EP3720961A1 - Means and methods to treat torsin related neurological diseases - Google Patents
Means and methods to treat torsin related neurological diseasesInfo
- Publication number
- EP3720961A1 EP3720961A1 EP18816009.7A EP18816009A EP3720961A1 EP 3720961 A1 EP3720961 A1 EP 3720961A1 EP 18816009 A EP18816009 A EP 18816009A EP 3720961 A1 EP3720961 A1 EP 3720961A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- inhibitor
- dystonia
- lipin
- mediated
- activity
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/13—Amines
- A61K31/133—Amines having hydroxy groups, e.g. sphingosine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/13—Amines
- A61K31/135—Amines having aromatic rings, e.g. ketamine, nortriptyline
- A61K31/138—Aryloxyalkylamines, e.g. propranolol, tamoxifen, phenoxybenzamine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7048—Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/03—Phosphoric monoester hydrolases (3.1.3)
- C12Y301/03004—Phosphatidate phosphatase (3.1.3.4)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/03—Phosphoric monoester hydrolases (3.1.3)
- C12Y301/03016—Phosphoprotein phosphatase (3.1.3.16), i.e. calcineurin
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/10—Screening for compounds of potential therapeutic value involving cells
Definitions
- the present application relates to the field of neurological diseases, particularly to neurological diseases characterized by a heterozygous or homozygous mutation in the TORSIN1A gene, even more particularly to dystonia (including DYT1 primary dystonia) and to congenital disorders characterized by severe arthrogryposis that might be accompanied with developmental delay, strabismus and tremor.
- the application provides inhibitors of phosphatidic acid phosphatase activity and medical uses of these inhibitors to treat the above diseases. Methods are disclosed to screen for medicaments that counteract the effects of TORSIN1A mutations.
- TORSINS are animal-specific proteins and members of the functionally diverse AAA+ ATPase family (Hanson and Whiteheart 2005; Vander Heyden et al 2011). Many studies show that they concentrate and appear to function in the nuclear envelope (NE) (Goodchild et al 2015; Goodchild and Gamb 2005; Kim et al. 2010; Sosa et al. 2014), a specialized endoplasmic reticulum (ER) subdomain. Mammals have four TORSIN genes with different tissue expression patterns (Jungwirth et al 2010). Mutations in TORSIN1A (TOR1A) cause torsion dystonia-1 (MIM: 128100) (also known as DYT1 dystonia) (Ozelius et al 1997 Nat Genet 17: 40-48).
- MIM torsion dystonia-1
- MIM DYT1 dystonia
- Dystonia is a non-degenerative neurological orphan disease with currently no treatment options and characterized by disabling involuntary twisting movements and postures involving one or more sites of the body.
- the most studied genetic form of dystonia is DYT1 dystonia, a form of early-onset dystonia caused by a heterozygous in-frame trinucleotide deletion (c.907_909delGAG), resulting in the loss of a glutamic acid residue (p.Glu303del) in the C-terminus of the TORSIN1A protein, close to the ATP binding region (Ozelius et al 1989 Neuron 42:202-209; Ozelius et al 1997 Nat Genet 17:40-48; Ozelius et al 1999 Genomics 62:377-384; Bressman et al 2002 Neurology 59:1780-1782).
- DYT1 dystonia associated with the p.Glu303del mutation displays greatly decreased penetrance, with only one-third of the individuals harbouring the GAG deletion manifesting the disease before the age of 28 years (Bressman et al 1989 Ann Neurol 26: 612-620; Bressman et al 2002 Neurology 59: 1780-1782; Risch et al 1995 Nat Genet 9: 152-159.).
- Another interesting observation is that until recently homozygous GAG deletions or compound heterozygosity for mutations in TOR1A have never been reported in humans.
- an infant with a severe congenital phenotype characterized by arthrogryposis, respiratory failure, and feeding difficulties found to have a combination of two TOR1A mutant alleles, i.e. the known c.907_909delGAG (p.Glu303del) mutation (paternally inherited) and a c.961delA (p.T321Rfs*6) variant (maternally inherited).
- dystonia and arthrogryposis multiplex congenita lack an identifiable structural or biochemical cause.
- Most dystonia patients are symptomatically treated by peripheral administration of Botulinum toxin to prevent muscle hyperactivation or deep brain stimulation that modifies basal ganglia rhythmicity via electrodes implanted into the globus pallidus.
- Botulinum toxin to prevent muscle hyperactivation or deep brain stimulation that modifies basal ganglia rhythmicity via electrodes implanted into the globus pallidus.
- pediatricians are completely helpless. There is thus a very high need to develop causative and more effective treatment options for dystonia and for arthrogryposis multiplex congenita.
- TORSIN1A negatively controls the activity of the CTDNEP1/CNEP1R1 phosphatase complex by promoting its dissociation.
- a functional CTDNEP1/CNEP1R1 complex dephosphorylates the phosphatidic acid (PtdA) phosphatase LIPIN thereby promoting its ER localization needed for its phosphatidic acid phosphatase (PAP) activity as well as its nuclear localization needed for its co-transcriptional role.
- PAP phosphatidic acid
- LIPIN homologues PAH1 or SMP2 in yeast
- DAG diacylglycerol
- CTDNEP1/CNEP1R1 complex is too active and LIPIN is hyperactivated.
- the data described in this application establishes that genetic inhibitors of CTDNEP1, CNEP1R1 and/or LIPIN can partially compensate for the loss of TORSIN1A and significantly lower the TORSIN1A loss-of-function related disease level in genetically accurate disease models for dystonia and arthrogryposis multiplex congenita.
- This newly described congenital disorder has never been linked to elevated PAP activity or hyperactivation of CTDNEP1/CNEP1R1 or of LIPIN.
- said inhibitor decreases the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10% compared to a control situation where said inhibitor was not present.
- Another aspect of the invention is to provide an inhibitor of phosphatidic acid phosphatase activity for use in the treatment of TORSINl-mediated neurological diseases, wherein said inhibitor is a gapmer, a shRNA, a siRNA, a CRISPR, a TALEN or a Zinc-finger nuclease and wherein said inhibitor inhibits the expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1.
- Another aspect of the invention is to provide an inhibitor of phosphatidic acid phosphatase activity for use in the treatment of TORSINl-mediated neurological diseases, wherein said inhibitor is selected from the list consisting of propranolol, sphingosine, sphinganine, rutin, keampferol, N-ethylmaleimide and bromoenol lactone.
- said inhibitor of phosphatidic acid phosphatase activity for use in the treatment of TORSINl-mediated neurological diseases decreases the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10% compared to a control situation where said inhibitor was not present.
- a pharmaceutical composition for use in treatment of TORSINl-mediated neurological diseases, wherein said pharmaceutical composition comprises an inhibitor of phosphatidic acid phosphatase activity, wherein said inhibitor is a gapmer, a shRNA, a siRNA, a CRISPR, a TALEN or a Zinc-finger nuclease and inhibits the expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1 or wherein said inhibitor is selected from the list consisting of propranolol, sphingosine, sphinganine, rutin, keampferol, N-ethylmaleimide and bromoenol lactone. It is also an object of the invention to provide a screening method to produce a compound for use in the treatment of a TORSINl-mediated neurological disease, comprising:
- test compound as a compound for use in the treatment of a TORSINl-mediated neurological disease if the growth of said yeast in the presence of said test compound is at least 10% higher than the growth of said yeast in the absence of said test compound.
- a method is disclosed to produce a pharmaceutical composition comprising a compound identified by the screening methods disclosed in this application.
- said TORSINl-mediated neurological disease is a disease selected from the list consisting of dystonia, primary dystonia, early-onset dystonia, DYT1 primary dystonia and arthrogryposis multiplex congenita.
- Figure 1 illustrates the genetic inhibition of lipin, dullard, CG8009 and CG41106 in dTorsin KO flies.
- Figure 1A shows a PCR genotyping to confirm the dTorsin KO allele in 5-day-old dTorsin KO larvae expressing an RNAi construct against dullard, CG8009, CG41106, luciferase or lipin.
- dTorsinKO/+ and WT larvae were used as control.
- II male larvae from crosses with r4-GAL4.
- Figure IB shows quantitative RT QPCR data showing the efficient knock-down of dullard, CG41106 and lipin in dTorsin KO larvae.
- Figure 2 demonstrates that genetic inhibition of dullard-CG8009/CG41106 complex results in a better rescue of dTorsin KO effects compared to lipin inhibition.
- Bright-field images are shown of the fat body in WT and dTorsin KO larvae expressing an RNAi construct against (from left to right) luciferase (negative control), lipin (positive control), dullard, CG8009 or CG41106.
- the second row of pictures shows Arm::GAL4 driven expression of RNAi constructs.
- the third row shows r4::GAL4 driven expression of RNAi constructs. Scale bar indicates 1mm.
- Figure 3 shows the rescue of fat body cell size of dTorsin KO larvae.
- Figure 3A shows confocal images of 5-day-old dTorsin KO larval fat body cells labeled with phalloidin and DAPI (scale bar indicates 20 pm). Cell size is significantly increased when lipin, dullard, CG8009 or CG41106 is genetically inhibited compared to the negative control (luciferase RNAi).
- Figure 3B shows the quantification of the confocal images of Figure 3A using an optimized macro.
- the graphs show mean +/- 95% Cl of fat body cell size in dTorsin KO larvae expressing different RNAi constructs with Arm-GAL4 (left graph) or r4-GAL4 (right graph) drivers. ****, *** and ** indicate p- values of ⁇ 0.0001, ⁇ 0.0006 and ⁇ 0.0025, respectively in a Dunn's multiple comparison test.
- Figure 4 is a schematic representation of the model that dTorsin regulates lipid synthesis by inhibiting dLipin enzymatic activity
- d Lipin converts PtDA into DAG and its activity depends on its phosphorylation state. Dephosphorylation causes dLipin activation and nuclear re-localization.
- CTDNEP1/NEP1R1 is a known phosphatase complex that strongly regulates lipin in yeast and is herein put forward as the intermediate between dTorsin and dLipin.
- Figure 5 shows elevated PAP activity in Torsinla mutant embryonic mouse brains.
- PAP activity or PtdA conversion to DAG is biochemically measured in 4 control (wild-type and Torla +/ ) and 4 Torla 7 and 4 Torla figag/figag knock-out embryonic (E18) mouse brains.
- a significantly elevated PAP activity is detected (One-Tailed T-Test), which is completely in line with the model developed in Drosophila.
- FIG. 6 shows that LIPIN activity is increased in the genetically accurate dystonia Torla mice model.
- the PAP activity of Torla figag/+ animals has a wider than normal variance, which might explain the partial penetrance of this genotype in driving dystonia in humans.
- Figure 7 shows that Lipinl knock-out reduces LIPIN activity in wild-type and Torla mutants. Compared to wild-type mice (Torla +/+ Lipinl +/+ ), LIPIN activity is significantly reduced in Lipin ⁇ mutant mice and as well as in Torla figag/figag mutant mice.
- FIG 8 shows that Lipinl knock-out increases survival of Torla mutant mice.
- Figure 9 shows that nuclear membrane defects in Torla mutant mice brain neurons are decreased when Lipin expression is reduced.
- Figure 10 illustrates the expression of Lipinl, Lipin2 and Lipin3 in mice brain.
- Figure 10A shows the relative expression of Lipinl, Lipin2 and Lipin3 in E18.5 embryonic mice brain.
- Figure 10B shows the normalized expression of Lipinl, Lipin2 and Lipin3 in E18.5 embryonic mice brain.
- Figure 10C shows the expression of Lipinl and Lipin2 at P0 (black), P7 (blue), P14 (green), P21 (red).
- Figure 11 is a schematic representation of the experimental set-up of virus mediated silencing of Lipin.
- Figure 11A shows that for testing AAV9-mediated silencing of Lipinl and Lipin2 in mice brain, pups are intracerebral ventricular injected at birth. Lipin expression and activity is tested at P7, P14 and P21.
- Figure 12 shows the assessment of infection efficiency by immunohistochemistry against GFP of mice brain 21 days after intracerebral ventricle injection of AAV9-GFP viral particles.
- Figure 12A shows transversal brain sections of mice injected with AAV9-GFP at 4x1o 11 .
- Figure 12B shows transversal brain section of mice injected with Vehicle.
- Figure 12C shows the quantification of anti-GFP signal (normalized through DAPI signal) in 7 different tissues (midbrain, pons, thalamus, hippocampus, cortex (IV-II/III), cortex (Vl-V), cerebellum (purkinje cells)).
- Figure 13 shows the expression of Lipinl and Lipin2 in mice brain upon intracerebral ventricular injection of AAV9-based silencing constructs. At postnatal day 14 and 21 the expression of both Lipinl and Lipin2 is strongly reduced upon injection of AAV9-shLpinl, AAV9-shLpin2 or AAV9-shLpinl/2 compared to the control (AAV9-shSCRAM).
- Pgkl and B2m are control genes.
- Figure 14 shows that Lipin activity is strongly reduced at 21 days after injection of AAV9-shLpinl, AAV9- shLpin2 or AAV9-shLpinl/2 compared to the scrambled control.
- Figure 15 illustrates that Lipinl loss improves survival of recessive TorsinlA mice.
- Figure 15 B and C show that Nestin-Cre mediated deletion of TorsinlA combined with DE produces a postnatally surviving model of TorsinlA disease (Peterfly et al 2001).
- PAP brain Lipin
- Figure 15 E shows experimental series to test whether Lipin hyperactivity contributes to cKO/DE neurological dysfunction.
- Figure 15 F illustrates that Lipinl loss rescues cKO/DE lethality.
- Survival curves of control flox/+
- cKO/ E:Lipinl+/- mice from P0-P60.
- Figure 15 G shows that kyphosis is significantly reduced in P21 cKO/ E:Lipinl+/- mice compared with cKO/ E:Lipinl+/+, ⁇ p ⁇ 0.05 (two-tailed Chi-square). Values indicate the number of surviving mice assessed in this test.
- FIG 16 shows that Lipinl loss reduces motor dysfunction in recessive TorsinlA syndrome mice and dominant TorsinlA dystonia mice.
- Figure 16 G shows P21 control mice with normally distributed limbs (upper) compared with cKO/DE (lower) displaying splayed hind limbs on ambulation.
- Figure 16 H and I show the % of animals that display abnormal gait (mild or severe). There are significantly more flox/DE (dystonia) and cKO/+ (haploinsufficient) TorsinlA mice with gait defects than control (flox/+); p ⁇ 0.05; two-tailed Chi-square. * indicates a significant effect of Lipinl genotype on the gait defects; p ⁇ 0.05 (two-tailed Chi-square). Values indicate the number of surviving mice assessed in these tests.
- genes and proteins are named according to the international agreements.
- Human gene symbols generally are italicised, with all letters in uppercase (e.g. TOR1A). Protein designations are the same as the gene symbol, but are not italicised, with all letters in uppercase (e.g. LIPIN) (http://www.genenames.org/about/overview).
- gene symbols In mice and rats, gene symbols generally are italicised, with only the first letter in uppercase and the remaining letters in lowercase (e.g. Torla). Protein designations are the same as the gene symbol, but are not italicised and all are upper case (e.g. LIPIN) (http://www.informatics.jax.org/mgihome/nomen/ gene.shtml).
- TorsinlA diseases are incurable and represent a life-time burden for patients and their carers.
- the distinct symptoms require different symptomatic treatments and point to distinct neurological defects. Nevertheless, they result from loss-of-function mutations in the same gene (TORSIN1A) in one or two copies. Both are also specifically neurological and emerge in development. This points to a situation where partial TORSIN1A impairment causes isolated dystonia, while more severe TORSIN1A loss broadly impacts the brain. If so, a therapeutic intervention that corrects for TORSINIA loss before it cascades into neuronal dysfunction would hypothetically treat TORSIN1A disease regardless of symptomology.
- the application provides an inhibitor of phosphatidic acid phosphatase activity for use in the treatment of neurological diseases, more particularly of TORSIN1A mediated neurological diseases, even more particularly for use in the treatment of dystonia, primary dystonia, early-onset dystonia, DYT1 primary dystonia or arthrogryposis multiplex congenita.
- an inhibitor of Mg 2+ dependent phosphatidic acid phosphatase activity is provided for use in the treatment of TORSIN1A mediated neurological diseases.
- an inhibitor of LIPIN-mediated phosphatidic acid phosphatase activity is provided for use in the treatment of TORSIN1A mediated neurological diseases.
- an inhibitor of LIPINl-mediated phosphatidic acid phosphatase activity and/or LIPIN2-mediated phosphatidic acid phosphatase activity is provided for use in the treatment of TORSIN1A mediated neurological diseases.
- an inhibitor of phosphatidic acid phosphatase activity or of LIPIN-mediated, LIPINl-mediated or LIPIN2-mediated phosphatidic acid phosphatase activity or of Mg 2+ dependent phosphatidic acid phosphatase activity is provided for use in the treatment of TORSIN1A mediated neurological diseases, wherein said inhibitor decreases the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% compared to a control situation where said inhibitor was not present.
- said inhibitor decreases the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture between 10% and 60% or between 20% and 40% or between 30% and 50% compared to a control situation where said inhibitor was not present.
- Phosphatidic acid phosphatase activity refers to the enzyme activity of phosphatidic acid phosphatase (PAP; EC 3.1.3.4). Said PAP catalyzes the Mg 2+ dependent dephosphorylation of phosphatidic acid or phosphatidate (PA), yielding diacylglycerol (DAG) and phosphate (Pi).
- an inhibitor of phosphatidic acid phosphatase activity or of LIPIN-mediated, LIPINl-mediated or LIPIN2-mediated phosphatidic acid phosphatase activity or of Mg 2+ dependent phosphatidic acid phosphatase activity is provided for use in the treatment of TORSIN1A mediated neurological diseases, wherein said inhibitor decreases the Mg 2+ dependent conversion of phosphatidic acid to diacylglycerol or decreases the Mg 2+ dependent dephosphorylation of PA in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% compared to a control situation where said inhibitor was not present.
- said inhibitor decreases the Mg 2+ dependent conversion of phosphatidic acid to diacylglycerol or decreases the Mg 2+ dependent dephosphorylation of PA in an in vitro cell culture between 10% and 60% or between 20% and 40% or between 30% and 50% compared to a control situation where said inhibitor was not present.
- Neurological diseases are disorders that affect the brain and/or the central and autonomic nervous systems. Those neurological disorders that are subject of this invention are those such as dystonia, arthrogryposis multiplex congenita, epilepsy, multiple sclerosis, Parkinson's disease, Huntington's disease and Alzheimer's disease.
- TORSIN1A mediated neurologic disease or "TOR1A neurologic disease” as used herein refers to a neurological disorder which is caused by a suboptimal TORSIN1A activity.
- Suboptimal TORSIN1A activity can be caused by a deletion, insertion, substitution or point mutation in the TORSIN1A gene.
- Said point mutation can be a missense or a nonsense mutation leading to a non-functional or truncated TORSIN1A protein or a TORSIN1A protein with a reduced activity compared to a non-mutated TORSIN1A.
- Non limiting examples of mutations that result in suboptimal TORSIN1A activity are the in-frame GAG deletion (p.Glu303del), the missense variant p.Gly318Ser, the translational frame shift mutation 961delA (p.T321Rfs*6), an 18-bp deletion (Phe323_Tyr328del), the missense mutations c.613T>A (p.Phe205lso), c.863G>A (p.Arg288Gln), c.581A>T (p.Aspl94Val), p.A14_P15del, p.E121K and c.385G>A (p.Val 129lle) (Leung et al 2001 Neurogenetics 3:133-143; Calakos et al 2010 J Med Genet doi:10.1136/ jmg.2009.072082; Zirn et al 2008 J Neurol Neurosurg Psychiatry 79: 1327
- TORSIN1A mediated neurological diseases are dystonia, primary dystonia, early-onset dystonia, DYT1 primary dystonia, DYT1 dystonia or arthrogryposis multiplex congenita.
- said inhibitor for use in the treatment of TORSIN1A mediated neurological diseases is a gapmer, a shRNA, a siRNA, a CRISPR-Cas, a CRISPR-C2c2, a TALEN, a Zinc-finger nuclease, an antisense oligomer, a miRNA, a morpholino, a locked nucleic acid, a peptide nucleic acid, ribozyme or a meganuclease and said inhibitor inhibits the expression or functional expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1.
- methods of treating TORSIN1A mediated neurological diseases in a subject in need thereof comprising administering an inhibitor of phosphatidic acid phosphatase activity or of LIPIN-mediated phosphatidic acid phosphatase activity or of LIPINl-mediated phosphatidic acid phosphatase activity or of LIPIN2-mediated phosphatidic acid phosphatase activity or of Mg 2+ dependent phosphatidic acid phosphatase activity to said subject, wherein said inhibitor inhibits the expression or functional expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1.
- said neurological disease is selected from dystonia, primary dystonia, early-onset dystonia, DYT1 primary dystonia, DYT1 dystonia or arthrogryposis multiplex congenita.
- the nature of the inhibitor of functional expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1 is not vital to the invention, as long as it inhibits the phosphatidic acid phosphatase activity or LIPIN-mediated phosphatidic acid phosphatase activity or LIPINl-mediated phosphatidic acid phosphatase activity or LIPIN2-mediated phosphatidic acid phosphatase activity or Mg 2+ dependent phosphatidic acid phosphatase activity.
- said inhibitor is selected from the inhibitory RNA technology (such as a gapmer, a shRNA, a siRNA, an antisense oligomer, a miRNA, a morpholino, a locked nucleic acid, peptide nucleic acid), a CRISPR-Cas, a CRISPR-Cpf, a CRISPR- C2c2, a TALEN, a meganuclease or a Zinc-finger nuclease.
- RNA technology such as a gapmer, a shRNA, a siRNA, an antisense oligomer, a miRNA, a morpholino, a locked nucleic acid, peptide nucleic acid
- CRISPR-Cas a CRISPR-Cpf
- CRISPR- C2c2 a CRISPR- C2c2
- TALEN TALEN
- an "inhibitor of functional expression” is a synonym for an inhibitor of transcription and/or translation of a particular gene.
- an “inhibitor of functional expression” is an "inhibitor of expression and/or activity”.
- functional expression can be deregulated on at least three levels. First, at the DNA level, e.g. by removing or disrupting the LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 gene, or by preventing transcription to take place (in both instances preventing synthesis of the relevant gene product, i.e. LI PIN 1, LIPIN2, CTDNEP1 or CNEP1R1).
- the lack of transcription can e.g. be caused by epigenetic changes (e.g. DNA methylation) or by loss-of-function mutations.
- a "loss-of-function" or "LOF” mutation as used herein is a mutation that prevents, reduces or abolishes the function of a gene product as opposed to a gain-of-function mutation that confers enhanced or new activity on a protein.
- LOF can be caused by a wide range of mutation types, including, but not limited to, a deletion of the entire gene or part of the gene, splice site mutations, frame-shift mutations caused by small insertions and deletions, nonsense mutations, missense mutations replacing an essential amino acid and mutations preventing correct cellular localization of the product.
- a null mutation is an LOF mutation that completely abolishes the function of the gene product.
- a null mutation in one allele will typically reduce expression levels by 50%, but may have severe effects on the function of the gene product.
- functional expression can also be deregulated because of a gain-of-function mutation: by conferring a new activity on the protein, the normal function of the protein is deregulated, and less functionally active protein is expressed. Vice versa, functional expression can be increased e.g. through gene duplication or by lack of DNA methylation.
- RNA level e.g. by lack of efficient translation taking place for example because of destabilization of the mRNA (e.g. by UTR variants) so that it is degraded before translation occurs from the transcript.
- lack of efficient transcription e.g. because a mutation introduces a new splicing variant.
- LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 can also be inhibited at the protein level by inhibiting the function of the LI PI N 1, LIPIN2, CTDNEP1 or CNEP1R1 protein.
- Non-limiting examples are intrabodies, alpha-bodies, antibodies, VHHs or (heavy chain only) single domain antibodies, phosphatases, kinases.
- the phosphatidic acid phosphatase activity or LIPIN-mediated phosphatidic acid phosphatase activity or LIPINl-mediated phosphatidic acid phosphatase activity or LIPIN2-mediated phosphatidic acid phosphatase activity or Mg 2+ dependent phosphatidic acid phosphatase activity in neuronal brain cells is reduced to have a positive effect on the treatment of TORSINlA-mediated neurological diseases, more particularly arthrogryposis multiplex congenita or dystonia, more particularly primary dystonia, even more particularly early onset dystonia, most particularly DYT1 primary dystonia.
- Said reduction in phosphatidic acid phosphatase activity which is preferably at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or even 100%, more preferably between 10% and 60% or between 20% and 40% or between 30% and 50% compared to a control situation where said inhibitor was not present, can be achieved by inhibition of the functional expression of LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1.
- Said inhibition is preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or even 100%.
- Gene inactivation i.e. inhibition of functional expression of the target gene
- the nature of the inhibitor and whether the effect is achieved by incorporating antisense RNA into the subject's genome or by administering antisense RNA is not vital to the invention, as long as said inhibitor inhibits the functional expression of the LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 gene.
- An antisense construct can be delivered, for example, as an expression plasmid, which, when transcribed in the cell, produces RNA that is complementary to at least a unique portion of the cellular LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 RNA.
- An inhibitor of functional expression of LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 can also be an antisense molecule or anti-gene agent that comprises an oligomer of at least about 10 nucleotides in length for which no transcription is needed in the treated subject. In embodiments such an inhibitor comprises at least 15, 18, 20, 25, 30, 35, 40, or 50 nucleotides.
- Antisense approaches involve the design of oligonucleotides (either DNA or RNA, or derivatives thereof) that are complementary to an RNA encoded by polynucleotide sequences of the LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 gene.
- Antisense RNA may be introduced into a cell to inhibit translation of a complementary mRNA by base pairing to it and physically obstructing the translation machinery. This effect is therefore stoichiometric. Absolute complementarity, although preferred, is not required.
- a sequence "complementary" to a portion of an RNA means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double stranded antisense polynucleotide sequences, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed.
- Antisense oligomers should be at least 10 nucleotides in length, and are preferably oligomers ranging from 15 to about 50 nucleotides in length.
- the oligomer is at least 15 nucleotides, at least 18 nucleotides, at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, or at least 50 nucleotides in length.
- Ribozymes are catalytic RNA molecules with enzyme-like cleavage properties that can be designed to target specific RNA sequences. Successful target gene inactivation, including temporally and tissue-specific gene inactivation, using ribozymes has been reported in mouse, zebrafish and fruitflies.
- RNA interference is another form of post- transcriptional gene silencing and used in this application as one of the many methods to inhibit or reduce the functional expression of LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1.
- RNAi mediated degradation of the target mRNA can be detected by measuring levels of the target mRNA or protein in the cells of a subject, using standard techniques for isolating and quantifying mRNA or protein as described in this application.
- the mediators of sequence-specific messenger RNA degradation are small interfering RNAs (siRNAs) generated by ribonuclease III cleavage from longer dsRNAs. Generally, the length of siRNAs is between 20-25 nucleotides (Elbashir et al 2001 Nature 411: 494-498).
- the siRNA typically comprise a sense RNA strand and a complementary antisense RNA strand annealed together by standard Watson-Crick base pairing interactions (hereinafter "base paired").
- the sense strand comprises a nucleic acid sequence that is identical to a target sequence (i.e. the LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 sequence in this application) contained within the target mRNA.
- the sense and antisense strands of the present siRNA can comprise two complementary, single stranded RNA molecules or can comprise a single molecule in which two complementary portions are base paired and are covalently linked by a single stranded "hairpin" area (often referred to as shRNA).
- the siRNAs that can be used to inhibit or reduce the functional expression of LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 can comprise partially purified RNA, substantially pure RNA, synthetic RNA, or recombinantly produced RNA, as well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides.
- Such alterations can include addition of non-nucleotide material, such as to the end(s) of the siRNA or to one or more internal nucleotides of the si NA, including modifications that make the siRNA resistant to nuclease digestion.
- the siRNAs can be targeted to any stretch of approximately 19 to 25 contiguous nucleotides in LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 sequence (the "target sequence"). Techniques for selecting target sequences for siRNA are well known in the art.
- the sense strand of the present siRNA comprises a nucleotide sequence identical to any contiguous stretch of about 19 to about 25 nucleotides in the target mRNA.
- siRNAs can be obtained using a number of techniques known to those of skill in the art. For example, the siRNAs can be chemically synthesized or recombinantly produced using methods known in the art.
- the siRNA of the invention are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer.
- the siRNA can be synthesized as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions.
- Commercial suppliers of synthetic RNA molecules or synthesis reagents include Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo., USA), Pierce Chemical (part of Perbio Science, Rockford, III., USA), Glen Research (Sterling, Va., USA), ChemGenes (Ashland, Mass., USA) and Cruachem (Glasgow, UK).
- siRNA can also be expressed from recombinant circular or linear DNA plasmids using any suitable promoter.
- suitable promoters for expressing siRNA targeted against LIPIN1, LIPIN2, CTDNEP1 OR CNEP1R1 activity from a plasmid include, for example, the U6 or HI RNA pol III promoter sequences and the cytomegalovirus promoter. Selection of other suitable promoters is within the skill in the art.
- the recombinant plasmids of the invention can also comprise inducible or regulatable promoters for expression of the siRNA in a particular tissue or in a particular intracellular environment.
- siRNA expressed from recombinant plasmids can either be isolated from cultured cell expression systems by standard techniques, or can be expressed intracellularly, e.g. in brain tissue or in neurons. siRNAs can also be expressed intracellularly from recombinant viral vectors.
- the recombinant viral vectors comprise sequences encoding the siRNAs of the invention and any suitable promoter for expressing the siRNA sequences.
- the siRNA will be administered in an "effective amount" which is an amount sufficient to cause RNAi mediated degradation of the target mRNA, or an amount sufficient to inhibit the phosphatidic acid phosphatase activity.
- an effective amount of the siRNA of the invention to be administered to a given subject by taking into account factors such as involuntary muscle contraction; the extent of the disease penetration; the age, health and sex of the subject; the route of administration; and whether the administration is regional or systemic.
- an effective amount of siRNAs targeting LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 expression comprises an intracellular concentration of from about 1 nanomolar (nM) to about 100 nM, preferably from about 2 nM to about 50 nM, more preferably from about 2.5 nM to about 10 nM. It is contemplated that greater or lesser amounts of siRNA can be administered.
- Another method for the inhibition of gene expression is based on the use of shorter antisense oligomers consisting of DNA, or other synthetic structural types such as phosphorothiates, 2'-0-alkylribonucleotide chimeras, locked nucleic acid (LNA), peptide nucleic acid (PNA), or morpholinos.
- LNA locked nucleic acid
- PNA peptide nucleic acid
- morpholinos With the exception of RNA oligomers, PNAs and morpholinos, all other antisense oligomers act in eukaryotic cells through the mechanism of RNase H-mediated target cleavage.
- PNAs and morpholinos bind complementary DNA and RNA targets with high affinity and specificity, and thus act through a simple steric blockade of the RNA translational machinery, and appear to be completely resistant to nuclease attack.
- morpholino antisense oligonucleotides in zebrafish and frogs overcome the limitations of RNase H-competent antisense oligonucleotides, which include numerous non-specific effects due to the non-target-specific cleavage of other mRNA molecules caused by the low stringency requirements of RNase H. Morpholino oligomers therefore represent an important new class of antisense molecule. Oligomers of the invention may be synthesized by standard methods known in the art. As examples, phosphorothioate oligomers may be synthesized by the method of Stein et al. (1988) Nucleic Acids Res.
- methylphosphonate oligomers can be prepared by use of controlled pore glass polymer supports (Sarin et al. (1988) Proc. Natl. Acad. Sci. USA. 85, 7448-7451). Morpholino oligomers may be synthesized by the method of Summerton and Weller U.S. Patent Nos. 5,217,866 and 5,185,444.
- a gapmer is a chimeric antisense oligonucleotide that contains a central block of deoxynucleotide monomers sufficiently long to induce RNase H cleavage.
- the central block of a gapmer is flanked by blocks of 2'-0 modified ribonucleotides or other artificially modified ribonucleotide monomers such as bridged nucleic acids (BNAs) that protect the internal block from nuclease degradation.
- BNAs bridged nucleic acids
- Phosphorothioates possess increased resistance to nucleases compared to unmodified DNA. However, they have several disadvantages. These include low binding capacity to complementary nucleic acids and non-specific binding to proteins that cause toxic side-effects limiting their applications. The occurrence of toxic side- effects together with non-specific binding causing off-target effects has stimulated the design of new artificial nucleic acids for the development of modified oligonucleotides that provide efficient and specific antisense activity in vivo without exhibiting toxic side-effects. By recruiting RNase H, gapmers selectively cleave the targeted oligonucleotide strand. The cleavage of this strand initiates an antisense effect.
- Gapmers are offered commercially, e.g. LNA longRNA GapmeRs by Exiqon, or MOE gapmers by Isis pharmaceuticals.
- MOE gapmers or "2'MOE gapmers” are an antisense phosphorothioate oligonucleotide of 15-30 nucleotides wherein all of the backbone linkages are modified by adding a sulfur at the non-bridging oxygen (phosphorothioate) and a stretch of at least 10 consecutive nucleotides remain unmodified (deoxy sugars) and the remaining nucleotides contain an O'-methyl O'-ethyl substitution at the 2' position (MOE).
- inhibitors of functional expression of the LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 gene can also act at the DNA level. If inhibition is to be achieved at the DNA level, this may be done using gene therapy to knock-out or disrupt the target gene.
- a "knock-out" can be a gene knockdown or the gene can be knocked out by a mutation such as, a point mutation, an insertion, a deletion, a frameshift, or a missense mutation by techniques known in the art, including, but not limited to, retroviral gene transfer.
- Zinc-finger nucleases are artificial restriction enzymes generated by fusing a zinc finger DNA-binding domain to a DNA-cleavage domain. Zinc finger domains can be engineered to target desired DNA sequences, which enable zinc-finger nucleases to target unique sequence within a complex genome. By taking advantage of endogenous DNA repair machinery, these reagents can be used to precisely alter the genomes of higher organisms.
- Other technologies for genome customization that can be used to knock out genes are meganucleases and TAL effector nucleases (TALENs, Cellectis bioresearch).
- a TALEN is composed of a TALE DNA binding domain for sequence- specific recognition fused to the catalytic domain of an endonuclease that introduces double strand breaks (DSB).
- the DNA binding domain of a TALEN is capable of targeting with high precision a large recognition site (for instance 17bp).
- Meganucleases are sequence-specific endonucleases, naturally occurring "DNA scissors", originating from a variety of single-celled organisms such as bacteria, yeast, algae and some plant organelles. Meganucleases have long recognition sites of between 12 and 30 base pairs. The recognition site of natural meganucleases can be modified in order to target native genomic DNA sequences (such as endogenous genes).
- CRISPR- Cas system Another recent genome editing technology is the CRISPR- Cas system, which can be used to achieve RNA-guided genome engineering.
- CRISPR interference is a genetic technique which allows for sequence-specific control of gene expression in prokaryotic and eukaryotic cells. It is based on the bacterial immune system-derived CRISPR (clustered regularly interspaced palindromic repeats) pathway that confers resistance to foreign genetic elements such as those present within plasmids and phages providing a form of acquired immunity.
- CRISPR/Cas9 A simple version of the CRISPR/Cas system, CRISPR/Cas9, has been modified to edit genomes.
- the cell's genome can be cut at a desired location, allowing existing genes to be removed and/or new ones added (Marraffini and Sontheimer 2010 Nat Rev Genet 11:181-190).
- gRNA synthetic guide RNA
- alternatives for the Cas9 nuclease have been identified, e.g. Cpfl or Casl2 (Zetsche et al 2015 Cell 3:759-771). Recently, it was demonstrated that the CRISPR-Cas editing system can also be used to target RNA.
- C2c2 (also known as Casl3) can be programmed to cleave single stranded RNA targets carrying complementary protospacers (Abudayyet et al 2016 Science aaf5573; Abudayyet et al 2017 Nature 5:280-284).
- C2c2 is a single-effector endoRNase mediating ssRNA cleavage once it has been guided by a single crRNA guide toward the target RNA. This system can thus also be used to target and thus to break down LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1.
- said inhibitor for use in treatment of TORSINlA-mediated neurological diseases is selected from the list consisting of propranolol, propranolol hydrochloride, sphingosine, sphinganine, rutin, keampferol, N-ethylmaleimide and bromoenol lactone.
- This application also envisages an inhibitor of phosphatidic acid phosphatase activity for use in treatment of TORSIN1A mediated neurological diseases, wherein said inhibitor is a variant of propranolol, propranolol hydrochloride, sphingosine, sphinganine, rutin, keampferol, N-ethylmaleimide or bromoenol lactone, wherein said inhibitor is still capable of decreasing the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said inhibitor was not present.
- Propranolol (C H NO ; CAS 525-66-6; PubChem CID 4946) is a well-known drug of the beta blocker type that is commercially available. As a beta-adrenergic receptor antagonist it is used to treat high blood pressure and a number of irregular heart rate types.
- propranolol, propranolol hydrochloride and variants thereof surprisingly can also be used to treat TORSINlA-mediated neurological diseases such as DYT1 dystonia and arthrogryposis multiplex congenita.
- Propranolol is also known to cross the blood-brain barrier and is defined by the chemical formula:
- propranolol or variant thereof is provided for use to treat a neurological disease, more particularly a TORSINlA-mediated neurological disease, wherein said propranolol variant decrease the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said propranolol variant was not present.
- N-Ethylmaleimide (C H NO ; CAS 128-53-0; PubChem CID 4362) is an organic compound that is derived from maleic acid. It contains the imide functional group, but more importantly it is an alkene that is reactive toward thiols and is commonly used to modify cysteine residues in proteins and peptides. It is also known as l-ethylpyrrole-2,5-dione or ethylmaleimide and has the following structural formula:
- N-ethylmaleimide or variant thereof is provided for use to treat a neurological disease, more particularly a TORSINlA-mediated neurological disease, wherein said N- ethylmaleimide variant decrease the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said N-ethylmaleimide variant was not present.
- Bromoenol lactone (C16H13Br02; CAS 478288-90-3) is an inhibitor of calcium-independent phospholipase y (iPLA2y) (Tsuchida et al 2015 Mediators Inflamm 605727).
- the calcium-independent phospholipases (iPLA2) are a PLA2 subfamily closely associated with the release of arachidonic acid in response to physiologic stimuli.
- BEL also inhibits LIPIN 1 and is therefore disclosed herein for use to treat TORSINlA-mediated neurological diseases.
- BEL has the following structural formula:
- bromoenol lactone or variant thereof for use to treat a neurological disease, more particularly a TORSIN1A mediated neurological disease, wherein said bromoenol lactone variant decrease the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said bromoenol lactone variant was not present.
- Kaempferol (C15H10O6; CAS 520-18-3; PubChem CID 5280863) also known as 3,5,7-Trihydroxy-2-(4- hydroxyphenyl)-4H-chromen-4-one, kaempherol, robigenin, pelargidenolon, rhamnolutein, rhamnolutin, populnetin, trifolitin, kempferol or swartziol is a natural flavonol, a type of flavonoid, found in a variety of plants and plant-derived foods. Kaempferol acts as an antioxidant by reducing oxidative stress.
- Kaempferol has the following structural formula:
- kaempferol or variant thereof for use to treat a neurological disease, more particularly a TORSINlA-mediated neurological disease, wherein said kaempferol variant decrease the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said kaempferol variant was not present.
- Rutin (C27H30O16; CAS 153-18-4; PubChem CIB 5280805) also known as rutoside, phytomelin, sophorin, birutan, eldrin, birutan forte, rutin trihydrate, globularicitrin, violaquercitrin, quercetin-3-O-rutinoside, quercetin rutinoside or 2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[a-L-rhamnopyranosyl-(l->6)- -D- glucopyranosyloxy]-4H-chromen-4-one, is the glycoside combining the flavonol quercetin and the disaccharide rutinose (a-L-rhamnopyranosyl-(l->6)- -D-glucopyranose). Rutin is a citrus flavonoid found in a wide variety of plants including citrus fruit with the following structural formula:
- rutin or variant thereof is provided for use to treat a neurological disease, more particularly a TORSINlA-mediated neurological disease, wherein said rutin variant decrease the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said rutin variant was not present.
- Sphinganine (C18H39NO2; CAS 764-22-7; PubChem CID 4094) also known as dihydrosphingosine or 2- amino-l,3-dihydroxyoctadecane is a blocker postlysosomal cholesterol transport by inhibition of low- density lipoprotein-induced esterification of cholesterol. Sphinganine causes unesterified cholesterol to accumulate in perinuclear vesicles. It has been suggested the possibility that endogenous sphinganine may inhibit cholesterol transport in Niemann-Pick Type C (NPC) disease (Roff et al 1991 Dev Neurosci 13:315-319). Here, it is disclosed that sphinganine can be used to treat TORSINlA-mediated neurological diseases.
- NPC Niemann-Pick Type C
- sphinganine or variant thereof is provided for use to treat a neurological disease, more particularly a TORSINlA-mediated neurological disease, wherein said sphinganine variant decrease the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said sphinganine variant was not present.
- Sphingosine C H NO ; CAS 123-78-4; PubChem CID 5280335
- 2-amino-4-octadecene- 1,3-diol is an 18-carbon amino alcohol with an unsaturated hydrocarbon chain, which forms a primary part of sphingolipids, a class of cell membrane lipids that include sphingomyelin, an important phospholipid.
- sphingosine or variant thereof is provided for use to treat a neurological disease, more particularly a TORSINlA-mediated neurological disease, wherein said sphingosine variant decrease the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said sphingosine variant was not present.
- said TORSINlA-mediated neurological disease is selected from the list consisting of dystonia, primary dystonia, early-onset dystonia, DYT1 primary dystonia and arthrogryposis multiplex congenita.
- a pharmaceutical composition for use in treatment of TORSINlA-mediated neurological diseases comprising an inhibitor of phosphatidic acid phosphatase activity.
- said phosphatidic acid phosphatase activity is Mg 2+ dependent phosphatidic acid phosphatase activity or LIPIN-mediated, LIPINl-mediated or LIPIN2- mediated phosphatidic acid phosphatase activity.
- said inhibitor further inhibits the functional expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1 and is selected from the list consisting of a gapmer, a shRNA, a siRNA, a CRISPR-Cas, a CRISPR-C2c2, a TALEN, a Zinc-finger nuclease, an antisense oligomer, a miRNA, a morpholino, a locked nucleic acid, a peptide nucleic acid, ribozyme and a meganuclease.
- a gapmer a shRNA, a siRNA, a CRISPR-Cas, a CRISPR-C2c2, a TALEN, a Zinc-finger nuclease, an antisense oligomer, a miRNA, a morpholino, a locked nucleic acid, a peptide nucleic acid, ribozyme and a meganucle
- a pharmaceutical composition for use in treatment of TORSINlA-mediated neurological diseases comprises a pharmaceutically effective amount of propranolol, propranolol hydrochloride, sphingosine, sphinganine, rutin, kaempferol, N-ethylmaleimide or bromoenol lactone.
- a pharmaceutical composition for use in treatment of TORSINlA-mediated neurological diseases comprising an inhibitor of phosphatidic acid phosphatase activity, wherein said inhibitor is selected from the list consisting of propranolol, propranolol hydrochloride, sphingosine, sphinganine, rutin, kaempferol, N-ethylmaleimide and bromoenol lactone.
- said TORSINlA-mediated neurological disease is selected from the list consisting of dystonia, primary dystonia, early-onset dystonia, DYT1 primary dystonia and arthrogryposis multiplex congenita.
- This invention thus also relates to pharmaceutical compositions comprising functional inhibitors of phosphatidic acid phosphatase activity or Mg 2+ dependent phosphatidic acid phosphatase activity or LIPIN-mediated, LIPINl-mediated or LIPIN2-mediated phosphatidic acid phosphatase activity or comprising functional inhibitors of LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 described herein before.
- compositions can be utilized to achieve the desired pharmacological effect by administration to a patient suffering from neurological disease, particularly a TORSINlA-mediated neurological disease such as arthrogryposis multiplex congenita or dystonia, more particularly primary dystonia, even more particularly early-onset dystonia, most particularly DYT1 dystonia, in need thereof.
- a patient for the purpose of this invention, is a mammal, including a human, in need of treatment for a neurological disease, particularly a TORSINlA-mediated neurological disease such as arthrogryposis multiplex congenita or dystonia, more particularly primary dystonia, even more particularly early-onset dystonia, most particularly DYT1 dystonia.
- the present invention includes pharmaceutical compositions that comprise a pharmaceutically acceptable carrier and a pharmaceutically effective amount of a functional inhibitor of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1 expression and/or activity, or salt of said inhibitor, of the present invention. Also, the present invention discloses pharmaceutical compositions that comprise a pharmaceutically acceptable carrier and a pharmaceutically effective amount of an inhibitor of phosphatidic acid phosphatase activity or Mg 2+ dependent phosphatidic acid phosphatase activity or LIPIN-mediated phosphatidic acid phosphatase activity or LIPINl-mediated phosphatidic acid phosphatase activity or LIPIN2-mediated phosphatidic acid phosphatase activity, or salt of said inhibitor, of the present invention.
- said inhibitor of phosphatidic acid phosphatase activity is selected from the list consisting of propranolol, propranolol hydrochloride, sphingosine, sphinganine, rutin, kaempferol, N-ethylmaleimide and bromoenol lactone.
- a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a pharmaceutically effective amount of propranolol, propranolol hydrochloride, sphingosine, sphinganine, rutin, kaempferol, N-ethylmaleimide or bromoenol lactone.
- a pharmaceutically acceptable carrier is preferably a carrier that is relatively non-toxic and innocuous to a patient at concentrations consistent with effective activity of the active ingredient so that any side effects ascribable to the carrier do not vitiate the beneficial effects of the active ingredient.
- a pharmaceutically effective amount of a functional inhibitor of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1 is preferably that amount which reduces the phosphatidic acid phosphatase activity or Mg 2+ dependent phosphatidic acid phosphatase activity or LIPIN-mediated, LIPINl-mediated or LIPIN2-mediated phosphatidic acid phosphatase activity in the brain of a patient suffering from a neurological disease (particularly a TORSINlA-mediated neurological disease) thereby influencing the particular condition being treated.
- the compounds of the present application can be administered with pharmaceutically acceptable carriers well known in the art using any effective conventional dosage unit forms, including immediate, slow and timed release preparations.
- the pharmaceutical compositions of this application may be in the form of oil-in-water emulsions.
- the emulsions may also contain sweetening and flavoring agents.
- Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil such as, for example, arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin.
- the pharmaceutical compositions may be in the form of sterile injectable aqueous suspensions. Such suspensions may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents, all well-known by the person skilled in the art.
- the sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent.
- Diluents and solvents that may be employed are, for example, water, Ringer's solution, isotonic sodium chloride solutions and isotonic glucose solutions.
- sterile fixed oils are conventionally employed as solvents or suspending media.
- any bland, fixed oil may be employed including synthetic mono- or diglycerides.
- fatty acids such as oleic acid can be used in the preparation of injectables.
- the compositions of the application can also contain other conventional pharmaceutically acceptable compounding ingredients, generally referred to as carriers or diluents, as necessary or desired. The nature of additional ingredients and the need of adding those to the composition of the invention is within the knowledge of a skilled person in the relevant art. Conventional procedures for preparing such compositions in appropriate dosage forms can be utilized.
- the inhibitor of functional expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1 may be provided as protein (e.g. nuclease) or as an RNA molecule or may be administered as a nucleic acid molecule encoding said protein or said RNA molecule or as a vector comprising such nucleic acid molecule. If the inhibitor of the invention is administered as protein or RNA molecule, it is particularly envisaged that it is administered intracerebroventricularly, such as e.g. through injection or pump. This is well known by the skilled one, e.g. US 20040162255 incorporated as reference. Alternatively, said inhibitor can be coupled to a (single domain) antibody that targets a blood brain barrier (BBB) receptor. This complex can be injected intravenous after which the BBB receptor targeting antibody (or single variable domain antibody) will shuttle the complex across the BBB.
- BBB blood brain barrier
- the inhibitor of the application is provided as a nucleic acid or a vector
- the inhibitor is administered through gene therapy.
- a non-limiting example is (adeno-associated) virus mediated gene silencing.
- Virus mediated gene therapy is well known in the art (e.g. US 20040023390; Mendell et al 2017 N Eng J Med 377:1713-1722 all incorporated herein as reference).
- Virus mediated gene therapy can be applied intracerebroventricularly but also intravenously (e.g. Mendell et al 2017 N Eng J Med 377:1713-1722).
- LIPIN as mentioned before and hereafter is human LIPIN and can be LIPIN1, LIPIN2 or LIPIN3.
- LIPIN is LIPIN1 and/or LIPIN2.
- LIPIN1 encodes a protein with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% homology to one of the isoforms depicted in SEQ ID No: 1-9.
- LIPIN1 encodes one of the isoforms depicted in SEQ ID No: 1-9.
- the cDNA reference in NCBI for LI PIN 1 in Mus musculus is AF180471.1; the mRNA references for the transcript variants are NM_172950.3, NM_015763.4, NM_001130412.1 and NM_001355598.1; the protein references for the isoforms are NP_001123884.1 and NP_056578.2.
- LIPIN2 encodes a protein with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% homology to SEQ ID No: 17. In even more particular embodiments, LIPIN2 encodes the sequence depicted in SEQ ID No: 17.
- the cDNA reference in NCBI for LIPIN2 in Mus musculus is AF286723.1; the mRNA references for the transcript variants are NM_001164885.1, NM_022882.4 and NM_001357791.1; the protein references for the isoforms are NP_001158357.1 and NP_001344720.1.
- The“TORS!NIA” gene as used herein is specified by SEQ ID N° 10 and encodes the TORSIN1A protein of SEQ ID N° 11.
- the cDNA and protein reference sequences in NCBI from homologues of TORSIN1A in Mus musculus and in Drosophila melanogaster are NM_144884 and NP_659133 (M. musculus) and NM_131950 and NP_572178 (D. melanogaster).
- CTDNEP1 or C-Terminal Domain Nuclear Envelope Phosphatase 1 is a protein in humans that is encoded by the CTDNEP1 gene (HGNC: 19085; Entrez Gene: 23399; Ensembl: ENSG00000175826; OMIM: 610684; UniProtKB: 095476; Chromosome 17, NC_000017.11 (7243587..7251940, complement)).
- Alternative names are Serine/Threonine-Protein Phosphatase Dullard or DULLARD.
- CTDNEP1 encodes a protein sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% homology SEQ ID No 14.
- the protein reference sequence in NCBI from homologues of CTDNEP1 in Mus musculus is NP_080293.1.
- CNEP1R1 or CTD Nuclear Envelope Phosphatase 1 Regulatory Subunit 1 is a protein in humans that is encoded by the CNEP1R1 gene (HGNC: 26759; Entrez Gene: 255919; Ensembl: ENSG00000205423; OMIM: 616869; UniProtKB: Q8N9A8; Chromosome 16, NC_000016.10 (50025206..50037088)).
- TMEM188 Transmembrane Protein 188
- NEP1R1 and C16orf69.
- CNEP1R1 encodes a protein sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% homology to one of two isoforms depicted in SEQ ID No 15 and 16.
- the protein reference sequence in NCBI from homologues of CNEP1R1 in Mus musculus is NP_083350.2.
- a screening method is provided to produce or identify a compound for use in the treatment of a TORSINlA-mediated neurological disease, comprising:
- test compound as a compound for use in the treatment of a TORSINlA-mediated neurological disease if the growth of said yeast in the presence of said test compound is at least 10%, at least 25%, at least 50%, at least 75%, at least 100%, at least 2-fold, at least 3-fold, at least 5-fold or at least 10-fold higher than the growth of said yeast in the absence of said test compound.
- a method is provided to produce a pharmaceutical composition comprising a compound, wherein said compound is identified by said screening method.
- “Hyperactivated” CTDNEP1/CNEP1R1 complex refers to a CTDNEP1/CNEP1R1 complex that overperforms in dephosphorylating LIPIN, thereby affecting the balance between phospholipid and TAG production in favor for TAG because of a LIPIN-dependent conversion of phosphatidate (PtdA) to diacylglycerol (DAG).
- PtdA phosphatidate
- DAG diacylglycerol
- inhibitors of CTDNEP1 or CNEP1R1 activity that can be used in the treatment of TORSINlA-mediated neurological diseases will be those that allow or restore growth of cells notwithstanding said cells produce a hyperactivated CTDNEP1/CNEP1R1 complex.
- said complex is a human complex.
- Methods to evaluate growth of cells e.g. yeast
- OD600 measurements include for example (without the purpose of being limiting) measurements of optical density (OD) at a wavelength of 600 nm, also known as OD600 measurements.
- the application provides screening methods to produce or identify an inhibitor of CTDNEP1 or CNEP1R1 activity, comprising:
- Triglycerides are esters derived from glycerol and three fatty acids. Triglycerides (also known as triacylglycerols) are the main constituents of body fat in humans and animals. Methods to stain storage lipids and imaging them are well known in the art and discussed in current application.
- CTDNEP1 or CNEP1R1 activity refers to the functional activity of CTDNEP1 or CNEP1R1 and thus of the enzyme complex consisting of CTDNEP1 and CNEP1R1.
- An inhibitor of CTDNEP1 or CNEP1R1 activity can be an antibody, a (heavy chain only) single variable domain antibody or VHH, a phosphatase, a kinase, a small molecule, etc ...
- test compound or a “drug candidate compound” described in connection with the methods of the present invention.
- these compounds comprise organic or inorganic compounds, derived synthetically or from natural resources.
- the compounds include polynucleotides, lipids or hormone analogs that are characterized by low molecular weights.
- Other biopolymeric organic test compounds include small peptides or peptide-like molecules (peptidomimetics) comprising from about 2 to about 40 amino acids and larger polypeptides comprising from about 40 to about 500 amino acids, such as antibodies or antibody conjugates.
- compound libraries may be used.
- a compound will "reduce” or “decrease” the lipid storage level of TORSIN1A knock-out cells. Lipid storage can be easily visualized by lipid dye (e.g. BODIPY 493/503) as in this application, but alternative methods are well-known for the skilled one.
- lipid dye e.g. BODIPY 493/503
- a compound will "enhance” or “stimulate” or “increase” the cell size of the TORSIN1A knock-out cells.
- One of the possible underlying activities is the stimulation or enhancement of membrane lipid synthesis. Assays and methods for visualization and/or measuring the cell size of in vitro cells are known in the art and provided in this application.
- the application provides SEQ ID N° 12 or a homologue thereof with a least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% homology to SEQ ID N°12 for use in the treatment of TORSIN1A- mediated neurological diseases.
- said TORSINlA-mediated neurological disease is a neurological disease caused by the present of one or two mutant alleles of the TORSIN1A gene. More particularly said TORSINlA-mediated neurological disease is arthrogryposis multiplex congenita, dystonia, primary dystonia, early-onset dystonia or DYT1 primary dystonia.
- the application provides a nucleic acid sequence encoding SEQ ID N° 13 or a homologue of SEQ ID N° 13 with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% homology to SEQ ID N° 13 for use in the treatment of TORSINlA-mediated neurological diseases.
- said TORSINlA-mediated neurological disease is a neurological disease caused by the present of one or two mutant alleles of the TORSIN1A gene. More particularly said TORSINlA-mediated neurological disease is arthrogryposis multiplex congenita, dystonia, primary dystonia, early-onset dystonia or DYT1 primary dystonia.
- SEQ ID N° 12 represents the nucleic acid sequence of choline-phosphate cytidylyltransferase A (PCYT1A), while SEQ ID N° 13 represents the amino acid sequence of the PCYT1A enzyme.
- PCYT1A is the human homologue of CCT from this application.
- the PCYT1A enzyme or the nucleic acid sequence encoding PCYT1A can be administered intracerebroventricularly or by way of gene therapy to stimulate membrane lipid synthesis (and consequently cell membrane synthesis) and counteract the hyperactivation of LIPIN or LIPIN1 and/or LIPIN2 activity due to the heterozygous or homozygous mutation in TORSIN1A.
- Gene therapy refers to therapy performed by the administration to a subject of an expressed or expressible nucleic acid.
- the nucleic acids produce PCYT1A (CCT), a functional fragment, a functional variant or homologue thereof mediates cell membrane synthesis.
- CCT PCYT1A
- a large number of methods for gene therapy are available in the art and a plethora of delivery methods (e.g. viral delivery systems, microinjection of DNA plasmids, biolistics of naked nucleic acids, use of a liposome) are well known to those of skill in the art.
- Gene therapy vectors can be delivered in vivo by administration to an individual patient, typically by systemic administration (e.g., intravenous, intraperitoneal infusion or brain injection).
- sequence homology of two related nucleotide or amino acid sequences refers to the number of positions in the two optimally aligned sequences which have identical residues (xlOO) divided by the number of positions compared.
- a gap i.e., a position in an alignment where a residue is present in one sequence but not in the other is regarded as a position with non-identical residues.
- the alignment of the two sequences is performed by the Needleman and Wunsch algorithm (Needleman and Wunsch (1970) J Mol Biol. 48: 443-453).
- sequence alignment can be conveniently performed using standard software program such as GAP which is part of the Wisconsin Package Version 10.1 (Genetics Computer Group, Madision, Wisconsin, USA) using the default scoring matrix with a gap creation penalty of 50 and a gap extension penalty of 3. Sequences are indicated as "essentially similar" when such sequences have a sequence identity of at least about 75%, particularly at least about 80 %, more particularly at least about 85%, quite particularly about 90%, especially about 95%, more especially about 100%, quite especially are identical. It is to be understood that although particular embodiments, specific configurations as well as materials and/or molecules, have been discussed herein for cells and methods according to the present invention, various changes or modifications in form and detail may be made without departing from the scope and spirit of this invention. The following examples are provided to better illustrate particular embodiments, and they should not be considered limiting the application. The application is limited only by the claims.
- the fly fat body is the main site of triacylglycerol (TAG) synthesis and storage and is the equivalent of the vertebrate adipose tissue and liver (KOhnlein et al 2012 J Lipid Res 53:14301436; Ugrankar et al 2011; Zhonghua et al 2013 ABBS 45:44-50). Fat body cells are post mitotic and have to expand in size during fly development. Grillet et al. (2016 Dev Cell 3, 235-247) showed that upon dTorsin loss the fat body mass and fat cell size are significantly decreased and demonstrated that these effects are achieved by a hyperactivation of dLipin in the dTorsin knock-out (KO) adipose tissue.
- TAG triacylglycerol
- CTDNEP1 (Neml in yeast and dullard in flies) is the catalytic subunit of the complex, while CNEP1R1 (Spo7 in yeast and CG8009 and CG41106 in flies) is the regulatory subunit.
- RNAi constructs were transactivated with two different GAL4 drivers: Arm (ubiquitous low expression) and r4 (fat body specific expression). All animals were confirmed to be dTorsin KO (Fig. 1A) and the knock-down efficiency of Lipin, Dullard and CG41106 was determined. RT-qPCR showed that each RNAi causes a significant decrease in its mRNA target (Fig. IB).
- the fat body of dTorsin KO flies expressing an RNAi construct against Dullard or CG41106 was more increased than the fat body of dTorsin KO flies expressing an RNAi construct against Lipin. Even more surprisingly, the fat body of dTorsin KO flies expressing an RNAi construct against Dullard or CG41106 could not be distinguished from the fat body of WT flies (Fig. 2). We then progressed to quantitatively measure how well the different gene knock-downs rescue the small fat body cell size of dTorsin KO flies as described in Grillet et al. (2016 Dev Cell 3, 235-247).
- dTorsin regulates the activity of dLipin in the flies adipose tissue through the activity of the inner nuclear membrane localized phosphatase complex CTDNEP1/NEP1R1 (Fig. 4).
- dTorsinA activity normally dissociates the complex and thus inhibits dephosphorylation of Lipin.
- the complex is too active resulting in excess Lipin PAP activity.
- dTorsin is required for the development of Drosophila adipose tissue (Grillet et al. 2016 Dev Cell 3, 235-247) by regulating Lipin dependent PAP activity.
- dTorsin KO effects in fly could be countered by genetically reducing expression of dLipin.
- LIPIN could be a target to treat TORSINlA-mediated neurological disorders in mammals.
- Torla 7 mice contain a large deletion, while the Torla Agag line contains the Agag mutation (or DE) in the endogenous mouse Torla gene (Goodchild et al 2005).
- Torla +/ and Torla +/Agag heterozygous intercrosses generate expected genotypes with normal Mendelian frequency.
- Torla 1 and Torla 4909/figag animals die within 48 hours of birth.
- LIPIN is a magnesium-dependent phosphatidate (PtdA) phosphatase (PAP) that therefore converts PtdA to diacylglycerol (DAG).
- PtdA magnesium-dependent phosphatidate
- DAG diacylglycerol
- Torla +/Agag is a genetically accurate disease model for DYT1 dystonia while Torla 7 and Torla figag/figag models are genetically accurate disease models for arthrogryposis multiplex congenita.
- Our experiment identified 1) that LIPIN PAP activity is robustly detected in the developing brain and 2) is highly abnormal in the brains of Torla mutant mice.
- a one-tailed T-test verified that this increase is statistically significant.
- LIPIN activity was also significantly elevated in the brains of the genetically accurate disease model for DYT1 dystonia (i.e.
- Torla Agag/+ mice (Fig. 6).
- the PAP activity of Torla Agag/+ animals has a wider than normal variance, suggesting variability in how animals are affected by Torla Agag/+ (Fig. 6). This is intriguing given the partial penetrance of this genotype in driving dystonia in humans.
- the above results reveal that both heterozygous as well as homozygous (bi-allelic) Torsinla mutations lead to increased LIPIN activity in mammalian neurons.
- LIPIN hyperactivity underlies the neurological consequences of Torsinla loss and whether the neurological defects of the dystonia- and arthrogryposis related Torla mutations could be rescued by inhibiting the functional expression of Lipin.
- the human and mouse genomes encode three LIPIN homologues: LIPIN1, 2 and 3, that all have magnesium dependent PtdA phosphatase activity (Csaki et al 2014, Molecular Metabolism 3: 145-154).
- LI PI N 1 was selected since homozygous deletion is shown to significantly reduce brain magnesium-dependent PtdA-phosphatase activity (Harris et al 2007 JBC 282: 277-286) and because LI PI N 1 is responsible for most LIPIN PAP activity in the post-natal brain ( Figure 15A).
- Mice harboring a Lipinl null allele (Lipinl fld/fld ) were crossed with heterozygous Torla +/Agag mice. The FI progeny was genotyped and the Torla +/Agag Lipinl +/ ⁇ mice were selected. The selected genotypes were crossed, phenotyped and genotyped.
- TorsinlA diseases are defined by their behavioral disturbances; early-onset dystonia and arthrogryposis, respectively. It has been challenging to find a behavioral correlate of dystonia in genetically accurate DE/+ mice, but abnormal motor behaviors of the cKO/DE mice may represent a readout for both dystonia as the TorsinlA recessive syndrome. We therefore analyzed the impact of reduced LIPIN activity on the behavior of these mice using cohorts that also contained littermate flox/DE.
- Lpinl, Lpin2 and Lpin3 genes encode the three LIPIN PAP enzymes of mammalian cells.
- Lpinl and Lpin2 mRNA were both strongly detected in the E18 mouse brain, while we had very few Lpin3 reads (Fig. 10A).
- qRT- PCR also detected Lpinl and Lpin2 mRNA, while Lpin3 was barely detectable (data not shown).
- the RNAseq data indicates that the late embryonic mouse brain expresses similar amounts of Lpinl and Lpin2 mRNA (Fig. 10B), but very little Lpin3.
- RNAi can knock-down the expression of multiple genes. RNAi also allows knock-down of neural gene expression; for example, when viruses expressing shRNA against a gene of interest are delivered into the brain by injection. In mice this delivery is most feasible soon after birth. This is also the time point when intervention against congenital recessive TOR1A disease would be needed.
- shRNA sequences against Lpinl and Lpin2 and produced adeno- associated virus serotype 9 (AAV-9) that carries these Lpinl or Lpin2 sequences, a scrambled control sequence, or GFP.
- Intracerebral ventricular (ICV) injections of 2 pi of virus (lxlO 12 GC/ml) (per ventricle) into neonatal (post-natal day 0; P0) pups provided the broadest transduction efficiency.
- Many cells in the cortex, hippocampus, striatum and dorsal thalamus were transduced to express the GFP reporter, although GFP expression was isolated or absent from ventral brain regions, midbrain, cerebellum and hindbrain (Fig. 12). This is similar to publications describing AAV9-delivered gene expression patterns (Chakrabarty et al 2013 PLoS One 8:e67680).
- mice were allowed to recover and then returned to their home cages for nursing. They were then euthanized at P7, P14 and P21 to collect brain tissue for 1) qRT-PCR assessment of Lpinl/2/3 mRNA levels and 2) biochemical measurement of brain LIPIN PAP activity.
- Lpin3 mRNA levels are not shown, as levels were often below detection.
- AAV9-shRNA mediated inhibition of LIPIN PAP activity prevents neurological dysfunction associated with TORlA-disease in mice (Fig. 11B).
- a conditional Torla floxed mouse model TOG1( Ioc/D9 ° 9 ) is used with co-delivery of AAV9-Cre and AAV9-shLpinl or AAV9-shLpin2 (or AAV9-shSCRAM control).
- the AAV9-Cre virus deletes several exons from Torla in transduced neurons, so that these individual cells have the genotype of recessive TOR1A disease.
- CTDNEP1 or CNEP1R1 is reduced in TOR1A disease mice using AAV9 delivered shRNA.
- Torla figag/figag Torla figag/+ mice were treated with chemical compounds known in the art to inhibit LI PIN 1 activity or LIPIN1 expression.
- Propranolol is known to cross the blood-brain-barrier and could therefore be injected intravenously.
- Four groups (3 concentrations and placebo) with four mice per group are used for three different genotypes (Torla figag/figag , Torla figag/+ and WT).
- New borne mice at P0 are intravenously injected (tail vein injection) with 1 mg/kg of propranolol (30 pg for a 30-g mouse) or 4 mg/kg of propranolol (120 pg for a 30-g mouse) or 10 mg/kg of propranolol (300 pg for a 30-g mouse) in 120 pL of phosphate buffered saline or 120 pL of phosphate buffered saline alone (placebo).
- the mouse tail vein dose of propranolol was determined using a ratio between appropriate human propranolol intravenous dose, maximum human intravenous dosing, and maximum rodent intravenous dosing (Ley et al 2010 J Trauma 68:353-356).
- the behavior, cognitive function and the neuronal cellular biology of treated versus non- treated Torla figag/figag , Torla figag/+ and control mice is determined. Given that propranolol crosses the BBB, we hypothesized that the compound would also cross the blood-placenta-barrier.
- Torla figag/+ mice are crossed and pregnant mice are intravenously injected (tain vein) with 1, 4 or 10 mg/kg of propranolol at the time the embryo's reached E18. After birth, pups are genotyped and evaluated at P0, P7 and P14 concerning behavior, motor function, gait, cognitive function and neuronal cellular biology. Second, sphingosine and sphinganine are checked. These compound are also known to cross the BBB. A similar approach as for propranolol is used but concentrations are adapted to 0.3 mg/kg, 0.5 mg/kg and 2 mg/kg.
- Rutin was purchased commercially (Sigma-Aldrich, St. Louis, MO, USA). Rutin is diluted in propylene glycol. To facilitate the dissolution of rutin, the solution is made to stand for 15 min in a water bath at 50 °C for 10 min. Rutin solution or vehicle (propylene glycol) is administered by intraperitoneal (i.p.) injection.
- Torla figag/figag , Torla figag/+ and WT animals are divided into three experimental groups: one that receives vehicle (control group), one that receives the dose of 50 mg of rutin/kg of body weight and one that receives the dose of 100 mg/kg of body weight.
- Rutin is daily injected during five consecutive days from P0 onwards. At P7, P14 and P21 the behavior, cognitive function and the neuronal cellular biology of treated versus non-treated Torla figag/figag , Torla figag/+ and control mice is determined.
- the UAS-GAL4 system was used to achieve conditional knockdown of specific genes, using two driver lines w-,dTorsinK078/FM7i, Act-GFP; Arm-Gal4/Arm-Gal4 (ubiquitous low expression) and w- ,dTorsinK078/FM7i, Act-GFP;; r4-Gal4/TM6C,tb (fat body specific expression), and UAS-RNAi transgenic lines (Grillet et al 2016 Dev Cell).
- the w-,dTorsinK078/FM7i, Act-GFP line was used to bring Arm-GAL4 and r4-GAL4 into dTorsin KO background.
- RNAi fly stock lines were used in this study: UAS- lipinRNAi (VDRC# 36006, CG8709), UAS-dNEPIRIRNAi (VDRC# 48955, CG8009 and VDRC# 101371, CG41106), UAS-dullardRNAi (VDRC# 12941) and UAS-luciferaseRNAi(BDSC#31603).
- AII stocks and crosses were cultured on conventional cornmeal/sucrose/dextrose/yeast medium and kept at 25°C.
- Cell size and lipid droplets were visualized using respectively phalloidin Alexa fluor 594 (lmg/mL, Life technologies# A12381) and BODIPY 493/503 (lmg/L, Invitrogen # D-3922). Cell size was quantified using Fiji and optimized macro. Data were analyzed and compared using the GraphPad Prism software and Dunn's multiple comparison test.
- dTorsin primer C 5' AC AC AA AT GTG C AG G C AC AG 3'
- dTorsin primer D 5'CACGACTGAGTGACTTTGAG3'
- RNA expression was checked using quantitative RT-PCR by isolating total RNA from 5-day-old male larvae expressing RNAi against specific genes using the Arm-GAL4 driver. More than 30 larvae per genotype were washed in ice cold lxPBS and stored at -80°C prior to analysis. Total RNA was isolated using the RNeasy Mini-kit (Qiagen# 74104) and reverse transcribed using the SuperScriptTM VILOTM cDNA Synthesis Kit (Thermofisher# 11754050). Quantitative RT-PCR was performed using a LightCycler ® 480 instrument with LightCycler ® 480 SYBR Green I Master mix (Roche# 04707516001). All SYBR Green assays were performed on 3 different samples and each sample was measured in triplicate and normalized to rp49 mRNA according to the CT method. Primers used for qRT-PCR are:
- CG41106 5'TGGTTTTCCAAATCCTGTCC3' and 5'ATCAATGTTAAGGCGGAACG3'
- Rp49 5'TACAGGCCCAAGATCGTGAA3' and 5'GTTCGATCCGTAACCGATGT3'
- PAP activity (Adapted from Dubots, et al. 2014 PLoS One 9, el04194 and Sembongi, et al. 2013 J Biol Chem 288, 34502-34513) was determined in mouse brain lysates by measuring the formation of fluorescent DAG from NBD-PA (l-acyl-2- ⁇ 12-[(7-nitro-2-l,3-benzoxadiazol-4-yl)amino]dodecanoyl ⁇ -sn- glycero-3-phosphate ammonium salt) (Avanti Polar lipids, Inc).
- NBD-PA l-acyl-2- ⁇ 12-[(7-nitro-2-l,3-benzoxadiazol-4-yl)amino]dodecanoyl ⁇ -sn- glycero-3-phosphate ammonium salt
- Snap frozen brain tissues were lysed with Tris-HCI, pH 7.5 buffer containing 0.25 m sucrose, 10 mM 2-mercaptoethanol, lx EDTA free protease inhibitor cocktail, and lx PhosSTOP phosphatase inhibitor cocktail (Roche). The lysates were centrifuged at 1,000 x g for 10 min at 4 °C, and the supernatant was used for the measurement of PAP activity.
- Reactions (100 pi; 60 pg of total protein extract) were carried out in buffer containing 50 mM Tris HCI pH 8.0, 1 mM MgCI2 or 4 mM EDTA, and 10 mM b-mercaptoethanol, and started by the addition of NBD- PA (2 mM) solubilized in 10 mM Triton X-100.
- the reactions were incubated for 30 min at 30°C and terminated by the addition of 0.4 ml of 0.1 M HCI (in methanol).
- RNAIater solution Snap frozen brain tissue (stored at -80°C) was preserved using RNAIater solution, to prevent RNA degradation.
- RNA isolation was performed using RNeasy Quiagen mini kit (Quiagen), combined with DNAse I on column digestion (Quiagen), according to manufactures instructions.
- Reverse transcription was done using the Superscript IV Reverse Transcriptase (Thermo Fisher), and using 2000ng of total RNA and random primers reaction.
- DNA was diluted 1:4 in nuclease-free water and stored at -20°C.
- qPCR reaction was performed using the SensiFast SYBR No-ROX kit (Bioline), and it was run on Lightcycler 480 (Roche).
- Cryoanesthetized neonates were injected using glass capillaries (3.5" Drummond #3-000-203-G/X) and a nanoinjection system (Drummond ® Nanoject II). 2 mI of virus (1x1012 viral genomes/ml) was slowly injected into each ventricle and the needle slowly retracted. After injection pups were allowed to completely recover under a heating lamp and then returned to the home cage.
- AAV virus were obtained from Cyagen (Cyagen Biosciences Inc., Santa Clara, CA, USA).
- the days of embryonic development were defined after assigning the day of vaginal plug detection as E0.5. Embryos were collected from pregnant females after they were euthanized by cervical dislocation. Days of post-natal development were defined with the birthdate as PO. Postnatal animals were permanently identified using the AIMS Pup Tattoo Identification System (Budd Lake, NJ). Tissues were collected from post-natal animals after decapitation (P0 until P14), cervical dislocation (P14 until P35), or CO2 inhalation. Tissue destined for biochemical analysis was snap frozen and stored at -80°C until use.
- Tissues destined for histological analysis were perfused and fixed overnight at 4°C in 4% paraformaldehyde in phosphate buffered saline (PBS). They were then either dehydrated and embedded in paraffin or cryoprotected in 30% sucrose, placed in embedding media, rapidly frozen on dry ice, and stored at -80°C until required. All mice were housed in the KU Leuven animal facility, fully compliant with European policy on the use of Laboratory Animals. To prevent environmental bias, mice were cohoused independent to genotype. All animal procedures were approved by the Institutional Animal Care and Research Advisory Committee of the KU Leuven (ECD P120/2017) and performed in accordance with the Animal Welfare Committee guidelines of KU Leuven, Belgium.
- PBS phosphate buffered saline
- mice were only examined for overall health, including weighing every fourth day.
- For tremor each mouse was observed in its home cage for 20s. Any sign of tremor (mild or severe) was recorded as positive.
- Forelimb and hindlimb clasping was examined upon suspending a mouse upside down by the tail. A positive score was recorded if the limbs touched. Gait was assessed by individually placing a mouse in a fresh cage facing away from the observer.
- the animal was scored 0 (normal) when it moved normally with both hindlimbs participating evenly and supporting its body weight on all 4 paws, with its abdomen not touching the ground; scores of 1-3 were given if tremor or limping was observed, if the pelvis was lowered or when the feet are pointed away from the body during locomotion ("duck feet"), or when a has difficulty moving forward and drags its abdomen along the ground. Kyphosis was also recorded in this assessment if the animal appeared unable to straighten its spine during ambulation or at rest. All tests were performed with all mice (12 genotypes including Lipinl-/-) that had been cohoused and observers were blind to genotype. While cKO/DE animals could be distinguished by their reduced weight, this could not discriminate their Lipinl genotype. References
- AAA+ protein torsinA interacts with a conserved domain present in LAP1 and a novel ER protein. J Cell Biol 168, 855-862. Goodchild et al., 2005
- AAA+ proteins have engine, will work. Nat Rev Mol Cell Biol 6, 519-529.
- TorsinA hypofunction causes abnormal twisting movements and sensorimotor circuit neurodegeneration.
- Lipin is a central regulator of adipose tissue development and function in Drosophila melanogaster. Mol Cell Biol 31, 1646-1656.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Genetics & Genomics (AREA)
- Epidemiology (AREA)
- Veterinary Medicine (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Immunology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biotechnology (AREA)
- Hematology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Organic Chemistry (AREA)
- Urology & Nephrology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Virology (AREA)
- Toxicology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GBGB1720401.7A GB201720401D0 (en) | 2017-12-07 | 2017-12-07 | Means and methods to treat torsin related neurologicl diseases |
| PCT/EP2018/083784 WO2019110728A1 (en) | 2017-12-07 | 2018-12-06 | Means and methods to treat torsin related neurological diseases |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP3720961A1 true EP3720961A1 (en) | 2020-10-14 |
Family
ID=61007310
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP18816009.7A Withdrawn EP3720961A1 (en) | 2017-12-07 | 2018-12-06 | Means and methods to treat torsin related neurological diseases |
Country Status (3)
| Country | Link |
|---|---|
| EP (1) | EP3720961A1 (en) |
| GB (1) | GB201720401D0 (en) |
| WO (1) | WO2019110728A1 (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2802775C (en) * | 2010-06-17 | 2019-09-24 | Vib Vzw | Increased protein expression through increased membrane formation |
| CL2011000273A1 (en) * | 2011-02-08 | 2011-06-17 | Univ Pontificia Catolica Chile | Use of a phosphatidic acid phosphohydrolase enzyme (pap) inhibitor or combination of inhibitors, in which the inhibitor is d (+) propranolol, and the combination is racemic mixture of propranolol od (+) propranolol together with desipramine, to prepare a Useful medicine in the treatment of cancer. |
| CA3027587A1 (en) * | 2016-06-06 | 2017-12-14 | Vib Vzw | Means and methods to treat dystonia |
-
2017
- 2017-12-07 GB GBGB1720401.7A patent/GB201720401D0/en not_active Ceased
-
2018
- 2018-12-06 EP EP18816009.7A patent/EP3720961A1/en not_active Withdrawn
- 2018-12-06 WO PCT/EP2018/083784 patent/WO2019110728A1/en not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| GB201720401D0 (en) | 2018-01-24 |
| WO2019110728A1 (en) | 2019-06-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tabrizi et al. | Huntington disease: new insights into molecular pathogenesis and therapeutic opportunities | |
| Schätzl et al. | Facioscapulohumeral muscular dystrophy: genetics, gene activation and downstream signalling with regard to recent therapeutic approaches: an update | |
| AU2015214141B2 (en) | Inhibition of NEAT1 for treatment of solid tumors | |
| Emery et al. | Myelin gene regulatory factor is a critical transcriptional regulator required for CNS myelination | |
| Van Epps et al. | The zebrafish nrc mutant reveals a role for the polyphosphoinositide phosphatase synaptojanin 1 in cone photoreceptor ribbon anchoring | |
| CN102459596A (en) | Treatment of Lipid Transport and Metabolism Gene-Associated Diseases by Inhibition of Natural Antisense Transcripts Targeting Lipid Transport and Metabolism Genes | |
| WO2011029092A1 (en) | Klf family members regulate intrinsic axon regeneration ability | |
| Tam et al. | Therapeutic benefit derived from RNAi-mediated ablation of IMPDH1 transcripts in a murine model of autosomal dominant retinitis pigmentosa (RP10) | |
| US20190203207A1 (en) | Anabolic Enhancers for Ameliorating Neurodegeneration | |
| JP2025118647A (en) | Compositions and methods for the treatment of leukodystrophies, and whole animal and cell models for identifying effective agents for the treatment of leukodystrophies | |
| Gentile et al. | Divalent siRNA for prion disease | |
| JP7682538B2 (en) | Feedback-enabled synthetic genes, target seed match cassettes, and uses thereof | |
| US20140056929A1 (en) | IMMUNOMODULATION BY CONTROLLING INTERFERON-GAMMA LEVELS WITH THE LONG NON-CODING RNA NeST | |
| US10881746B2 (en) | Means and methods to treat dystonia | |
| EP3720961A1 (en) | Means and methods to treat torsin related neurological diseases | |
| US20240200065A1 (en) | Compositions and methods useful for the treatment of h-abc leukodystrophy | |
| US20250170273A1 (en) | Therapeutic factors for the treatment of polyq diseases | |
| JP2015515485A (en) | Archease as a member of the RNA ligase complex | |
| US20210244828A1 (en) | Miri26-5p for treating motor neuron diseases | |
| US20250228918A1 (en) | Methods of controlling body weight and/or energy expenditure | |
| US11207426B2 (en) | Compositions and methods for selective inhibition of grainyhead-like protein expression | |
| Doran | Re-evaluating the Role of SARM1 as a Transcriptional Regulator Using Improved Genome-Edited Mouse Models | |
| Trollope | Zebrafish as a translational model of Parkinson’s disease–a study of microRNAs | |
| Munnich et al. | Vanessa Vedrenne, Ali Gowher, 2, 6 Pascale De Lonlay, 3 Patrick Nitschke, 4 Valérie Serre, Nathalie Boddaert, 3 Cecilia Altuzarra, 5 Anne-Marie Mager-Heckel, 2 Florence Chretien, Nina Entelis, 2 | |
| WO2017038945A1 (en) | Therapeutic agent for diseases associated with accumulation of abnormal substances in cells, biomarker, diagnostic agent, and screening method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20200703 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| AX | Request for extension of the european patent |
Extension state: BA ME |
|
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: KATHOLIEKE UNIVERSITEIT LEUVEN, K.U.LEUVEN R&D Owner name: VIB VZW |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| RAP3 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: KATHOLIEKE UNIVERSITEIT LEUVEN, K.U.LEUVEN R&D Owner name: VIB VZW |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20240702 |