EP3743516A1 - Targeting bcl11a distal regulatory elements with a cas9-cas9 fusion for fetal hemoglobin reinduction - Google Patents
Targeting bcl11a distal regulatory elements with a cas9-cas9 fusion for fetal hemoglobin reinductionInfo
- Publication number
- EP3743516A1 EP3743516A1 EP18902550.5A EP18902550A EP3743516A1 EP 3743516 A1 EP3743516 A1 EP 3743516A1 EP 18902550 A EP18902550 A EP 18902550A EP 3743516 A1 EP3743516 A1 EP 3743516A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- cell
- fusion protein
- dna
- composition
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/01—Preparation of mutants without inserting foreign genetic material therein; Screening processes therefor
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/14—Blood; Artificial blood
- A61K35/18—Erythrocytes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/48—Reproductive organs
- A61K35/54—Ovaries; Ova; Ovules; Embryos; Foetal cells; Germ cells
- A61K35/545—Embryonic stem cells; Pluripotent stem cells; Induced pluripotent stem cells; Uncharacterised stem cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
- A61K38/465—Hydrolases (3) acting on ester bonds (3.1), e.g. lipases, ribonucleases
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/795—Porphyrin- or corrin-ring-containing peptides
- C07K14/805—Haemoglobins; Myoglobins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K2035/124—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells the cells being hematopoietic, bone marrow derived or blood cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
Definitions
- Normal adult hemoglobin comprises four globin proteins, two of which are alpha (a) proteins and two of which are beta (b) proteins.
- the fetus produces fetal hemoglobin, which comprises two gamma (y)-globin proteins instead of the two b- globin proteins.
- a globin switch occurs, referred to as the“fetal switch”, at which point, erythroid precursors switch from making predominantly g-globin to making predominantly b-globin.
- the developmental switch from production of predominantly fetal hemoglobin or HbF (a 2 7 2 ) to production of adult hemoglobin or HbA (a 2 b 2 ) begins at about 28 to 34 weeks of gestation and continues shortly after birth until HbA becomes predominant. This switch results primarily from decreased transcription of the gamma-globin genes and increased transcription of beta-globin genes. On average, the blood of a normal adult contains less than 1% HbF, though residual HbF levels have a variance of over 20 fold in healthy adults and are genetically controlled.
- Hemoglobinopathies encompass a number of anemias of genetic origin in which there is a decreased production and/or increased destruction (hemolysis) of red blood cells (RBCs). These also include genetic defects that result in the production of abnormal hemoglobins with a concomitant impaired ability to maintain oxygen concentration. Some such disorders involve the failure to produce normal b-globin in sufficient amounts, while others involve the failure to produce normal b-globin entirely. These disorders associated with the b-globin protein are referred to generally as b- hemoglobinopathies. For example, b-thalassemias result from a partial or complete defect in the expression of the b-globin gene, leading to deficient or absent HbA.
- Sickle cell anemia results from a point mutation in the b-globin structural gene, leading to the production of an abnormal (sickle) hemoglobin (HbS).
- HbS is prone to polymerization, particularly under deoxygenated conditions.
- HbS RBCs are more fragile than normal RBCs and undergo hemolysis more readily, leading eventually to anemia.
- HbF fetal hemoglobin
- the switch from fetal hemoglobin to adult hemoglobin usually proceeds within six months after parturition.
- the upstream g globin genes are intact and fully functional, so that if these genes become reactivated, functional hemoglobin synthesis could be maintained during adulthood, and thus ameliorate disease severity.
- the in vivo molecular mechanisms underlying the globin switch are not well understood.
- kits for increasing fetal b-globin levels in a cell by disrupting BCL11A expression at the genomic level are also provided herein. Also provided herein are methods and compositions relating to the treatment of hemoglobinopathies by reinduction of fetal b-globin levels.
- One aspect of the invention described herein provides a method for producing a progenitor cell having decreased BCL11A mRNA or protein expression comprising contacting an isolated progenitor cell with an agent that deletes the GATA1 binding element in the functional core of the BCL11A enhancer +58kb, wherein the agent is a composition comprising a fusion protein comprising at least two DNA-targeting endonucleases, or the agent is a composition comprising a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases whereby the DNA- targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element to delete it, thereby reducing the mRNA or protein expression of BCL11A.
- the agent disrupts the GATA1 binding element in the functional core of the BCL11A enhancer +58kb.
- “disrupts” refers to the disruption of its expression, e.g., translation, post-translational processing, stability, degradation, or nuclear or cytoplasmic localization of a polypeptide, or transcription, post transcriptional processing, stability or degradation of a polynucleotide or bind to, partially or totally block stimulation, DNA binding, transcription factor activity, decrease, prevent, delay activation, inactivate, desensitize, or down regulate the activity of a polypeptide or polynucleotide encoding the GATA1 binding element.
- Disruption can be direct or indirect.
- Another aspect of the invention described herein provides a method for producing an isolated genetic engineered human cell having at least one genetic modification comprising; contacting an isolated cell with an effective amount of a composition comprising a fusion protein comprising at least two DNA-targeting endonucleases or a composition comprising a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases, whereby the DNA-targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element to delete it, thereby causing at least one genetic modification therein.
- Another aspect of the invention described herein provides a method of increasing fetal hemoglobin levels in a cell, the method comprising; contacting an isolated cell with an effective amount of a composition comprising a fusion protein comprising at least two DNA-targeting endonucleases or a composition comprising a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases, whereby the DNA-targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element to delete it, thereby causing at least one genetic modification therein, whereby fetal hemoglobin expression is increased in said cell, or its progeny, relative to said cell prior to said contacting.
- Another aspect of the invention described herein provides a method for increasing fetal hemoglobin levels in a mammal in need thereof, the method comprising; contacting an isolated hematopoietic progenitor cell in said mammal with an effective amount of a composition comprising a fusion protein comprising at least two DNA-targeting endonucleases or a composition comprising a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases, whereby the DNA-targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element, thereby causing at least one genetic modification therein, whereby fetal hemoglobin expression is increased in said mammal, relative to expression prior to said contacting.
- the isolated progenitor cell or isolated cell is a hematopoietic progenitor cell.
- the hematopoietic progenitor is a cell of the erythroid lineage.
- the isolated progenitor cell or isolated cell is a human cell.
- the isolated progenitor cell or isolated cell is a CD34+ cell.
- the isolated progenitor cell or isolated cell is an induced pluripotent stem cell.
- the hematopoietic progenitor cell is contacted ex vivo or in vitro.
- the at least one genetic modification is a deletion.
- the deletion removes the entire region or a portion of the targeted GATA1 binding element.
- the GATA1 binding element comprises, consists of, or consists essentially of SEQ ID NO: 1.
- the agent composition further comprises guideRNA.
- the guideRNA comprises, consists of, or consists essentially of a sequence selected from SEQ ID NOs 2-9.
- Another aspect of the invention described herein provides an isolated genetic engineered human cell having at least one genetic modification on chromosome 2 location 60,716,189-60,728,612, near the GATA1 binding element in the functional core of the BCL11A enhancer +58kb generated by any of the methods described herein.
- composition comprising isolated genetic engineered human cells described herein.
- Another aspect of the invention described herein provides a method for increasing fetal hemoglobin levels in a mammal in need thereof, the method comprising transplanting an isolated genetic engineered human cell or a composition described herein into the mammal.
- the mammal has been diagnosed with a hemoglobinopathy.
- the hemoglobinopathy is a b-hemoglobinopathy.
- the hemoglobinopathy is sickle cell disease.
- the hemoglobinopathy is b-thalassemia.
- Another aspect of the invention described herein provides a method of treatment of a
- hemoglobinopathy in a subject comprising; administering an effective amount of a composition comprising isolated genetic engineered human cells described herein, and whereby fetal hemoglobin expression is increased in the subject relative to prior treatment.
- the subject has been diagnosed with a hemoglobinopathy.
- the method further comprises selecting a subject who has been diagnosed with a hemoglobinopathy.
- Another aspect of the invention described herein provides a method of treatment of a
- hemoglobinopathy in a subject comprising; administering an effective amount of a composition comprising hematopoietic progenitor cells to the subject, wherein the hematopoietic progenitor cells have been contacted ex vivo or in vitro with an effective amount of a composition comprising a fusion protein comprising at least two DNA-targeting endonucleases, or a composition comprising a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases whereby the DNA-targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element, thereby causing at least one genetic modification therein, and whereby fetal hemoglobin expression is increased in the subject relative to prior treatment.
- the composition further comprises a pharmaceutically acceptable carrier or diluent.
- the composition is administered by injection, infusion, instillation, or ingestion.
- the mammal or subject is further administered an epigenetic modifier.
- the mammal or subject or isolated cells are human or derived from a human.
- the isolated progenitor cell or isolated cell is a hematopoietic progenitor cell.
- the isolated progenitor cell or isolated cell is a human cell.
- the isolated progenitor cell is a CD34+ cell.
- compositions comprising a CD34+ hematopoietic progenitor cell that comprises a fusion protein comprising at least two DNA-targeting endonucleases, or the CD34+ hematopoietic progenitor cell comprises a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases whereby the DNA- targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element, thereby causing at least one genetic modification therein, and thereby reduces the mRNA or protein expression of BCL11A in the cell.
- the composition further comprises a pharmaceutically acceptable carrier or diluent, and/or an epigenetic modifier.
- the CD 34+ hematopoietic progenitor cell is expanded ex vivo.
- the CD 34+ hematopoietic progenitor cell is formulated for injection or infusion.
- CD34+ hematopoietic progenitor cells comprise a fusion protein comprising at least two DNA-targeting endonucleases
- the CD34+ hematopoietic progenitor cells comprise a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases whereby the DNA-targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element, thereby causing at least one genetic modification therein, thereby reducing the mRNA or protein expression of BCL11A in the cells.
- the population of CD34+ hematopoietic progenitor cells further comprise a pharmaceutically acceptable carrier or diluent.
- the population of CD34+ hematopoietic progenitor cells further comprise an epigenetic modifier.
- the CD 34+ hematopoietic progenitor cell is expanded ex vivo.
- the CD 34+ hematopoietic progenitor cell is formulated for injection or infusion.
- compositions or methods described herein further comprise an epigenetic modifier.
- the fusion protein comprising at least two DNA-targeting endonucleases comprising a first Cas9 or Casl2a nuclease, said nuclease comprising a protospacer adjacent motif recognition domain and a peptide linker, wherein said peptide linker is attached to a second Cas9 or Casl2a nuclease.
- the Cas9 nuclease of the fusion protein is selected from the group consisting of SpCas9, SaCas9, NmCas9, CjCas9, and AnCas9.
- the Cas9 nuclease of the fusion protein is selected from the group consisting of FnCasl2a, LbCasl2a, and AsCasl2a.
- the protospacer adjacent motif recognition domain of fusion protein is selected from the group consisting of SpCas9, SpCas9 MT1 , SpCas9 MT2 , SpCas9 MT3 , NmCas9 SM and NmCas9 DM .
- the protospacer adjacent motif recognition domain of fusion protein is mutated or non-mutated.
- the peptide linker of fusion protein is a peptide linker. In one embodiment of any aspect, the peptide linker is between twenty-five and eighty amino acids. [0056] In one embodiment of any aspect, the fusion protein further comprises a guide RNA which is attached to a guide sequence element.
- the mutated protospacer adjacent motif recognition domain of the fusion protein comprises mutated DNA phosphodiester recognition amino acid residues.
- the guide RNA of said fusion protein is selected from the group consisting of an sgRNA sequence, a crRNA sequence and a tracrRNA sequence.
- the guide sequence element of said guide RNA of said fusion protein is truncated. In one embodiment of any aspect, the truncated guide sequence element is less than twenty nucleotides
- Figures 1A-1B show comparison of the different Cas9-DTU frameworks.
- Figure 1A shows the original Cas9MT-DTU system where the pDBD is either a zinc finger protein or a TALE array.
- Figure IB describes the Cas9-Cas9 fusion where DNA binding and cleavage by SpCas9MT is facilitated by direct linkage to NmCas9.
- the NmCas9 module can be nuclease-dead (dNmCas9) or active. If active, it can create precise deletions between the Cas9 cleavage sites with high efficiency.
- Figures 2A-2F show the assessment of the activity profiles of nucleases that are targeting the GATA1 binding element in BCL11A enhancer +58kb.
- Figure 2A shows the lesion rates and types are determined by deep sequencing. Single nucleases generate small indels at their corresponding cleavage sites, whereas dual nucleases (independent, fusionWT, or fusionMT) may generate six types of lesion products.
- Figure 2B shows the ratios of precise deletions relative to other types of lesions for each nuclease and target site.
- Figure 2C-2E shows an overview of the nuclease activities at 12 GATA1 target sites:
- Figure 2C shows the total lesion rates
- Figure 2D shows the precise deletion rates
- Figure 2E shows the fraction of precise deletions among all lesions.
- Each Box plot is drawn by GraphPad Prism, where the box represents 25th and 75th percentile and the middle line is the median. Whiskers and outliers are defined by the Tukey method.
- Statistical significance is determined by one-way analysis of variance (ANOVA),“*”,“***” and“****” denote P ⁇ 0.05, P ⁇ 0.001 and P ⁇ 0.0001 respectively. Deep sequencing data are from three independent biological replicates performed on different days in
- the SpCas9 protospacer is bold underlined with its PAM element
- the SaCas9 protospacer is double underlined with its PAM element
- the NmCas9 protospacer is wavy underlined with its PAM element.
- Figure 3 shows a table of SpCas9-SaCas9 RNP complex mixing parameters and titrations for BCL11A TS9 editing in CD34+ HSCs.
- Figure 4 shows the editing rates for SpCas9-SaCas9 fusion proteins in CD34+ HSCs at target site 9 (TS9).
- TS9 target site 9
- Two different complex formation approaches between the Cas9-Cas9 protein and the sgRNAs were examined (Samples 1 through 5 & 7 through 11) with a titration of different concentrations of each complex delivered to CD34+ HSCs via nucleofection.
- the majority of the deletion products that are observed are precise deletions (green bars) that will delete the critical GATA1 binding site from the BCL11A erythroid enhancer element.
- Sequence data are determined by deep sequencing PCR products spanning the target site in the treated genomic DNAs.
- FIG. 5 shows that Cas9-Cas9 fusions achieve robust and specific genome editing.
- Deep sequencing determined lesion rates for these nucleases at a subset of off-target sites discovered by the GUIDE-seq data or predicted by CasOFFinder.
- the deep sequencing data are from three independent biological replicates performed on different days in HEK293T cells. Error bars indicate ⁇ s.e.m.
- Statistical significance is determined by one-way analysis of variance (ANOVA),“*” and“NS” denote BH- adjusted P-values of ⁇ 0.05 and“not significant” respectively
- Figure 6 shows that SpCas9WT-SaCas9WT RNPs display low levels of off-target editing at two genomic target sites. Editing rates are ⁇ 0.3% at the highest doses. In addition, dose-dependent activity was observed at these target sites.
- the deep sequencing data are from one experiment.
- Figure 7 shows the qRT-PCR analysis of gamma-globin expression levels in CD34+ HSCs differentiated to erythrocytes, where these are represented as the fraction relative to beta-globin expression levels.
- X-axis corresponds to the sample #s in Figures 3 and 4.
- Figure 8 shows 40 pmol SpCas9-SaCas9 + 100 pmol sgRNA.
- the arrow indicates the deletion product at TS13 and TS14 target sites.
- Figure 9 shows BCL11A Target Site PCR amplicon.
- the SpCas9 1617 target site underlined.
- the SaCas9 TS13 target site is show in italics and the TS14 target site is squiggle underlined.
- Figure 10 shows 1617 target and sgRNA sequences, the TS13 target and sgRNA sequences, and the TS14 target and sgRNA sequences.
- Figure 11 shows three-stages of target site licensing of Cas9-DBD chimera.
- Figure 12 shows a schematic of Cas9-Cas9 fusions.
- Figure 13 shows sequence of four different configurations with various spacing.
- Figure 14 shows identification of functional parameters of the Cas9-dCas9 fusions.
- Figure 15 shows Cas9-dCas9 nucleases display improved specificity.
- Figure 16 shows Cas9-Cas9 dual nuclease fusions primarily generate precise segmental deletions.
- Figure 17 shows activity profiles of the given nucleases at 12 genomic sites.
- Figure 18 shows that Cas9-Cas9 fusions expand the targeting range of SpCas9.
- Figure 19 shows Cas9-Cas9 fusions effectively delete the GATA1 binding site within BCL11A enhancer +58kb in HEK293T.
- Figure 20 describes the production of functional Cas9-Cas9 fusion protein.
- the methods and compositions described herein relate, in part, to the discovery of a distal regulatory region upstream of the BCL11A gene that can regulate expression of the BCL11A protein.
- the BCL11A protein acts as a stage specific regulator of fetal hemoglobin expression by repressing y- globin induction.
- the methods and compositions provided herein are novel methods for the regulation of g-globin expression in erythroid cells. More specifically, these activities can be harnessed in methods for the treatment of b-hemoglobinopathies by induction of g-globin via inhibition of the BCL11A gene product.
- the disclosure described herein does not concern a process for cloning human beings, processes for modifying the germ line genetic identity of human beings, uses of human embryos for industrial or commercial purposes or processes for modifying the genetic identity of animals which are likely to cause them suffering without any substantial medical benefit to man or animal, and also animals resulting from such processes.
- One aspect provided herein relates to a method for producing a progenitor cell having decreased BCL11A mRNA or protein expression comprising contacting an isolated progenitor cell with an agent that deletes the GATA1 binding element in the functional core of the BCL11A enhancer +58kb, wherein the agent is a composition comprising a fusion protein comprising at least two DNA-targeting endonucleases, or the agent is a composition comprising a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases whereby the DNA-targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element to delete it, thereby reducing the mRNA or protein expression of BCL11A.
- a composition consists of a fusion protein comprising at least two DNA- targeting endonucleases, or a composition consists of a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases.
- the composition consists essentially of a fusion protein comprising at least two DNA-targeting endonucleases, or a composition consists essentially of a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases.
- “precise cleavages near the targeted GATA1 binding element” refers to precise cleavages within at least 100 base pairs of the start of the GATA1 binding element.
- the precise cleavages can be with 100 base pairs upstream or downstream of the start or end of the GATA1 binding element, respectively.
- the precise cleavages can be within at least 95, at least 90, at least 85, at least 80, at least 75, at least 70, at least 65, at least 60, at least 55, at least 50, at least 45, at least 40, at least 35, at least 30, at least 25, at least 20, at least 15, at least 10, at least 5, at least 4, at least 3, at least 2, at least 1, or less base pairs of the start or end of the GATA1 binding element. If at least two precise cleavages are made, the at least two precise cleavages can all be present upstream of the GATA1 binding element, downstream of the GATA1 binding element, or can be present both upstream and downstream of the GATA1 binding element.
- Another aspect provided herein relates to a method for producing an isolated genetic engineered human cell having at least one genetic modification comprising contacting an isolated cell with an effective amount of a composition comprising a fusion protein comprising at least two DNA-targeting endonucleases or a composition comprising a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases, whereby the DNA-targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element to delete it, thereby causing at least one genetic modification therein.
- Another aspect provided herein relates to a method of increasing fetal hemoglobin levels in a cell comprising contacting an isolated cell with an effective amount of a composition comprising a fusion protein comprising at least two DNA-targeting endonucleases or a composition comprising a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases, whereby the DNA-targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element to delete it, thereby causing at least one genetic modification therein, whereby fetal hemoglobin expression is increased in said cell, or its progeny, relative to said cell prior to said contacting.
- Another aspect provided herein relates to a method for increasing fetal hemoglobin levels in a mammal in need thereof comprising contacting an isolated hematopoietic progenitor cell in said mammal with an effective amount of a composition comprising a fusion protein comprising at least two DNA- targeting endonucleases or a composition comprising a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases, whereby the DNA-targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element, thereby causing at least one genetic modification therein, whereby fetal hemoglobin expression is increased in said mammal, relative to expression prior to said contacting.
- Another aspect provided herein relates to an isolated genetic engineered human cell having at least one genetic modification on chromosome 2 location 60,716,189-60,728,612, (according to UCSC Genome Browser hg 19 human genome assembly) near the GATA1 binding element in the functional core of the BCL11A enhancer +58kb generated by any method described herein.
- the decrease of BCL11A mRNA or protein expression is achieved by causing at least one genetic modification at the genomic DNA of the cell on chromosome 2 location 60,716,189-60,728,612 that results in epigenetic modification of the genetic function at chromosome 2 location 60,716,189- 60,728,612.
- the BCL11A enhancer activity located within this chromosome 2 location 60,716,189-60,728,612 is reduced.
- the enhancer activity in enhancing BCL11A mRNA or protein expression in the cell is at least 5% lower, at least 10% lower, at least 20% lower, at least 30% lower, at least 40% lower, at least 50% lower, at least 60% lower, at least 70% lower, at least 80% lower, at least 90% lower, at least l-fold lower, at least 2-fold lower, at least 5-fold lower, at least 10 fold lower, at least 100 fold lower, at least 1000-fold lower, or more compared to a control cell that is not treated in any method disclosed herein.
- decrease of the BCL11A mRNA or protein expression in the cell means that protein expression is at least 5% lower, at least 10% lower, at least 20% lower, at least 30% lower, at least 40% lower, at least 50% lower, at least 60% lower, at least 70% lower, at least 80% lower, at least 90% lower, at least l-fold lower, at least 2-fold lower, at least 5-fold lower, at least 10 fold lower, at least 100 fold lower, at least 1000-fold lower, or more compared to a control cell that is not treated in any method disclosed herein.
- composition comprising isolated genetic engineered human cells described herein.
- Another aspect provided herein relates to a method for increasing fetal hemoglobin levels in a mammal in need thereof, the method comprising transplanting an isolated genetic engineered human cell or a composition described herein into the mammal.
- Another aspect provided herein relates to a method of treatment of a hemoglobinopathy in a subject comprising; administering an effective amount of a composition comprising isolated genetic engineered human cells described herein, and whereby fetal hemoglobin expression is increased in the subject relative to prior treatment.
- Another aspect provided herein relates to a method of treatment of a hemoglobinopathy in a subject comprising administering an effective amount of a composition comprising hematopoietic progenitor cells to the subject, wherein the hematopoietic progenitor cells have been contacted ex vivo or in vitro with an effective amount of a composition comprising a fusion protein comprising at least two DNA-targeting endonucleases, or a composition comprising a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases whereby the DNA-targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element, thereby causing at least one genetic modification therein, and whereby fetal hemoglobin expression is increased in the subject relative to prior treatment.
- compositions comprising a CD34+ hematopoietic progenitor cell that comprises a fusion protein comprising at least two DNA-targeting endonucleases, or the CD34+ hematopoietic progenitor cell comprises a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases whereby the DNA-targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element, thereby causing at least one genetic modification therein, and thereby reduces the mRNA or protein expression of BCL11A in the cell.
- CD34+ hematopoietic progenitor cells comprise a fusion protein comprising at least two DNA-targeting endonucleases
- the CD34+ hematopoietic progenitor cells comprise a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases whereby the DNA-targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element, thereby causing at least one genetic modification therein, thereby reducing the mRNA or protein expression of BCL11A in the cells.
- the isolated progenitor cell or isolated cell is a hematopoietic progenitor cell, a human cell, a CD34+, or an induced pluripotent stem cell.
- the hematopoietic progenitor is a cell of the erythroid lineage. Methods of isolating hematopoietic progenitor cell are well known in the art, e.g., by flow cytometric purification of CD34+ or CD133+ cells, microbeads conjugated with antibodies against CD34 or CD 133, markers of hematopoietic progenitor cell. Commercial kits are also available, e.g., MACS® Technology CD34 MicroBead Kit, human, and CD34 MultiSort Kit, human, and
- the hematopoietic progenitor cell, the isolated human cell, or isolated cell is contacted ex vivo or in vitro.
- the at least one genetic modification is a deletion.
- An epigenetic modification can indirectly or directly affect the location on the chromosome which it resides.“Indirect affect” refers to long distance effects of epigenetic modification in the genomic DNA of the cell on chromosome.
- the deletion removes the entire region or a portion of the targeted GATA1 binding element.
- the GATA1 binding element site is at chr2: 60, 495, 264-60, 495, 271 in genome version hg38.
- the GATA1 binding element comprises, consists of, or consists essentially of SEQ ID NO: 1.
- the GATA1 binding motif is further described in, e.g., Canver, M. C. et al. BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis. Nature 527, 192-197 (2015), which is incorporated herein by reference in its entirety.
- SEQ ID NO: 1 is a nucleic acid sequence that encodes the GATA1 binding element.
- the deletion is of other functional sequences with the +58 BCL11A enhancer genomic region.
- the deletion comprises one or more of the DNAse 1 -hypersensitive sites (DHS) +62, +58, and +55 as described herein in the Examples section, in Table 1, and further in, e.g., Canver, M. C. et al. BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis. Nature 527, 192-197 (2015), which is incorporated herein by reference in its entirety.
- the deletion consists essentially of one or more of the DNAse 1 -hypersensitive sites (DHS) +62, +58, and +55 as described herein in the Examples section.
- the deletion consists of one or more of the DNAse 1 -hypersensitive sites (DHS) +62, +58, and +55 as described herein in the Examples section.
- the epigenetic modification comprises or affects one or more of the DNAse 1 -hypersensitive sites (DHS) +62, +58, and +55 as described herein in the Examples section.
- DHS DNAse 1 -hypersensitive sites
- the phrase“affects one or more of the DNAse 1 -hypersensitive sites” means natural function of these DNAse 1 -hypersensitive sites (DHS) +62, +58, and +55 are reduce, for example, access to transcription factors or DNA degradation enzymes such as DNase I.
- DNase I hypersensitive sites are regions of chromatin which are sensitive to cleavage by the DNase I enzyme.
- chromatin In these specific regions of the genome, chromatin has lost its condensed structure, exposing the DNA, and making it accessible. This raises the availability of DNA to degradation by enzymes, like DNase I. These accessible chromatin zones are functionally related to transcriptional activity, since this remodeled state is necessary for the binding of proteins such as transcription factors.
- the epigenetic modification contemplated herein results in reduced access to DNA degradation enzymes that is at least 5% lower, at least 10% lower, at least 20% lower, at least 30% lower, at least 40% lower, at least 50% lower, at least 60% lower, at least 70% lower, at least 80% lower, at least 90% lower, at least l-fold lower, at least 2-fold lower, at least 5-fold lower, at least 10 fold lower, at least 100 fold lower, at least 1000-fold lower, or more compared to a control cell that is not treated in any method disclosed herein.
- the deletion comprises one or more of the SNP markers described in Table 2. In another embodiment of this aspect and all other aspects described herein, the deletion consists essentially of one or more of the SNP markers described in Table 2. In another embodiment of this aspect and all other aspects described herein, the deletion consists of one or more of the SNP markers described in Table 2.
- the epigenetic modification comprises or affects one or more of the SNP markers described in Table 2.
- the phrase“affects one or more of the SNP markers” means natural function(s) of these SNPs are to reduce, for example, access to transcription factors. For example, methylation of these SNPs would reduce the binding of transcription factors, leading to reduced mRNA or protein expression of BCL11A.
- the deletion comprises one or more of the fragments listed in Table 7. In another embodiment of this aspect and all other aspects described herein, the deletion consists essentially of one or more of the fragments listed in Table 7. In another embodiment of this aspect and all other aspects described herein, the deletion consists of one or more of the fragments listed in Table 7.
- the deletion is from 60,716,189 to 60,728,612, from 60,716,189 to 60,723,870, from 60,722,992 to 60,728,612, from 60,717,236 to 60,719,036, from 60,722,006 to 60,723,058, from 60,724,917 to 60,726,282, from 60,616,396 to 60,618,032, from 60,623,536 to 60,624,989, from
- 60,626,565 to 60,628,177 from 60,717,236 to 60,719,036, from 60,721,212 to 60,722,958, from
- the epigenetic modification comprises or affects one or more of the fragments listed in Table 7.
- the phrase“affects one or more of the fragments listed in Table 7” means natural function(s) of these fragments are reduce, for example, access to transcription factors. For example, methylation of these fragments would reduce the binding of transcription factors, leading to reduced mRNA or protein expression of BCL11A.
- the epigenetic modification is from 60,716,189 to 60,728,612, from 60,716,189 to 60,723,870, from 60,722,992 to 60,728,612, from 60,717,236 to 60,719,036, from 60,722,006 to 60,723,058, from 60,724,917 to 60,726,282, from 60,616,396 to 60,618,032, from 60,623,536 to 60,624,989, from 60,626,565 to 60,628,177, from 60,717,236 to 60,719,036, from 60,721,212 to 60,722,958, from 60,724,780 to 60,726,471, from 60,739,075 to 60,740,154, from 60,748,003 to 60,749,009, from 60,826,438 to 60,827,601, or from 60,831,589 to 60,833,
- the deletion removes the entire region between chromosome 2 location 60,716,189-60,728,612 or removes a portion of the region resulting in disruption of one of more DNAse 1 -hypersensitive sites (DHS).
- DHS DNAse 1 -hypersensitive sites
- the term“disruption” refers to a decrease in erythroid transcription of BCL11A in a cell comprising a disruption of one or more DNAse -1 hypersensitive sites by at least 10% (e.g., at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or even 100% (i.e., no detectable erythroid transcription)) compared to a cell not having such a disruption.
- the disruption comprises an inability of a modified DNAse- 1 hypersensitive site to bind to its native transcription factors (e.g., GATA1 and TAL1).
- the epigenetic modification that interferes with the establishment and/or maintenance of the epigenetic signature at the enhancer region on chromosome 2 location 60,716,189-60,728,612 (according to UCSC Genome Browser hg 19 human genome assembly) thereby leading to reduced mRNA or protein expression of BCL11A, and increasing fetal hemoglobin expression in the mammal.
- the epigenetic modification that interferes with the establishment and/or maintenance of the epigenetic signature at the enhancer region on chromosome 2 location 60,716,189-60,728,612 includes but is not limited to epigenetic modifications that affects DNase I sensitivity, epigenetic modifications that affects histone modifications, epigenetic modifications that affects GATA1/TAL1 binding, and epigenetic modifications that affects long-range promoter interaction of the promoter of BCL11A.
- an epigenetic modification that interferes with the establishment and/or maintenance of the epigenetic signature at the enhancer region on chromosome 2 location 60,716,189- 60,728,612 include but is not limited to at least one deletion within chromosome 2 location 60,716,189- 60,728,612 such that the overall function of this region is affected whereby the mRNA and expression of BCL11A is reduced or decreased.
- the deletion is at the DNasel sensitivity regions chromosome 2 location 60,716,189-60,728,612, e.g., +62, +58, and +55.
- the deletion could be at +62 or +58 or +55 or combination thereof. For examples, at +62 and +58, +58 and +55, +62 and +55, or at all three +62, +58, and +55.
- an epigenetic modification that interferes with the establishment and/or maintenance of the epigenetic signature at the enhancer region on chromosome 2 location 60,716,189-
- 60,728,612 include but is not limited to changes in the histone modifications on chromosome 2 that is not at location 60,716,189-60,728,612, or changes in the histone modifications on chromosome 2 at location
- an epigenetic modification that interferes with the establishment and/or maintenance of the epigenetic signature at the enhancer region on chromosome 2 location 60,716,189-
- 60,728,612 include but is not limited to an insertion of at least one engineered specific -repressor sequence that change the epigenetic features of noncoding elements at chromosome 2 location
- the first is specifically focused on epigenetically repressing individual enhancers.
- insertion of engineered specific-repressor sequences into chromosome 2 would prospectively interfering with epigenetic modification at the BCL11A erythroid enhancer which eventually leads to reduced BCL11A gene expression.
- the insertion of at least one engineered specific-repressor sequence on any location chromosome 2 results in but is not limited to reduced DNasel sensitivity regions at chromosome 2 location 60,716,189-60,728,612, e.g., +62, +58, and +55; increased histone modifications on chromosome 2 location 60,716,189-60,728,612; reduced transcription factors binding to the GATA1/TAL1 of the enhancer region on chromosome 2 location
- the overall effects of the insertion of at least one engineered specific -repressor sequence on any location chromosome 2 is reduced or decreased mRNA and expression of BCL11A.
- the term “reduced” or“decreased” refers to at least 5% lower, at least 10% lower, at least 20% lower, at least 30% lower, at least 40% lower, at least 50% lower, at least 60% lower, at least 70% lower, at least 80% lower, at least 90% lower, at least l-fold lower, at least 2-fold lower, at least 5 -fold lower, at least 10 fold lower, at least 100 fold lower, at least 1000-fold lower, or more compared to the control situation that is in the absence of the epigenetic modification or insertion of engineered sequences disclosed herein.
- decrease of the BCL11A mRNA or protein expression in the cell means that protein expression is at least 5% lower, at least 10% lower, at least 20% lower, at least 30% lower, at least 40% lower, at least 50% lower, at least 60% lower, at least 70% lower, at least 80% lower, at least 90% lower, at least l-fold lower, at least 2-fold lower, at least 5 -fold lower, at least 10 fold lower, at least 100 fold lower, at least 1000-fold lower, or more compared to a control cell that does not have the epigenetic modification or insertion of engineered sequences disclosed herein.
- the insertion of at least one engineered specific-repressor sequence occurs within the DNasel sensitivity regions of chromosome 2 location 60,716,189-60,728,612, e.g., +62, +58, and +55.
- the insertion could be at the 5’end of +62 or +58 or +55 or at the 3’end of +62 or +58 or +55, or between +62 and +58, or between +58 and +55, or between +55 and +62.
- the insertion of at least one engineered specific-repressor sequence changes the DNasel sensitivity regions of chromosome 2 location 60,716,189-60,728,612.
- the epigenetic modification changes the DNasel sensitivity regions of chromosome 2 location 60,716,189-60,728,612.
- the epigenetic modification changes the histone modifications on chromosome 2 location 60,716,189-60,728,612.
- the insertion of at least one engineered specific-repressor sequence changes the histone modifications on chromosome 2 location
- the epigenetic modifications changes the GATA1/TAL1 binding of the enhancer region on chromosome 2 location
- 60.716.189-60,728,612 such that the overall function of this region is affected whereby the mRNA and expression of BCL11A is reduced or decreased.
- the insertion of at least one engineered specific-repressor sequence occurs within the GATA1/TAL1 as described herein.
- the insertion can be at the 5’ end or 3’end of GATA 1 or TAL 1.
- the insertion can be between GATA 1 and TALl.
- the insertion changes the GATA1/TAL1 binding of the enhancer region on chromosome 2 location 60,716,189-60,728,612 such that the overall function of this region is affected whereby the mRNA and expression of BCL11A is reduced or decreased. For example, the binding of transcription factors to the GATA1/TAL1.
- the epigenetic modification changes the interaction between the BCL11A enhancer and the BCL11A promoter.
- the interaction is reduced or weakened such that the overall function of this region is affected whereby the mRNA and expression of BCL11A is reduced or decreased.
- the epigenetic modifications changes the interaction between the chromosome 2 location 60,716,189-60,728,612 with the BCL11A promoter.
- the interaction is reduced or weakened such that the overall function of this region is affected whereby the mRNA and expression of BCL11A is reduced or decreased.
- the isolated genetic engineered human cell having at least one epigenetic modification at the genomic DNA of the cell on chromosome 2.
- the cells are transplanted into a mammal for use in increasing the fetal hemoglobin in the mammal.
- the isolated genetic engineered human cell having at least one genetic modification at the genomic DNA of the cell on chromosome 2 location 60,716,189-60,728,612 is transplanted into a mammal for use in increasing the fetal hemoglobin in the mammal.
- the isolated genetic engineered human cell having at least one genetic modification at the genomic DNA of the cell on chromosome 2 location 60,716,189-60,728,612 is stored for later use by cryopreservation.
- the cells are stored for later use by cryopreservation.
- the isolated genetic engineered human cell having at least one genetic modification at the genomic DNA of the cell on chromosome 2 location 60,716,189-60,728,612 is cryopreserved, thawed and transplanted into mammal for use in increasing the fetal hemoglobin in the mammal.
- any of those isolated genetic engineered human cells having at least one epigenetic modification cryopreserved, thawed and transplanted into mammal for use in increasing the fetal hemoglobin in the mammal.
- the agent composition further comprises guideRNA.
- the guideRNA comprising a sequence selected from SEQ ID NOs 2-9. GuideRNAs are known in the art. One of skill in the can determine an appropriate guideRNA for use in this disclosed invention.
- the method further comprises selecting a subject who has been diagnosed with a hemoglobinopathy.
- the mammal has been diagnosed with a hemoglobinopathy.
- hemoglobinopathies include b-hemoglobinopathy, sickle cell disease, and b-thalassemia.
- the composition is administered by injection, infusion, instillation, or ingestion.
- the mammal or subject is further administered an epigenetic modifier.
- the mammal or subject or isolated cells are human or derived from a human.
- the isolated progenitor cell or isolated cell is a hematopoietic progenitor cell. In one embodiment of this aspect, and all other aspects, the isolated progenitor cell or isolated cell is a human cell. In one embodiment of this aspect, and all other aspects, the isolated progenitor cell is a CD34+ cell.
- composition further comprises a pharmaceutically acceptable carrier or diluent, and/or an epigenetic modifier.
- the CD 34+ hematopoietic progenitor cell is expanded ex vivo.
- the CD 34+ hematopoietic progenitor cell is formulated for injection or infusion.
- the fusion protein comprises at least two DNA-targeting endonucleases comprising a first Cas9 or Casl2a nuclease, wherein said nuclease comprises a protospacer adjacent motif recognition domain and a peptide linker, and wherein said peptide linker is attached to a second Cas9 or Casl2a nuclease.
- the Cas9 nuclease of the fusion protein is SpCas9, SaCas9, NmCas9, CjCas9 and AnCas9.
- the Casl2a nuclease of the fusion protein is FnCasl2a, LbCasl2a and AsCasl2a.
- Cas proteins exemplified herein are merely examples, and are not to be construed as limiting. A vast number of Cas proteins derived from various species are known in the art, and one skilled in the art would be able to select and utilize at least one Cas protein in the present invention.
- the protospacer adjacent motif recognition domain of fusion protein is SpCas9, SpCas9 MT1 , SpCas9 MT2 , SpCas9 MT3 , NmCas9 SM and NmCas9 DM .
- the protospacer adjacent motif recognition domain of fusion protein is mutated or non-mutated. In one embodiment of this aspect, and all other aspects, the mutated protospacer adjacent motif recognition domain of the fusion protein comprises mutated DNA phosphodiester recognition amino acid residues.
- the peptide linker of fusion protein is a peptide linker between twenty-five and eighty amino acids. In one embodiment, the peptide linker is less than twenty-five, or more than 80 amino acids.
- the fusion protein further comprises a guide RNA which is attached to a guide sequence element.
- the guide RNA of said fusion protein is an sgRNA sequence, a crRNA sequence, or a tracrRNA sequence.
- the guide sequence element of said guide RNA of said fusion protein is truncated. In one embodiment of this aspect, and all other aspects, the truncated guide sequence element is less than twenty nucleotides.
- HbF-associated variations at BCL11A There are HbF-associated variations at BCL11A.
- Six GWAS of HbF level (or the highly correlated trait F-cell number) have been conducted in individuals of European, African and Asian descent, each identifying trait-associated variants within BCL11A (7-12). The same variants are associated with the clinical severity of SCD and b-thalassemia (9, 10, 50), consistent with HbF as a major modifier of these disorders.
- Variation at BCL11A is estimated to explain -15% of the trait variance in HbF level (7, 12, 43).
- rs 1427407 is the SNP most strongly associated with HbF level within the erythroid DHSs and better accounts for the trait association than other previously described sentinel SNPs.
- rsl427407 is found directly at the center of a GATA1 and TAL1 binding peak at DHS +62.
- chromatin was sonicated to approximately 500-bp fragments.
- the five primary human erythroid precursor samples heterozygous for rs 1427407 used for ChIP-qPCR were Sanger sequenced at the erythroid DHSs.
- HbF-associated rs 1427407- rs7606l73 haplotype influence BCL11A expression in an erythroid-specific context, a possibility consistent with the DNase I sensitivity findings.
- BCL11A mRNA expression in primary erythroid precursors differed by 1.7-fold between the high-HbF rsl427407-rs7606l73 T-G and low-HbF G-C haplotypes (data not show); correspondingly, median HbF levels were 10.6% and 3.1% in T-G and G-C homozygotes, respectively.
- the circulating yolk sac -derived primitive erythrocytes express embryonic-stage globins sy and bHI, whereas the fetal liver definitive erythroblasts express adult-stage globins b ⁇ and b2.
- BCL11A is expressed in the definitive but not primitive-stage erythroid lineage and required for the change in globin gene expression (16, 52).
- PCR and Southern blotting verified excision of the +50.4-60.4 kb intronic segment of Bell la in three unique MEL clones and two unique pre-B lymphocyte clones. Sanger-sequenced breakpoints were characteristic of TALEN-mediated cleavage with subsequent NHEJ repair.
- dramatic reduction in BCL11A transcript was observed in the MEL cell clones by RT-qPCR, using primer pairs detecting exon junctions upstream, spanning or downstream of the deletion.
- A‘‘nucleic acid”, as described herein, can be RNA or DNA, and can be single or double stranded, and can be selected, for example, from a group including: nucleic acid encoding a protein of interest, oligonucleotides, nucleic acid analogues, for example peptide- nucleic acid (PNA), pseudo complementary PNA (pc-PNA), locked nucleic acid (LNA) etc.
- PNA peptide- nucleic acid
- pc-PNA pseudo complementary PNA
- LNA locked nucleic acid
- nucleic acid sequences include, for example, but are not limited to, nucleic acid sequence encoding proteins, for example that act as transcriptional repressors, antisense molecules, ribozymes, small inhibitory nucleic acid sequences, for example but are not limited to RNAi, shRNAi, siRNA, micro RNAi (mRNAi), antisense oligonucleotides etc.
- the amount of interaction of BCL11A with the BCL11A binding partner in a BCL1 lA-inhibitor treated population is at least 10% lower, at least 20% lower, at least 30% lower, at least 40% lower, at least 50% lower, at least 60% lower, at least 70% lower, at least 80% lower, at least 90% lower, at least l-fold lower, at least 2-fold lower, at least 5 -fold lower, at least 10 fold lower, at least 100 fold lower, at least 1000-fold lower, or more than a comparable control treated population in which no BCL11A inhibitor is added.
- BCL11A interaction can be assayed by determining the amount of BCL11A binding to the BCL11A binding partner using techniques standard in the art, including, but not limited to, mass spectrometry, immunoprecipitation, or gel filtration assays.
- BCL11A activity can be assayed by measuring fetal hemoglobin expression at the mRNA or protein level following treatment with a candidate BCL11A inhibitor.
- BCL11A activity is the interaction of BCL11A with its binding partners: GATA-l, FOG-l, components of the NuRD complex, matrin-3, MTA2 and RBBP7. Accordingly, any antibody or fragment thereof, small molecule, chemical or compound that can block this interaction is considered an inhibitor of BCL11A activity.
- the term“genetic engineered cell” refers to a cell that comprises at least one genetic modification, as that term is used herein.
- the term“genetic modification” refers to a disruption at the genomic level resulting in a decrease in BCL11A expression or activity in a cell.
- Exemplary genetic modifications can include deletions, frame shift mutations, point mutations, exon removal, removal of one or more DNAse 1 -hypersensitive sites (DHS) (e.g., 2, 3, 4 or more DHS regions), etc.
- DHS DNAse 1 -hypersensitive sites
- BCL11A expression is meant that the amount of expression of BCL11A is at least 5% lower in a cell or cell population treated with a DNA-targeting endonuclease, than a comparable, control cell or cell population, wherein no agent that deletes the GATA1 binding element is present.
- the percentage of BCL11A expression in a treated population is at least 10% lower, at least 20% lower, at least 30% lower, at least 40% lower, at least 50% lower, at least 60% lower, at least 70% lower, at least 80% lower, at least 90% lower, at least l-fold lower, at least 2-fold lower, at least 5-fold lower, at least 10 fold lower, at least 100 fold lower, at least 1000-fold lower, or more than a comparable control treated population in which no agent that deletes the GATA1 binding element is added.
- BCL11A activity is meant that the amount of functional activity of BCL11A is at least 5% lower in a cell or cell population treated with the methods described herein, than a comparable, control cell or population, wherein no agent that deletes the GATA1 binding element is present.
- the percentage of BCL11A activity in a treated population is at least 10% lower, at least 20% lower, at least 30% lower, at least 40% lower, at least 50% lower, at least 60% lower, at least 70% lower, at least 80% lower, at least 90% lower, at least l-fold lower, at least 2-fold lower, at least 5-fold lower, at least 10 fold lower, at least 100 fold lower, at least 1000-fold lower, or more than a comparable control treated population in which no agent that deletes the GATA1 binding element is added.
- BCL11A activity can be assayed by determining the amount of BCL11A expression at the protein or mRNA levels, using techniques standard in the art.
- BCL11A activity can be determined using a reporter construct, wherein the reporter construct is sensitive to BCL11A activity.
- the g-globin locus sequence is recognizable by the nucleic acid-binding motif of the BCL11A construct.
- DNA targeting endonuclease refers to an endonuclease that generates a double-stranded break at a desired position in the genome (e.g., chromosome 2 location 60,716,189-60,728,612) without producing undesired off-target double-stranded breaks.
- the DNA targeting endonuclease can be a naturally occurring endonuclease (e.g., a bacterial meganuclease) or it can be artificially generated (e.g., engineered meganucleases, TALENs, or ZFNs, among others).
- the term“DNA targeting endonuclease” refers to an endonuclease that generates a single-stranded break or a“nick” or break on one strand of the DNA phosphate sugar backbone at a desired position in the genome (e.g., chromosome 2 location 60,716,189- 60,728,612) without producing undesired off-target DNA stranded breaks.
- vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
- plasmid refers to a circular double stranded DNA loop into which additional nucleic acid segments can be ligated.
- viral vector Another type of vector is a viral vector, wherein additional nucleic acid segments can be ligated into the viral genome.
- Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.
- vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as“recombinant expression vectors”, or more simply "expression vectors.”
- expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
- plasmid and “vector” can be used interchangeably as the plasmid is the most commonly used form of vector.
- the methods and compositions described herein can include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, lentiviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.
- operably linked is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a target cell when the vector is introduced into the target cell).
- regulatory sequence is intended to include promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in
- DNA-targeting endonuclease can be delivered by way of a vector comprising a regulatory sequence to direct synthesis of the DNA-targeting endonuclease at specific intervals, or over a specific time period. It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the target cell, the level of expression desired, and the like.
- cleaves generally refers to the generation of a double-stranded break in the DNA genome at a desired location.
- the term“effective amount of a composition comprising at least two DNA- targeting endonuclease” refers to an amount of at least two DNA-targeting endonuclease that yields sufficient endonuclease activity to generate at least two double-stranded breaks in the desired location of the genome with the goal of creating a deletion between these breaks.
- the effective amount of at least two DNA-targeting endonuclease generates at least two double-stranded break at the desired genetic locus in at least 20% of the cells in a population contacted with the composition (e.g., at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or even 100% of the cells in the population comprise a genetic modification produced by the DNA-targeting endonuclease composition).
- the term“increasing the fetal hemoglobin levels” in a cell indicates that fetal hemoglobin is at least 5% higher in populations treated with an agent that disrupts BCL11A mRNA or protein expression (e.g., comprising at least two DNA-targeting endonuclease) by binding to genomic DNA at chromosome 2 location 60,716,189-60,728,612, than in a comparable, control population, wherein no agent is present. It is preferred that the percentage of fetal hemoglobin expression in a population treated with such an agent that binds the genomic DNA at chromosome 2 location
- 60,716,189-60,728,612 is at least 10% higher, at least 20% higher, at least 30% higher, at least 40% higher, at least 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least l-fold higher, at least 2-fold higher, at least 5 -fold higher, at least 10 fold higher, at least 100 fold higher, at least 1000-fold higher, or more than a control treated population of comparable size and culture conditions.
- control treated population is used herein to describe a population of cells that has been treated with identical media, viral induction, nucleic acid sequences, temperature, confluency, flask size, pH, etc., with the exception of the addition of the agent that binds genomic DNA at chromosome 2 location 60,716,189-60,728,612.
- any method known in the art can be used to measure an increase in fetal hemoglobin expression, e. g. Western Blot analysis of fetal g- globin protein and quantifying mRNA of fetal g-globin.
- isolated cell refers to a cell that has been removed from an organism in which it was originally found, or a descendant of such a cell.
- the cell has been cultured in vitro, e.g., in the presence of other cells.
- the cell is later introduced into a second organism or re-introduced into the organism from which it (or the cell from which it is descended) was isolated.
- isolated population refers to a population of cells that has been removed and separated from a mixed or heterogeneous population of cells.
- an isolated population is a substantially pure population of cells as compared to the heterogeneous population from which the cells were isolated or enriched.
- the isolated population is an isolated population of human hematopoietic progenitor cells, e.g., a substantially pure population of human hematopoietic progenitor cells as compared to a heterogeneous population of cells comprising human hematopoietic progenitor cells and cells from which the human hematopoietic progenitor cells were derived.
- substantially pure refers to a population of cells that is at least about 75%, preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95% pure, with respect to the cells making up a total cell population.
- the terms "substantially pure” or “essentially purified,” with regard to a population of hematopoietic progenitor cells refers to a population of cells that contain fewer than about 20%, more preferably fewer than about 15%, 10%, 8%, 7%, most preferably fewer than about 5%, 4%, 3%, 2%, 1%, or less than 1%, of cells that are not hematopoietic progenitor cells as defined by the terms herein.
- the term “treating” includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder.
- treating and “treatment” refers to administering to a subject an effective amount of a composition, e.g., an effective amount of a composition comprising a population of hematopoietic progenitor cells so that the subject has a reduction in at least one symptom of the disease or an improvement in the disease, for example, beneficial or desired clinical results.
- beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptoms, diminishment of extent of disease, disease stabilization (e.g., not worsening), delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total) , whether detectable or undetectable.
- treating can refer to prolonging survival as compared to expected survival if not receiving treatment.
- a treatment can improve the disease condition, but may not be a complete cure for the disease.
- treatment can include prophylaxis. However, in alternative embodiments, treatment does not include prophylaxis.
- phrases "pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
- compositions, carriers, diluents and reagents are used interchangeably and represent that the materials are capable of administration to or upon a mammal without the production of undesirable physiological effects such as nausea, dizziness, gastric upset and the like.
- a pharmaceutically acceptable carrier will not promote the raising of an immune response to an agent with which it is admixed, unless so desired.
- the preparation of a pharmacological composition that contains active ingredients dissolved or dispersed therein is well understood in the art and need not be limited based on formulation.
- compositions are prepared as injectable either as liquid solutions or suspensions, however, solid forms suitable for solution, or suspensions, in liquid prior to use can also be prepared.
- the preparation can also be emulsified or presented as a liposome composition.
- the active ingredient can be mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient and in amounts suitable for use in the therapeutic methods described herein. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol or the like and
- compositions can contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents and the like which enhance the effectiveness of the active ingredient.
- auxiliary substances such as wetting or emulsifying agents, pH buffering agents and the like which enhance the effectiveness of the active ingredient.
- the therapeutic composition of the present invention can include pharmaceutically acceptable salts of the components therein.
- Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the polypeptide) that are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, tartaric, mandelic and the like.
- Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine and the like.
- Physiologically tolerable carriers are well known in the art.
- Exemplary liquid carriers are sterile aqueous solutions that contain no materials in addition to the active ingredients and water, or contain a buffer such as sodium phosphate at physiological pH value, physiological saline or both, such as phosphate-buffered saline.
- aqueous carriers can contain more than one buffer salt, as well as salts such as sodium and potassium chlorides, dextrose, polyethylene glycol and other solutes.
- Liquid compositions can also contain liquid phases in addition to and to the exclusion of water. Exemplary of such additional liquid phases are glycerin, vegetable oils such as cottonseed oil, and water-oil emulsions.
- the amount of an active agent used with the methods described herein that will be effective in the treatment of a particular disorder or condition will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques.
- prevention when used in reference to a disease, disorder or symptoms thereof, refers to a reduction in the likelihood that an individual will develop a disease or disorder, e.g., a hemoglobinopathy.
- the likelihood of developing a disease or disorder is reduced, for example, when an individual having one or more risk factors for a disease or disorder either fails to develop the disorder or develops such disease or disorder at a later time or with less severity, statistically speaking, relative to a population having the same risk factors and not receiving treatment as described herein.
- the failure to develop symptoms of a disease, or the development of reduced (e.g., by at least 10% on a clinically accepted scale for that disease or disorder) or delayed (e.g., by days, weeks, months or years) symptoms is considered effective prevention.
- the phrase“increasing fetal hemoglobin levels in a cell” indicates that fetal hemoglobin in a cell or population of cells is at least 5% higher in the cell or population of cells treated with the DNA-targeting endonuclease, than a comparable, control population, wherein no DNA-targeting endonuclease is present.
- the fetal hemoglobin expression in a DNA-targeting endonuclease treated cell is at least 10% higher, at least 20% higher, at least 30% higher, at least 40% higher, at least 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least l-fold higher, at least 2-fold higher, at least 5 -fold higher, at least 10 fold higher, at least 100 fold higher, at least lOOO-fold higher, or more than a comparable control treated population.
- control treated population is used herein to describe a population of cells that has been treated with identical media, viral induction, nucleic acid sequences, temperature, confluency, flask size, pH, etc., with the exception of the addition of the BCL11A inhibitor.
- mammal is intended to encompass a singular "mammal” and plural “mammals,” and includes, but is not limited to humans; primates such as apes, monkeys, orangutans, and chimpanzees; canids such as dogs and wolves; felids such as cats, lions, and tigers; equids such as horses, donkeys, and zebras; food animals such as cows, pigs, and sheep; ungulates such as deer and giraffes; rodents such as mice, rats, hamsters and guinea pigs; and bears.
- a mammal is a human.
- the mammal has been diagnosed with a hemoglobinopathy.
- the hemoglobinopathy is a b-hemoglobinopathy.
- the hemoglobinopathy is a sickle cell disease.
- “sickle cell disease” can be sickle cell anemia, sickle-hemoglobin C disease (HbSC), sickle beta-plus-thalassaemia (HbS/b-i-), or sickle beta-zero- thalassaemia (HbS/bO).
- the hemoglobinopathy is a b-thalassemia.
- hemoglobinopathy means any defect in the structure or function of any hemoglobin of an individual, and includes defects in the primary, secondary, tertiary or quaternary structure of hemoglobin caused by any mutation, such as deletion mutations or substitution mutations in the coding regions of the b-globin gene, or mutations in, or deletions of, the promoters or enhancers of such genes that cause a reduction in the amount of hemoglobin produced as compared to a normal or standard condition.
- the term further includes any decrease in the amount or effectiveness of hemoglobin, whether normal or abnormal, caused by external factors such as disease, chemotherapy, toxins, poisons, or the like.
- the term“effective amount”, as used herein, refers to the amount of a cell composition that is safe and sufficient to treat, lesson the likelihood of, or delay the development of a hemoglobinopathy.
- the amount can thus cure or result in amelioration of the symptoms of the hemoglobinopathy, slow the course of hemoglobinopathy disease progression, slow or inhibit a symptom of a hemoglobinopathy, slow or inhibit the establishment of secondary symptoms of a hemoglobinopathy or inhibit the development of a secondary symptom of a hemoglobinopathy.
- the effective amount for the treatment of the hemoglobinopathy depends on the type of hemoglobinopathy to be treated, the severity of the symptoms, the subject being treated, the age and general condition of the subject, the mode of administration and so forth. Thus, it is not possible or prudent to specify an exact“effective amount". However, for any given case, an appropriate“effective amount" can be determined by one of ordinary skill in the art using only routine experimentation.
- the term "consisting essentially of' refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.
- compositions, methods, and respective components thereof refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
- Fetal hemoglobin is a tetramer of two adult a-globin polypeptides and two fetal b-like g- globin polypeptides.
- the duplicated g-globin genes constitute the predominant genes transcribed from the b-globin locus.
- g-globin becomes progressively replaced by adult b-globin, a process referred to as the "fetal switch" (3).
- the molecular mechanisms underlying this switch have remained largely undefined and have been a subject of intense research.
- HbF fetal hemoglobin
- HbA adult hemoglobin
- Hemoglobinopathies encompass a number of anemias of genetic origin in which there is a decreased production and/or increased destruction (hemolysis) of red blood cells (RBCs). These disorders also include genetic defects that result in the production of abnormal hemoglobins with a concomitant impaired ability to maintain oxygen concentration. Some such disorders involve the failure to produce normal b-globin in sufficient amounts, while others involve the failure to produce normal b-globin entirely. These disorders specifically associated with the b-globin protein are referred to generally as b- hemoglobinopathies. For example, b-thalassemias result from a partial or complete defect in the expression of the b-globin gene, leading to deficient or absent HbA.
- Sickle cell anemia results from a point mutation in the b-globin structural gene, leading to the production of an abnormal (sickled) hemoglobin (HbS).
- HbS RBCs are more fragile than normal RBCs and undergo hemolysis more readily, leading eventually to anemia (Atweh, Semin. Hematol. 38(4):367-73 (2001)).
- HBS1L-MYB variation ameliorates the clinical severity in beta-thalassemia.
- This variant has been shown to be associated with HbF levels. It has been shown that there is an odds ratio of 5 for having a less severe form of beta-thalassemia with the high-HbF variant (Galanello S. et ak, 2009, Blood, in press).
- HbF fetal hemoglobin
- the second group of compounds investigated for the ability to cause HbF reactivation activity was short chain fatty acids.
- the initial observation in fetal cord blood progenitor cells led to the discovery that g-aminobutyric acid can act as a fetal hemoglobin inducer (Perrine et al., Biochem Biophys Res Commun.148(2):694-700 (1987)).
- Subsequent studies showed that butyrate stimulated globin production in adult baboons (Constantoulakis et al., Blood. Dec; 72(6): 1961-7 (1988)), and it induced g-globin in erythroid progenitors in adult animals or patients with sickle cell anemia (Perrine et al., Blood.
- hydroxyurea stimulates HbF production and has been shown to clinically reduce sickling crisis, it is potentially limited by myelotoxicity and the risk of carcinogenesis.
- Potential long term carcinogenicity would also exist in 5-azacytidine-based therapies.
- Erythropoietin-based therapies have not proved consistent among a range of patient populations.
- the short half-lives of butyric acid in vivo have been viewed as a potential obstacle in adapting these compounds for use in therapeutic interventions.
- butyric acid are necessary for inducing g-globin gene expression, requiring catheritization for continuous infusion of the compound.
- these high dosages of butyric acid can be associated with neurotoxicity and multiorgan damage (Blau, et ah, Blood 81: 529-537 (1993)). While even minimal increases in HbF levels are helpful in sickle cell disease, b-thalassemias require a much higher increase that is not reliably, or safely, achieved by any of the currently used agents (Olivieri, Seminars in Hematology 33: 24-42 (1996)).
- BCL11A a C2H2-type zinc finger transcription factor
- lymphocyte development Liu et al., Nat Immunol 4, 525 (2003) and Liu et al., Mol Cancer 5, 18 (2006)
- red blood cell production or globin gene regulation has not been previously assessed.
- the hematopoietic progenitor cell is contacted ex vivo or in vitro.
- the cell being contacted is a cell of the erythroid lineage.
- the cell composition comprises cells having decreased BCL11A expression.
- Hematopoietic progenitor cell refers to cells of a stem cell lineage that give rise to all the blood cell types including the myeloid (monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells), and the lymphoid lineages (T-cells, B-cells, NK-cells).
- A“cell of the erythroid lineage” indicates that the cell being contacted is a cell that undergoes erythropoeisis such that upon final differentiation it forms an erythrocyte or red blood cell (RBC).
- Such cells belong to one of three lineages, erythroid, lymphoid, and myeloid, originating from bone marrow haematopoietic progenitor cells.
- haematopoietic progenitor cells Upon exposure to specific growth factors and other components of the haematopoietic microenvironment, haematopoietic progenitor cells can mature through a series of intermediate differentiation cellular types, all intermediates of the erythroid lineage, into RBCs.
- cells of the“erythroid lineage”, as the term is used herein comprise hematopoietic progenitor cells, rubriblasts, prorubricytes, erythroblasts, metarubricytes, reticulocytes, and erythrocytes.
- the hematopoietic progenitor cell has at least one of the cell surface marker characteristic of hematopoietic progenitor cells: CD34+, CD59+, Thyl/CD90+,CD38lo/-, and C- kit/CDl 17+.
- the hematopoietic progenitor cells have several of these markers.
- the hematopoietic progenitor cells of the erythroid lineage have the cell surface marker characteristic of the erythroid lineage: CD71 and Terl 19.
- Stem cells such as hematopoietic progenitor cells, are capable of proliferation and giving rise to more progenitor cells having the ability to generate a large number of mother cells that can in turn give rise to differentiated or differentiable daughter cells.
- the daughter cells themselves can be induced to proliferate and produce progeny that subsequently differentiate into one or more mature cell types, while also retaining one or more cells with parental developmental potential.
- stem cell refers then, to a cell with the capacity or potential, under particular circumstances, to differentiate to a more specialized or differentiated phenotype, and which retains the capacity, under certain circumstances, to proliferate without substantially differentiating.
- progenitor or stem cell refers to a generalized mother cell whose descendants (progeny) specialize, often in different directions, by differentiation, e.g., by acquiring completely individual characters, as occurs in progressive diversification of embryonic cells and tissues.
- Cellular differentiation is a complex process typically occurring through many cell divisions.
- a differentiated cell may derive from a multipotent cell which itself is derived from a multipotent cell, and so on.
- stem cells While each of these multipotent cells may be considered stem cells, the range of cell types each can give rise to may vary considerably. Some differentiated cells also have the capacity to give rise to cells of greater developmental potential. Such capacity may be natural or may be induced artificially upon treatment with various factors. In many biological instances, stem cells are also "multipotent” because they can produce progeny of more than one distinct cell type, but this is not required for "stem-ness.” Self-renewal is the other classical part of the stem cell definition, and it is essential as used in this document. In theory, self-renewal can occur by either of two major mechanisms. Stem cells may divide asymmetrically, with one daughter retaining the stem state and the other daughter expressing some distinct other specific function and phenotype.
- stem cells in a population can divide symmetrically into two stems, thus maintaining some stem cells in the population as a whole, while other cells in the population give rise to differentiated progeny only.
- progenitor cells have a cellular phenotype that is more primitive (i.e., is at an earlier step along a developmental pathway or progression than is a fully differentiated cell).
- progenitor cells also have significant or very high proliferative potential.
- Progenitor cells can give rise to multiple distinct differentiated cell types or to a single differentiated cell type, depending on the developmental pathway and on the environment in which the cells develop and differentiate.
- differentiated is a cell that has progressed further down the developmental pathway than the cell it is being compared with.
- stem cells can differentiate to lineage-restricted precursor cells (such as a hematopoietic progenitor cell), which in turn can differentiate into other types of precursor cells further down the pathway (such as an erthyrocyte precursor), and then to an end-stage differentiated cell, such as an erthyrocyte, which plays a characteristic role in a certain tissue type, and may or may not retain the capacity to proliferate further.
- the genetic engineered human cells described herein are derived from isolated pluripotent stem cells.
- An advantage of using iPSCs is that the cells can be derived from the same subject to which the progenitor cells are to be administered. That is, a somatic cell can be obtained from a subject, reprogrammed to an induced pluripotent stem cell, and then re-differentiated into a hematopoietic progenitor cell to be administered to the subject (e.g., autologous cells).
- the progenitors are essentially derived from an autologous source, the risk of engraftment rejection or allergic responses is reduced compared to the use of cells from another subject or group of subjects.
- the hematopoeitic progenitors are derived from non-autologous sources.
- the use of iPSCs negates the need for cells obtained from an embryonic source.
- the stem cells used in the disclosed methods are not embryonic stem cells.
- reprogramming refers to a process that alters or reverses the differentiation state of a differentiated cell (e.g., a somatic cell). Stated another way, reprogramming refers to a process of driving the differentiation of a cell backwards to a more undifferentiated or more primitive type of cell. It should be noted that placing many primary cells in culture can lead to some loss of fully differentiated characteristics. Thus, simply culturing such cells included in the term
- differentiated cells does not render these cells non-differentiated cells (e.g., undifferentiated cells) or pluripotent cells.
- the transition of a differentiated cell to pluripotency requires a reprogramming stimulus beyond the stimuli that lead to partial loss of differentiated character in culture.
- Reprogrammed cells also have the characteristic of the capacity of extended passaging without loss of growth potential, relative to primary cell parents, which generally have capacity for only a limited number of divisions in culture.
- the cell to be reprogrammed can be either partially or terminally differentiated prior to reprogramming.
- reprogramming encompasses complete reversion of the differentiation state of a differentiated cell (e.g., a somatic cell) to a pluripotent state or a multipotent state.
- reprogramming encompasses complete or partial reversion of the differentiation state of a differentiated cell (e.g., a somatic cell) to an undifferentiated cell (e.g., an embryonic-like cell). Reprogramming can result in expression of particular genes by the cells, the expression of which further contributes to reprogramming.
- reprogramming of a differentiated cell causes the differentiated cell to assume an undifferentiated state (e.g., is an undifferentiated cell).
- the resulting cells are referred to as
- reprogrammed cells or“induced pluripotent stem cells (iPSCs or iPS cells).”
- Reprogramming can involve alteration, e.g., reversal, of at least some of the heritable patterns of nucleic acid modification (e.g., methylation), chromatin condensation, epigenetic changes, genomic imprinting, etc., that occur during cellular differentiation.
- Reprogramming is distinct from simply maintaining the existing undifferentiated state of a cell that is already pluripotent or maintaining the existing less than fully differentiated state of a cell that is already a multipotent cell (e.g., a hematopoietic stem cell).
- Reprogramming is also distinct from promoting the self-renewal or proliferation of cells that are already pluripotent or multipotent, although the compositions and methods described herein can also be of use for such purposes, in some embodiments.
- reprogramming The specific approach or method used to generate pluripotent stem cells from somatic cells (broadly referred to as“reprogramming”) is not critical to the claimed invention. Thus, any method that re-programs a somatic cell to the pluripotent phenotype would be appropriate for use in the methods described herein.
- iPSCs resemble ES cells as they restore the pluripotency-associated transcriptional circuitry and muc of the epigenetic landscape.
- mouse iPSCs satisfy all the standard assays for pluripotency: specifically, in vitro differentiation into cell types of the three germ layers, teratoma formation, contribution to chimeras, germline transmission (Maherali and Hochedlinger, 2008), and tetraploid complementation (Woltjen et al., 2009).
- iPS cells can be obtained using similar transduction methods (Lowry et al., 2008; Park et al., 2008; Takahashi et al., 2007; Yu et al., 2007b), and the transcription factor trio, OCT4, SOX2, and NANOG, has been established as the core set of transcription factors that govern pluripotency (Jaenisch and Young, 2008).
- the production of iPS cells can be achieved by the introduction of nucleic acid sequences encoding stem cell-associated genes into an adult, somatic cell, historically using viral vectors.
- iPS cells can be generated or derived from terminally differentiated somatic cells, as well as from adult stem cells, or somatic stem cells. That is, a non-pluripotent progenitor cell can be rendered pluripotent or multipotent by reprogramming. In such instances, it may not be necessary to include as many reprogramming factors as required to reprogram a terminally differentiated cell.
- reprogramming can be induced by the non-viral introduction of reprogramming factors, e.g., by introducing the proteins themselves, or by introducing nucleic acids that encode the reprogramming factors, or by introducing messenger RNAs that upon translation produce the reprogramming factors (see e.g., Warren et al., Cell Stem Cell, 2010 Nov 5;7(5):6l8-30).
- Reprogramming can be achieved by introducing a combination of nucleic acids encoding stem cell-associated genes including, for example Oct-4 (also known as Oct-3/4 or Pouf5l), Soxl, Sox2, Sox3, Sox 15, Sox 18, NANOG, , Klfl, Klf2,
- reprogramming using the methods and compositions described herein can further comprise introducing one or more of Oct-3/4, a member of the Sox family, a member of the Klf family, and a member of the Myc family to a somatic cell.
- the methods and compositions described herein further comprise introducing one or more of each of Oct 4, Sox2, Nanog, c-MYC and Klf4 for reprogramming. As noted above, the exact method used for reprogramming is not necessarily critical to the methods and compositions described herein.
- the reprogramming is not effected by a method that alters the genome.
- reprogramming is achieved, e.g., without the use of viral or plasmid vectors.
- the efficiency of reprogramming i.e.. the number of reprogrammed cells derived from a population of starting cells can be enhanced by the addition of various small molecules as shown by Shi, Y., et al (2008) Cell-Stem Cell 2:525-528, Huangfu, D., et al (2008) Nature Biotechnology 26(7):795- 797, and Marson, A., et al (2008) Cell-Stem Cell 3: 132-135.
- an agent or combination of agents that enhance the efficiency or rate of induced pluripotent stem cell production can be used in the production of patient-specific or disease-specific iPSCs.
- agents that enhance reprogramming efficiency include soluble Wnt, Wnt conditioned media, BIX-01294 (a G9a histone methyltransferase), PD0325901 (a MEK inhibitor), DNA methyltransferase inhibitors, histone deacetylase (HDAC) inhibitors, valproic acid, 5'-azacytidine, dexamethasone, suberoylanilide, hydroxamic acid (SAHA), vitamin C, and trichostatin (TSA), among others.
- reprogramming enhancing agents include: Suberoylanilide Hydroxamic Acid (SAHA (e.g., MK0683, vorinostat) and other hydroxamic acids), BML-210,
- SAHA Suberoylanilide Hydroxamic Acid
- BML-210 BML-210
- Depudecin e.g., (-)-Depudecin
- HC Toxin Nullscript (4-(l,3-Dioxo-lH,3H-benzo[de]isoquinolin-2-yl)- N-hydroxybutanamide), Phenylbutyrate (e.g., sodium phenylbutyrate) and Valproic Acid ((VPA) and other short chain fatty acids), Scriptaid, Suramin Sodium, Trichostatin A (TSA), APHA Compound 8, Apicidin, Sodium Butyrate, pivaloyloxymethyl butyrate (Pivanex, AN-9), Trapoxin B, Chlamydocin, Depsipeptide (also known as FR901228 or FK228), benzamides (e.g., CI-994 (e.g., N-acetyl dinaline) and MS-27-275), MGCD0103, NVP-FAQ-824, CBHA (m
- reprogramming enhancing agents include, for example, dominant negative forms of the HDACs (e.g., catalytically inactive forms), siRNA inhibitors of the HDACs, and antibodies that specifically bind to the HDACs.
- HDACs e.g., catalytically inactive forms
- siRNA inhibitors of the HDACs e.g., siRNA inhibitors of the HDACs
- antibodies that specifically bind to the HDACs are available, e.g., from BIOMOF International, Fukasawa, Merck Biosciences, Novartis, Gloucester Pharmaceuticals, Aton Pharma, Titan
- isolated clones can be tested for the expression of a stem cell marker.
- a stem cell marker can be selected from the non-limiting group including SSEA3, SSEA4, CD9, Nanog, Fbxl5, Ecatl, Esgl, Eras, Gdf3, Fgf4, Cripto, Daxl, Zpf296, Slc2a3, Rexl, Utfl, and Natl.
- a cell that expresses Oct4 or Nanog is identified as pluripotent.
- Methods for detecting the expression of such markers can include, for example, RT-PCR and immunological methods that detect the presence of the encoded polypeptides, such as Western blots or flow cytometric analyses. In some embodiments, detection does not involve only RT-PCR, but also includes detection of protein markers. Intracellular markers may be best identified via RT-PCR, while cell surface markers are readily identified, e.g., by immunocytochemistry.
- the pluripotent stem cell character of isolated cells can be confirmed by tests evaluating the ability of the iPSCs to differentiate to cells of each of the three germ layers.
- teratoma formation in nude mice can be used to evaluate the pluripotent character of the isolated clones.
- the cells are introduced to nude mice and histology and/or immunohistochemistry is performed on a tumor arising from the cells.
- the growth of a tumor comprising cells from all three germ layers, for example, further indicates that the cells are pluripotent stem cells.
- Somatic cells refer to any cells forming the body of an organism, excluding germline cells. Every cell type in the mammalian body— apart from the sperm and ova, the cells from which they are made (gametocytes) and undifferentiated stem cells— is a differentiated somatic cell. For example, internal organs, skin, bones, blood, and connective tissue are all made up of differentiated somatic cells.
- a fibroblast e.g., a primary fibroblast
- a muscle cell e.g., a myocyte
- a cumulus cell a neural cell, a mammary cell, an hepatocyte and a pancreatic islet cell.
- the somatic cell is a primary cell line or is the progeny of a primary or secondary cell line.
- the somatic cell is obtained from a human sample, e.g., a hair follicle, a blood sample, a biopsy (e.g., a skin biopsy or an adipose biopsy), a swab sample (e.g., an oral swab sample), and is thus a human somatic cell.
- a human sample e.g., a hair follicle, a blood sample, a biopsy (e.g., a skin biopsy or an adipose biopsy), a swab sample (e.g., an oral swab sample), and is thus a human somatic cell.
- differentiated somatic cells include, but are not limited to, epithelial, endothelial, neuronal, adipose, cardiac, skeletal muscle, immune cells, hepatic, splenic, lung, circulating blood cells, gastrointestinal, renal, bone marrow, and pancreatic cells.
- a somatic cell can be a primary cell isolated from any somatic tissue including, but not limited to brain, liver, gut, stomach, intestine, fat, muscle, uterus, skin, spleen, endocrine organ, bone, etc.
- somatic cell can be from any mammalian species, with non-limiting examples including a murine, bovine, simian, porcine, equine, ovine, or human cell. In some embodiments, the somatic cell is a human somatic cell.
- somatic cells isolated from the patient being treated.
- somatic cells involved in diseases, and somatic cells participating in therapeutic treatment of diseases and the like can be used.
- a method for selecting the reprogrammed cells from a heterogeneous population comprising reprogrammed cells and somatic cells they were derived or generated from can be performed by any known means.
- a drug resistance gene or the like, such as a selectable marker gene can be used to isolate the reprogrammed cells using the selectable marker as an index.
- Reprogrammed somatic cells as disclosed herein can express any number of pluripotent cell markers, including: alkaline phosphatase (AP); ABCG2; stage specific embryonic antigen-l (SSEA-l); SSEA-3; S SEA-4; TRA-l-60; TRA-1-81; Tra-2-49/6E; ERas/ECAT5, E-cadherin; b-IP-tubulin; ⁇ x- smooth muscle actin (a-SMA); fibroblast growth factor 4 (Fgf4), Cripto, Daxl; zinc finger protein 296 (Zfp296); N-acetyltransferase-l (Natl); (ES cell associated transcript 1 (ECAT1);
- telomerase including TERT; silent X chromosome genes; Dnmt3a; Dnmt3b; TRIM28; F-box containing protein 15 (Fbxl5); Nanog/ECAT4; Oct3/4; Sox2; Klf4; c-Myc; Esrrb; TDGF1; GABRB3; Zfp42, FoxD3; GDF3; CYP25A1; developmental phiripotency-associated 2 (DPPA2); T-cell lymphoma breakpoint 1 (Tell); DPPA3/Stella; DPPA4; other general markers for pluripotency, etc.
- DPPA2 developmental phiripotency-associated 2
- Tell T-cell lymphoma breakpoint 1
- DPPA3/Stella T-cell lymphoma breakpoint 1
- DPPA4 other general markers for pluripotency, etc.
- markers can include Dnmt3L; Soxl5; Stat3; Grb2; b-catenin, and Bmil.
- Such cells can also be characterized by the down-regulation of markers characteristic of the somatic cell from which the induced pluripotent stem cell is derived.
- the term“genome editing” refers to a reverse genetics method using artificially engineered nucleases to cut and create specific double-stranded breaks at a desired location(s) in the genome, which are then repaired by cellular endogenous processes such as, homologous recombination (HR), homology directed repair (HDR) and non-homologous end-joining (NHEJ).
- HR homologous recombination
- HDR homology directed repair
- NHEJ non-homologous end-joining
- compositions comprising a fusion protein comprising at least two DNA-targeting endonucleases, or a composition comprising a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases.
- a fusion protein having at least Cas9 proteins, or a Cas9 and a Casl2a protein.
- Genome editing cannot be performed using traditional restriction endonucleases since most restriction enzymes recognize a few base pairs on the DNA as their target and the probability is very high that the recognized base pair combination will be found in many locations across the genome resulting in multiple cuts (i.e., not limited to a desired location).
- restriction enzymes recognize a few base pairs on the DNA as their target and the probability is very high that the recognized base pair combination will be found in many locations across the genome resulting in multiple cuts (i.e., not limited to a desired location).
- ZFNs Zinc finger nucleases
- Cas9/CRISPR system Cas9/CRISPR system
- TALENs transcription-activator like effector nucleases
- Meganucleases are commonly grouped into four families: the LAGLIDADG family, the GIY- YIG family, the His-Cys box family and the HNH family. These families are characterized by structural motifs, which affect catalytic activity and recognition sequence. For instance, members of the
- LAGLIDADG motif see Chevalier et al. (2001), Nucleic Acids Res. 29(18): 3757-3774).
- LAGLIDADG meganucleases with a single copy of the LAGLIDADG motif form homodimers, whereas members with two copies of the LAGLIDADG are found as monomers.
- the GIY-YIG family members have a GIY-YIG module, which is 70-100 residues long and includes four or five conserved sequence motifs with four invariant residues, two of which are required for activity (see Van Roey et al. (2002), Nature Struct. Biol. 9: 806-811).
- the His-Cys box meganucleases are characterized by a highly conserved series of histidines and cysteines over a region encompassing several hundred amino acid residues (see Chevalier et al.
- Meganucleases are found commonly in microbial species and have the unique property of having very long recognition sequences (>l4bp) thus making them naturally very specific for cutting at a desired location. This can be exploited to make site-specific double-stranded breaks in genome editing.
- One of skill in the art can use these naturally occurring meganucleases, however the number of such naturally occurring meganucleases is limited.
- mutagenesis and high throughput screening methods have been used to create meganuclease variants that recognize unique sequences. For example, various meganucleases have been fused to create hybrid enzymes that recognize a new sequence.
- DNA interacting amino acids of the meganuclease can be altered to design sequence specific meganucleases (see e.g., US Patent 8,021,867).
- Meganucleases can be designed using the methods described in e.g., Certo, MT et al. Nature Methods (2012) 9:073-975; U.S. Patent Nos. 8,304,222; 8,021,867; 8,119,381; 8,124,369; 8,129,134; 8,133,697; 8,143,015; 8,143,016; 8,148,098; or 8,163,514, the contents of each are incorporated herein by reference in their entirety.
- meganucleases with site specific cutting characteristics can be obtained using commercially available technologies e.g., Precision BioSciences’ Directed Nuclease EditorTM genome editing technology.
- ZFNs and TALENs restriction endonuclease technology utilizes a non-specific DNA cutting enzyme which is linked to a specific DNA sequence recognizing peptide(s) such as zinc fingers and transcription activator-like effectors (TALEs).
- TALEs transcription activator-like effectors
- an endonuclease whose DNA recognition site and cleaving site are separate from each other is selected and the its cleaving portion is separated and then linked to a sequence recognizing peptide, thereby yielding an endonuclease with very high specificity for a desired sequence.
- An exemplary restriction enzyme with such properties is Fokl.
- Fokl has the advantage of requiring dimerization to have nuclease activity and this means the specificity increases dramatically as each nuclease partner recognizes a unique DNA sequence.
- Fokl nucleases have been engineered that can only function as heterodimers and have increased catalytic activity. The heterodimer functioning nucleases avoid the possibility of unwanted homodimer activity and thus increase specificity of the double-stranded break.
- ZFNs rely on Cys2- His2 zinc fingers and TALENs on TALEs. Both of these DNA recognizing peptide domains have the characteristic that they are naturally found in combinations in their proteins. Cys2-His2 Zinc fingers typically happen in repeats that are 3 bp apart and are found in diverse combinations in a variety of nucleic acid interacting proteins such as transcription factors. TALEs on the other hand are found in repeats with a one-to-one recognition ratio between the amino acids and the recognized nucleotide pairs.
- Zinc fingers correlated with a triplet sequence are attached in a row to cover the required sequence
- OPEN low-stringency selection of peptide domains vs. triplet nucleotides followed by high-stringency selections of peptide combination vs. the final target in bacterial systems
- ZFNs for use with the methods and compositions described herein can be obtained commercially from e.g., Sangamo BiosciencesTM (Richmond, CA).
- Cas9/CRISPR system of genome editing be employed with the methods and compositions described herein.
- Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) systems is useful for RNA-programmable genome editing (see e.g., Jinek, M. et al. Science (2012) 337(6096): 816-821).
- genome editing can be performed using recombinant adeno-associated virus (rAAV) based genome engineering, which is a genome-editing platform centered around the use of rAAV vectors that enables insertion, deletion or substitution of DNA sequences into the genomes of live mammalian cells.
- the rAAV genome is a single-stranded deoxyribonucleic acid (ssDNA) molecule, either positive- or negative-sensed, which is about 4.7 kilobase long.
- ssDNA deoxyribonucleic acid
- These single-stranded DNA viral vectors have high transduction rates and have a unique property of stimulating endogenous homologous recombination in the absence of causing double strand DNA breaks in the genome.
- rAAV genome editing has the advantage in that it targets a single allele and does not result in any off-target genomic alterations.
- rAAV genome editing technology is commercially available, for example, the rAAV GENESISTM system from HorizonTM (Cambridge, UK).
- compositions comprising hematopoietic progenitor cells.
- Therapeutic compositions contain a physiologically tolerable carrier together with the cell composition and optionally at least one additional bioactive agent as described herein, dissolved or dispersed therein as an active ingredient.
- the therapeutic composition is not substantially immunogenic when administered to a mammal or human patient for therapeutic purposes, unless so desired.
- the hematopoietic progenitor cells described herein are administered as a suspension with a pharmaceutically acceptable carrier.
- a pharmaceutically acceptable carrier to be used in a cell composition will not include buffers, compounds, cryopreservation agents, preservatives, or other agents in amounts that substantially interfere with the viability of the cells to be delivered to the subject.
- a formulation comprising cells can include e.g., osmotic buffers that permit cell membrane integrity to be maintained, and optionally, nutrients to maintain cell viability or enhance engraftment upon administration.
- Such formulations and suspensions are known to those of skill in the art and/or can be adapted for use with the hematopoietic progenitor cells as described herein using routine experimentation.
- a cell composition can also be emulsified or presented as a liposome composition, provided that the emulsification procedure does not adversely affect cell viability.
- the cells and any other active ingredient can be mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient and in amounts suitable for use in the therapeutic methods described herein.
- Additional agents included in a cell composition as described herein can include
- Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the polypeptide) that are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, tartaric, mandelic and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine and the like. Physiologically tolerable carriers are well known in the art.
- Exemplary liquid carriers are sterile aqueous solutions that contain no materials in addition to the active ingredients and water, or contain a buffer such as sodium phosphate at physiological pH value, physiological saline or both, such as phosphate-buffered saline. Still further, aqueous carriers can contain more than one buffer salt, as well as salts such as sodium and potassium chlorides, dextrose, polyethylene glycol and other solutes. Liquid compositions can also contain liquid phases in addition to and to the exclusion of water. Exemplary of such additional liquid phases are glycerin, vegetable oils such as cottonseed oil, and water-oil emulsions. The amount of an active compound used in the cell compositions as described herein that is effective in the treatment of a particular disorder or condition will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques.
- administering introducing
- transplanting are used interchangeably in the context of the placement of cells, e.g. hematopoietic progenitor cells, as described herein into a subject, by a method or route which results in at least partial localization of the introduced cells at a desired site, such as a site of injury or repair, such that a desired effect(s) is produced.
- the cells e.g. hematopoietic progenitor cells, or their differentiated progeny can be administered by any appropriate route which results in delivery to a desired location in the subject where at least a portion of the implanted cells or components of the cells remain viable.
- the period of viability of the cells after administration to a subject can be as short as a few hours, e.g., twenty-four hours, to a few days, to as long as several years, i.e., long-term engraftment.
- an effective amount of hematopoietic progenitor cells is administered via a systemic route of administration, such as an intraperitoneal or intravenous route.
- hematopoietic progenitor cells described herein can be administered to a subject in advance of any symptom of a hemoglobinopathy, e.g., prior to the switch from fetal g-globin to predominantly b-globin. Accordingly, the prophylactic administration of a hematopoietic progenitor cell population serves to prevent a hemoglobinopathy, as disclosed herein.
- hematopoietic progenitor cells are provided at (or after) the onset of a symptom or indication of a hemoglobinopathy, e.g., upon the onset of sickle cell disease.
- the hematopoietic progenitor cell population being administered according to the methods described herein comprises allogeneic hematopoietic progenitor cells obtained from one or more donors.
- allogeneic refers to a hematopoietic progenitor cell or biological samples comprising hematopoietic progenitor cells obtained from one or more different donors of the same species, where the genes at one or more loci are not identical.
- a hematopoietic progenitor cell population being administered to a subject can be derived from umbilical cord blood obtained from one more unrelated donor subjects, or from one or more non-identical siblings.
- syngeneic hematopoietic progenitor cell populations can be used, such as those obtained from genetically identical animals, or from identical twins.
- the hematopoietic progenitor cells are autologous cells; that is, the hematopoietic progenitor cells are obtained or isolated from a subject and administered to the same subject, i.e., the donor and recipient are the same.
- an effective amount of hematopoietic progenitor cells comprises at least 10 2 hematopoietic progenitor cells, at least 5 X 10 2 hematopoietic progenitor cells, at least 10 3 hematopoietic progenitor cells, at least 5 X 10 3 hematopoietic progenitor cells, at least 10 4 hematopoietic progenitor cells, at least 5 X 10 4 hematopoietic progenitor cells, at least 10 5 hematopoietic progenitor cells, at least 2 X 10 5 hematopoietic progenitor cells, at least 3 X 10 5 hematopoietic progenitor cells, at least 4 X 10 5 hematopoietic progenitor cells, at least 5 X 10 5 hematopoietic progenitor cells, at least 6 X 10 5 hematopoietic
- the hematopoietic progenitor cells can be derived from one or more donors, or can be obtained from an autologous source. In some embodiments of the aspects described herein, the hematopoietic progenitor cells are expanded in culture prior to administration to a subject in need thereof.
- the term“effective amount” as used herein refers to the amount of a population of human hematopoietic progenitor cells or their progeny needed to alleviate at least one or more symptom of a hemoglobinopathy, and relates to a sufficient amount of a composition to provide the desired effect, e.g., treat a subject having a hemoglobinopathy.
- the term "therapeutically effective amount” therefore refers to an amount of hematopoietic progenitor cells or a composition comprising hematopoietic progenitor cells that is sufficient to promote a particular effect when administered to a typical subject, such as one who has or is at risk for a hemoglobinopathy.
- an effective amount as used herein would also include an amount sufficient to prevent or delay the development of a symptom of the disease, alter the course of a symptom disease (for example but not limited to, slow the progression of a symptom of the disease), or reverse a symptom of the disease. It is understood that for any given case, an appropriate“effective amount" can be determined by one of ordinary skill in the art using routine experimentation.
- administered refers to the delivery of a hematopoietic stem cell composition as described herein into a subject by a method or route which results in at least partial localization of the cell composition at a desired site.
- a cell composition can be administered by any appropriate route which results in effective treatment in the subject, i.e. administration results in delivery to a desired location in the subject where at least a portion of the composition delivered, i.e. at least 1 x 10 4 cells are delivered to the desired site for a period of time.
- Modes of administration include injection, infusion, instillation, or ingestion.
- “Injection” includes, without limitation, intravenous, intramuscular, intra-arterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrastemal injection and infusion.
- injection includes, without limitation, intravenous, intramuscular, intra-arterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrastemal injection and infusion.
- injection includes, without limitation, intravenous, intramuscular, intra-arterial, intrathecal, intraventricular, intracapsular, intra
- the cells as described herein are administered systemically.
- systemic administration refers to the administration of a population of hematopoietic progenitor cells other than directly into a target site, tissue, or organ, such that it enters, instead, the subject’s circulatory system and, thus, is subject to metabolism and other like processes.
- efficacy of a treatment comprising a composition as described herein for the treatment of a hemoglobinopathy can be determined by the skilled clinician.
- a treatment is considered “effective treatment,” as the term is used herein, if any one or all of the signs or symptoms of, as but one example, levels of fetal b-globin are altered in a beneficial manner, other clinically accepted symptoms or markers of disease are improved or ameliorated, e.g., by at least 10% following treatment with an inhibitor. Efficacy can also be measured by failure of an individual to worsen as assessed by
- Treatment includes any treatment of a disease in an individual or an animal (some non-limiting examples include a human, or a mammal) and includes: (1) inhibiting the disease, e.g., arresting, or slowing the progression of sepsis; or (2) relieving the disease, e.g., causing regression of symptoms; and (3) preventing or reducing the likelihood of the development of infection or sepsis.
- the treatment according to the present invention ameliorates one or more symptoms associated with a b-globin disorder by increasing the amount of fetal hemoglobin in the individual.
- Symptoms typically associated with a hemoglobinopathy include for example, anemia, tissue hypoxia, organ dysfunction, abnormal hematocrit values, ineffective erythropoiesis, abnormal reticulocyte (erythrocyte) count, abnormal iron load, the presence of ring sideroblasts, splenomegaly, hepatomegaly, impaired peripheral blood flow, dyspnea, increased hemolysis, jaundice, anemic pain crises, acute chest syndrome, splenic sequestration, priapism, stroke, hand-foot syndrome, and pain such as angina pectoris.
- the hematopoietic progenitor cell is contacted ex vivo or in vitro with a composition comprising a fusion protein comprising at least two DNA-targeting endonucleases, or a composition comprising a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases, and the cell or its progeny is administered to the mammal (e.g., human).
- a composition comprising a fusion protein comprising at least two DNA-targeting endonucleases, or a composition comprising a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases, and the cell or its progeny is administered to the mammal (e.g., human).
- the hematopoietic progenitor cell is a cell of the erythroid lineage.
- a composition comprising a hematopoietic progenitor cell that was previously contacted with a composition comprising a fusion protein comprising at least two DNA-targeting endonucleases, or a composition comprising a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases and a pharmaceutically acceptable carrier and is administered to a mammal.
- any method known in the art can be used to measure an increase in fetal hemoglobin expression, e.g., Western Blot analysis of fetal hemoglobin protein and quantifying mRNA of fetal g-globin.
- the hematopoietic progenitor cell is contacted with a composition comprising a fusion protein comprising at least two DNA-targeting endonucleases, or a composition comprising a vector carrying the coding sequence of a fusion protein comprising at least two DNA- targeting endonucleases in vitro, or ex vivo.
- the cell is of human origin (e.g., an autologous or heterologous cell).
- the composition causes an increase in fetal hemoglobin expression.
- the agent is a composition comprising a fusion protein comprising at least two DNA-targeting endonucleases, or the agent is a composition comprising a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases whereby the DNA-targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element to delete it, thereby reducing the mRNA or protein expression of BCL11A.
- a method for producing an isolated genetic engineered human cell having at least one genetic modification comprising; contacting an isolated cell with an effective amount of a composition comprising a fusion protein comprising at least two DNA-targeting endonucleases or a composition comprising a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases, whereby the DNA-targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element to delete it, thereby causing at least one genetic modification therein.
- a method of increasing fetal hemoglobin levels in a cell comprising; contacting an isolated cell with an effective amount of a composition comprising a fusion protein comprising at least two DNA-targeting endonucleases or a composition comprising a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases, whereby the DNA-targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element to delete it, thereby causing at least one genetic modification therein, whereby fetal hemoglobin expression is increased in said cell, or its progeny, relative to said cell prior to said contacting.
- a method for increasing fetal hemoglobin levels in a mammal in need thereof the method
- compositions comprising; contacting an isolated hematopoietic progenitor cell in said mammal with an effective amount of a composition comprising a fusion protein comprising at least two DNA- targeting endonucleases or a composition comprising a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases, whereby the DNA- targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element, thereby causing at least one genetic modification therein, whereby fetal hemoglobin expression is increased in said mammal, relative to expression prior to said contacting.
- the isolated progenitor cell or isolated cell is a hematopoietic progenitor cell.
- the isolated progenitor cell or isolated cell is a human cell.
- the isolated progenitor cell or isolated cell is a CD34+ cell.
- the isolated progenitor cell or isolated cell is an induced pluripotent stem cell.
- agent composition further comprises guideRNA.
- An isolated genetic engineered human cell having at least one genetic modification on chromosome 2 location 60,716,189-60,728,612, near the GATA1 binding element in the functional core of the BCL11A enhancer +58kb.
- composition comprising isolated genetic engineered human cells of paragraph 15.
- a method for increasing fetal hemoglobin levels in a mammal in need thereof comprising transplanting an isolated genetic engineered human cell of paragraph 15 or a composition of paragraph 16 into the mammal.
- hemoglobinopathy is a b-hemoglobinopathy.
- a method of treatment of a hemoglobinopathy in a subject comprising; administering an effective amount of a composition comprising isolated genetic engineered human cells of paragraph 15, and whereby fetal hemoglobin expression is increased in the subject relative to prior treatment.
- the method of paragraph 22 wherein the subject has been diagnosed with a hemoglobinopathy.
- hemoglobinopathy is sickle cell disease.
- hemoglobinopathy is b-thalassemia.
- a method of treatment of a hemoglobinopathy in a subject comprising; administering an effective amount of a composition comprising hematopoietic progenitor cells to the subject, wherein the hematopoietic progenitor cells have been contacted ex vivo or in vitro with an effective amount of a composition comprising a fusion protein comprising at least two DNA- targeting endonucleases, or a composition comprising a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases whereby the DNA-targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element, thereby causing at least one genetic modification therein, and whereby fetal hemoglobin expression is increased in the subject relative to prior treatment.
- agent composition further comprises guideRNA.
- composition further comprising a pharmaceutically acceptable carrier or diluent.
- composition is administered by injection, infusion, instillation, or ingestion.
- composition is administered by injection, infusion, instillation, or ingestion.
- mammal or subject is further administered an epigenetic modifier.
- a composition comprising a CD34+ hematopoietic progenitor cell that comprises a fusion protein comprising at least two DNA-targeting endonucleases, or the CD34+ hematopoietic progenitor cell comprises a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases whereby the DNA-targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element, thereby causing at least one genetic modification therein, and thereby reduces the mRNA or protein expression of BCL11A in the cell.
- composition of paragraph 46 wherein the at least one genetic modification is a deletion.
- composition of paragraph 47, wherein the deletion removes the entire region or a portion of the targeted GATA1 binding element.
- agent composition further comprises guideRNA.
- composition of any preceding paragraph, wherein the composition further comprises a pharmaceutically acceptable carrier or diluent, and/or an epigenetic modifier.
- a population of CD34+ hematopoietic progenitor cells wherein the CD34+ hematopoietic progenitor cells comprise a fusion protein comprising at least two DNA-targeting endonucleases, or the CD34+ hematopoietic progenitor cells comprise a vector carrying the coding sequence of a fusion protein comprising at least two DNA-targeting endonucleases whereby the DNA-targeting endonuclease fusion protein makes precise cleavages near the targeted GATA1 binding element, thereby causing at least one genetic modification therein, thereby reducing the mRNA or protein expression of BCL11A in the cells.
- the population of CD34+ hematopoietic progenitor cells of paragraph 54 further comprises a pharmaceutically acceptable carrier or diluent.
- the population of CD34+ hematopoietic progenitor cells of paragraph 54 or 55 further comprises an epigenetic modifier.
- CD34+ hematopoietic progenitor cells of any preceding paragraph, wherein the CD 34+ hematopoietic progenitor cell is expanded ex vivo.
- CD34+ hematopoietic progenitor cells of any preceding paragraph, wherein the CD 34+ hematopoietic progenitor cell is formulated for injection or infusion.
- composition or method of any preceding paragraph further comprising an epigenetic modifier.
- the fusion protein comprising at least two DNA-targeting endonucleases comprising a first Cas9 or Casl2a nuclease, said nuclease comprising a protospacer adjacent motif recognition domain and a peptide linker, wherein said peptide linker is attached to a second Cas9 or Casl2a nuclease.
- the said Cas9 nuclease of the fusion protein is selected from the group consisting of SpCas9, SaCas9, NmCas9, CjCas9 and An-Cas9.
- the said Casl2a nuclease of the fusion protein is selected from the group consisting of FnCasl2a, LbCasl2a and AsCasl2a.
- said protospacer adjacent motif recognition domain of fusion protein is selected from the group consisting of SpCas9, SpCas9 MT1 , SpCas9 MT2 , SpCas9 MT3 , NmCas9 SM and NmCas9 DM .
- said protospacer adjacent motif recognition domain of fusion protein is mutated or non-mutated.
- said peptide linker of fusion protein is a peptide linker. In any of the preceding paragraphs, wherein said peptide linker is between twenty -five and eighty amino acids.
- said fusion protein further comprises a guide RNA which is attached to a guide sequence element.
- said mutated protospacer adjacent motif recognition domain of the fusion protein comprises mutated DNA phosphodiester recognition amino acid residues.
- said guide RNA of said fusion protein is selected from the group consisting of an sgRNA sequence, a crRNA sequence and a tracrRNA sequence. In any of the preceding paragraphs, wherein said guide sequence element of said guide RNA of said fusion protein is truncated.
- the methods and compositions described herein detail fetal hemoglobin reinduction using Cas9 fusion proteins.
- the invention methods and compositions described herein represent an extension of previously described Cas9-fusion proteins with applications for human hematopoietic stem and progenitor cells (CD34+ HSPCs).
- the methods and compositions provided herein are a therapeutic treatment for beta-hemoglobinopathies, such as sickle cell disease and beta-thalassemia.
- the methods and compositions described herein detail the reactivating gamma-globin expression to complement the loss of beta-globin function.
- EXAMPLE 1 Fetal hemoglobin re-induction using Cas9 fusion proteins
- the majority of transformed HEK293T cells treated with this dual nuclease system have segmental deletions of a critical regulatory element at a therapeutically relevant locus (BCL11A) for beta-hemoglobinopathies such as sickle cell 1 .
- BCL11A therapeutically relevant locus
- the data described herein shows the use of Cas9-Cas9 fusion proteins in human CD34+ HSCs to successfully generate targeted deletions within the BCL11A locus. These deletions successfully reactivate HbF in erythrocytes that are differentiated from these CD34+ HSCs.
- Cas9 A and Cas9 B fusions serve as the wild-type or attenuated nuclease domain
- Cas9 B the Cas9 module with or without nuclease activity
- sgRNA B the Cas9 module with or without nuclease activity
- sgRNA B the Cas9 module with or without nuclease activity
- sgRNA B the Cas9 module with or without nuclease activity
- sgRNA B and its corresponding sgRNA
- DTU Figure 1
- the evidence described herein shows that like the Cas9- ZFPs previously described, the Cas9 A -Cas9 B fusions improve the precision of the associated nucleases.
- a critical regulatory element that is responsible for repressing fetal hemoglobin (HbF) expression in erythrocytes has been defined within the BCL11A locus, which is responsible for the expression of this negative regulatory factor in proerythrocytes 6 .
- Deletion or mutation of the GATA1 binding site leads to decreased BCL11A expression and increased HbF, which can complement for the loss of function of adult beta-globin (HbA) or the presence of the sickle cell mutation (HbS).
- a screen was performed on a variety of different target sites for SpCas9-SaCas9 or SpCas9-NmCas9 target sites within this locus in HEK293T cells and identified a number of target sites that produced efficient deletion of the target sequence (Figure 2). These fusion nucleases were more effective than the SpCas9 and SaCas9 or NmCas9 nucleases employed in combination as independent nucleases.
- SpCas9-SaCas9 fusion protein A range of doses of the SpCas9-SaCas9 fusion protein were tested with an excess of synthetic sgRNAs designed to target TS9.
- the SpCas9 nuclease was not attenuated by mutation.
- SpCas9-SaCas9 protein - sgRNA complexes (Cas9-Cas9 RNPs) were generated using two different approaches of combining the guides and Cas9-Cas9 protein, and then these complexes were titrated from 80 pmol/L to 5 pmol/L for nucleofection into CD34+ HSCs ( Figure 3).
- the ability to precisely and efficiently excise genomic segments could have broad clinical utility in gene therapy applications where the removal of a regulatory element (either transcriptional or mRNA splicing) would compensate for a specific genetic dysfunction.
- the Cas9-Cas9 nucleases can be utilized for a number of different therapeutic applications, where local deletions will enforce a regulatory change that will result in a phenotypic change in cell behavior.
- the experiments described herein have demonstrated that Cas9-Cas9 fusion proteins delivered to human CD34+ HSPCs can efficiently delete regulatory segments from the genome. Current efforts to target this locus had previously been focused on the use of a nuclease (e.g.
- Cas9 or zinc finger nucleases targeting a single site within the locus.
- the use of Cas9-Cas9 nucleases has the potential to produce more profound effects due to the precise deletion of segments within the genome as opposed to simple mutagenesis. Deletions within a genomic locus are the next focus of this technology, where BCL11A can be used as a treatment for beta-hemoglobinopathies.
- the dual Cas9 system described herein will provide improvements in activity, precision, and sequence targeting range much like the previously described Cas9-DTU. Importantly, this system can efficiently generate precise deletions within cells, where one of the Cas9s (attenuated by mutation) is dependent on its fused partner for activity and improves the precision of the system.
- the composition and methods described herein indicates that these nucleases are highly precise, and can deliver purified Cas9-Cas9 fusion proteins into human CD34+ HSCs for genome modification by nucleofection. This nuclease produces high rates of precise deletions and measurable phenotypic changes within differentiated cells from this treated population.
- EXAMPLE 2 sgRNA sequences for the active Belli A guides
- Example 2 Provided herein in Example 2 are sgRNA sequences for the active Bell 1A guides using the Cas9-Cas9 fusions (either SpCas9-SaCas9 or SpCas9-NmCas9 fusions).
- the zigzag underlined text denotes the NmCas9 guide region sequence of the sgRNAs.
- NmCas9 target site it is also listed as a crRNA/tracrRNA combination, as this was used for Cas9 RNP efforts as opposed to the sgRNA.
- AAAA UGCCGUGUUUA UCUCGUCAACUUGUUGGCGAGA UUUU SEQ ID NO: 4
- Nm_TS 7_sgRNA
- Nm_TS 7_crRNA
- Nm_TS7_tracrRNA Nm_TS7_tracrRNA
- EXAMPLE 3 ORTHOGONAL CAS9-CAS9 FUSIONS PROVIDE A VERSATILE PLATFORM FOR PRECISE GENOME EDITING
- SpCas9 MT DNA-binding-domain
- DBD DNA-binding-domain
- Cas9-Cas9 chimeras based on this platform were created by replacing the DBD with an orthogonal Cas9 from N. meningiditis (NmCas9) or S. aureus (SaCas9), which generates a system that is entirely RNA-programmable. Within this system, the number of targetable PAMs for SpCas9 is expanded. [00276] In the single nuclease format, SpCas9 is fused to nuclease dead NmCas9 or SaCas9.
- the attenuated SpCas9 MT nuclease activity is restored when delivered to its target site as a SpCas9 MT - dNmCas9 or SpCas9 MT -dSaCas9 fusion due to its increased effective concentration.
- GUIDE-seq analysis and targeted deep sequencing of potential off-target sites indicates that the SpCas9 MT -dNmCas9 or SpCas9 MT -dSaCas9 fusions display excellent accuracy.
- the BCL11A target site PCR amplicon sequence is show in Figure 9 with the underlined SpCas9 1617 target site underlined.
- the SaCas9 TS13 target site is show in italics and the TS 14 target site is squiggle underlined. It is important to note that the TS13 and TS 14 target sites overlap.
- EXAMPLE 5 Cas9-Cas9 fusions provide a versatile genome editing platform.
- the DBD has been replaced with an orthogonal Cas9 from either N. meningiditis (NmCas9) or S. aureus (SaCas9) to make the system entirely RNA-programmable ( Figure 12).
- the Cas9-Cas9 chimeras have been constructed in both single and dual nuclease formats.
- the SpCas9 is fused to a nuclease dead NmCas9 or SaCas9, whose orthogonal guide is programmed to target a neighboring DNA sequence.
- the loss of nuclease activity of the SpCas9 MT is restored when delivered to its target site by a nuclease dead NmCas9 or SaCas9
- GUIDE-seq-based genome-wide specificity analysis 2 indicates that the SpCas9 MT -dNmCas9 or SpCas9 MT -dSaCas9 fusions display higher accuracy than wild-type SpCas9 ( Figure 15). This improved specificity of the nuclease activity is similar to SpCas9 MT -DBD chimera, which also requires three-stages of target site licensing.
- both nucleases of the orthogonal Cas9-Cas9 fusions are active. It is contemplated that synchronous cleavage of the target genome at two neighboring positions will primarily produce precise segmental deletions. Analysis of nuclease activity at 12 genomic sites revealed that the total level of editing and the fraction of precise segmental deletions are higher for Cas9-Cas9 nucleases than a pair of Cas9 monomers used simultaneously. Notably, Cas9-Cas9 nucleases generated precise segmental deletions as high as 95% of all lesions ( Figure 16 and 17).
- SpCas9-DBD chimera has increased targeting range due to the expansion of number of functional PAM sequences 1 .
- Cas9-Cas9 fusions extends the targeting repertoire of SpCas9
- BCL11A is the negative regulator of the fetal g- globin gene expression in erythrocytes.
- Previous studies identified an erythroid-lineage specific enhancer element of BCL11A (enhancer +58kb) 4 ’ 5 .
- the GATA1 binding motif within this enhancer is considered one of primary regulatory sequence elements.
- Cas9-Cas9 fusions were engineered to effectively delete the GATA1 binding motif within BCL11A enhancer +58kb ( Figure 19).
- ribonucleoproteins of the Cas9-Cas9 fusions were produced by utilizing a split-intein system 6 . These Cas9-Cas9 RNPs efficiently produce segmental deletions when electroporated into human cells
- the Cas9-dCas9 fusion protein provides accurate genome editing with an expanded targeting range. Furthermore, Cas9-Cas9 dual nuclease fusions generate efficient, precise, segmental deletions. Cas9-Cas9 dual nucleases effectively deletes functional regulatory elements in a complex genome. Split-intein approach can be utilized to produce functional Cas9-Cas9 fusion proteins.
- Genotyped SNPs are identified and MAF within the CSSCD listed. Genomic coordinates hgl9. Table 4. Conditional analyses of four sentinel SNPs
- Emulsion fusion PCR analysis of rs7569946-rs 1427407 haplotype Emulsion fusion PCR analysis of rs7569946-rs 1427407 haplotype.
- genotype is listed.
- lacZ-RT-F GCCAACATTGAGACACATGG RT-qPCR (lacZ) (SEQ ID NO: 66)
- lacZ-RT-R TGTCTCTCTGCACCATCCTG RT-qPCR (lacZ) (SEQ ID NO: 67)
- lacZ-F TTCAATGCTGTCAGGTGCTC PCR genotyping (lacZ) (SEQ ID NO: 68) n H lacZ-R GCCATGTGTCTCAATGTTGG PCR genotyping (lacZ) (SEQ ID NO: 69) d rs7569946-F GTCTGCCCTCTTTTGAGCTG haplotyping fusion PCR (SEQ ID NO: 70) n
- ChIP-hBCL 11 A-63.1 -R TGTGGAGCTCTGGAATGATG ChIP-qPCR (SEQ ID NO: 119)
- ChIP-hBCL 11 A-61 7-R ATGCCTAGGGTGTTTTGACG ChIP-qPCR (SEQ ID NO: 131)
- ChIP-hBCL 11 A-61 0-R TCCAGCAGGCTTCAAAAAGT ChIP-qPCR (SEQ ID NO: 137)
- ChIP-hBCLl 1A-58.7-R GGGAAAGGGCCTGATAACTT ChIP-qPCR (SEQ ID NO: 153)
- ChIP-hBCLl 1A-58.3-R CCTCTTTCGGAAGGCTCTCT ChIP-qPCR (SEQ ID NO: 155)
- ChIP-hBCLl 1A-57.3-R AGAACTTTCCCGGTTCTGGT ChIP-qPCR (SEQ ID NO: 159)
- ChIP-hBCLl 1A-55.9-R TGACTGGTAAGAGCCGATTG ChIP-qPCR (SEQ ID NO: 167)
- ChIP-hBCLl 1A-54.4-F AGGCAT CC AAAGGGAAGAAT ChIP-qPCR (SEQ ID NO: 172)
- ChIP-hBCLl 1A-52.7-F TTCAAGCCTTGGTGGATAGG ChIP-qPCR (SEQ ID NO: 180) ChIP-hBCLl 1A-52.7-R GCCAGGAAATTGGTGGTAGA ChIP-qPCR (SEQ ID NO: 181) ChIP-hBCLl 1A-52.3-F TGCCCACATGAGACATCTTT ChIP-qPCR (SEQ ID NO: 182) ChIP-hBCLl 1A-52.3-R AAATTGGCTGCCATTGAATC ChIP-qPCR (SEQ ID NO: 183) ChIP-hBCLl 1A-51 3-F CCACCAGAAGTCCTGGAAAA ChIP-qPCR (SEQ ID NO: 184) ChIP-hBCLl 1A-51 3-R TTGGAGGGACCTGATCTCTG ChIP-qPCR (SEQ ID NO: 185) ChIP-hBCLl 1A-50.2-F CCAAGATGGAGAAGCCACAT ChIP-qPCR (SEQ ID NO: 186)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Developmental Biology & Embryology (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Hematology (AREA)
- Reproductive Health (AREA)
- Gynecology & Obstetrics (AREA)
- Toxicology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201862622599P | 2018-01-26 | 2018-01-26 | |
| PCT/US2018/043073 WO2019147302A1 (en) | 2018-01-26 | 2018-07-20 | Targeting bcl11a distal regulatory elements with a cas9-cas9 fusion for fetal hemoglobin reinduction |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP3743516A1 true EP3743516A1 (en) | 2020-12-02 |
| EP3743516A4 EP3743516A4 (en) | 2021-10-13 |
Family
ID=67396120
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP18902550.5A Withdrawn EP3743516A4 (en) | 2018-01-26 | 2018-07-20 | TARGETING &XC9; L &XC9; MENTS R &XC9; BCL11A DISTAL GULATORS WITH CAS9-CAS9 FUSION FOR R &XC9; INDUCTION OF H &XC9; MOGLOBIN F &X152; TALE |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US12098363B2 (en) |
| EP (1) | EP3743516A4 (en) |
| WO (1) | WO2019147302A1 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20220411822A1 (en) * | 2020-01-22 | 2022-12-29 | Altius Institute For Biomedical Sciences | Novel Erythroid Specific Enhancers and Uses Thereof |
| US20240245725A1 (en) * | 2021-05-13 | 2024-07-25 | The Children's Medical Center Corporation | Methods for stratifying subjects for fetal hemoglobin reinduction |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2013266968B2 (en) * | 2012-05-25 | 2017-06-29 | Emmanuelle CHARPENTIER | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| CN109554350B (en) * | 2012-11-27 | 2022-09-23 | 儿童医疗中心有限公司 | Targeted BCL11A distal regulatory elements for fetal hemoglobin reinduction |
| PL3360964T3 (en) * | 2012-12-06 | 2020-03-31 | Sigma-Aldrich Co. Llc | Crispr-based genome modification and regulation |
| US10190106B2 (en) | 2014-12-22 | 2019-01-29 | Univesity Of Massachusetts | Cas9-DNA targeting unit chimeras |
| US11572543B2 (en) | 2015-05-08 | 2023-02-07 | The Children's Medical Center. Corporation | Targeting BCL11A enhancer functional regions for fetal hemoglobin reinduction |
| US9957501B2 (en) * | 2015-06-18 | 2018-05-01 | Sangamo Therapeutics, Inc. | Nuclease-mediated regulation of gene expression |
| MX2018007987A (en) * | 2015-12-28 | 2019-01-10 | Novartis Ag | Compositions and methods for the treatment of hemoglobinopathies. |
| AU2017252023B2 (en) * | 2016-04-18 | 2024-05-02 | Vertex Pharmaceuticals Incorporated | Materials and methods for treatment of hemoglobinopathies |
-
2018
- 2018-07-20 WO PCT/US2018/043073 patent/WO2019147302A1/en not_active Ceased
- 2018-07-20 US US16/964,461 patent/US12098363B2/en active Active
- 2018-07-20 EP EP18902550.5A patent/EP3743516A4/en not_active Withdrawn
Also Published As
| Publication number | Publication date |
|---|---|
| US20210047632A1 (en) | 2021-02-18 |
| EP3743516A4 (en) | 2021-10-13 |
| WO2019147302A1 (en) | 2019-08-01 |
| US12098363B2 (en) | 2024-09-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2021218012B2 (en) | Targeting bcl11a distal regulatory elements for fetal hemoglobin reinduction | |
| EP3294873B2 (en) | Targeting bcl11a enhancer functional regions for fetal hemoglobin reinduction | |
| EP3371306B1 (en) | Materials and methods for treatment of hemoglobinopathies | |
| AU2016225178B2 (en) | Materials and methods for treatment of hemoglobinopathies | |
| US12098363B2 (en) | Targeting BCL11A distal regulatory elements with a CAS9-CAS9 fusion for fetal hemoglobin reinduction | |
| EP4337232A1 (en) | Methods for stratifying subjects for fetal hemoglobin reinduction | |
| WO2024173692A2 (en) | Methods and compositions for bach2 gene editing | |
| HK1215720B (en) | Targeting bcl11a distal regulatory elements for fetal hemoglobin reinduction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20200819 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| AX | Request for extension of the european patent |
Extension state: BA ME |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: ZENG, JING Inventor name: BOLUKBASI, MEHMET FATIH Inventor name: ROSCOE, BENJAMIN Inventor name: WOLFE, SCOT Inventor name: WU, YUXUAN Inventor name: LIU, PENGPENG Inventor name: LUK, KEVIN Inventor name: BAUER, DANIEL E. |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: LUK, KEVIN Inventor name: BOLUKBASI, MEHMET FATIH Inventor name: WOLFE, SCOT Inventor name: BAUER, DANIEL E. Inventor name: WU, YUXUAN Inventor name: LIU, PENGPENG Inventor name: ZENG, JING Inventor name: ROSCOE, BENJAMIN |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20210915 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: C12N 9/22 20060101ALI20210909BHEP Ipc: A61K 35/12 20150101ALI20210909BHEP Ipc: A61K 38/46 20060101ALI20210909BHEP Ipc: C12N 15/01 20060101AFI20210909BHEP |
|
| P01 | Opt-out of the competence of the unified patent court (upc) registered |
Effective date: 20230523 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: EXAMINATION IS IN PROGRESS |
|
| 17Q | First examination report despatched |
Effective date: 20240625 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20251003 |