EP3589315A1 - Compositions and methods for inducing hiv-1 antibodies - Google Patents
Compositions and methods for inducing hiv-1 antibodiesInfo
- Publication number
- EP3589315A1 EP3589315A1 EP18760878.1A EP18760878A EP3589315A1 EP 3589315 A1 EP3589315 A1 EP 3589315A1 EP 18760878 A EP18760878 A EP 18760878A EP 3589315 A1 EP3589315 A1 EP 3589315A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- envelope
- hiv
- antibodies
- trimer
- env
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
- C07K14/08—RNA viruses
- C07K14/15—Retroviridae, e.g. bovine leukaemia virus, feline leukaemia virus human T-cell leukaemia-lymphoma virus
- C07K14/155—Lentiviridae, e.g. human immunodeficiency virus [HIV], visna-maedi virus or equine infectious anaemia virus
- C07K14/16—HIV-1 ; HIV-2
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55555—Liposomes; Vesicles, e.g. nanoparticles; Spheres, e.g. nanospheres; Polymers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55577—Saponins; Quil A; QS21; ISCOMS
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16111—Human Immunodeficiency Virus, HIV concerning HIV env
- C12N2740/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16111—Human Immunodeficiency Virus, HIV concerning HIV env
- C12N2740/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Definitions
- the present invention relates, in general, to human immunodeficiency virus (HIV), and, in particular, to HIV-1 immunogenic compositions their methods of making and their use in vaccination regimens.
- HIV human immunodeficiency virus
- an HIV-1 vaccine should induce broadly neutralizing antibodies (bnAbs).
- bnAbs broadly neutralizing antibodies
- One class of bnAbs among antibodies isolated from infected individuals targets the glycan-polypeptide at the base of the envelope third variable loop (V3).
- V3 envelope third variable loop
- BnAbs have not been successfully induced by vaccine constructs thus far.
- the invention provides an HIV-1 envelope sequence comprising non-glycosylatable amino acids in the VI loop, at positions corresponding to N 133 and/or N138 in the CH848.3.D0949.10.17 envelope sequence, wherein the envelope protomer sequence is based on the amino acid, comprises amino acids from the CH848.3.D0949.10.17 envelope sequence, and wherein the protomer is deglycosylated in the VI loop (partially or completely in the VI loop).
- the envelope comprises amino acids substitutions within the CH848.3.D0949.10.17 sequence such that the envelope promoter forms a trimer. Any suitable envelope design or form is contemplated, so long as the envelope is based on CH848.3.D0949.10.17 sequence and the VI loop is deglycosylated. In some embodiments short VI loops of various length could be incorporated.
- the invention provides amino acid or nucleic acids sequences encoding such deglycosylated proteins.
- nucleic acids including modified mRNAs which are stable and could be used as immunogens.
- nucleic acids optionally designed as vectors, for example for recombinant expression and/or stable integration, e.g. but not limited, gpl60 DNA encoding trimer for stable expression, or VLP incorporation.
- the deglycosylated envelope is designed as a chimeric trimer chimeric (e.g incorporates amino acids and/or portions of envelope BG505).
- the deglycosylated envelopes are not chimeric, i.e. based on the sequence of envelope CH848.3.D0949.10.17 and comprising amino acids which help trimer formation.
- the envelope is designed as any suitable trimer, such as but not limited to various SO SIP desings, UFO trimers, or any other trimers.
- the envelopes of the invention comprising deglycosylated VI positions binds and/or neutralizes DH270UCA3 and/or DH270UCA4.
- the envelope protomer wherein the envelope is gp l20, gpl40, gp l45, gp l50 or gp l60.
- the invention provides a method of inducing an immune response in a subject comprising administering a combination of immunognes comprising V3 -peptide and/or glycopeptide, wherein the peptide binds to a UCA of a V3 glycan antibody, HIV- 1 envelope CH848.0949.10.17; CH848.0836.10.31 ;
- compositions contemplate nucleic acid, as DNA and/or RNA, or proteins immunogens either alone or in any combination.
- the methods contemplate genetic, as DNA and/or RNA, immunization either alone or in combination with envelope protein(s).
- the nucleic acid encoding an envelope is operably linked to a promoter inserted an expression vector.
- the compositions comprise a suitable carrier.
- the compositions comprise a suitable adjuvant.
- the induced immune response includes induction of antibodies, including but not limited to autologous and/or cross-reactive (broadly) neutralizing antibodies against HIV-1 envelope.
- antibodies including but not limited to autologous and/or cross-reactive (broadly) neutralizing antibodies against HIV-1 envelope.
- assays that analyze whether an immunogenic composition induces an immune response, and the type of antibodies induced are known in the art and are also described herein.
- the invention provides an expression vector comprising any of the nucleic acid sequences of the invention, wherein the nucleic acid is operably linked to a promoter.
- the invention provides an expression vector comprising a nucleic acid sequence encoding any of the polypeptides of the invention, wherein the nucleic acid is operably linked to a promoter.
- the nucleic acids are codon optimized for expression in a mammalian cell, in vivo or in vitro.
- the invention provides nucleic acids comprising any one of the nucleic acid sequences of invention.
- the invention provides nucleic acids consisting essentially of any one of the nucleic acid sequences of invention.
- the invention provides nucleic acids consisting of any one of the nucleic acid sequences of invention.
- the nucleic acid of the invention is operably linked to a promoter and is inserted in an expression vector.
- the invention provides an immunogenic composition comprising the expression vector.
- the invention provides a composition comprising at least one of the nucleic acid sequences of the invention. In certain aspects the invention provides a composition comprising any one of the nucleic acid sequences of invention. In certain aspects the invention provides a composition comprising at least one nucleic acid sequence encoding any one of the polypeptides of the invention.
- the envelope used in the compositions and methods of the invention can be in any suitable form: a gpl60, gpl50, gpl45, any suitable form of a trimer, for example but not limited to SOSIP trimers, gpl40 (including but not limited to gpl40C, gpl40CF, gpl40CFI), gpl20, gp41, N-terminal deletion variants (e.g. delta 11 deletions) as described herein, cleavage resistant variants, or codon optimized sequences thereof.
- gpl60 gpl60
- gpl50 gpl45
- any suitable form of a trimer for example but not limited to SOSIP trimers
- gpl40 including but not limited to gpl40C, gpl40CF, gpl40CFI
- gpl20 including but not limited to gpl40C, gpl40CF, gpl40CFI
- the polypeptide contemplated by the invention can be a polypeptide comprising any one of the polypeptides described herein.
- the polypeptide contemplated by the invention can be a polypeptide consisting essentially of any one of the polypeptides described herein.
- the polypeptide contemplated by the invention can be a polypeptide consisting of any one of the polypeptides described herein.
- the polypeptide is recombinantly produced.
- the polypeptides and nucleic acids of the invention are suitable for use as an immunogen, for example to be administered in a human subject.
- the envelope is any of the forms of HIV- 1 envelope.
- the envelope is gpl20, gpl40, gpl45 (i.e. with a transmembrane), gpl50, optionally as a trimer.
- the trimer is a chimeric SOSIP trimer. See WO2016/037154 incorporated by reference in its entirety.
- envelope trimers are purified from cellular recombinant fractions by antibody binding and reconstituted in lipid comprising formulations. See for example WO2015/127108 titled "Trimeric HIV- 1 envelopes and uses thereof which content is herein incorporated by reference in its entirety.
- the envelope is in a liposome and transmembrane with a cytoplasmic tail in a liposome.
- the nucleic acid comprises a nucleic acid sequence which encode a gpl20, gpl40 (including but not limited to gpl40C, gpl40CF, gpl40CFI), gpl45, gpl50 or gpl60.
- the envelope used in the compositions and methods of the invention can be a gpl60, gpl50, gpl45, gpl40, gpl20, gp41, N-terminal deletion variants as described herein, cleavage resistant variants as described herein, or codon optimized sequences thereof.
- the composition comprises envelopes as trimers.
- envelope proteins are multimerized, for example trimers are attached to a particle such that multiple copies of the trimer are attached and the multimerized envelope is prepared and formulated for immunization in a human.
- the compositions comprise envelopes, including but not limited to trimers as particulate, high- density array on liposomes or other particles, for example but not limited to nanoparticles.
- the trimers are in a well ordered, near native like or closed conformation.
- the trimer compositions comprise a homogenous mix of native like trimers.
- the trimer compositions comprise at least 85%, 90%, 95% native like trimers.
- the vectors is any suitable vector.
- suitable vector include, the VSV, replicating rAdenovirus type 4, MVA, Chimp adenovirus vectors, pox vectors, and the like.
- the nucleic acids are administered in NanoTaxi block polymer nanospheres.
- the composition and methods comprise an adjuvant.
- Non-limiting examples include, AS01 B, AS01 E, Gla/SE, alum, Poly I poly C (in any form, including but not limited to PolylC/long chain (LC)), TLR agonists, TLR7/8 and 9 agonists, or a combination of TLR7/8 and TLR9 agonists (see Moody et al. (2014) J. Virol. March 2014 vol. 88 no. 6 3329-3339) , or any other adjuvant.
- TLR7/8 agonist include TLR7/8 ligands, Gardiquimod, Imiquimod and R848 (resiquimod).
- a non- limiting embodiment of a combination of TLR7/8 and TLR9 agonist comprises R848 and oCpG in STS (see Moody et al. (2014) J. Virol. March 2014 vol. 88 no. 6 3329-3339).
- the invention provides a kit comprising a combination/selection of immunogens, for example but not limited to immunogens in Figure 37A-D, and Example 3.
- the selection of immunogens is selection F, selection G, or selection H.
- the kit comprises instructions on how to carry out the immunization regimen.
- the kit comprises instructions on administration of the selection of immunogens as a prime or boost as part of a prime/boost immunization regimen.
- the invention provides a recombinant HIV- 1 envelope polypeptide, wherein the polypeptide comprises the amino acid sequence of any one of the envelopes designs in Table 1, Table 3, Example 3, Example 5.
- the envelope is engineered with modifications so as to improve its binding to the DH270UCA antibody.
- the engineered envelope is based on the sequence of HIV- 1 envelope CH848.0949.10.17.
- the protein does not include the signal peptide.
- the invention provides a recombinant HIV- 1 envelope polypeptide from Table 1, Table 3, Example 3, Example 5 wherein the polypeptide is non-naturally occurring and designed to form a soluble trimer.
- the protein does not include the signal peptide.
- the invention provides a nucleic acid encoding any one of the polypeptides of the invention.
- the nucleic acids could be formulated in any suitable way for immunogenic delivery of nucleic acids.
- the invention provides an immunogenic composition comprising the recombinant HIV- 1 envelope polypeptides of the invention and a carrier.
- the invention provides an immunogenic composition comprising the nucleic acid of the invention and a carrier.
- the compositions could comprise an adjuvant.
- a method of inducing an immune response in a subject comprising administering a composition comprising an HIV-1 envelope polypeptide (s) in an amount sufficient to induce an immune response from one or more of the following groups: deglycosylated envelope polypeptide form(s) of CH848.0949.10.17 designed to bind DH270UCA (Table 1, Table 3, Table 4, Ex. 3, Ex. 5), or any combination thereof as a prime; and wherein the administration step can alternatively, or in addition, comprise administering any suitable form of a nucleic acid(s) encoding an HIV-1 envelope polypeptide(s) in an amount sufficient to induce an immune response from one or more of the following groups:
- deglycosylated envelope polypeptide form(s) of CH848.0949.10.17 designed to bind DH270UCA (Table 1, Table 3, Table 4, Ex. 3, Ex. 5), or any combination thereof as a prime.
- the invention provides methods of inducing an immune response in a subject comprising administering a composition comprising an HIV-1 envelope polypeptide (s) in an amount sufficient to induce an immune response from one or more of the following groups:
- administration step can alternatively, or in addition, comprise administering any suitable form of a nucleic acid(s) encoding an HIV-1 envelope polypeptide (s) in an amount sufficient to induce an immune response from one or more of the following groups:
- the first boost administered after the prime comprises HIV-1 envelope polypeptide CH848.0949.10.17 in any suitable form.
- the boos could comprise any of the envelopes of the invention.
- the boost is any of the envelopes of Table 1, Table 3 or Table 4. Non-limiting embodiment include any of the envelopes in Figure 50.
- the nucleic acid encodes a gpl20 envelope, gpl20Dl 1 envelope, a gpl40 envelope (gpl40C, gpl40CF, gpl40CFI) as soluble or stabilized protomer of a SOSIP trimer, a gpl45 envelope, a gpl50 envelope, or a transmembrane bound envelope.
- a gpl20 envelope gpl20Dl 1 envelope
- a gpl40 envelope gpl40C, gpl40CF, gpl40CFI
- the polypeptide is gpl20 envelope, gpl20Dl 1 envelope, a gpl40 envelope (gpl40C, gpl40CF, gpl40CFI) as soluble or stabilized protomer of a SOSIP trimer, a gpl45 envelope, a gpl50 envelope, or a transmembrane bound envelope.
- the methods further comprise administering an agent which modulates host immune tolerance.
- the immunogen of the invention is multimerized in a liposome or nanoparticle.
- the methods further comprise administering one or more additional HIV-1 immunogens to induce a T cell response.
- the invention provides a kit comprising a combination/selection of immunogens of Selection I (V3 peptide in any suitable form such aglycone, glycosylated, multimerized, carrying T cell epitopes, etc.); recombinant HIV-1 envelopes
- a kit comprising a combination/selection of immunogens comprising any suitable envelope design which binds to the DH270UCA; recombinant HIV-1 envelopes CH848.0949.10.17; CH848.0358.80.06; CH848.1432.5.41; CH848.0526.25.02), and optionally envelope polypeptide CH0848.3.dl651.10.0, and/or a nucleic acid encoding the same in any suitable form.
- the envelope and/or nucleic acid in the kits of the invention could be in any suitable form.
- the V3 peptide in the kits of the invention could be of SEQ ID NO: 1.
- the peptide is glycosylated.
- the peptide is not glycosylated.
- the kit comprises an adjuvant.
- the kit comprises instructions on how to carry out the immunization regiment: the immunogen could be administered sequentially or additively.
- the invention provides a recombinant CH848 envelope protein designed to form a soluble trimer, wherein the CH848 envelope protein comprises the sequence of any one of the envelopes or designs in Tables 1, 3, 4 and Ex, 3. Ex. 5, Figures 39A, 40A or 41 A, Figs. 49, et seq. In certain embodiments, the protein does not include the signal peptide.
- the invention provides an immunogenic composition comprising the recombinant HIV- 1 envelope CH848.0949.10.17, CH848.0836.10.31, CH848.0358.80.06; CH848.1432.5.41; CH848.0526.25.02 in any suitable form or a nucleic acid encoding the same.
- the recombinant envelope comprises the sequence of the CHIM.6R.SOSIP.664V4.1 design, or any other suitable trimer design, or multimerized timer.
- the recombinant envelope comprises the sequence any other envelope form (See e.g. Figures 39-41, 49-78; other forms such as gpl40C, gpl40CF, gpl40CFI).
- the invention also provides compositions comprising suitable form of an HIV-1 envelope polypeptide or any suitable form of a nucleic acid encoding HIV-1 envelope from the selections of envelopes listed in Tables 1, 3 and Ex, 3, Ex. 5 Figures 39A, 40A or 41 A, 49, or any combination thereof.
- the invention provides a kit comprising a combination/selection of immunogens described in Tables 1, 3 and Ex, 3, and instructions for which immunogen are administered as a prime and which immunogens are administered as a boost.
- the kit of Selection I V3 peptide in any suitable form such aglycone, glycosylated, multimerized, carrying T cell epitopes, etc.; recombinant HIV-1 envelopes CH848.0949.10.17; CH848.0358.80.06; CH848.1432.5.41; CH848.0526.25.02) and/or a nucleic acid encoding the same.
- the envelope and/or nucleic acid in the kits of the invention could be in any suitable form.
- the V3 peptide in the kits of the invention could be of SEQ ID NO: 1.
- the peptide is glycosylated.
- the peptide is not glycosylated.
- the kit comprises an adjuvant.
- the kit comprises instructions on how to carry out the immunization regiment: the immunogen could be administered sequentially or additively.
- the invention provides a recombinant cell, a clonal population of cells, or a pool of cells comprising a nucleic acid encoding any one of the envelope proteins or immunogens of the invention.
- a recombinant HIV-1 Envelope ectodomain trimer comprising three gpl20-gp41 protomers comprising a gpl20 polypeptide and a gp41 ectodomain, wherein each protomer is the same and comprises portions from envelope BG505 HIV-1 strain and gpl20 polypeptide portions from a CH0848 HIV-1 strain and stabilizing mutations A316W and E64K, wherein the trimer is stabilized in a prefusion mature closed conformation, and wherein the trimer does not comprise non-natural disulfide bond between cysteine substitutions at positions 201 and 433 of the HXB2 reference sequence.
- the amino acid sequence of one monomer of trimer In some embodiments, the amino acid sequence of one monomer of trimer.
- the trimer is immunogenic. In some embodiments the trimer binds to any one of the antibodies PGT145, PGT151, CH103UCA, CH103, VRCOl, PGT128, or any combination thereof. In some embodiments the trimer does not bind to antibody 19B and/or 17B.
- the compositions comprising trimers are immunogenic.
- the invention provides a pharmaceutical composition comprising any one of the recombinant trimers of the invention.
- the compositions comprising trimers are immunogenic.
- the percent trimer in such immunogenic compositions could vary.
- the composition comprises 70%, 71%, 72%, 73%, 74%,75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% stabilized trimer.
- the invention is directed to recombinant HIV-1 envelope which comprises changes in the amino acid sequence such that the envelope is partially
- the partially deglycosylated envelopes binds to specific UCA antibodies, including but not limited to the DH270 UCA.
- the contemplated changes are with respect to a reference envelope sequence, which may or may not be naturally occurring.
- deglycosylation is in the VI loop of the HIV-1 envelope. In certain embodiments these changes are at positions N133, N138, N156, N301, N332, or any combination thereof.
- the envelope is glycosylated at positions N301 and N332 (See Example 5, Figures 49-78). Position given with respect to VI loop sequence shown in Figure 75.
- Any suitable amino acid change is contemplated so long as glycosylation at that position is abolished.
- Non-limiting embodiments include amino acids which are naturally occurring at the respective position in other envelopes such that the modified envelopes are deglycosylated.
- Non-limiting amino acid changes include change to alanine, or any of the following: N133D, N138T, N301A, N301S, N332A, N332T.
- Any envelope form e.g. but not limited to stabilized SOSIP trimer designs, gpl40s, etc. could be designed to comprise deglycosylation mutations.
- the envelope is
- compositions comprising these
- deglycosylated envelopes In certain embodiments, these deglycosylated envelopes are used as immunogens. In certain embodiments, these deglycosylated envelopes are comprised in immunogenic compositions with suitable carriers and/or adjuvants.
- the invention also contemplates multimerized forms of any of the recombinant envelopes of the invention.
- the invention provides immunogenic compositions and their use to induce immune responses, wherein the envelope immunogen structure is stabilized by the addition of small molecules.
- a non-limiting example of such compound is BMS- 626529.
- the invention provides methods of inducing immune response in a subject comprising administering compositions comprising deglycosylated envelopes.
- these deglycosylated envelopes are administered as a prime.
- the prime could be a nucleic acid encoding a deglycosylaed
- the glycosylated envelopes could also be administered as a boost.
- the invention provides compositions comprising V3 antibody immunogens and methods for inducing antibodies to the V3 HIV- 1 envelope region.
- the invention provides selection of immunogens which are used to induce V3 antibodies.
- the immunogens include a homogeneous minimal immunogen with high mannose glycans reflective of a native Env V3-glycan bnAb epitope, (Man9-V3).
- the immunogens include a homogeneous minimal immunogen without glycans.
- V3-glycan bnAbs bound to Man9-V3 glycopeptide and native-like gp l40 trimers with similar affinities. Both fluorophore-labeled Man9-V3 or native-like trimers similarly bound to bnAb memory B cells, and by flow sorting isolated members of a bnAb clonal lineage from an HIV-1 -infected individual.
- the glycopeptide of Figure 38A-E bound the germline of a V3-glycan bnAb lineage.
- a Man9-V3 glycopeptide mimics a HIV-1 V3-glycan bnAb epitope and is a candidate immunogen to initiate V3-glycan bnAb lineage maturation.
- compositions comprise immunologically and
- FIG. 1A-B DH270 lineage with time of appearance and neutralization by selected members.
- A Phylogenetic relationship of 6 mAbs and 93 NGS VHDJH sequence reads in the DH270 clonal lineage. External nodes (filled circles) represent VHDJH nucleotide sequences of either antibodies retrieved from cultured and sorted memory B cells (labeled) or a curated dataset of NGS VHDJH rearrangement reads (unlabeled). Coloring is by time of isolation. Samples from week 11, 19, 64, 111, 160, 186 and 240 were tested and time-points from which no NGS reads within the lineage were retrieved are reported in Figures 30A-C.
- FIGS 2A-D Heterologous breadth in the DH270 lineage.
- A Neutralizing activity of DH270.1, DH270.5 and DH270.6 bnAbs (columns) for 207 tier 2 heterologous viruses (rows). Coloring is by neutralization IC50 ⁇ g/ml).
- the first column displays presence of a PNG site at position 332 (blue), N334 (orange) or at neither one (black).
- the second column indicates the clade of each individual HIV-1 strain and is color coded as indicated: clade A: green; clade B: blue; clade C: yellow; clade D: purple; CRF01 : pink; clade G: cyan; others: gray.
- FIG. 33 Heterologous neutralization of all DH270 lineage antibodies for a 24- virus panel. Color coding for presence of PNG sites, clade and IC50 is the same of panel A. See Figures 7A-D and Figures 34-35.
- C Co-variation between VH mutation frequencies (x- axis), neutralization breadth (y-axis, top panels) and potency (y-axis, bottom panels) of individual antibodies against viruses with a PNG site at position N332 from the larger (left) and smaller (right) pseudovirus panels.
- D Correlation between viral VI loop length and DH270 lineage antibody neutralization.
- Top panel neutralization of 17 viruses (with N332 and sensitive to at least one DH270 lineage antibody) by selected DH270 lineage antibodies from UCA to mature bnAbs (x-axis). Viruses are identified by their respective VI loop lengths (y-axis); for each virus, neutralization sensitivity is indicated by an open circle and resistance by a solid circle. The >-value is a Wilcoxon rank sum comparison of VI length distributions between sensitive and resistant viruses.
- Bottom panel regression lines (IC50 for neutralization vs. VI loop length) for DH270.1 and DH270.6, with a p-value based on Kendall's tau.
- Figures 3A-E A single disfavored mutation early during DH270 clonal development conferred neutralizing activity to the V3 glycan bnAb DH270 precursor antibodies.
- AID hotspots are indicated by red lines (solid: canonical; dashed: non-canonical); AID cold spots by blue lines (solid: canonical; dashed: non-canonical) (20).
- DH270.IA4 retained positional conformity with DH272 but not identity conformity (red boxes).
- B Sequence logo plot of aa mutated from germline (top) in NGS reads of the DH270 (middle) and DH272 (bottom) lineages at weeks 186 and 1 1 1 post-transmission, respectively. Red asterisks indicate aa mutated in DH270.IA4. The black arrow indicates lack of identity conformity between the two lineages at aa position 57.
- C Sequence logo plot of nucleotide mutations (position 165-173) in the DH270 and DH272 lineages at weeks 186 and 1 1 1 post-transmission, respectively. The arrow indicates position 169.
- D Effect of reversion mutations on DH270.IA4 neutralization. Coloring is by IC50.
- E Effect of G57R mutation on DH270.UCA autologous (top) and heterologous (bottom) neutralizing activity.
- FIGS 4A-C Cooperation among DH270, DH272 and DH475 N332 dependent V3 glycan nAb lineages.
- A Neutralizing activity of DH272, DH475 and DH270 lineage antibodies (columns) against 90 autologous viruses isolated from CH848 over time (rows). Neutralization potency (IC50) is shown as indicated in the bar. For each pseudovirus, presence of an N332 PNG site and VI loop length are indicated on the right. Also see Figs. 34-35.
- B, C Susceptibility to DH270.1 and to (B) DH475 or (C) DH272 of autologous viruses bearing selected immunotype-specific mutations.
- FIGS 5A-H Figures 5A-H. Fab/scFv crystal structures and 3D-reconstruction of DH270.1 bound with the 92BR SOSIP.664 trimer. Superposition of backbone ribbon diagrams for DH270 lineage members: UCA1 (gray), DH270.1 (green), and DH270.6 (blue) (A) alone, (B) with the DH272 cooperating antibody (red), (C) with PGT 128 (magenta), and (D) with PGT124 (orange). Arrows indicate major differences in CDR regions.
- FIG. 1 Top and (F) side views of a fit of the DH270.1 Fab (green) and the BG505 SO SIP trimer (gray) into a map obtained from negative-stain EM.
- FIG. 1 Top and (H) side views of the BG505 trimer (PDB ID: 5ACO) (28) (gray, with V1/V2 and V3 loops highlighted in red and blue, respectively) bound with PGT124 (PDB ID: 4R2G) (27) (orange), PGT128 (PDB ID: 3TYG) (17) (magenta), PGT135 (PDB ID: 4JM2) (22) (cyan) and DH270.1 (green), superposed.
- FIG. 6A-B DH270 lineage antibody binding to autologous CH848 Env components.
- A Binding of DH270 lineage antibodies (column) to 120 CH848 autologous gpl20 Env glycoproteins (rows) grouped based on time of isolation (w: week; d: day; black and white blocks). The last three rows show the neutralization profile of the three autologous viruses that lost the PNG at position N332 (blue blocks). VI aa length of each virus is color- coded as indicated.
- Antibody binding is measured in ELISA and expressed as log area under the curve (LogAUC) and color-coded based on the categories shown in the histogram. The histogram shows the distribution of the measured values in each category. The black arrow indicated Env 10.17. Viruses isolated at and after week 186, which is the time of first evidence of DH270 lineage presence, are highlighted in different colors according to week of isolation.
- B Left: Binding to CH848.TF mutants with disrupted N301 and/or N332 glycan sites. Results are expressed as LogAUC. VH mutation frequency is shown in parenthesis for each antibody (see also Fig. 7A).
- Middle Binding to CH848 Env trimer expressed on the cell surface of CHO cells.
- Results are expressed as maximum percentage of binding and are representative of duplicate experiments. DH270 antibodies are shown in red. Palivizumab is the negative control (gray area). The curves indicate binding to the surface antigen on a 0 to 100 scale (y-axis), the highest peak between the test antibody and the negative control sets the value of 100. Right: Binding to free glycans measured on a microarray. Results are the average of background-subtracted triplicate measurements and are expressed in RU. Figures 2A-D.
- Figures 7A-D Characteristics of DH270 lineage monoclonal antibodies.
- A Immunogenetics of DH270 lineage monoclonal antibodies.
- B Phylogenetic relationship of VHDJH rearrangements of the unmutated common ancestor (DH270.UCA) and maturation intermediates DH270.IA1 through DH270.IA4 inferred from mature antibodies DH270.1 through DH270.5.
- DH270.6 was not included and clusters close to DH270.4 and DH270.5 as shown in Fig. 1.
- FIGS 8A-C DH270 lineage displays a N332-dependent V3 glycan bnAb functional profile.
- A DH270 antibody lineage neutralization of five HIV-1 pseudoviruses and respective N332A mutants. Data are expressed as IC50 ⁇ g/ml. Positivity ⁇ 10 ⁇ g/ml is shown in bold.
- B, C DH270.1 ability to compete gpl20 Env binding of V3 glycan bnAbs PGT125 and PGT128. Inhibition by cold PGT125 or PGT128 (grey line) was used as control (see Methods).
- FIGS 9A-D DH475 and DH272 are strain-specific, N332-glycan dependent antibodies.
- A Phylogenetic trees of DH475 (top) and DH272 (bottom) clonal lineages. External nodes (filled circles) representing VHDJH observed sequences retrieved from cultured and sorted memory B cells (labeled) or NGS antibody sequences (unlabeled) are colored according to time point of isolation. Internal nodes (open circles) represent inferred ancestral intermediate sequences. Branch length estimates units are nucleotide substitution per site.
- FIG. 10 CH848 was infected by a single transmitted founder virus. 79 HIV-1 3' half single genome sequences were generated from screening timepoint plasma. Depicted is a nucleotide Highlighter plot (www.hiv.lanl.gov/content/sequence/HIGHLIGHT/
- Horizontal lines represent single genome sequences and tic marks denote nucleotide changes relative to the inferred TF sequence (key at top, nucleotide position relative to HXB2).
- FIGS 11A-B CH848 was infected by a subtype C virus.
- A PhyML was used to construct a maximum likelihood phylogenetic tree comparing the CH848 transmitted founder virus to representative sequences from subtypes Al, A2, B, C, D, Fl, F2, G, H, and K (substitution model: GTR+I+G, scale bar bottom right).
- the CH848 TF sequence in the subtype C virus cluster is shown in red.
- FIG. 12 Co-evolution of CH848 autologous virus and N332-dependent V3 glycan antibody lineages DH272, DH475 and DH270. Mutations relative to the CH848 TF virus in the alignment of CH848 sequences with accompanying neutralization data
- FIG. 13A-B Mutations in CH848 Env over time.
- A Variable positions that are close to the PGT128 epitope in a trimer structure (PDB ID: 4TVP) (13) are represented by spheres color-coded by the time post-infection when they first mutate away from the CH848 TF sequence.
- Env positions with either main chain, side chain or glycans within 8.5A of any PGT128 heavy atom are shown in yellow surface and brown ribbon representations. Time of appearance of mutations are color coded as indicated.
- B Same as (A) for mutating Env sites that were autologous antibody signatures of antibody sensitivity and resistance.
- FIG 14. Accumulation of amino acid mutations in CH848 virus over time. This figure shows all of the readily aligned positions near the contact site of V3 glycan antibodies in Figures 13A-B, (excluding amino acids that are embedded in the VI hypervariable regions).
- the magenta O is a PNG site, whereas an N is an Asn that is not embedded in a glycosylation site.
- the logo plots represent the frequency of amino acids at each position, and the TF amino acid is left blank to highlight the differences over time.
- FIG. 16A-F Inverse-correlation between the potency of V3 glycan broadly neutralizing antibodies and VI length shown for the full panel of 207 viruses.
- Correlation p-values are non-parametric two sided, Kendall's tau. Slopes show linear regression.
- FIGS 17A-B Role of VH1-2*02 intrinsic mutability in determining DH270 lineage antibody somatic hypermutation.
- A The sequence logo plot shows the frequency of VH1- 2*02 amino acid (aa) mutations from germline at each position, calculated from an alignment of 10,995 VHl-2*02 reads obtained from 8 HIV-1 negative individuals by NGS that replicated across two independent Illumina experiments (35). The logo plot shows the frequency of mutated aa at each position. The red line indicates the threshold of mutation frequency (20%) used to define frequently mutated aa.
- the VH aa sequences of DH270 lineage antibodies, DH272 and VRCOl are aligned on the top.
- the 12 red vertical stripes indicate frequently mutated aa that were also frequently mutated (>25% of the VH sequences of isolated antibodies) in the DH270 lineage.
- Figure discloses SEQ ID NOS 84-96, respectively, in order of appearance.
- (B) VH aa encoded by VH1-2 sequences from genomic DNA aligned to DH270 lineage antibodies aa sequences (see “Sequencing of germline variable region from genomic DNA” in Methods).
- Figure discloses SEQ ID NOS 97-109, respectively, in order of appearance.
- FIGS 18A-B Effect of the G57R mutation on DH270.IA4 and DH270.UCA binding to Env 10.17 gpl20.
- A Binding to Env 10.17 gpl20 by wild-type DH270.IA4 (black) and DH270.IA4 variants in which each mutated aa was reverted to germline (D31G, blue; I34M, orange; T55S, green, R57G, red). Mean and standard deviation from duplicate observations are indicated for each datapoint and curve fitting (non-linear, 4-parameters) is shown for each dataset. Binding is quantified as background subtracted OD450 values.
- B Binding to Env 10.17 by wild-type DH270.UCA (black) and the DH270.UCA with the G57R mutation (red).
- FIG. 19 Virus signature analysis.
- Logo plots represent the frequency of amino acids mutations in CH848 virus quasispecies from transmitted founder at indicated positions over time. Red indicates a negatively charged amino acid, blue positive, black neutral; the light blue O is a PNG site.
- the signatures outlined in detail in Figure 36 are summarized in the bottom right column where a red amino acid is associated with resistance to the antibody on the right, a blue amino acid is associated with sensitivity.
- Figures 20A-F Autologous Env VI length associations with DH270 lineage neutralization and gpl20 binding. Eighty-two virus Envs - the subset from Figures 34-35 that were assayed for both neutralization (A-C) and binding (D-F) to DH270.1, DH270.4 and DH270.5 - were evaluated. The 3 Envs that had lost the PNG site at N332 were not included, as they were negative for all antibodies tested independently of VI length. Only points from positive results are plotted: IC50 ⁇ 50 ⁇ g/ml for neutralization in panels A-C, and AUC >1 for binding in panels D-F. N is the number of positive sample.
- Figures 21A-C Sequence and structural comparison of DH270.UCA1 and
- DH270.UCA3 Sequence alignments of UCA3 and UCAl .
- A Heavy chains (SEQ ID NOS 110-112, respectively, in order of appearance) and
- the UCA3 and UCA4 light chains are identical. Asterisks indicate positions in which the amino acids are the same. Colon period ".” and blanks " " correspond to strictly conserved, conserved and major differences, respectively.
- C Superposition of UCA3 (cyan) and UCAl (gray). Structural differences in CDR regions are indicated with an arrow.
- FIG. 22 Accumulation of mutation in DH270 lineage antibodies. Mutations are highlighted as spheres on the Fv region of each antibody, where the CDR regions, labeled on the backbone of the UCA, face outward. The G57R mutation is shown in red; the other mutations incurred between the UCA and IA4 are shown in orange. Mutations between intermediates are colored as follows: between IA2 and IA4, yellow; between IA1 and IA2, green; between IA3 and IA4, magenta. Mutations between the late intermediates and DH270.1, DH270.2, DH270.3, DH270.4, and DH270.5 are in brown, light purple, dark purple, blue, and dark blue, respectively.
- FIG. 24 DH270.1 and other N332 bnAbs bound to the 92BR SOSIP.664 trimer.
- the arrows indicate the direction of the principal axis of each of the bnAb Fabs; the color of each arrow matches that of the corresponding bnAb.
- FIGS 25A-B DH270.1 binding kinetics to 92BR SOSIP.664 trimers with mutated PNG sites.
- A Glycans forming a "funnel" are shown on the surface of the trimer. VI -V2 and V3 loops are colored red and blue, respectively.
- B Association and dissociation curves, using biolayer interferometry, against different 92BR SOSIP.664 glycan mutants.
- FIGS 26A-C DH270.1 binding kinetics to 92BR SOSIP.664 trimer with additional mutations.
- A Sequence Logo of the V3 region of CH848 autologous viruses are shown.
- B Binding kinetics, using biolayer interferometry, against different 92BR SOSIP.664 V3 loop region mutants.
- C DH270.1 heavy chain mutants and 92BR SOSIP.664.
- Biolayer interferometry association and dissociation curves for the indicated Fab mutants for binding to 92BR SOSIP.664 (600nM curves are shown) Not shown are curves for DH270.1 heavy chain mutants K32A, R72A, D73A, S25D, S54D, S60D and double mutant S75/77A for which there was little or no reduction in affinity.
- FIGS 27A-B Man 9 -V3 glycopeptide binding of DH270 lineage antibodies.
- DH270 lineage tree (A, top left) is shown with VH mutations of intermediates and mature antibodies.
- DH270.6 mAb which clusters close to DH270.4 and DH270.5, is not shown in the phylogenetic tree.
- Binding of Man9-V3 glycopeptide and its aglycone form to DH270 lineage antibodies was measured by BLI assay using either biotinylated Man9-V3 (A) or biotinylated aglycone V3 (B) as described in Methods.
- DH270 lineage antibodies were each used at concentrations of 5, 10, 25, 50, 100, 150 ⁇ g/mL.
- Insets in (A) for UCA (150 ⁇ g/mL), IA4 (100, 50, 25 ug/mL), IA3 and IA2 (100, 50, 25, 10 ⁇ g/mL) show rescaled binding curves following subtraction of non-specific signal on a control antibody (Palivizumab). Rate (ka, kd) and dissociation constants (Kd) were measured for intermediate IA 1 and mature mAbs with glycan-dependent binding to Man9-V3. Kinetics analyses were performed by global curve fitting using bivalent avidity model and as described in methods ("Affinity
- Figure 28 Example of an immunization regimen derived from studies of virus-bnAb coevolution in CH848.
- An immunization strategy composed of the following steps: first, prime with an immunogen that binds the UCA and the boost with immunogens with the following characteristics: i. engagement of DH270.IA4-like antibodies and selection for the
- FIG. 29 N332-dependent CH848 plasma neutralization. Fold difference in CH848 plasma neutralization IC50 of selected wild-type and N332 mutant HIV-1 strains
- DH270, DH272 and DH475 lineages from memory B cell mRNA.
- Figure 32 Data collection and refinement statistics.
- Figure 33 DH270 lineage heterologous neutralization (207-virus panel).
- Figure discloses SEQ ID NOS 115-322, respectively, in order of appearance.
- Figure 36 Virus signatures.
- Figures 37A-D show non-limiting embodiments of selection of immunogens to induce V3 antibodies.
- the figures show binding of gpl20 envelopes listed (and/or neutralization) in the figure to various antibodies from the V3 glycan antibody lineage DH270.
- Figure 37A Prime with Man9 V3 glycopeptide or aglycone.
- Boost (ii) in Figure 37A is optional.
- V3 peptide is SEQ ID NO: 1.
- Figure 37D shows one non-limiting embodiment of a selection of immunogens. These immunogens in any suitable form are expected to be used as boost(s) in the induction of V3 glycan antibodies such as but not limited to antibodies with the specificity of DH270 lineage antibodies.
- Man9 V3 glycopeptide or aglycone engages UCA and allows G57R to occur (i.e. UCA to IA4).
- Boost with CH848.d949.10.17 selects IA4 with G57R.
- CH848.d794.05.41 engages IA3 and IA2-like antibodies and further increase chances to induce DH270.1 -like antibodies.
- the matching virus of this envelope is still neutralized by IA3 and IA2. (optional step).
- (2) CH848.d358.80.06 engages DH270.1-like antibodies and bring them to DH270.4, .5 and .6-like gradually increasing exposure to longer VI loops.
- the matching virus is neutralized by DH270.1 and more mature bnAbs antibodies.
- Figures 37B and 37C disclose SEQ ID NO: 1.
- Figures 38A-E show synthesis of Man9 derivatized V3 glycopeptide. Chemical synthesis of oligomannose (Man ⁇ >) derivatized V3 glycopeptide. (A) Chemical structure of Man9GlcN Ad-Nth.
- aglycone V3 peptide has SEQ ID NO: 1.
- Figure 38A discloses SEQ ID NOS 514-517, 1, and 1, respectively, in order of appearance.
- Figure 38B discloses SEQ ID NOS 1, 1, 1, and 1, respectively, in order of appearance.
- Figure 38E discloses SEQ ID NOS 1, 518, 1, 519, 1, and 519, respectively, in order of appearance.
- Figure 38B shows Synthetic lipid based V3 peptides for multivalent lipid nanoparticle constructs. Schematic of lipid nanoparticles with multimers of synthetic aglycone V3 (2C) and Man9V3 glycopeptide (D). In Figure 38C and 38D both Aglycone V3 and Man9V3 peptides were synthesized with a cholesterol moiety attached via PEG linker as outlined in Figure 38B. The length of PEG linker is variable and can be short with [PEG]3 or longer with [PEG] 9 or more units.
- the lipid composition of the lipid nanoparticle constructs include the following phospholipid combinations- POPC:POPE:DMPA:cholesterol-V3 /POPC:POPG:cholesterol-V3
- V3 peptide to lipid ratio will be used to provide 50-200 mer V3 peptide units per lOOnm lipid nanoparticle.
- the multimeric V3 peptide lipid nanoparticles will be produced by methods previously described (Alam et al., 2007; 2009; Dennison et al., 2009, 2011.
- Figure 38E shows synthetic V3 peptides for multivalent lipid nanoparticle constructs with Th peptide.
- the schematics shown in 2 and 3 both include the Th peptide GTH1 of the sequence shown above and will be covalently attached to the V3 aglycone or Man9 V3 glycopeptide (as shown in 2 and 3) via a [PEG]n linker of varying units.
- Th peptide sequence can be substituted and synthesized as in constructs 2 and 3.
- the amphipathic GTH1 sequence is also utilized for anchoring to lipid nanoparticles (Alam et al., 2007).
- the lipid compositions, and peptide:lipid molar ratios used will be as described in Figures 38C and 38D.
- Figures 39A-B show amino acids sequences of CH848.0949.10.17 in various forms (SEQ ID NOS 323-328 of Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety and forms part of the specification). Various other forms can readily be obtained from the gpl60 amino acid sequence. A skilled artisan appreciates that recombinantly produced envelope of any form do not include the signal peptide.
- FIG. 39B shows one embodiment of nucleic acid sequences of the designs in Figure 39A (SEQ ID NOS 329- 334 of Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety and forms part of the specification).
- Figures 40A-C Figure 40A shows amino acid sequences of various forms of CH848 envelopes CH848.0836.10.31; CH848.0358.80.06; CH848.1432.5.41; CH848.0526.25.02.
- Figure 40B shows one embodiment of nucleic acid sequences of the designs in Figure 40A.
- Figure 40B shows one embodiment of codon optimized nucleic acid sequences of the designs in Figure 40A.
- Figure 40B discloses SEQ ID NOS 371-406 of Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety and forms part of the specification.
- Figure 40C shows the amino acids sequence as gp l60 of CH848 T/F envelope (SEQ ID NO: 407 of Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety and forms part of the specification).
- the CH848 T/F envelope can also be designed in any suitable form.
- Figures 41A-C show amino acid sequences of various forms of CH0848 envelopes (SEQ ID NOS 408-427 of Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety and forms part of the specification).
- SEQ ID NOS 408-427 of Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety and forms part of the specification.
- a heterologous signal peptide of CH0848.3.D0949.10.17 chim.6R.DS.SOSIP.664V4.1 is provided in the figure
- FIG. 4 IB shows one embodiment of nucleic acid sequences of the designs in Figure 41 A (SEQ ID NOS 428-447 of Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety and forms part of the specification).
- Figure 41C shows annotated amino acid sequence of a chimeric trimer design of
- Figures 42 and 43 show the contacts, emphasizes position D325N, and that envelope CH848 1305.10.13 retains some binding and neutralization sensitivity.
- CH8481305.10.13 has a proline after the N, GDIR -> GNPR (SEQ ID NOS 34 and 35, respectively). The proline at that position is really rare.
- envelope CH0848.3.dl651.10.07, which has GNIR (SEQ ID NO: 36), and residual binding to DH270.4 and DH270.6 is a better vaccine choice.
- Figures 44A-44D show amino acid and nucleic acid sequences of envelopes: >CH848 703010848.3.d0949.10.17_signature_opt_b gpl 60 (Fig. 44A) (SEQ ID NOS 450-455, respectively, in order of appearance), >CH848
- Figure 45 shows amino acid sequences listed in Table 3 of Example 3A (SEQ ID NOS 474-502, respectively, in order of appearance).
- Figure 46 shows amino acid sequences of engineered VI loop variants of CH848 3.d0949.10.17 envelope (Table 3 lines 23-25) (SEQ ID NOS 503-505, respectively, in order of appearance).
- Figures 47A-47C shows SORTASE-C designs and sequences.
- Figure 47A discloses SEQ ID NOS 506-509, respectively, in order of appearance.
- Figure 47B discloses SEQ ID NOS 520-522, respectively, in order of appearance.
- Figure 47C discloses SEQ ID NOS 523, 61, and 524, respectively, in order of appearance.
- Figures 48A-48B show screening of various envelope constructs for binding to DH270UCA4 by SPR (SPR— S200).
- Figure 48A shows DH270 UCA (unmutated common ancestor) binding to CH848 SOSIP gp l40 trimers.
- CH848.3.D0949.10.17 SOSIP trimers (lOOmg/mL) were injected over DH270 UCA captured on an anti -human Ig-Fc immobilized mAb sensor surface and binding monitored by SPR analysis on BIAcore S200 (GE)
- FIG. 48B shows screening of various envelopes for binding to PGT121tkUCA_v2 and DH270UCA4_Protein Panel Screening by SPR (SPR— S200). Only J, K and O samples show binding to DH270UCA4.
- Figure 48C lists the names of different envelopes tested in Figure 48B.
- Figure 48B listing of tested envelopes is as follows:
- Figure 49A shows an alignment of amino acid sequences of envelope
- N133 and N138 could be mutated to any other suitable amino acid, such that glycosylation of the amino acid position is prevented.
- Figure 49B shows the sequence of HIV envelope CH0848.3.dl305.10.19gpl60
- amino acid and nucleic acid sequence are amino acids and nucleic acid sequence.
- Figures 50A-D shows sequences of various envelopes.
- Figure 51 shows sequences of various envelopes.
- Figure 52A shows sequence of CH848d949.10.17_N133DN138T_SOSIPv5.2.8gpl60 (Amino acid).
- Figure 52B shows an alignment of
- Figure 53A shows sequence of
- Figure 53B shows schematic diagram with various positions and mutations to make SOSIP, SOSIP v4.1, SOSIP v5.2, TD8 mutations.
- Figure 53C lists mutations to make SOSIP v.5.2.8..
- Figure 53D shows an alignment of various envelopes.
- Figure 53E shows signal peptide prediction from a signal peptide prediction server Signal P-4.1.
- Figure 54A-C show various amino acid sequences.
- Figure 54D depicts a schematic diagram of CH848.3.D949.10.17_N133DN138TchimericTD8.DS.SOSIP.
- Figure 54E shows an annotated amino acid sequence of
- Figure 54F displays an alignment of amino acid sequences in Figures 54A, B and C [0120]
- Figure 55A-D shows binding data for a trimer comprising
- BLI sensor tips were coated with different bnAb precursors.
- Two DH270 UCA precursors were inferred (See e.g. Figure 21) and binding to CH0848 Envelope in solution was examined with BLI.
- Both DH270 UCAs bound to the Env. DH270 UCA3 bound at a higher magnitude and had a low dissociation rate so once it is bound it remains engaged with Env. V3 glycan bnAb precursors PGT121 and PGT128 did not bind.
- BnAb precursors to bnAb epitopes with the CD4bs, V1V2 glycan did not bind to this trimer.
- Figure 56A-D shows binding for a trimer comprising
- BLI sensor tips were coated with different bnAb precursors.
- Two DH270 UCA precursors were inferred (See e.g. Figure 21) and binding to CH0848 Envelope in solution was examined with BLI.
- Both DH270 UCAs bound to the Env. DH270 UCA3 bound at a higher magnitude and had a low dissociation rate so once it is bound it remains engaged with Env. V3 glycan bnAb precursors PGT121 and PGT128 did not bind.
- BnAb precursors to bnAb epitopes with the CD4bs, V1V2 glycan did not bind to this trimer.
- Figure 57 A-D shows binding data for a trimer comprising
- CH848.3.D0949.10.17SOFA.DS.chSOSIP_N133N138A produced in 293F cells.
- BLI sensor tips were coated with different bnAb precursors.
- Two DH270 UCA precursors were inferred (See e.g. Figure 21) and binding to CH0848 Envelope in solution was examined with BLI.
- Both DH270 UCAs bound to the Env. DH270 UCA3 bound at a higher magnitude and had a low dissociation rate so once it is bound it remains engaged with Env. V3 glycan bnAb precursors PGT121 and PGT128 did not bind.
- BnAb precursors to bnAb epitopes with the CD4bs, V1V2 glycan did not bind to this trimer.
- Figure 58 shows CH0848.D0949.10.17 SOSIP trimer formation.
- Deglycosylated trimer in Figures 58-69 is CH848.3.D0949.10.17CHIM.6R.SOSIP.664V4.1_N133DN138T.
- FIG. 59 shows that CH0848 trimers are antigenic for cleaved trimer specific bnAb PGT151, but not coreceptor Ab 17B.
- WT refers to trimer design without N133 and N138 changes.
- Figure 60 shows that DH270 UCA binds SOSIP trimers, but not uncleaved gpl40 oligomers or monomeric gpl20.
- Figure 61A and 61B show that CH0848 10.17 N133D N138T SOSIP engages the DH270 UCA Fab with 29 nM affinity.
- Figure 62 shows effect of VI glycans on virus neutralization.
- Figure 62A shows that VI glycans inhibit DH270 UCA recognition of native Env trimers: Autologous Env
- CH0848.3.D949.10.17 possessed a short VI loop (17aa); N133D and N138T mutations removed potential N-linked glycosylation sites within the VI loop.
- Figure 62B shows DH270UCA does not neutralize all viruses lacking VI glycans. JR-FL N135Q N137Q N141Q SOSIPs also showed no binding to the DH270 UCA. Negative control virus MuLV titers were >50 ⁇ g/mL.
- Figure 63 is a model of DH270.6 binding to SOSIP trimer and shows potential N137 glycan interference.
- DH270 structure in complex with Man9-V3 glycopeptide (Fera D. et al., Nature Communication in press) is modeled onto BG505 SOSIP gp l20 from Stewart- Jones et al. Cell 2016 (PDB: 5FYL).
- Figure 64 shows that CH0848 N133D N138T SOSIP induces Ca2+ flux in DH270 UCA and DH270 Ramos cell lines.
- Figure 65 shows DH270 UCA knock-in (DH270 UCA3 VH +/ ⁇ DH270 UCA VL +/ ) mice SOSIP immunization regimen— Heterozygous pre-rearranged DH270 UCA knock-in mice.
- Protein dose 25 ⁇ g; Route: Intramuscular; Adjuvant: GLA-SE.
- Group 1 CH848 N133D/N138T SOSIP;
- Group 2 Adjuvant only.
- Figure 66 shows immunization with N133D/N138T SOSIP induced SOSIP-binding antibodies in DH270 UCA knock in mice.
- Figure shows serum IgG binding to
- Figure 67 shows that DH270 UCA knock-in mouse serum antibodies can bind to CH0848.D949.10.17 in the presence of N133 and N138 glycans.
- Figure shows serum IgG binding to CH0848.D494.10.17 SOSIP.
- Figure 68 show shows that DH270 UCA knock-in mouse sera neutralize
- Figure 69 shows DH270 UCA knock-in mouse sera neutralize tier 2 virus
- Figure 70 shows JRFL, CH0848.D 1305.10.19, and CH0848.D949.10.17 V3 loop alignment.
- Figure 71 shows that DH270 UCA does not bind CH0848 natural Env
- FIG. 72 shows that DH270-resistant CH0848 natural Env with a 17 aa VI loop and no N 133 and N138 glycan acquire V2 apex bnAb binding— Potential V3-glycan escape variant is recognized by V2 apex bnAbs (PGT145).
- Figure 72A shows DH270- reactive envelope CH0848.D0949.10.17.
- Figure 72B shows DH270-non reactive envelope
- Figure 73 shows DH270 UCA knock-in sera (see Figure 65) block V3-glycan bnAb binding to gpl20.
- Figure 74A-D show neutralization data from non-human primate study NHP-144. Arrows indicate immunizations at weeks 0, 4, 10, 16, 22. Samples tested for neutralization at weeks 0, 12, 18 or 24.
- Figure 75 A and 75B show the V1V2 loop sequence alignments show there are two glycosylation sites within the 10.17 VI loop.
- the precise asparagines that are mutated in the 10.17DT Env design are underlined.
- the sequence for 10.17 is shown in relation to V1V2 loops of other viruses since VI V2 amino acid numbering can vary depending on the alignment software, thus this alignment shows the exact position of each of the asparagines.
- Con-S VI length is 22 aa.
- JRFL VI length is 25aa.
- T250-4 VI length is 22.
- Figure 76A-D shows binding data for a trimer comprising
- BLI sensor tips were coated with different bnAb precursors.
- Two DH270 UCA precursors were inferred (See e.g. Figure 21) and binding to CH0848 Envelope in solution was examined with BLI.
- Both DH270 UCAs bound to the Env. DH270 UCA3 bound at a higher magnitude and had a low dissociation rate so once it is bound it remains engaged with Env. V3 glycan bnAb precursors PGT121 and PGT128 did not bind.
- BnAb precursors to bnAb epitopes with the CD4bs, V1V2 glycan did not bind to this trimer.
- Figure 77A-L shows sequences of various envelopes described in Table 4.
- Figure 77A shows the sequence of HV1301331_degly3 with N138, N133, and N301 glycans removed. These glycans were believed to prevent DH270 mAb binding by blocking access to HIV peptide binding.
- Figure 77B shows the sequence of HV1301331_N138T. This Env has a single VI glycan removed. This Env would be used to sequentially add back glycans in the VI loop to select antibodies capable of tolerating N301 and N133 glycans but not N138T. This Env could be used in a sequential Env vaccine where glycans are removed and added back sequentially.
- Figure 77C shows the sequence of HV1301345 D368R. This Env has D368R mutation to reduce CD4 binding. CD4 binding could disrupt Env conformation in vivo.
- Figure 77D shows the sequence of HV1301331_N133DN138T_c-SORTA. This tagged Env that can be ligated to particles by sortase A enzyme.
- Figure 77E shows the sequence of HV 1301522. This ferritin particle has a VI glycan mutant Env attached as a fusion protein.
- Figure 77F shows the sequence of HV1301345_N133D_N138T_cSORTA. This tagged Env can be ligated to particles by sortase A enzyme reactions in vitro.
- Figure 77G shows the sequence of HV1301581, a full length gpl60 HIV Env with VI glycans removed to engender DH270 UCA binding.
- Figure 77H shows the sequence of HV1301345_TFVlloop with the 10.17 Env with a long VI loop that was transplanted from the TF virus sequence. This can be used to select for antibodies capable of accommodating a long VI loop.
- Figure 771 shows the sequence of HV1301345_N133D_N138T which is a stabilized trimer with VI glycans removed to facilitate DH270 UCA binding.
- Figure 77 J shows the sequence of
- HV1301262 (has avi tag), a non-chimeric Env.
- Figure 77K shows the sequence of
- HV1301263 (has avi tag), a chimeric DS Env without VI glycan mutated.
- Figure 77L shows the sequence of HV1301264 (has avi tag), a non-chimeric DS stabilized CH0848 trimer.
- Figure 78A-B shows annotated sequences of CH848.3.D0949.10.17.6R.SOSIP.664 envelope and CH848.3.D0949.10.17 SOSIPv5.2.8.
- Figure 78A shows the annotated sequence of CH848.3.D0949.10.17.6R.SOSIP.664.
- Figure 78B shows the annotated sequence of CH848.3.D0949.10.17 SOSIPv5.2.8.
- Figure 79A-79L shows binding data for a trimer comprising
- BLI sensor tips were coated with different bnAb as indicated in the various panels. Binding was determined in the absence (79G-L) and presence (79A-79F) of lOum of Temsavir (BMS- 626529). Vertical dotted line indicates response at the end of association
- Figure 80 shows a summary of binding data (from Figures 79A-79L) for a trimer comprising CH8483.D0949.1017chim.6R.DS.SOSIP.664 N133D N138T produced in 293F cells.
- Figure shows binding Ratio Relative to PGT151. Diamonds show antibody trimer binding without BMS-626529 and squares show trimer binding in the presence of BMS-626529.
- Figure 81 shows a summary of BLI binding data for a trimer comprising
- V3 of the envelope glycoprotein, gpl20 of HIV-1 is a target for virus broad neutralizing antibodies.
- V3 glycan dependent broad neutralizing antibodies bnAbs
- Soluble Env gp l20 or cell surface Env trimers do not bind V3 -glycan bnAb UCAs (20) (See Example 1).
- the invention provides that the Man9- V3glycopeptide (Example 2) as well as its aglycone (Example 2) form binds the UCA of the DH270V3-glycan bnAb lineage. Moreover, Man9-V3/aglycone binds to the UCA of gp l40- induced V3 -glycan neutralizing mAb, DH501. With affinity maturation in both the DH270 bnAb and the DH501 lineages, binding to the aglycone-V3 diminished and binding to Mans>- V3 was dramatically enhanced. These observations raise the hypothesis that initiating immunogens for V3 -glycan lineages may be denatured or Env fragments (Example 1 Bonsignori, M. et al. submitted).
- the invention provides various methods to choose a subset of viral variants, including but not limited to envelopes, to investigate the role of antigenic diversity in serial samples.
- the invention provides compositions comprising viral variants, for example but not limited to envelopes, selected based on various criteria as described herein to be used as immunogens.
- the immunogens are selected based on the envelope and/or peptide binding to the UCA, and/or intermediate antibodies.
- the immunogens are selected based on UCA and/or intermediate antibodies neutralizing properties against viruses.
- the immunogens are selected based on their chronological appearance and/or sequence diversity during infection.
- the invention provides immunization strategies using the selections of immunogens to induce cross-reactive neutralizing antibodies.
- the invention provides an HIV-1 envelope sequence comprising non-glycosylatable amino acids in the VI loop, at positions corresponding to N 133 and/or N138 in the CH848.3.D0949.10.17 envelope sequence, wherein the envelope protomer sequence is based on the amino acid sequence of CH848.3.D0949.10.17 envelope; comprises amino acids from the CH848.3.D0949.10.17 envelope sequence, consists essentially of amino acids from CH848.3.D0949.10.17 envelope sequence and wherein the protomer is deglycosylated in the VI loop (partially or completely in the VI loop).
- the envelope protomer sequence is based on the amino acid sequence of CH848.3.D0949.10.17 envelope; comprises amino acids from the CH848.3.D0949.10.17 envelope sequence, consists essentially of amino acids from CH848.3.D0949.10.17 envelope sequence and wherein the protomer is deglycosylated in the VI loop (partially or completely in the VI loop).
- a deglycosylated envelope consists essentially of amino acids from CH848.3.D0949.10.17 envelope sequence when the deglycosylated envelopes has all amino acids from CH848.3.D0949.10.17 envelope sequence except for the amino acids at positions N133 and/or N138. In some embodiments, it further comprises amino acid changes for trimer formation.
- sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are.
- homology or similarity or homology
- NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al, J. Mol. Biol. 215:403, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, Md.) and on the internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. A description of how to determine sequence identity using this program is available on the NCBI website on the internet.
- a deglycosylated envelope is based on CH848.3.D0949.10.17 envelope if it is characterized by possession of at least about 65%, 70%, 75%, for example at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity counted over the full length alignment with the amino acid sequence of interest.
- a deglycosylated envelope could have at least 80% sequence identity over short windows of 10-20 amino acids, and may possess sequence identities of at least 85% or at least 90% or 95% depending on their similarity to the reference sequence.
- a deglycosylated envelope is based on CH848.3.D0949.10.17 envelope if it is characterized as having 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75.
- the envelope comprises amino acids substitutions within the CH848.3.D0949.10.17 sequence such that the envelope promoter forms a trimer. Any suitable envelope design or form is contemplated, so long as the envelope is based on CH848.3.D0949.10.17 sequence and the VI loop is deglycosylated. In some embodiments short VI loops of various length could be incorporated.
- the invention provides amino acid or nucleic acids sequences encoding such deglycosylated proteins.
- nucleic acids including modified mRNAs which are stable and could be used as immunogens.
- nucleic acids optionally designed as vectors, for example for recombinant expression and/or stable integration, e.g. but not limited, gpl60 DNA encoding trimer for stable expression, or VLP incorporation.
- the deglycosylated envelope is designed as a chimeric trimer chimeric (e.g incorporates amino acids and/or portions of envelope BG505).
- the deglycosylated envelopes are not chimeric, i.e. based on the sequence of envelope CH848.3.D0949.10.17 and comprising amino acids which help trimer formation.
- the envelope is designed as any suitable trimer, such as but not limited to various SO SIP designs, UFO trimers, or any other trimers.
- the envelopes of the invention comprising deglycosylated VI positions binds and/or neutralizes DH270UCA3 and/or DH270UCA4.
- the envelope protomer wherein the envelope is gpl20, gpl40, gpl45, gpl50 or gpl60.
- Example 2 shows that a synthetic homogeneous Man9-V3 glycopeptide mimics a HIV-1 Env V3-glycan bnAb epitope.
- Man9-V3 recognition by V3-glycan memory B cell and UCA BCR suggest that a minimal V3-glycan epitope construct may be a candidate for the induction of V3-glycan bnAb lineages.
- the DH270 V3-glycan bnAb lineage developed over ⁇ 4 years (Bonsignori, M et al.
- V3-gly can-targeted antibodies took 4 years to develop in macaques repetitively immunized with Env gp l40 (Saunders, K et al. submitted).
- Env gp l40 Single-chain Env monomers or trimers
- V3-glycopeptide does bind UCAs, suggesting that minimal Env epitopes may accelerate induction of V3-glycan bnAb B cell lineages.
- V3 glycan epitope defined by V3 binding antibodies.
- Minimal V3 region glycopeptide s bearing two glycans of appropriate structure can mimic the antigenic nature of this epitope, and can provide an effective platform for immunogen development.
- This concept based on the "two glycans and a strand" paradigm of recognition suggested by x-ray analysis. sup.6— has been successfully applied to the V 1V2 region anti -glycan BnAb site.
- preferred immunogens include those that exclude potentially interfering immunodominant epitopes. These immunogens can be evaluated not only based on their affinities for mature BnAbs, but also their germline precursors.
- the invention provides a composition comprising any one of the inventive peptides, wherein the composition comprises purified homogenously glycosylated peptides.
- the composition comprises purified homogenously glycosylated peptides.
- about 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 99.9% of the peptides in the composition are homogenously glycosylated peptides.
- 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 99.9% of the peptides in the composition are homogenously glycosylated peptides.
- 70%-75%, 75.1%-80%, 80.1%-85%, 85.1%-90%, 90.1%-95%, 95.1%-99%, 96%-99%, 97%-99%, 98%- 99% or 99.9% of the peptides in the composition are homogenously glycosylated peptides.
- the glycosylation pattern is homogenous on all V3 peptides in the composition.
- the glycosylation pattern is substantially identical on all V3 peptides in the composition.
- glycosylation pattern on a peptide can be determined by Liquid chromatography—mass spectrometry (LC-MS, or alternatively HPLC-MS).
- V3 glycopeptides can be synthesized with well-defined glycans at N332 and N301 using clade B and clade C sequences (derived from Envs with known antigenicity toward V3 anti-glycan BnAbs). Variations of the peptide framework include full length vs. truncated V3 loops, as well as linear vs. constrained cyclic forms (via disulfide bond formation). Antigenicity testing provides the data needed to determine the peptide design motif that is optimal for binding to HIV-1 Env anti-glycan BnAbs.
- derivatives can be synthesized bearing different glycans at N332 and N301 and the determination made as to the optimal carbohydrate design for anti-glycan BnAb binding.
- the constructs that exhibit the highest affinity for V3-directed anti-glycan BnAbs and their UCAs can be synthesized on larger scale and subjected to trials e.g., in non-human primates—immunogenicity can be evaluated for constructs both with and without conjugation to carrier protein.
- the present invention thus relates, at least in part, to immunogens that focus the immune response to the V3 glycan epitope on gp l20 that lead to BnAbs and away from epitopes that lead to non-neutralizing antibodies.
- Central to the present design strategy is making the immunogen as minimal in size as possible so as not to introduce diverting, non- neutralizing epitopes.
- Non-limiting embodiments of immunogens are described in the Examples below.
- the immunogens can be formulated with appropriate carriers using standard techniques to yield compositions suitable for administration.
- the compositions can include an adjuvant, such as, for example, alum, poly IC, poly IC/LC, MF-59 or other squalene-based adjuvant, ASO IB or other liposomal based adjuvant suitable for protein immunization.
- Suitable vaccine strategies include, e.g., those described, for in the Examples that follow.
- Nucleic acid sequences encoding the immunogens can also be administered to a subject (e.g., a human) under conditions such that the immunogen is expressed in vivo and BNAbs are produced.
- the DNA can be present as naked DNA with a potent promoter such as the CMV promoter as used in the pCMVr plasmid (Churchyard et al, PLoS One 6:e21225 (201 1)) or as an insert in a vector, such as a rAdenoviral (Barouch, et al. Nature Med.
- Immunogens of the invention and nucleic acids (e.g., DNAs) encoding same, are suitable for use in generating an immune response (e.g., BNAbs) in a patient (e.g., a human patient) to HIV-1.
- an immune response e.g., BNAbs
- the V3 N301, N332 peptide glycan can optimally be administered as a peptide-glycan formulated in a squalene based adjuvant such as MF59, or GLA-SE (Alving et al, Current Opinion in Immunology 24:310 (2012)).
- the mode of administration of the immunogen, or encoding sequence can vary with the particular immunogen, the patient and the effect sought, similarly, the dose administered.
- the administration route is intramuscular or subcutaneous injection (intravenous and intraperitoneal can also be used).
- the formulations can be administered via the intranasal route, or intrarectally or vaginally as a suppository-like vehicle.
- Optimum dosing regimens can be readily determined by one skilled in the art.
- the immunogens (and nucleic acids encoding same) are preferred for use prophylactically, however, their administration to infected individuals may reduce viral load.
- the present invention includes the specific protein immunogens disclosed herein and nucleic acids comprising nucleotide sequences encoding same.
- the proteins can be expressed, for example, in 293T cells, 293F cells or CHO cells (Liao et al, Virology 353:268- 82 (2006))
- polypeptides of the present invention may be fused to or chemically linked with an appropriate carrier molecule, such as tetanus toxin, MLv gp70, cholera toxin, keyhole limpet haemocyanin or gpl20.
- an appropriate carrier molecule such as tetanus toxin, MLv gp70, cholera toxin, keyhole limpet haemocyanin or gpl20.
- the polypeptides of the present invention may be inserted by genetic engineering techniques into permissible exposed loops of antigenic proteins.
- Carrier proteins used in currently licensed vaccines include tetanus toxoid (TT), diphtheria toxoid (DT), CRM.sub.197 (cross-reactive material of diphtheria toxin. sub.197), N. meningitidis outer membrane protein (OMP), and H. influenzae protein D.. sup.64
- TT tetanus toxoid
- DT diphtheria toxoid
- CRM.sub.197 cross-reactive material of diphtheria toxin. sub.197
- N. meningitidis outer membrane protein (OMP) N. meningitidis outer membrane protein
- H. influenzae protein D.. sup.64 For the initial studies, CRM.sub.197, a non-toxic mutant (G52.fwdarw.D) of diphtheria toxin, will be selected which, unlike TT and DT, does not require chemical detoxification with formaldehyde.
- polypeptides of the present invention may be linked to amino acids derived from a T-helper epitope to enhance their immunogenicity.
- a T-helper epitope is a peptide capable of activating a T helper cell.
- the T-helper epitope may be a human immunodeficiency virus (HIV) T helper epitope e.g. from the C4 domain of HIV gp l20.
- the T helper epitope comprises about 16 consecutive residues from the C4 domain (about residues 421 to 436).
- the T-helper sequence is a variation of the above.
- T helper epitopes from the C4 domain are described in U.S. Pat. Appl. No. 20030147888, incorporated herein by reference.
- Other T helper determinants from HIV or from non-HIV proteins can also be used.
- a further T helper epitope suitable for use in the invention is from HIV gag (e.g., residues 262-278).
- HIV gag e.g., residues 262-278
- GTH1 One such sequence is designated GTH1. Variants of this sequence can also be used.
- T helper epitope is derived from murine HSP60 458-474.
- a carbohydrate such as the outer membrane protein of pneumococcus, or another carbohydrate or protein with immunogenic, T helper activity can be used.
- T-helper epitope amino acids may be linked to the V3 portion of the peptides of the present invention using any method known in the art so long as it does not decrease the immunogenic and antigenic properties of the peptide.
- amino acids of the V3 domain of gp l20 are preferably linked C terminal to the amino acids of the T-helper epitope.
- the V3 portion of the polypeptide is linked to the T helper epitope via a covalent bond (e.g. a peptide bond).
- the V3 portion of the polypeptide is linked to the T helper epitope via a non-covalent linker.
- the linkage may be direct or via bonding to an intervening linker element, such as a linker peptide or other chemical moiety, such as an organic polymer.
- Natural aromatic amino acids, Trp, Tyr and Phe may be substituted for synthetic non- natural acid such as Phenylglycine, TIC, naphthylelanine (Nol), ring-methylated derivatives of Phe, halogenated derivatives of Phe or o-methyl-Tyr.
- synthetic non- natural acid such as Phenylglycine, TIC, naphthylelanine (Nol), ring-methylated derivatives of Phe, halogenated derivatives of Phe or o-methyl-Tyr.
- polypeptides of the present invention may also include one or more modified amino acids or one or more non-amino acid moieties (e.g. lipids, complex carbohydrates etc.). In some embodiments, these non-amino acid moieties are used to multimerize the peptides of the invention.
- non-amino acid moieties e.g. lipids, complex carbohydrates etc.
- Amino acids incorporated in the peptides of the invention could include the 20 naturally occurring amino acids, D- and L-amino acids (stereoisomers); those amino acids often modified post-translationally in vivo, including, for example, hydroxyproline, phosphoserine and phosphothreonine; and other unusual amino acids including, but not limited to, 2-aminoadipic acid, hydroxylysine, isodesmosine, nor-valine, nor-leucine and ornithine.
- nucleic and amino acids sequences of HIV-1 envelopes are in any suitable form.
- the described HIV- 1 envelope sequences are gp l60s.
- the described HIV-1 envelope sequences are gp l20s.
- sequences for example but not limited to stable SOSIP trimer designs, gp l45s, gp l40s, both cleaved and uncleaved, gp l40 Envs with the deletion of the cleavage (C) site, fusion (F) and immunodominant (I) region in gp41 ⁇ named as gp l40ACFI (gpl40CFI), gp l40 Envs with the deletion of only the cleavage (C) site and fusion (F) domain ⁇ named as gpl40ACF (gp l40CF), gpl40 Envs with the deletion of only the cleavage (C)— named gpl40AC (gp l40C) (See e.g.
- nucleic acid sequences are codon optimized for optimal expression in a host cell, for example a mammalian cell, a rBCG cell or any other suitable expression system.
- An HIV- 1 envelope has various structurally defined fragments/forms: gp l60; gp l40 ⁇ -including cleaved gp l40 and uncleaved gp l40 (gp l40C), gp l40CF, or gpl40CFI; gp l20 and gp41.
- gp l60 gp l40 ⁇ -including cleaved gp l40 and uncleaved gp l40 (gp l40C), gp l40CF, or gpl40CFI; gp l20 and gp41.
- gpl60 polypeptide is processed and proteolytically cleaved to gp l20 and gp41 proteins. Cleavages of gp l60 to gp l20 and gp41 occurs at a conserved cleavage site "REKR" (SEQ ID NO: 37). See Chakrabarti et al. Journal of Virology vol. 76, pp. 5357-5368 (2002) see for example Figure 1, and Second paragraph in the Introduction on p. 5357; Binley et al. Journal of Virology vol. 76, pp.
- gp l40 envelope forms are also well known in the art, along with the various specific changes which give rise to the gp l40C (uncleaved envelope), gp l40CF and gp l40CFI forms.
- Envelope gp l40 forms are designed by introducing a stop codon within the gp41 sequence. See Chakrabarti et al. at Figure 1.
- Envelope gp l40C refers to a gp l40 HIV-1 envelope design with a functional deletion of the cleavage (C) site, so that the gp l40 envelope is not cleaved at the furin cleavage site.
- C cleavage
- RRVVEREKR SEQ ID NO: 38
- ERVVEREKE SEQ ID NO: 39
- SEKS SEKS
- Envelope gp l40CF refers to a gp l40 HIV- 1 envelope design with a deletion of the cleavage (C) site and fusion (F) region.
- Envelope gp l40CFI refers to a gp l40 HIV-1 envelope design with a deletion of the cleavage (C) site, fusion (F) and immunodominant (I) region in gp41. See Chakrabarti et al. Journal of Virology vol. 76, pp. 5357-5368 (2002) see for example Figure 1, and Second paragraph in the Introduction on p. 5357; Binley et al. Journal of Virology vol. 76, pp.
- the envelope design in accordance with the present invention involves deletion of residues (e.g., 5-1 1, 5, 6, 7, 8, 9, 10, or 1 1 amino acids) at the N- terminus.
- residues e.g., 5-1 1, 5, 6, 7, 8, 9, 10, or 1 1 amino acids
- amino acid residues ranging from 4 residues or even fewer to 14 residues or even more are deleted. These residues are between the maturation (signal peptide, usually ending with CXX, X can be any amino acid) and "VPVXXXX... ".
- CH0848.3.D0949.10.17 Deltal l gp l20 is shown as an example in Figure 3A.
- the invention relates generally to an immunogen, gpl60, gpl20 or gpl40, without an N-terminal Herpes Simplex gD tag substituted for amino acids of the N-terminus of gpl20, with an HIV leader sequence (or other leader sequence), and without the original about 4 to about 25, for example 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 amino acids of the N-terminus of the envelope (e.g. gpl20).
- HIV leader sequence or other leader sequence
- WO2013/006688 e.g. at pages 10-12, the contents of which publication is hereby incorporated by reference in its entirety.
- N-terminal amino acids of envelopes results in proteins, for example gpl20s, expressed in mammalian cells that are primarily monomeric, as opposed to dimeric, and, therefore, solves the production and scalability problem of commercial gpl20 Env vaccine production.
- the amino acid deletions at the N-terminus result in increased immunogenicity of the envelopes.
- the invention provides envelope sequences, amino acid sequences and the corresponding nucleic acids, and in which the V3 loop is substituted with the following V3 loop sequence TRPNNNTRKSIRIGPGQTFY ATGDIIGNIRQAH (SEQ ID NO: 41). This substitution of the V3 loop reduced product cleavage and improves protein yield during recombinant protein production in CHO cells.
- Soluble trimers comprising CH848 envelopes are contemplated by the invention and such trimer are contemplated for use in the methods of the invention.
- Various ways to form soluble envelope trimers are known in the art. See e.g. US Pub. 20100041875; US Pub 20110076298; US Pub. 20110250220; WO2016/037154, de Taeye et al. Cell. 2015 Dec 17; 163(7): 1702-15. doi: 10.1016/j.cell.2015.11.056.; Kwon et al. Nat Struct Mol Biol. 2015 Jul;22(7):522-31. doi: 10.1038/nsmb.3051. Epub 2015 Jun 22; Sharma et al. Cell Rep.
- the invention provides new chimeric designs, for example but not limited to
- trimer complexes of the invention can be determined by any suitable assay used to characterize trimer envelope complexes.
- Antigenicity of the trimers for example binding to HIV-1 antibodies, including but not limited to antibodies described in the invention, conformational state of the trimers, i.e., "open” or "closed", immunogenicity can be determined by any suitable assay.
- the invention provides composition and methods which use a selection of Envs, as gpl20s, gp 140s cleaved and uncleaved, gp l45s, gp l50s and gpl 60s, as proteins, as monomers or trimers, as DNAs, as RNAs, or any combination thereof, administered as primes and boosts to elicit immune response. Envelopes as proteins could be co-administered with nucleic acid vectors containing Envs to amplify antibody induction.
- the compositions and methods include any immunogenic HIV-1 sequences to give the best coverage for T cell help and cytotoxic T cell induction.
- the compositions and methods include mosaic and/or consensus HIV-1 genes to give the best coverage for T cell help and cytotoxic T cell induction.
- the compositions and methods include mosaic group M and/or consensus genes to give the best coverage for T cell help and cytotoxic T cell induction.
- the mosaic genes are any suitable gene from the HIV- 1 genome.
- the mosaic genes are Env genes, Gag genes, Pol genes, Nef genes, or any combination thereof. See e.g. US Patent No. 7951377.
- the mosaic genes are bivalent mosaics. In some embodiments the mosaic genes are trivalent.
- the mosaic genes are administered in a suitable vector with each immunization with Env gene inserts in a suitable vector and/or as a protein.
- the mosaic genes for example as bivalent mosaic Gag group M consensus genes, are administered in a suitable vector, for example but not limited to HSV2, would be administered with each immunization with Env gene inserts in a suitable vector, for example but not limited to HSV-2.
- the invention provides compositions and methods of Env genetic immunization either alone or with Env proteins to recreate the swarms of evolved viruses that have led to bnAb induction.
- Nucleotide -based vaccines offer a flexible vector format to immunize against virtually any protein antigen.
- DNAs and mR As are available for testing— DNAs and mR As.
- the invention contemplates using immunogenic compositions wherein immunogens are delivered as DNA. See Graham BS, Enama ME, Nason MC, Gordon IJ, Peel SA, et al. (2013) DNA Vaccine Delivered by a Needle-Free Injection Device Improves Potency of Priming for Antibody and CD8+ T-Cell Responses after rAd5 Boost in a Randomized Clinical Trial. PLoS ONE 8(4): e59340, page 9.
- Various technologies for delivery of nucleic acids, as DNA and/or RNA, so as to elicit immune response, both T-cell and humoral responses are known in the art and are under developments.
- DNA can be delivered as naked DNA.
- DNA is formulated for delivery by a gene gun.
- DNA is administered by electroporation, or by a needle-free injection technologies, for example but not limited to Biojector® device.
- the DNA is inserted in vectors.
- the DNA is delivered using a suitable vector for expression in mammalian cells.
- the nucleic acids encoding the envelopes are optimized for expression.
- DNA is optimized, e.g. codon optimized, for expression.
- the nucleic acids are optimized for expression in vectors and/or in mammalian cells.
- these are bacterially derived vectors, adenovirus based vectors, rAdenovirus (e.g. Barouch DH, et al. Nature Med. 16: 319-23, 2010), recombinant mycobacteria (e.g. rBCG or M smegmatis) (Yu, JS et al. Clinical Vaccine Immunol. 14: 886- 093,2007; ibid 13: 1204-11,2006), and recombinant vaccinia type of vectors (Santra S.
- VVA modified vaccinia Ankara
- VEE Venezuelan equine encephalitis
- Herpes Simplex Virus vectors and other suitable vectors.
- the invention contemplates using immunogenic compositions wherein immunogens are delivered as DNA or RNA in suitable formulations.
- DNA or RNA is administered as nanoparticles consisting of low dose antigen-encoding DNA formulated with a block copolymer (amphiphilic block copolymer 704). See Cany et al, Journal of Hepatology 2011 vol. 54 j 115-121; Arnaoty et al, Chapter 17 in Yves Bigot (ed.), Mobile Genetic Elements: Protocols and Genomic Applications, Methods in Molecular Biology, vol.
- Nanocarrier technologies called Nanotaxi® for immunogenic macromolecules (DNA, RNA, Protein) delivery are under development. See for example technologies developed by Incellart.
- the nucleic acids for e.g. mRNAs encoding immunogens of the invention, are delivered by a lipid nanoparticle (LNP) technology.
- the LNPs could comprise four different lipids that could self assemble to 80-100nm size particles.
- the invention contemplates using immunogenic compositions wherein immunogens are delivered as recombinant proteins.
- immunogenic compositions wherein immunogens are delivered as recombinant proteins.
- Various methods for production and purification of recombinant proteins suitable for use in immunization are known in the art.
- recombinant proteins are produced in CHO cells.
- the immunogenic envelopes can also be administered as a protein boost in combination with a variety of nucleic acid envelope primes (e.g., HIV -1 Envs delivered as DNA expressed in viral or bacterial vectors).
- nucleic acid envelope primes e.g., HIV -1 Envs delivered as DNA expressed in viral or bacterial vectors.
- a single dose of nucleic acid can range from a few nanograms (ng) to a few micrograms ⁇ g) or milligram of a single immunogenic nucleic acid.
- Recombinant protein dose can range from a few ⁇ g micrograms to a few hundred micrograms, or milligrams of a single immunogenic polypeptide.
- compositions can be formulated with appropriate carriers using known techniques to yield compositions suitable for various routes of administration.
- compositions are delivered via intramascular (IM), via
- subcutaneous via intravenous, via nasal, via mucosal routes, or any other suitable route of immunization.
- compositions can be formulated with appropriate carriers and adjuvants using techniques to yield compositions suitable for immunization.
- the compositions can include an adjuvant, such as, for example but not limited to, alum, poly IC, MF-59 or other squalene- based adjuvant, ASO IB, or other liposomal based adjuvant suitable for protein or nucleic acid immunization.
- the adjuvant is GSK AS01E adjuvant containing MPL and QS21.
- This adjuvant has been shown by GSK to be as potent as the similar adjuvant ASO IB but to be less reactogenic using HBsAg as vaccine antigen [Leroux-Roels et al., IABS Conference, April 2013,9] .
- TLR agonists are used as adjuvants.
- adjuvants which break immune tolerance are included in the immunogenic compositions.
- the compositions are formulated such that the immunoges are comprises in nanoparticles.
- these are lipid nanoparticle immunogens.
- these are liposomes comprising immunogens.
- these are lipid nanodiscs.
- the immunogens could be arranged as particulate, high-density array on liposomes or other particles, for example but not limited to nanoparticles.
- the liposome comprises cholesterol, PC, PE, PA, or any combination thereof See Alam et al. J Immunol. 2007 Apr l;178(7):4424-35; Alam et al. J Virol. 2008 Jan;82(l): 115-25; Alam et al.
- the lipid composition of lipid nanoparticle comprises cholesterol, POPC, sphingomyelin, or any combination thereof.
- the lipids could comprise POPC, POPE, DMPA, cholesterol, or any combination thereof.
- the ratio is POPC:POPE:DMPA:Cholesterol 45:25:20: 1.33.
- the protein to lipid ratio is about 1 :3000.
- the peptide to lipid ratio used provides 50-100 mer V3 peptide units per 100- 200nm lipid nanoparticle.
- the peptide: lipid ratio is 1: 100. A skilled artisan can readily determine conditions and lipids to achieve different desired ratios.
- compositions and methods comprise any suitable agent or immune modulation which could modulate mechanisms of host immune tolerance and release of the induced antibodies.
- modulation includes PD-1 blockade; T regulatory cell depletion; anti-CD25 antibodies; CD40L hyperstimulation; anti-CTLA4 antibodies; soluble antigen administration, wherein the soluble antigen is designed such that the soluble agent eliminates B cells targeting dominant epitopes, or a combination thereof.
- an immunomodulatory agent is administered in at time and in an amount sufficient for transient modulation of the subject's immune response so as to induce an immune response which comprises broad neutralizing antibodies against HIV-1 envelope.
- Non-limiting examples of such agents is any one of the agents described herein: e.g.
- the modulation includes administering an anti-CTLA4 antibody.
- Non-limiting examples are ipilimumab and tremelimumab.
- the methods comprise administering a second immunomodulatory agent, wherein the second and first immunomodulatory agents are different.
- envelope glycoproteins referenced in various examples and figures comprise a signal/leader sequence.
- HIV- 1 envelope glycoprotein is a secretory protein with a signal or leader peptide sequence that is removed during processing and recombinant expression (without removal of the signal peptide, the protein is not secreted). See for example Li et al. Control of expression, glycosylation, and secretion of HIV- 1 gpl20 by homologous and heterologous signal sequences. Virology 204(l):266-78 (1994) ("Li et al. 1994”), at first paragraph, and Li et al.
- the leader sequence is the endogenous leader sequence.
- Most of the gpl20 and gpl60 amino acid sequences include the endogenous leader sequence.
- the leaders sequence is human Tissue Plasminogen Activator (TP A) sequence, human CD5 leader sequence (e.g. MPMGSLQPLATLYLLGMLVASVLA (SEQ ID NO: 42)).
- TP A Tissue Plasminogen Activator
- CD5 leader sequence e.g. MPMGSLQPLATLYLLGMLVASVLA (SEQ ID NO: 42)
- Most of the chimeric designs include CD5 leader sequence.
- the invention is directed to HIV-1 envelope immunogens which comprises changes in the amino acid sequence of glycosylation sites such that the envelope is partially deglycosylated.
- deglycosylation is in the VI loop of the HIV-1 envelope. In certain embodiments these changes are at positions N133, N138, N156, N301, N332, or any combination thereof.
- the envelope is not glycosylated at positions N301 and N332. Position number given with respect to HXB2. Any suitable amino acid change is contemplated so longs as glycosylation at that position is abolished.
- Non-limiting embodiments include amino acids which are naturally occurring at the respective position in other envelopes and the envelopes are deglycosylated.
- Non-limiting amino acid changes include change to alanine, or any of the following: N133D, N138T, N301A, N301S, N332A, N332T.
- Any envelope form e.g. but not limited to stabilized SOSIP trimer designs, gpl40s, etc. could be designed to comprise deglycosylation mutations.
- the envelope is CH848.3.D0949.10.17CHIM.6R.SOSIP.664V4.1_N133DN138T.
- the envelope is
- the invention provides compositions comprising these deglycosylated envelopes.
- the invention provides methods of inducing immune response in a subject comprising administering compositions comprising deglycosylated envelopes.
- these deglycosylated envelopes are administered as a prime.
- the prime could be a nucleic acid encoding a deglycosylated
- the glycosylated envelopes could also be administered as a boost.
- chim.6R.DS.SOSIP.664 is SOSIP.I
- CHIM.6R.SOSIP.664 is SOSIP.II
- CHIM.6R.SOSIP.664V4.1 is SOSIP.III. Additional designs of envelopes deglycosylated in the VI loop are also contemplated and covered by the invention. Using the sequence information, annotations and listing of amino acid positions and changes, a skilled artisan can envision additional envelopes based on the sequence of CH848.3.D0949.10.17.
- Non-limiting embodiments include chimeric trimer designs, which could comprise portions of BG505 envelope.
- Figure 41C shows a non-limiting embodiment of a chimeric trimer design of a 6R.SOSIP664v4.1. Using this annotated sequence which shows the amino acids derived from BG505, a person of skill in the art could design any other chimeric trimer design.
- Non-limiting embodiments include non-chimeric trimer designs. See for example Figure 54, 39A.
- Non-limiting embodiments of various deglycosylaton designs, trimer designs, chimeric or non-chimeric designs are summarized in Table 1, Table 3 and Table4.
- a non-limiting example of a non-SOSIP trimer design is described in Kong et al. in Nat Commun. 2016 Jun 28;7: 12040. doi: 10.1038/ncomms 12040.
- Example 1 Staged induction of HIV-1 glycan-dependent broadly neutralizing antibodies
- a preventive HIV-1 vaccine should induce HIV-1 specific broadly neutralizing antibodies (bnAbs).
- bnAbs generally require high levels of somatic hypermutation
- V3 of the HIV-1 envelope protein require limited SHM
- the V3 glycan epitope is a desirable vaccine target.
- a vaccine to prevent HIV-1 infection should include immunogens that can induce broadly neutralizing antibodies (bnAbs) (1, 2).
- bnAbs broadly neutralizing antibodies
- the gly can-rich apex of the HIV-1 envelope (Env) trimer and the base of the third variable loop (V3) are distinguished by the potency of antibodies directed against them (3-8).
- CD4bs CD4 binding site
- MPER gp41 membrane-proximal region
- DH270 antibodies were recovered from memory B cells at all three sampling times (weeks 205, 232, and 234) and expansion of the clone did not occur until week 186 (Fig. 1A and Figs. 30A-C). Clonal expansion was concurrent with development of plasma
- Man9-V3 glycopeptide (DH270.6) was isolated using a fluorophore-labeled Man9-V3 glycopeptide that is a mimic of the V3-glycan bnAb epitope (16) comprising a discontinuous 30 amino acid residue peptide segment within gp l20 V3 and representative of the PGT128-bound minimal epitope described by Pejchal et al. (17).
- the synthetic Man9-V3 glycopeptide includes high mannose glycan residues (Mam) each at N301 and N332 and was synthesized using a chemical process similar to that described previously (18, 19).
- V3 glycan bnAb PGT128 affinity for the Mans>- V3 glycopeptide was similar to that of PGT128 for the BG505 SOSIP trimer and Mans>-V3 glycopeptide was therefore an effective affinity bait for isolating of V3 glycan bnAbs (16).
- Neutralization assays and competition with V3-glycan bnAbs PGT125 and PGT128 confirmed lineage N332- dependence (Figs. 8A-C).
- the DH475 mAb was recovered from memory B cells at week 232 post-transmission by antigen-specific sorting using the fluorophore -labeled Man9-V3 glycopeptide (16).
- the DH272 mAb came from cultured memory B cells obtained at week 205 post- transmission. DH272 lineage VHDJH rearrangements were detected as early as 19 weeks post-transmission by NGS (Fig. 9A and Figs. 30A-C).
- the DH272 heavy chain used VHT - 2*02, as did DH270, but it paired with a VK 2-30 light chain. Its CDRH3 was 17 amino acids long; VH mutation was 14.9%.
- DH272, an IgA isotype had a 6-nt deletion in FRH3 (Fig. 9B).
- Viruses in the second clade resisted DH270 lineage neutralization and comprised gpl20 Envs that were not bound by the DH270 antibodies (Fig. 12, triangles and Figs. 34- 35).
- the third and fourth clades defined autologous viruses whose gpl20 Env was bound by DH270 lineage antibodies but that were either only weakly neutralized by the most mature members of the DH270 lineage (Fig. 12, "X” and Figs. 34-35) or were completely neutralization resistant (Fig. 12, "+” and Figs. 34-35), respectively.
- both DH270 and DH272 used VH1-2*02 although unlike the CD4bs bnAbs, V3 glycan bnAbs in general can use quite disparate VH gene segments (3, 17, 22-25), and antibodies in both lineages have mutations at the same amino acid positions that correspond to sites of intrinsic mutability that we identified in the VH1-2*02 CD4bs bnAbs (77) (Fig. 17A).
- Fig. 17A In HIV-1 negative individuals, we identified 20 aa that frequently mutate from the VH1-2*02 germline sequence (Fig. 17A).
- the G169C mutation in DH270.IA4 which encoded the G57R amino acid mutation, occurred at a site with a very low predicted level of mutability (20), generated a canonical cold spot (GTC) and disrupted the overlapping AID hotspot at G 170 within the same codon, which was instead used by DH272 and resulted in the G57V substitution (Fig. 3A).
- GTC canonical cold spot
- Fig. 3A the substitution in the DH270 lineage (G57R) was an improbable event whereas the substitution (G57V) in the DH272 lineage was much more probable.
- DH475 neutralized viruses from week 15 through week 39 and DH272 neutralized the CH848 transmitted/founder and all viruses isolated up to week 51, when viruses that resisted DH475 and DH272 became strongly sensitive to the more mature antibodies in the DH270 lineage (Vii nt mutation frequency ⁇ 5.6%) (Fig. 4A).
- the VI loop of the transmitted/founder virus was longer than the average V I length of 28 residues (range 1 1 to 64) of HIV- 1 Env sequences found in the Los Alamos Sequence Database (26).
- DH270 lineage antibodies acquired the ability to neutralize larger fractions of autologous viruses as maturation progressed by gaining activity for viruses with longer VI loops, although at the expense of lower potency (Figs. 20A-C). This correlation was less clear for gp l20 binding (Figs. 20D-F), however, suggesting that the VI loop-length dependency of V3 glycan bnAb neutralization has a conformational component.
- DH475 cooperated with the DH270 bnAb lineage by selecting viral escape mutants sensitive to bnAb lineage members.
- DH272 had a CDRH3 configured differently from that of DH270 lineage members and a significantly longer CDRLl (Fig. 5B), compatible with their distinct neutralization profiles.
- DH270.1 since it is a potential partner for Arg57 on the Fab. Mutating Asp321 led to a modest loss in affinity; R327A had no effect (Fig. 26A-C). These data further distinguish DH270 from PGT124 and PGT128. Mutating W101, Y105, D 107, D 1 15, Y 1 16 or W1 17 in
- DH270 UCA did not bind to any of the 120 CH848 autologous gp l20 Env glycoproteins isolated from time of infection to 245 weeks post-infection, including the TF Env (Fig. 6A). DH270 UCA, as well as maturation intermediate antibodies, also did not recognize free glycans or cell surface membrane expressed gp l60 trimers (Fig. 6B).
- DH270 UCA bound to the Mans>-V3 synthetic glycopeptide mimic of the V3- glycan bnAb gp l20 epitope (Fig. 27A) and also bound to the aglycone form of the same peptide (Fig. 27B).
- DH270 UCA and early intermediate antibodies binding to the Mans>-V3 glycopeptide was low (>10 ⁇ ) (Fig. 27A).
- the CH848 viral population underwent a transition from a long VI loop in the TF (34 residues) to short loops (16-17 residues) when escaping DH272/DH475 and facilitating expansion of DH270, to restoration of longer VI loops later in infection as resistance to DH270 intermediates developed.
- DH270 antibodies adapted to viruses with longer VI loops, allowing recognition of a broader spectrum of Envs and enhancing breadth.
- DH270.6 could neutralize heterologous viruses regardless of VI loop length, but viruses with long loops tended to be less sensitive to it. Association of long VI loops with reduced sensitivity was evident for three other V3 glycan bnAbs isolated from other individuals and may be a general feature of this class.
- V I loop deletions in CH848 autologous virus removed the PNG site at position 137. While the hypervariable nature of the VI loop (which evolves by insertion and deletion, resulting in extreme length heterogeneity, as well as extreme variation in number of PNG sites) complicates the interpretation of direct comparisons among unrelated HIV-1 strains, it is worth noting that a PNG in this region specified as N 137 was shown to be important for regulating affinity maturation of the PGT121 V3 glycan bnAb family, with some members of the lineage evolving to bind (PGT121- 123) and others (PGT124) to accommodate or avoid this glycan (29).
- the absence of detectable binding to the CH848 TF Env raised at least two possibilities.
- One is that the lineage arose at the end of year 1, either from a primary response to viruses present at that time (e.g., with deletions in V1-V2) or from subversion of an antibody lineage initially elicited by some other antigen.
- the other is that some altered form of the CH848 TF envelope protein (e.g.
- V3 glycan bnAbs recreates the events that led to bnAb induction in CH848: start by priming with a ligand that binds the bnAb UCA, such as the synthetic glycopeptide mimic of the V3 -glycan bnAb gp l20 epitope, then boost with an Env that can select G57R CDR H2 mutants, followed by Envs with progressive VI lengths (Fig. 28).
- a ligand that binds the bnAb UCA such as the synthetic glycopeptide mimic of the V3 -glycan bnAb gp l20 epitope
- MAbs DH270.1 and DH270.3 were isolated from cultured memory B cells isolated 205 weeks post-transmission (14).
- DH270.6 and DH475 mAbs were isolated from Man9-V3 glycopeptide-specific memory B cells collected 232 and 234 weeks post-transmission, respectively, using direct sorting.
- DH270.2, DH270.4 and DH270.5 mAbs were isolated from memory B cells collected 232 weeks post-transmission that bound to Consensus C gpl20 Env but not to Consensus C N332A gp l20 Env using direct sorting
- a total of 30,700 memory B cells from individual CH848 were isolated from PBMC collected 205 weeks post-transmission using magnetic-activated cell sorting as described in (14). Memory B cells were cultured at limiting dilution at a calculated concentration of 2 cells/well for 2 weeks as described in (1 1) using irradiated CD40L L cells (7,500 cGy) as feeder cells at a concentration of 5,000 cells/well; culture medium was refreshed 7 days after plating.
- RNAlater Qiagen
- MAbs DH270.1 and DH270.3 were isolated from cultures that bound to CH848.TF gpl20 Env and Consensus C gp l20 but did not bind to C N332A gp l20 Env.
- DH272 was isolated from a culture that neutralized 99% CH848.TF virus infectivity.
- DH272 dependency to N332-linked glycans was first detected on the transiently transfected recombinant antibody tested at higher concentration and confirmed in the purified recombinant antibody. From the stored RNAlater samples, mRNA of cells from these cultures was extracted and
- DH270.6 and DH475 mAbs were isolated from Man9-V3 glycopeptide-specific memory B cells collected 232 and 234 weeks post-transmission, respectively, using direct sorting (16). Briefly, biotinylated Man9-V3 peptides were tetramerized via streptavidin that was conjugated with either AlexaFluor 647 (AF647; ThermoScientific) or Brilliant Violet 421 (BV421) (Biolegend) dyes. Peptide tetramer quality following conjugation was assessed by flow cytometry to a panel of well-characterized HIV-1 V3 glycan antibodies (PGT128, and 2G12) and linear V3 antibodies (F39F) attached to polymer beads.
- AF647 AlexaFluor 647
- BV421 Brilliant Violet 421
- PBMCs from donor CH848 were stained with LIVE/DEAD Fixable Aqua Stain (ThermoScientific), anti-human IgM (FITC), CD3 (PE-Cy5), CD235a (PE-Cy5), CD 19 (APC-Cy7), and CD27 (PE-Cy7) (BD Biosciences); anti -human antibodies against IgD (PE); anti -human antibodies against CD 10 (ECD), CD38 (APC-AF700), CD19 (APC-Cy7), CD16 (BV570), CD14 (BV605)
- PBMCs that were Aqua Stain -, CD14-, CD16-, CD3-, CD235a-, positive for CD19+, and negative for surface IgD were defined as memory B cells; these cells were then gated for Man9-V3+ positivity in both AF647 and BV421, and were single-cell sorted using a BD FACS Aria II into 96-well plates containing 20 ⁇ 1 of reverse transcriptase buffer (RT).
- RT reverse transcriptase buffer
- DH270.2, DH270.4 and DH270.5 mAbs were isolated from memory B cells collected 232 weeks post-transmission that bound to Consensus C gpl20 Env but not to Consensus C N332A gpl20 Env using direct sorting. Reagents were made using biotinylated Consensus C gpl20 Env and Consensus C N332A gpl20 Env by reaction with streptavidin that was conjugated with either AlexaFluor 647 (AF647; ThermoScientific) or Brilliant Violet 421 (BV421) (Biolegend) dyes, respectively.
- AF647 AlexaFluor 647
- BV421 Brilliant Violet 421
- Env tetramer quality following conjugation was assessed by flow cytometry to a panel of well-characterized HIV-1 V3 glycan antibodies (PGT128, and 2G12) and linear V3 antibodies (F39F) attached to polymer beads.
- PBMCs were stained as outlined for DH475 and DH270.6, however these cells were then gated for Consensus C gpl20 positivity and Consensus C N332A gpl20 negativity in AF647 and BV421, respectively, and were single cell sorted and processed as outlined for DH475 and DH270.6.
- Reported mutation frequency is calculated as frequency of nucleotide mutations in the V gene region of antibody sequence.
- CDRH3 lengths reported are defined as the number of residues after the invariant Cys in FR3 and before the invariant Trp in FR4.
- Immunoglobulin genes of mAbs DH270.1 through DH270.6, DH272 and DH475 were amplified from R A from isolated cells, expression cassettes made, and mAbs expressed as described (12, 14). Inference of unmutated common ancestor (UCA) and intermediate antibodies DH270.IA1 through DH270.IA4 was conducted using methods previously described (36).
- Heavy chain plasmids were co-transfected with appropriate light chain plasmids at an equal ratio in Expi 293 cells using ExpiFectamine 293 transfection reagents (Thermo Fisher Scientific) according to the manufacturer's protocols.
- transfected cultures were incubated at 37°C 8% C02 for 2-6 days, harvested, concentrated and incubated overnight with Protein A beads at 4°C on a rotating shaker before loading the bead mixture in columns for purification; following PBS/NaCl wash, eluate was neutralized with trizma hydrochloride and antibody concentration was determined by Nanodrop. Purified antibodies were tested in SDS-Page Coomassie and western blots, and stored at 4°C.
- PBMC-extracted RNA from weeks 1 1, 19, 64, 1 1 1, 160, 186, and 240 post-infection were used to generate cDNA amplicons for next-generation sequencing (Illumina Miseq) as described previously (35). Briefly, RNA isolated from PBMCs was separated into two equal aliquots before cDNA production; cDNA amplification and NGS were performed on both aliquots as independent samples (denoted A and B). Reverse transcription (RT) was carried out using human IgG, IgA, IgM, IgK and Igk primers as previously described (12).
- IgG isotype IGHV1 and IGHV3 genes were amplified separately from weeks 1 1, 19, 64, 1 1 1, 160, and 186.
- IGHV1-IGHV6 genes were amplified at week 240.
- a second PCR step was performed to add Nextera index sequencing adapters (Illumina) and libraries were purified by gel extraction (Qiagen) and quantified by quantitative PCR using the KAPA SYBR FAST qPCR kit (KAPA Biosy stems). Each replicate library was sequencing using the Illumina Miseq V3 2x 300bp kit.
- NGS reads were computationally processed and analyzed as previously described (35). Briefly, forward and reverse reads were merged with FLASH with average read length and fragment read length parameters set to 450 and 300, respectively. Reads were quality filtered using FASTX (http://hannonlab.cshl.edu/fastx_toolkit/) for sequences with a minimum of 50 percent of bases with a Phred quality score of 20 or greater (corresponding to
- Clonal lineage reconstruction was performed on the NGS replicated sequences and probe -identified sequences of each clone using the Cloanalyst software package. A maximum of 100 sequences were used as input for inferring phylogenetic trees of clonal lineages. Clonal sequence sets were sub-sampled down to 100 sequences by collapsing to one sequence within a 2 or 9 base pair difference radius for the DH272 and DH270 clones, respectively.
- Unmutated common ancestors (UCA) and ancestral intermediate sequences were computationally inferred with the Cloanalyst software package.
- Cloanalyst uses Bayesian inference methods to infer the full unmutated V(D)J rearrangement thereby including a predicted unmutated CDR3 sequence.
- UCA inferences were performed each time a new member of the DH270 clonal lineage was experimentally isolated and thus several versions of the DH270 UCA were produced and tested.
- UCA1 and UCA3 were used for structural determination.
- UCA4 (referred to as DH270.UCA throughout the text), which was inferred using the most observed DH270 clonal members and had the lowest uncertainty of UCAs inferred (as quantified by the sum of the error probability over all base positions in the sequence), was used for binding and neutralization studies. Subsequently, the DH270 UCA was also re-inferred when NGS data became available. We applied a bootstrapping procedure to infer the UCA with the NGS data included, resampling clonal lineage trees 10 times with 100 input NGS sequences each. The UCA4 amino acid sequence was recapitulated by 7 out of 10 UCA inferences of the resampled NGS trees confirming support for UCA4.
- Each inference of V(D)J calls is associated with a probability.
- the probability of the DH270 lineage to use the VH1-2 family gene was 99.99% and that of using allele 02 (VH1- 2*02) was 98.26%. Therefore, there was a 0.01% probability that the family was incorrectly identified and a 1.74% probability that the allele was incorrectly identified. Therefore, we sequenced genomic DNA of individual CH848. As previously reported, positional conformity is defined as sharing a mutation at the same position in the V gene segment and identity conformity as sharing the same amino acid substitution at the same position (11).
- Genomic DNA was isolated from donor CH848 from PBMCs 3 weeks after infection (QIAmp DNA Blood mini kit; Qiagen).
- IGVH1-2 and IGVL2-23 sequences were amplified using 2 independent primer sets by PCR. To ensure amplification of non-rearranged variable sequences, both primer sets reverse primers aligned to sequences present in the non-coding genomic DNA downstream the V-recombination site.
- the forward primer for set 1 resided in the IGVH1-2 and IGVL2-23 leader sequences and upstream of the leader in set 2.
- the PCR fragments were cloned into a pcDNA2.1 (TOPO-TA kit; Life technologies) and transformed into bacteria for sequencing of individual colonies.
- VH1- 2_1_S tcctcttcttggtggcagcag (SEQ ID NO: 43); VH1-2_2_S: tacagatctgtcctgtgccct (SEQ ID NO: 44); VHl-2_l_tmAS: ttctcagccccagcacagctg (SEQ ID NO: 45); VHl-2_2_TmAS: gggtggcagagtgagactctgtcaca (SEQ ID NO: 46); VL2-23_2_S: agaggagcccaggatgctgat (SEQ ID NO: 47); VL2-23_1_S: actctcctcactcaggacaca (SEQ ID NO: 48); VL2-23_1_AS: tctcaaggccgcgctgcagca (SEQ ID NO: 49); VL2-23_2_AS: tctcaaggc
- VH 1-2*02 The canonical sequence and a variant that encoded a VH that differed by 9 amino acids. Of these 9 amino acids, only 1 was shared among DH270 antibodies whereas 8 amino acids were not represented in DH270 lineage antibodies (Fig. 17B).
- the VHl-2*02 variant isolated from genomic DNA did not encode an arginine at position 57.
- the DH270 lineage is likely derived from the canonical VHl-2*02 sequence.
- Direct-binding ELISAs were performed as described (1 1). Briefly, 384-well plates were blocked for 1 h at room temperature (RT) or overnight at 4°C (both procedures were previously validated); primary purified antibodies were tested at a starting concentrations of 100 ⁇ g/ml, serially three-fold diluted and incubated for 1 h at RT; HRP -conjugated human IgG antibody was added at optimized concentration of 1 :30,000 in assay diluent for 1 hour and developed using TMB substrate; plates were read at 450 nm in a SpectraMax 384 PLUS reader (Molecular Devices, Sunnyvale, CA); results are reported as logarithm area under the curve (LogAUC) unless otherwise noted.
- RT room temperature
- 4°C both procedures were previously validated
- HRP -conjugated human IgG antibody was added at optimized concentration of 1 :30,000 in assay diluent for 1 hour and developed using TMB substrate
- plates were read at 450 nm in
- biotinylated avi-tagged antigens plates were coated with streptavidin (2 ⁇ g/ml); blocked plates were stored at -20°C until used and biotinylated avi-tagged antigens were added at 2 ⁇ g/ml for 30 minutes at RT.
- the CH848 env sequence was codon-optimized and cloned into an HIV- 1 -based lentiviral vector.
- a heterologous signal sequence from CD5 was inserted replacing that of the HIV-1 Env.
- the proteolytic cleavage site between gpl20 and gp41 was altered, substituting serine residues for Arg508 and Arg511, the tyrosine at residues 712 was changed to alanine (Y712A), and the cytoplasmic tail was truncated by replacing the Lys808 codon with a sequence encoding (Gly)3 (His)6 (SEQ ID NO: 51) followed immediately by a TAA stop codon.
- This env-containing sequences was inserted into the vector immediately downstream of the tetracycline (tet)-responsive element (TRE), and upstream of an internal ribosome entry site (IRES) and a contiguous puromycin (puro)-T2A-EGFP open reading frame (generating K4831), as described previously for the JRFL and CH505 Envs (45).
- tet tetracycline
- IVS internal ribosome entry site
- puro puromycin
- CHO-S cells (Invitrogen) modified to constitutively express the reverse tet transactivator (rtTA) were transduced with packaged vesicular stomatitis virus (VSV) G glycoprotein-pseudotyped CH848 Env expression vector.
- Transduced cells were incubated in culture medium containing ⁇ g/ml of doxycycline (dox) and selected for 7 days in medium supplemented with 25 ⁇ g/ml of puromycin, generating the Env expressor-population cell line termed D831. From D831, a stable, high-expressor clonal cell line was derived, termed D835.
- D835 a stable, high-expressor clonal cell line was derived, termed D835.
- the integrity of the recombinant env sequence in the clonal cell lines was confirmed by direct (without cloning) sequence analysis of PCR amplicons.
- D831 Selected TRE2.CH848.JF-8.IRS6A Chinese Hamster Ovary Cells were cultured in DMEM/F-12 supplemented with HEPES and L-glutamine (Thermo Fischer, Cat#l 1330057) 10% heat inactivated fetal bovine serum [FBS] (Thermo Fischer,
- Stain buffer was removed from cells and 0.2ml/well of DH270 lineage antibodies, palivizumab (negative control) or PGT128 (positive control) were added at optimal concentration of 5 ⁇ g/mL for 30 minutes at 4°C. After a 2X wash, cells were stained with 40 ul of APC-conjugated mouse anti-Human IgG (BD Pharmigen, Cat#562025) per well (final volume 0.2 ml/well) for 30 minutes at 4°C. Unstained cells were used as further negative control.
- Oligomannose arrays were printed with glycans at 100, 33, and 10 ⁇ (Z Biotech). Arrays were blocked for lh in Hydrazide glycan blocking buffer. Monoclonal antibodies were diluted to 50 ⁇ g/mL in Hydrazide Glycan Assay Buffer, incubated on an individual subarray for 1 h, and then washed 5 times with PBS supplemented with 0.05% tween-20 (PBS-T).
- PBS-T 0.05% tween-20
- Subarray s that received biotinylated Concanavalin A were incubated with streptavidin-Cy3 (Sigma), whereas all other wells were incubated with anti-IgG-Cy3 (Sigma) for lh while rotating at 40 rpm covered from light.
- the arrays were washed 5 times with 70 ⁇ ⁇ of PBS-T and then washed once with 0.0 IX PBS.
- the washed arrays were spun dry and scanned with a GenePix 4000B (Molecular Devices) scanner at wavelength 532 nm using GenePix Pro7 software.
- the fluorescence within each feature was background subtracted using the local method in GenePix Pro7 software (Molecular Devices). To determine glycan specific binding, the local background corrected fluorescence of the print buffer alone was subtracted from each feature containing a glycan.
- Man9-V3 glycopeptide A 30-amino acid V3 glycopeptide with oligomannose glycans (Man9-V3), based on the clade B JRFL mini-V3 construct (16), was chemically synthesized as described earlier (18). Briefly, after the synthesis of the oligomannose glycans in solution phase (18), two partially protected peptide fragments were obtained by Fmoc-based solid phase peptide synthesis, each featuring a single unprotected aspartate residue. The Man9GlcNAc2 anomeric amine was conjugated to each fragment (D301 or D332) using our one-flask
- Antibody binding kinetic rate constants (ka, kd) of the Man9-V3 glycopeptide and its aglycone form (16) were measured by Bio-layer Interferometry (BLI, ForteBio Octet Red96) measurements.
- the BLI assay was performed using streptavidin coated sensors (ForteBio) to capture either biotin-tagged Man9-V3 glycopeptide or Aglycone-V3 peptide.
- the V3 peptide immobilized sensors were dipped into varying concentrations of antibodies following blocking of sensors in BSA (0.1%). Antibody concentrations ranged from 0.5 to 150 ⁇ g/mL and non-specific binding interactions were subtracted using the control anti-RSV
- Rate constants were calculated by global curve fitting analyses to the Bivalent Avidity model of binding responses with a 10 min association and 15 min dissociation interaction time.
- the dissociation constant (Kd) values without avidity contribution were derived using the initial components of the association and dissociation rates (kal and kdl) respectively.
- Steady-state binding Kd values for binding to Man9-V3 glycopeptide with avidity contribution were derived using near steady-state binding responses at varying antibody concentrations (0.5-80 ⁇ g/mL) and using a non-linear 4-paramater curve fitting analysis.
- Antibody site-directed mutagenesis Site-directed mutagenesis of antibody genes was performed using the Quikchange II lightening multi-site-directed mutagenesis kit following manufacturer's protocol (Agilent). Mutant plasmid products were confirmed by single-colony sequencing.
- DH270_IA4_D31G cccagtgtatatagtagccggtgaaggtgtatcca
- DH270.IA4 I34M tcgcacccagtgcatatagtagtcggtgaaggtgt
- DH270.IA4 T55S gatggatcaaccctaactctggtcgcacaaactat
- DH270.IA4 R57G tgtgcatagtttgtgccaccagtgttagggttgat (SEQ ID NO: 55
- DH270.IA4 R57V tgtgcatagtttgtgccaccagtgttagggttgat
- the codon-optimized CH848-derived env genes were generated by de novo synthesis (GeneScript, Piscataway, NJ) or site-directed mutagenesis in mammalian expression plasmid pcDNA3.1/hygromycin (Invitrogen) as described (10), and stored at -80°C until use.
- the heavy- and light-chain variable and constant domains of the DH270 lineage Fabs were cloned into the pVRC-8400 expression vector using Notl and Nhe l restriction sites and the tissue plasminogen activator signal sequence.
- the DH270.1 single chain variable fragment (scFv) was cloned into the same expression vector.
- the C terminus of the heavy- chain constructs and scFv contained a noncleavable 6x histidine tag (SEQ ID NO: 58).
- Site- directed mutagenesis was carried out, using manufacturer's protocols (Stratagene), to introduce mutations into the CDR regions of DH270.1.
- Fabs were expressed and purified as described previously (46).
- the DH270.1 scFv was purified the same way as the Fabs.
- the furin cleavage site between gpl20 and gp41 (508REKR511 (SEQ ID NO: 37)) was altered to 506RRRRRR511 (SEQ ID NO: 59) to enhance cleavage (48).
- the resulting, codon- optimized 92BR SOSIP.664 env gene was obtained from GenScript (Piscataway, NJ) and cloned into pVRC-8400 as described above for Fabs using Nhel and Notl.
- SOSIP.664 constructs were transfected along with a plasmid encoding the cellular protease furin at a 4: 1 Env:furin ratio in HEK 293F cells. Site-directed mutagenesis was performed using manufacturer's protocols (Stratagene) for mutations in the V3 region and glycosylation sites. The cells were allowed to express soluble SOSIP.664 trimers for 5-7 days. Culture supernatants were collected and cells were removed by centrifugation at 3,800 x g for 20 min, and filtered with a 0.2 ⁇ pore size filter.
- SOSIP.664 proteins were purified by flowing the supernatant over a lectin (Galanthus nivalis) affinity chromatography column overnight at 4°C. The lectin column was washed with lx PBS and proteins were eluted with 0.5M methyl-a-D-mannopyranoside and 0.5M NaCl.
- the eluate was concentrated and loaded onto a Superdex 200 10/300 GL column (GE Life Sciences) prequilibrated in a buffer of lOmM Hepes, pH 8.0, 150mM NaCl and 0.02% sodium azide for EM, or in 2.5mM Tris, pH 7.5, 350mM NaCl, 0.02% sodium azide for binding analysis, to separate the trimer-size oligomers from aggregates and gp l40 monomers.
- Particles were picked semi-automatically using EMAN2 and put into a particle stack.
- Initial, reference-free, two-dimensional (2D) class averages were calculated and particles corresponding to complexes (with three Fabs bound) were selected into a substack for determination of an initial model.
- the initial model was calculated in EMAN2 using 3 -fold symmetry and EMAN2 was used for subsequent refinement using 3-fold symmetry.
- 5,419 particles were included in the final reconstruction for the 3D average of 92BR
- Heat maps and logo plots were generated using the Los Alamos HIV database web interfaces (www.hiv.lanl.gov, version Dec. 2015, HEATMAP and Analyze Align).
- V(D)J rearrangement sequences of DH272, DH475 and the DH270 lineage antibodies have been deposited in GenBank with accession numbers KY354938 through KY354963.
- NGS sequence data for clones DH270, DH272 and DH475 have been deposited in GenBank with accession numbers KY347498 through KY347701.
- This example provides non-limiting embodiments of V3 peptides which can be used in the immunogenic compositions and methods.
- Mans>-V3 glycopeptide was synthesized using a similar synthetic approach used to produce V1V2 glycopeptides (B. Aussedat et al, J Am Chem Soc 135, 13113 (2013)). As controls, a biotinylated aglycone-V3 peptide with no high mannose glycans (Fig. 38C) and a biotinylated Man9 free glycan (Fig. 38A) were also synthesized.
- V3-glycan bnAb DH270 unmutated common ancestor binding to the peptide component of Man9-V3 glycopeptide [0352]
- the DH270 bnAb UCA did bind to Man9V3 ( Figure 27A) and, as well, bound to the aglycone- V3 ( Figures 27B).
- any of the peptides could be biotinylated.
- the peptides are biotinylated on the C terminus, except CH848.TF_V3_biotin-315-340 and
- the peptides of the invention can be synthesized by any known method.
- V3 aglycone of and Man9V3 and their synthesis are provided in Figure 38A. See also WO2014//172366.
- the peptides are:
- peptides which are not biotinylated do not include an N- or C-terminal lysine (or other specific functional groups or residues) for targeting with biotynalation reagents.
- V3 (+ the base containing N332 NGS) of CH848 transmitted founder
- Non-limiting embodiments of V3 peptides variants include:
- GDIA (SEQ ID NO: 511): EINCTRPNNNTRPGEIIGDIRQAHCNISRA
- GAIR (SEQ ID NO: 512): EINCTRPNNNTRPGEIIGAIRQAHCNISRA
- ADAR (SEQ ID NO: 513): EINCTRPNNNTRPGEIIADAROAHCNISRA (SEQ ID NO: 33 )
- the peptides of the invention could be glycosylated at either or both positions N301 and N332.
- the glycan is Man9GlcNAc2.
- peptides which are not biotinylated do not include an N- or C-terminal lysine (or other specific functional groups or residues) for targeting with biotynaltion reagents.
- the invention also contemplates peptides which comprise T-cell helper epitope.
- T-cell helper epitope One non-limiting embodiment includes GTHl helper epitope.
- the helper epitope(s) could be at the N-or C-terminus of the peptide.
- the peptides of the invention could be multimerized.
- the peptides are biotinylated or multimerized.
- the multimeric peptides comprise a T-helper epitope, e.g. but not limited to GTHl epitope.
- the helper epitope(s) could be at the N-or C-terminus of the peptide.
- the peptides are conjugated to a lipid and then multimerized.
- the lipids could be pegylated.
- a non-limiting example is V3 (SEQ ID NO: 1) Peg-GTHl-DPPE peptide.
- immunogens are selected which can do (i) and (iii). In other embodiments, the selection includes immunogens which can do (ii).
- the envelope used in the compositions and methods of the invention can be a gpl60, gpl50, gpl45, gpl40, gpl20, gp41, N-terminal deletion variants as described herein, cleavage resistant variants as described herein, or codon optimized sequences thereof.
- the composition comprises envelopes as trimers.
- envelope proteins are multimerized, for example trimers are attached to a particle such that multiple copies of the trimer are attached and the multimerized envelope is prepared and formulated for immunization in a human.
- the compositions comprise envelopes, including but not limited to trimers as particulate, high-density array on liposomes or other particles, for example but not limited to nanoparticles.
- the trimers are in a well ordered, near native like or closed conformation.
- the trimer compositions comprise a homogenous mix of native like trimers.
- Near-native soluble trimers using the 6R.SOSIP.664 design are capable of generating autologous tier 2 neutralizing plasma antibodies in the plasma (Sanders et al. 2015), which provides a starting point for designing immunogens to elicit broadly neutralizing antibodies. While these trimers are preferentially antigenic for neutralizing antibodies they still possess the ability to expose the V3 loop, which generally results in strain-specific binding and neutralizing antibodies after vaccination. Using the unliganded structure the
- BG505.6R.SOSIP.664 has been stabilized by adding cysteines at position 201 and 433 to constrain the conformational flexibility such that the V3 loop is maintained unexposed (Kwon et al. 2015).
- WO2015/153638 could be designed as SOSIP trimers.
- CHIM.6R.SOSIP.664V4.1design is expected to be in closed stabilized conformation. This design is expected to show preferential binding to broad neutralizing antibodies compared to binding to non-neutralizing antibodies. This design is expected to bind to antibodies from the V3 antibodies of Example 1.
- the gpl20 of C.CH848 envelope was fused with the BG505 inner domain gpl20 sequence within the alpha helix 5 (alpha5) to result in a chimeric protein.
- the chimeric gpl20 is disulfide linked to the A.BG505 gp41 as outlined by Sanders et al. (PLOS Path 2013).
- the immunogens were designed as chimeric proteins that possess the BG505 gp41 connected to the CH848 gpl20, since the BG505 strain is particularly adept at forming well-folded, closed state trimers (See Figure 41C).
- This envelope design retains the CH848 base of the V3 loop and glycan(s) that are targeted by the DH270 lineage of broadly neutralizing antibody lineages that were isolated from CH848 (Example 1).
- V3 peptide used as a prime is:
- EINCTRPN TRPGEIIGDIRQAHCNISRA (SEQ ID NO: 1) as aglycone or as
- Man9GlcNAc2 glycosylated at both N301 and N332.
- the envelopes could be administered in any suitable form, as nucleic acids, amino acids and/or combination, a gpl60, gpl50, gpl45, any suitable form of a trimer, for example but not limited to SOSIP trimers, preferably in a closed conformation , gp l40 (including but not limited to gpl40C, gpl40CF, gpl40CFI), gpl20, gp41, N-terminal deletion variants (e.g. delta 11 deletions) as described herein, cleavage resistant variants, or codon optimized sequences thereof.
- Non-limiting examples of sequences are provided in Figures 39A-B, 40A- C, and 41A-C.
- the boost could be sequential or additive.
- Selection I V3 glycopeptide and/or aglycone peptide (SEQ ID NO: 1) as a prime; Boost: CH848.0949.10.17; CH848.0358.80.06; CH848.1432.5.41; CH848.0526.25.02. See Figure 37A and Figure 28 in Example 1.
- Selection II V3 glycopeptide and/or aglycone peptide as a prime; Boost:
- deglycosylated envelope boost: CH848.0949.10.17; optionally CH848.0836.10.31;
- the prime could be selected from any of the contemplated envelope designs that show binding to the DH270UCA.
- the boost could include CH848.dl305.10.13 and
- CRF02_AG.T250 is an envelope which is very sensitive to V2glycan and V3glycan antibodies, and resistant to CD4bs antibodies. Short positively charged VI V2's are highly associated with sensitivity, and T250 has among the shortest VI V2 regions—So do
- T250's VI V2 region could be introduced in any of the envelopes describe herein, e.g. in CH0848.d0949.021.10.17.
- the best antibody from the DH270 lineage is DH270.6. Like most V3 antibodies, it requires the N332 PNGS. In addition, D325N is highly associated with resistance, and is a common circulating mutation. Other V3glycan bNAbs can tolerate the mutation, and it arose in CH848 after DH270 lineage antibodies were isolated, likely possibly as an escape from our DH270 lineage. An N325 CH848 envelope isolate could be included in the vaccine to potentially extend breadth when DH270-like linages is started. There are several candidates, but only two had any binding or neutralizing activity CH848.dl305.10.13 and
- CH848.dl305.10.13 has a proline after the N, GDIR -> GNPR (SEQ ID NOS 34 and 35, respectively), which is rare,
- CH0848.3.dl651.10.07 based envelopes are better vaccine option.
- Figures 44A, 44B, and 44D show additional envelope designs, to introduce changes in the sequence of CH0848.3.D0949.10.17 to increase the sensitivity of these envelopes to antibodies in the DH270 lineage. Some of the changes affect glycans while others do not impact glycosylation positions.
- Table 3 provides a listing of reagents for use as prime(s)/DH270 lineage germline binders and/or boosts (Amino acid sequences of these envelopes are provided in Figure 45).
- VI glycans block PGT121 from binding to the V3 glycan site (Garces et al. Cell. 2014 Sep 25; 159(l):69-79. doi: 10.1016/j.cell.2014.09.009; Garces et
- VI glycans block PGT121 from binding to the V3 glycan site (Garces et).
- Some bnAb precursor antibodies bind stronger to trimer than gpl20 7CHIM.6R.SOSIP.66
- Some bnAb precursor antibodies bind stronger to trimer than gpl20 31CHIM.6R.SOSIP.6
- Some bnAb precursor antibodies bind stronger to trimer than gpl20 06CHIM.6R.SOSIP.6
- Some bnAb precursor antibodies bind stronger to trimer than gpl20 CHIM.6R.SOSIP.664
- Some bnAb precursor antibodies bind stronger to trimer than gpl20 2CHIM.6R.SOSIP.66
- Env as a stable trimer. Also for immunization the native stable trimer has less exposure of nonneutralizing epitopes.
- Some bnAb precursor antibodies bind stronger to trimer than gpl20 7chim.6R.DS.SOSIP.
- Some bnAb precursor antibodies bind stronger to trimer than gpl20 7chim.6R.DS.SOSIP.
- bnAb precursor antibodies bind stronger to trimer than gpl20 monomers. This is an autologous Env made as a stable trimer.
- bnAb precursor antibodies bind stronger to trimer than gpl20 monomers. This is an autologous Env made as a stable trimer.
- DH270 does not bind free glycan and may interfere with the UCA being
- Glycans were removed by mutation of the indicated amino acid position(s).
- bnAb precursor antibodies bind stronger to trimer than gpl20 monomers. This is an autologous Env made as a stable trimer.
- DH270 does not bind free glycan and may interfere with the UCA being
- Glycans were removed by mutation of the indicated amino acid position(s).
- bnAb precursor antibodies bind stronger to trimer than gpl20 monomers. This is an autologous Env made as a stable trimer.
- DH270 does not bind free glycan and may interfere with the UCA being
- Glycans were removed by mutation of the indicated amino acid position(s).
- V1B acids of the VI loop with a GlySerGly linker 664 V1B acids of the VI loop with a GlySerGly linker.
- DH270 does not bind free glycan and may interfere with the UCA being 7CHIM.6R.SOSIP.66
- VI glycans block PGT121 from 4V4.1degly4
- DH270 does not bind free glycan and may interfere with the UCA being 17gpl40C_degly4 able to bind to the base of the V3 loop.
- VI glycans block PGT121 from binding to the V3 glycan site (Garces et al Immunity). So we made an Env with N137 and N141 potential glycosylation sites in VI removed. Glycans were removed by mutation of the indicated amino acid position(s).
- Glycans were removed by mutation of the indicated amino acid position(s).
- Glycans were removed by mutation of the indicated amino acid position(s).
- envelopes and modified version thereof for use as DH270 lineage germline binders are provided and contemplated.
- CD5ss gpl40C Contemplated is also a SOSIP design of the envelope CH848
- Envelope JRFL Core with miniV3 (293F produced/KIF treated/EndoH treated).
- Signature_opt_filled_rare_holes_a designs are also referred to as SOFA design. Additional designs are also contemplated and covered by the invention.
- Non-limiting embodiments include chimeric trimer designs, which could comprise portions of BG505 envelope (See Figure 41C for example).
- Non-limiting embodiments include non-chimeric trimer designs. See for example Figure 54, Example 3B.
- the example describes CH848 envelopes, trimers and additional envelopes, modifications and designs.
- This example shows that stabilized HIV-1 Env trimer immunogens show enhanced antigenicity. See Figures 48A-48B.
- these envelopes, including but not limited to trimers are further mutlimerized, and/or used as particulate, high- density array in liposomes or other particles, for example but not limited to nanoparticles. Any one of the envelopes of the invention could be designed and expressed as described herein.
- the envelopes of the invention are engineered and tested for binding to various antibodies from the DH270 lineage.
- Neutralizing antibodies target the native trimeric HIV-1 Env on the surface virions.
- the trimeric HIV-1 envelope protein consists of three protomers each containing a gpl20 and gp41 heterodimer.
- Recent immunogen design efforts have generated soluble near-native mimics of the Env trimer that bind to neutralizing antibodies but not non-neutralizing antibodies.
- the recapitulation of the native trimer could be a key component of vaccine induction of neutralizing antibodies.
- Neutralizing Abs target the native trimeric HIV-1 Env on the surface of viruses (Poignard et al. J Virol. 2003 Jan;77(l):353-65; Parren et al. J Virol. 1998 Dec;72(12): 10270-4.; Yang et al. J Virol.
- the HIV-1 Env protein consists of three protomers of gpl20 and gp41 heterodimers that are noncovalently linked together (Center et al. J Virol. 2002 Aug;76(15):7863-7.). Soluble near-native trimers preferentially bind neutralizing antibodies as opposed to non-neutralizing antibodies (Sanders et al. PLoS Pathog. 2013 Sep; 9(9): el003618).
- DH270UCA DH270UCA
- DH270 lineage antibodies bind to the DH270UCA, and/or other DH270 lineage antibodies and are useful for Env immunizations as prime(s) and/or boosts.
- Near-native soluble trimers using the 6R.SOSIP.664 design are capable of generating autologous tier 2 neutralizing plasma antibodies in the plasma (Sanders et al. 2015), which provides a starting point for designing immunogens to elicit broadly neutralizing antibodies. While these trimers are preferentially antigenic for neutralizing antibodies they still possess the ability to expose the V3 loop, which generally results in strain-specific binding and neutralizing antibodies after vaccination. Using the unliganded structure the
- BG505.6R.SOSIP.664 has been stabilized by adding cysteines at position 201 and 433 to constrain the conformational flexibility such that the V3 loop is maintained unexposed (Kwon et al. Nat Struct Mol Biol. 2015 Jul; 22(7): 522-531.).
- Immunogen design Provided are engineered trimeric envelopes, for use as immunogens, wherein the envelopes are based on multiple viruses from CH848, and other viruses with suitable characteristics, e.g. VI loop length, as described.
- 6R.SOSIP.664 (Kwon et al Nat Struct Mol Biol. 2015 Jul; 22(7): 522-531.), chimeric 6R.SOSIP.664v4.1 (DeTaeye et al. Cell. 2015 Dec 17;163(7): 1702-15. doi:
- the 6R.SOSIP.664 is the basis for all of these designs and is made as a chimera of C.CH0505 and A.BG505.
- the gpl20 of C.CH848 was fused with the BG505 inner domain gpl20 sequence within the alpha helix 5 (ot5) to result in the chimeric protein.
- the chimeric gpl20 is disulfide linked to the A.BG505 gp41 as outlined by Sanders et al. (PLoS Pathog. 2013 Sep; 9(9): el003618). These immunogens were designed as chimeric proteins that possess the BG505 gp41 connected to the CH848 gpl20, since the BG505 strain is particularly adept at forming well-folded, closed trimers. This envelope design are expected to retain and expose features of the envelopes recognized by DH270 by broadly neutralizing antibody lineages that were isolated from CH848.
- Figures 39A-B, 40A-C, and 41A-C show nucleic acid and amino acid and sequences of various CH848 and other envelope trimer designs.
- Figure 41C shows an annotated sequence of the SOSIP.III design. Based on the various SOSIP designs, any other suitable envelope, for example but not limited to CH848 envelopes as described in WO2015/153638 can be designed.
- Recombinant envelopes as trimers could be produced and purified by any suitable method.
- purification methods see Ringe RP, Yasmeen A, Ozorowski G, Go EP, Pritchard LK, Guttman M, Ketas TA, Cottrell CA, Wilson IA, Sanders RW, Cupo A, Crispin M, Lee KK, Desaire H, Ward AB, Klasse PJ, Moore JP. 2015.
- envelopes including but not limited to trimers as particulate, high-density array on liposomes or other particles, for example but not limited to nanoparticles. See e.g. He et al. Nature Communications 7, Article number: 12041 (2016), doi: 10.1038/ncomms 12041 ; Bamrungsap et al. Nanomedicine, 2012, 7 (8), 1253-1271.
- the first construct was made by fusing HIV-1 Envelope trimer CH848 to ferritin.
- Ferritin protein self assembles into a small nanoparticle with three fold axis of symmetry. At these axis CH848 envelope protein was fused. Therefore the assembly of the three-fold axis also clusters three HIV-1 envelope protomers together to form an envelope trimer.
- Each ferritin particle has 6 axis which equates to 6 CH848 trimers being displayed per particle. See e.g. Sliepen et al.
- Another approach to multimerize expression constructs uses staphylococcus Sortase A transpeptidase ligation to conjugate CH848 envelope trimers to cholesterol.
- the CH848 trimers can then be embedded into liposomes via the conjugated cholesterol.
- To conjugate the CH848 trimer to cholesterol either a C-teminal LPXTG tag (SEQ ID NO: 60) or a N-terminal pentaglycine repeat tag (SEQ ID NO: 61) was added to the CH505 envelope trimer gene. Cholesterol was also synthesized with these two tags.
- Sortase A was then used to covalently bond the tagged CH505 envelope to the cholesterol.
- the sortase A-tagged trimer protein can also be used to conjugate the trimer to other peptides, proteins, or fluorescent labels.
- the invention provides design of envelopes and trimer designs wherein the envelope comprises a linker which permits addition of a lipid, such as but not limited to cholesterol, via a Sortase A reaction.
- a Sortase A reaction See e.g. Tsukiji, S. and Nagamune, T. (2009), Sortase-Mediated Ligation: A Gift from Gram-Positive Bacteria to Protein Engineering. ChemBioChem, 10: 787-798. doi: 10.1002/cbic.200800724; Proft, T. Sortase-mediated protein ligation: an emerging biotechnology tool for protein modification and immobilisation. Biotechnol Lett (2010) 32: 1.
- lipid modified envelopes and trimers could be formulated as liposomes. Any suitable liposome composition is contemplated.
- Non-limiting embodiments of envelope designs for use in Sortase A reaction are shown in Figure 47B-C.
- the trimeric Envelope expressing cells are sorted by fluorescence-activated cell sorting using a HIV-1 trimer specific antibody.
- the sorted cells can then be used to initiate clonal populations of cells that have been phenotypically shown to express the protein of interest.
- the expression construct is designed by taking advantage of the amber stop codon UAG in messenger RNA.
- the codon UAG usually signifies the end of the polypeptide sequence, but at a low rate the ribosome can readthrough this stop codon and continue to elongate the polypeptide chain.
- This stop codon into our protein construct followed by the natural BG505 gp41 transmembrane and cytoplasmic tail sequence ended with two stop codons. Therefore, when the stop codon is readthrough a membrane-anchored gpl20/gp41 heterodimer is formed. Loughran et al. (Nucleic Acids Res. 2014
- animal models Any suitable animal model will be used. Such animal models include mouse models, including humanized mice carrying human immunoglobulin locus, guinea pigs, rabbits, non-human primates, or any other model. Adults and neonates could be used in the studies.
- Mouse study prime with Man9 V3 (SEQ ID NO: 1) glycan monomer with adjuvant LASTS.
- Boost at least twice with CH848 d0949.10.17Al l gpl20 with adjuvant, e.g. LASTS.
- the first boost after the prime comprises CH848 d0949.10.17 envelope either as a protein or nucleic acid in any suitable form.
- the adjuvant in the above studies could be any suitable adjuvant, for example but no limited to polylC or polylC/LC.
- Example 5 Modification of HIV Env glycosylation augments binding to unmutated common ancestor and intermediate antibodies of V3-glycan broadly neutralizing antibody lineages. This example investigates whether envelope designs with a short VI loop and no glycans near N137 engage the DH270 UCA.
- Example 5 shows data for one non-limited embodiment of a deglycosylated envelope. These data include antigenic and immunogenic characterization of the envelope, and characterization of immunogenic responses in animals immunized with the deglycosylated envelope CH848.3.D0949.10.17CHIM.6R.SOSIP.664V4.1_N133DN138T.
- trimer designs based on CH848.3.D0949.10.17 envelope are also contemplated as deglycosylated immunogens.
- the recombinant envelopes in this example are expressed in mammalian cells and purified by methods known in the art.
- Example 1 In a study described in Example 1 (Bonsignori et al. Sci. Transl. Med. 9, eaai7514 (2017)), we described the antibody lineage called DH270 that was isolated from an HIV- infected individual called CH0848. We isolated this lineage using memory B cell cultures and single B cell sorting followed by RT-PCR. In total we isolated 6 natural antibody heavy chain and light chain pairs. The most potent and broad neutralizing antibody of the lineage neutralized 71% of viruses tested. Using these antibodies, we inferred a unmutated common ancestor or UCA antibody using the Cloanalyst program. The UCA lacks any somatic mutation and is our best approximation of the germline starting point for the DH270 lineage.
- CH0848.D0949.10.17 An autologous Env from the CH0848 individual was identified— this envelope called CH0848.D0949.10.17, which possessed a 17 amino acid VI loop. It had glycosylation sites within the VI loop at positions 133, 138 and N156. We removed the N133 and N138 glycans by substituting in amino acids that naturally occur at those sites.
- SOSIP trimer derived from the CH0848.10.17 sequence (see for example Figure 49A as a non-limiting embodiment).
- Figure 58 shows analysis of trimer formation by negative stain electron microscopy. Shown here are the 2D class averages of each of the soluble trimers— for the 32 classes, both Envs were trimeric.
- Figure 59 shows analysis of the antigenicity of the trimers.
- trimer-specific broadly neutralizing antibody PGT151 and non-neutralizing antibodies A32, CH58, and 17B, which target the CI, linear V2 peptide, and coreceptor binding site on Env.
- Both of the trimers bound strongly to PGT151 as indicated by the red curves.
- the nonneutralizing antibodies against the various epitopes showed no binding, which suggested these Envs were not in the CD4 induced conformation.
- FIG 62 A shows that VI glycans inhibit DH270 UCA recognition of native Env trimers.
- the DH270 UCA did not neutralize the wildtype 10.17 virus, however, the broadly neutralizing antibody DH270.7 potently neutralized the virus.
- the bnAb DH270.6 more potently neutralized the VI glycan modified virus.
- Figure 62B shows that VI glycan deletion was not solely sufficient for neutralization sensitivity since we performed the same experiment with JR-FL pseudoviruses and despite removing the VI glycans at three positions the DH270 UCA still could not neutralize the virus. We also did not detect any binding to JR- FL N135Q N137Q N141Q SOSIPs. Therefore, the DH270 UCA binding and neutralization of the autologous virus likely requires specific amino acids in addition to the removal of glycans.
- Figure 65 shows DH270 UCA knock-in (DH270 UCA VH +/ ⁇ DH270 UCA VL +/ ) mice SOSIP immunization regimen.
- DH270 UCA knock-in mouse model was created for these immunization studies. In this mouse the rearranged DH270 UCA variable region is knocked in for both the heavy chain and the light chain and the mouse is heterozygous for the knock- in genes.
- Figure 66 shows that immunization with N133D/N138T SOSIP induced SOSIP- binding antibodies in DH270 UCA knock in mice.
- binding titers represented as log area under the curve and observed that autologous binding antibodies were elicited in all five mice by the third immunization.
- the binidng titers continued to be boosted with subsequent immunizations. This response was specific to the Env immunogen since the adjuvant only mice did not mount any binding responses.
- FIG. 67 shows that DH270 UCA knock-in mouse serum antibodies can bind to CH0848.D949.10.17 in the presence ofN133 and N138 glycans. We added the VI glycans back to the Env, and while titers decreased they were still detectable in all of the mice.
- Figure 69 shows that DH270 UCA knock-in mouse sera neutralize tier 2 virus CH0848.D0949.10.17 with N133/N138 glycan.
- neutralizing antibodies elicited after six vaccinations of DH270 UCA mice with a glycan modified immunogen were able to neutralize the wildtype virus with the natural glycan shield.
- DH270 UCA preferentially bound autologous SOSIP trimers, but not gpl20 or uncleaved gpl40 versions of the same Env; that the glycans in the VI loop are not only inhibitory for PGT121, but also are inhibitory for other V3 glycan antibodies such as DH270; that the CH0848 10.17N133DN138T SOSIP elicited binding and neutralizing antibodies against the unmodified, WT CH0848 10.17 virus in rearranged DH270 UCA knock in mice.
- FIG. 71 shows that DH270 UCA does not bind CH0848 natural Env that has a 17 aa VI loop and lacks N133 and N138 glycans.
- Figure 72 shows that DH270-resistant CH0848 natural Env with a 17 aa VI loop and no N 133 and N138 glycan acquire V2 apex bnAb binding (PGT145).
- Figure 73 shows that DH270 UCA knock-in sera block V3 -glycan bnAb binding to gpl20.
- NHP 144 CH0848 10.17N133DN138T SOSIP was used as an immunogen in a non- human primate study. Regimen was as follows: week 0— all groups
- SOFA deglycosylated envelopes See Example 3 and Figure 50 will be analyzed in mouse and non-human primate immunization studies.
- Table 4 is summary of various designs of VI deglycosylated envelopes
- HV1301331_degly3 This Env has N138, N133, and N301 glycans
- This Env could be used in a sequential Env vaccine where glycans are
- CD4 binding could disrupt Env conformation in vivo
- HV130133 l_N133DN138T_c-SORTA Tagged Env that can be ligated to
- HV1301522 Ferritin particle with VI glycan mutant Env attached as a
- HV1301345_N133D_N138T_cSORTA Tagged Env that can be ligated to
- HV1301581 Full length gpl60 HIV Env with VI glycans removed to
- HV1301345_TFVlloop The 10.17 Env with a long VI loop that was
- HV1301345 N133D N138T Stabilized trimer with VI glycans removed
- HV1301263 (has avi tag): Chimeric DS Env without VI glycan mutated
- HV1301264 (has avi tag): Non-chimeric DS stabilized CH0848
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Virology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- AIDS & HIV (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Epidemiology (AREA)
- Hematology (AREA)
- Mycology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/US2017/020823 WO2017152146A2 (en) | 2016-03-03 | 2017-03-03 | Compositions and methods for inducing hiv-1 antibodies |
| US201862624620P | 2018-01-31 | 2018-01-31 | |
| PCT/US2018/020788 WO2018161049A1 (en) | 2017-03-03 | 2018-03-02 | Compositions and methods for inducing hiv-1 antibodies |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP3589315A1 true EP3589315A1 (en) | 2020-01-08 |
| EP3589315A4 EP3589315A4 (en) | 2021-06-23 |
Family
ID=63371208
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP18760878.1A Pending EP3589315A4 (en) | 2017-03-03 | 2018-03-02 | Compositions and methods for inducing hiv-1 antibodies |
Country Status (3)
| Country | Link |
|---|---|
| EP (1) | EP3589315A4 (en) |
| CA (1) | CA3055204A1 (en) |
| WO (1) | WO2018161049A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11884704B2 (en) | 2016-03-01 | 2024-01-30 | Duke University | Compositions comprising HIV envelopes to induce CH235 lineage antibodies |
Families Citing this family (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11246920B2 (en) | 2016-03-03 | 2022-02-15 | Duke University | Compositions and methods for inducing HIV-1 antibodies |
| US11318197B2 (en) | 2016-03-03 | 2022-05-03 | Duke University | Compositions and methods for inducing HIV-1 antibodies |
| WO2018067580A1 (en) | 2016-10-03 | 2018-04-12 | Duke University | Methods to identify immunogens by targeting improbable mutations |
| WO2019169356A1 (en) * | 2018-03-02 | 2019-09-06 | Duke University | Compositions comprising hiv envelopes to induce hiv-1 antibodies |
| EP3860650A4 (en) | 2018-10-01 | 2022-06-29 | Duke University | Hiv-1 envelope stabilizing mutations |
| US20210379178A1 (en) * | 2018-10-01 | 2021-12-09 | Duke University | Compositions comprising hiv envelopes to induce hiv-1 antibodies |
| KR20210124205A (en) * | 2018-12-04 | 2021-10-14 | 더 락커펠러 유니버시티 | HIV Vaccine Immunogen |
| EP4229070A4 (en) * | 2020-10-19 | 2025-03-05 | Duke University | COMPOSITIONS CONTAINING HIV ENVELOPES FOR THE INDUCTION OF HIV-1 ANTIBODIES |
| CA3206343A1 (en) * | 2021-01-28 | 2022-08-04 | Rory HENDERSON | Compositions comprising hiv envelopes to induce hiv-1 antibodies |
| CA3211186A1 (en) * | 2021-03-08 | 2022-09-15 | Kevin SAUNDERS | Hiv-1 envelope glycopeptide nanoparticles and their uses |
| WO2023064280A2 (en) * | 2021-10-11 | 2023-04-20 | Duke University | Compositions comprising hiv envelopes to induce hiv-1 antibodies |
| WO2025245259A2 (en) * | 2024-05-21 | 2025-11-27 | Dana-Farber Cancer Institute, Inc. | Hiv-1 immunogen compositions and methods of using the same |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014043386A1 (en) * | 2012-09-12 | 2014-03-20 | Duke University | Clonal lineage antibodies |
| WO2015127108A1 (en) | 2014-02-19 | 2015-08-27 | Duke University | Trimeric hiv-1 envelopes compositions and uses thereof |
| AU2015240883B2 (en) * | 2014-03-31 | 2021-09-02 | Duke University | Compositions comprising CH848 envelopes and uses thereof |
| WO2016037154A1 (en) | 2014-09-04 | 2016-03-10 | The United States Of America, As Represented By The Secretary, Department Of Health & Human Services | Recombinant hiv-1 envelope proteins and their use |
-
2018
- 2018-03-02 WO PCT/US2018/020788 patent/WO2018161049A1/en not_active Ceased
- 2018-03-02 CA CA3055204A patent/CA3055204A1/en active Pending
- 2018-03-02 EP EP18760878.1A patent/EP3589315A4/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11884704B2 (en) | 2016-03-01 | 2024-01-30 | Duke University | Compositions comprising HIV envelopes to induce CH235 lineage antibodies |
Also Published As
| Publication number | Publication date |
|---|---|
| EP3589315A4 (en) | 2021-06-23 |
| WO2018161049A1 (en) | 2018-09-07 |
| CA3055204A1 (en) | 2018-09-07 |
| WO2018161049A8 (en) | 2018-10-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11246920B2 (en) | Compositions and methods for inducing HIV-1 antibodies | |
| EP3589315A1 (en) | Compositions and methods for inducing hiv-1 antibodies | |
| US11318197B2 (en) | Compositions and methods for inducing HIV-1 antibodies | |
| US11884704B2 (en) | Compositions comprising HIV envelopes to induce CH235 lineage antibodies | |
| US11746143B2 (en) | Methods to identify immunogens by targeting improbable mutations | |
| Williams et al. | Identification of HIV gp41-specific antibodies that mediate killing of infected cells | |
| Krebs et al. | Multimeric scaffolds displaying the HIV-1 envelope MPER induce MPER-specific antibodies and cross-neutralizing antibodies when co-immunized with gp160 DNA | |
| US11814413B2 (en) | Compositions comprising modified HIV envelopes | |
| US10005819B2 (en) | Method of purifying authentic trimeric HIV-1 GP140 envelope glycoproteins comprising a long linker and tag | |
| Zhu et al. | Identification of variant HIV envelope proteins with enhanced affinities for precursors to anti-gp41 broadly neutralizing antibodies | |
| Killick et al. | Env–2dCD4S60C complexes act as super immunogens and elicit potent, broadly neutralizing antibodies against clinically relevant human immunodeficiency virus type 1 (HIV-1) | |
| CA3039089C (en) | Methods to identify immunogens by targeting improbable mutations | |
| CA3064345C (en) | Compositions comprising modified hiv envelopes | |
| Cheng | Elicitation of antibody responses against the HIV-1 gp41 Membrane Proximal External Region (MPER) | |
| Harley | Production and characterization of novel immunogens and their applications in pioneering vaccination strategies for induction of broadly neutralizing antibodies against HIV-1 | |
| Regula | Fusion glycoproteins of HIV-1 and the Ebola Virus: Structure, function, and inhibition with antibodies | |
| Lee | Structural Characterization of Broadly Neutralizing Quaternary Epitopes on the Human Immunodeficiency Virus-1 Envelope Glycoprotein | |
| Pandey et al. | Envelope Variants Circulating as Initial Neutralization Breadth Developed in Two 1 HIV-Infected Subjects Stimulate Multiclade Neutralizing Antibodies in Rabbits 2 | |
| Essomba | Genetic and immunological characterization of new subtype G envelope expressing HIV-1 pseudoviruses |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20190926 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| AX | Request for extension of the european patent |
Extension state: BA ME |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: A61P 31/18 20060101ALI20201216BHEP Ipc: C07K 14/16 20060101ALI20201216BHEP Ipc: A61K 39/12 20060101AFI20201216BHEP Ipc: A61K 9/127 20060101ALI20201216BHEP Ipc: C12Q 1/68 20180101ALI20201216BHEP |
|
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R079 Free format text: PREVIOUS MAIN CLASS: A61K0039210000 Ipc: A61K0039120000 |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20210520 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: A61K 39/12 20060101AFI20210514BHEP Ipc: A61K 9/127 20060101ALI20210514BHEP Ipc: C07K 14/16 20060101ALI20210514BHEP Ipc: C12Q 1/68 20180101ALI20210514BHEP Ipc: A61P 31/18 20060101ALI20210514BHEP |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: EXAMINATION IS IN PROGRESS |
|
| 17Q | First examination report despatched |
Effective date: 20230116 |
|
| P01 | Opt-out of the competence of the unified patent court (upc) registered |
Effective date: 20231102 |