EP3720961A1 - Means and methods to treat torsin related neurological diseases - Google Patents

Means and methods to treat torsin related neurological diseases

Info

Publication number
EP3720961A1
EP3720961A1 EP18816009.7A EP18816009A EP3720961A1 EP 3720961 A1 EP3720961 A1 EP 3720961A1 EP 18816009 A EP18816009 A EP 18816009A EP 3720961 A1 EP3720961 A1 EP 3720961A1
Authority
EP
European Patent Office
Prior art keywords
inhibitor
dystonia
lipin
mediated
activity
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP18816009.7A
Other languages
German (de)
French (fr)
Inventor
Rose GOODCHILD
Ana Catarina CASCALHO
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Katholieke Universiteit Leuven
Vlaams Instituut voor Biotechnologie VIB
Original Assignee
Katholieke Universiteit Leuven
Vlaams Instituut voor Biotechnologie VIB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Katholieke Universiteit Leuven, Vlaams Instituut voor Biotechnologie VIB filed Critical Katholieke Universiteit Leuven
Publication of EP3720961A1 publication Critical patent/EP3720961A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/13Amines
    • A61K31/133Amines having hydroxy groups, e.g. sphingosine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/13Amines
    • A61K31/135Amines having aromatic rings, e.g. ketamine, nortriptyline
    • A61K31/138Aryloxyalkylamines, e.g. propranolol, tamoxifen, phenoxybenzamine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7048Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • C12Y301/03Phosphoric monoester hydrolases (3.1.3)
    • C12Y301/03004Phosphatidate phosphatase (3.1.3.4)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • C12Y301/03Phosphoric monoester hydrolases (3.1.3)
    • C12Y301/03016Phosphoprotein phosphatase (3.1.3.16), i.e. calcineurin
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/10Screening for compounds of potential therapeutic value involving cells

Definitions

  • the present application relates to the field of neurological diseases, particularly to neurological diseases characterized by a heterozygous or homozygous mutation in the TORSIN1A gene, even more particularly to dystonia (including DYT1 primary dystonia) and to congenital disorders characterized by severe arthrogryposis that might be accompanied with developmental delay, strabismus and tremor.
  • the application provides inhibitors of phosphatidic acid phosphatase activity and medical uses of these inhibitors to treat the above diseases. Methods are disclosed to screen for medicaments that counteract the effects of TORSIN1A mutations.
  • TORSINS are animal-specific proteins and members of the functionally diverse AAA+ ATPase family (Hanson and Whiteheart 2005; Vander Heyden et al 2011). Many studies show that they concentrate and appear to function in the nuclear envelope (NE) (Goodchild et al 2015; Goodchild and Gamb 2005; Kim et al. 2010; Sosa et al. 2014), a specialized endoplasmic reticulum (ER) subdomain. Mammals have four TORSIN genes with different tissue expression patterns (Jungwirth et al 2010). Mutations in TORSIN1A (TOR1A) cause torsion dystonia-1 (MIM: 128100) (also known as DYT1 dystonia) (Ozelius et al 1997 Nat Genet 17: 40-48).
  • MIM torsion dystonia-1
  • MIM DYT1 dystonia
  • Dystonia is a non-degenerative neurological orphan disease with currently no treatment options and characterized by disabling involuntary twisting movements and postures involving one or more sites of the body.
  • the most studied genetic form of dystonia is DYT1 dystonia, a form of early-onset dystonia caused by a heterozygous in-frame trinucleotide deletion (c.907_909delGAG), resulting in the loss of a glutamic acid residue (p.Glu303del) in the C-terminus of the TORSIN1A protein, close to the ATP binding region (Ozelius et al 1989 Neuron 42:202-209; Ozelius et al 1997 Nat Genet 17:40-48; Ozelius et al 1999 Genomics 62:377-384; Bressman et al 2002 Neurology 59:1780-1782).
  • DYT1 dystonia associated with the p.Glu303del mutation displays greatly decreased penetrance, with only one-third of the individuals harbouring the GAG deletion manifesting the disease before the age of 28 years (Bressman et al 1989 Ann Neurol 26: 612-620; Bressman et al 2002 Neurology 59: 1780-1782; Risch et al 1995 Nat Genet 9: 152-159.).
  • Another interesting observation is that until recently homozygous GAG deletions or compound heterozygosity for mutations in TOR1A have never been reported in humans.
  • an infant with a severe congenital phenotype characterized by arthrogryposis, respiratory failure, and feeding difficulties found to have a combination of two TOR1A mutant alleles, i.e. the known c.907_909delGAG (p.Glu303del) mutation (paternally inherited) and a c.961delA (p.T321Rfs*6) variant (maternally inherited).
  • dystonia and arthrogryposis multiplex congenita lack an identifiable structural or biochemical cause.
  • Most dystonia patients are symptomatically treated by peripheral administration of Botulinum toxin to prevent muscle hyperactivation or deep brain stimulation that modifies basal ganglia rhythmicity via electrodes implanted into the globus pallidus.
  • Botulinum toxin to prevent muscle hyperactivation or deep brain stimulation that modifies basal ganglia rhythmicity via electrodes implanted into the globus pallidus.
  • pediatricians are completely helpless. There is thus a very high need to develop causative and more effective treatment options for dystonia and for arthrogryposis multiplex congenita.
  • TORSIN1A negatively controls the activity of the CTDNEP1/CNEP1R1 phosphatase complex by promoting its dissociation.
  • a functional CTDNEP1/CNEP1R1 complex dephosphorylates the phosphatidic acid (PtdA) phosphatase LIPIN thereby promoting its ER localization needed for its phosphatidic acid phosphatase (PAP) activity as well as its nuclear localization needed for its co-transcriptional role.
  • PAP phosphatidic acid
  • LIPIN homologues PAH1 or SMP2 in yeast
  • DAG diacylglycerol
  • CTDNEP1/CNEP1R1 complex is too active and LIPIN is hyperactivated.
  • the data described in this application establishes that genetic inhibitors of CTDNEP1, CNEP1R1 and/or LIPIN can partially compensate for the loss of TORSIN1A and significantly lower the TORSIN1A loss-of-function related disease level in genetically accurate disease models for dystonia and arthrogryposis multiplex congenita.
  • This newly described congenital disorder has never been linked to elevated PAP activity or hyperactivation of CTDNEP1/CNEP1R1 or of LIPIN.
  • said inhibitor decreases the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10% compared to a control situation where said inhibitor was not present.
  • Another aspect of the invention is to provide an inhibitor of phosphatidic acid phosphatase activity for use in the treatment of TORSINl-mediated neurological diseases, wherein said inhibitor is a gapmer, a shRNA, a siRNA, a CRISPR, a TALEN or a Zinc-finger nuclease and wherein said inhibitor inhibits the expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1.
  • Another aspect of the invention is to provide an inhibitor of phosphatidic acid phosphatase activity for use in the treatment of TORSINl-mediated neurological diseases, wherein said inhibitor is selected from the list consisting of propranolol, sphingosine, sphinganine, rutin, keampferol, N-ethylmaleimide and bromoenol lactone.
  • said inhibitor of phosphatidic acid phosphatase activity for use in the treatment of TORSINl-mediated neurological diseases decreases the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10% compared to a control situation where said inhibitor was not present.
  • a pharmaceutical composition for use in treatment of TORSINl-mediated neurological diseases, wherein said pharmaceutical composition comprises an inhibitor of phosphatidic acid phosphatase activity, wherein said inhibitor is a gapmer, a shRNA, a siRNA, a CRISPR, a TALEN or a Zinc-finger nuclease and inhibits the expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1 or wherein said inhibitor is selected from the list consisting of propranolol, sphingosine, sphinganine, rutin, keampferol, N-ethylmaleimide and bromoenol lactone. It is also an object of the invention to provide a screening method to produce a compound for use in the treatment of a TORSINl-mediated neurological disease, comprising:
  • test compound as a compound for use in the treatment of a TORSINl-mediated neurological disease if the growth of said yeast in the presence of said test compound is at least 10% higher than the growth of said yeast in the absence of said test compound.
  • a method is disclosed to produce a pharmaceutical composition comprising a compound identified by the screening methods disclosed in this application.
  • said TORSINl-mediated neurological disease is a disease selected from the list consisting of dystonia, primary dystonia, early-onset dystonia, DYT1 primary dystonia and arthrogryposis multiplex congenita.
  • Figure 1 illustrates the genetic inhibition of lipin, dullard, CG8009 and CG41106 in dTorsin KO flies.
  • Figure 1A shows a PCR genotyping to confirm the dTorsin KO allele in 5-day-old dTorsin KO larvae expressing an RNAi construct against dullard, CG8009, CG41106, luciferase or lipin.
  • dTorsinKO/+ and WT larvae were used as control.
  • II male larvae from crosses with r4-GAL4.
  • Figure IB shows quantitative RT QPCR data showing the efficient knock-down of dullard, CG41106 and lipin in dTorsin KO larvae.
  • Figure 2 demonstrates that genetic inhibition of dullard-CG8009/CG41106 complex results in a better rescue of dTorsin KO effects compared to lipin inhibition.
  • Bright-field images are shown of the fat body in WT and dTorsin KO larvae expressing an RNAi construct against (from left to right) luciferase (negative control), lipin (positive control), dullard, CG8009 or CG41106.
  • the second row of pictures shows Arm::GAL4 driven expression of RNAi constructs.
  • the third row shows r4::GAL4 driven expression of RNAi constructs. Scale bar indicates 1mm.
  • Figure 3 shows the rescue of fat body cell size of dTorsin KO larvae.
  • Figure 3A shows confocal images of 5-day-old dTorsin KO larval fat body cells labeled with phalloidin and DAPI (scale bar indicates 20 pm). Cell size is significantly increased when lipin, dullard, CG8009 or CG41106 is genetically inhibited compared to the negative control (luciferase RNAi).
  • Figure 3B shows the quantification of the confocal images of Figure 3A using an optimized macro.
  • the graphs show mean +/- 95% Cl of fat body cell size in dTorsin KO larvae expressing different RNAi constructs with Arm-GAL4 (left graph) or r4-GAL4 (right graph) drivers. ****, *** and ** indicate p- values of ⁇ 0.0001, ⁇ 0.0006 and ⁇ 0.0025, respectively in a Dunn's multiple comparison test.
  • Figure 4 is a schematic representation of the model that dTorsin regulates lipid synthesis by inhibiting dLipin enzymatic activity
  • d Lipin converts PtDA into DAG and its activity depends on its phosphorylation state. Dephosphorylation causes dLipin activation and nuclear re-localization.
  • CTDNEP1/NEP1R1 is a known phosphatase complex that strongly regulates lipin in yeast and is herein put forward as the intermediate between dTorsin and dLipin.
  • Figure 5 shows elevated PAP activity in Torsinla mutant embryonic mouse brains.
  • PAP activity or PtdA conversion to DAG is biochemically measured in 4 control (wild-type and Torla +/ ) and 4 Torla 7 and 4 Torla figag/figag knock-out embryonic (E18) mouse brains.
  • a significantly elevated PAP activity is detected (One-Tailed T-Test), which is completely in line with the model developed in Drosophila.
  • FIG. 6 shows that LIPIN activity is increased in the genetically accurate dystonia Torla mice model.
  • the PAP activity of Torla figag/+ animals has a wider than normal variance, which might explain the partial penetrance of this genotype in driving dystonia in humans.
  • Figure 7 shows that Lipinl knock-out reduces LIPIN activity in wild-type and Torla mutants. Compared to wild-type mice (Torla +/+ Lipinl +/+ ), LIPIN activity is significantly reduced in Lipin ⁇ mutant mice and as well as in Torla figag/figag mutant mice.
  • FIG 8 shows that Lipinl knock-out increases survival of Torla mutant mice.
  • Figure 9 shows that nuclear membrane defects in Torla mutant mice brain neurons are decreased when Lipin expression is reduced.
  • Figure 10 illustrates the expression of Lipinl, Lipin2 and Lipin3 in mice brain.
  • Figure 10A shows the relative expression of Lipinl, Lipin2 and Lipin3 in E18.5 embryonic mice brain.
  • Figure 10B shows the normalized expression of Lipinl, Lipin2 and Lipin3 in E18.5 embryonic mice brain.
  • Figure 10C shows the expression of Lipinl and Lipin2 at P0 (black), P7 (blue), P14 (green), P21 (red).
  • Figure 11 is a schematic representation of the experimental set-up of virus mediated silencing of Lipin.
  • Figure 11A shows that for testing AAV9-mediated silencing of Lipinl and Lipin2 in mice brain, pups are intracerebral ventricular injected at birth. Lipin expression and activity is tested at P7, P14 and P21.
  • Figure 12 shows the assessment of infection efficiency by immunohistochemistry against GFP of mice brain 21 days after intracerebral ventricle injection of AAV9-GFP viral particles.
  • Figure 12A shows transversal brain sections of mice injected with AAV9-GFP at 4x1o 11 .
  • Figure 12B shows transversal brain section of mice injected with Vehicle.
  • Figure 12C shows the quantification of anti-GFP signal (normalized through DAPI signal) in 7 different tissues (midbrain, pons, thalamus, hippocampus, cortex (IV-II/III), cortex (Vl-V), cerebellum (purkinje cells)).
  • Figure 13 shows the expression of Lipinl and Lipin2 in mice brain upon intracerebral ventricular injection of AAV9-based silencing constructs. At postnatal day 14 and 21 the expression of both Lipinl and Lipin2 is strongly reduced upon injection of AAV9-shLpinl, AAV9-shLpin2 or AAV9-shLpinl/2 compared to the control (AAV9-shSCRAM).
  • Pgkl and B2m are control genes.
  • Figure 14 shows that Lipin activity is strongly reduced at 21 days after injection of AAV9-shLpinl, AAV9- shLpin2 or AAV9-shLpinl/2 compared to the scrambled control.
  • Figure 15 illustrates that Lipinl loss improves survival of recessive TorsinlA mice.
  • Figure 15 B and C show that Nestin-Cre mediated deletion of TorsinlA combined with DE produces a postnatally surviving model of TorsinlA disease (Peterfly et al 2001).
  • PAP brain Lipin
  • Figure 15 E shows experimental series to test whether Lipin hyperactivity contributes to cKO/DE neurological dysfunction.
  • Figure 15 F illustrates that Lipinl loss rescues cKO/DE lethality.
  • Survival curves of control flox/+
  • cKO/ E:Lipinl+/- mice from P0-P60.
  • Figure 15 G shows that kyphosis is significantly reduced in P21 cKO/ E:Lipinl+/- mice compared with cKO/ E:Lipinl+/+, ⁇ p ⁇ 0.05 (two-tailed Chi-square). Values indicate the number of surviving mice assessed in this test.
  • FIG 16 shows that Lipinl loss reduces motor dysfunction in recessive TorsinlA syndrome mice and dominant TorsinlA dystonia mice.
  • Figure 16 G shows P21 control mice with normally distributed limbs (upper) compared with cKO/DE (lower) displaying splayed hind limbs on ambulation.
  • Figure 16 H and I show the % of animals that display abnormal gait (mild or severe). There are significantly more flox/DE (dystonia) and cKO/+ (haploinsufficient) TorsinlA mice with gait defects than control (flox/+); p ⁇ 0.05; two-tailed Chi-square. * indicates a significant effect of Lipinl genotype on the gait defects; p ⁇ 0.05 (two-tailed Chi-square). Values indicate the number of surviving mice assessed in these tests.
  • genes and proteins are named according to the international agreements.
  • Human gene symbols generally are italicised, with all letters in uppercase (e.g. TOR1A). Protein designations are the same as the gene symbol, but are not italicised, with all letters in uppercase (e.g. LIPIN) (http://www.genenames.org/about/overview).
  • gene symbols In mice and rats, gene symbols generally are italicised, with only the first letter in uppercase and the remaining letters in lowercase (e.g. Torla). Protein designations are the same as the gene symbol, but are not italicised and all are upper case (e.g. LIPIN) (http://www.informatics.jax.org/mgihome/nomen/ gene.shtml).
  • TorsinlA diseases are incurable and represent a life-time burden for patients and their carers.
  • the distinct symptoms require different symptomatic treatments and point to distinct neurological defects. Nevertheless, they result from loss-of-function mutations in the same gene (TORSIN1A) in one or two copies. Both are also specifically neurological and emerge in development. This points to a situation where partial TORSIN1A impairment causes isolated dystonia, while more severe TORSIN1A loss broadly impacts the brain. If so, a therapeutic intervention that corrects for TORSINIA loss before it cascades into neuronal dysfunction would hypothetically treat TORSIN1A disease regardless of symptomology.
  • the application provides an inhibitor of phosphatidic acid phosphatase activity for use in the treatment of neurological diseases, more particularly of TORSIN1A mediated neurological diseases, even more particularly for use in the treatment of dystonia, primary dystonia, early-onset dystonia, DYT1 primary dystonia or arthrogryposis multiplex congenita.
  • an inhibitor of Mg 2+ dependent phosphatidic acid phosphatase activity is provided for use in the treatment of TORSIN1A mediated neurological diseases.
  • an inhibitor of LIPIN-mediated phosphatidic acid phosphatase activity is provided for use in the treatment of TORSIN1A mediated neurological diseases.
  • an inhibitor of LIPINl-mediated phosphatidic acid phosphatase activity and/or LIPIN2-mediated phosphatidic acid phosphatase activity is provided for use in the treatment of TORSIN1A mediated neurological diseases.
  • an inhibitor of phosphatidic acid phosphatase activity or of LIPIN-mediated, LIPINl-mediated or LIPIN2-mediated phosphatidic acid phosphatase activity or of Mg 2+ dependent phosphatidic acid phosphatase activity is provided for use in the treatment of TORSIN1A mediated neurological diseases, wherein said inhibitor decreases the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% compared to a control situation where said inhibitor was not present.
  • said inhibitor decreases the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture between 10% and 60% or between 20% and 40% or between 30% and 50% compared to a control situation where said inhibitor was not present.
  • Phosphatidic acid phosphatase activity refers to the enzyme activity of phosphatidic acid phosphatase (PAP; EC 3.1.3.4). Said PAP catalyzes the Mg 2+ dependent dephosphorylation of phosphatidic acid or phosphatidate (PA), yielding diacylglycerol (DAG) and phosphate (Pi).
  • an inhibitor of phosphatidic acid phosphatase activity or of LIPIN-mediated, LIPINl-mediated or LIPIN2-mediated phosphatidic acid phosphatase activity or of Mg 2+ dependent phosphatidic acid phosphatase activity is provided for use in the treatment of TORSIN1A mediated neurological diseases, wherein said inhibitor decreases the Mg 2+ dependent conversion of phosphatidic acid to diacylglycerol or decreases the Mg 2+ dependent dephosphorylation of PA in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% compared to a control situation where said inhibitor was not present.
  • said inhibitor decreases the Mg 2+ dependent conversion of phosphatidic acid to diacylglycerol or decreases the Mg 2+ dependent dephosphorylation of PA in an in vitro cell culture between 10% and 60% or between 20% and 40% or between 30% and 50% compared to a control situation where said inhibitor was not present.
  • Neurological diseases are disorders that affect the brain and/or the central and autonomic nervous systems. Those neurological disorders that are subject of this invention are those such as dystonia, arthrogryposis multiplex congenita, epilepsy, multiple sclerosis, Parkinson's disease, Huntington's disease and Alzheimer's disease.
  • TORSIN1A mediated neurologic disease or "TOR1A neurologic disease” as used herein refers to a neurological disorder which is caused by a suboptimal TORSIN1A activity.
  • Suboptimal TORSIN1A activity can be caused by a deletion, insertion, substitution or point mutation in the TORSIN1A gene.
  • Said point mutation can be a missense or a nonsense mutation leading to a non-functional or truncated TORSIN1A protein or a TORSIN1A protein with a reduced activity compared to a non-mutated TORSIN1A.
  • Non limiting examples of mutations that result in suboptimal TORSIN1A activity are the in-frame GAG deletion (p.Glu303del), the missense variant p.Gly318Ser, the translational frame shift mutation 961delA (p.T321Rfs*6), an 18-bp deletion (Phe323_Tyr328del), the missense mutations c.613T>A (p.Phe205lso), c.863G>A (p.Arg288Gln), c.581A>T (p.Aspl94Val), p.A14_P15del, p.E121K and c.385G>A (p.Val 129lle) (Leung et al 2001 Neurogenetics 3:133-143; Calakos et al 2010 J Med Genet doi:10.1136/ jmg.2009.072082; Zirn et al 2008 J Neurol Neurosurg Psychiatry 79: 1327
  • TORSIN1A mediated neurological diseases are dystonia, primary dystonia, early-onset dystonia, DYT1 primary dystonia, DYT1 dystonia or arthrogryposis multiplex congenita.
  • said inhibitor for use in the treatment of TORSIN1A mediated neurological diseases is a gapmer, a shRNA, a siRNA, a CRISPR-Cas, a CRISPR-C2c2, a TALEN, a Zinc-finger nuclease, an antisense oligomer, a miRNA, a morpholino, a locked nucleic acid, a peptide nucleic acid, ribozyme or a meganuclease and said inhibitor inhibits the expression or functional expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1.
  • methods of treating TORSIN1A mediated neurological diseases in a subject in need thereof comprising administering an inhibitor of phosphatidic acid phosphatase activity or of LIPIN-mediated phosphatidic acid phosphatase activity or of LIPINl-mediated phosphatidic acid phosphatase activity or of LIPIN2-mediated phosphatidic acid phosphatase activity or of Mg 2+ dependent phosphatidic acid phosphatase activity to said subject, wherein said inhibitor inhibits the expression or functional expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1.
  • said neurological disease is selected from dystonia, primary dystonia, early-onset dystonia, DYT1 primary dystonia, DYT1 dystonia or arthrogryposis multiplex congenita.
  • the nature of the inhibitor of functional expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1 is not vital to the invention, as long as it inhibits the phosphatidic acid phosphatase activity or LIPIN-mediated phosphatidic acid phosphatase activity or LIPINl-mediated phosphatidic acid phosphatase activity or LIPIN2-mediated phosphatidic acid phosphatase activity or Mg 2+ dependent phosphatidic acid phosphatase activity.
  • said inhibitor is selected from the inhibitory RNA technology (such as a gapmer, a shRNA, a siRNA, an antisense oligomer, a miRNA, a morpholino, a locked nucleic acid, peptide nucleic acid), a CRISPR-Cas, a CRISPR-Cpf, a CRISPR- C2c2, a TALEN, a meganuclease or a Zinc-finger nuclease.
  • RNA technology such as a gapmer, a shRNA, a siRNA, an antisense oligomer, a miRNA, a morpholino, a locked nucleic acid, peptide nucleic acid
  • CRISPR-Cas a CRISPR-Cpf
  • CRISPR- C2c2 a CRISPR- C2c2
  • TALEN TALEN
  • an "inhibitor of functional expression” is a synonym for an inhibitor of transcription and/or translation of a particular gene.
  • an “inhibitor of functional expression” is an "inhibitor of expression and/or activity”.
  • functional expression can be deregulated on at least three levels. First, at the DNA level, e.g. by removing or disrupting the LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 gene, or by preventing transcription to take place (in both instances preventing synthesis of the relevant gene product, i.e. LI PIN 1, LIPIN2, CTDNEP1 or CNEP1R1).
  • the lack of transcription can e.g. be caused by epigenetic changes (e.g. DNA methylation) or by loss-of-function mutations.
  • a "loss-of-function" or "LOF” mutation as used herein is a mutation that prevents, reduces or abolishes the function of a gene product as opposed to a gain-of-function mutation that confers enhanced or new activity on a protein.
  • LOF can be caused by a wide range of mutation types, including, but not limited to, a deletion of the entire gene or part of the gene, splice site mutations, frame-shift mutations caused by small insertions and deletions, nonsense mutations, missense mutations replacing an essential amino acid and mutations preventing correct cellular localization of the product.
  • a null mutation is an LOF mutation that completely abolishes the function of the gene product.
  • a null mutation in one allele will typically reduce expression levels by 50%, but may have severe effects on the function of the gene product.
  • functional expression can also be deregulated because of a gain-of-function mutation: by conferring a new activity on the protein, the normal function of the protein is deregulated, and less functionally active protein is expressed. Vice versa, functional expression can be increased e.g. through gene duplication or by lack of DNA methylation.
  • RNA level e.g. by lack of efficient translation taking place for example because of destabilization of the mRNA (e.g. by UTR variants) so that it is degraded before translation occurs from the transcript.
  • lack of efficient transcription e.g. because a mutation introduces a new splicing variant.
  • LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 can also be inhibited at the protein level by inhibiting the function of the LI PI N 1, LIPIN2, CTDNEP1 or CNEP1R1 protein.
  • Non-limiting examples are intrabodies, alpha-bodies, antibodies, VHHs or (heavy chain only) single domain antibodies, phosphatases, kinases.
  • the phosphatidic acid phosphatase activity or LIPIN-mediated phosphatidic acid phosphatase activity or LIPINl-mediated phosphatidic acid phosphatase activity or LIPIN2-mediated phosphatidic acid phosphatase activity or Mg 2+ dependent phosphatidic acid phosphatase activity in neuronal brain cells is reduced to have a positive effect on the treatment of TORSINlA-mediated neurological diseases, more particularly arthrogryposis multiplex congenita or dystonia, more particularly primary dystonia, even more particularly early onset dystonia, most particularly DYT1 primary dystonia.
  • Said reduction in phosphatidic acid phosphatase activity which is preferably at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or even 100%, more preferably between 10% and 60% or between 20% and 40% or between 30% and 50% compared to a control situation where said inhibitor was not present, can be achieved by inhibition of the functional expression of LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1.
  • Said inhibition is preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or even 100%.
  • Gene inactivation i.e. inhibition of functional expression of the target gene
  • the nature of the inhibitor and whether the effect is achieved by incorporating antisense RNA into the subject's genome or by administering antisense RNA is not vital to the invention, as long as said inhibitor inhibits the functional expression of the LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 gene.
  • An antisense construct can be delivered, for example, as an expression plasmid, which, when transcribed in the cell, produces RNA that is complementary to at least a unique portion of the cellular LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 RNA.
  • An inhibitor of functional expression of LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 can also be an antisense molecule or anti-gene agent that comprises an oligomer of at least about 10 nucleotides in length for which no transcription is needed in the treated subject. In embodiments such an inhibitor comprises at least 15, 18, 20, 25, 30, 35, 40, or 50 nucleotides.
  • Antisense approaches involve the design of oligonucleotides (either DNA or RNA, or derivatives thereof) that are complementary to an RNA encoded by polynucleotide sequences of the LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 gene.
  • Antisense RNA may be introduced into a cell to inhibit translation of a complementary mRNA by base pairing to it and physically obstructing the translation machinery. This effect is therefore stoichiometric. Absolute complementarity, although preferred, is not required.
  • a sequence "complementary" to a portion of an RNA means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double stranded antisense polynucleotide sequences, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed.
  • Antisense oligomers should be at least 10 nucleotides in length, and are preferably oligomers ranging from 15 to about 50 nucleotides in length.
  • the oligomer is at least 15 nucleotides, at least 18 nucleotides, at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, or at least 50 nucleotides in length.
  • Ribozymes are catalytic RNA molecules with enzyme-like cleavage properties that can be designed to target specific RNA sequences. Successful target gene inactivation, including temporally and tissue-specific gene inactivation, using ribozymes has been reported in mouse, zebrafish and fruitflies.
  • RNA interference is another form of post- transcriptional gene silencing and used in this application as one of the many methods to inhibit or reduce the functional expression of LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1.
  • RNAi mediated degradation of the target mRNA can be detected by measuring levels of the target mRNA or protein in the cells of a subject, using standard techniques for isolating and quantifying mRNA or protein as described in this application.
  • the mediators of sequence-specific messenger RNA degradation are small interfering RNAs (siRNAs) generated by ribonuclease III cleavage from longer dsRNAs. Generally, the length of siRNAs is between 20-25 nucleotides (Elbashir et al 2001 Nature 411: 494-498).
  • the siRNA typically comprise a sense RNA strand and a complementary antisense RNA strand annealed together by standard Watson-Crick base pairing interactions (hereinafter "base paired").
  • the sense strand comprises a nucleic acid sequence that is identical to a target sequence (i.e. the LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 sequence in this application) contained within the target mRNA.
  • the sense and antisense strands of the present siRNA can comprise two complementary, single stranded RNA molecules or can comprise a single molecule in which two complementary portions are base paired and are covalently linked by a single stranded "hairpin" area (often referred to as shRNA).
  • the siRNAs that can be used to inhibit or reduce the functional expression of LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 can comprise partially purified RNA, substantially pure RNA, synthetic RNA, or recombinantly produced RNA, as well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides.
  • Such alterations can include addition of non-nucleotide material, such as to the end(s) of the siRNA or to one or more internal nucleotides of the si NA, including modifications that make the siRNA resistant to nuclease digestion.
  • the siRNAs can be targeted to any stretch of approximately 19 to 25 contiguous nucleotides in LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 sequence (the "target sequence"). Techniques for selecting target sequences for siRNA are well known in the art.
  • the sense strand of the present siRNA comprises a nucleotide sequence identical to any contiguous stretch of about 19 to about 25 nucleotides in the target mRNA.
  • siRNAs can be obtained using a number of techniques known to those of skill in the art. For example, the siRNAs can be chemically synthesized or recombinantly produced using methods known in the art.
  • the siRNA of the invention are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer.
  • the siRNA can be synthesized as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions.
  • Commercial suppliers of synthetic RNA molecules or synthesis reagents include Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo., USA), Pierce Chemical (part of Perbio Science, Rockford, III., USA), Glen Research (Sterling, Va., USA), ChemGenes (Ashland, Mass., USA) and Cruachem (Glasgow, UK).
  • siRNA can also be expressed from recombinant circular or linear DNA plasmids using any suitable promoter.
  • suitable promoters for expressing siRNA targeted against LIPIN1, LIPIN2, CTDNEP1 OR CNEP1R1 activity from a plasmid include, for example, the U6 or HI RNA pol III promoter sequences and the cytomegalovirus promoter. Selection of other suitable promoters is within the skill in the art.
  • the recombinant plasmids of the invention can also comprise inducible or regulatable promoters for expression of the siRNA in a particular tissue or in a particular intracellular environment.
  • siRNA expressed from recombinant plasmids can either be isolated from cultured cell expression systems by standard techniques, or can be expressed intracellularly, e.g. in brain tissue or in neurons. siRNAs can also be expressed intracellularly from recombinant viral vectors.
  • the recombinant viral vectors comprise sequences encoding the siRNAs of the invention and any suitable promoter for expressing the siRNA sequences.
  • the siRNA will be administered in an "effective amount" which is an amount sufficient to cause RNAi mediated degradation of the target mRNA, or an amount sufficient to inhibit the phosphatidic acid phosphatase activity.
  • an effective amount of the siRNA of the invention to be administered to a given subject by taking into account factors such as involuntary muscle contraction; the extent of the disease penetration; the age, health and sex of the subject; the route of administration; and whether the administration is regional or systemic.
  • an effective amount of siRNAs targeting LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 expression comprises an intracellular concentration of from about 1 nanomolar (nM) to about 100 nM, preferably from about 2 nM to about 50 nM, more preferably from about 2.5 nM to about 10 nM. It is contemplated that greater or lesser amounts of siRNA can be administered.
  • Another method for the inhibition of gene expression is based on the use of shorter antisense oligomers consisting of DNA, or other synthetic structural types such as phosphorothiates, 2'-0-alkylribonucleotide chimeras, locked nucleic acid (LNA), peptide nucleic acid (PNA), or morpholinos.
  • LNA locked nucleic acid
  • PNA peptide nucleic acid
  • morpholinos With the exception of RNA oligomers, PNAs and morpholinos, all other antisense oligomers act in eukaryotic cells through the mechanism of RNase H-mediated target cleavage.
  • PNAs and morpholinos bind complementary DNA and RNA targets with high affinity and specificity, and thus act through a simple steric blockade of the RNA translational machinery, and appear to be completely resistant to nuclease attack.
  • morpholino antisense oligonucleotides in zebrafish and frogs overcome the limitations of RNase H-competent antisense oligonucleotides, which include numerous non-specific effects due to the non-target-specific cleavage of other mRNA molecules caused by the low stringency requirements of RNase H. Morpholino oligomers therefore represent an important new class of antisense molecule. Oligomers of the invention may be synthesized by standard methods known in the art. As examples, phosphorothioate oligomers may be synthesized by the method of Stein et al. (1988) Nucleic Acids Res.
  • methylphosphonate oligomers can be prepared by use of controlled pore glass polymer supports (Sarin et al. (1988) Proc. Natl. Acad. Sci. USA. 85, 7448-7451). Morpholino oligomers may be synthesized by the method of Summerton and Weller U.S. Patent Nos. 5,217,866 and 5,185,444.
  • a gapmer is a chimeric antisense oligonucleotide that contains a central block of deoxynucleotide monomers sufficiently long to induce RNase H cleavage.
  • the central block of a gapmer is flanked by blocks of 2'-0 modified ribonucleotides or other artificially modified ribonucleotide monomers such as bridged nucleic acids (BNAs) that protect the internal block from nuclease degradation.
  • BNAs bridged nucleic acids
  • Phosphorothioates possess increased resistance to nucleases compared to unmodified DNA. However, they have several disadvantages. These include low binding capacity to complementary nucleic acids and non-specific binding to proteins that cause toxic side-effects limiting their applications. The occurrence of toxic side- effects together with non-specific binding causing off-target effects has stimulated the design of new artificial nucleic acids for the development of modified oligonucleotides that provide efficient and specific antisense activity in vivo without exhibiting toxic side-effects. By recruiting RNase H, gapmers selectively cleave the targeted oligonucleotide strand. The cleavage of this strand initiates an antisense effect.
  • Gapmers are offered commercially, e.g. LNA longRNA GapmeRs by Exiqon, or MOE gapmers by Isis pharmaceuticals.
  • MOE gapmers or "2'MOE gapmers” are an antisense phosphorothioate oligonucleotide of 15-30 nucleotides wherein all of the backbone linkages are modified by adding a sulfur at the non-bridging oxygen (phosphorothioate) and a stretch of at least 10 consecutive nucleotides remain unmodified (deoxy sugars) and the remaining nucleotides contain an O'-methyl O'-ethyl substitution at the 2' position (MOE).
  • inhibitors of functional expression of the LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 gene can also act at the DNA level. If inhibition is to be achieved at the DNA level, this may be done using gene therapy to knock-out or disrupt the target gene.
  • a "knock-out" can be a gene knockdown or the gene can be knocked out by a mutation such as, a point mutation, an insertion, a deletion, a frameshift, or a missense mutation by techniques known in the art, including, but not limited to, retroviral gene transfer.
  • Zinc-finger nucleases are artificial restriction enzymes generated by fusing a zinc finger DNA-binding domain to a DNA-cleavage domain. Zinc finger domains can be engineered to target desired DNA sequences, which enable zinc-finger nucleases to target unique sequence within a complex genome. By taking advantage of endogenous DNA repair machinery, these reagents can be used to precisely alter the genomes of higher organisms.
  • Other technologies for genome customization that can be used to knock out genes are meganucleases and TAL effector nucleases (TALENs, Cellectis bioresearch).
  • a TALEN is composed of a TALE DNA binding domain for sequence- specific recognition fused to the catalytic domain of an endonuclease that introduces double strand breaks (DSB).
  • the DNA binding domain of a TALEN is capable of targeting with high precision a large recognition site (for instance 17bp).
  • Meganucleases are sequence-specific endonucleases, naturally occurring "DNA scissors", originating from a variety of single-celled organisms such as bacteria, yeast, algae and some plant organelles. Meganucleases have long recognition sites of between 12 and 30 base pairs. The recognition site of natural meganucleases can be modified in order to target native genomic DNA sequences (such as endogenous genes).
  • CRISPR- Cas system Another recent genome editing technology is the CRISPR- Cas system, which can be used to achieve RNA-guided genome engineering.
  • CRISPR interference is a genetic technique which allows for sequence-specific control of gene expression in prokaryotic and eukaryotic cells. It is based on the bacterial immune system-derived CRISPR (clustered regularly interspaced palindromic repeats) pathway that confers resistance to foreign genetic elements such as those present within plasmids and phages providing a form of acquired immunity.
  • CRISPR/Cas9 A simple version of the CRISPR/Cas system, CRISPR/Cas9, has been modified to edit genomes.
  • the cell's genome can be cut at a desired location, allowing existing genes to be removed and/or new ones added (Marraffini and Sontheimer 2010 Nat Rev Genet 11:181-190).
  • gRNA synthetic guide RNA
  • alternatives for the Cas9 nuclease have been identified, e.g. Cpfl or Casl2 (Zetsche et al 2015 Cell 3:759-771). Recently, it was demonstrated that the CRISPR-Cas editing system can also be used to target RNA.
  • C2c2 (also known as Casl3) can be programmed to cleave single stranded RNA targets carrying complementary protospacers (Abudayyet et al 2016 Science aaf5573; Abudayyet et al 2017 Nature 5:280-284).
  • C2c2 is a single-effector endoRNase mediating ssRNA cleavage once it has been guided by a single crRNA guide toward the target RNA. This system can thus also be used to target and thus to break down LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1.
  • said inhibitor for use in treatment of TORSINlA-mediated neurological diseases is selected from the list consisting of propranolol, propranolol hydrochloride, sphingosine, sphinganine, rutin, keampferol, N-ethylmaleimide and bromoenol lactone.
  • This application also envisages an inhibitor of phosphatidic acid phosphatase activity for use in treatment of TORSIN1A mediated neurological diseases, wherein said inhibitor is a variant of propranolol, propranolol hydrochloride, sphingosine, sphinganine, rutin, keampferol, N-ethylmaleimide or bromoenol lactone, wherein said inhibitor is still capable of decreasing the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said inhibitor was not present.
  • Propranolol (C H NO ; CAS 525-66-6; PubChem CID 4946) is a well-known drug of the beta blocker type that is commercially available. As a beta-adrenergic receptor antagonist it is used to treat high blood pressure and a number of irregular heart rate types.
  • propranolol, propranolol hydrochloride and variants thereof surprisingly can also be used to treat TORSINlA-mediated neurological diseases such as DYT1 dystonia and arthrogryposis multiplex congenita.
  • Propranolol is also known to cross the blood-brain barrier and is defined by the chemical formula:
  • propranolol or variant thereof is provided for use to treat a neurological disease, more particularly a TORSINlA-mediated neurological disease, wherein said propranolol variant decrease the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said propranolol variant was not present.
  • N-Ethylmaleimide (C H NO ; CAS 128-53-0; PubChem CID 4362) is an organic compound that is derived from maleic acid. It contains the imide functional group, but more importantly it is an alkene that is reactive toward thiols and is commonly used to modify cysteine residues in proteins and peptides. It is also known as l-ethylpyrrole-2,5-dione or ethylmaleimide and has the following structural formula:
  • N-ethylmaleimide or variant thereof is provided for use to treat a neurological disease, more particularly a TORSINlA-mediated neurological disease, wherein said N- ethylmaleimide variant decrease the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said N-ethylmaleimide variant was not present.
  • Bromoenol lactone (C16H13Br02; CAS 478288-90-3) is an inhibitor of calcium-independent phospholipase y (iPLA2y) (Tsuchida et al 2015 Mediators Inflamm 605727).
  • the calcium-independent phospholipases (iPLA2) are a PLA2 subfamily closely associated with the release of arachidonic acid in response to physiologic stimuli.
  • BEL also inhibits LIPIN 1 and is therefore disclosed herein for use to treat TORSINlA-mediated neurological diseases.
  • BEL has the following structural formula:
  • bromoenol lactone or variant thereof for use to treat a neurological disease, more particularly a TORSIN1A mediated neurological disease, wherein said bromoenol lactone variant decrease the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said bromoenol lactone variant was not present.
  • Kaempferol (C15H10O6; CAS 520-18-3; PubChem CID 5280863) also known as 3,5,7-Trihydroxy-2-(4- hydroxyphenyl)-4H-chromen-4-one, kaempherol, robigenin, pelargidenolon, rhamnolutein, rhamnolutin, populnetin, trifolitin, kempferol or swartziol is a natural flavonol, a type of flavonoid, found in a variety of plants and plant-derived foods. Kaempferol acts as an antioxidant by reducing oxidative stress.
  • Kaempferol has the following structural formula:
  • kaempferol or variant thereof for use to treat a neurological disease, more particularly a TORSINlA-mediated neurological disease, wherein said kaempferol variant decrease the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said kaempferol variant was not present.
  • Rutin (C27H30O16; CAS 153-18-4; PubChem CIB 5280805) also known as rutoside, phytomelin, sophorin, birutan, eldrin, birutan forte, rutin trihydrate, globularicitrin, violaquercitrin, quercetin-3-O-rutinoside, quercetin rutinoside or 2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[a-L-rhamnopyranosyl-(l->6)- -D- glucopyranosyloxy]-4H-chromen-4-one, is the glycoside combining the flavonol quercetin and the disaccharide rutinose (a-L-rhamnopyranosyl-(l->6)- -D-glucopyranose). Rutin is a citrus flavonoid found in a wide variety of plants including citrus fruit with the following structural formula:
  • rutin or variant thereof is provided for use to treat a neurological disease, more particularly a TORSINlA-mediated neurological disease, wherein said rutin variant decrease the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said rutin variant was not present.
  • Sphinganine (C18H39NO2; CAS 764-22-7; PubChem CID 4094) also known as dihydrosphingosine or 2- amino-l,3-dihydroxyoctadecane is a blocker postlysosomal cholesterol transport by inhibition of low- density lipoprotein-induced esterification of cholesterol. Sphinganine causes unesterified cholesterol to accumulate in perinuclear vesicles. It has been suggested the possibility that endogenous sphinganine may inhibit cholesterol transport in Niemann-Pick Type C (NPC) disease (Roff et al 1991 Dev Neurosci 13:315-319). Here, it is disclosed that sphinganine can be used to treat TORSINlA-mediated neurological diseases.
  • NPC Niemann-Pick Type C
  • sphinganine or variant thereof is provided for use to treat a neurological disease, more particularly a TORSINlA-mediated neurological disease, wherein said sphinganine variant decrease the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said sphinganine variant was not present.
  • Sphingosine C H NO ; CAS 123-78-4; PubChem CID 5280335
  • 2-amino-4-octadecene- 1,3-diol is an 18-carbon amino alcohol with an unsaturated hydrocarbon chain, which forms a primary part of sphingolipids, a class of cell membrane lipids that include sphingomyelin, an important phospholipid.
  • sphingosine or variant thereof is provided for use to treat a neurological disease, more particularly a TORSINlA-mediated neurological disease, wherein said sphingosine variant decrease the Mg 2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said sphingosine variant was not present.
  • said TORSINlA-mediated neurological disease is selected from the list consisting of dystonia, primary dystonia, early-onset dystonia, DYT1 primary dystonia and arthrogryposis multiplex congenita.
  • a pharmaceutical composition for use in treatment of TORSINlA-mediated neurological diseases comprising an inhibitor of phosphatidic acid phosphatase activity.
  • said phosphatidic acid phosphatase activity is Mg 2+ dependent phosphatidic acid phosphatase activity or LIPIN-mediated, LIPINl-mediated or LIPIN2- mediated phosphatidic acid phosphatase activity.
  • said inhibitor further inhibits the functional expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1 and is selected from the list consisting of a gapmer, a shRNA, a siRNA, a CRISPR-Cas, a CRISPR-C2c2, a TALEN, a Zinc-finger nuclease, an antisense oligomer, a miRNA, a morpholino, a locked nucleic acid, a peptide nucleic acid, ribozyme and a meganuclease.
  • a gapmer a shRNA, a siRNA, a CRISPR-Cas, a CRISPR-C2c2, a TALEN, a Zinc-finger nuclease, an antisense oligomer, a miRNA, a morpholino, a locked nucleic acid, a peptide nucleic acid, ribozyme and a meganucle
  • a pharmaceutical composition for use in treatment of TORSINlA-mediated neurological diseases comprises a pharmaceutically effective amount of propranolol, propranolol hydrochloride, sphingosine, sphinganine, rutin, kaempferol, N-ethylmaleimide or bromoenol lactone.
  • a pharmaceutical composition for use in treatment of TORSINlA-mediated neurological diseases comprising an inhibitor of phosphatidic acid phosphatase activity, wherein said inhibitor is selected from the list consisting of propranolol, propranolol hydrochloride, sphingosine, sphinganine, rutin, kaempferol, N-ethylmaleimide and bromoenol lactone.
  • said TORSINlA-mediated neurological disease is selected from the list consisting of dystonia, primary dystonia, early-onset dystonia, DYT1 primary dystonia and arthrogryposis multiplex congenita.
  • This invention thus also relates to pharmaceutical compositions comprising functional inhibitors of phosphatidic acid phosphatase activity or Mg 2+ dependent phosphatidic acid phosphatase activity or LIPIN-mediated, LIPINl-mediated or LIPIN2-mediated phosphatidic acid phosphatase activity or comprising functional inhibitors of LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 described herein before.
  • compositions can be utilized to achieve the desired pharmacological effect by administration to a patient suffering from neurological disease, particularly a TORSINlA-mediated neurological disease such as arthrogryposis multiplex congenita or dystonia, more particularly primary dystonia, even more particularly early-onset dystonia, most particularly DYT1 dystonia, in need thereof.
  • a patient for the purpose of this invention, is a mammal, including a human, in need of treatment for a neurological disease, particularly a TORSINlA-mediated neurological disease such as arthrogryposis multiplex congenita or dystonia, more particularly primary dystonia, even more particularly early-onset dystonia, most particularly DYT1 dystonia.
  • the present invention includes pharmaceutical compositions that comprise a pharmaceutically acceptable carrier and a pharmaceutically effective amount of a functional inhibitor of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1 expression and/or activity, or salt of said inhibitor, of the present invention. Also, the present invention discloses pharmaceutical compositions that comprise a pharmaceutically acceptable carrier and a pharmaceutically effective amount of an inhibitor of phosphatidic acid phosphatase activity or Mg 2+ dependent phosphatidic acid phosphatase activity or LIPIN-mediated phosphatidic acid phosphatase activity or LIPINl-mediated phosphatidic acid phosphatase activity or LIPIN2-mediated phosphatidic acid phosphatase activity, or salt of said inhibitor, of the present invention.
  • said inhibitor of phosphatidic acid phosphatase activity is selected from the list consisting of propranolol, propranolol hydrochloride, sphingosine, sphinganine, rutin, kaempferol, N-ethylmaleimide and bromoenol lactone.
  • a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a pharmaceutically effective amount of propranolol, propranolol hydrochloride, sphingosine, sphinganine, rutin, kaempferol, N-ethylmaleimide or bromoenol lactone.
  • a pharmaceutically acceptable carrier is preferably a carrier that is relatively non-toxic and innocuous to a patient at concentrations consistent with effective activity of the active ingredient so that any side effects ascribable to the carrier do not vitiate the beneficial effects of the active ingredient.
  • a pharmaceutically effective amount of a functional inhibitor of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1 is preferably that amount which reduces the phosphatidic acid phosphatase activity or Mg 2+ dependent phosphatidic acid phosphatase activity or LIPIN-mediated, LIPINl-mediated or LIPIN2-mediated phosphatidic acid phosphatase activity in the brain of a patient suffering from a neurological disease (particularly a TORSINlA-mediated neurological disease) thereby influencing the particular condition being treated.
  • the compounds of the present application can be administered with pharmaceutically acceptable carriers well known in the art using any effective conventional dosage unit forms, including immediate, slow and timed release preparations.
  • the pharmaceutical compositions of this application may be in the form of oil-in-water emulsions.
  • the emulsions may also contain sweetening and flavoring agents.
  • Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil such as, for example, arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin.
  • the pharmaceutical compositions may be in the form of sterile injectable aqueous suspensions. Such suspensions may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents, all well-known by the person skilled in the art.
  • the sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent.
  • Diluents and solvents that may be employed are, for example, water, Ringer's solution, isotonic sodium chloride solutions and isotonic glucose solutions.
  • sterile fixed oils are conventionally employed as solvents or suspending media.
  • any bland, fixed oil may be employed including synthetic mono- or diglycerides.
  • fatty acids such as oleic acid can be used in the preparation of injectables.
  • the compositions of the application can also contain other conventional pharmaceutically acceptable compounding ingredients, generally referred to as carriers or diluents, as necessary or desired. The nature of additional ingredients and the need of adding those to the composition of the invention is within the knowledge of a skilled person in the relevant art. Conventional procedures for preparing such compositions in appropriate dosage forms can be utilized.
  • the inhibitor of functional expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1 may be provided as protein (e.g. nuclease) or as an RNA molecule or may be administered as a nucleic acid molecule encoding said protein or said RNA molecule or as a vector comprising such nucleic acid molecule. If the inhibitor of the invention is administered as protein or RNA molecule, it is particularly envisaged that it is administered intracerebroventricularly, such as e.g. through injection or pump. This is well known by the skilled one, e.g. US 20040162255 incorporated as reference. Alternatively, said inhibitor can be coupled to a (single domain) antibody that targets a blood brain barrier (BBB) receptor. This complex can be injected intravenous after which the BBB receptor targeting antibody (or single variable domain antibody) will shuttle the complex across the BBB.
  • BBB blood brain barrier
  • the inhibitor of the application is provided as a nucleic acid or a vector
  • the inhibitor is administered through gene therapy.
  • a non-limiting example is (adeno-associated) virus mediated gene silencing.
  • Virus mediated gene therapy is well known in the art (e.g. US 20040023390; Mendell et al 2017 N Eng J Med 377:1713-1722 all incorporated herein as reference).
  • Virus mediated gene therapy can be applied intracerebroventricularly but also intravenously (e.g. Mendell et al 2017 N Eng J Med 377:1713-1722).
  • LIPIN as mentioned before and hereafter is human LIPIN and can be LIPIN1, LIPIN2 or LIPIN3.
  • LIPIN is LIPIN1 and/or LIPIN2.
  • LIPIN1 encodes a protein with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% homology to one of the isoforms depicted in SEQ ID No: 1-9.
  • LIPIN1 encodes one of the isoforms depicted in SEQ ID No: 1-9.
  • the cDNA reference in NCBI for LI PIN 1 in Mus musculus is AF180471.1; the mRNA references for the transcript variants are NM_172950.3, NM_015763.4, NM_001130412.1 and NM_001355598.1; the protein references for the isoforms are NP_001123884.1 and NP_056578.2.
  • LIPIN2 encodes a protein with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% homology to SEQ ID No: 17. In even more particular embodiments, LIPIN2 encodes the sequence depicted in SEQ ID No: 17.
  • the cDNA reference in NCBI for LIPIN2 in Mus musculus is AF286723.1; the mRNA references for the transcript variants are NM_001164885.1, NM_022882.4 and NM_001357791.1; the protein references for the isoforms are NP_001158357.1 and NP_001344720.1.
  • The“TORS!NIA” gene as used herein is specified by SEQ ID N° 10 and encodes the TORSIN1A protein of SEQ ID N° 11.
  • the cDNA and protein reference sequences in NCBI from homologues of TORSIN1A in Mus musculus and in Drosophila melanogaster are NM_144884 and NP_659133 (M. musculus) and NM_131950 and NP_572178 (D. melanogaster).
  • CTDNEP1 or C-Terminal Domain Nuclear Envelope Phosphatase 1 is a protein in humans that is encoded by the CTDNEP1 gene (HGNC: 19085; Entrez Gene: 23399; Ensembl: ENSG00000175826; OMIM: 610684; UniProtKB: 095476; Chromosome 17, NC_000017.11 (7243587..7251940, complement)).
  • Alternative names are Serine/Threonine-Protein Phosphatase Dullard or DULLARD.
  • CTDNEP1 encodes a protein sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% homology SEQ ID No 14.
  • the protein reference sequence in NCBI from homologues of CTDNEP1 in Mus musculus is NP_080293.1.
  • CNEP1R1 or CTD Nuclear Envelope Phosphatase 1 Regulatory Subunit 1 is a protein in humans that is encoded by the CNEP1R1 gene (HGNC: 26759; Entrez Gene: 255919; Ensembl: ENSG00000205423; OMIM: 616869; UniProtKB: Q8N9A8; Chromosome 16, NC_000016.10 (50025206..50037088)).
  • TMEM188 Transmembrane Protein 188
  • NEP1R1 and C16orf69.
  • CNEP1R1 encodes a protein sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% homology to one of two isoforms depicted in SEQ ID No 15 and 16.
  • the protein reference sequence in NCBI from homologues of CNEP1R1 in Mus musculus is NP_083350.2.
  • a screening method is provided to produce or identify a compound for use in the treatment of a TORSINlA-mediated neurological disease, comprising:
  • test compound as a compound for use in the treatment of a TORSINlA-mediated neurological disease if the growth of said yeast in the presence of said test compound is at least 10%, at least 25%, at least 50%, at least 75%, at least 100%, at least 2-fold, at least 3-fold, at least 5-fold or at least 10-fold higher than the growth of said yeast in the absence of said test compound.
  • a method is provided to produce a pharmaceutical composition comprising a compound, wherein said compound is identified by said screening method.
  • “Hyperactivated” CTDNEP1/CNEP1R1 complex refers to a CTDNEP1/CNEP1R1 complex that overperforms in dephosphorylating LIPIN, thereby affecting the balance between phospholipid and TAG production in favor for TAG because of a LIPIN-dependent conversion of phosphatidate (PtdA) to diacylglycerol (DAG).
  • PtdA phosphatidate
  • DAG diacylglycerol
  • inhibitors of CTDNEP1 or CNEP1R1 activity that can be used in the treatment of TORSINlA-mediated neurological diseases will be those that allow or restore growth of cells notwithstanding said cells produce a hyperactivated CTDNEP1/CNEP1R1 complex.
  • said complex is a human complex.
  • Methods to evaluate growth of cells e.g. yeast
  • OD600 measurements include for example (without the purpose of being limiting) measurements of optical density (OD) at a wavelength of 600 nm, also known as OD600 measurements.
  • the application provides screening methods to produce or identify an inhibitor of CTDNEP1 or CNEP1R1 activity, comprising:
  • Triglycerides are esters derived from glycerol and three fatty acids. Triglycerides (also known as triacylglycerols) are the main constituents of body fat in humans and animals. Methods to stain storage lipids and imaging them are well known in the art and discussed in current application.
  • CTDNEP1 or CNEP1R1 activity refers to the functional activity of CTDNEP1 or CNEP1R1 and thus of the enzyme complex consisting of CTDNEP1 and CNEP1R1.
  • An inhibitor of CTDNEP1 or CNEP1R1 activity can be an antibody, a (heavy chain only) single variable domain antibody or VHH, a phosphatase, a kinase, a small molecule, etc ...
  • test compound or a “drug candidate compound” described in connection with the methods of the present invention.
  • these compounds comprise organic or inorganic compounds, derived synthetically or from natural resources.
  • the compounds include polynucleotides, lipids or hormone analogs that are characterized by low molecular weights.
  • Other biopolymeric organic test compounds include small peptides or peptide-like molecules (peptidomimetics) comprising from about 2 to about 40 amino acids and larger polypeptides comprising from about 40 to about 500 amino acids, such as antibodies or antibody conjugates.
  • compound libraries may be used.
  • a compound will "reduce” or “decrease” the lipid storage level of TORSIN1A knock-out cells. Lipid storage can be easily visualized by lipid dye (e.g. BODIPY 493/503) as in this application, but alternative methods are well-known for the skilled one.
  • lipid dye e.g. BODIPY 493/503
  • a compound will "enhance” or “stimulate” or “increase” the cell size of the TORSIN1A knock-out cells.
  • One of the possible underlying activities is the stimulation or enhancement of membrane lipid synthesis. Assays and methods for visualization and/or measuring the cell size of in vitro cells are known in the art and provided in this application.
  • the application provides SEQ ID N° 12 or a homologue thereof with a least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% homology to SEQ ID N°12 for use in the treatment of TORSIN1A- mediated neurological diseases.
  • said TORSINlA-mediated neurological disease is a neurological disease caused by the present of one or two mutant alleles of the TORSIN1A gene. More particularly said TORSINlA-mediated neurological disease is arthrogryposis multiplex congenita, dystonia, primary dystonia, early-onset dystonia or DYT1 primary dystonia.
  • the application provides a nucleic acid sequence encoding SEQ ID N° 13 or a homologue of SEQ ID N° 13 with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% homology to SEQ ID N° 13 for use in the treatment of TORSINlA-mediated neurological diseases.
  • said TORSINlA-mediated neurological disease is a neurological disease caused by the present of one or two mutant alleles of the TORSIN1A gene. More particularly said TORSINlA-mediated neurological disease is arthrogryposis multiplex congenita, dystonia, primary dystonia, early-onset dystonia or DYT1 primary dystonia.
  • SEQ ID N° 12 represents the nucleic acid sequence of choline-phosphate cytidylyltransferase A (PCYT1A), while SEQ ID N° 13 represents the amino acid sequence of the PCYT1A enzyme.
  • PCYT1A is the human homologue of CCT from this application.
  • the PCYT1A enzyme or the nucleic acid sequence encoding PCYT1A can be administered intracerebroventricularly or by way of gene therapy to stimulate membrane lipid synthesis (and consequently cell membrane synthesis) and counteract the hyperactivation of LIPIN or LIPIN1 and/or LIPIN2 activity due to the heterozygous or homozygous mutation in TORSIN1A.
  • Gene therapy refers to therapy performed by the administration to a subject of an expressed or expressible nucleic acid.
  • the nucleic acids produce PCYT1A (CCT), a functional fragment, a functional variant or homologue thereof mediates cell membrane synthesis.
  • CCT PCYT1A
  • a large number of methods for gene therapy are available in the art and a plethora of delivery methods (e.g. viral delivery systems, microinjection of DNA plasmids, biolistics of naked nucleic acids, use of a liposome) are well known to those of skill in the art.
  • Gene therapy vectors can be delivered in vivo by administration to an individual patient, typically by systemic administration (e.g., intravenous, intraperitoneal infusion or brain injection).
  • sequence homology of two related nucleotide or amino acid sequences refers to the number of positions in the two optimally aligned sequences which have identical residues (xlOO) divided by the number of positions compared.
  • a gap i.e., a position in an alignment where a residue is present in one sequence but not in the other is regarded as a position with non-identical residues.
  • the alignment of the two sequences is performed by the Needleman and Wunsch algorithm (Needleman and Wunsch (1970) J Mol Biol. 48: 443-453).
  • sequence alignment can be conveniently performed using standard software program such as GAP which is part of the Wisconsin Package Version 10.1 (Genetics Computer Group, Madision, Wisconsin, USA) using the default scoring matrix with a gap creation penalty of 50 and a gap extension penalty of 3. Sequences are indicated as "essentially similar" when such sequences have a sequence identity of at least about 75%, particularly at least about 80 %, more particularly at least about 85%, quite particularly about 90%, especially about 95%, more especially about 100%, quite especially are identical. It is to be understood that although particular embodiments, specific configurations as well as materials and/or molecules, have been discussed herein for cells and methods according to the present invention, various changes or modifications in form and detail may be made without departing from the scope and spirit of this invention. The following examples are provided to better illustrate particular embodiments, and they should not be considered limiting the application. The application is limited only by the claims.
  • the fly fat body is the main site of triacylglycerol (TAG) synthesis and storage and is the equivalent of the vertebrate adipose tissue and liver (KOhnlein et al 2012 J Lipid Res 53:14301436; Ugrankar et al 2011; Zhonghua et al 2013 ABBS 45:44-50). Fat body cells are post mitotic and have to expand in size during fly development. Grillet et al. (2016 Dev Cell 3, 235-247) showed that upon dTorsin loss the fat body mass and fat cell size are significantly decreased and demonstrated that these effects are achieved by a hyperactivation of dLipin in the dTorsin knock-out (KO) adipose tissue.
  • TAG triacylglycerol
  • CTDNEP1 (Neml in yeast and dullard in flies) is the catalytic subunit of the complex, while CNEP1R1 (Spo7 in yeast and CG8009 and CG41106 in flies) is the regulatory subunit.
  • RNAi constructs were transactivated with two different GAL4 drivers: Arm (ubiquitous low expression) and r4 (fat body specific expression). All animals were confirmed to be dTorsin KO (Fig. 1A) and the knock-down efficiency of Lipin, Dullard and CG41106 was determined. RT-qPCR showed that each RNAi causes a significant decrease in its mRNA target (Fig. IB).
  • the fat body of dTorsin KO flies expressing an RNAi construct against Dullard or CG41106 was more increased than the fat body of dTorsin KO flies expressing an RNAi construct against Lipin. Even more surprisingly, the fat body of dTorsin KO flies expressing an RNAi construct against Dullard or CG41106 could not be distinguished from the fat body of WT flies (Fig. 2). We then progressed to quantitatively measure how well the different gene knock-downs rescue the small fat body cell size of dTorsin KO flies as described in Grillet et al. (2016 Dev Cell 3, 235-247).
  • dTorsin regulates the activity of dLipin in the flies adipose tissue through the activity of the inner nuclear membrane localized phosphatase complex CTDNEP1/NEP1R1 (Fig. 4).
  • dTorsinA activity normally dissociates the complex and thus inhibits dephosphorylation of Lipin.
  • the complex is too active resulting in excess Lipin PAP activity.
  • dTorsin is required for the development of Drosophila adipose tissue (Grillet et al. 2016 Dev Cell 3, 235-247) by regulating Lipin dependent PAP activity.
  • dTorsin KO effects in fly could be countered by genetically reducing expression of dLipin.
  • LIPIN could be a target to treat TORSINlA-mediated neurological disorders in mammals.
  • Torla 7 mice contain a large deletion, while the Torla Agag line contains the Agag mutation (or DE) in the endogenous mouse Torla gene (Goodchild et al 2005).
  • Torla +/ and Torla +/Agag heterozygous intercrosses generate expected genotypes with normal Mendelian frequency.
  • Torla 1 and Torla 4909/figag animals die within 48 hours of birth.
  • LIPIN is a magnesium-dependent phosphatidate (PtdA) phosphatase (PAP) that therefore converts PtdA to diacylglycerol (DAG).
  • PtdA magnesium-dependent phosphatidate
  • DAG diacylglycerol
  • Torla +/Agag is a genetically accurate disease model for DYT1 dystonia while Torla 7 and Torla figag/figag models are genetically accurate disease models for arthrogryposis multiplex congenita.
  • Our experiment identified 1) that LIPIN PAP activity is robustly detected in the developing brain and 2) is highly abnormal in the brains of Torla mutant mice.
  • a one-tailed T-test verified that this increase is statistically significant.
  • LIPIN activity was also significantly elevated in the brains of the genetically accurate disease model for DYT1 dystonia (i.e.
  • Torla Agag/+ mice (Fig. 6).
  • the PAP activity of Torla Agag/+ animals has a wider than normal variance, suggesting variability in how animals are affected by Torla Agag/+ (Fig. 6). This is intriguing given the partial penetrance of this genotype in driving dystonia in humans.
  • the above results reveal that both heterozygous as well as homozygous (bi-allelic) Torsinla mutations lead to increased LIPIN activity in mammalian neurons.
  • LIPIN hyperactivity underlies the neurological consequences of Torsinla loss and whether the neurological defects of the dystonia- and arthrogryposis related Torla mutations could be rescued by inhibiting the functional expression of Lipin.
  • the human and mouse genomes encode three LIPIN homologues: LIPIN1, 2 and 3, that all have magnesium dependent PtdA phosphatase activity (Csaki et al 2014, Molecular Metabolism 3: 145-154).
  • LI PI N 1 was selected since homozygous deletion is shown to significantly reduce brain magnesium-dependent PtdA-phosphatase activity (Harris et al 2007 JBC 282: 277-286) and because LI PI N 1 is responsible for most LIPIN PAP activity in the post-natal brain ( Figure 15A).
  • Mice harboring a Lipinl null allele (Lipinl fld/fld ) were crossed with heterozygous Torla +/Agag mice. The FI progeny was genotyped and the Torla +/Agag Lipinl +/ ⁇ mice were selected. The selected genotypes were crossed, phenotyped and genotyped.
  • TorsinlA diseases are defined by their behavioral disturbances; early-onset dystonia and arthrogryposis, respectively. It has been challenging to find a behavioral correlate of dystonia in genetically accurate DE/+ mice, but abnormal motor behaviors of the cKO/DE mice may represent a readout for both dystonia as the TorsinlA recessive syndrome. We therefore analyzed the impact of reduced LIPIN activity on the behavior of these mice using cohorts that also contained littermate flox/DE.
  • Lpinl, Lpin2 and Lpin3 genes encode the three LIPIN PAP enzymes of mammalian cells.
  • Lpinl and Lpin2 mRNA were both strongly detected in the E18 mouse brain, while we had very few Lpin3 reads (Fig. 10A).
  • qRT- PCR also detected Lpinl and Lpin2 mRNA, while Lpin3 was barely detectable (data not shown).
  • the RNAseq data indicates that the late embryonic mouse brain expresses similar amounts of Lpinl and Lpin2 mRNA (Fig. 10B), but very little Lpin3.
  • RNAi can knock-down the expression of multiple genes. RNAi also allows knock-down of neural gene expression; for example, when viruses expressing shRNA against a gene of interest are delivered into the brain by injection. In mice this delivery is most feasible soon after birth. This is also the time point when intervention against congenital recessive TOR1A disease would be needed.
  • shRNA sequences against Lpinl and Lpin2 and produced adeno- associated virus serotype 9 (AAV-9) that carries these Lpinl or Lpin2 sequences, a scrambled control sequence, or GFP.
  • Intracerebral ventricular (ICV) injections of 2 pi of virus (lxlO 12 GC/ml) (per ventricle) into neonatal (post-natal day 0; P0) pups provided the broadest transduction efficiency.
  • Many cells in the cortex, hippocampus, striatum and dorsal thalamus were transduced to express the GFP reporter, although GFP expression was isolated or absent from ventral brain regions, midbrain, cerebellum and hindbrain (Fig. 12). This is similar to publications describing AAV9-delivered gene expression patterns (Chakrabarty et al 2013 PLoS One 8:e67680).
  • mice were allowed to recover and then returned to their home cages for nursing. They were then euthanized at P7, P14 and P21 to collect brain tissue for 1) qRT-PCR assessment of Lpinl/2/3 mRNA levels and 2) biochemical measurement of brain LIPIN PAP activity.
  • Lpin3 mRNA levels are not shown, as levels were often below detection.
  • AAV9-shRNA mediated inhibition of LIPIN PAP activity prevents neurological dysfunction associated with TORlA-disease in mice (Fig. 11B).
  • a conditional Torla floxed mouse model TOG1( Ioc/D9 ° 9 ) is used with co-delivery of AAV9-Cre and AAV9-shLpinl or AAV9-shLpin2 (or AAV9-shSCRAM control).
  • the AAV9-Cre virus deletes several exons from Torla in transduced neurons, so that these individual cells have the genotype of recessive TOR1A disease.
  • CTDNEP1 or CNEP1R1 is reduced in TOR1A disease mice using AAV9 delivered shRNA.
  • Torla figag/figag Torla figag/+ mice were treated with chemical compounds known in the art to inhibit LI PIN 1 activity or LIPIN1 expression.
  • Propranolol is known to cross the blood-brain-barrier and could therefore be injected intravenously.
  • Four groups (3 concentrations and placebo) with four mice per group are used for three different genotypes (Torla figag/figag , Torla figag/+ and WT).
  • New borne mice at P0 are intravenously injected (tail vein injection) with 1 mg/kg of propranolol (30 pg for a 30-g mouse) or 4 mg/kg of propranolol (120 pg for a 30-g mouse) or 10 mg/kg of propranolol (300 pg for a 30-g mouse) in 120 pL of phosphate buffered saline or 120 pL of phosphate buffered saline alone (placebo).
  • the mouse tail vein dose of propranolol was determined using a ratio between appropriate human propranolol intravenous dose, maximum human intravenous dosing, and maximum rodent intravenous dosing (Ley et al 2010 J Trauma 68:353-356).
  • the behavior, cognitive function and the neuronal cellular biology of treated versus non- treated Torla figag/figag , Torla figag/+ and control mice is determined. Given that propranolol crosses the BBB, we hypothesized that the compound would also cross the blood-placenta-barrier.
  • Torla figag/+ mice are crossed and pregnant mice are intravenously injected (tain vein) with 1, 4 or 10 mg/kg of propranolol at the time the embryo's reached E18. After birth, pups are genotyped and evaluated at P0, P7 and P14 concerning behavior, motor function, gait, cognitive function and neuronal cellular biology. Second, sphingosine and sphinganine are checked. These compound are also known to cross the BBB. A similar approach as for propranolol is used but concentrations are adapted to 0.3 mg/kg, 0.5 mg/kg and 2 mg/kg.
  • Rutin was purchased commercially (Sigma-Aldrich, St. Louis, MO, USA). Rutin is diluted in propylene glycol. To facilitate the dissolution of rutin, the solution is made to stand for 15 min in a water bath at 50 °C for 10 min. Rutin solution or vehicle (propylene glycol) is administered by intraperitoneal (i.p.) injection.
  • Torla figag/figag , Torla figag/+ and WT animals are divided into three experimental groups: one that receives vehicle (control group), one that receives the dose of 50 mg of rutin/kg of body weight and one that receives the dose of 100 mg/kg of body weight.
  • Rutin is daily injected during five consecutive days from P0 onwards. At P7, P14 and P21 the behavior, cognitive function and the neuronal cellular biology of treated versus non-treated Torla figag/figag , Torla figag/+ and control mice is determined.
  • the UAS-GAL4 system was used to achieve conditional knockdown of specific genes, using two driver lines w-,dTorsinK078/FM7i, Act-GFP; Arm-Gal4/Arm-Gal4 (ubiquitous low expression) and w- ,dTorsinK078/FM7i, Act-GFP;; r4-Gal4/TM6C,tb (fat body specific expression), and UAS-RNAi transgenic lines (Grillet et al 2016 Dev Cell).
  • the w-,dTorsinK078/FM7i, Act-GFP line was used to bring Arm-GAL4 and r4-GAL4 into dTorsin KO background.
  • RNAi fly stock lines were used in this study: UAS- lipinRNAi (VDRC# 36006, CG8709), UAS-dNEPIRIRNAi (VDRC# 48955, CG8009 and VDRC# 101371, CG41106), UAS-dullardRNAi (VDRC# 12941) and UAS-luciferaseRNAi(BDSC#31603).
  • AII stocks and crosses were cultured on conventional cornmeal/sucrose/dextrose/yeast medium and kept at 25°C.
  • Cell size and lipid droplets were visualized using respectively phalloidin Alexa fluor 594 (lmg/mL, Life technologies# A12381) and BODIPY 493/503 (lmg/L, Invitrogen # D-3922). Cell size was quantified using Fiji and optimized macro. Data were analyzed and compared using the GraphPad Prism software and Dunn's multiple comparison test.
  • dTorsin primer C 5' AC AC AA AT GTG C AG G C AC AG 3'
  • dTorsin primer D 5'CACGACTGAGTGACTTTGAG3'
  • RNA expression was checked using quantitative RT-PCR by isolating total RNA from 5-day-old male larvae expressing RNAi against specific genes using the Arm-GAL4 driver. More than 30 larvae per genotype were washed in ice cold lxPBS and stored at -80°C prior to analysis. Total RNA was isolated using the RNeasy Mini-kit (Qiagen# 74104) and reverse transcribed using the SuperScriptTM VILOTM cDNA Synthesis Kit (Thermofisher# 11754050). Quantitative RT-PCR was performed using a LightCycler ® 480 instrument with LightCycler ® 480 SYBR Green I Master mix (Roche# 04707516001). All SYBR Green assays were performed on 3 different samples and each sample was measured in triplicate and normalized to rp49 mRNA according to the CT method. Primers used for qRT-PCR are:
  • CG41106 5'TGGTTTTCCAAATCCTGTCC3' and 5'ATCAATGTTAAGGCGGAACG3'
  • Rp49 5'TACAGGCCCAAGATCGTGAA3' and 5'GTTCGATCCGTAACCGATGT3'
  • PAP activity (Adapted from Dubots, et al. 2014 PLoS One 9, el04194 and Sembongi, et al. 2013 J Biol Chem 288, 34502-34513) was determined in mouse brain lysates by measuring the formation of fluorescent DAG from NBD-PA (l-acyl-2- ⁇ 12-[(7-nitro-2-l,3-benzoxadiazol-4-yl)amino]dodecanoyl ⁇ -sn- glycero-3-phosphate ammonium salt) (Avanti Polar lipids, Inc).
  • NBD-PA l-acyl-2- ⁇ 12-[(7-nitro-2-l,3-benzoxadiazol-4-yl)amino]dodecanoyl ⁇ -sn- glycero-3-phosphate ammonium salt
  • Snap frozen brain tissues were lysed with Tris-HCI, pH 7.5 buffer containing 0.25 m sucrose, 10 mM 2-mercaptoethanol, lx EDTA free protease inhibitor cocktail, and lx PhosSTOP phosphatase inhibitor cocktail (Roche). The lysates were centrifuged at 1,000 x g for 10 min at 4 °C, and the supernatant was used for the measurement of PAP activity.
  • Reactions (100 pi; 60 pg of total protein extract) were carried out in buffer containing 50 mM Tris HCI pH 8.0, 1 mM MgCI2 or 4 mM EDTA, and 10 mM b-mercaptoethanol, and started by the addition of NBD- PA (2 mM) solubilized in 10 mM Triton X-100.
  • the reactions were incubated for 30 min at 30°C and terminated by the addition of 0.4 ml of 0.1 M HCI (in methanol).
  • RNAIater solution Snap frozen brain tissue (stored at -80°C) was preserved using RNAIater solution, to prevent RNA degradation.
  • RNA isolation was performed using RNeasy Quiagen mini kit (Quiagen), combined with DNAse I on column digestion (Quiagen), according to manufactures instructions.
  • Reverse transcription was done using the Superscript IV Reverse Transcriptase (Thermo Fisher), and using 2000ng of total RNA and random primers reaction.
  • DNA was diluted 1:4 in nuclease-free water and stored at -20°C.
  • qPCR reaction was performed using the SensiFast SYBR No-ROX kit (Bioline), and it was run on Lightcycler 480 (Roche).
  • Cryoanesthetized neonates were injected using glass capillaries (3.5" Drummond #3-000-203-G/X) and a nanoinjection system (Drummond ® Nanoject II). 2 mI of virus (1x1012 viral genomes/ml) was slowly injected into each ventricle and the needle slowly retracted. After injection pups were allowed to completely recover under a heating lamp and then returned to the home cage.
  • AAV virus were obtained from Cyagen (Cyagen Biosciences Inc., Santa Clara, CA, USA).
  • the days of embryonic development were defined after assigning the day of vaginal plug detection as E0.5. Embryos were collected from pregnant females after they were euthanized by cervical dislocation. Days of post-natal development were defined with the birthdate as PO. Postnatal animals were permanently identified using the AIMS Pup Tattoo Identification System (Budd Lake, NJ). Tissues were collected from post-natal animals after decapitation (P0 until P14), cervical dislocation (P14 until P35), or CO2 inhalation. Tissue destined for biochemical analysis was snap frozen and stored at -80°C until use.
  • Tissues destined for histological analysis were perfused and fixed overnight at 4°C in 4% paraformaldehyde in phosphate buffered saline (PBS). They were then either dehydrated and embedded in paraffin or cryoprotected in 30% sucrose, placed in embedding media, rapidly frozen on dry ice, and stored at -80°C until required. All mice were housed in the KU Leuven animal facility, fully compliant with European policy on the use of Laboratory Animals. To prevent environmental bias, mice were cohoused independent to genotype. All animal procedures were approved by the Institutional Animal Care and Research Advisory Committee of the KU Leuven (ECD P120/2017) and performed in accordance with the Animal Welfare Committee guidelines of KU Leuven, Belgium.
  • PBS phosphate buffered saline
  • mice were only examined for overall health, including weighing every fourth day.
  • For tremor each mouse was observed in its home cage for 20s. Any sign of tremor (mild or severe) was recorded as positive.
  • Forelimb and hindlimb clasping was examined upon suspending a mouse upside down by the tail. A positive score was recorded if the limbs touched. Gait was assessed by individually placing a mouse in a fresh cage facing away from the observer.
  • the animal was scored 0 (normal) when it moved normally with both hindlimbs participating evenly and supporting its body weight on all 4 paws, with its abdomen not touching the ground; scores of 1-3 were given if tremor or limping was observed, if the pelvis was lowered or when the feet are pointed away from the body during locomotion ("duck feet"), or when a has difficulty moving forward and drags its abdomen along the ground. Kyphosis was also recorded in this assessment if the animal appeared unable to straighten its spine during ambulation or at rest. All tests were performed with all mice (12 genotypes including Lipinl-/-) that had been cohoused and observers were blind to genotype. While cKO/DE animals could be distinguished by their reduced weight, this could not discriminate their Lipinl genotype. References
  • AAA+ protein torsinA interacts with a conserved domain present in LAP1 and a novel ER protein. J Cell Biol 168, 855-862. Goodchild et al., 2005
  • AAA+ proteins have engine, will work. Nat Rev Mol Cell Biol 6, 519-529.
  • TorsinA hypofunction causes abnormal twisting movements and sensorimotor circuit neurodegeneration.
  • Lipin is a central regulator of adipose tissue development and function in Drosophila melanogaster. Mol Cell Biol 31, 1646-1656.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Epidemiology (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Organic Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Virology (AREA)
  • Toxicology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present application relates to the field of neurological diseases, particularly to neurological diseases characterized by a heterozygous or homozygous mutation in the TORSIN1A gene, even more particularly to dystonia (including DYT1 primary dystonia) and to congenital disorders characterized by severe arthrogryposis that might be accompanied with developmental delay, strabismus and tremor. The application provides inhibitors of phosphatidic acid phosphatase activity and medical uses of these inhibitors. Methods are disclosed to screen for medicaments that counteract the effects of TORSIN1A mutations.

Description

MEANS AND METHODS TO TREAT TORSIN RELATED NEUROLOGICAL
DISEASES
Field of the invention
The present application relates to the field of neurological diseases, particularly to neurological diseases characterized by a heterozygous or homozygous mutation in the TORSIN1A gene, even more particularly to dystonia (including DYT1 primary dystonia) and to congenital disorders characterized by severe arthrogryposis that might be accompanied with developmental delay, strabismus and tremor. The application provides inhibitors of phosphatidic acid phosphatase activity and medical uses of these inhibitors to treat the above diseases. Methods are disclosed to screen for medicaments that counteract the effects of TORSIN1A mutations.
Background
TORSINS are animal-specific proteins and members of the functionally diverse AAA+ ATPase family (Hanson and Whiteheart 2005; Vander Heyden et al 2011). Many studies show that they concentrate and appear to function in the nuclear envelope (NE) (Goodchild et al 2015; Goodchild and Dauer 2005; Kim et al. 2010; Sosa et al. 2014), a specialized endoplasmic reticulum (ER) subdomain. Mammals have four TORSIN genes with different tissue expression patterns (Jungwirth et al 2010). Mutations in TORSIN1A (TOR1A) cause torsion dystonia-1 (MIM: 128100) (also known as DYT1 dystonia) (Ozelius et al 1997 Nat Genet 17: 40-48).
Dystonia is a non-degenerative neurological orphan disease with currently no treatment options and characterized by disabling involuntary twisting movements and postures involving one or more sites of the body. The most studied genetic form of dystonia is DYT1 dystonia, a form of early-onset dystonia caused by a heterozygous in-frame trinucleotide deletion (c.907_909delGAG), resulting in the loss of a glutamic acid residue (p.Glu303del) in the C-terminus of the TORSIN1A protein, close to the ATP binding region (Ozelius et al 1989 Neuron 42:202-209; Ozelius et al 1997 Nat Genet 17:40-48; Ozelius et al 1999 Genomics 62:377-384; Bressman et al 2002 Neurology 59:1780-1782). One intriguing aspect of DYT1 dystonia associated with the p.Glu303del mutation is that it displays greatly decreased penetrance, with only one-third of the individuals harbouring the GAG deletion manifesting the disease before the age of 28 years (Bressman et al 1989 Ann Neurol 26: 612-620; Bressman et al 2002 Neurology 59: 1780-1782; Risch et al 1995 Nat Genet 9: 152-159.). Another intriguing observation is that until recently homozygous GAG deletions or compound heterozygosity for mutations in TOR1A have never been reported in humans. In 2017, as part of on-going studies into arthrogryposis, genome sequencing was applied in genetically- unresolved cases with a clinical presentation of arthrogryposis multiplex congenita (AMC), which is defined as congenital contractures in more than two joints and in multiple body areas (Hall 1997 J Pediatr Orthop B 6:159-166). In five cases out of four families, genome sequencing revealed biallelic mutations in TOR1A (Kariminejad et al 2017 Brain 140: 2764-2767; Reichert et al 2017 Neurol Genet 3:el54). The previously known p.Glu303del in TOR1A associated with DYT1 dystonia was found in a homozygous state in two unrelated families with severe arthrogryposis, developmental delay, strabismus and tremor (Kariminejad et al 2017 Brain 140: 2764-2767). In addition, two novel TOR1A mutations were identified. In two affected siblings of one additional family with a similar presentation of severe arthrogryposis, developmental delay, strabismus and tremor a novel homozygous missense variant in TOR1A (c.952G4A, p.Gly318Ser) was detected (Kariminejad et al 2017 Brain 140: 2764-2767). In a fourth family, an infant with a severe congenital phenotype characterized by arthrogryposis, respiratory failure, and feeding difficulties found to have a combination of two TOR1A mutant alleles, i.e. the known c.907_909delGAG (p.Glu303del) mutation (paternally inherited) and a c.961delA (p.T321Rfs*6) variant (maternally inherited).
Both dystonia and arthrogryposis multiplex congenita lack an identifiable structural or biochemical cause. Currently, there is no cure for these devastating diseases. Most dystonia patients are symptomatically treated by peripheral administration of Botulinum toxin to prevent muscle hyperactivation or deep brain stimulation that modifies basal ganglia rhythmicity via electrodes implanted into the globus pallidus. For arthrogryposis multiplex congenita, pediatricians are completely helpless. There is thus a very high need to develop causative and more effective treatment options for dystonia and for arthrogryposis multiplex congenita.
Although there is a firm link between both diseases and loss of TORSIN activity (Goodchild et al., 2005; Liang et al., 2014; WO1998057984; US20070212333; Kariminejad et al 2017 Brain 140: 2764-2767; Reichert et al 2017 Neurol Genet 3:el54), this information has not yet been translated to therapy because TORSIN1A function is insufficiently understood. It would thus be advantageous to understand the role of TORSIN1A in order to develop new and innovative therapies for TORSIN related neurological diseases, more particularly for dystonia and arthrogryposis multiplex congenita.
Summary
In this application it is disclosed that TORSIN1A negatively controls the activity of the CTDNEP1/CNEP1R1 phosphatase complex by promoting its dissociation. A functional CTDNEP1/CNEP1R1 complex dephosphorylates the phosphatidic acid (PtdA) phosphatase LIPIN thereby promoting its ER localization needed for its phosphatidic acid phosphatase (PAP) activity as well as its nuclear localization needed for its co-transcriptional role. LIPIN (homologues PAH1 or SMP2 in yeast) controls membrane abundance, membrane composition and storage lipid production by catalyzing the conversion of PtdA into diacylglycerol (DAG). In patients with reduced or absent TORSIN1A activity, the CTDNEP1/CNEP1R1 complex is too active and LIPIN is hyperactivated. This has been established in genetically accurate disease models of dystonia (i.e. Torla+/figag mice) as well as of arthrogryposis multiplex congenita (i.e. Torla /_ and Torlafigag/figag mutant mice). The data described in this application establishes that genetic inhibitors of CTDNEP1, CNEP1R1 and/or LIPIN can partially compensate for the loss of TORSIN1A and significantly lower the TORSIN1A loss-of-function related disease level in genetically accurate disease models for dystonia and arthrogryposis multiplex congenita. This newly described congenital disorder has never been linked to elevated PAP activity or hyperactivation of CTDNEP1/CNEP1R1 or of LIPIN.
It is an object of the invention to provide an inhibitor of phosphatidic acid phosphatase activity for use in the treatment of TORSINl-mediated neurological diseases. In particular embodiments, said inhibitor decreases the Mg2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10% compared to a control situation where said inhibitor was not present.
Another aspect of the invention is to provide an inhibitor of phosphatidic acid phosphatase activity for use in the treatment of TORSINl-mediated neurological diseases, wherein said inhibitor is a gapmer, a shRNA, a siRNA, a CRISPR, a TALEN or a Zinc-finger nuclease and wherein said inhibitor inhibits the expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1.
Another aspect of the invention is to provide an inhibitor of phosphatidic acid phosphatase activity for use in the treatment of TORSINl-mediated neurological diseases, wherein said inhibitor is selected from the list consisting of propranolol, sphingosine, sphinganine, rutin, keampferol, N-ethylmaleimide and bromoenol lactone. In particular embodiments of the invention, said inhibitor of phosphatidic acid phosphatase activity for use in the treatment of TORSINl-mediated neurological diseases decreases the Mg2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10% compared to a control situation where said inhibitor was not present.
In another aspect, a pharmaceutical composition is provided for use in treatment of TORSINl-mediated neurological diseases, wherein said pharmaceutical composition comprises an inhibitor of phosphatidic acid phosphatase activity, wherein said inhibitor is a gapmer, a shRNA, a siRNA, a CRISPR, a TALEN or a Zinc-finger nuclease and inhibits the expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1 or wherein said inhibitor is selected from the list consisting of propranolol, sphingosine, sphinganine, rutin, keampferol, N-ethylmaleimide and bromoenol lactone. It is also an object of the invention to provide a screening method to produce a compound for use in the treatment of a TORSINl-mediated neurological disease, comprising:
- expressing an active human CTDNEP1/CNEP1R1 complex in yeast;
- administering a test compound to said yeast;
- identifying said test compound as a compound for use in the treatment of a TORSINl-mediated neurological disease if the growth of said yeast in the presence of said test compound is at least 10% higher than the growth of said yeast in the absence of said test compound.
According to yet another aspect of the invention, a method is disclosed to produce a pharmaceutical composition comprising a compound identified by the screening methods disclosed in this application. In particular embodiments of the above aspects, said TORSINl-mediated neurological disease is a disease selected from the list consisting of dystonia, primary dystonia, early-onset dystonia, DYT1 primary dystonia and arthrogryposis multiplex congenita.
Brief description of the Figures
Figure 1 illustrates the genetic inhibition of lipin, dullard, CG8009 and CG41106 in dTorsin KO flies. Figure 1A shows a PCR genotyping to confirm the dTorsin KO allele in 5-day-old dTorsin KO larvae expressing an RNAi construct against dullard, CG8009, CG41106, luciferase or lipin. dTorsinKO/+ and WT larvae were used as control. (I) Male larvae from the crosses with the Arm-GAL4 driver; (II) male larvae from crosses with r4-GAL4.
Figure IB shows quantitative RT QPCR data showing the efficient knock-down of dullard, CG41106 and lipin in dTorsin KO larvae. The graph shows mean with SD of n=3 replicates. Multiple t-test examined whether the relative expression of lipin, dullard and CG41106 significantly decreased by their respective RNAi (p-value < 0.004 in each case).
Figure 2 demonstrates that genetic inhibition of dullard-CG8009/CG41106 complex results in a better rescue of dTorsin KO effects compared to lipin inhibition. Bright-field images are shown of the fat body in WT and dTorsin KO larvae expressing an RNAi construct against (from left to right) luciferase (negative control), lipin (positive control), dullard, CG8009 or CG41106. The second row of pictures shows Arm::GAL4 driven expression of RNAi constructs. The third row shows r4::GAL4 driven expression of RNAi constructs. Scale bar indicates 1mm. Figure 3 shows the rescue of fat body cell size of dTorsin KO larvae.
Figure 3A shows confocal images of 5-day-old dTorsin KO larval fat body cells labeled with phalloidin and DAPI (scale bar indicates 20 pm). Cell size is significantly increased when lipin, dullard, CG8009 or CG41106 is genetically inhibited compared to the negative control (luciferase RNAi).
Figure 3B shows the quantification of the confocal images of Figure 3A using an optimized macro. The graphs show mean +/- 95% Cl of fat body cell size in dTorsin KO larvae expressing different RNAi constructs with Arm-GAL4 (left graph) or r4-GAL4 (right graph) drivers. ****, *** and ** indicate p- values of <0.0001, <0.0006 and <0.0025, respectively in a Dunn's multiple comparison test.
Figure 4 is a schematic representation of the model that dTorsin regulates lipid synthesis by inhibiting dLipin enzymatic activity d Lipin converts PtDA into DAG and its activity depends on its phosphorylation state. Dephosphorylation causes dLipin activation and nuclear re-localization. CTDNEP1/NEP1R1 is a known phosphatase complex that strongly regulates lipin in yeast and is herein put forward as the intermediate between dTorsin and dLipin.
Figure 5 shows elevated PAP activity in Torsinla mutant embryonic mouse brains. PAP activity or PtdA conversion to DAG is biochemically measured in 4 control (wild-type and Torla+/ ) and 4 Torla7 and 4 Torlafigag/figag knock-out embryonic (E18) mouse brains. A significantly elevated PAP activity is detected (One-Tailed T-Test), which is completely in line with the model developed in Drosophila.
Figure 6 shows that LIPIN activity is increased in the genetically accurate dystonia Torla mice model. In the brains of genetically accurate Torlafigag/+ DYT1 mice LIPIN activity is significantly elevated (p=0.021). Note that the PAP activity of Torlafigag/+ animals has a wider than normal variance, which might explain the partial penetrance of this genotype in driving dystonia in humans.
Figure 7 shows that Lipinl knock-out reduces LIPIN activity in wild-type and Torla mutants. Compared to wild-type mice (Torla+/+ Lipinl+/+), LIPIN activity is significantly reduced in Lipin ^ mutant mice and as well as in Torlafigag/figag mutant mice.
Figure 8 shows that Lipinl knock-out increases survival of Torla mutant mice. The life-span of Torla gag/ gag Lipinl _/ (n=25) mice is significantly increased compared to j0rla aaa/ gaa mice with a functional Lipinl (n=19) (p=0.0016). Figure 9 shows that nuclear membrane defects in Torla mutant mice brain neurons are decreased when Lipin expression is reduced.
Figure 9A and B show that iln the mildly affected CNS zone 1 of 7orlafigag/figag mice brains, Lipinl knock out significantly reduces the number of cells with affected nuclear membranes (p=0.0133).
Figure 9 C and D show that in the moderately affected CNS zone 2 the severity of affected neurons in 7orlafigag/figag mutant mice brains is reduced (0 (p=0.018); + (p=0.018); ++ (p=0.019); +++ (p=0.001)).
Figure 10 illustrates the expression of Lipinl, Lipin2 and Lipin3 in mice brain.
Figure 10A shows the relative expression of Lipinl, Lipin2 and Lipin3 in E18.5 embryonic mice brain. Figure 10B shows the normalized expression of Lipinl, Lipin2 and Lipin3 in E18.5 embryonic mice brain. Figure 10C shows the expression of Lipinl and Lipin2 at P0 (black), P7 (blue), P14 (green), P21 (red).
Figure 11 is a schematic representation of the experimental set-up of virus mediated silencing of Lipin. Figure 11A shows that for testing AAV9-mediated silencing of Lipinl and Lipin2 in mice brain, pups are intracerebral ventricular injected at birth. Lipin expression and activity is tested at P7, P14 and P21. Figure 11B shows the experimental set-up to analyze the effect of Lipin silencing on lifespan, motor defects and neuronal defects of Torla mutant mice. 7orlc ,¥/¾f = Torlaflox/&gag.
Figure 12 shows the assessment of infection efficiency by immunohistochemistry against GFP of mice brain 21 days after intracerebral ventricle injection of AAV9-GFP viral particles.
Figure 12A shows transversal brain sections of mice injected with AAV9-GFP at 4x1o11.
Figure 12B shows transversal brain section of mice injected with Vehicle.
Figure 12C shows the quantification of anti-GFP signal (normalized through DAPI signal) in 7 different tissues (midbrain, pons, thalamus, hippocampus, cortex (IV-II/III), cortex (Vl-V), cerebellum (purkinje cells)).
Figure 13 shows the expression of Lipinl and Lipin2 in mice brain upon intracerebral ventricular injection of AAV9-based silencing constructs. At postnatal day 14 and 21 the expression of both Lipinl and Lipin2 is strongly reduced upon injection of AAV9-shLpinl, AAV9-shLpin2 or AAV9-shLpinl/2 compared to the control (AAV9-shSCRAM). Pgkl and B2m are control genes.
Figure 14 shows that Lipin activity is strongly reduced at 21 days after injection of AAV9-shLpinl, AAV9- shLpin2 or AAV9-shLpinl/2 compared to the scrambled control. Figure 15 illustrates that Lipinl loss improves survival of recessive TorsinlA mice.
Figure 15 A shows that heterozygous and homozygous deletion of Lipinl strongly reduces Lipin PAP activity in P21 mouse brain. Bars show mean +/- SD of n=5 embryos/ group.
Figure 15 B and C show that Nestin-Cre mediated deletion of TorsinlA combined with DE produces a postnatally surviving model of TorsinlA disease (Peterfly et al 2001).
Figure 15 D shows that elevated brain Lipin (PAP) activity in "pre-symptomatic" cKO/DE E18.5 embryos is partially rescued by Lipinl deletion. Bars show mean +/- SD of n=4 embryos/ group. *, ** indicate significant difference (p < 0.05, 0.01) compared to cKO/ E:Lipinl+/+ (One-way ANOVA).
Figure 15 E shows experimental series to test whether Lipin hyperactivity contributes to cKO/DE neurological dysfunction.
Figure 15 F illustrates that Lipinl loss rescues cKO/DE lethality. Survival curves of control (flox/+), cKO/ E:Lipinl+/+ and cKO/ E:Lipinl+/- mice from P0-P60. Data from 0-30 days comes from two cohorts (n= shown in Figure 15 E), while 30+ days comes from a single cohort. **** indicates a significant difference between cKO/ E:Lipinl+/+ and cKO/ E:Lipinl+/- p<0.0001 (Log-rank Mantel-Cox test). Note that Nestin-Cre does not affect survival.
Figure 15 G shows that kyphosis is significantly reduced in P21 cKO/ E:Lipinl+/- mice compared with cKO/ E:Lipinl+/+,· p < 0.05 (two-tailed Chi-square). Values indicate the number of surviving mice assessed in this test.
Figure 16 shows that Lipinl loss reduces motor dysfunction in recessive TorsinlA syndrome mice and dominant TorsinlA dystonia mice.
Figure 16 A till F show the % of littermate animals with each abnormality. cKO/DE significantly differ to wild-type (flox/+) on all measures, while flox/DE (dystonia model; pale orange) appear like wild-type. * indicates a significant effect of Lipinl genotype on the % of affected cKO/DE mice; p < 0.05 (two-tailed Chi-square).
Figure 16 G shows P21 control mice with normally distributed limbs (upper) compared with cKO/DE (lower) displaying splayed hind limbs on ambulation.
Figure 16 H and I show the % of animals that display abnormal gait (mild or severe). There are significantly more flox/DE (dystonia) and cKO/+ (haploinsufficient) TorsinlA mice with gait defects than control (flox/+); p < 0.05; two-tailed Chi-square. * indicates a significant effect of Lipinl genotype on the gait defects; p < 0.05 (two-tailed Chi-square). Values indicate the number of surviving mice assessed in these tests. Detailed description
Definitions
The present invention will be described with respect to particular embodiments and with reference to certain drawings but the invention is not limited thereto but only by the claims. Any reference signs in the claims shall not be construed as limiting the scope. The drawings described are only schematic and are non-limiting. In the drawings, the size of some of the elements may be exaggerated and not drawn on scale for illustrative purposes. Where the term "comprising" is used in the present description and claims, it does not exclude other elements or steps. Where an indefinite or definite article is used when referring to a singular noun e.g. "a" or "an", "the", this includes a plural of that noun unless something else is specifically stated. Furthermore, the terms first, second, third and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein. The following terms or definitions are provided solely to aid in the understanding of the invention. Unless specifically defined herein, all terms used herein have the same meaning as they would to one skilled in the art of the present invention. Practitioners are particularly directed to Sambrook et al., Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Press, Plainsview, New York (2012); and Ausubel et al., current Protocols in Molecular Biology (Supplement 100), John Wiley & Sons, New York (2012), for definitions and terms of the art. The definitions provided herein should not be construed to have a scope less than understood by a person of ordinary skill in the art.
In the application, genes and proteins are named according to the international agreements. Human gene symbols generally are italicised, with all letters in uppercase (e.g. TOR1A). Protein designations are the same as the gene symbol, but are not italicised, with all letters in uppercase (e.g. LIPIN) (http://www.genenames.org/about/overview). In mice and rats, gene symbols generally are italicised, with only the first letter in uppercase and the remaining letters in lowercase (e.g. Torla). Protein designations are the same as the gene symbol, but are not italicised and all are upper case (e.g. LIPIN) (http://www.informatics.jax.org/mgihome/nomen/ gene.shtml). Fly gene names and symbols begin with an uppercase letter and are italicized (e.g. dTorsin). Symbols for proteins begin also with an upper case letter but are not italicized (e.g. dLipin) (flybase.org).
Since several years it is known that a heterozygous loss-of-function mutation in the TORSIN1A gene is causative to the DYT1 dystonia neurological disease. Recently it became clear that homozygous loss-of- function mutations in the TORSIN1A gene are causative to a severe congenital disorder characterized by severe arthrogryposis accompanied with developmental delay, strabismus and tremor (Kariminejad et al 2017 Brain 140: 2764-2767; Reichert et al 2017 Neurol Genet 3:el54). From hereon said congenital arthrogryposis will be referred to as arthrogryposis multiplex congenita. Both TorsinlA diseases are incurable and represent a life-time burden for patients and their carers. The distinct symptoms require different symptomatic treatments and point to distinct neurological defects. Nevertheless, they result from loss-of-function mutations in the same gene (TORSIN1A) in one or two copies. Both are also specifically neurological and emerge in development. This points to a situation where partial TORSIN1A impairment causes isolated dystonia, while more severe TORSIN1A loss broadly impacts the brain. If so, a therapeutic intervention that corrects for TORSINIA loss before it cascades into neuronal dysfunction would hypothetically treat TORSIN1A disease regardless of symptomology. In this application it is shown that genetic inhibition of dLipin, Dullard or CG41106 rescues the developmental defects of Torsin knock out flies. It is also disclosed that genetic inhibition of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1 as well as pharmacological inhibition of phosphatidic acid phosphatase activity reduces the disease symptoms in murine disease models which are genetically accurate for DYT1 dystonia or for arthrogryposis multiplex congenita.
Thus in a first aspect, the application provides an inhibitor of phosphatidic acid phosphatase activity for use in the treatment of neurological diseases, more particularly of TORSIN1A mediated neurological diseases, even more particularly for use in the treatment of dystonia, primary dystonia, early-onset dystonia, DYT1 primary dystonia or arthrogryposis multiplex congenita. In one embodiment, an inhibitor of Mg2+ dependent phosphatidic acid phosphatase activity is provided for use in the treatment of TORSIN1A mediated neurological diseases. In another embodiment, an inhibitor of LIPIN-mediated phosphatidic acid phosphatase activity is provided for use in the treatment of TORSIN1A mediated neurological diseases. In a more particular embodiment, an inhibitor of LIPINl-mediated phosphatidic acid phosphatase activity and/or LIPIN2-mediated phosphatidic acid phosphatase activity is provided for use in the treatment of TORSIN1A mediated neurological diseases.
In yet another embodiment, an inhibitor of phosphatidic acid phosphatase activity or of LIPIN-mediated, LIPINl-mediated or LIPIN2-mediated phosphatidic acid phosphatase activity or of Mg2+ dependent phosphatidic acid phosphatase activity is provided for use in the treatment of TORSIN1A mediated neurological diseases, wherein said inhibitor decreases the Mg2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% compared to a control situation where said inhibitor was not present. Preferably, said inhibitor decreases the Mg2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture between 10% and 60% or between 20% and 40% or between 30% and 50% compared to a control situation where said inhibitor was not present. "Phosphatidic acid phosphatase activity" as used herein refers to the enzyme activity of phosphatidic acid phosphatase (PAP; EC 3.1.3.4). Said PAP catalyzes the Mg2+ dependent dephosphorylation of phosphatidic acid or phosphatidate (PA), yielding diacylglycerol (DAG) and phosphate (Pi). Therefore, in yet another embodiment, an inhibitor of phosphatidic acid phosphatase activity or of LIPIN-mediated, LIPINl-mediated or LIPIN2-mediated phosphatidic acid phosphatase activity or of Mg2+ dependent phosphatidic acid phosphatase activity is provided for use in the treatment of TORSIN1A mediated neurological diseases, wherein said inhibitor decreases the Mg2+ dependent conversion of phosphatidic acid to diacylglycerol or decreases the Mg2+ dependent dephosphorylation of PA in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% compared to a control situation where said inhibitor was not present. Preferably, said inhibitor decreases the Mg2+ dependent conversion of phosphatidic acid to diacylglycerol or decreases the Mg2+ dependent dephosphorylation of PA in an in vitro cell culture between 10% and 60% or between 20% and 40% or between 30% and 50% compared to a control situation where said inhibitor was not present.
Assays to determine whether a compound would inhibit phosphatidic acid phosphatase activity are well- known in the art and are available for the skilled one without a burden for experimentation. Multiple references can be found in the art, e.g. Morita et al 2009 J Lipid Res 50:1945-1952, Ullah et al 2012 Adv Biol Chem 2:416-421, Hardman et al 2017 Yeast 34:83-91. Moreover, in current application measurements of PAP activity are performed (e.g. see Figures 5-7) and explained in detail in the Materials and Methods section.
The term "neurological diseases" as used in this application are disorders that affect the brain and/or the central and autonomic nervous systems. Those neurological disorders that are subject of this invention are those such as dystonia, arthrogryposis multiplex congenita, epilepsy, multiple sclerosis, Parkinson's disease, Huntington's disease and Alzheimer's disease.
"TORSIN1A mediated neurologic disease" or "TOR1A neurologic disease" as used herein refers to a neurological disorder which is caused by a suboptimal TORSIN1A activity. Suboptimal TORSIN1A activity can be caused by a deletion, insertion, substitution or point mutation in the TORSIN1A gene. Said point mutation can be a missense or a nonsense mutation leading to a non-functional or truncated TORSIN1A protein or a TORSIN1A protein with a reduced activity compared to a non-mutated TORSIN1A. Non limiting examples of mutations that result in suboptimal TORSIN1A activity are the in-frame GAG deletion (p.Glu303del), the missense variant p.Gly318Ser, the translational frame shift mutation 961delA (p.T321Rfs*6), an 18-bp deletion (Phe323_Tyr328del), the missense mutations c.613T>A (p.Phe205lso), c.863G>A (p.Arg288Gln), c.581A>T (p.Aspl94Val), p.A14_P15del, p.E121K and c.385G>A (p.Val 129lle) (Leung et al 2001 Neurogenetics 3:133-143; Calakos et al 2010 J Med Genet doi:10.1136/ jmg.2009.072082; Zirn et al 2008 J Neurol Neurosurg Psychiatry 79: 1327-1330; Cheng et al 2014 Mov Disord 29:1079-1083; Vulinovic et al 2014 Hum Mutat 35: 1114-1122; Dobricic et al 2015 Parkinsonism Relat Disord 21:1256-1259). It is generally established that heterozygous TORSIN1A mutations can lead to the development of dystonia, more particularly DYT1 dystonia. Intriguingly these heterozygous have a penetrance of 30%, meaning that only 1 in 3 patients with a heterozygous TORSIN1A mutation will develop the disease. Recently, several infants with a severe congenital form of arthrogryposis have been diagnosed with a homozygous or bi-allelic mutation in the TORSIN1A gene. Hence, in a most particular embodiment, TORSIN1A mediated neurological diseases are dystonia, primary dystonia, early-onset dystonia, DYT1 primary dystonia, DYT1 dystonia or arthrogryposis multiplex congenita.
In a particular embodiment, said inhibitor for use in the treatment of TORSIN1A mediated neurological diseases is a gapmer, a shRNA, a siRNA, a CRISPR-Cas, a CRISPR-C2c2, a TALEN, a Zinc-finger nuclease, an antisense oligomer, a miRNA, a morpholino, a locked nucleic acid, a peptide nucleic acid, ribozyme or a meganuclease and said inhibitor inhibits the expression or functional expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1.
This is equivalent as saying that methods of treating TORSIN1A mediated neurological diseases in a subject in need thereof are provided, comprising administering an inhibitor of phosphatidic acid phosphatase activity or of LIPIN-mediated phosphatidic acid phosphatase activity or of LIPINl-mediated phosphatidic acid phosphatase activity or of LIPIN2-mediated phosphatidic acid phosphatase activity or of Mg2+ dependent phosphatidic acid phosphatase activity to said subject, wherein said inhibitor inhibits the expression or functional expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1. In particular embodiments, said neurological disease is selected from dystonia, primary dystonia, early-onset dystonia, DYT1 primary dystonia, DYT1 dystonia or arthrogryposis multiplex congenita. Throughout current application, the nature of the inhibitor of functional expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1 is not vital to the invention, as long as it inhibits the phosphatidic acid phosphatase activity or LIPIN-mediated phosphatidic acid phosphatase activity or LIPINl-mediated phosphatidic acid phosphatase activity or LIPIN2-mediated phosphatidic acid phosphatase activity or Mg2+ dependent phosphatidic acid phosphatase activity. According to specific embodiments, said inhibitor is selected from the inhibitory RNA technology (such as a gapmer, a shRNA, a siRNA, an antisense oligomer, a miRNA, a morpholino, a locked nucleic acid, peptide nucleic acid), a CRISPR-Cas, a CRISPR-Cpf, a CRISPR- C2c2, a TALEN, a meganuclease or a Zinc-finger nuclease. With "functional expression" of LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1, in the present invention it is meant the transcription and/or translation of functional gene product. Hence, an "inhibitor of functional expression" is a synonym for an inhibitor of transcription and/or translation of a particular gene. In particular embodiments, an "inhibitor of functional expression" is an "inhibitor of expression and/or activity". For protein coding genes like LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 "functional expression" can be deregulated on at least three levels. First, at the DNA level, e.g. by removing or disrupting the LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 gene, or by preventing transcription to take place (in both instances preventing synthesis of the relevant gene product, i.e. LI PIN 1, LIPIN2, CTDNEP1 or CNEP1R1). The lack of transcription can e.g. be caused by epigenetic changes (e.g. DNA methylation) or by loss-of-function mutations. A "loss-of-function" or "LOF" mutation as used herein is a mutation that prevents, reduces or abolishes the function of a gene product as opposed to a gain-of-function mutation that confers enhanced or new activity on a protein. LOF can be caused by a wide range of mutation types, including, but not limited to, a deletion of the entire gene or part of the gene, splice site mutations, frame-shift mutations caused by small insertions and deletions, nonsense mutations, missense mutations replacing an essential amino acid and mutations preventing correct cellular localization of the product. Also included within this definition are mutations in promoters or regulatory regions of the LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 gene if these interfere with gene function. A null mutation is an LOF mutation that completely abolishes the function of the gene product. A null mutation in one allele will typically reduce expression levels by 50%, but may have severe effects on the function of the gene product. Note that functional expression can also be deregulated because of a gain-of-function mutation: by conferring a new activity on the protein, the normal function of the protein is deregulated, and less functionally active protein is expressed. Vice versa, functional expression can be increased e.g. through gene duplication or by lack of DNA methylation.
Second, at the RNA level, e.g. by lack of efficient translation taking place for example because of destabilization of the mRNA (e.g. by UTR variants) so that it is degraded before translation occurs from the transcript. Or by lack of efficient transcription, e.g. because a mutation introduces a new splicing variant.
Third, the functional expression of LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 can also be inhibited at the protein level by inhibiting the function of the LI PI N 1, LIPIN2, CTDNEP1 or CNEP1R1 protein. Non-limiting examples are intrabodies, alpha-bodies, antibodies, VHHs or (heavy chain only) single domain antibodies, phosphatases, kinases.
In the present invention it is essential that the phosphatidic acid phosphatase activity or LIPIN-mediated phosphatidic acid phosphatase activity or LIPINl-mediated phosphatidic acid phosphatase activity or LIPIN2-mediated phosphatidic acid phosphatase activity or Mg2+ dependent phosphatidic acid phosphatase activity in neuronal brain cells is reduced to have a positive effect on the treatment of TORSINlA-mediated neurological diseases, more particularly arthrogryposis multiplex congenita or dystonia, more particularly primary dystonia, even more particularly early onset dystonia, most particularly DYT1 primary dystonia. Said reduction in phosphatidic acid phosphatase activity which is preferably at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or even 100%, more preferably between 10% and 60% or between 20% and 40% or between 30% and 50% compared to a control situation where said inhibitor was not present, can be achieved by inhibition of the functional expression of LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1. Said inhibition is preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or even 100%. 100% means that no detectable functional expression of LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 is detected. Accordingly, it is an object of the invention to provide inhibitors of expression or of activity or of functional expression of the LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 gene. In this application this has been fully reduced to practice by using the inhibitory RNA technology (see Examples 1-4).
Gene inactivation, i.e. inhibition of functional expression of the target gene, can be achieved through the creation of transgenic organisms expressing antisense RNA, or by administering antisense RNA to the subject (see Example 2-5 of the application). The nature of the inhibitor and whether the effect is achieved by incorporating antisense RNA into the subject's genome or by administering antisense RNA is not vital to the invention, as long as said inhibitor inhibits the functional expression of the LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 gene. An antisense construct can be delivered, for example, as an expression plasmid, which, when transcribed in the cell, produces RNA that is complementary to at least a unique portion of the cellular LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 RNA.
An inhibitor of functional expression of LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 can also be an antisense molecule or anti-gene agent that comprises an oligomer of at least about 10 nucleotides in length for which no transcription is needed in the treated subject. In embodiments such an inhibitor comprises at least 15, 18, 20, 25, 30, 35, 40, or 50 nucleotides. Antisense approaches involve the design of oligonucleotides (either DNA or RNA, or derivatives thereof) that are complementary to an RNA encoded by polynucleotide sequences of the LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 gene. Antisense RNA may be introduced into a cell to inhibit translation of a complementary mRNA by base pairing to it and physically obstructing the translation machinery. This effect is therefore stoichiometric. Absolute complementarity, although preferred, is not required. A sequence "complementary" to a portion of an RNA, as referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double stranded antisense polynucleotide sequences, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length of the antisense polynucleotide sequence. Generally, the longer the hybridizing polynucleotide sequence, the more base mismatches with an RNA it may contain and still form a stable duplex (or triplex, as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex. Antisense oligomers should be at least 10 nucleotides in length, and are preferably oligomers ranging from 15 to about 50 nucleotides in length. In certain embodiments, the oligomer is at least 15 nucleotides, at least 18 nucleotides, at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, or at least 50 nucleotides in length.
A related method uses ribozymes instead of antisense RNA. Ribozymes are catalytic RNA molecules with enzyme-like cleavage properties that can be designed to target specific RNA sequences. Successful target gene inactivation, including temporally and tissue-specific gene inactivation, using ribozymes has been reported in mouse, zebrafish and fruitflies. RNA interference (RNAi) is another form of post- transcriptional gene silencing and used in this application as one of the many methods to inhibit or reduce the functional expression of LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1. Numerous reports have described RNA interference in all kinds of organisms, including experiments demonstrating spatial and/or temporal control of gene inactivation, including plants, protozoa, invertebrates, vertebrates and mammals. RNAi mediated degradation of the target mRNA can be detected by measuring levels of the target mRNA or protein in the cells of a subject, using standard techniques for isolating and quantifying mRNA or protein as described in this application. The mediators of sequence-specific messenger RNA degradation are small interfering RNAs (siRNAs) generated by ribonuclease III cleavage from longer dsRNAs. Generally, the length of siRNAs is between 20-25 nucleotides (Elbashir et al 2001 Nature 411: 494-498). The siRNA typically comprise a sense RNA strand and a complementary antisense RNA strand annealed together by standard Watson-Crick base pairing interactions (hereinafter "base paired"). The sense strand comprises a nucleic acid sequence that is identical to a target sequence (i.e. the LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 sequence in this application) contained within the target mRNA. The sense and antisense strands of the present siRNA can comprise two complementary, single stranded RNA molecules or can comprise a single molecule in which two complementary portions are base paired and are covalently linked by a single stranded "hairpin" area (often referred to as shRNA). The siRNAs that can be used to inhibit or reduce the functional expression of LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 can comprise partially purified RNA, substantially pure RNA, synthetic RNA, or recombinantly produced RNA, as well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of the siRNA or to one or more internal nucleotides of the si NA, including modifications that make the siRNA resistant to nuclease digestion. The siRNAs can be targeted to any stretch of approximately 19 to 25 contiguous nucleotides in LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 sequence (the "target sequence"). Techniques for selecting target sequences for siRNA are well known in the art. Thus, the sense strand of the present siRNA comprises a nucleotide sequence identical to any contiguous stretch of about 19 to about 25 nucleotides in the target mRNA. siRNAs can be obtained using a number of techniques known to those of skill in the art. For example, the siRNAs can be chemically synthesized or recombinantly produced using methods known in the art. Preferably, the siRNA of the invention are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer. The siRNA can be synthesized as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions. Commercial suppliers of synthetic RNA molecules or synthesis reagents include Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo., USA), Pierce Chemical (part of Perbio Science, Rockford, III., USA), Glen Research (Sterling, Va., USA), ChemGenes (Ashland, Mass., USA) and Cruachem (Glasgow, UK). Alternatively, siRNA can also be expressed from recombinant circular or linear DNA plasmids using any suitable promoter. Suitable promoters for expressing siRNA targeted against LIPIN1, LIPIN2, CTDNEP1 OR CNEP1R1 activity from a plasmid include, for example, the U6 or HI RNA pol III promoter sequences and the cytomegalovirus promoter. Selection of other suitable promoters is within the skill in the art. The recombinant plasmids of the invention can also comprise inducible or regulatable promoters for expression of the siRNA in a particular tissue or in a particular intracellular environment. The siRNA expressed from recombinant plasmids can either be isolated from cultured cell expression systems by standard techniques, or can be expressed intracellularly, e.g. in brain tissue or in neurons. siRNAs can also be expressed intracellularly from recombinant viral vectors. The recombinant viral vectors comprise sequences encoding the siRNAs of the invention and any suitable promoter for expressing the siRNA sequences. The siRNA will be administered in an "effective amount" which is an amount sufficient to cause RNAi mediated degradation of the target mRNA, or an amount sufficient to inhibit the phosphatidic acid phosphatase activity. One skilled in the art can readily determine an effective amount of the siRNA of the invention to be administered to a given subject, by taking into account factors such as involuntary muscle contraction; the extent of the disease penetration; the age, health and sex of the subject; the route of administration; and whether the administration is regional or systemic. Generally, an effective amount of siRNAs targeting LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 expression comprises an intracellular concentration of from about 1 nanomolar (nM) to about 100 nM, preferably from about 2 nM to about 50 nM, more preferably from about 2.5 nM to about 10 nM. It is contemplated that greater or lesser amounts of siRNA can be administered. Another method for the inhibition of gene expression is based on the use of shorter antisense oligomers consisting of DNA, or other synthetic structural types such as phosphorothiates, 2'-0-alkylribonucleotide chimeras, locked nucleic acid (LNA), peptide nucleic acid (PNA), or morpholinos. With the exception of RNA oligomers, PNAs and morpholinos, all other antisense oligomers act in eukaryotic cells through the mechanism of RNase H-mediated target cleavage. PNAs and morpholinos bind complementary DNA and RNA targets with high affinity and specificity, and thus act through a simple steric blockade of the RNA translational machinery, and appear to be completely resistant to nuclease attack.
Recently it has been shown that morpholino antisense oligonucleotides in zebrafish and frogs overcome the limitations of RNase H-competent antisense oligonucleotides, which include numerous non-specific effects due to the non-target-specific cleavage of other mRNA molecules caused by the low stringency requirements of RNase H. Morpholino oligomers therefore represent an important new class of antisense molecule. Oligomers of the invention may be synthesized by standard methods known in the art. As examples, phosphorothioate oligomers may be synthesized by the method of Stein et al. (1988) Nucleic Acids Res. 16, 3209 3021), methylphosphonate oligomers can be prepared by use of controlled pore glass polymer supports (Sarin et al. (1988) Proc. Natl. Acad. Sci. USA. 85, 7448-7451). Morpholino oligomers may be synthesized by the method of Summerton and Weller U.S. Patent Nos. 5,217,866 and 5,185,444.
Another particularly form of antisense RNA strategy are gapmers. A gapmer is a chimeric antisense oligonucleotide that contains a central block of deoxynucleotide monomers sufficiently long to induce RNase H cleavage. The central block of a gapmer is flanked by blocks of 2'-0 modified ribonucleotides or other artificially modified ribonucleotide monomers such as bridged nucleic acids (BNAs) that protect the internal block from nuclease degradation. Gapmers have been used to obtain RNase-H mediated cleavage of target RNAs, while reducing the number of phosphorothioate linkages. Phosphorothioates possess increased resistance to nucleases compared to unmodified DNA. However, they have several disadvantages. These include low binding capacity to complementary nucleic acids and non-specific binding to proteins that cause toxic side-effects limiting their applications. The occurrence of toxic side- effects together with non-specific binding causing off-target effects has stimulated the design of new artificial nucleic acids for the development of modified oligonucleotides that provide efficient and specific antisense activity in vivo without exhibiting toxic side-effects. By recruiting RNase H, gapmers selectively cleave the targeted oligonucleotide strand. The cleavage of this strand initiates an antisense effect. This approach has proven to be a powerful method in the inhibition of gene functions and is emerging as a popular approach for antisense therapeutics. Gapmers are offered commercially, e.g. LNA longRNA GapmeRs by Exiqon, or MOE gapmers by Isis pharmaceuticals. MOE gapmers or "2'MOE gapmers" are an antisense phosphorothioate oligonucleotide of 15-30 nucleotides wherein all of the backbone linkages are modified by adding a sulfur at the non-bridging oxygen (phosphorothioate) and a stretch of at least 10 consecutive nucleotides remain unmodified (deoxy sugars) and the remaining nucleotides contain an O'-methyl O'-ethyl substitution at the 2' position (MOE).
Next to the use of the inhibitory RNA technology to reduce or inhibit functional expression of the LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 gene on the level of gene product, inhibitors of functional expression of the LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 gene can also act at the DNA level. If inhibition is to be achieved at the DNA level, this may be done using gene therapy to knock-out or disrupt the target gene. As used herein, a "knock-out" can be a gene knockdown or the gene can be knocked out by a mutation such as, a point mutation, an insertion, a deletion, a frameshift, or a missense mutation by techniques known in the art, including, but not limited to, retroviral gene transfer. Another way in which genes can be knocked out is by the use of zinc finger nucleases. Zinc-finger nucleases (ZFNs) are artificial restriction enzymes generated by fusing a zinc finger DNA-binding domain to a DNA-cleavage domain. Zinc finger domains can be engineered to target desired DNA sequences, which enable zinc-finger nucleases to target unique sequence within a complex genome. By taking advantage of endogenous DNA repair machinery, these reagents can be used to precisely alter the genomes of higher organisms. Other technologies for genome customization that can be used to knock out genes are meganucleases and TAL effector nucleases (TALENs, Cellectis bioresearch). A TALEN is composed of a TALE DNA binding domain for sequence- specific recognition fused to the catalytic domain of an endonuclease that introduces double strand breaks (DSB). The DNA binding domain of a TALEN is capable of targeting with high precision a large recognition site (for instance 17bp). Meganucleases are sequence-specific endonucleases, naturally occurring "DNA scissors", originating from a variety of single-celled organisms such as bacteria, yeast, algae and some plant organelles. Meganucleases have long recognition sites of between 12 and 30 base pairs. The recognition site of natural meganucleases can be modified in order to target native genomic DNA sequences (such as endogenous genes). Another recent genome editing technology is the CRISPR- Cas system, which can be used to achieve RNA-guided genome engineering. CRISPR interference is a genetic technique which allows for sequence-specific control of gene expression in prokaryotic and eukaryotic cells. It is based on the bacterial immune system-derived CRISPR (clustered regularly interspaced palindromic repeats) pathway that confers resistance to foreign genetic elements such as those present within plasmids and phages providing a form of acquired immunity. A simple version of the CRISPR/Cas system, CRISPR/Cas9, has been modified to edit genomes. By delivering the Cas9 nuclease complexed with a synthetic guide RNA (gRNA) into a cell, the cell's genome can be cut at a desired location, allowing existing genes to be removed and/or new ones added (Marraffini and Sontheimer 2010 Nat Rev Genet 11:181-190). In meantime, alternatives for the Cas9 nuclease have been identified, e.g. Cpfl or Casl2 (Zetsche et al 2015 Cell 3:759-771). Recently, it was demonstrated that the CRISPR-Cas editing system can also be used to target RNA. It has been shown that the Class 2 type Vl-A CRISPR-Cas effector C2c2 (also known as Casl3) can be programmed to cleave single stranded RNA targets carrying complementary protospacers (Abudayyet et al 2016 Science aaf5573; Abudayyet et al 2017 Nature 5:280-284). C2c2 is a single-effector endoRNase mediating ssRNA cleavage once it has been guided by a single crRNA guide toward the target RNA. This system can thus also be used to target and thus to break down LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1.
In another particular embodiment, said inhibitor for use in treatment of TORSINlA-mediated neurological diseases is selected from the list consisting of propranolol, propranolol hydrochloride, sphingosine, sphinganine, rutin, keampferol, N-ethylmaleimide and bromoenol lactone. This application also envisages an inhibitor of phosphatidic acid phosphatase activity for use in treatment of TORSIN1A mediated neurological diseases, wherein said inhibitor is a variant of propranolol, propranolol hydrochloride, sphingosine, sphinganine, rutin, keampferol, N-ethylmaleimide or bromoenol lactone, wherein said inhibitor is still capable of decreasing the Mg2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said inhibitor was not present.
Propranolol (C H NO ; CAS 525-66-6; PubChem CID 4946) is a well-known drug of the beta blocker type that is commercially available. As a beta-adrenergic receptor antagonist it is used to treat high blood pressure and a number of irregular heart rate types. Here it is disclosed that propranolol, propranolol hydrochloride and variants thereof surprisingly can also be used to treat TORSINlA-mediated neurological diseases such as DYT1 dystonia and arthrogryposis multiplex congenita. Propranolol is also known to cross the blood-brain barrier and is defined by the chemical formula:
In a most particular embodiment, propranolol or variant thereof is provided for use to treat a neurological disease, more particularly a TORSINlA-mediated neurological disease, wherein said propranolol variant decrease the Mg2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said propranolol variant was not present.
N-Ethylmaleimide (NEM) (C H NO ; CAS 128-53-0; PubChem CID 4362) is an organic compound that is derived from maleic acid. It contains the imide functional group, but more importantly it is an alkene that is reactive toward thiols and is commonly used to modify cysteine residues in proteins and peptides. It is also known as l-ethylpyrrole-2,5-dione or ethylmaleimide and has the following structural formula:
In a most particular embodiment, N-ethylmaleimide or variant thereof is provided for use to treat a neurological disease, more particularly a TORSINlA-mediated neurological disease, wherein said N- ethylmaleimide variant decrease the Mg2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said N-ethylmaleimide variant was not present.
Bromoenol lactone (BEL) (C16H13Br02; CAS 478288-90-3) is an inhibitor of calcium-independent phospholipase y (iPLA2y) (Tsuchida et al 2015 Mediators Inflamm 605727). The calcium-independent phospholipases (iPLA2) are a PLA2 subfamily closely associated with the release of arachidonic acid in response to physiologic stimuli. However, BEL also inhibits LIPIN 1 and is therefore disclosed herein for use to treat TORSINlA-mediated neurological diseases. BEL has the following structural formula:
In a most particular embodiment, bromoenol lactone or variant thereof is provided for use to treat a neurological disease, more particularly a TORSIN1A mediated neurological disease, wherein said bromoenol lactone variant decrease the Mg2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said bromoenol lactone variant was not present.
Kaempferol (C15H10O6; CAS 520-18-3; PubChem CID 5280863) also known as 3,5,7-Trihydroxy-2-(4- hydroxyphenyl)-4H-chromen-4-one, kaempherol, robigenin, pelargidenolon, rhamnolutein, rhamnolutin, populnetin, trifolitin, kempferol or swartziol is a natural flavonol, a type of flavonoid, found in a variety of plants and plant-derived foods. Kaempferol acts as an antioxidant by reducing oxidative stress. Many studies suggest that consuming kaempferol may reduce the risk of various cancers, and it is currently under consideration as a possible cancer treatment. It is herein disclosed that kaempferol can be used in the treatment of TORSINlA-mediated neurological diseases. Kaempferol has the following structural formula:
In a most particular embodiment, kaempferol or variant thereof is provided for use to treat a neurological disease, more particularly a TORSINlA-mediated neurological disease, wherein said kaempferol variant decrease the Mg2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said kaempferol variant was not present.
Rutin (C27H30O16; CAS 153-18-4; PubChem CIB 5280805) also known as rutoside, phytomelin, sophorin, birutan, eldrin, birutan forte, rutin trihydrate, globularicitrin, violaquercitrin, quercetin-3-O-rutinoside, quercetin rutinoside or 2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[a-L-rhamnopyranosyl-(l->6)- -D- glucopyranosyloxy]-4H-chromen-4-one, is the glycoside combining the flavonol quercetin and the disaccharide rutinose (a-L-rhamnopyranosyl-(l->6)- -D-glucopyranose). Rutin is a citrus flavonoid found in a wide variety of plants including citrus fruit with the following structural formula:
In a most particular embodiment, rutin or variant thereof is provided for use to treat a neurological disease, more particularly a TORSINlA-mediated neurological disease, wherein said rutin variant decrease the Mg2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said rutin variant was not present.
Sphinganine (C18H39NO2; CAS 764-22-7; PubChem CID 4094) also known as dihydrosphingosine or 2- amino-l,3-dihydroxyoctadecane is a blocker postlysosomal cholesterol transport by inhibition of low- density lipoprotein-induced esterification of cholesterol. Sphinganine causes unesterified cholesterol to accumulate in perinuclear vesicles. It has been suggested the possibility that endogenous sphinganine may inhibit cholesterol transport in Niemann-Pick Type C (NPC) disease (Roff et al 1991 Dev Neurosci 13:315-319). Here, it is disclosed that sphinganine can be used to treat TORSINlA-mediated neurological diseases.
In a most particular embodiment, sphinganine or variant thereof is provided for use to treat a neurological disease, more particularly a TORSINlA-mediated neurological disease, wherein said sphinganine variant decrease the Mg2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said sphinganine variant was not present.
Sphingosine (C H NO ; CAS 123-78-4; PubChem CID 5280335) also known as 2-amino-4-octadecene- 1,3-diol is an 18-carbon amino alcohol with an unsaturated hydrocarbon chain, which forms a primary part of sphingolipids, a class of cell membrane lipids that include sphingomyelin, an important phospholipid.
In a most particular embodiment, sphingosine or variant thereof is provided for use to treat a neurological disease, more particularly a TORSINlA-mediated neurological disease, wherein said sphingosine variant decrease the Mg2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75% compared to a control situation where said sphingosine variant was not present.
In a particular embodiment of the first aspect and of all its embodiments, said TORSINlA-mediated neurological disease is selected from the list consisting of dystonia, primary dystonia, early-onset dystonia, DYT1 primary dystonia and arthrogryposis multiplex congenita.
In a second aspect, a pharmaceutical composition for use in treatment of TORSINlA-mediated neurological diseases is provided, wherein said pharmaceutical composition comprises an inhibitor of phosphatidic acid phosphatase activity. In one embodiment, said phosphatidic acid phosphatase activity is Mg2+ dependent phosphatidic acid phosphatase activity or LIPIN-mediated, LIPINl-mediated or LIPIN2- mediated phosphatidic acid phosphatase activity. In another embodiment, said inhibitor further inhibits the functional expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1 and is selected from the list consisting of a gapmer, a shRNA, a siRNA, a CRISPR-Cas, a CRISPR-C2c2, a TALEN, a Zinc-finger nuclease, an antisense oligomer, a miRNA, a morpholino, a locked nucleic acid, a peptide nucleic acid, ribozyme and a meganuclease.
In another embodiment, a pharmaceutical composition for use in treatment of TORSINlA-mediated neurological diseases is provided, wherein said pharmaceutical composition comprises a pharmaceutically effective amount of propranolol, propranolol hydrochloride, sphingosine, sphinganine, rutin, kaempferol, N-ethylmaleimide or bromoenol lactone. Also, a pharmaceutical composition for use in treatment of TORSINlA-mediated neurological diseases is provided, wherein said pharmaceutical composition comprises an inhibitor of phosphatidic acid phosphatase activity, wherein said inhibitor is selected from the list consisting of propranolol, propranolol hydrochloride, sphingosine, sphinganine, rutin, kaempferol, N-ethylmaleimide and bromoenol lactone.
In a particular embodiment, said TORSINlA-mediated neurological disease is selected from the list consisting of dystonia, primary dystonia, early-onset dystonia, DYT1 primary dystonia and arthrogryposis multiplex congenita.
This invention thus also relates to pharmaceutical compositions comprising functional inhibitors of phosphatidic acid phosphatase activity or Mg2+ dependent phosphatidic acid phosphatase activity or LIPIN-mediated, LIPINl-mediated or LIPIN2-mediated phosphatidic acid phosphatase activity or comprising functional inhibitors of LIPIN1, LIPIN2, CTDNEP1 or CNEP1R1 described herein before. These compositions can be utilized to achieve the desired pharmacological effect by administration to a patient suffering from neurological disease, particularly a TORSINlA-mediated neurological disease such as arthrogryposis multiplex congenita or dystonia, more particularly primary dystonia, even more particularly early-onset dystonia, most particularly DYT1 dystonia, in need thereof. A patient, for the purpose of this invention, is a mammal, including a human, in need of treatment for a neurological disease, particularly a TORSINlA-mediated neurological disease such as arthrogryposis multiplex congenita or dystonia, more particularly primary dystonia, even more particularly early-onset dystonia, most particularly DYT1 dystonia. Therefore, the present invention includes pharmaceutical compositions that comprise a pharmaceutically acceptable carrier and a pharmaceutically effective amount of a functional inhibitor of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1 expression and/or activity, or salt of said inhibitor, of the present invention. Also, the present invention discloses pharmaceutical compositions that comprise a pharmaceutically acceptable carrier and a pharmaceutically effective amount of an inhibitor of phosphatidic acid phosphatase activity or Mg2+ dependent phosphatidic acid phosphatase activity or LIPIN-mediated phosphatidic acid phosphatase activity or LIPINl-mediated phosphatidic acid phosphatase activity or LIPIN2-mediated phosphatidic acid phosphatase activity, or salt of said inhibitor, of the present invention. More particularly, said inhibitor of phosphatidic acid phosphatase activity is selected from the list consisting of propranolol, propranolol hydrochloride, sphingosine, sphinganine, rutin, kaempferol, N-ethylmaleimide and bromoenol lactone. Hence, a pharmaceutical composition is provided comprising a pharmaceutically acceptable carrier and a pharmaceutically effective amount of propranolol, propranolol hydrochloride, sphingosine, sphinganine, rutin, kaempferol, N-ethylmaleimide or bromoenol lactone.
A pharmaceutically acceptable carrier is preferably a carrier that is relatively non-toxic and innocuous to a patient at concentrations consistent with effective activity of the active ingredient so that any side effects ascribable to the carrier do not vitiate the beneficial effects of the active ingredient. A pharmaceutically effective amount of a functional inhibitor of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1 is preferably that amount which reduces the phosphatidic acid phosphatase activity or Mg2+ dependent phosphatidic acid phosphatase activity or LIPIN-mediated, LIPINl-mediated or LIPIN2-mediated phosphatidic acid phosphatase activity in the brain of a patient suffering from a neurological disease (particularly a TORSINlA-mediated neurological disease) thereby influencing the particular condition being treated. The compounds of the present application can be administered with pharmaceutically acceptable carriers well known in the art using any effective conventional dosage unit forms, including immediate, slow and timed release preparations.
The pharmaceutical compositions of this application may be in the form of oil-in-water emulsions. The emulsions may also contain sweetening and flavoring agents. Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil such as, for example, arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. The pharmaceutical compositions may be in the form of sterile injectable aqueous suspensions. Such suspensions may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents, all well-known by the person skilled in the art. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent. Diluents and solvents that may be employed are, for example, water, Ringer's solution, isotonic sodium chloride solutions and isotonic glucose solutions. In addition, sterile fixed oils are conventionally employed as solvents or suspending media. For this purpose, any bland, fixed oil may be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can be used in the preparation of injectables. The compositions of the application can also contain other conventional pharmaceutically acceptable compounding ingredients, generally referred to as carriers or diluents, as necessary or desired. The nature of additional ingredients and the need of adding those to the composition of the invention is within the knowledge of a skilled person in the relevant art. Conventional procedures for preparing such compositions in appropriate dosage forms can be utilized. Such ingredients and procedures include those described in the following references, each of which is incorporated herein by reference: Powell, M. F. et al., "Compendium of Excipients for Parenteral Formulations" PDA Journal of Pharmaceutical Science & Technology 1998, 52(5), 238-311 ; Strickley, R.G "Parenteral Formulations of Small Molecule Therapeutics Marketed in the United States (1999)-Part-1" PDA Journal of Pharmaceutical Science & Technology 1999, 53(6), 324-349 ; and Nema, S. et al. , "Excipients and Their Use in Injectable Products" PDA Journal of Pharmaceutical Science & Technology 1997, 51 (4), 166-171.
In yet another embodiment, even though the inhibition of phosphatidic acid phosphatase activity or Mg2+ dependent phosphatidic acid phosphatase activity or LIPIN-mediated, LIPINl-mediated or LIPIN2- mediated phosphatidic acid phosphatase activity or the functional inhibition of LIPIN1, LIPIN2, CTDNEP1 and/or NCPE1R1 is sufficient to achieve a therapeutic effect, it is likely that stronger, synergistic effects can be obtained in combination with conventional treatment options for TORSIN1A mediated neurological diseases such as for example injection with Botulinum toxin or deep brain stimulation. The synergistic effect can be obtained through simultaneous, concurrent, separate or sequential use for treating TORSINlA-mediated neurological diseases.
The inhibitor of functional expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1 may be provided as protein (e.g. nuclease) or as an RNA molecule or may be administered as a nucleic acid molecule encoding said protein or said RNA molecule or as a vector comprising such nucleic acid molecule. If the inhibitor of the invention is administered as protein or RNA molecule, it is particularly envisaged that it is administered intracerebroventricularly, such as e.g. through injection or pump. This is well known by the skilled one, e.g. US 20040162255 incorporated as reference. Alternatively, said inhibitor can be coupled to a (single domain) antibody that targets a blood brain barrier (BBB) receptor. This complex can be injected intravenous after which the BBB receptor targeting antibody (or single variable domain antibody) will shuttle the complex across the BBB.
In case the inhibitor of the application is provided as a nucleic acid or a vector, it is particularly envisaged that the inhibitor is administered through gene therapy. A non-limiting example is (adeno-associated) virus mediated gene silencing. Virus mediated gene therapy is well known in the art (e.g. US 20040023390; Mendell et al 2017 N Eng J Med 377:1713-1722 all incorporated herein as reference). Virus mediated gene therapy can be applied intracerebroventricularly but also intravenously (e.g. Mendell et al 2017 N Eng J Med 377:1713-1722).
In particular embodiments of the application,“LIPIN" as mentioned before and hereafter is human LIPIN and can be LIPIN1, LIPIN2 or LIPIN3. In more particular embodiments, LIPIN is LIPIN1 and/or LIPIN2. In other particular embodiments, LIPIN1 encodes a protein with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% homology to one of the isoforms depicted in SEQ ID No: 1-9. In even more particular embodiments, LIPIN1 encodes one of the isoforms depicted in SEQ ID No: 1-9.
The cDNA reference in NCBI for LI PIN 1 in Mus musculus is AF180471.1; the mRNA references for the transcript variants are NM_172950.3, NM_015763.4, NM_001130412.1 and NM_001355598.1; the protein references for the isoforms are NP_001123884.1 and NP_056578.2.
In other particular embodiments, LIPIN2 encodes a protein with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% homology to SEQ ID No: 17. In even more particular embodiments, LIPIN2 encodes the sequence depicted in SEQ ID No: 17.
The cDNA reference in NCBI for LIPIN2 in Mus musculus is AF286723.1; the mRNA references for the transcript variants are NM_001164885.1, NM_022882.4 and NM_001357791.1; the protein references for the isoforms are NP_001158357.1 and NP_001344720.1.
The“TORS!NIA" gene as used herein is specified by SEQ ID N° 10 and encodes the TORSIN1A protein of SEQ ID N° 11. The cDNA and protein reference sequences in NCBI from homologues of TORSIN1A in Mus musculus and in Drosophila melanogaster are NM_144884 and NP_659133 (M. musculus) and NM_131950 and NP_572178 (D. melanogaster).
"CTDNEP1" or C-Terminal Domain Nuclear Envelope Phosphatase 1 is a protein in humans that is encoded by the CTDNEP1 gene (HGNC: 19085; Entrez Gene: 23399; Ensembl: ENSG00000175826; OMIM: 610684; UniProtKB: 095476; Chromosome 17, NC_000017.11 (7243587..7251940, complement)). Alternative names are Serine/Threonine-Protein Phosphatase Dullard or DULLARD. In particular embodiments, CTDNEP1 encodes a protein sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% homology SEQ ID No 14. The protein reference sequence in NCBI from homologues of CTDNEP1 in Mus musculus is NP_080293.1.
"CNEP1R1" or CTD Nuclear Envelope Phosphatase 1 Regulatory Subunit 1 is a protein in humans that is encoded by the CNEP1R1 gene (HGNC: 26759; Entrez Gene: 255919; Ensembl: ENSG00000205423; OMIM: 616869; UniProtKB: Q8N9A8; Chromosome 16, NC_000016.10 (50025206..50037088)). Alternative names are Transmembrane Protein 188 (TMEM188), NEP1R1 and C16orf69. In particular embodiments, CNEP1R1 encodes a protein sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% homology to one of two isoforms depicted in SEQ ID No 15 and 16. The protein reference sequence in NCBI from homologues of CNEP1R1 in Mus musculus is NP_083350.2. In a third aspect, a screening method is provided to produce or identify a compound for use in the treatment of a TORSINlA-mediated neurological disease, comprising:
- expressing a hyperactive CTDNEP1/CNEP1R1 complex in yeast;
- administering a test compound to said yeast;
- identifying said test compound as a compound for use in the treatment of a TORSINlA-mediated neurological disease if the growth of said yeast in the presence of said test compound is at least 10%, at least 25%, at least 50%, at least 75%, at least 100%, at least 2-fold, at least 3-fold, at least 5-fold or at least 10-fold higher than the growth of said yeast in the absence of said test compound.
Also a method is provided to produce a pharmaceutical composition comprising a compound, wherein said compound is identified by said screening method.
"Hyperactivated" CTDNEP1/CNEP1R1 complex as used herein refers to a CTDNEP1/CNEP1R1 complex that overperforms in dephosphorylating LIPIN, thereby affecting the balance between phospholipid and TAG production in favor for TAG because of a LIPIN-dependent conversion of phosphatidate (PtdA) to diacylglycerol (DAG). As a result of dephosphorylated LIPIN, cell growth is inhibited. Yet, inhibitors of CTDNEP1 or CNEP1R1 activity that can be used in the treatment of TORSINlA-mediated neurological diseases will be those that allow or restore growth of cells notwithstanding said cells produce a hyperactivated CTDNEP1/CNEP1R1 complex. In particular embodiments said complex is a human complex.
Methods to evaluate growth of cells (e.g. yeast) or to compare growth of treated versus untreated cells are well-known in the art and include for example (without the purpose of being limiting) measurements of optical density (OD) at a wavelength of 600 nm, also known as OD600 measurements.
In another aspect, the application provides screening methods to produce or identify an inhibitor of CTDNEP1 or CNEP1R1 activity, comprising:
- determining the storage lipid levels of TORSIN1A knock-out cells in an in vitro cell culture set up;
- administering a test compound to said TORSIN1A knock-out cells;
- wherein, a reduction in said storage lipid levels of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% compared to a condition wherein no test compound was administered, identifies said test compound as an inhibitor of CTDNEP1 or CNEP1R1 activity.
The term "storage lipids" as used herein refers to triglyceride molecules. Triglycerides are esters derived from glycerol and three fatty acids. Triglycerides (also known as triacylglycerols) are the main constituents of body fat in humans and animals. Methods to stain storage lipids and imaging them are well known in the art and discussed in current application.
"CTDNEP1 or CNEP1R1 activity" as used herein refers to the functional activity of CTDNEP1 or CNEP1R1 and thus of the enzyme complex consisting of CTDNEP1 and CNEP1R1. An inhibitor of CTDNEP1 or CNEP1R1 activity can be an antibody, a (heavy chain only) single variable domain antibody or VHH, a phosphatase, a kinase, a small molecule, etc ...
The term "compound" is used herein in the context of a "test compound" or a "drug candidate compound" described in connection with the methods of the present invention. As such, these compounds comprise organic or inorganic compounds, derived synthetically or from natural resources. The compounds include polynucleotides, lipids or hormone analogs that are characterized by low molecular weights. Other biopolymeric organic test compounds include small peptides or peptide-like molecules (peptidomimetics) comprising from about 2 to about 40 amino acids and larger polypeptides comprising from about 40 to about 500 amino acids, such as antibodies or antibody conjugates. For high- throughput purposes, compound libraries may be used. Examples include, but are not limited to, natural compound libraries, allosteric compound libraries, peptide libraries, antibody fragment libraries, synthetic compound libraries, etc. In particular embodiments, a compound will "reduce" or "decrease" the lipid storage level of TORSIN1A knock-out cells. Lipid storage can be easily visualized by lipid dye (e.g. BODIPY 493/503) as in this application, but alternative methods are well-known for the skilled one. In other particular embodiments, a compound will "enhance" or "stimulate" or "increase" the cell size of the TORSIN1A knock-out cells. One of the possible underlying activities is the stimulation or enhancement of membrane lipid synthesis. Assays and methods for visualization and/or measuring the cell size of in vitro cells are known in the art and provided in this application.
In yet another aspect, the application provides SEQ ID N° 12 or a homologue thereof with a least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% homology to SEQ ID N°12 for use in the treatment of TORSIN1A- mediated neurological diseases. In a particular embodiment, said TORSINlA-mediated neurological disease is a neurological disease caused by the present of one or two mutant alleles of the TORSIN1A gene. More particularly said TORSINlA-mediated neurological disease is arthrogryposis multiplex congenita, dystonia, primary dystonia, early-onset dystonia or DYT1 primary dystonia.
In another aspect, the application provides a nucleic acid sequence encoding SEQ ID N° 13 or a homologue of SEQ ID N° 13 with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% homology to SEQ ID N° 13 for use in the treatment of TORSINlA-mediated neurological diseases. In a particular embodiment, said TORSINlA-mediated neurological disease is a neurological disease caused by the present of one or two mutant alleles of the TORSIN1A gene. More particularly said TORSINlA-mediated neurological disease is arthrogryposis multiplex congenita, dystonia, primary dystonia, early-onset dystonia or DYT1 primary dystonia.
SEQ ID N° 12 represents the nucleic acid sequence of choline-phosphate cytidylyltransferase A (PCYT1A), while SEQ ID N° 13 represents the amino acid sequence of the PCYT1A enzyme. PCYT1A is the human homologue of CCT from this application. The PCYT1A enzyme or the nucleic acid sequence encoding PCYT1A can be administered intracerebroventricularly or by way of gene therapy to stimulate membrane lipid synthesis (and consequently cell membrane synthesis) and counteract the hyperactivation of LIPIN or LIPIN1 and/or LIPIN2 activity due to the heterozygous or homozygous mutation in TORSIN1A. Gene therapy refers to therapy performed by the administration to a subject of an expressed or expressible nucleic acid. In this embodiment of the application, the nucleic acids produce PCYT1A (CCT), a functional fragment, a functional variant or homologue thereof mediates cell membrane synthesis. A large number of methods for gene therapy are available in the art and a plethora of delivery methods (e.g. viral delivery systems, microinjection of DNA plasmids, biolistics of naked nucleic acids, use of a liposome) are well known to those of skill in the art. Gene therapy vectors can be delivered in vivo by administration to an individual patient, typically by systemic administration (e.g., intravenous, intraperitoneal infusion or brain injection).
Throughout this application, sequence homology of two related nucleotide or amino acid sequences, expressed as a percentage, refers to the number of positions in the two optimally aligned sequences which have identical residues (xlOO) divided by the number of positions compared. A gap, i.e., a position in an alignment where a residue is present in one sequence but not in the other is regarded as a position with non-identical residues. The alignment of the two sequences is performed by the Needleman and Wunsch algorithm (Needleman and Wunsch (1970) J Mol Biol. 48: 443-453). The computer-assisted sequence alignment above, can be conveniently performed using standard software program such as GAP which is part of the Wisconsin Package Version 10.1 (Genetics Computer Group, Madision, Wisconsin, USA) using the default scoring matrix with a gap creation penalty of 50 and a gap extension penalty of 3. Sequences are indicated as "essentially similar" when such sequences have a sequence identity of at least about 75%, particularly at least about 80 %, more particularly at least about 85%, quite particularly about 90%, especially about 95%, more especially about 100%, quite especially are identical. It is to be understood that although particular embodiments, specific configurations as well as materials and/or molecules, have been discussed herein for cells and methods according to the present invention, various changes or modifications in form and detail may be made without departing from the scope and spirit of this invention. The following examples are provided to better illustrate particular embodiments, and they should not be considered limiting the application. The application is limited only by the claims.
Examples
Examplel: Reducing CTDNEP1/CNEP1R1 complex activity rescues dTorsin KO effects in fly
The fly fat body is the main site of triacylglycerol (TAG) synthesis and storage and is the equivalent of the vertebrate adipose tissue and liver (KOhnlein et al 2012 J Lipid Res 53:14301436; Ugrankar et al 2011; Zhonghua et al 2013 ABBS 45:44-50). Fat body cells are post mitotic and have to expand in size during fly development. Grillet et al. (2016 Dev Cell 3, 235-247) showed that upon dTorsin loss the fat body mass and fat cell size are significantly decreased and demonstrated that these effects are achieved by a hyperactivation of dLipin in the dTorsin knock-out (KO) adipose tissue. We questioned whether dTorsin regulation of dLipin is achieved via the CTDNEP1/CNEP1R1 phosphatase complex. CTDNEP1 (Neml in yeast and dullard in flies) is the catalytic subunit of the complex, while CNEP1R1 (Spo7 in yeast and CG8009 and CG41106 in flies) is the regulatory subunit.
To address this issue, we generated dTorsin KO flies that express a UAS driven RNAi construct against luciferase (negative control), Lipin (positive control), Dullard (CTDNEP1 homolog in flies), CG8009 (NEP1R1 homolog in flies) and CG41106 (NEP1R1 homolog in flies). The RNAi constructs were transactivated with two different GAL4 drivers: Arm (ubiquitous low expression) and r4 (fat body specific expression). All animals were confirmed to be dTorsin KO (Fig. 1A) and the knock-down efficiency of Lipin, Dullard and CG41106 was determined. RT-qPCR showed that each RNAi causes a significant decrease in its mRNA target (Fig. IB).
We then visually assessed the dTorsin KO fat body in all fly lines. In the negative control line (RNAi luciferase) the fat body size was dramatically decreased in dTorsin KO flies compared to WT flies. However, a visible increase in fat body size was observed when the expression of Dullard or CG41106 was reduced in the dTorsin KO background. The increase was more pronounced with the r4 compared to Arm driven RNAi expression (Fig. 2). Surprisingly, the fat body of dTorsin KO flies expressing an RNAi construct against Dullard or CG41106 was more increased than the fat body of dTorsin KO flies expressing an RNAi construct against Lipin. Even more surprisingly, the fat body of dTorsin KO flies expressing an RNAi construct against Dullard or CG41106 could not be distinguished from the fat body of WT flies (Fig. 2). We then progressed to quantitatively measure how well the different gene knock-downs rescue the small fat body cell size of dTorsin KO flies as described in Grillet et al. (2016 Dev Cell 3, 235-247). These experiments fully confirmed the above described visual inspection of intact fat bodies: fat body cells were significantly larger in 5-day-old dTorsin KO larvae expressing RNAi against Lipin, Dullard or CG41106 compared to the control line (i.e. dTorsin KO expressing RNAi against luciferase) (Fig. 3A). This effect was again more pronounced with the r4::GAL4 driver than the Arm::Gal4 driver (Fig. 3B).
Based on the above, a hypothesis is put forward in which dTorsin regulates the activity of dLipin in the flies adipose tissue through the activity of the inner nuclear membrane localized phosphatase complex CTDNEP1/NEP1R1 (Fig. 4). dTorsinA activity normally dissociates the complex and thus inhibits dephosphorylation of Lipin. In the absence of dTorsin, the complex is too active resulting in excess Lipin PAP activity.
Example 2: LIPIN hyperactivity contributes to the reduced survival of TorsinA mice
It was previously shown that dTorsin is required for the development of Drosophila adipose tissue (Grillet et al. 2016 Dev Cell 3, 235-247) by regulating Lipin dependent PAP activity. dTorsin KO effects in fly (reduced adipose tissue development) could be countered by genetically reducing expression of dLipin. We questioned whether LIPIN could be a target to treat TORSINlA-mediated neurological disorders in mammals.
We validated our results in genetically accurate disease models for dystonia (i.e. Torla*1 and Torla+/ gag) and arthrogryposis multiplex congenita (i.e. Torla 7 and Torlafigag/figag). Torla 7 mice contain a large deletion, while the TorlaAgag line contains the Agag mutation (or DE) in the endogenous mouse Torla gene (Goodchild et al 2005). Both Torla +/ and Torla+/Agag heterozygous intercrosses generate expected genotypes with normal Mendelian frequency. However, while heterozygotes are indistinguishable from their littermate controls, Torla 1 and Torla4909/figag animals die within 48 hours of birth. Both sets of homozygous animals move, breath, and respond to stimuli, but they typically fail to feed or vocalize, and both show characteristic nuclear membrane defects in neurons (Goodchild et al 2005). The direct relation between severity of disease and the amount of gene product as observed in these disease models is completely in line with the situation in human patients.
First, we examined LIPIN activity in embryonic mouse brains. LIPIN is a magnesium-dependent phosphatidate (PtdA) phosphatase (PAP) that therefore converts PtdA to diacylglycerol (DAG). We added fluorescently labeled PtdA to brain lysates, incubated these in the presence and absence of EDTA, and then used thin-layer chromatography to detect the presence of fluorescently labeled DAG. We performed this direct biochemical measure of LIPIN activity in duplicate samples prepared from wild- type, Torla*lAgag, Torla7 and Torlafigag/figag embryonic mouse brains at embryonic day 18.5 (E18.5). Torla+/Agag is a genetically accurate disease model for DYT1 dystonia while Torla7 and Torlafigag/figag models are genetically accurate disease models for arthrogryposis multiplex congenita. Our experiment identified 1) that LIPIN PAP activity is robustly detected in the developing brain and 2) is highly abnormal in the brains of Torla mutant mice. We detected a 3-fold increase of magnesium dependent DAG production in Torla / and joriaA9a9/Aga9 mutant brains compared to control brains (Fig. 5). A one-tailed T-test verified that this increase is statistically significant. LIPIN activity was also significantly elevated in the brains of the genetically accurate disease model for DYT1 dystonia (i.e. TorlaAgag/+ mice) (Fig. 6). Interestingly, the PAP activity of TorlaAgag/+ animals has a wider than normal variance, suggesting variability in how animals are affected by TorlaAgag/+ (Fig. 6). This is intriguing given the partial penetrance of this genotype in driving dystonia in humans. To summarize, the above results reveal that both heterozygous as well as homozygous (bi-allelic) Torsinla mutations lead to increased LIPIN activity in mammalian neurons.
Second, we asked whether LIPIN hyperactivity underlies the neurological consequences of Torsinla loss and whether the neurological defects of the dystonia- and arthrogryposis related Torla mutations could be rescued by inhibiting the functional expression of Lipin. The human and mouse genomes encode three LIPIN homologues: LIPIN1, 2 and 3, that all have magnesium dependent PtdA phosphatase activity (Csaki et al 2014, Molecular Metabolism 3: 145-154). LI PI N 1 was selected since homozygous deletion is shown to significantly reduce brain magnesium-dependent PtdA-phosphatase activity (Harris et al 2007 JBC 282: 277-286) and because LI PI N 1 is responsible for most LIPIN PAP activity in the post-natal brain (Figure 15A). Mice harboring a Lipinl null allele (Lipinlfld/fld) were crossed with heterozygous Torla+/Agag mice. The FI progeny was genotyped and the Torla+/Agag Lipinl+/~ mice were selected. The selected genotypes were crossed, phenotyped and genotyped. Knocking-out Lipinl was sufficient to cause a 40% reduction in the LIPIN PAP hyperactivity of TorlaAg3g/Ag3g brains (E18.5) (Fig. 7). This partial reduction in PAP hyperactivity was paralleled by significantly longer survival of TorlaAgaglAg3S mice (Fig. 8). In addition, there was also a significant improvement in the membrane pathology within TorlaAgaglAgag neurons (Fig. 9). Both the number of cells that show nuclear membrane defects (Fig. 9 A-B) as well as the severity of the nuclear membrane defects (Fig. 9 C-D) were reduced upon knocking-out Lipinl. The membrane defects (also referred to as nuclear membrane blebbing) observed in the nuclear membrane of Torla 1 and TorlaAgaslAgag mutants are well known in the art as the prime cell biological read-out of strong TORSIN1A loss (Cascalho et al., 2016; Goodchild et al., 2005; Tanabe et al., 2016).
Given the severe postnatal phenotypes of the Torla7 and Torlafigag/figag models, we also made use of a milder disease model. More precisely, the heterozygous DE (or Agag) mutation was combined with a neural-specific TorsinlA deletion (Torlacl<0/AE (Nestm Cre) from here on referred to as "cKO/DE"; Figure 15B). This was previously shown to result in TorsinlA mutant mice that survive past birth and develop motor dysfunction reminiscent of the recessive and dominant human disease (Liang et al 2014). We confirmed their postnatal survival (Figure 15C), but also saw significant lethality beginning a few days after birth. This is more severe than first reported for these mice, but in-line with a recent description of a conditional cKO/cAENestm Cre mouse (Weisheit and Dauer 2015). We first confirmed that LIPIN is hyperactive in late stage cKO/DE embryos consistent with it playing a role in postnatal lethality. It was observed that both Lipinl+/~ and Lipinl ^ genotypes significantly reduced LIPIN hyperactivity albeit that this remained above normal levels (Figure 15D). We moved forward to examine whether LIPIN hyperactivity contributes to poor cKO/DE survival, also considering that some humans with biallelic TorsinA mutations fail to survive. We intercrossed Torla,lox, TorlaAE, Nestin-Cre and Lipin alleles to produce offspring with 12 distinct genotypes (Figure 15E) and assessed their survival and general health blind to genotype. As previously shown, Lipin ^ itself is pathogenic, including reducing animal survival, and thus we did not further consider animals with this genotype. In contrast, Lipinl+/~ did not have negative consequences (data not shown). In line with the results obtained with the Torla7 and Torlafigag/figag disease models, reduction of LIPIN activity also resulted in a highly significant rescue of cKO/DE lethality. While > 80% of cKO/DE animals with uncorrected LIPIN hyperactivity succumbed between P3 and P30, the majority survived when LIPIN hyperactivity was reduced (Figure 15F). Indeed, once cKO/DE animals survived to P30 we saw no additional lethality (cKO/AE\Lipin /+ n=2; cKO/AE\Lipinl +/ n=22). We also assessed kyphosis (hunchback) as an indicator of whether LIPIN reduction improved animal health and found that Lipinl+/~ reduced the percentage of affected juvenile (P21) cKO/DE animals (Figure 15G), and despite the fact that a larger number of the clinically worst cKO/AE\Lipinl+/+ mice had been removed from the study before reaching this time-point. Considered together, these data establish that even a partial reduction of LIPIN hyperactivity can improve cKO/DE survival, and thus confirms the pathogenic role of LIPIN hyperactivity in TorsinlA disease. Interestingly, these data fully confirmed the results obtained in fly (Grillet et al. 2016 Dev Cell 3, 235-247) and thus that Drosophila adipose tissue is a reliable model system to study modulators of TorsinlA activity of mammals.
Example 3. LIPIN hyperactivity contributes to motor dysfunction of TorsinlA disease
Dominant (e.g. Torlafigag/+) and recessive (e.g. Torlafigag/figag) TorsinlA diseases are defined by their behavioral disturbances; early-onset dystonia and arthrogryposis, respectively. It has been challenging to find a behavioral correlate of dystonia in genetically accurate DE/+ mice, but abnormal motor behaviors of the cKO/DE mice may represent a readout for both dystonia as the TorsinlA recessive syndrome. We therefore analyzed the impact of reduced LIPIN activity on the behavior of these mice using cohorts that also contained littermate flox/DE. When testing the animals at P15 and P21 for the presence of abnormal motor behaviors, significant amounts of tremor, excess limb clasping and severely abnormal gait were detected in cKO/DE mice. Interestingly, these motor phenotypes were consistently rescued by the Lipinl+/~ genotype (Figure 16A-F). This occurred without significantly affecting animal weight, thus further suggesting a specific intervention on abnormal movements. Furthermore, we detected this significant benefit of LIPIN reduction even though we lost 50% more of the most severely affected cKO/AE:Lipinl+/+ mice before they reached behavioral testing time-points (Figure 15F), and that Lipinl+/~ only partially rescues LIPIN hyperactivity in embryos and young mice (Figure 15D). Thus, LIPIN hyperactivity does strongly contribute to abnormal motor function in recessive TorsinlA disease mice. The littermate DE/flox mice in these cohorts, as expected, acquired development skills in the same timeframe as controls (data not shown) and lacked severe overt motor dysfunction (Figure 6A-F). Surprisingly, however, our analysis detected abnormal gait in 19% of juvenile DE/flox mice; a phenotype that was never observed in wild-type (+/flox) animals (Figure 16G-I). Furthermore, we also detected gait defects in 35% of TorsinlA haploinsufficient +/cKO mice (Figure 161). These analyses were conducted blind to genotype and included littermates with 12 genotypes, amongst which DE/flox, +/cKO are visually indistinguishable from +/flox. Additionally, while Lipinl+/~ had no effect on baseline development or motor skills of +/flox mice (Figure 161), Lipinl+/~ did significantly reduce the percentage of DE/flox with detectable gait defects (Figure 161; center columns) as well as +/cKO with gait defects (Figure 161; right columns). Thus, these results demonstrate that LIPIN PAP hyperactivity also contributes to motor dysfunction in TorsinlA animals with a dominant disease genotype and that inhibitor of PAP activity can be used for the treatment of both dystonia as the TorlA recessive syndrome.
Example 4: Lipinl and Lipin2 inhibition in Torsinla ( Torla ) mutant mice
The data from Examples 2 and 3 strongly support the concept of LIPIN reduction as therapy for neurological TOR1A diseases. Although the reduction of LIPIN1 activity surprisingly rescues many effects of the TOR1A mediated diseases, a full recovery to wild-type levels is only occasionally observed. Aside it was shown that LI PIN 1 is responsible for most LIPIN PAP activity in the postnatal brain (Figure 15A), it is still possible that multiple Lipin genes contribute to LIPIN mediated PAP activity during brain development.
Lpinl, Lpin2 and Lpin3 genes encode the three LIPIN PAP enzymes of mammalian cells. We analyzed their relative expression in E18 brain as part of an RNAseq experiment. Lpinl and Lpin2 mRNA were both strongly detected in the E18 mouse brain, while we had very few Lpin3 reads (Fig. 10A). In addition, qRT- PCR also detected Lpinl and Lpin2 mRNA, while Lpin3 was barely detectable (data not shown). When normalized to mRNA length, the RNAseq data indicates that the late embryonic mouse brain expresses similar amounts of Lpinl and Lpin2 mRNA (Fig. 10B), but very little Lpin3. We then examined how Lpinl and Lpin2 expression changes as neurodevelopment proceeds, particularly given the data that the LI PIN 1 enzyme underlies most PAP activity in adult mouse brain (Harris et al 2007). We took the time period from E18.5 through to P21 that covers the developmental window when mice are most sensitive to TOR1A loss (Liang et al 2014 2; Tanabe et al 2016). This identified that both Lpinl mRNA and Lpin2 mRNA decrease as the brain matures (compared to house-keeping gene expression) (Fig. 10C). Considered together, these data show that LPIN1 /LIPIN1 and LPIN2 /LIPIN2 are relevant therapeutic targets for TOR1A disease. In contrast, LPIN3 is not a relevant therapeutic target for neurodevelopmental disease.
We next aimed to uncover an approach that simultaneously inhibits LI PIN 1 and LIPIN2 PAP activity in neurons of the developing mice brain. RNAi can knock-down the expression of multiple genes. RNAi also allows knock-down of neural gene expression; for example, when viruses expressing shRNA against a gene of interest are delivered into the brain by injection. In mice this delivery is most feasible soon after birth. This is also the time point when intervention against congenital recessive TOR1A disease would be needed. We therefore designed shRNA sequences against Lpinl and Lpin2, and produced adeno- associated virus serotype 9 (AAV-9) that carries these Lpinl or Lpin2 sequences, a scrambled control sequence, or GFP. Optimization of injection conditions defined that intracerebral ventricular (ICV) injections of 2 pi of virus (lxlO12 GC/ml) (per ventricle) into neonatal (post-natal day 0; P0) pups provided the broadest transduction efficiency. Many cells in the cortex, hippocampus, striatum and dorsal thalamus were transduced to express the GFP reporter, although GFP expression was isolated or absent from ventral brain regions, midbrain, cerebellum and hindbrain (Fig. 12). This is similar to publications describing AAV9-delivered gene expression patterns (Chakrabarty et al 2013 PLoS One 8:e67680).
We then tested whether neonatal viral delivery of shRNA against Lipnl and Lipn2 is able to reduce 1) Lipin gene expression and 2) LIPIN PAP activity. These analyses were performed on whole brain tissue - even though the transduction procedure spares many neurons - and thus the data inform on whether it is possible to suppress LIPIN activity rather than the efficiency that each shRNA acts when transduced into a neuron. We injected P0 wildtype mouse pups (C57BI6(Jax) background) with AAV9-shRNA constructs encoding for shRNAs against Lpinl (AAV9-shLpinl), Lpin2 (AAV9-shLpin2), a scrambled control shRNA sequence (AAV9-shSCRAM), or equal amounts of Lpinl and Lpin2 shRNA viruses (Fig. 11A). The injected mice were allowed to recover and then returned to their home cages for nursing. They were then euthanized at P7, P14 and P21 to collect brain tissue for 1) qRT-PCR assessment of Lpinl/2/3 mRNA levels and 2) biochemical measurement of brain LIPIN PAP activity. Of note, Lpin3 mRNA levels are not shown, as levels were often below detection.
At P7, qRT-PCR found no difference in the levels of Lpinl or Lpin2 mRNA between animals injected with AAV9 that target Lipin expression vs. AAV9 expressing the scrambled nonsense shRNA sequence. However, significant decreases in Lipin gene expression were detected at both P14 and P21 (Fig. 13). At both time points, Lpinl mRNA levels were decreased in animals injected with AAV9-shLpinl compared to AAV9-shSCRAM, including in animals co-injected with AAV9-shLpinl+ AAV9-shLpin2. The P14 and P21 data testing whether AAV9-shLpin2 affects Lpin2 expression was similar; there is significantly less Lpin2 mRNA in mice that received AAV9-shLpin2 compared to AAV9-shSCRAM at both stages, including when this is co-injected with AAV9-shLpinl. The degree of Lpinl and Lpin2 knock-down was also similar, with mean values (n=4 animals) indicating that AAV9-shRNA produce 50-75% decrease in Lipin gene expression (in animals that are also mosaic for neuronal transduction). This data show the feasibility of a genetic approach to reduce Lipin gene expression.
Surprisingly, we also detected apparent co-regulation of Lpinl and Lpin2 expression. P0 injection of AAV9-shLpinl produced significantly less Lpin2 mRNA at P14 and P21 - while AAV9-shLpin2 injections reduced Lpinl mRNA levels at P21. This is very surprising, and thus we explored whether the viruses are acting specifically on Lipin genes, or having broader effects. However, housekeeping genes showed a coefficient of variation <10% to suggest that the effects were specific to the Lipin genes. In addition, we examined the expression of two unrelated genes; Pgkl and B2m. These were both unaltered by AAV9- shLpinl or AAV9-shLpin2 (Fig. 13) showing that the AAV9 delivered shRNA sequences specifically target Lipin enzymes (are not broadly affecting gene transcription).
We also tested whether altered Lipin mRNA levels are sufficient to affect LIPIN enzyme PAP activity. This indeed is the case. All three AAV9 strategies cause ~50% reduction in brain LIPIN PAP activity compared to animals that received AAV9-shSCRAM, which is seen at both P14 and P21 in parallel with when we detect altered Lipin mRNA levels (Fig. 14). Furthermore, finding 50% loss of PAP activity despite incomplete viral transduction (many brain areas express low/no virus) shows the relative sensitivity of PAP activity to AAV9 delivered shRNA against Lipin enzymes. These data raise the possibly that shRNA against a single Lipin gene can strongly affect LIPIN PAP activity at neurodevelopmental stages implicated in TOR1A recessive and dominant disease.
In a next step, it is examined whether AAV9-shRNA mediated inhibition of LIPIN PAP activity prevents neurological dysfunction associated with TORlA-disease in mice (Fig. 11B). A conditional Torla floxed mouse model ( TOG1( Ioc/D9° 9) is used with co-delivery of AAV9-Cre and AAV9-shLpinl or AAV9-shLpin2 (or AAV9-shSCRAM control). The AAV9-Cre virus deletes several exons from Torla in transduced neurons, so that these individual cells have the genotype of recessive TOR1A disease. Since we co-inject viruses, a high proportion of these Cre-transduced neurons also express a Lipin shRNA virus. Thus, this experiment allows us to confirm that Lipin inhibition (here mediated via shRNA knock-down) is useful against Torla loss, while circumventing the experimental problem of incomplete AAV9 transduction. As read outs, we expect that AAV9-delivered Torla deletion is sufficient to cause 1) behavioral defects in motor function and/or cognitive functioning, and 2) will induce the characteristic neuronal cellular pathology of cells lacking torsin activity. Thus, we will confirm that Lipin inhibition is sufficient to overcome one or both these measures of TOR1A pathology (Fig. 11B). Example 5: Inhibition of functional expression of CTDNEP1 or CNEP1R1 in Torsinla [Torla) mutant mice
Surprisingly, we found that genetic inhibition of the upstream LIPIN activating phosphatase complex (CTDNEP1/CNEP1R1) rescued dTorsin KO effects in fly adipose tissue significantly better compared to Lipin RNAi (Example 1). This is especially interesting given the translationability of results on Torsin modulation obtained in fly adipose tissue to mammals (see Example 2 and 3). To confirm in mice that the NEP1 phosphatase complex would be an alternative target to treat TORSIN1A mediated defects in mammals such as dystonia and arthrogryposis multiplex congenita, a similar approach as disclosed in Example 4 was set up, i.e. expression of CTDNEP1 or CNEP1R1 is reduced in TOR1A disease mice using AAV9 delivered shRNA. First, the efficiency of silencing using AAV9-shCTDNEPl and AAV9-shCEPlRl constructs is determined. Second, the behavior, cognitive functioning and the neuronal cellular biology of a conditional Torla floxed mouse model (Tor2c ,¥/¾909) injected with AAV9-Cre and AAV9-shCTDNEPl or AAV9-shCEPlRl (or AAV9-shSCRAM control) is assessed.
Example 6. Pharmacological inhibition of LIPIN
To complement the results obtained by genetic inhibition of Lipinl and/or Lipin2 in mice, Torlafigag/figag, Torlafigag/+ and control mice were treated with chemical compounds known in the art to inhibit LI PIN 1 activity or LIPIN1 expression. In total 8 compounds were selected: propranolol (Brohee et al 2015 Oncotarget; Grkovich et al 2006 J Biol Chem; Albert et al 2008 J Leukoc Biol; Han and Carman 2010 J Biol Chem 285: 14628-14638); the sphingoid bases sphingosine and sphinganine (Han and Carman 2010); N- ethylmaleimide (NEM) (Grkovich et al 2006; Han and Carman 2010); bromoenol lacton (BEL) (Grkovich et al 2006; Albert et al 2008); rutin (Han et al 2016 Am J Ch Med 44: 565-578) and the HIF-1 inhibitors kaempferol and MTD (Mylonis et al 2012 J Cell Sc 125: 3485-3493).
Propranolol is known to cross the blood-brain-barrier and could therefore be injected intravenously. Four groups (3 concentrations and placebo) with four mice per group are used for three different genotypes (Torlafigag/figag, Torlafigag/+ and WT). New borne mice at P0 are intravenously injected (tail vein injection) with 1 mg/kg of propranolol (30 pg for a 30-g mouse) or 4 mg/kg of propranolol (120 pg for a 30-g mouse) or 10 mg/kg of propranolol (300 pg for a 30-g mouse) in 120 pL of phosphate buffered saline or 120 pL of phosphate buffered saline alone (placebo). The mouse tail vein dose of propranolol was determined using a ratio between appropriate human propranolol intravenous dose, maximum human intravenous dosing, and maximum rodent intravenous dosing (Ley et al 2010 J Trauma 68:353-356). At P7, P14 and P21 the behavior, cognitive function and the neuronal cellular biology of treated versus non- treated Torlafigag/figag, Torlafigag/+ and control mice is determined. Given that propranolol crosses the BBB, we hypothesized that the compound would also cross the blood-placenta-barrier. Therefore, Torlafigag/+ mice are crossed and pregnant mice are intravenously injected (tain vein) with 1, 4 or 10 mg/kg of propranolol at the time the embryo's reached E18. After birth, pups are genotyped and evaluated at P0, P7 and P14 concerning behavior, motor function, gait, cognitive function and neuronal cellular biology. Second, sphingosine and sphinganine are checked. These compound are also known to cross the BBB. A similar approach as for propranolol is used but concentrations are adapted to 0.3 mg/kg, 0.5 mg/kg and 2 mg/kg.
Third, the flavonoid rutin is checked. Rutin was purchased commercially (Sigma-Aldrich, St. Louis, MO, USA). Rutin is diluted in propylene glycol. To facilitate the dissolution of rutin, the solution is made to stand for 15 min in a water bath at 50 °C for 10 min. Rutin solution or vehicle (propylene glycol) is administered by intraperitoneal (i.p.) injection. Torlafigag/figag, Torlafigag/+ and WT animals are divided into three experimental groups: one that receives vehicle (control group), one that receives the dose of 50 mg of rutin/kg of body weight and one that receives the dose of 100 mg/kg of body weight. These doses were chosen from previous studies showing effect of rutin on rodent brain (Pu et al 2007 J Pharmacol Sci 104:329-334; Rodrigues et al 2013 Brain Res 1503:53-61). Rutin is daily injected during five consecutive days from P0 onwards. At P7, P14 and P21 the behavior, cognitive function and the neuronal cellular biology of treated versus non-treated Torlafigag/figag, Torlafigag/+ and control mice is determined.
Materials and Methods
Drosophila stocks
The UAS-GAL4 system was used to achieve conditional knockdown of specific genes, using two driver lines w-,dTorsinK078/FM7i, Act-GFP; Arm-Gal4/Arm-Gal4 (ubiquitous low expression) and w- ,dTorsinK078/FM7i, Act-GFP;; r4-Gal4/TM6C,tb (fat body specific expression), and UAS-RNAi transgenic lines (Grillet et al 2016 Dev Cell). The w-,dTorsinK078/FM7i, Act-GFP line was used to bring Arm-GAL4 and r4-GAL4 into dTorsin KO background. The following RNAi fly stock lines were used in this study: UAS- lipinRNAi (VDRC# 36006, CG8709), UAS-dNEPIRIRNAi (VDRC# 48955, CG8009 and VDRC# 101371, CG41106), UAS-dullardRNAi (VDRC# 12941) and UAS-luciferaseRNAi(BDSC#31603).AII stocks and crosses were cultured on conventional cornmeal/sucrose/dextrose/yeast medium and kept at 25°C.
Labelling. Imaging and Quantification
5-Day-old male larvae of the different genotypes were dissected in ice cold lx PBS prior to brightfield imaging and fluorescent labeling. All tissues were removed except for nervous system and adipose tissue. Larval guts were saved for genotyping to confirm dTorsin knock-out in each larvae. Bright-field images were collected using the Zeiss Lumar V12 stereomicroscope. Fluorescent labeling was performed on larval fillets fixed in 4% paraformaldehyde and washed in lxPBS containing 0.4% Triton X-100, larval fillets were removed and mounted using Vectashield with DAPI (Vector# H-1200) prior to imaging using the Nikon Eclipse confocal microscope. Cell size and lipid droplets (not shown in this study) were visualized using respectively phalloidin Alexa fluor 594 (lmg/mL, Life technologies# A12381) and BODIPY 493/503 (lmg/L, Invitrogen # D-3922). Cell size was quantified using Fiji and optimized macro. Data were analyzed and compared using the GraphPad Prism software and Dunn's multiple comparison test.
5-Day-old larvae were dissected and gut was taken and kept in -80°C prior to genotyping. Gut was squished using squishing buffer containing lOmM Tris-HCI pH 8, ImM EDTA, 25nM NaCI and 200g/mL Proteinase K followed by a 30 minutes incubation at 37°C and 3 minute inactivation at 95°C. Samples were centrifuged and supernatant was collected to perform a PCR reaction with following primers: dTorsin primer A: 5'AGTGGCTAAATCCCTGGTTAG3'
dTorsin primer C: 5' AC AC AA AT GTG C AG G C AC AG 3'
dTorsin primer D: 5'CACGACTGAGTGACTTTGAG3'
As controls 5-day-old WT, dTorsinKO and dTorsinKO/+ were used.
Quantitative real-time PCR
mRNA expression was checked using quantitative RT-PCR by isolating total RNA from 5-day-old male larvae expressing RNAi against specific genes using the Arm-GAL4 driver. More than 30 larvae per genotype were washed in ice cold lxPBS and stored at -80°C prior to analysis. Total RNA was isolated using the RNeasy Mini-kit (Qiagen# 74104) and reverse transcribed using the SuperScriptTM VILOTM cDNA Synthesis Kit (Thermofisher# 11754050). Quantitative RT-PCR was performed using a LightCycler® 480 instrument with LightCycler® 480 SYBR Green I Master mix (Roche# 04707516001). All SYBR Green assays were performed on 3 different samples and each sample was measured in triplicate and normalized to rp49 mRNA according to the CT method. Primers used for qRT-PCR are:
Lipin: 5'GTCGCAACCTAAGCGAAAAG3'and 5'TT GT G ACCGTGGT GAGGTTA3'
Dullard: 5'GCCAAGTGCGAGCTTTTATC3' and 5'GATTCCGATCGATGGTCATT3'
CG41106: 5'TGGTTTTCCAAATCCTGTCC3' and 5'ATCAATGTTAAGGCGGAACG3'
Rp49: 5'TACAGGCCCAAGATCGTGAA3' and 5'GTTCGATCCGTAACCGATGT3'
Lipin activity
PAP activity (Adapted from Dubots, et al. 2014 PLoS One 9, el04194 and Sembongi, et al. 2013 J Biol Chem 288, 34502-34513) was determined in mouse brain lysates by measuring the formation of fluorescent DAG from NBD-PA (l-acyl-2-{12-[(7-nitro-2-l,3-benzoxadiazol-4-yl)amino]dodecanoyl}-sn- glycero-3-phosphate ammonium salt) (Avanti Polar lipids, Inc). Snap frozen brain tissues were lysed with Tris-HCI, pH 7.5 buffer containing 0.25 m sucrose, 10 mM 2-mercaptoethanol, lx EDTA free protease inhibitor cocktail, and lx PhosSTOP phosphatase inhibitor cocktail (Roche). The lysates were centrifuged at 1,000 x g for 10 min at 4 °C, and the supernatant was used for the measurement of PAP activity. Reactions (100 pi; 60 pg of total protein extract) were carried out in buffer containing 50 mM Tris HCI pH 8.0, 1 mM MgCI2 or 4 mM EDTA, and 10 mM b-mercaptoethanol, and started by the addition of NBD- PA (2 mM) solubilized in 10 mM Triton X-100. The reactions were incubated for 30 min at 30°C and terminated by the addition of 0.4 ml of 0.1 M HCI (in methanol). Following addition of 0.4 ml chloroform and 0.4 ml of 1 M MgCI2 and centrifugation (1000 rpm for 10 min at room temperature), the chloroform- soluble lipid fractions were isolated and dried under nitrogen. Lipids were resuspended in chloroform/methanol (1:1), deposited on silica gel plates (Merck) and separated by thin layer chromatography using chloroform/methanol/H20 (62:25:4) as a solvent system. NBD-DAG production was determined by recording fluorescence with a LAS 4000 (Green-RGB) and quantified with ImageJ. qRT-PCR
Snap frozen brain tissue (stored at -80°C) was preserved using RNAIater solution, to prevent RNA degradation. RNA isolation was performed using RNeasy Quiagen mini kit (Quiagen), combined with DNAse I on column digestion (Quiagen), according to manufactures instructions. Reverse transcription was done using the Superscript IV Reverse Transcriptase (Thermo Fisher), and using 2000ng of total RNA and random primers reaction. DNA was diluted 1:4 in nuclease-free water and stored at -20°C. qPCR reaction was performed using the SensiFast SYBR No-ROX kit (Bioline), and it was run on Lightcycler 480 (Roche). Each sample was run in duplicate for all Lipin genes (Lipinl/2/3) and using at least 3 housekeeping genes for normalization (HPRT1, KDEL3, LAMA2). Appropriate no-RT and non-template controls were included in each 96-well PCR reaction, and dissociation analysis was performed at the end of each run to confirm the specificity of the reaction. Quantification was done on the Lightcycler quantification software, and normalized using the standard geometric normalization.
Neonatal Virus injections
The procedure was adapted from Passini et al. (2003 J Virol 77:7034-7040) .The time of delivery was monitored closely as it was crucial to inject as soon as possible after delivery (P0 after begging to nurse). P0 pups were injected as close as possible to their birth (0-24hours postnatal). The naive pups were covered in aluminum foil and completely surrounded in ice for 3-4 min, resulting in the body temperature being lowered to <10°C. The pups are completely cryoanesthetized when all movement stops and the skin color changes from pink to purple. Cryoanesthetized neonates were injected using glass capillaries (3.5" Drummond #3-000-203-G/X) and a nanoinjection system (Drummond® Nanoject II). 2 mI of virus (1x1012 viral genomes/ml) was slowly injected into each ventricle and the needle slowly retracted. After injection pups were allowed to completely recover under a heating lamp and then returned to the home cage.
AAV construction and preparation
AAV virus were obtained from Cyagen (Cyagen Biosciences Inc., Santa Clara, CA, USA).
Immunohistochemistry and Image processing
Three weeks old brains were dissected and fixed overnight in 4% paraformaldehyde solution at 4°C. Fixed brains were cryopreserved (sucrose gradient) and mounted using OCT mounting medium and serial sagittal sections (35pm) were cut using the Nx70 cryostat. Immunohistochemistry was performed using EGFP (homemade; 1:1000) followed by development using DAB reagents (Vector Labs). Immunohistochemically stained sections were captured using the Leica DM5500 microscope. Double immunofluorescent staining was done using eGFP (1:1000, homemade), NeuN (1:200, Milipore) and developed using Alexa Fluor labeled secondary antibodies (1:100, Invitrogen). Fluorescently labeled sections were captured using a Nikon C2 microscope and analyzed using ImageJ. Brightness and contrast alterations were applied identically on captured images using ImageJ.
Statistical Analysis
Statistics analysis were performed on Graphpad Prim (V7.01). The respective tests performed on each set of experiments are described under each figure.
Mice
Husbandry and Tissue Collection
Lipinl, Torla and Nestin-Cre mice and genotyping are previously described (Goodchild et al 2005,
Peterfly et al 2001, Liang et al 2014, Tronche et al 1999 Nat Genet 23:99-103). The days of embryonic development were defined after assigning the day of vaginal plug detection as E0.5. Embryos were collected from pregnant females after they were euthanized by cervical dislocation. Days of post-natal development were defined with the birthdate as PO. Postnatal animals were permanently identified using the AIMS Pup Tattoo Identification System (Budd Lake, NJ). Tissues were collected from post-natal animals after decapitation (P0 until P14), cervical dislocation (P14 until P35), or CO2 inhalation. Tissue destined for biochemical analysis was snap frozen and stored at -80°C until use. Tissues destined for histological analysis were perfused and fixed overnight at 4°C in 4% paraformaldehyde in phosphate buffered saline (PBS). They were then either dehydrated and embedded in paraffin or cryoprotected in 30% sucrose, placed in embedding media, rapidly frozen on dry ice, and stored at -80°C until required. All mice were housed in the KU Leuven animal facility, fully compliant with European policy on the use of Laboratory Animals. To prevent environmental bias, mice were cohoused independent to genotype. All animal procedures were approved by the Institutional Animal Care and Research Advisory Committee of the KU Leuven (ECD P120/2017) and performed in accordance with the Animal Welfare Committee guidelines of KU Leuven, Belgium.
Neurological function
P0-P21 pups were weighed each day and tested at P15 and P21 using adaptions of existing protocols (Hill and Stone 2008 Neuromethods 39; Feather-Schussler and Ferguson 2016 J Vis Exp). After weaning (P21) mice animals were only examined for overall health, including weighing every fourth day. For tremor, each mouse was observed in its home cage for 20s. Any sign of tremor (mild or severe) was recorded as positive. Forelimb and hindlimb clasping was examined upon suspending a mouse upside down by the tail. A positive score was recorded if the limbs touched. Gait was assessed by individually placing a mouse in a fresh cage facing away from the observer. The animal was scored 0 (normal) when it moved normally with both hindlimbs participating evenly and supporting its body weight on all 4 paws, with its abdomen not touching the ground; scores of 1-3 were given if tremor or limping was observed, if the pelvis was lowered or when the feet are pointed away from the body during locomotion ("duck feet"), or when a has difficulty moving forward and drags its abdomen along the ground. Kyphosis was also recorded in this assessment if the animal appeared unable to straighten its spine during ambulation or at rest. All tests were performed with all mice (12 genotypes including Lipinl-/-) that had been cohoused and observers were blind to genotype. While cKO/DE animals could be distinguished by their reduced weight, this could not discriminate their Lipinl genotype. References
Goodchild, R.E., and Dauer, W.T. (2005). The AAA+ protein torsinA interacts with a conserved domain present in LAP1 and a novel ER protein. J Cell Biol 168, 855-862. Goodchild et al., 2005
Goodchild, R.E., Buchwalter, A.L., Naismith, T.V., Holbrook, K., Billion, K., Dauer, W.T., Liang, C.C., Dear, M.L., and Hanson, P.l. (2015). Access of torsinA to the inner nuclear membrane is activity dependent and regulated in the endoplasmic reticulum. J Cell Sci 128, 2854-2865.
Goodchild, R.E., Kim, C.E., and Dauer, W.T. (2005). Loss of the Dystonia-Associated Protein TorsinA Selectively Disrupts the Neuronal Nuclear Envelope. Neuron 48, 923-932.
Hanson, P.L, and Whiteheart, S.W. (2005). AAA+ proteins: have engine, will work. Nat Rev Mol Cell Biol 6, 519-529.
Harris, T.E., Huffman, T.A., Chi, A., Shabanowitz, J., Hunt, D.F., Kumar, A., and Lawrence, J.C., Jr. (2007). Insulin controls subcellular localization and multisite phosphorylation of the phosphatidic acid phosphatase, lipin 1. J Biol Chem 282, 277-286.
Jungwirth, M., Dear, M.L., Brown, P., Holbrook, K., and Goodchild, R. (2010). Relative tissue expression of homologous torsinB correlates with the neuronal specific importance of DYT1 dystonia-associated torsinA. Hum Mol Genet 19, 888-900.
Kim, C.E., Perez, A., Perkins, G., Ellisman, M.H., and Dauer, W.T. (2010). A molecular mechanism underlying the neural-specific defect in torsinA mutant mice. Proc Natl Acad Sci U S A 107, 9861-9866.
Liang, C.C., Tanabe, L.M., Jou, S., Chi, F., and Dauer, W.T. (2014). TorsinA hypofunction causes abnormal twisting movements and sensorimotor circuit neurodegeneration. The Journal of clinical investigation 124, 3080-3092.
Peterfy, M., Phan, J., Xu, P., and Reue, K. (2001). Lipodystrophy in the fid mouse results from mutation of a new gene encoding a nuclear protein, lipin. Nat Genet 27, 121-124.
Sosa, B.A., Demircioglu, F.E., Chen, J.Z., Ingram, J., Ploegh, H.L., and Schwartz, T.U. (2014). How lamina- associated polypeptide 1 (LAP1) activates Torsin. eLife 3.
Tanabe, L.M., Liang, C.-C., and Dauer, W.T. (2016). Neuronal nuclear membrane budding occurs during a developmental window modulated by Torisin paralogs. Cell Reports 16, 3322-3333
Ugrankar, R., Liu, Y., Provaznik, J., Schmitt, S., and Lehmann, M. (2011). Lipin is a central regulator of adipose tissue development and function in Drosophila melanogaster. Mol Cell Biol 31, 1646-1656.
Vander Heyden, A.B., Naismith, T.V., Snapp, E.L., Hodzic, D., and Hanson, P.L (2009). LULL1 Retargets TorsinA to the Nuclear Envelope Revealing an Activity that Is Impaired by the DYT1 Dystonia Mutation. Mol Biol Cell 20, 2661-2672.
Weisheit, C. E., Dauer, W. T. (2015). A novel conditional knock-in approach defines molecular and circuit effects of the DYT1 dystonia mutation. Hum Mol Genet 24, 6459-6472.

Claims

Claims
1. An inhibitor of phosphatidic acid phosphatase activity for use in treatment of TORSIN1 mediated neurological diseases.
2. The inhibitor of claim 1 for use in treatment of TORSIN1 mediated neurological diseases wherein said inhibitor decreases the Mg2+ dependent phosphatidic acid phosphatase activity in an in vitro cell culture with at least 10% compared to a control situation where said inhibitor was not present.
3. The inhibitor of any of claims 1-2 for use in treatment of TORSIN1 mediated neurological diseases, where said inhibitor is a gapmer, a shRNA, a siRNA, a CRISPR, a TALEN or a Zinc-finger nuclease and wherein said inhibitor inhibits the expression of LIPIN1, LIPIN2, CTDNEP1 and/or CNEP1R1.
4. The inhibitor of any of claims 1-2 for use in treatment of TORSIN1 mediated neurological diseases, wherein said inhibitor is selected from the list consisting of propranolol, sphingosine, sphinganine, rutin, keampferol, N-ethylmaleimide and bromoenol lactone.
5. The inhibitor of any of claims 1-4 for use in treatment of a TORSIN1 mediated neurological disease selected from the list consisting of dystonia, primary dystonia, early-onset dystonia, DYT1 primary dystonia and arthrogryposis multiplex congenita.
6. A pharmaceutical composition for use in treatment of TORSIN1 mediated neurological diseases, wherein said pharmaceutical composition comprises the inhibitor according to any of claims 1-4.
7. The pharmaceutical composition of claim 6 for use in treatment of a TORSIN1 mediated neurological disease selected from the list consisting of dystonia, primary dystonia, early-onset dystonia, DYT1 primary dystonia and arthrogryposis multiplex congenita.
8. A screening method to produce a compound for use in the treatment of a TORSIN1 mediated neurological disease, comprising:
- expressing an active human CTDNEP1/CNEP1R1 complex in yeast;
- administering a test compound to said yeast;
- identifying said test compound as a compound for use in the treatment of a TORSIN1 mediated neurological disease if the growth of said yeast in the presence of said test compound is at least 10% higher than the growth of said yeast in the absence of said test compound.
9. A method to produce a pharmaceutical composition comprising a compound, wherein said compound is identified by the screening method according to claim 8.
EP18816009.7A 2017-12-07 2018-12-06 Means and methods to treat torsin related neurological diseases Withdrawn EP3720961A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB1720401.7A GB201720401D0 (en) 2017-12-07 2017-12-07 Means and methods to treat torsin related neurologicl diseases
PCT/EP2018/083784 WO2019110728A1 (en) 2017-12-07 2018-12-06 Means and methods to treat torsin related neurological diseases

Publications (1)

Publication Number Publication Date
EP3720961A1 true EP3720961A1 (en) 2020-10-14

Family

ID=61007310

Family Applications (1)

Application Number Title Priority Date Filing Date
EP18816009.7A Withdrawn EP3720961A1 (en) 2017-12-07 2018-12-06 Means and methods to treat torsin related neurological diseases

Country Status (3)

Country Link
EP (1) EP3720961A1 (en)
GB (1) GB201720401D0 (en)
WO (1) WO2019110728A1 (en)

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2802775C (en) * 2010-06-17 2019-09-24 Vib Vzw Increased protein expression through increased membrane formation
CL2011000273A1 (en) * 2011-02-08 2011-06-17 Univ Pontificia Catolica Chile Use of a phosphatidic acid phosphohydrolase enzyme (pap) inhibitor or combination of inhibitors, in which the inhibitor is d (+) propranolol, and the combination is racemic mixture of propranolol od (+) propranolol together with desipramine, to prepare a Useful medicine in the treatment of cancer.
CA3027587A1 (en) * 2016-06-06 2017-12-14 Vib Vzw Means and methods to treat dystonia

Also Published As

Publication number Publication date
GB201720401D0 (en) 2018-01-24
WO2019110728A1 (en) 2019-06-13

Similar Documents

Publication Publication Date Title
Tabrizi et al. Huntington disease: new insights into molecular pathogenesis and therapeutic opportunities
Schätzl et al. Facioscapulohumeral muscular dystrophy: genetics, gene activation and downstream signalling with regard to recent therapeutic approaches: an update
AU2015214141B2 (en) Inhibition of NEAT1 for treatment of solid tumors
Emery et al. Myelin gene regulatory factor is a critical transcriptional regulator required for CNS myelination
Van Epps et al. The zebrafish nrc mutant reveals a role for the polyphosphoinositide phosphatase synaptojanin 1 in cone photoreceptor ribbon anchoring
CN102459596A (en) Treatment of Lipid Transport and Metabolism Gene-Associated Diseases by Inhibition of Natural Antisense Transcripts Targeting Lipid Transport and Metabolism Genes
WO2011029092A1 (en) Klf family members regulate intrinsic axon regeneration ability
Tam et al. Therapeutic benefit derived from RNAi-mediated ablation of IMPDH1 transcripts in a murine model of autosomal dominant retinitis pigmentosa (RP10)
US20190203207A1 (en) Anabolic Enhancers for Ameliorating Neurodegeneration
JP2025118647A (en) Compositions and methods for the treatment of leukodystrophies, and whole animal and cell models for identifying effective agents for the treatment of leukodystrophies
Gentile et al. Divalent siRNA for prion disease
JP7682538B2 (en) Feedback-enabled synthetic genes, target seed match cassettes, and uses thereof
US20140056929A1 (en) IMMUNOMODULATION BY CONTROLLING INTERFERON-GAMMA LEVELS WITH THE LONG NON-CODING RNA NeST
US10881746B2 (en) Means and methods to treat dystonia
EP3720961A1 (en) Means and methods to treat torsin related neurological diseases
US20240200065A1 (en) Compositions and methods useful for the treatment of h-abc leukodystrophy
US20250170273A1 (en) Therapeutic factors for the treatment of polyq diseases
JP2015515485A (en) Archease as a member of the RNA ligase complex
US20210244828A1 (en) Miri26-5p for treating motor neuron diseases
US20250228918A1 (en) Methods of controlling body weight and/or energy expenditure
US11207426B2 (en) Compositions and methods for selective inhibition of grainyhead-like protein expression
Doran Re-evaluating the Role of SARM1 as a Transcriptional Regulator Using Improved Genome-Edited Mouse Models
Trollope Zebrafish as a translational model of Parkinson’s disease–a study of microRNAs
Munnich et al. Vanessa Vedrenne, Ali Gowher, 2, 6 Pascale De Lonlay, 3 Patrick Nitschke, 4 Valérie Serre, Nathalie Boddaert, 3 Cecilia Altuzarra, 5 Anne-Marie Mager-Heckel, 2 Florence Chretien, Nina Entelis, 2
WO2017038945A1 (en) Therapeutic agent for diseases associated with accumulation of abnormal substances in cells, biomarker, diagnostic agent, and screening method

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20200703

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: KATHOLIEKE UNIVERSITEIT LEUVEN, K.U.LEUVEN R&D

Owner name: VIB VZW

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
RAP3 Party data changed (applicant data changed or rights of an application transferred)

Owner name: KATHOLIEKE UNIVERSITEIT LEUVEN, K.U.LEUVEN R&D

Owner name: VIB VZW

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20240702