EP3638039A1 - Plant-based pesticide obtained from the euphorbia characias l. - Google Patents

Plant-based pesticide obtained from the euphorbia characias l.

Info

Publication number
EP3638039A1
EP3638039A1 EP18734475.9A EP18734475A EP3638039A1 EP 3638039 A1 EP3638039 A1 EP 3638039A1 EP 18734475 A EP18734475 A EP 18734475A EP 3638039 A1 EP3638039 A1 EP 3638039A1
Authority
EP
European Patent Office
Prior art keywords
chitinase
plant
pesticidal composition
seq
elc
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP18734475.9A
Other languages
German (de)
French (fr)
Inventor
Maria Soledad MARTOS ARIAS
Carlota POSCHENRIEDER WIENS
Núria AGUSTÍ ABELLA
Jordi Riudavets Muñoz
Rosaria MEDDA
Francesca PINTUS
Delia SPANÒ
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Universitat Autonoma de Barcelona UAB
Institut Recerca i Tecnologia Agroalimentaries IRTA
Cagliari Unica, University of
Original Assignee
Universitat Autonoma de Barcelona UAB
Institut Recerca i Tecnologia Agroalimentaries IRTA
Cagliari Unica, University of
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universitat Autonoma de Barcelona UAB, Institut Recerca i Tecnologia Agroalimentaries IRTA, Cagliari Unica, University of filed Critical Universitat Autonoma de Barcelona UAB
Publication of EP3638039A1 publication Critical patent/EP3638039A1/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N65/00—Biocides, pest repellants or attractants, or plant growth regulators containing material from algae, lichens, bryophyta, multi-cellular fungi or plants, or extracts thereof
    • A01N65/08—Magnoliopsida [dicotyledons]
    • A01N65/18—Euphorbiaceae [Spurge family], e.g. ricinus [castorbean]
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • Plant-based pesticide obtained from the Euphorbia characias L.
  • the invention relates to an environment-friendly method for the control of plant pest, particularly Drosophila suzukii, using a plant-based pesticide, wherein the pesticide is a chitinase obtained from the Euphorbia characias latex, providing a deeper insight on this plant chitinase with agronomic potential to pest control.
  • the fly Drosophila suzukii (Diptera Drosophilidae), also called Spotted Wing Drosophila, causes great economic losses in the fruit sector. It is a highly polyphagous invasive pest, endemic in Southeast Asia, which has recently been spreading to western countries like the United States, Canada, Mexico and several European countries, mainly in Spain and Italy (Cini A. et al., Bulletin of Insectology. 2012, 65: 149-160). Its main hosts are soft fruits such as cherries, grapes, plums, strawberries and other cultivated berries, as well as wild berries and figs that serve as a reservoir when there is no susceptible crop.
  • Drosophila suzukii represents a significant threat to fruit farms due to its extreme fecundity and high dispersal potential (Cini A. et al., Bulletin of Insectology. 2012, 65: 149-160). Unlike other flies that prefer rotten orfermented fruit, Drosophila suzukii attacks fresh ripe fruit. It is most active at 20° C and its activity is reduced at temperatures below 0° C. and above 30° C.
  • Chitin a linear biopolymer of ⁇ -(1 ,4) N-acetyl-D-glucosamines, is considered one of the most abundant molecules in the biosphere as a structural component of arthropods, nematodes, mollusks, insects and cell wall of fungi and green algae; and is degraded by chitinolytic enzymes being the chitinases the best known group.
  • Chitinases (E.C 3.2.2.14) are glycosyl hydrolases with the sizes ranging from 20 kDa to about 90 kDa.
  • Chitinases have the ability to degrade chitin directly to low molecular weight chitooligomers, which serve a broad range of industrial, agricultural, and medical functions such as elicitor action and anti-tumor activity. These enzymes have been found not only in chitin-containing organisms but also in bacteria, plants and vertebrates. In that sense, some chitinases have been isolated from latex of plants.
  • One of these latex-producing plants is E. characias L, a ubiquitous evergreen shrub and typical member of the Mediterranean vegetation. As other spurges, E. characias presents specialized cells, called laticifers, where the latex is produced and exuded when plants are damaged.
  • the latex composition is highly diversified with identified substances such as sugars, free radical-scavenging molecules, alkaloids, terpenoid and phenolic compounds, polymeric substances as resins and gums, starch, oils, and numerous proteins.
  • chitinases The insecticidal potential of chitinases has been tested on bioassays with model organisms, such as Drosophila melanogaster Meigen (Kitajima S., et al. BMC Biochemistry. 2010, 1 1 , article n° 6). Although there are several examples using pest insects, the works are based on bacterial, fungal or insect chitinases (Li M., et al. Journal of Insect Science. 2014, 14, n° 32; Prasanna L, et al., Applied Microbiology and Biotechnology. 2013, 97: 1601 -161 1 ; Boldo J.T., et al., Current Genetics.
  • characias latex chitinase surprisingly revealed a high effectivity against Drosophila suzukii larvae at a low concentration.
  • a commercial pesticide Liflubenzuron
  • chitin-degrading activity was tested at the recommended concentration and its activity was highly decreased compared to the studied plant chitinase.
  • Chitinases have ability to degrade chitin but their insecticidal and/or antifungal activities has to be specifically proven. In fact, not all of them show activity against fungi or insects. For instance, Wsweeping Zhong et al.'The Chitinase C Gene PsChiC from Pseudomonas Sp. and Its Synergistic Effects on Larvicidal Activity," Genetics and Molecular Biology 38, no. 3 (2015): 366-72 escribe a bacterial chitinase with little insecticidal activity towards insect larvae. The authors suggest that chitinases are highly diverse and that their biological activity degrading chitin from fungi or insects depend on the each specific chitinase protein composition.
  • Kitajima et al. “Comparative study of gene expression and major proteins function of laticifers in lignified and unlignified organs of mulberry” Planta (2012) 235:589-601 (2012) describe plant chitinases that do not have insecticidal activity but antifungal activity. They even mention the lack on plant chitinases against insects because main part of them show antifungal effects.
  • the interest of the present invention is the proved insecticidal activity of the plant chitinase of E. characias on D. suzukii, a newly described pest in Europe.
  • the present invention discloses a novel plant-based pesticide obtained from the £. characias latex (ELC) against D. suzukii at concentrations that were harmless to the plants, opening the door for the development of integrated pest management strategies based on the disruption of cuticle and peritrophic matrix of insects. Therefore, it could be considered as an environmentally friendly alternative to chemical pesticides.
  • a first aspect of the present invention related to a pesticidal composition for controlling plant pests which comprises a chitinase comprising the amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence SEQ ID NO: 1 , or a functionally variants thereof.
  • the chitinase comprises the amino acid sequence as set forth in SEQ ID NO: 1 , or a variant functionally equivalent thereof. In a more preferred embodiment, the chitinase consists of SEQ ID NO: 1 .
  • the pesticidal compositions of the present invention may be used in the control of agricultural, natural environmental and domestic/household pests.
  • the pesticidal composition is used against plant pests, particularly against insects, by the application of pesticidally effective amount of the pesticidal compositions of the present invention to a location where pest control is desired.
  • the pesticidal composition is used against a Drosophila insect; and even more preferably against Drosophila suzukii.
  • pest as used herein includes mosquitoes, insects and other organisms which adversely affect, preferably to plants.
  • pest refers to mosquitoes and insects.
  • pests which can be controlled according to the subject invention include, but are not limited to, mosquitos, fleshflies, fleas, sandflies, houseflies, dogfiies, and insects which attack plants.
  • Chitinase used in the present invention is not particularly limited, and is intended to include not only exact duplicates of this enzyme, but also any enzyme having substantially the same amino acid sequence, and substantially the same chitin-binding activity.
  • Chitinases [E.C. 3.2.1.14], hydrolyze b-1 ,4-glycosidic bonds of chitin and have an ubiquitous distribution in animals, plants, insects, fungi, bacteria and viruses. These enzymes are involved in growth and development processes, participate in cell death and in stress response to heavy metals and counteract oxidative stress.
  • the chitinase comprising the amino acid sequence SEQ ID NO: 1 was isolated from E. characias latex (ELC) and purified by magnetic separation procedure followed by DEAE-cellulose chromatography. According to the nucleotide sequence (SEQ ID NO: 2), the ELC was classified as a class III endochitinase and the antifungal assay revealed that it does not exhibit any inhibitory activity towards four filamentous fungi, and has a molecular weight of 36.5 ⁇ 2 kDa. This chitinase is sometimes referred to hereinafter as the "chitinase of the invention".
  • homology or “identity” or “similarity” refer to sequence similarity between two nucleic or amino acid sequences. Homology can be determined by comparing a position in each sequence, which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are identical at that position. A degree of homology or similarity or identity between nucleic acid sequences or amino acids sequences is a function of the number of identical or matching nucleotides or amino acids at positions shared by the nucleic acid sequences or amino acids sequences, respectively.
  • the degree of homology, identity, and/or similarity can be determined by use of algorithms, programs and methods, such as and without limitations Clustal, Wilbur-Lipman, GAG, GAP, BLAST, BLASTN, BLASTP, EMBOSS Needle, FASTA, Smith Waterman or BLOSUM.
  • biologically functional equivalent refers to peptides, polypeptides, and proteins that contain a sequence or moiety exhibiting sequence similarity to the chitinase of the present invention, preferably to the chitinase comprising the SEQ ID NO: 1 , and which exhibit the same or similar pesticide activity, preferably insecticide activity, as that of the chitinase disclosed herein, comprising the SEQ ID NO: 1 .
  • peptides, polypeptides, and proteins biologically functionally equivalent to the chitinase disclosed herein include amino acid sequences containing conservative amino acid changes in the fundamental sequence shown in SEQ ID NO: 1 .
  • one or more amino acids in the fundamental sequence is (are) substituted with another amino acid(s), the charge and polarity of which is similar to that of the native amino acid, i.e., a conservative amino acid substitution, resulting in a silent change.
  • Substitutes for an amino acid within the fundamental polypeptide sequence can be selected from other members of the class to which the naturally occurring amino acid belongs.
  • Amino acids can be divided into the following four groups: (1 ) acidic amino acids; (2) basic amino acids; (3) neutral polar amino acids; and (4) neutral non-polar amino acids.
  • Representative amino acids within these various groups include, but are not limited to: (1 ) acidic (negatively charged) amino acids such as aspartic acid and glutamic acid; (2) basic (positively charged) amino acids such as arginine, histidine, and lysine; (3) neutral polar amino acids such as glycine, serine, threonine, cyteine, cysteine, tyrosine, asparagine, and glutamine; (4) neutral nonpolar (hydrophobic) amino acids such as alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine.
  • the encoding nucleotide sequence (gene, plasmid DNA, cDNA, or synthetic DNA) will thus have corresponding base substitutions, permitting it to code for the biologically functionally equivalent form of the chitinase of the present invention.
  • variants should be understood as a , peptides, polypeptides, and proteins which are functionally equivalent to the chitinase of the invention, preferably the chitinase comprising the SEQ ID NO: 1 .
  • variants which may be identified using appropriate screening techniques, are a part of the present invention.
  • the term "pesticidal composition” refers to the admixture of the chitinase of the invention with an appropriate carrier or diluent.
  • the carrier or diluent may be either liquid or solid which is chemically inert to the chitinase of the invention.
  • suitable examples of the solid diluent include clay, kaolin, talc, diatornaceous earth, silica, vermiculite, calcium carbonate, sodium hydrogen carbonate, pyrophyllite, activated carbon, zeolite, cellulose, calcium, chitosan, and the like, or their mixtures thereof.
  • Liquid diluents may be solvents which can dissolve the chitinase of the invention (active ingredient compound), or may be other liquids in which it may be dispersed or dissolved with aid of any surface active agent.
  • suitable examples of liquid diluents which may be used include water, phosphate buffer solution, aqueous solution of organic acids, liquid manure, seaweed, plants, wood extracts, minerals, and an amino acids aqueous solution, benzene, kerosene, alcohols, dioxane, acetone, animal oil, vegetable oil, and the like.
  • the pesticidal composition of the present invention In order to insure that effective application of the pesticidal composition of the present invention can be achieved, it is preferred to apply the pesticidal composition in combination with spreading agent, wetting agent, sticking agent, dispersing agents, suspending agents, penetrating agents, and/or emulsifying agent, etc.
  • the proportion of the chitinase of the invention to the diluent and additive mixed may vary over a wide range.
  • the concentration should be lower than 0.25% m/v, and may ranges from 0.005 to 0.025% m/v.
  • the chitinase of the present invention is to be applied in the form of a dust or wettable powder, it is desirable that the solid preparations contain the chitinase of the invention in a pesticidally effective amount.
  • the pesticidal composition of the present invention in admixture with other known fungicides, insecticides, herbicides and/or plant growth regulators, if desired.
  • Another aspect of the present invention relates to a method of controlling plant pests, which comprises contacting the plant with a chitinase that comprises the amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence SEQ ID NO: 1 , in a pesticidally effective amount.
  • the chitinase comprises the amino acid sequence as set forth in SEQ ID NO: 1 . In a more preferred embodiment, the chitinase consisting of the SEQ ID NO: 1.
  • the chitinase is encompassed in the pesticidal composition of the present invention.
  • the pesticidally effective amount is lower than 0.25 % m/v; and even more preferably, the pesticidally effective amount ranges between 0.005 and 0.025% m/v.
  • the plant pest is caused by an insect, and even more preferably, a fly.
  • the fly belongs to the Drosophila genus.
  • the fly comprises D. melanogaster, D. immigrans, D. simulans, D. subobscura, Zaprionus indianus, D. bifurca, D. sechelUa, D. yakuba, D. erecta, D. ananassae, D. suzukii, D. pseudoobscura, D. persimilis, D. willistoni, D. mojavensis, D. virilis or D. grimshawi.
  • the fly is D. suzukii.
  • Drosophila suzukii has a wide host range and can attack many fruit crops, including small fruit crops, fruit trees and grapevine. Its host range includes: Actinidia spp. (kiwis), Diospyros kaki (persimmons), Ficus carica (figs), Fragaria ananassa (strawberries), Malus domestica (apples), Prunus avium (sweet cherries), Rubus idaeus (raspberry), Cyanococcus vaccinium (blueberry), P. domestica (plums), P. persica (peaches), Pyrus pyrifolia (Asian pears), Rubus armeniacus (Himalayan blackberries), R.
  • loganobaccus loganberries
  • R. idaeus raspberries
  • R. laciniatus evergreen blackberries
  • R. ursinus marionberries
  • other blackberries Rubus spp.
  • Vaccinium spp. blueberries
  • Vitis vinifera table and wine grapes
  • the chitinase of the invention is encompassed in a pesticidal composition as defined in the first aspect of the invention.
  • control or “controlling” used throughout the specification and claims, are meant to include any pesticidal (killing) or pestistatic (inhibiting, maiming or generally interfering) activities of a pesticidal or insecticide composition against a given pest.
  • these terms not only include killing, but also include such activities as those of chemisterilants which produce sterility in insects by preventing the production of ova or sperm, by causing death of sperm or ova, or by producing severe injury to the genetic material of sperm or ova, so that the larvae that are produced do not develop into mature progeny.
  • the term "effective amount” or “pesticidally effective amount,” as used herein, refers to an amount that is capable of controlling (as defined herein above) at least one plant parasite, inducing larval mortality, pupae formation, pupae mortality and inhibiting adult emergence.
  • the term “inhibit” is used herein to mean reduce the growth and/or development of the organism (arthropods, nematodes, mollusks, insects, fungi, etc.) compared to where inhibiting agent is not present.
  • the at least one plant parasite is preferably an insect and more preferably a fly. Therefore, the pesticidally effective amount refers preferably to at least an insecticidally effective amount.
  • plant includes whole plants, shoots, vegetative organs/structures (e.g. leaves, stems and tubers), roots, flowers and floral organs/structures (e.g. bracts, sepals, petals, stamens, carpels, anthers and ovules), seed (including embryo, endosperm, and seed coat) and fruit (the mature ovary), plant tissue (e.g. vascular tissue, ground tissue, and the like) and cells (e.g. guard cells, egg cells, trichomes and the like), and progeny of same.
  • vegetative organs/structures e.g. leaves, stems and tubers
  • roots e.g. bracts, sepals, petals, stamens, carpels, anthers and ovules
  • seed including embryo, endosperm, and seed coat
  • fruit the mature ovary
  • plant tissue e.g. vascular tissue, ground tissue, and the like
  • cells e.g. guard cells, egg cells, trichome
  • the class of plants that can be used in the method of the invention is generally as broad as the class of higher and lower plants amenable to transformation techniques, including angiosperms (monocotyledonous and dicotyledonous plants), gymnosperms, ferns, and multicellular algae. It includes plants of a variety of ploidy levels, including aneuploid, polyploid, diploid, haploid and hemizygous plants.
  • the pesticidal composition or the SEQ ID NO: 1 of the invention are formulated in known manner to emulsifiable concentrates, coatable pastes, directly sprayable or dilutable solutions, dilute emulsions, wettable powders, soluble powders, dusts, granulates, and also encapsulations, for example, in polymer substances.
  • the methods of application such as spraying, immersion, atomizing, dusting, scattering or pouring, are chosen in accordance with the intended objectives and the prevailing circumstances.
  • a third aspect of the present invention relates to the use of a chitinase, preferably a plant chitinase, more preferably a plant chitinase isolated from the E. characias L, and more preferably a plant chitinase comprising the amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 97% or 99% identical to the amino acid sequence SEQ ID NO: 1 , for controlling plant pests or as insecticide.
  • a chitinase preferably a plant chitinase, more preferably a plant chitinase isolated from the E. characias L, and more preferably a plant chitinase comprising the amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 97% or 99% identical to the amino acid sequence SEQ ID NO: 1 , for controlling plant pests or as insecticide.
  • the chitinase comprises the amino acid sequence as set forth in SEQ ID NO: 1 .
  • the chitinase consisting of the amino acid sequence of SEQ ID NO: 1.
  • the plant pest is caused by an insect, and even more preferably, a fly.
  • the fly belongs to the Drosophila genus.
  • the fly comprises D. melanogaster, D. immigrans, D. simulans, D. subobscura, Zaprionus indianus, D. bifurca, D. sechelUa, D. yakuba, D. erecta, D. ananassae, D. suzukii, D. pseudoobscura, D. persimilis, D. willistoni, D. mojavensis, D. virilis or D. grimshawi.
  • the fly is D. suzukii.
  • Drosophila suzukii has a wide host range and can attack many fruit crops, including small fruit crops, fruit trees and grapevine. Its host range includes: Actinidia spp. (kiwis), Diospyros kaki (persimmons), Ficus carica (figs), Fragaria ananassa (strawberries), Malus domestica (apples), Prunus avium (sweet cherries), Rubus idaeus (raspberry), Cyanococcus vaccinium (blueberry), P. domestica (plums), P. persica (peaches), Pyrus pyrifolia (Asian pears), Rubus armeniacus (Himalayan blackberries), R.
  • loganobaccus loganberries
  • R. idaeus raspberries
  • R. laciniatus evergreen blackberries
  • R. ursinus marionberries
  • other blackberries Rubus spp.
  • Vaccinium spp. blueberries
  • Vitis vinifera table and wine grapes
  • Fig. 1 Confocal images of D. suzukii larvae 3 days after they were immersed in artificial diets: A-B, larva fed on a diet supplemented with ELC (0.005% m/v); C-D, larva fed on a diet supplemented with DFB (2%); and E-F, larva fed on a control diet.
  • ELC 0.005% m/v
  • C-D larva fed on a diet supplemented with DFB (2%)
  • E-F larva fed on a control diet.
  • General structures Hoechst 33342 staining
  • images A, C and E and sugar cell walls are detailed on rounded forms (ConA staining) on images B, D and F. Unaltered structures are visualized with higher light intensity. Used objective was 20x and scale bars represent 100 ⁇ .
  • Fig. 2 Effect of the ELC treatment on the chlorophyll content of F. x ananassa cv. Garriguette and R. idaeus (plant hosts of D. suzukii). The physiological parameter was measured on ELC (0.025%) treated and control (MQ water) leaves. Results are means of 5 different plants with SE error bars. * means statistical significance higher than 0.05. ** means statistical significance higher than 0.01.
  • Fig. 3 Effect of the ELC treatment on the chlorophyll fluorescence of F. x ananassa cv. Garriguette and R. idaeus (plant hosts of D. suzukii). The physiological parameter was measured on ELC (0.025%) treated and control (MQ water) leaves. Results are means of 5 different plants with SE error bars.
  • Fig. 4 Effect of the ELC treatment on the gas exchange of F. x ananassa cv. Garriguette and R. idaeus (plant hosts of D. suzukii). The physiological parameter was measured on ELC (0.025%) treated and control (MQ water) leaves. Results are means of 5 different plants with SE error bars. * means statistical significance higher than 0.05.
  • Fig. 5 Effect of the ELC treatment on the water potential of F. x ananassa cv. Garriguette (plant host of D. suzukii). The parameter was only measured on F. x ananassa because the petiole morphology of R. idaeus made impossible to create an airlock on the Scholander chamber. The water potential was measured on ELC (0.025%) treated and control (MQ water) leaves. Results are means of 5 different plants with SE error bars. Fig. 6. Foliar symptoms of F. x ananassa cv. Garriguette and R.
  • Fig. 7 Gene expression (relative expression, R.E.) of PGIP, Chi2_1 , Chi2_2 after ELC treatment on F. x ananassa cv. Garriguette leaves along the time (4, 24 and 48 hours after treatment). Expression profile of three genes, PGIP, Chi2_1 and Chi2_2, was normalized to the expression level of ACTIN gene and then compared to R.E. of control plants at each specific time point. Results are means obtained from a pool of 5 different plants with three technical replicates per plant. Colum bars represent the standard error of the mean. Different letters mean statistically significant differences at one specific gene along the time (capital letters compare differences in PGIP, lowercase letters in Chi2_1 and Greek letters in Chi2_2).
  • KPi potassium phosphate
  • This complex was washed with 10 mM KPi buffer pH 7.0 to remove the ballast proteins. Then, the bounded proteins were separated from magnetic chitin with 100 mM acetic acid, pH 2.8. The solution was immediately adjusted to pH 7.0 with 1 M NaOH and dialyzed against 10 mM KPi buffer pH 7.0, for 12 h at 4°C. This step was repeated 5 times (with fresh portions of latex) to obtain a sufficient amount of proteins to be subjected to further treatment. The dialyzed was loaded on DEAE cellulose column (1 x 5 cm) equilibrated with 10 mM KPi buffer pH 7.0, at 4 °C.
  • the spotted wing drosophila was coming from a colony reared at IRTA (Institut de Recerca i Tecnologia Agroalimentaries) as described by Gabarra, R., et al. (Biocontro 2015, 60:, 331 -339).
  • Five males and females were introduced for 24 hours in a 1 I glass container with 50 ml of an artificial diet (agar 0.7%, yeast 1 %, sucrose 1 .7%, wheat-germ flour 12.5%, nipagin 0.1 %, ascorbic acid 0.7% and ethanol 0.1 %). After three days, the biggest and most active larvae were used for the experiment. Using a thin paintbrush they were placed on 2.5 cm diameter plastic containers filled with 5 ml of 4 different diets.
  • These diets were 4 versions of the previously described diet: one with ELC at two different concentrations (see below), another one with a commercial insecticide (Dimilin®, Diflubenzuron (DFB), Kenogard S.A., Barcelona, Spain) used as a positive control diet; and a negative control diet enriched only with distilled water.
  • the lyophilized ELC (stored at -20°C) was diluted in distilled water immediately before the experiment at two different concentrations (0.025 and 0.005% m/v).
  • the DFB was diluted with distilled water to reach a 2% concentration following the producer's instructions. Both solutions were mixed (1 :1 ) with the freshly prepared artificial diet once reached room temperature.
  • the diet was mixed with distilled water (1 :1 ).
  • the example 1 was in a completely randomized design with ten replicates. Continuous data were analysed by the software Statistica 7.0 (Stat Soft, Inc. OK, USA). Normal distribution was checked and data not conforming to Normal distribution were transformed with logarithm and logit corrections before applying parametrical tests. To know statistic differences among groups, a one-way ANOVA was used. Tukey HSD tests were used to know statistic differences among groups caused by categorical factors on previously defined dependent variables.
  • the purified chitinase obtained from the E. characias latex (ELC) induced a 100% of mortality on D. suzukii larvae at 0.025% m/v concentration. Mortality was also high at 5-time lower concentration (0.005% m/v) (Table 1 ). Results obtained with the first ELC treatment on larval mortality were higher than the commercial insecticide (2%) based on diflubenzuron (DFB) as active principle, although the assayed concentration of DFB was 80 and 400 higher than ELC. The highest ELC concentration avoided complete pupal formation or adult emergence and both parameters were below 10% on the lowest ELC assayed concentration.
  • Results are percentages of 10 larvae (in parentheses, the logit transformed means) are calculated based on 10 replicates. Total measured larvae: 100. ** Results (in ⁇ ) are means of 10 measured larvae obtained with confocal microscope images using the x5 objective (L: long, W: width). Different letters mean statistically significant differences for different groups for each variable (column) based on a Tukey test (P ⁇ 0.05). For "larval size", lower letters compare larval long and capital letters compare larval width.
  • Microscope images showed the alterations caused by both substances (ELC 0.005% and DFB) on D. suzukii larval morphology after 3 days immersed on the modified diets (Fig. 1 ).
  • Larvae fed on the control diet showed heavily stained structures with both fluorescence dyes compared to ELC and DFB supplemented diets.
  • Larvae fed on the control diet showed heavily stained structures with both fluorescence dyes compared to ELC and DFB supplemented diets.
  • Larvae DNA were labelled with Hoechst dye which covers uniformly the larval body drawing perfectly the external morphology of the control larva (Fig. 1 E).
  • Larvae treated with DFB and ELC showed lower fluorescence intensity and the external structure was considerably altered (Figs 1A and C).
  • ConA dye which stains cell wall sugars, was less permeable than Hoechst dye in all samples but there were also differences among treatments. Control larva accumulated ConA dye in specific zones with strong intensity (Fig. 1 F) that were reduced due to DFB treatment (Fig. 1 D) and disappeared almost completely on the ELC treatment (Fig. 1 B).
  • the data show the effectiveness of the low concentrations (0.025 and 0.005%) of the chitinase of the invention (SEQ ID NO: 1 ), which induce total and high mortality on D. suzukii larvae, respectively.
  • the commercial insecticide dFB tested at a 400 times higher concentration, generated just a 20% of larval mortality.
  • Kitajima and cols purified two latex proteins from mulberry (Morus sp., Fam. Moraceae) and these proteins showed insecticidal activity against D. melanogaster (Kitajima S., et al. BMC Biochemistry. 2010, 1 1 , article n° 6).
  • the percentages of larval mortality obtained by Kitajima and cols. were between 80 and 100% which are similar to the percentages obtained with the ECL of the present invention (SEQ IDN O: 1 ).
  • SEQ IDN O: 1 the percentages obtained with the ECL of the present invention
  • the assayed concentration by Kitajima and cols (0.1 %) is 4 and 20 times higher than the concentrations of the ECL (SEQ ID NO: 1 ) tested in the present invention. Therefore, the ECL (SEQ ID NO: 1 ) of the present invention is the most effective and environment-friendly plant chitinase know in the art.
  • Potted plants were kept in a growth chamber under a 16/8 hours light/dark photoperiod, 23-20°C light-dark temperatures and PAR 135 ⁇ m-2 s "1 . After two weeks, half of the plants (5 strawberries and 5 raspberries) were treated with the ELC and five more plants were left as controls.
  • the lyophilized ELC was storage at -20°C and diluted at 0.005% in MQ water-Silwet L-77 (0.01 %) immediately before the plant application.
  • the diluted ELC was applied with a paintbrush to new and fully developed leaves of each plant.
  • Control plants were treated with MQ water-Silwet L-77 (0.01 %) using the same method.
  • the possible toxic effect was investigated on overexposed plants of strawberry and raspberry. For this purpose the plants were treated with a 50 fold higher protein concentration (0.25% m/v). All plants were in a completely randomised design.
  • the effect of the ELC treatment was analyzed on different physiological parameters for both host plants.
  • the studied parameters were: leaf chlorophyll concentration (CCM-300 chlorophyll content Meter, Opti-Sciences, NH, USA), chlorophyll fluorescence by the Fv/Fm ratio (JUNIOR-PAM, Heinz Walz GmbH, Germany), leaf gas exchanged (IRGA, ADC BioScientific Ltd., Hoddesdon, UK), and water potential (Arimad 2 Scholander chamber, MRC Ltd., Israel). Water potential was measured only on detached leaves of strawberry plants because the petiole morphology of raspberry plants made impossible to create an airlock on the Scholander chamber. All physiological parameters were measured on treated and control plants at 24, 72 hours and 1 week after treatment.
  • Example 2 was in a completely randomized design with five replicates. Continuous data were analysed by the software Statistica 7.0 (Stat Soft, Inc. OK, USA). Normal distribution was checked and data not conforming to Normal distribution were transformed with logarithm and logit corrections before applying parametrical tests. Data were analysed by a split-plot in time ANOVA. The means were compared by Tukey test and differences at p ⁇ 0.05 were considered significant.
  • RNA of the pool was extracted per triplicate using the protocol described by Jaakola and cols. (Jaakola L, et al. Molecular Biotechnology. 2001 , 19: 201 -203) with further modifications published by Liao and cols. (Liao Z., et al. Preparative Biochemistry and Biotechnology. 2004, 34: 209-214.).
  • RNA extracted was quantified with Nanodrop 2000 (Thermo Scientific, DE, USA) and quality controlled by ratios 260/280 (around 2.0) and 260/230 (> 2.0).
  • One [Jig of RNA was then transformed on cDNA in a 20 ⁇ reaction volume with iScriptTM 193 cDNA Synthesis Kit (Bio-Rad, CA, USA).
  • a diluted cDNA (1 :25) was used as a template for quantitative PCRs using iTaqTM Universal SYBR® Green Supermix (Bio-Rad, CA, USA). Real-time detection of fluorescence emissions was performed on a CFX384 Real-Time System (Bio-Rad, CA, USA) and plates were edited by the software CFX manager version 3.1 .
  • the selected three defence plant genes Chi2_1 (GenBank accession number AF420226.1 ), Chi2_2 (GenBank accession number AF420225.1 ), GPIP (GenBank accession number EU1 17213.1 ), were a polygalacturonase-inhibiting protein (PGIP) and two class II chitinases (Chi2_1 and Chi2_2).
  • PGIP polygalacturonase-inhibiting protein
  • Chi2_1 and Chi2_2 two class II chitinases
  • the expression of target genes was normalized to the expression level of the actin gene (GenBank accession number LC017712.1 ).
  • the expression of the actin gene was analyzed individually and it remained constant along the time.
  • the relative expression (RE) of each gene was calculated compared to non-treated plants harvested at each specific time point.
  • the sequences of used primers are detailed in Table 2.
  • Standard curves from serial dilutions of sample cDNA were used to check the primer efficiency was around 100%.
  • Expression of the target gene relative to the expression of the reference gene was calculated using the 2 " ⁇ method (Livak K.J., Schmittgen T.D. Methods. 2001 , 25: 402-408). The results are means of the five treated plants with three technical replicates per plant.
  • Example 3 was in a completely randomized design with three replicates. Continuous data were analysed by the software Statistica 7.0 (Stat Soft, Inc. OK, USA). Normal distribution was checked and data not conforming to Normal distribution were transformed with logarithm and logit corrections before applying parametrical tests. To know statistic differences among groups, a one-way ANOVA was used. The means were compared by Tukey test and differences at p ⁇ 0.05 were considered significant.
  • the ELC of the present invention is an environmentally friendly alternative to chemicals with a similar mode of action to the commercial insecticide DFB but without the adverse effects which have been already detected as resistance, severe mortality on non-target insects and persistence in aquatic ecosystems. Additionally, the concentrations of the ELC were harmless to the plants. Thus, modern societies demand less aggressive methods of crop protections in order to develop a sustainable agriculture and in this sense; the protein nature of the ELC reduces the long-term activity on the environment and further reduces the effects on non-target organisms.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Agronomy & Crop Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Plant Pathology (AREA)
  • Dentistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Environmental Sciences (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)

Abstract

The invention relates to an environment-friendly method for the control of plant pest insects, particularly Drosophila suzukii, using a plant-based pesticide, wherein the pesticide is a chitinase obtained from the Euphorbia. characiaslatex, providing a deeper insight on this plant chitinase with agronomic potential to insect control.

Description

Plant-based pesticide obtained from the Euphorbia characias L.
The invention relates to an environment-friendly method for the control of plant pest, particularly Drosophila suzukii, using a plant-based pesticide, wherein the pesticide is a chitinase obtained from the Euphorbia characias latex, providing a deeper insight on this plant chitinase with agronomic potential to pest control.
BACKGROUND ART The fly Drosophila suzukii (Diptera Drosophilidae), also called Spotted Wing Drosophila, causes great economic losses in the fruit sector. It is a highly polyphagous invasive pest, endemic in Southeast Asia, which has recently been spreading to western countries like the United States, Canada, Mexico and several European countries, mainly in Spain and Italy (Cini A. et al., Bulletin of Insectology. 2012, 65: 149-160). Its main hosts are soft fruits such as cherries, grapes, plums, strawberries and other cultivated berries, as well as wild berries and figs that serve as a reservoir when there is no susceptible crop. Indeed, the existence of alternative hosts that ripen at different times throughout the year exacerbates the potential pest status (Walsh DB., et al., Journal of Integrated Pest Management. 201 1 , 1 : 1 -7). In addition to its wide range of hosts, Drosophila suzukii represents a significant threat to fruit farms due to its extreme fecundity and high dispersal potential (Cini A. et al., Bulletin of Insectology. 2012, 65: 149-160). Unlike other flies that prefer rotten orfermented fruit, Drosophila suzukii attacks fresh ripe fruit. It is most active at 20° C and its activity is reduced at temperatures below 0° C. and above 30° C. (Walsh DB., et al., Journal of Integrated Pest Management. 201 1 , 1 : 1 -7). In general, they prefer a moderate climate (although adults can endure long periods of cold); they are nevertheless very sensitive to desiccation. In the Mediterranean climate, the periods of greatest risk are concentrated especially in spring and autumn. This new pest is causing great concern since until now there was no efficient monitoring or control tool available for this species.
Chitin, a linear biopolymer of β-(1 ,4) N-acetyl-D-glucosamines, is considered one of the most abundant molecules in the biosphere as a structural component of arthropods, nematodes, mollusks, insects and cell wall of fungi and green algae; and is degraded by chitinolytic enzymes being the chitinases the best known group. Chitinases (E.C 3.2.2.14) are glycosyl hydrolases with the sizes ranging from 20 kDa to about 90 kDa. Chitinases have the ability to degrade chitin directly to low molecular weight chitooligomers, which serve a broad range of industrial, agricultural, and medical functions such as elicitor action and anti-tumor activity. These enzymes have been found not only in chitin-containing organisms but also in bacteria, plants and vertebrates. In that sense, some chitinases have been isolated from latex of plants. One of these latex-producing plants is E. characias L, a ubiquitous evergreen shrub and typical member of the Mediterranean vegetation. As other spurges, E. characias presents specialized cells, called laticifers, where the latex is produced and exuded when plants are damaged. The latex composition is highly diversified with identified substances such as sugars, free radical-scavenging molecules, alkaloids, terpenoid and phenolic compounds, polymeric substances as resins and gums, starch, oils, and numerous proteins.
The insecticidal potential of chitinases has been tested on bioassays with model organisms, such as Drosophila melanogaster Meigen (Kitajima S., et al. BMC Biochemistry. 2010, 1 1 , article n° 6). Although there are several examples using pest insects, the works are based on bacterial, fungal or insect chitinases (Li M., et al. Journal of Insect Science. 2014, 14, n° 32; Prasanna L, et al., Applied Microbiology and Biotechnology. 2013, 97: 1601 -161 1 ; Boldo J.T., et al., Current Genetics. 2009, 55: 551 -560; Binod P., et al, Journal of Applied Microbiology. 2007, 103: 1845-1852; Hernandez-Torres I., et al, World Journal of Microbiology and Biotechnology. 2004, 20: 207-210), but the state of the art is silent about the use of the plant chitinases as pest insect. In this sense, there is a need in the art of finding new environment-friendly compounds which can be useful and effective as plant-based pesticides for the pest control in their host plants.
Delia Spano et al. ("Chitinase III in Euphorbia Characias Latex: Purification and Characterization," Protein Expression and Purification 1 16 (2015): 152-58) describe a new protocol for an optimal extraction and purification of a chitinase from the latex of the Euphorbia characias plant and there is no specific discussion as a pesticide. In this manuscript, the authors prove the non-antifungal activity of this chitinase and they just point at the possible insecticidal activity as a hypothesis. However, the activity has not been supported by any experiment. In a further work, the E. characias latex chitinase (ELC) surprisingly revealed a high effectivity against Drosophila suzukii larvae at a low concentration. In the same experiment, a commercial pesticide (Diflubenzuron) with chitin-degrading activity, was tested at the recommended concentration and its activity was highly decreased compared to the studied plant chitinase.
Chitinases have ability to degrade chitin but their insecticidal and/or antifungal activities has to be specifically proven. In fact, not all of them show activity against fungi or insects. For instance, Wanfang Zhong et al.'The Chitinase C Gene PsChiC from Pseudomonas Sp. and Its Synergistic Effects on Larvicidal Activity," Genetics and Molecular Biology 38, no. 3 (2015): 366-72 escribe a bacterial chitinase with little insecticidal activity towards insect larvae. The authors suggest that chitinases are highly diverse and that their biological activity degrading chitin from fungi or insects depend on the each specific chitinase protein composition. On the other hand, Kitajima et al. "Comparative study of gene expression and major proteins function of laticifers in lignified and unlignified organs of mulberry" Planta (2012) 235:589-601 (2012) describe plant chitinases that do not have insecticidal activity but antifungal activity. They even mention the lack on plant chitinases against insects because main part of them show antifungal effects. The interest of the present invention is the proved insecticidal activity of the plant chitinase of E. characias on D. suzukii, a newly described pest in Europe.
SUMMARY OF THE INVENTION The present invention discloses a novel plant-based pesticide obtained from the £. characias latex (ELC) against D. suzukii at concentrations that were harmless to the plants, opening the door for the development of integrated pest management strategies based on the disruption of cuticle and peritrophic matrix of insects. Therefore, it could be considered as an environmentally friendly alternative to chemical pesticides.
Therefore, a first aspect of the present invention related to a pesticidal composition for controlling plant pests which comprises a chitinase comprising the amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence SEQ ID NO: 1 , or a functionally variants thereof.
In a preferred embodiment, the chitinase comprises the amino acid sequence as set forth in SEQ ID NO: 1 , or a variant functionally equivalent thereof. In a more preferred embodiment, the chitinase consists of SEQ ID NO: 1 .
The pesticidal compositions of the present invention may be used in the control of agricultural, natural environmental and domestic/household pests.
In a preferred embodiment, the pesticidal composition is used against plant pests, particularly against insects, by the application of pesticidally effective amount of the pesticidal compositions of the present invention to a location where pest control is desired. Preferably, the pesticidal composition is used against a Drosophila insect; and even more preferably against Drosophila suzukii.
The term "pest" as used herein includes mosquitoes, insects and other organisms which adversely affect, preferably to plants. In a preferred embodiment, the term pest refers to mosquitoes and insects. Examples of pests which can be controlled according to the subject invention include, but are not limited to, mosquitos, fleshflies, fleas, sandflies, houseflies, dogfiies, and insects which attack plants.
The term "Chitinase" used in the present invention is not particularly limited, and is intended to include not only exact duplicates of this enzyme, but also any enzyme having substantially the same amino acid sequence, and substantially the same chitin-binding activity. Chitinases [E.C. 3.2.1.14], hydrolyze b-1 ,4-glycosidic bonds of chitin and have an ubiquitous distribution in animals, plants, insects, fungi, bacteria and viruses. These enzymes are involved in growth and development processes, participate in cell death and in stress response to heavy metals and counteract oxidative stress.
Particularly, the chitinase comprising the amino acid sequence SEQ ID NO: 1 was isolated from E. characias latex (ELC) and purified by magnetic separation procedure followed by DEAE-cellulose chromatography. According to the nucleotide sequence (SEQ ID NO: 2), the ELC was classified as a class III endochitinase and the antifungal assay revealed that it does not exhibit any inhibitory activity towards four filamentous fungi, and has a molecular weight of 36.5 ± 2 kDa. This chitinase is sometimes referred to hereinafter as the "chitinase of the invention".
The terms "homology" or "identity" or "similarity" refer to sequence similarity between two nucleic or amino acid sequences. Homology can be determined by comparing a position in each sequence, which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are identical at that position. A degree of homology or similarity or identity between nucleic acid sequences or amino acids sequences is a function of the number of identical or matching nucleotides or amino acids at positions shared by the nucleic acid sequences or amino acids sequences, respectively. The degree of homology, identity, and/or similarity can be determined by use of algorithms, programs and methods, such as and without limitations Clustal, Wilbur-Lipman, GAG, GAP, BLAST, BLASTN, BLASTP, EMBOSS Needle, FASTA, Smith Waterman or BLOSUM.
The terms "biologically functional equivalent", "functional equivalent", "functionally equivalent" as used herein refer to peptides, polypeptides, and proteins that contain a sequence or moiety exhibiting sequence similarity to the chitinase of the present invention, preferably to the chitinase comprising the SEQ ID NO: 1 , and which exhibit the same or similar pesticide activity, preferably insecticide activity, as that of the chitinase disclosed herein, comprising the SEQ ID NO: 1 .
In this sense, peptides, polypeptides, and proteins biologically functionally equivalent to the chitinase disclosed herein include amino acid sequences containing conservative amino acid changes in the fundamental sequence shown in SEQ ID NO: 1 . In such amino acid sequences, one or more amino acids in the fundamental sequence is (are) substituted with another amino acid(s), the charge and polarity of which is similar to that of the native amino acid, i.e., a conservative amino acid substitution, resulting in a silent change. Substitutes for an amino acid within the fundamental polypeptide sequence can be selected from other members of the class to which the naturally occurring amino acid belongs. Amino acids can be divided into the following four groups: (1 ) acidic amino acids; (2) basic amino acids; (3) neutral polar amino acids; and (4) neutral non-polar amino acids. Representative amino acids within these various groups include, but are not limited to: (1 ) acidic (negatively charged) amino acids such as aspartic acid and glutamic acid; (2) basic (positively charged) amino acids such as arginine, histidine, and lysine; (3) neutral polar amino acids such as glycine, serine, threonine, cyteine, cysteine, tyrosine, asparagine, and glutamine; (4) neutral nonpolar (hydrophobic) amino acids such as alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine.
The encoding nucleotide sequence (gene, plasmid DNA, cDNA, or synthetic DNA) will thus have corresponding base substitutions, permitting it to code for the biologically functionally equivalent form of the chitinase of the present invention.
In the present context, the term "variant" should be understood as a , peptides, polypeptides, and proteins which are functionally equivalent to the chitinase of the invention, preferably the chitinase comprising the SEQ ID NO: 1 . Such variants, which may be identified using appropriate screening techniques, are a part of the present invention.
In the present invention, the term "pesticidal composition" refers to the admixture of the chitinase of the invention with an appropriate carrier or diluent. The carrier or diluent may be either liquid or solid which is chemically inert to the chitinase of the invention. Suitable examples of the solid diluent include clay, kaolin, talc, diatornaceous earth, silica, vermiculite, calcium carbonate, sodium hydrogen carbonate, pyrophyllite, activated carbon, zeolite, cellulose, calcium, chitosan, and the like, or their mixtures thereof. Liquid diluents may be solvents which can dissolve the chitinase of the invention (active ingredient compound), or may be other liquids in which it may be dispersed or dissolved with aid of any surface active agent. Suitable examples of liquid diluents which may be used include water, phosphate buffer solution, aqueous solution of organic acids, liquid manure, seaweed, plants, wood extracts, minerals, and an amino acids aqueous solution, benzene, kerosene, alcohols, dioxane, acetone, animal oil, vegetable oil, and the like. In order to insure that effective application of the pesticidal composition of the present invention can be achieved, it is preferred to apply the pesticidal composition in combination with spreading agent, wetting agent, sticking agent, dispersing agents, suspending agents, penetrating agents, and/or emulsifying agent, etc. The proportion of the chitinase of the invention to the diluent and additive mixed may vary over a wide range.
When the chitinase of the present invention is to be applied in the form of a solution, the concentration should be lower than 0.25% m/v, and may ranges from 0.005 to 0.025% m/v. When the chitinase of the present invention is to be applied in the form of a dust or wettable powder, it is desirable that the solid preparations contain the chitinase of the invention in a pesticidally effective amount. Of course, it is also possible to apply the pesticidal composition of the present invention in admixture with other known fungicides, insecticides, herbicides and/or plant growth regulators, if desired.
Another aspect of the present invention relates to a method of controlling plant pests, which comprises contacting the plant with a chitinase that comprises the amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence SEQ ID NO: 1 , in a pesticidally effective amount.
In a preferred embodiment, the chitinase comprises the amino acid sequence as set forth in SEQ ID NO: 1 . In a more preferred embodiment, the chitinase consisting of the SEQ ID NO: 1.
In a more preferred embodiment, the chitinase is encompassed in the pesticidal composition of the present invention.
In another preferred embodiment, the pesticidally effective amount is lower than 0.25 % m/v; and even more preferably, the pesticidally effective amount ranges between 0.005 and 0.025% m/v.
In another preferred embodiment, the plant pest is caused by an insect, and even more preferably, a fly. In yet other embodiments, the fly belongs to the Drosophila genus. In yet other embodiments, the fly comprises D. melanogaster, D. immigrans, D. simulans, D. subobscura, Zaprionus indianus, D. bifurca, D. sechelUa, D. yakuba, D. erecta, D. ananassae, D. suzukii, D. pseudoobscura, D. persimilis, D. willistoni, D. mojavensis, D. virilis or D. grimshawi. In a more preferred embodiment the fly is D. suzukii.
Drosophila suzukii has a wide host range and can attack many fruit crops, including small fruit crops, fruit trees and grapevine. Its host range includes: Actinidia spp. (kiwis), Diospyros kaki (persimmons), Ficus carica (figs), Fragaria ananassa (strawberries), Malus domestica (apples), Prunus avium (sweet cherries), Rubus idaeus (raspberry), Cyanococcus vaccinium (blueberry), P. domestica (plums), P. persica (peaches), Pyrus pyrifolia (Asian pears), Rubus armeniacus (Himalayan blackberries), R. loganobaccus (loganberries), R. idaeus (raspberries), R. laciniatus (evergreen blackberries), R. ursinus (marionberries), and other blackberries (Rubus spp.), Vaccinium spp. (blueberries), Vitis vinifera (table and wine grapes).
In another preferred embodiment, the chitinase of the invention is encompassed in a pesticidal composition as defined in the first aspect of the invention. The terms "control" or "controlling" used throughout the specification and claims, are meant to include any pesticidal (killing) or pestistatic (inhibiting, maiming or generally interfering) activities of a pesticidal or insecticide composition against a given pest. Thus, these terms not only include killing, but also include such activities as those of chemisterilants which produce sterility in insects by preventing the production of ova or sperm, by causing death of sperm or ova, or by producing severe injury to the genetic material of sperm or ova, so that the larvae that are produced do not develop into mature progeny.
The term "effective amount" or "pesticidally effective amount," as used herein, refers to an amount that is capable of controlling (as defined herein above) at least one plant parasite, inducing larval mortality, pupae formation, pupae mortality and inhibiting adult emergence. The term "inhibit" is used herein to mean reduce the growth and/or development of the organism (arthropods, nematodes, mollusks, insects, fungi, etc.) compared to where inhibiting agent is not present. In specific aspects, the at least one plant parasite is preferably an insect and more preferably a fly. Therefore, the pesticidally effective amount refers preferably to at least an insecticidally effective amount. The term "plant" includes whole plants, shoots, vegetative organs/structures (e.g. leaves, stems and tubers), roots, flowers and floral organs/structures (e.g. bracts, sepals, petals, stamens, carpels, anthers and ovules), seed (including embryo, endosperm, and seed coat) and fruit (the mature ovary), plant tissue (e.g. vascular tissue, ground tissue, and the like) and cells (e.g. guard cells, egg cells, trichomes and the like), and progeny of same. The class of plants that can be used in the method of the invention is generally as broad as the class of higher and lower plants amenable to transformation techniques, including angiosperms (monocotyledonous and dicotyledonous plants), gymnosperms, ferns, and multicellular algae. It includes plants of a variety of ploidy levels, including aneuploid, polyploid, diploid, haploid and hemizygous plants.
In a preferred embodiment, the pesticidal composition or the SEQ ID NO: 1 of the invention, are formulated in known manner to emulsifiable concentrates, coatable pastes, directly sprayable or dilutable solutions, dilute emulsions, wettable powders, soluble powders, dusts, granulates, and also encapsulations, for example, in polymer substances. Like the nature of the compositions, the methods of application, such as spraying, immersion, atomizing, dusting, scattering or pouring, are chosen in accordance with the intended objectives and the prevailing circumstances. A third aspect of the present invention relates to the use of a chitinase, preferably a plant chitinase, more preferably a plant chitinase isolated from the E. characias L, and more preferably a plant chitinase comprising the amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 97% or 99% identical to the amino acid sequence SEQ ID NO: 1 , for controlling plant pests or as insecticide.
In a preferred embodiment, the chitinase comprises the amino acid sequence as set forth in SEQ ID NO: 1 . In a more preferred embodiment, the chitinase consisting of the amino acid sequence of SEQ ID NO: 1. In another preferred embodiment, the plant pest is caused by an insect, and even more preferably, a fly. In yet other embodiments, the fly belongs to the Drosophila genus. In yet other embodiments, the fly comprises D. melanogaster, D. immigrans, D. simulans, D. subobscura, Zaprionus indianus, D. bifurca, D. sechelUa, D. yakuba, D. erecta, D. ananassae, D. suzukii, D. pseudoobscura, D. persimilis, D. willistoni, D. mojavensis, D. virilis or D. grimshawi. In a more preferred embodiment the fly is D. suzukii.
Drosophila suzukii has a wide host range and can attack many fruit crops, including small fruit crops, fruit trees and grapevine. Its host range includes: Actinidia spp. (kiwis), Diospyros kaki (persimmons), Ficus carica (figs), Fragaria ananassa (strawberries), Malus domestica (apples), Prunus avium (sweet cherries), Rubus idaeus (raspberry), Cyanococcus vaccinium (blueberry), P. domestica (plums), P. persica (peaches), Pyrus pyrifolia (Asian pears), Rubus armeniacus (Himalayan blackberries), R. loganobaccus (loganberries), R. idaeus (raspberries), R. laciniatus (evergreen blackberries), R. ursinus (marionberries), and other blackberries (Rubus spp.), Vaccinium spp. (blueberries), Vitis vinifera (table and wine grapes).
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skilled in the art to which this invention belongs. Methods and materials similar or equivalent to those described herein can be used in the practice of the present invention. Throughout the description and claims the word "comprise" and its variations are not intended to exclude other technical features, additives, components, or steps. Additional objects, advantages and features of the invention will become apparent to those skilled in the art upon examination of the description or may be learned by practice of the invention. The following examples, drawings and sequence listing are provided by way of illustration and are not intended to be limiting of the present invention. DESCRIPTION OF THE DRAWINGS
Fig. 1. Confocal images of D. suzukii larvae 3 days after they were immersed in artificial diets: A-B, larva fed on a diet supplemented with ELC (0.005% m/v); C-D, larva fed on a diet supplemented with DFB (2%); and E-F, larva fed on a control diet. General structures (Hoechst 33342 staining) are visualized in images A, C and E and sugar cell walls are detailed on rounded forms (ConA staining) on images B, D and F. Unaltered structures are visualized with higher light intensity. Used objective was 20x and scale bars represent 100 μηι.
Fig. 2. Effect of the ELC treatment on the chlorophyll content of F. x ananassa cv. Garriguette and R. idaeus (plant hosts of D. suzukii). The physiological parameter was measured on ELC (0.025%) treated and control (MQ water) leaves. Results are means of 5 different plants with SE error bars. * means statistical significance higher than 0.05. ** means statistical significance higher than 0.01.
Fig. 3. Effect of the ELC treatment on the chlorophyll fluorescence of F. x ananassa cv. Garriguette and R. idaeus (plant hosts of D. suzukii). The physiological parameter was measured on ELC (0.025%) treated and control (MQ water) leaves. Results are means of 5 different plants with SE error bars.
Fig. 4. Effect of the ELC treatment on the gas exchange of F. x ananassa cv. Garriguette and R. idaeus (plant hosts of D. suzukii). The physiological parameter was measured on ELC (0.025%) treated and control (MQ water) leaves. Results are means of 5 different plants with SE error bars. * means statistical significance higher than 0.05.
Fig. 5. Effect of the ELC treatment on the water potential of F. x ananassa cv. Garriguette (plant host of D. suzukii). The parameter was only measured on F. x ananassa because the petiole morphology of R. idaeus made impossible to create an airlock on the Scholander chamber. The water potential was measured on ELC (0.025%) treated and control (MQ water) leaves. Results are means of 5 different plants with SE error bars. Fig. 6. Foliar symptoms of F. x ananassa cv. Garriguette and R. idaeus with an overdose of ELC (0.25% m/v) 1 week after treatment compared to plants treated with ELC (0.025% m/v). Fig. 7. Gene expression (relative expression, R.E.) of PGIP, Chi2_1 , Chi2_2 after ELC treatment on F. x ananassa cv. Garriguette leaves along the time (4, 24 and 48 hours after treatment). Expression profile of three genes, PGIP, Chi2_1 and Chi2_2, was normalized to the expression level of ACTIN gene and then compared to R.E. of control plants at each specific time point. Results are means obtained from a pool of 5 different plants with three technical replicates per plant. Colum bars represent the standard error of the mean. Different letters mean statistically significant differences at one specific gene along the time (capital letters compare differences in PGIP, lowercase letters in Chi2_1 and Greek letters in Chi2_2).
Examples
The following examples are offered to illustrate, but not to limit, the claimed invention. It is understood that the examples and embodiments described herein are for illustrative purposes only, and persons skilled in the art will recognize various reagents or parameters that can be altered without departing from the spirit of the invention or the scope of the appended claims.
Example 1
Purification of the chitinase of the invention (ELC)
E. characias latex, exuded from cut apical branches of several plants, was collected during the whole year at several locations in southern Sardinia (Italy) and centrifuged at 9000 rpm for 30 min. The supernatant (20 mL) was diluted up to 100 mL with 10 mM potassium phosphate (KPi) buffer, pH 7.0, and incubated with magnetic chitin (10 g), previously equilibrated with the same buffer. The incubation was carried out for 1 h, at 4 °C, under continuous stirring. Afterwards, the complex enzyme-magnetic chitin was separated from latex using a strong magnetic separator (NdFeB permanent magnet). This complex was washed with 10 mM KPi buffer pH 7.0 to remove the ballast proteins. Then, the bounded proteins were separated from magnetic chitin with 100 mM acetic acid, pH 2.8. The solution was immediately adjusted to pH 7.0 with 1 M NaOH and dialyzed against 10 mM KPi buffer pH 7.0, for 12 h at 4°C. This step was repeated 5 times (with fresh portions of latex) to obtain a sufficient amount of proteins to be subjected to further treatment. The dialyzed was loaded on DEAE cellulose column (1 x 5 cm) equilibrated with 10 mM KPi buffer pH 7.0, at 4 °C.
Under these conditions the chitinase ELC (SEQ ID NO: 1 ) was not bound to the column and was collected, lyophilized, and stored at -20 °C.
Assessment of the ELC effect on D. suzukii
The spotted wing drosophila was coming from a colony reared at IRTA (Institut de Recerca i Tecnologia Agroalimentaries) as described by Gabarra, R., et al. (Biocontro 2015, 60:, 331 -339). Five males and females were introduced for 24 hours in a 1 I glass container with 50 ml of an artificial diet (agar 0.7%, yeast 1 %, sucrose 1 .7%, wheat-germ flour 12.5%, nipagin 0.1 %, ascorbic acid 0.7% and ethanol 0.1 %). After three days, the biggest and most active larvae were used for the experiment. Using a thin paintbrush they were placed on 2.5 cm diameter plastic containers filled with 5 ml of 4 different diets. These diets were 4 versions of the previously described diet: one with ELC at two different concentrations (see below), another one with a commercial insecticide (Dimilin®, Diflubenzuron (DFB), Kenogard S.A., Barcelona, Spain) used as a positive control diet; and a negative control diet enriched only with distilled water. The lyophilized ELC (stored at -20°C) was diluted in distilled water immediately before the experiment at two different concentrations (0.025 and 0.005% m/v). The DFB was diluted with distilled water to reach a 2% concentration following the producer's instructions. Both solutions were mixed (1 :1 ) with the freshly prepared artificial diet once reached room temperature. For the negative control, the diet was mixed with distilled water (1 :1 ). After that, ten larvae were deposited on the surface of each 5 ml diet container and 10 replicates were prepared per each of the 4 diet treatments. Containers were maintained in aerated 50 ml cylindrical plastic pots to avoid condensation. Pots were in a completely randomised design. They were daily checked for larval mortality, pupae formation, pupae mortality and adult emergence for 10 days. The experiment was held under controlled conditions of 25°C and 16/8 hours light/dark photoperiod.
Larvae from each treatment were examined using an Olympus Fluoview 1000 Confocal Laser Scanning Biological Microscope (Olympus Corporation, Tokyo, Japan). Images were captured by Olympus UPlansApo 5x and 20x objectives using the Leica LAS EZ software (Leica Microsystems, Wetzlar, Germany). Previous to observation larvae were stained for 1 hour at room temperature with two fluorescent dyes: Concanavalina A (ConA at 50 μg ml, Molecular Probes, Oregon, USA) and Hoechst 33342 (at 12 μg ml, Molecular Probes, Oregon, USA) with fluorescence emission at 518 nm and 461 nm, respectively. Images were finally processed using I maris software (Bitplane, Belfast, UK). A total of 10 larvae were analyzed by confocal microscopy 3 days after they were immersed in three different artificial diets: 1 ) supplemented with ELC (0.005% m/v), 2) supplemented with DFB (2%) and 3) non- modified diet (control). Larval size of 10 specimens was measured with 5x images.
Statistics
The example 1 was in a completely randomized design with ten replicates. Continuous data were analysed by the software Statistica 7.0 (Stat Soft, Inc. OK, USA). Normal distribution was checked and data not conforming to Normal distribution were transformed with logarithm and logit corrections before applying parametrical tests. To know statistic differences among groups, a one-way ANOVA was used. Tukey HSD tests were used to know statistic differences among groups caused by categorical factors on previously defined dependent variables.
Results
The purified chitinase obtained from the E. characias latex (ELC) induced a 100% of mortality on D. suzukii larvae at 0.025% m/v concentration. Mortality was also high at 5-time lower concentration (0.005% m/v) (Table 1 ). Results obtained with the first ELC treatment on larval mortality were higher than the commercial insecticide (2%) based on diflubenzuron (DFB) as active principle, although the assayed concentration of DFB was 80 and 400 higher than ELC. The highest ELC concentration avoided complete pupal formation or adult emergence and both parameters were below 10% on the lowest ELC assayed concentration. On the contrary, DFB treatment induced the following life stage and an 80% of larvae were in pupal stage 5 days after the treatment, a result close to the control diet. However, these pupae did not evolve to adults (0% of adult emergence) (Table 1 ). Table 1. Effect of the artificial diets (supplemented with ELC, DFB or distilled water, DW) on biological parameters of D. suzukii cycle. Larval and pupal mortality, as well as, adult emergence were calculated 10 days after treatment. Pupae percentage and larval size were calculated 5 and 3 days after treatment, respectively.
* Results are percentages of 10 larvae (in parentheses, the logit transformed means) are calculated based on 10 replicates. Total measured larvae: 100. ** Results (in μηη) are means of 10 measured larvae obtained with confocal microscope images using the x5 objective (L: long, W: width). Different letters mean statistically significant differences for different groups for each variable (column) based on a Tukey test (P < 0.05). For "larval size", lower letters compare larval long and capital letters compare larval width.
Results on the non-modified diet revealed the set-up experiment was useful to evaluate drug toxicity, since larval mortality was reduced and adult emergence was up to 60%. Larval size confirmed the previous results and evidenced the reduced larvae development on the drug-supplemented diets compared to control (distilled water) (Table 1 ). Surprisingly, larval bodies were completely desegregated at the ELC 0.025% m/v treatment and that made it impossible to measure them. DFB decreased a 40% (23% in long and 57% in width) the size of larvae that grew on the control diet. The growth reduction was more important in the ELC 0.005% m/v treatment with larvae size 66% lower compared to control (59% in long and 73% in width). The decrease on growth was noticeable on the confocal images (Fig. 1 ).
Microscope images showed the alterations caused by both substances (ELC 0.005% and DFB) on D. suzukii larval morphology after 3 days immersed on the modified diets (Fig. 1 ). Larvae fed on the control diet showed heavily stained structures with both fluorescence dyes compared to ELC and DFB supplemented diets. Larvae fed on the control diet showed heavily stained structures with both fluorescence dyes compared to ELC and DFB supplemented diets. Larvae DNA were labelled with Hoechst dye which covers uniformly the larval body drawing perfectly the external morphology of the control larva (Fig. 1 E). Larvae treated with DFB and ELC showed lower fluorescence intensity and the external structure was considerably altered (Figs 1A and C). Internal structures that were hidden in the control larva were clearly visible in the affected larvae. ConA dye, which stains cell wall sugars, was less permeable than Hoechst dye in all samples but there were also differences among treatments. Control larva accumulated ConA dye in specific zones with strong intensity (Fig. 1 F) that were reduced due to DFB treatment (Fig. 1 D) and disappeared almost completely on the ELC treatment (Fig. 1 B).
Therefore, the data show the effectiveness of the low concentrations (0.025 and 0.005%) of the chitinase of the invention (SEQ ID NO: 1 ), which induce total and high mortality on D. suzukii larvae, respectively. On the contrary, the commercial insecticide dFB, tested at a 400 times higher concentration, generated just a 20% of larval mortality.
It is important to note that Kitajima and cols, purified two latex proteins from mulberry (Morus sp., Fam. Moraceae) and these proteins showed insecticidal activity against D. melanogaster (Kitajima S., et al. BMC Biochemistry. 2010, 1 1 , article n° 6). The percentages of larval mortality obtained by Kitajima and cols., were between 80 and 100% which are similar to the percentages obtained with the ECL of the present invention (SEQ IDN O: 1 ). But it is very important to note that the assayed concentration by Kitajima and cols (0.1 %) is 4 and 20 times higher than the concentrations of the ECL (SEQ ID NO: 1 ) tested in the present invention. Therefore, the ECL (SEQ ID NO: 1 ) of the present invention is the most effective and environment-friendly plant chitinase know in the art. Example 2
Assessment of the ELC effect on D. suzukii host plants
Strawberry plants (Fragaria x ananassa Duch.) from cv. Garriguette and raspberry plants (Rubus idaeus L.) were selected for the study for being host plant of the pest D. suzukii. Hybrid strawberries come from a collection of the CRAG (Centre for Research in Agricultura Genomics, Barcelona, Spain) and raspberries were provided by a Spanish plant producer (Planasa, Valtierra, Navarra). Plants were transferred to 1 .5 I pots with soil-perlite (1 :1 ) and were watered with Hoagland's solution (25% strength) to maintain a good hydration and nutrient status. Potted plants were kept in a growth chamber under a 16/8 hours light/dark photoperiod, 23-20°C light-dark temperatures and PAR 135 μΕ m-2 s"1. After two weeks, half of the plants (5 strawberries and 5 raspberries) were treated with the ELC and five more plants were left as controls. The lyophilized ELC was storage at -20°C and diluted at 0.005% in MQ water-Silwet L-77 (0.01 %) immediately before the plant application. The diluted ELC was applied with a paintbrush to new and fully developed leaves of each plant. Control plants were treated with MQ water-Silwet L-77 (0.01 %) using the same method. The possible toxic effect was investigated on overexposed plants of strawberry and raspberry. For this purpose the plants were treated with a 50 fold higher protein concentration (0.25% m/v). All plants were in a completely randomised design.
The effect of the ELC treatment was analyzed on different physiological parameters for both host plants. The studied parameters were: leaf chlorophyll concentration (CCM-300 chlorophyll content Meter, Opti-Sciences, NH, USA), chlorophyll fluorescence by the Fv/Fm ratio (JUNIOR-PAM, Heinz Walz GmbH, Germany), leaf gas exchanged (IRGA, ADC BioScientific Ltd., Hoddesdon, UK), and water potential (Arimad 2 Scholander chamber, MRC Ltd., Israel). Water potential was measured only on detached leaves of strawberry plants because the petiole morphology of raspberry plants made impossible to create an airlock on the Scholander chamber. All physiological parameters were measured on treated and control plants at 24, 72 hours and 1 week after treatment.
Statistics The Example 2 was in a completely randomized design with five replicates. Continuous data were analysed by the software Statistica 7.0 (Stat Soft, Inc. OK, USA). Normal distribution was checked and data not conforming to Normal distribution were transformed with logarithm and logit corrections before applying parametrical tests. Data were analysed by a split-plot in time ANOVA. The means were compared by Tukey test and differences at p < 0.05 were considered significant.
Results
The studied physiological parameters (leaf chlorophyll concentration, chlorophyll fluorescence, leaf gas exchanged and water potential) revealed that plant activity was not particularly altered during the analyzed period when both species were treated with the ELC (Figs. 2, 3, 4 and 5). With constitutively lower chlorophyll content, raspberry plants registered a reduction of this parameter 72 h after treatment that was recovered to control levels 1 week later (Fig. 2). So ELC treatment did not induce pigment degradation when plant leaves were exposed to a concentration of 0.005% m/v. Chlorophyll fluorescence (Fig. 3), gas exchange (Fig. 4) and water relations (Fig. 5) on ELC treated plants were invariable compared to control plants. These three parameters proved that the Euphorbia chitinase did not alter the normal functioning of the photosynthetic apparatus. A five-time higher concentration (0.025% m/v) did not affect leaves of strawberry and raspberry plants 1 week after the exposition, while causing a 100% larval mortality. Only an overdose using a 10 times higher concentration (0.25% m/v) induced necrosis in the leaf borders while the leaf blade remained intact (Fig. 6). Example 3
Relative expression of defence genes in F. x ananassa plants The expressions of the three plant defence genes Chi2_1 (GenBank accession number AF420226.1 ), Chi2_2 (GenBank accession number AF420225.1 ), GPIP (GenBank accession number EU1 17213.1 ) were analysed in leaves treated with the ELC for 4, 24 and 48 hours after treatment compared to the control. The application of the ELC was done following the previously described method. Control plants were treated with distilled water-Silwet L-77 (0.01 %). Treated leaves of five different plants were collected together at each time point and then directly immersed into liquid nitrogen, homogenized to fine powder and stored at -80 °C until use. Total RNA of the pool was extracted per triplicate using the protocol described by Jaakola and cols. (Jaakola L, et al. Molecular Biotechnology. 2001 , 19: 201 -203) with further modifications published by Liao and cols. (Liao Z., et al. Preparative Biochemistry and Biotechnology. 2004, 34: 209-214.). RNA extracted was quantified with Nanodrop 2000 (Thermo Scientific, DE, USA) and quality controlled by ratios 260/280 (around 2.0) and 260/230 (> 2.0). One [Jig of RNA was then transformed on cDNA in a 20 μΙ reaction volume with iScriptTM 193 cDNA Synthesis Kit (Bio-Rad, CA, USA). A diluted cDNA (1 :25) was used as a template for quantitative PCRs using iTaq™ Universal SYBR® Green Supermix (Bio-Rad, CA, USA). Real-time detection of fluorescence emissions was performed on a CFX384 Real-Time System (Bio-Rad, CA, USA) and plates were edited by the software CFX manager version 3.1 . The selected three defence plant genes, Chi2_1 (GenBank accession number AF420226.1 ), Chi2_2 (GenBank accession number AF420225.1 ), GPIP (GenBank accession number EU1 17213.1 ), were a polygalacturonase-inhibiting protein (PGIP) and two class II chitinases (Chi2_1 and Chi2_2). The expression of target genes was normalized to the expression level of the actin gene (GenBank accession number LC017712.1 ). The expression of the actin gene was analyzed individually and it remained constant along the time. The relative expression (RE) of each gene was calculated compared to non-treated plants harvested at each specific time point. The sequences of used primers are detailed in Table 2. Standard curves from serial dilutions of sample cDNA were used to check the primer efficiency was around 100%. Expression of the target gene relative to the expression of the reference gene was calculated using the 2"ΔΔα method (Livak K.J., Schmittgen T.D. Methods. 2001 , 25: 402-408). The results are means of the five treated plants with three technical replicates per plant.
Table 2. Primer sequences used for gene expression quantification in F. x ananassa.
Gene Primers 5' -3' (Fw/Rv) SEQ ID NO:
TTCATCTAGACCGCAACCAGC 3
FaPGIP
ACGGTGCCAACGAA I I I CCC 4
TCGGCACCACCGGAAGT 5
FaC i2_1
TGGGAGATCTGAGCAAGAAATG 6
GGTCAAACCTCTCACGAAACCA 7
FaC i2_2
ATCCCCAAGCATAAGGACCAT 8
GGGCCAGAAAGATGCTTATGTCGG 9
FaActin
G GG CAAC ACG AAG CTCATTGTAG AAG 10
Statistics
The Example 3 was in a completely randomized design with three replicates. Continuous data were analysed by the software Statistica 7.0 (Stat Soft, Inc. OK, USA). Normal distribution was checked and data not conforming to Normal distribution were transformed with logarithm and logit corrections before applying parametrical tests. To know statistic differences among groups, a one-way ANOVA was used. The means were compared by Tukey test and differences at p < 0.05 were considered significant.
Results
Since plants chitinases are commonly expressed under stress situations therefore the possible activation of these proteins or other defence genes was investigated F. x anannassa plants once they were exposed to the ELC. The relative expression of two genes (Chi2_1 and Chi2_2) encoding class II chitinases and, a third one, {PGIP) encoding a polygalacturonase-inhibiting protein are described for playing a role in plant defence and were selected to analyse the possible influence of the ELC on plant defence reactions.
The activation of these three plant defence genes (Chi2_1, Chi2_2 and PGIP) was studied on a time course experiment after ELC treatment (Fig. 7). The highest relative expression was observed 4 hours after the leaves exposure to the ELC (0.005%) for the three genes. One and two days after the ELC application, the relative expression of genes was reduced close to 1.
In general, results based on these three defence plant genes, Chi2_1, Chi2_2 and PGIP, revealed that the plant defence system was slightly activated in the early hours after ELC application but fell to basal levels or they were even down-regulated 24h later (Fig. 7). The highest relative expression was observed 4 hours after the leaves exposure to the ELC (0.005%) for the three genes. One and two days after the ELC application, the relative expression of genes was reduced close to 1 .
Although the plant defence system was slightly activated in the early hours after ELC application, later on the plant defence reaction was not as strong as that observed after real insect attack. This indicates that ELC is not an elicitor of the expression of defence genes in the host.
Therefore, the results showed in the present invention stated the effectiveness of a plant chitinase comprising the SEQ ID NO: 1 against the spotted wing Drosophila. The ELC of the present invention is an environmentally friendly alternative to chemicals with a similar mode of action to the commercial insecticide DFB but without the adverse effects which have been already detected as resistance, severe mortality on non-target insects and persistence in aquatic ecosystems. Additionally, the concentrations of the ELC were harmless to the plants. Thus, modern societies demand less aggressive methods of crop protections in order to develop a sustainable agriculture and in this sense; the protein nature of the ELC reduces the long-term activity on the environment and further reduces the effects on non-target organisms.

Claims

A pesticidal composition for controlling plant pests which comprises a chitinase comprising an amino acid sequence with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 1 , or a variant functionally equivalent thereof.
A pesticidal composition according to claim 1 , wherein the chitinase comprising the SEQ ID NO: 1 , or a variant functionally equivalent thereof.
A pesticidal composition according to any of claims 1 to 2, wherein the concentration of the chitinase is lower than 0.25% m/v.
4. A pesticidal composition according to claim 3, wherein the concentration ranges from 0.005 to 0.025% m/v.
5. A pesticidal composition according to any of claims 1 to 4, wherein the plant pest is caused by an insect, preferably by Drosophila spp.
6. A pesticidal composition according to claim 5 wherein the Drosophila spp. are selected from: D. melanogaster, D. immigrans, D. simulans, D. subobscura, Zaprionus indianus, D. bifurca, D. sechelUa, D. yakuba, D. erecta, D. ananassae, D. suzukii, D. pseudoobscura, D. persimilis, D. willistoni, D. mojavensis, D. virilis or D. grimshawi.
7. A pesticidal composition according to any of claims 5 to 6 wherein the Drosophila spp is D. suzukii.
8. A method of controlling plant pests, which comprises contacting the plant with a chitinase comprising an amino acid sequence with at least 75%, 80%, 85%,
90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 1 , or a functionally equivalent variant thereof, in a pesticidally effective amount.
9. A method according to claim 8 wherein the chitinase comprising the SEQ ID NO: 1 , or a variant functionally equivalent thereof.
10. A method according to any of claims 8 to 9, wherein the chitinase is encompassed in a pesticidal composition as defined in any of claims 1 to 7.
1 1 . A method according to any of claims 8 to 10, wherein the plant is a Drosophila spp host plant selected from Actinidia spp. (kiwis), Diospyros kaki (persimmons), Ficus carica (figs), Fragaria ananassa (strawberries), Malus domestica (apples), Prunus avium (sweet cherries), Rubus idaeus (raspberry),
Cyanococcus vaccinium (blueberry), P. domestica (plums), P. persica (peaches), Pyrus pyrifolia (Asian pears), Rubus armeniacus (Himalayan blackberries), R. loganobaccus (loganberries), R. idaeus (raspberries), R. laciniatus (evergreen blackberries), R. ursinus (marionberries), and other blackberries {Rubus spp.), Vaccinium spp. (blueberries), Vitis vinifera (table and wine grapes).
12. A method according to claim 10, wherein the plant is Fragaria ananassa or Rubus idaeus.
13. Use of a chitinase comprising an amino acid sequence with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 1 , or a functionally equivalent variant thereof, for controlling plant pests.
14. Use of a chitinase according to claim 13 wherein the chitinase comprising the SEQ ID NO: 1 , or a variant functionally equivalent thereof.
15. Use according to claim 14, wherein the chitinase is encompassed in a pesticidal composition as defined in any of claims 1 to 8.
EP18734475.9A 2017-06-16 2018-06-15 Plant-based pesticide obtained from the euphorbia characias l. Pending EP3638039A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP17382369 2017-06-16
PCT/EP2018/065932 WO2018229247A1 (en) 2017-06-16 2018-06-15 Plant-based pesticide obtained from the euphorbia characias l.

Publications (1)

Publication Number Publication Date
EP3638039A1 true EP3638039A1 (en) 2020-04-22

Family

ID=59078012

Family Applications (1)

Application Number Title Priority Date Filing Date
EP18734475.9A Pending EP3638039A1 (en) 2017-06-16 2018-06-15 Plant-based pesticide obtained from the euphorbia characias l.

Country Status (2)

Country Link
EP (1) EP3638039A1 (en)
WO (1) WO2018229247A1 (en)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3191594A4 (en) * 2014-09-11 2018-06-13 Marrone Bio Innovations, Inc. Chromobacterium subtsugae genome

Also Published As

Publication number Publication date
WO2018229247A1 (en) 2018-12-20

Similar Documents

Publication Publication Date Title
Woo et al. Exploiting the interactions between fungal antagonists, pathogens and the plant for biocontrol
Khalil et al. Nematicidal activity of a biopolymer chitosan at different molecular weights against root-knot nematode, Meloidogyne incognita
Narayanasamy Mechanisms of action of fungal biological control agents
TW201340874A (en) Pesticidal Flavobacterium strain and bioactive compositions, metabolites and uses
Suriani et al. Antifungal activity of Piper caninum against Pyricularia oryzae Cav. the cause of rice blast disease on rice
JP7425884B2 (en) Bacillus subtilis JCK-1398 strain that induces resistance in various plants, composition and method for controlling pine wood nematode disease using the same
Yadav et al. Bacillus subtilis NBRI-W9 simultaneously activates SAR and ISR against Fusarium chlamydosporum NBRI-FOL7 to increase wilt resistance in tomato
CN107427011A (en) Method for preventing infection in crops and ornamental plants, preferably viticulture and woody plants
Somashetty et al. A COMPREHENSIVE REVIEW ON RECENT ADVANCES IN THE RESEARCH ON BACTERIAL LEAF SPOT IN TOMATO CAUSED BY XANTHOMONAS SPECIES.
Derbalah et al. Silver oxide nanostructures as a new trend to control strawberry charcoal rot induced by Macrophomina phaseolina
Crisp et al. An evaluation of biological and abiotic controls for grapevine powdery mildew. 1. Greenhouse studies
Brunetti et al. In vitro and in planta screening of compounds for the control of Pseudomonas syringae pv. actinidiae in Actinidia chinensis var. chinensis
WO2022234569A1 (en) Bacterial strains having fungicidal activity, compositions comprising same and use thereof
Mohamed et al. Genetic improvement of Pseudomonas aeruginosa and Bacillus cereus for controlling root knot nematode and two weeds under laboratory conditions.
WO2018229247A1 (en) Plant-based pesticide obtained from the euphorbia characias l.
KR102533982B1 (en) Composition for controlling weeds comprising Streptomyces sp. DS001 or a culture medium thereof and a method for controlling weeds using the same
Alfy et al. The efficacy of chitosan as a natural component to combat aphids and enhance the physiologic response of barley productivity
US12507698B2 (en) Use of an extract of part of a rocket plant for stimulating the defenses of plants and trees and associated composition and method
Nasr Toxic and biochemical effects for certain natural compounds on the peach fruit fly, Bactrocera zonata (Diptera, Tephritidae)
Nayyer et al. Molecular approaches for the control of Septoria leaf spot in tomato
Soliman et al. Role of some essential plant oils, fungicides and inducer resistance elicitors on the management of cucumber downy mildew
Zaidi et al. Trichoderma—an impeccable plant health booster
Makhlouf et al. Biological, Histological and Pathological Studies of Tomato Wilt Disease Caused by Fusarium oxysporum f. sp. Lycopersici.
Sarfaraz et al. Biological management of Bactrocera zonata through an effective delivery system of mycoproteins of Beauveria bassiana integrated with synthetic attractant baits
Kotze Biological control of the grapevine trunk disease pathogens: pruning wound protection

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20200108

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

RIN1 Information on inventor provided before grant (corrected)

Inventor name: AGUSTI ABELLA, NURIA

Inventor name: POSCHENRIEDER WIENS, CARLOTA

Inventor name: PINTUS, FRANCESCA

Inventor name: SPANO, DELIA

Inventor name: MARTOS ARIAS, MARIA SOLEDAD

Inventor name: RIUDAVETS MUNOZ, JORDI

Inventor name: MEDDA, ROSARIA

RIN1 Information on inventor provided before grant (corrected)

Inventor name: AGUSTI ABELLA, NURIA

Inventor name: PINTUS, FRANCESCA

Inventor name: POSCHENRIEDER WIENS, CARLOTA

Inventor name: MARTOS ARIAS, MARIA SOLEDAD

Inventor name: MEDDA, ROSARIA

Inventor name: SPANO, DELIA

Inventor name: RIUDAVETS MUNOZ, JORDI

RIN1 Information on inventor provided before grant (corrected)

Inventor name: MARTOS ARIAS, MARIA SOLEDAD

Inventor name: MEDDA, ROSARIA

Inventor name: POSCHENRIEDER WIENS, CARLOTA

Inventor name: SPANO, DELIA

Inventor name: RIUDAVETS MUNOZ, JORDI

Inventor name: AGUSTI ABELLA, NURIA

Inventor name: PINTUS, FRANCESCA

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20210119

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN