EP3481941A1 - Breast and ovarian cancer methylation markers and uses thereof - Google Patents

Breast and ovarian cancer methylation markers and uses thereof

Info

Publication number
EP3481941A1
EP3481941A1 EP17824913.2A EP17824913A EP3481941A1 EP 3481941 A1 EP3481941 A1 EP 3481941A1 EP 17824913 A EP17824913 A EP 17824913A EP 3481941 A1 EP3481941 A1 EP 3481941A1
Authority
EP
European Patent Office
Prior art keywords
methylation
subject
breast cancer
sample
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP17824913.2A
Other languages
German (de)
French (fr)
Other versions
EP3481941A4 (en
Inventor
Kang Zhang
Rui Hou
Lianghong ZHENG
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Youhealth Biotech Ltd
University of California
University of California Berkeley
University of California San Diego UCSD
Original Assignee
Youhealth Biotech Ltd
University of California
University of California Berkeley
University of California San Diego UCSD
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Youhealth Biotech Ltd, University of California, University of California Berkeley, University of California San Diego UCSD filed Critical Youhealth Biotech Ltd
Publication of EP3481941A1 publication Critical patent/EP3481941A1/en
Publication of EP3481941A4 publication Critical patent/EP3481941A4/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/154Methylation markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/52Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57515Immunoassay; Biospecific binding assay; Materials therefor for cancer of the breast

Definitions

  • kits for identifying a subject as having breast cancer or ovarian cancer are also provided herein. Also provided herein are methods and kits for determining the prognosis of a subject having breast cancer or ovarian cancer. Further provided herein are methods and kits for determining the progression of breast cancer or ovarian cancer in a subject.
  • a method of selecting a subject suspected of having breast cancer for treatment comprising: (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject suspected of having breast cancer; (b) generating a methylation profile comprising one or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
  • the methylation profile comprises cgl0673833.
  • the methylation profile comprises one or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783,
  • the methylation profile comprises cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335,
  • the comparing further comprises generating a pair-wise methylation difference dataset comprising: (i) a first difference between the methylation profile of the treated genomic DNA with a methylation profile of a first normal sample; (ii) a second difference between a methylation profile of a second normal sample and a
  • the comparing further comprises analyzing the pair-wise methylation difference dataset with a control by a machine learning method to generate the methylation profile.
  • the first primary cancer sample is a breast cancer sample.
  • the second primary cancer sample is a non-breast cancer sample.
  • control comprises a set of methylation profiles, wherein each said methylation profile is generated from a biological sample obtained from a known cancer type.
  • the known cancer type is breast cancer. In some embodiments, the known cancer type is breast cancer.
  • the known cancer type is a relapsed or refractory breast cancer. In some embodiments, the known cancer type is a metastatic breast cancer.
  • the machine learning method utilizes an algorithm selected from one or more of the following: a principal component analysis, a logistic regression analysis, a nearest neighbor analysis, a support vector machine, and a neural network model.
  • the generating further comprises hybridizing each of the one or more biomarkers with a probe, and performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers.
  • the biological sample comprises a blood sample.
  • the biological sample comprises a tissue biopsy sample.
  • the biological sample comprises circulating tumor cells.
  • the subject is a human.
  • a method of generating a methylation profile of a biomarker in a subject in need thereof comprising: (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject; (b) detecting a hybridization between the extracted genomic DNA and a probe, wherein the probe hybridizes to a biomarker selected from cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
  • the methylation profile comprises cgl0673833.
  • the methylation profile comprises one or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783,
  • the methylation profile comprises cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335,
  • the generating further comprises generating a pair-wise methylation difference dataset comprising: (i) a first difference between the methylation profile of the treated genomic DNA with a methylation profile of a first normal sample; (ii) a second difference between a methylation profile of a second normal sample and a
  • methylation profile of a first primary cancer sample and a methylation profile of a second primary cancer sample.
  • the generating further comprises analyzing the pair-wise methylation difference dataset with a control by a machine learning method to generate the methylation profile.
  • the first primary cancer sample is a breast cancer sample.
  • the second primary cancer sample is a non-breast cancer sample.
  • control comprises a set of methylation profiles, wherein each said methylation profile is generated from a biological sample obtained from a known cancer type.
  • the known cancer type is breast cancer. In some embodiments, the known cancer type is breast cancer.
  • the known cancer type is a relapsed or refractory breast cancer. In some embodiments, the known cancer type is a metastatic breast cancer. In some embodiments, the known cancer type is ductal carcinoma in situ, invasive or infiltrating ductal carcinoma, invasive or infiltrating lobular carcinoma, lobular carcinoma in situ, inflammatory breast cancer, Paget disease of the nipple, Phyllodes tumor, angiosarcoma, metaplastic carcinoma, low-grade adenosquamous carcinoma, spindle cell carcinoma of the breast, squamous carcinoma, triple-negative breast cancer, or mixed carcinoma.
  • invasive ductal carcinoma comprises tubular carcinoma of the breast, medullary carcinoma of the breast, mucinous (or colloid) carcinoma of the breast, papillary carcinoma of the breast, micropapillary carcinoma, or cribriform carcinoma of the breast.
  • the machine learning method utilizes an algorithm selected from one or more of the following: a principal component analysis, a logistic regression analysis, a nearest neighbor analysis, a support vector machine, and a neural network model.
  • the method further comprises performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers prior to generating the methylation profile.
  • the biological sample comprises a blood sample. In some embodiments, the biological sample comprises a tissue biopsy sample. In some embodiments, the biological sample comprises circulating tumor cells.
  • the subject is a human.
  • a method of determining the prognosis of a subject having breast cancer or monitoring the progression of breast cancer in the subject comprising: (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject having breast cancer; (b) generating a methylation profile comprising one or more biomarkers selected from:
  • the methylation profile comprises cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435,
  • the methylation profile further comprises one or more biomarkers selected from: cg24714666, cg03156547, cg06605933, cg09601629,
  • the methylation profile further comprises one or more biomarkers selected from: cg24714666, cg03156547, cg06605933, cg09601629, cgl3278334, cgl l851098, cgl2188860, cg25189085, and cg25488021.
  • the methylation profile further comprises cg24714666.
  • the methylation profile further comprises one or more biomarkers selected from: cg03156547, cg06605933, cg09601629, cgl3278334,
  • the methylation profile further comprises cg24714666, cg03156547, cg06605933, cg09601629, cgl3278334, cgl l851098, cgl2188860,
  • the methylation score of from about 1.5 to about 3 is indicative of a survival for at least 6 months. In some embodiments, the methylation score of from about 1.5 to about 3 is indicative of a survival for at least 1 year. In some embodiments, the methylation score of from about 1.5 to about 3 is indicative of a survival for at least 1.5 years. In some embodiments, the methylation score of from about 1.5 to about 3 is indicative of a survival for at least 2 years. In some embodiments, the methylation score of from about 1.5 to about 3 is indicative of a survival for at least 2.5 years. In some embodiments, the methylation score of from about 1.5 to about 3 is indicative of a survival for at least 3 years.
  • the methylation score of from about 1.5 to about 3 is indicative of a survival for at least 4 years. In some embodiments, the methylation score of from about 1.5 to about 3 is indicative of a survival for at least 5 years. [0039] In some embodiments, the methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 6 months. In some embodiments, the methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 1 year. In some
  • the methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 1.5 years. In some embodiments, the methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 2 years. In some embodiments, the methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 2.5 years. In some embodiments, the methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 3 years. In some embodiments, the methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 4 years. In some embodiments, the methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 5 years.
  • the methylation score of less than 1.5 is indicative of a survival of less than 5 years. In some embodiments, the methylation score of less than 1.5 is indicative of a survival of less than 4 years. In some embodiments, the methylation score of less than 1.5 is indicative of a survival of less than 3 years. In some embodiments, the methylation score of less than 1.5 is indicative of a survival of less than 2.5 years. In some embodiments, the methylation score of less than 1.5 is indicative of a survival of less than 2 years. In some embodiments, the methylation score of less than 1.5 is indicative of a survival of less than 1.5 years. In some embodiments, the methylation score of less than 1.5 is indicative of a survival of less than 1 year. In some embodiments, the methylation score of less than 1.5 is indicative of a survival of less than 6 months.
  • the methylation score is calculated based on Cox
  • breast cancer is metastatic breast cancer.
  • breast cancer is ductal carcinoma in situ, invasive or infiltrating ductal carcinoma, invasive or infiltrating lobular carcinoma, lobular carcinoma in situ, inflammatory breast cancer, Paget disease of the nipple, Phyllodes tumor, angiosarcoma, metaplastic carcinoma, low-grade adenosquamous carcinoma, spindle cell carcinoma of the breast, squamous carcinoma, triple-negative breast cancer, or mixed carcinoma.
  • invasive ductal carcinoma comprises tubular carcinoma of the breast, medullary carcinoma of the breast, mucinous (or colloid) carcinoma of the breast, papillary carcinoma of the breast, micropapillary carcinoma, or cribriform carcinoma of the breast.
  • the generating further comprises hybridizing each of the one or more biomarkers with a probe, and performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers.
  • the biological sample comprises a blood sample. In some embodiments, the biological sample comprises a tissue biopsy sample. In some embodiments, the biological sample comprises circulating tumor cells.
  • the subject is a human.
  • a method of selecting a subject suspected of having ovarian cancer for treatment comprising: (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject suspected of having ovarian cancer; (b) generating a methylation profile comprising biomarker cgl0673833 from the extracted genomic DNA; (c) comparing the methylation profile of the biomarkers with a control; (d) identifying the subject as having ovarian cancer if the methylation profile correlates to the control; and (e) administering an effective amount of a therapeutic agent to the subject if the subject is identified as having ovarian cancer.
  • the comparing further comprises generating a pair-wise methylation difference dataset comprising: (i) a first difference between the methylation profile of the treated genomic DNA with a methylation profile of a first normal sample; (ii) a second difference between a methylation profile of a second normal sample and a
  • methylation profile of a first primary cancer sample and a methylation profile of a second primary cancer sample.
  • the comparing further comprises analyzing the pair-wise methylation difference dataset with a control by a machine learning method to generate the methylation profile.
  • the first primary cancer sample is an ovarian cancer sample.
  • the second primary cancer sample is a non-ovarian cancer sample.
  • control comprises a set of methylation profiles, wherein each said methylation profile is generated from a biological sample obtained from a known cancer type.
  • known cancer type is ovarian cancer.
  • the known cancer type is a relapsed or refractory ovarian cancer. In some embodiments, the known cancer type is a metastatic ovarian cancer.
  • the machine learning method utilizes an algorithm selected from one or more of the following: a principal component analysis, a logistic regression analysis, a nearest neighbor analysis, a support vector machine, and a neural network model.
  • the generating further comprises hybridizing each of the one or more biomarkers with a probe, and performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers.
  • the biological sample comprises a blood sample. In some embodiments, the biological sample comprises a tissue biopsy sample. In some embodiments, the biological sample comprises circulating tumor cells.
  • the subject is a human.
  • a method of generating a methylation profile of a biomarker in a subject in need thereof comprising: (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject; (b) detecting a hybridization between the extracted genomic DNA and a probe, wherein the probe hybridizes to biomarker eg 10673833; and (c) generating a methylation profile based on the detected hybridization between the extracted genomic DNA and the probe.
  • the generating further comprises generating a pair-wise methylation difference dataset comprising: (i) a first difference between the methylation profile of the treated genomic DNA with a methylation profile of a first normal sample; (ii) a second difference between a methylation profile of a second normal sample and a
  • methylation profile of a first primary cancer sample and a methylation profile of a second primary cancer sample.
  • the generating further comprises analyzing the pair-wise methylation difference dataset with a control by a machine learning method to generate the methylation profile.
  • the first primary cancer sample is an ovarian cancer sample.
  • the second primary cancer sample is a non-ovarian cancer sample.
  • the control comprises a set of methylation profiles, wherein each said methylation profile is generated from a biological sample obtained from a known cancer type.
  • the known cancer type is ovarian cancer. In some embodiments, the known cancer type is ovarian cancer. In some
  • the known cancer type is a relapsed or refractory ovarian cancer. In some embodiments, the known cancer type is a metastatic ovarian cancer. In some embodiments, the known cancer type is epithelial ovarian cancer, stromal cell ovarian tumors, germ cell ovarian tumors, borderline ovarian tumors, small cell ovarian carcinoma, neuro-endocrine carcinomas, squamous cell carcinoma, struma ovarii malignum or psammocarcinoma.
  • the machine learning method utilizes an algorithm selected from one or more of the following: a principal component analysis, a logistic regression analysis, a nearest neighbor analysis, a support vector machine, and a neural network model.
  • the method further comprises performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers prior to generating the methylation profile.
  • the biological sample comprises a blood sample. In some embodiments, the biological sample comprises a tissue biopsy sample. In some embodiments, the biological sample comprises circulating tumor cells.
  • the subject is a human.
  • kits comprising a set of nucleic acid probes that hybridizes to biomarkers: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210,
  • the set of nucleic acid probes comprises a set of padlock probes.
  • kit comprising a set of nucleic acid probes that hybridizes to biomarkers: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361, and cg24229963.
  • the kit further comprises a nucleic acid probe that hybridizes to a biomarker selected from cg24714666, cg03156547, cg06605933, cg09601629, cgl3278334,
  • the set of nucleic acid probes comprises a set of padlock probes.
  • kit comprising a nucleic acid probe that hybridizes to biomarker cgl0673833.
  • the nucleic acid probe comprises a padlock probe.
  • Fig. 1 illustrates Kaplan-Meier curves from LASSO (left panel) and Bosting (right panel).
  • Fig. 2 shows Cox proportional hazards regression prediction curves from LASSO
  • Fig. 3 shows a multiclass ROC curve from LASSO.
  • Fig. 4A-Fig. 4B show the distribution of Cob-2 methylation rate of cell-free DNA (cfDNA) in normal and breast cancer plasma.
  • Fig. 5 A-Fig. 5B illustrate the methylation rate of Cob-2 of cell-free DNA (cfDNA) in normal and breast cancer plasma.
  • Fig. 6A-Fig. 6B illustrate the methylation rate of cell-free DNA (cfDNA) in different subgroup of breast cancer plasma.
  • Fig. 7 illustrates the ROC curve of Cob-2 methylateion rate of cell-free DNA (cfDNA).
  • Fig. 8A-Fig. 8B show the Cob-2 methylation rate of cell -free DNA (cfDNA) from individual breast cancer patients with partial response (PR) to a therapy.
  • cfDNA cell -free DNA
  • Fig. 9A-Fig. 9B show the Cob-2 methylation rate of cell -free DNA (cfDNA) from individual breast cancer patients with stable disease (SD).
  • Fig. 1 OA-Fig. 10B show the Cob-2 methylation rate of cell-free DNA (cfDNA) from individual breast cancer patients with progressive disease (PD).
  • Fig. 11 A-Fig. 1 IB show the Cob-2 methylation rate of cell-free DNA (cfDNA) from individual breast cancer patients post-surgery.
  • Fig. 12 shows a boxplot for methylation change in different response groups for breast cancer.
  • Fig. 13 shows a boxplot for methylation change in different response groups for breast cancer.
  • Fig. 14A-Fig. 14B show the methylation rate of cell-free DNA (cfDNA) in different subgroup of ovarian cancer plasma.
  • Fig. 15 illustrates an exemplary BCM for breast cancer.
  • Cancer is characterized by an abnormal growth of a cell caused by one or more mutations or modifications of a gene leading to dysregulated balance of cell proliferation and cell death.
  • DNA methylation silences expression of tumor suppression genes, and presents itself as one of the first neoplastic changes.
  • Methylation patterns found in neoplastic tissue and plasma demonstrate homogeneity, and in some instances are utilized as a sensitive diagnostic marker.
  • cMethDNA assay has been shown in one study to be about 91% sensitive and about 96% specific when used to diagnose metastatic breast cancer.
  • circulating tumor DNA was about 87.2% sensitive and about 99.2% specific when it was used to identify KRAS gene mutation in a large cohort of patients with metastatic colon cancer (Bettegowda et al., Detection of Circulating Tumor DNA in Early- and Late-Stage Human Malignancies. Sci. Transl. Med, 6(224):ra24. 2014).
  • ctDNA is detectable in >75% of patients with advanced pancreatic, ovarian, colorectal, bladder, gastroesophageal, breast, melanoma, hepatocellular, and head and neck cancers (Bettegowda et al).
  • DNA methylation profiling provides higher clinical sensitivity and dynamic range compared to somatic mutation analysis for cancer detection.
  • altered DNA methylation signature has been shown to correlate with the prognosis of treatment response for certain cancers. For example, one study illustrated that in a group of patients with advanced rectal cancer, ten differentially methylated regions were used to predict patients' prognosis.
  • SRBC gene hypermethylation was associated with poor outcome in patients with colorectal cancer treated with oxaliplatin in a different study.
  • kits of diagnosing breast cancer or ovarian cancer based on DNA methylation profiling In some instances, provided herein are methods and kits of identifying a subject has having breast cancer or ovarian cancer based on the DNA methylation profiling. In some instances, also provided herein are methods and kits of determining the prognosis of a subject having breast cancer or ovarian cancer and determining the progression of breast cancer or ovarian cancer in a subject based on the DNA methylation profilings.
  • a biomarker comprises a cytosine methylation site.
  • cytosine methylation comprises 5-methylcytosine (5-mCyt) and 5- hydroxymethylcytosine.
  • a cytosine methylation site occurs in a CpG dinucleotide motif.
  • a cytosine methylation site occurs in a CHG or CHH motif, in which H is adenine, cytosine, or thymine.
  • one or more CpG dinucleotide motif or CpG site forms a CpG island, a short DNA sequence rich in CpG dinucleotide.
  • CpG islands are typically, but not always, between about 0.2 to about 1 kb in length.
  • a biomarker comprises a CpG island.
  • a method of selecting a subject suspected of having breast cancer for treatment comprises (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject suspected of having breast cancer; (b) generating a methylation profile comprising one or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
  • a method of selecting a subject suspected of having ovarian cancer for treatment comprising (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject suspected of having ovarian cancer; (b) generating a methylation profile comprising biomarker cgl0673833 from the extracted genomic DNA; (c) comparing the methylation profile of the biomarkers with a control; (d) identifying the subject as having ovarian cancer if the methylation profile correlates to the control; and (e) administering an effective amount of a therapeutic agent to the subject if the subject is identified as having ovarian cancer.
  • a methylation profile comprises a plurality of CpG methylation data for one or more biomarkers described herein.
  • a plurality of CpG methylation data is generated by first obtaining a genomic DNA (e.g., nuclear DNA or circulating DNA) from a biological sample, and then treating the genomic DNA by a deaminating agent to generate an extracted genomic DNA.
  • the extracted genomic DNA e.g., extracted nuclear DNA or extracted circulating DNA
  • the sequencing analysis comprises hybridizing each of the one or more biomarkers described herein with a probe, and performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers.
  • the CpG methylation data is then input into a machine learning/classification program to generate a methylation profile.
  • a set of biological samples are generated and subsequently input into the machine learning/classification program.
  • the set of biological samples comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, or more biological samples.
  • the set of biological samples comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, or more normal biological samples.
  • the set of biological samples comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, or more cancerous biological samples.
  • the set of biological samples comprise a biological sample of interest, a first primary cancer sample, a second primary cancer sample, a first normal sample, a second normal sample, and a third normal sample; wherein the first, and second primary cancer samples are different; and wherein the first, second, and third normal samples are different.
  • three pairs of difference datasets are generated in which the three pairs of dataset comprise: a first difference dataset between the methylation profile of the biological sample of interest and the first normal sample, in which the biological sample of interest and the first normal sample are from the same biological sample source; a second difference dataset between a methylation profile of a second normal sample and a methylation profile of a third normal sample, in which the second and third normal samples are different; and a third difference dataset between a methylation profile of a first primary cancer sample and a methylation profile of a second primary cancer sample, in which the first and second primary cancer samples are different.
  • the difference datasets are further input into the machine learning/classification program.
  • a pair-wise methylation difference dataset from the first, second, and third datasets is generated and then analyzed in the presence of a control dataset or a training dataset by the machine learning/classification method to generate the cancer CpG methylation profile.
  • the first primary cancer sample is a breast cancer sample.
  • the second primary cancer sample is a non-breast cancer sample.
  • the machine learning method comprises identifying a plurality of markers and a plurality of weights based on a top score (e.g., a t-test value, a ⁇ test value), and classifying the samples based on the plurality of markers and the plurality of weights.
  • the machine learning method utilizes an algorithm selected from one or more of the following: a principal component analysis, a logistic regression analysis, a nearest neighbor analysis, a support vector machine, and a neural network model.
  • the CpG methylation profile comprises one or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276,
  • the CpG methylation profile comprises two or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083,
  • the CpG methylation profile comprises three or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335,
  • the CpG methylation profile comprises four or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
  • the CpG methylation profile comprises five or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516,
  • the CpG methylation profile comprises six or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516,
  • the CpG methylation profile comprises seven or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918,
  • the CpG methylation profile comprises eight or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918,
  • the CpG methylation profile comprises nine or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516,
  • the CpG methylation profile comprises ten or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516,
  • the CpG methylation profile comprises eleven or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918,
  • the CpG methylation profile comprises twelve or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918,
  • the CpG methylation profile comprises cg01327147, cg02680086,
  • the CpG methylation profile comprises one or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783,
  • the CpG methylation profile comprises two or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918,
  • the CpG methylation profile comprises three or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
  • the CpG methylation profile comprises four or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
  • the CpG methylation profile comprises five or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
  • the CpG methylation profile comprises six or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
  • the CpG methylation profile comprises seven or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
  • the CpG methylation profile comprises eight or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
  • the CpG methylation profile comprises nine or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
  • the CpG methylation profile comprises ten or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
  • the CpG methylation profile comprises eleven or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
  • the CpG methylation profile comprises twelve or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
  • the CpG methylation profile comprises cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210,
  • the CpG methylation profile comprises biomarker cgl0673833.
  • the subject is diagnosed in having breast cancer.
  • breast cancer further comprises a relapsed or refractory breast cancer.
  • breast cancer comprises a metastatic breast cancer.
  • the subject is diagnosed in having a relapsed or refractory breast cancer.
  • the subject is diagnosed in having a metastatic breast cancer.
  • a breast cancer is any type of breast cancer.
  • a breast cancer comprises ductal carcinoma in situ, invasive or infiltrating ductal carcinoma, invasive or infiltrating lobular carcinoma, lobular carcinoma in situ, inflammatory breast cancer, Paget disease of the nipple, Phyllodes tumor, angiosarcoma, metaplastic carcinoma, low-grade adenosquamous carcinoma, spindle cell carcinoma of the breast, squamous carcinoma, triple-negative breast cancer, or mixed carcinoma.
  • invasive ductal carcinoma comprises tubular carcinoma of the breast, medullary carcinoma of the breast, mucinous (or colloid) carcinoma of the breast, papillary carcinoma of the breast, micropapillary carcinoma, or cribriform carcinoma of the breast.
  • breast cancer is further classified by a grade.
  • the grades of breast cancer include Grade X, Grade 1, Grade 2, Grade 3 or Grade 4.
  • a breast cancer is further indicated by a category of tubule formation, nuclear grade and/or the mitotic rate. Each category is optionally assigned with a specific score between one and three.
  • a stage is assigned based on the tumor, the regional lymph nodes and/or distant metastasis.
  • the stages assigned to the tumor include TX, TO, Tis, Tl, T2, T3, or T4.
  • the stages assigned to a regional lymph node include NX, NO, Nl, N2, or N3.
  • the stages assigned to a distant metastasis include MX, MO, or Ml .
  • the stages include stage 0, stage I, stage II, stage III or stage IV.
  • a breast cancer is classified as more than one grade or stage of cancer.
  • the subject diagnosed of having breast cancer is further treated with a therapeutic agent.
  • therapeutic agents include, but are not limited to, anastrozole, capecitabine, cyclophosphamide, doxorubicin, epirubicin hydrochloride, everolimus, exemestane, fulvestrant, fluorouracil injection, gemcitabine hydrochloride, goserelin acetate, ixabepilone, lapatinib ditosylate, letrozole, methotrexate, paclitaxel, palbociclib, pamidronate disodium, pertuzumab, toremifene, trastuzumab, ado-trastuzumab emtansine, or vinblastine sulfate, or a combination thereof.
  • the subject is diagnosed in having ovarian cancer.
  • ovarian cancer further comprises a relapsed or refractory ovarian cancer.
  • ovarian cancer comprises a metastatic ovarian cancer.
  • the subject is diagnosed in having a relapsed or refractory ovarian cancer.
  • the subject is diagnosed in having a metastatic ovarian cancer.
  • an ovarian cancer is any type of ovarian cancer.
  • an ovarian cancer comprises epithelial ovarian cancer, stromal cell ovarian tumors, germ cell ovarian tumors, borderline ovarian tumors, small cell ovarian carcinoma, neuroendocrine carcinomas, squamous cell carcinoma, struma ovarii malignum or
  • the subject diagnosed of having ovarian cancer is further treated with a therapeutic agent.
  • exemplary therapeutic agents include, but are not limited, bevacizumab, carboplatin, cisplatin, cyclophosphamide, doxorubicin, gemcitabine
  • hydrochloride melphalan, topotecan hydrochloride, olaparib, paclitaxel, thiotepa, topotecan hydrochloride, or a combination thereof.
  • the method comprises (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject; (b) detecting a hybridization between the extracted genomic DNA and a probe, wherein the probe hybridizes to a biomarker selected from cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516,
  • one or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
  • cg20069090, cg24732563, cg00886954, cg23690893, and cgl0673833 are used to generate a methylation profile.
  • cg00886954, cg23690893, and cgl0673833 are used to generate the methylation profile.
  • cgl5412918, cgl8482112, cg20069090, cg24732563, cg00886954, cg23690893, and eg 10673833 are used to generate a methylation profile.
  • a method of generating a methylation profile of a biomarker which comprises (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject; (b) detecting a hybridization between the extracted genomic DNA and a probe, wherein the probe hybridizes to biomarker cgl0673833; and generating a methylation profile based on the detected hybridization between the extracted genomic DNA and the probe.
  • a pair-wise methylation difference dataset is generated prior to generating a methylation profile.
  • the pair-wise methylation difference dataset comprises (i) a first difference between the methylation profile of the treated genomic DNA with a methylation profile of a first normal sample; (ii) a second difference between a methylation profile of a second normal sample and a methylation profile of a third normal sample; and (iii) a third difference between a methylation profile of a first primary cancer sample and a methylation profile of a second primary cancer sample.
  • the pair-wise methylation difference dataset is analyzed with a control by a machine learning method to generate a methylation profile.
  • the machine learning method utilizes an algorithm selected from one or more of the following: a principal component analysis, a logistic regression analysis, a nearest neighbor analysis, a support vector machine, and a neural network model.
  • a probe comprises a DNA probe, RNA probe, or a combination thereof.
  • a probe comprises natural nucleic acid molecules and non-natural nucleic acid molecules.
  • a probe comprises a labeled probe, such as for example, fluorescently labeled probe or radioactively labeled probe.
  • a probe correlates to a CpG site.
  • a probe is utilized in a next generation sequencing reaction to generate a CpG methylation data.
  • a probe is used in a solution-based next generation sequencing reaction to generate a CpG methylation data.
  • a probe comprises a molecular beacon probe, a TaqMan probe, locked nucleic acid probe, a padlock probe, or Scorpion probe.
  • a probe comprises a pad-lock probe.
  • the method further comprises performing a DNA sequencing reaction such as those described elsewhere herein to quantify the methylation of each of the one or more biomarkers prior to generating a methylation profile.
  • a CpG methylation site is located at the promoter region (e.g., induces a promoter methylation).
  • promoter methylation leads to a downregulation of its corresponding gene expression.
  • one or more CpG methylation sites described supra and in subsequent paragraphs are located at promoter regions, leading to promoter methylation, and subsequent downregulation of the
  • the CpG methylation site is as illustrated in Tables 11 (e.g., Table 11 A) or 12. In some cases, an increase in gene expression leads to a decrease in tumor volume.
  • one or more eg markers reference one or more genes.
  • cg01327147 references uncharacterized family 31 glucosidase
  • cg02680086 references solute carrier family 43 member 1 (SLC43A1).
  • cg04772948 references uncharacterized LOC284788 (LOC284788).
  • cg04917276 references HNFl homeobox B (HNF1B).
  • cg05395187 references nuclear receptor corepressor 2 (NCOR2).
  • cg08549335 references zinc and ring finger 2, E3 ubiquitin protein ligase (ZNRF2).
  • cgl3976210 references dual specificity phosphatase 12 (DUSP12).
  • cgl4817783 references Kelch like family member 23 (KLHL23).
  • cg20069090 references RNA polymerase subunit D (POLRID).
  • cg00886954 references plectin (PLEC1).
  • cg23690893 references trans-2,3-enoyl-CoA reductase (TECR).
  • cgl0673833 references myosin IG (MYOIG).
  • cg07493516, cg08268679, cg09819083, cgl5412918, cgl8482112 references, and cg24732563 do not independently reference a gene.
  • a method of selecting a subject suspected of having breast cancer for treatment comprising generating a methylation profile comprising one or more genes selected from: uncharacterized family 31 glucosidase
  • KIAA1161 KLAA1161
  • solute carrier family 43 member 1 SLC43A1
  • LOC284788 HNF1 homeobox B
  • NOR2 nuclear receptor corepressor 2
  • ZNRF2 E3 ubiquitin protein ligase
  • DUSP12 dual specificity phosphatase 12
  • KLHL23 Kelch like family member 23
  • POLRID RNA polymerase subunit D
  • PLC1 trans-2,3-enoyl-CoA reductase
  • MYOIG myosin IG
  • the methylation profile comprises one or more genes selected from: uncharacterized family 31 glucosidase KIAA1161 (KIAA1161), solute carrier family 43 member 1 (SLC43A1), uncharacterized LOC284788 (LOC284788), HNF1 homeobox B (HNF1B), nuclear receptor corepressor 2 (NCOR2), zinc and ring finger 2, E3 ubiquitin protein ligase (ZNRF2), dual specificity phosphatase 12 (DUSP12), Kelch like family member 23 (KLHL23), RNA polymerase subunit D (POLRID), plectin (PLEC1), and trans-2,3-enoyl-CoA reductase (TECR).
  • KIAA1161 KIAA1161
  • SLC43A1 solute carrier family 43 member 1
  • LOC284788 uncharacterized LOC284788
  • HNF1B HNF1 homeobox B
  • NCOR2 nuclear receptor corepressor 2
  • ZNRF2 E3 ubiquit
  • the methylation profile comprises: uncharacterized family 31 glucosidase KIAA1161 (KLAA1161), solute carrier family 43 member 1 (SLC43A1), uncharacterized LOC284788 (LOC284788), HNF1 homeobox B (HNF1B), nuclear receptor corepressor 2 (NCOR2), zinc and ring finger 2, E3 ubiquitin protein ligase (ZNRF2), dual specificity phosphatase 12 (DUSP12), Kelch like family member 23 (KLHL23), RNA polymerase subunit D (POLRID), plectin (PLEC1), and trans- 2,3-enoyl-CoA reductase (TECR).
  • the methylation profile comprises myosin IG (MYOIG).
  • a method of generating a methylation profile of a gene detecting a hybridization between the extracted genomic DNA and a probe wherein the probe hybridizes to a gene selected from: uncharacterized family 31 glucosidase KIAA1161 (KLAA1161), solute carrier family 43 member 1 (SLC43A1), uncharacterized LOC284788 (LOC284788), HNF1 homeobox B (HNF1B), nuclear receptor corepressor 2 (NCOR2), zinc and ring finger 2, E3 ubiquitin protein ligase (ZNRF2), dual specificity phosphatase 12 (DUSP12), Kelch like family member 23 (KLHL23), RNA polymerase subunit D (POLR1D), plectin (PLEC1), trans-2,3-enoyl-CoA reductase (TECR), and myosin IG (MYOIG).
  • KLAA1161 solute carrier family 43 member 1
  • LOC284788 uncharacterized LOC284788
  • the methylation profile comprises one or more genes selected from: uncharacterized family 31 glucosidase KIAA1161 (KIAA1161), solute carrier family 43 member 1 (SLC43A1), uncharacterized LOC284788 (LOC284788), HNF1 homeobox B (HNF1B), nuclear receptor corepressor 2 (NCOR2), Kelch like family member 23 (KLHL23), zinc and ring finger 2, E3 ubiquitin protein ligase (ZNRF2), dual specificity phosphatase 12 (DUSP12), RNA polymerase subunit D (POLR1D), plectin (PLEC1), and trans-2,3-enoyl-CoA reductase (TECR).
  • KIAA1161 KIAA1161
  • SLC43A1 solute carrier family 43 member 1
  • LOC284788 uncharacterized LOC284788
  • HNF1B HNF1 homeobox B
  • NCOR2 nuclear receptor corepressor 2
  • KLHL23 Kelch like family
  • the methylation profile comprises: uncharacterized family 31 glucosidase KIAA1161 (KIAA1161), solute carrier family 43 member 1 (SLC43A1), uncharacterized LOC284788 (LOC284788), HNF1 homeobox B (HNF1B), nuclear receptor corepressor 2 (NCOR2), zinc and ring finger 2, E3 ubiquitin protein ligase (ZNRF2), Kelch like family member 23 (KLHL23), dual specificity
  • the methylation profile comprises myosin IG (MYOIG).
  • eg marker cgl0673833.1 references myosin IG (MYOIG).
  • described herein is a method of selecting a subject suspected of having ovarian cancer for treatment, the method comprising generating a methylation profile comprising gene myosin IG (MYOIG).
  • disclosed herein include a method of determining the prognosis of a subject having breast cancer or monitoring the progression of breast cancer in a subject.
  • breast cancer comprises ductal carcinoma in situ, invasive or infiltrating ductal carcinoma, invasive or infiltrating lobular carcinoma, lobular carcinoma in situ, inflammatory breast cancer, Paget disease of the nipple, Phyllodes tumor, angiosarcoma, metaplastic carcinoma, low-grade adenosquamous carcinoma, spindle cell carcinoma of the breast, squamous carcinoma, triple-negative breast cancer, or mixed carcinoma.
  • invasive ductal carcinoma comprises tubular carcinoma of the breast, medullary carcinoma of the breast, mucinous (or colloid) carcinoma of the breast, papillary carcinoma of the breast, micropapillary carcinoma, or cribriform carcinoma of the breast.
  • disclosed herein is a method of determining the prognosis of a subject having breast cancer or monitoring the progression of breast cancer in a subject.
  • the method comprises (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject having breast cancer; (b) generating a methylation profile comprising one or more biomarkers selected from: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361, and cg24229963 from the extracted genomic DNA; (c) obtaining a methylation score based on the methylation profile of the one or more biomarkers; and (d) based on the methylation score, initiate a first treatment, decrease a dosage of a first therapeutic agent if the subject has experienced a remission, initiate a second treatment if the subject has experienced a
  • the methylation profile comprises two or more biomarkers selected from: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361, and cg24229963.
  • the methylation profile comprises three or more biomarkers selected from: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046,
  • the methylation profile comprises four or more biomarkers selected from: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361, and cg24229963.
  • the methylation profile comprises five or more biomarkers selected from: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361, and cg24229963.
  • the methylation profile comprises six or more biomarkers selected from: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046,
  • the methylation profile comprises seven or more biomarkers selected from: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361, and cg24229963.
  • the methylation profile comprises eight or more biomarkers selected from: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361, and cg24229963.
  • the methylation profile comprises nine or more biomarkers selected from: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046,
  • the methylation profile comprises cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361, and cg24229963.
  • the methylation profile further comprises one or more biomarkers selected from: cg24714666, cg03156547, cg06605933, cg09601629, cgl3278334, cg23653712, cgl 1851098, cgl2188860, cg25189085, and cg25488021.
  • the methylation profile further comprises one or more biomarkers selected from: cg24714666, cg03156547, cg06605933, cg09601629, cgl3278334, cgl l851098, cgl2188860,
  • the methylation profile further comprises one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or nine or more biomarkers selected from: cg24714666, cg03156547, cg06605933, cg09601629, cgl3278334, cgl 1851098, cgl2188860, cg25189085, and cg25488021.
  • the methylation profile further comprises biomarkers cg24714666, cg03156547, cg06605933, cg09601629, cgl3278334, cgl l851098,
  • the methylation profile further comprises one or more biomarkers selected from: cg03156547, cg06605933, cg09601629, cgl3278334, cgl l 851098, cgl2188860, cg25189085, and cg25488021.
  • the methylation profile further comprises one or more, two or more, three or more, four or more, five or more, six or more, seven or more, or eight or more biomarkers selected from: cg03156547, cg06605933, cg09601629, cgl3278334, cgl 1851098, cgl2188860, cg25189085, and cg25488021.
  • the methylation profile further comprises biomarkers cg03156547, cg06605933, cg09601629, cgl3278334, cgl 1851098, cgl2188860, cg25189085, and cg25488021.
  • the methylation profile further comprises cg24714666.
  • the methylation profile comprises one or more biomarkers selected from: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361 and cg24229963; and one or more biomarkers selected from: cg24714666, cg03156547, cg06605933, cg09601629,
  • one or more eg markers reference one or more genes.
  • cg00819310 references VANGL planar cell polarity protein 1 (VANGLI).
  • cg04447890 references G protein-coupled receptor 177 (GPR177).
  • GPR177 protein-coupled receptor 177
  • cg08623383 references chromosome 1 open reading frame 38 (CI or/38).
  • cg09799714 references PDZ domain containing 3 (PDZD3).
  • cgl 0971790 references fuzzy planar cell polarity protein (FUZ).
  • cgl5357639 references 8-oxoguanine DNA glycosylase (OGG1).
  • cgl 7188046 references T bachyury transcription factor ( ⁇ ).
  • cg21230435 references opsin 1 (cone pigments), short-wave-sensitive (OPNISW).
  • cg22043361 references zinc finger and BTB domain containing 25 (ZBTB25).
  • cg24229963 references zinc finger AN1- type containing 1 (ZFAND1).
  • one or more eg markers reference one or more genes.
  • cg03156547 references cadherin 24 (CDH24).
  • cg06605933 references BolA family member 1 (BOLA1).
  • cg09601629 references coiled-coil domain containing 15 (CCDC15).
  • cgl 3278334 references PIH1 domain containing 1 (PIH1D1).
  • cgl 1851098 references WBP2 N-terminal like (WBP2NL).
  • cgl2188860 references topoisomerase (DNA) I, mitochondrial (TOP1MT).
  • cg25189085 references SH3 and cysteine rich domain 3 (STAC3).
  • cg25488021 references erythrocyte membrane protein band 4.1 like 2 (EPB41L2).
  • a method of determining the prognosis of a subject having breast cancer or monitoring the progression of breast cancer in the subject comprising generating a methylation profile comprising one or more genes selected from: VANGL planar cell polarity protein 1 (VANGLI), G protein-coupled receptor 177 (GPR177), chromosome 1 open reading frame 38 (Clorf38), PDZ domain containing 3 (PDZD3), fuzzy planar cell polarity protein (FUZ), 8-oxoguanine DNA glycosylase (OGG1), T brachyury transcription factor (7), opsin 1 (cone pigments), short-wave-sensitive (OPNISW), zinc finger and BTB domain containing 25 (ZBTB25), and zinc finger ANl-type containing 1
  • VANGLI VANGL planar cell polarity protein 1
  • GPR177 G protein-coupled receptor 177
  • CrZD3 chromosome 1 open reading frame 38
  • PDZD3 PDZ domain containing 3
  • FUZ
  • the methylation profile comprises: VANGL planar cell polarity protein 1 (VANGLI), G protein-coupled receptor 177 (GPR177), chromosome 1 open reading frame 38 (Clorf38), PDZ domain containing 3 (PDZD3), fuzzy planar cell polarity protein (FUZ), 8-oxoguanine DNA glycosylase (OGG1), T brachyury transcription factor (7), opsin 1 (cone pigments), short-wave-sensitive (OPNISW), zinc finger and BTB domain containing 25 (ZBTB25), and zinc finger ANl-type containing 1 (ZFAND1).
  • the methylation profile comprises one or more genes selected from: cadherin 24 (CDH24), BolA family member 1 (BOLA J), coiled-coil domain containing 15 (CCDC15), PIHl domain containing 1 (PIH1D1), WBP2 N-terminal like (WBP2NL), topoisomerase (DNA) I, mitochondrial (TOPJMT), SH3 and cysteine rich domain 3 (STAC3), erythrocyte membrane protein band 4.1 like 2 (EPB41L2).
  • the methylation profile comprises one or more genes selected from: cadherin 24 (CDH24), BolA family member 1 (BOLA1), coiled-coil domain containing 15 (CCDC15), PIHl domain containing 1
  • PBH1D1 WBP2 N-terminal like (WBP2NL), topoisomerase (DNA) I, mitochondrial ( ⁇ 1 ⁇ ), SH3 and cysteine rich domain 3 (STAC3), erythrocyte membrane protein band 4.1 like 2 (EPB41L2).
  • the methylation profile comprises: cadherin 24 (CDH24), BolA family member 1 (BOLA J), coiled-coil domain containing 15 (CCDC15), PIHl domain containing 1 (PIH1D1), WBP2 N-terminal like (WBP2NL), topoisomerase (DNA) I, mitochondrial (TOPJMT), SH3 and cysteine rich domain 3 (STAC3), erythrocyte membrane protein band 4.1 like 2 (EPB41L2).
  • a methylation score is utilized to determine the prognosis of a subject.
  • prognosis refers to the prediction of the likelihood of cancer- attributable death or progression, including recurrence, metastatic spread, and drug resistance, of breast cancer.
  • the term "prediction" is used herein to refer to the likelihood that a subject will respond either favorably or unfavorably to a drug or set of drugs, and also the extent of those responses, or that a subject will survive, following chemotherapy for a certain period of time without cancer recurrence and/or following surgery (e.g., removal of the spleen).
  • a methylation score is utilized to determine the prognosis of a subject having breast cancer or ovarian cancer.
  • a methylation score is utilized to determine the prognosis of a subject having breast cancer.
  • a methylation score of from about 1.5 to about 4 is associated with a "good" prognosis.
  • a "good” prognosis refers to the likelihood that a subject will likely respond favorably to a drug or set of drugs, leading to a complete or partial remission of breast cancer or ovarian cancer or a decrease and/or a stop in the progression of breast cancer or ovarian cancer.
  • a "good” prognosis refers to the survival of a subject of from at least 1 month to at least 90 years.
  • a "good” prognosis refers to the survival of a subject in which the survival of the subject upon treatment is from at least 1 month to at least 90 years.
  • the survival of a subject further refers to an extended survival rate of a subject receiving a treatment course relative to a subject without receiving the same course of treatment.
  • a "good" prognosis refers to an extended survival time of a subject receiving a treatment course relative to a subject without receiving the same course of treatment.
  • a methylation score of from about 1.5 to about 4 is indicative of a survival from at least 1 month to at least 90 years. In some instances, a methylation score of from about 1.5 to about 4 is indicative of a survival of at least 2 months, 4 months, 6 months, 8 months, 10 months, 1 year, 1.5 years, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 30 years, 50 years, or more.
  • a methylation score of from about 1.5 to about 3 is indicative of a survival from at least 1 month to at least 90 years. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival of at least 2 months, 4 months, 6 months, 8 months, 10 months, 1 year, 1.5 years, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 30 years, 50 years, or more.
  • a methylation score of from about 1.5 to about 2.5 is indicative of a survival from at least 1 month to at least 90 years. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival of at least 2 months, 4 months, 6 months, 8 months, 10 months, 1 year, 1.5 years, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 30 years, 50 years, or more.
  • a methylation score of from about 1.5 to about 2 is indicative of a survival from at least 1 month to at least 90 years. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival of at least 2 months, 4 months, 6 months, 8 months, 10 months, 1 year, 1.5 years, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 30 years, 50 years, or more.
  • a methylation score of from about 1.5 to about 4 is associated with a "good" prognosis in a subject having breast cancer. In some embodiments, a methylation score of from about 1.5 to about 4, from about 1.5 to about 3.5, from about 1.5 to about 3, from about 1.5 to about 2.5, or from about 1.5 to about 2 is associated with a "good" prognosis in a subject having breast cancer.
  • a methylation score of from about 1.5 to about 3 is indicative of a survival from at least 1 month to at least 90 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival of at least 2 months, 4 months, 6 months, 8 months, 10 months, 1 year, 1.5 years, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 30 years, 50 years, or more in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 2 months in a subject having breast cancer.
  • a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 3 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 4 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 5 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 6 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 8 months in a subject having breast cancer.
  • a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 10 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 1 year in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 1.5 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 2 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 2.5 years in a subject having breast cancer.
  • a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 3 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 4 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 5 years in a subject having breast cancer.
  • a methylation score of from about 1.5 to about 2.5 is indicative of a survival from at least 1 month to at least 90 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival of at least 2 months, 4 months, 6 months, 8 months, 10 months, 1 year, 1.5 years, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 30 years, 50 years, or more in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 2 months in a subject having breast cancer.
  • a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 3 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 4 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 5 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 6 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 8 months in a subject having breast cancer.
  • a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 10 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 1 year in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 1.5 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 2 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 2.5 years in a subject having breast cancer.
  • a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 3 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 4 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 5 years in a subject having breast cancer.
  • a methylation score of from about 1.5 to about 2 is indicative of a survival from at least 1 month to at least 90 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival of at least 2 months, 4 months, 6 months, 8 months, 10 months, 1 year, 1.5 years, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 30 years, 50 years, or more in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 2 months in a subject having breast cancer.
  • a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 3 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 4 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 5 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 6 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 8 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 10 months in a subject having breast cancer.
  • a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 1 year in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 1.5 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 2 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 2.5 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 3 years in a subject having breast cancer.
  • a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 4 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 5 years in a subject having breast cancer.
  • a methylation score of less than about 1.5 is associated with a "poor" prognosis.
  • a “poor” prognosis refers to the likelihood that a subject will likely respond unfavorably to a drug or set of drugs, leading to a progression of breast cancer (e.g., progression to metastatic breast cancer) and/or to refractory of one or more therapeutic agents.
  • a “poor” prognosis refers to the likelihood that a subject will not respond to a drug or set of drugs, leading to a progression of breast cancer.
  • a “poor” prognosis refers to the survival of a subject of from less than 5 years to less than 1 month.
  • a “poor” prognosis refers to the survival of a subject in which the survival of the subject upon treatment is from less than 5 years to less than 1 month. In some instances, a “poor” prognosis further refers to the likelihood that a subject will develop a refractory breast cancer or refractory ovarian cancer toward one or more drugs.
  • a methylation score of less than 1.5 is indicative of a survival of from less than 5 years to less than 1 month. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 5 years, 4 years, 3 years, 2 years, 1.5 years, 1 year, 10 months, 8 months, 6 months, 4 months, or 2 months.
  • a methylation score of less than about 1.5 is associated with a "poor" prognosis in a subject having breast cancer. In some embodiments, a methylation score of less than about 1.5 is associated with a "poor” prognosis in a subject having breast cancer. [0143] In some instances, a methylation score of less than 1.5 is indicative of a survival of from less than 5 years to less than 1 month in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 5 years, 4 years, 3 years, 2 years, 1.5 years, 1 year, 10 months, 8 months, 6 months, 4 months, or 2 months in a subject having breast cancer.
  • a methylation score of less than 1.5 is indicative of a survival of less than 5 years in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 4 years in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 3 years in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 2.5 years in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 2 years in a subject having breast cancer.
  • a methylation score of less than 1.5 is indicative of a survival of less than 1.5 years in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 1 year in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 6 months in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 5 months in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 4 months in a subject having breast cancer.
  • a methylation score of less than 1.5 is indicative of a survival of less than 3 months in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 2 months in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 1 month in a subject having breast cancer.
  • one or more samples are obtained from a subject during the course of a treatment to monitor the progression of breast cancer in the subject.
  • the subject initially has a methylation score of from about 1.5 to about 3 and progressively during each subsequent testing has a lower methylation score.
  • a subject initially has a methylation score of 3 and during subsequent testings, has methylation scores of 2.5, 2, 1.5, or 1.
  • the subject is further tested to determine the progression of breast cancer (e.g., whether breast cancer has progressed into a metastatic state or into a refractory state) and a treatment course is optionally altered based on the changes in prognosis.
  • the methylation score is calculated based on model for a survival analysis.
  • a survival analysis is a statistic analysis for analyzing the expected duration of time until one or more events of interest happen.
  • survival analysis comprises Cox proportional hazards (PH) regression analysis, log-rank test or a product limit estimator.
  • the methylation score is calculated based on Cox proportional hazards (PH) regression analysis, log-rank test or product limit estimator.
  • the methylation score is calculated based on Cox proportional hazards (PH) regression analysis.
  • the methylation score is further calculated based on a log-rank test.
  • the log-rank test is a hypothesis test to compare the survival distribution of two samples (e.g., a training set and a validation set).
  • the log-rank test is also referred to as a Mantel-Cox test or a time-stratified Cochran-Mantel-Haenszel test.
  • the methylation score is additionally calculated based on a product limit estimator.
  • a product limit estimator also known as Kaplan-Meier estimator
  • Kaplan-Meier estimator is a non-parametric statistic used to estimate the survival function from lifetime data.
  • the methylation score is initially calculated based on Cox proportional hazards (PH) regression analysis and then reprocessed with a log-rank test.
  • PH Cox proportional hazards
  • a control is a methylation value, methylation level, or methylation profile of a sample.
  • the control comprises a set of
  • each said methylation profile is generated from a biological sample obtained from a known cancer type.
  • the known cancer type is breast cancer or ovarian cancer.
  • the known cancer type is breast cancer.
  • the known cancer type is a relapsed or refractory breast cancer.
  • the known cancer type is a metastatic breast cancer.
  • the known cancer type is ductal carcinoma in situ, invasive or infiltrating ductal carcinoma, invasive or infiltrating lobular carcinoma, lobular carcinoma in situ, inflammatory breast cancer, Paget disease of the nipple, Phyllodes tumor, angiosarcoma, metaplastic carcinoma, low-grade adenosquamous carcinoma, spindle cell carcinoma of the breast, squamous carcinoma, triple-negative breast cancer, or mixed carcinoma.
  • the known cancer type is invasive ductal carcinoma comprises tubular carcinoma of the breast, medullary carcinoma of the breast, mucinous (or colloid) carcinoma of the breast, papillary carcinoma of the breast,
  • the known cancer type is ovarian cancer. In some cases, the known cancer type is a relapsed or refractory ovarian cancer. In other cases, the known cancer type is a metastatic ovarian cancer. In some cases, the known cancer type is epithelial ovarian cancer, stromal cell ovarian tumors, germ cell ovarian tumors, borderline ovarian tumors, small cell ovarian carcinoma, neuro-endocrine carcinomas, squamous cell carcinoma, struma ovarii malignum or psammocarcinoma.
  • one or more probes described above comprise a structure of Formula I:
  • A is a first target-binding region
  • B is a second target-binding region
  • L is a linker region
  • A comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 30 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37;
  • B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 12 contiguous nucleotides starting at position from the 3' terminus of the same sequence selected from SEQ ID NOs: 1-37; and wherein L is attached to A; and B is attached to either A or L.
  • L is attached to A and B is attached to L.
  • A, B, and L are attached as illustrated in Formula la:
  • A comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 35 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37. In some cases, A comprises at least 70%, 80%, 90%), 95%), or 99% sequence identity to at least 40 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37. In some cases, A comprises at least 70%, 80%>, 90%, 95%, or 99% sequence identity to at least 45 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37.
  • A comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 50 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37. In some cases, A comprises at least 70%, 80%, 90%), 95%), or 99%) sequence identity to at least 55 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37. In some cases, A comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 60 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37.
  • A comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 65 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37. In some cases, A comprises at least 70%, 80%, 90%), 95%), or 99%) sequence identity to at least 70 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37. In some cases, A comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 80 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37. In some cases, A comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 90 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37.
  • B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 14 contiguous nucleotides starting at position from the 3' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%), 80%), 90%), 95%), or 99% sequence identity to at least 15 contiguous nucleotides starting at position from the 3' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 18 contiguous nucleotides starting at position from the 3' terminus of the same sequence selected from SEQ ID NOs: 1-37.
  • B comprises at least 70%, 80%, 90%), 95%), or 99%) sequence identity to at least 20 contiguous nucleotides starting at position from the 3' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 22 contiguous nucleotides starting at position from the 3' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99%) sequence identity to at least 25 contiguous nucleotides starting at position 1 ' from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37.
  • B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 28 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 30 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 35 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37.
  • B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 40 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%), 95%), or 99% sequence identity to at least 45 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 50 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1 -37.
  • B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 55 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 60 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 65 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37.
  • B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 70 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 80 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%), 95%), or 99%) sequence identity to at least 90 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37.
  • a probe described above is used in a next generation sequencing reaction to generate a CpG methylation data. In some instances, the probe is used in a solution-based next generation sequencing reaction to generate a CpG methylation data.
  • the next generation sequencing reaction comprises 454 Life Sciences platform (Roche, Branford, CT); lllumina's Genome Analyzer, GoldenGate Methylation Assay, or Infinium Methylation Assays, i.e., Infinium HumanMethylation 27K BeadArray or VeraCode GoldenGate methylation array (Illumina, San Diego, CA); QX200TM Droplet DigitalTM PCR System from Bio-Rad; DNA Sequencing by Ligation, SOLiD System
  • the solution-based next generation sequencing reaction is a droplet digital PCR sequencing method.
  • each probe correlates to a CpG site. In some instances, each probe correlates to a biomarker (e.g., CpG site) as illustrated in Table 5.
  • a biomarker e.g., CpG site
  • L is between 10 and 60, 15 and 55, 20 and 50, 25 and 45, and 30 and 40 nucleotides in length. In some instances, L is about 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides in length.
  • L further comprises an adaptor region.
  • the adaptor region comprises a sequence used to identify each probe.
  • the adaptor region in each illustrative sequence is reflected by a series of N, in which each N is A, T, G, or C.
  • a probe described herein comprises at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a sequence selected from SEQ ID NOs: 1-37.
  • the probe comprises at least 50% sequence identity to a sequence selected from SEQ ID NOs: 1-37.
  • the probe comprises at least 60% sequence identity to a sequence selected from SEQ ID NOs: 1 - 37.
  • the probe comprises at least 70% sequence identity to a sequence selected from SEQ ID NOs: 1-37.
  • the probe comprises at least 80% sequence identity to a sequence selected from SEQ ID NOs: 1-37.
  • the probe comprises at least 85% sequence identity to a sequence selected from SEQ ID NOs: 1 - 37. In some instances, the probe comprises at least 90% sequence identity to a sequence selected from SEQ ID NOs: 1-37. In some instances, the probe comprises at least 91% sequence identity to a sequence selected from SEQ ID NOs: 1-37. In some instances, the probe comprises at least 92% sequence identity to a sequence selected from SEQ ID NOs: 1- 37. In some instances, the probe comprises at least 93% sequence identity to a sequence selected from SEQ ID NOs: 1-37. In some instances, the probe comprises at least 94% sequence identity to a sequence selected from SEQ ID NOs: 1-37.
  • the probe comprises at least 95% sequence identity to a sequence selected from SEQ ID NOs: 1 - 37. In some instances, the probe comprises at least 96% sequence identity to a sequence selected from SEQ ID NOs: 1-37. In some instances, the probe comprises at least 97% sequence identity to a sequence selected from SEQ ID NOs: 1-37. In some instances, the probe comprises at least 98% sequence identity to a sequence selected from SEQ ID NOs: 1 - 37. In some instances, the probe comprises at least 99% sequence identity to a sequence selected from SEQ ID NOs: 1-37. In some instances, the probe comprises 100% sequence identity to a sequence selected from SEQ ID NOs: 1-37. In some instances, the probe consists of a sequence selected from SEQ ID NOs: 1-37.
  • a probe described above is utilized in a digital PCR sequencing method.
  • the probe is utilized in a droplet digital PCR (ddPCR) sequencing method.
  • a number of methods are utilized to measure, detect, determine, identify, and characterize the methylation status/level of a gene or a biomarker (e.g., CpG island-containing region/fragment) in identifying a subject as having breast cancer or ovarian cancer, determining the breast cancer or ovarian cancer subtype, the prognosis of a subject having breast cancer or ovarian cancer, and the progression or regression of breast cancer or ovarian cancer in subject in the presence of a therapeutic agent.
  • a biomarker e.g., CpG island-containing region/fragment
  • the methylation profile is generated from a biological sample isolated from an individual.
  • the biological sample is a biopsy.
  • the biological sample is a tissue sample.
  • the biological sample is a tissue biopsy sample.
  • the biological sample is a blood sample.
  • the biological sample is a cell-free biological sample.
  • the biological sample is a circulating tumor DNA sample.
  • the biological sample is a cell-free biological sample containing circulating tumor DNA.
  • a biomarker (or an epigenetic marker) is obtained from a liquid sample.
  • the liquid sample comprises blood and other liquid samples of biological origin (including, but not limited to, peripheral blood, sera, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper's fluid or pre-ejaculatory fluid, female ejaculate, sweat, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, ascites, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions/flushing, synovial fluid, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspir
  • biological origin including, but not limited to,
  • the biological fluid is blood, a blood derivative or a blood fraction, e.g., serum or plasma.
  • a sample comprises a blood sample.
  • a serum sample is used.
  • a sample comprises urine.
  • the liquid sample also encompasses a sample that has been manipulated in any way after their procurement, such as by centrifugation, filtration, precipitation, dialysis, chromatography, treatment with reagents, washed, or enriched for certain cell populations.
  • a biomarker (or an epigenetic marker) is obtained from a tissue sample.
  • a tissue corresponds to any cell(s). Different types of tissue correspond to different types of cells (e.g., liver, lung, blood, connective tissue, and the like), but also healthy cells vs. tumor cells or to tumor cells at various stages of neoplasia, or to displaced malignant tumor cells.
  • a tissue sample further encompasses a clinical sample, and also includes cells in culture, cell supernatants, organs, and the like. Samples also comprise fresh-frozen and/or formalin- fixed, paraffin-embedded tissue blocks, such as blocks prepared from clinical or pathological biopsies, prepared for pathological analysis or study by immunohistochemistry.
  • a biomarker (or an epigenetic marker) is methylated or unmethylated in a normal sample (e.g., normal or control tissue without disease, or normal or control body fluid, stool, blood, serum, amniotic fluid), most importantly in healthy stool, blood, serum, amniotic fluid or other body fluid.
  • a normal sample e.g., normal or control tissue without disease, or normal or control body fluid, stool, blood, serum, amniotic fluid
  • a biomarker is hypomethylated or hypermethylated in a sample from a patient having or at risk of a disease (e.g., one or more indications described herein); for example, at a decreased or increased (respectively) methylation frequency of at least about 50%, at least about 60%), at least about 70%, at least about 75%, at least about 80%>, at least about 85%>, at least about 90%, at least about 95%, or about 100% in comparison to a normal sample.
  • a sample is also hypomethylated or hypermethylated in comparison to a previously obtained sample analysis of the same patient having or at risk of a disease (e.g., one or more indications described herein), particularly to compare progression of a disease.
  • a methylome comprises a set of epigenetic markers or biomarkers, such as a biomarker described above.
  • a methylome that corresponds to the methylome of a tumor of an organism e.g., a human
  • a tumor methylome is determined using tumor tissue or cell-free (or protein-free) tumor DNA in a biological sample.
  • Other examples of methylomes of interest include the methylomes of organs that contribute DNA into a bodily fluid (e.g. methylomes of tissue such as brain, breast, lung, the prostate, and the kidneys, plasma, etc.).
  • a plasma methylome is the methylome determined from the plasma or serum of an animal (e.g., a human).
  • the plasma methylome is an example of a cell-free or protein-free methylome since plasma and serum include cell-free DNA.
  • the plasma methylome is also an example of a mixed methylome since it is a mixture of tumor and other methylomes of interest.
  • the urine methylome is determined from the urine sample of a subject.
  • a cellular methylome corresponds to the methylome determined from cells (e.g., blood cells) of the patient.
  • the methylome of the blood cells is called the blood cell methylome (or blood methylome).
  • DNA e.g., genomic DNA such as extracted genomic DNA or treated genomic DNA
  • genomic DNA is isolated by any means standard in the art, including the use of commercially available kits. Briefly, wherein the DNA of interest is encapsulated in by a cellular membrane the biological sample is disrupted and lysed by enzymatic, chemical, or mechanical means. In some cases, the DNA solution is then cleared of proteins and other contaminants e.g. by digestion with proteinase K. The DNA is then recovered from the solution. In such cases, this is carried out by means of a variety of methods including salting out, organic extraction or binding of the DNA to a solid phase support. In some instances, the choice of method is affected by several factors including time, expense and required quantity of DNA.
  • sample DNA is not enclosed in a membrane (e.g. circulating DNA from a cell free sample such as blood or urine) methods standard in the art for the isolation and/or purification of DNA are optionally employed (See, for example, Bettegowda et al. Detection of Circulating Tumor DNA in Early- and Late-Stage Human Malignancies. Sci. Transl. Med, 6(224): ra24. 2014).
  • a protein degenerating reagent e.g. chaotropic salt e.g. guanidine hydrochloride or urea
  • a detergent e.g. sodium dodecyl sulphate (SDS), cyanogen bromide.
  • Alternative methods include but are not limited to ethanol precipitation or propanol precipitation, vacuum concentration amongst others by means of a centrifuge.
  • filter devices e.g. ultrafiltration, silica surfaces or membranes, magnetic particles, polystyrol particles, polystyrol surfaces, positively charged surfaces, and positively charged membranes, charged membranes, charged surfaces, charged switch membranes, charged switched surfaces.
  • methylation analysis is carried out by any means known in the art.
  • a variety of methylation analysis procedures are known in the art and may be used to practice the methods disclosed herein. These assays allow for determination of the methylation state of one or a plurality of CpG sites within a tissue sample. In addition, these methods may be used for absolute or relative quantification of methylated nucleic acids.
  • Such methylation assays involve, among other techniques, two major steps. The first step is a methylation specific reaction or separation, such as (i) bisulfite treatment, (ii) methylation specific binding, or (iii) methylation specific restriction enzymes.
  • the second major step involves (i) amplification and detection, or (ii) direct detection, by a variety of methods such as (a) PCR (sequence-specific amplification) such as Taqman(R), (b) DNA sequencing of untreated and bisulfite-treated DNA, (c) sequencing by ligation of dye-modified probes (including cyclic ligation and cleavage), (d) pyrosequencing, (e) single-molecule sequencing, (f) mass spectroscopy, or (g) Southern blot analysis.
  • PCR sequence-specific amplification
  • Taqman(R) DNA sequencing of untreated and bisulfite-treated DNA
  • sequencing by ligation of dye-modified probes including cyclic ligation and cleavage
  • pyrosequencing sequencing by ligation of dye-modified probes (including cyclic ligation and cleavage)
  • pyrosequencing sequencing by ligation of dye-modified probes (including cyclic
  • restriction enzyme digestion of PCR products amplified from bisulfite-converted DNA may be used, e.g., the method described by Sadri and Hornsby (1996, Nucl. Acids Res. 24:5058- 5059), or COBRA (Combined Bisulfite Restriction
  • COBRA analysis is a quantitative methylation assay useful for determining DNA methylation levels at specific gene loci in small amounts of genomic DNA. Briefly, restriction enzyme digestion is used to reveal methylation-dependent sequence differences in PCR products of sodium bisulfite- treated DNA. Methylation-dependent sequence differences are first introduced into the genomic DNA by standard bisulfite treatment according to the procedure described by Frommer et al. (Frommer et al, 1992, Proc. Nat. Acad. Sci. USA, 89, 1827-1831).
  • PCR amplification of the bisulfite converted DNA is then performed using primers specific for the CpG sites of interest, followed by restriction endonuclease digestion, gel electrophoresis, and detection using specific, labeled hybridization probes.
  • Methylation levels in the original DNA sample are represented by the relative amounts of digested and undigested PCR product in a linearly quantitative fashion across a wide spectrum of DNA methylation levels.
  • this technique can be reliably applied to DNA obtained from micro-dissected paraffin- embedded tissue samples.
  • Typical reagents for COBRA analysis may include, but are not limited to: PCR primers for specific gene (or methylation-altered DNA sequence or CpG island); restriction enzyme and appropriate buffer; gene-hybridization oligo; control hybridization oligo; kinase labeling kit for oligo probe; and radioactive nucleotides.
  • bisulfite conversion reagents may include: DNA denaturation buffer; sulfo nation buffer; DNA recovery reagents or kits (e.g., precipitation, ultrafiltration, affinity column); desulfonation buffer; and DNA recovery components.
  • the methylation profile of selected CpG sites is determined using methylation-Specific PCR (MSP).
  • MSP allows for assessing the methylation status of virtually any group of CpG sites within a CpG island, independent of the use of methylation- sensitive restriction enzymes (Herman et al, 1996, Proc. Nat. Acad. Sci. USA, 93, 9821- 9826; U.S. Pat. Nos. 5,786,146, 6,017,704, 6,200,756, 6,265, 171 (Herman and Baylin); U.S. Pat. Pub. No. 2010/0144836 (Van Engeland et al)).
  • DNA is modified by a deaminating agent such as sodium bisulfite to convert unm ethyl ated, but not methylated cytosines to uracil, and subsequently amplified with primers specific for methylated versus unmethylated DNA.
  • a deaminating agent such as sodium bisulfite to convert unm ethyl ated, but not methylated cytosines to uracil
  • primers specific for methylated versus unmethylated DNA e.g., as might be found in a typical MSP- based kit
  • typical reagents include, but are not limited to: methylated and
  • PCR primers for specific gene or methylation- altered DNA sequence or CpG island
  • optimized PCR buffers and deoxynucleotides and specific probes.
  • the ColoSureTM test is a commercially available test for colon cancer based on the MSP technology and measurement of methylation of the vimentin gene (Itzkowitz et al, 2007, Clin Gastroenterol. Hepatol. 5(1), 111-117).
  • QM-PCR quantitative multiplexed methylation specific PCR
  • the methylation profile of selected CpG sites is determined using MethyLight and/or Heavy Methyl Methods.
  • the MethyLight and Heavy Methyl assays are a high-throughput quantitative methylation assay that utilizes fluorescence- based real-time PCR (Taq Man(R)) technology that requires no further manipulations after the PCR step (Eads, C.A. et al, 2000, Nucleic Acid Res. 28, e 32; Cottrell et al, 2007, J. Urology 177, 1753, U.S. Pat. Nos. 6,331,393 (Laird et al)).
  • the MethyLight process begins with a mixed sample of genomic DNA that is converted, in a sodium bisulfite reaction, to a mixed pool of methylation-dependent sequence differences according to standard procedures (the bisulfite process converts unmethylated cytosine residues to uracil). Fluorescence-based PCR is then performed either in an "unbiased” (with primers that do not overlap known CpG methylation sites) PCR reaction, or in a “biased” (with PCR primers that overlap known CpG dinucleotides) reaction. In some cases, sequence discrimination occurs either at the level of the amplification process or at the level of the fluorescence detection process, or both.
  • the MethyLight assay is used as a quantitative test for methylation patterns in the genomic DNA sample, wherein sequence discrimination occurs at the level of probe hybridization.
  • the PCR reaction provides for unbiased amplification in the presence of a fluorescent probe that overlaps a particular putative methylation site.
  • An unbiased control for the amount of input DNA is provided by a reaction in which neither the primers, nor the probe overlie any CpG dinucleotides.
  • a qualitative test for genomic methylation is achieved by probing of the biased PCR pool with either control oligonucleotides that do not "cover" known methylation sites (a fluorescence- based version of the "MSP" technique), or with oligonucleotides covering potential methylation sites.
  • Typical reagents e.g., as might be found in a typical MethyLight- based kit
  • MethyLight analysis include, but are not limited to: PCR primers for specific gene (or methylation-altered DNA sequence or CpG island); TaqMan(R) probes; optimized PCR buffers and deoxynucleotides; and Taq polymerase.
  • Quantitative MethyLight uses bisulfite to convert genomic DNA and the methylated sites are amplified using PCR with methylation independent primers. Detection probes specific for the methylated and unmethylated sites with two different fluorophores provides simultaneous quantitative measurement of the methylation.
  • the Heavy Methyl technique begins with bisulfate conversion of DNA. Next specific blockers prevent the amplification of unmethylated DNA. Methylated genomic DNA does not bind the blockers and their sequences will be amplified. The amplified sequences are detected with a methylation specific probe. (Cottrell et al, 2004, Nuc. Acids Res. 32:el0).
  • the Ms-SNuPE technique is a quantitative method for assessing methylation differences at specific CpG sites based on bisulfite treatment of DNA, followed by single- nucleotide primer extension (Gonzalgo and Jones, 1997, Nucleic Acids Res. 25, 2529-2531). Briefly, genomic DNA is reacted with sodium bisulfite to convert unmethylated cytosine to uracil while leaving 5 -methyl cytosine unchanged. Amplification of the desired target sequence is then performed using PCR primers specific for bisulfite-converted DNA, and the resulting product is isolated and used as a template for methylation analysis at the CpG site(s) of interest.
  • Typical reagents e.g., as is found in a typical Ms- SNuPE-based kit
  • Ms- SNuPE analysis include, but are not limited to: PCR primers for specific gene (or methylation-altered DNA sequence or CpG island); optimized PCR buffers and deoxynucleotides; gel extraction kit; positive control primers; Ms-SNuPE primers for specific gene; reaction buffer (for the Ms-SNuPE reaction); and radioactive nucleotides.
  • bisulfite conversion reagents may include: DNA denaturation buffer;
  • DNA recovery regents or kit e.g., precipitation, ultrafiltration, affinity column
  • desulfonation buffer e.g., DNA recovery buffer
  • the methylation status of selected CpG sites is determined using differential Binding-based Methylation Detection Methods.
  • one approach is to capture methylated DNA.
  • This approach uses a protein, in which the methyl binding domain of MBD2 is fused to the Fc fragment of an antibody (MBD-FC) (Gebhard et al, 2006, Cancer Res. 66:6118-6128; and PCT Pub. No. WO 2006/056480 A2 (Relhi)).
  • MBD-FC a protein, in which the methyl binding domain of MBD2 is fused to the Fc fragment of an antibody (MBD-FC) (Gebhard et al, 2006, Cancer Res. 66:6118-6128; and PCT Pub. No. WO 2006/056480 A2 (Relhi)).
  • MBD FC has a higher affinity to methylated DNA and it binds double stranded DNA.
  • Methylation specific antibodies bind DNA stochastically, which means that only a binary answer can be obtained.
  • the methyl binding domain of MBD-FC binds DNA molecules regardless of their methylation status. The strength of this protein - DNA interaction is defined by the level of DNA methylation.
  • eluate solutions of increasing salt concentrations can be used to fractionate non- methylated and methylated DNA allowing for a more controlled separation (Gebhard et al, 2006, Nucleic Acids Res. 34: e82). Consequently this method, called Methyl- CpG immunoprecipitation (MCIP), not only enriches, but also fractionates genomic DNA according to methylation level, which is particularly helpful when the unmethylated DNA fraction should be investigated as well.
  • MCIP Methyl- CpG immunoprecipitation
  • a 5 -methyl cytidine antibody to bind and precipitate methylated DNA.
  • Antibodies are available from Abeam (Cambridge, MA), Diagenode (Sparta, NJ) or Eurogentec (c/o AnaSpec, Fremont, CA).
  • MIRA methylated CpG-island recovery assay
  • MeDIP methylated DNA immunoprecipitation
  • methods for detecting methylation include randomly shearing or randomly fragmenting the genomic DNA, cutting the DNA with a methylation- dependent or methylation-sensitive restriction enzyme and subsequently selectively identifying and/or analyzing the cut or uncut DNA.
  • Selective identification can include, for example, separating cut and uncut DNA (e.g., by size) and quantifying a sequence of interest that was cut or, alternatively, that was not cut. See, e.g., U.S. Patent No. 7, 186,512.
  • the method can encompass amplifying intact DNA after restriction enzyme digestion, thereby only amplifying DNA that was not cleaved by the restriction enzyme in the area amplified. See, e.g., U.S. Patents No. 7,910,296; No. 7,901,880; and No. 7,459,274.
  • amplification can be performed using primers that are gene specific.
  • methyl-sensitive enzymes that preferentially or substantially cleave or digest at their DNA recognition sequence if it is non-methylated.
  • an unmethylated DNA sample is cut into smaller fragments than a methylated DNA sample.
  • a hypermethylated DNA sample is not cleaved.
  • methyl-sensitive enzymes that cleave at their DNA recognition sequence only if it is methylated.
  • Methyl- sensitive enzymes that digest unmethylated DNA suitable for use in methods of the technology include, but are not limited to, Hpall, Hhal, Maell, BstUI and Acil.
  • an enzyme that is used is Hpall that cuts only the unmethylated sequence CCGG.
  • another enzyme that is used is Hhal that cuts only the unmethylated sequence GCGC. Both enzymes are available from New England BioLabs(R), Inc.
  • Suitable enzymes that digest only methylated DNA include, but are not limited to, Dpnl, which only cuts at fully methylated 5'-GATC sequences, and McrBC, an endonuclease, which cuts DNA containing modified cytosines (5-methylcytosine or 5- hydroxym ethyl cytosine or N4- methyl cytosine) and cuts at recognition site 5'... PumC(N4o- 3ooo) PumC... 3' (New England BioLabs, Inc., Beverly, MA). Cleavage methods and procedures for selected restriction enzymes for cutting DNA at specific sites are well known to the skilled artisan.
  • restriction enzymes provide information on conditions and types of DNA sequences cut by specific restriction enzymes, including New England BioLabs, Pro-Mega Biochems, Boehringer-Mannheim, and the like.
  • Sambrook et al. See Sambrook et al. Molecular Biology: A Laboratory Approach, Cold Spring Harbor, N.Y. 1989) provide a general description of methods for using restriction enzymes and other enzymes.
  • a methylation-dependent restriction enzyme is a restriction enzyme that cleaves or digests DNA at or in proximity to a methylated recognition sequence, but does not cleave DNA at or near the same sequence when the recognition sequence is not methylated.
  • Methylation-dependent restriction enzymes include those that cut at a methylated recognition sequence (e.g., Dpnl) and enzymes that cut at a sequence near but not at the recognition sequence (e.g., McrBC).
  • McrBC's recognition sequence is 5' RmC (N40-3000) RmC 3 ' where "R” is a purine and "mC” is a methylated cytosine and "N40-3000" indicates the distance between the two RmC half sites for which a restriction event has been observed.
  • McrBC generally cuts close to one half-site or the other, but cleavage positions are typically distributed over several base pairs, approximately 30 base pairs from the methylated base. McrBC sometimes cuts 3' of both half sites, sometimes 5' of both half sites, and sometimes between the two sites.
  • Exemplary methylation-dependent restriction enzymes include, e.g., McrBC, McrA, MrrA, Bisl, Glal and Dpnl.
  • any methylation-dependent restriction enzyme including homologs and orthologs of the restriction enzymes described herein, is also suitable for use with one or more methods described herein.
  • a methylation-sensitive restriction enzyme is a restriction enzyme that cleaves DNA at or in proximity to an unmethylated recognition sequence but does not cleave at or in proximity to the same sequence when the recognition sequence is methylated.
  • Exemplary methylation-sensitive restriction enzymes are described in, e.g., McClelland et al, 22(17) NUCLEIC ACIDS RES. 3640-59 (1994).
  • Suitable methylation-sensitive restriction enzymes that do not cleave DNA at or near their recognition sequence when a cytosine within the recognition sequence is methylated at position C5 include, e.g., Aat II, Aci I, Acd I, Age I, Alu I, Asc I, Ase I, AsiS I, Bbe I, BsaA I, BsaH I, BsiE I, BsiW I, BsrF I, BssH II, BssK I, BstB I, BstN I, BstU I, Cla I, Eae I, Eag I, Fau I, Fse I, Hha I, HinPl I, HinC II, Hpa II, Hpy99 I, HpyCH4 IV, Kas I, Mbo I, Mlu I, MapAl I, Msp I, Nae I, Nar I, Not I, Pml I, Pst I, Pvu I, Rsr II, Sac II
  • Suitable methylation-sensitive restriction enzymes that do not cleave DNA at or near their recognition sequence when an adenosine within the recognition sequence is methylated at position N6 include, e.g., Mbo I.
  • any methylation-sensitive restriction enzyme including homologs and orthologs of the restriction enzymes described herein, is also suitable for use with one or more of the methods described herein.
  • a methylation-sensitive restriction enzyme that fails to cut in the presence of methylation of a cytosine at or near its recognition sequence may be insensitive to the presence of methylation of an adenosine at or near its recognition sequence.
  • a methylation-sensitive restriction enzyme that fails to cut in the presence of methylation of an adenosine at or near its recognition sequence may be insensitive to the presence of methylation of a cytosine at or near its recognition sequence.
  • Sau3AI is sensitive (i.e., fails to cut) to the presence of a methylated cytosine at or near its recognition sequence, but is insensitive (i.e., cuts) to the presence of a methylated adenosine at or near its recognition sequence.
  • some methylation-sensitive restriction enzymes are blocked by methylation of bases on one or both strands of DNA encompassing of their recognition sequence, while other
  • methylation-sensitive restriction enzymes are blocked only by methylation on both strands, but can cut if a recognition site is hemi-methylated.
  • adaptors are optionally added to the ends of the randomly fragmented DNA, the DNA is then digested with a methyl ati on-dependent or methylation-sensitive restriction enzyme, and intact DNA is subsequently amplified using primers that hybridize to the adaptor sequences. In this case, a second step is performed to determine the presence, absence or quantity of a particular gene in an amplified pool of DNA. In some embodiments, the DNA is amplified using real-time, quantitative PCR.
  • the methods comprise quantifying the average methylation density in a target sequence within a population of genomic DNA.
  • the method comprises contacting genomic DNA with a methylation-dependent restriction enzyme or methylation-sensitive restriction enzyme under conditions that allow for at least some copies of potential restriction enzyme cleavage sites in the locus to remain uncleaved; quantifying intact copies of the locus; and comparing the quantity of amplified product to a control value representing the quantity of methylation of control DNA, thereby quantifying the average methylation density in the locus compared to the methylation density of the control DNA.
  • the quantity of methylation of a locus of DNA is determined by providing a sample of genomic DNA comprising the locus, cleaving the DNA with a restriction enzyme that is either methylation-sensitive or methylation-dependent, and then quantifying the amount of intact DNA or quantifying the amount of cut DNA at the DNA locus of interest.
  • the amount of intact or cut DNA will depend on the initial amount of genomic DNA containing the locus, the amount of methylation in the locus, and the number (i.e., the fraction) of nucleotides in the locus that are methylated in the genomic DNA.
  • the amount of methylation in a DNA locus can be determined by comparing the quantity of intact DNA or cut DNA to a control value representing the quantity of intact DNA or cut DNA in a similarly-treated DNA sample.
  • the control value can represent a known or predicted number of methylated nucleotides.
  • the control value can represent the quantity of intact or cut DNA from the same locus in another (e.g., normal, non-diseased) cell or a second locus.
  • methylation-sensitive or methylation-dependent restriction enzyme By using at least one methylation-sensitive or methylation-dependent restriction enzyme under conditions that allow for at least some copies of potential restriction enzyme cleavage sites in the locus to remain uncleaved and subsequently quantifying the remaining intact copies and comparing the quantity to a control, average methylation density of a locus can be determined. If the methylation-sensitive restriction enzyme is contacted to copies of a DNA locus under conditions that allow for at least some copies of potential restriction enzyme cleavage sites in the locus to remain uncleaved, then the remaining intact DNA will be directly proportional to the methylation density, and thus may be compared to a control to determine the relative methylation density of the locus in the sample.
  • a methylation-dependent restriction enzyme is contacted to copies of a DNA locus under conditions that allow for at least some copies of potential restriction enzyme cleavage sites in the locus to remain uncleaved, then the remaining intact DNA will be inversely proportional to the methylation density, and thus may be compared to a control to determine the relative methylation density of the locus in the sample.
  • assays are disclosed in, e.g., U.S. Patent No. 7,910,296.
  • the methylated CpG island amplification (MCA) technique is a method that can be used to screen for altered methylation patterns in genomic DNA, and to isolate specific sequences associated with these changes (Toyota et al, 1999, Cancer Res. 59, 2307-2312, U.S. Pat. No. 7,700,324 (Issa et al)). Briefly, restriction enzymes with different sensitivities to cytosine methylation in their recognition sites are used to digest genomic DNAs from primary tumors, cell lines, and normal tissues prior to arbitrarily primed PCR amplification. Fragments that show differential methylation are cloned and sequenced after resolving the PCR products on high-resolution polyacrylamide gels.
  • Typical reagents for MCA analysis may include, but are not limited to: PCR primers for arbitrary priming Genomic DNA; PCR buffers and nucleotides, restriction enzymes and appropriate buffers; gene-hybridization oligos or probes; control hybridization oligos or probes.
  • Additional methylation detection methods include those methods described in, e.g., U.S. Patents No. 7,553,627; No. 6,331,393; U.S. Patent Serial No. 12/476,981; U.S. Patent Publication No. 2005/0069879; Rein, et al, 26(10) NUCLEIC ACIDS RES. 2255-64 (1998); and Olek et al, 17(3) NAT. GENET. 275-6 (1997).
  • the methylation status of selected CpG sites is determined using Methylation- Sensitive High Resolution Melting (HRM).
  • HRM Methylation- Sensitive High Resolution Melting
  • RotorGene6000 and the Applied Biosystems 7500.
  • HRM may also be combined with other amplification techniques such as pyrosequencing as described by Candiloro et al. (Candiloro et al, 2011, Epigenetics 6(4) 500-507).
  • the methylation status of selected CpG locus is determined using a primer extension assay, including an optimized PCR amplification reaction that produces amplified targets for analysis using mass spectrometry.
  • the assay can also be done in multiplex.
  • Mass spectrometry is a particularly effective method for the detection of polynucleotides associated with the differentially methylated regulatory elements. The presence of the polynucleotide sequence is verified by comparing the mass of the detected signal with the expected mass of the polynucleotide of interest.
  • the relative signal strength e.g., mass peak on a spectra
  • the relative signal strength indicates the relative population of a specific allele, thus enabling calculation of the allele ratio directly from the data.
  • This method is described in detail in PCT Pub. No. WO 2005/012578A1 (Beaulieu et al), which is hereby incorporated by reference in its entirety.
  • the assay can be adopted to detect bisulfite introduced methylation dependent C to T sequence changes.
  • multiplexed amplification reactions and multiplexed primer extension reactions e.g., multiplexed homogeneous primer mass extension (hME) assays
  • hME primer mass extension
  • Bayeyt et al. have reported selective oxidants that oxidize 5-methylcytosine, without reacting with thymidine, which are followed by PCR or pyro sequencing (WO 2009/049916 (Bayeyt et al).
  • quantitative amplification methods e.g., quantitative PCR or quantitative linear amplification
  • Methods of quantitative amplification are disclosed in, e.g., U.S. Patents No. 6, 180,349; No. 6,033,854; and No. 5,972,602, as well as in, e.g., DeGraves, et al, 34(1) BIOTECHNIQUES 106-15 (2003); Deiman B, et al., 20(2) MOL. BIOTECHNOL. 163-79 (2002); and Gibson et al, 6 GENOME RESEARCH 995-1001 (1996).
  • nucleic acid Following reaction or separation of nucleic acid in a methylation specific manner, the nucleic acid in some cases are subjected to sequence-based analysis. For example, once it is determined that one particular genomic sequence from a sample is hypermethylated or hypomethylated compared to its counterpart, the amount of this genomic sequence can be determined. Subsequently, this amount can be compared to a standard control value and used to determine the present of breast cancer in the sample. In many instances, it is desirable to amplify a nucleic acid sequence using any of several nucleic acid amplification procedures which are well known in the art.
  • nucleic acid amplification is the chemical or enzymatic synthesis of nucleic acid copies which contain a sequence that is complementary to a nucleic acid sequence being amplified (template).
  • the methods and kits may use any nucleic acid amplification or detection methods known to one skilled in the art, such as those described in U.S. Pat. Nos. 5,525,462 (Takarada et al); 6, 114,117 (Hepp et al); 6,127, 120 (Graham et al); 6,344,317 (Urnovitz); 6,448,001 (Oku); 6,528,632 (Catanzariti et al); and PCT Pub. No. WO 2005/111209 (Nakajima et al).
  • the nucleic acids are amplified by PCR amplification using methodologies known to one skilled in the art.
  • amplification can be accomplished by any known method, such as ligase chain reaction (LCR), Q -replicas amplification, rolling circle amplification, transcription amplification, self-sustained sequence replication, nucleic acid sequence-based amplification (NASBA), each of which provides sufficient amplification.
  • LCR ligase chain reaction
  • Q -replicas amplification Q -replicas amplification
  • rolling circle amplification transcription amplification
  • self-sustained sequence replication nucleic acid sequence-based amplification
  • NASBA nucleic acid sequence-based amplification
  • Branched-DNA technology is also optionally used to qualitatively demonstrate the presence of a sequence of the technology, which represents a particular methylation pattern, or to quantitatively determine the amount of this particular genomic sequence in a sample.
  • Nolte reviews branched-DNA signal amplification for direct quantit
  • PCR process is well known in the art and include, for example, reverse transcription PCR, ligation mediated PCR, digital PCR (dPCR), or droplet digital PCR (ddPCR).
  • dPCR digital PCR
  • ddPCR droplet digital PCR
  • PCR reagents and protocols are also available from commercial vendors, such as Roche Molecular Systems.
  • PCR is carried out as an automated process with a thermostable enzyme. In this process, the temperature of the reaction mixture is cycled through a denaturing region, a primer annealing region, and an extension reaction region automatically. Machines specifically adapted for this purpose are commercially available.
  • amplified sequences are also measured using invasive cleavage reactions such as the Invader(R) technology (Zou et al, 2010, Association of Clinical Chemistry (AACC) poster presentation on July 28, 2010, "Sensitive Quantification of Methylated Markers with a Novel Methylation Specific Technology; and U.S. Pat. No. 7,011,944 (Prudent et al)).
  • Invader(R) technology Zaou et al, 2010, Association of Clinical Chemistry (AACC) poster presentation on July 28, 2010, "Sensitive Quantification of Methylated Markers with a Novel Methylation Specific Technology; and U.S. Pat. No. 7,011,944 (Prudent et al)).
  • Suitable next generation sequencing technologies are widely available. Examples include the 454 Life Sciences platform (Roche, Branford, CT) (Margulies et al. 2005 Nature, 437, 376-380); lllumina's Genome Analyzer, GoldenGate Methylation Assay, or Infinium Methylation Assays, i.e., Infinium HumanMethylation 27K BeadArray or VeraCode
  • GoldenGate methylation array (Illumina, San Diego, CA; Bibkova et al, 2006, Genome Res. 16, 383-393; U.S. Pat. Nos. 6,306,597 and 7,598,035 (Macevicz); 7,232,656 (Balasubramanian et al.)); QX200TM Droplet DigitalTM PCR System from Bio-Rad; or DNA Sequencing by Ligation, SOLiD System (Applied Biosystems/Life Technologies; U.S. Pat. Nos.
  • Pyrosequencing is a nucleic acid sequencing method based on sequencing by synthesis, which relies on detection of a pyrophosphate released on nucleotide incorporation.
  • sequencing by synthesis involves synthesizing, one nucleotide at a time, a DNA strand complimentary to the strand whose sequence is being sought.
  • Study nucleic acids may be immobilized to a solid support, hybridized with a sequencing primer, incubated with DNA polymerase, ATP sulfurylase, luciferase, apyrase, adenosine 5' phosphsulfate and luciferin. Nucleotide solutions are sequentially added and removed.
  • An example of a system that can be used by a person of ordinary skill based on pyrosequencing generally involves the following steps: ligating an adaptor nucleic acid to a study nucleic acid and hybridizing the study nucleic acid to a bead; amplifying a nucleotide sequence in the study nucleic acid in an emulsion; sorting beads using a picoliter multiwell solid support; and sequencing amplified nucleotide sequences by pyrosequencing methodology (e.g., Nakano et al, 2003, J. Biotech. 102, 117- 124).
  • Such a system can be used to exponentially amplify amplification products generated by a process described herein, e.g., by ligating a heterologous nucleic acid to the first amplification product generated by a process described herein.
  • the methylation values measured for biomarkers of a biomarker panel are mathematically combined and the combined value is correlated to the underlying diagnostic question.
  • methylated biomarker values are combined by any appropriate state of the art mathematical method.
  • DA discriminant analysis
  • DFA Discriminant Functional Analysis
  • Kernel Methods e.g., SVM
  • Multidimensional Scaling MDS
  • Nonparametric Methods e.g., k-Nearest-Neighbor Classifiers
  • PLS Partial Least Squares
  • Tree-Based Methods e.g., Logic Regression, CART, Random Forest Methods, Boosting/Bagging Methods
  • Generalized Linear Models e.g., Logistic
  • the method used in a correlating methylation status of an epigenetic marker or biomarker combination is selected from DA (e.g., Linear-, Quadratic-, Regularized Discriminant Analysis), DFA, Kernel Methods (e.g., SVM), MDS, Nonparametric Methods (e.g., k-Nearest-Neighbor Classifiers), PLS (Partial Least Squares), Tree-Based Methods (e.g., Logic Regression, CART, Random Forest Methods, Boosting Methods), or Generalized Linear Models (e.g., Logistic
  • DA Linear-, Quadratic-, Regularized Discriminant Analysis
  • DFA Kernel Methods
  • MDS Nonparametric Methods
  • PLS Partial Least Squares
  • Tree-Based Methods e.g., Logic Regression, CART, Random Forest Methods, Boosting Methods
  • Generalized Linear Models e.g., Logistic
  • the correlated results for each methylation panel are rated by their correlation to the disease or tumor type positive state, such as for example, by p-value test or t-value test or F-test.
  • Rated (best first, i.e. low p- or t-value) biomarkers are then subsequently selected and added to the methylation panel until a certain diagnostic value is reached.
  • Such methods include identification of methylation panels, or more broadly, genes that were differentially methylated among several classes using, for example, a random- variance t-test (Wright G. W. and Simon R, Bioinformatics 19:2448-2455,2003).
  • Other methods include the step of specifying a significance level to be used for determining the epigenetic markers that will be included in the biomarker panel.
  • Epigenetic markers that are differentially methylated between the classes at a univariate parametric significance level less than the specified threshold are included in the panel. It doesn't matter whether the specified significance level is small enough to exclude enough false discoveries. In some problems better prediction is achieved by being more liberal about the biomarker panels used as features. In some cases, the panels are biologically interpretable and clinically applicable, however, if fewer markers are included.
  • biomarker selection is repeated for each training set created in the cross-validation process. That is for the purpose of providing an unbiased estimate of prediction error.
  • the methylation panel for use with new patient sample data is the one resulting from application of the methylation selection and classifier of the "known" methylation information, or control methylation panel.
  • Models for utilizing methylation profile to predict the class of future samples can also be used. These models may be based on the Compound Covariate Predictor (Radmacher et al. Journal of Computational Biology 9:505-511, 2002), Diagonal Linear Discriminant Analysis (Dudoit et al. Journal of the American Statistical Association 97:77-87, 2002), Nearest Neighbor Classification (also Dudoit et al.), and Support Vector Machines with linear kernel (Ramaswamy et al. PNAS USA 98: 15149-54, 2001). The models incorporated markers that were differentially methylated at a given significance level (e.g.
  • the prediction error of each model using cross validation preferably leave-one-out cross-validation (Simon et al. Journal of the National Cancer Institute 95: 14- 18, 2003can be estimated.
  • the entire model building process is repeated, including the epigenetic marker selection process.
  • the class labels are randomly permuted and the entire leave-one-out cross-validation process is then repeated.
  • the significance level is the proportion of the random permutations that gives a cross-validated error rate no greater than the cross-validated error rate obtained with the real methylation data.
  • Another classification method is the greedy-pairs method described by Bo and Jonassen (Genome Biology 3(4):research0017.1-0017.11, 2002).
  • the greedy-pairs approach starts with ranking all markers based on their individual t-scores on the training set. This method attempts to select pairs of markers that work well together to discriminate the classes.
  • a binary tree classifier for utilizing methylation profile is optionally used to predict the class of future samples.
  • the first node of the tree incorporated a binary classifier that distinguished two subsets of the total set of classes.
  • the individual binary classifiers are based on the "Support Vector Machines" incorporating markers that were differentially expressed among markers at the significance level (e.g. 0.01, 0.05 or 0.1) as assessed by the random variance t-test (Wright G. W. and Simon R. Bioinformatics 19:2448- 2455, 2003). Classifiers for all possible binary partitions are evaluated and the partition selected is that for which the cross-validated prediction error is minimum. The process is then repeated successively for the two subsets of classes determined by the previous binary split.
  • the prediction error of the binary tree classifier can be estimated by cross-validating the entire tree building process.
  • This overall cross-validation includes re-selection of the optimal partitions at each node and re-selection of the markers used for each cross-validated training set as described by Simon et al. (Simon et al. Journal of the National Cancer Institute 95: 14-18, 2003).
  • Simon et al. Simon et al.
  • Several-fold cross validation in which a fraction of the samples is withheld, a binary tree developed on the remaining samples, and then class membership is predicted for the samples withheld. This is repeated several times, each time withholding a different percentage of the samples.
  • the samples are randomly partitioned into fractional test sets (Simon R and Lam A. BRB-ArrayTools User Guide, version 3.2. Biometric Research Branch, National Cancer Institute).
  • the correlated results for each marker b) are rated by their correct correlation to the disease, preferably by p-value test. It is also possible to include a step in that the markers are selected d) in order of their rating.
  • factors such as the value, level, feature, characteristic, property, etc. of a transcription rate, mRNA level, translation rate, protein level, biological activity, cellular characteristic or property, genotype, phenotype, etc. can be utilized in addition prior to, during, or after administering a therapy to a patient to enable further analysis of the patient's cancer status.
  • a diagnostic test to correctly predict status is measured as the sensitivity of the assay, the specificity of the assay or the area under a receiver operated characteristic ("ROC") curve.
  • sensitivity is the percentage of true positives that are predicted by a test to be positive
  • specificity is the percentage of true negatives that are predicted by a test to be negative.
  • an ROC curve provides the sensitivity of a test as a function of 1- specificity. The greater the area under the ROC curve, for example, the more accurate or powerful the predictive value of the test.
  • Other useful measures of the utility of a test include positive predictive value and negative predictive value. Positive predictive value is the percentage of people who test positive that are actually positive. Negative predictive value is the percentage of people who test negative that are actually negative.
  • one or more of the biomarkers disclosed herein show a statistical difference in different samples of at least p ⁇ 0.05, p ⁇ 10 "2 , p ⁇ 10 "3 , p ⁇ 10 "4 or p ⁇ 10 "5 . Diagnostic tests that use these biomarkers may show an ROC of at least 0.6, at least about 0.7, at least about 0.8, or at least about 0.9. In some instances, the biomarkers are
  • the biomarkers for different subtypes of breast cancer are differentially methylated.
  • the biomarkers are measured in a patient sample using the methods described herein and compared, for example, to predefined biomarker levels and are used to determine whether the patient has breast cancer, which breast cancer subtype does the patient have, and/or what is the prognosis of the patient having breast cancer.
  • the correlation of a combination of biomarkers in a patient sample is compared, for example, to a predefined set of biomarkers.
  • the measurement s) is then compared with a relevant diagnostic amount(s), cut-off(s), or multivariate model scores that distinguish between the presence or absence of breast cancer, between breast cancer subtypes, and between a "good” or a “poor” prognosis.
  • a relevant diagnostic amount(s), cut-off(s), or multivariate model scores that distinguish between the presence or absence of breast cancer, between breast cancer subtypes, and between a "good” or a “poor” prognosis.
  • the particular diagnostic cut-off is determined, for example, by measuring the amount of biomarker hypermethylation or hypomethylation in a statistically significant number of samples from patients with or without breast cancer and from patients with different breast cancer subtypes, and drawing the cut-off to suit the desired levels of specificity and sensitivity.
  • the kit comprises a plurality of primers or probes to detect or measure the methylation
  • kits comprise, in some instances, at least one polynucleotide that hybridizes to at least one of the methylation marker sequences described herein and at least one reagent for detection of gene methylation.
  • Reagents for detection of methylation include, e.g., sodium bisulfate, polynucleotides designed to hybridize to sequence that is the product of a marker sequence if the marker sequence is not methylated (e.g., containing at least one C-U conversion), and/or a methylation- sensitive or methylation- dependent restriction enzyme.
  • the kits provide solid supports in the form of an assay apparatus that is adapted to use in the assay.
  • the kits further comprise detectable labels, optionally linked to a polynucleotide, e.g., a probe, in the kit.
  • kits comprise one or more (e.g., 1, 2, 3, 4, or more) different polynucleotides (e.g., primers and/or probes) capable of specifically amplifying at least a portion of a DNA region of a biomarker described herein.
  • one or more detectably-labeled polypeptides capable of hybridizing to the amplified portion are also included in the kit.
  • the kits comprise sufficient primers to amplify 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different DNA regions or portions thereof, and optionally include detectably-labeled polynucleotides capable of hybridizing to each amplified DNA region or portion thereof.
  • the kits further can comprise a methylation-dependent or methylation sensitive restriction enzyme and/or sodium bisulfite.
  • kits comprise sodium bisulfite, primers and adapters (e.g., oligonucleotides that can be ligated or otherwise linked to genomic fragments) for whole genome amplification, and polynucleotides (e.g., detectably-labeled polynucleotides) to quantify the presence of the converted methylated and or the converted unmethylated sequence of at least one cytosine from a DNA region of an epigenetic marker described herein.
  • primers and adapters e.g., oligonucleotides that can be ligated or otherwise linked to genomic fragments
  • polynucleotides e.g., detectably-labeled polynucleotides
  • kits comprise methylation sensing restriction enzymes (e.g., a methylation-dependent restriction enzyme and/or a methylation-sensitive restriction enzyme), primers and adapters for whole genome amplification, and polynucleotides to quantify the number of copies of at least a portion of a DNA region of an epigenetic marker described herein.
  • methylation sensing restriction enzymes e.g., a methylation-dependent restriction enzyme and/or a methylation-sensitive restriction enzyme
  • primers and adapters for whole genome amplification e.g., primers and adapters for whole genome amplification, and polynucleotides to quantify the number of copies of at least a portion of a DNA region of an epigenetic marker described herein.
  • kits comprise a methylation binding moiety and one or more polynucleotides to quantify the number of copies of at least a portion of a DNA region of a marker described herein.
  • a methylation binding moiety refers to a molecule (e.g., a polypeptide) that specifically binds to methyl-cytosine.
  • Examples include restriction enzymes or fragments thereof that lack DNA cutting activity but retain the ability to bind methylated DNA, antibodies that specifically bind to methylated DNA, etc.).
  • the kit includes a packaging material.
  • packaging material can refer to a physical structure housing the components of the kit.
  • the packaging material maintains sterility of the kit components, and is made of material commonly used for such purposes (e.g., paper, corrugated fiber, glass, plastic, foil, ampules, etc.).
  • Other materials useful in the performance of the assays are included in the kits, including test tubes, transfer pipettes, and the like.
  • the kits also include written instructions for the use of one or more of these reagents in any of the assays described herein.
  • kits also include a buffering agent, a preservative, or a protein/nucleic acid stabilizing agent. In some cases, kits also include other components of a reaction mixture as described herein. For example, kits include one or more aliquots of thermostable DNA polymerase as described herein, and/or one or more aliquots of dNTPs. In some cases, kits also include control samples of known amounts of template DNA molecules harboring the individual alleles of a locus. In some embodiments, the kit includes a negative control sample, e.g., a sample that does not contain DNA molecules harboring the individual alleles of a locus. In some embodiments, the kit includes a positive control sample, e.g., a sample containing known amounts of one or more of the individual alleles of a locus.
  • ranges and amounts can be expressed as “about” a particular value or range. About also includes the exact amount. Hence “about 5 ⁇ _,” means “about 5 ⁇ _,” and also “5 ⁇ . “ Generally, the term “about” includes an amount that would be expected to be within experimental error.
  • the terms "individual(s)", “subject(s)” and “patient(s)” mean any mammal.
  • the mammal is a human.
  • the mammal is a non-human. None of the terms require or are limited to situations characterized by the supervision (e.g. constant or intermittent) of a health care worker (e.g. a doctor, a registered nurse, a nurse practitioner, a physician's assistant, an orderly or a hospice worker).
  • a health care worker e.g. a doctor, a registered nurse, a nurse practitioner, a physician's assistant, an orderly or a hospice worker.
  • a "site” corresponds to a single site, which in some cases is a single base position or a group of correlated base positions, e.g., a CpG site.
  • a "locus” corresponds to a region that includes multiple sites. In some instances, a locus includes one site.
  • Genomic DNA extraction from pieces of freshly frozen healthy or cancer tissues was performed with QIAamp DNA Mini Kit (Qiagen) according to manufacturer's recommendations. DNA was extracted from roughly 0.5 mg of tissue. DNA was stored at - 20°C and analyzed within one week of preparation.
  • Genomic DNA from frozen FFPE samples was extracted using QIAamp DNA FFPE Tissue Kit with several modifications. DNA were stored at -20°C for further analysis.
  • Padlock probes were designed to capture regions containing the CpG markers whose methylation levels significantly differed in any of the comparison between any cancer tissue and any normal tissue.
  • Padlock probes were designed using the ppDesigner software. The average length of the captured region was 100 bp, with the CpG marker located in the central portion of the captured region. Linker sequence between arms contained binding sequences for
  • amplification primers separated by a variable stretch of Cs to produced probes of equal length.
  • a 6-bp unique molecular identifier (UMI) sequence in probe design was incorporated to allow for the identification of unique individual molecular capture events and accurate scoring of DNA methylation levels.
  • Probes were synthesized as separate oligonucleotides using standard commercial synthesis methods (ITD).
  • Circular products of site-specific capture were amplified by PCR with concomitant barcoding of separate samples. Amplification was carried out using primers specific to linker DNA within padlock probes, one of which contained specific 6bp barcodes. Both primers contained Illumina next-generation sequencing adaptor sequences. PCR was done as follows: IX Phusion Flash Master Mix, 3 ⁇ of captured DNA and 200nM primers, using the following cycle: 10s @ 98°C, 8X of (Is @ 98°C, 5s @ 58°C, 10s @ 72°C), 25X of (Is @ 98°C, 15s @ 72°C), 60s @ 72°C.
  • PCR reactions were mixed and the resulting library was size selected to include effective captures ( ⁇ 230bp) and exclude “empty” captures ( ⁇ 150bp) using Agencourt AMPure XP beads (Beckman Coulter). Libraries were sequenced using MiSeq and HiSeq2500 systems (Illumina).
  • methylation data were obtained from the TCGA analysis of about 450,000 sites generated using the Infinium 450K Methylation Array. Methylation profiles for breast cancer tissue and normal breast tissue were analyzed. Four clinical covariates were used, which includes:
  • Gender (categorical) with two levels: Female/ Male;
  • Race (categorical) with three levels: Asian, Black or African American and White. The category American Indian or Alaska Native was removed due to insufficient number of observations;
  • colon cancer tissue 404
  • colon normal tissue 45 [0242] liver cancer tissue: 377
  • liver normal tissue 50
  • lung cancer tissue 839
  • lung normal tissue 74
  • each dataset (or sample set) were split into a training set and a test set with a 2: 1 ratio.
  • a pre-screening procedure was used first to remove excessive noise on the training data using the 'moderated t-statistics ' (Smyth, G. "Linear models and empirical bayes methods for assessing differential expression in microarray experiments," Statistical Applications in Genetics and Molecular Biology 3(1): 1- 25 (2004)).
  • t-statistics ' Semth, G. "Linear models and empirical bayes methods for assessing differential expression in microarray experiments," Statistical Applications in Genetics and Molecular Biology 3(1): 1- 25 (2004).
  • For each set of comparison one type of sample was compared against all other 7 types of samples. A list of markers with significantly difference in mean among all 8 sets of comparisons were retained for future analysis.
  • the Benjamini-Hochberg procedure was used to remove excessive noise on the training data using the 'moderated t-statistics ' (Smyth, G. "Linear models and empirical bayes methods
  • Methodological p289-300, 1995 was used to control the FDR at significance level 0.05.
  • least absolute shrinkage and selection operator LASSO
  • the tuning parameter was determined by the expected generalization error estimated from 10-fold cross-validation. Similar to survival analysis in Example 2, the random split scheme was repeated for 10 times to stabilize the variable selection procedure.
  • a composite panel was constructed by keeping markers with a high selection probability and disregard those with low selection probability from the 10 sets of markers selected from the aforementioned procedure.
  • a multi-class prediction system based on (Friedman et al., "Regularization paths for generalized linear models via coordinate descent," Journal of statistical software, 33(1): 1, 2010) was constructed to predict the group membership of samples in the test data using the panel of markers selected.
  • a confusion matrix and ROC curves were also provided to evaluate sensitivity and specificity, in addition to prediction accuracy.
  • Table 1 shows a list of markers presented in at least 7 out of 10 random split. Based on 10 random split, the median prediction accuracy on test data was 98.0% with minimum 47.7% and maximum 99.1%. In some instances, this list of markers is used for diagnostic purposes.
  • Table 2 shows the confusion matrix (or error matrix) on TCGA test dataset. The prediction is based on a list of markers presented in at least 7 out of 10 random split.
  • DNA methylation data were obtained from the TCGA analysis of about 27,000 sites generated using the Infinium 450K Methylation Array. Methylation profile for breast cancer tissue was analyzed. Four clinical covariates were used as described in Example 1.
  • the data were further modified by removal of 1) negative and 0 survival time; or 2) missing value in any of the four clinical and demographic covariates; to generate 967 breast cancer samples with 103 events (the event of interest was defined as death) for subsequent diagnostic analysis.
  • Colon cancer 365 observations with 53 events
  • Lung adenocarcinoma 516 observations with 141 events;
  • Lung squamous cell carcinoma 418 observations with 150 events;
  • LASSO Least Absolute Shrinkage and Selection Operator
  • a Cox proportional hazards model was fitted on the training data using markers selected at the optimal step as the covariates.
  • the predictability of the model was evaluated by p 2 on the training data and concordance probability (also known as c-index) on the test data.
  • p 2 - the proportion of explained randomness (O'Quigley et al., "Explained randomness in proportional hazards models," Statistics in medicine, 24(3): 479-489, 2005), is a function of Kullback- Leibler information gain bounded between 0 and 1, with a larger value indicating larger proportion of randomness explained.
  • Table 3 illustrates a list of markers selected in 3 out of 10 training/test split. In some instances, the list of markers is used for prognosis of a subject having breast cancer.
  • Table 4 illustrates validation and prediction performance.
  • Fig. 1 illustrates Kaplan-Meier curves from LASSO (left panel) and Bosting (right panel).
  • Fig. 2 shows Cox proportional hazards regression prediction curves from LASSO
  • Fig. 3 shows a multiclass ROC curve from LASSO.
  • Example 4 Diagnosis of breast cancer or ovarian cancer utilizing a cell-free DNA sample
  • Cell-free DNA sample was obtained from a QIAamp Circulating Nucleic Acid Kit. Methylation profile of biomarker cpl0673833 (Cob-2) was used for the analysis.
  • Figs. 12 show boxplots for the methylation changes in four different response groups.
  • Tukey's post-hoc analysis Table 8
  • a pairwise comparison was conducted between all possible combinations.
  • the CR and PR groups were combined as the response group, and repeated the aforementioned analysis (Fig. 13).
  • Tukey's post-hoc analysis Table 10
  • Fig. 14 shows methylation rate of Cob-2 from a subject having ovarian cancer relative to the methylation rate of Cob-2 from a normal subject. Upon treatment, the rate of methylation is observed to decrease in the absence of tumor burden (Fig. 14A). Fig. 14B shows a boxplot of the methylation changes in the different response group. Table 7. Summary statistics mean (standard deviation) and ANOVA results for breast cancer
  • Methylation Correlated Block This procedure combined between 2 and 22 CpG positions in each block to identify a total number of BCMs in each diagnostic category within the padlock data. Methylation frequencies for entire MCBs were calculated by summing up the numbers of Cs at all interrogated CpG positions within a BCM and dividing by the total number of C+Ts at those positions Pearson correlation coefficients between methylation frequencies of each pair of CpG markers separated by no more than 200bp were calculated separately from 30 cancer and 30 corresponding normal tissue samples from each of the two diagnostic categories. A value of Pearson's r ⁇ 0.5 was used to identify transition spots (boundaries) between any two adjacent markers indicating uncorrelated methylation. Markers not separated by a boundary were combined into
  • Methylation Correlated Block MBB. Methylation frequencies for entire BCMs were calculated by summing up the numbers of Cs at all interrogated CpG positions within a BCM and dividing by the total number of C+Ts at those positions.
  • FIG. 15 illustrates an exemplary BCM for breast cancer.
  • Data was compiled from both healthy tissue samples and corresponding cancers.
  • Row I represents a CG dinucieodide analyzed in this study. Subset of those correspond to CG markers included on Ulumina's Infmium HimiaiiMethyiation450 BeadChip (leftmost column), whereas the majority represent previously unknown potential novel markers.
  • Ro II lists genomic distances between markers and Row III shows genomic location of each analyzed CG.
  • Each row within Row I illustrates Pearson correlation coefficients r2 between ⁇ values of two closely positioned CGs calculated for samples from each tissue type separately.
  • Correlation between any two markers is represented by a gray square at the intersection of (virtual) perpendicular lines originating from these two markers.
  • White color indicates no significant correlation
  • gray color intensity marks r:2 values between 0,5 and I Black boxes indicate the ends of analyzed regions.
  • TCGA DNA methylation and RNAseq expression data for breast cancer samples are obtained from the TCGA website.
  • the degree of DNA methylation at each CpG is denoted as a beta value and is calculated as (M/(M+U)), where M and U are normalized values representing the methylated and unmethylated allele intensities respectively.
  • Beta values range from 0 to 1 and reflect the fraction of methylated alleles at each CpG in each sample.
  • the methylation beta value is calculated for all 485,000 markers for each of the breast tumor and matched normal breast tissues in the TCGA data. CpG markers with a mean value less than .05 or greater than .95 are selected for further evaluation.
  • Markers with a difference between the mean methylation value for the tumor tissue and the mean methylation value of the corresponding normal tissue of greater than 0.5 are also selected. At the intersection of these two groups, markers for which the mean methylation is ⁇ 05 for normal breast tissue samples and the difference between normal and tumor is greater than 0.5 are further selected and the genes associated with these markers are identified. For each marker, the tumor samples are then separated into those with methylation values greater than the mean value of the tumor samples and those with methylation values less than the mean value of the tumor samples. Next, the RNAseq data in the TCGA data is examined and the relative expression of each gene is calculated. Because of the wide variation of the expression values, the values are adjusted as follows: log2 (expression Value + 1). Genes are identified in which the difference in the methylation values correlated with variation in the associated gene expression levels. Genes for which there is a correlation were selected for further functional evaluation and validation.
  • Tumor and corresponding far site samples of the same tissue are obtained from patients who underwent surgical tumor resection; samples are frozen and preserved at -80°C until use. Isolation of DNA and RNA from samples is performed using AllPrep DNA/RNA Mini kit (Qiagen, Valencia, CA) according to the manufacturer's recommendations. During RNA isolation, the sample is subjected to on-column DNase digestion. RNA is quantified using a Nanodrop 2000 (Thermo Scientific). 200ng RNA of each sample is used for cDNA synthesis using iScript cDNA synthesis kit (Bio-rad, Inc) according to the manufacturer's instructions.
  • qPCR is performed by a standard 40-cycle amplification protocol using gene-specific primers and a Power SYBR Green PCR Master Mix on a 7500 Real Time PCR system (Applied Biosystems). Experiments are carried out in triplicate and normalized to endogenous ACTB levels. Relative fold change in expression is calculated using the AACT method (cycle threshold values ⁇ 30).
  • Human breast cancer cell line MDA-MB-231 and the human embryonic kidney cell line HEK293a are obtained from American type culture collection (Manassas, VA, USA) and cultured according to their instructions.
  • the expression construct for a gene disclosed herein is purchased from Origene in a form of TrueORF ® cDNA clones in pCMV6-Entry vector. cDNAs are shuttled into pLenti-C-mGFP (Origene) to create a lentivector encoding a fusion protein between the desired gene and mGFP.
  • Lentiviral particles are made by co-transfection of HEK-293T cells with a breast cancer gene mGFP lentivector together with a third-generation packaging vector using calcium phosphate precipitation. Viral supernatants are collected 36 hours post-transfection.
  • Human breast cancer cell line MDA-DB-231 are plated in a 6-well plate the day before transfection of the breast cancer gene mGFP lentivector.
  • Stable cell lines are generated by infecting cells with viral particles at the MOI of ⁇ 5 for 24hrs and are collected and sorted to 100% GFP - positivity using FACS. The GFP positive cells are then used for a colony formation assay in cell culture and tumor xenograft in nude mice.
  • mice All animal studies are performed in accordance with institutional and international animal regulations. Animal protocols are approved by the Institutional Animal Care and Use Committee of Sun Yat- Sen University. Female athymic BALB/c nude mice (4-5 weeks of age, 18-20 g) are purchased from a vendor (Guangdongzhou Laboratory Animal Center, Guangzhou, China).
  • Table 11 A-Table 1 IB illustrate the gene names referenced by the CpG sites described herein.
  • Table 11 A illustrates the CpG sites and the respective gene names.
  • Table 1 IB shows the associated chromosome location with the CpG sites described Genome CH Chromosome Coordinate 3
  • Table 12 illustrates CpG sequences described herein.
  • Embodiment 1 refers to a method of generating a methylation profile of a biomarker in a subject in need thereof, comprising: (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject; (b) detecting a hybridization between the extracted genomic DNA and a probe, wherein the probe hybridizes to a biomarker selected from cg01327147 (uncharacterized family 31 glucosidase KIAA1161), cg02680086 (solute carrier family 43 member 1), cg04772948 (uncharacterized LOC284788), cg04917276 (HNF1 homeobox B), cg05395187 (nuclear receptor corepressor 2), cg07493516, cg08268679, cg08549335 (zinc and ring finger 2, E3 ubiquitin
  • Embodiment 2 the method of embodiment 1, wherein the methylation profile comprises cgl0673833.
  • Embodiment 3 the method of embodiment 1, wherein the methylation profile comprises one or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083,
  • Embodiment 4 the method of embodiment 1, wherein the methylation profile comprises cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918,
  • Embodiment 5 the method of embodiment 1, wherein the probe comprises a structure of Formula I:
  • A is a first target-binding region
  • B is a second target-binding region
  • L is a linker region
  • A comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 30 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37;
  • B comprises at least 70%, 80%, 90%, 95%), or 99% sequence identity to at least 12 contiguous nucleotides starting at position from the 3' terminus of the same sequence selected from SEQ ID NOs: 1- 37;
  • L is attached to A; and B is attached to either A or L.
  • Embodiment 6 the method of embodiment 5, wherein the probe comprises a structure of Formula la: A L 8
  • Embodiment 7 the method of embodiment 5, wherein A comprises at least 70%, 80%), 90%), 95%), or 99% sequence identity to at least 40 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37.
  • Embodiment 8 the method of embodiment 5, wherein A comprises at least 70%, 80%), 90%), 95%), or 99% sequence identity to at least 50 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37.
  • Embodiment 9 the method of embodiment 5, wherein B comprises at least 70%, 80%), 90%), 95%), or 99% sequence identity to at least 15 contiguous nucleotides starting at position from the 3' terminus of the same sequence selected from SEQ ID NOs: 1-37.
  • Embodiment 10 the method of embodiment 5, wherein B comprises at least 70%, 80%), 90%), 95%), or 99% sequence identity to at least 20 contiguous nucleotides starting at position from the 3' terminus of the same sequence selected from SEQ ID NOs: 1-37.
  • Embodiment 11 the method of embodiment 5, wherein L is about 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides in length.
  • Embodiment 12 the method of embodiment 1, wherein the probe comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a sequence selected from SEQ ID NOs: 1-37.
  • Embodiment 13 the method of embodiment 1, wherein the generating further comprises generating a pair-wise methylation difference dataset comprising: (i) a first difference between the methylation profile of the treated genomic DNA with a methylation profile of a first normal sample; (ii) a second difference between a methylation profile of a second normal sample and a methylation profile of a third normal sample; and (iii) a third difference between a methylation profile of a first primary cancer sample and a methylation profile of a second primary cancer sample.
  • Embodiment 14 the method of embodiment 13, wherein the generating further comprises analyzing the pair-wise methylation difference dataset with a control by a machine learning method to generate the methylation profile.
  • Embodiment 15 the method of embodiment 13, wherein the first primary cancer sample is a breast cancer sample.
  • Embodiment 16 the method of embodiment 13, wherein the second primary cancer sample is a non-breast cancer sample.
  • Embodiment 17 the method of embodiment 14, wherein the control comprises a set of methylation profiles, wherein each said methylation profile is generated from a biological sample obtained from a known cancer type.
  • Embodiment 18 the method of embodiment 17, wherein the known cancer type is breast cancer.
  • Embodiment 19 the method of embodiment 17, wherein the known cancer type is a relapsed or refractory breast cancer.
  • Embodiment 20 the method of embodiment 17, wherein the known cancer type is a metastatic breast cancer.
  • Embodiment 21 the method of embodiment 17, where the known cancer type is ductal carcinoma in situ, invasive or infiltrating ductal carcinoma, invasive or infiltrating lobular carcinoma, lobular carcinoma in situ, inflammatory breast cancer, Paget disease of the nipple, Phyllodes tumor, angiosarcoma, metaplastic carcinoma, low-grade adenosquamous carcinoma, spindle cell carcinoma of the breast, squamous carcinoma, triple-negative breast cancer, or mixed carcinoma.
  • the known cancer type is ductal carcinoma in situ, invasive or infiltrating ductal carcinoma, invasive or infiltrating lobular carcinoma, lobular carcinoma in situ, inflammatory breast cancer, Paget disease of the nipple, Phyllodes tumor, angiosarcoma, metaplastic carcinoma, low-grade adenosquamous carcinoma, spindle cell carcinoma of the breast, squamous carcinoma, triple-negative breast cancer, or mixed carcinoma.
  • Embodiment 22 the method of embodiment 21, where invasive ductal carcinoma comprises tubular carcinoma of the breast, medullary carcinoma of the breast, mucinous (or colloid) carcinoma of the breast, papillary carcinoma of the breast, micropapillary carcinoma, or cribriform carcinoma of the breast.
  • Embodiment 23 the method of embodiment 14, wherein the machine learning method utilizes an algorithm selected from one or more of the following: a principal component analysis, a logistic regression analysis, a nearest neighbor analysis, a support vector machine, and a neural network model.
  • Embodiment 24 the method of embodiment 1, wherein the method further comprises performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers prior to generating the methylation profile.
  • Embodiment 25 refers to a method of selecting a subject suspected of having breast cancer for treatment, the method comprising: (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject suspected of having breast cancer; (b) generating a methylation profile comprising one or more biomarkers selected from: cg01327147 (uncharacterized family 31 glucosidase
  • cg02680086 (solute carrier family 43 member 1), cg04772948 (uncharacterized LOC284788), cg04917276 (HNFl homeobox B), cg05395187 (nuclear receptor corepressor 2), cg07493516, cg08268679, cg08549335 (zinc and ring finger 2, E3 ubiquitin protein ligase), cg09819083, cgl3976210 (dual specificity phosphatase 12), cgl4817783 (Kelch like family member 23), cgl5412918, cgl8482112, cg20069090 (RNA polymerase subunit D), cg24732563, cg00886954 (plectin), cg23690893 (trans-2,3-enoyl-CoA reductase), and eg 10673833 (myosin IG) from the extracted genomic
  • Embodiment 26 the method of embodiment 25, wherein the methylation profile comprises cgl0673833.
  • Embodiment 27 the method of embodiment 25, wherein the methylation profile comprises one or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112, cg20069090, cg24732563, cg00886954, and cg23690893.
  • biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl
  • Embodiment 28 the method of embodiment 25, wherein the methylation profile comprises cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112, cg20069090, cg24732563, cg00886954, and cg23690893.
  • Embodiment 29 the method of embodiment 25, wherein the comparing further comprises generating a pair-wise methylation difference dataset comprising: (i) a first difference between the methylation profile of the treated genomic DNA with a methylation profile of a first normal sample; (ii) a second difference between a methylation profile of a second normal sample and a methylation profile of a third normal sample; and (iii) a third difference between a methylation profile of a first primary cancer sample and a methylation profile of a second primary cancer sample.
  • Embodiment 30 the method of embodiment 29, wherein the comparing further comprises analyzing the pair-wise methylation difference dataset with a control by a machine learning method to generate the methylation profile.
  • Embodiment 31 the method of embodiment 29, wherein the first primary cancer sample is a breast cancer sample.
  • Embodiment 32 the method of embodiment 29, wherein the second primary cancer sample is a non-breast cancer sample.
  • Embodiment 33 the method of embodiment 30, wherein the control comprises a set of methylation profiles, wherein each said methylation profile is generated from a biological sample obtained from a known cancer type.
  • Embodiment 34 the method of embodiment 33, wherein the known cancer type is breast cancer.
  • Embodiment 35 the method of embodiment 33, wherein the known cancer type is a relapsed or refractory breast cancer.
  • Embodiment 36 the method of embodiment 33, wherein the known cancer type is a metastatic breast cancer.
  • Embodiment 37 the method of embodiment 30, wherein the machine learning method utilizes an algorithm selected from one or more of the following: a principal component analysis, a logistic regression analysis, a nearest neighbor analysis, a support vector machine, and a neural network model.
  • Embodiment 38 the method of embodiment 25, wherein the generating further comprises hybridizing each of the one or more biomarkers with a probe, and performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers.
  • Embodiment 39 refers to a method of determining the prognosis of a subject having breast cancer or monitoring the progression of breast cancer in the subject, comprising: (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject having breast cancer; (b) generating a methylation profile comprising one or more biomarkers selected from: cg00819310 (VANGL planar cell polarity protein 1), cg04447890 (G protein-coupled receptor 177), cg08623383 (chromosome 1 open reading frame 38), cg09799714 (PDZ domain containing 3), eg 10971790 (fuzzy planar cell polarity protein), cgl5357639 (8-oxoguanine DNA glycosylase), cgl7188046 (T brachyury transcription factor), cg21230435 (VANGL
  • Embodiment 40 the method of embodiment 39, wherein the methylation profile comprises cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361 and cg24229963.
  • Embodiment 41 the method of embodiment 39, wherein the methylation profile further comprises one or more biomarkers selected from: cg24714666, cg03156547 (cadherin 24), cg06605933 (BolA family member 1), cg09601629 (coiled-coil domain containing 15), cgl3278334 (PIH1 domain containing 1), cgl 1851098 (WBP2 N-terminal like), cgl2188860 (topoisom erase (DNA) I, mitochondrial), cg25189085 (SH3 and cysteine rich domain 3), and cg25488021 (erythrocyte membrane protein band 4.1 like 2).
  • biomarkers selected from: cg24714666, cg03156547 (cadherin 24), cg06605933 (BolA family member 1), cg09601629 (coiled-coil domain containing 15), cgl3278334 (PIH
  • Embodiment 42 the method of embodiment 39, wherein the methylation profile further comprises cg24714666.
  • Embodiment 43 the method of embodiment 39, wherein the methylation profile further comprises one or more biomarkers selected from: cg03156547, cg06605933, cg09601629, cgl3278334, cgl 1851098, cgl2188860, cg25189085, and cg25488021.
  • Embodiment 44 the method of embodiment 39, wherein the methylation profile further comprises cg24714666, cg03156547, cg06605933, cg09601629, cgl3278334, cgl 1851098, cgl2188860, cg25189085, and cg25488021.
  • Embodiment 45 the method of embodiment 39, wherein the methylation score of from about 1.5 to about 3 is indicative of a survival for at least 6 months, at least 1 year, at least 1.5 years, at least 2 years, at least 2.5 years, at least 3 years, at least 4 years, or at least 5 years.
  • Embodiment 46 the method of embodiment 39, wherein the methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 6 months, at least 1 year, at least 1.5 years, at least 2 years, at least 2.5 years, at least 3 years, at least 4 years, or at least 5 years.
  • Embodiment 47 the method of embodiment 39, wherein the methylation score of less than 1.5 is indicative of a survival of less than 5 years, less than 4 years, less than 3 years, less than 2.5 years, less than 2 years, less than 1.5 years, less than 1 year, or less than 6 months.
  • Embodiment 48 the method of embodiment 39, wherein the methylation score is calculated based on Cox proportional hazards (PH) regression analysis.
  • Embodiment 49 the method of embodiment 39, wherein breast cancer is metastatic breast cancer.
  • Embodiment 50 the method of embodiment 39, wherein breast cancer is ductal carcinoma in situ, invasive or infiltrating ductal carcinoma, invasive or infiltrating lobular carcinoma, lobular carcinoma in situ, inflammatory breast cancer, Paget disease of the nipple, Phyllodes tumor, angiosarcoma, metaplastic carcinoma, low-grade adenosquamous carcinoma, spindle cell carcinoma of the breast, squamous carcinoma, triple-negative breast cancer, or mixed carcinoma.
  • Embodiment 51 the method of embodiment 50, where invasive ductal carcinoma comprises tubular carcinoma of the breast, medullary carcinoma of the breast, mucinous (or colloid) carcinoma of the breast, papillary carcinoma of the breast, micropapillary carcinoma, or cribriform carcinoma of the breast.
  • Embodiment 52 the method of embodiment 39, wherein the generating further comprises hybridizing each of the one or more biomarkers with a probe, and performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers.
  • Embodiment 53 refers to a method of selecting a subject suspected of having ovarian cancer for treatment, the method comprising: (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject suspected of having ovarian cancer; (b) generating a methylation profile comprising biomarker cgl0673833 (myosin IG) from the extracted genomic DNA; (c) comparing the methylation profile of the biomarkers with a control; (d) identifying the subject as having ovarian cancer if the methylation profile correlates to the control; and (e) administering an effective amount of a therapeutic agent to the subject if the subject is identified as having ovarian cancer.
  • Embodiment 54 the method of embodiment 53, wherein the comparing further comprises generating a pair-wise methylation difference dataset comprising: (i) a first difference between the methylation profile of the treated genomic DNA with a methylation profile of a first normal sample; (ii) a second difference between a methylation profile of a second normal sample and a methylation profile of a third normal sample; and (iii) a third difference between a methylation profile of a first primary cancer sample and a methylation profile of a second primary cancer sample.
  • Embodiment 55 the method of embodiment 54, wherein the comparing further comprises analyzing the pair-wise methylation difference dataset with a control by a machine learning method to generate the methylation profile.
  • Embodiment 56 the method of embodiment 54, wherein the first primary cancer sample is an ovarian cancer sample.
  • Embodiment 57 the method of embodiment 54, wherein the second primary cancer sample is a non-ovarian cancer sample.
  • Embodiment 58 the method of embodiment 55, wherein the control comprises a set of methylation profiles, wherein each said methylation profile is generated from a biological sample obtained from a known cancer type.
  • Embodiment 59 the method of embodiment 58, wherein the known cancer type is ovarian cancer.
  • Embodiment 60 the method of embodiment 58, wherein the known cancer type is a relapsed or refractory ovarian cancer.
  • Embodiment 61 the method of embodiment 58, wherein the known cancer type is a metastatic ovarian cancer.
  • Embodiment 62 the method of embodiment 55, wherein the machine learning method utilizes an algorithm selected from one or more of the following: a principal component analysis, a logistic regression analysis, a nearest neighbor analysis, a support vector machine, and a neural network model.
  • Embodiment 63 the method of embodiment 53, wherein the generating further comprises hybridizing each of the one or more biomarkers with a probe, and performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers.
  • Embodiment 64 refers to a method of generating a methylation profile of a biomarker in a subject in need thereof, comprising: (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject; (b) detecting a hybridization between the extracted genomic DNA and a probe, wherein the probe hybridizes to biomarker cgl0673833 (myosin IG); and (c) generating a methylation profile based on the detected hybridization between the extracted genomic DNA and the probe.
  • Embodiment 65 the method of any one of the embodiments 38, 52, or 63, wherein the probe comprises a structure of Formula I:
  • A is a first target-binding region
  • B is a second target-binding region
  • L is a linker region
  • A comprises at least 70%, 80%>, 90%, 95%, or 99% sequence identity to at least 30 contiguous nucleotides starting at position 1 from the 5 ' terminus of a sequence selected from SEQ ID NOs: 1 -37;
  • B comprises at least 70%, 80%, 90%, 95%o, or 99%o sequence identity to at least 12 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1 - 37;
  • L is attached to A; and B is attached to either A or L.
  • Embodiment 66 the method of embodiment 65, wherein the probe comprises a structure of Formula la:
  • Embodiment 67 the method of embodiment 65, wherein A comprises at least 70%, 80%), 90%), 95%o, or 99% sequence identity to at least 40 contiguous nucleotides starting at position 1 from the 5 ' terminus of a sequence selected from SEQ ID NOs: 1 -37.
  • Embodiment 68 the method of embodiment 65, wherein A comprises at least 70%, 80%), 90%), 95%o, or 99% sequence identity to at least 50 contiguous nucleotides starting at position 1 from the 5 ' terminus of a sequence selected from SEQ ID NOs: 1 -37.
  • Embodiment 69 the method of embodiment 65, wherein B comprises at least 70%, 80%), 90%), 95%o, or 99% sequence identity to at least 15 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1 -37.
  • Embodiment 70 the method of embodiment 65, wherein B comprises at least 70%, 80%), 90%), 95%o, or 99% sequence identity to at least 20 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1 -37.
  • Embodiment 71 the method of embodiment 65, wherein L is about 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides in length.
  • Embodiment 72 the method of any one of the embodiments 38, 52, or 63, wherein the probe comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a sequence selected from SEQ ID NOs: 1-37.
  • Embodiment 73 the method of any one of the preceding embodiments, wherein the biological sample comprises a blood sample.
  • Embodiment 74 the method of any one of the preceding embodiments, wherein the biological sample comprises a tissue biopsy sample.
  • Embodiment 75 the method of any one of the preceding embodiments, wherein the biological sample comprises circulating tumor cells.
  • Embodiment 76 the method of any one of the preceding embodiments, wherein the subject is a human.
  • Embodiment 77 refers to a kit comprising a set of nucleic acid probes that hybridizes to biomarkers: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783,
  • Embodiment 78 refers to a kit comprising a set of nucleic acid probes that hybridizes to biomarkers: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361, and cg24229963.
  • Embodiment 79 the kit of embodiment 78, wherein the kit further comprises a nucleic acid probe that hybridizes to a biomarker selected from cg24714666, cg03156547, cg06605933, cg09601629, cgl3278334, cgl 1851098, cgl2188860, cg25189085, and cg25488021.
  • a biomarker selected from cg24714666, cg03156547, cg06605933, cg09601629, cgl3278334, cgl 1851098, cgl2188860, cg25189085, and cg25488021.
  • Embodiment 80 the kit of any one of the embodiments 77-79, wherein the set of nucleic acid probes comprises a set of probes selected from SEQ ID NOs: 1-37.
  • Embodiment 81 refers to a kit comprising a nucleic acid probe that hybridizes to biomarker cgl0673833.
  • Embodiment 82 the kit of embodiment 81, wherein the nucleic acid probe comprises SEQ ID NO: 18.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Disclosed herein are methods and kits for identifying a subject as having breast cancer. Also provided herein are methods and kits for determining the prognosis of a subject having breast cancer and for determining the progression of breast cancer in a subject.

Description

BREAST AND OVARIAN CANCER METHYLATION MARKERS AND USES
THEREOF
CROSS-REFERENCE
[0001] This application claims the benefit of U.S. Provisional Application No. 62/358,771, filed July 6, 2016, which application is incorporated herein by reference.
BACKGROUND OF THE DISCLOSURE
[0002] Cancer is a leading cause of deaths worldwide, with annual cases expected to increase from 14 million in 2012 to 22 million during the next two decades (WHO).
Diagnostic procedures for breast cancer or ovarian cancer, in some cases, begin only after a patient is already present with symptoms, leading to costly, invasive, and sometimes time- consuming procedures. In addition, inaccessible areas sometimes prevent an accurate diagnosis. Further, high cancer morbidities and mortalities are associated with late diagnosis.
SUMMARY OF THE DISCLOSURE
[0003] Provided herein are methods and kits for identifying a subject as having breast cancer or ovarian cancer. Also provided herein are methods and kits for determining the prognosis of a subject having breast cancer or ovarian cancer. Further provided herein are methods and kits for determining the progression of breast cancer or ovarian cancer in a subject.
[0004] In certain embodiments, provided herein is a method of selecting a subject suspected of having breast cancer for treatment, the method comprising: (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject suspected of having breast cancer; (b) generating a methylation profile comprising one or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112,
cg20069090, cg24732563, cg00886954, cg23690893, and cgl0673833 from the extracted genomic DNA; (c) comparing the methylation profile of the one or more biomarkers with a control; (d) identifying the subject as having breast cancer if the methylation profile correlates to the control; and (e) administering an effective amount of a therapeutic agent to the subject if the subject is identified as having breast cancer. [0005] In some embodiments, the methylation profile comprises cgl0673833.
[0006] In some embodiments, the methylation profile comprises one or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783,
cgl5412918, cgl8482112, cg20069090, cg24732563, cg00886954, and cg23690893.
[0007] In some embodiments, the methylation profile comprises cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335,
cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112, cg20069090,
cg24732563, cg00886954, and cg23690893.
[0008] In some embodiments, the comparing further comprises generating a pair-wise methylation difference dataset comprising: (i) a first difference between the methylation profile of the treated genomic DNA with a methylation profile of a first normal sample; (ii) a second difference between a methylation profile of a second normal sample and a
methylation profile of a third normal sample; and (iii) a third difference between a methylation profile of a first primary cancer sample and a methylation profile of a second primary cancer sample.
[0009] In some embodiments, the comparing further comprises analyzing the pair-wise methylation difference dataset with a control by a machine learning method to generate the methylation profile.
[0010] In some embodiments, the first primary cancer sample is a breast cancer sample.
[0011] In some embodiments, the second primary cancer sample is a non-breast cancer sample.
[0012] In some embodiments, the control comprises a set of methylation profiles, wherein each said methylation profile is generated from a biological sample obtained from a known cancer type.
[0013] In some embodiments, the known cancer type is breast cancer. In some
embodiments, the known cancer type is a relapsed or refractory breast cancer. In some embodiments, the known cancer type is a metastatic breast cancer.
[0014] In some embodiments, the machine learning method utilizes an algorithm selected from one or more of the following: a principal component analysis, a logistic regression analysis, a nearest neighbor analysis, a support vector machine, and a neural network model.
[0015] In some embodiments, the generating further comprises hybridizing each of the one or more biomarkers with a probe, and performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers. [0016] In some embodiments, the biological sample comprises a blood sample. In some embodiments, the biological sample comprises a tissue biopsy sample. In some embodiments, the biological sample comprises circulating tumor cells.
[0017] In some embodiments, the subject is a human.
[0018] In certain embodiments, provided herein is a method of generating a methylation profile of a biomarker in a subject in need thereof, comprising: (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject; (b) detecting a hybridization between the extracted genomic DNA and a probe, wherein the probe hybridizes to a biomarker selected from cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112,
cg20069090, cg24732563, cg00886954, cg23690893, and cgl0673833; and (c) generating a methylation profile based on the detected hybridization between the extracted genomic DNA and the probe.
[0019] In some embodiments, the methylation profile comprises cgl0673833.
[0020] In some embodiments, the methylation profile comprises one or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783,
cgl5412918, cgl8482112, cg20069090, cg24732563, cg00886954, and cg23690893.
[0021] In some embodiments, the methylation profile comprises cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335,
cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112, cg20069090,
cg24732563, cg00886954, and cg23690893.
[0022] In some embodiments, the generating further comprises generating a pair-wise methylation difference dataset comprising: (i) a first difference between the methylation profile of the treated genomic DNA with a methylation profile of a first normal sample; (ii) a second difference between a methylation profile of a second normal sample and a
methylation profile of a third normal sample; and (iii) a third difference between a
methylation profile of a first primary cancer sample and a methylation profile of a second primary cancer sample.
[0023] In some embodiments, the generating further comprises analyzing the pair-wise methylation difference dataset with a control by a machine learning method to generate the methylation profile. [0024] In some embodiments, the first primary cancer sample is a breast cancer sample.
[0025] In some embodiments, the second primary cancer sample is a non-breast cancer sample.
[0026] In some embodiments, the control comprises a set of methylation profiles, wherein each said methylation profile is generated from a biological sample obtained from a known cancer type.
[0027] In some embodiments, the known cancer type is breast cancer. In some
embodiments, the known cancer type is a relapsed or refractory breast cancer. In some embodiments, the known cancer type is a metastatic breast cancer. In some embodiments, the known cancer type is ductal carcinoma in situ, invasive or infiltrating ductal carcinoma, invasive or infiltrating lobular carcinoma, lobular carcinoma in situ, inflammatory breast cancer, Paget disease of the nipple, Phyllodes tumor, angiosarcoma, metaplastic carcinoma, low-grade adenosquamous carcinoma, spindle cell carcinoma of the breast, squamous carcinoma, triple-negative breast cancer, or mixed carcinoma. In some embodiments, invasive ductal carcinoma comprises tubular carcinoma of the breast, medullary carcinoma of the breast, mucinous (or colloid) carcinoma of the breast, papillary carcinoma of the breast, micropapillary carcinoma, or cribriform carcinoma of the breast.
[0028] In some embodiments, the machine learning method utilizes an algorithm selected from one or more of the following: a principal component analysis, a logistic regression analysis, a nearest neighbor analysis, a support vector machine, and a neural network model.
[0029] In some embodiments, the method further comprises performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers prior to generating the methylation profile.
[0030] In some embodiments, the biological sample comprises a blood sample. In some embodiments, the biological sample comprises a tissue biopsy sample. In some embodiments, the biological sample comprises circulating tumor cells.
[0031] In some embodiments, the subject is a human.
[0032] In certain embodiments, provided herein is a method of determining the prognosis of a subject having breast cancer or monitoring the progression of breast cancer in the subject, comprising: (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject having breast cancer; (b) generating a methylation profile comprising one or more biomarkers selected from:
cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361, and cg24229963 from the extracted genomic DNA; (c) obtaining a methylation score based on the methylation profile of the one or more biomarkers; and (d) based on the methylation score, initiate a first treatment, decrease a dosage of a first therapeutic agent if the subject has experienced a remission, initiate a second treatment if the subject has experienced a relapse, or switch to a second therapeutic agent if the subject becomes refractory to the first therapeutic agent.
[0033] In some embodiments, the methylation profile comprises cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435,
cg22043361, and cg24229963.
[0034] In some embodiments, the methylation profile further comprises one or more biomarkers selected from: cg24714666, cg03156547, cg06605933, cg09601629,
cgl3278334, cg23653712, cgl l851098, cgl2188860, cg25189085 and cg25488021. In some embodiments, the methylation profile further comprises one or more biomarkers selected from: cg24714666, cg03156547, cg06605933, cg09601629, cgl3278334, cgl l851098, cgl2188860, cg25189085, and cg25488021.
[0035] In some embodiments, the methylation profile further comprises cg24714666.
[0036] In some embodiments, the methylation profile further comprises one or more biomarkers selected from: cg03156547, cg06605933, cg09601629, cgl3278334,
cgl 1851098, cgl2188860, cg25189085, and cg25488021.
[0037] In some embodiments, the methylation profile further comprises cg24714666, cg03156547, cg06605933, cg09601629, cgl3278334, cgl l851098, cgl2188860,
cg25189085, and cg25488021.
[0038] In some embodiments, the methylation score of from about 1.5 to about 3 is indicative of a survival for at least 6 months. In some embodiments, the methylation score of from about 1.5 to about 3 is indicative of a survival for at least 1 year. In some embodiments, the methylation score of from about 1.5 to about 3 is indicative of a survival for at least 1.5 years. In some embodiments, the methylation score of from about 1.5 to about 3 is indicative of a survival for at least 2 years. In some embodiments, the methylation score of from about 1.5 to about 3 is indicative of a survival for at least 2.5 years. In some embodiments, the methylation score of from about 1.5 to about 3 is indicative of a survival for at least 3 years. In some embodiments, the methylation score of from about 1.5 to about 3 is indicative of a survival for at least 4 years. In some embodiments, the methylation score of from about 1.5 to about 3 is indicative of a survival for at least 5 years. [0039] In some embodiments, the methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 6 months. In some embodiments, the methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 1 year. In some
embodiments, the methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 1.5 years. In some embodiments, the methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 2 years. In some embodiments, the methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 2.5 years. In some embodiments, the methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 3 years. In some embodiments, the methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 4 years. In some embodiments, the methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 5 years.
[0040] In some embodiments, the methylation score of less than 1.5 is indicative of a survival of less than 5 years. In some embodiments, the methylation score of less than 1.5 is indicative of a survival of less than 4 years. In some embodiments, the methylation score of less than 1.5 is indicative of a survival of less than 3 years. In some embodiments, the methylation score of less than 1.5 is indicative of a survival of less than 2.5 years. In some embodiments, the methylation score of less than 1.5 is indicative of a survival of less than 2 years. In some embodiments, the methylation score of less than 1.5 is indicative of a survival of less than 1.5 years. In some embodiments, the methylation score of less than 1.5 is indicative of a survival of less than 1 year. In some embodiments, the methylation score of less than 1.5 is indicative of a survival of less than 6 months.
[0041] In some embodiments, the methylation score is calculated based on Cox
proportional hazards (PH) regression analysis.
[0042] In some embodiments, breast cancer is metastatic breast cancer.
[0043] In some embodiments, breast cancer is ductal carcinoma in situ, invasive or infiltrating ductal carcinoma, invasive or infiltrating lobular carcinoma, lobular carcinoma in situ, inflammatory breast cancer, Paget disease of the nipple, Phyllodes tumor, angiosarcoma, metaplastic carcinoma, low-grade adenosquamous carcinoma, spindle cell carcinoma of the breast, squamous carcinoma, triple-negative breast cancer, or mixed carcinoma. In some embodiments, invasive ductal carcinoma comprises tubular carcinoma of the breast, medullary carcinoma of the breast, mucinous (or colloid) carcinoma of the breast, papillary carcinoma of the breast, micropapillary carcinoma, or cribriform carcinoma of the breast. [0044] In some embodiments, the generating further comprises hybridizing each of the one or more biomarkers with a probe, and performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers.
[0045] In some embodiments, the biological sample comprises a blood sample. In some embodiments, the biological sample comprises a tissue biopsy sample. In some embodiments, the biological sample comprises circulating tumor cells.
[0046] In some embodiments, the subject is a human.
[0047] In certain embodiments, provided herein is a method of selecting a subject suspected of having ovarian cancer for treatment, the method comprising: (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject suspected of having ovarian cancer; (b) generating a methylation profile comprising biomarker cgl0673833 from the extracted genomic DNA; (c) comparing the methylation profile of the biomarkers with a control; (d) identifying the subject as having ovarian cancer if the methylation profile correlates to the control; and (e) administering an effective amount of a therapeutic agent to the subject if the subject is identified as having ovarian cancer.
[0048] In some embodiments, the comparing further comprises generating a pair-wise methylation difference dataset comprising: (i) a first difference between the methylation profile of the treated genomic DNA with a methylation profile of a first normal sample; (ii) a second difference between a methylation profile of a second normal sample and a
methylation profile of a third normal sample; and (iii) a third difference between a
methylation profile of a first primary cancer sample and a methylation profile of a second primary cancer sample.
[0049] In some embodiments, the comparing further comprises analyzing the pair-wise methylation difference dataset with a control by a machine learning method to generate the methylation profile.
[0050] In some embodiments, the first primary cancer sample is an ovarian cancer sample.
[0051] In some embodiments, the second primary cancer sample is a non-ovarian cancer sample.
[0052] In some embodiments, the control comprises a set of methylation profiles, wherein each said methylation profile is generated from a biological sample obtained from a known cancer type. [0053] In some embodiments, the known cancer type is ovarian cancer. In some
embodiments, the known cancer type is a relapsed or refractory ovarian cancer. In some embodiments, the known cancer type is a metastatic ovarian cancer.
[0054] In some embodiments, the machine learning method utilizes an algorithm selected from one or more of the following: a principal component analysis, a logistic regression analysis, a nearest neighbor analysis, a support vector machine, and a neural network model.
[0055] In some embodiments, the generating further comprises hybridizing each of the one or more biomarkers with a probe, and performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers.
[0056] In some embodiments, the biological sample comprises a blood sample. In some embodiments, the biological sample comprises a tissue biopsy sample. In some embodiments, the biological sample comprises circulating tumor cells.
[0057] In some embodiments, the subject is a human.
[0058] In certain embodiments, provided herein is a method of generating a methylation profile of a biomarker in a subject in need thereof, comprising: (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject; (b) detecting a hybridization between the extracted genomic DNA and a probe, wherein the probe hybridizes to biomarker eg 10673833; and (c) generating a methylation profile based on the detected hybridization between the extracted genomic DNA and the probe.
[0059] In some embodiments, the generating further comprises generating a pair-wise methylation difference dataset comprising: (i) a first difference between the methylation profile of the treated genomic DNA with a methylation profile of a first normal sample; (ii) a second difference between a methylation profile of a second normal sample and a
methylation profile of a third normal sample; and (iii) a third difference between a
methylation profile of a first primary cancer sample and a methylation profile of a second primary cancer sample.
[0060] In some embodiments, the generating further comprises analyzing the pair-wise methylation difference dataset with a control by a machine learning method to generate the methylation profile.
[0061] In some embodiments, the first primary cancer sample is an ovarian cancer sample.
[0062] In some embodiments, the second primary cancer sample is a non-ovarian cancer sample. [0063] In some embodiments, the control comprises a set of methylation profiles, wherein each said methylation profile is generated from a biological sample obtained from a known cancer type.
[0064] In some embodiments, the known cancer type is ovarian cancer. In some
embodiments, the known cancer type is a relapsed or refractory ovarian cancer. In some embodiments, the known cancer type is a metastatic ovarian cancer. In some embodiments, the known cancer type is epithelial ovarian cancer, stromal cell ovarian tumors, germ cell ovarian tumors, borderline ovarian tumors, small cell ovarian carcinoma, neuro-endocrine carcinomas, squamous cell carcinoma, struma ovarii malignum or psammocarcinoma.
[0065] In some embodiments, the machine learning method utilizes an algorithm selected from one or more of the following: a principal component analysis, a logistic regression analysis, a nearest neighbor analysis, a support vector machine, and a neural network model.
[0066] In some embodiments, the method further comprises performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers prior to generating the methylation profile.
[0067] In some embodiments, the biological sample comprises a blood sample. In some embodiments, the biological sample comprises a tissue biopsy sample. In some embodiments, the biological sample comprises circulating tumor cells.
[0068] In some embodiments, the subject is a human.
[0069] In certain embodiments, provided herein is a kit comprising a set of nucleic acid probes that hybridizes to biomarkers: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210,
cgl4817783, cgl5412918, cgl8482112, cg20069090, cg24732563, cg00886954,
cg23690893, and eg 10673833. In some embodiments, the set of nucleic acid probes comprises a set of padlock probes.
[0070] In certain embodiments, provided herein is kit comprising a set of nucleic acid probes that hybridizes to biomarkers: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361, and cg24229963. In some embodiments, the kit further comprises a nucleic acid probe that hybridizes to a biomarker selected from cg24714666, cg03156547, cg06605933, cg09601629, cgl3278334,
egl 1851098, cgl2188860, cg25189085, and cg25488021. In some embodiments, the set of nucleic acid probes comprises a set of padlock probes. [0071] In certain embodiments, provided herein is kit comprising a nucleic acid probe that hybridizes to biomarker cgl0673833. In some embodiments, the nucleic acid probe comprises a padlock probe.
BRIEF DESCRIPTION OF THE DRAWINGS
[0072] Various aspects of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings of which:
[0073] Fig. 1 illustrates Kaplan-Meier curves from LASSO (left panel) and Bosting (right panel).
[0074] Fig. 2 shows Cox proportional hazards regression prediction curves from LASSO
(left panel) and Boosting (right panel).
[0075] Fig. 3 shows a multiclass ROC curve from LASSO.
[0076] Fig. 4A-Fig. 4B show the distribution of Cob-2 methylation rate of cell-free DNA (cfDNA) in normal and breast cancer plasma.
[0077] Fig. 5 A-Fig. 5B illustrate the methylation rate of Cob-2 of cell-free DNA (cfDNA) in normal and breast cancer plasma.
[0078] Fig. 6A-Fig. 6B illustrate the methylation rate of cell-free DNA (cfDNA) in different subgroup of breast cancer plasma.
[0079] Fig. 7 illustrates the ROC curve of Cob-2 methylateion rate of cell-free DNA (cfDNA).
[0080] Fig. 8A-Fig. 8B show the Cob-2 methylation rate of cell -free DNA (cfDNA) from individual breast cancer patients with partial response (PR) to a therapy.
[0081] Fig. 9A-Fig. 9B show the Cob-2 methylation rate of cell -free DNA (cfDNA) from individual breast cancer patients with stable disease (SD).
[0082] Fig. 1 OA-Fig. 10B show the Cob-2 methylation rate of cell-free DNA (cfDNA) from individual breast cancer patients with progressive disease (PD).
[0083] Fig. 11 A-Fig. 1 IB show the Cob-2 methylation rate of cell-free DNA (cfDNA) from individual breast cancer patients post-surgery.
[0084] Fig. 12 shows a boxplot for methylation change in different response groups for breast cancer. [0085] Fig. 13 shows a boxplot for methylation change in different response groups for breast cancer.
[0086] Fig. 14A-Fig. 14B show the methylation rate of cell-free DNA (cfDNA) in different subgroup of ovarian cancer plasma.
[0087] Fig. 15 illustrates an exemplary BCM for breast cancer.
DETAILED DESCRIPTION OF THE DISCLOSURE
[0088] Cancer is characterized by an abnormal growth of a cell caused by one or more mutations or modifications of a gene leading to dysregulated balance of cell proliferation and cell death. DNA methylation silences expression of tumor suppression genes, and presents itself as one of the first neoplastic changes. Methylation patterns found in neoplastic tissue and plasma demonstrate homogeneity, and in some instances are utilized as a sensitive diagnostic marker. For example, cMethDNA assay has been shown in one study to be about 91% sensitive and about 96% specific when used to diagnose metastatic breast cancer. In another study, circulating tumor DNA (ctDNA) was about 87.2% sensitive and about 99.2% specific when it was used to identify KRAS gene mutation in a large cohort of patients with metastatic colon cancer (Bettegowda et al., Detection of Circulating Tumor DNA in Early- and Late-Stage Human Malignancies. Sci. Transl. Med, 6(224):ra24. 2014). The same study further demonstrated that ctDNA is detectable in >75% of patients with advanced pancreatic, ovarian, colorectal, bladder, gastroesophageal, breast, melanoma, hepatocellular, and head and neck cancers (Bettegowda et al).
[0089] In some embodiments, DNA methylation profiling provides higher clinical sensitivity and dynamic range compared to somatic mutation analysis for cancer detection. In other instances, altered DNA methylation signature has been shown to correlate with the prognosis of treatment response for certain cancers. For example, one study illustrated that in a group of patients with advanced rectal cancer, ten differentially methylated regions were used to predict patients' prognosis. In addition, SRBC gene hypermethylation was associated with poor outcome in patients with colorectal cancer treated with oxaliplatin in a different study.
[0090] In some embodiments, disclosed herein are methods and kits of diagnosing breast cancer or ovarian cancer based on DNA methylation profiling. In some instances, provided herein are methods and kits of identifying a subject has having breast cancer or ovarian cancer based on the DNA methylation profiling. In some instances, also provided herein are methods and kits of determining the prognosis of a subject having breast cancer or ovarian cancer and determining the progression of breast cancer or ovarian cancer in a subject based on the DNA methylation profilings.
Methods of Use
Methods of Diagnosis of a Subject
[0091] Disclosed herein, in certain embodiments, are methods of diagnosing breast cancer or ovarian cancer and selecting subjects suspected of having breast cancer or ovarian cancer for treatment. In some instances, the methods comprise utilizing one or more biomarkers described herein. In some instances, a biomarker comprises a cytosine methylation site. In some instances, cytosine methylation comprises 5-methylcytosine (5-mCyt) and 5- hydroxymethylcytosine. In some cases, a cytosine methylation site occurs in a CpG dinucleotide motif. In other cases, a cytosine methylation site occurs in a CHG or CHH motif, in which H is adenine, cytosine, or thymine. In some instances, one or more CpG dinucleotide motif or CpG site forms a CpG island, a short DNA sequence rich in CpG dinucleotide. In some instances, CpG islands are typically, but not always, between about 0.2 to about 1 kb in length. In some instances, a biomarker comprises a CpG island.
[0092] In some embodiments, disclosed herein is a method of selecting a subject suspected of having breast cancer for treatment, in which the method comprises (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject suspected of having breast cancer; (b) generating a methylation profile comprising one or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112,
cg20069090, cg24732563, cg00886954, cg23690893, and cgl0673833 from the extracted genomic DNA; (c) comparing the methylation profile of the one or more biomarkers with a control; (d) identifying the subject as having breast cancer if the methylation profile correlates to the control; and (e) administering an effective amount of a therapeutic agent to the subject if the subject is identified as having breast cancer.
[0093] In some embodiments, also disclosed herein is a method of selecting a subject suspected of having ovarian cancer for treatment, the method comprising (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject suspected of having ovarian cancer; (b) generating a methylation profile comprising biomarker cgl0673833 from the extracted genomic DNA; (c) comparing the methylation profile of the biomarkers with a control; (d) identifying the subject as having ovarian cancer if the methylation profile correlates to the control; and (e) administering an effective amount of a therapeutic agent to the subject if the subject is identified as having ovarian cancer.
[0094] In some embodiments, a methylation profile comprises a plurality of CpG methylation data for one or more biomarkers described herein. In some instances, a plurality of CpG methylation data is generated by first obtaining a genomic DNA (e.g., nuclear DNA or circulating DNA) from a biological sample, and then treating the genomic DNA by a deaminating agent to generate an extracted genomic DNA. In some instances, the extracted genomic DNA (e.g., extracted nuclear DNA or extracted circulating DNA) is optionally treated with one or more restriction enzymes to generate a set of DNA fragments prior to submitting for sequencing analysis to generate CpG methylation data. In some cases, the sequencing analysis comprises hybridizing each of the one or more biomarkers described herein with a probe, and performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers. In some instances, the CpG methylation data is then input into a machine learning/classification program to generate a methylation profile.
[0095] In some instances, a set of biological samples are generated and subsequently input into the machine learning/classification program. In some instances, the set of biological samples comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, or more biological samples. In some instances, the set of biological samples comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, or more normal biological samples. In some instances, the set of biological samples comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, or more cancerous biological samples. In some cases, the set of biological samples comprise a biological sample of interest, a first primary cancer sample, a second primary cancer sample, a first normal sample, a second normal sample, and a third normal sample; wherein the first, and second primary cancer samples are different; and wherein the first, second, and third normal samples are different. In some cases, three pairs of difference datasets are generated in which the three pairs of dataset comprise: a first difference dataset between the methylation profile of the biological sample of interest and the first normal sample, in which the biological sample of interest and the first normal sample are from the same biological sample source; a second difference dataset between a methylation profile of a second normal sample and a methylation profile of a third normal sample, in which the second and third normal samples are different; and a third difference dataset between a methylation profile of a first primary cancer sample and a methylation profile of a second primary cancer sample, in which the first and second primary cancer samples are different. In some instances, the difference datasets are further input into the machine learning/classification program. In some cases, a pair-wise methylation difference dataset from the first, second, and third datasets is generated and then analyzed in the presence of a control dataset or a training dataset by the machine learning/classification method to generate the cancer CpG methylation profile. In some instances, the first primary cancer sample is a breast cancer sample. In some cases, the second primary cancer sample is a non-breast cancer sample. In some cases, the machine learning method comprises identifying a plurality of markers and a plurality of weights based on a top score (e.g., a t-test value, a β test value), and classifying the samples based on the plurality of markers and the plurality of weights. In some cases, the machine learning method utilizes an algorithm selected from one or more of the following: a principal component analysis, a logistic regression analysis, a nearest neighbor analysis, a support vector machine, and a neural network model.
[0096] In some embodiments, the CpG methylation profile comprises one or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276,
cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210,
cgl4817783, cgl5412918, cgl8482112, cg20069090, cg24732563, cg00886954,
cg23690893, and eg 10673833. In some embodiments, the CpG methylation profile comprises two or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083,
cgl3976210, cgl4817783, cgl5412918, cgl8482112, cg20069090, cg24732563,
cg00886954, cg23690893, and cgl0673833. In some embodiments, the CpG methylation profile comprises three or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335,
cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112, cg20069090,
cg24732563, cg00886954, cg23690893, and cgl0673833. In some embodiments, the CpG methylation profile comprises four or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112,
cg20069090, cg24732563, cg00886954, cg23690893, and cgl0673833. In some
embodiments, the CpG methylation profile comprises five or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516,
cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918,
cgl8482112, cg20069090, cg24732563, cg00886954, cg23690893, and cgl0673833. In some embodiments, the CpG methylation profile comprises six or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516,
cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918,
cgl8482112, cg20069090, cg24732563, cg00886954, cg23690893, and cgl0673833. In some embodiments, the CpG methylation profile comprises seven or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918,
cgl8482112, cg20069090, cg24732563, cg00886954, cg23690893, and cgl0673833. In some embodiments, the CpG methylation profile comprises eight or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918,
cgl8482112, cg20069090, cg24732563, cg00886954, cg23690893, and cgl0673833. In some embodiments, the CpG methylation profile comprises nine or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516,
cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918,
cgl8482112, cg20069090, cg24732563, cg00886954, cg23690893, and cgl0673833. In some embodiments, the CpG methylation profile comprises ten or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516,
cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918,
cgl8482112, cg20069090, cg24732563, cg00886954, cg23690893, and cgl0673833. In some embodiments, the CpG methylation profile comprises eleven or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918,
cgl8482112, cg20069090, cg24732563, cg00886954, cg23690893, and cgl0673833. In some embodiments, the CpG methylation profile comprises twelve or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918,
cgl8482112, cg20069090, cg24732563, cg00886954, cg23690893, and cgl0673833. In some embodiments, the CpG methylation profile comprises cg01327147, cg02680086,
cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335,
cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112, cg20069090,
cg24732563, cg00886954, cg23690893, and cgl0673833.
[0097] In some instances, the CpG methylation profile comprises one or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783,
cgl5412918, cgl8482112, cg20069090, cg24732563, cg00886954, and cg23690893. In some instances, the CpG methylation profile comprises two or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918,
cgl 84821 12, cg20069090, cg24732563, cg00886954, and cg23690893. In some instances, the CpG methylation profile comprises three or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112,
cg20069090, cg24732563, cg00886954, and cg23690893. In some instances, the CpG methylation profile comprises four or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
cg08549335, cg09819083, cgl3976210, cgl4817783, cgl 5412918, cgl8482112,
cg20069090, cg24732563, cg00886954, and cg23690893. In some instances, the CpG methylation profile comprises five or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
cg08549335, cg09819083, cgl3976210, cgl4817783, cgl 5412918, cgl8482112,
cg20069090, cg24732563, cg00886954, and cg23690893. In some instances, the CpG methylation profile comprises six or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl84821 12,
cg20069090, cg24732563, cg00886954, and cg23690893. In some instances, the CpG methylation profile comprises seven or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112,
cg20069090, cg24732563, cg00886954, and cg23690893. In some instances, the CpG methylation profile comprises eight or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112,
cg20069090, cg24732563, cg00886954, and cg23690893. In some instances, the CpG methylation profile comprises nine or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
cg08549335, cg09819083, cgl3976210, cgl4817783, cgl 5412918, cgl8482112,
cg20069090, cg24732563, cg00886954, and cg23690893. In some instances, the CpG methylation profile comprises ten or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112,
cg20069090, cg24732563, cg00886954, and cg23690893. In some instances, the CpG methylation profile comprises eleven or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112,
cg20069090, cg24732563, cg00886954, and cg23690893. In some instances, the CpG methylation profile comprises twelve or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112,
cg20069090, cg24732563, cg00886954, and cg23690893. In some instances, the CpG methylation profile comprises cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210,
cgl4817783, cgl5412918, cgl8482112, cg20069090, cg24732563, cg00886954, and cg23690893.
[0098] In some instances, the CpG methylation profile comprises biomarker cgl0673833.
[0099] In some instances, the subject is diagnosed in having breast cancer. In some instances, breast cancer further comprises a relapsed or refractory breast cancer. In other instances, breast cancer comprises a metastatic breast cancer. In some cases, the subject is diagnosed in having a relapsed or refractory breast cancer. In additional cases, the subject is diagnosed in having a metastatic breast cancer.
[0100] In some embodiments, a breast cancer is any type of breast cancer. In some instances, a breast cancer comprises ductal carcinoma in situ, invasive or infiltrating ductal carcinoma, invasive or infiltrating lobular carcinoma, lobular carcinoma in situ, inflammatory breast cancer, Paget disease of the nipple, Phyllodes tumor, angiosarcoma, metaplastic carcinoma, low-grade adenosquamous carcinoma, spindle cell carcinoma of the breast, squamous carcinoma, triple-negative breast cancer, or mixed carcinoma. In some cases, invasive ductal carcinoma comprises tubular carcinoma of the breast, medullary carcinoma of the breast, mucinous (or colloid) carcinoma of the breast, papillary carcinoma of the breast, micropapillary carcinoma, or cribriform carcinoma of the breast.
[0101] In some cases, breast cancer is further classified by a grade. For example, the grades of breast cancer include Grade X, Grade 1, Grade 2, Grade 3 or Grade 4. In some instances, a breast cancer is further indicated by a category of tubule formation, nuclear grade and/or the mitotic rate. Each category is optionally assigned with a specific score between one and three. In some cases, a stage is assigned based on the tumor, the regional lymph nodes and/or distant metastasis. For example, the stages assigned to the tumor include TX, TO, Tis, Tl, T2, T3, or T4. For example, the stages assigned to a regional lymph node include NX, NO, Nl, N2, or N3. For example, the stages assigned to a distant metastasis include MX, MO, or Ml . In some cases, the stages include stage 0, stage I, stage II, stage III or stage IV. Sometimes, a breast cancer is classified as more than one grade or stage of cancer.
[0102] In some embodiments, the subject diagnosed of having breast cancer is further treated with a therapeutic agent. Exemplary therapeutic agents include, but are not limited to, anastrozole, capecitabine, cyclophosphamide, doxorubicin, epirubicin hydrochloride, everolimus, exemestane, fulvestrant, fluorouracil injection, gemcitabine hydrochloride, goserelin acetate, ixabepilone, lapatinib ditosylate, letrozole, methotrexate, paclitaxel, palbociclib, pamidronate disodium, pertuzumab, toremifene, trastuzumab, ado-trastuzumab emtansine, or vinblastine sulfate, or a combination thereof.
[0103] In some instances, the subject is diagnosed in having ovarian cancer. In some instances, ovarian cancer further comprises a relapsed or refractory ovarian cancer. In other instances, ovarian cancer comprises a metastatic ovarian cancer. In some cases, the subject is diagnosed in having a relapsed or refractory ovarian cancer. In additional cases, the subject is diagnosed in having a metastatic ovarian cancer.
[0104] In some embodiments, an ovarian cancer is any type of ovarian cancer. In some instances, an ovarian cancer comprises epithelial ovarian cancer, stromal cell ovarian tumors, germ cell ovarian tumors, borderline ovarian tumors, small cell ovarian carcinoma, neuroendocrine carcinomas, squamous cell carcinoma, struma ovarii malignum or
psammocarcinoma.
[0105] In some embodiments, the subject diagnosed of having ovarian cancer is further treated with a therapeutic agent. Exemplary therapeutic agents include, but are not limited, bevacizumab, carboplatin, cisplatin, cyclophosphamide, doxorubicin, gemcitabine
hydrochloride, melphalan, topotecan hydrochloride, olaparib, paclitaxel, thiotepa, topotecan hydrochloride, or a combination thereof.
[0106] In some embodiments, also described herein include a method of generating a methylation profile of a biomarker. In some instances, the method comprises (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject; (b) detecting a hybridization between the extracted genomic DNA and a probe, wherein the probe hybridizes to a biomarker selected from cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516,
cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918,
cgl8482112, cg20069090, cg24732563, cg00886954, cg23690893, and cgl0673833; and (c) generating a methylation profile based on the detected hybridization between the extracted genomic DNA and the probe.
[0107] In some embodiments, one or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679,
cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112,
cg20069090, cg24732563, cg00886954, cg23690893, and cgl0673833 are used to generate a methylation profile. In some embodiments, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, or twelve or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083,
cgl3976210, cgl4817783, cgl5412918, cgl8482112, cg20069090, cg24732563,
cg00886954, cg23690893, and cgl0673833 are used to generate the methylation profile. In some embodiments, cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783,
cgl5412918, cgl8482112, cg20069090, cg24732563, cg00886954, cg23690893, and eg 10673833 are used to generate a methylation profile.
[0108] In some embodiments, further described herein include a method of generating a methylation profile of a biomarker which comprises (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject; (b) detecting a hybridization between the extracted genomic DNA and a probe, wherein the probe hybridizes to biomarker cgl0673833; and generating a methylation profile based on the detected hybridization between the extracted genomic DNA and the probe.
[0109] In some instances, as described elsewhere herein, a pair-wise methylation difference dataset is generated prior to generating a methylation profile. In some cases, the pair-wise methylation difference dataset comprises (i) a first difference between the methylation profile of the treated genomic DNA with a methylation profile of a first normal sample; (ii) a second difference between a methylation profile of a second normal sample and a methylation profile of a third normal sample; and (iii) a third difference between a methylation profile of a first primary cancer sample and a methylation profile of a second primary cancer sample. [0110] In some cases, the pair-wise methylation difference dataset is analyzed with a control by a machine learning method to generate a methylation profile. In some cases, the machine learning method utilizes an algorithm selected from one or more of the following: a principal component analysis, a logistic regression analysis, a nearest neighbor analysis, a support vector machine, and a neural network model.
[0111] In some embodiments, a probe comprises a DNA probe, RNA probe, or a combination thereof. In some instances, a probe comprises natural nucleic acid molecules and non-natural nucleic acid molecules. In some cases, a probe comprises a labeled probe, such as for example, fluorescently labeled probe or radioactively labeled probe. In some instances, a probe correlates to a CpG site. In some instances, a probe is utilized in a next generation sequencing reaction to generate a CpG methylation data. In further instances, a probe is used in a solution-based next generation sequencing reaction to generate a CpG methylation data. In some cases, a probe comprises a molecular beacon probe, a TaqMan probe, locked nucleic acid probe, a padlock probe, or Scorpion probe. In some cases, a probe comprises a pad-lock probe.
[0112] In some cases, the method further comprises performing a DNA sequencing reaction such as those described elsewhere herein to quantify the methylation of each of the one or more biomarkers prior to generating a methylation profile.
[0113] In some embodiments, a CpG methylation site is located at the promoter region (e.g., induces a promoter methylation). In some instances, promoter methylation leads to a downregulation of its corresponding gene expression. In some instances, one or more CpG methylation sites described supra and in subsequent paragraphs are located at promoter regions, leading to promoter methylation, and subsequent downregulation of the
corresponding gene expression. In some instances, the CpG methylation site is as illustrated in Tables 11 (e.g., Table 11 A) or 12. In some cases, an increase in gene expression leads to a decrease in tumor volume.
[0114] In some embodiments, one or more eg markers reference one or more genes. In some embodiments, cg01327147 references uncharacterized family 31 glucosidase
KIAAl 161 {KIAAl 161). In some embodiments, cg02680086 references solute carrier family 43 member 1 (SLC43A1). In some embodiments, cg04772948 references uncharacterized LOC284788 (LOC284788). In some embodiments, cg04917276 references HNFl homeobox B (HNF1B). In some embodiments, cg05395187 references nuclear receptor corepressor 2 (NCOR2). In some embodiments, cg08549335 references zinc and ring finger 2, E3 ubiquitin protein ligase (ZNRF2). In some embodiments, cgl3976210 references dual specificity phosphatase 12 (DUSP12). In some embodiments, cgl4817783 references Kelch like family member 23 (KLHL23). In some embodiments, cg20069090 references RNA polymerase subunit D (POLRID). In some embodiments, cg00886954 references plectin (PLEC1). In some embodiments, cg23690893 references trans-2,3-enoyl-CoA reductase (TECR). In some embodiments, cgl0673833 references myosin IG (MYOIG).
[0115] In some embodiments, cg07493516, cg08268679, cg09819083, cgl5412918, cgl8482112 references, and cg24732563 do not independently reference a gene.
[0116] In some embodiments, described herein is a method of selecting a subject suspected of having breast cancer for treatment, the method comprising generating a methylation profile comprising one or more genes selected from: uncharacterized family 31 glucosidase
KIAA1161 (KLAA1161), solute carrier family 43 member 1 (SLC43A1), uncharacterized LOC284788 (LOC284788), HNF1 homeobox B (HNF1B), nuclear receptor corepressor 2 (NCOR2), zinc and ring finger 2, E3 ubiquitin protein ligase (ZNRF2), dual specificity phosphatase 12 (DUSP12), Kelch like family member 23 (KLHL23), RNA polymerase subunit D (POLRID), plectin (PLEC1), trans-2,3-enoyl-CoA reductase (TECR), and myosin IG (MYOIG). In some instances, the methylation profile comprises one or more genes selected from: uncharacterized family 31 glucosidase KIAA1161 (KIAA1161), solute carrier family 43 member 1 (SLC43A1), uncharacterized LOC284788 (LOC284788), HNF1 homeobox B (HNF1B), nuclear receptor corepressor 2 (NCOR2), zinc and ring finger 2, E3 ubiquitin protein ligase (ZNRF2), dual specificity phosphatase 12 (DUSP12), Kelch like family member 23 (KLHL23), RNA polymerase subunit D (POLRID), plectin (PLEC1), and trans-2,3-enoyl-CoA reductase (TECR). In some instances, the methylation profile comprises: uncharacterized family 31 glucosidase KIAA1161 (KLAA1161), solute carrier family 43 member 1 (SLC43A1), uncharacterized LOC284788 (LOC284788), HNF1 homeobox B (HNF1B), nuclear receptor corepressor 2 (NCOR2), zinc and ring finger 2, E3 ubiquitin protein ligase (ZNRF2), dual specificity phosphatase 12 (DUSP12), Kelch like family member 23 (KLHL23), RNA polymerase subunit D (POLRID), plectin (PLEC1), and trans- 2,3-enoyl-CoA reductase (TECR). In some instances, the methylation profile comprises myosin IG (MYOIG).
[0117] In some embodiments, described herein is a method of generating a methylation profile of a gene detecting a hybridization between the extracted genomic DNA and a probe, wherein the probe hybridizes to a gene selected from: uncharacterized family 31 glucosidase KIAA1161 (KLAA1161), solute carrier family 43 member 1 (SLC43A1), uncharacterized LOC284788 (LOC284788), HNF1 homeobox B (HNF1B), nuclear receptor corepressor 2 (NCOR2), zinc and ring finger 2, E3 ubiquitin protein ligase (ZNRF2), dual specificity phosphatase 12 (DUSP12), Kelch like family member 23 (KLHL23), RNA polymerase subunit D (POLR1D), plectin (PLEC1), trans-2,3-enoyl-CoA reductase (TECR), and myosin IG (MYOIG). In some instances, the methylation profile comprises one or more genes selected from: uncharacterized family 31 glucosidase KIAA1161 (KIAA1161), solute carrier family 43 member 1 (SLC43A1), uncharacterized LOC284788 (LOC284788), HNF1 homeobox B (HNF1B), nuclear receptor corepressor 2 (NCOR2), Kelch like family member 23 (KLHL23), zinc and ring finger 2, E3 ubiquitin protein ligase (ZNRF2), dual specificity phosphatase 12 (DUSP12), RNA polymerase subunit D (POLR1D), plectin (PLEC1), and trans-2,3-enoyl-CoA reductase (TECR). In some instances, the methylation profile comprises: uncharacterized family 31 glucosidase KIAA1161 (KIAA1161), solute carrier family 43 member 1 (SLC43A1), uncharacterized LOC284788 (LOC284788), HNF1 homeobox B (HNF1B), nuclear receptor corepressor 2 (NCOR2), zinc and ring finger 2, E3 ubiquitin protein ligase (ZNRF2), Kelch like family member 23 (KLHL23), dual specificity
phosphatase 12 (DUSP12), RNA polymerase subunit D (POLR1D), plectin (PLEC1), and trans-2,3-enoyl-CoA reductase (TECR). In some instances, the methylation profile comprises myosin IG (MYOIG).
[0118] In some embodiments, eg marker cgl0673833.1 references myosin IG (MYOIG). In some embodiments, described herein is a method of selecting a subject suspected of having ovarian cancer for treatment, the method comprising generating a methylation profile comprising gene myosin IG (MYOIG).
Determining the Prognosis of a Subject Having Breast Cancer or Monitoring the Progression of Breast Cancer in a Subject
[0119] In some embodiments, disclosed herein include a method of determining the prognosis of a subject having breast cancer or monitoring the progression of breast cancer in a subject.
[0120] In some embodiments, disclosed herein include a method of determining the prognosis of a subject having breast cancer and/or monitoring the progression of breast cancer in a subject. In some instances, breast cancer comprises ductal carcinoma in situ, invasive or infiltrating ductal carcinoma, invasive or infiltrating lobular carcinoma, lobular carcinoma in situ, inflammatory breast cancer, Paget disease of the nipple, Phyllodes tumor, angiosarcoma, metaplastic carcinoma, low-grade adenosquamous carcinoma, spindle cell carcinoma of the breast, squamous carcinoma, triple-negative breast cancer, or mixed carcinoma. In some instances, invasive ductal carcinoma comprises tubular carcinoma of the breast, medullary carcinoma of the breast, mucinous (or colloid) carcinoma of the breast, papillary carcinoma of the breast, micropapillary carcinoma, or cribriform carcinoma of the breast. In some instances, disclosed herein is a method of determining the prognosis of a subject having breast cancer or monitoring the progression of breast cancer in a subject. In some embodiments, the method comprises (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject having breast cancer; (b) generating a methylation profile comprising one or more biomarkers selected from: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361, and cg24229963 from the extracted genomic DNA; (c) obtaining a methylation score based on the methylation profile of the one or more biomarkers; and (d) based on the methylation score, initiate a first treatment, decrease a dosage of a first therapeutic agent if the subject has experienced a remission, initiate a second treatment if the subject has experienced a relapse, or switch to a second therapeutic agent if the subject becomes refractory to the first therapeutic agent.
[0121] In some instances, the methylation profile comprises two or more biomarkers selected from: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361, and cg24229963. In some instances, the methylation profile comprises three or more biomarkers selected from: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046,
cg21230435, cg22043361, and cg24229963. In some instances, the methylation profile comprises four or more biomarkers selected from: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361, and cg24229963. In some instances, the methylation profile comprises five or more biomarkers selected from: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361, and cg24229963. In some instances, the methylation profile comprises six or more biomarkers selected from: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046,
cg21230435, cg22043361, and cg24229963. In some instances, the methylation profile comprises seven or more biomarkers selected from: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361, and cg24229963. In some instances, the methylation profile comprises eight or more biomarkers selected from: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361, and cg24229963. In some instances, the methylation profile comprises nine or more biomarkers selected from: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046,
cg21230435, cg22043361, and cg24229963. In some instances, the methylation profile comprises cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361, and cg24229963.
[0122] In some cases, the methylation profile further comprises one or more biomarkers selected from: cg24714666, cg03156547, cg06605933, cg09601629, cgl3278334, cg23653712, cgl 1851098, cgl2188860, cg25189085, and cg25488021. In some cases, the methylation profile further comprises one or more biomarkers selected from: cg24714666, cg03156547, cg06605933, cg09601629, cgl3278334, cgl l851098, cgl2188860,
cg25189085, and cg25488021. In some cases, the methylation profile further comprises one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or nine or more biomarkers selected from: cg24714666, cg03156547, cg06605933, cg09601629, cgl3278334, cgl 1851098, cgl2188860, cg25189085, and cg25488021. In some cases, the methylation profile further comprises biomarkers cg24714666, cg03156547, cg06605933, cg09601629, cgl3278334, cgl l851098,
cgl2188860, cg25189085, and cg25488021.
[0123] In some cases, the methylation profile further comprises one or more biomarkers selected from: cg03156547, cg06605933, cg09601629, cgl3278334, cgl l 851098, cgl2188860, cg25189085, and cg25488021. In some cases, the methylation profile further comprises one or more, two or more, three or more, four or more, five or more, six or more, seven or more, or eight or more biomarkers selected from: cg03156547, cg06605933, cg09601629, cgl3278334, cgl 1851098, cgl2188860, cg25189085, and cg25488021. In some cases, the methylation profile further comprises biomarkers cg03156547, cg06605933, cg09601629, cgl3278334, cgl 1851098, cgl2188860, cg25189085, and cg25488021.
[0124] In some cases, the methylation profile further comprises cg24714666.
[0125] In some instances, the methylation profile comprises one or more biomarkers selected from: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361 and cg24229963; and one or more biomarkers selected from: cg24714666, cg03156547, cg06605933, cg09601629,
cgl3278334, cgl 1851098, cgl2188860, cg25189085, and cg25488021.
[0126] In some embodiments, one or more eg markers reference one or more genes. In some embodiments, cg00819310 references VANGL planar cell polarity protein 1 (VANGLI). In some embodiments, cg04447890 references G protein-coupled receptor 177 (GPR177). In some embodiments, cg08623383 references chromosome 1 open reading frame 38 (CI or/38). In some embodiments, cg09799714 references PDZ domain containing 3 (PDZD3). In some embodiments, cgl 0971790 references fuzzy planar cell polarity protein (FUZ). In some embodiments, cgl5357639 references 8-oxoguanine DNA glycosylase (OGG1). In some embodiments, cgl 7188046 references T bachyury transcription factor (Ί). In some embodiments, cg21230435 references opsin 1 (cone pigments), short-wave-sensitive (OPNISW). In some embodiments, cg22043361 references zinc finger and BTB domain containing 25 (ZBTB25). In some embodiments, cg24229963 references zinc finger AN1- type containing 1 (ZFAND1).
[0127] In further embodiments, one or more eg markers reference one or more genes. In further embodiments, cg03156547 references cadherin 24 (CDH24). In further embodiments, cg06605933 references BolA family member 1 (BOLA1). In further embodiments, cg09601629 references coiled-coil domain containing 15 (CCDC15). In further
embodiments, cgl 3278334 references PIH1 domain containing 1 (PIH1D1). In further embodiments, cgl 1851098 references WBP2 N-terminal like (WBP2NL). In further embodiments, cgl2188860 references topoisomerase (DNA) I, mitochondrial (TOP1MT). In further embodiments, cg25189085 references SH3 and cysteine rich domain 3 (STAC3). In further embodiments, cg25488021 references erythrocyte membrane protein band 4.1 like 2 (EPB41L2).
[0128] In some embodiments, described herein is a method of determining the prognosis of a subject having breast cancer or monitoring the progression of breast cancer in the subject, comprising generating a methylation profile comprising one or more genes selected from: VANGL planar cell polarity protein 1 (VANGLI), G protein-coupled receptor 177 (GPR177), chromosome 1 open reading frame 38 (Clorf38), PDZ domain containing 3 (PDZD3), fuzzy planar cell polarity protein (FUZ), 8-oxoguanine DNA glycosylase (OGG1), T brachyury transcription factor (7), opsin 1 (cone pigments), short-wave-sensitive (OPNISW), zinc finger and BTB domain containing 25 (ZBTB25), and zinc finger ANl-type containing 1
(ZFAND1). In some instances, the methylation profile comprises: VANGL planar cell polarity protein 1 (VANGLI), G protein-coupled receptor 177 (GPR177), chromosome 1 open reading frame 38 (Clorf38), PDZ domain containing 3 (PDZD3), fuzzy planar cell polarity protein (FUZ), 8-oxoguanine DNA glycosylase (OGG1), T brachyury transcription factor (7), opsin 1 (cone pigments), short-wave-sensitive (OPNISW), zinc finger and BTB domain containing 25 (ZBTB25), and zinc finger ANl-type containing 1 (ZFAND1). In some instances, the methylation profile comprises one or more genes selected from: cadherin 24 (CDH24), BolA family member 1 (BOLA J), coiled-coil domain containing 15 (CCDC15), PIHl domain containing 1 (PIH1D1), WBP2 N-terminal like (WBP2NL), topoisomerase (DNA) I, mitochondrial (TOPJMT), SH3 and cysteine rich domain 3 (STAC3), erythrocyte membrane protein band 4.1 like 2 (EPB41L2). In some instances, the methylation profile comprises one or more genes selected from: cadherin 24 (CDH24), BolA family member 1 (BOLA1), coiled-coil domain containing 15 (CCDC15), PIHl domain containing 1
(PIH1D1), WBP2 N-terminal like (WBP2NL), topoisomerase (DNA) I, mitochondrial (ΤΟΡ1ΜΊ), SH3 and cysteine rich domain 3 (STAC3), erythrocyte membrane protein band 4.1 like 2 (EPB41L2). In some instances, the methylation profile comprises: cadherin 24 (CDH24), BolA family member 1 (BOLA J), coiled-coil domain containing 15 (CCDC15), PIHl domain containing 1 (PIH1D1), WBP2 N-terminal like (WBP2NL), topoisomerase (DNA) I, mitochondrial (TOPJMT), SH3 and cysteine rich domain 3 (STAC3), erythrocyte membrane protein band 4.1 like 2 (EPB41L2).
Methylation Scores
[0129] In some instances, a methylation score is utilized to determine the prognosis of a subject. In some instances, prognosis refers to the prediction of the likelihood of cancer- attributable death or progression, including recurrence, metastatic spread, and drug resistance, of breast cancer. The term "prediction" is used herein to refer to the likelihood that a subject will respond either favorably or unfavorably to a drug or set of drugs, and also the extent of those responses, or that a subject will survive, following chemotherapy for a certain period of time without cancer recurrence and/or following surgery (e.g., removal of the spleen). In some instances, a methylation score is utilized to determine the prognosis of a subject having breast cancer or ovarian cancer. In some cases, a methylation score is utilized to determine the prognosis of a subject having breast cancer.
[0130] In some embodiments, a methylation score of from about 1.5 to about 4 is associated with a "good" prognosis. In some instances, a "good" prognosis refers to the likelihood that a subject will likely respond favorably to a drug or set of drugs, leading to a complete or partial remission of breast cancer or ovarian cancer or a decrease and/or a stop in the progression of breast cancer or ovarian cancer. In some instances, a "good" prognosis refers to the survival of a subject of from at least 1 month to at least 90 years. In some instances, a "good" prognosis refers to the survival of a subject in which the survival of the subject upon treatment is from at least 1 month to at least 90 years. In some instances, the survival of a subject further refers to an extended survival rate of a subject receiving a treatment course relative to a subject without receiving the same course of treatment. In some cases, a "good" prognosis refers to an extended survival time of a subject receiving a treatment course relative to a subject without receiving the same course of treatment.
[0131] In some instances, a methylation score of from about 1.5 to about 4 is indicative of a survival from at least 1 month to at least 90 years. In some instances, a methylation score of from about 1.5 to about 4 is indicative of a survival of at least 2 months, 4 months, 6 months, 8 months, 10 months, 1 year, 1.5 years, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 30 years, 50 years, or more.
[0132] In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival from at least 1 month to at least 90 years. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival of at least 2 months, 4 months, 6 months, 8 months, 10 months, 1 year, 1.5 years, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 30 years, 50 years, or more.
[0133] In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival from at least 1 month to at least 90 years. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival of at least 2 months, 4 months, 6 months, 8 months, 10 months, 1 year, 1.5 years, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 30 years, 50 years, or more.
[0134] In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival from at least 1 month to at least 90 years. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival of at least 2 months, 4 months, 6 months, 8 months, 10 months, 1 year, 1.5 years, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 30 years, 50 years, or more.
[0135] In some embodiments, a methylation score of from about 1.5 to about 4 is associated with a "good" prognosis in a subject having breast cancer. In some embodiments, a methylation score of from about 1.5 to about 4, from about 1.5 to about 3.5, from about 1.5 to about 3, from about 1.5 to about 2.5, or from about 1.5 to about 2 is associated with a "good" prognosis in a subject having breast cancer.
[0136] In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival from at least 1 month to at least 90 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival of at least 2 months, 4 months, 6 months, 8 months, 10 months, 1 year, 1.5 years, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 30 years, 50 years, or more in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 2 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 3 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 4 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 5 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 6 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 8 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 10 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 1 year in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 1.5 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 2 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 2.5 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 3 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 4 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 3 is indicative of a survival for at least 5 years in a subject having breast cancer.
[0137] In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival from at least 1 month to at least 90 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival of at least 2 months, 4 months, 6 months, 8 months, 10 months, 1 year, 1.5 years, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 30 years, 50 years, or more in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 2 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 3 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 4 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 5 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 6 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 8 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 10 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 1 year in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 1.5 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 2 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 2.5 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 3 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 4 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 5 years in a subject having breast cancer.
[0138] In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival from at least 1 month to at least 90 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival of at least 2 months, 4 months, 6 months, 8 months, 10 months, 1 year, 1.5 years, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years, 30 years, 50 years, or more in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 2 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 3 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 4 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 5 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 6 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 8 months in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 10 months in a subject having breast cancer.
[0139] In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 1 year in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 1.5 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 2 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 2.5 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 3 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 4 years in a subject having breast cancer. In some instances, a methylation score of from about 1.5 to about 2 is indicative of a survival for at least 5 years in a subject having breast cancer.
[0140] In some embodiments, a methylation score of less than about 1.5 is associated with a "poor" prognosis. In some instances, a "poor" prognosis refers to the likelihood that a subject will likely respond unfavorably to a drug or set of drugs, leading to a progression of breast cancer (e.g., progression to metastatic breast cancer) and/or to refractory of one or more therapeutic agents. In some instances, a "poor" prognosis refers to the likelihood that a subject will not respond to a drug or set of drugs, leading to a progression of breast cancer. In some instances, a "poor" prognosis refers to the survival of a subject of from less than 5 years to less than 1 month. In some instances, a "poor" prognosis refers to the survival of a subject in which the survival of the subject upon treatment is from less than 5 years to less than 1 month. In some instances, a "poor" prognosis further refers to the likelihood that a subject will develop a refractory breast cancer or refractory ovarian cancer toward one or more drugs.
[0141] In some instances, a methylation score of less than 1.5 is indicative of a survival of from less than 5 years to less than 1 month. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 5 years, 4 years, 3 years, 2 years, 1.5 years, 1 year, 10 months, 8 months, 6 months, 4 months, or 2 months.
[0142] In some embodiments, a methylation score of less than about 1.5 is associated with a "poor" prognosis in a subject having breast cancer. In some embodiments, a methylation score of less than about 1.5 is associated with a "poor" prognosis in a subject having breast cancer. [0143] In some instances, a methylation score of less than 1.5 is indicative of a survival of from less than 5 years to less than 1 month in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 5 years, 4 years, 3 years, 2 years, 1.5 years, 1 year, 10 months, 8 months, 6 months, 4 months, or 2 months in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 5 years in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 4 years in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 3 years in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 2.5 years in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 2 years in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 1.5 years in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 1 year in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 6 months in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 5 months in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 4 months in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 3 months in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 2 months in a subject having breast cancer. In some instances, a methylation score of less than 1.5 is indicative of a survival of less than 1 month in a subject having breast cancer.
[0144] In some instances, one or more samples are obtained from a subject during the course of a treatment to monitor the progression of breast cancer in the subject. In some instances, the subject initially has a methylation score of from about 1.5 to about 3 and progressively during each subsequent testing has a lower methylation score. For example, a subject initially has a methylation score of 3 and during subsequent testings, has methylation scores of 2.5, 2, 1.5, or 1. In such cases, the subject is further tested to determine the progression of breast cancer (e.g., whether breast cancer has progressed into a metastatic state or into a refractory state) and a treatment course is optionally altered based on the changes in prognosis. [0145] In some embodiments, the methylation score is calculated based on model for a survival analysis. In some instances, a survival analysis is a statistic analysis for analyzing the expected duration of time until one or more events of interest happen. In some instances, survival analysis comprises Cox proportional hazards (PH) regression analysis, log-rank test or a product limit estimator. In some instances, the methylation score is calculated based on Cox proportional hazards (PH) regression analysis, log-rank test or product limit estimator. In some instances, the methylation score is calculated based on Cox proportional hazards (PH) regression analysis. In some embodiments, the methylation score is further calculated based on a log-rank test. In some instances, the log-rank test is a hypothesis test to compare the survival distribution of two samples (e.g., a training set and a validation set). In some instances, the log-rank test is also referred to as a Mantel-Cox test or a time-stratified Cochran-Mantel-Haenszel test. In some instances, the methylation score is additionally calculated based on a product limit estimator. A product limit estimator (also known as Kaplan-Meier estimator) is a non-parametric statistic used to estimate the survival function from lifetime data. In some embodiments, the methylation score is initially calculated based on Cox proportional hazards (PH) regression analysis and then reprocessed with a log-rank test.
Control
[0146] In some embodiments, a control is a methylation value, methylation level, or methylation profile of a sample. In some instances, the control comprises a set of
methylation profiles, wherein each said methylation profile is generated from a biological sample obtained from a known cancer type. In some cases, the known cancer type is breast cancer or ovarian cancer. In some cases, the known cancer type is breast cancer. In some cases, the known cancer type is a relapsed or refractory breast cancer. In other cases, the known cancer type is a metastatic breast cancer. In some cases, the known cancer type is ductal carcinoma in situ, invasive or infiltrating ductal carcinoma, invasive or infiltrating lobular carcinoma, lobular carcinoma in situ, inflammatory breast cancer, Paget disease of the nipple, Phyllodes tumor, angiosarcoma, metaplastic carcinoma, low-grade adenosquamous carcinoma, spindle cell carcinoma of the breast, squamous carcinoma, triple-negative breast cancer, or mixed carcinoma. In some cases, the known cancer type is invasive ductal carcinoma comprises tubular carcinoma of the breast, medullary carcinoma of the breast, mucinous (or colloid) carcinoma of the breast, papillary carcinoma of the breast,
micropapillary carcinoma, or cribriform carcinoma of the breast. [0147] In some cases, the known cancer type is ovarian cancer. In some cases, the known cancer type is a relapsed or refractory ovarian cancer. In other cases, the known cancer type is a metastatic ovarian cancer. In some cases, the known cancer type is epithelial ovarian cancer, stromal cell ovarian tumors, germ cell ovarian tumors, borderline ovarian tumors, small cell ovarian carcinoma, neuro-endocrine carcinomas, squamous cell carcinoma, struma ovarii malignum or psammocarcinoma.
Probes
[0148] In some embodiments, one or more probes described above comprise a structure of Formula I:
Formula I
wherein:
A is a first target-binding region;
B is a second target-binding region; and
L is a linker region;
wherein A comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 30 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37; B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 12 contiguous nucleotides starting at position from the 3' terminus of the same sequence selected from SEQ ID NOs: 1-37; and wherein L is attached to A; and B is attached to either A or L.
[0149] In some instances, L is attached to A and B is attached to L. In some cases, A, B, and L are attached as illustrated in Formula la:
Formula la.
[0150] In some embodiments, A comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 35 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37. In some cases, A comprises at least 70%, 80%, 90%), 95%), or 99% sequence identity to at least 40 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37. In some cases, A comprises at least 70%, 80%>, 90%, 95%, or 99% sequence identity to at least 45 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37. In some cases, A comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 50 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37. In some cases, A comprises at least 70%, 80%, 90%), 95%), or 99%) sequence identity to at least 55 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37. In some cases, A comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 60 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37. In some cases, A comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 65 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37. In some cases, A comprises at least 70%, 80%, 90%), 95%), or 99%) sequence identity to at least 70 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37. In some cases, A comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 80 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37. In some cases, A comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 90 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37.
[0151] In some embodiments, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 14 contiguous nucleotides starting at position from the 3' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%), 80%), 90%), 95%), or 99% sequence identity to at least 15 contiguous nucleotides starting at position from the 3' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 18 contiguous nucleotides starting at position from the 3' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%), 95%), or 99%) sequence identity to at least 20 contiguous nucleotides starting at position from the 3' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 22 contiguous nucleotides starting at position from the 3' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99%) sequence identity to at least 25 contiguous nucleotides starting at position 1 ' from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 28 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 30 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 35 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 40 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%), 95%), or 99% sequence identity to at least 45 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 50 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1 -37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 55 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 60 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 65 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 70 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 80 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37. In some cases, B comprises at least 70%, 80%, 90%), 95%), or 99%) sequence identity to at least 90 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1-37.
[0152] In some instances, a probe described above is used in a next generation sequencing reaction to generate a CpG methylation data. In some instances, the probe is used in a solution-based next generation sequencing reaction to generate a CpG methylation data. In some instances, the next generation sequencing reaction comprises 454 Life Sciences platform (Roche, Branford, CT); lllumina's Genome Analyzer, GoldenGate Methylation Assay, or Infinium Methylation Assays, i.e., Infinium HumanMethylation 27K BeadArray or VeraCode GoldenGate methylation array (Illumina, San Diego, CA); QX200™ Droplet Digital™ PCR System from Bio-Rad; DNA Sequencing by Ligation, SOLiD System
(Applied Biosystems/Life Technologies); the Helicos True Single Molecule DNA sequencing technology; semiconductor sequencing (Ion Torrent; Personal Genome Machine); DNA nanoball sequencing; sequencing using technology from Dover Systems (Polonator), and technologies that do not require amplification or otherwise transform native DNA prior to sequencing (e.g., Pacific Biosciences and Helicos), such as nanopore-based strategies (e.g., Oxford Nanopore, Genia Technologies, and Nabsys). In some instances, the solution-based next generation sequencing reaction is a droplet digital PCR sequencing method.
[0153] In some instances, each probe correlates to a CpG site. In some instances, each probe correlates to a biomarker (e.g., CpG site) as illustrated in Table 5.
[0154] In some instances, L is between 10 and 60, 15 and 55, 20 and 50, 25 and 45, and 30 and 40 nucleotides in length. In some instances, L is about 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides in length.
[0155] In some instances, L further comprises an adaptor region. In some instances, the adaptor region comprises a sequence used to identify each probe. In some instances as illustrated in Table 5, the adaptor region in each illustrative sequence is reflected by a series of N, in which each N is A, T, G, or C.
[0156] In some embodiments, a probe described herein comprises at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a sequence selected from SEQ ID NOs: 1-37. In some instances, the probe comprises at least 50% sequence identity to a sequence selected from SEQ ID NOs: 1-37. In some instances, the probe comprises at least 60% sequence identity to a sequence selected from SEQ ID NOs: 1 - 37. In some instances, the probe comprises at least 70% sequence identity to a sequence selected from SEQ ID NOs: 1-37. In some instances, the probe comprises at least 80% sequence identity to a sequence selected from SEQ ID NOs: 1-37. In some instances, the probe comprises at least 85% sequence identity to a sequence selected from SEQ ID NOs: 1 - 37. In some instances, the probe comprises at least 90% sequence identity to a sequence selected from SEQ ID NOs: 1-37. In some instances, the probe comprises at least 91% sequence identity to a sequence selected from SEQ ID NOs: 1-37. In some instances, the probe comprises at least 92% sequence identity to a sequence selected from SEQ ID NOs: 1- 37. In some instances, the probe comprises at least 93% sequence identity to a sequence selected from SEQ ID NOs: 1-37. In some instances, the probe comprises at least 94% sequence identity to a sequence selected from SEQ ID NOs: 1-37. In some instances, the probe comprises at least 95% sequence identity to a sequence selected from SEQ ID NOs: 1 - 37. In some instances, the probe comprises at least 96% sequence identity to a sequence selected from SEQ ID NOs: 1-37. In some instances, the probe comprises at least 97% sequence identity to a sequence selected from SEQ ID NOs: 1-37. In some instances, the probe comprises at least 98% sequence identity to a sequence selected from SEQ ID NOs: 1 - 37. In some instances, the probe comprises at least 99% sequence identity to a sequence selected from SEQ ID NOs: 1-37. In some instances, the probe comprises 100% sequence identity to a sequence selected from SEQ ID NOs: 1-37. In some instances, the probe consists of a sequence selected from SEQ ID NOs: 1-37.
[0157] In some cases, a probe described above is utilized in a digital PCR sequencing method. In some cases, the probe is utilized in a droplet digital PCR (ddPCR) sequencing method.
Detection Methods
[0158] In some embodiments, a number of methods are utilized to measure, detect, determine, identify, and characterize the methylation status/level of a gene or a biomarker (e.g., CpG island-containing region/fragment) in identifying a subject as having breast cancer or ovarian cancer, determining the breast cancer or ovarian cancer subtype, the prognosis of a subject having breast cancer or ovarian cancer, and the progression or regression of breast cancer or ovarian cancer in subject in the presence of a therapeutic agent.
[0159] In some instances, the methylation profile is generated from a biological sample isolated from an individual. In some embodiments, the biological sample is a biopsy. In some instances, the biological sample is a tissue sample. In some instances, the biological sample is a tissue biopsy sample. In some instances, the biological sample is a blood sample. In other instances, the biological sample is a cell-free biological sample. In other instances, the biological sample is a circulating tumor DNA sample. In one embodiment, the biological sample is a cell-free biological sample containing circulating tumor DNA.
[0160] In some embodiments, a biomarker (or an epigenetic marker) is obtained from a liquid sample. In some embodiments, the liquid sample comprises blood and other liquid samples of biological origin (including, but not limited to, peripheral blood, sera, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper's fluid or pre-ejaculatory fluid, female ejaculate, sweat, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, ascites, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions/flushing, synovial fluid, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspirates, blastocyl cavity fluid, or umbilical cord blood. In some embodiments, the biological fluid is blood, a blood derivative or a blood fraction, e.g., serum or plasma. In a specific embodiment, a sample comprises a blood sample. In another embodiment, a serum sample is used. In another embodiment, a sample comprises urine. In some embodiments, the liquid sample also encompasses a sample that has been manipulated in any way after their procurement, such as by centrifugation, filtration, precipitation, dialysis, chromatography, treatment with reagents, washed, or enriched for certain cell populations.
[0161] In some embodiments, a biomarker (or an epigenetic marker) is obtained from a tissue sample. In some instances, a tissue corresponds to any cell(s). Different types of tissue correspond to different types of cells (e.g., liver, lung, blood, connective tissue, and the like), but also healthy cells vs. tumor cells or to tumor cells at various stages of neoplasia, or to displaced malignant tumor cells. In some embodiments, a tissue sample further encompasses a clinical sample, and also includes cells in culture, cell supernatants, organs, and the like. Samples also comprise fresh-frozen and/or formalin- fixed, paraffin-embedded tissue blocks, such as blocks prepared from clinical or pathological biopsies, prepared for pathological analysis or study by immunohistochemistry.
[0162] In some embodiments, a biomarker (or an epigenetic marker) is methylated or unmethylated in a normal sample (e.g., normal or control tissue without disease, or normal or control body fluid, stool, blood, serum, amniotic fluid), most importantly in healthy stool, blood, serum, amniotic fluid or other body fluid. In other embodiments, a biomarker (or an epigenetic marker) is hypomethylated or hypermethylated in a sample from a patient having or at risk of a disease (e.g., one or more indications described herein); for example, at a decreased or increased (respectively) methylation frequency of at least about 50%, at least about 60%), at least about 70%, at least about 75%, at least about 80%>, at least about 85%>, at least about 90%, at least about 95%, or about 100% in comparison to a normal sample. In one embodiment, a sample is also hypomethylated or hypermethylated in comparison to a previously obtained sample analysis of the same patient having or at risk of a disease (e.g., one or more indications described herein), particularly to compare progression of a disease. [0163] In some embodiments, a methylome comprises a set of epigenetic markers or biomarkers, such as a biomarker described above. In some instances, a methylome that corresponds to the methylome of a tumor of an organism (e.g., a human) is classified as a tumor methylome. In some cases, a tumor methylome is determined using tumor tissue or cell-free (or protein-free) tumor DNA in a biological sample. Other examples of methylomes of interest include the methylomes of organs that contribute DNA into a bodily fluid (e.g. methylomes of tissue such as brain, breast, lung, the prostate, and the kidneys, plasma, etc.).
[0164] In some embodiments, a plasma methylome is the methylome determined from the plasma or serum of an animal (e.g., a human). In some instances, the plasma methylome is an example of a cell-free or protein-free methylome since plasma and serum include cell-free DNA. The plasma methylome is also an example of a mixed methylome since it is a mixture of tumor and other methylomes of interest. In some instances, the urine methylome is determined from the urine sample of a subject. In some cases, a cellular methylome corresponds to the methylome determined from cells (e.g., blood cells) of the patient. The methylome of the blood cells is called the blood cell methylome (or blood methylome).
[0165] In some embodiments, DNA (e.g., genomic DNA such as extracted genomic DNA or treated genomic DNA) is isolated by any means standard in the art, including the use of commercially available kits. Briefly, wherein the DNA of interest is encapsulated in by a cellular membrane the biological sample is disrupted and lysed by enzymatic, chemical, or mechanical means. In some cases, the DNA solution is then cleared of proteins and other contaminants e.g. by digestion with proteinase K. The DNA is then recovered from the solution. In such cases, this is carried out by means of a variety of methods including salting out, organic extraction or binding of the DNA to a solid phase support. In some instances, the choice of method is affected by several factors including time, expense and required quantity of DNA.
[0166] Wherein the sample DNA is not enclosed in a membrane (e.g. circulating DNA from a cell free sample such as blood or urine) methods standard in the art for the isolation and/or purification of DNA are optionally employed (See, for example, Bettegowda et al. Detection of Circulating Tumor DNA in Early- and Late-Stage Human Malignancies. Sci. Transl. Med, 6(224): ra24. 2014). Such methods include the use of a protein degenerating reagent e.g. chaotropic salt e.g. guanidine hydrochloride or urea; or a detergent e.g. sodium dodecyl sulphate (SDS), cyanogen bromide. Alternative methods include but are not limited to ethanol precipitation or propanol precipitation, vacuum concentration amongst others by means of a centrifuge. In some cases, the person skilled in the art also make use of devices such as filter devices e.g. ultrafiltration, silica surfaces or membranes, magnetic particles, polystyrol particles, polystyrol surfaces, positively charged surfaces, and positively charged membranes, charged membranes, charged surfaces, charged switch membranes, charged switched surfaces.
[0167] In some instances, once the nucleic acids have been extracted, methylation analysis is carried out by any means known in the art. A variety of methylation analysis procedures are known in the art and may be used to practice the methods disclosed herein. These assays allow for determination of the methylation state of one or a plurality of CpG sites within a tissue sample. In addition, these methods may be used for absolute or relative quantification of methylated nucleic acids. Such methylation assays involve, among other techniques, two major steps. The first step is a methylation specific reaction or separation, such as (i) bisulfite treatment, (ii) methylation specific binding, or (iii) methylation specific restriction enzymes. The second major step involves (i) amplification and detection, or (ii) direct detection, by a variety of methods such as (a) PCR (sequence-specific amplification) such as Taqman(R), (b) DNA sequencing of untreated and bisulfite-treated DNA, (c) sequencing by ligation of dye-modified probes (including cyclic ligation and cleavage), (d) pyrosequencing, (e) single-molecule sequencing, (f) mass spectroscopy, or (g) Southern blot analysis.
[0168] Additionally, restriction enzyme digestion of PCR products amplified from bisulfite-converted DNA may be used, e.g., the method described by Sadri and Hornsby (1996, Nucl. Acids Res. 24:5058- 5059), or COBRA (Combined Bisulfite Restriction
Analysis) (Xiong and Laird, 1997, Nucleic Acids Res. 25:2532- 2534). COBRA analysis is a quantitative methylation assay useful for determining DNA methylation levels at specific gene loci in small amounts of genomic DNA. Briefly, restriction enzyme digestion is used to reveal methylation-dependent sequence differences in PCR products of sodium bisulfite- treated DNA. Methylation-dependent sequence differences are first introduced into the genomic DNA by standard bisulfite treatment according to the procedure described by Frommer et al. (Frommer et al, 1992, Proc. Nat. Acad. Sci. USA, 89, 1827-1831). PCR amplification of the bisulfite converted DNA is then performed using primers specific for the CpG sites of interest, followed by restriction endonuclease digestion, gel electrophoresis, and detection using specific, labeled hybridization probes. Methylation levels in the original DNA sample are represented by the relative amounts of digested and undigested PCR product in a linearly quantitative fashion across a wide spectrum of DNA methylation levels. In addition, this technique can be reliably applied to DNA obtained from micro-dissected paraffin- embedded tissue samples. Typical reagents (e.g., as might be found in a typical COBRA- based kit) for COBRA analysis may include, but are not limited to: PCR primers for specific gene (or methylation-altered DNA sequence or CpG island); restriction enzyme and appropriate buffer; gene-hybridization oligo; control hybridization oligo; kinase labeling kit for oligo probe; and radioactive nucleotides. Additionally, bisulfite conversion reagents may include: DNA denaturation buffer; sulfo nation buffer; DNA recovery reagents or kits (e.g., precipitation, ultrafiltration, affinity column); desulfonation buffer; and DNA recovery components.
[0169] In an embodiment, the methylation profile of selected CpG sites is determined using methylation-Specific PCR (MSP). MSP allows for assessing the methylation status of virtually any group of CpG sites within a CpG island, independent of the use of methylation- sensitive restriction enzymes (Herman et al, 1996, Proc. Nat. Acad. Sci. USA, 93, 9821- 9826; U.S. Pat. Nos. 5,786,146, 6,017,704, 6,200,756, 6,265, 171 (Herman and Baylin); U.S. Pat. Pub. No. 2010/0144836 (Van Engeland et al)). Briefly, DNA is modified by a deaminating agent such as sodium bisulfite to convert unm ethyl ated, but not methylated cytosines to uracil, and subsequently amplified with primers specific for methylated versus unmethylated DNA. In some instances, typical reagents (e.g., as might be found in a typical MSP- based kit) for MSP analysis include, but are not limited to: methylated and
unmethylated PCR primers for specific gene (or methylation- altered DNA sequence or CpG island), optimized PCR buffers and deoxynucleotides, and specific probes. The ColoSure™ test is a commercially available test for colon cancer based on the MSP technology and measurement of methylation of the vimentin gene (Itzkowitz et al, 2007, Clin Gastroenterol. Hepatol. 5(1), 111-117). Alternatively, one may use quantitative multiplexed methylation specific PCR (QM-PCR), as described by Fackler et al. Fackler et al, 2004, Cancer Res.
64(13) 4442-4452; or Fackler et al, 2006, Clin. Cancer Res. 12(11 Pt 1) 3306-3310.
[0170] In an embodiment, the methylation profile of selected CpG sites is determined using MethyLight and/or Heavy Methyl Methods. The MethyLight and Heavy Methyl assays are a high-throughput quantitative methylation assay that utilizes fluorescence- based real-time PCR (Taq Man(R)) technology that requires no further manipulations after the PCR step (Eads, C.A. et al, 2000, Nucleic Acid Res. 28, e 32; Cottrell et al, 2007, J. Urology 177, 1753, U.S. Pat. Nos. 6,331,393 (Laird et al)). Briefly, the MethyLight process begins with a mixed sample of genomic DNA that is converted, in a sodium bisulfite reaction, to a mixed pool of methylation-dependent sequence differences according to standard procedures (the bisulfite process converts unmethylated cytosine residues to uracil). Fluorescence-based PCR is then performed either in an "unbiased" (with primers that do not overlap known CpG methylation sites) PCR reaction, or in a "biased" (with PCR primers that overlap known CpG dinucleotides) reaction. In some cases, sequence discrimination occurs either at the level of the amplification process or at the level of the fluorescence detection process, or both. In some cases, the MethyLight assay is used as a quantitative test for methylation patterns in the genomic DNA sample, wherein sequence discrimination occurs at the level of probe hybridization. In this quantitative version, the PCR reaction provides for unbiased amplification in the presence of a fluorescent probe that overlaps a particular putative methylation site. An unbiased control for the amount of input DNA is provided by a reaction in which neither the primers, nor the probe overlie any CpG dinucleotides. Alternatively, a qualitative test for genomic methylation is achieved by probing of the biased PCR pool with either control oligonucleotides that do not "cover" known methylation sites (a fluorescence- based version of the "MSP" technique), or with oligonucleotides covering potential methylation sites. Typical reagents (e.g., as might be found in a typical MethyLight- based kit) for MethyLight analysis include, but are not limited to: PCR primers for specific gene (or methylation-altered DNA sequence or CpG island); TaqMan(R) probes; optimized PCR buffers and deoxynucleotides; and Taq polymerase.
[0171] Quantitative MethyLight uses bisulfite to convert genomic DNA and the methylated sites are amplified using PCR with methylation independent primers. Detection probes specific for the methylated and unmethylated sites with two different fluorophores provides simultaneous quantitative measurement of the methylation. The Heavy Methyl technique begins with bisulfate conversion of DNA. Next specific blockers prevent the amplification of unmethylated DNA. Methylated genomic DNA does not bind the blockers and their sequences will be amplified. The amplified sequences are detected with a methylation specific probe. (Cottrell et al, 2004, Nuc. Acids Res. 32:el0).
[0172] The Ms-SNuPE technique is a quantitative method for assessing methylation differences at specific CpG sites based on bisulfite treatment of DNA, followed by single- nucleotide primer extension (Gonzalgo and Jones, 1997, Nucleic Acids Res. 25, 2529-2531). Briefly, genomic DNA is reacted with sodium bisulfite to convert unmethylated cytosine to uracil while leaving 5 -methyl cytosine unchanged. Amplification of the desired target sequence is then performed using PCR primers specific for bisulfite-converted DNA, and the resulting product is isolated and used as a template for methylation analysis at the CpG site(s) of interest. In some cases, small amounts of DNA are analyzed (e.g., micro-dissected pathology sections), and the method avoids utilization of restriction enzymes for determining the methylation status at CpG sites. Typical reagents (e.g., as is found in a typical Ms- SNuPE-based kit) for Ms- SNuPE analysis include, but are not limited to: PCR primers for specific gene (or methylation-altered DNA sequence or CpG island); optimized PCR buffers and deoxynucleotides; gel extraction kit; positive control primers; Ms-SNuPE primers for specific gene; reaction buffer (for the Ms-SNuPE reaction); and radioactive nucleotides. Additionally, bisulfite conversion reagents may include: DNA denaturation buffer;
sulfonation buffer; DNA recovery regents or kit (e.g., precipitation, ultrafiltration, affinity column); desulfonation buffer; and DNA recovery components.
[0173] In another embodiment, the methylation status of selected CpG sites is determined using differential Binding-based Methylation Detection Methods. For identification of differentially methylated regions, one approach is to capture methylated DNA. This approach uses a protein, in which the methyl binding domain of MBD2 is fused to the Fc fragment of an antibody (MBD-FC) (Gebhard et al, 2006, Cancer Res. 66:6118-6128; and PCT Pub. No. WO 2006/056480 A2 (Relhi)). This fusion protein has several advantages over conventional methylation specific antibodies. The MBD FC has a higher affinity to methylated DNA and it binds double stranded DNA. Most importantly the two proteins differ in the way they bind DNA. Methylation specific antibodies bind DNA stochastically, which means that only a binary answer can be obtained. The methyl binding domain of MBD-FC, on the other hand, binds DNA molecules regardless of their methylation status. The strength of this protein - DNA interaction is defined by the level of DNA methylation. After binding genomic DNA, eluate solutions of increasing salt concentrations can be used to fractionate non- methylated and methylated DNA allowing for a more controlled separation (Gebhard et al, 2006, Nucleic Acids Res. 34: e82). Consequently this method, called Methyl- CpG immunoprecipitation (MCIP), not only enriches, but also fractionates genomic DNA according to methylation level, which is particularly helpful when the unmethylated DNA fraction should be investigated as well.
[0174] In an alternative embodiment, a 5 -methyl cytidine antibody to bind and precipitate methylated DNA. Antibodies are available from Abeam (Cambridge, MA), Diagenode (Sparta, NJ) or Eurogentec (c/o AnaSpec, Fremont, CA). Once the methylated fragments have been separated they may be sequenced using microarray based techniques such as methylated CpG-island recovery assay (MIRA) or methylated DNA immunoprecipitation (MeDIP) (Pelizzola et al, 2008, Genome Res. 18, 1652-1659; O'Geen et al, 2006,
BioTechniques 41(5), 577-580, Weber et al, 2005, Nat. Genet. 37, 853-862; Horak and Snyder, 2002, Methods Enzymol, 350, 469-83; Lieb, 2003, Methods Mol Biol, 224, 99-109). Another technique is methyl-CpG binding domain column/segregation of partly melted molecules (MBD/SPM, Shiraishi et al, 1999, Proc. Natl. Acad. Sci. USA 96(6):2913-2918).
[0175] In some embodiments, methods for detecting methylation include randomly shearing or randomly fragmenting the genomic DNA, cutting the DNA with a methylation- dependent or methylation-sensitive restriction enzyme and subsequently selectively identifying and/or analyzing the cut or uncut DNA. Selective identification can include, for example, separating cut and uncut DNA (e.g., by size) and quantifying a sequence of interest that was cut or, alternatively, that was not cut. See, e.g., U.S. Patent No. 7, 186,512.
Alternatively, the method can encompass amplifying intact DNA after restriction enzyme digestion, thereby only amplifying DNA that was not cleaved by the restriction enzyme in the area amplified. See, e.g., U.S. Patents No. 7,910,296; No. 7,901,880; and No. 7,459,274. In some embodiments, amplification can be performed using primers that are gene specific.
[0176] For example, there are methyl-sensitive enzymes that preferentially or substantially cleave or digest at their DNA recognition sequence if it is non-methylated. Thus, an unmethylated DNA sample is cut into smaller fragments than a methylated DNA sample. Similarly, a hypermethylated DNA sample is not cleaved. In contrast, there are methyl- sensitive enzymes that cleave at their DNA recognition sequence only if it is methylated. Methyl- sensitive enzymes that digest unmethylated DNA suitable for use in methods of the technology include, but are not limited to, Hpall, Hhal, Maell, BstUI and Acil. In some instances, an enzyme that is used is Hpall that cuts only the unmethylated sequence CCGG. In other instances, another enzyme that is used is Hhal that cuts only the unmethylated sequence GCGC. Both enzymes are available from New England BioLabs(R), Inc.
Combinations of two or more methyl-sensitive enzymes that digest only unmethylated DNA are also used. Suitable enzymes that digest only methylated DNA include, but are not limited to, Dpnl, which only cuts at fully methylated 5'-GATC sequences, and McrBC, an endonuclease, which cuts DNA containing modified cytosines (5-methylcytosine or 5- hydroxym ethyl cytosine or N4- methyl cytosine) and cuts at recognition site 5'... PumC(N4o- 3ooo) PumC... 3' (New England BioLabs, Inc., Beverly, MA). Cleavage methods and procedures for selected restriction enzymes for cutting DNA at specific sites are well known to the skilled artisan. For example, many suppliers of restriction enzymes provide information on conditions and types of DNA sequences cut by specific restriction enzymes, including New England BioLabs, Pro-Mega Biochems, Boehringer-Mannheim, and the like. Sambrook et al. (See Sambrook et al. Molecular Biology: A Laboratory Approach, Cold Spring Harbor, N.Y. 1989) provide a general description of methods for using restriction enzymes and other enzymes.
[0177] In some instances, a methylation-dependent restriction enzyme is a restriction enzyme that cleaves or digests DNA at or in proximity to a methylated recognition sequence, but does not cleave DNA at or near the same sequence when the recognition sequence is not methylated. Methylation-dependent restriction enzymes include those that cut at a methylated recognition sequence (e.g., Dpnl) and enzymes that cut at a sequence near but not at the recognition sequence (e.g., McrBC). For example, McrBC's recognition sequence is 5' RmC (N40-3000) RmC 3 ' where "R" is a purine and "mC" is a methylated cytosine and "N40-3000" indicates the distance between the two RmC half sites for which a restriction event has been observed. McrBC generally cuts close to one half-site or the other, but cleavage positions are typically distributed over several base pairs, approximately 30 base pairs from the methylated base. McrBC sometimes cuts 3' of both half sites, sometimes 5' of both half sites, and sometimes between the two sites. Exemplary methylation-dependent restriction enzymes include, e.g., McrBC, McrA, MrrA, Bisl, Glal and Dpnl. One of skill in the art will appreciate that any methylation-dependent restriction enzyme, including homologs and orthologs of the restriction enzymes described herein, is also suitable for use with one or more methods described herein.
[0178] In some cases, a methylation-sensitive restriction enzyme is a restriction enzyme that cleaves DNA at or in proximity to an unmethylated recognition sequence but does not cleave at or in proximity to the same sequence when the recognition sequence is methylated. Exemplary methylation-sensitive restriction enzymes are described in, e.g., McClelland et al, 22(17) NUCLEIC ACIDS RES. 3640-59 (1994). Suitable methylation-sensitive restriction enzymes that do not cleave DNA at or near their recognition sequence when a cytosine within the recognition sequence is methylated at position C5 include, e.g., Aat II, Aci I, Acd I, Age I, Alu I, Asc I, Ase I, AsiS I, Bbe I, BsaA I, BsaH I, BsiE I, BsiW I, BsrF I, BssH II, BssK I, BstB I, BstN I, BstU I, Cla I, Eae I, Eag I, Fau I, Fse I, Hha I, HinPl I, HinC II, Hpa II, Hpy99 I, HpyCH4 IV, Kas I, Mbo I, Mlu I, MapAl I, Msp I, Nae I, Nar I, Not I, Pml I, Pst I, Pvu I, Rsr II, Sac II, Sap I, Sau3 A I, Sfl I, Sfo I, SgrA I, Sma I, SnaB I, Tsc I, Xma I, and Zra I. Suitable methylation-sensitive restriction enzymes that do not cleave DNA at or near their recognition sequence when an adenosine within the recognition sequence is methylated at position N6 include, e.g., Mbo I. One of skill in the art will appreciate that any methylation- sensitive restriction enzyme, including homologs and orthologs of the restriction enzymes described herein, is also suitable for use with one or more of the methods described herein. One of skill in the art will further appreciate that a methylation-sensitive restriction enzyme that fails to cut in the presence of methylation of a cytosine at or near its recognition sequence may be insensitive to the presence of methylation of an adenosine at or near its recognition sequence. Likewise, a methylation-sensitive restriction enzyme that fails to cut in the presence of methylation of an adenosine at or near its recognition sequence may be insensitive to the presence of methylation of a cytosine at or near its recognition sequence. For example, Sau3AI is sensitive (i.e., fails to cut) to the presence of a methylated cytosine at or near its recognition sequence, but is insensitive (i.e., cuts) to the presence of a methylated adenosine at or near its recognition sequence. One of skill in the art will also appreciate that some methylation-sensitive restriction enzymes are blocked by methylation of bases on one or both strands of DNA encompassing of their recognition sequence, while other
methylation-sensitive restriction enzymes are blocked only by methylation on both strands, but can cut if a recognition site is hemi-methylated.
[0179] In alternative embodiments, adaptors are optionally added to the ends of the randomly fragmented DNA, the DNA is then digested with a methyl ati on-dependent or methylation-sensitive restriction enzyme, and intact DNA is subsequently amplified using primers that hybridize to the adaptor sequences. In this case, a second step is performed to determine the presence, absence or quantity of a particular gene in an amplified pool of DNA. In some embodiments, the DNA is amplified using real-time, quantitative PCR.
[0180] In other embodiments, the methods comprise quantifying the average methylation density in a target sequence within a population of genomic DNA. In some embodiments, the method comprises contacting genomic DNA with a methylation-dependent restriction enzyme or methylation-sensitive restriction enzyme under conditions that allow for at least some copies of potential restriction enzyme cleavage sites in the locus to remain uncleaved; quantifying intact copies of the locus; and comparing the quantity of amplified product to a control value representing the quantity of methylation of control DNA, thereby quantifying the average methylation density in the locus compared to the methylation density of the control DNA.
[0181] In some instances, the quantity of methylation of a locus of DNA is determined by providing a sample of genomic DNA comprising the locus, cleaving the DNA with a restriction enzyme that is either methylation-sensitive or methylation-dependent, and then quantifying the amount of intact DNA or quantifying the amount of cut DNA at the DNA locus of interest. The amount of intact or cut DNA will depend on the initial amount of genomic DNA containing the locus, the amount of methylation in the locus, and the number (i.e., the fraction) of nucleotides in the locus that are methylated in the genomic DNA. The amount of methylation in a DNA locus can be determined by comparing the quantity of intact DNA or cut DNA to a control value representing the quantity of intact DNA or cut DNA in a similarly-treated DNA sample. The control value can represent a known or predicted number of methylated nucleotides. Alternatively, the control value can represent the quantity of intact or cut DNA from the same locus in another (e.g., normal, non-diseased) cell or a second locus.
[0182] By using at least one methylation-sensitive or methylation-dependent restriction enzyme under conditions that allow for at least some copies of potential restriction enzyme cleavage sites in the locus to remain uncleaved and subsequently quantifying the remaining intact copies and comparing the quantity to a control, average methylation density of a locus can be determined. If the methylation-sensitive restriction enzyme is contacted to copies of a DNA locus under conditions that allow for at least some copies of potential restriction enzyme cleavage sites in the locus to remain uncleaved, then the remaining intact DNA will be directly proportional to the methylation density, and thus may be compared to a control to determine the relative methylation density of the locus in the sample. Similarly, if a methylation-dependent restriction enzyme is contacted to copies of a DNA locus under conditions that allow for at least some copies of potential restriction enzyme cleavage sites in the locus to remain uncleaved, then the remaining intact DNA will be inversely proportional to the methylation density, and thus may be compared to a control to determine the relative methylation density of the locus in the sample. Such assays are disclosed in, e.g., U.S. Patent No. 7,910,296.
[0183] The methylated CpG island amplification (MCA) technique is a method that can be used to screen for altered methylation patterns in genomic DNA, and to isolate specific sequences associated with these changes (Toyota et al, 1999, Cancer Res. 59, 2307-2312, U.S. Pat. No. 7,700,324 (Issa et al)). Briefly, restriction enzymes with different sensitivities to cytosine methylation in their recognition sites are used to digest genomic DNAs from primary tumors, cell lines, and normal tissues prior to arbitrarily primed PCR amplification. Fragments that show differential methylation are cloned and sequenced after resolving the PCR products on high-resolution polyacrylamide gels. The cloned fragments are then used as probes for Southern analysis to confirm differential methylation of these regions. Typical reagents (e.g., as might be found in a typical MCA-based kit) for MCA analysis may include, but are not limited to: PCR primers for arbitrary priming Genomic DNA; PCR buffers and nucleotides, restriction enzymes and appropriate buffers; gene-hybridization oligos or probes; control hybridization oligos or probes.
[0184] Additional methylation detection methods include those methods described in, e.g., U.S. Patents No. 7,553,627; No. 6,331,393; U.S. Patent Serial No. 12/476,981; U.S. Patent Publication No. 2005/0069879; Rein, et al, 26(10) NUCLEIC ACIDS RES. 2255-64 (1998); and Olek et al, 17(3) NAT. GENET. 275-6 (1997).
[0185] In another embodiment, the methylation status of selected CpG sites is determined using Methylation- Sensitive High Resolution Melting (HRM). Recently, Wojdacz et al. reported methylation-sensitive high resolution melting as a technique to assess methylation. (Wojdacz and Dobrovic, 2007, Nuc. Acids Res. 35(6) e41; Wojdacz et al. 2008, Nat. Prot. 3(12) 1903-1908; Balic et al, 2009 J. Mol. Diagn. 11 102- 108; and US Pat. Pub. No.
2009/0155791 (Wojdacz et al)). A variety of commercially available real time PCR machines have HRM systems including the Roche LightCycler480, Corbett Research
RotorGene6000, and the Applied Biosystems 7500. HRM may also be combined with other amplification techniques such as pyrosequencing as described by Candiloro et al. (Candiloro et al, 2011, Epigenetics 6(4) 500-507).
[0186] In another embodiment, the methylation status of selected CpG locus is determined using a primer extension assay, including an optimized PCR amplification reaction that produces amplified targets for analysis using mass spectrometry. The assay can also be done in multiplex. Mass spectrometry is a particularly effective method for the detection of polynucleotides associated with the differentially methylated regulatory elements. The presence of the polynucleotide sequence is verified by comparing the mass of the detected signal with the expected mass of the polynucleotide of interest. The relative signal strength, e.g., mass peak on a spectra, for a particular polynucleotide sequence indicates the relative population of a specific allele, thus enabling calculation of the allele ratio directly from the data. This method is described in detail in PCT Pub. No. WO 2005/012578A1 (Beaulieu et al), which is hereby incorporated by reference in its entirety. For methylation analysis, the assay can be adopted to detect bisulfite introduced methylation dependent C to T sequence changes. These methods are particularly useful for performing multiplexed amplification reactions and multiplexed primer extension reactions (e.g., multiplexed homogeneous primer mass extension (hME) assays) in a single well to further increase the throughput and reduce the cost per reaction for primer extension reactions.
[0187] Other methods for DNA methylation analysis include restriction landmark genomic scanning (RLGS, Costello et al, 2002, Meth. Mol Biol, 200, 53-70), methylation- sensitive- representational difference analysis (MS-RDA, Ushijima and Yamashita, 2009, Methods Mol Biol 507, 1 17-130). Comprehensive high-throughput arrays for relative methylation
(CHARM) techniques are described in WO 2009/021141 (Feinberg and Irizany). The Roche(R) NimbleGen(R) microarrays including the Chromatin Immunoprecipitation-on- chip (ChlP-chip) or methylated DNA immunoprecipitation-on-chip (MeDIP-chip). These tools have been used for a variety of cancer applications including melanoma, liver cancer and lung cancer (Koga et al, 2009, Genome Res., 19, 1462-1470; Acevedo et al, 2008, Cancer Res., 68, 2641-2651; Rauch et al, 2008, Proc. Nat. Acad. Sci. USA, 105, 252-257). Others have reported bisulfate conversion, padlock probe hybridization, circularization,
amplification and next generation or multiplexed sequencing for high throughput detection of methylation (Deng et al, 2009, Nat. Biotechnol 27, 353-360; Ball et al, 2009, Nat. Biotechnol 27, 361-368; U.S. Pat. No. 7,611,869 (Fan)). As an alternative to bisulfate oxidation, Bayeyt et al. have reported selective oxidants that oxidize 5-methylcytosine, without reacting with thymidine, which are followed by PCR or pyro sequencing (WO 2009/049916 (Bayeyt et al).
[0188] In some instances, quantitative amplification methods (e.g., quantitative PCR or quantitative linear amplification) are used to quantify the amount of intact DNA within a locus flanked by amplification primers following restriction digestion. Methods of quantitative amplification are disclosed in, e.g., U.S. Patents No. 6, 180,349; No. 6,033,854; and No. 5,972,602, as well as in, e.g., DeGraves, et al, 34(1) BIOTECHNIQUES 106-15 (2003); Deiman B, et al., 20(2) MOL. BIOTECHNOL. 163-79 (2002); and Gibson et al, 6 GENOME RESEARCH 995-1001 (1996).
[0189] Following reaction or separation of nucleic acid in a methylation specific manner, the nucleic acid in some cases are subjected to sequence-based analysis. For example, once it is determined that one particular genomic sequence from a sample is hypermethylated or hypomethylated compared to its counterpart, the amount of this genomic sequence can be determined. Subsequently, this amount can be compared to a standard control value and used to determine the present of breast cancer in the sample. In many instances, it is desirable to amplify a nucleic acid sequence using any of several nucleic acid amplification procedures which are well known in the art. Specifically, nucleic acid amplification is the chemical or enzymatic synthesis of nucleic acid copies which contain a sequence that is complementary to a nucleic acid sequence being amplified (template). The methods and kits may use any nucleic acid amplification or detection methods known to one skilled in the art, such as those described in U.S. Pat. Nos. 5,525,462 (Takarada et al); 6, 114,117 (Hepp et al); 6,127, 120 (Graham et al); 6,344,317 (Urnovitz); 6,448,001 (Oku); 6,528,632 (Catanzariti et al); and PCT Pub. No. WO 2005/111209 (Nakajima et al).
[0190] In some embodiments, the nucleic acids are amplified by PCR amplification using methodologies known to one skilled in the art. One skilled in the art will recognize, however, that amplification can be accomplished by any known method, such as ligase chain reaction (LCR), Q -replicas amplification, rolling circle amplification, transcription amplification, self-sustained sequence replication, nucleic acid sequence-based amplification (NASBA), each of which provides sufficient amplification. Branched-DNA technology is also optionally used to qualitatively demonstrate the presence of a sequence of the technology, which represents a particular methylation pattern, or to quantitatively determine the amount of this particular genomic sequence in a sample. Nolte reviews branched-DNA signal amplification for direct quantitation of nucleic acid sequences in clinical samples (Nolte, 1998, Adv. Clin. Chem. 33 :201-235).
[0191] The PCR process is well known in the art and include, for example, reverse transcription PCR, ligation mediated PCR, digital PCR (dPCR), or droplet digital PCR (ddPCR). For a review of PCR methods and protocols, see, e.g., Innis et al, eds., PCR Protocols, A Guide to Methods and Application, Academic Press, Inc., San Diego, Calif. 1990; U.S. Pat. No. 4,683,202 (Mullis). PCR reagents and protocols are also available from commercial vendors, such as Roche Molecular Systems. In some instances, PCR is carried out as an automated process with a thermostable enzyme. In this process, the temperature of the reaction mixture is cycled through a denaturing region, a primer annealing region, and an extension reaction region automatically. Machines specifically adapted for this purpose are commercially available.
[0192] In some embodiments, amplified sequences are also measured using invasive cleavage reactions such as the Invader(R) technology (Zou et al, 2010, Association of Clinical Chemistry (AACC) poster presentation on July 28, 2010, "Sensitive Quantification of Methylated Markers with a Novel Methylation Specific Technology; and U.S. Pat. No. 7,011,944 (Prudent et al)).
[0193] Suitable next generation sequencing technologies are widely available. Examples include the 454 Life Sciences platform (Roche, Branford, CT) (Margulies et al. 2005 Nature, 437, 376-380); lllumina's Genome Analyzer, GoldenGate Methylation Assay, or Infinium Methylation Assays, i.e., Infinium HumanMethylation 27K BeadArray or VeraCode
GoldenGate methylation array (Illumina, San Diego, CA; Bibkova et al, 2006, Genome Res. 16, 383-393; U.S. Pat. Nos. 6,306,597 and 7,598,035 (Macevicz); 7,232,656 (Balasubramanian et al.)); QX200™ Droplet Digital™ PCR System from Bio-Rad; or DNA Sequencing by Ligation, SOLiD System (Applied Biosystems/Life Technologies; U.S. Pat. Nos. 6,797,470, 7,083,917, 7,166,434, 7,320,865, 7,332,285, 7,364,858, and 7,429,453 (Barany et al); the Helicos True Single Molecule DNA sequencing technology (Harris et al, 2008 Science, 320, 106-109; U.S. Pat. Nos. 7,037,687 and 7,645,596 (Williams et al); 7, 169,560 (Lapidus et al); 7,769,400 (Harris)), the single molecule, real-time (SMRT™) technology of Pacific Biosciences, and sequencing (Soni and Meller, 2007, Clin. Chem. 53, 1996-2001); semiconductor sequencing (Ion Torrent; Personal Genome Machine); DNA nanoball sequencing; sequencing using technology from Dover Systems (Polonator), and technologies that do not require amplification or otherwise transform native DNA prior to sequencing (e.g., Pacific Biosciences and Helicos), such as nanopore-based strategies (e.g., Oxford Nanopore, Genia Technologies, and Nabsys). These systems allow the sequencing of many nucleic acid molecules isolated from a specimen at high orders of multiplexing in a parallel fashion. Each of these platforms allow sequencing of clonally expanded or non- amplified single molecules of nucleic acid fragments. Certain platforms involve, for example, (i) sequencing by ligation of dye- modified probes (including cyclic ligation and cleavage), (ii) pyrosequencing, and (iii) single-molecule sequencing.
[0194] Pyrosequencing is a nucleic acid sequencing method based on sequencing by synthesis, which relies on detection of a pyrophosphate released on nucleotide incorporation. Generally, sequencing by synthesis involves synthesizing, one nucleotide at a time, a DNA strand complimentary to the strand whose sequence is being sought. Study nucleic acids may be immobilized to a solid support, hybridized with a sequencing primer, incubated with DNA polymerase, ATP sulfurylase, luciferase, apyrase, adenosine 5' phosphsulfate and luciferin. Nucleotide solutions are sequentially added and removed. Correct incorporation of a nucleotide releases a pyrophosphate, which interacts with ATP sulfurylase and produces ATP in the presence of adenosine 5' phosphsulfate, fueling the luciferin reaction, which produces a chemiluminescent signal allowing sequence determination. Machines for pyrosequencing and methylation specific reagents are available from Qiagen, Inc. (Valencia, CA). See also Tost and Gut, 2007, Nat. Prot. 2 2265-2275. An example of a system that can be used by a person of ordinary skill based on pyrosequencing generally involves the following steps: ligating an adaptor nucleic acid to a study nucleic acid and hybridizing the study nucleic acid to a bead; amplifying a nucleotide sequence in the study nucleic acid in an emulsion; sorting beads using a picoliter multiwell solid support; and sequencing amplified nucleotide sequences by pyrosequencing methodology (e.g., Nakano et al, 2003, J. Biotech. 102, 117- 124). Such a system can be used to exponentially amplify amplification products generated by a process described herein, e.g., by ligating a heterologous nucleic acid to the first amplification product generated by a process described herein.
CpG Methylation Data Analysis Methods
[0195] In certain embodiments, the methylation values measured for biomarkers of a biomarker panel are mathematically combined and the combined value is correlated to the underlying diagnostic question. In some instances, methylated biomarker values are combined by any appropriate state of the art mathematical method. Well-known
mathematical methods for correlating a biomarker combination to a disease status employ methods like discriminant analysis (DA) (e.g., linear-, quadratic-, regularized-DA),
Discriminant Functional Analysis (DFA), Kernel Methods (e.g., SVM), Multidimensional Scaling (MDS), Nonparametric Methods (e.g., k-Nearest-Neighbor Classifiers), PLS (Partial Least Squares), Tree-Based Methods (e.g., Logic Regression, CART, Random Forest Methods, Boosting/Bagging Methods), Generalized Linear Models (e.g., Logistic
Regression), Principal Components based Methods (e.g., SFMCA), Generalized Additive Models, Fuzzy Logic based Methods, Neural Networks and Genetic Algorithms based Methods. The skilled artisan will have no problem in selecting an appropriate method to evaluate an epigenetic marker or biomarker combination described herein. In one
embodiment, the method used in a correlating methylation status of an epigenetic marker or biomarker combination, e.g. to diagnose breast cancer or a breast cancer subtype, is selected from DA (e.g., Linear-, Quadratic-, Regularized Discriminant Analysis), DFA, Kernel Methods (e.g., SVM), MDS, Nonparametric Methods (e.g., k-Nearest-Neighbor Classifiers), PLS (Partial Least Squares), Tree-Based Methods (e.g., Logic Regression, CART, Random Forest Methods, Boosting Methods), or Generalized Linear Models (e.g., Logistic
Regression), and Principal Components Analysis. Details relating to these statistical methods are found in the following references: Ruczinski et al., 12 J. OF COMPUTATIONAL AND GRAPHICAL STATISTICS 475-511 (2003); Friedman, J. H., 84 J. OF THE AMERICAN STATISTICAL ASSOCIATION 165-75 (1989); Hastie, Trevor, Tibshirani, Robert,
Friedman, Jerome, The Elements of Statistical Learning, Springer Series in Statistics (2001); Breiman, L., Friedman, J. H., Olshen, R. A., Stone, C. J. Classification and regression trees, California: Wadsworth (1984); Breiman, L., 45 MACHINE LEARNING 5-32 (2001); Pepe, M. S., The Statistical Evaluation of Medical Tests for Classification and Prediction, Oxford Statistical Science Series, 28 (2003); and Duda, R. O., Hart, P. E., Stork, D. O., Pattern Classification, Wiley Interscience, 2nd Edition (2001).
[0196] In one embodiment, the correlated results for each methylation panel are rated by their correlation to the disease or tumor type positive state, such as for example, by p-value test or t-value test or F-test. Rated (best first, i.e. low p- or t-value) biomarkers are then subsequently selected and added to the methylation panel until a certain diagnostic value is reached. Such methods include identification of methylation panels, or more broadly, genes that were differentially methylated among several classes using, for example, a random- variance t-test (Wright G. W. and Simon R, Bioinformatics 19:2448-2455,2003). Other methods include the step of specifying a significance level to be used for determining the epigenetic markers that will be included in the biomarker panel. Epigenetic markers that are differentially methylated between the classes at a univariate parametric significance level less than the specified threshold are included in the panel. It doesn't matter whether the specified significance level is small enough to exclude enough false discoveries. In some problems better prediction is achieved by being more liberal about the biomarker panels used as features. In some cases, the panels are biologically interpretable and clinically applicable, however, if fewer markers are included. Similar to cross-validation, biomarker selection is repeated for each training set created in the cross-validation process. That is for the purpose of providing an unbiased estimate of prediction error. The methylation panel for use with new patient sample data is the one resulting from application of the methylation selection and classifier of the "known" methylation information, or control methylation panel.
[0197] Models for utilizing methylation profile to predict the class of future samples can also be used. These models may be based on the Compound Covariate Predictor (Radmacher et al. Journal of Computational Biology 9:505-511, 2002), Diagonal Linear Discriminant Analysis (Dudoit et al. Journal of the American Statistical Association 97:77-87, 2002), Nearest Neighbor Classification (also Dudoit et al.), and Support Vector Machines with linear kernel (Ramaswamy et al. PNAS USA 98: 15149-54, 2001). The models incorporated markers that were differentially methylated at a given significance level (e.g. 0.01, 0.05 or 0.1) as assessed by the random variance t-test (Wright G. W. and Simon R. Bioinformatics 19:2448-2455, 2003). The prediction error of each model using cross validation, preferably leave-one-out cross-validation (Simon et al. Journal of the National Cancer Institute 95: 14- 18, 2003can be estimated. For each leave-one-out cross-validation training set, the entire model building process is repeated, including the epigenetic marker selection process. In some instances, it is also evaluated in whether the cross-validated error rate estimate for a model is significantly less than one would expect from random prediction. In some cases, the class labels are randomly permuted and the entire leave-one-out cross-validation process is then repeated. The significance level is the proportion of the random permutations that gives a cross-validated error rate no greater than the cross-validated error rate obtained with the real methylation data.
[0198] Another classification method is the greedy-pairs method described by Bo and Jonassen (Genome Biology 3(4):research0017.1-0017.11, 2002). The greedy-pairs approach starts with ranking all markers based on their individual t-scores on the training set. This method attempts to select pairs of markers that work well together to discriminate the classes.
[0199] Furthermore, a binary tree classifier for utilizing methylation profile is optionally used to predict the class of future samples. The first node of the tree incorporated a binary classifier that distinguished two subsets of the total set of classes. The individual binary classifiers are based on the "Support Vector Machines" incorporating markers that were differentially expressed among markers at the significance level (e.g. 0.01, 0.05 or 0.1) as assessed by the random variance t-test (Wright G. W. and Simon R. Bioinformatics 19:2448- 2455, 2003). Classifiers for all possible binary partitions are evaluated and the partition selected is that for which the cross-validated prediction error is minimum. The process is then repeated successively for the two subsets of classes determined by the previous binary split. The prediction error of the binary tree classifier can be estimated by cross-validating the entire tree building process. This overall cross-validation includes re-selection of the optimal partitions at each node and re-selection of the markers used for each cross-validated training set as described by Simon et al. (Simon et al. Journal of the National Cancer Institute 95: 14-18, 2003). Several-fold cross validation in which a fraction of the samples is withheld, a binary tree developed on the remaining samples, and then class membership is predicted for the samples withheld. This is repeated several times, each time withholding a different percentage of the samples. The samples are randomly partitioned into fractional test sets (Simon R and Lam A. BRB-ArrayTools User Guide, version 3.2. Biometric Research Branch, National Cancer Institute).
[0200] Thus, in one embodiment, the correlated results for each marker b) are rated by their correct correlation to the disease, preferably by p-value test. It is also possible to include a step in that the markers are selected d) in order of their rating.
[0201] In additional embodiments, factors such as the value, level, feature, characteristic, property, etc. of a transcription rate, mRNA level, translation rate, protein level, biological activity, cellular characteristic or property, genotype, phenotype, etc. can be utilized in addition prior to, during, or after administering a therapy to a patient to enable further analysis of the patient's cancer status.
[0202] In some embodiments, a diagnostic test to correctly predict status is measured as the sensitivity of the assay, the specificity of the assay or the area under a receiver operated characteristic ("ROC") curve. In some instances, sensitivity is the percentage of true positives that are predicted by a test to be positive, while specificity is the percentage of true negatives that are predicted by a test to be negative. In some cases, an ROC curve provides the sensitivity of a test as a function of 1- specificity. The greater the area under the ROC curve, for example, the more accurate or powerful the predictive value of the test. Other useful measures of the utility of a test include positive predictive value and negative predictive value. Positive predictive value is the percentage of people who test positive that are actually positive. Negative predictive value is the percentage of people who test negative that are actually negative.
[0203] In some embodiments, one or more of the biomarkers disclosed herein show a statistical difference in different samples of at least p<0.05, p<10"2, p<10"3, p<10"4 or p<10"5. Diagnostic tests that use these biomarkers may show an ROC of at least 0.6, at least about 0.7, at least about 0.8, or at least about 0.9. In some instances, the biomarkers are
differentially methylated in different subjects with or without breast cancer. In additional instances, the biomarkers for different subtypes of breast cancer are differentially methylated. In certain embodiments, the biomarkers are measured in a patient sample using the methods described herein and compared, for example, to predefined biomarker levels and are used to determine whether the patient has breast cancer, which breast cancer subtype does the patient have, and/or what is the prognosis of the patient having breast cancer. In other embodiments, the correlation of a combination of biomarkers in a patient sample is compared, for example, to a predefined set of biomarkers. In some embodiments, the measurement s) is then compared with a relevant diagnostic amount(s), cut-off(s), or multivariate model scores that distinguish between the presence or absence of breast cancer, between breast cancer subtypes, and between a "good" or a "poor" prognosis. As is well understood in the art, by adjusting the particular diagnostic cut-off(s) used in an assay, one can increase sensitivity or specificity of the diagnostic assay depending on the preference of the diagnostician. In some
embodiments, the particular diagnostic cut-off is determined, for example, by measuring the amount of biomarker hypermethylation or hypomethylation in a statistically significant number of samples from patients with or without breast cancer and from patients with different breast cancer subtypes, and drawing the cut-off to suit the desired levels of specificity and sensitivity.
Kits/Article of Manufacture
[0204] In some embodiments, provided herein include kits for detecting and/or
characterizing the methylation profile of a biomarker described herein. In some instances, the kit comprises a plurality of primers or probes to detect or measure the methylation
status/levels of one or more samples. Such kits comprise, in some instances, at least one polynucleotide that hybridizes to at least one of the methylation marker sequences described herein and at least one reagent for detection of gene methylation. Reagents for detection of methylation include, e.g., sodium bisulfate, polynucleotides designed to hybridize to sequence that is the product of a marker sequence if the marker sequence is not methylated (e.g., containing at least one C-U conversion), and/or a methylation- sensitive or methylation- dependent restriction enzyme. In some cases, the kits provide solid supports in the form of an assay apparatus that is adapted to use in the assay. In some instances, the kits further comprise detectable labels, optionally linked to a polynucleotide, e.g., a probe, in the kit.
[0205] In some embodiments, the kits comprise one or more (e.g., 1, 2, 3, 4, or more) different polynucleotides (e.g., primers and/or probes) capable of specifically amplifying at least a portion of a DNA region of a biomarker described herein. Optionally, one or more detectably-labeled polypeptides capable of hybridizing to the amplified portion are also included in the kit. In some embodiments, the kits comprise sufficient primers to amplify 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different DNA regions or portions thereof, and optionally include detectably-labeled polynucleotides capable of hybridizing to each amplified DNA region or portion thereof. The kits further can comprise a methylation-dependent or methylation sensitive restriction enzyme and/or sodium bisulfite.
[0206] In some embodiments, the kits comprise sodium bisulfite, primers and adapters (e.g., oligonucleotides that can be ligated or otherwise linked to genomic fragments) for whole genome amplification, and polynucleotides (e.g., detectably-labeled polynucleotides) to quantify the presence of the converted methylated and or the converted unmethylated sequence of at least one cytosine from a DNA region of an epigenetic marker described herein.
[0207] In some embodiments, the kits comprise methylation sensing restriction enzymes (e.g., a methylation-dependent restriction enzyme and/or a methylation-sensitive restriction enzyme), primers and adapters for whole genome amplification, and polynucleotides to quantify the number of copies of at least a portion of a DNA region of an epigenetic marker described herein.
[0208] In some embodiments, the kits comprise a methylation binding moiety and one or more polynucleotides to quantify the number of copies of at least a portion of a DNA region of a marker described herein. A methylation binding moiety refers to a molecule (e.g., a polypeptide) that specifically binds to methyl-cytosine.
[0209] Examples include restriction enzymes or fragments thereof that lack DNA cutting activity but retain the ability to bind methylated DNA, antibodies that specifically bind to methylated DNA, etc.).
[0210] In some embodiments, the kit includes a packaging material. As used herein, the term "packaging material" can refer to a physical structure housing the components of the kit. In some instances, the packaging material maintains sterility of the kit components, and is made of material commonly used for such purposes (e.g., paper, corrugated fiber, glass, plastic, foil, ampules, etc.). Other materials useful in the performance of the assays are included in the kits, including test tubes, transfer pipettes, and the like. In some cases, the kits also include written instructions for the use of one or more of these reagents in any of the assays described herein.
[0211] In some embodiments, kits also include a buffering agent, a preservative, or a protein/nucleic acid stabilizing agent. In some cases, kits also include other components of a reaction mixture as described herein. For example, kits include one or more aliquots of thermostable DNA polymerase as described herein, and/or one or more aliquots of dNTPs. In some cases, kits also include control samples of known amounts of template DNA molecules harboring the individual alleles of a locus. In some embodiments, the kit includes a negative control sample, e.g., a sample that does not contain DNA molecules harboring the individual alleles of a locus. In some embodiments, the kit includes a positive control sample, e.g., a sample containing known amounts of one or more of the individual alleles of a locus.
Certain Terminology
[0212] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the claimed subject matter belongs. It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of any subject matter claimed. In this application, the use of the singular includes the plural unless specifically stated otherwise. It must be noted that, as used in the specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. In this application, the use of "or" means "and/or" unless stated otherwise. Furthermore, use of the term "including" as well as other forms, such as "include", "includes," and "included," is not limiting.
[0213] As used herein, ranges and amounts can be expressed as "about" a particular value or range. About also includes the exact amount. Hence "about 5 μΙ_," means "about 5 μΙ_," and also "5 μΐ. " Generally, the term "about" includes an amount that would be expected to be within experimental error.
[0214] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.
[0215] As used herein, the terms "individual(s)", "subject(s)" and "patient(s)" mean any mammal. In some embodiments, the mammal is a human. In some embodiments, the mammal is a non-human. None of the terms require or are limited to situations characterized by the supervision (e.g. constant or intermittent) of a health care worker (e.g. a doctor, a registered nurse, a nurse practitioner, a physician's assistant, an orderly or a hospice worker).
[0216] A "site" corresponds to a single site, which in some cases is a single base position or a group of correlated base positions, e.g., a CpG site. A "locus" corresponds to a region that includes multiple sites. In some instances, a locus includes one site.
EXAMPLES
[0217] These examples are provided for illustrative purposes only and not to limit the scope of the claims provided herein.
Example 1. General Methodology
[0218] Tumor DNA extraction
[0219] Genomic DNA extraction from pieces of freshly frozen healthy or cancer tissues was performed with QIAamp DNA Mini Kit (Qiagen) according to manufacturer's recommendations. DNA was extracted from roughly 0.5 mg of tissue. DNA was stored at - 20°C and analyzed within one week of preparation.
[0220] DNA extraction from FFPE samples
[0221] Genomic DNA from frozen FFPE samples was extracted using QIAamp DNA FFPE Tissue Kit with several modifications. DNA were stored at -20°C for further analysis.
[0222] Bisulfite conversion of genomic DNA [0223] 1 μg of genomic DNA was converted to bis-DNA using EZ DNA Methylation- Lightning™ Kit (Zymo Research) according to the manufacturer's protocol. Resulting bis- DNA had a size distribution of -200-3000 bp, with a peak around -500-1000 bp. The efficiency of bisulfite conversion was >99.8% as verified by deep-sequencing of bis-DNA and analyzing the ratio of C to T conversion of CH (non-CG) dinucleotides.
[0224] Determination of DNA methylation levels of the second validation cohort by deep sequencing of bis-DNA captured with molecular-inversion (padlock) probes
[0225] Padlock probes were designed to capture regions containing the CpG markers whose methylation levels significantly differed in any of the comparison between any cancer tissue and any normal tissue.
[0226] Probe design and synthesis
[0227] Padlock probes were designed using the ppDesigner software. The average length of the captured region was 100 bp, with the CpG marker located in the central portion of the captured region. Linker sequence between arms contained binding sequences for
amplification primers separated by a variable stretch of Cs to produced probes of equal length. A 6-bp unique molecular identifier (UMI) sequence in probe design was incorporated to allow for the identification of unique individual molecular capture events and accurate scoring of DNA methylation levels. Probes were synthesized as separate oligonucleotides using standard commercial synthesis methods (ITD).
[0228] Bis-DNA capture
[0229] 50 ng of bisulfite-converted DNA was mixed with padlock probes in 20 μΐ reactions containing IX Ampligase buffer (Epicentre). To anneal probes to DNA, 30 second
denaturation at 95°C was followed by a slow cooling to 55°C. Hybridization was left to complete for 15 hrs at 55°C. To fill gaps between annealed arms, 5μ1 of the following mixture was added to each reaction: 2U of PfuTurbo polymerase (Agilent), 0.5U of Ampligase (Epicentre) and 250 pmol of each dNTP in IX Ampligase buffer. 5 μΐ of exonuclease mix (20U of Exo I and 100U of ExoIII, both from Epicentre) was added and single- stranded DNA degradation was carried out at 37°C for 2 hours, followed by enzyme inactivation for 2 minutes at 94°C.
[0230] Circular products of site-specific capture were amplified by PCR with concomitant barcoding of separate samples. Amplification was carried out using primers specific to linker DNA within padlock probes, one of which contained specific 6bp barcodes. Both primers contained Illumina next-generation sequencing adaptor sequences. PCR was done as follows: IX Phusion Flash Master Mix, 3 μΐ of captured DNA and 200nM primers, using the following cycle: 10s @ 98°C, 8X of (Is @ 98°C, 5s @ 58°C, 10s @ 72°C), 25X of (Is @ 98°C, 15s @ 72°C), 60s @ 72°C. PCR reactions were mixed and the resulting library was size selected to include effective captures (~230bp) and exclude "empty" captures (~150bp) using Agencourt AMPure XP beads (Beckman Coulter). Libraries were sequenced using MiSeq and HiSeq2500 systems (Illumina).
[0231] Sequencing data analysis
[0232] Mapping of sequencing reads was done using the software tool bisReadMapper with some modifications. First, UMI were extracted from each sequencing read and appended to read headers within FASTQ files using a custom script. Reads were on-the-fly converted as if all C were non-methylated and mapped to in-silico converted DNA strands of the human genome, also as if all C were non-methylated, using Bowtie2. Methylation frequencies were calculated for all CpG dinucleotides contained within the regions captured by padlock probes by dividing the numbers of unique reads carrying a C at the interrogated position by the total number of reads covering the interrogated position.
Example 2. Breast Cancer Diagnostic
[0233] Patient data was obtained from the Cancer Genome Atlas (TCGA). DNA
methylation data were obtained from the TCGA analysis of about 450,000 sites generated using the Infinium 450K Methylation Array. Methylation profiles for breast cancer tissue and normal breast tissue were analyzed. Four clinical covariates were used, which includes:
[0234] Age (continuous);
[0235] Gender (categorical) with two levels: Female/ Male;
[0236] Race (categorical) with three levels: Asian, Black or African American and White. The category American Indian or Alaska Native was removed due to insufficient number of observations;
[0237] American Join Committee on Cancer (AJCC) stage - combined into a four-level covariate: Stage I, Stage II, Stage III and Stage IV.
[0238] The data were further modified by removal of missing value in any of the four clinical and demographic covariates to generate 790 breast cancer samples and 97 normal breast tissue samples for subsequent diagnostic analysis.
[0239] Six additional datasets were also obtained from TCGA which includes:
[0240] colon cancer tissue: 404
[0241] colon normal tissue:45 [0242] liver cancer tissue: 377
[0243] liver normal tissue: 50
[0244] lung cancer tissue: 839
[0245] lung normal tissue: 74
[0246] and were used during the subsequent diagnostic analysis.
[0247] For each of the eight types of sample, each dataset (or sample set) were split into a training set and a test set with a 2: 1 ratio. A pre-screening procedure was used first to remove excessive noise on the training data using the 'moderated t-statistics ' (Smyth, G. "Linear models and empirical bayes methods for assessing differential expression in microarray experiments," Statistical Applications in Genetics and Molecular Biology 3(1): 1- 25 (2004)). For each set of comparison, one type of sample was compared against all other 7 types of samples. A list of markers with significantly difference in mean among all 8 sets of comparisons were retained for future analysis. The Benjamini-Hochberg procedure
(Benjamini and Hochberg, "Controlling the false discovery rate: a practical and powerful approach to multiple testing," Journal of the Royal Statistical Society. Series B
Methodological p289-300, 1995) was used to control the FDR at significance level 0.05. For multinomial classification, least absolute shrinkage and selection operator (LASSO) was used under multinomial distribution. The tuning parameter was determined by the expected generalization error estimated from 10-fold cross-validation. Similar to survival analysis in Example 2, the random split scheme was repeated for 10 times to stabilize the variable selection procedure. A composite panel was constructed by keeping markers with a high selection probability and disregard those with low selection probability from the 10 sets of markers selected from the aforementioned procedure.
[0248] A multi-class prediction system based on (Friedman et al., "Regularization paths for generalized linear models via coordinate descent," Journal of statistical software, 33(1): 1, 2010) was constructed to predict the group membership of samples in the test data using the panel of markers selected. A confusion matrix and ROC curves were also provided to evaluate sensitivity and specificity, in addition to prediction accuracy.
[0249] The hypothesis testing was two-sided with p-value < 0.05 and was considered to be statistically significant. The analysis was conducted in R version 3.3.2 with the following packages used: 'glmnet', 'lpc', 'CoxBoost', 'limma', and 'ROCR'.
[0250] Table 1 shows a list of markers presented in at least 7 out of 10 random split. Based on 10 random split, the median prediction accuracy on test data was 98.0% with minimum 47.7% and maximum 99.1%. In some instances, this list of markers is used for diagnostic purposes.
Table 1.
breast "cg01327147" "cg02680086" "cg04772948" "cg04917276" "cg05395187" cancer
"cg07493516" "cg08268679" "cg08549335" "cg09819083" "cgl3976210"
"cgl4817783" "cgl5412918" "cgl8482112" "cg20069090" "cg24732563"
Breast- "cg00886954" "cg23690893"
normal
[0251] Table 2 shows the confusion matrix (or error matrix) on TCGA test dataset. The prediction is based on a list of markers presented in at least 7 out of 10 random split.
Table 2.
Example 3. Prognosis Analysis
[0252] DNA methylation data were obtained from the TCGA analysis of about 27,000 sites generated using the Infinium 450K Methylation Array. Methylation profile for breast cancer tissue was analyzed. Four clinical covariates were used as described in Example 1.
[0253] The data were further modified by removal of 1) negative and 0 survival time; or 2) missing value in any of the four clinical and demographic covariates; to generate 967 breast cancer samples with 103 events (the event of interest was defined as death) for subsequent diagnostic analysis.
[0254] Additional datasets were also obtained from TCGA which includes:
[0255] Colon cancer: 365 observations with 53 events;
[0256] Liver cancer: 355 observations with 98 events;
[0257] Lung adenocarcinoma (LUAD): 516 observations with 141 events;
[0258] Lung squamous cell carcinoma (LUSC): 418 observations with 150 events;
[0259] and were used during the subsequent diagnostic analysis.
[0260] For each type of cancer: breast, colon, liver, and lung (LUAD and LUSC
combined), the full dataset was split randomly into training and test sets with 2: 1 ratio. A randomized lasso was used (Meinshausen and Buhlmann, "Stability selection," Journal of the Royal Statistical Society: Series B Statistical Methodology, 72(4): 417-473, 2010), the random split and variable selection scheme were repeated for 10 times, which provides finite sample error control and improves stability of variable selection. For each random split, the univariate pre-screening procedure was first performed on the training data to remove excessive noise and accelerate the computational procedure (Wasserman and Roeder, "High dimensional variable selection. Annals of statistics, 37(5A): 2178, 2009). For each methylation marker, a univariate Cox proportional hazards model was fitted by using each marker as the covariate. A marker with p-value < 0.05 from the Wald statistic was retained in the dataset.
[0261] Four variable selection methods suitable for high-dimensionality on the prescreened training dataset were applied: Least Absolute Shrinkage and Selection Operator (LASSO) (Tibshirani, "Regression shrinkage and selection via the lasso," Journal of the Royal
Statistical Society. Series B (Methodological), p267-288, 1996), Elastic Net (Zou and Hastie, "Regularization and variable selection via the elastic net," Journal of the Royal Statistical Society: Series B (Statistical Methodology), 67(2): 301-320, 2005), Lassoed Principal Components (LPC) (Witten and Tibshirani, "Testing significance of features by lassoed principal components," The annals of applied statistics, 2(3): 986, 2008) and Boosting
[Binder et al., "Boosting for high-dimensional time-to event data with competing risks," Bioinformatics, 25(7): 890-896, 2009]. For LASSO and elastic net, the tuning parameters (λ for LASSO and λ, a for elastic net) were determined according to the expected generalization error estimated from 10-fold cross-validation and information-based criteria AIC/BIC. For LPC, the markers with p-value < 0.05 after False Discovery Rate (FDR) correction were considered to be statistically significant. For boosting, the optimal step was determined by expected generalization error estimated from 10-fold cross-validation. For all methods, the number of markers was also governed by the effective sample size in the training dataset, which approximately equaled to the number of events (death). A Cox proportional hazards model was fitted on the training data using markers selected at the optimal step as the covariates. The predictability of the model was evaluated by p 2 on the training data and concordance probability (also known as c-index) on the test data. p 2 - the proportion of explained randomness (O'Quigley et al., "Explained randomness in proportional hazards models," Statistics in medicine, 24(3): 479-489, 2005), is a function of Kullback- Leibler information gain bounded between 0 and 1, with a larger value indicating larger proportion of randomness explained. C-index (Harrell et al., "Tutorial in biostatistics multivariable prognostic models: issues in developing models, evaluating assumptions and adequacy, and measuring and reducing errors," Statistics in medicine, 15: 361-387, 1996) calculates the proportions of concordant pairs among all pairs of observations with 1 indicating perfect prediction accuracy. The selection of the optimal tuning parameter was difficult given the variability in samples, as such, a composite panel was constructed by keeping markers with a high selection probability and disregard those with low selection probability from the 10 sets of markers selected from the aforementioned procedure.
[0262] To validate, a Cox proportional hazards model was fitted using the panel of markers with high selection probability on the training data. By multiplying the coefficient estimates and the design matrix in the test data, a risk score was obtained for each observation in the test data. By dividing the risk score according to its median, a high risk group and a low risk group were formed with roughly equal number of observations. A plot of Kaplan-Meier estimator and log-rank test were included to determine if the median survival time was significantly different. A model-based prediction was also provided. The high concordance between the non-parametric and semi-parametric prediction curves indicated the possibility of accurately predicting a new patient's survival status for any future time point using the panel of markers selected.
[0263] Table 3 illustrates a list of markers selected in 3 out of 10 training/test split. In some instances, the list of markers is used for prognosis of a subject having breast cancer. Table 4 illustrates validation and prediction performance.
[0264] By using two different statistical learning algorithms, a panel of 19 and 11 methylation markers present in at least 3 out of 10 "randomly split-screen-selection" procedure was identified (see Table 4). Among these markers identified, there were 10 overlapping markers. The average, the proportion of explained randomness calculated from the training data is 0.86 (min: 0.59; max: 0.98) for LASSO and 0.90 (min: 0.75; max: 0.99) for boosting, respectively. The average C-index calculated from the test data is 0.63 (min: 0.56; max: 0.71) for LASSO and 0.61(min:0.54; max:0.68) for boosting. The values from both criteria indicated good predictability from the methylation signatures. The prognostic utility on TCGA data on newly generated TCGA training and test datasets with 2: 1 ratio was also evaluated. In a validation study, 5 out of 10 times the panel of aggregated methylation markers from LASSO can separate groups of high and low risk patients completely; 3 out of 10 times the panel of aggregated methylation markers from boosting can separate different risk groups. [0265] Table 5 shows a log-rank test on the test data (Chi-squared test = 14.3, df=l, p=0.0002). High and low risk group classification is based on risk score using markers selected by the method LASSO.
[0266] Table 6 illustrates a log-rank test on the test data (Chi-squared test = 4.5, df=l, p=0.03). High and low risk group classification is based on risk score using markers selected by the method Boosting.
Table 3.
LASSO "q 500819310" "q 503156547" "q ,04447890" "q 506605933" "q 508623383"
"q 509601629" "q 509799714" "q 510971790" "q 511851098" "q 512188860"
"q 513278334" "q 515357639" "q 517188046" "q 521230435" "q 522043361"
"q 523653712" "q 524229963" "q 525189085" "q 525488021"
Boosting "q 500819310" "q ,04447890" "q 508623383" "q 509799714" "q 510971790"
"q 515357639" "q 517188046" "q 521230435" "q 522043361" "q 524229963"
"q 524714666"
Overlapping "q 500819310" "q ,04447890" "q 508623383" "q 509799714" "q 510971790"
"q 515357639" "q 517188046" "q 521230435" "q 522043361" "c g24229963
Table 4.
LASSO p2 on training 0.86 (min: 0.59 - max: 0.98)
c-index on test 0.63 (min: 0.56 - max: 0.71)
Boosting p2 on training 0.90 (min: 0.75 - max: 0.99)
c-index on test 0.61 (min: 0.54 - max: 0.68) log-rank
5/10 p-value < 0.05
LASSO
log-rank
3/10 p-value < 0.05
Boosting
Table 5.
N Observed Expected
High risk 160 24 13.5
Low risk 160 9 19.5
Table 6.
N Observed Expected
High risk 160 20 14.4
Low risk 160 8 13.6 [0267] Fig. 1 illustrates Kaplan-Meier curves from LASSO (left panel) and Bosting (right panel).
[0268] Fig. 2 shows Cox proportional hazards regression prediction curves from LASSO
(left panel) and Boosting (right panel).
[0269] Fig. 3 shows a multiclass ROC curve from LASSO.
Example 4. Diagnosis of breast cancer or ovarian cancer utilizing a cell-free DNA sample
[0270] Cell-free DNA sample was obtained from a QIAamp Circulating Nucleic Acid Kit. Methylation profile of biomarker cpl0673833 (Cob-2) was used for the analysis.
[0271] The distribution of Cob-2 methylation rate of cell-free DNA (cfDNA) in normal and breast cancer plasma is shown in Fig. 4. The frequency of methylation in the cancer sample is higher relative to the frequency of methylation in the normal sample. Similarly, the methylation rate of Cob-2 from a subject having breast cancer is higher relative to the methylation rate of Cob-2 from a normal subject (Fig. 5). Upon treatment, the rate of methylation is observed to decrease in the absence of tumor burden (Fig. 6). Further, the methylation rate is observed to decrease after treatment but not prior to treatment or after recurrence (Fig. 6). The accuracy of using Cob-2 was assessed by the ROC curve (Fig. 7) with AUC of 0.9531. The methylation rate of Cob-2 in different subpopulations are shown in Fig. 8 (partial response group), Fig. 9 (stable disease group), Fig. 10 (progressive disease group) and Fig. 11 (post-surgery group).
[0272] Figs. 12 show boxplots for the methylation changes in four different response groups. ANOVA (F-test = 29.748, p-value < 0.001) (Table 7) indicates the mean methylation change is different across four groups. By using Tukey's post-hoc analysis (Table 8), a pairwise comparison was conducted between all possible combinations. In addition, the CR and PR groups were combined as the response group, and repeated the aforementioned analysis (Fig. 13). ANOVA (F-test = 29.764, p-value < 0.001) (Table 9) indicates the mean methylation change is significantly different across three groups. By using Tukey's post-hoc analysis (Table 10), the methylation changes between all pairwise comparisons are different.
[0273] Fig. 14 shows methylation rate of Cob-2 from a subject having ovarian cancer relative to the methylation rate of Cob-2 from a normal subject. Upon treatment, the rate of methylation is observed to decrease in the absence of tumor burden (Fig. 14A). Fig. 14B shows a boxplot of the methylation changes in the different response group. Table 7. Summary statistics mean (standard deviation) and ANOVA results for breast cancer
Table 8. Tukey's post-hoc analysis on pairwise comparison for breast cancer
mean.diff lower 95 % CI upper 95 % CI adjust p-value
PR-surgery -0.17 -0.28 -0.06 0.00
SD-surgery 0.09 -0.04 0.21 0.28
PD-surgery 0.36 0.22 0.50 0.00
SD-PR 0.26 0.12 0.40 0.00
PD-PR 0.53 0.38 0.68 0.00
PD-SD 0.27 0.11 0.44 0.00
Table 9. Summary statistics mean (standard deviation) and ANOVA results for breast cancer
Table 10. Tukey's post-hoc analysis on pairwise comparison for breast cancer
mean.diff lower 95 % CI upper 95 % CI adjust p-value
SD-Response 0.15 0.03 0.27 0.01
PD-Response 0.42 0.29 0.56 0.00
PD-SD 0.27 0.11 0.44 0.00
Example 5. Identification of Methylation Correlated Block (MCB)
[0274] In some instances, closely positioned CpG have similar methylation levels, due to a processivity and lack of sequence-specificity of DNA methyltransf erases and demethylases, as well as the concept of haplotype blocks in genetic linkage analysis. Pearson correlation coefficients r2 between β values of any two CpGs positioned within one kilobase of one another were calculated. A cutoff of r2>0.5 was used to identify Methylation Correlated Block (MCB) (also refers to herein as BCM) within regions interrogated by the padlock probes. A value of Pearson's r<0.5 was used to identify transition spots (boundaries) between any two adjacent markers indicating uncorrected methylation. Markers not separated by a boundary were combined into Methylation Correlated Block (MCB). This procedure combined between 2 and 22 CpG positions in each block to identify a total number of BCMs in each diagnostic category within the padlock data. Methylation frequencies for entire MCBs were calculated by summing up the numbers of Cs at all interrogated CpG positions within a BCM and dividing by the total number of C+Ts at those positions Pearson correlation coefficients between methylation frequencies of each pair of CpG markers separated by no more than 200bp were calculated separately from 30 cancer and 30 corresponding normal tissue samples from each of the two diagnostic categories. A value of Pearson's r<0.5 was used to identify transition spots (boundaries) between any two adjacent markers indicating uncorrelated methylation. Markers not separated by a boundary were combined into
Methylation Correlated Block (MCB). Methylation frequencies for entire BCMs were calculated by summing up the numbers of Cs at all interrogated CpG positions within a BCM and dividing by the total number of C+Ts at those positions.
[0275] Fig. 15 illustrates an exemplary BCM for breast cancer. Data was compiled from both healthy tissue samples and corresponding cancers. Row I represents a CG dinucieodide analyzed in this study. Subset of those correspond to CG markers included on Ulumina's Infmium HimiaiiMethyiation450 BeadChip (leftmost column), whereas the majority represent previously unknown potential novel markers. Ro II lists genomic distances between markers and Row III shows genomic location of each analyzed CG. Each row within Row I illustrates Pearson correlation coefficients r2 between β values of two closely positioned CGs calculated for samples from each tissue type separately. Correlation between any two markers is represented by a gray square at the intersection of (virtual) perpendicular lines originating from these two markers. White color indicates no significant correlation, gray color intensity marks r:2 values between 0,5 and I , Black boxes indicate the ends of analyzed regions.
Example 6. Linking differentially methylated markers to gene expression
[0276] TCGA DNA methylation and RNAseq expression data for breast cancer samples are obtained from the TCGA website. The degree of DNA methylation at each CpG is denoted as a beta value and is calculated as (M/(M+U)), where M and U are normalized values representing the methylated and unmethylated allele intensities respectively. Beta values range from 0 to 1 and reflect the fraction of methylated alleles at each CpG in each sample. The methylation beta value is calculated for all 485,000 markers for each of the breast tumor and matched normal breast tissues in the TCGA data. CpG markers with a mean value less than .05 or greater than .95 are selected for further evaluation. Markers with a difference between the mean methylation value for the tumor tissue and the mean methylation value of the corresponding normal tissue of greater than 0.5 are also selected. At the intersection of these two groups, markers for which the mean methylation is < 05 for normal breast tissue samples and the difference between normal and tumor is greater than 0.5 are further selected and the genes associated with these markers are identified. For each marker, the tumor samples are then separated into those with methylation values greater than the mean value of the tumor samples and those with methylation values less than the mean value of the tumor samples. Next, the RNAseq data in the TCGA data is examined and the relative expression of each gene is calculated. Because of the wide variation of the expression values, the values are adjusted as follows: log2 (expression Value + 1). Genes are identified in which the difference in the methylation values correlated with variation in the associated gene expression levels. Genes for which there is a correlation were selected for further functional evaluation and validation.
[0277] DNA RNA isolation and Quantitative PCR
[0278] Tumor and corresponding far site samples of the same tissue are obtained from patients who underwent surgical tumor resection; samples are frozen and preserved at -80°C until use. Isolation of DNA and RNA from samples is performed using AllPrep DNA/RNA Mini kit (Qiagen, Valencia, CA) according to the manufacturer's recommendations. During RNA isolation, the sample is subjected to on-column DNase digestion. RNA is quantified using a Nanodrop 2000 (Thermo Scientific). 200ng RNA of each sample is used for cDNA synthesis using iScript cDNA synthesis kit (Bio-rad, Inc) according to the manufacturer's instructions. qPCR is performed by a standard 40-cycle amplification protocol using gene- specific primers and a Power SYBR Green PCR Master Mix on a 7500 Real Time PCR system (Applied Biosystems). Experiments are carried out in triplicate and normalized to endogenous ACTB levels. Relative fold change in expression is calculated using the AACT method (cycle threshold values <30).
[0279] Cell culture and gene transfections
[0280] Human breast cancer cell line MDA-MB-231 and the human embryonic kidney cell line HEK293a are obtained from American type culture collection (Manassas, VA, USA) and cultured according to their instructions. The expression construct for a gene disclosed herein is purchased from Origene in a form of TrueORF ® cDNA clones in pCMV6-Entry vector. cDNAs are shuttled into pLenti-C-mGFP (Origene) to create a lentivector encoding a fusion protein between the desired gene and mGFP.
[0281] Lentiviral particles are made by co-transfection of HEK-293T cells with a breast cancer gene mGFP lentivector together with a third-generation packaging vector using calcium phosphate precipitation. Viral supernatants are collected 36 hours post-transfection. Human breast cancer cell line MDA-DB-231 are plated in a 6-well plate the day before transfection of the breast cancer gene mGFP lentivector. Stable cell lines are generated by infecting cells with viral particles at the MOI of ~5 for 24hrs and are collected and sorted to 100% GFP - positivity using FACS. The GFP positive cells are then used for a colony formation assay in cell culture and tumor xenograft in nude mice.
[0282] Colony formation assays
[0283] Cells are plated in 6-well plates at a density of 500 cells per well and are cultured at 37°C with 5% C02 humidified air for 14 days. The colonies are fixed with 10%
formaldehyde for 5 min and then stained with 0.1% crystal violet for 30 seconds. Colony consisting of 50 or more cells are counted. The experiment is performed in triplicate and repeated 3 times. Plate efficiency = (colony numbers /inoculated cell numbers) χ 100%.
[0284] Tumor xenograft
[0285] All animal studies are performed in accordance with institutional and international animal regulations. Animal protocols are approved by the Institutional Animal Care and Use Committee of Sun Yat- Sen University. Female athymic BALB/c nude mice (4-5 weeks of age, 18-20 g) are purchased from a vendor (Guangdong Province Laboratory Animal Center, Guangzhou, China).
[0286] Mice are injected subcutaneously with 100 μΐ of tumor cells suspended in serum free medium. Tumor growth is monitored every 3 days by visual examination. Tumor sizes are measured using a caliper, and tumor volume is calculated according to the following equation: tumor volume (mm3) = (length (mm) x width (mm)2) x 0.5. All animals are sacrificed 3-4 weeks postinjection and the xenografts were harvested. Representative data are obtained from five mice per experimental group. Statistical analyses are performed with oneway repeated- measures ANOVA.
Example 7.
[0287] Table 11 A-Table 1 IB illustrate the gene names referenced by the CpG sites described herein. Table 11 A illustrates the CpG sites and the respective gene names.
polarity protein
Table 1 IB shows the associated chromosome location with the CpG sites described Genome CH Chromosome Coordinate 3
CpG Site MAP INFO Gene Name
Build R 36 6
cgl4817783 37 2 1.71E+08 2 170259991 KLHL23 cgl5412918 37 5 1.73E+08 5 173228664 ~ cgl8482112 37 3 1.84E+08 3 185691799 ~ cg20069090 37 13 28240007 13 27138007 POLR1D cg24732563 37 1 2.04E+08 1 202616510 ~ cg00886954 37 8 1.45E+08 8 145119701 PLEC1 cg23690893 37 19 14671371 19 14532371 TECR cgl0673833 37 7 45018849 7 44985374 MYOIG cg00819310 37 1 1.16E+08 1 115995306 VANGL1
Cg04447890 37 1 68697988 1 68470576 GPR177 cg08623383 37 1 28205926 1 28078513 Clorf38 cg09799714 37 11 1.19E+08 11 118561920 PDZD3 cgl0971790 37 19 50316458 19 55008270 FUZ cgl5357639 37 3 9790443 3 9765443 OGG1 cgl7188046 37 6 1.67E+08 6 166502187 T cg21230435 37 7 1.28E+08 7 128203259 OPN1SW cg22043361 37 14 64970199 14 64039952 ZBTB25 cg24229963 37 8 82633648 8 82796203 ZFAND1 cg24714666 37 X 13752442 X 13662363 ~ cg03156547 37 14 23525003 14 22594843 CDH24 cg06605933 37 1 1.5E+08 1 148137601 BOLA1 cg09601629 37 19 15122224 19 14983224 CCDC15 cgl3278334 37 19 49954994 19 54646806 PIH1D1 cgl l851098 37 22 42395340 22 40725286 WBP2NL cgl2188860 37 8 1.44E+08 8 144487860 TOP1MT cg25189085 37 12 57644658 12 55930925 STAC3 cg25488021 37 6 1.31E+08 6 131319140 EPB41L2 cgl0673833.
37 7 45018849 7 44985374 MYOIG 1
Example 8.
[0289] Table 12 illustrates CpG sequences described herein.
SEQ ID
CpG Site Gene Probe Sequence
NO:
CACATCTCCGAGCCCACGAGACCCCCCCCCCCCCC CCCCCCCCCCTCGTCGGCAGCGTCAGATGTGTATA AGAGACAGN N N AATAAATCCCCTCCACCT
ACCCTCCTAACTAAAACAAAACTGTCTCTTATACA CATCTCCGAGCCCACGAGACCCCCCCCCCCCCCCC
cg05395187 NCOR2 5
CCCCCCTCGTCGGCAGCGTCAGATGTGTATAAGAG ACAGN N CCAAAACCTAACAAAATAAAAA
ACCCCTAAAACCCCCTGTCTCTTATACACATCTCC GAGCCCACGAGACCCCCCCCCCCCCCCCCCCCCCT
cg07493516 ~ 6
CGTCGGCAGCGTCAGATGTGTATAAGAGACAGN N AAAAACTAAAAATATACACAAAATAAATA
ACTTCCCCAACAATTTACAAATCAAAATCTGTCTC TTATACACATCTCCGAGCCCACGAGACCCCCCCCC
cg08268679 ~ 7
CCCCCCCTCGTCGGCAGCGTCAGATGTGTATAAGA GACAGN N NTTAATTACAAAAACCCAAAAA
ACACTATACTACATACTAAAATAAACTAAATCCTG TCTCTTATACACATCTCCGAGCCCACGAGACCCCC
cg08549335 ZNRF2 8
CCCCTCGTCGGCAGCGTCAGATGTGTATAAGAGA CAGN N TTACTTAATATTTTCCTTAATCTT
ACCTAACTCCCCCTACTACTCCTACTCTACCCTGTC TCTTATACACATCTCCGAGCCCACGAGACCCCCCC
cg09819083 ~ 9
CCTCGTCGGCAGCGTCAGATGTGTATAAGAGACA GN TTCCCTCATTTTAAACCTTAAAACA
ACATCAACAAAAATTCACACCCCACTGTCTCTTAT ACACATCTCCGAGCCCACGAGACCCCCCCCCCCCT
cgl3976210 DUSP12 10
CGTCGGCAGCGTCAGATGTGTATAAGAGACAGN N TTACTTAATTAAAATTAATTTCTTATAAT
AAATCTTTTTATTCTTTCATTTTAAAAACTGTCTCT TATACACATCTCCGAGCCCACGAGACCCCCCCCTC
cgl4817783 KLHL23 11
GTCGGCAGCGTCAGATGTGTATAAGAGACAGN N TTTTCTTAATTATTCCATACTTACCAACA
ATCTTACCTATTCTACACTACAACCTGTCTCTTATA CACATCTCCGAGCCCACGAGACCCCCCCCCCCTCG
cgl5412918 ~ 12
TCGGCAGCGTCAGATGTGTATAAGAGACAGN N TTAATTCCTCAAATAAAACTTCAATTTTAA
ATAAAACCTCAACCCCACTACCTGTCTCTTATACA CATCTCCGAGCCCACGAGACCCCCCCCCCCCCCCC
eg 18482112 ~ 13
CCTCGTCGGCAGCGTCAGATGTGTATAAGAGACA GN TCCTAAAACTACTACTATCCTCAAAA
AAACAACCAAAACAAATACCTGTCTCTTATACAC ATCTCCGAGCCCACGAGACCCCCCCCCCCCCCCCC
cg20069090 POLR1D 14
CCCCCCCCTCGTCGGCAGCGTCAGATGTGTATAAG AGACAGNN N AAAAACACAAAAACCATCCTT
ACCTAAAATTCCTAAAAACATTTACCCTGTCTCTT ATACACATCTCCGAGCCCACGAGACCCCCCCCCCC
cg24732563 ~ 15
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGN N AAATAACATATATTTAAAAACATATATT
CACCCAAAATACCCCACCTGTCTCTTATACACATC TCCGAGCCCACGAGACCCCCCCCCCCCCCCCCCCC
cg00886954 PLEC1 16
CCCCCCCCCCCCCTCGTCGGCAGCGTCAGATGTGT ATAAGAGACAGNNN AAACCTCCAACACCC
cg23690893 TECR TTAAACCCCACCAAAAACTGTCTCTTATACACATC 17 SEQ ID
CpG Site Gene Probe Sequence
NO:
TCCGAGCCCACGAGACCCCCCCCCCCCCCCCCCCT CGTCGGCAGCGTCAGATGTGTATAAGAGACAGN N AAAAATTACTAAACTCCTCCAAACCACAA
AACACAACCTCCTTATAAAACCTGTCTCTTATACA CATCTCCGAGCCCACGAGACTCGTCGGCAGCGTC
cgl0673833 MY01G 18
AGATGTGTATAAGAGACAGN AACIAAAAA CCCTCCAAA
ACTCCACCCATACAACAACCACTGTCTCTTATACA CATCTCCGAGCCCACGAGACCCCCCCCCCCCCCCC
cg00819310 VANGL1 19
CCCCCCTCGTCGGCAGCGTCAGATGTGTATAAGAG ACAGN N AATAAATAACAAAACCACACCT
CCCTCCTCTCACACACTCCCCTGTCTCTTATACACA TCTCCGAGCCCACGAGACCCCCCCCCCCCCCCCCC
Cg04447890 GPR177 20
CCCCCCCCTCGTCGGCAGCGTCAGATGTGTATAAG AGACAGNN N CACAACTTCTTAATACTCA
ACCCTATATCCCTCAACCCTACAACCCAAACTGTC TCTTATACACATCTCCGAGCCCACGAGACCCCCCC
cg08623383 ClorB8 21
CCTCGTCGGCAGCGTCAGATGTGTATAAGAGACA GN ATATATCCCTCTTCCATTCTCTATAT
ATTATTTCCTCCCCTTACCCCACTGTCTCTTATACA CATCTCCGAGCCCACGAGACCCCCCCCCCCCCCCC
cg09799714 PDZD3 22
CCCTCGTCGGCAGCGTCAGATGTGTATAAGAGAC AGN AAATACAAACTAACAACTAAACTT
CCATACTCCAAAACCCCTGTCTCTTATACACATCT CCGAGCCCACGAGACCCCCCCCCCCCCCCCCCCCC
eg 10971790 FUZ 23
CCCCTCGTCGGCAGCGTCAGATGTGTATAAGAGA CAGN N AAAAATTAATCCTCTTCCAATCAA
ACTCTTCAAAAATTTACAATCTAAACCTGTCTCTT ATACACATCTCCGAGCCCACGAGACCCCCCCCCCC
cgl5357639 OGG1 24
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGN N TAATAACACTAATCTAATATTAATTCCA
ACAACAAATCCTATTTTTATAAAAACTGTCTCTTA TACACATCTCCGAGCCCACGAGACCCCCCCCCCCC
cgl7188046 T 25
CCCCCCCCCCCTCGTCGGCAGCGTCAGATGTGTAT AAGAGACAGNN N ACCTTCTCCCACCTTCC
TTAATATTAATCATTCACAAAACCTGTCTCTTATA CACATCTCCGAGCCCACGAGACCCCCCCCCCCCCC
cg21230435 OPN1SW 26
CCCCCCCCCCCTCGTCGGCAGCGTCAGATGTGTAT AAGAGACAGNN N CCCAATCTCTTATCCTC
ACCCAAAACCACCCTTTACTCTGTCTCTTATACAC ATCTCCGAGCCCACGAGACCCCCCCCCCCCCCCCC
cg22043361 ZBTB25 27
CCCCCCCCTCGTCGGCAGCGTCAGATGTGTATAAG AGACAGNN N AAAATATCAAACAAAACACA
CCCCACCTATAAACTCCCTGTCTCTTATACACATC TCCGAGCCCACGAGACCCCCCCCCCCCCCCCCCCC
cg24229963 ZFAND1 28
CTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG N AAAAACACTCACAAAACAATAACCTTT
CACTAAATCATTCAACTAACCCAAAATTTCTTCTG TCTCTTATACACATCTCCGAGCCCACGAGACCCCC
cg24714666 ~ 29
CCCCCCCCCCCCCTCGTCGGCAGCGTCAGATGTGT ATAAGAGACAGNNN AACCTACCAACCCTC
cg03156547 CDH24 CCCCTAACCCTCCTCCCCCCTGTCTCTTATACACAT 30 SEQ ID
CpG Site Gene Probe Sequence
NO:
CTCCGAGCCCACGAGACCCCCCCCCCCCCCCCCCC CCCCCCCCTCGTCGGCAGCGTCAGATGTGTATAAG AGACAGNNNNNNACTAAAACTAAACCAAACC
ACTTTCTAACCACCTTACCAATAAAACTGTCTCTT ATACACATCTCCGAGCCCACGAGACCCCCCCCCCC
cg06605933 BOLA1 31
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGN NNNNNTACAAAATCTATTAACAATAAAATAAAT
ACCCCAACCTAACTACAAAAACTACTGTCTCTTAT ACACATCTCCGAGCCCACGAGACCCCCCCCCCCCC
cg09601629 CCDC15 32
CCTCGTCGGCAGCGTCAGATGTGTATAAGAGACA GNNNNNNAAAAATCTACTTATTAACCAACAAAA
TAAAAACCAAAACAAACACCTGTCTCTTATACAC ATCTCCGAGCCCACGAGACCCCCCCCCCCCCCCCC
cgl3278334 PIH1D1 33
CCCCCCCCCCCCCTCGTCGGCAGCGTCAGATGTGT ATAAGAGACAGNNNNNNAACACATATTCCCCAC
ACACCCAATACCTATCCTCATCCACTGTCTCTTAT ACACATCTCCGAGCCCACGAGACCCCCCCCCCCCC
cgl l851098 WBP2NL 34
CCTCGTCGGCAGCGTCAGATGTGTATAAGAGACA GNNNNNNATTTAAAATCTTTCCAAAATAATCCA
ACATCACCAAACACAAACCCTGTCTCTTATACACA TCTCCGAGCCCACGAGACCCCCCCCCCCCCCCCCC
cgl2188860 TOP1MT 35
CCCCTCGTCGGCAGCGTCAGATGTGTATAAGAGA CAGNNNNNNTTACTATACATAATCTTCTAAAAC
TAAATTATAAATCAAAACAACTAAACTGTCTCTTA TACACATCTCCGAGCCCACGAGACCCCCCCCCCCC
cg25189085 STAC3 36
CCCCCCCCCCCCCCTCGTCGGCAGCGTCAGATGTG TATAAGAGACAGNNNNNNCCCCACCCCCACCC
ACTTTAACTTTCAACTACAAAAACTGTCTCTTATA CACATCTCCGAGCCCACGAGACCCCCCCCCCCCTC
cg25488021 EPB41L2 37
GTCGGCAGCGTCAGATGTGTATAAGAGACAGNNN NNNTAAAATATATAACTTTTACTTCTTAAACCA
[0290] Embodiment 1 refers to a method of generating a methylation profile of a biomarker in a subject in need thereof, comprising: (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject; (b) detecting a hybridization between the extracted genomic DNA and a probe, wherein the probe hybridizes to a biomarker selected from cg01327147 (uncharacterized family 31 glucosidase KIAA1161), cg02680086 (solute carrier family 43 member 1), cg04772948 (uncharacterized LOC284788), cg04917276 (HNF1 homeobox B), cg05395187 (nuclear receptor corepressor 2), cg07493516, cg08268679, cg08549335 (zinc and ring finger 2, E3 ubiquitin protein ligase), cg09819083, cgl3976210 (dual specificity phosphatase 12), cgl4817783 (Kelch like family member 23), cgl5412918, cgl8482112, cg20069090 (RNA polymerase subunit D), cg24732563, cg00886954 (plectin), cg23690893 (trans-2,3-enoyl- CoA reductase), and eg 10673833 (myosin IG); and (c) generating a methylation profile based on the detected hybridization between the extracted genomic DNA and the probe.
[0291] Embodiment 2: the method of embodiment 1, wherein the methylation profile comprises cgl0673833.
[0292] Embodiment 3 : the method of embodiment 1, wherein the methylation profile comprises one or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083,
cgl3976210, cgl4817783, cgl5412918, cgl8482112, cg20069090, cg24732563,
cg00886954, and cg23690893.
[0293] Embodiment 4: the method of embodiment 1, wherein the methylation profile comprises cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918,
cgl8482112, cg20069090, cg24732563, cg00886954, and cg23690893.
[0294] Embodiment 5: the method of embodiment 1, wherein the probe comprises a structure of Formula I:
Formula I
wherein:
A is a first target-binding region;
B is a second target-binding region; and
L is a linker region;
wherein A comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 30 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37; B comprises at least 70%, 80%, 90%, 95%), or 99% sequence identity to at least 12 contiguous nucleotides starting at position from the 3' terminus of the same sequence selected from SEQ ID NOs: 1- 37; and
wherein L is attached to A; and B is attached to either A or L.
[0295] Embodiment 6: the method of embodiment 5, wherein the probe comprises a structure of Formula la: A L 8
Formula la.
[0296] Embodiment 7: the method of embodiment 5, wherein A comprises at least 70%, 80%), 90%), 95%), or 99% sequence identity to at least 40 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37.
[0297] Embodiment 8: the method of embodiment 5, wherein A comprises at least 70%, 80%), 90%), 95%), or 99% sequence identity to at least 50 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37.
[0298] Embodiment 9: the method of embodiment 5, wherein B comprises at least 70%, 80%), 90%), 95%), or 99% sequence identity to at least 15 contiguous nucleotides starting at position from the 3' terminus of the same sequence selected from SEQ ID NOs: 1-37.
[0299] Embodiment 10: the method of embodiment 5, wherein B comprises at least 70%, 80%), 90%), 95%), or 99% sequence identity to at least 20 contiguous nucleotides starting at position from the 3' terminus of the same sequence selected from SEQ ID NOs: 1-37.
[0300] Embodiment 11 : the method of embodiment 5, wherein L is about 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides in length.
[0301] Embodiment 12: the method of embodiment 1, wherein the probe comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a sequence selected from SEQ ID NOs: 1-37.
[0302] Embodiment 13 : the method of embodiment 1, wherein the generating further comprises generating a pair-wise methylation difference dataset comprising: (i) a first difference between the methylation profile of the treated genomic DNA with a methylation profile of a first normal sample; (ii) a second difference between a methylation profile of a second normal sample and a methylation profile of a third normal sample; and (iii) a third difference between a methylation profile of a first primary cancer sample and a methylation profile of a second primary cancer sample.
[0303] Embodiment 14: the method of embodiment 13, wherein the generating further comprises analyzing the pair-wise methylation difference dataset with a control by a machine learning method to generate the methylation profile.
[0304] Embodiment 15: the method of embodiment 13, wherein the first primary cancer sample is a breast cancer sample.
[0305] Embodiment 16: the method of embodiment 13, wherein the second primary cancer sample is a non-breast cancer sample. [0306] Embodiment 17: the method of embodiment 14, wherein the control comprises a set of methylation profiles, wherein each said methylation profile is generated from a biological sample obtained from a known cancer type.
[0307] Embodiment 18: the method of embodiment 17, wherein the known cancer type is breast cancer.
[0308] Embodiment 19: the method of embodiment 17, wherein the known cancer type is a relapsed or refractory breast cancer.
[0309] Embodiment 20: the method of embodiment 17, wherein the known cancer type is a metastatic breast cancer.
[0310] Embodiment 21 : the method of embodiment 17, where the known cancer type is ductal carcinoma in situ, invasive or infiltrating ductal carcinoma, invasive or infiltrating lobular carcinoma, lobular carcinoma in situ, inflammatory breast cancer, Paget disease of the nipple, Phyllodes tumor, angiosarcoma, metaplastic carcinoma, low-grade adenosquamous carcinoma, spindle cell carcinoma of the breast, squamous carcinoma, triple-negative breast cancer, or mixed carcinoma.
[0311] Embodiment 22: the method of embodiment 21, where invasive ductal carcinoma comprises tubular carcinoma of the breast, medullary carcinoma of the breast, mucinous (or colloid) carcinoma of the breast, papillary carcinoma of the breast, micropapillary carcinoma, or cribriform carcinoma of the breast.
[0312] Embodiment 23 : the method of embodiment 14, wherein the machine learning method utilizes an algorithm selected from one or more of the following: a principal component analysis, a logistic regression analysis, a nearest neighbor analysis, a support vector machine, and a neural network model.
[0313] Embodiment 24: the method of embodiment 1, wherein the method further comprises performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers prior to generating the methylation profile.
[0314] Embodiment 25 refers to a method of selecting a subject suspected of having breast cancer for treatment, the method comprising: (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject suspected of having breast cancer; (b) generating a methylation profile comprising one or more biomarkers selected from: cg01327147 (uncharacterized family 31 glucosidase
KIAA1161), cg02680086 (solute carrier family 43 member 1), cg04772948 (uncharacterized LOC284788), cg04917276 (HNFl homeobox B), cg05395187 (nuclear receptor corepressor 2), cg07493516, cg08268679, cg08549335 (zinc and ring finger 2, E3 ubiquitin protein ligase), cg09819083, cgl3976210 (dual specificity phosphatase 12), cgl4817783 (Kelch like family member 23), cgl5412918, cgl8482112, cg20069090 (RNA polymerase subunit D), cg24732563, cg00886954 (plectin), cg23690893 (trans-2,3-enoyl-CoA reductase), and eg 10673833 (myosin IG) from the extracted genomic DNA; (c) comparing the methylation profile of the one or more biomarkers with a control; (d) identifying the subject as having breast cancer if the methylation profile correlates to the control; and (e) administering an effective amount of a therapeutic agent to the subject if the subject is identified as having breast cancer.
[0315] Embodiment 26: the method of embodiment 25, wherein the methylation profile comprises cgl0673833.
[0316] Embodiment 27: the method of embodiment 25, wherein the methylation profile comprises one or more biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112, cg20069090, cg24732563, cg00886954, and cg23690893.
[0317] Embodiment 28: the method of embodiment 25, wherein the methylation profile comprises cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112, cg20069090, cg24732563, cg00886954, and cg23690893.
[0318] Embodiment 29: the method of embodiment 25, wherein the comparing further comprises generating a pair-wise methylation difference dataset comprising: (i) a first difference between the methylation profile of the treated genomic DNA with a methylation profile of a first normal sample; (ii) a second difference between a methylation profile of a second normal sample and a methylation profile of a third normal sample; and (iii) a third difference between a methylation profile of a first primary cancer sample and a methylation profile of a second primary cancer sample.
[0319] Embodiment 30: the method of embodiment 29, wherein the comparing further comprises analyzing the pair-wise methylation difference dataset with a control by a machine learning method to generate the methylation profile.
[0320] Embodiment 31 : the method of embodiment 29, wherein the first primary cancer sample is a breast cancer sample.
[0321] Embodiment 32: the method of embodiment 29, wherein the second primary cancer sample is a non-breast cancer sample. [0322] Embodiment 33 : the method of embodiment 30, wherein the control comprises a set of methylation profiles, wherein each said methylation profile is generated from a biological sample obtained from a known cancer type.
[0323] Embodiment 34: the method of embodiment 33, wherein the known cancer type is breast cancer.
[0324] Embodiment 35: the method of embodiment 33, wherein the known cancer type is a relapsed or refractory breast cancer.
[0325] Embodiment 36: the method of embodiment 33, wherein the known cancer type is a metastatic breast cancer.
[0326] Embodiment 37: the method of embodiment 30, wherein the machine learning method utilizes an algorithm selected from one or more of the following: a principal component analysis, a logistic regression analysis, a nearest neighbor analysis, a support vector machine, and a neural network model.
[0327] Embodiment 38: the method of embodiment 25, wherein the generating further comprises hybridizing each of the one or more biomarkers with a probe, and performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers.
[0328] Embodiment 39 refers to a method of determining the prognosis of a subject having breast cancer or monitoring the progression of breast cancer in the subject, comprising: (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject having breast cancer; (b) generating a methylation profile comprising one or more biomarkers selected from: cg00819310 (VANGL planar cell polarity protein 1), cg04447890 (G protein-coupled receptor 177), cg08623383 (chromosome 1 open reading frame 38), cg09799714 (PDZ domain containing 3), eg 10971790 (fuzzy planar cell polarity protein), cgl5357639 (8-oxoguanine DNA glycosylase), cgl7188046 (T brachyury transcription factor), cg21230435 (opsin 1 cone pigments, short-wave-sensitive), cg22043361 (zinc finger and BTB domain containing 25), and cg24229963 (zinc finger AN1- type containing 1) from the extracted genomic DNA; (c) obtaining a methylation score based on the methylation profile of the one or more biomarkers; and (d) based on the methylation score, initiate a first treatment, decrease a dosage of a first therapeutic agent if the subject has experienced a remission, initiate a second treatment if the subject has experienced a relapse, or switch to a second therapeutic agent if the subject becomes refractory to the first therapeutic agent. [0329] Embodiment 40: the method of embodiment 39, wherein the methylation profile comprises cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361 and cg24229963.
[0330] Embodiment 41 : the method of embodiment 39, wherein the methylation profile further comprises one or more biomarkers selected from: cg24714666, cg03156547 (cadherin 24), cg06605933 (BolA family member 1), cg09601629 (coiled-coil domain containing 15), cgl3278334 (PIH1 domain containing 1), cgl 1851098 (WBP2 N-terminal like), cgl2188860 (topoisom erase (DNA) I, mitochondrial), cg25189085 (SH3 and cysteine rich domain 3), and cg25488021 (erythrocyte membrane protein band 4.1 like 2).
[0331] Embodiment 42: the method of embodiment 39, wherein the methylation profile further comprises cg24714666.
[0332] Embodiment 43 : the method of embodiment 39, wherein the methylation profile further comprises one or more biomarkers selected from: cg03156547, cg06605933, cg09601629, cgl3278334, cgl 1851098, cgl2188860, cg25189085, and cg25488021.
[0333] Embodiment 44: the method of embodiment 39, wherein the methylation profile further comprises cg24714666, cg03156547, cg06605933, cg09601629, cgl3278334, cgl 1851098, cgl2188860, cg25189085, and cg25488021.
[0334] Embodiment 45: the method of embodiment 39, wherein the methylation score of from about 1.5 to about 3 is indicative of a survival for at least 6 months, at least 1 year, at least 1.5 years, at least 2 years, at least 2.5 years, at least 3 years, at least 4 years, or at least 5 years.
[0335] Embodiment 46: the method of embodiment 39, wherein the methylation score of from about 1.5 to about 2.5 is indicative of a survival for at least 6 months, at least 1 year, at least 1.5 years, at least 2 years, at least 2.5 years, at least 3 years, at least 4 years, or at least 5 years.
[0336] Embodiment 47: the method of embodiment 39, wherein the methylation score of less than 1.5 is indicative of a survival of less than 5 years, less than 4 years, less than 3 years, less than 2.5 years, less than 2 years, less than 1.5 years, less than 1 year, or less than 6 months.
[0337] Embodiment 48: the method of embodiment 39, wherein the methylation score is calculated based on Cox proportional hazards (PH) regression analysis.
[0338] Embodiment 49: the method of embodiment 39, wherein breast cancer is metastatic breast cancer. [0339] Embodiment 50: the method of embodiment 39, wherein breast cancer is ductal carcinoma in situ, invasive or infiltrating ductal carcinoma, invasive or infiltrating lobular carcinoma, lobular carcinoma in situ, inflammatory breast cancer, Paget disease of the nipple, Phyllodes tumor, angiosarcoma, metaplastic carcinoma, low-grade adenosquamous carcinoma, spindle cell carcinoma of the breast, squamous carcinoma, triple-negative breast cancer, or mixed carcinoma.
[0340] Embodiment 51 : the method of embodiment 50, where invasive ductal carcinoma comprises tubular carcinoma of the breast, medullary carcinoma of the breast, mucinous (or colloid) carcinoma of the breast, papillary carcinoma of the breast, micropapillary carcinoma, or cribriform carcinoma of the breast.
[0341] Embodiment 52: the method of embodiment 39, wherein the generating further comprises hybridizing each of the one or more biomarkers with a probe, and performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers.
[0342] Embodiment 53 refers to a method of selecting a subject suspected of having ovarian cancer for treatment, the method comprising: (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject suspected of having ovarian cancer; (b) generating a methylation profile comprising biomarker cgl0673833 (myosin IG) from the extracted genomic DNA; (c) comparing the methylation profile of the biomarkers with a control; (d) identifying the subject as having ovarian cancer if the methylation profile correlates to the control; and (e) administering an effective amount of a therapeutic agent to the subject if the subject is identified as having ovarian cancer.
[0343] Embodiment 54: the method of embodiment 53, wherein the comparing further comprises generating a pair-wise methylation difference dataset comprising: (i) a first difference between the methylation profile of the treated genomic DNA with a methylation profile of a first normal sample; (ii) a second difference between a methylation profile of a second normal sample and a methylation profile of a third normal sample; and (iii) a third difference between a methylation profile of a first primary cancer sample and a methylation profile of a second primary cancer sample.
[0344] Embodiment 55: the method of embodiment 54, wherein the comparing further comprises analyzing the pair-wise methylation difference dataset with a control by a machine learning method to generate the methylation profile. [0345] Embodiment 56: the method of embodiment 54, wherein the first primary cancer sample is an ovarian cancer sample.
[0346] Embodiment 57: the method of embodiment 54, wherein the second primary cancer sample is a non-ovarian cancer sample.
[0347] Embodiment 58: the method of embodiment 55, wherein the control comprises a set of methylation profiles, wherein each said methylation profile is generated from a biological sample obtained from a known cancer type.
[0348] Embodiment 59: the method of embodiment 58, wherein the known cancer type is ovarian cancer.
[0349] Embodiment 60: the method of embodiment 58, wherein the known cancer type is a relapsed or refractory ovarian cancer.
[0350] Embodiment 61 : the method of embodiment 58, wherein the known cancer type is a metastatic ovarian cancer.
[0351] Embodiment 62: the method of embodiment 55, wherein the machine learning method utilizes an algorithm selected from one or more of the following: a principal component analysis, a logistic regression analysis, a nearest neighbor analysis, a support vector machine, and a neural network model.
[0352] Embodiment 63 : the method of embodiment 53, wherein the generating further comprises hybridizing each of the one or more biomarkers with a probe, and performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers.
[0353] Embodiment 64 refers to a method of generating a methylation profile of a biomarker in a subject in need thereof, comprising: (a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject; (b) detecting a hybridization between the extracted genomic DNA and a probe, wherein the probe hybridizes to biomarker cgl0673833 (myosin IG); and (c) generating a methylation profile based on the detected hybridization between the extracted genomic DNA and the probe.
[0354] Embodiment 65: the method of any one of the embodiments 38, 52, or 63, wherein the probe comprises a structure of Formula I:
Formula I
wherein:
A is a first target-binding region;
B is a second target-binding region; and
L is a linker region;
wherein A comprises at least 70%, 80%>, 90%, 95%, or 99% sequence identity to at least 30 contiguous nucleotides starting at position 1 from the 5 ' terminus of a sequence selected from SEQ ID NOs: 1 -37; B comprises at least 70%, 80%, 90%, 95%o, or 99%o sequence identity to at least 12 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1 - 37; and
wherein L is attached to A; and B is attached to either A or L.
[0355] Embodiment 66: the method of embodiment 65, wherein the probe comprises a structure of Formula la:
Formula la.
[0356] Embodiment 67: the method of embodiment 65, wherein A comprises at least 70%, 80%), 90%), 95%o, or 99% sequence identity to at least 40 contiguous nucleotides starting at position 1 from the 5 ' terminus of a sequence selected from SEQ ID NOs: 1 -37.
[0357] Embodiment 68 : the method of embodiment 65, wherein A comprises at least 70%, 80%), 90%), 95%o, or 99% sequence identity to at least 50 contiguous nucleotides starting at position 1 from the 5 ' terminus of a sequence selected from SEQ ID NOs: 1 -37.
[0358] Embodiment 69: the method of embodiment 65, wherein B comprises at least 70%, 80%), 90%), 95%o, or 99% sequence identity to at least 15 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1 -37.
[0359] Embodiment 70: the method of embodiment 65, wherein B comprises at least 70%, 80%), 90%), 95%o, or 99% sequence identity to at least 20 contiguous nucleotides starting at position from the 3 ' terminus of the same sequence selected from SEQ ID NOs: 1 -37. [0360] Embodiment 71 : the method of embodiment 65, wherein L is about 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides in length.
[0361] Embodiment 72: the method of any one of the embodiments 38, 52, or 63, wherein the probe comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a sequence selected from SEQ ID NOs: 1-37.
[0362] Embodiment 73 : the method of any one of the preceding embodiments, wherein the biological sample comprises a blood sample.
[0363] Embodiment 74: the method of any one of the preceding embodiments, wherein the biological sample comprises a tissue biopsy sample.
[0364] Embodiment 75: the method of any one of the preceding embodiments, wherein the biological sample comprises circulating tumor cells.
[0365] Embodiment 76: the method of any one of the preceding embodiments, wherein the subject is a human.
[0366] Embodiment 77 refers to a kit comprising a set of nucleic acid probes that hybridizes to biomarkers: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783,
cgl5412918, cgl8482112, cg20069090, cg24732563, cg00886954, cg23690893, and cgl0673833.
[0367] Embodiment 78 refers to a kit comprising a set of nucleic acid probes that hybridizes to biomarkers: cg00819310, cg04447890, cg08623383, cg09799714, cgl0971790, cgl5357639, cgl7188046, cg21230435, cg22043361, and cg24229963.
[0368] Embodiment 79: the kit of embodiment 78, wherein the kit further comprises a nucleic acid probe that hybridizes to a biomarker selected from cg24714666, cg03156547, cg06605933, cg09601629, cgl3278334, cgl 1851098, cgl2188860, cg25189085, and cg25488021.
[0369] Embodiment 80: the kit of any one of the embodiments 77-79, wherein the set of nucleic acid probes comprises a set of probes selected from SEQ ID NOs: 1-37.
[0370] Embodiment 81 refers to a kit comprising a nucleic acid probe that hybridizes to biomarker cgl0673833.
[0371] Embodiment 82: the kit of embodiment 81, wherein the nucleic acid probe comprises SEQ ID NO: 18.
[0372] While preferred embodiments of the present disclosure have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosure. It should be understood that various alternatives to the embodiments of the disclosure described herein may be employed in practicing the disclosure. It is intended that the following claims define the scope of the disclosure and that methods and structures within the scope of these claims and their equivalents be covered thereby.

Claims

CLAIMS WHAT IS CLAIMED IS:
1. A method of generating a methylation profile of a biomarker in a subject in need thereof, comprising:
a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject;
b) detecting a hybridization between the extracted genomic DNA and a probe, wherein the probe hybridizes to a biomarker selected from cg01327147 (uncharacterized family 31 glucosidase KIAA1161), cg02680086 (solute carrier family 43 member 1), cg04772948 (uncharacterized LOC284788), cg04917276 (HNF1 homeobox B), cg05395187 (nuclear receptor corepressor 2), cg07493516, cg08268679, cg08549335 (zinc and ring finger 2, E3 ubiquitin protein ligase), cg09819083, cgl3976210 (dual specificity phosphatase 12), cgl4817783 (Kelch like family member 23), cgl5412918, cgl8482112, cg20069090 (RNA polymerase subunit D), cg24732563, cg00886954 (plectin), cg23690893 (trans-2,3-enoyl-CoA reductase), and eg 10673833 (myosin IG); and
c) generating a methylation profile based on the detected hybridization between the extracted genomic DNA and the probe.
2. The method of claim 1, wherein the methylation profile comprises cgl0673833.
3. The method of claim 1, wherein the methylation profile comprises one or more
biomarkers selected from: cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112, cg20069090, cg24732563, cg00886954, and cg23690893.
4. The method of claim 1, wherein the methylation profile comprises cg01327147, cg02680086, cg04772948, cg04917276, cg05395187, cg07493516, cg08268679, cg08549335, cg09819083, cgl3976210, cgl4817783, cgl5412918, cgl8482112, cg20069090, cg24732563, cg00886954, and cg23690893.
5. The method of claim 1, wherein the probe comprises a structure of Formula I:
Formula I
wherein:
A is a first target-binding region;
B is a second target-binding region; and
L is a linker region;
wherein A comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 30 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37; B comprises at least 70%, 80%, 90%, 95%), or 99% sequence identity to at least 12 contiguous nucleotides starting at position from the 3' terminus of the same sequence selected from SEQ ID NOs: 1- 37; and
wherein L is attached to A; and B is attached to either A or L.
6. The method of claim 5, wherein the probe comprises a structure of Formula la:
Formula la.
7. The method of claim 5, wherein A comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 40 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37.
8. The method of claim 5, wherein A comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 50 contiguous nucleotides starting at position 1 from the 5' terminus of a sequence selected from SEQ ID NOs: 1-37.
9. The method of claim 5, wherein B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 15 contiguous nucleotides starting at position from the 3' terminus of the same sequence selected from SEQ ID NOs: 1-37.
10. The method of claim 5, wherein B comprises at least 70%, 80%, 90%, 95%, or 99% sequence identity to at least 20 contiguous nucleotides starting at position 1 ' from the 3' terminus of the same sequence selected from SEQ ID NOs: 1-37.
11. The method of claim 5, wherein L is about 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides in length.
12. The method of claim 1, wherein the probe comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a sequence selected from SEQ ID NOs: 1-37.
13. The method of claim 1, wherein the generating further comprises generating a pair- wise methylation difference dataset comprising:
(i) a first difference between the methylation profile of the treated genomic DNA with a methylation profile of a first normal sample;
(ii) a second difference between a methylation profile of a second normal
sample and a methylation profile of a third normal sample; and
(iii) a third difference between a methylation profile of a first primary cancer sample and a methylation profile of a second primary cancer sample.
14. The method of claim 13, wherein the generating further comprises analyzing the pair- wise methylation difference dataset with a control by a machine learning method to generate the methylation profile.
15. The method of claim 13, wherein the first primary cancer sample is a breast cancer sample.
16. The method of claim 13, wherein the second primary cancer sample is a non-breast cancer sample.
17. The method of claim 14, wherein the control comprises a set of methylation profiles, wherein each said methylation profile is generated from a biological sample obtained from a known cancer type.
18. The method of claim 17, wherein the known cancer type is breast cancer.
19. The method of claim 17, wherein the known cancer type is a relapsed or refractory breast cancer.
20. The method of claim 17, wherein the known cancer type is a metastatic breast cancer.
21. The method of claim 17, where the known cancer type is ductal carcinoma in situ, invasive or infiltrating ductal carcinoma, invasive or infiltrating lobular carcinoma, lobular carcinoma in situ, inflammatory breast cancer, Paget disease of the nipple, Phyllodes tumor, angiosarcoma, metaplastic carcinoma, low-grade adenosquamous carcinoma, spindle cell carcinoma of the breast, squamous carcinoma, triple-negative breast cancer, or mixed carcinoma.
22. The method of claim 21, where invasive ductal carcinoma comprises tubular
carcinoma of the breast, medullary carcinoma of the breast, mucinous (or colloid) carcinoma of the breast, papillary carcinoma of the breast, micropapillary carcinoma, or cribriform carcinoma of the breast.
23. The method of claim 14, wherein the machine learning method utilizes an algorithm selected from one or more of the following: a principal component analysis, a logistic regression analysis, a nearest neighbor analysis, a support vector machine, and a neural network model.
24. The method of claim 1, wherein the method further comprises performing a DNA sequencing reaction to quantify the methylation of each of the one or more biomarkers prior to generating the methylation profile.
25. A method of selecting a subject suspected of having breast cancer for treatment, the method comprising:
a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject suspected of having breast cancer;
b) generating a methylation profile comprising one or more biomarkers selected from: cg01327147 (uncharacterized family 31 glucosidase KIAA1161), cg02680086 (solute carrier family 43 member 1), cg04772948 (uncharacterized LOC284788), cg04917276 (HNF1 homeobox B), cg05395187 (nuclear receptor corepressor 2), cg07493516, cg08268679, cg08549335 (zinc and ring finger 2, E3 ubiquitin protein ligase), cg09819083, eg 13976210 (dual specificity phosphatase 12), eg 14817783 (Kelch like family member 23), cgl5412918, cgl8482112, cg20069090 (RNA polymerase subunit D), cg24732563, cg00886954 (plectin), cg23690893 (trans-2,3-enoyl- CoA reductase), and eg 10673833 (myosin IG) from the extracted genomic DNA;
c) comparing the methylation profile of the one or more biomarkers with a
control;
d) identifying the subject as having breast cancer if the methylation profile
correlates to the control; and
e) administering an effective amount of a therapeutic agent to the subject if the subject is identified as having breast cancer.
26. A method of determining the prognosis of a subject having breast cancer or
monitoring the progression of breast cancer in the subject, comprising: a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject having breast cancer;
b) generating a methylation profile comprising one or more biomarkers selected from: cg00819310 (VANGL planar cell polarity protein 1), cg04447890 (G protein-coupled receptor 177), cg08623383 (chromosome 1 open reading frame 38), cg09799714 (PDZ domain containing 3), cgl 0971790 (fuzzy planar cell polarity protein), cgl5357639 (8-oxoguanine DNA glycosylase), cgl7188046 (T brachyury transcription factor), cg21230435 (opsin 1 cone pigments, short-wave-sensitive), cg22043361 (zinc finger and BTB domain containing 25), and cg24229963 (zinc finger ANl-type containing 1) from the extracted genomic DNA;
c) obtaining a methylation score based on the methylation profile of the one or more biomarkers; and
d) based on the methylation score, initiate a first treatment, decrease a dosage of a first therapeutic agent if the subject has experienced a remission, initiate a second treatment if the subject has experienced a relapse, or switch to a second therapeutic agent if the subject becomes refractory to the first therapeutic agent.
A method of selecting a subject suspected of having ovarian cancer for treatment, the method comprising:
a) processing an extracted genomic DNA with a deaminating agent to generate a genomic DNA sample comprising deaminated nucleotides, wherein the extracted genomic DNA is obtained from a biological sample from the subject suspected of having ovarian cancer;
b) generating a methylation profile comprising biomarker cgl0673833 (myosin IG) from the extracted genomic DNA;
c) comparing the methylation profile of the biomarkers with a control;
d) identifying the subject as having ovarian cancer if the methylation profile correlates to the control; and
e) administering an effective amount of a therapeutic agent to the subject if the subject is identified as having ovarian cancer. The method of any one of the preceding claims, wherein the biological sample comprises a blood sample.
The method of any one of the preceding claims, wherein the biological sample comprises a tissue biopsy sample.
The method of any one of the preceding claims, wherein the biological sample comprises circulating tumor cells.
EP17824913.2A 2016-07-06 2017-07-06 BREAST AND OVARY CANCER METHYLATION MARKERS AND USES THEREOF Pending EP3481941A4 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662358771P 2016-07-06 2016-07-06
PCT/US2017/040955 WO2018009703A1 (en) 2016-07-06 2017-07-06 Breast and ovarian cancer methylation markers and uses thereof

Publications (2)

Publication Number Publication Date
EP3481941A1 true EP3481941A1 (en) 2019-05-15
EP3481941A4 EP3481941A4 (en) 2020-04-15

Family

ID=60913199

Family Applications (1)

Application Number Title Priority Date Filing Date
EP17824913.2A Pending EP3481941A4 (en) 2016-07-06 2017-07-06 BREAST AND OVARY CANCER METHYLATION MARKERS AND USES THEREOF

Country Status (3)

Country Link
US (1) US11396678B2 (en)
EP (1) EP3481941A4 (en)
WO (1) WO2018009703A1 (en)

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018009705A1 (en) * 2016-07-06 2018-01-11 Youhealth Biotech, Limited Liver cancer methylation markers and uses thereof
WO2018009696A1 (en) * 2016-07-06 2018-01-11 Youhealth Biotech, Limited Colon cancer methylation markers and uses thereof
EP3481941A4 (en) * 2016-07-06 2020-04-15 Youhealth Biotech, Limited BREAST AND OVARY CANCER METHYLATION MARKERS AND USES THEREOF
EP3481954A4 (en) 2016-07-06 2020-04-15 Youhealth Biotech, Limited SPECIFIC METHYLATION MARKERS OF LUNG CANCER AND USES OF THE SAME
US10093986B2 (en) 2016-07-06 2018-10-09 Youhealth Biotech, Limited Leukemia methylation markers and uses thereof
BR112019018272A2 (en) * 2017-03-02 2020-07-28 Youhealth Oncotech, Limited methylation markers to diagnose hepatocellular carcinoma and cancer
DE202019005627U1 (en) 2018-04-02 2021-05-31 Grail, Inc. Methylation markers and targeted methylation probe panels
CN108531593A (en) * 2018-04-17 2018-09-14 中国科学院北京基因组研究所 Special application of the methylation sites as breast cancer relapse diagnosis marker
CN112662691B (en) * 2018-05-31 2023-06-27 福建医科大学附属第一医院 Human PFBC pathogenic gene MYORG with 348 th to 349 th sites mutated and application thereof
BR112020013857A2 (en) * 2018-07-09 2020-12-01 Hkg Epitherapeutics Limited method of using a dna methylation signature of cancer "binary-categorical" to detect cancer and kit to detect at least one cancer, hepatocellular carcinoma (chc), lung cancer, prostate cancer, breast cancer, cancer colorectal cancer, pancreatic cancer, glioblastoma brain cancer, gastric (stomach) cancer, ovarian cancer, cervical cancer, head and neck squamous cell carcinoma (hnsc), esophageal carcinoma, bladder cancer, kidney cancer, cancer testicular, common solid tumors, acute myeloid leukemia (lma) and melanoma
WO2020069350A1 (en) 2018-09-27 2020-04-02 Grail, Inc. Methylation markers and targeted methylation probe panel
BR112021010640A2 (en) 2018-12-04 2021-09-08 Hkg Epitherapeutics Limited IN-VITRO METHOD TO OBTAIN EARLY PREDICTORS OF CERVICAL CANCER, PANEL OF DNA METHYLATION BIOMARKERS FOR SCREENING AND EARLY DETECTION OF CERVICAL CANCER, COMBINATION OF DNA Methylation BIOMARKERS FOR SCREENING AND EARLY DETECTION OF CERVICAL CANCER, KIT FOR DETECTION OF CERVICAL CANCER , USE OF MULTIVARIABLE LINEAR REGRESSION EQUATION OR NEURA NETWORK ANALYSIS, USE OF RECEPTOR OPERATION CHARACTERISTICS (ROC) ASSAYS, AND COMPUTER-IMPLEMENTED METHOD TO OBTAIN DNA Methylation BIOMARKERS FOR EARLY DETECTION OF CERVICAL CANCER DIAGNOSIS
US20220259670A1 (en) * 2019-07-01 2022-08-18 St. Jude Children's Research Hospital Kit and method for analyzing single t cells
KR102313455B1 (en) * 2020-02-27 2021-10-15 이화여자대학교 산학협력단 Method for diagnosing prodromal Alzheimer’s disease or predicting risk of progression to symptomatic Alzheimer's disease
CN114369661B (en) * 2022-01-13 2024-09-20 博尔诚(北京)科技有限公司 Marker for breast cancer screening, probe composition and application thereof
US12254987B2 (en) 2023-03-23 2025-03-18 Certis Oncology Solutions, Inc. Artificial intelligence for identifying one or more predictive biomarkers

Family Cites Families (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US5525462A (en) 1991-05-02 1996-06-11 Toyo Boseki Kabushiki Kaisha Nucleic acid sequence amplification method, detection method, and reagent kit therefor
US6033854A (en) 1991-12-16 2000-03-07 Biotronics Corporation Quantitative PCR using blocking oligonucleotides
WO1995006137A1 (en) 1993-08-27 1995-03-02 Australian Red Cross Society Detection of genes
US5750341A (en) 1995-04-17 1998-05-12 Lynx Therapeutics, Inc. DNA sequencing by parallel oligonucleotide extensions
GB9517955D0 (en) 1995-07-25 1995-11-08 Univ Strathclyde Nucleotide sequence detection and analysis
US5985557A (en) 1996-01-24 1999-11-16 Third Wave Technologies, Inc. Invasive cleavage of nucleic acids
US6852487B1 (en) 1996-02-09 2005-02-08 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
EP2369007B1 (en) 1996-05-29 2015-07-29 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions
US6017704A (en) 1996-06-03 2000-01-25 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US5786146A (en) 1996-06-03 1998-07-28 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US5858665A (en) 1996-07-25 1999-01-12 Navix, Inc. Homogeneous diagnostic assay method utilizing simultaneous target and signal amplification
EP0960210A4 (en) 1996-10-04 2004-06-09 Chronix Biomedical DETECTION OF NUCLEIC ACID USEFUL FOR DIAGNOSIS
JPH10253632A (en) 1997-03-10 1998-09-25 Nissui Pharm Co Ltd Method, kit and device for analysis
US6558901B1 (en) 1997-05-02 2003-05-06 Biomerieux Vitek Nucleic acid assays
US6054276A (en) 1998-02-23 2000-04-25 Macevicz; Stephen C. DNA restriction site mapping
CA2330673C (en) 1998-05-01 2009-05-26 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and dna molecules
US6780591B2 (en) 1998-05-01 2004-08-24 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US6787308B2 (en) 1998-07-30 2004-09-07 Solexa Ltd. Arrayed biomolecules and their use in sequencing
US7700324B1 (en) 1998-11-03 2010-04-20 The Johns Hopkins University School Of Medicine Methylated CpG island amplification (MCA)
US6331393B1 (en) 1999-05-14 2001-12-18 University Of Southern California Process for high-throughput DNA methylation analysis
US6180349B1 (en) 1999-05-18 2001-01-30 The Regents Of The University Of California Quantitative PCR method to enumerate DNA copy number
US7611869B2 (en) 2000-02-07 2009-11-03 Illumina, Inc. Multiplexed methylation detection methods
DE10130800B4 (en) 2001-06-22 2005-06-23 Epigenomics Ag Method for the detection of cytosine methylation with high sensitivity
CA2489360C (en) 2002-06-26 2013-01-29 Cold Spring Harbor Laboratory Methods and compositions for determining methylation profiles
EP2107129B1 (en) 2003-07-31 2012-08-22 Sequenom, Inc. Methods for high level multiplexed polymerase chain reactions and homogeneous mass extension reactions for genotyping of polymorhisms
WO2005040399A2 (en) 2003-10-21 2005-05-06 Orion Genomics Llc Methods for quantitative determination of methylation density in a dna locus
US7169560B2 (en) 2003-11-12 2007-01-30 Helicos Biosciences Corporation Short cycle methods for sequencing polynucleotides
WO2005085477A1 (en) 2004-03-02 2005-09-15 Orion Genomics Llc Differential enzymatic fragmentation by whole genome amplification
JP2005328709A (en) 2004-05-18 2005-12-02 Toyobo Co Ltd High-speed PCR using high-speed DNA polymerase
US7643818B2 (en) 2004-11-22 2010-01-05 Seven Networks, Inc. E-mail messaging to/from a mobile terminal
JP5149013B2 (en) 2004-11-29 2013-02-20 セクエノム,インコーポレイティド Means and method for detecting methylated DNA
US20080261217A1 (en) * 2006-10-17 2008-10-23 Melnikov Anatoliy A Methylation Profile of Cancer
GB0700374D0 (en) 2007-01-09 2007-02-14 Oncomethylome Sciences S A NDRG family methylation markers
US8911937B2 (en) 2007-07-19 2014-12-16 Brainreader Aps Method for detecting methylation status by using methylation-independent primers
WO2009021141A1 (en) 2007-08-07 2009-02-12 The Johns Hopkins University Comprehensive high throughput arrays for relative methylation
EP2053131A1 (en) 2007-10-19 2009-04-29 Ludwig-Maximilians-Universität München Method for determining methylation at deoxycytosine residues
EP2233590A1 (en) * 2009-01-28 2010-09-29 AIT Austrian Institute of Technology GmbH Methylation assay
US8859202B2 (en) * 2012-01-20 2014-10-14 The Ohio State University Breast cancer biomarker signatures for invasiveness and prognosis
EP2746403A1 (en) * 2012-12-21 2014-06-25 Life Science Inkubator GmbH & Co. KG Method for determining the degree of DNA methylation
EP3140420B1 (en) 2014-05-07 2019-09-11 Universite Libre De Bruxelles Breast cancer epigenetic markers useful in anthracycline treatment prognosis
US20180051343A1 (en) * 2014-08-08 2018-02-22 Ait Austrian Institute Of Technology Gmbh Thyroid cancer diagnosis by dna methylation analysis
EP3194624B1 (en) 2014-09-15 2022-02-16 Garvan Institute of Medical Research Methods for diagnosis, prognosis and monitoring of breast cancer and reagents therefor
US20170306406A1 (en) 2014-10-22 2017-10-26 The Hospital For Sick Children Dna methylation markers for neurodevelopmental syndromes
WO2018009696A1 (en) * 2016-07-06 2018-01-11 Youhealth Biotech, Limited Colon cancer methylation markers and uses thereof
EP3481954A4 (en) * 2016-07-06 2020-04-15 Youhealth Biotech, Limited SPECIFIC METHYLATION MARKERS OF LUNG CANCER AND USES OF THE SAME
WO2018009705A1 (en) * 2016-07-06 2018-01-11 Youhealth Biotech, Limited Liver cancer methylation markers and uses thereof
EP3481941A4 (en) * 2016-07-06 2020-04-15 Youhealth Biotech, Limited BREAST AND OVARY CANCER METHYLATION MARKERS AND USES THEREOF
CN113151458A (en) * 2016-07-06 2021-07-23 优美佳肿瘤技术有限公司 Solid tumor methylation marker and application thereof
CN111742062B (en) * 2017-10-06 2023-11-17 优美佳肿瘤技术有限公司 Methylation markers for cancer diagnosis

Also Published As

Publication number Publication date
US11396678B2 (en) 2022-07-26
WO2018009703A1 (en) 2018-01-11
US20190360052A1 (en) 2019-11-28
EP3481941A4 (en) 2020-04-15

Similar Documents

Publication Publication Date Title
US20250092462A1 (en) Methylation markers for diagnosing hepatocellular carcinoma and lung cancer
US12359258B2 (en) Lung cancer methylation markers and uses thereof
US12351876B2 (en) Colon cancer methylation markers and uses thereof
US11396678B2 (en) Breast and ovarian cancer methylation markers and uses thereof
US12359257B2 (en) Liver cancer methylation markers and uses thereof
US10544467B2 (en) Solid tumor methylation markers and uses thereof
EP3692164B1 (en) Methylation markers for diagnosing cancer
US10829821B2 (en) Leukemia methylation markers and uses thereof
US20240209453A1 (en) Liver cancer methylation and protein markers and their uses
HK40056939A (en) Solid tumor methylation markers and uses thereof
HK1253057B (en) Solid tumor methylation markers and uses thereof

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20190206

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20200317

RIC1 Information provided on ipc code assigned before grant

Ipc: G01N 33/574 20060101ALI20200311BHEP

Ipc: C12N 1/11 20060101AFI20200311BHEP

Ipc: C12Q 1/68 20180101ALI20200311BHEP

REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 40009008

Country of ref document: HK

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20230515

REG Reference to a national code

Ref country code: HK

Ref legal event code: WD

Ref document number: 40009008

Country of ref document: HK