EP3445380B1 - Bacteriotherapy - Google Patents

Bacteriotherapy Download PDF

Info

Publication number
EP3445380B1
EP3445380B1 EP17720211.6A EP17720211A EP3445380B1 EP 3445380 B1 EP3445380 B1 EP 3445380B1 EP 17720211 A EP17720211 A EP 17720211A EP 3445380 B1 EP3445380 B1 EP 3445380B1
Authority
EP
European Patent Office
Prior art keywords
sequence
bacterium
seq
hmi
therapeutic composition
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
EP17720211.6A
Other languages
German (de)
French (fr)
Other versions
EP3445380C0 (en
EP3445380A1 (en
EP3445380B3 (en
EP3445380B8 (en
Inventor
Anne Neville
Hilary BROWNE
Sam FORSTER
Trevor LAWLEY
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genome Research Ltd
Original Assignee
Genome Research Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genome Research Ltd filed Critical Genome Research Ltd
Priority to EP24168584.1A priority Critical patent/EP4417261A3/en
Publication of EP3445380A1 publication Critical patent/EP3445380A1/en
Application granted granted Critical
Publication of EP3445380C0 publication Critical patent/EP3445380C0/en
Publication of EP3445380B1 publication Critical patent/EP3445380B1/en
Publication of EP3445380B8 publication Critical patent/EP3445380B8/en
Publication of EP3445380B3 publication Critical patent/EP3445380B3/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/74Bacteria
    • A61K35/741Probiotics
    • A61K35/742Spore-forming bacteria, e.g. Bacillus coagulans, Bacillus subtilis, clostridium or Lactobacillus sporogenes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/74Bacteria
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0031Rectum, anus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0053Mouth and digestive tract, i.e. intraoral and peroral administration
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/06Anti-spasmodics, e.g. drugs for colics, esophagic dyskinesia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/14Prodigestives, e.g. acids, enzymes, appetite stimulants, antidyspeptics, tonics, antiflatulents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/06Antihyperlipidemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to therapeutic compositions comprising at least one isolated bacterium as defined herein and a pharmaceutically acceptable excipient, as well as methods of preparing such therapeutic compositions.
  • the therapeutic compositions find application in the treatment of dysbiosis, in particular dysbiosis of the gastrointestinal tract.
  • the dysbiosis may be a dysbiosis associated with an enteric bacterial infection, inflammatory bowel disease, pouchitis, irritable bowel syndrome, a metabolic disease, a neuropsychiatric disorder, an autoimmune disease, an allergic disorder, a cancer, or hepatic encephalopathy.
  • a typical human intestinal microbiota contains 100-1000 bacterial species. There is extensive compositional diversity between individuals, such that each individual's microbiota is as unique as a fingerprint (Qin, Li et al. 2010; Nielsen, Almeida et al. 2014). The majority of the bacterial species within the adult human microbiota are derived from four high level taxonomic classifications or phyla, the Firmicutes, Bacteroidetes, Actinobacteria and Proteobacteria. These groups change in abundance from birth to adulthood to old age, reflecting changing environmental influences such as initial mode of delivery, diet, insults such as pathogen infection and in many cases antibiotic usage (Dominguez-Bello, Costello et al.
  • the intestinal microbiota plays a key role in digesting food inaccessible to the human gastrointestinal tract, such as metabolizing carbohydrates into short chain fatty acids (Sekirov, Russell et al. 2010), interacting with the immune system to maintain homeostasis (Hooper, Littman et al. 2012), promoting maturation of the gut (Hooper, Wong et al. 2001) and development of the immune system.
  • the intestinal microbiota also plays an important role in resisting pathogen invasion, termed 'colonisation resistance'. This functions through the diversity and abundance of commensal species present and through the occupation of key niches and utilization of nutrients (Lawley and Walker 2013; Britton and Young 2014). If microbial homeostasis is disturbed, for example through use of antibiotics, a shift towards dysbiosis can occur.
  • Dysbiosis provides the opportunity for pathogens to establish themselves and cause disease to the individual in question. This has been best studied in terms of a single implicated pathogen such as Clostridium difficile (Lawley et al. 2012; Britton and Young 2014; Buffie et al. 2015), but dysbiosis has also been linked with other more complex, multi-factorial diseases such as Inflammatory Bowel Disease (IBD), pouchitis (Angeriman et al. 2014), Irritable Bowel Syndrome (IBS), hepatic encephalopathy (Bajaj 2014; Bajaj et al.
  • IBD Inflammatory Bowel Disease
  • pouchitis Angeriman et al. 2014
  • IBS Irritable Bowel Syndrome
  • hepatic encephalopathy Bajaj 2014; Bajaj et al.
  • metabolic diseases including metabolic syndrome, malnutrition, and obesity
  • neuropsychiatric disorders such as Parkinson's and Alzheimer's disease
  • autoimmune diseases allergic disorders, and cancer
  • Jostins Ripke et al. 2012, Collins 2014, Hold, Smith et al. 2014, Perez Martinez, Bauerl et al. 2014, Scheperjans, Aho et al. 2015; Blanton et al. 2016, Xu et al. 2015).
  • Faecal microbiota transplantation has proved successful in resolving C. difficile associated dysbiosis (Petrof et al. 2013, van Nood et al. 2013), and the administration of specific bacteria has also proved effective for this purpose (Lawley et al. 2012, Buffie et al. 2015). FMT has also showed promising results in the treatment of other intestinal diseases, as well as the management of extra-intestinal disorders associated with gut microbiota, including metabolic diseases, neuropsychiatric disorders, autoimmune diseases, allergic disorders, and tumours (Xu et al. 2015).
  • Therapeutic compositions based on known, defined, bacteria or bacterial mixtures are advantageous as they improve patient safety because they comprise only defined and well characterised bacteria that are known to promote, and not harm, human health, and eliminate the possibility of inadvertently transferring pathogenic material to a recipient by FMT.
  • therapeutic compositions can be prepared in vitro in a large-scale manner using standardised, reproducible procedures, thereby providing batch consistency, and do not rely on regular donations from healthy human donors.
  • Therapeutic compositions comprising known, defined, bacteria or bacterial mixtures can also be therapeutically delivered e.g.
  • the bacteria included in such therapeutic compositions can further be tailored to the treatment of specific dysbiotic states and diseases associated therewith by specifically altering the bacterial composition to optimally resolve the dysbiotic state in question and thus improve efficacy.
  • the present invention relates to therapeutic compositions, in particular therapeutic compositions for use in the treatment of dysbiosis in an individual as shown in the appended claims.
  • Dysbiosis can occur in any part of the human or animal body which is normally colonized by bacteria and other microbes.
  • the present invention particularly concerns dysbiosis of the gastrointestinal tract in humans.
  • the present inventors have surprisingly found that the majority of bacteria present in the human intestinal microbiota can be cultured, contrary to the prevailing view in the art which was that the majority of the human intestinal microbiota is unculturable.
  • This major breakthrough now allows the majority of bacteria present in the human microbiota to be isolated and characterised, and evaluated for their activity in treating dysbiosis. This is possible not only for individual bacterial isolates but also for combinations of bacteria isolated from the intestinal microbiota.
  • isolation of these bacteria allows the bacteria to be screened, for example, for the absence of virulence factors and antibiotic resistance prior to their inclusion in a therapeutic composition, thereby improving safety.
  • the bacteria included in a therapeutic composition can be tailored to the treatment of a specific dysbiotic state and/or disease associated therewith by optimising the bacterial composition to resolve the dysbiosis in question, thereby improving efficacy. None of this is possible in FMT where undefined mixes of bacteria are used, usually obtained from a faecal sample of a healthy human donor.
  • the use of isolated bacteria for the treatment of dysbiosis has the further advantage that it allows the bacteriotherapy treatment to be standardised, making patient outcomes more predictable, as well as facilitating evaluation of the therapeutic potential of bacteriotherapy in the context of particular diseases by removing the variability in bacterial composition associated with the use of FMT.
  • the present inventors were able to prepare libraries of intestinal bacteria which were then subjected to whole-genome sequencing and screened using both in silico analysis and in vitro experiments to identify bacteria which are expected to be useful in treating dysbiosis, in particular dysbiosis of the gastrointestinal tract.
  • the present inventors identified 51 bacteria which are expected to be useful for this purpose, including several families, genera, and species of bacteria which have not previously been described, let alone isolated or employed in the treatment of dysbiosis.
  • the present disclosure provides a therapeutic composition
  • a therapeutic composition comprising at least one isolated bacterium and a pharmaceutically acceptable excipient.
  • the bacterium preferably comprises a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 1 to 51.
  • rRNA 16S ribosomal RNA
  • the therapeutic composition may comprise more than one isolated bacterium, in addition to the pharmaceutically acceptable excipient. Where more than one bacterium is included in the therapeutic composition, the bacteria are preferably distinct, wherein each bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 1 to 51.
  • the therapeutic composition may comprise two distinct isolated bacteria, wherein the first bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in SEQ ID NO: 1 and the second bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in SEQ ID NO: 2.
  • the therapeutic compositions of the present invention find application in the treatment of dysbiosis, in particular the treatment of a dysbiosis of the intestinal tract.
  • the present invention provides a therapeutic composition according to the invention for use in a method of treating a dysbiosis of the gastrointestinal tract, in an individual.
  • the present invention provides a method of preparing or manufacturing a therapeutic composition according to the present invention, wherein the method preferably comprises the steps of:
  • the therapeutic compositions of the present invention may comprise at least two distinct isolated bacteria as shown in the appended claims.
  • the method of preparing or manufacturing a therapeutic composition preferably comprises steps of:
  • the bacteria disclosed herein have been obtained from human stool samples, and thus are naturally present in the gastrointestinal tract of at least some healthy human individuals. However, these bacteria have been cultured in vitro for the first time by the present inventors, thereby isolating them from their environment in pure form, and making it possible to include them as defined active ingredients in therapeutic compositions.
  • the bacterium present in the therapeutic composition of the present invention is thus isolated.
  • the bacterium present in the therapeutic composition is provided in isolated and/or purified form, e.g. isolated and/or purified from the environment in which it is normally present, such as the gastrointestinal tract and/or stool samples.
  • the isolated bacterium present in the therapeutic composition may be in substantially pure, or in homogeneous form.
  • the bacterium may be free, or substantially free, of material with which it is found in the environment in which it is normally present (e.g. the gastrointestinal tract and/or stool samples).
  • the bacterium present in the therapeutic composition of the present disclosure is preferably a human intestinal bacterium, i.e. a bacterium found in the human intestine.
  • the bacteria whose 16S rRNA gene sequences are set out in SEQ ID NOs 1 to 51 are all intestinal bacteria.
  • the bacterium is preferably a non-pathogenic bacterium.
  • the bacterium preferably does not cause disease in a healthy human individual when administered to said individual, in particular the gastrointestinal tract of said individual.
  • the therapeutic composition can be administered to an individual in a variety of ways as described in more detailed elsewhere herein, including in the form of a tablet or enema.
  • the bacterium present in the therapeutic composition of the present disclosure is preferably susceptible to treatment with one or more antibiotics.
  • the bacterium is preferably not resistant to treatment with at least one antibiotic. This allows antibiotic treatment of an individual in the event that one or more of the bacteria included in a therapeutic composition administered to the individual causes disease in the individual, contrary to expectations. All of the 51 bacteria disclosed herein where found to carry no known genes conferring resistance to the following antibiotics: beta-lactams, fusidic acid, elfamycin, aminoglycoside, fosfomycin, and tunicamycin.
  • the bacterium is susceptible to treatment with one or more antibiotics selected from the group consisting of: a beta-lactam, fusidic acid, elfamycin, aminoglycoside, fosfomycin, and tunicamycin.
  • antibiotics selected from the group consisting of: a beta-lactam, fusidic acid, elfamycin, aminoglycoside, fosfomycin, and tunicamycin.
  • the bacterium included in the therapeutic composition of the present disclosure preferably does not comprise one or more genes encoding one or more virulence factors and/or preferably does not produce one or more virulence factors.
  • Virulence factors in this context are properties which enhance the potential of a bacterium to cause disease in an individual. Virulence factors include the production of bacterial toxins, such as endotoxins and exotoxins by a bacterium, as well as the production of hydrolytic enzymes that may contribute to the pathogenicity of the bacterium.
  • Methods for screening bacteria for genes encoding virulence factors are known in the art and include the in silico methods described in Example 1. The 51 bacteria disclosed herein were found not to carry any known virulence factors using in silico analysis. Methods for screening bacteria for the production of virulence factors are similarly known in the art.
  • Bacteria can be taxonomically classified based on the sequence of the gene encoding the 16S ribosomal RNA (rRNA) in the bacterium. This gene sequence is also referred to as the ribosomal DNA sequence (rDNA).
  • rRNA ribosomal DNA sequence
  • a bacterium comprising a gene which encodes a 16S rRNA which has 90% or more sequence identity with the 16S rRNA encoded by a second bacterium belongs to the same family as said second bacterium.
  • a bacterium comprising a gene which encodes a 16S rRNA which has 95% or more sequence identity with the 16S rRNA encoded by a second bacterium belongs to the same genus as said second bacterium.
  • a bacterium comprising a gene which encodes a 16S rRNA which has 97% or more, or 98.7% or more sequence identity with the 16S rRNA encoded by a second bacterium belongs to the same species as said second bacterium.
  • a bacterium included in the therapeutic composition of the present disclosure may be a bacterium which belongs to the same family, genus, and/or species as a bacterium disclosed herein.
  • a bacterium which belongs to the same family, genus, and/or species as a bacterium disclosed herein is expected to retain one or more properties of the disclosed bacterium.
  • a bacterium present in the therapeutic composition of the present disclosure belongs to the same family, genus, and/or species as a bacterium disclosed herein and retains at least one property of the bacterium disclosed herein.
  • properties of the bacteria disclosed herein are described and include, for example, a lack of production of one or more virulence factors, susceptibility to treatment with one or more antibiotics, and a lack of pathogenicity.
  • the therapeutic composition of the present disclosure may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 1 to 51.
  • the therapeutic composition of the present disclosure may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 1 to 51.
  • the therapeutic composition comprises an isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, and wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in SEQ ID NO: 1.
  • the therapeutic composition may comprise an isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, and wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in SEQ ID NO: 21.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 1 to 51.
  • the therapeutic composition comprises at least one isolated bacterium, wherein said bacterium comprises a gene encoding a 16S rRNA, and wherein said gene comprises a sequence with at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 2 to 20, or 22 to 51, more preferably any one of SEQ ID NOs 5, 6, 11, 13, 14, 15, 17, 18, 19, 20, 22, 23, 24, 26, 29, 33, 35, 41, 43, 45, 46, 47, 49, or 50, yet more preferably any one of SEQ ID NOs 5, 6, 11, 13, 15, 19, 22, 23, 29, 33, 35, 41, 43, 45, 46, or 50.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 97%, or at least 98.7%, sequence identity with the sequence set forth in any one of SEQ ID NOs 1 to 51.
  • the therapeutic composition comprises at least one isolated bacterium, wherein said bacterium comprises a gene encoding a 16S rRNA, and wherein said gene comprises a sequence with at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 2 to 20, or 22 to 51, more preferably any one of SEQ ID NOs 2 to 3, 5 to 8, 10 to 20, 22 to 26, 29 to 37, or 39 to 50, yet more preferably any one of SEQ ID NOs 3, 5 to 8, 10 to 13, 15, 16, 19, 22, 23, 29, 32 to 37, 39 to 46, or 48 to 50.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein said bacterium comprises a gene encoding a 16S rRNA, and wherein said gene comprises a sequence with at least 98.7% sequence identity with the sequence set forth in any one of SEQ ID NOs 2 to 20, or 22 to 51, more preferably any one of SEQ ID NOs 2 to 4, 5 to 20, 22 to 26, 29 to 37 to 51, yet more preferably any one of SEQ ID NOs 2 to 8, 10 to 13, 15, 16, 17, 19, 20, 22, 23, 29, 31, 32 to 37 to 46, or 48 to 51.
  • the therapeutic composition of the present disclosure may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 21.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 91% sequence identity with the sequence set forth in SEQ ID NO: 29.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 92% sequence identity with the sequence set forth in any one of SEQ ID NOs 6, 11, 19 or 24.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 93% sequence identity with the sequence set forth in any one of SEQ ID NOs 13, 22, 26 or 35.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 5, 14, 15, 17, 18, 23, or 50.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 20, 33, 41, 43, 45, 46, 47, or 49.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 7, 8, 10, 12, 30, 32, 39, 42, 44, or 48.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 3, 16, 25, 31, 34, 36, 37, or 40.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 98% sequence identity with the sequence set forth in any one of SEQ ID NOs 4 or 9.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 99% sequence identity with the sequence set forth in any one of SEQ ID NOs 27, 28, 38, or 51.
  • the therapeutic composition of the present disclosure may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 21.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 92% sequence identity with the sequence set forth in any one of SEQ ID NOs 6, or 11.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 93% sequence identity with the sequence set forth in SEQ ID NO: 35.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 5, 19, 22, 23, or 50.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 13, 15, 29, 33, 41, 43, 45, or 46.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 7, 12, 32, 39, 42, or 44, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 3, 8, 10, 16, 34, 36, 37, 40, 48, or 49.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 98% sequence identity with the sequence set forth in any one of SEQ ID NOs 4, 9, 17 or 31.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 99% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 20, 38, or 51.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 14, 18, 24, 25, 26, 27, 28, 30, or 47.
  • GAP Garnier GCG package, Accelerys Inc, San Diego USA.
  • Other algorithms suitable for the alignment of nucleotide sequences may be used instead of GAP, e.g. BLAST (Basic Local Alignment Search Tool) (which uses the method of Altschul et al. (1990) J. Mol. Biol.
  • FASTA which uses the method of Pearson and Lipman (1988) PNAS USA 85: 2444-2448 ), the Smith-Waterman algorithm ( Smith and Waterman (1981) J. Mol Biol. 147: 195-197 ), the TBLASTN program, of Altschul et al. (1990) supra, or the psi-Blast algorithm ( Nucl. Acids Res. (1997) 25 3389-3402 ), generally employing default parameters.
  • BLAST may be used, preferably employing default parameters.
  • the isolated bacterium present in the therapeutic composition of the present disclosure comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence, which (in addition to the specified sequence identity) has a query coverage of at least 98%, at least 99%, or 100%, preferably at least 98%.
  • the query coverage refers to the percentage of said sequence which overlaps with the sequence with which it has the specified sequence identity, e.g. SEQ ID NO: 1.
  • the bacterium present in the therapeutic composition may comprise a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 1 to 51 and at least 98% query coverage.
  • the therapeutic composition of the present disclosure may comprise at least one isolated bacterium, wherein the bacterium is a bacterium as deposited under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedures at the Leibniz-Institut DSMZ - Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ), Inhoffenstr. 7B, 38124 Braunschweig by Genome Research Limited under an accession number as listed in Table 1 below.
  • the therapeutic composition of the present disclosure may comprise at least one isolated bacterium, wherein the bacterium is a bacterium as deposited under the Budapest Treaty at DSMZ under one of the following accession numbers (the date of deposit with DSMZ for each bacterium deposited is indicated in brackets after the accession number): DSM32191 (27 October 2015), DSM32147 (23 September 2015), DSM32149 (23 September 2015), DSM32175 (6 October 2015), DSM32153 (27 October 2015), DSM32152 (23 September 2015), DSM32158 (23 September 2015), DSM32192 (27 October 2015), DSM32148 (23 September 2015), DSM32166 (6 October 2015), DSM32151 (23 September 2015), DSM32150 (23 September 2015), DSM32193 (27 October 2015), DSM32162 (6 October 2015), DSM32194 (27 October 2015), DSM32163 (6 October 2015), DSM32205 (1 March 2016), DSM32195 (27 October 2015), DSM32164 (6 October 2015), DSM32177
  • the therapeutic composition of the present disclosure comprises at least one isolated bacterium, wherein the bacterium is a bacterium as deposited under the Budapest Treaty at DSMZ under one of the following accession numbers: DSM32191 and DSM32177.
  • the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium is a bacterium as deposited under the Budapest Treaty at DSMZ under one of the following accession numbers: DSM32153, DSM32152, DSM32151, DSM32193, DSM32162, DSM32194, DSM32205, DSM32195, DSM32164, DSM32177, DSM32165, DSM32169, DSM32168, DSM32182, DSM32184, DSM32211, DSM32222, DSM32215, DSM32217, DSM32218, DSM32224, DSM32214, DSM32223, and DSM32225; more preferably a bacterium as deposited under one of the following accession numbers: DSM32153, DSM32152, DSM32151, DSM32193, DSM32194, DSM32164, DSM32165, DSM32169, DSM32184, DSM32211, DSM32222, DSM322
  • the therapeutic composition of the present disclosure may comprise at least one isolated bacterium, said bacterium comprising a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence of the gene encoding the 16S rRNA in a deposited bacterium as described above.
  • the therapeutic composition of the disclosure may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least nineteen, at least twenty, at least twenty-one, at least twenty-two, at least twenty-three, at least twenty-four, at least twenty-five, at least twenty-six, at least twenty-seven, at least twenty-eight, at least twenty-nine, at least thirty, at least thirty-one, at least thirty-two, at least thirty-three, at least thirty-four, at least thirty-five, at least thirty-six, at least thirty-seven, at least thirty-eight, at least thirty-nine, at least forty, at least forty-one, at least forty-two, at least forty-three, at least forty-four, at least forty-five, at least forty
  • the therapeutic composition of the disclosure may comprise one, up to two, up to three, up to four, up to five, up to six, up to seven, up to eight, up to nine, up to ten, up to eleven, up to twelve, up to thirteen, up to fourteen, up to fifteen, up to sixteen, up to seventeen, up to eighteen, up to nineteen, up to nineteen, up to twenty, up to twenty-one, up to twenty-two, up to twenty-three, up to twenty-four, up to twenty-five, up to twenty-six, up to twenty-seven, up to twenty-eight, up to twenty-nine, up to thirty, up to thirty-one, up to thirty-two, up to thirty-three, up to thirty-four, up to thirty-five, up to thirty-six, up to thirty-seven, up to thirty-eight, up to thirty-nine, up to forty, up to forty-one, up to forty-two, up to forty-three, up to forty-four, up to forty-five, up to forty-s
  • a therapeutic composition comprises more than one isolated bacterium
  • the isolated bacteria are preferably distinct. “Distinct” may refer to the isolated bacteria encoding distinct 16S rRNA sequences.
  • the therapeutic composition of the disclosure may comprise at least one isolated bacterium which forms spores.
  • a bacterium is also referred to as a spore-forming bacterium.
  • Spores are metabolically dormant structures that are resilient to environmental insults and are used by certain bacteria as a survival strategy upon encountering adverse conditions.
  • HMI_1, HMI_2, HMI_4, HMI_6, HMI_10, HMI_15, HMI_17, HMI_21, HMI_22, HMI_33, HMI_36, HMI_37, HMI_38, HMI_44, HMI_47, HMI_48, HMI_50, HMI_51, and HMI_52 were isolated from ethanol-treated samples and are thus expected to be capable of forming spores.
  • HMI_3, HMI_7, HMI_8, HMI_16, HMI_18, HMI_19, HMI_24, HMI_25, HMI_26, HMI_27, HMI_28, HMI_29, HMI_30, HMI_34, HMI_41, and HMI_46 are expected to be spore formers based on phylogenetic analysis.
  • the therapeutic composition of the present disclosure may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least twenty, at least twenty-one, at least twenty-two, at least twenty-three, at least twenty-four, at least twenty-five, at least twenty-six, at least twenty-seven, at least twenty-eight, at least twenty-nine, at least thirty, at least thirty-one, at least thirty-two, at least thirty-three, at least thirty-four, or at least thirty-five isolated spore-forming bacteria.
  • the bacteria in the therapeutic composition may consist of spore forming bacteria.
  • the spore-forming bacterium may thus be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA) , wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 1, 2, 3, 4, 6, 7, 8, 10, 14, 15, 16, 17, 18, 20, 21, 23, 24, 25, 26, 27, 28, 29, 32, 33, 35, 36, 37, 40, 43, 45, 46, 47, 49, 50, or 51.
  • rRNA 16S ribosomal RNA
  • the spore forming bacterium may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 1, 2, 4, 6, 10, 14, 16, 20, 21, 32, 35, 36, 37, 43, 46, 47, 49, 50, or 51.
  • rRNA ribosomal RNA
  • the spore-forming bacterium may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 1, 2, 3, 4, 6, 7, 8, 10, 14, 15, 16, 17, 18, 20, 21, 23, 24, 25, 26, 27, 28, 29, 32, 33, 35, 36, 37, 40, 43, 45, 46, 47, 49, 50, or 51.
  • rRNA 16S ribosomal RNA
  • the spore forming bacterium may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 1, 2, 4, 6, 10, 14, 16, 20, 21, 32, 35, 36, 37, 43, 46, 47, 49, 50, or 51.
  • rRNA 16S ribosomal RNA
  • the spore forming bacterium is a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in SEQ ID NOs 1 or SEQ ID NO: 21, and/or at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 3, 4, 6, 7, 8, 10, 14, 15, 16, 17, 18, 20, 23, 24, 25, 26, 27, 28, 29, 32, 33, 35, 36, 37, 40, 43, 45, 46, 47, 49, 50, or 51.
  • rRNA 16S ribosomal RNA
  • the spore forming bacterium may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in SEQ ID NOs 1 or SEQ ID NO: 21, and/or at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID Nos 2, 4, 6, 10, 14, 16, 20, 32, 35, 36, 37, 43, 46, 47, 49, 50, or 51.
  • rRNA 16S ribosomal RNA
  • the spore forming bacterium may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth SEQ ID NO: 1 or SEQ ID NO: 21, at least 92% sequence identity with the sequence set forth in SEQ ID NO: 29, at least 92% sequence identity with the sequence set forth in SEQ ID NOs 6, or 24 at least 93% sequence identity with the sequence set forth in SEQ ID NOs 35 or 26, at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 14, 15, 17, 18, 23, or 50, at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 20, 33, 43, 45, 46, 47, or 49, at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 7, 8, 10, or 32, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 3,16, 25, 36, 37 or 40, at least 9
  • the spore forming bacterium may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth SEQ ID NO: 1 or SEQ ID NO: 21, at least 92% sequence identity with the sequence set forth in SEQ ID NO: 6, at least 93% sequence identity with the sequence set forth in SEQ ID NO: 35, at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 14, or 50, at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 20, 43, 46, 47, or 49, at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 10, or 32, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 16, 36, or 37, at least 98% sequence identity with the sequence set forth in SEQ ID NO: 4, or at least 99% sequence identity with the sequence set forth in SEQ ID NO: 51
  • the spore forming bacterium may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 21, at least 92% sequence identity with the sequence set forth SEQ ID NO: 6, at least 93% sequence identity with the sequence set forth in SEQ ID NO: 35, at least 94% sequence identity with the sequence set forth in SEQ ID NOs 23 or 50, at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 15, 29, 33, 43, 45 or 46, at least 96% sequence identity with the sequence set forth in SEQ ID NOs 7 or 32, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 3, 10, 16, 36, 37, 40 or 49, at least 98% sequence identity with the sequence set forth in SEQ ID NOs 4, 8 or 17, at least 99% sequence identity with the sequence set forth in any one of SEQ ID NO
  • the spore forming bacterium may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 21, at least 92% sequence identity with the sequence set forth SEQ ID NO: 6, at least 93% sequence identity with the sequence set forth in SEQ ID NO: 35, at least 94% sequence identity with the sequence set forth in SEQ ID NO: 50, at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 43, or 46, at least 96% sequence identity with the sequence set forth in SEQ ID NO: 32, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 10, 16, 36, 37, or 49, at least 98% sequence identity with the sequence set forth in SEQ ID NO: 4, at least 99% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 20, or 51, or 100% sequence identity with the sequence
  • the spore forming bacterium may be a bacterium as deposited at DSMZ under accession number DSM32191, DSM32147, DSM32175, DSM32152, DSM32166, DSM32162, DSM32163, DSM32177, DSM32167, DSM 32262, DSM 32222, DSM 32261, DSM32212, DSM32217, DSM32224, DSM32214, DSM32223, DSM32225, DSM32265, DSM32149, DSM32158, DSM32192, DSM32194, DSM32205, DSM32195, DSM32169, DSM32168, DSM32178, DSM32182, DSM32179, DSM32180, DSM32211, DSM32226, or DSM32218.
  • the spore forming bacterium is a bacterium as deposited at DSMZ under accession number DSM32191, DSM32147, DSM32175, DSM32152, DSM32166, DSM32162, DSM32163, DSM32177, DSM32167, DSM 32262, DSM 32222, DSM 32261, DSM32212, DSM32217, DSM32224, DSM32214, DSM32223, DSM32225, or DSM32265.
  • the therapeutic composition of the present disclosure may comprise at least one isolated spore-forming bacterium, said bacterium comprising a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence of the gene encoding the 16S rRNA in a deposited bacterium as described above.
  • the isolated bacterium present in the therapeutic composition may be antagonistic towards an intestinal bacterium, inhibit or prevent the growth or sporulation of an intestinal bacterium, and/or neutralize or protect against a toxin produced by an intestinal bacterium.
  • the bacterium inhibits or prevents the growth of an intestinal bacterium.
  • the intestinal bacterium may be a pathogenic or non-pathogenic intestinal bacterium.
  • the intestinal bacterium is a pathogenic bacterium. This is particularly preferred in the context of a therapeutic composition for use in the treatment of a dysbiosis associated with an enteric bacterial infection.
  • other diseases are also known to be characterised by an increase in certain types of bacteria in the gastrointestinal tract.
  • inflammatory bowel disease is known to be characterised by an increase in bacteria from the Proteobacteria phylum, such as Escherichia coli, in the intestinal microbiota.
  • irritable bowel syndrome, obesity and malnutrition are known to be characterised by an increase in certain types of bacteria in the gastrointestinal tract.
  • a bacterial composition comprising at least one bacterium which is antagonistic towards an intestinal bacterium, inhibits or prevents the growth or sporulation of an intestinal bacterium, and/or neutralizes or protects against a toxin produced by an intestinal bacterium thus also finds application in the treatment of dysbiosis associated with inflammatory bowel disease, irritable bowel syndrome, obesity, or malnutrition.
  • the pathogenic bacterium may be a Gram positive bacterium, or a Gram negative bacterium.
  • Exemplary pathogenic bacteria include pathogenic bacteria of the genera Clostridium, Escherichia, Enterococcus, Klebsiella, Enterobacter, Proteus, Salmonella, Shigella, Staphylococcus, Vibrio, Aeromonas, Campylobacter, Bacillus, Helicobacter, Listeria, Plesiomonas, or Yersinia.
  • the pathogenic bacterium is a pathogenic bacterium of the genera Clostridium or Escherichia, such as Clostridium difficile or Escherichia coli.
  • pathogenic Escherichia coli examples include adherent-invasive Escherichia coli (AlEC), enteroaggregative Escherichia coli, enterohemorrhagic Escherichia coli, enteroinvasive Escherichia coli, enterotoxigenic Escherichia coli, and Escherichia coli 0157:H7.
  • An enterotoxigenic Escherichia coli may produce a heat-labile enterotoxin, or heat-stable enterotoxin.
  • the pathogenic bacterium may be Clostridium difficile or adherent-invasive E . coli (AIEC).
  • AIEC adherent-invasive E . coli
  • HMI_14, HMI_25, HMI_42, HMI_26, HMI_28, HMI_35 and HMI_46 have been shown to inhibit growth of Clostridium difficile in an overlay assay.
  • HMI_2, HMI_4, HMI_5, HMI_6, HMI_15, HMI_26, HMI_27, HMI_28, HMI_34, HMI_35, HMI_39, HMI_40, HMI_43, HMI_44, HMI_46 and HMI_47 have been shown to inhibit growth of Clostridium difficile in a CFS-relative growth inhibition assay (see Example 2, Figure 13 , and Table 1).
  • HMI_4, HMI_10, HMI_11, HMI_14, HMI_26, HMI_28, HMI_33, HMI_35, HMI_42 and HMI_46 have been shown to inhibit growth of Escherichia coli in an overlay assay.
  • HMI_46 and HMI_28 have been shown to inhibit growth of Escherichia coli in a CFS-relative growth inhibition assay (see Example 2, Figure 13 , and Table 1).
  • the pathogenic bacterium may be a proteobacterium.
  • Proteobacteria include (apart from Escherichia species), Salmonella species, Campylobacter species, Vibrio species, Helicobacter species, and Yersinia species.
  • the pathogenic bacterium may be a bacterium of the genus Clostridium.
  • Pathogenic bacteria of the genus Clostridium include Clostridium perfringens, Clostridium botulinum, and Clostridium tetani.
  • the therapeutic composition may thus comprise at least one isolated bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli.
  • the therapeutic composition may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least twenty, at least twenty-one, or at least twenty-two isolated bacteria which inhibit the growth of Clostridium difficile and/or Escherichia coli.
  • the bacteria in the therapeutic composition may consist of one or more isolated bacteria which have been shown to inhibit the growth of Clostridium difficile and/or Escherichia coli.
  • the therapeutic composition may comprise at least one isolated bacterium which has been shown to inhibit the growth of Clostridium difficile.
  • a therapeutic composition for use in the treatment of a dysbiosis associated with an enteric infection, in particular a dysbiosis associated with an infection with a pathogenic Clostridium-related species, such as Clostridium difficile, Clostridium perfringens, Clostridium botulinum, or Clostridium tetani, most preferably Clostridium difficile.
  • the therapeutic composition may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, or at least nineteen isolated bacteria which inhibit the growth of Clostridium difficile.
  • the bacteria in the therapeutic composition may consist of bacteria which inhibit the growth of Clostridium difficile.
  • a bacterium inhibits the growth of Clostridium difficile may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 4, 5, 6, 13, 14, 24, 25, 26, 27, 33, 34, 38, 39, 41, 42, 43, 45 and 46.
  • rRNA 16S ribosomal RNA
  • a bacterium which inhibits the growth of Clostridium difficile may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 91%, at least 92%, at least 93%,at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 4, 5, 6, 13, 14, 24, 25, 26, 27, 33, 34, 38, 39, 41, 42, 43, 45 and 46.
  • rRNA 16S ribosomal RNA
  • a bacterium which inhibits the growth of Clostridium difficile may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 92% sequence identity with the sequence set forth in any one of SEQ ID NOs 6, or 24, at least 93% sequence identity with the sequence set forth in any one of SEQ ID NOs 13, or 26, at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 5, or 14, at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 33, 41, 43, 45, or 46, at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 39, or 42, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 25, or 34, at least 98% sequence identity with the sequence set forth in SEQ ID NO: 4, or at least 99% sequence identity with the sequence set forth in any one of SEQ ID NOs 27, or 38.
  • rRNA 16
  • a bacterium which inhibits the growth of Clostridium difficile may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 92% sequence identity with the sequence set forth SEQ ID NO: 6, at least 94% sequence identity with the sequence set forth in SEQ ID NO: 5, at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 13, 33, 41, 43, 45, or 46, at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 39, or 42, at least 97% sequence identity with the sequence set forth in SEQ ID NO: 34, at least 98% sequence identity with the sequence set forth in SEQ ID NO: 4, at least 99% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, or 38, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 14, 24, 25, 26, or 27.
  • rRNA 16S ribosomal RNA
  • the bacterium which inhibits the growth of Clostridium difficile may be a bacterium as deposited at DSMZ under accession number DSM32147, DSM32175, DSM32153, DSM32152, DSM32193, DSM32162, DSM32168, DSM32178, DSM32182, DSM32179, DSM32211, DSM 32219, DSM32220, DSM32213, DSM32215, DSM32216, DSM 32217, DSM32218, DSM 32224.
  • the therapeutic composition of the present disclosure may comprise at least one isolated bacterium which inhibits the growth of Clostridium difficile, wherein said bacterium comprising a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence of the gene encoding the 16S rRNA in a deposited bacterium as described above.
  • the therapeutic composition may comprise at least one isolated bacterium which inhibits the growth of Escherichia coli.
  • a dysbiosis associated with an enteric infection in particular a dysbiosis associated with an infection with a Proteobacterium, such as Escherichia species, Salmonella species, Campylobacter species, Vibrio species, Helicobacter species, and Yersinia species, most preferably a dysbiosis associated with an infection with Escherichia coli.
  • the therapeutic composition may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten, isolated bacteria which inhibit the growth of Escherichia coli.
  • the bacteria in the therapeutic composition may consist of bacteria which inhibit the growth of Escherichia coli.
  • a bacterium which inhibits the growth of Escherichia coli may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 4, 10, 11, 13, 25, 27, 32, 34, 41, and 45.
  • rRNA ribosomal RNA
  • a bacterium which inhibits the growth of Escherichia coli may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 91%, at least 92%, at least 93%,at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 4, 10, 11, 13, 25, 27, 32, 34, 41, and 45.
  • rRNA 16S ribosomal RNA
  • a bacterium which inhibits the growth of Escherichia coli may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 92% sequence identity with the sequence set forth in SEQ ID NO: 11, at least 93% sequence identity with the sequence set forth in SEQ ID NO: 13, at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 41, or 45, at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 10, or 32, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 25, or 34, at least 98% sequence identity with the sequence set forth in SEQ ID NO: 4, or at least 99% sequence identity with the sequence set forth in SEQ ID NO: 27.
  • rRNA 16S ribosomal RNA
  • a bacterium which inhibits the growth of Escherichia coli may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 92% sequence identity with the sequence set forth in SEQ ID NO: 11, at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 13, 41, or 45, at least 96% sequence identity with the sequence set forth in SEQ ID NO: 32, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 10, or 34, at least 98% sequence identity with the sequence set forth in SEQ ID NO: 4, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 25, or 27.
  • rRNA 16S ribosomal RNA
  • the bacterium which inhibits the growth of Escherichia coli may be a bacterium as deposited at DSMZ under accession number DSM32175, DSM32166, DSM32151, DSM32193, DSM32178, DSM32179, DSM 32262, DSM 32219, DSM32215, DSM32218.
  • the therapeutic composition of the present disclosure may comprise at least one isolated bacterium which inhibits the growth of Escherichia coli, wherein said bacterium comprising a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence of the gene encoding the 16S rRNA in a deposited bacterium as described above.
  • the therapeutic composition may comprise at least one isolated bacterium which co-occurs with a bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli as disclosed herein.
  • HMI_2 Bacteriotherapy candidates which have been shown to co-occur with a bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli as disclosed herein are HMI_2, HMI_5, HMI_6, HMI_7, HMI_8, HMI_9, HMI_10, HMI_11, HMI_12, HMI_14, HMI_15, HMI_16, HMI_17, HMI_18, HMI_19, HMI_20, HMI_26, HMI_27, HMI_31, HMI_33, HMI_34, HMI_35, HMI_37, HMI_38, HMI_39, HMI_41, HMI_42, HMI_43, HMI_44, HMI_46, HMI_47, HMI_48, HMI_50, HMI_51, and HMI_52 (see Table 1 for details).
  • the therapeutic composition may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least nineteen, at least twenty, at least twenty-one, at least twenty-two, at least twenty-three, at least twenty-four, at least twenty-five, at least twenty-six, at least twenty-seven, at least twenty-eight, at least twenty-nine, at least thirty, at least thirty-one, at least thirty-two, at least thirty-three, at least thirty-four, or thirty-five isolated bacteria which co-occur with a bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli as disclosed herein.
  • the bacterium which co-occurs with a bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli as disclosed herein may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 25, 26, 30, 32, 33, 34, 36, 37, 38, 40, 41, 42, 43, 45, 46, 47, 49, 50, or 51.
  • rRNA 16S ribosomal RNA
  • the bacterium which co-occurs with a bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli as disclosed herein may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 25, 26, 30, 32, 33, 34, 36, 37, 38, 40, 41, 42, 43, 45, 46, 47, 49, 50, or 51.
  • rRNA 16S ribosomal RNA
  • the bacterium which co-occurs with a bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli as disclosed herein is a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 92% sequence identity with the sequence set forth in any one of SEQ ID NOs 6, 11, or 19, at least 93% sequence identity with the sequence set forth in any one of SEQ ID NOs 13 or 26, at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 5, 14, 15, 17, 18, or 50, at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 33, 41, 43, 45, 46, 47, or 49, at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 7, 8, 10, 12, 30, 32, or 42, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 16, 25, 34, 36, 37, or 40,
  • the bacterium which co-occurs with a bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli as disclosed herein is a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 92% sequence identity with the sequence set forth in any one of SEQ ID NOs 6, or 11, at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 5, 19, or 50, at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 13, 15, 33, 41, 43, 45, or 46, at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 7, 12, 32, or 42, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 8, 10, 16, 34, 36, 37, 40, or 49, at least 98% sequence identity with the sequence set forth in any one of SEQ ID NOs 9 or 17, at least 99% sequence identity with rRNA
  • the bacterium which co-occurs with a bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli as disclosed herein is a bacterium as deposited at DSMZ under accession number DSM32147, DSM32153, DSM32152, DSM32158, DSM32192, DSM32148, DSM32166, DSM32151, DSM32150, DSM32193, DSM32162, DSM32194, DSM32163, DSM32205, DSM32195, DSM32164, DSM32178, DSM32182, DSM32181, DSM32262, DSM32211, DSM32219, DSM32261, DSM32212, DSM32220, DSM32226, DSM32215, DSM32216, DSM32217, DSM32218, DSM32224, DSM32214, DSM32223, DSM32225, or DSM32265.
  • the therapeutic composition of the present disclosure may comprise at least one isolated bacterium which co-occurs with a bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli as disclosed herein, wherein said bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence of the gene encoding the 16S rRNA in a deposited bacterium as described above.
  • the isolated bacterium present in the therapeutic composition may thus be a bacterium which has immunomodulatory activity.
  • the bacterium may reduce inflammation in the individual, e.g. in the gastrointestinal tract of the individual.
  • Bacteriotherapy candidates which are in the same genus as bacteria which have been shown to be beneficial in reducing inflammation through interactions with the host immune system are HMI_4, HMI_9, HMI_10, HMI_15, HMI_27, HMI_28 and HMI_38.
  • the bacteria ar therefore expected to have immunomodulatory activity, such as reducing inflammation in the individual, e.g. in the gastrointestinal tract of the individual.
  • the therapeutic composition may comprise at least one, at least two, at least three, at least four, at least five, at least six, or at least seven isolated bacteria which have immunomodulatory activity.
  • the bacteria in the therapeutic composition may consist of bacteria which reduce inflammation in the individual.
  • the bacterium which has immunomodulatory activity may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 4, 9, 10, 14, 26, 27, or 37.
  • rRNA 16S ribosomal RNA
  • a bacterium which has immunomodulatory activity may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 91%, at least 92%, at least 93%,at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 4, 9, 10, 14, 26, 27, or 37.
  • rRNA 16S ribosomal RNA
  • a bacterium which has immunomodulatory activity may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 93% sequence identity with the sequence set forth in SEQ ID NO: 26, at least 94% sequence identity with the sequence set forth in SEQ ID NO: 14, at least 96% sequence identity with the sequence set forth in SEQ ID NO:10, at least 97% sequence identity with the sequence set forth in SEQ ID NO: 37, at least 98% sequence identity with the sequence set forth in any one of SEQ ID NOs 4 or 9, or at least 99% sequence identity with the sequence set forth in SEQ ID NO: 27.
  • a bacterium which has immunomodulatory activity may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 97% sequence identity with the sequence set forth in in any of SEQ ID NOs 10 or 37, at least 98%
  • the bacterium which has immunomodulatory activity may be a bacterium as deposited at DSMZ under accession number DSM32175, DSM32148, DSM32166, DSM32162, DSM32182, DSM32179, or DSM32212.
  • the therapeutic composition of the present disclosure may comprise at least one isolated bacterium which has immunomodulatory activity, wherein said bacterium comprising a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence of the gene encoding the 16S rRNA in a deposited bacterium as described above.
  • the therapeutic composition of the disclosure may comprise at least one isolated bacterium which is on the Human Microbiome Project's (HMP) "most wanted” list.
  • Bacteriotherapy candidates HMI_1, HMI_2, HMI_4, HMI_5, HMI_7, HMI_11, HMI_12, HMI_15, HMI_16, HMI_17, HMI_18, HMI_19, HMI_35, HMI_37, HMI_38, HMI_39, HMI_45, HMI_50, and HMI_51 are on HMP's "most wanted" list.
  • the therapeutic composition of the present disclosure may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, or nineteen bacteria which are on HMP's "most wanted” list.
  • the bacteria in the therapeutic composition may consist of bacteria which are on HMP's "most wanted" list.
  • the bacterium which is on HMP's "most wanted” list may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 1, 2, 4, 5, 7, 11, 12, 14, 15, 16, 17, 18, 34, 36, 37, 38, 44, 49, or 50.
  • rRNA ribosomal RNA
  • the bacterium which is on HMP's "most wanted” list may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 1, 2, 4, 5, 7, 11, 12, 14, 15, 16, 17, 18, 34, 36, 37, 38, 44, 49, or 50.
  • rRNA 16S ribosomal RNA
  • the bacterium which is on HMP's "most wanted” list is a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth SEQ ID NO: 1, at least 92% sequence identity with the sequence set forth SEQ ID NO: 11, at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 5, 14, 15, 17, 18, or 50, at least 95% sequence identity with the sequence set forth SEQ ID NO: 49, at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 7, 12, or 44, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 16, 34, 36, or 37, at least 98% sequence identity with the sequence set forth in SEQ ID NO: 4, or at least 99% sequence identity with the sequence set forth in SEQ ID NO: 38.
  • rRNA 16S ribosomal RNA
  • the bacterium which is on HMP's "most wanted” list is a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth SEQ ID NO: 1, at least 92% sequence identity with the sequence set forth SEQ ID NO: 11, at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 5 or 50, at least 95% sequence identity with the sequence set forth SEQ ID NO: 15, at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 7, 12, or 44, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 16, 34, 36, 37, 49, at least 98% sequence identity with the sequence set forth in any one of SEQ ID NOs 4, or 17, at least 99% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, or 38, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 14, or 18.
  • the bacterium which is on HMP's "most wanted” list is a bacterium as deposited at DSMZ under accession number DSM32191, DSM32147, DSM32175, DSM32153, DSM32158, DSM32151, DSM32150, DSM32162, DSM32194, DSM32163, DSM32205, DSM32195, DSM32219, DSM32261, DSM32212, DSM32220, DSM32221, DSM32223, or DSM32225.
  • the therapeutic composition of the present disclosure may comprise at least one bacterium which is on HMP's "most wanted" list, wherein said bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence of the gene encoding the 16S rRNA in a deposited bacterium as described above.
  • the therapeutic composition of the disclosure may comprise at least one isolated bacterium which is a keystone species.
  • Bacteriotherapy candidates HMI_17, HMI_23, HMI_24, HMI_25, HMI_26, HMI_27, HMI_28, HMI_29, HMI_30, HMI_31, HMI_32, HMI_45, HMI_49, HMI_51, and HMI_52 are expected to be keystone species.
  • the therapeutic composition of the present disclosure may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, or fifteen bacteria which are keystone species.
  • the bacteria in the therapeutic composition may consist of bacteria which are keystone species.
  • the bacterium which is a keystone species may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA) , wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 16, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 44, 48, 50, or 51.
  • rRNA ribosomal RNA
  • the bacterium which is a keystone species may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA) wherein said gene comprises a sequence with at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 16, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 44, 48, 50, or 51.
  • rRNA 16S ribosomal RNA
  • the bacterium which is a keystone species is a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA) wherein said gene comprises a sequence with at least 91% sequence identity with the sequence set forth in SEQ ID NO: 29, at least 92% sequence identity with the sequence set forth in SEQ ID NO: 24, at least 93% sequence identity with the sequence set forth in any one of SEQ ID NOs 22, or 26, at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 23, or 50, at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 30, 44, or 48, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 16, 25, or 31, or at least 99% sequence identity with the sequence set forth in any one of SEQ ID NOs 27, 28, or 51.
  • rRNA 16S ribosomal RNA
  • the bacterium which is a keystone species is a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA) wherein said gene comprises a sequence with at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 22, 23, or 50, at least 95% sequence identity with the sequence set forth in SEQ ID NO: 29, at least 96% sequence identity with the sequence set forth in SEQ ID NO: 44, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 16, or 48, at least 98% sequence identity with the sequence set forth in SEQ ID NO: 31, at least 99% sequence identity with the sequence set forth in SEQ ID NO: 51, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 24, 25, 26, 27, 28, or 30.
  • rRNA 16S ribosomal RNA
  • the bacterium which is a keystone species is a bacterium as deposited at DSMZ under accession number DSM32163, DSM32165, DSM32169, DSM32168, DSM32178, DSM32182, DSM32179, DSM32180, DSM32184, DSM32181, DSM32183, DSM32221, DSM32263, DSM32225, or DSM32265.
  • the therapeutic composition of the present disclosure may comprise at least one bacterium which is a keystone species, wherein said bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence of the gene encoding the 16S rRNA in a deposited bacterium as described above.
  • the therapeutic composition of the disclosure may comprise at least one isolated bacterium which has been shown to be present post-FMT.
  • the bacteriotherapy candidates to which this applies are set out in Table 1.
  • the therapeutic composition may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least twenty, at least twenty-one or twenty two bacteria which has been shown to be present post-FMT.
  • the bacterium which has been shown to be present post-FMT may comprise a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 36, 38, 40, 43, 44, 45, 46, 48, or 51.
  • rRNA 16S ribosomal RNA
  • the bacterium which has been shown to be present post-FMT is a bacterium as deposited at DSMZ under accession number DSM32165, DSM32169, DSM32168, DSM32178, DSM32182, DSM32179, DSM32180, DSM32184, DSM32181, DSM32183, DSM32262, DSM32211, DSM32219, DSM32261, DSM32220, DSM32226, DSM32217, DSM32221, DSM32218, DSM32224, DSM32263, or DSM32265.
  • the therapeutic composition of the present disclosure may comprise at least one bacterium which has been shown to be present post-FMT, wherein said bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence of the gene encoding the 16S rRNA in a deposited bacterium as described above.
  • the therapeutic composition of the disclosure may comprise at least one isolated bacterium which is expected to produce one or more beneficial metabolites, such as short chain fatty acids (SCFA).
  • SCFA short chain fatty acids
  • the therapeutic composition may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, or fourteen bacteria which produce one or more beneficial metabolites.
  • the bacterium which produces one or more beneficial metabolites may comprise a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 9, 12, 19, 20, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31.
  • rRNA 16S ribosomal RNA
  • the bacterium which is expected to produce one or more beneficial metabolites is a bacterium as deposited at DSMZ under accession number DSM32148, DSM32150, DSM32164, DSM32177, DSM32165, DSM32169, DSM32168, DSM32178, DSM32182, DSM32179, DSM32180, DSM32184, DSM32181, or DSM32183.
  • the therapeutic composition of the present disclosure may comprise at least one bacterium which produces one or more beneficial metabolites, wherein said bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence of the gene encoding the 16S rRNA in a deposited bacterium as described above.
  • the isolated bacterium or isolated bacteria present in a therapeutic composition may make up at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 7%, 75%, 80%, 85%, or 90% of the therapeutic composition by volume or weight.
  • the therapeutic composition may comprise no other active ingredient other than the isolated bacterium or isolated bacteria in question, and optionally a prebiotic.
  • the active ingredient of the therapeutic composition may consist of one or more isolated bacteria disclosed herein, and optionally a prebiotic. This may also be referred to as a defined active ingredient.
  • the therapeutic composition of the present invention is not a faecal microbiota transplant (FMT).
  • FMTs usually consist of a stool sample from a healthy human donor which is administered directly to the recipient, e.g. in the form of an enema, without bacteria present in the stool sample being isolated prior to the administration of the FMT to the recipient.
  • An advantage of the therapeutic composition of the invention is that it may comprise no undefined components, which are present in FMTs, thereby allowing the therapeutic composition to be standardised and increasing safety.
  • the therapeutic composition of the present disclosure may be prepared by a method comprising culturing the one or more isolated bacteria present in the therapeutic composition in a suitable medium or media.
  • Media and conditions suitable for culturing the bacteria to be included in the therapeutic composition of the present disclosure are described in detail elsewhere herein.
  • a method of preparing a therapeutic composition according to the present disclosure may comprise the steps of:
  • the above method may include steps of culturing each isolated bacterium which is to be included in the therapeutic composition.
  • the method may e.g. further include steps of culturing a third, fourth, fifth, sixth, seventh, eighth, ninth, and/or tenth distinct isolated bacterium, as required.
  • the method comprise steps of culturing up to 51 distinct isolated bacteria.
  • the bacterium or bacteria cultured by said method may be any bacterium as disclosed herein.
  • the method may optionally comprise one or more further steps in which the bacteria are mixed with one or more additional ingredients, such as a pharmaceutically acceptable excipient, prebiotic, carrier, insoluble fibre, buffer, osmotic agent, antifoaming agent, and/or preservative.
  • the method may comprise suspending the bacteria obtained in (i) and optionally (ii) in a chemostat medium, or saline, e.g. 0.9% saline.
  • the bacteria obtained in (i) and optionally (ii) may be provided under a reduced atmosphere, such as N 2 , CO 2 , H 2 , or a mixture thereof, e.g. N 2 :CO 2 :H 2 .
  • the gases may be present in appropriate ratios for the preservation of the bacteria present in the therapeutic composition.
  • the reduced atmosphere may comprise 80% N 2 , 10% CO 2 and 10% H 2 .
  • the method may comprise a step of lyophilising the bacteria obtained in (i) and optionally (ii), optionally in the presence of a stabiliser and/or cryprotectant.
  • the method may also comprise a step of preparing a capsule, tablet, or enema comprising the bacteria obtained in (i) and optionally (ii).
  • the capsule or tablet may be enteric-coated, pH dependant, slow-release, and/or gastro-resistant.
  • the present disclosure also encompasses a therapeutic composition obtainable by, or obtained by, a method as disclosed herein.
  • a therapeutic composition may further be used for a therapeutic purpose, in a therapeutic method, or for the manufacture of a medicament, as described herein, such as treatment of a dysbiosis, in particular a dysbiosis of the gastrointestinal tract.
  • the bacteria disclosed herein will be suitable for the treatment of a dysbiosis, in particular a dysbiosis of the gastrointestinal tract. Without wishing to be limited by theory, it is expected that administration of one or more of the bacteria disclosed herein to an in individual will resolve a gastrointestinal dysbiosis, where present, and/or prevent the occurrence of gastrointestinal dysbiosis, in the individual.
  • "Individual”, as used herein, refers to a human individual or human patient.
  • Treatment of a dysbiosis may refer to the cure, prevention, or amelioration of a dysbiosis or the amelioration of at least one symptom associated with dysbiosis.
  • treatment of the dysbiosis may refer to the cure, prevention, or amelioration of said disease, or the amelioration of at least one symptom associated with said disease.
  • the therapeutic compositions of the present invention thus find application in the treatment of dysbiosis of the gastrointestinal tract. Accordingly, the invention provides a therapeutic composition according to the invention for use in a method of treating a dysbiosis in an individual.
  • Dysbiosis in the context of the present invention refers to a state in which the normal diversity and/or function of the microbiota or microbiome, in particular the human gastrointestinal microbiota, is disrupted. Any disruption from the normal state of the microbiota in a healthy individual can be considered a dysbiosis, even if the dysbiosis does not result in a detectable decrease in health in the individual.
  • the dysbiosis may be associated with one or more pathological symptoms.
  • “dysbiosis” may refer to a decrease in the microbial diversity of the microbiota.
  • dysbiosis may refer to an increase in the abundance of one or more bacteria, e.g. one or more pathogenic bacteria, in the microbiota of an individual relative to the abundance of said bacterium or bacteria in the microbiota of a healthy individual, i.e. an individual without a dysbiosis.
  • the pathogenic bacteria present during dysbiosis are often Proteobacteria and resistant to one or more antibiotics. Examples of Proteobacteria include Escherichia, Salmonella, Campylobacter, Vibrio, Helicobacter, and Yersinia species.
  • the dysbiosis may be a dysbiosis associated with an enteric bacterial infection, such as an infection of the gastrointestinal tract with a pathogenic bacterium.
  • Many bacteria capable of causing infections of the gastrointestinal tract in humans are known and include: gram positive bacteria, and gram negative bacteria.
  • the pathogenic bacterium is preferably a pathogenic species of the genus Clostridium, Escherichia, Enterococcus, Klebsiella, Enterobacter, Proteus, Salmonella, Shigella, Staphylococcus, Vibrio, Aeromonas, Campylobacter, Plesiomonas, Bacillus, Helicobacter, Listeria, or Yersinia.
  • pathogenic bacteria include Clostridium difficile, Clostridium perfringens, Clostridium botulinum, Escherichia coli, Salmonella typhi, Staphylococcus aureus, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Campylobacter fetus, Campylobacter jejuni, Aeromonas hydrophila, Plesiomonas shigelloides, Bacillus cereus, Helicobacter pylori, Listeria monocytogenes, and Yersinia enterocolitica. More preferably, the pathogenic bacterium is a pathogenic species of the genus Clostridium or Escherichia. Most preferably, the pathogenic bacterium is Clostridium difficile or Escherichia coli.
  • the pathogenic bacterium may resistant to one or more antibiotics.
  • the pathogenic bacterium e.g. Clostridium difficile
  • the pathogenic bacterium may be resistant to one or more carbapenems.
  • Carbapenems are antibiotics used for the treatment of infections by multidrug-resistant (MDR) bacteria, and examples include imipenem, meropenem, ertapenem, doripenem, panipenem, and biapenem.
  • Treatment of a dysbiosis associated with an infection with a pathogenic bacterium may comprise reducing the abundance of the pathogenic bacterium, e.g. in the gastrointestinal tract of the individual, relative to the abundance of the pathogenic bacterium prior to treatment.
  • the dysbiosis may be a recurrent or chronic dysbiosis.
  • Clostridium difficile is known to result in recurrent infections in some individuals, with the infection reoccurring once antibiotic treatment is stopped. This may be referred to as a recurrent or chronic dysbiosis.
  • Dysbiosis of the gastrointestinal tract is known to be associated with, and is thought to play a causal role in, a number of diverse diseases, including inflammatory bowel disease, irritable bowel syndrome, metabolic disease, a neuropsychiatric disorder, an autoimmune disease, an allergic disorder, or a cancer.
  • the dysbiosis may be a dysbiosis associated with inflammatory bowel disease, irritable bowel syndrome, a metabolic disease, a neuropsychiatric disorder, an autoimmune disease, an allergic disorder, a cancer, or hepatic encephalopathy.
  • Examples of inflammatory bowel disease include ulcerative colitis and Crohn's disease.
  • Metabolic disease in which dysbiosis of the gastrointestinal tract has been shown to play a role include metabolic syndrome, obesity, type 2 diabetes mellitus, a cardiovascular disease, and non-alcoholic fatty liver.
  • Neuropsychiatric disorder in which dysbiosis of the gastrointestinal tract has been shown to play a role include Parkinson's disease, Alzheimer's disease, multiple sclerosis, myoclonus dystonia, autism and chronic fatigue syndrome.
  • Autoimmune diseases in which dysbiosis of the gastrointestinal tract has been shown to play a role include idiopathic thrombocytopenic purpura, arthritis, Sjögren's syndrome, systemic lupus erythematosus, and Hashimoto's thyroiditis.
  • Allergic disorder in which dysbiosis of the gastrointestinal tract has been shown to play a role include atopy, and asthma.
  • Cancers in which dysbiosis of the gastrointestinal tract has been shown to play a role include colorectal cancer, extra-intestinal tumours, mammary tumours, hepatocellular carcinoma, lymphoma, melanoma, and lung cancer.
  • the therapeutic composition of the disclosure may comprise a pharmaceutically acceptable excipient, carrier, buffer, stabilizer or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the isolated bacteria present in the therapeutic composition.
  • the precise nature of the pharmaceutically acceptable excipient or other material will depend on the route of administration, which may be oral or rectal. Many methods for the preparation of therapeutic compositions are known to those skilled in the art. See e.g. Robinson ed., Sustained and Controlled Release Drug Delivery Systems, Marcel Dekker, Inc., New York, 1978 .
  • the therapeutic composition of the disclosure may comprise a prebiotic, a carrier, insoluble fibre, a buffer, an osmotic agent, an anti-foaming agent and/or a preservative.
  • Prebiotics may provide nutrients for the isolated bacteria present in the therapeutic composition to assist their early growth and colonisation after administration to the individual. Any prebiotic known in the art may be used.
  • Non-limiting examples of prebiotics include oligosaccharides, e.g., fructooligosaccharides such as oligofructose and inulin, mannan oligosaccharides and galactooligosaccharides, soluble, oligofructose-enriched inulin and soluble fiber.
  • Insoluble fiber may be included in the therapeutic composition as a carrier, e.g., to provide protection during transit or storage.
  • a buffer may be included in the therapeutic composition to promote the viability of the isolated bacteria present.
  • An antifungal agent may included in the therapeutic composition as a preservative.
  • the therapeutic composition may be made or provided in chemostat medium.
  • the therapeutic composition may be made or provided in saline, e.g., 0.9% saline. It will be understood that any carrier or solution which does not impair viability of the bacteria present in the therapeutic composition and is compatible with administration to an individual may be used.
  • the therapeutic composition may be made or provided under reduced atmosphere, i.e., in the absence of oxygen.
  • the synthetic stool preparation may be made or provided under N 2 , CO 2 , H 2 , or a mixture thereof, optionally with controlled levels of partial pressure of N 2 :CO 2 :H 2 .
  • the therapeutic composition may be for oral or rectal administration to the individual. Where the therapeutic composition is for oral administration, the therapeutic composition may be in the form of a capsule, or a tablet. Where the therapeutic composition is for rectal administration, the therapeutic composition may be in the form of an enema.
  • the preparation of suitable capsules, tablets and enema is well-known in the art.
  • the capsule or tablet may comprise a coating to protect the capsule or tablet from stomach acid.
  • the capsule or tablet may be enteric-coated, pH dependant, slow-release, and/or gastro-resistant. Such capsules and tablets are used, for example, to minimize dissolution of the capsule or tablet in the stomach but allow dissolution in the small intestine.
  • the therapeutic composition may be lyophilized.
  • the lyophilized therapeutic composition may comprise one or more stabilisers and/or cryoprotectants.
  • the lyophilized therapeutic composition may be reconstituted using a suitable diluent prior to administration to the individual.
  • a therapeutic composition according to the present disclosure may be administered alone or in combination with other treatments, concurrently or sequentially or as a combined preparation with another therapeutic agent or agents, for the treatment of dysbiosis, or a disease associated with dysbiosis as described herein.
  • a conjugate of the disclosure may be used in combination with an existing therapeutic agent for inflammatory bowel disease, irritable bowel syndrome, a metabolic disease, a neuropsychiatric disorder, an autoimmune disease, an allergic disorder, a cancer, or hepatic encephalopathy.
  • the therapeutic composition may optionally be administered in combination a cancer immunotherapy, such as an immune check-point inhibitor, to the individual.
  • a cancer immunotherapy such as an immune check-point inhibitor
  • check-point inhibitors which may be employed in this context include Programmed cell death protein 1 (PD-1) inhibitors, Programmed death-ligand 1 (PD-L1) inhibitors, cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) inhibitors.
  • PD-1 inhibitors Programmed cell death protein 1 (PD-1) inhibitors
  • PD-L1 Programmed death-ligand 1
  • CTLA-4 cytotoxic T-lymphocyte-associated protein 4
  • Manipulation of the gut microbiota in combination with immune check-point inhibitor treatment has been shown to improve efficacy of immune check-point inhibitors in treating cancer (Snyder et al. 2015).
  • the cancer in this context is lung cancer or melanoma.
  • Immune check-point inhibitors have been approved for the treatment of these cancers and bacteriotherapy has been shown
  • the therapeutic compositions of the disclosure may be administered to an individual, preferably a human individual. Administration may be in a "therapeutically effective amount", this being sufficient to show benefit to the individual. Such benefit may be at least amelioration of at least one symptom. Thus “treatment” of a specified disease refers to amelioration of at least one symptom.
  • the actual amount administered, and rate and time-course of administration, will depend on the nature and severity of what is being treated, the particular patient being treated, the clinical condition of the individual patient, the cause of the dysbiosis, the site of delivery of the composition, the type of therapeutic composition, the method of administration, the scheduling of administration and other factors known to medical practitioners. Prescription of treatment, e.g.
  • a therapeutically effective amount or suitable dose of a therapeutic composition of the disclosure can be determined by comparing its in vitro activity and in vivo activity in an animal model. Methods for extrapolation of effective dosages in mice and other test animals to humans are known. The precise dose will depend upon a number of factors, including whether the therapeutic composition is for prevention or for treatment.
  • fresh faecal samples were obtained from six consenting healthy adult human donors (one faecal sample per donor - minimum 0.5g). The samples were placed in anaerobic conditions within one hour of passing to preserve the viability of anaerobic bacteria. All sample processing and culturing took place under anaerobic conditions in a Whitley DG250 workstation (Don Whitley, West Yorkshire, UK) at 37°C. Culture media, phosphate-buffered saline (PBS) and all other materials that were used for culturing were placed in the anaerobic cabinet 24 hours before use. The faecal samples were divided into two portions.
  • PBS phosphate-buffered saline
  • the medium was supplemented with 0.1% sodium taurocholate to stimulate spore germination. Colonies were picked 72 hours after plating from petri dishes of both ethanol-treated and non-ethanol-treated conditions harbouring non-confluent growth, (i.e. plates on which the colonies were distinct and not touching). The colonies that were picked were re-streaked to confirm purity.
  • FMT Faecal Microbiota Transplantation
  • Faecal samples were collected from the patients 1-2 days after stopping vancomycin treatment (pre-FMT) and at different times post-FMT. Stool samples used for FMT were also collected from the donors. Samples from healthy individuals and individuals infected with C. difficile treated with antibiotics were also included as controls. Faecal samples were collected in sterile containers and were frozen at -80°C. DNA was extracted from all samples for 454 sequencing and subsequent analysis as described below.
  • FMT faecal microbiota transplant
  • PBS reduced phosphate buffered saline
  • the following media were used: fastidious anaerobic agar (FAA, Lab M Ltd, Lancashire, UK) containing 2% defibrinated horse blood, Brain Heart Infusion (BHI, Oxoid UK), de Man Rogosa Sharpe and CCEY (Bioconnections, UK) agars with and without the addition of 10 ⁇ g/ml vancomycin (AppliChem, Germany). All plated media were incubated anaerobically at 37°C for 48-72 hours except for the BHI agar, which was incubated aerobically at 37°C for 24-48 hours.
  • FAA fastidious anaerobic agar
  • BHI Brain Heart Infusion
  • CCEY Bioconnections, UK
  • All plated media were incubated anaerobically at 37°C for 48-72 hours except for the BHI agar, which was incubated aerobically at 37°C for 24-48 hours.
  • the R package seqinr version 3.1 was used to determine sequence similarity between 16S rRNA gene sequences and, as full-length 16S rRNA gene sequence reads were generated, 98.7% was used as the species-level cut-off to classify reads to Operational Taxonomic Units (OTUs) (Bosshard, Abels et al. 2003, Clarridge 2004). As only partial length 16S rRNA gene sequence reads were generated for candidate bacteria from CIP2, 97% was used as the species-level cut-off (Bosshard, Abels et al. 2003, Clarridge 2004) and the OTUs at this cut-off were determined using mothur (Schloss, Westcott et al. 2009).
  • OTUs Operational Taxonomic Units
  • the 16S rRNA gene sequence of each species-level OTU was then compared to the Ribosomal Database Project (RDP) reference database to assign taxonomic designations down to the genus level (Wang, Garrity et al. 2007).
  • RDP Ribosomal Database Project
  • a BLASTn search was then performed with the 16S rRNA gene sequences to determine whether the OTU represented either a previously characterised or a novel species (Altschul, Gish et al.1990).
  • Comparisons of the OTUs with the Human Microbiome Project (HMP) "Most Wanted” list and reference genomes database were carried out using 97% sequence identity of the 16S rRNA gene sequences to define a bacterial species because only partial 16S rRNA gene sequences were available for the bacteria on the HMP "Most Wanted” list and reference genomes database.
  • HMP Human Microbiome Project
  • Genomic DNA was extracted from at least one representative of each unique OTU using a phenol-chloroform based DNA isolation procedure. DNA was sequenced on the Illumina HiSeq platform generating read lengths of 100bp and these were assembled and annotated for further analysis.
  • DNA was also extracted directly from each faecal sample for whole community metagenomic and 16S rRNA gene amplicon sequencing using the MP Biomedical FastDNA SPIN Kit for soil. To enable comparisons with the complete community samples, non-confluent cultures were scraped from agar plates 72 hours after inoculation with the initial faecal sample and DNA was extracted from this community using the same DNA isolation process. 16S rRNA gene amplicon libraries were made by PCR amplification of variable regions 1 and 2 of the 16S rRNA gene using the Q5 High-Fidelity Polymerase Kit supplied by New England Biolabs.
  • Thermocycling involved an initial 2-min denaturation step at 94°C followed by 20 cycles of denaturation (94°C for 30 s), annealing (53°C for 30 s) and elongation (68°C for 2 min).
  • the PCR products were purified using the Wizard SV Gel and PCR Clean-Up System (Promega, UK) following the manufacturer's protocol and quantified using the Qubit ® dsDNA HS Assay Kit (Life_Technologies, UK). Equimolar volumes of each cleaned-up products of each PCR reaction were sequenced on the Roche 454 FLX-Titanium platform.
  • a maximum likelihood phylogeny of the culture derived bacteria from CIP1 was generated from the aligned RDP sequence using FastTree version 2.1.3 (Price, Dehal et al. 2010) with the following settings: a Generalised Time-Reversible (GTR) model of nucleotide substitution and CAT approximation of the variation in rates across sites with 20 rate categories.
  • GTR Generalised Time-Reversible
  • the ethanol resistant phylogeny was derived directly from the entire culture phylogeny. All phylogenetic trees were edited in ITOL (Letunic and Bork 2011).
  • sequence reads were trimmed, filtered and pre-processed using the mothur software 454 SOP accessed in November 2012 (Schloss, Westcott et al. 2009, Schloss, Gevers et al. 2011). To ensure high quality sequence data for analysis, the sequences were trimmed using a window size of 50 bp (average quality score of 35 bp), homopolymers > 8 bp were removed and no ambiguous bases or mismatches in the primer sequence were allowed. Redundant sequence reads were removed to generate unique sequences, which were aligned to the SILVA alignment database (Pruesse, Quast et al. 2007).
  • Microbial abundance was calculated using the Human Pan-Microbe Community Database (Forster, Browne et al. 2015) against 1883 healthy individuals (3218 samples) and 458 diseased individuals (628 samples). Occurrence was calculated as greater than 1000, independent, normalised reads with abundance calculated relative to total high quality reads within the sample. Antimicrobial resistance and virulence factor identification were performed using automated sequence homology search against protein sequences annotated in the complete genome sequence. The antimicrobial resistance reference list was defined based on the comprehensive antimicrobial CARD database (McArthur, Waglechner et al. 2013) while toxins were identified by occurrence in the Database of Bacterial Exotoxins for Humans (DBETH) (Chakraborty, Ghosh et al. 2012).
  • DBETH Bacterial Exotoxins for Humans
  • the inventors established methods to isolate and identify bacteria for incorporation into a therapeutic composition tailored to the treatment of dysbiosis of the gastrointestinal tract, as well as e.g. enteric infections, such as, but not limited to, those caused by Clostridium difficile.
  • enteric infections such as, but not limited to, those caused by Clostridium difficile.
  • CIP1 relied on a broad culturing approach from healthy adult donors to establish a culture collection which is as representative as possible of the bacterial component of the healthy human intestinal microbiota.
  • This process also incorporated a targeted culturing approach to preferentially select bacteria displaying a particular phenotype or function e.g. spore formation.
  • CIP2 was more targeted in nature and aimed to acquire bacterial species specifically associated with resolving gastrointestinal dysbiosis by comparing individuals before and FMT to resolve C. difficile associated dysbiosis.
  • the inventors first sought to establish a genomic-based workflow that could be used as a platform for targeted culturing of specific bacterial phenotypes ( Figure 1 ).
  • Fresh faecal samples were collected from 6 healthy humans and defined the resident bacterial communities with a combined metagenomic sequencing and bacterial culturing approach.
  • the inventors profiled and compared the bacterial species present in the original faecal samples to those that grew as distinct colonies on agar plates containing the complex, broad range bacteriological medium, YCFA (Duncan, Hold et al. 2002) supplemented with glucose, maltose and cellobiose.
  • YCFA Uncan, Hold et al. 2002
  • the human intestinal microbiota is dominated by strict anaerobic bacteria that are extremely sensitive to ambient oxygen. Certain members of the Firmicutes, including Clostridium difficile, produce metabolically dormant and highly resistant spores during colonisation that facilitate both persistence within the host and environmental transmission (Lawley, Clare et al. 2009, Francis, Allen et al. 2013, Janoir, Deneve et al. 2013). Relatively few intestinal spore-forming bacteria have been cultured to date and while metagenomic studies suggest that other unexpected members of the intestinal microbiota possess potential sporulation genes, they remain poorly characterised (Galperin, Mekhedov et al. 2012, Abecasis, Serrano et al. 2013, Meehan and Beiko 2014, Rajilic-Stojanovic and de Vos 2014).
  • sporulation might be an unappreciated basic phenotype of the human intestinal microbiota that may have a profound impact on microbiota persistence and spread between humans. Spore-formation is also viewed as desirable for bacteriotherapy formulations since the resistant nature of the spore structure would promote survival of the medicine during production and subsequent storage. Spores from C. difficile are resistant to ethanol and this phenotype can be used to select for spores from a mixed population of spores and ethanol-sensitive vegetative cells (Riley, Brazier et al. 1987). Faecal samples with or without ethanol treatment were processed using our combined culture and metagenomics workflow ( Figure 1 ).
  • CI P2 Targeted identification of candidates to resolve gastrointestinal dysbiosis
  • FMT has proven effective in resolving CDI.
  • the inventors therefore sought to culture from faecal samples from FMT donors and recipients to isolate candidate bacteria that could be used in therapy.
  • a panel of different microbiological media were tested to recover the broadest range of bacterial species from the faecal samples (see Methods). This approach allowed culturing and archival of bacterial candidates.
  • Over 2600 bacterial isolates were cultured and using 16S rRNA gene sequencing these were taxonomically classified ( Figure 7 ). These bacterial isolates were members of the 4 major phyla (Actinobacteria, Bacteroidetes, Proteobacteria and Firmicutes) in the intestinal microbiota. These bacterial isolates represented more than 350 different OTUs based on alignments of the partial length 16S rRNA gene.
  • the inventors first sought to analyse the isolates cultured from FMT donors and recipients. At one to three months post-FMT, the faecal microbiota profiles of the recipients were similar to those of the donors and the healthy controls. In particular, the relative abundances of the four major bacterial phyla present in the gut microbiota were also similar across these groups.
  • the microbiota community structure in the donors and recipients was visualised for evaluation using principal component analysis (PCA) ( Figure 6 ).
  • PCA principal component analysis
  • the PCA plot demonstrates the presence of two distinct compositional profiles representing a "health-associated" microbiota, and a "vancomycin" microbiota.
  • the health-associated profile contained samples from FMT donors, healthy controls and FMT recipients at 2-3 months post treatment.
  • the "vancomycin" microbiota profile was separated from the health-associated microbiota along Principal Component 1 and only contained individuals treated with vancomycin. These vancomycin control individuals became infected with C . difficile while taking antibiotics to treat other disease conditions. Additionally, the "metronidazole-associated” profile was separated from the "health-associated” profile along Principal Component 2 and contained samples from C . difficile infected patients treated with metronidazole.
  • the donor-recipient profiles of each pair were compared before and after FMT to identify taxa that were present in the donor sample, and which increased in relative abundance in the recipient's profile after FMT.
  • a total of 786 OTUs from all recipient samples were detected after FMT but singleton OTUs present at the different time points were removed. This resulted in 375 OTUs for further analysis.
  • OTUs that were increased in relative proportional abundances at 2-3 months post-FMT were analysed further.
  • CIP1 and CIP2 bacteriotherapy candidates from both of our culturing approaches.
  • CIP1 and CIP2 bacteriotherapy candidates from both of our culturing approaches.
  • a healthy intestinal microbiota is based on a diverse and abundant microbial community.
  • the inventors computationally assessed their prevalence in healthy and diseased individuals in public metagenomic data-sets using the HPMC database tool (Forster, Browne et al. 2015).
  • Candidate bacteria were first filtered to include only those isolates with greater than 0.001 % average abundance within the bacterial community across all healthy individuals in which they were detected ( Figure 8 ).
  • bacteriotherapy candidates were further analysed on the basis of computationally predicted antimicrobial resistance (AMR) and virulence factors.
  • Bacteriotherapy candidates with overall predicted resistance scores below 20% of the overall predicted resistance scores of the known pathogens C. difficile, Enterococcus faecalis and Escherichia coli were included.
  • Candidates were also selected for the absence of in-silico predicted resistance to beta-lactams, fusidic acid, elfamycin, aminoglycoside, fosfomycin and tunicamycin and by the absence of known toxins as listed in Chakrabory A. et al, 2012, A Database of Bacterial Exotoxins for Humans (DBETH).
  • the inventors identified 51 candidates for use in bacteriotherapy from CIP1 and CIP2 (see Table 1). 10 of these bacteriotherapy candidates were identified using CIP2, namely: HMI_23, HMI_24, HMI_25, HMI_26, HMI_27, HMI_28, HMI_29, HMI_30, HMI_31 and HMI_32 (see Table 1 for details). All of these 10 isolates were cultured from healthy donors. The remaining bacteriotherapy candidates were identified using CIP1.
  • the bacterial isolates of interest identified in Example 1 were streaked in an "X" shape over the surface of a standard Petri dish containing warmed and reduced YCFA agar. These inoculated plates were then incubated anaerobically at 37°C for 3 to 6 days, until bacterial growth was clearly visible.
  • Overlay agar was prepared by adding 0.8% agar to an appropriate broth. For C. difficile, BHI broth + 0.8% agar was used. For E. coli, LB + 0.8% agar was prepared. The overlay agar was held molten at 50°C before use. The overlay agar was inoculated (1% inoculum) with an aliquot of a turbid culture of the pathogen of interest, in this case either C.
  • Bacteriotherapy candidates were grown in 1ml aliquots of reduced YCFA broth at 37°C under anaerobic conditions for two days.
  • Cell free supernatant (CFS) was prepared by centrifuging each culture to remove the bacteria and by passing the resulting supernatant through a 0.22 ⁇ m filter to sterilise it.
  • Uninoculated YCFA broth was also filter sterilised.
  • the CFSs and filtered YCFA broth aliquots were frozen at -20°C until they were required. These filtrates were thawed under anaerobic conditions at 37°C and a 100 ⁇ l aliquot of each CFS was added to one well of a flat-bottomed 96-well plate.
  • the relative growth of the pathogen of interest in each of the CFSs tested was then calculated as follows: For each CFS tested, every raw-data value was expressed relative to its OD 600 reading that was taken at the ten minute time-point. Such data normalisation permitted direct comparison of C. difficile or E. coli growth in the various CFSs by eliminating the initial inherent variation in the optical density of the CFSs (due to the pre-fermentation of the media) from consideration. The relative growth achieved at the 18.17h time-point by C. difficile or E. coli in each of the CFSs was compared to the relative growth of the pathogen of interest that was achieved in YCFA broth. A commensal strain was considered a potential inhibitor of C. difficile or E.
  • bacteriotherapy candidates tested 22 demonstrate growth inhibition of at least one of C. difficile M7404 or E. coli (AIEC) in one of the assays performed.
  • 11 of the bacteriotherapy candidates inhibited the growth of at least one of either C. difficile or E. coli in overlay assays, suggesting that the inhibition conferred by these bacteriotherapy candidates is direct.
  • 5 of the bacteriotherapy candidates inhibit only the growth of either C. difficile or E. coli, suggesting that the inhibitory activity of these bacteriotherapy candidates is not generic, i.e. that the inhibitory activity is specific for one or more pathogenic bacteria.
  • the results from the CFS-relative growth inhibition assay demonstrate that the CFS from 16 of the 50 bacteriotherapy candidates tested, only supported the relative growth of C. difficile to levels more than two standard deviations below the mean relative growth in YCFA broth at the 18.17h time-point. These bacteriotherapy candidates are thus considered to inhibit C. difficile growth. 5 of these bacteriotherapy candidates were also shown to directly inhibit C. difficile and/or E. coli growth in the overlay assays. This suggests that these 5 bacteriotherapy candidates secrete one or more substances which inhibit the growth of these pathogenic bacteria. The remaining 11 bacteriotherapy candidates which showed inhibitory activity in the CFS-relative growth inhibition assay are likely to compete with C. difficile for nutrients. CFS from two of the bacteriotherapy candidates did not support growth of E. coli to within two standard deviations of the mean growth observed for E. coli in YCFA broth. These isolates are therefore considered to inhibit the growth of E. coli.
  • Example 2 To identify bacteria that, while not capable of directly inhibiting pathogen growth as tested in Example 2, may support the growth or survival of those bacteria that exhibited direct inhibition of pathogen growth in Example 2, co-abundance network analysis was performed.
  • Bacterial isolates that inhibited the growth of one or more pathogenic bacteria as shown in Example 2 are expected to be suitable for treating gastrointestinal dysbiosis in humans.
  • Example 2 bacterial isolates that did not show evidence of pathogen inhibition in Example 2 are still expected to be useful for the treatment of gastrointestinal dysbiosis.
  • Example 3 based on the co-occurrence data obtained in Example 3, a large number of the deposited bacteria are expected to support the colonization of the gastrointestinal tract by the inhibitory bacteria identified in Example 2 through direct or indirect interaction. Metabolic networks in which consortia of bacteria thrive by cross-feeding, structural networks, such as biofilms, or the interactions of 'keystone species', allow the microbiota to establish and stabilise (Ze and Mougen et al. 2013).
  • Co-occurrence analysis identified 35 candidates that formed first degree co-occurrence neighbours with direct inhibitors at a rate above 95% (HMI_2, HMI_5, HMI_6, HMI_7, HMI_8, HMI_9, HMI_10, HMI_11, HMI_12, HMI_14, HMI_15, HMI_16, HMI_17, HMI_18, HMI_19, HMI_20, HMI_26, HMI_27, HMI_31, HMI_33, HMI_34, HMI_35, HMI_37, HMI_38, HMI_39, HMI_41, HMI_42, HMI_43, HMI_44, HMI_46, HMI_47, HMI_48, HMI_50, HMI_51, HMI_52; see Table 1 for details).
  • Example 1 the bacterial isolates listed in Table 1 are shown in Example 1 to contribute to the overall diversity of the gastrointestinal microbiota, which is low during dysbiosis. Specifically, a number of these bacteria (HMI_23 to HMI_32 inclusive) were recovered from the intestinal microbiota of FMT donors as part of CIP2. When the microbiota of a healthy donor was transferred to an individual with dysbiosis due to antibiotic treatment for recurrent C. difficile infection, all were restored to health ( Figure 6 ), which was determined as the absence of C. difficile at 2-3 months post-FMT.
  • the criteria for identifying bacteriotherapy candidates by the CIP2 process required that a certain candidate bacterial species was present in the microbiota of half the recipients at more than >0.6% average relative abundance at 2-3 months post-FMT.
  • genera representing several of the 51 bacteria listed in Table 1 were also identified in healthy donors and in cured recipients post-FMT ( Figure 14 ).
  • the in silico analysis presented herein revealed that the 51 candidate bacteriotherapy isolates are prevalent in healthy individuals, in whom they occur at an average relative abundance >0.001% and these bacteria tend to be depleted under conditions of dysbiosis ( Figure 9 ). Together, these data strongly suggest that the 51 bacterial isolates listed in Table 1 are suitable in the treatment of gastrointestinal dysbiosis.
  • the bacterial isolates listed in Table 1 are expected to compete with enteric pathogens in the gastrointestinal tract, and thus find application in the treatment of gastrointestinal dysbiosis. Specifically, the widespread occurrence of these bacteria in healthy individuals implies that they efficiently colonise the gastrointestinal tract. When the microbiota is populated by these health-associated bacteria, the likelihood of enteric infection with any pathogenic bacterium is known to be low, as such infections usually do not occur in individuals with a healthy gastrointestinal microbiota. Indeed, following FMT, during which genera representing many of the 51 bacteria listed in Table 1 were identified in individuals treated for a dysbiosis of the gastrointestinal tract following antibiotic treatment for C.
  • Clostridium related species have been shown to be immunomodulatory and can be beneficial in reducing inflammation (Atarashi, Tanoue et al. 2013).
  • examples in this context that are in the same genus as these bacteria are HMI_4, HMI_9, HMI_10, HMI_15, HMI_27, HMI_28 and HMI_38.
  • 16S rRNA gene sequences of the 51 deposited bacterial isolates listed in Table 1 are set out below below.
  • a putative genus and species name is give.
  • the genus was and species names were assigned based on the Ribosomal Database Project (RDP) reference database and BLASTn analysis as explained in Example 1.
  • the genus and species names assigned to each of the bacteriotherapy candidates are thus that of the most closely related known bacterium and hence subject to change.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Diabetes (AREA)
  • Neurosurgery (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Epidemiology (AREA)
  • Obesity (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Pulmonology (AREA)
  • Nutrition Science (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Physiology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Psychology (AREA)
  • Hospice & Palliative Care (AREA)
  • Psychiatry (AREA)
  • Emergency Medicine (AREA)
  • Rheumatology (AREA)

Description

    Field of the Invention
  • The present invention relates to therapeutic compositions comprising at least one isolated bacterium as defined herein and a pharmaceutically acceptable excipient, as well as methods of preparing such therapeutic compositions. The therapeutic compositions find application in the treatment of dysbiosis, in particular dysbiosis of the gastrointestinal tract. The dysbiosis may be a dysbiosis associated with an enteric bacterial infection, inflammatory bowel disease, pouchitis, irritable bowel syndrome, a metabolic disease, a neuropsychiatric disorder, an autoimmune disease, an allergic disorder, a cancer, or hepatic encephalopathy.
  • Background to the invention
  • A typical human intestinal microbiota contains 100-1000 bacterial species. There is extensive compositional diversity between individuals, such that each individual's microbiota is as unique as a fingerprint (Qin, Li et al. 2010; Nielsen, Almeida et al. 2014). The majority of the bacterial species within the adult human microbiota are derived from four high level taxonomic classifications or phyla, the Firmicutes, Bacteroidetes, Actinobacteria and Proteobacteria. These groups change in abundance from birth to adulthood to old age, reflecting changing environmental influences such as initial mode of delivery, diet, insults such as pathogen infection and in many cases antibiotic usage (Dominguez-Bello, Costello et al. 2010, Koenig, Spor et al. 2011, Ottman, Smidt et al. 2012). In adulthood, the intestinal microbiota is dominated by the Firmicutes and the Bacteroidetes, both of which are strict anaerobes.
  • The intestinal microbiota plays a key role in digesting food inaccessible to the human gastrointestinal tract, such as metabolizing carbohydrates into short chain fatty acids (Sekirov, Russell et al. 2010), interacting with the immune system to maintain homeostasis (Hooper, Littman et al. 2012), promoting maturation of the gut (Hooper, Wong et al. 2001) and development of the immune system. The intestinal microbiota also plays an important role in resisting pathogen invasion, termed 'colonisation resistance'. This functions through the diversity and abundance of commensal species present and through the occupation of key niches and utilization of nutrients (Lawley and Walker 2013; Britton and Young 2014). If microbial homeostasis is disturbed, for example through use of antibiotics, a shift towards dysbiosis can occur.
  • Dysbiosis provides the opportunity for pathogens to establish themselves and cause disease to the individual in question. This has been best studied in terms of a single implicated pathogen such as Clostridium difficile (Lawley et al. 2012; Britton and Young 2014; Buffie et al. 2015), but dysbiosis has also been linked with other more complex, multi-factorial diseases such as Inflammatory Bowel Disease (IBD), pouchitis (Angeriman et al. 2014), Irritable Bowel Syndrome (IBS), hepatic encephalopathy (Bajaj 2014; Bajaj et al. 2012) metabolic diseases (including metabolic syndrome, malnutrition, and obesity), neuropsychiatric disorders such as Parkinson's and Alzheimer's disease, autoimmune diseases, allergic disorders, and cancer (Jostins, Ripke et al. 2012, Collins 2014, Hold, Smith et al. 2014, Perez Martinez, Bauerl et al. 2014, Scheperjans, Aho et al. 2015; Blanton et al. 2016, Xu et al. 2015).
  • Faecal microbiota transplantation (FMT) has proved successful in resolving C. difficile associated dysbiosis (Petrof et al. 2013, van Nood et al. 2013), and the administration of specific bacteria has also proved effective for this purpose (Lawley et al. 2012, Buffie et al. 2015). FMT has also showed promising results in the treatment of other intestinal diseases, as well as the management of extra-intestinal disorders associated with gut microbiota, including metabolic diseases, neuropsychiatric disorders, autoimmune diseases, allergic disorders, and tumours (Xu et al. 2015).
  • Recent years have seen great advances in understanding the role the intestinal microbiota plays in health and disease and how it can be manipulated for the benefit of the host. The majority of our understanding has to date been derived by culture-independent studies, i.e. by studying the compositional components of the microbiota and how they change during disease using molecular and genomic techniques. This process allows identification of potential therapeutic candidates that can resolve disease. However, the isolation, purification and acquisition of such candidate therapeutic bacteria has proven difficult.
  • There is therefore a need in the art to identify and isolate specific bacteria, as well as combinations of bacteria, which can be used to treat dysbiosis. Therapeutic compositions based on known, defined, bacteria or bacterial mixtures are advantageous as they improve patient safety because they comprise only defined and well characterised bacteria that are known to promote, and not harm, human health, and eliminate the possibility of inadvertently transferring pathogenic material to a recipient by FMT. In addition, such therapeutic compositions can be prepared in vitro in a large-scale manner using standardised, reproducible procedures, thereby providing batch consistency, and do not rely on regular donations from healthy human donors. Therapeutic compositions comprising known, defined, bacteria or bacterial mixtures can also be therapeutically delivered e.g. in a capsule, as a tablet, or as an enema, which is more acceptable to patients and health care professionals than suspensions of faecal material used in the case of FMT. The bacteria included in such therapeutic compositions can further be tailored to the treatment of specific dysbiotic states and diseases associated therewith by specifically altering the bacterial composition to optimally resolve the dysbiotic state in question and thus improve efficacy.
  • However, in order to isolate such candidate therapeutic bacteria for the treatment of dysbiosis, a thorough understanding of the biology of the candidates in question is required, as well as a large initial panel of candidates to select from. This poses a problem as the majority of the bacteria in the intestinal microbiota are considered to be unculturable and have never been isolated in the laboratory (Eckburg, Bik et al. 2005, Hattori and Taylor 2009, Stewart 2012). Thus, gaining a basic understanding of the functional attributes of the microbiota and developing a multi-species bacteria-based therapeutic with fastidious, anaerobic commensal isolates presents a formidable challenge. While recent efforts have made progress in resolving this issue (Goodman, Kallstrom et al. 2011, Lagier, Hugon et al. 2015), there remains a need in the art to identify and isolate bacteria capable of treating dysbiosis.
  • Statements of invention
  • The present invention relates to therapeutic compositions, in particular therapeutic compositions for use in the treatment of dysbiosis in an individual as shown in the appended claims. Dysbiosis can occur in any part of the human or animal body which is normally colonized by bacteria and other microbes. The present invention particularly concerns dysbiosis of the gastrointestinal tract in humans.
  • The present inventors have surprisingly found that the majority of bacteria present in the human intestinal microbiota can be cultured, contrary to the prevailing view in the art which was that the majority of the human intestinal microbiota is unculturable. This major breakthrough now allows the majority of bacteria present in the human microbiota to be isolated and characterised, and evaluated for their activity in treating dysbiosis. This is possible not only for individual bacterial isolates but also for combinations of bacteria isolated from the intestinal microbiota. In addition, isolation of these bacteria allows the bacteria to be screened, for example, for the absence of virulence factors and antibiotic resistance prior to their inclusion in a therapeutic composition, thereby improving safety. In addition, the bacteria included in a therapeutic composition can be tailored to the treatment of a specific dysbiotic state and/or disease associated therewith by optimising the bacterial composition to resolve the dysbiosis in question, thereby improving efficacy. None of this is possible in FMT where undefined mixes of bacteria are used, usually obtained from a faecal sample of a healthy human donor. The use of isolated bacteria for the treatment of dysbiosis has the further advantage that it allows the bacteriotherapy treatment to be standardised, making patient outcomes more predictable, as well as facilitating evaluation of the therapeutic potential of bacteriotherapy in the context of particular diseases by removing the variability in bacterial composition associated with the use of FMT.
  • Through surprisingly being able to culture the majority of bacteria present in the human intestinal microbiota, the present inventors were able to prepare libraries of intestinal bacteria which were then subjected to whole-genome sequencing and screened using both in silico analysis and in vitro experiments to identify bacteria which are expected to be useful in treating dysbiosis, in particular dysbiosis of the gastrointestinal tract. Using this approach, the present inventors identified 51 bacteria which are expected to be useful for this purpose, including several families, genera, and species of bacteria which have not previously been described, let alone isolated or employed in the treatment of dysbiosis. As already explained above, the majority of the human microbiota was thought in the art to be unculturable, so the mere disclosure of a 16S ribosomal RNA sequence of one of these bacteria does not in itself enable the isolation of such a bacterium from its natural environment. Nor does the disclosure of such a 16S ribosomal RNA sequence suggest that a bacterium with such a sequence has previously been isolated, as 16S ribosomal RNA sequence information can be obtained from bacterial populations, including faecal samples, without the need to isolate individual bacteria. However, the ability to isolate bacteria in pure form from their natural environment is a prerequisite for their inclusion in therapeutic compositions according to the present invention.
  • Thus, in a first aspect, the present disclosure provides a therapeutic composition comprising at least one isolated bacterium and a pharmaceutically acceptable excipient. The bacterium preferably comprises a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 1 to 51.
  • The therapeutic composition may comprise more than one isolated bacterium, in addition to the pharmaceutically acceptable excipient. Where more than one bacterium is included in the therapeutic composition, the bacteria are preferably distinct, wherein each bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 1 to 51. Thus, for example, the therapeutic composition may comprise two distinct isolated bacteria, wherein the first bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in SEQ ID NO: 1 and the second bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in SEQ ID NO: 2.
  • As mentioned above, the therapeutic compositions of the present invention find application in the treatment of dysbiosis, in particular the treatment of a dysbiosis of the intestinal tract. Thus, in a second aspect, the present invention provides a therapeutic composition according to the invention for use in a method of treating a dysbiosis of the gastrointestinal tract, in an individual.
  • Methods of preparing or manufacturing a therapeutic composition according to the present invention also form part of the invention as shown in the appended claims. Thus, in a third aspect, the present invention provides a method of preparing or manufacturing a therapeutic composition according to the present invention, wherein the method preferably comprises the steps of:
    1. (i) culturing an isolated bacterium as described herein; and
    2. (ii) mixing the bacteria obtained in (i) with a pharmaceutically acceptable excipient.
  • As mentioned above, the therapeutic compositions of the present invention may comprise at least two distinct isolated bacteria as shown in the appended claims. Where the therapeutic composition comprise more than one distinct isolated bacteria, the method of preparing or manufacturing a therapeutic composition preferably comprises steps of:
    • (i) culturing a first isolated bacterium as described herein;
    • (ii) culturing a second isolated bacterium as described herein; and
    • (ii) mixing the bacteria obtained in (i) and (ii) with a pharmaceutically acceptable excipient. The bacteria cultured in steps (i) and (ii) preferably have distinct 16S rRNA sequences. Steps (i) and (ii) are preferably performed independently. The above method can be adapted to include further steps to allow the culturing of more than two distinct isolated bacteria, preferably bacteria with distinct 16S rRNA sequences, by including an additional step or steps for the culturing of a third or further isolated bacterium as disclosed herein. In this case, all bacteria cultured in the method are mixed with a pharmaceutically acceptable excipient.
    Brief Description of the Figures
    • Figure 1 shows a schematic diagram of the workflow used to culture, archive and characterise the intestinal microbiota. The process incorporates several steps which are: culture, re-streak, archive and phenotype. (A) Fresh faecal samples were left untreated or were treated to select for bacteria with a desired phenotype (such as sporulation). The stool was homogenised and then serially diluted before aliquots of the homogenate were inoculated on YCFA agar to culture the bacteria present in the faecal samples. (B) Bacterial isolates were identified by selecting single colonies that were then streaked to purity before full-length 16S rRNA gene amplification and sequencing was performed. (C) Each unique, novel and desired bacterial isolate was archived frozen in a culture collection and a whole genome sequence was generated for each. (D) Phenotypic characterisation and functional validation of metagenomics studies was then performed using in vitro and in vivo methods.
    • Figure 2 : Targeted phenotypic culturing facilitates bacterial discovery from healthy human faecal microbiota. Figure 2 shows the relative abundance of bacteria in faecal samples (x axis) compared to the relative abundance of bacteria growing on YCFA agar plates (y axis) as determined by metagenomic sequencing. The results demonstrate that the bacteria grown on YCFA agar are representative of the bacteria present in complete faecal samples as indicated by Spearman Rho =0.75.
    • Figure 3 shows a principal component analysis (PCoA) plot of 16S rRNA gene sequences detected from 6 donor faecal samples representing bacteria in the complete faecal samples (unfilled circles), faecal bacterial colonies recovered from YCFA agar plates without ethanol pre-treatment (filled black squares) or with ethanol pre-treatment to select for ethanol-resistant spore-forming bacteria (filled black circles). These results demonstrate that culturing without ethanol selection is representative of the complete faecal sample, while ethanol treatment shifts the profile, enriching for ethanol-resistant spore-forming bacteria and allowing their subsequent isolation.
    • Figure 4 : Archiving of bacterial diversity and novelty through anaerobic culturing. Figure 4A shows that the culture conditions employed by the present inventors enabled isolation of representatives from 21 of the 25 most abundant faecal bacterial genera as determined by metagenomic sequencing. A black dot indicates the number of species cultured and archived from each genus. Lachnospiraceae incertae sedis, unclassified Lachnospiraceae, Clostridium IV and Clostridium XI are not strict genera and represent currently unclassified species. Figure 4B shows the 24 most abundant bacterial species (comprising 90% of the total bacterial abundance at the species level) as determined by metagenomic sequencing. All were cultured and archived except for Odoribacter splanchnicus. Figure 4C shows that intestinal microbiota members present at low abundance were also cultured. At least one representative species from each of the genera presented was cultured. Genera are listed in order of decreasing abundance.
    • Figure 5 : Phylogeny of cultured and archived bacteria from healthy human faecal microbiota. Figure 5 shows a phylogenetic tree of bacteria cultured from the 6 donors constructed from full length 16S rRNA gene sequences. Novel candidate species (filled black circles), genera (grey filled circles) and families (filled stars) are shown by dot colours. Major phyla and family names are indicated. Proteobacteria were not cultured, but are included for context.
    • Figure 6 : Faecal Microbiota Transplant (FMT) restores the intestinal microbiota of patients with recurrent C. difficile infection to a healthy state. Figure 6 shows the results of a principal component analysis of the donors, recipients and controls at 2-3 months after FMT. The clustering of the faecal samples indicates a similar microbial community structure. Antibiotic use and exposure to C. difficile likely leads to a shift from the healthy state, as seen in the metronidazole-treated control samples. Treatment of C. difficile infection (CDI) with vancomycin, an antibiotic that targets Gram-positive organisms would presumably lead to further disruption of the intestinal microbiota. FMT led to a shift from a diseased microbiota to a healthy one with most of the post-FMT samples clustering with the donors and healthy control samples.
    • Figure 7 : Taxonomic summary of the bacteria isolated from faecal samples of the donors, recipients and controls from a study to treat C. difficile using FMT. These bacterial isolates represent a large cross-section of intestinal microbiota diversity.
    • Figure 8 : Average relative abundance of bacteriotherapy candidates in healthy individuals. The bacteriotherapy candidates occur at an average abundance of greater than 0.001% within the gastrointestinal microbiota of 1883 healthy individuals (3218 samples).
    • Figure 9 : The bacteriotherapy candidates are depleted in dysbiotic and disease states. The average fold change in the relative abundance of each bacteriotherapy candidate in diseased and dysbiotic states in comparison to its relative abundance in a healthy microbiota is plotted. Escherichia coli, a marker of dysbiosis is also included for comparison. The relative abundance of a bacterium refers to the proportion of the total microbiota represented by the bacterium in question.
    • Figure 10 demonstrates how the zone of clearing around bacteriotherapy candidates was measured in the overlay assays. Figure 10 shows part of a YCFA agar plate on which a bacteriotherapy candidate was streaked in an X-shape and allowed to grow. Following growth of the bacteriotherapy candidate, the plate was covered with overlay agar comprising C. difficile or E.coli. Inhibition of C. difficile or E.coli growth by a bacteriotherapy candidate was measured by determining the width of the zone of clearing around the bacteriotherapy candidate strain grown on the plate. The black diagonal line in Figure 10 indicates the distance measured and recorded as the width of the zone of clearing for an exemplary bacteriotherapy candidate. Four such measurements were taken per plate.
    • Figure 11 shows the results of C. difficile and E. coli growth overlay assays to determine the anti-pathogen activity of bacteriotherapy candidates. The zones of clearing were measured with a ruler as described in Figure 10. Millimetre (mm) measurements were taken. Figure 11 shows the mean measurement ± standard deviation from a representative experiment.
    • Figure 12 shows the results of C. difficile and E. coli growth inhibition assays to determine the anti-pathogen activity of bacteriotherapy candidates. Figure 12A shows the reduced relative C. difficile growth in Cell Free Supernatant (CFS) of bacteriotherapy candidate cultures at the 18.17h time-point, while Figure 12B shows reduced relative E. coli growth in CFS from the candidate bacteriotherapy isolates. The relative growth of either pathogen in the control YCFA medium was high (C. difficile = 8.96±0.39 rel. growth units; E. coli 11.61±2.55 rel. growth units, at the 18.17h time-point). When the mean and two standard deviations of relative growth of either pathogen in CFS derived from a bacteriotherapy candidate culture was more than two standard deviations below its mean growth in YCFA at the 18.17 h time-point, growth of the pathogen was considered to be inhibited. Where only one relative growth value was available for a particular CFS (vs C. difficile, Figure 12A: HMI 15, HMI 26, HMI 27, HMI 28), the bacteriotherapy candidate was considered to be inhibitory if the relative growth of C. difficile was two standard deviations below the mean growth of C. difficile in YCFA broth. Only the results from inhibitory CFS are shown.
    • Figure 13 shows a summary of the results obtained in the growth overlay and growth inhibition assays. Bacterial isolates shown to have inhibitory activity in the E. coli (AIEC) overlay assay, C. difficile overlay assay and C. difficile and E. coli growth assays are shown. Bacterial isolates showing inhibitory activity in two or more assays are shown in the overlapping regions. Bacterial isolates are referred to by their isolate number. See Table 1 for details of the bacterial isolates listed.
    • Figure 14 : Dendrogram and bar plots showing the relative abundance of each genus indicated in Figure 14 at 3 months post-FMT in both donors and recipients. The dendrogram clusters samples based on the phylogenetic relationship of the microbial community present within the samples. The composition of donor and recipient profiles were similar when assessed at the genus level post-FMT.
    Detailed Description
  • The bacteria disclosed herein have been obtained from human stool samples, and thus are naturally present in the gastrointestinal tract of at least some healthy human individuals. However, these bacteria have been cultured in vitro for the first time by the present inventors, thereby isolating them from their environment in pure form, and making it possible to include them as defined active ingredients in therapeutic compositions. The bacterium present in the therapeutic composition of the present invention is thus isolated. In other words, the bacterium present in the therapeutic composition is provided in isolated and/or purified form, e.g. isolated and/or purified from the environment in which it is normally present, such as the gastrointestinal tract and/or stool samples. The isolated bacterium present in the therapeutic composition may be in substantially pure, or in homogeneous form. For example, the bacterium may be free, or substantially free, of material with which it is found in the environment in which it is normally present (e.g. the gastrointestinal tract and/or stool samples).
  • The bacterium present in the therapeutic composition of the present disclosure is preferably a human intestinal bacterium, i.e. a bacterium found in the human intestine. The bacteria whose 16S rRNA gene sequences are set out in SEQ ID NOs 1 to 51 are all intestinal bacteria.
  • The bacterium is preferably a non-pathogenic bacterium. In other words, the bacterium preferably does not cause disease in a healthy human individual when administered to said individual, in particular the gastrointestinal tract of said individual. The therapeutic composition can be administered to an individual in a variety of ways as described in more detailed elsewhere herein, including in the form of a tablet or enema.
  • The bacterium present in the therapeutic composition of the present disclosure is preferably susceptible to treatment with one or more antibiotics. In other words, the bacterium is preferably not resistant to treatment with at least one antibiotic. This allows antibiotic treatment of an individual in the event that one or more of the bacteria included in a therapeutic composition administered to the individual causes disease in the individual, contrary to expectations. All of the 51 bacteria disclosed herein where found to carry no known genes conferring resistance to the following antibiotics: beta-lactams, fusidic acid, elfamycin, aminoglycoside, fosfomycin, and tunicamycin. Thus, in a preferred embodiment, the bacterium is susceptible to treatment with one or more antibiotics selected from the group consisting of: a beta-lactam, fusidic acid, elfamycin, aminoglycoside, fosfomycin, and tunicamycin. In vitro and in silico methods for screening bacteria for antibiotic resistance are known in the art. Exemplary in silico methods are also described in Example 1.
  • The bacterium included in the therapeutic composition of the present disclosure preferably does not comprise one or more genes encoding one or more virulence factors and/or preferably does not produce one or more virulence factors. Virulence factors in this context are properties which enhance the potential of a bacterium to cause disease in an individual. Virulence factors include the production of bacterial toxins, such as endotoxins and exotoxins by a bacterium, as well as the production of hydrolytic enzymes that may contribute to the pathogenicity of the bacterium. Methods for screening bacteria for genes encoding virulence factors are known in the art and include the in silico methods described in Example 1. The 51 bacteria disclosed herein were found not to carry any known virulence factors using in silico analysis. Methods for screening bacteria for the production of virulence factors are similarly known in the art.
  • Bacteria can be taxonomically classified based on the sequence of the gene encoding the 16S ribosomal RNA (rRNA) in the bacterium. This gene sequence is also referred to as the ribosomal DNA sequence (rDNA). A bacterium comprising a gene which encodes a 16S rRNA which has 90% or more sequence identity with the 16S rRNA encoded by a second bacterium belongs to the same family as said second bacterium. A bacterium comprising a gene which encodes a 16S rRNA which has 95% or more sequence identity with the 16S rRNA encoded by a second bacterium belongs to the same genus as said second bacterium. A bacterium comprising a gene which encodes a 16S rRNA which has 97% or more, or 98.7% or more sequence identity with the 16S rRNA encoded by a second bacterium belongs to the same species as said second bacterium. A bacterium included in the therapeutic composition of the present disclosure may be a bacterium which belongs to the same family, genus, and/or species as a bacterium disclosed herein.
  • A bacterium which belongs to the same family, genus, and/or species as a bacterium disclosed herein is expected to retain one or more properties of the disclosed bacterium. Thus, in a preferred embodiment of the disclosure, a bacterium present in the therapeutic composition of the present disclosure belongs to the same family, genus, and/or species as a bacterium disclosed herein and retains at least one property of the bacterium disclosed herein. Various properties of the bacteria disclosed herein are described and include, for example, a lack of production of one or more virulence factors, susceptibility to treatment with one or more antibiotics, and a lack of pathogenicity.
  • The therapeutic composition of the present disclosure may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 1 to 51.
  • For example, the therapeutic composition of the present disclosure may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 1 to 51. In a preferred embodiment of the disclosure, the therapeutic composition comprises an isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, and wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in SEQ ID NO: 1. In addition, or alternatively, the therapeutic composition may comprise an isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, and wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in SEQ ID NO: 21.
  • In addition, or alternatively, the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 1 to 51. In a preferred embodiment of the disclosure, the therapeutic composition comprises at least one isolated bacterium, wherein said bacterium comprises a gene encoding a 16S rRNA, and wherein said gene comprises a sequence with at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 2 to 20, or 22 to 51, more preferably any one of SEQ ID NOs 5, 6, 11, 13, 14, 15, 17, 18, 19, 20, 22, 23, 24, 26, 29, 33, 35, 41, 43, 45, 46, 47, 49, or 50, yet more preferably any one of SEQ ID NOs 5, 6, 11, 13, 15, 19, 22, 23, 29, 33, 35, 41, 43, 45, 46, or 50.
  • In addition, or alternatively, the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 97%, or at least 98.7%, sequence identity with the sequence set forth in any one of SEQ ID NOs 1 to 51. In a preferred embodiment of the disclosure, the therapeutic composition comprises at least one isolated bacterium, wherein said bacterium comprises a gene encoding a 16S rRNA, and wherein said gene comprises a sequence with at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 2 to 20, or 22 to 51, more preferably any one of SEQ ID NOs 2 to 3, 5 to 8, 10 to 20, 22 to 26, 29 to 37, or 39 to 50, yet more preferably any one of SEQ ID NOs 3, 5 to 8, 10 to 13, 15, 16, 19, 22, 23, 29, 32 to 37, 39 to 46, or 48 to 50. In an alternative preferred embodiment of the disclosure, the therapeutic composition may comprise at least one isolated bacterium, wherein said bacterium comprises a gene encoding a 16S rRNA, and wherein said gene comprises a sequence with at least 98.7% sequence identity with the sequence set forth in any one of SEQ ID NOs 2 to 20, or 22 to 51, more preferably any one of SEQ ID NOs 2 to 4, 5 to 20, 22 to 26, 29 to 37 to 51, yet more preferably any one of SEQ ID NOs 2 to 8, 10 to 13, 15, 16, 17, 19, 20, 22, 23, 29, 31, 32 to 37 to 46, or 48 to 51.
  • As mentioned above, in a preferred embodiment of the disclosure, the therapeutic composition of the present disclosure may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 21. In addition, or alternatively, the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 91% sequence identity with the sequence set forth in SEQ ID NO: 29. In addition, or alternatively, the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 92% sequence identity with the sequence set forth in any one of SEQ ID NOs 6, 11, 19 or 24. In addition, or alternatively, the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 93% sequence identity with the sequence set forth in any one of SEQ ID NOs 13, 22, 26 or 35. In addition, or alternatively, the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 5, 14, 15, 17, 18, 23, or 50. In addition, or alternatively, the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 20, 33, 41, 43, 45, 46, 47, or 49. In addition, or alternatively, the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 7, 8, 10, 12, 30, 32, 39, 42, 44, or 48. In addition, or alternatively, the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 3, 16, 25, 31, 34, 36, 37, or 40. In addition, or alternatively, the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 98% sequence identity with the sequence set forth in any one of SEQ ID NOs 4 or 9. In addition, or alternatively, the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 99% sequence identity with the sequence set forth in any one of SEQ ID NOs 27, 28, 38, or 51.
  • More preferably, the therapeutic composition of the present disclosure may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 21. In addition, or alternatively, the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 92% sequence identity with the sequence set forth in any one of SEQ ID NOs 6, or 11. In addition, or alternatively, the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 93% sequence identity with the sequence set forth in SEQ ID NO: 35. In addition, or alternatively, the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 5, 19, 22, 23, or 50. In addition, or alternatively, the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 13, 15, 29, 33, 41, 43, 45, or 46. In addition, or alternatively, the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 7, 12, 32, 39, 42, or 44, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 3, 8, 10, 16, 34, 36, 37, 40, 48, or 49. In addition, or alternatively, the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 98% sequence identity with the sequence set forth in any one of SEQ ID NOs 4, 9, 17 or 31. In addition, or alternatively, the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 99% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 20, 38, or 51. In addition, or alternatively, the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 14, 18, 24, 25, 26, 27, 28, 30, or 47.
  • Sequence identity is commonly defined with reference to the algorithm GAP (Wisconsin GCG package, Accelerys Inc, San Diego USA). GAP uses the Needleman and Wunsch algorithm to align two complete sequences that maximizes the number of matches and minimizes the number of gaps. Generally, default parameters are used, with a gap creation penalty = 12 and gap extension penalty = 4. Other algorithms suitable for the alignment of nucleotide sequences may be used instead of GAP, e.g. BLAST (Basic Local Alignment Search Tool) (which uses the method of Altschul et al. (1990) J. Mol. Biol. 215: 405-410), FASTA (which uses the method of Pearson and Lipman (1988) PNAS USA 85: 2444-2448), the Smith-Waterman algorithm (Smith and Waterman (1981) J. Mol Biol. 147: 195-197), the TBLASTN program, of Altschul et al. (1990) supra, or the psi-Blast algorithm (Nucl. Acids Res. (1997) 25 3389-3402), generally employing default parameters. In particular, BLAST may be used, preferably employing default parameters.
  • Sequence alignment algorithms, such as BLAST, calculate the similarity score between a query sequence and a subject sequence. The sequence identity of the query sequence to the subject sequence may be dependent on the percentage of the query sequence that is required to overlap with the subject sequence. This is also referred to as query coverage. In a preferred embodiment of the disclosure, the isolated bacterium present in the therapeutic composition of the present disclosure comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence, which (in addition to the specified sequence identity) has a query coverage of at least 98%, at least 99%, or 100%, preferably at least 98%. The query coverage refers to the percentage of said sequence which overlaps with the sequence with which it has the specified sequence identity, e.g. SEQ ID NO: 1. For example, the bacterium present in the therapeutic composition may comprise a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 1 to 51 and at least 98% query coverage.
  • Yet more preferably, the therapeutic composition of the present disclosure may comprise at least one isolated bacterium, wherein the bacterium is a bacterium as deposited under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedures at the Leibniz-Institut DSMZ - Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ), Inhoffenstr. 7B, 38124 Braunschweig by Genome Research Limited under an accession number as listed in Table 1 below. Specifically, the therapeutic composition of the present disclosure may comprise at least one isolated bacterium, wherein the bacterium is a bacterium as deposited under the Budapest Treaty at DSMZ under one of the following accession numbers (the date of deposit with DSMZ for each bacterium deposited is indicated in brackets after the accession number): DSM32191 (27 October 2015), DSM32147 (23 September 2015), DSM32149 (23 September 2015), DSM32175 (6 October 2015), DSM32153 (27 October 2015), DSM32152 (23 September 2015), DSM32158 (23 September 2015), DSM32192 (27 October 2015), DSM32148 (23 September 2015), DSM32166 (6 October 2015), DSM32151 (23 September 2015), DSM32150 (23 September 2015), DSM32193 (27 October 2015), DSM32162 (6 October 2015), DSM32194 (27 October 2015), DSM32163 (6 October 2015), DSM32205 (1 March 2016), DSM32195 (27 October 2015), DSM32164 (6 October 2015), DSM32177 (13 October 2015), DSM32167 (6 October 2015), DSM32165 (6 October 2015), DSM32169 (6 October 2015), DSM32168 (6 October 2015), DSM32178 (13 October 2015), DSM32182 (13 October 2015), DSM32179 (13 October 2015), DSM32180 (13 October 2015), DSM32184 (13 October 2015), DSM32181 (13 October 2015), DSM32183 (13 October 2015), DSM 32262 (2 February 2016), DSM32211 (2 December 2015), DSM 32219 (8 December 2015), DSM 32222 (8 December 2015), DSM 32261 (2 February 2016), DSM32212 (2 December 2015), DSM32220 (8 December 2015), DSM32213 (2 December 2015), DSM 32226 (8 December 2015), DSM32215 (2 December 2015), DSM32216 (2 December 2015), DSM 32217 (2 February 2016), DSM32221 (8 December 2015), DSM32218 (2 December 2015), DSM 32224 (8 December 2015), DSM 32214 (2 December 2015), DSM 32263 (2 February 2016), DSM 32223 (8 December 2015), DSM 32225 (8 December 2015), and DSM 32265 (10 February 2016). The putative genus and species names of the deposited bacteria, as well as their known characteristics, are listed in Table 1 below.
  • Yet more preferably, the therapeutic composition of the present disclosure comprises at least one isolated bacterium, wherein the bacterium is a bacterium as deposited under the Budapest Treaty at DSMZ under one of the following accession numbers: DSM32191 and DSM32177. In addition, or alternatively, the therapeutic composition may comprise at least one isolated bacterium, wherein the bacterium is a bacterium as deposited under the Budapest Treaty at DSMZ under one of the following accession numbers: DSM32153, DSM32152, DSM32151, DSM32193, DSM32162, DSM32194, DSM32205, DSM32195, DSM32164, DSM32177, DSM32165, DSM32169, DSM32168, DSM32182, DSM32184, DSM32211, DSM32222, DSM32215, DSM32217, DSM32218, DSM32224, DSM32214, DSM32223, and DSM32225; more preferably a bacterium as deposited under one of the following accession numbers: DSM32153, DSM32152, DSM32151, DSM32193, DSM32194, DSM32164, DSM32165, DSM32169, DSM32184, DSM32211, DSM32222, DSM32215, DSM32217, DSM32218, DSM32224, and DSM32225.
  • Alternatively, the therapeutic composition of the present disclosure may comprise at least one isolated bacterium, said bacterium comprising a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence of the gene encoding the 16S rRNA in a deposited bacterium as described above.
  • The therapeutic composition of the disclosure may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least nineteen, at least twenty, at least twenty-one, at least twenty-two, at least twenty-three, at least twenty-four, at least twenty-five, at least twenty-six, at least twenty-seven, at least twenty-eight, at least twenty-nine, at least thirty, at least thirty-one, at least thirty-two, at least thirty-three, at least thirty-four, at least thirty-five, at least thirty-six, at least thirty-seven, at least thirty-eight, at least thirty-nine, at least forty, at least forty-one, at least forty-two, at least forty-three, at least forty-four, at least forty-five, at least forty-six, at least forty-seven, at least forty-eight, at least forty-nine, at least fifty, or at least fifty-one bacteria as disclosed herein.
  • The therapeutic composition of the disclosure may comprise one, up to two, up to three, up to four, up to five, up to six, up to seven, up to eight, up to nine, up to ten, up to eleven, up to twelve, up to thirteen, up to fourteen, up to fifteen, up to sixteen, up to seventeen, up to eighteen, up to nineteen, up to nineteen, up to twenty, up to twenty-one, up to twenty-two, up to twenty-three, up to twenty-four, up to twenty-five, up to twenty-six, up to twenty-seven, up to twenty-eight, up to twenty-nine, up to thirty, up to thirty-one, up to thirty-two, up to thirty-three, up to thirty-four, up to thirty-five, up to thirty-six, up to thirty-seven, up to thirty-eight, up to thirty-nine, up to forty, up to forty-one, up to forty-two, up to forty-three, up to forty-four, up to forty-five, up to forty-six, up to forty-seven, up to forty-eight, up to forty-nine, up to fifty, or up to fifty-one bacteria as disclosed herein. Preferably, the therapeutic composition of the disclosure comprise up to twenty, preferably up to ten, bacteria as disclosed herein.
  • Where a therapeutic composition comprises more than one isolated bacterium, the isolated bacteria are preferably distinct. "Distinct" may refer to the isolated bacteria encoding distinct 16S rRNA sequences.
  • The therapeutic composition of the disclosure may comprise at least one isolated bacterium which forms spores. Such a bacterium is also referred to as a spore-forming bacterium. Spores are metabolically dormant structures that are resilient to environmental insults and are used by certain bacteria as a survival strategy upon encountering adverse conditions. Bacteriotherapy candidates HMI_1, HMI_2, HMI_4, HMI_6, HMI_10, HMI_15, HMI_17, HMI_21, HMI_22, HMI_33, HMI_36, HMI_37, HMI_38, HMI_44, HMI_47, HMI_48, HMI_50, HMI_51, and HMI_52 were isolated from ethanol-treated samples and are thus expected to be capable of forming spores. In addition, HMI_3, HMI_7, HMI_8, HMI_16, HMI_18, HMI_19, HMI_24, HMI_25, HMI_26, HMI_27, HMI_28, HMI_29, HMI_30, HMI_34, HMI_41, and HMI_46 are expected to be spore formers based on phylogenetic analysis.
  • Thus, the therapeutic composition of the present disclosure may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least twenty, at least twenty-one, at least twenty-two, at least twenty-three, at least twenty-four, at least twenty-five, at least twenty-six, at least twenty-seven, at least twenty-eight, at least twenty-nine, at least thirty, at least thirty-one, at least thirty-two, at least thirty-three, at least thirty-four, or at least thirty-five isolated spore-forming bacteria. In one aspect, the bacteria in the therapeutic composition may consist of spore forming bacteria.
  • The spore-forming bacterium may thus be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA) , wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 1, 2, 3, 4, 6, 7, 8, 10, 14, 15, 16, 17, 18, 20, 21, 23, 24, 25, 26, 27, 28, 29, 32, 33, 35, 36, 37, 40, 43, 45, 46, 47, 49, 50, or 51. Alternatively, the spore forming bacterium may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 1, 2, 4, 6, 10, 14, 16, 20, 21, 32, 35, 36, 37, 43, 46, 47, 49, 50, or 51.
  • The spore-forming bacterium may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 1, 2, 3, 4, 6, 7, 8, 10, 14, 15, 16, 17, 18, 20, 21, 23, 24, 25, 26, 27, 28, 29, 32, 33, 35, 36, 37, 40, 43, 45, 46, 47, 49, 50, or 51. Alternatively, the spore forming bacterium may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 1, 2, 4, 6, 10, 14, 16, 20, 21, 32, 35, 36, 37, 43, 46, 47, 49, 50, or 51.
  • Preferably, the spore forming bacterium is a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in SEQ ID NOs 1 or SEQ ID NO: 21, and/or at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 3, 4, 6, 7, 8, 10, 14, 15, 16, 17, 18, 20, 23, 24, 25, 26, 27, 28, 29, 32, 33, 35, 36, 37, 40, 43, 45, 46, 47, 49, 50, or 51. More preferably, the spore forming bacterium may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in SEQ ID NOs 1 or SEQ ID NO: 21, and/or at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID Nos 2, 4, 6, 10, 14, 16, 20, 32, 35, 36, 37, 43, 46, 47, 49, 50, or 51.
  • More preferably, the spore forming bacterium may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth SEQ ID NO: 1 or SEQ ID NO: 21, at least 92% sequence identity with the sequence set forth in SEQ ID NO: 29, at least 92% sequence identity with the sequence set forth in SEQ ID NOs 6, or 24 at least 93% sequence identity with the sequence set forth in SEQ ID NOs 35 or 26, at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 14, 15, 17, 18, 23, or 50, at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 20, 33, 43, 45, 46, 47, or 49, at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 7, 8, 10, or 32, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 3,16, 25, 36, 37 or 40, at least 98% sequence identity with the sequence set forth in SEQ ID NO: 4, or at least 99% sequence identity with the sequence set forth in SEQ ID NOs 27, 28, or 51. Yet more preferably, the spore forming bacterium may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth SEQ ID NO: 1 or SEQ ID NO: 21, at least 92% sequence identity with the sequence set forth in SEQ ID NO: 6, at least 93% sequence identity with the sequence set forth in SEQ ID NO: 35, at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 14, or 50, at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 20, 43, 46, 47, or 49, at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 10, or 32, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 16, 36, or 37, at least 98% sequence identity with the sequence set forth in SEQ ID NO: 4, or at least 99% sequence identity with the sequence set forth in SEQ ID NO: 51.
  • More preferably, the spore forming bacterium may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 21, at least 92% sequence identity with the sequence set forth SEQ ID NO: 6, at least 93% sequence identity with the sequence set forth in SEQ ID NO: 35, at least 94% sequence identity with the sequence set forth in SEQ ID NOs 23 or 50, at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 15, 29, 33, 43, 45 or 46, at least 96% sequence identity with the sequence set forth in SEQ ID NOs 7 or 32, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 3, 10, 16, 36, 37, 40 or 49, at least 98% sequence identity with the sequence set forth in SEQ ID NOs 4, 8 or 17, at least 99% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 20, or 51, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 14, 18, 25, 26, 27, 28, or 47. Even more preferably, the spore forming bacterium may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 21, at least 92% sequence identity with the sequence set forth SEQ ID NO: 6, at least 93% sequence identity with the sequence set forth in SEQ ID NO: 35, at least 94% sequence identity with the sequence set forth in SEQ ID NO: 50, at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 43, or 46, at least 96% sequence identity with the sequence set forth in SEQ ID NO: 32, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 10, 16, 36, 37, or 49, at least 98% sequence identity with the sequence set forth in SEQ ID NO: 4, at least 99% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 20, or 51, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 14, or 47.
  • Yet more preferably, the spore forming bacterium may be a bacterium as deposited at DSMZ under accession number DSM32191, DSM32147, DSM32175, DSM32152, DSM32166, DSM32162, DSM32163, DSM32177, DSM32167, DSM 32262, DSM 32222, DSM 32261, DSM32212, DSM32217, DSM32224, DSM32214, DSM32223, DSM32225, DSM32265, DSM32149, DSM32158, DSM32192, DSM32194, DSM32205, DSM32195, DSM32169, DSM32168, DSM32178, DSM32182, DSM32179, DSM32180, DSM32211, DSM32226, or DSM32218. Most preferably, the spore forming bacterium is a bacterium as deposited at DSMZ under accession number DSM32191, DSM32147, DSM32175, DSM32152, DSM32166, DSM32162, DSM32163, DSM32177, DSM32167, DSM 32262, DSM 32222, DSM 32261, DSM32212, DSM32217, DSM32224, DSM32214, DSM32223, DSM32225, or DSM32265. Alternatively, the therapeutic composition of the present disclosure may comprise at least one isolated spore-forming bacterium, said bacterium comprising a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence of the gene encoding the 16S rRNA in a deposited bacterium as described above.
  • The isolated bacterium present in the therapeutic composition may be antagonistic towards an intestinal bacterium, inhibit or prevent the growth or sporulation of an intestinal bacterium, and/or neutralize or protect against a toxin produced by an intestinal bacterium. Preferably the bacterium inhibits or prevents the growth of an intestinal bacterium. The intestinal bacterium may be a pathogenic or non-pathogenic intestinal bacterium. Preferably, the intestinal bacterium is a pathogenic bacterium. This is particularly preferred in the context of a therapeutic composition for use in the treatment of a dysbiosis associated with an enteric bacterial infection. However, other diseases are also known to be characterised by an increase in certain types of bacteria in the gastrointestinal tract. For example, inflammatory bowel disease is known to be characterised by an increase in bacteria from the Proteobacteria phylum, such as Escherichia coli, in the intestinal microbiota. Similarly, irritable bowel syndrome, obesity and malnutrition are known to be characterised by an increase in certain types of bacteria in the gastrointestinal tract. A bacterial composition comprising at least one bacterium which is antagonistic towards an intestinal bacterium, inhibits or prevents the growth or sporulation of an intestinal bacterium, and/or neutralizes or protects against a toxin produced by an intestinal bacterium thus also finds application in the treatment of dysbiosis associated with inflammatory bowel disease, irritable bowel syndrome, obesity, or malnutrition.
  • The pathogenic bacterium may be a Gram positive bacterium, or a Gram negative bacterium. Exemplary pathogenic bacteria include pathogenic bacteria of the genera Clostridium, Escherichia, Enterococcus, Klebsiella, Enterobacter, Proteus, Salmonella, Shigella, Staphylococcus, Vibrio, Aeromonas, Campylobacter, Bacillus, Helicobacter, Listeria, Plesiomonas, or Yersinia. In a preferred embodiment of the disclosure, the pathogenic bacterium is a pathogenic bacterium of the genera Clostridium or Escherichia, such as Clostridium difficile or Escherichia coli.
  • Examples of pathogenic Escherichia coli include adherent-invasive Escherichia coli (AlEC), enteroaggregative Escherichia coli, enterohemorrhagic Escherichia coli, enteroinvasive Escherichia coli, enterotoxigenic Escherichia coli, and Escherichia coli 0157:H7. An enterotoxigenic Escherichia coli may produce a heat-labile enterotoxin, or heat-stable enterotoxin.
  • For example, the pathogenic bacterium may be Clostridium difficile or adherent-invasive E. coli (AIEC).
  • Bacteriotherapy candidates HMI_14, HMI_25, HMI_42, HMI_26, HMI_28, HMI_35 and HMI_46 have been shown to inhibit growth of Clostridium difficile in an overlay assay. In addition, HMI_2, HMI_4, HMI_5, HMI_6, HMI_15, HMI_26, HMI_27, HMI_28, HMI_34, HMI_35, HMI_39, HMI_40, HMI_43, HMI_44, HMI_46 and HMI_47 have been shown to inhibit growth of Clostridium difficile in a CFS-relative growth inhibition assay (see Example 2, Figure 13, and Table 1).
  • Bacteriotherapy candidates HMI_4, HMI_10, HMI_11, HMI_14, HMI_26, HMI_28, HMI_33, HMI_35, HMI_42 and HMI_46 have been shown to inhibit growth of Escherichia coli in an overlay assay. In addition, HMI_46 and HMI_28, have been shown to inhibit growth of Escherichia coli in a CFS-relative growth inhibition assay (see Example 2, Figure 13, and Table 1).
  • It is expected that a bacterium which inhibits the growth of Escherichia coli also inhibits the growth of other Proteobacteria. Thus, the pathogenic bacterium may be a proteobacterium. Proteobacteria include (apart from Escherichia species), Salmonella species, Campylobacter species, Vibrio species, Helicobacter species, and Yersinia species.
  • It is expected that a bacterium which inhibits the growth of Clostridium difficile also inhibits the growth of other bacteria of the genus Clostridium. Thus, the pathogenic bacterium may be a bacterium of the genus Clostridium. Pathogenic bacteria of the genus Clostridium (apart from Clostridium difficile), include Clostridium perfringens, Clostridium botulinum, and Clostridium tetani.
  • The therapeutic composition may thus comprise at least one isolated bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli. For example, the therapeutic composition may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least twenty, at least twenty-one, or at least twenty-two isolated bacteria which inhibit the growth of Clostridium difficile and/or Escherichia coli. In one embodiment of the disclosure, the bacteria in the therapeutic composition may consist of one or more isolated bacteria which have been shown to inhibit the growth of Clostridium difficile and/or Escherichia coli.
  • In a preferred embodiment of the disclosure, the therapeutic composition may comprise at least one isolated bacterium which has been shown to inhibit the growth of Clostridium difficile. This is preferred in the context of a therapeutic composition for use in the treatment of a dysbiosis associated with an enteric infection, in particular a dysbiosis associated with an infection with a pathogenic Clostridium-related species, such as Clostridium difficile, Clostridium perfringens, Clostridium botulinum, or Clostridium tetani, most preferably Clostridium difficile.
  • For example, the therapeutic composition may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, or at least nineteen isolated bacteria which inhibit the growth of Clostridium difficile. In one embodiment of the disclosure, the bacteria in the therapeutic composition may consist of bacteria which inhibit the growth of Clostridium difficile.
  • A bacterium inhibits the growth of Clostridium difficile may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 4, 5, 6, 13, 14, 24, 25, 26, 27, 33, 34, 38, 39, 41, 42, 43, 45 and 46.
  • Alternatively, a bacterium which inhibits the growth of Clostridium difficile may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 91%, at least 92%, at least 93%,at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 4, 5, 6, 13, 14, 24, 25, 26, 27, 33, 34, 38, 39, 41, 42, 43, 45 and 46.
  • More preferably, a bacterium which inhibits the growth of Clostridium difficile may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 92% sequence identity with the sequence set forth in any one of SEQ ID NOs 6, or 24, at least 93% sequence identity with the sequence set forth in any one of SEQ ID NOs 13, or 26, at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 5, or 14, at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 33, 41, 43, 45, or 46, at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 39, or 42, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 25, or 34, at least 98% sequence identity with the sequence set forth in SEQ ID NO: 4, or at least 99% sequence identity with the sequence set forth in any one of SEQ ID NOs 27, or 38.
  • Even more preferably, a bacterium which inhibits the growth of Clostridium difficile may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 92% sequence identity with the sequence set forth SEQ ID NO: 6, at least 94% sequence identity with the sequence set forth in SEQ ID NO: 5, at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 13, 33, 41, 43, 45, or 46, at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 39, or 42, at least 97% sequence identity with the sequence set forth in SEQ ID NO: 34, at least 98% sequence identity with the sequence set forth in SEQ ID NO: 4, at least 99% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, or 38, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 14, 24, 25, 26, or 27.
  • Most preferably, the bacterium which inhibits the growth of Clostridium difficile may be a bacterium as deposited at DSMZ under accession number DSM32147, DSM32175, DSM32153, DSM32152, DSM32193, DSM32162, DSM32168, DSM32178, DSM32182, DSM32179, DSM32211, DSM 32219, DSM32220, DSM32213, DSM32215, DSM32216, DSM 32217, DSM32218, DSM 32224. Alternatively, the therapeutic composition of the present disclosure may comprise at least one isolated bacterium which inhibits the growth of Clostridium difficile, wherein said bacterium comprising a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence of the gene encoding the 16S rRNA in a deposited bacterium as described above.
  • In an alternative preferred embodiment of the disclosure, the therapeutic composition may comprise at least one isolated bacterium which inhibits the growth of Escherichia coli. This is preferred in the context of a therapeutic composition for use in the treatment of a dysbiosis associated with an enteric infection, in particular a dysbiosis associated with an infection with a Proteobacterium, such as Escherichia species, Salmonella species, Campylobacter species, Vibrio species, Helicobacter species, and Yersinia species, most preferably a dysbiosis associated with an infection with Escherichia coli.
  • For example, the therapeutic composition may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten, isolated bacteria which inhibit the growth of Escherichia coli. In one embodiment of the disclosure, the bacteria in the therapeutic composition may consist of bacteria which inhibit the growth of Escherichia coli.
  • A bacterium which inhibits the growth of Escherichia coli may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 4, 10, 11, 13, 25, 27, 32, 34, 41, and 45.
  • Alternatively, a bacterium which inhibits the growth of Escherichia coli may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 91%, at least 92%, at least 93%,at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 4, 10, 11, 13, 25, 27, 32, 34, 41, and 45.
  • More preferably, a bacterium which inhibits the growth of Escherichia coli may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 92% sequence identity with the sequence set forth in SEQ ID NO: 11, at least 93% sequence identity with the sequence set forth in SEQ ID NO: 13, at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 41, or 45, at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 10, or 32, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 25, or 34, at least 98% sequence identity with the sequence set forth in SEQ ID NO: 4, or at least 99% sequence identity with the sequence set forth in SEQ ID NO: 27.
  • Even more preferably, a bacterium which inhibits the growth of Escherichia coli may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 92% sequence identity with the sequence set forth in SEQ ID NO: 11, at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 13, 41, or 45, at least 96% sequence identity with the sequence set forth in SEQ ID NO: 32, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 10, or 34, at least 98% sequence identity with the sequence set forth in SEQ ID NO: 4, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 25, or 27.
  • Most preferably, the bacterium which inhibits the growth of Escherichia coli may be a bacterium as deposited at DSMZ under accession number DSM32175, DSM32166, DSM32151, DSM32193, DSM32178, DSM32179, DSM 32262, DSM 32219, DSM32215, DSM32218. Alternatively, the therapeutic composition of the present disclosure may comprise at least one isolated bacterium which inhibits the growth of Escherichia coli, wherein said bacterium comprising a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence of the gene encoding the 16S rRNA in a deposited bacterium as described above.
  • In addition to an isolated bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli, the therapeutic composition may comprise at least one isolated bacterium which co-occurs with a bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli as disclosed herein. Bacteriotherapy candidates which have been shown to co-occur with a bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli as disclosed herein are HMI_2, HMI_5, HMI_6, HMI_7, HMI_8, HMI_9, HMI_10, HMI_11, HMI_12, HMI_14, HMI_15, HMI_16, HMI_17, HMI_18, HMI_19, HMI_20, HMI_26, HMI_27, HMI_31, HMI_33, HMI_34, HMI_35, HMI_37, HMI_38, HMI_39, HMI_41, HMI_42, HMI_43, HMI_44, HMI_46, HMI_47, HMI_48, HMI_50, HMI_51, and HMI_52 (see Table 1 for details).
  • Thus, the therapeutic composition may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least nineteen, at least twenty, at least twenty-one, at least twenty-two, at least twenty-three, at least twenty-four, at least twenty-five, at least twenty-six, at least twenty-seven, at least twenty-eight, at least twenty-nine, at least thirty, at least thirty-one, at least thirty-two, at least thirty-three, at least thirty-four, or thirty-five isolated bacteria which co-occur with a bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli as disclosed herein.
  • The bacterium which co-occurs with a bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli as disclosed herein, may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 25, 26, 30, 32, 33, 34, 36, 37, 38, 40, 41, 42, 43, 45, 46, 47, 49, 50, or 51.
  • Alternatively, the bacterium which co-occurs with a bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli as disclosed herein, may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 25, 26, 30, 32, 33, 34, 36, 37, 38, 40, 41, 42, 43, 45, 46, 47, 49, 50, or 51. Preferably, the bacterium which co-occurs with a bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli as disclosed herein, is a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 92% sequence identity with the sequence set forth in any one of SEQ ID NOs 6, 11, or 19, at least 93% sequence identity with the sequence set forth in any one of SEQ ID NOs 13 or 26, at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 5, 14, 15, 17, 18, or 50, at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 33, 41, 43, 45, 46, 47, or 49, at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 7, 8, 10, 12, 30, 32, or 42, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 16, 25, 34, 36, 37, or 40, at least 98% sequence identity with the sequence set forth in SEQ ID NO: 9, or at least 99% sequence identity with the sequence set forth in any one of SEQ ID NOs 38, or 51.
  • More preferably, the bacterium which co-occurs with a bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli as disclosed herein, is a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 92% sequence identity with the sequence set forth in any one of SEQ ID NOs 6, or 11, at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 5, 19, or 50, at least 95% sequence identity with the sequence set forth in any one of SEQ ID NOs 13, 15, 33, 41, 43, 45, or 46, at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 7, 12, 32, or 42, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 8, 10, 16, 34, 36, 37, 40, or 49, at least 98% sequence identity with the sequence set forth in any one of SEQ ID NOs 9 or 17, at least 99% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 38, 51, or at least 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 14, 18, 25, 26, 30, or 47.
  • Most preferably, the bacterium which co-occurs with a bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli as disclosed herein, is a bacterium as deposited at DSMZ under accession number DSM32147, DSM32153, DSM32152, DSM32158, DSM32192, DSM32148, DSM32166, DSM32151, DSM32150, DSM32193, DSM32162, DSM32194, DSM32163, DSM32205, DSM32195, DSM32164, DSM32178, DSM32182, DSM32181, DSM32262, DSM32211, DSM32219, DSM32261, DSM32212, DSM32220, DSM32226, DSM32215, DSM32216, DSM32217, DSM32218, DSM32224, DSM32214, DSM32223, DSM32225, or DSM32265. Alternatively, the therapeutic composition of the present disclosure may comprise at least one isolated bacterium which co-occurs with a bacterium which inhibits the growth of Clostridium difficile and/or Escherichia coli as disclosed herein, wherein said bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence of the gene encoding the 16S rRNA in a deposited bacterium as described above.
  • Bacteria related to the genus Clostridium have been shown to be beneficial in reducing inflammation through interactions with the host immune system (Atarashi, Tanoue et al. 2013). The isolated bacterium present in the therapeutic composition may thus be a bacterium which has immunomodulatory activity. For example, the bacterium may reduce inflammation in the individual, e.g. in the gastrointestinal tract of the individual. Bacteriotherapy candidates which are in the same genus as bacteria which have been shown to be beneficial in reducing inflammation through interactions with the host immune system are HMI_4, HMI_9, HMI_10, HMI_15, HMI_27, HMI_28 and HMI_38. The bacteria ar therefore expected to have immunomodulatory activity, such as reducing inflammation in the individual, e.g. in the gastrointestinal tract of the individual.
  • Thus, the therapeutic composition may comprise at least one, at least two, at least three, at least four, at least five, at least six, or at least seven isolated bacteria which have immunomodulatory activity. In one embodiment of the disclosure, the bacteria in the therapeutic composition may consist of bacteria which reduce inflammation in the individual.
  • The bacterium which has immunomodulatory activity may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 4, 9, 10, 14, 26, 27, or 37.
  • Alternatively, a bacterium which has immunomodulatory activity may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 91%, at least 92%, at least 93%,at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 4, 9, 10, 14, 26, 27, or 37.
  • Preferably, a bacterium which has immunomodulatory activity may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 93% sequence identity with the sequence set forth in SEQ ID NO: 26, at least 94% sequence identity with the sequence set forth in SEQ ID NO: 14, at least 96% sequence identity with the sequence set forth in SEQ ID NO:10, at least 97% sequence identity with the sequence set forth in SEQ ID NO: 37, at least 98% sequence identity with the sequence set forth in any one of SEQ ID NOs 4 or 9, or at least 99% sequence identity with the sequence set forth in SEQ ID NO: 27.More preferably, a bacterium which has immunomodulatory activity may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 97% sequence identity with the sequence set forth in in any of SEQ ID NOs 10 or 37, at least 98% sequence identity with the sequence set forth in any one of SEQ ID NOs 4 or 9, or at least 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 14, 26, or 27.
  • Most preferably, the bacterium which has immunomodulatory activity may be a bacterium as deposited at DSMZ under accession number DSM32175, DSM32148, DSM32166, DSM32162, DSM32182, DSM32179, or DSM32212. Alternatively, the therapeutic composition of the present disclosure may comprise at least one isolated bacterium which has immunomodulatory activity, wherein said bacterium comprising a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence of the gene encoding the 16S rRNA in a deposited bacterium as described above.
  • The therapeutic composition of the disclosure may comprise at least one isolated bacterium which is on the Human Microbiome Project's (HMP) "most wanted" list. Bacteriotherapy candidates HMI_1, HMI_2, HMI_4, HMI_5, HMI_7, HMI_11, HMI_12, HMI_15, HMI_16, HMI_17, HMI_18, HMI_19, HMI_35, HMI_37, HMI_38, HMI_39, HMI_45, HMI_50, and HMI_51 are on HMP's "most wanted" list.
  • Thus, the therapeutic composition of the present disclosure may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, or nineteen bacteria which are on HMP's "most wanted" list. In one embodiment of the disclosure, the bacteria in the therapeutic composition may consist of bacteria which are on HMP's "most wanted" list.
  • The bacterium which is on HMP's "most wanted" list may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 1, 2, 4, 5, 7, 11, 12, 14, 15, 16, 17, 18, 34, 36, 37, 38, 44, 49, or 50.
  • Alternatively, the bacterium which is on HMP's "most wanted" list may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 1, 2, 4, 5, 7, 11, 12, 14, 15, 16, 17, 18, 34, 36, 37, 38, 44, 49, or 50.
  • Preferably, the bacterium which is on HMP's "most wanted" list is a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth SEQ ID NO: 1, at least 92% sequence identity with the sequence set forth SEQ ID NO: 11, at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 5, 14, 15, 17, 18, or 50, at least 95% sequence identity with the sequence set forth SEQ ID NO: 49, at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, 7, 12, or 44, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 16, 34, 36, or 37, at least 98% sequence identity with the sequence set forth in SEQ ID NO: 4, or at least 99% sequence identity with the sequence set forth in SEQ ID NO: 38.
  • More preferably, the bacterium which is on HMP's "most wanted" list is a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth SEQ ID NO: 1, at least 92% sequence identity with the sequence set forth SEQ ID NO: 11, at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 5 or 50, at least 95% sequence identity with the sequence set forth SEQ ID NO: 15, at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 7, 12, or 44, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 16, 34, 36, 37, 49, at least 98% sequence identity with the sequence set forth in any one of SEQ ID NOs 4, or 17, at least 99% sequence identity with the sequence set forth in any one of SEQ ID NOs 2, or 38, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 14, or 18.
  • Most preferably, the bacterium which is on HMP's "most wanted" list is a bacterium as deposited at DSMZ under accession number DSM32191, DSM32147, DSM32175, DSM32153, DSM32158, DSM32151, DSM32150, DSM32162, DSM32194, DSM32163, DSM32205, DSM32195, DSM32219, DSM32261, DSM32212, DSM32220, DSM32221, DSM32223, or DSM32225. Alternatively, the therapeutic composition of the present disclosure may comprise at least one bacterium which is on HMP's "most wanted" list, wherein said bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence of the gene encoding the 16S rRNA in a deposited bacterium as described above.
  • The therapeutic composition of the disclosure may comprise at least one isolated bacterium which is a keystone species. Bacteriotherapy candidates HMI_17, HMI_23, HMI_24, HMI_25, HMI_26, HMI_27, HMI_28, HMI_29, HMI_30, HMI_31, HMI_32, HMI_45, HMI_49, HMI_51, and HMI_52 are expected to be keystone species.
  • Thus, the therapeutic composition of the present disclosure may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, or fifteen bacteria which are keystone species. In one embodiment of the disclosure, the bacteria in the therapeutic composition may consist of bacteria which are keystone species.
  • The bacterium which is a keystone species may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA) , wherein said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 16, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 44, 48, 50, or 51.
  • Alternatively, the bacterium which is a keystone species may be a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA) wherein said gene comprises a sequence with at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 16, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 44, 48, 50, or 51.
  • Preferably, the bacterium which is a keystone species is a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA) wherein said gene comprises a sequence with at least 91% sequence identity with the sequence set forth in SEQ ID NO: 29, at least 92% sequence identity with the sequence set forth in SEQ ID NO: 24, at least 93% sequence identity with the sequence set forth in any one of SEQ ID NOs 22, or 26, at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 23, or 50, at least 96% sequence identity with the sequence set forth in any one of SEQ ID NOs 30, 44, or 48, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 16, 25, or 31, or at least 99% sequence identity with the sequence set forth in any one of SEQ ID NOs 27, 28, or 51.
  • More preferably, the bacterium which is a keystone species is a bacterium comprising a gene encoding a 16S ribosomal RNA (rRNA) wherein said gene comprises a sequence with at least 94% sequence identity with the sequence set forth in any one of SEQ ID NOs 22, 23, or 50, at least 95% sequence identity with the sequence set forth in SEQ ID NO: 29, at least 96% sequence identity with the sequence set forth in SEQ ID NO: 44, at least 97% sequence identity with the sequence set forth in any one of SEQ ID NOs 16, or 48, at least 98% sequence identity with the sequence set forth in SEQ ID NO: 31, at least 99% sequence identity with the sequence set forth in SEQ ID NO: 51, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 24, 25, 26, 27, 28, or 30.
  • Most preferably, the bacterium which is a keystone species is a bacterium as deposited at DSMZ under accession number DSM32163, DSM32165, DSM32169, DSM32168, DSM32178, DSM32182, DSM32179, DSM32180, DSM32184, DSM32181, DSM32183, DSM32221, DSM32263, DSM32225, or DSM32265. Alternatively, the therapeutic composition of the present disclosure may comprise at least one bacterium which is a keystone species, wherein said bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence of the gene encoding the 16S rRNA in a deposited bacterium as described above.
  • In addition, or alternatively, the therapeutic composition of the disclosure may comprise at least one isolated bacterium which has been shown to be present post-FMT. The bacteriotherapy candidates to which this applies are set out in Table 1. For example, the therapeutic composition may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least twenty, at least twenty-one or twenty two bacteria which has been shown to be present post-FMT. For example the bacterium which has been shown to be present post-FMT may comprise a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 36, 38, 40, 43, 44, 45, 46, 48, or 51. Preferably, the bacterium which has been shown to be present post-FMT is a bacterium as deposited at DSMZ under accession number DSM32165, DSM32169, DSM32168, DSM32178, DSM32182, DSM32179, DSM32180, DSM32184, DSM32181, DSM32183, DSM32262, DSM32211, DSM32219, DSM32261, DSM32220, DSM32226, DSM32217, DSM32221, DSM32218, DSM32224, DSM32263, or DSM32265. Alternatively, the therapeutic composition of the present disclosure may comprise at least one bacterium which has been shown to be present post-FMT, wherein said bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence of the gene encoding the 16S rRNA in a deposited bacterium as described above.
  • In addition, or alternatively, the therapeutic composition of the disclosure may comprise at least one isolated bacterium which is expected to produce one or more beneficial metabolites, such as short chain fatty acids (SCFA). The bacteriotherapy candidates to which this applies are set out in Table 1. For example, the therapeutic composition may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, or fourteen bacteria which produce one or more beneficial metabolites. For example the bacterium which produces one or more beneficial metabolites may comprise a gene encoding a 16S ribosomal RNA (rRNA), wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence set forth in any one of SEQ ID NOs 9, 12, 19, 20, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31. Preferably, the bacterium which is expected to produce one or more beneficial metabolites is a bacterium as deposited at DSMZ under accession number DSM32148, DSM32150, DSM32164, DSM32177, DSM32165, DSM32169, DSM32168, DSM32178, DSM32182, DSM32179, DSM32180, DSM32184, DSM32181, or DSM32183. Alternatively, the therapeutic composition of the present disclosure may comprise at least one bacterium which produces one or more beneficial metabolites, wherein said bacterium comprises a gene encoding a 16S rRNA, wherein said gene comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.7%, at least 99%, or 100% sequence identity with the sequence of the gene encoding the 16S rRNA in a deposited bacterium as described above.
  • The isolated bacterium or isolated bacteria present in a therapeutic composition may make up at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 7%, 75%, 80%, 85%, or 90% of the therapeutic composition by volume or weight.
  • The therapeutic composition may comprise no other active ingredient other than the isolated bacterium or isolated bacteria in question, and optionally a prebiotic. Thus, the active ingredient of the therapeutic composition may consist of one or more isolated bacteria disclosed herein, and optionally a prebiotic. This may also be referred to as a defined active ingredient.
  • The therapeutic composition of the present invention is not a faecal microbiota transplant (FMT). FMTs usually consist of a stool sample from a healthy human donor which is administered directly to the recipient, e.g. in the form of an enema, without bacteria present in the stool sample being isolated prior to the administration of the FMT to the recipient. An advantage of the therapeutic composition of the invention is that it may comprise no undefined components, which are present in FMTs, thereby allowing the therapeutic composition to be standardised and increasing safety.
  • The therapeutic composition of the present disclosure may be prepared by a method comprising culturing the one or more isolated bacteria present in the therapeutic composition in a suitable medium or media. Media and conditions suitable for culturing the bacteria to be included in the therapeutic composition of the present disclosure are described in detail elsewhere herein. For example, a method of preparing a therapeutic composition according to the present disclosure may comprise the steps of:
    1. (i) culturing a first isolated bacterium;
    2. (ii) optionally culturing a second isolated bacterium; and
    3. (iii) mixing the bacteria obtained in (i) and optionally (ii) to prepare the therapeutic composition. The isolated bacteria to be included in the therapeutic composition are preferably cultured in separate steps. In other words, a separate culture of each bacterium to be included in the therapeutic composition is preferably prepared. This allows the growth of each bacterium to be evaluated and the amount of each bacterium to be included in the pharmaceutical composition to be controlled as desired. The bacteria cultured in steps (i) and (ii) preferably have distinct 16S rRNA sequences.
  • The above method may include steps of culturing each isolated bacterium which is to be included in the therapeutic composition. Thus, the method may e.g. further include steps of culturing a third, fourth, fifth, sixth, seventh, eighth, ninth, and/or tenth distinct isolated bacterium, as required. In this way, the method comprise steps of culturing up to 51 distinct isolated bacteria. The bacterium or bacteria cultured by said method may be any bacterium as disclosed herein.
  • The method may optionally comprise one or more further steps in which the bacteria are mixed with one or more additional ingredients, such as a pharmaceutically acceptable excipient, prebiotic, carrier, insoluble fibre, buffer, osmotic agent, antifoaming agent, and/or preservative. In addition, or alternatively, the method may comprise suspending the bacteria obtained in (i) and optionally (ii) in a chemostat medium, or saline, e.g. 0.9% saline. The bacteria obtained in (i) and optionally (ii) may be provided under a reduced atmosphere, such as N2, CO2, H2, or a mixture thereof, e.g. N2:CO2:H2. The gases may be present in appropriate ratios for the preservation of the bacteria present in the therapeutic composition. For Example, the reduced atmosphere may comprise 80% N2, 10% CO2 and 10% H2. In addition, or alternatively, the method may comprise a step of lyophilising the bacteria obtained in (i) and optionally (ii), optionally in the presence of a stabiliser and/or cryprotectant. The method may also comprise a step of preparing a capsule, tablet, or enema comprising the bacteria obtained in (i) and optionally (ii). The capsule or tablet may be enteric-coated, pH dependant, slow-release, and/or gastro-resistant.
  • The present disclosure also encompasses a therapeutic composition obtainable by, or obtained by, a method as disclosed herein. Such a therapeutic composition may further be used for a therapeutic purpose, in a therapeutic method, or for the manufacture of a medicament, as described herein, such as treatment of a dysbiosis, in particular a dysbiosis of the gastrointestinal tract.
  • It is expected that the bacteria disclosed herein will be suitable for the treatment of a dysbiosis, in particular a dysbiosis of the gastrointestinal tract. Without wishing to be limited by theory, it is expected that administration of one or more of the bacteria disclosed herein to an in individual will resolve a gastrointestinal dysbiosis, where present, and/or prevent the occurrence of gastrointestinal dysbiosis, in the individual. "Individual", as used herein, refers to a human individual or human patient.
  • Treatment of a dysbiosis may refer to the cure, prevention, or amelioration of a dysbiosis or the amelioration of at least one symptom associated with dysbiosis. Where the dysbiosis is associated with a disease, such as inflammatory bowel disease, treatment of the dysbiosis may refer to the cure, prevention, or amelioration of said disease, or the amelioration of at least one symptom associated with said disease.
  • The therapeutic compositions of the present invention thus find application in the treatment of dysbiosis of the gastrointestinal tract. Accordingly, the invention provides a therapeutic composition according to the invention for use in a method of treating a dysbiosis in an individual.
  • "Dysbiosis" in the context of the present invention refers to a state in which the normal diversity and/or function of the microbiota or microbiome, in particular the human gastrointestinal microbiota, is disrupted. Any disruption from the normal state of the microbiota in a healthy individual can be considered a dysbiosis, even if the dysbiosis does not result in a detectable decrease in health in the individual. In a preferred embodiment, the dysbiosis may be associated with one or more pathological symptoms. For example, "dysbiosis" may refer to a decrease in the microbial diversity of the microbiota. In addition, or alternatively, "dysbiosis" may refer to an increase in the abundance of one or more bacteria, e.g. one or more pathogenic bacteria, in the microbiota of an individual relative to the abundance of said bacterium or bacteria in the microbiota of a healthy individual, i.e. an individual without a dysbiosis. The pathogenic bacteria present during dysbiosis are often Proteobacteria and resistant to one or more antibiotics. Examples of Proteobacteria include Escherichia, Salmonella, Campylobacter, Vibrio, Helicobacter, and Yersinia species.
  • The dysbiosis may be a dysbiosis associated with an enteric bacterial infection, such as an infection of the gastrointestinal tract with a pathogenic bacterium. Many bacteria capable of causing infections of the gastrointestinal tract in humans are known and include: gram positive bacteria, and gram negative bacteria. The pathogenic bacterium is preferably a pathogenic species of the genus Clostridium, Escherichia, Enterococcus, Klebsiella, Enterobacter, Proteus, Salmonella, Shigella, Staphylococcus, Vibrio, Aeromonas, Campylobacter, Plesiomonas, Bacillus, Helicobacter, Listeria, or Yersinia. Preferred examples of such pathogenic bacteria include Clostridium difficile, Clostridium perfringens, Clostridium botulinum, Escherichia coli, Salmonella typhi, Staphylococcus aureus, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Campylobacter fetus, Campylobacter jejuni, Aeromonas hydrophila, Plesiomonas shigelloides, Bacillus cereus, Helicobacter pylori, Listeria monocytogenes, and Yersinia enterocolitica. More preferably, the pathogenic bacterium is a pathogenic species of the genus Clostridium or Escherichia. Most preferably, the pathogenic bacterium is Clostridium difficile or Escherichia coli.
  • The pathogenic bacterium may resistant to one or more antibiotics. For example, the pathogenic bacterium, e.g. Clostridium difficile, may be resistant to fluoroquinolones. In addition, or alternatively, the pathogenic bacterium may be resistant to one or more carbapenems. Carbapenems are antibiotics used for the treatment of infections by multidrug-resistant (MDR) bacteria, and examples include imipenem, meropenem, ertapenem, doripenem, panipenem, and biapenem.
  • Treatment of a dysbiosis associated with an infection with a pathogenic bacterium may comprise reducing the abundance of the pathogenic bacterium, e.g. in the gastrointestinal tract of the individual, relative to the abundance of the pathogenic bacterium prior to treatment.
  • The dysbiosis may be a recurrent or chronic dysbiosis. For example, Clostridium difficile is known to result in recurrent infections in some individuals, with the infection reoccurring once antibiotic treatment is stopped. This may be referred to as a recurrent or chronic dysbiosis.
  • Dysbiosis of the gastrointestinal tract is known to be associated with, and is thought to play a causal role in, a number of diverse diseases, including inflammatory bowel disease, irritable bowel syndrome, metabolic disease, a neuropsychiatric disorder, an autoimmune disease, an allergic disorder, or a cancer. Thus the dysbiosis may be a dysbiosis associated with inflammatory bowel disease, irritable bowel syndrome, a metabolic disease, a neuropsychiatric disorder, an autoimmune disease, an allergic disorder, a cancer, or hepatic encephalopathy. Examples of inflammatory bowel disease include ulcerative colitis and Crohn's disease.
  • Metabolic disease in which dysbiosis of the gastrointestinal tract has been shown to play a role include metabolic syndrome, obesity, type 2 diabetes mellitus, a cardiovascular disease, and non-alcoholic fatty liver.
  • Neuropsychiatric disorder in which dysbiosis of the gastrointestinal tract has been shown to play a role include Parkinson's disease, Alzheimer's disease, multiple sclerosis, myoclonus dystonia, autism and chronic fatigue syndrome.
  • Autoimmune diseases in which dysbiosis of the gastrointestinal tract has been shown to play a role include idiopathic thrombocytopenic purpura, arthritis, Sjögren's syndrome, systemic lupus erythematosus, and Hashimoto's thyroiditis.
  • Allergic disorder in which dysbiosis of the gastrointestinal tract has been shown to play a role include atopy, and asthma.
  • Cancers in which dysbiosis of the gastrointestinal tract has been shown to play a role include colorectal cancer, extra-intestinal tumours, mammary tumours, hepatocellular carcinoma, lymphoma, melanoma, and lung cancer.
  • The therapeutic composition of the disclosure may comprise a pharmaceutically acceptable excipient, carrier, buffer, stabilizer or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the isolated bacteria present in the therapeutic composition. The precise nature of the pharmaceutically acceptable excipient or other material will depend on the route of administration, which may be oral or rectal. Many methods for the preparation of therapeutic compositions are known to those skilled in the art. See e.g. Robinson ed., Sustained and Controlled Release Drug Delivery Systems, Marcel Dekker, Inc., New York, 1978.
  • The therapeutic composition of the disclosure may comprise a prebiotic, a carrier, insoluble fibre, a buffer, an osmotic agent, an anti-foaming agent and/or a preservative.
  • Prebiotics may provide nutrients for the isolated bacteria present in the therapeutic composition to assist their early growth and colonisation after administration to the individual. Any prebiotic known in the art may be used. Non-limiting examples of prebiotics include oligosaccharides, e.g., fructooligosaccharides such as oligofructose and inulin, mannan oligosaccharides and galactooligosaccharides, soluble, oligofructose-enriched inulin and soluble fiber. Insoluble fiber may be included in the therapeutic composition as a carrier, e.g., to provide protection during transit or storage. A buffer may be included in the therapeutic composition to promote the viability of the isolated bacteria present. An antifungal agent may included in the therapeutic composition as a preservative.
  • The therapeutic composition may be made or provided in chemostat medium. Alternatively, the therapeutic composition may be made or provided in saline, e.g., 0.9% saline. It will be understood that any carrier or solution which does not impair viability of the bacteria present in the therapeutic composition and is compatible with administration to an individual may be used.
  • The therapeutic composition may be made or provided under reduced atmosphere, i.e., in the absence of oxygen. The synthetic stool preparation may be made or provided under N2, CO2, H2, or a mixture thereof, optionally with controlled levels of partial pressure of N2:CO2:H2.
  • The therapeutic composition may be for oral or rectal administration to the individual. Where the therapeutic composition is for oral administration, the therapeutic composition may be in the form of a capsule, or a tablet. Where the therapeutic composition is for rectal administration, the therapeutic composition may be in the form of an enema. The preparation of suitable capsules, tablets and enema is well-known in the art. The capsule or tablet may comprise a coating to protect the capsule or tablet from stomach acid. For example, the capsule or tablet may be enteric-coated, pH dependant, slow-release, and/or gastro-resistant. Such capsules and tablets are used, for example, to minimize dissolution of the capsule or tablet in the stomach but allow dissolution in the small intestine.
  • The therapeutic composition may be lyophilized. The lyophilized therapeutic composition may comprise one or more stabilisers and/or cryoprotectants. The lyophilized therapeutic composition may be reconstituted using a suitable diluent prior to administration to the individual.
  • A therapeutic composition according to the present disclosure may be administered alone or in combination with other treatments, concurrently or sequentially or as a combined preparation with another therapeutic agent or agents, for the treatment of dysbiosis, or a disease associated with dysbiosis as described herein. For example, a conjugate of the disclosure may be used in combination with an existing therapeutic agent for inflammatory bowel disease, irritable bowel syndrome, a metabolic disease, a neuropsychiatric disorder, an autoimmune disease, an allergic disorder, a cancer, or hepatic encephalopathy.
  • For example, where the therapeutic composition is for the treatment of a dysbiosis associated with cancer, the therapeutic composition may optionally be administered in combination a cancer immunotherapy, such as an immune check-point inhibitor, to the individual. Examples of check-point inhibitors which may be employed in this context include Programmed cell death protein 1 (PD-1) inhibitors, Programmed death-ligand 1 (PD-L1) inhibitors, cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) inhibitors. Manipulation of the gut microbiota in combination with immune check-point inhibitor treatment has been shown to improve efficacy of immune check-point inhibitors in treating cancer (Snyder et al. 2015). In a preferred embodiment, the cancer in this context is lung cancer or melanoma. Immune check-point inhibitors have been approved for the treatment of these cancers and bacteriotherapy has been shown to improve efficacy of check-point inhibitors in the treatment of melanoma (Snyder et al. 2015).
  • The therapeutic compositions of the disclosure may be administered to an individual, preferably a human individual. Administration may be in a "therapeutically effective amount", this being sufficient to show benefit to the individual. Such benefit may be at least amelioration of at least one symptom. Thus "treatment" of a specified disease refers to amelioration of at least one symptom. The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of what is being treated, the particular patient being treated, the clinical condition of the individual patient, the cause of the dysbiosis, the site of delivery of the composition, the type of therapeutic composition, the method of administration, the scheduling of administration and other factors known to medical practitioners. Prescription of treatment, e.g. decisions on dosage etc., is within the responsibility of general practitioners and other medical doctors, and may depend on the severity of the symptoms and/or progression of a disease being treated. A therapeutically effective amount or suitable dose of a therapeutic composition of the disclosure can be determined by comparing its in vitro activity and in vivo activity in an animal model. Methods for extrapolation of effective dosages in mice and other test animals to humans are known. The precise dose will depend upon a number of factors, including whether the therapeutic composition is for prevention or for treatment.
  • Further aspects and embodiments of the disclosure will be apparent to those skilled in the art given the present disclosure including the following experimental exemplification.
  • Unless the context dictates otherwise, the singular includes the plural.
  • "and/or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. For example "A and/or B" is to be taken as specific disclosure of each of (i) A, (ii) B and (iii) A and B, just as if each is set out individually herein.
  • Examples Example 1 - Identification and isolation of bacteriotherapy candidates Materials and Methods
  • Two different approaches were used to isolate bacterial species for inclusion in a therapeutic composition for treating dysbiosis. The first relied on a broad culturing approach from healthy adult donors to establish a culture collection which is as representative as possible of the bacterial component of the intestinal microbiota of healthy individuals. This process also incorporated a targeted culturing approach to preferentially select bacteria displaying a particular phenotype or function e.g. spore formation. The second approach was more targeted in nature and aimed to isolate bacterial species specifically associated with resolving gastrointestinal dysbiosis by comparing the microbiota of individuals before and after Faecal Microbiota Transplantation (FMT) administered to resolve dysbiosis associated with C. difficile infection. These two approaches are respectively referred to as Candidate Isolation Process 1 (CIP1) and Candidate Isolation Process 2 (CIP2) below.
  • Sample collection and culturing
  • For CIP1, fresh faecal samples were obtained from six consenting healthy adult human donors (one faecal sample per donor - minimum 0.5g). The samples were placed in anaerobic conditions within one hour of passing to preserve the viability of anaerobic bacteria. All sample processing and culturing took place under anaerobic conditions in a Whitley DG250 workstation (Don Whitley, West Yorkshire, UK) at 37°C. Culture media, phosphate-buffered saline (PBS) and all other materials that were used for culturing were placed in the anaerobic cabinet 24 hours before use. The faecal samples were divided into two portions. One portion was homogenised in reduced PBS (0.1g stool/ml PBS) and was serially diluted and plated directly onto YCFA (Duncan, Hold et al. 2002) agar supplemented with 0.002g/ml each of glucose, maltose and cellobiose in large (13.5cm diameter) petri dishes. This sample was also subjected to metagenomic sequencing to profile the entire community. The other portion was treated with an equal volume of 70% (v/v) ethanol for 4 hours at room temperature under ambient aerobic conditions to kill vegetative cells. Then, the solid material was washed 3 times with PBS and it was eventually resuspended in PBS. Plating was performed in same manner as described for the non-ethanol treated samples above.
  • For the ethanol-treated samples of CIP1, the medium was supplemented with 0.1% sodium taurocholate to stimulate spore germination. Colonies were picked 72 hours after plating from petri dishes of both ethanol-treated and non-ethanol-treated conditions harbouring non-confluent growth, (i.e. plates on which the colonies were distinct and not touching). The colonies that were picked were re-streaked to confirm purity.
  • For CIP2, twelve individuals who had each experienced more than three recurrences of Clostridium difficile infection (CDI), having failed treatment with metronidazole and vancomycin were selected for Faecal Microbiota Transplantation (FMT). The donors were screened for pathogens and other viral infections as previously described (Landy, Al-Hassi et al. 2011). The patients discontinued oral vancomycin 1-2 days before FMT. FMT was administered to recipients by enema (n = 3), pills (n = 6), a combination of both (n = 2, R8 and R10), or by nasogastric infusion (n = 1, R7). Faecal samples were collected from the patients 1-2 days after stopping vancomycin treatment (pre-FMT) and at different times post-FMT. Stool samples used for FMT were also collected from the donors. Samples from healthy individuals and individuals infected with C. difficile treated with antibiotics were also included as controls. Faecal samples were collected in sterile containers and were frozen at -80°C. DNA was extracted from all samples for 454 sequencing and subsequent analysis as described below.
  • For the culturing of samples from the faecal microbiota transplant (FMT) recipients (CIP2), 50 mg of each faecal sample was mixed thoroughly in 0.5 ml sterile, reduced phosphate buffered saline (PBS). The homogenate was serially diluted to 10-6 and aliquots of this dilution were plated on a panel of media under anaerobic conditions. The following media were used: fastidious anaerobic agar (FAA, Lab M Ltd, Lancashire, UK) containing 2% defibrinated horse blood, Brain Heart Infusion (BHI, Oxoid UK), de Man Rogosa Sharpe and CCEY (Bioconnections, UK) agars with and without the addition of 10 µg/ml vancomycin (AppliChem, Germany). All plated media were incubated anaerobically at 37°C for 48-72 hours except for the BHI agar, which was incubated aerobically at 37°C for 24-48 hours.
  • Microbiota profiling and sequencing
  • Identification of each cultured isolate was performed by PCR amplification of the full length 16S rRNA gene (using 7F (5-AGAGTTTGATYMTGGCTCAG-3) forward primer and 1510R (5'-ACGGYTACCTTGTTACGACTT-3) reverse primer followed by capillary sequencing. For both CIP1 and CIP2, 16S rRNA gene sequence reads were aligned in the Ribosomal Database Project (RDP) and manually curated in ARB (Ludwig, Strunk et al. 2004). For CIP1, the R package seqinr version 3.1 was used to determine sequence similarity between 16S rRNA gene sequences and, as full-length 16S rRNA gene sequence reads were generated, 98.7% was used as the species-level cut-off to classify reads to Operational Taxonomic Units (OTUs) (Bosshard, Abels et al. 2003, Clarridge 2004). As only partial length 16S rRNA gene sequence reads were generated for candidate bacteria from CIP2, 97% was used as the species-level cut-off (Bosshard, Abels et al. 2003, Clarridge 2004) and the OTUs at this cut-off were determined using mothur (Schloss, Westcott et al. 2009). For both CIP1 and CIP2, the 16S rRNA gene sequence of each species-level OTU was then compared to the Ribosomal Database Project (RDP) reference database to assign taxonomic designations down to the genus level (Wang, Garrity et al. 2007). A BLASTn search was then performed with the 16S rRNA gene sequences to determine whether the OTU represented either a previously characterised or a novel species (Altschul, Gish et al.1990).
  • Comparisons of the OTUs with the Human Microbiome Project (HMP) "Most Wanted" list and reference genomes database were carried out using 97% sequence identity of the 16S rRNA gene sequences to define a bacterial species because only partial 16S rRNA gene sequences were available for the bacteria on the HMP "Most Wanted" list and reference genomes database. HMP data regarding the most wanted taxa and the completed sequencing projects were downloaded from the NIH Human Microbiome Project's "Most Wanted" Taxa from the Human Microbiome for Whole Genome Sequencing () and the NIH Human Microbiome Project's Reference Genomes Data (), respectively. Genomic DNA was extracted from at least one representative of each unique OTU using a phenol-chloroform based DNA isolation procedure. DNA was sequenced on the Illumina HiSeq platform generating read lengths of 100bp and these were assembled and annotated for further analysis.
  • DNA was also extracted directly from each faecal sample for whole community metagenomic and 16S rRNA gene amplicon sequencing using the MP Biomedical FastDNA SPIN Kit for soil. To enable comparisons with the complete community samples, non-confluent cultures were scraped from agar plates 72 hours after inoculation with the initial faecal sample and DNA was extracted from this community using the same DNA isolation process. 16S rRNA gene amplicon libraries were made by PCR amplification of variable regions 1 and 2 of the 16S rRNA gene using the Q5 High-Fidelity Polymerase Kit supplied by New England Biolabs. Primers 27F AATGATACGGCGACCACCGAGATCTACAC TATGGTAATT CC AGMGTTYGATYMTGGCTCAG (1st part = Illumina adapter, 2nd = forward primer pad, 3rd= Forward primer linker and 4th = Forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT ACGAGACTGATT AGTCAGTCAG AA GCTGCCTCCCGTAGGAGT (1st part= reverse complement of 3' Illumina adapter, 2nd = golay barcode, 3rd =reverse primer pad, 4th =reverse primer linker and 5th =reverse primer) were used. Four PCR amplification reactions per sample were carried out; products were pooled and combined in equimolar amounts for sequencing using the Illumina MiSeq platform, generating 150 bp reads.
  • For 454 amplicon sequencing of the CIP2 derived faecal samples, DNA was extracted directly from the faecal samples (70 mg) using the FastDNA Spin Kit for Soil on a Fastprep instrument (MP Biomedicals, USA) following the manufacturer's instructions. The V3-V5 regions of the 16S rRNA gene were amplified using barcoded primers 338F (5'-ACTCCTACGGGAGGCAGCAG-3') and 926R (5'-CCG TCA ATT CMT TTR AGT-3') adapted with linkers. Thermocycling involved an initial 2-min denaturation step at 94°C followed by 20 cycles of denaturation (94°C for 30 s), annealing (53°C for 30 s) and elongation (68°C for 2 min). The PCR products were purified using the Wizard SV Gel and PCR Clean-Up System (Promega, UK) following the manufacturer's protocol and quantified using the Qubit® dsDNA HS Assay Kit (Life_Technologies, UK). Equimolar volumes of each cleaned-up products of each PCR reaction were sequenced on the Roche 454 FLX-Titanium platform.
  • Microbiota analysis
  • A maximum likelihood phylogeny of the culture derived bacteria from CIP1 was generated from the aligned RDP sequence using FastTree version 2.1.3 (Price, Dehal et al. 2010) with the following settings: a Generalised Time-Reversible (GTR) model of nucleotide substitution and CAT approximation of the variation in rates across sites with 20 rate categories. The ethanol resistant phylogeny was derived directly from the entire culture phylogeny. All phylogenetic trees were edited in ITOL (Letunic and Bork 2011).
  • Analysis of the partial 16S rRNA gene sequence generated from the 16S rRNA gene amplicon libraries from the CIP1 derived faecal samples was carried out using the mothur MiSeq SOP (Kozich, Westcott et al. 2013) on August 29th 2014, identifying 7549 OTUs across all samples. A sequence identity threshold of ≥ 97% was again used to define an OTU.
  • For the 454 sequence analysis from CIP2 derived faecal samples the sequence reads were trimmed, filtered and pre-processed using the mothur software 454 SOP accessed in November 2012 (Schloss, Westcott et al. 2009, Schloss, Gevers et al. 2011). To ensure high quality sequence data for analysis, the sequences were trimmed using a window size of 50 bp (average quality score of 35 bp), homopolymers > 8 bp were removed and no ambiguous bases or mismatches in the primer sequence were allowed. Redundant sequence reads were removed to generate unique sequences, which were aligned to the SILVA alignment database (Pruesse, Quast et al. 2007). These aligned sequences were screened to ensure that sequences overlapped in the same alignment space using the screen.seqs command in mothur. Unique sequences were again generated and the sequences were preclustered to remove sequences that were likely due to pyrosequencing errors (Huse, Dethlefsen et al. 2008). Chimeric sequences were removed using Perseus (Quince, Lanzen et al. 2011) and other contaminants such as chloroplast and mitochrondria were also removed. Sequences with ≥ 97% sequence identity and their assigned taxonomy from phylum to genus level according to the Ribosomal Database Project (RDP) (Cole, Wang et al. 2014) and SILVA (Pruesse, Quast et al. 2007) databases were regarded as belonging to the same operational taxonomic units (OTUs). The species diversity in each sample was measured by calculating the Shannon diversity Index (SDI), which takes into account both species richness and relative proportional abundance (Schloss, Westcott et al. 2009). The OTUs were then used to cluster dendrograms, using the Bray Curtis calculator in the mothur package. Other analyses, such as Invsimpson index, principal component analysis (PCA) and the UniFrac method of comparing microbial communities were performed as described previously using the mothur software (Lozupone and Knight 2005, Lawley, Clare et al. 2012).
  • Metagenomic Analysis
  • Microbial abundance was calculated using the Human Pan-Microbe Community Database (Forster, Browne et al. 2015) against 1883 healthy individuals (3218 samples) and 458 diseased individuals (628 samples). Occurrence was calculated as greater than 1000, independent, normalised reads with abundance calculated relative to total high quality reads within the sample. Antimicrobial resistance and virulence factor identification were performed using automated sequence homology search against protein sequences annotated in the complete genome sequence. The antimicrobial resistance reference list was defined based on the comprehensive antimicrobial CARD database (McArthur, Waglechner et al. 2013) while toxins were identified by occurrence in the Database of Bacterial Exotoxins for Humans (DBETH) (Chakraborty, Ghosh et al. 2012).
  • Experimental set-up and results
  • The inventors established methods to isolate and identify bacteria for incorporation into a therapeutic composition tailored to the treatment of dysbiosis of the gastrointestinal tract, as well as e.g. enteric infections, such as, but not limited to, those caused by Clostridium difficile. As mentioned above, two different approaches for acquiring bacterial candidates for inclusion in a therapeutic were employed. The first (CIP1) relied on a broad culturing approach from healthy adult donors to establish a culture collection which is as representative as possible of the bacterial component of the healthy human intestinal microbiota. This process also incorporated a targeted culturing approach to preferentially select bacteria displaying a particular phenotype or function e.g. spore formation. The second process (CIP2) was more targeted in nature and aimed to acquire bacterial species specifically associated with resolving gastrointestinal dysbiosis by comparing individuals before and FMT to resolve C. difficile associated dysbiosis. These two approaches are described in more detail below.
  • CIP1- broad culturing approach to identify therapeutic candidates:
  • The inventors first sought to establish a genomic-based workflow that could be used as a platform for targeted culturing of specific bacterial phenotypes ( Figure 1 ). Fresh faecal samples were collected from 6 healthy humans and defined the resident bacterial communities with a combined metagenomic sequencing and bacterial culturing approach. Applying shotgun metagenomic sequencing, the inventors profiled and compared the bacterial species present in the original faecal samples to those that grew as distinct colonies on agar plates containing the complex, broad range bacteriological medium, YCFA (Duncan, Hold et al. 2002) supplemented with glucose, maltose and cellobiose. Importantly, a strong correlation was observed between the two samples at the species level (Spearman Rho = 0.75, p < 0.01) ( Figure 2 ). When sequenced, the original faecal sample and the cultured bacterial community shared an average of 93% of raw reads across the 6 donors.
  • These results demonstrate that surprisingly, and contrary to the established view in the art, a significant proportion of the bacteria within the faecal microbiota can be cultured with a single growth medium. Thus, a broad range culturing method was established that, when combined with high throughput archiving or specific phenotypic selection, can be utilised to isolate and identify novel bacteria from the human gastrointestinal tract.
  • The human intestinal microbiota is dominated by strict anaerobic bacteria that are extremely sensitive to ambient oxygen. Certain members of the Firmicutes, including Clostridium difficile, produce metabolically dormant and highly resistant spores during colonisation that facilitate both persistence within the host and environmental transmission (Lawley, Clare et al. 2009, Francis, Allen et al. 2013, Janoir, Deneve et al. 2013). Relatively few intestinal spore-forming bacteria have been cultured to date and while metagenomic studies suggest that other unexpected members of the intestinal microbiota possess potential sporulation genes, they remain poorly characterised (Galperin, Mekhedov et al. 2012, Abecasis, Serrano et al. 2013, Meehan and Beiko 2014, Rajilic-Stojanovic and de Vos 2014).
  • The inventors hypothesized that sporulation might be an unappreciated basic phenotype of the human intestinal microbiota that may have a profound impact on microbiota persistence and spread between humans. Spore-formation is also viewed as desirable for bacteriotherapy formulations since the resistant nature of the spore structure would promote survival of the medicine during production and subsequent storage. Spores from C. difficile are resistant to ethanol and this phenotype can be used to select for spores from a mixed population of spores and ethanol-sensitive vegetative cells (Riley, Brazier et al. 1987). Faecal samples with or without ethanol treatment were processed using our combined culture and metagenomics workflow ( Figure 1 ). Principle component analysis demonstrated that ethanol treatment profoundly altered the culturable bacterial composition and when compared to the original profile, efficiently enriched for ethanol-resistant bacteria, facilitating their isolation (Figure 3). -2,000 individual bacterial colonies were picked from both ethanol-treated and non-ethanol-treated conditions, re-streaked them to purity and performed full-length 16S rRNA gene sequencing to enable taxonomic characterisation. Unique taxa were then archived as frozen stocks for future phenotypic analysis.
  • In total, bacteria representing 96% of the bacterial abundance at the genus level and 90% of the bacterial abundance at the species level based on average relative abundance across the 6 donors ( Figure 4A and 4B ) were archived. Even genera that were present at low average relative abundance (<0.2%) were isolated and purified ( Figure 4C ). Ethanol-resistant species were isolated from 5 known families (Clostridiaceae, Peptostreptococcaceae, Lachnospiraceae, Ruminococcaceae and Erysipelotrichaceae) and 2 newly identified candidate families (bacterial isolates HMI_1 and HMI_22) (see Table 1 for details). The identification of these new and unexpected spore-formers highlights the broad taxonomic distribution of this phenotype among the enteric species of the Firmicutes. Overall, 137 distinct bacterial species including 45 candidate novel species and isolates representing 20 candidate novel genera and 2 candidate novel families were archived ( Figure 5 ). Our collection contains 90 species from the Human Microbiome Project's (HMP) 'most wanted' list of previously uncultured and unsequenced microbes (Fodor, DeSantis et al. 2012). 19 of the deposited bacterial isolates listed in Table 1 are included in the HMP's "Most Wanted" list, namely: HMI_1, HMI_2, HMI_4, HMI_5, HMI_7, HMI_11, HMI_12, HMI_15, HMI_16, HMI_17, HMI_18, HMI_19, HMI_35, HMI_37, HMI_38, HMI_39, HMI_45, HMI_50 and HMI_51 (see Table 1 for details). Thus, our broad-range YCFA based culturing approach led to the discovery of large numbers of novel bacteria (including novel families, genera, species, and isolates) and challenges the prevailing perception in the art that the majority of the intestinal microbiota is "unculturable".
  • CI P2: Targeted identification of candidates to resolve gastrointestinal dysbiosis
  • As described above, FMT has proven effective in resolving CDI. The inventors therefore sought to culture from faecal samples from FMT donors and recipients to isolate candidate bacteria that could be used in therapy. A panel of different microbiological media were tested to recover the broadest range of bacterial species from the faecal samples (see Methods). This approach allowed culturing and archival of bacterial candidates. Over 2600 bacterial isolates were cultured and using 16S rRNA gene sequencing these were taxonomically classified ( Figure 7 ). These bacterial isolates were members of the 4 major phyla (Actinobacteria, Bacteroidetes, Proteobacteria and Firmicutes) in the intestinal microbiota. These bacterial isolates represented more than 350 different OTUs based on alignments of the partial length 16S rRNA gene.
  • In silico analysis of candidate bacteria:
    Having established a culture collection through the two approaches described above (CIP1 and CIP2), the inventors next sought to screen these bacteria to identify bacterial candidates for bacteriotherapy.
  • The inventors first sought to analyse the isolates cultured from FMT donors and recipients. At one to three months post-FMT, the faecal microbiota profiles of the recipients were similar to those of the donors and the healthy controls. In particular, the relative abundances of the four major bacterial phyla present in the gut microbiota were also similar across these groups. The microbiota community structure in the donors and recipients (before and after FMT) was visualised for evaluation using principal component analysis (PCA) ( Figure 6 ). The PCA plot demonstrates the presence of two distinct compositional profiles representing a "health-associated" microbiota, and a "vancomycin" microbiota. The health-associated profile contained samples from FMT donors, healthy controls and FMT recipients at 2-3 months post treatment. The "vancomycin" microbiota profile was separated from the health-associated microbiota along Principal Component 1 and only contained individuals treated with vancomycin. These vancomycin control individuals became infected with C. difficile while taking antibiotics to treat other disease conditions. Additionally, the "metronidazole-associated" profile was separated from the "health-associated" profile along Principal Component 2 and contained samples from C. difficile infected patients treated with metronidazole.
  • The donor-recipient profiles of each pair were compared before and after FMT to identify taxa that were present in the donor sample, and which increased in relative abundance in the recipient's profile after FMT. A total of 786 OTUs from all recipient samples were detected after FMT but singleton OTUs present at the different time points were removed. This resulted in 375 OTUs for further analysis. Given that recurrence of CDI typically occurs 3-4 weeks after the withdrawal of antibiotic treatment, (Cornely, Miller et al. 2012, Abujamel, Cadnum et al. 2013) OTUs that were increased in relative proportional abundances at 2-3 months post-FMT were analysed further.
  • Next, the inventors undertook in silico analysis to further screen the bacteriotherapy candidates from both of our culturing approaches (CIP1 and CIP2). As described above a healthy intestinal microbiota is based on a diverse and abundant microbial community. Using the whole genome sequences that the inventors generated from bacterial isolates from CIP1 and CIP2, the inventors computationally assessed their prevalence in healthy and diseased individuals in public metagenomic data-sets using the HPMC database tool (Forster, Browne et al. 2015). Candidate bacteria were first filtered to include only those isolates with greater than 0.001 % average abundance within the bacterial community across all healthy individuals in which they were detected ( Figure 8 ). All of the bacteria deposited with DSMZ thus had greater than 0.001% average abundance within the bacterial community across all healthy individuals in which they were detected (see Table 1). In addition to being health-associated, preferred candidates for bacteriotherapy applications are expected to ameliorate gastrointestinal dysbiosis. To identify such candidates, the distribution of each of our isolates in publicly available metagenomics datasets was examined. Bacterial species whose total average abundance was substantially decreased (greater than four-fold decrease) in individuals with gastrointestinal dysbiosis relative to healthy individuals were selected and subjected to further analysis as described below ( Figure 9 ). All of the bacteria deposited with DSMZ thus showed a decreased total average abundance (greater than four-fold decrease) in individuals with gastrointestinal dysbiosis relative to healthy individuals (see Table 1).
  • The list of bacteriotherapy candidates was further analysed on the basis of computationally predicted antimicrobial resistance (AMR) and virulence factors. Bacteriotherapy candidates with overall predicted resistance scores below 20% of the overall predicted resistance scores of the known pathogens C. difficile, Enterococcus faecalis and Escherichia coli were included. Candidates were also selected for the absence of in-silico predicted resistance to beta-lactams, fusidic acid, elfamycin, aminoglycoside, fosfomycin and tunicamycin and by the absence of known toxins as listed in Chakrabory A. et al, 2012, A Database of Bacterial Exotoxins for Humans (DBETH). Based on this analysis the inventors identified 51 candidates for use in bacteriotherapy from CIP1 and CIP2 (see Table 1). 10 of these bacteriotherapy candidates were identified using CIP2, namely: HMI_23, HMI_24, HMI_25, HMI_26, HMI_27, HMI_28, HMI_29, HMI_30, HMI_31 and HMI_32 (see Table 1 for details). All of these 10 isolates were cultured from healthy donors. The remaining bacteriotherapy candidates were identified using CIP1.
  • The bacteriotherapy candidates identified using CIP1 and CIP2, with the exception of HMI_17, were then subjected to in vitro analysis to establish their therapeutic efficacy in treating C. difficile and E. coli infection as described in Example 2 below.
  • Example 2 - In vitro analysis of bacteriotherapy candidates Detection of anti-pathogen activities of the bacteriotherapy candidates by an overlay assay
  • The bacterial isolates of interest identified in Example 1 were streaked in an "X" shape over the surface of a standard Petri dish containing warmed and reduced YCFA agar. These inoculated plates were then incubated anaerobically at 37°C for 3 to 6 days, until bacterial growth was clearly visible. Overlay agar was prepared by adding 0.8% agar to an appropriate broth. For C. difficile, BHI broth + 0.8% agar was used. For E. coli, LB + 0.8% agar was prepared. The overlay agar was held molten at 50°C before use. The overlay agar was inoculated (1% inoculum) with an aliquot of a turbid culture of the pathogen of interest, in this case either C. difficile M7404 or E. coli (AlEC). A 10ml aliquot of the inoculated overlay agar was added to the surface of the agar plates bearing each commensal strain of interest. The overlay agar was allowed to set and the plates were incubated anaerobically at 37°C for one to two days. Following incubation, zones of clearing could be observed if the commensal strain of interest was capable of inhibiting the growth of the pathogen in the overlay layer. The width of each zone of clearing was measured with a ruler as shown in Figure 10 . The results are shown in Figure 11 .
  • Detection of anti-pathogen activity by CFS-relative growth inhibition assay.
  • Bacteriotherapy candidates were grown in 1ml aliquots of reduced YCFA broth at 37°C under anaerobic conditions for two days. Cell free supernatant (CFS) was prepared by centrifuging each culture to remove the bacteria and by passing the resulting supernatant through a 0.22µm filter to sterilise it. Uninoculated YCFA broth was also filter sterilised. The CFSs and filtered YCFA broth aliquots were frozen at -20°C until they were required. These filtrates were thawed under anaerobic conditions at 37°C and a 100µl aliquot of each CFS was added to one well of a flat-bottomed 96-well plate. Several wells were filled with filter-sterilised YCFA broth to serve as positive controls for pathogen growth. Each well was inoculated (2-5% inoculum) with a turbid, early-mid exponential phase C. difficile M7404 culture. Alternatively, a 5% inoculum of a stationary phase E. coli culture adjusted to OD600 ≈1 was used. The 96-well plate was sealed with an optically clear film and it was transferred to a FLUOstar Omega microplate-reader (BMG Labtech). The plate was incubated static at 37°C in the plate-reader and OD600 readings were taken every 10min for 18.17 hours. The plate was shaken for 10 seconds before each OD reading was taken. All isolates, except HMI17 were tested.
  • The relative growth of the pathogen of interest in each of the CFSs tested was then calculated as follows: For each CFS tested, every raw-data value was expressed relative to its OD600 reading that was taken at the ten minute time-point. Such data normalisation permitted direct comparison of C. difficile or E. coli growth in the various CFSs by eliminating the initial inherent variation in the optical density of the CFSs (due to the pre-fermentation of the media) from consideration. The relative growth achieved at the 18.17h time-point by C. difficile or E. coli in each of the CFSs was compared to the relative growth of the pathogen of interest that was achieved in YCFA broth. A commensal strain was considered a potential inhibitor of C. difficile or E. coli if the relative growth plus two standard deviations of the pathogen of interest in the CFS derived from that same commensal isolate, was less than the mean minus two standard deviations of the relative growth of the pathogen in YCFA broth. Where only one relative growth value was available, a CFS was considered as potentially inhibitory if the relative pathogen growth was more than two standard deviations below the mean relative growth in YCFA broth. The results for bacteriotherapy candidates found to have inhibitory activity are shown in Figure 12 .
  • Results
  • A summary of the results obtained in the growth overlay and growth inhibition assays is shown in Figure 13 and Table 1. The bacteriotherapy candidates which showed activity in each of the in vitro assays are indicated in this figure.
  • Of the 50 bacteriotherapy candidates tested, 22 demonstrate growth inhibition of at least one of C. difficile M7404 or E. coli (AIEC) in one of the assays performed. 11 of the bacteriotherapy candidates inhibited the growth of at least one of either C. difficile or E. coli in overlay assays, suggesting that the inhibition conferred by these bacteriotherapy candidates is direct. According to the overlay assay data, 5 of the bacteriotherapy candidates inhibit only the growth of either C. difficile or E. coli, suggesting that the inhibitory activity of these bacteriotherapy candidates is not generic, i.e. that the inhibitory activity is specific for one or more pathogenic bacteria.
  • Of the 50 bacteriotherapy candidates tested, 6 inhibited the growth of both C. difficile and E. coli in overlay assays, suggesting that they have a broad-spectrum of inhibitory activity and are likely to also have inhibitory activity against other pathogenic bacteria.
  • The results from the CFS-relative growth inhibition assay demonstrate that the CFS from 16 of the 50 bacteriotherapy candidates tested, only supported the relative growth of C. difficile to levels more than two standard deviations below the mean relative growth in YCFA broth at the 18.17h time-point. These bacteriotherapy candidates are thus considered to inhibit C. difficile growth. 5 of these bacteriotherapy candidates were also shown to directly inhibit C. difficile and/or E. coli growth in the overlay assays. This suggests that these 5 bacteriotherapy candidates secrete one or more substances which inhibit the growth of these pathogenic bacteria. The remaining 11 bacteriotherapy candidates which showed inhibitory activity in the CFS-relative growth inhibition assay are likely to compete with C. difficile for nutrients. CFS from two of the bacteriotherapy candidates did not support growth of E. coli to within two standard deviations of the mean growth observed for E. coli in YCFA broth. These isolates are therefore considered to inhibit the growth of E. coli.
  • Example 3 - In silico co-abundance network analysis
  • To identify bacteria that, while not capable of directly inhibiting pathogen growth as tested in Example 2, may support the growth or survival of those bacteria that exhibited direct inhibition of pathogen growth in Example 2, co-abundance network analysis was performed.
  • This analysis was performed as described previously using the complete list of healthy datasets in the HPMC database tool (Forster, Browne et al. 2015). For each candidate bacterium that demonstrated inhibition of pathogen growth in Example 2, a complete list of first degree neighbour species that exhibited co-occurrence with the candidate bacterium across at least 95% of faecal samples with an average abundance greater than 0.001% and a minimum of 100 reads was generated. Bacteria that exhibited extensive co-occurrence with candidate bacteria exhibiting direct inhibitory activity of pathogen growth are predicted to provide a metabolic, environmental and/or immunomodulatory support function required for colonization of the gastrointestinal tract by the candidate bacteria. The deposited bacteria demonstrating such co-occurrence is indicated in Table 1.
  • Discussion
  • Bacterial isolates that inhibited the growth of one or more pathogenic bacteria as shown in Example 2 are expected to be suitable for treating gastrointestinal dysbiosis in humans.
  • However, bacterial isolates that did not show evidence of pathogen inhibition in Example 2 are still expected to be useful for the treatment of gastrointestinal dysbiosis.
  • Firstly, based on the co-occurrence data obtained in Example 3, a large number of the deposited bacteria are expected to support the colonization of the gastrointestinal tract by the inhibitory bacteria identified in Example 2 through direct or indirect interaction. Metabolic networks in which consortia of bacteria thrive by cross-feeding, structural networks, such as biofilms, or the interactions of 'keystone species', allow the microbiota to establish and stabilise (Ze and Mougen et al. 2013). Co-occurrence analysis identified 35 candidates that formed first degree co-occurrence neighbours with direct inhibitors at a rate above 95% (HMI_2, HMI_5, HMI_6, HMI_7, HMI_8, HMI_9, HMI_10, HMI_11, HMI_12, HMI_14, HMI_15, HMI_16, HMI_17, HMI_18, HMI_19, HMI_20, HMI_26, HMI_27, HMI_31, HMI_33, HMI_34, HMI_35, HMI_37, HMI_38, HMI_39, HMI_41, HMI_42, HMI_43, HMI_44, HMI_46, HMI_47, HMI_48, HMI_50, HMI_51, HMI_52; see Table 1 for details). In addition, several of the bacterial isolates listed in Table 1 reside within the same genera as known keystone species (HMI_17, HMI_23 to HMI_32, HMI_45, HMI_49, HMI_51 and HMI_52; see Table 1 for details) and thus are expected to represent keystone species themselves.
  • Secondly, the bacterial isolates listed in Table 1 are shown in Example 1 to contribute to the overall diversity of the gastrointestinal microbiota, which is low during dysbiosis. Specifically, a number of these bacteria (HMI_23 to HMI_32 inclusive) were recovered from the intestinal microbiota of FMT donors as part of CIP2. When the microbiota of a healthy donor was transferred to an individual with dysbiosis due to antibiotic treatment for recurrent C. difficile infection, all were restored to health ( Figure 6 ), which was determined as the absence of C. difficile at 2-3 months post-FMT. The criteria for identifying bacteriotherapy candidates by the CIP2 process required that a certain candidate bacterial species was present in the microbiota of half the recipients at more than >0.6% average relative abundance at 2-3 months post-FMT. Moreover, genera representing several of the 51 bacteria listed in Table 1 were also identified in healthy donors and in cured recipients post-FMT ( Figure 14 ). Furthermore, the in silico analysis presented herein ( Figures 8 and 9 ) revealed that the 51 candidate bacteriotherapy isolates are prevalent in healthy individuals, in whom they occur at an average relative abundance >0.001% and these bacteria tend to be depleted under conditions of dysbiosis ( Figure 9 ). Together, these data strongly suggest that the 51 bacterial isolates listed in Table 1 are suitable in the treatment of gastrointestinal dysbiosis.
  • Thirdly, the bacterial isolates listed in Table 1 are expected to compete with enteric pathogens in the gastrointestinal tract, and thus find application in the treatment of gastrointestinal dysbiosis. Specifically, the widespread occurrence of these bacteria in healthy individuals implies that they efficiently colonise the gastrointestinal tract. When the microbiota is populated by these health-associated bacteria, the likelihood of enteric infection with any pathogenic bacterium is known to be low, as such infections usually do not occur in individuals with a healthy gastrointestinal microbiota. Indeed, following FMT, during which genera representing many of the 51 bacteria listed in Table 1 were identified in individuals treated for a dysbiosis of the gastrointestinal tract following antibiotic treatment for C. difficile infection ( Figure 14 ), a healthy microbiota profile was restored ( Figure 6 and Figure 14 ) and C. difficile infection did not recur within 3 months. This indicates that these bacteria promote health according to the principles of colonisation resistance, in which pathogens are excluded or suppressed by competition with the resident health-associated bacteria for nutrients and attachment sites (Britton & Young 2014; Lawley & Walker 2013).
  • Fourthly, several of the bacterial isolates listed in Table 1 are expected, on the basis of extrapolation from investigations of other species in the same genera or clades (Louis & Flint, 2009), to produce metabolites, such as short chain fatty acids, which have known benefits for gastrointestinal health (e.g. HMI_9, HMI_12, HMI_20, HMI_21 and HMI_23-HMI_32; see table 1 for details).
  • Finally some Clostridium related species have been shown to be immunomodulatory and can be beneficial in reducing inflammation (Atarashi, Tanoue et al. 2013). Based on a comparison of 16S rRNA gene sequences using 95% sequence identity as a cut-off to define a genus (Bosshard, Abels et al. 2003), examples in this context that are in the same genus as these bacteria are HMI_4, HMI_9, HMI_10, HMI_15, HMI_27, HMI_28 and HMI_38.
    Figure imgb0001
    Figure imgb0002
  • Sequence listing
  • 16S rRNA gene sequences of the 51 deposited bacterial isolates listed in Table 1 are set out below below. For each bacteriotherapy candidate a putative genus and species name is give. The genus was and species names were assigned based on the Ribosomal Database Project (RDP) reference database and BLASTn analysis as explained in Example 1. The genus and species names assigned to each of the bacteriotherapy candidates are thus that of the most closely related known bacterium and hence subject to change.
    • HMI 1 Clostridium thermocellum 16S rDNA sequence (SEQ ID NO: 11
      Figure imgb0003
    • HMI 2 Flavonifractor plautii 16S rDNA sequence (SEQ ID NO: 2)
      Figure imgb0004
    • HMI 3 Flavonifractor plautii 16S rDNA sequence (SEQ ID NO: 3)
      Figure imgb0005
      Figure imgb0006
    • HMI 4 Clostridium orbiscindens 16S rDNA sequence (SEQ ID NO: 4)
      Figure imgb0007
    • HMI 5 Ruminococcus flavefaciens 16S rDNA sequence (SEQ ID NO: 5)
      Figure imgb0008
      Figure imgb0009
    • HMI 6 Anaerotruncus colihominis 16S rDNA sequence (SEQ ID NO: 6)
      Figure imgb0010
    • HMI 7 Clostridium xylanolyticum 16S rDNA sequence (SEQ ID NO: 7)
      Figure imgb0011
      Figure imgb0012
    • HMI 8 Clostridium oroticum 16S rDNA sequence (SEQ ID NO: 8)
      Figure imgb0013
    • HMI 9 Eubacterium contortum 16S rDNA sequence (SEQ ID NO: 9)
      Figure imgb0014
      Figure imgb0015
    • HMI 10 Clostridium oroticum 16S rDNA sequence (SEQ ID NO: 10)
      Figure imgb0016
    • HMI 11 Lachnospira pectinoschiza 16S rDNA sequence (SEQ ID NO: 11)
      Figure imgb0017
    • HMI 12 Roseburia faecis 16S rDNA sequence (SEQ ID NO: 12)
      Figure imgb0018
      Figure imgb0019
    • HMI 14 Clostridium hathewayi 16S rDNA sequence (SEQ ID NO: 13)
      Figure imgb0020
    • HMI 15 Fusicatenibacter saccharivorans 16S rDNA sequence (SEQ ID NO: 14)
      Figure imgb0021
      Figure imgb0022
    • HMI 16 Clostridium clostridioforme 16S rDNA sequence (SEQ ID NO: 15)
      Figure imgb0023
    • HMI 17 Ruminococcus torques 16S rDNA sequence (SEQ ID NO: 16)
      Figure imgb0024
      Figure imgb0025
    • HMI 18 Clostridium celerecrescens 16S rDNA sequence (SEQ ID NO: 17)
      Figure imgb0026
    • HMI 19 Clostridium celerescens 16S rDNA sequence (SEQ ID NO: 18)
      Figure imgb0027
      Figure imgb0028
    • HMI 20 Eubacterium infirmum 16S rDNA sequence (SEQ ID NO: 19)
      Figure imgb0029
      Figure imgb0030
    • HMI 21 Eubacterium infirmum 16S rDNA sequence (SEQ ID NO: 20)
      Figure imgb0031
    • HMI 22 Clostridium thermocellum 16S rDNA sequence (SEQ ID NO: 21)
      Figure imgb0032
      Figure imgb0033
    • HMI 23 Anaerovorax odorimutans 16S rDNA sequence (SEQ ID NO: 22)
      Figure imgb0034
      Figure imgb0035
    • HMI 24 Clostridium saccharoqumia 16S rDNA sequence (SEQ ID NO: 23)
      Figure imgb0036
    • HMI 25 Clostridium saccharoqumia 16S rDNA sequence (SEQ ID NO: 24)
      Figure imgb0037
      Figure imgb0038
    • HMI 26 Blautia luti 16S rDNA sequence (SEQ ID NO: 25)
      Figure imgb0039
    • HMI 27 Clostridium clostridioforme 16S rDNA sequence (SEQ ID NO: 26)
      Figure imgb0040
      Figure imgb0041
    • HMI 28 Blautia products 16S rDNA sequence (SEQ ID NO: 27)
      Figure imgb0042
      Figure imgb0043
    • HMI 29 Blautia qlucerasea 16S rDNA sequence (SEQ ID NO: 28)
      Figure imgb0044
    • HMI 30 Clostridium straminisolvens 16S rDNA sequence (SEQ ID NO: 29)
      Figure imgb0045
    • HMI 31 Butyricoccus pullicaecorum 16S rDNA sequence (SEQ ID NO: 30)
      Figure imgb0046
    • HMI 32 Clostridium maritium 16S rDNA sequence (SEQ ID NO: 31)
      Figure imgb0047
    • HMI 33 Eubacterium fissicatens 16S rDNA sequence (SEQ ID NO: 32)
      Figure imgb0048
      Figure imgb0049
    • HMI 34 Clostridium saccharolyticum 16S rDNA sequence (SEQ ID NO: 33)
      Figure imgb0050
    • HMI 35 Blautia luti 16S rDNA sequence (SEQ ID NO: 34)
      Figure imgb0051
    • HMI 36 Clostridium methylpentosum 16S rDNA sequence (SEQ ID NO: 35)
      Figure imgb0052
      Figure imgb0053
    • HMI 37 Clostridium xylanolyticum 16S rDNA sequence (SEQ ID NO: 36)
      Figure imgb0054
      Figure imgb0055
    • HMI 38 Oscillibacter valericigenes 16S rDNA sequence (SEQ ID NO: 37)
      Figure imgb0056
    • HMI 39 Ruminococcus obeum 16S rDNA sequence (SEQ ID NO: 38)
      Figure imgb0057
      Figure imgb0058
    • HMI 40 Megasphaera elsdenii 16S rDNA sequence (SEQ ID NO: 39)
      Figure imgb0059
      Figure imgb0060
    • HMI 41 Blautia luti 16S rDNA sequence (SEQ ID NO: 40)
      Figure imgb0061
    • HMI 42 Bacteroides coprocola 16S rDNA sequence (SEQ ID NO: 41)
      Figure imgb0062
      Figure imgb0063
    • HMI 43 Bacteroides plebius 16S rDNA sequence (SEQ ID NO: 42)
      Figure imgb0064
      Figure imgb0065
    • HMI 44 Roseburia inulinivorans 16S rDNA sequence (SEQ ID NO: 43)
      Figure imgb0066
    • HMI 45 Ruminococcus albus 16S rDNA sequence (SEQ ID NO: 44)
      Figure imgb0067
      Figure imgb0068
    • HMI 46 Blautia producta 16S rDNA sequence (SEQ ID NO: 45)
      Figure imgb0069
      Figure imgb0070
    • HMI 47 Clostridium nexile 16S rDNA sequence (SEQ ID NO: 46)
      Figure imgb0071
    • HMI 48 Butyricicoccus pullicaecorum 16S rDNA sequence (SEQ ID NO: 47)
      Figure imgb0072
      Figure imgb0073
    • HMI 49 Ruminococcus flavefaciens 16S rDNA sequence (SEQ ID NO: 48)
      Figure imgb0074
      Figure imgb0075
    • HMI 50 Clostridium orbiscindens 16S rDNA sequence (SEQ ID NO: 49)
      Figure imgb0076
    • HMI 51 Ruminococcus bromii 16S rDNA sequence (SEQ ID NO: 50)
      Figure imgb0077
      Figure imgb0078
    • HMI 52 Ruminococcus albus 926R 16S rDNA sequence (SEQ ID NO: 51)
      Figure imgb0079
      Figure imgb0080
    References

Claims (15)

  1. A therapeutic composition comprising at least one isolated bacterium and a pharmaceutically acceptable excipient, wherein the bacterium comprises a gene encoding a 16S ribosomal RNA (rRNA) and said gene comprises a sequence with at least 90% sequence identity with the sequence set forth in any one of SEQ ID NOs 21, 22, 23, 29, 39, 41, 42; a sequence with at least 91% sequence identity with the sequence set forth in any one of SEQ ID NOs 1, 6, 30, 47; a sequence with at least 92% sequence identity with the sequence set forth in any one of SEQ ID Nos 11, 19, 36; a sequence with at least 93% sequence identity with the sequence set forth in any one of SEQ ID Nos 14, 15, 34, 35, 37, 38, 43, 44, 50; a sequence with at least 94% sequence identity with the sequence set forth in any one of SEQ ID Nos 5, 13, 17, 18, 27, 40, 45, 46; a sequence with at least 95% sequence identity with the sequence set forth in any one of SEQ ID Nos 7, 32, 33, 48, 51; a sequence with at least 96% sequence identity with the sequence set forth in any one of SEQ ID Nos 12, 16, 20, 49; a sequence with at least 97% sequence identity with the sequence set forth in any one of SEQ ID Nos 3, 8, 9, 10; a sequence with at least 98% sequence identity with the sequence set forth in any one of SEQ ID Nos 2, 4, 31, or a sequence with at least 100% sequence identity with the sequence set forth in any one of SEQ ID Nos 14, 24, 25, 26, 28 .
  2. The therapeutic composition according to claim 1, wherein the gene encoding the 16S rRNA comprises a sequence with at least 100% sequence identity with the sequence set forth in any of SEQ ID NOs: 1 to 51.
  3. The therapeutic composition according to any one of claims 1 or 2, wherein the isolated bacterium is a bacterium as deposited at the Leibniz-Institut DSMZ under accession number DSM32191, DSM32147, DSM32149, DSM32175, DSM32153, DSM32152, DSM32158, DSM32192, DSM32148, DSM32166, DSM32151, DSM32150, DSM32193, DSM32162, DSM32194, DSM32163, DSM32205, DSM32195, DSM32164, DSM32177, DSM32167, DSM32165, DSM32169, DSM32168, DSM32178, DSM32182, DSM32179, DSM32180, DSM32184, DSM32181, DSM32183, DSM32262, DSM32211, DSM32219, DSM32222, DSM32261, DSM32212, DSM32220, DSM32213, DSM32226, DSM32215, DSM32216, DSM32217, DSM32221, DSM32218, DSM32224, DSM32214, DSM32263, DSM32223, DSM32225, or DSM32265.
  4. The therapeutic composition according to any one of claims 1 to 3, wherein the composition comprises at least two distinct isolated bacteria, and wherein the bacteria are as defined in any one of claims 1 to 3.
  5. The therapeutic composition according to any one of claims 1 to 4, wherein the composition is for use in the treatment of a dysbiosis of the gastrointestinal tract in an individual.
  6. The therapeutic composition for use according to claim 5, wherein the dysbiosis is a dysbiosis associated with an enteric bacterial infection.
  7. The therapeutic composition for use according to claim 6, wherein the enteric bacterial infection is an infection with a pathogenic bacterium, for example of the genus Clostridium, such as Clostridium difficile, Escherichia, such as E. coli, Enterococcus, Klebsiella, Enterobacter, Proteus, Salmonella, Shigella, Staphylococcus, Vibrio, Aeromonas, Campylobacter, Bacillus, Helicobacter, Listeria, Plesiomonas, or Yersinia.
  8. The therapeutic composition for use according to claim 7, wherein the pathogenic bacterium is resistant to treatment with one or more antibiotics.
  9. The therapeutic composition for use according to claim 5, wherein the dysbiosis is a dysbiosis associated with inflammatory bowel disease (IBD), such as ulcerative colitis (UC) or Crohn's disease or pouchitis or irritable bowel syndrome (IBS), a metabolic disease, such as metabolic syndrome, obesity, type 2 diabetes mellitus, a cardiovascular disease, and non-alcoholic fatty liver, a neuropsychiatric disorder, such as Parkinson's disease, Alzheimer's disease, multiple sclerosis, myoclonus dystonia, autism and chronic fatigue syndrome, an autoimmune disease, such as idiopathic thrombocytopenic purpura, arthritis, Sjögren's syndrome, systemic lupus erythematosus, and Hashimoto's thyroiditis, an allergic disorder, such as atopy, and asthma, or a cancer, such as colorectal cancer, extra-intestinal tumours, mammary tumours, hepatocellular carcinoma, lymphoma, melanoma, and lung cancer or wherein the dysbiosis is a dysbiosis associated with hepatic encephalopathy.
  10. The therapeutic composition or therapeutic composition for use according to any one of claims 1 to 9, wherein the isolated bacterium is a spore-forming bacterium.
  11. The therapeutic composition or therapeutic composition for use according to any one of claims 1 to 10, wherein at least one of bacteria in the composition is antagonistic towards a pathogenic intestinal bacterium, inhibits or prevents the growth of a pathogenic intestinal bacterium, or neutralizes or protects against a toxin produced by an intestinal bacterium.
  12. The therapeutic composition or therapeutic composition for use according to any one of claims 1 to 11, wherein at least one of bacteria in the composition has immunomodulatory activity.
  13. The therapeutic composition or therapeutic composition for use according to any one of claims 1 to 12, wherein the composition is in the form of a capsule, a tablet, or an enema.
  14. A method of preparing a therapeutic composition according to any one of claims 1 to 4, wherein the method comprises the steps of:
    (i) culturing an isolated bacterium as set out in any one of claims 1 to 4; and
    (ii) mixing the bacteria obtained in (i) with a pharmaceutically acceptable excipient.
  15. A method of preparing a therapeutic composition according to 14, wherein the method comprises the steps of:
    (i) culturing a first isolated bacterium as set out in any one of claims 1 to 4;
    (ii) culturing a second isolated bacterium as set out in any one of claims 1 to 4; and
    (ii) mixing the bacteria obtained in (i) and (ii) with a pharmaceutically acceptable excipient, wherein the bacteria cultured in steps (i) and (ii) have distinct 16S rRNA sequences, and wherein steps (i) and (ii) are performed independently.
EP17720211.6A 2016-04-19 2017-04-19 Bacteriotherapy Active EP3445380B3 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP24168584.1A EP4417261A3 (en) 2016-04-19 2017-04-19 Bacteriotherapy

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB201606801 2016-04-19
PCT/GB2017/051083 WO2017182796A1 (en) 2016-04-19 2017-04-19 Bacteriotherapy

Related Child Applications (2)

Application Number Title Priority Date Filing Date
EP24168584.1A Division EP4417261A3 (en) 2016-04-19 2017-04-19 Bacteriotherapy
EP24168584.1A Division-Into EP4417261A3 (en) 2016-04-19 2017-04-19 Bacteriotherapy

Publications (5)

Publication Number Publication Date
EP3445380A1 EP3445380A1 (en) 2019-02-27
EP3445380C0 EP3445380C0 (en) 2024-04-10
EP3445380B1 true EP3445380B1 (en) 2024-04-10
EP3445380B8 EP3445380B8 (en) 2024-06-05
EP3445380B3 EP3445380B3 (en) 2025-01-08

Family

ID=58640921

Family Applications (2)

Application Number Title Priority Date Filing Date
EP24168584.1A Pending EP4417261A3 (en) 2016-04-19 2017-04-19 Bacteriotherapy
EP17720211.6A Active EP3445380B3 (en) 2016-04-19 2017-04-19 Bacteriotherapy

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP24168584.1A Pending EP4417261A3 (en) 2016-04-19 2017-04-19 Bacteriotherapy

Country Status (9)

Country Link
US (2) US11786562B2 (en)
EP (2) EP4417261A3 (en)
JP (1) JP2019515918A (en)
CN (2) CN118924794A (en)
AU (2) AU2017252504C1 (en)
CA (1) CA3021247A1 (en)
ES (1) ES2987655T7 (en)
PL (1) PL3445380T6 (en)
WO (1) WO2017182796A1 (en)

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11786562B2 (en) 2016-04-19 2023-10-17 Genome Research Limited Bacteriotherapy
EP3703720A1 (en) 2017-10-30 2020-09-09 Seres Therapeutics, Inc. Compositions and methods for treating antibiotic resistance
CA3084954A1 (en) 2017-12-05 2019-06-13 BioPlx, Inc. Methods and compositions to prevent microbial infection
MX2020010177A (en) * 2018-03-29 2021-01-15 Seres Therapeutics Inc Compositions and methods for treating inflammatory bowel diseases.
EP3594321A1 (en) * 2018-07-10 2020-01-15 Université catholique de Louvain Dusodibacter, a novel bacterial genus of the gastroinstestinal microbiota and uses thereof
EP4061389A1 (en) 2019-11-20 2022-09-28 4D Pharma Research Limited Compositions comprising bacterial strains
EP3838281A1 (en) * 2019-12-20 2021-06-23 4D Pharma Research Limited Compositions comprising bacterial strains
EP3858363A1 (en) 2020-01-28 2021-08-04 Institut national de recherche pour l'agriculture, l'alimentation et l'environnement Composition for treating intestinal or pulmonary diseases
CN111413503A (en) * 2020-03-28 2020-07-14 浙江大学 Application of osteopontin as target molecule in regulating obesity caused by high fat diet
GB202007452D0 (en) 2020-05-19 2020-07-01 Microbiotica Ltd Threrapeutic bacterial composition
GB202015687D0 (en) 2020-10-02 2020-11-18 Microbiotica Ltd Therapeutic composition
CN118891356A (en) * 2022-04-28 2024-11-01 慕恩(广州)生物科技有限公司 Pharmaceutical composition, megasphaerella and application thereof
CN118891357A (en) * 2022-04-28 2024-11-01 慕恩(广州)生物科技有限公司 Pharmaceutical composition, megasphaerella and application thereof
KR102620189B1 (en) * 2022-08-31 2024-01-04 주식회사 바이오뱅크힐링 Blautia brookingsii strain, and vesicles from thereof and anti-inflammation and anti-bacteria uses of thereof
IL322901A (en) * 2023-02-28 2025-10-01 Persephone Biosciences Inc Compositions for modulating gut microflora populations, treatment of dysbiosis and disease prevention, and methods for making and using same

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013037068A1 (en) * 2011-09-14 2013-03-21 Queen's University At Kingston Method for treatment of disorders of the gastrointestinal system
WO2014121301A1 (en) * 2013-02-04 2014-08-07 Seres Health, Inc. Compositions and methods for inhibition of pathogenic bacterial growth
US20150190435A1 (en) * 2012-11-23 2015-07-09 Seres Health, Inc. Synergistic bacterial compositions and methods of production and use thereof

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012039615A2 (en) * 2010-09-21 2012-03-29 Winclove Bio Industries B.V. Commensal rat ileum bacterium (crib)
EP2850202B1 (en) * 2012-05-18 2020-03-11 Genome Research Limited Methods and groups
NZ709392A (en) 2012-11-23 2016-10-28 Seres Therapeutics Inc Synergistic bacterial compositions and methods of production and use thereof
MX367109B (en) * 2013-11-25 2019-08-05 Seres Therapeutics Inc Synergistic bacterial compositions and methods of production and use thereof.
CN106659746A (en) 2014-04-10 2017-05-10 国立研究开发法人理化学研究所 Compositions and methods for induction of TH17 cells
AU2015340605B2 (en) * 2014-10-29 2021-06-24 Biogaia Ab Use of L. reuteri for recovery of microbiota dysbiosis in early life
MA41010B1 (en) * 2015-06-15 2020-01-31 4D Pharma Res Ltd Compositions comprising bacterial strains
AU2016357554B2 (en) * 2015-11-20 2019-04-04 Cj Bioscience, Inc. Compositions comprising bacterial strains
US11786562B2 (en) 2016-04-19 2023-10-17 Genome Research Limited Bacteriotherapy

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013037068A1 (en) * 2011-09-14 2013-03-21 Queen's University At Kingston Method for treatment of disorders of the gastrointestinal system
US20150190435A1 (en) * 2012-11-23 2015-07-09 Seres Health, Inc. Synergistic bacterial compositions and methods of production and use thereof
WO2014121301A1 (en) * 2013-02-04 2014-08-07 Seres Health, Inc. Compositions and methods for inhibition of pathogenic bacterial growth

Also Published As

Publication number Publication date
CN110545828A (en) 2019-12-06
AU2017252504C1 (en) 2024-03-28
JP2019515918A (en) 2019-06-13
EP4417261A3 (en) 2024-10-02
US20220184149A1 (en) 2022-06-16
US11786562B2 (en) 2023-10-17
ES2987655T7 (en) 2025-04-29
AU2017252504A1 (en) 2018-11-01
WO2017182796A1 (en) 2017-10-26
CA3021247A1 (en) 2017-10-26
EP3445380C0 (en) 2024-04-10
PL3445380T3 (en) 2024-07-15
AU2017252504B2 (en) 2023-10-12
AU2023282231A1 (en) 2024-01-18
EP3445380A1 (en) 2019-02-27
PL3445380T6 (en) 2025-05-05
EP3445380B3 (en) 2025-01-08
ES2987655T3 (en) 2024-11-15
EP4417261A2 (en) 2024-08-21
CN118924794A (en) 2024-11-12
EP3445380B8 (en) 2024-06-05
US20240156880A1 (en) 2024-05-16
AU2023282231B2 (en) 2026-02-05

Similar Documents

Publication Publication Date Title
AU2023282231B2 (en) Bacteriotherapy
JP7491643B2 (en) Synergistic bacterial compositions and methods of making and using same
CA2931317C (en) Synergistic bacterial compositions and methods of production and use thereof
US8906668B2 (en) Synergistic bacterial compositions and methods of production and use thereof
AU2018282348A1 (en) Compositions and methods
Doron et al. Effect of Lactobacillus rhamnosus GG administration on vancomycin-resistant Enterococcus colonization in adults with comorbidities
WO2014121304A1 (en) Compositions and methods
Quigley et al. Lactobacillus gasseri APC 678 reduces shedding of the pathogen Clostridium difficile in a murine model
HK40114595A (en) Bacteriotherapy
JP2022545652A (en) Bacterial composition for treatment of disease

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20181119

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20200710

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: GRANT OF PATENT IS INTENDED

INTG Intention to grant announced

Effective date: 20231030

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE PATENT HAS BEEN GRANTED

REG Reference to a national code

Ref country code: DE

Ref legal event code: R081

Ref document number: 602017080826

Country of ref document: DE

Owner name: GENOME RESEARCH LTD., SAFFRON WALDEN, GB

Free format text: FORMER OWNER: GENOME RESEARCH LTD., CAMBRIDGE, CAMBRIDGESHIRE, GB

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

RAP4 Party data changed (patent owner data changed or rights of a patent transferred)

Owner name: GENOME RESEARCH LIMITED

REG Reference to a national code

Ref country code: DE

Ref legal event code: R096

Ref document number: 602017080826

Country of ref document: DE

REG Reference to a national code

Ref country code: CH

Ref legal event code: PK

Free format text: DIE PUBLIKATION VOM 27.03.2024 WURDE AM 24.04.2024 IRRTUEMLICHERWEISE ERNEUT PUBLIZIERT. LA PUBLICATION DU 27.03.2024 A ETE REPUBLIEE PAR ERREUR LE 24.04.2024. LA PUBBLICAZIONE DEL 27.03.2024 E STATA ERRONEAMENTE RIPUBBLICATA IL 24.04.2024.

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: PK

Free format text: BERICHTIGUNG B8

U01 Request for unitary effect filed

Effective date: 20240426

U07 Unitary effect registered

Designated state(s): AT BE BG DE DK EE FI FR IT LT LU LV MT NL PT SE SI

Effective date: 20240506

U20 Renewal fee for the european patent with unitary effect paid

Year of fee payment: 8

Effective date: 20240507

REG Reference to a national code

Ref country code: DE

Ref legal event code: R055

Ref document number: 602017080826

Country of ref document: DE

PLCP Request for limitation filed

Free format text: ORIGINAL CODE: EPIDOSNLIM1

PLCQ Request for limitation of patent found admissible

Free format text: ORIGINAL CODE: 0009231

PLCR Communication despatched that request for limitation of patent was allowed

Free format text: ORIGINAL CODE: 0009245

REG Reference to a national code

Ref country code: DE

Ref legal event code: R056

Ref document number: 602017080826

Country of ref document: DE

LIM1 Request for limitation found admissible

Free format text: SEQUENCE NO: 1; FILED DURING OPPOSITION PERIOD

Filing date: 20240725

Effective date: 20240725

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240810

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: HR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240711

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: NO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240710

Ref country code: IS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240810

Ref country code: HR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240711

Ref country code: RS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240710

REG Reference to a national code

Ref country code: ES

Ref legal event code: FG2A

Ref document number: 2987655

Country of ref document: ES

Kind code of ref document: T3

Effective date: 20241115

PUAM (expected) publication of b3 document

Free format text: ORIGINAL CODE: 0009410

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE PATENT HAS BEEN LIMITED

REG Reference to a national code

Ref country code: DE

Ref legal event code: R097

Ref document number: 602017080826

Country of ref document: DE

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: CZ

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: RO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

Ref country code: SK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SM

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SM

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

Ref country code: SK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

Ref country code: RO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

Ref country code: CZ

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

Ref country code: MC

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

26N No opposition filed

Effective date: 20250113

U20 Renewal fee for the european patent with unitary effect paid

Year of fee payment: 9

Effective date: 20250320

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: PL

Payment date: 20250411

Year of fee payment: 9

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: ES

Payment date: 20250530

Year of fee payment: 9

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: CH

Payment date: 20250501

Year of fee payment: 9

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: IE

Payment date: 20250422

Year of fee payment: 9

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: CY

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT; INVALID AB INITIO

Effective date: 20170419

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: HU

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT; INVALID AB INITIO

Effective date: 20170419

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: GB

Payment date: 20260219

Year of fee payment: 10

U20 Renewal fee for the european patent with unitary effect paid

Year of fee payment: 10

Effective date: 20260319

REG Reference to a national code

Ref country code: CH

Ref legal event code: U11

Free format text: ST27 STATUS EVENT CODE: U-0-0-U10-U11 (AS PROVIDED BY THE NATIONAL OFFICE)

Effective date: 20260501