20240400542A1 (en) | Sulfonyl-triazoles useful as covalent kinase ligands | |
| EP3642630A1 (en) | Lysine reactive probes and uses thereof | |
| WO2014159990A1 (en) | Interferon production using short rna duplexes | |
| US20200278355A1 (en) | Conjugated proteins and uses thereof | |
| CN103476411B (en) | Targeting human thymonucleotide kinase induces DNA repair toxicity in malignancy | |
| Carreiras et al. | Hydrazides as inhibitors of histone deacetylases | |
| Zhao et al. | From classic medicinal chemistry to state‐of‐the‐art interdisciplinary medicine: Recent advances in proteolysis‐targeting chimeras technology | |
| US9261497B2 (en) | Method of treating cancer with modulators of SCFSkp2 | |
| Zhong et al. | Discovery of a potent and selective protein arginine methyltransferase 5 (PRMT5) PROTAC degrader | |
| Jian et al. | Discovery of aminoratjadone derivatives as potent noncovalent CRM1 inhibitors | |
| Bano et al. | A review on cullin neddylation and strategies to identify its inhibitors for cancer therapy | |
| Mandel et al. | Covalent targeting leads to the development of a LIMK1 isoform-selective inhibitor | |
| Iyer et al. | Synthesis and characterization of DNA minor groove binding alkylating agents | |
| Ma et al. | Discovery of dCDK9-202 as a Highly Potent and Selective PROTAC CDK9 Degrader with Strong In Vivo Antitumor Activity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20210426 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R079 Free format text: PREVIOUS MAIN CLASS: C07K0014470000 Ipc: A61K0047550000 |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20220822 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: C07D 495/04 20060101ALI20220816BHEP Ipc: C07D 401/14 20060101ALI20220816BHEP Ipc: C07D 401/12 20060101ALI20220816BHEP Ipc: C07D 215/20 20060101ALI20220816BHEP Ipc: C07D 211/36 20060101ALI20220816BHEP Ipc: C07K 14/47 20060101ALI20220816BHEP Ipc: A61K 47/55 20170101AFI20220816BHEP |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20230321 |