EP3720486A1 - Use of a non-structural protein from prv to protect against heart and skeletal muscle inflammation - Google Patents

Use of a non-structural protein from prv to protect against heart and skeletal muscle inflammation

Info

Publication number
EP3720486A1
EP3720486A1 EP18826507.8A EP18826507A EP3720486A1 EP 3720486 A1 EP3720486 A1 EP 3720486A1 EP 18826507 A EP18826507 A EP 18826507A EP 3720486 A1 EP3720486 A1 EP 3720486A1
Authority
EP
European Patent Office
Prior art keywords
prv
structural protein
sequence
polynucleotide
vector
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP18826507.8A
Other languages
German (de)
French (fr)
Inventor
Stephane Villoing
Kjartan HODNELAND
Petter Frost
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Intervet International BV
Original Assignee
Intervet International BV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Intervet International BV filed Critical Intervet International BV
Publication of EP3720486A1 publication Critical patent/EP3720486A1/en
Pending legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/15Reoviridae, e.g. calf diarrhea virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C07K14/08RNA viruses
    • C07K14/14Reoviridae, e.g. rotavirus, bluetongue virus, Colorado tick fever virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/55Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552Veterinary vaccine
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/80Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
    • Y02A40/81Aquaculture, e.g. of fish

Definitions

  • the present invention relates to the field of protection against heart and skeletal muscle inflammation (HSMI) disease in fish. More specifically the present invention relates to the protection of HSMI caused by Piscine orthoreovirus (PRV). More specifically the invention relates to the use of the non-structural proteins from PRV. In particular the invention relates to the use of the non-structural protein from PRV to protect against heart and skeletal muscle inflammation caused by an infection of PRV.
  • HSMI heart and skeletal muscle inflammation
  • PRV Piscine orthoreovirus
  • HSMI Heart and skeletal muscle inflammation
  • Salmonids includes salmon, trout, chars, freshwater whitefishes and graylings.
  • HSMI usually occurs 5-9 months after transfer of the fish to seawater, and is characterized by epi-, endo- and myocarditis, myocardial necrosis, myositis and necrosis of the red skeletal muscle.
  • the cumulative mortality may reach 20%, but the morbidity is higher as most fish in an affected sea cage show histopathological lesions in the heart.
  • Piscine orthoreovirus is the causative agent of heart and skeletal muscle inflammation (HSMI) in farmed salmon. HSMI causes significant economic losses to the salmon aquaculture industry, and there is currently no vaccine available. PRV is an orthoreovirus in the family Reovirus. The PRV genome is predicted to encode at least 12 primary translation products where putative functions are assigned (Table 1 ) based upon sequence homology to mammalian reovirus (MRV), avian orthoreovirus (ARV) and grass carp reovirus (GCRV).
  • MMV mammalian reovirus
  • ARV avian orthoreovirus
  • GCRV grass carp reovirus
  • Structural proteins are outer capsid proteins o1 , o3, A2, p1c and inner capsid proteins l1 , o2, m2, and A3.
  • the non structural proteins oNS and pNS are RNA binding protein that are thought to be involved in assembling the viral mRNA for viral genome replication.
  • WO201 1/041789 discloses the Piscine reovirus (PRV), and isolated nucleic acids sequences and peptides thereof. It describes schematically a method for generating antibodies against structural proteins s1 , s2, s3, m1 and FAST in rabbits. Antiserum from immunised rabbits recognised m 1 , s2, o3, protein in immunohistochemistry of hearts from salmon with HSMI. It was said that the serum against the m1 protein worked best and gave a good signal to noise ratio in immunohistochemistry. In WO2011/041789 the cell attachment protein is denoted o2, however function, length and weight are of s1.
  • WO2011/041789 describes that the PRV nucleic sequences and the PRV encoded proteins may be useful for generation of antibodies and generation of vaccine against Piscine reovirus and screening for drugs effective against Piscine reovirus.
  • EP 3039128 discloses an ex vivo method for propagating and isolating orthoreoviruses using nucleated erythrocytes, such as nucleated piscine erythrocytes.
  • EP 3039128 discloses that when the orthoreovirus obtained by the method is piscine reovirus (PRV), a vaccine
  • composition comprising an inactivated PRV virus may be used for the treatment and/or prevention of Heart and Skeletal Muscle Inflammation (HSMI).
  • HSMI Heart and Skeletal Muscle Inflammation
  • Non-structural proteins pNS and oNS have been found to be involved in disrupting the innate immune response to infection.
  • Carroll et al (Virology 448(2014)133-145) and Choudhury et al (J Virol 91 :e01298-17.) found that pNS and oNS prevent Stress Granules (SG) formation.
  • SGs are a component of the innate immune response to virus infection, and modulation of SG assembly is a common mechanism employed by viruses to counter this antiviral response.
  • non-structural protein in a vaccine composition showed that after challenge with the virus, viral RNA was somewhat reduced when compared to control compositions but the viral RNA levels were still at a high level. It was therefore surprising that histopathology data showed that the vaccines comprising the non-structural proteins had an effect on the heart muscle inflammation.
  • the present invention is directed to PRV non-structural protein as subunit for use in treatment of fish against heart and skeletal muscle inflammation (HSMI) disease. Also, the present invention is directed to PRV non-structural protein as subunit for use in protecting fish against heart and skeletal muscle inflammation (HSMI) disease.
  • the PRV non-structural protein is in the form of subunit composition, which means that the use of the whole virus is excluded.
  • the present invention is further directed to treatment of fish against heart and skeletal muscle inflammation (HSMI) disease by using a PRV non-structural protein.
  • the present invention is further directed to protecting fish against heart and skeletal muscle inflammation (HSMI) disease by using a PRV non-structural protein.
  • the PRV non-structural protein is pNS or oNS.
  • the use of a combination of pNS and oNS is also contemplated..
  • the PRV non-structural protein is a polypeptide having a sequence having at least about 70% identity to any one of SEQ ID NO: 12 or 13.
  • the PRV non-structural protein has at least about 72%, about 75%, about 77%, about 78%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99% or about 99.5% identity to any one of SEQ ID NO: 12 or 13.
  • the PRV non- structural protein is a polypeptide having at least 50 consecutive amino acids of a polypeptide having a sequence having at least about 70% identity to any one of SEQ ID NO: 12 or 13.
  • the treatment or protection treatment comprises administering to a fish a composition comprising a polypeptide of the PRV non-structural protein of the present invention and/or embodiments thereof.
  • the polypeptide has at least 50 consecutive amino acids of polypeptide having a sequence having at least about 70% identity to any one of SEQ ID NO: 12 or 13.
  • the treatment comprises administering to a fish a composition comprising a polypeptide having a sequence having at least about 72%, about 75%, about 77%, about 78%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99% or about 99.5% identity to any one of SEQ ID NO: 12 or 13.
  • the invention is directed to a polynucleotide encoding the PRV non-structural protein as defined herein for use in treatment in fish against heart and skeletal muscle inflammation disease.
  • the polynucleotide encodes for a PRV non-structural protein as a subunit protein.
  • the treatment comprises administering to fish a composition comprising a polynucleotide encoding a PRV non-structural protein as defined herein.
  • a composition comprising a polynucleotide encoding a PRV non-structural protein as defined herein.
  • the polynucleotide encoding a PRV non-structural protein is a polynucleotide having a sequence having at least about 70% identity to any one of SEQ ID NO: 14 or 15.
  • the polynucleotide encoding the PRV non-structural protein is a polynucleotide having a sequence having at least about 72%, about 75%, about 77%, about 78%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99% or about 99.5% identity to any one of SEQ ID NO: 14 or 15.
  • the treatment or protection treatment comprises administering to a fish a composition comprising a vector encoding a PRV non-structural protein as defined herein.
  • the vector comprises a polynucleotide encoding a PRV non-structural protein as defined herein.
  • the vector encodes for a PRV non-structural protein according to the invention and/or embodiments thereof.
  • the vector is an expression vector which encodes the PRV non-structural protein, preferably the vector is a DNA vector, replicon vector, a viral vector, or a plasmid, preferably a DNA vector or a plasmid.
  • the treatment or protection comprises additionally administering to a fish at least one PRV structural protein selected from the group comprising l1 , l2, l3, m1 , m2, s1 , s2, and s3.
  • at least one of the outer capsid proteins o1 , o2, and/or o3 are additionally administered.
  • o1 is additionally administered.
  • m2 is additionally administered.
  • the PRV structural protein is administered as a polypeptide.
  • At least one polynucleotide encoding a PRV structural protein selected from the group comprising l1 , l2, l3, m1 , m2, s1 , s2, and s3 is additionally administered.
  • a vector encoding at least one PRV structural protein selected from the group comprising A1 , K2, l3, m1 , m2, s1 , s2, and s3 is additionally administered.
  • the fish is a salmonid.
  • Another aspect of the invention relates to a vector, wherein the vector comprises at least a promoter sequence and polynucleotide sequence that encodes for a PRV non-structural protein.
  • the polynucleotide sequence encodes for a PRV non-structural protein as defined herein.
  • Another aspect of the invention relates to a vaccine comprising a vector comprising DNA- encoding sequence that encodes for a PRV non-structural protein.
  • the vector according to the invention and/or embodiments thereof further comprises transcription or translation enhancing sequences.
  • the polynucleotide sequence that encodes for a PRV non-structural protein encodes for pNS and/or oNS.
  • the polynucleotide sequence that encodes for a PRV non-structural protein comprises a nucleotide sequences that is at least 70% identical to any of the sequences SEQ ID NO: 14 or 15, or comprises a nucleotide sequences that is at least 70% identical to a nucleotide sequence that encodes for a
  • DNA-encoding sequence that encodes for a PRV non-structural protein encodes for any of the PRV non- structural protein, or fragment thereof as defined in the present invention.
  • the invention in another aspect relates to a vaccine composition
  • a vaccine composition comprising a vector according to the invention and/or any embodiments thereof.
  • the invention in another aspect relates to a vaccine composition
  • a vaccine composition comprising a PRV non- structural protein as defined herein as a subunit .
  • a vaccine of the present invention and/or embodiments thereof is used in a treatment or protection of fish against heart and skeletal muscle inflammation disease.
  • PRV polypeptide is a polypeptide from a PRV non-structural protein. It may be the whole protein or a fragment thereof. PRV polypeptide and PRV non-structural protein are used interchangeably.
  • PRV polynucleotide is a polynucleotide that encodes for a PRV non-structural protein or a PRV polypeptide.
  • treatment is to be understood as bringing a body from a pathological state back to its normal, healthy state or preventing a pathological state.
  • the latter may be denoted as “prophylactic treatment”.
  • Treatment is meant to cover protection against a pathological state.
  • Treatment also means to have a reduction in pathological changes when compared to individuals that have not been treated.
  • there is at least a reduction of 10% in pathological changes more preferably, at least a reduction of 25%, 20%, 25%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or even a 100% in pathological changes when compared to individuals that have not been treated.
  • pharmaceutically acceptable carrier is intended to include formulation used to stabilize, solubilize and otherwise be mixed with active ingredients to be administered to living animals, including fish. This includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.
  • disease as used herein is intended to be generally synonymous, and is used interchangeably with, the terms “disorder” and “condition” (as in medical condition), in that all reflect an abnormal condition of the body or of one of its parts that impairs normal functioning and is typically manifested by distinguishing signs and symptoms.
  • Heart and skeletal muscle inflammation was first diagnosed in 1999, and there has since been a yearly increase in the number of recorded outbreaks. Atlantic salmon are commonly affected 5 to 9 month after transfer to sea, but outbreaks have been recorded as early as 14 d following seawater transfer. Affected fish are anorexic and display abnormal swimming behaviour. Autopsy findings typically include a pale heart, yellow liver, ascites, swollen spleen and petechiae in the perivisceral fat. HSMI is diagnosed on the basis of histopathology. The major pathological changes occur in the myocardium and red skeletal muscle, where extensive inflammation and multifocal necrosis of myocytes are evident.
  • HSMI is characterized by epi-, endo- and myocarditis, myocardial necrosis, myositis and necrosis of the red skeletal muscle. Most notably the epicarditis and myocarditis characterise the disease.
  • subunit protein means an isolated protein of a pathogen such as a specific protein.
  • subunit protein means an isolated specific protein from PRV. More than one subunit protein may be used in the present invention, but always as an isolated protein and not in the form of a virus, whole or otherwise. Also combination of subunit proteins are contemplated, but not in the form of a virus, whole or otherwise. Usually a subunit protein is a recombinant protein. The subunit protein may be used in a subunit vaccine.
  • a subunit vaccine as used herein presents an antigen to the immune system without introducing viral particles, whole or otherwise.
  • One method of production involves isolation of a specific protein from a virus and administering this by itself, or a recombinant method of producing a specific protein.
  • vector any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, virus, replicon particle virion, etc., which is capable of expressing DNA sequences contained therein, where such sequences are operatively linked to other sequences capable of effecting their expression.
  • the term includes cloning and expression vehicles, as well as viral vectors.
  • the term vector is given here a functional definition, and any DNA sequence which is capable of effecting expression of a specified DNA sequence disposed therein is included in this term as it is applied to the specified sequence.
  • vectors of utility in recombinant DNA techniques are often in the form of "plasmids" referred to as circular double stranded DNA loops which, in their vector form, are not bound to the chromosome.
  • Replicon means any nucleotide sequence or molecule which possesses a replication origin and which is therefore potentially capable of being replicated in a suitable cell.
  • recombinant virus is meant a virus that has been genetically altered, e.g., by the addition or insertion of the coding sequence as defined herein into the particle.
  • control sequences and “control elements” refer collectively to promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites ("IRES"), enhancers, and the like, which collectively provide for the replication, transcription and translation of a coding sequence in a recipient cell. Not all of these control sequences/elements need always be present so long as the selected coding sequence is capable of being replicated, transcribed and translated in an appropriate host cell.
  • IRS internal ribosome entry sites
  • operably linked refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function.
  • control sequences operably linked to a coding sequence are capable of effecting the expression of the coding sequence.
  • the control sequences need not be contiguous with the coding sequence, so long as they function to direct the expression thereof.
  • intervening untranslated yet transcribed sequences can be present between a promoter sequence and the coding sequence and the promoter sequence can still be considered “operably linked" to the coding sequence.
  • nucleic acid sequences or two amino acid sequences are identical (i.e., on a nucleotide-by-nucleotide basis or amino acid-by-amino acid basis) over the window of comparison.
  • percentage of sequence identity is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base or amino acid occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
  • substantially identical denotes a characteristic of a polynucleotide sequence or polypeptide sequence, wherein the polynucleotide comprises a sequence that has at least 70 percent sequence identity, preferably at least 80 percent identity and often 90 to 95 percent sequence identity, more usually at least 99 percent sequence identity as compared to a reference sequence over a comparison window of at least 20 nucleotide positions or amino acid positions.
  • Alignment tools to determine the sequence identity are well known to a skilled person, such as BLAST (Altschul et al , Nucleic Acids Res. 1997;25:3389-3402) and FASTA (Pearson and Lipman . Natl. Acad. Sci. USA. 1988;85:2444-2448).
  • Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains.
  • a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine;
  • a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine;
  • a group of amino acids having amide-containing side chains is asparagine and glutamine;
  • a group of amino acids having aromatic side chains is
  • phenylalanine, tyrosine, and tryptophan a group of amino acids having basic side chains is lysine, arginine, and histidine
  • a group of amino acids having sulfur-containing side chains is cysteine and methionine.
  • Preferred conservative amino acids substitution groups are: valine- leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine- glutamine.
  • the terms“protecting” or“providing protection to” and “aids in the protection” do not require complete protection from any indication of infection.
  • “aids in the protection” can mean that the protection is sufficient such that, after challenge, symptoms of the underlying infection are at least reduced, and/or that one or more of the underlying cellular, physiological, or biochemical causes or mechanisms causing the symptoms are reduced and/or eliminated.
  • “reduced,” as used in this context means relative to the state of the infection, including the molecular state of the infection, not just the physiological state of the infection.
  • Protecting against HSMI means that there is a reduction in heart lesions.
  • heart lesion is scored histopathological changes.
  • the histopathological changes are scored from 0 to 4 using criteria described in Table 4A and 4B.
  • heart lesions in consistence with HSMI are scored for epicardial and myocardial changes.
  • Suitably protection means that there is a reduction in epicardial changes of at least 10% when compared to fish that are infected with PRV and have not been treated with the non-structural PRV proteins of the present invention. More preferably, there is at least 20%, 25,% 30%, 40%, 50%, 60%, 70% 75%, 80%, 85%, 90%, or even at 95% reduction in epicardial changes when compared to fish that are infected with PRV and have not been treated with the non-structural PRV proteins of the present invention.
  • Suitably protection means that there is a reduction in myocardial changes of at least 10% when compared to fish that are infected with PRV and have not been treated with the non-structural PRV proteins of the present invention. More preferably, there is at least 20%, 25,% 30%, 40%, 50%, 60%, 70% 75%, 80%, 85%, 90%, or even at 95% reduction in myocardial changes when compared to fish that are infected with PRV and have not been treated with the non-structural PRV proteins of the present invention.
  • a reduction in myocardial changes of between 100% and 20% more preferably there is a reduction in myocardial changes of between 30% and 90%, more preferably there is a reduction in myocardial changes of between 35% and 85%, more preferably there is a reduction in myocardial changes of between 40% and 80%, more preferably there is a reduction in myocardial changes of between 45% and 75%, more preferably there is a reduction in myocardial changes of between 50% and 70%, more preferably there is a reduction in myocardial changes of between 55% and 65%.
  • the present invention is directed to a treatment or protection of fish against heart and skeletal muscle inflammation (HSMI).
  • HSMI may be caused by Piscine orthoreovirus (PRV).
  • PRV Piscine orthoreovirus
  • PRV non-structural proteins appear to have only a modest effect on viral load, but are very effective in preventing HSMI after infection with PRV.
  • the PRV non-structural protein of the present invention and/or embodiments is a subunit protein.
  • the protein may be recombinantly produced with systems that are well known to a skilled person, such as with expression vectors in suitable cells, bacterial expression systems, eukaryotic expression system, such as yeast expression systems, baculovirus system,
  • Filamentous fungi system Filamentous fungi system, leishmania expression system, mammalian systems, such as Chinese Hamster ovary (CHO) or Human Embryonic Kidney (HEK) systems.
  • mammalian systems such as Chinese Hamster ovary (CHO) or Human Embryonic Kidney (HEK) systems.
  • the present invention does not relate to the use of the whole virus.
  • the PRV non-structural protein may be pNS or oNS and also the use of a combination of pNS and oNS is contemplated.
  • the amino acid sequence of pNS is SEQ ID NO: 12 and the amino acid sequence of oNS is SEQ ID NO: 13 (figure 1 and 2).
  • the PRV non-structural protein may be a polypeptide fragment comprising about 50 consecutive amino acids of a PRV non-structural protein described herein.
  • the PRV non-structural protein fragment may be a polypeptide comprising about 60 consecutive amino acids of a PRV non-structural polypeptide described herein.
  • the PRV non-structural protein fragment may be a PRV non- structural polypeptide comprising about 75 consecutive amino acids of a PRV non-structural protein described herein. In another embodiment, the PRV non-structural protein fragment may be a PRV non-structural polypeptide comprising about 90 consecutive amino acids of a PRV non-structural protein described herein. In another embodiment, the PRV non-structural protein fragment may be a polypeptide comprising about 100 consecutive amino acids of a PRV non- structural protein described herein. In another embodiment, the PRV non-structural protein fragment may be a polypeptide comprising about 120 consecutive amino acids of a PRV non- structural protein described herein. In another embodiment, the PRV non-structural protein fragment may be a polypeptide comprising about 150 or more consecutive amino acids of a PRV non-structural protein described herein.
  • the PRV non-structural protein fragment may be a polypeptide comprising from about 50 to about 750, about 60 to about 700, about 70 to about 650, about 75 to about 600, about 80 to about 550, about 90 to about 500, about 100 to about 450, about 120 to about 400, about 140 to about 350, about 150 to about 300, about 160 to about 250, about 170 to about 220, about 180 to about 200 or more consecutive amino acids of a PRV non-structural protein described herein.
  • the PRV non-structural protein is a polypeptide having a sequence having at least about 70% identity to any one of SEQ ID NO: 12 or 13.
  • the PRV non-structural protein is a polypeptide having a sequence having at least about 72%, about 74%, about 75%, about 76%, about 78%, about 80%, about 82%, about 84%, about 85%, about 87%, about 88%, about 90%, about 91 %, about
  • the PRV non-structural protein is a polypeptide having a sequence having at least about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to any one of SEQ ID NO: 12 or 13.
  • the PRV non-structural polypeptide is encoded by a nucleic acid having a sequence having at least about 70% identity to any one of SEQ ID NOs: 14 or 15, or a fragment thereof.
  • the PRV polypeptide is encoded by a polynucleotide having a sequence having at least about 72%, about 74%, about 75%, about 76%, about 78%, about 80%, about 82%, about 84%, about 85%, about 87%, about
  • the PRV polypeptide is encoded by a polynucleotide having a sequence having at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to that of any one of SEQ ID NOs: 14 or 15, or a fragment thereof.
  • the treatment or protection comprises administering to a fish a composition comprising a polypeptide of the PRV non-structural protein as described herein.
  • the PRV polypeptide has at least 50 consecutive amino acids of a polypeptide having a sequence having at least 70% identity to any of SEQ ID NO: 12 or 13.
  • the PRV polypeptide has an amino acids sequence of any of SEQ ID NO: 12 or 13.
  • the PRV polypeptide or PRV non-structural protein is encoded by a nucleic acid complementary to a PRV
  • polynucleotide sequence having a sequence having at least 70% identity to any of SEQ ID NOs: 14 or 15, or a fragment thereof.
  • the PRV polynucleotide has a length from about 150 to about 2200, about 200 to about 2000, about 250 to about 1800, about 300 to about 1600, about 350 to about 1400, about 300 to about 1200, about 400 to about 1000, about 500 to about 900, about 600 to about 800, about 650 to about 750, or more nucleotides.
  • the treatment or protection comprises administering to fish a composition comprising a polynucleotide encoding the PRV non-structural protein as defined herein.
  • a composition comprising a polynucleotide encoding the PRV non-structural protein as defined herein.
  • the polynucleotide encoding the PRV non- structural protein is a polynucleotide having a sequence having at least 70% identity to any of SEQ ID NO: 14 or 15.
  • the polynucleotide encoding the PRV non-structural protein is polynucleotide having a sequence having at least about 72%, about 74%, about 75%, about 76%, about 78%, about 80%, about 82%, about 84%, about 85%, about 87%, about 88%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, identity to any one of any one of SEQ ID NO: 14 or 15.
  • the PRV polynucleotide having a sequence having at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to any one of SEQ ID NO: 14 or 15.
  • the treatment comprises administering to fish a composition comprising a vector encoding the PRV non-structural protein as defined herein.
  • the vector comprises a polynucleotide encoding the PRV non- structural protein as defined herein.
  • the vector encodes for a PRV non-structural protein according to the invention and/or embodiments thereof.
  • the vector is an expression vector. Suitable vectors are DNA vector, replicon vector, plasmid, phage, or a viral vector, preferably a DNA vector or plasmid.
  • the vector is non-viral.
  • the vector is an expression vector.
  • the treatment comprises the production of the PRV non-structural protein in the cell of the target animal.
  • This may be accomplished by e.g. DNA vaccines.
  • the internal production of proteins is often accomplished by using a suitable expression vector comprising a suitable promoter.
  • suitable promoters such as e.g. the CMV promoter.
  • the vector of the present invention and/or embodiments thereof comprises sequences that optimise the expression in eukaryotic cells.
  • the vectors may include eukaryotic sequences for performing transcription (sequences upstream of 5', promoters, intron-processing signals) and translation (polyadenylation signals) in eukaryotic cells.
  • the PRV polynucleotide is administered as naked DNA.
  • the PRV non-structural protein of the invention can be administered by any appropriate route of administration that results in a protection against HSMI, for which the PRV non-structural protein will be formulated in a manner that is suitable for the chosen route of administration.
  • the administration in the methods described herein may be oral administration, immersion administration or injection administration.
  • the administration is injection
  • administration More preferably the administration is intramuscular injection.
  • the PRV polypeptide of the present invention may be administered in the presence of agents which enhance uptake of the PRV polypeptide by target cells, such as phospholipid formulation, e.g, a liposome.
  • agents which enhance uptake of the PRV polypeptide by target cells such as phospholipid formulation, e.g, a liposome.
  • the PRV polynucleotide or the vector of the present invention is also administered in the presence of agents which enhance uptake of the polynucleotide or vector by target cells, such as phospholipid formulation, e.g, a liposome, lipid nanoparticles, polymeric nanocarriers, or cationic dendrimers.
  • agents which enhance uptake of the polynucleotide or vector by target cells such as phospholipid formulation, e.g, a liposome, lipid nanoparticles, polymeric nanocarriers, or cationic dendrimers.
  • Suitable administration method for polynucleotides and/or vectors include electroporation of . polynucleotides and/or vectors.
  • the treatment of the invention and/or any embodiments thereof is useful to vaccinate a fish against heart muscle inflammation pathology caused by infection of PRV.
  • the treatment of the invention and/or any embodiments thereof is useful to protect a fish against heart muscle inflammation pathology caused by infection of PRV.
  • the treatment or protection of the invention and/or any embodiments thereof does not comprise PRV as a whole virus, live, killed or otherwise.
  • the treatment comprises additionally administering to a fish a PRV structural protein selected from the group comprising l1 , l2, l3, m1 , m2, s1 , s2, and s3.
  • a PRV structural protein selected from the group comprising l1 , l2, l3, m1 , m2, s1 , s2, and s3.
  • the outer capsid proteins o1 , o2, and/or o3 are additionally administered.
  • o1 is additionally administered.
  • m2 is additionally administered
  • an expression vector encoding the PRV structural protein selected from the group comprising l1 , l2, l3, m1 , m2, s1 , s2, and s3 is used.
  • the PRV structural protein may be m2 or o1 and also the use of a combination of m2 and o1 is contemplated.
  • the amino acid sequence of m2 is SEQ ID NO: 18 and the amino acid sequence of o1 is SEQ ID NO: 16.
  • the PRV structural protein may be a polypeptide fragment comprising about 50 consecutive amino acids of a PRV structural protein described herein.
  • the PRV structural protein fragment may be a polypeptide comprising about 60 consecutive amino acids of a PRV structural polypeptide described herein.
  • the PRV structural protein fragment may be a PRV structural polypeptide comprising about 75 consecutive amino acids of a PRV structural protein described herein.
  • the PRV structural protein fragment may be a PRV structural polypeptide comprising about 90 consecutive amino acids of a PRV structural protein described herein. In another embodiment, the PRV structural protein fragment may be a polypeptide comprising about 100 consecutive amino acids of a PRV structural protein described herein. In another embodiment, the PRV structural protein fragment may be a polypeptide comprising about 120 consecutive amino acids of a PRV structural protein described herein. In another embodiment, the PRV structural protein fragment may be a polypeptide comprising about 150 or more consecutive amino acids of a PRV structural protein described herein.
  • the PRV structural protein fragment may be a polypeptide comprising from about 50 to about 750, about 60 to about 700, about 70 to about 650, about 75 to about 600, about 80 to about 550, about 90 to about 500, about 100 to about 450, about 120 to about 400, about 140 to about 350, about 150 to about 300, about 160 to about 250, about 170 to about 220, about 180 to about 200 or more consecutive amino acids of a PRV structural protein described herein.
  • the PRV structural protein is a polypeptide having a sequence having at least about 70% identity to any one of SEQ ID NO: 16 or 18.
  • the PRV structural protein is a polypeptide having a sequence having at least about 72%, about 74%, about 75%, about 76%, about 78%, about 80%, about 82%, about 84%, about 85%, about 87%, about 88%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, identity to any one of SEQ ID NO: 16 or 18.
  • the PRV structural protein is a polypeptide having a sequence having at least about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to any one of SEQ ID NO: 16 or 18.
  • the PRV structural polypeptide is encoded by a nucleic acid having a sequence having at least about 70% identity to any one of SEQ ID NOs: 17 or 19, or a fragment thereof.
  • the PRV structural polypeptide is encoded by a polynucleotide having a sequence having at least about 72%, about 74%, about 75%, about 76%, about 78%, about 80%, about 82%, about 84%, about 85%, about 87%, about 88%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, identity to any one of SEQ ID NO: 17 or 19, or a fragment thereof.
  • the PRV structural polypeptide is encoded by a polynucleotide having a sequence having at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to that of any one of SEQ ID NOs: 17 or 19, or a fragment thereof.
  • the treatment or protection additionally comprises administering to a fish a composition comprising a polypeptide of the PRV structural protein as described herein.
  • the PRV structural polypeptide has at least 50 consecutive amino acids of a polypeptide having a sequence having at least 70% identity to any of SEQ ID NO: 16 or 18.
  • the PRV structural polypeptide has an amino acids sequence of any of SEQ ID NO: 16 or 18.
  • the PRV polypeptide or PRV structural protein is encoded by a nucleic acid complementary to a PRV polynucleotide sequence having a sequence having at least 70% identity to any of SEQ ID NOs: 17 or 19, or a fragment thereof.
  • the PRV polynucleotide has a length from about 150 to about 2200, about 200 to about 2000, about 250 to about 1800, about 300 to about 1600, about 350 to about 1400, about 300 to about 1200, about 400 to about 1000, about 500 to about 900, about 600 to about 800, about 650 to about 750, or more nucleotides.
  • the treatment or protection comprises administering to fish a composition comprising a polynucleotide encoding the PRV structural protein as defined herein.
  • the polynucleotide encoding the PRV structural protein is a polynucleotide having a sequence having at least 70% identity to any of SEQ ID NO: 17 or 19.
  • the polynucleotide encoding the PRV structural protein is polynucleotide having a sequence having at least about 72%, about 74%, about 75%, about 76%, about 78%, about 80%, about 82%, about 84%, about 85%, about 87%, about 88%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, identity to any one of any one of SEQ ID NO: 17 or 19.
  • the PRV polynucleotide having a sequence having at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to any one of SEQ ID NO: 17 or 19.
  • the fish is a salmonid.
  • Salmonids include salmon, trout, chars, freshwater whitefishes, and graylings.
  • the invention is directed to a vaccine comprising a vector comprising polynucleotide sequence that encodes for a PRV non-structural protein.
  • the vaccine comprises a vector of the invention and/or embodiments thereof.
  • the invention is directed to a vaccine composition
  • a vaccine composition comprising a PRV non- structural protein as defined herein as a subunit .
  • the vaccine is used in a treatment or protection of fish against HSMI disease.
  • the vaccine is used to protect fish against HSMI disease.
  • the vaccine does not comprise PRV particles, live, killed, attenuated or otherwise.
  • Suitable the vector comprises a promoter.
  • Classic promoters include the human
  • CMV/immediate early or CMV-chicken-b actin (CAGG) promoters are used for most DNA vectors since they drive high constitutive expression levels in a wide range of mammalian tissues and do not suppress downstream read-through. Improvement of expression and immunogenicity have been observed by modifying CMV promoters (i.e., incorporation of HTLV-1 R-U5 downstream of the CMV promoter) or by using chimeric SV40-CMV promoter.
  • Alternatives to CMV promoters include host tissue-specific promoters, which avoid constitutive expression of antigens in inappropriate tissues. The presence of an intron in the vector backbone downstream of the promoter can enhance the stability of mRNA and increase gene expression.
  • a kozak sequence immediately prior to the ATG start codon may further enhance protein expression.
  • the use of species-specific codons increases protein expression.
  • Gene expression can be manipulated by altering the polyA sequence, which is required for proper termination of transcription and export of mRNA from the nucleus. Many current DNA vectors use the bovine hormone terminator sequence. Alteration of the polyA sequence may enhance gene expression of DNA vectors.
  • an embodiment of the present invention and/or embodiments thereof is directed to a vector comprising a promoter sequence and a polynucleotide sequence that encodes for a PRV non-structural protein.
  • the vector further comprises an enhancing 5’ sequence.
  • the promoter is a CMV promoter.
  • Many commercially available vectors comprise the CMV promoter, such as e.g. the pcDNA3 plasmid (Invitrogen).
  • the promoter is preferably operately joined to the polynucleotide sequence that encodes for a PRV non-structural protein.
  • the expression "operatively joined” means that the PRV non-structural protein is expressed in the correct reading frame under the control of the promoter .
  • another aspect of the invention relates to a vector, hereinafter the vector of the invention, which comprises at least a promoter sequence and polynucleotide sequence that encodes for a PRV non-structural protein.
  • Said vector can be a viral vector or a non-viral vector.
  • the vector of the invention can be obtained using conventional methods known to a person skilled in the art (Sambrook et al., 1989).
  • the vector encodes the PRV non structural protein as a subunit protein.
  • the expression of PRV non structural protein is such that a PRV viral particle cannot be assembled.
  • the vector of the invention is a non-viral vector, such as a plasmid or an expression vector that can be expressed in eukaryotic cells, e.g. in animals cells, which comprises at least a promoter sequence and polynucleotide sequence that encodes for a PRV non-structural protein, which, when introduced into a host cell, is either integrated into the genome of said cell or not.
  • a non-viral vector such as a plasmid or an expression vector that can be expressed in eukaryotic cells, e.g. in animals cells, which comprises at least a promoter sequence and polynucleotide sequence that encodes for a PRV non-structural protein, which, when introduced into a host cell, is either integrated into the genome of said cell or not.
  • the vector of the invention and/or embodiments thereof may also contain the necessary elements for expression of the PRV non-structural protein and the elements that regulate its transcription and/or translation.
  • the vector of the invention and/or embodiments thereof may also contain RNA-processing sequences such as intron sequences for transcript splicing, transcription termination sequences, sequences for peptide secretion, etc.
  • the vector of the invention may contain an origin of replication and a selectable marker, such as an antibiotic-resistant gene.
  • the vector of the invention and/or embodiments thereof contains a single polynucleotide sequence that encodes for a PRV non-structural protein.
  • the vector of the invention contains two or more polynucleotide sequences that encodes for a PRV non-structural protein.
  • the vector of the invention can encode two or more different PRV non-structural protein.
  • the vector of the invention can encode one PRV non-structural and one or more PRV structural proteins.
  • the vector of the invention can encode two PRV non-structural and one or more PRV structural proteins.
  • the vector of the invention encodes for further proteins from a fish pathogen other than PRV, thereby producing a multi-purpose vaccine.
  • polynucleotide of pG of VHSV, the VP2 of IPNV or the E2 protein of PDV may be included in the same vector.
  • the vector of the invention encodes at least pNS and at least one PRV structural protein.
  • the vector of the invention encodes at least oNS and at least one PRV structural protein.
  • the vector of the invention encodes pNS and pNS and at least one PRV structural protein.
  • the vector of the invention encodes at least pNS and o1.
  • the vector of the invention encodes at least pNS and m2.
  • the vector of the invention encodes at least oNS and o1.
  • the vector of the invention encodes at least oNS and m2.
  • the vector of the invention encodes pNS and pNS and o1.
  • the vector of the invention encodes pNS and pNS and m2.
  • the vector of the invention encodes pNS and pNS and o1 and m2.
  • the cells into which said vector of the invention has been introduced express the PRV non-structural protein and optionally the PRV structural protein in the vector of the invention, resulting in the protection or treatment of the fish against HSMI pathology or disease.
  • the vector of the invention and/or embodiments thereof can include CpG dinucleotides, as they have immunostimulatory effects, thus enabling the DNA to act as an adjuvant.
  • the vector of the invention and/or embodiments thereof may comprise two polynucleotide sequence that each encodes for a different PRV non-structural protein.
  • the vector of the invention and/or embodiments thereof may comprise two polynucleotide sequence that each encodes for a different PRV non-structural protein.
  • polynucleotide sequence that encodes for a PRV non-structural protein encodes for pNS and/or oNS.
  • the polynucleotide sequence that encodes for a PRV non-structural protein encodes for at least pNS.
  • the vector may code for pNS and oNS.
  • the pNS and oNS may be under a single promoter or they may each be linked to a separate promoter.
  • two or more vectors are used in the method of the invention and/or embodiments thereof wherein each vector comprises a polynucleotide sequence that encodes for a different PRV non-structural protein or PRV structural protein such as m2 or s1.
  • the polynucleotide sequence that encodes for a PRV non-structural protein comprises any of the sequences SEQ ID NO: 14 or 15, or comprises a nucleotide sequences that encodes for a polypeptide havingy any of the sequences SEQ ID NO: 12 or 13.
  • the DNA- encoding sequence that encodes for a PRV non-structural protein may comprise a nucleotide sequences that is at least 70% identical to any of the sequences SEQ ID NO: 14 or 15, or comprises a nucleotide sequences that is at least 70% identical to a nucleotide sequence that encodes for a polypeptide having any of the sequences SEQ ID NO: 12 or 13.
  • the polynucleotide sequence that encodes for a PRV non-structural protein may comprise a nucleotide sequences that is at least about 72%, about 74%, about 75%, about 76%, about 78%, about 80%, about 82%, about 84%, about 85%, about 87%, about 88%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, identical to any one of SEQ ID NO: 14 or 15 or to a nucleotide sequence that encodes for a polypeptide having a sequence of any of the sequences SEQ ID NO: 12 or 13.
  • the polynucleotide sequence that encodes for a PRV non-structural protein may comprise a nucleotide sequences that is at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identical to any one of SEQ ID NOs 14 or 15 or to a nucleotide sequence that encodes for a polypeptide having any of the sequences SEQ ID NO: 12 or 13.
  • polynucleotide sequence that encodes for a PRV non-structural protein comprises a nucleotide sequence that is complementary to a sequence having at least 70% identity to any one of SEQ ID NOs 14 or 15 or to a nucleotide sequence that encodes for a polypeptide having any of the sequences SEQ ID NO: 12 or 13.
  • the polynucleotide sequence that encodes for a PRV structural protein comprises any of the sequences SEQ ID NO: 17 or 19, or comprises a nucleotide sequences that encodes for a polypeptide havingy any of the sequences SEQ ID NO: 16 or 18.
  • the DNA- encoding sequence that encodes for a PRV structural protein may comprise a nucleotide sequences that is at least 70% identical to any of the sequences SEQ ID NO: 17 or 19, or comprises a nucleotide sequences that is at least 70% identical to a nucleotide sequence that encodes for a polypeptide having any of the sequences SEQ ID NO: 16 or 18.
  • the polynucleotide sequence that encodes for a PRV structural protein may comprise a nucleotide sequences that is at least about 72%, about 74%, about 75%, about 76%, about 78%, about 80%, about 82%, about 84%, about 85%, about 87%, about 88%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, identical to any one of SEQ ID NO: 17 or 19 or to a nucleotide sequence that encodes for a polypeptide having a sequence of any of the sequences SEQ ID NO: 16 or 18.
  • the polynucleotide sequence that encodes for a PRV structural protein may comprise a nucleotide sequences that is at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identical to any one of SEQ ID NOs 17 or 19 or to a nucleotide sequence that encodes for a polypeptide having any of the sequences SEQ ID NO: 16 or 18.
  • polynucleotide sequence that encodes for a PRV structural protein comprises a nucleotide sequence that is complementary to a sequence having at least 70% identity to any one of SEQ ID NOs 17 or 17 or to a nucleotide sequence that encodes for a polypeptide having any of the sequences SEQ ID NO: 16 or 18.
  • vector of the present invention and/or embodiments thereof may also code for fragments of the PRV non-structural protein as defined herein.
  • the vector of the present invention and/or embodiments thereof encodes a fragment of the PRV non-structural protein comprising from about 50 to about 750, about 60 to about 700, about 70 to about 650, about 75 to about 600, about 80 to about 550, about 90 to about 500, about 100 to about 450, about 120 to about 400, about 140 to about 350, about 150 to about 300, about 160 to about 250, about 170 to about 220, about 180 to about 200 or more consecutive amino acids of a PRV non-structural protein as described herein.
  • vector of the present invention and/or embodiments thereof may also code for fragments of the PRV structural protein as defined herein.
  • the vector of the present invention and/or embodiments thereof encodes a fragment of the PRV structural protein comprising from about 50 to about 750, about 60 to about 700, about 70 to about 650, about 75 to about 600, about 80 to about 550, about 90 to about 500, about 100 to about 450, about 120 to about 400, about 140 to about 350, about 150 to about 300, about 160 to about 250, about 170 to about 220, about 180 to about 200 or more consecutive amino acids of a PRV structural protein as described herein.
  • polynucleotide sequence encodes for a PRV structural protein, and/or fragment thereof as defined in the present invention.
  • the vaccine comprises a vector according to the invention and/or any embodiments thereof.
  • the vaccine may comprise optionally one of more adjuvants and/or pharmaceutically acceptable ingredients.
  • the vaccine of the invention and/or embodiments thereof can be prepared in the form of an aqueous solution or suspension, in a pharmaceutically acceptable vehicle, such as saline solution, phosphate buffered saline (PBS), or any other pharmaceutically acceptable vehicle.
  • the adjuvants may comprise plasmid-encoded signalling molecules including cytokines, chemokines, immune costimulatory molecules, toll-like receptor agonists or inhibitors of immune suppressive pathways.
  • traditional adjuvants including killed bacteria, bacterial components, such LPS, aluminium salts, oil emulsions, polysaccharide particles, liposomes and biopolymers may be used.
  • Suitable systems use nanoparticles based on biodegradable polymers.
  • Synthetic polymers such as poly(vinylpyridine), polylactide-co- glycolides (PLG) and polylactide-co-glycolide acid (PLGA) may be used. Encapsulation of DNA helps protect the plasmid from nuclease degradation and provides prolonged release.
  • the vaccine of the invention and/or embodiments thereof may be prepared using conventional methods known by a person skilled in the art.
  • said vaccine is prepared using the PRV polypeptide, PRV polynucleotides, or a vector of the invention, optionally having one or more adjuvants and/or pharmaceutically acceptable vehicles.
  • the vector of the invention and/or embodiments thereof can be incorporated into conventional transfection reagents, such as liposomes, e.g. cationic liposomes, fluorocarbon emulsions, cochleates, tubules, gold particles, biodegradable microspheres, cationic polymers, etc.
  • transfection reagents such as liposomes, e.g. cationic liposomes, fluorocarbon emulsions, cochleates, tubules, gold particles, biodegradable microspheres, cationic polymers, etc.
  • the vector of the invention and/or embodiments thereof is administered by electroporation.
  • the PRV non-structural protein, polynucleotide encoding the PRV non-structural protein, PRV structural protein, polynucleotide encoding the PRV structural protein vectors of the present invention and/or embodiments thereof are administered in an effective amount.
  • the expression "effective amount” refers to an effective amount to provide protection against HSMI caused by an infection by PRV.
  • the pharmaceutically acceptable vehicles that may be used in the formulation of a vaccine of the invention must be sterile and physiologically compatible, e.g. sterile water, saline solution, aqueous buffers such as PBS, alcohols, polyols and suchlike. Said vaccine may also contain other additives, such as adjuvants, stabilisers, antioxidants, preservatives and suchlike.
  • the available adjuvants include, but are not limited to, aluminium salts or gels, carbomers, nonionic block copolymers, tocopherols, muramyl dipeptide, oil emulsions, cytokines, etc. The amount of adjuvant that may be added depends on the nature of the adjuvant.
  • the stabilisers available for use in vaccines according to the invention are, e.g. carbohydrates, including sorbitol, mannitol, dextrin, glucose and proteins such as albumin and casein, and buffers such as alkaline phosphatase.
  • the available preservatives include, among others, thimerosal, merthiolate and gentamicin.
  • ORFs open reading frames
  • PRV genes encoding pNS, s1 , s3, m2, and oNS
  • PfuUltra II Fusion HS DNA polymerase Agilent, Santa Clara, CA, USA
  • cDNA prepared like in an earlier study (Miller CL, et al. Localization of mammalian orthoreovirus proteins to cytoplasmic factory-like structures via nonoverlapping regions of microNS. J Virol 2010, 84(2):867-882).
  • Expression vector pcDNA3.1 (+) (Invitrogen) expressing PRV pNS, oNS, s1 , s3, m2, or enhanced Green fluorescent protein (EGFP) (control) was constructed.
  • the PCR amplicons of the ORFs were cloned into the Xbal restriction site of pcDNA3.1 .
  • CHSE-214 cells (ATCC CRL-1681 , Chinook salmon embryo) were cultivated in Leibovitz L-15 medium (L15, Life Technologies, Carlsbad, USA) supplemented with 10 % heat inactivated fetal bovine serum (FBS, Life technologies), 2 mM L-glutamine, 0.04 mM mercaptoethanol and 0.05 mg/ml gentamycin-sulphate (Life Technologies).
  • FBS heat inactivated fetal bovine serum
  • 2 mM L-glutamine 2 mM L-glutamine
  • 0.04 mM mercaptoethanol 0.04 mM mercaptoethanol
  • gentamycin-sulphate Life Technologies
  • transfected cells were diluted in 1 mL pre-equilibrated L-15 growth medium and 100 pL of the diluted cells was seeded onto gelatin embedded cover slips (12 mm) in a 24-well plate for expression analysis by immunofluorescence microscopy.
  • pcDNA3.1/EGFP construct was used as positive expression controls.
  • PRV piscine reovirus
  • the concentration of plasmid constructs were measured using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) and diluted in PBS to 1000 ng/pL. Samples for vaccination were prepared to contain 10 pg of each plasmid construct in a total volume 50 pL.
  • Cohabitant challenge experiment was performed following vaccination of a pcDNA3.1 -based expression vaccines.
  • the trials were performed using previously unvaccinated Atlantic salmon pre-smolts with an average weight of 30-40 g, confirmed free of common salmon pathogens.
  • the fish were kept in a freshwater flow-through system (temperature: 12°C; oxygen: > 70%; pH 6.6-6.9), acclimatized for 1 week and starved 48 hours prior to vaccination.
  • the fish were randomly selected for vaccination, anesthetized by bath immersion (2-5 min) in benzocaine chloride (0.5 g/10 L water, Apotekproduksjon AS, Oslo, Norway), labelled with passive integrated transponder (PIT) tags (two weeks prior to vaccination) and intramuscularly (i.m.) injected with the vaccines or control substances.
  • the challenges were performed in connection with transfer to seawater six weeks after vaccination and after photoperiod manipulation.
  • the shedders were i.p. injected with 0.1 mL of pooled heparinized blood samples from a previous PRV challenge experiment (Finstad et al. Piscine orthoreovirus (PRV) infects Atlantic salmon erythrocytes. Vet Res 2014, 45:35).
  • the inoculum was confirmed negative for the salmon viruses including infectious pancreatic necrosis virus (IPNV), infectious salmon anemia virus (ISAV), salmonid alphavirus (SAV) and piscine myocarditis virus (PMCV) by RT-qPCR.
  • IPNV infectious pancreatic necrosis virus
  • ISAV infectious salmon anemia virus
  • SAV salmonid alphavirus
  • PMCV piscine myocarditis virus
  • the fish were starved for 24 hours prior to challenge. Fish were divided into six groups, each vaccinated by i.m. injection of 10 pg/50 pl_ per pcDNA3.1 construct, control construct (pcDNA3.1/EGFP) or PBS (Table 3).
  • RNA quantification was performed using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA). For the plasma samples, a 10 pL volume was diluted in PBS to 140 pL and used in the Mini spin column (Qiagen), as recommended by the manufacturer.
  • the Qiagen OneStep kit (Qiagen) was used for RT-qPCR with a standard input of 100 ng (5 pL of 20 ng/pL) of the isolated total RNA per reaction. From the cell free plasma samples, 5 pL input of total eluted RNA was used.
  • the template RNA was denatured at 95°C for 5 min prior to RT-qPCR targeting PRV gene segment S1 (S1 Fwd: 5’TGCGTCCTGCGTATGGCACC’3 (SEQ ID NO: 9) S1 Rev: 5’GGCTGGCATGCCCGAATAGCA’3 (SEQ ID NO: 10) and S1 probe: 5 -FAM- ATCACAACGCCTACCT’3- MGBNFQ (SEQ ID NO: 11 ) using the following conditions: 400 nM primer, 300 nM probe, 400 nM dNTPs, 1.26 mM MgCI2, 1 :100 RNase Out (Invitrogen) and 1 x ROX reference dye.
  • the cycling conditions were 50°C for 30 min and 94°C for 15 min, followed by 35 cycles of 94°C/15 sec, 54°C/30 sec and 72°C/15 sec in an AriaMx (Agilent, Santa Clara, CA, USA). All samples were run in duplicates, and a sample was defined as positive if both parallels produced a Ct value below 35.
  • the PRV RT-qPCR results and the histopathology scores were analyzed statistically using the Mann Whitney compare ranks test. All statistical analysis described were performed with GraphPad Prism (GraphPad Software inc., USA) and p-values of p ⁇ 0.05 were considered as significant.
  • RT-qPCR analysis indicated high PRV loads at the two sampling points 6 and 8 wpc for both control. All four vaccinated groups remain a high viral load although viral RNA loads in blood cells was reduced when compared to the controls at 6 wpc (table 5). Group 1 showed significantly lower viral RNA load 6 wpc compared to control groups 5 and 6. Group 4 showed the highest viral load of all vaccination groups at both 6 and 8 wpc. In addition, group 4 showed higher PRV RNA levels than the control groups at 8 wpc.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The present invention is directed to a treatment method in fish against heart and skeletal muscle inflammation caused by Piscine orthoreovirus (PRV) by using PRV non-structural protein. The invention is further directed to vectors comprising a promoter sequence and a DNA-encoding sequence that encodes for a PRV non-structural protein and to vaccine compositions comprising such vectors.

Description

Title: Use of a non-structural protein from PRV to protect against heart and skeletal muscle inflammation
The present invention relates to the field of protection against heart and skeletal muscle inflammation (HSMI) disease in fish. More specifically the present invention relates to the protection of HSMI caused by Piscine orthoreovirus (PRV). More specifically the invention relates to the use of the non-structural proteins from PRV. In particular the invention relates to the use of the non-structural protein from PRV to protect against heart and skeletal muscle inflammation caused by an infection of PRV.
Background
Heart and skeletal muscle inflammation (HSMI) is an important disease in farmed salmonids. Salmonids includes salmon, trout, chars, freshwater whitefishes and graylings. HSMI usually occurs 5-9 months after transfer of the fish to seawater, and is characterized by epi-, endo- and myocarditis, myocardial necrosis, myositis and necrosis of the red skeletal muscle. The cumulative mortality may reach 20%, but the morbidity is higher as most fish in an affected sea cage show histopathological lesions in the heart.
Piscine orthoreovirus (PRV) is the causative agent of heart and skeletal muscle inflammation (HSMI) in farmed salmon. HSMI causes significant economic losses to the salmon aquaculture industry, and there is currently no vaccine available. PRV is an orthoreovirus in the family Reovirus. The PRV genome is predicted to encode at least 12 primary translation products where putative functions are assigned (Table 1 ) based upon sequence homology to mammalian reovirus (MRV), avian orthoreovirus (ARV) and grass carp reovirus (GCRV).
Table 1 :
Structural proteins are outer capsid proteins o1 , o3, A2, p1c and inner capsid proteins l1 , o2, m2, and A3. The non structural proteins oNS and pNS are RNA binding protein that are thought to be involved in assembling the viral mRNA for viral genome replication.
WO201 1/041789 discloses the Piscine reovirus (PRV), and isolated nucleic acids sequences and peptides thereof. It describes schematically a method for generating antibodies against structural proteins s1 , s2, s3, m1 and FAST in rabbits. Antiserum from immunised rabbits recognised m 1 , s2, o3, protein in immunohistochemistry of hearts from salmon with HSMI. It was said that the serum against the m1 protein worked best and gave a good signal to noise ratio in immunohistochemistry. In WO2011/041789 the cell attachment protein is denoted o2, however function, length and weight are of s1.
WO2011/041789 describes that the PRV nucleic sequences and the PRV encoded proteins may be useful for generation of antibodies and generation of vaccine against Piscine reovirus and screening for drugs effective against Piscine reovirus.
Generation of antibodies against certain structural proteins were described, however no description of any vaccine comprising any of the PRV non structural proteins and nucleic acids encoding these was disclosed, nor any experimental data with such a vaccine was disclosed in WO2011/041789.
EP 3039128 discloses an ex vivo method for propagating and isolating orthoreoviruses using nucleated erythrocytes, such as nucleated piscine erythrocytes. EP 3039128 discloses that when the orthoreovirus obtained by the method is piscine reovirus (PRV), a vaccine
composition comprising an inactivated PRV virus may be used for the treatment and/or prevention of Heart and Skeletal Muscle Inflammation (HSMI).
None of the above described studies show any effect against HSMI.
Non-structural proteins pNS and oNS have been found to be involved in disrupting the innate immune response to infection. Carroll et al (Virology 448(2014)133-145) and Choudhury et al (J Virol 91 :e01298-17.) found that pNS and oNS prevent Stress Granules (SG) formation. SGs are a component of the innate immune response to virus infection, and modulation of SG assembly is a common mechanism employed by viruses to counter this antiviral response. In addition, Stanifer et al (Scientific Reports 7, Article number: 10873 (2017)) demonstrated that pNS is solely responsible for sequestering interferon regulatory factor 3 (IRF3) thereby impairing the interferon-mediated antiviral immune response. The authors hypothesize that the pNS protein actively participates in immune evasion.
Using the non-structural protein in a vaccine composition showed that after challenge with the virus, viral RNA was somewhat reduced when compared to control compositions but the viral RNA levels were still at a high level. It was therefore surprising that histopathology data showed that the vaccines comprising the non-structural proteins had an effect on the heart muscle inflammation.
Summary of the Invention
The present invention is directed to PRV non-structural protein as subunit for use in treatment of fish against heart and skeletal muscle inflammation (HSMI) disease. Also, the present invention is directed to PRV non-structural protein as subunit for use in protecting fish against heart and skeletal muscle inflammation (HSMI) disease. The PRV non-structural protein is in the form of subunit composition, which means that the use of the whole virus is excluded.
The present invention is further directed to treatment of fish against heart and skeletal muscle inflammation (HSMI) disease by using a PRV non-structural protein. The present invention is further directed to protecting fish against heart and skeletal muscle inflammation (HSMI) disease by using a PRV non-structural protein.
Suitably the PRV non-structural protein is pNS or oNS. The use of a combination of pNS and oNS is also contemplated..
In a certain embodiment of the invention and/or embodiments thereof the PRV non-structural protein is a polypeptide having a sequence having at least about 70% identity to any one of SEQ ID NO: 12 or 13. Suitably the PRV non-structural protein has at least about 72%, about 75%, about 77%, about 78%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99% or about 99.5% identity to any one of SEQ ID NO: 12 or 13. Suitably, the PRV non- structural protein is a polypeptide having at least 50 consecutive amino acids of a polypeptide having a sequence having at least about 70% identity to any one of SEQ ID NO: 12 or 13.
In a certain embodiment of the invention and/or embodiments thereof the treatment or protection treatment comprises administering to a fish a composition comprising a polypeptide of the PRV non-structural protein of the present invention and/or embodiments thereof. Suitably the polypeptide has at least 50 consecutive amino acids of polypeptide having a sequence having at least about 70% identity to any one of SEQ ID NO: 12 or 13. In a certain embodiment of the invention and/or embodiments thereof the treatment comprises administering to a fish a composition comprising a polypeptide having a sequence having at least about 72%, about 75%, about 77%, about 78%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99% or about 99.5% identity to any one of SEQ ID NO: 12 or 13.
In another aspect the invention is directed to a polynucleotide encoding the PRV non-structural protein as defined herein for use in treatment in fish against heart and skeletal muscle inflammation disease. Preferably the polynucleotide encodes for a PRV non-structural protein as a subunit protein.
In another embodiment of the invention and/or embodiments thereof the treatment comprises administering to fish a composition comprising a polynucleotide encoding a PRV non-structural protein as defined herein. Suitably the polynucleotide encoding a PRV non-structural protein is a polynucleotide having a sequence having at least about 70% identity to any one of SEQ ID NO: 14 or 15. Suitably the polynucleotide encoding the PRV non-structural protein is a polynucleotide having a sequence having at least about 72%, about 75%, about 77%, about 78%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99% or about 99.5% identity to any one of SEQ ID NO: 14 or 15.
In a certain embodiment of the invention and/or embodiments thereof the treatment or protection treatment comprises administering to a fish a composition comprising a vector encoding a PRV non-structural protein as defined herein. Suitably the vector comprises a polynucleotide encoding a PRV non-structural protein as defined herein. Suitably, the vector encodes for a PRV non-structural protein according to the invention and/or embodiments thereof. Suitably, the vector is an expression vector which encodes the PRV non-structural protein, preferably the vector is a DNA vector, replicon vector, a viral vector, or a plasmid, preferably a DNA vector or a plasmid.
In yet another embodiment of the invention and/or embodiments thereof, the treatment or protection comprises additionally administering to a fish at least one PRV structural protein selected from the group comprising l1 , l2, l3, m1 , m2, s1 , s2, and s3. Suitably, at least one of the outer capsid proteins o1 , o2, and/or o3 are additionally administered. Preferably, o1 , is additionally administered. . Preferably, m2, is additionally administered. Suitably the PRV structural protein is administered as a polypeptide. In another embodiment, at least one polynucleotide encoding a PRV structural protein selected from the group comprising l1 , l2, l3, m1 , m2, s1 , s2, and s3 is additionally administered. In another embodiment a vector encoding at least one PRV structural protein selected from the group comprising A1 , K2, l3, m1 , m2, s1 , s2, and s3 is additionally administered.
Suitably, the fish is a salmonid.
Another aspect of the invention relates to a vector, wherein the vector comprises at least a promoter sequence and polynucleotide sequence that encodes for a PRV non-structural protein. Suitably the polynucleotide sequence encodes for a PRV non-structural protein as defined herein.
Another aspect of the invention relates to a vaccine comprising a vector comprising DNA- encoding sequence that encodes for a PRV non-structural protein.
Suitably, the vector according to the invention and/or embodiments thereof further comprises transcription or translation enhancing sequences. The vector of the invention and/or
combination thereof may comprise two polynucleotide sequences that each encodes for a different PRV non-structural protein. Suitably, the polynucleotide sequence that encodes for a PRV non-structural protein encodes for pNS and/or oNS. Suitably the polynucleotide sequence that encodes for a PRV non-structural protein comprises a nucleotide sequences that is at least 70% identical to any of the sequences SEQ ID NO: 14 or 15, or comprises a nucleotide sequences that is at least 70% identical to a nucleotide sequence that encodes for a
polypeptide having any of the sequences SEQ ID NO: 12 or 13. Suitably the DNA-encoding sequence that encodes for a PRV non-structural protein encodes for any of the PRV non- structural protein, or fragment thereof as defined in the present invention.
In another aspect the invention relates to a vaccine composition comprising a vector according to the invention and/or any embodiments thereof.
In another aspect the invention relates to a vaccine composition comprising a PRV non- structural protein as defined herein as a subunit .
Suitably a vaccine of the present invention and/or embodiments thereof is used in a treatment or protection of fish against heart and skeletal muscle inflammation disease.
Detailed description
Definitions As used herein, PRV polypeptide is a polypeptide from a PRV non-structural protein. It may be the whole protein or a fragment thereof. PRV polypeptide and PRV non-structural protein are used interchangeably.
As used herein, PRV polynucleotide is a polynucleotide that encodes for a PRV non-structural protein or a PRV polypeptide.
As used in the specification and the appended claims the term "treatment" is to be understood as bringing a body from a pathological state back to its normal, healthy state or preventing a pathological state. The latter may be denoted as "prophylactic treatment". Treatment is meant to cover protection against a pathological state. Treatment also means to have a reduction in pathological changes when compared to individuals that have not been treated. Suitably, there is at least a reduction of 10% in pathological changes, more preferably, at least a reduction of 25%, 20%, 25%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or even a 100% in pathological changes when compared to individuals that have not been treated.
The term "pharmaceutically acceptable carrier" is intended to include formulation used to stabilize, solubilize and otherwise be mixed with active ingredients to be administered to living animals, including fish. This includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.
The term "disease" as used herein is intended to be generally synonymous, and is used interchangeably with, the terms "disorder" and "condition" (as in medical condition), in that all reflect an abnormal condition of the body or of one of its parts that impairs normal functioning and is typically manifested by distinguishing signs and symptoms.
Heart and skeletal muscle inflammation (HSMI) was first diagnosed in 1999, and there has since been a yearly increase in the number of recorded outbreaks. Atlantic salmon are commonly affected 5 to 9 month after transfer to sea, but outbreaks have been recorded as early as 14 d following seawater transfer. Affected fish are anorexic and display abnormal swimming behaviour. Autopsy findings typically include a pale heart, yellow liver, ascites, swollen spleen and petechiae in the perivisceral fat. HSMI is diagnosed on the basis of histopathology. The major pathological changes occur in the myocardium and red skeletal muscle, where extensive inflammation and multifocal necrosis of myocytes are evident. HSMI is characterized by epi-, endo- and myocarditis, myocardial necrosis, myositis and necrosis of the red skeletal muscle. Most notably the epicarditis and myocarditis characterise the disease. Although field observations have suggested that surviving fish in affected sea cages may recover, non-lethal outbreaks are still considered a significant problem in salmon farming due to poor growth and general performance of fish following infection
As used herein, subunit protein means an isolated protein of a pathogen such as a specific protein. In the present invention subunit protein means an isolated specific protein from PRV. More than one subunit protein may be used in the present invention, but always as an isolated protein and not in the form of a virus, whole or otherwise. Also combination of subunit proteins are contemplated, but not in the form of a virus, whole or otherwise. Usually a subunit protein is a recombinant protein. The subunit protein may be used in a subunit vaccine.
A subunit vaccine as used herein presents an antigen to the immune system without introducing viral particles, whole or otherwise. One method of production involves isolation of a specific protein from a virus and administering this by itself, or a recombinant method of producing a specific protein.
By "vector" is meant any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, virus, replicon particle virion, etc., which is capable of expressing DNA sequences contained therein, where such sequences are operatively linked to other sequences capable of effecting their expression.. Thus, the term includes cloning and expression vehicles, as well as viral vectors. The term vector is given here a functional definition, and any DNA sequence which is capable of effecting expression of a specified DNA sequence disposed therein is included in this term as it is applied to the specified sequence. In general, vectors of utility in recombinant DNA techniques are often in the form of "plasmids" referred to as circular double stranded DNA loops which, in their vector form, are not bound to the chromosome.
“Replicon” means any nucleotide sequence or molecule which possesses a replication origin and which is therefore potentially capable of being replicated in a suitable cell.
By "recombinant virus" is meant a virus that has been genetically altered, e.g., by the addition or insertion of the coding sequence as defined herein into the particle.
The terms DNA "control sequences" and "control elements" refer collectively to promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites ("IRES"), enhancers, and the like, which collectively provide for the replication, transcription and translation of a coding sequence in a recipient cell. Not all of these control sequences/elements need always be present so long as the selected coding sequence is capable of being replicated, transcribed and translated in an appropriate host cell.
"Operably linked" refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function. Thus, control sequences operably linked to a coding sequence are capable of effecting the expression of the coding sequence. The control sequences need not be contiguous with the coding sequence, so long as they function to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between a promoter sequence and the coding sequence and the promoter sequence can still be considered "operably linked" to the coding sequence.
The term "identical" or "identity" means that two nucleic acid sequences or two amino acid sequences are identical (i.e., on a nucleotide-by-nucleotide basis or amino acid-by-amino acid basis) over the window of comparison. The term "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base or amino acid occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. The terms "substantial identity" as used herein denotes a characteristic of a polynucleotide sequence or polypeptide sequence, wherein the polynucleotide comprises a sequence that has at least 70 percent sequence identity, preferably at least 80 percent identity and often 90 to 95 percent sequence identity, more usually at least 99 percent sequence identity as compared to a reference sequence over a comparison window of at least 20 nucleotide positions or amino acid positions. Alignment tools to determine the sequence identity are well known to a skilled person, such as BLAST (Altschul et al , Nucleic Acids Res. 1997;25:3389-3402) and FASTA (Pearson and Lipman . Natl. Acad. Sci. USA. 1988;85:2444-2448).
Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is
phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are: valine- leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine- glutamine.
As used herein, the terms“protecting” or“providing protection to” and "aids in the protection" do not require complete protection from any indication of infection. For example, "aids in the protection" can mean that the protection is sufficient such that, after challenge, symptoms of the underlying infection are at least reduced, and/or that one or more of the underlying cellular, physiological, or biochemical causes or mechanisms causing the symptoms are reduced and/or eliminated. It is understood that“reduced,” as used in this context, means relative to the state of the infection, including the molecular state of the infection, not just the physiological state of the infection. Protecting against HSMI means that there is a reduction in heart lesions.
Preferably there is at least a 10% reduction in heart lesions. More preferably, there is at least 20%, 25,% 30%, 40%, 50%, 60%, 70% 75%, 80%, 85%, 90%, or even at 95% reduction in heart lesions compared to a fish that has been infected with PRV and not treated with the non- structural PRV proteins of the present invention. Preferably the heart lesion is scored histopathological changes. Preferably the histopathological changes are scored from 0 to 4 using criteria described in Table 4A and 4B. Suitably, heart lesions in consistence with HSMI, are scored for epicardial and myocardial changes. Suitably protection means that there is a reduction in epicardial changes of at least 10% when compared to fish that are infected with PRV and have not been treated with the non-structural PRV proteins of the present invention. More preferably, there is at least 20%, 25,% 30%, 40%, 50%, 60%, 70% 75%, 80%, 85%, 90%, or even at 95% reduction in epicardial changes when compared to fish that are infected with PRV and have not been treated with the non-structural PRV proteins of the present invention. Suitably there is a reduction in epicardial changes of between 100% and 20%, more preferably there is a reduction in epicardial changes of between 30% and 90%, more preferably there is a reduction in epicardial changes of between 35% and 85%, more preferably there is a reduction in epicardial changes of between 40% and 80%, more preferably there is a reduction in epicardial changes of between 45% and 75%, more preferably there is a reduction in epicardial changes of between 50% and 70%, more preferably there is a reduction in epicardial changes of between 55% and 65%.
Suitably protection means that there is a reduction in myocardial changes of at least 10% when compared to fish that are infected with PRV and have not been treated with the non-structural PRV proteins of the present invention. More preferably, there is at least 20%, 25,% 30%, 40%, 50%, 60%, 70% 75%, 80%, 85%, 90%, or even at 95% reduction in myocardial changes when compared to fish that are infected with PRV and have not been treated with the non-structural PRV proteins of the present invention. Suitably there is a reduction in myocardial changes of between 100% and 20%, more preferably there is a reduction in myocardial changes of between 30% and 90%, more preferably there is a reduction in myocardial changes of between 35% and 85%, more preferably there is a reduction in myocardial changes of between 40% and 80%, more preferably there is a reduction in myocardial changes of between 45% and 75%, more preferably there is a reduction in myocardial changes of between 50% and 70%, more preferably there is a reduction in myocardial changes of between 55% and 65%.
The grade of changes was scored from 0 to 4 using criteria described in Table 4A and 4B
The present invention is directed to a treatment or protection of fish against heart and skeletal muscle inflammation (HSMI). HSMI may be caused by Piscine orthoreovirus (PRV).
It was surprisingly found that fish that were vaccinated with one or two PRV non-structural proteins were protected from heart muscle inflammation. The PRV non-structural proteins appear to have only a modest effect on viral load, but are very effective in preventing HSMI after infection with PRV.
The PRV non-structural protein of the present invention and/or embodiments is a subunit protein. The protein may be recombinantly produced with systems that are well known to a skilled person, such as with expression vectors in suitable cells, bacterial expression systems, eukaryotic expression system, such as yeast expression systems, baculovirus system,
Filamentous fungi system, leishmania expression system, mammalian systems, such as Chinese Hamster ovary (CHO) or Human Embryonic Kidney (HEK) systems.
The present invention does not relate to the use of the whole virus.
The PRV non-structural protein may be pNS or oNS and also the use of a combination of pNS and oNS is contemplated. The amino acid sequence of pNS is SEQ ID NO: 12 and the amino acid sequence of oNS is SEQ ID NO: 13 (figure 1 and 2). In one embodiment of the invention and/or embodiments thereof, the PRV non-structural protein may be a polypeptide fragment comprising about 50 consecutive amino acids of a PRV non-structural protein described herein. In another embodiment, the PRV non-structural protein fragment may be a polypeptide comprising about 60 consecutive amino acids of a PRV non-structural polypeptide described herein. In another embodiment, the PRV non-structural protein fragment may be a PRV non- structural polypeptide comprising about 75 consecutive amino acids of a PRV non-structural protein described herein. In another embodiment, the PRV non-structural protein fragment may be a PRV non-structural polypeptide comprising about 90 consecutive amino acids of a PRV non-structural protein described herein. In another embodiment, the PRV non-structural protein fragment may be a polypeptide comprising about 100 consecutive amino acids of a PRV non- structural protein described herein. In another embodiment, the PRV non-structural protein fragment may be a polypeptide comprising about 120 consecutive amino acids of a PRV non- structural protein described herein. In another embodiment, the PRV non-structural protein fragment may be a polypeptide comprising about 150 or more consecutive amino acids of a PRV non-structural protein described herein.
In yet another embodiment of the invention and/or embodiments thereof, the PRV non-structural protein fragment may be a polypeptide comprising from about 50 to about 750, about 60 to about 700, about 70 to about 650, about 75 to about 600, about 80 to about 550, about 90 to about 500, about 100 to about 450, about 120 to about 400, about 140 to about 350, about 150 to about 300, about 160 to about 250, about 170 to about 220, about 180 to about 200 or more consecutive amino acids of a PRV non-structural protein described herein.
In another embodiment of the invention and/or embodiments thereof the PRV non-structural protein is a polypeptide having a sequence having at least about 70% identity to any one of SEQ ID NO: 12 or 13. Suitably the PRV non-structural protein is a polypeptide having a sequence having at least about 72%, about 74%, about 75%, about 76%, about 78%, about 80%, about 82%, about 84%, about 85%, about 87%, about 88%, about 90%, about 91 %, about
92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, identity to any one of SEQ ID NO: 12 or 13. More suitably the PRV non-structural protein is a polypeptide having a sequence having at least about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to any one of SEQ ID NO: 12 or 13.
In another embodiment of the invention and/or embodiments thereof the PRV non-structural polypeptide is encoded by a nucleic acid having a sequence having at least about 70% identity to any one of SEQ ID NOs: 14 or 15, or a fragment thereof.
In another embodiment of the invention and/or embodiments thereof the PRV polypeptide is encoded by a polynucleotide having a sequence having at least about 72%, about 74%, about 75%, about 76%, about 78%, about 80%, about 82%, about 84%, about 85%, about 87%, about
88%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about
97%, about 98%, about 99%, identity to any one of SEQ ID NO: 14 or 15, or a fragment thereof. In one embodiment, the PRV polypeptide is encoded by a polynucleotide having a sequence having at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to that of any one of SEQ ID NOs: 14 or 15, or a fragment thereof.
In a certain embodiment of the invention and/or embodiments thereof the treatment or protection comprises administering to a fish a composition comprising a polypeptide of the PRV non-structural protein as described herein. Suitably the PRV polypeptide has at least 50 consecutive amino acids of a polypeptide having a sequence having at least 70% identity to any of SEQ ID NO: 12 or 13. Suitably the PRV polypeptide has an amino acids sequence of any of SEQ ID NO: 12 or 13.
In another embodiment of the invention and/or embodiments thereof the PRV polypeptide or PRV non-structural protein is encoded by a nucleic acid complementary to a PRV
polynucleotide sequence having a sequence having at least 70% identity to any of SEQ ID NOs: 14 or 15, or a fragment thereof.
In another embodiment of the invention and/or embodiments thereof, the PRV polynucleotide has a length from about 150 to about 2200, about 200 to about 2000, about 250 to about 1800, about 300 to about 1600, about 350 to about 1400, about 300 to about 1200, about 400 to about 1000, about 500 to about 900, about 600 to about 800, about 650 to about 750, or more nucleotides.
In another embodiment of the invention and/or embodiments thereof the treatment or protection comprises administering to fish a composition comprising a polynucleotide encoding the PRV non-structural protein as defined herein. Suitably the polynucleotide encoding the PRV non- structural protein is a polynucleotide having a sequence having at least 70% identity to any of SEQ ID NO: 14 or 15. Suitably the polynucleotide encoding the PRV non-structural protein is polynucleotide having a sequence having at least about 72%, about 74%, about 75%, about 76%, about 78%, about 80%, about 82%, about 84%, about 85%, about 87%, about 88%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, identity to any one of any one of SEQ ID NO: 14 or 15. Suitably the PRV polynucleotide having a sequence having at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to any one of SEQ ID NO: 14 or 15.
In a certain embodiment of the invention and/or embodiments thereof the treatment comprises administering to fish a composition comprising a vector encoding the PRV non-structural protein as defined herein. Suitably the vector comprises a polynucleotide encoding the PRV non- structural protein as defined herein. Suitably, the vector encodes for a PRV non-structural protein according to the invention and/or embodiments thereof. Suitably, the vector is an expression vector. Suitable vectors are DNA vector, replicon vector, plasmid, phage, or a viral vector, preferably a DNA vector or plasmid. Suitably the vector is non-viral. Suitably the vector is an expression vector.
Suitably the treatment comprises the production of the PRV non-structural protein in the cell of the target animal. This may be accomplished by e.g. DNA vaccines. The internal production of proteins is often accomplished by using a suitable expression vector comprising a suitable promoter. A skilled person is well aware of suitable promoters, such as e.g. the CMV promoter.
Suitably the vector of the present invention and/or embodiments thereof comprises sequences that optimise the expression in eukaryotic cells. The vectors may include eukaryotic sequences for performing transcription (sequences upstream of 5', promoters, intron-processing signals) and translation (polyadenylation signals) in eukaryotic cells.
In preferred embodiments, the PRV polynucleotide is administered as naked DNA.
The PRV non-structural protein of the invention can be administered by any appropriate route of administration that results in a protection against HSMI, for which the PRV non-structural protein will be formulated in a manner that is suitable for the chosen route of administration. The administration in the methods described herein may be oral administration, immersion administration or injection administration. Preferably the administration is injection
administration. More preferably the administration is intramuscular injection.
In preferred embodiments the PRV polypeptide of the present invention may be administered in the presence of agents which enhance uptake of the PRV polypeptide by target cells, such as phospholipid formulation, e.g, a liposome.
In preferred embodiments the PRV polynucleotide or the vector of the present invention is also administered in the presence of agents which enhance uptake of the polynucleotide or vector by target cells, such as phospholipid formulation, e.g, a liposome, lipid nanoparticles, polymeric nanocarriers, or cationic dendrimers.
Suitable administration method for polynucleotides and/or vectors include electroporation of . polynucleotides and/or vectors. In a suitable embodiment, the treatment of the invention and/or any embodiments thereof is useful to vaccinate a fish against heart muscle inflammation pathology caused by infection of PRV.
In a suitable embodiment, the treatment of the invention and/or any embodiments thereof is useful to protect a fish against heart muscle inflammation pathology caused by infection of PRV.
In a suitable embodiment, the treatment or protection of the invention and/or any embodiments thereof does not comprise PRV as a whole virus, live, killed or otherwise.
In yet another embodiment of the invention and/or embodiments thereof, the treatment comprises additionally administering to a fish a PRV structural protein selected from the group comprising l1 , l2, l3, m1 , m2, s1 , s2, and s3. Suitably, the outer capsid proteins o1 , o2, and/or o3 are additionally administered. Preferably, o1 , is additionally administered. Preferably, m2, is additionally administered
Also contemplated is the administration of a polynucleotide encoding at least one of the PRV structural protein selected from the group comprising l1 , l2, l3, m1 , m2, s1 , s2, and s3.
Suitably an expression vector encoding the PRV structural protein selected from the group comprising l1 , l2, l3, m1 , m2, s1 , s2, and s3 is used.
In preferred embodiment the PRV structural protein may be m2 or o1 and also the use of a combination of m2 and o1 is contemplated. The amino acid sequence of m2 is SEQ ID NO: 18 and the amino acid sequence of o1 is SEQ ID NO: 16. In one embodiment of the invention and/or embodiments thereof, the PRV structural protein may be a polypeptide fragment comprising about 50 consecutive amino acids of a PRV structural protein described herein. In another embodiment, the PRV structural protein fragment may be a polypeptide comprising about 60 consecutive amino acids of a PRV structural polypeptide described herein. In another embodiment, the PRV structural protein fragment may be a PRV structural polypeptide comprising about 75 consecutive amino acids of a PRV structural protein described herein. In another embodiment, the PRV structural protein fragment may be a PRV structural polypeptide comprising about 90 consecutive amino acids of a PRV structural protein described herein. In another embodiment, the PRV structural protein fragment may be a polypeptide comprising about 100 consecutive amino acids of a PRV structural protein described herein. In another embodiment, the PRV structural protein fragment may be a polypeptide comprising about 120 consecutive amino acids of a PRV structural protein described herein. In another embodiment, the PRV structural protein fragment may be a polypeptide comprising about 150 or more consecutive amino acids of a PRV structural protein described herein. In yet another embodiment of the invention and/or embodiments thereof, the PRV structural protein fragment may be a polypeptide comprising from about 50 to about 750, about 60 to about 700, about 70 to about 650, about 75 to about 600, about 80 to about 550, about 90 to about 500, about 100 to about 450, about 120 to about 400, about 140 to about 350, about 150 to about 300, about 160 to about 250, about 170 to about 220, about 180 to about 200 or more consecutive amino acids of a PRV structural protein described herein.
In another embodiment of the invention and/or embodiments thereof the PRV structural protein is a polypeptide having a sequence having at least about 70% identity to any one of SEQ ID NO: 16 or 18. Suitably the PRV structural protein is a polypeptide having a sequence having at least about 72%, about 74%, about 75%, about 76%, about 78%, about 80%, about 82%, about 84%, about 85%, about 87%, about 88%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, identity to any one of SEQ ID NO: 16 or 18. More suitably the PRV structural protein is a polypeptide having a sequence having at least about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to any one of SEQ ID NO: 16 or 18.
In another embodiment of the invention and/or embodiments thereof the PRV structural polypeptide is encoded by a nucleic acid having a sequence having at least about 70% identity to any one of SEQ ID NOs: 17 or 19, or a fragment thereof.
In another embodiment of the invention and/or embodiments thereof the PRV structural polypeptide is encoded by a polynucleotide having a sequence having at least about 72%, about 74%, about 75%, about 76%, about 78%, about 80%, about 82%, about 84%, about 85%, about 87%, about 88%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, identity to any one of SEQ ID NO: 17 or 19, or a fragment thereof. In one embodiment, the PRV structural polypeptide is encoded by a polynucleotide having a sequence having at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to that of any one of SEQ ID NOs: 17 or 19, or a fragment thereof.
In a certain embodiment of the invention and/or embodiments thereof the treatment or protection additionally comprises administering to a fish a composition comprising a polypeptide of the PRV structural protein as described herein. Suitably the PRV structural polypeptide has at least 50 consecutive amino acids of a polypeptide having a sequence having at least 70% identity to any of SEQ ID NO: 16 or 18. Suitably the PRV structural polypeptide has an amino acids sequence of any of SEQ ID NO: 16 or 18.
In another embodiment of the invention and/or embodiments thereof the PRV polypeptide or PRV structural protein is encoded by a nucleic acid complementary to a PRV polynucleotide sequence having a sequence having at least 70% identity to any of SEQ ID NOs: 17 or 19, or a fragment thereof.
In another embodiment of the invention and/or embodiments thereof, the PRV polynucleotide has a length from about 150 to about 2200, about 200 to about 2000, about 250 to about 1800, about 300 to about 1600, about 350 to about 1400, about 300 to about 1200, about 400 to about 1000, about 500 to about 900, about 600 to about 800, about 650 to about 750, or more nucleotides.
In another embodiment of the invention and/or embodiments thereof the treatment or protection comprises administering to fish a composition comprising a polynucleotide encoding the PRV structural protein as defined herein. Suitably the polynucleotide encoding the PRV structural protein is a polynucleotide having a sequence having at least 70% identity to any of SEQ ID NO: 17 or 19. Suitably the polynucleotide encoding the PRV structural protein is polynucleotide having a sequence having at least about 72%, about 74%, about 75%, about 76%, about 78%, about 80%, about 82%, about 84%, about 85%, about 87%, about 88%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, identity to any one of any one of SEQ ID NO: 17 or 19. Suitably the PRV polynucleotide having a sequence having at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to any one of SEQ ID NO: 17 or 19.
Suitably, the fish is a salmonid. Salmonids include salmon, trout, chars, freshwater whitefishes, and graylings.
In another aspect the invention is directed to a vaccine comprising a vector comprising polynucleotide sequence that encodes for a PRV non-structural protein. Suitably the vaccine comprises a vector of the invention and/or embodiments thereof.
In another aspect the invention is directed to a vaccine composition comprising a PRV non- structural protein as defined herein as a subunit . Suitably the vaccine is used in a treatment or protection of fish against HSMI disease. Suitably the vaccine is used to protect fish against HSMI disease. Suitably the vaccine does not comprise PRV particles, live, killed, attenuated or otherwise.
Suitable the vector comprises a promoter. Classic promoters include the human
CMV/immediate early or CMV-chicken-b actin (CAGG) promoters. CMV promoters are used for most DNA vectors since they drive high constitutive expression levels in a wide range of mammalian tissues and do not suppress downstream read-through. Improvement of expression and immunogenicity have been observed by modifying CMV promoters (i.e., incorporation of HTLV-1 R-U5 downstream of the CMV promoter) or by using chimeric SV40-CMV promoter. Alternatives to CMV promoters include host tissue-specific promoters, which avoid constitutive expression of antigens in inappropriate tissues. The presence of an intron in the vector backbone downstream of the promoter can enhance the stability of mRNA and increase gene expression. A kozak sequence immediately prior to the ATG start codon may further enhance protein expression. The use of species-specific codons increases protein expression. Gene expression can be manipulated by altering the polyA sequence, which is required for proper termination of transcription and export of mRNA from the nucleus. Many current DNA vectors use the bovine hormone terminator sequence. Alteration of the polyA sequence may enhance gene expression of DNA vectors.
Therefore an embodiment of the present invention and/or embodiments thereof, is directed to a vector comprising a promoter sequence and a polynucleotide sequence that encodes for a PRV non-structural protein. Suitably the vector further comprises an enhancing 5’ sequence.
Examples of such enhancing 5’sequences may be found i.a. in EP1818406. Suitably the promoter is a CMV promoter. Many commercially available vectors comprise the CMV promoter, such as e.g. the pcDNA3 plasmid (Invitrogen). The promoter is preferably operately joined to the polynucleotide sequence that encodes for a PRV non-structural protein. As used herein, the expression "operatively joined" means that the PRV non-structural protein is expressed in the correct reading frame under the control of the promoter .
Therefore, another aspect of the invention relates to a vector, hereinafter the vector of the invention, which comprises at least a promoter sequence and polynucleotide sequence that encodes for a PRV non-structural protein. Said vector can be a viral vector or a non-viral vector. In general, the choice of vector will depend on the host cell in which it is subsequently to be introduced. The vector of the invention can be obtained using conventional methods known to a person skilled in the art (Sambrook et al., 1989). Suitably, the vector encodes the PRV non structural protein as a subunit protein. Preferably, the expression of PRV non structural protein is such that a PRV viral particle cannot be assembled.
In a particular embodiment, the vector of the invention is a non-viral vector, such as a plasmid or an expression vector that can be expressed in eukaryotic cells, e.g. in animals cells, which comprises at least a promoter sequence and polynucleotide sequence that encodes for a PRV non-structural protein, which, when introduced into a host cell, is either integrated into the genome of said cell or not.
The vector of the invention and/or embodiments thereof may also contain the necessary elements for expression of the PRV non-structural protein and the elements that regulate its transcription and/or translation. The vector of the invention and/or embodiments thereof may also contain RNA-processing sequences such as intron sequences for transcript splicing, transcription termination sequences, sequences for peptide secretion, etc. If desired, the vector of the invention may contain an origin of replication and a selectable marker, such as an antibiotic-resistant gene.
In one particular embodiment, the vector of the invention and/or embodiments thereof contains a single polynucleotide sequence that encodes for a PRV non-structural protein. However, in another particular embodiment, the vector of the invention contains two or more polynucleotide sequences that encodes for a PRV non-structural protein. In this case, the vector of the invention can encode two or more different PRV non-structural protein. Alternatively, the vector of the invention can encode one PRV non-structural and one or more PRV structural proteins. Alternatively, the vector of the invention can encode two PRV non-structural and one or more PRV structural proteins. Also contemplated is that the vector of the invention encodes for further proteins from a fish pathogen other than PRV, thereby producing a multi-purpose vaccine. For example, polynucleotide of pG of VHSV, the VP2 of IPNV or the E2 protein of PDV may be included in the same vector. Suitably the vector of the invention encodes at least pNS and at least one PRV structural protein. Suitably the vector of the invention encodes at least oNS and at least one PRV structural protein. Suitably the vector of the invention encodes pNS and pNS and at least one PRV structural protein. Suitably the vector of the invention encodes at least pNS and o1. Suitably the vector of the invention encodes at least pNS and m2. Suitably the vector of the invention encodes at least oNS and o1. Suitably the vector of the invention encodes at least oNS and m2. . Suitably the vector of the invention encodes pNS and pNS and o1. . Suitably the vector of the invention encodes pNS and pNS and m2. . Suitably the vector of the invention encodes pNS and pNS and o1 and m2. When the vector of the invention comprises two or more gene constructs encoding for proteins, the transcription of each nucleic acid sequence encoding each protein can be directed from its own expression control sequence to which it is operatively joined or it can be two or more proteins in the same reading frame.
When the vector of the invention is introduced into cells of an appropriate fish, the cells into which said vector of the invention has been introduced express the PRV non-structural protein and optionally the PRV structural protein in the vector of the invention, resulting in the protection or treatment of the fish against HSMI pathology or disease.
The vector of the invention and/or embodiments thereof, can include CpG dinucleotides, as they have immunostimulatory effects, thus enabling the DNA to act as an adjuvant.
The vector of the invention and/or embodiments thereof may comprise two polynucleotide sequence that each encodes for a different PRV non-structural protein. Suitably, the
polynucleotide sequence that encodes for a PRV non-structural protein encodes for pNS and/or oNS. Preferably, the polynucleotide sequence that encodes for a PRV non-structural protein encodes for at least pNS. It is contemplated that the vector may code for pNS and oNS. The pNS and oNS may be under a single promoter or they may each be linked to a separate promoter. It is also contemplated that two or more vectors are used in the method of the invention and/or embodiments thereof wherein each vector comprises a polynucleotide sequence that encodes for a different PRV non-structural protein or PRV structural protein such as m2 or s1.
Suitably the polynucleotide sequence that encodes for a PRV non-structural protein comprises any of the sequences SEQ ID NO: 14 or 15, or comprises a nucleotide sequences that encodes for a polypeptide havingy any of the sequences SEQ ID NO: 12 or 13. Furthermore, the DNA- encoding sequence that encodes for a PRV non-structural protein may comprise a nucleotide sequences that is at least 70% identical to any of the sequences SEQ ID NO: 14 or 15, or comprises a nucleotide sequences that is at least 70% identical to a nucleotide sequence that encodes for a polypeptide having any of the sequences SEQ ID NO: 12 or 13.
Suitably, the polynucleotide sequence that encodes for a PRV non-structural protein may comprise a nucleotide sequences that is at least about 72%, about 74%, about 75%, about 76%, about 78%, about 80%, about 82%, about 84%, about 85%, about 87%, about 88%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, identical to any one of SEQ ID NO: 14 or 15 or to a nucleotide sequence that encodes for a polypeptide having a sequence of any of the sequences SEQ ID NO: 12 or 13.
Suitably, the polynucleotide sequence that encodes for a PRV non-structural protein may comprise a nucleotide sequences that is at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identical to any one of SEQ ID NOs 14 or 15 or to a nucleotide sequence that encodes for a polypeptide having any of the sequences SEQ ID NO: 12 or 13.
It is also possible that the polynucleotide sequence that encodes for a PRV non-structural protein comprises a nucleotide sequence that is complementary to a sequence having at least 70% identity to any one of SEQ ID NOs 14 or 15 or to a nucleotide sequence that encodes for a polypeptide having any of the sequences SEQ ID NO: 12 or 13.
Suitably the polynucleotide sequence that encodes for a PRV structural protein comprises any of the sequences SEQ ID NO: 17 or 19, or comprises a nucleotide sequences that encodes for a polypeptide havingy any of the sequences SEQ ID NO: 16 or 18. Furthermore, the DNA- encoding sequence that encodes for a PRV structural protein may comprise a nucleotide sequences that is at least 70% identical to any of the sequences SEQ ID NO: 17 or 19, or comprises a nucleotide sequences that is at least 70% identical to a nucleotide sequence that encodes for a polypeptide having any of the sequences SEQ ID NO: 16 or 18.
Suitably, the polynucleotide sequence that encodes for a PRV structural protein may comprise a nucleotide sequences that is at least about 72%, about 74%, about 75%, about 76%, about 78%, about 80%, about 82%, about 84%, about 85%, about 87%, about 88%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, identical to any one of SEQ ID NO: 17 or 19 or to a nucleotide sequence that encodes for a polypeptide having a sequence of any of the sequences SEQ ID NO: 16 or 18.
Suitably, the polynucleotide sequence that encodes for a PRV structural protein may comprise a nucleotide sequences that is at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identical to any one of SEQ ID NOs 17 or 19 or to a nucleotide sequence that encodes for a polypeptide having any of the sequences SEQ ID NO: 16 or 18.
It is also possible that the polynucleotide sequence that encodes for a PRV structural protein comprises a nucleotide sequence that is complementary to a sequence having at least 70% identity to any one of SEQ ID NOs 17 or 17 or to a nucleotide sequence that encodes for a polypeptide having any of the sequences SEQ ID NO: 16 or 18.
Further the vector of the present invention and/or embodiments thereof may also code for fragments of the PRV non-structural protein as defined herein.
Suitably, the vector of the present invention and/or embodiments thereof encodes a fragment of the PRV non-structural protein comprising from about 50 to about 750, about 60 to about 700, about 70 to about 650, about 75 to about 600, about 80 to about 550, about 90 to about 500, about 100 to about 450, about 120 to about 400, about 140 to about 350, about 150 to about 300, about 160 to about 250, about 170 to about 220, about 180 to about 200 or more consecutive amino acids of a PRV non-structural protein as described herein.
Further the vector of the present invention and/or embodiments thereof may also code for fragments of the PRV structural protein as defined herein.
Suitably, the vector of the present invention and/or embodiments thereof encodes a fragment of the PRV structural protein comprising from about 50 to about 750, about 60 to about 700, about 70 to about 650, about 75 to about 600, about 80 to about 550, about 90 to about 500, about 100 to about 450, about 120 to about 400, about 140 to about 350, about 150 to about 300, about 160 to about 250, about 170 to about 220, about 180 to about 200 or more consecutive amino acids of a PRV structural protein as described herein.
Suitably the polynucleotide sequence encodes for a PRV structural protein, and/or fragment thereof as defined in the present invention.
In another aspect of the invention, the vaccine comprises a vector according to the invention and/or any embodiments thereof.
The vaccine may comprise optionally one of more adjuvants and/or pharmaceutically acceptable ingredients. The vaccine of the invention and/or embodiments thereof can be prepared in the form of an aqueous solution or suspension, in a pharmaceutically acceptable vehicle, such as saline solution, phosphate buffered saline (PBS), or any other pharmaceutically acceptable vehicle. The adjuvants may comprise plasmid-encoded signalling molecules including cytokines, chemokines, immune costimulatory molecules, toll-like receptor agonists or inhibitors of immune suppressive pathways. Also traditional adjuvants including killed bacteria, bacterial components, such LPS, aluminium salts, oil emulsions, polysaccharide particles, liposomes and biopolymers may be used. Suitable systems use nanoparticles based on biodegradable polymers. Synthetic polymers such as poly(vinylpyridine), polylactide-co- glycolides (PLG) and polylactide-co-glycolide acid (PLGA) may be used. Encapsulation of DNA helps protect the plasmid from nuclease degradation and provides prolonged release.
The vaccine of the invention and/or embodiments thereof may be prepared using conventional methods known by a person skilled in the art. In a particular embodiment, said vaccine is prepared using the PRV polypeptide, PRV polynucleotides, or a vector of the invention, optionally having one or more adjuvants and/or pharmaceutically acceptable vehicles.
The vector of the invention and/or embodiments thereof, can be incorporated into conventional transfection reagents, such as liposomes, e.g. cationic liposomes, fluorocarbon emulsions, cochleates, tubules, gold particles, biodegradable microspheres, cationic polymers, etc. A review of said transfection reagents can be found in US 5780448. Suitably the vector of the invention and/or embodiments thereof is administered by electroporation.
Preferably the PRV non-structural protein, polynucleotide encoding the PRV non-structural protein, PRV structural protein, polynucleotide encoding the PRV structural protein vectors of the present invention and/or embodiments thereof are administered in an effective amount. In the meaning used herein, the expression "effective amount" refers to an effective amount to provide protection against HSMI caused by an infection by PRV.
The pharmaceutically acceptable vehicles that may be used in the formulation of a vaccine of the invention must be sterile and physiologically compatible, e.g. sterile water, saline solution, aqueous buffers such as PBS, alcohols, polyols and suchlike. Said vaccine may also contain other additives, such as adjuvants, stabilisers, antioxidants, preservatives and suchlike. The available adjuvants include, but are not limited to, aluminium salts or gels, carbomers, nonionic block copolymers, tocopherols, muramyl dipeptide, oil emulsions, cytokines, etc. The amount of adjuvant that may be added depends on the nature of the adjuvant. The stabilisers available for use in vaccines according to the invention are, e.g. carbohydrates, including sorbitol, mannitol, dextrin, glucose and proteins such as albumin and casein, and buffers such as alkaline phosphatase. The available preservatives include, among others, thimerosal, merthiolate and gentamicin.
Examples:
The invention will now be further described by the following, non-limiting, examples.
Materials and methods Plasmid constructs
The full-length open reading frames (ORFs) of PRV genes encoding pNS, s1 , s3, m2, and oNS, were amplified using PfuUltra II Fusion HS DNA polymerase (Agilent, Santa Clara, CA, USA) and cDNA prepared like in an earlier study (Miller CL, et al. Localization of mammalian orthoreovirus proteins to cytoplasmic factory-like structures via nonoverlapping regions of microNS. J Virol 2010, 84(2):867-882). Expression vector pcDNA3.1 (+) (Invitrogen) expressing PRV pNS, oNS, s1 , s3, m2, or enhanced Green fluorescent protein (EGFP) (control), was constructed. In short, the PCR amplicons of the ORFs were cloned into the Xbal restriction site of pcDNA3.1 .
Primer sequences are listed in Table 2.
Table 2: Primer sequences
Transfections of fish cells
CHSE-214 cells (ATCC CRL-1681 , Chinook salmon embryo) were cultivated in Leibovitz L-15 medium (L15, Life Technologies, Carlsbad, USA) supplemented with 10 % heat inactivated fetal bovine serum (FBS, Life technologies), 2 mM L-glutamine, 0.04 mM mercaptoethanol and 0.05 mg/ml gentamycin-sulphate (Life Technologies). A total of 3 million CHSE cells were pelleted by centrifugation, resuspended in 100 pL Ingenio Electroporation Solution (Mirus, Madison, Wl, USA) and separately transfected with 3 pg of each the plasmids using the Amaxa T-20 program. The transfected cells were diluted in 1 mL pre-equilibrated L-15 growth medium and 100 pL of the diluted cells was seeded onto gelatin embedded cover slips (12 mm) in a 24-well plate for expression analysis by immunofluorescence microscopy. Transfections with
pcDNA3.1/EGFP construct was used as positive expression controls.
Immunofluorescence microscopy
Transfected CHSE-214 cells were fixed and stained using an intracellular Fixation and
Permabilization Buffer (eBioscience, San Diego, CA, USA). The cells were washed in
Dulbecco’s PBS (DPBS) with sodium azide. Intracellular fixation buffer was added before incubation with primary antibodies, anti-pNS (1 :1000) (Haatveit et al. Viral Protein Kinetics of Piscine Orthoreovirus Infection in Atlantic Salmon Blood Cells. Viruses 2017, 9(3)), anti-o1 (1 :1000) (Finstad et al: Immunohistochemical detection of piscine reovirus (PRV) in hearts of Atlantic salmon coincides with the course of heart and skeletal muscle inflammation (HSMI). Vet Res 2012, 43:2715). Secondary antibodies were anti-rabbit immunoglobulin G (IgG) conjugated with Alexa Fluor 488 (Life Technologies, 1 :400) or anti-goat IgG conjugated with Alexa Fluor 594 (Life Technologies, 1 :400). Nuclear staining was performed with Hoechst trihydrochloride trihydrate stain solution (Life Technologies). The cover slips were mounted onto glass slides using Fluoroshield (Sigma-Aldrich) and images were captured on an inverted fluorescence microscope (Olympus 1X81 ).
Vaccine preparations
The concentration of plasmid constructs were measured using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) and diluted in PBS to 1000 ng/pL. Samples for vaccination were prepared to contain 10 pg of each plasmid construct in a total volume 50 pL.
Vaccination trials
Cohabitant challenge experiment was performed following vaccination of a pcDNA3.1 -based expression vaccines. The trials were performed using previously unvaccinated Atlantic salmon pre-smolts with an average weight of 30-40 g, confirmed free of common salmon pathogens. The fish were kept in a freshwater flow-through system (temperature: 12°C; oxygen: > 70%; pH 6.6-6.9), acclimatized for 1 week and starved 48 hours prior to vaccination. The fish were randomly selected for vaccination, anesthetized by bath immersion (2-5 min) in benzocaine chloride (0.5 g/10 L water, Apotekproduksjon AS, Oslo, Norway), labelled with passive integrated transponder (PIT) tags (two weeks prior to vaccination) and intramuscularly (i.m.) injected with the vaccines or control substances. The challenges were performed in connection with transfer to seawater six weeks after vaccination and after photoperiod manipulation. The shedders were i.p. injected with 0.1 mL of pooled heparinized blood samples from a previous PRV challenge experiment (Finstad et al. Piscine orthoreovirus (PRV) infects Atlantic salmon erythrocytes. Vet Res 2014, 45:35). The inoculum was confirmed negative for the salmon viruses including infectious pancreatic necrosis virus (IPNV), infectious salmon anemia virus (ISAV), salmonid alphavirus (SAV) and piscine myocarditis virus (PMCV) by RT-qPCR. The fish were starved for 24 hours prior to challenge. Fish were divided into six groups, each containing 26 fish, and vaccinated by i.m. injection of 10 pg/50 pl_ per pcDNA3.1 construct, control construct (pcDNA3.1/EGFP) or PBS (Table 3).
Table 3: Vaccination groups
At 4 wpc, six fish from the PBS control group were sampled and analyzed for viral RNA loads in blood to determine suitable time points for the following two samplings, set to 6 and 8 wpc. Further, 12 fish per group were sampled at these two time-points before termination of the experiment. Heparinized blood, plasma and heart (stored in 4% formalin or RNAIater) were sampled from both challenge experiments.
RNA isolation and RT-qPCR
Total RNA was isolated from 20 pl_ heparinized blood homogenized in 650 mI_ QIAzol Lysis Reagent (Qiagen, Hilden, Germany) using 5 mm steel beads, TissueLyser II (Qiagen) and RNeasy Mini spin column (Qiagen) as recommended by the manufacturer. RNA quantification was performed using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA). For the plasma samples, a 10 pL volume was diluted in PBS to 140 pL and used in the Mini spin column (Qiagen), as recommended by the manufacturer. The Qiagen OneStep kit (Qiagen) was used for RT-qPCR with a standard input of 100 ng (5 pL of 20 ng/pL) of the isolated total RNA per reaction. From the cell free plasma samples, 5 pL input of total eluted RNA was used. The template RNA was denatured at 95°C for 5 min prior to RT-qPCR targeting PRV gene segment S1 (S1 Fwd: 5’TGCGTCCTGCGTATGGCACC’3 (SEQ ID NO: 9) S1 Rev: 5’GGCTGGCATGCCCGAATAGCA’3 (SEQ ID NO: 10) and S1 probe: 5 -FAM- ATCACAACGCCTACCT’3- MGBNFQ (SEQ ID NO: 11 ) using the following conditions: 400 nM primer, 300 nM probe, 400 nM dNTPs, 1.26 mM MgCI2, 1 :100 RNase Out (Invitrogen) and 1 x ROX reference dye. The cycling conditions were 50°C for 30 min and 94°C for 15 min, followed by 35 cycles of 94°C/15 sec, 54°C/30 sec and 72°C/15 sec in an AriaMx (Agilent, Santa Clara, CA, USA). All samples were run in duplicates, and a sample was defined as positive if both parallels produced a Ct value below 35.
Histopathological scoring
Sections for histopathology were processed and stained with hematoxylin and eosin following standard procedures. Individual fish from both vaccination trials were examined for heart lesions in consistence with HSMI, discriminating between epicardial and myocardial changes. The grade of changes was scored from 0 to 4 using criteria described in Table 4A and 4B. The individual histopathological scores were used to calculate the mean score ± SD at each time point of sampling (n = 6 or n = 12) for both epicardial and myocardial changes.
Table 4A:
Table 4B:
Statistical analyses
The PRV RT-qPCR results and the histopathology scores were analyzed statistically using the Mann Whitney compare ranks test. All statistical analysis described were performed with GraphPad Prism (GraphPad Software inc., USA) and p-values of p < 0.05 were considered as significant.
Results
RT-qPCR analysis indicated high PRV loads at the two sampling points 6 and 8 wpc for both control. All four vaccinated groups remain a high viral load although viral RNA loads in blood cells was reduced when compared to the controls at 6 wpc (table 5). Group 1 showed significantly lower viral RNA load 6 wpc compared to control groups 5 and 6. Group 4 showed the highest viral load of all vaccination groups at both 6 and 8 wpc. In addition, group 4 showed higher PRV RNA levels than the control groups at 8 wpc.
Table 5:
At 8 wpc when the control groups showed sever epicard and myocard pathology, all the vaccination groups showed a significant less pathology. Group 4 showed the least pathology. It is interesting to note that group 4 showed the highest viral load at 8wpc, even higher than the control groups.

Claims

1. PRV non-structural protein for use in protection in fish against heart and skeletal muscle inflammation disease, wherein the PRV non-structural protein is administered as a subunit protein.
2. PRV non-structural protein for use according to claim 1 wherein the PRV non-structural protein is pNS or oNS.
3. PRV non-structural protein for use according to any of claim 1 to 2 wherein the PRV non-structural protein is a polypeptide having a sequence having at least about 70% identity to any one of SEQ ID NO: 12 or 13.
4. PRV non-structural protein for use according to claim 3 wherein the PRV non-structural protein is a polypeptide having a sequence having at least about 72%, about 75%, about 77%, about 78%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99% or about 99.5% identity to any one of SEQ ID NO: 12 or 13.
5. PRV non-structural protein for use according to any of claim 2-4 wherein the PRV non- structural protein is a polypeptide fragment having at least 50 consecutive amino acids of a polypeptide having a sequence having at least about 70% identity to any one of SEQ ID NO: 12 or 13.
6. PRV non-structural protein for use according to any of claim 1 or 5 wherein the
protection comprises administering to fish a composition comprising a polypeptide of the PRV non-structural protein as defined in any of claims 2-5.
7. PRV non-structural protein for use according to any of claims 1 to 6 wherein the
protection comprises additionally administering to fish a PRV structural protein selected from the group comprising l1 , l2, l3, m1 , m2, s1 , s2, and s3, preferably s1 or m2 or the combination of s1 and m2.
8. PRV non-structural protein for use according to any of claims 1 to 7 wherein the fish is a salmonid.
9. A polynucleotide encoding the PRV non-structural protein as defined in any of claims 2-5 for use in treatment in fish against heart and skeletal muscle inflammation disease, wherein the polynucleotide encodes for a PRV non-structural protein as a subunit protein.
10. A polynucleotide for use according to claim 9 wherein the protection comprises
administering to fish a composition comprising a polynucleotide encoding the PRV non- structural protein as defined in any of claims 2-5.
1 1. A polynucleotide for use according to any of claim 9 or 10 wherein the polynucleotide encoding the PRV non-structural protein is a polynucleotide having a sequence having at least about 70% identity to any of SEQ ID NO: 14 or 15.
12. A polynucleotide for use according to any of claim 9-1 1 wherein the protection comprises administering to fish a vector comprising the polynucleotide as defined in any of claim 9-11.
13. A polynucleotide for use according to claim 12 wherein the protection comprises
administering to fish a vector according to any of claim 16-20.
14. A polynucleotide for use according to any of claims 9 to 13 wherein the protection
comprises additionally administering to fish a polynucleotide encoding a PRV structural protein selected from the group comprising l1 , l2, l3, m1 , m2, s1 , s2, and s3, preferably s1 or m2 or the combination of o1 and m2.
15. A polynucleotide for use according to any of claims 9 to 14 wherein the fish is a
salmonid.
16. Vector comprising at least a promoter sequence and a polynucleotide sequence that encodes for a PRV non-structural protein as defined in any of claims 2-5.
17. Vector according to claim 16 further comprising transcription or translation enhancing sequences.
18. Vector according to claim 16 or 17 comprising two polynucleotide sequences that each encodes for a different PRV non-structural protein.
19. Vector according to any of claim 16 to 18 wherein the polynucleotide sequence that encodes for a PRV non-structural protein encodes for pNS and/or oNS.
20. Vector according to any of claim 16 to 19 wherein the polynucleotide sequence that encodes for a PRV non-structural protein comprises a nucleotide sequences that is at least 70% identical to any of the sequences SEQ ID NO: 14 or 15, or comprises a nucleotide sequences that is at least 70% identical to a nucleotide sequence that encodes for a polypeptide having any of the sequences SEQ ID NO: 12 or 13.
21. Vector according to any of claim 16 to 20 further comprising a polynucleotide encoding a PRV structural protein selected from the group comprising l1 , l2, l3, m1 , m2, s1 , s2, and s3, preferably s1 or m2 or the combination of o1 and m2.
22. Vaccine composition comprising a PRV non-structural protein as defined in any of claims 2-5 as subunit.
23. Vaccine composition according to claim 22 further comprising a PRV structural protein selected from the group comprising l1 , l2, l3, m1 , m2, s1 , s2, and s3, preferably s1 or m2 or the combination of o1 and m2.
24. Vaccine composition comprising a vector comprising according to any of the claims 16- 21 .
25. Vaccine composition according to any of claims 22 or 24 for use in protection in fish against heart and skeletal muscle inflammation disease.
EP18826507.8A 2017-12-06 2018-12-05 Use of a non-structural protein from prv to protect against heart and skeletal muscle inflammation Pending EP3720486A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP17205626 2017-12-06
PCT/EP2018/083656 WO2019110664A1 (en) 2017-12-06 2018-12-05 Use of a non-structural protein from prv to protect against heart and skeletal muscle inflammation

Publications (1)

Publication Number Publication Date
EP3720486A1 true EP3720486A1 (en) 2020-10-14

Family

ID=60629469

Family Applications (1)

Application Number Title Priority Date Filing Date
EP18826507.8A Pending EP3720486A1 (en) 2017-12-06 2018-12-05 Use of a non-structural protein from prv to protect against heart and skeletal muscle inflammation

Country Status (4)

Country Link
EP (1) EP3720486A1 (en)
CA (1) CA3083873A1 (en)
CL (1) CL2020001494A1 (en)
WO (1) WO2019110664A1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NO344967B1 (en) * 2019-01-30 2020-08-03 Patogen As Piscine Orthoreovirus Virulence Markers
US12502426B2 (en) 2019-12-16 2025-12-23 Intervet Inc. Inactivated piscine orthoreovirus vaccine
CL2024000227A1 (en) * 2024-01-25 2024-07-12 Univ Santiago Chile Piscine orthoreovirus protein; vaccine composition; and its use.

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5780448A (en) 1995-11-07 1998-07-14 Ottawa Civic Hospital Loeb Research DNA-based vaccination of fish
ES2247942B1 (en) 2004-08-27 2006-10-01 Instituto Nacional De Investigacion Y Tecnologia Agraria Y Alimentaria (Inia) GENE CONSTRUCTION, VECTOR AND DNA VACCINE FOR THE VACCINATION OF AQUATIC ANIMALS.
WO2011041789A1 (en) 2009-10-02 2011-04-07 The Trustees Of Columbia University In The City Of New York Piscine reovirus immunogenic compositions
CA2922621C (en) 2013-08-30 2023-05-23 Pharmaq As Method for propagating piscine orthoreovirus

Also Published As

Publication number Publication date
CL2020001494A1 (en) 2021-01-29
WO2019110664A1 (en) 2019-06-13
CA3083873A1 (en) 2019-06-13

Similar Documents

Publication Publication Date Title
US11235052B2 (en) Chikungunya virus RNA vaccines
EP3313864B1 (en) Prrsv minor protein-containing recombinant viral vectors and methods of making and use thereof
CA2796178C (en) Nucleic acid sequences of fish cardiomyopathy syndrome virus and the use thereof
KR20230066360A (en) Gene Therapy for Neurodegenerative Disorders
KR20210150486A (en) Gene therapy for lysosomal disorders
WO2019110664A1 (en) Use of a non-structural protein from prv to protect against heart and skeletal muscle inflammation
EP4205762A1 (en) Improved dna vaccine for sars-cov-2
CN118973610A (en) Methods to block ASFV infection by interrupting the interaction between cell and virus receptors
US20210338807A1 (en) Covid19 vaccines and related methods
RS66227B1 (en) Compositions and methods for treating retinal disorders
US20250127873A1 (en) Compositions and methods for prevention of piscine myocarditis
JP2026062907A (en) Immunogens of mumps virus and measles virus and their use
CN113637695B (en) A novel coronavirus mRNA vaccine targeting stimulation of humoral and cellular immunity
CN1650013A (en) DNA Vaccine Against Hantavirus Infection
CN114891830B (en) Recombinant expression vectors, recombinant viruses and uses based on varicella-zoster virus
TW202313981A (en) Compositions and methods for enhancing visual function
US20230398201A1 (en) Gene shuffled lyssavirus vaccine
JP2021516551A (en) EHV insertion site UL43
KR20220097422A (en) Chikungunya virus-like particle vaccine and method of use thereof
CN118910097A (en) Toxoplasma gondii GRA6 and ROP2A antigen mRNA-LNP vaccine and application thereof
CN116426543B (en) Novel coronavirus vaccine and preparation method thereof
KR20240109612A (en) Compositions and methods for expressing antigens in cell membranes
US20250249089A1 (en) Recombinant plasmid, immunogenic composition, kit and uses thereof
WO2025011529A2 (en) Circular rna vaccines for seasonal flu and methods of uses
WO2024259078A2 (en) Anti-tick vaccines and methods of use thereof

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20200706

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20210421