EP3426798A1 - Myo1a for predicting conversion of acute pain into chronic pain and use of myo1a for therapy of pain - Google Patents

Myo1a for predicting conversion of acute pain into chronic pain and use of myo1a for therapy of pain

Info

Publication number
EP3426798A1
EP3426798A1 EP17710176.3A EP17710176A EP3426798A1 EP 3426798 A1 EP3426798 A1 EP 3426798A1 EP 17710176 A EP17710176 A EP 17710176A EP 3426798 A1 EP3426798 A1 EP 3426798A1
Authority
EP
European Patent Office
Prior art keywords
pain
myola
subject
injury
induced chronic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP17710176.3A
Other languages
German (de)
French (fr)
Inventor
Abdelaziz MOQRICH
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aix Marseille Universite
Centre National de la Recherche Scientifique CNRS
Original Assignee
Aix Marseille Universite
Centre National de la Recherche Scientifique CNRS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aix Marseille Universite, Centre National de la Recherche Scientifique CNRS filed Critical Aix Marseille Universite
Priority claimed from PCT/EP2017/055354 external-priority patent/WO2017153424A1/en
Publication of EP3426798A1 publication Critical patent/EP3426798A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276—Knock-out vertebrates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/711—Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5082—Supracellular entities, e.g. tissue, organisms
    • G01N33/5088—Supracellular entities, e.g. tissue, organisms of vertebrates
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/035—Animal model for multifactorial diseases
    • A01K2267/0356—Animal model for processes and diseases of the central nervous system, e.g. stress, learning, schizophrenia, pain, epilepsy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/28—Neurological disorders
    • G01N2800/2842—Pain, e.g. neuropathic pain, psychogenic pain

Definitions

  • the present invention relates to the identification of Myola as a biomarker of conversion of acute pain into chronic pain, and as a therapeutic target.
  • the invention in particular relates to products and methods for assessing the predisposition of a subject to develop an injury- induced chronic mechanical pain and/or an inflammatory- induced chronic thermal pain, and is particularly suited for mammals, preferably human subjects.
  • the present invention more specifically relates to the assessment of the predisposition of a subject to develop an injury- induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain using preferably the MYOIA gene as a biomarker.
  • Inventors herein provide binding reagents specific for MYOIA, compositions, devices, kits containing the same and animal model, and further describe their uses for assessing the predisposition of a subject to suffer from chronic pain.
  • the invention also relates to products and methods for diagnosing, preventing, managing or treating chronic pain.
  • Chronic inflammatory or neuropathic pain gives rise to highly debilitating and long lasting sensory abnormities such as hyperalgesia, allodynia and spontaneous pain (Munro et al., 2009). These symptoms occur as a consequence of aberrantly prolonged sensitization of pain pathways both in the peripheral and central nervous systems, causing either increased facilitation or loss of inhibition in pain-transmitting circuits (Sandkuhler, 2009; Zeilhofer et al., 2012). Diminished spinal inhibition occurs in the setting of inflammation and nerve injury through various mechanisms.
  • prostaglandin E2-mediated inhibition of the inhibitory glycine receptor (Ahmadi et al., 2002; Harvey et al., 2004; Muller et al., 2003; Zeilhofer et al., 2012) and brain-derived neurotrophic factor (BDNF)-mediated downregulation of the potassium chloride exporter KCC2 that perturbs chloride homeostasis thus altering GABAergic and glycinergic inhibitory functions (Coull et al., 2005; Coull et al., 2003; Zeilhofer et al., 2012).
  • BDNF brain-derived neurotrophic factor
  • inventors herein demonstrate for the first time that loss of Myola or an altered expression thereof is associated to the predisposition of a subject to develop an injury- induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain.
  • a first object of the invention thus relates to the use of the DNA or mRNA encoding Myosin IA (Myola), preferably the Myola gene, or of the Myola protein, as a biomarker for assessing the predisposition of a subject to develop an injury- induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain.
  • Myola Myosin IA
  • the present invention also relates to an in vitro method of assessing the predisposition of a subject to develop an injury-induced chronic mechanical pain or an inflammatory-induced chronic thermal pain, wherein the method comprises a step of analyzing, typically sequencing, the Myola nucleic acid sequence obtained from a biological sample of the subject, the detection of an alteration of the nucleic acid sequence of Myola in the subject when compared to the Myola wild-type nucleic acid sequence as identified in SEQ ID NO: 1 indicating that the subject is predisposed to develop an injury- induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain whereas the absence of alteration indicates that the subject is not predisposed to develop an injury- induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain.
  • Myosin IA an agonist of the Myola protein
  • an in vitro or ex vivo screening method of a Myola modulator comprising determining the ability of a drug candidate to activate or stimulate, or on the contrary to decrease or suppress, Myola functional expression and/or biological function, and, if the ability is confirmed, the identification of the drug candidate as a Myola agonist (activator), and potentially as a drug candidate for preventing, reducing or treating pain, or on the contrary as a Myola antagonist (inhibitor).
  • Myola KO Myola -1-
  • Inventors herein reveal the possible use of a Myola KO (Myola -1- ) animal model for screening for Myola modulators and/or for drugs for preventing, reducing or inhibiting pain.
  • kits and devices suitable for implementing the above methods for example a device comprising at least one complementary nucleic acid that binds all or part of the Myola gene or of a Myola gene locus immobilized on a support, typically oligonucleotides for sequencing the Myola nucleic acid, or a kit for assessing the predisposition of a subject to develop an injury-induced chronic mechanical pain or an inflammatory-induced chronic thermal pain comprising oligonucleotides for sequencing the Myola nucleic acid obtained from a biological sample of the subject.
  • the invention relates to the use of a device comprising at least one complementary nucleic acid that binds all or part of the Myola gene or of a Myola gene locus immobilized on a support for assessing the predisposition of a subject to develop an injury- induced chronic mechanical pain or an inflammatory- induced chronic thermal pain.
  • the invention relates to the use of a kit for assessing the predisposition a subject to develop an injury-induced chronic mechanical pain or an inflammatory- induced chronic thermal pain, wherein the kit comprises oligonucleotides for sequencing the Myola nucleic acid obtained from a biological sample of the subject.
  • the subject is any mammalian subject, particularly a human subject.
  • nociceptive pain is generally distinguished from inflammatory pain and from pathological pain which is a disease state caused by damage to the nervous system (i.e., neuropathic pain) or by its abnormal function (dysfunctional pain, like in fibromyalgia, irritable bowel syndrome, tension type headache, etc.).
  • Pain is usually transitory, lasting only until the noxious stimulus is removed or the underlying damage or pathology has healed, but some painful conditions, such as rheumatoid arthritis, peripheral neuropathy, cancer and idiopathic pain (pain that persists after the trauma or pathology has healed, or that arises without any apparent cause), may persist for years. Pain that lasts a long time is called chronic, and pain that resolves quickly is called acute.
  • Pain sensation is conveyed to the brain by sensory neurons which are also called nociceptors.
  • Nociceptors are considered as polymodal since they may respond to multiple forms of noxious or intense stimuli, such as thermal (heat/cold), mechanical, and chemical stimuli.
  • Sensory afferent fibers of nociceptors are heterogeneous in many aspects. For example, sensory nerves are classified as Aa, - ⁇ , - ⁇ and C-fibers according to their diameter and degree of myelination. Then, sensory inputs from the periphery are processed and conveyed to higher brain regions by complex circuits involving excitatory and inhibitory interneurons within the spinal cord (Basbaum et al., 2009; Todd, 2010). The balance between excitation and inhibition is crucial for maintenance of normal sensory function, and dysfunction of these circuits leads to the development of pain such as inflammatory and neuropathic pain.
  • Treatment of pain includes the use of local anesthetics, which block neuronal transmission and affect sensation as well as pain, and analgesics, which relieve pain and additionally may interfere with the activity of chemical mediators of inflammation.
  • Acute pain is usually managed with medications such as analgesics and anesthetics.
  • Management of chronic pain is much more difficult.
  • inadequate treatment of pain is widespread throughout surgical wards, intensive care units, accident and emergency departments, in general practice, in the management of all forms of chronic pain including cancer pain, and in end of life care. This neglect is extended to all ages, from neonates to the frail elderly.
  • Improved treatments of pain are up to date still highly requested by patients in particular when considering neuropathic, inflammatory and/or chronic pains for which treatment remains incomplete whatever the selected known analgesic molecule.
  • the purpose of the present invention is to distinguish between subjects those who are prone to develop chronic pain in order to help the practitioner optimizing pain treatment for them.
  • the patient or subject is an animal, preferably a vertebrate, typically a mammal.
  • the mammal is a human being, whatever its age or sex.
  • the mammal may further be an animal, in particular a domestic or breeding animal, in particular a horse, a dog, a cat, etc.
  • Inventors herein demonstrate that in Myola KO mice, a short lasting and reversible inflammatory, neuropathic and post-operative pain is converted into an irreversible chronic pain, indicating that loss of Myola predisposes the mice to develop chronic pain regardless the etiology of the incurred lesion.
  • Using behavioral pharmacology they found that Myola KO mice were selectively insensitive to the analgesic effects of the GABA A -R agonist muscimol in the setting of inflammation and nerve injury, demonstrating that loss of Myola impaired the ionotropic GABAergic signaling.
  • Myola Myosin IA
  • the mechanical or thermal pain can be a mechanical or thermal allodynia (pain caused by a stimulus that normally is not painful) or hyperalgesia (exaggerated response to a stimulus which is normally painful).
  • the injury-induced chronic mechanical pain is typically an inflammatory-, a neuropathic- and/or a post-operative-chronic mechanical pain.
  • Each of these three classically distinguished kinds of pain is triggered by an injury, i.e. is associated with tissue damage. More particularly, in the context of the invention:
  • neuropathic chronic mechanical pain is triggered by an injury which impacts the nervous system and may or may not involve actual damage to the nervous system, i.e. nerves can be infiltrated or compressed by tumors, strangulated by scar tissue, or inflamed by infection.
  • the pain frequently has burning, lancinating, or electric shock qualities.
  • Persistent allodynia is also a common characteristic of neuropathic pain. The pain may persist for months or years beyond the apparent healing of any damaged tissues.
  • neuropathic pain examples include post herpetic (or post-shingles) neuralgia, reflex sympathetic dystrophy / causalgia (nerve trauma), components of cancer pain, phantom limb pain, entrapment neuropathy (e.g., carpal tunnel syndrome), and peripheral neuropathy (widespread nerve damage).
  • peripheral neuropathy a widespread nerve damage.
  • diabetes is the most common, but the condition can also be caused by chronic alcohol use, exposure to other toxins (including many chemotherapies), vitamin deficiencies, and a large variety of other medical conditions— it is not unusual for the cause of the condition to go undiagnosed; and
  • Myola gene encodes a member of the myosin superfamily, Myosin- la (herein also identified as "Myola”).
  • the protein represents an unconventional myosin. It should not be confused with the conventional skeletal muscle myosin- 1 (MYH1).
  • Unconventional myosins contain the basic domains characteristic of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors.
  • Myosin IA is known to be expressed in neurons of the spinal cord [more specifically in LTMR neurons from the adult lumbar Dorsal Root Ganglion (DRG) also herein identified as "lumbar LTMRs”] and in neurons of specific area of the intestine.
  • DDG lumbar Dorsal Root Ganglion
  • Myosin IA is also expressed in the trigeminal nerve (Tyska, M.J. et al.).
  • the absence, a reduced or insufficient expression or a nonfunctional expression of Myosin IA (Myola) in a subject when compared to the expression observed in a Myola homozygote (Myola +l+ ) reference subject expressing a functional Myosin la (Myola), predisposes the subject to develop an injury- induced chronic mechanical pain and/or an inflammatory- induced chronic thermal pain.
  • the reference subject expressing a functional Myosin la is a Myola homozygote (Myola +/+ ) subject.
  • the Myola gene of the reference subject consists in SEQ ID NO: 1 or in a functional variant thereof.
  • a functional Myola variant of SEQ ID NO:l encodes a functional Myosin la (SEQ ID NO: 2).
  • Functional Myola variants can for example, and without limitations, be selected from orthologs of SEQ ID NO: 1 such as SEQ ID NO: 3 (dog) and SEQ ID NO: 5 (cat).
  • a non- functional expression of Myosin IA is typically associated to a selective upregulation of the a2 subunit of the GABA receptor (GABA-R) in the dorsal root ganglia (DRG) and spinal cord, and can thus be indirectly detected by the skilled person.
  • GABA-R GABA receptor
  • DRG dorsal root ganglia
  • a detected alteration of the GABAergic signaling in a subject should be a reason for verifying the expression of Myosin IA or for sequencing Myola in said subject.
  • a preferred method of assessing the predisposition of a subject to develop an injury-induced chronic mechanical pain or an inflammatory-induced chronic thermal pain is an in vitro method comprising a step of analyzing, preferably sequencing, the Myola nucleic acid sequence obtained from a biological sample of the subject, the detection of an alteration of the nucleic acid sequence of Myola in the subject when compared to the Myola wild-type nucleic acid sequence as identified in SEQ ID NO: 1 , indicating that the subject is predisposed to develop an injury-induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain whereas the absence of alteration indicates that the subject is not predisposed to develop an injury- induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain.
  • the alteration of the nucleic acid sequence is responsible for an abnormal expression of the Myola nucleic acid, typically a reduced, decreased or insufficient expression when compared to the expression observed in a Myola homozygote (Myola +l+ ) reference subject expressing a functional Myola, or of an abnormal, typically a non- functional, expression or activity of the protein (Myola) encoded by the nucleic acid.
  • the alteration in a nucleic acid sequence may be determined at the level of the Myola gene, typically DNA, cDNA or RNA.
  • the detection is performed by sequencing all or part of the gene locus or by selective hybridization or amplification of all or part of the gene locus. More preferably a gene locus specific amplification is carried out before the alteration identification step.
  • the altered nucleic acid or gene locus is typically a nucleic acid or gene locus sequence comprising a mutation or combination of mutations in the coding and/or non-coding region of the locus.
  • the mutation is typically a point mutation, or a deletion or insertion of two or more residues (bases).
  • the point mutation can be a substitution that exchanges one base for another, an insertion in which an extra base is inserted into a new place in the nucleic acid sequence.
  • the point mutation can be a missense mutation, which is a point mutation where a single nucleotide is changed to cause substitution of a different amino acid , or a nonsense mutation, for example a frameshift mutation, that results in a premature stop codon or a nonsense codon in the transcribed mRNA and in a truncated or incomplete protein product.
  • Deletions may encompass any region of two or more residues in a coding or non-coding portion of the gene locus, such as from two residues up to the entire gene or locus. Typical deletions affect smaller regions, such as domains (introns) or repeated sequences or fragments of less than about 50 consecutive base pairs, although larger deletions may occur as well. Insertions may encompass the addition of one or several residues in a coding or non-coding portion of the gene locus. Insertions may typically comprise an addition of between 1 and 50 base pairs in the gene locus. Rearrangement includes inversion of sequences. The gene locus alteration may result in the creation of stop codons, frameshift mutations, amino acid substitutions, particular RNA splicing or processing, product instability, truncated polypeptide production, etc.
  • the mutation stops or decreases the production of a functional protein product or results in a non- functional protein product.
  • the mutation is typically a loss-of- function mutation.
  • the "Myola gene locus” designates all sequences or products in a cell or organism including the Myola coding sequences, Myola non-coding sequences (e.g., introns), Myola regulatory sequences controlling transcription and/or translation (e.g., promoter, enhancer/silencer regions, terminator, 5'UTR, 3'UTR, etc.), all corresponding expression products, such as Myola RNAs (e.g., mRNAs); as well as surrounding sequences of 20 kb region, preferably 15.3 kb region, upstream the starting codon (flanking the 5'UTR region) of the Myola gene and 20 kb region, preferably 14.1 kb region, downstream the untranslated region (flanking the 3'UTR region). In a particular embodiment most alterations are not in the promoter sequence.
  • Myola non-coding sequences e.g., introns
  • Myola regulatory sequences controlling transcription and/or translation e.g.,
  • the altered Myola nucleic acid is a Myola wild-type nucleic acid comprising at least one point mutation, preferably a single nucleotide polymorphism (SNP), for example a loss-of-function SNP, i.e., a SNP responsible for the absent or abnormal (non-functional) expression of the protein encoded by the nucleic acid.
  • SNP single nucleotide polymorphism
  • the Myola wild-type nucleic acid may also comprise several single nucleotide polymorphism(s) (SNPs).
  • any SNP in linkage disequilibrium with a first SNP associated with chronic pain predisposition phenotype will be associated with this trait. Therefore, once the association has been demonstrated between a given SNP and chronic pain predisposition phenotype, the discovery of additional SNPs associated with this trait can be of great interest in order to increase the density of SNPs in this particular region.
  • Identification of additional SNPs in linkage disequilibrium with a given SNP involves: (a) amplifying a fragment from the genomic region comprising or surrounding a first SNP from a plurality of individuals; (b) identifying of second SNP in the genomic region harboring or surrounding said first SNP; (c) conducting a linkage disequilibrium analysis between said first SNP and second SNP; and (d) selecting said second SNP as being in linkage disequilibrium with said first marker. Sub-combinations comprising steps (b) and (c) are also contemplated.
  • SNPs in linkage disequilibrium can also be used in the methods according to the present invention, and more particularly in the methods of assessing the predisposition of a subject to develop an injury- induced chronic mechanical pain or an inflammatory-induced chronic thermal pain according to the present invention.
  • Mutations in a gene locus which are responsible for chronic pain predisposition phenotype may be identified by comparing the sequences of the gene locus from patients presenting chronic pain predisposition phenotype to the sequences of the gene locus from reference patients (as defined herein above containing SEQ ID NO: l or a functional variant thereof). Based on the identified SNPs or association of SNPs of the Myola gene, the identified locus can be scanned for mutations.
  • functional regions such as exons and splice sites, promoters and other regulatory regions of the gene locus are scanned for mutations.
  • patients presenting chronic pain predisposition phenotype carry a mutation or a mutated allele shown to be associated with chronic pain predisposition phenotype and referent patients do not carry the mutation or mutated allele associated with chronic pain predisposition phenotype.
  • the method used to detect such mutations generally comprises the following steps: amplification of a region of the gene locus of interest comprising a SNP or a group of SNPs associated with chronic pain predisposition phenotype from DNA samples of the gene locus from patients presenting chronic pain predisposition and from referent patients; sequencing of the amplified region; comparison of DNA sequences of the Myola genes from patients presenting chronic pain predisposition phenotype and from patients presenting referent phenotype; determination of mutations specific to patients presenting chronic pain predisposition phenotype.
  • the method of assessing the predisposition of a subject to develop an injury-induced chronic mechanical pain or an inflammatory- induced chronic thermal pain is an in vitro method comprising the following steps of (a) obtaining from the subject a test sample of Myola DNA, cDNA or RNA, preferably DNA, (b) contacting the test sample with at least one nucleic acid probe, wherein said nucleic acid is complementary to and specifically hybridises with a targeted altered Myola nucleic acid sequence preferably comprising at least one mutation, typically a point mutation, for example a single nucleotide polymorphism (SNP), to form a hybridization sample, (c) maintaining the hybridization sample under conditions sufficient for the specific hybridization of the targeted nucleic acid sequence with the nucleic acid probe to occur, and (d) detecting whether there is specific hybridization of the altered targeted nucleic acid sequence with the nucleic acid probe, such a specific hybridization revealing the predisposition of the subject to develop an injury- induced chronic mechanical
  • nucleic acid obtained from cells of a biological sample which is typically a blood sample, a plasma sample or a serum sample of the subject.
  • the alteration may also be determined at the level of the Myosin IA polypeptide (e.g., a pre-protein and the mature protein).
  • the presence of an alteration in a nucleic acid may be easily detected by the man skilled in the art using methods of the art such as restriction digestion, sequencing, selective hybridisation (for example with a nucleic acid probe present on a nucleotide array), and/or selective amplification, as further explained below.
  • Alterations in a gene may also be detected by determining the presence of an altered RNA expression.
  • Altered RNA expression includes the presence of an altered RNA sequence, the presence of an altered RNA splicing or processing, the presence of an altered quantity of RNA, etc. These may be detected by various techniques known in the art, including by sequencing all or part of the RNA or by selective hybridisation or selective amplification of all or part of said RNA, for instance.
  • telomere sequence may be detected in particular by real time quantitative reverse transcription PCR (qRT-PCR) using probes designed to hybridize within the target nucleic acid sequence (see O'Driscoll L. et al., 1993 and Yajima T. et al, 1998).
  • the method comprises detecting the presence of an altered expression of the polypeptide or protein encoded by the gene of interest.
  • Altered polypeptide expression includes the presence of an altered polypeptide sequence, the presence of an altered quantity of polypeptide, the presence of an altered tissue distribution, etc. These may be detected by various techniques known in the art, including by sequencing and/or binding to specific ligands (such as antibodies), for instance.
  • the detection of an abnormal protein expression may be easily performed, by the man skilled in the art, by measuring the cellular level of mRNA encoding a normal protein, a decreased level compared to a control or standard level being correlated to an abnormal protein expression.
  • Sequencing can be carried out using techniques well known in the art, using automatic sequencers.
  • the sequencing may be performed on the complete gene locus or, more preferably, on specific domains thereof, typically those known or suspected to carry deleterious mutations or other alterations.
  • Amplification is based on the formation of specific hybrids between complementary nucleic acid sequences that serve to initiate nucleic acid reproduction.
  • Amplification may be performed according to various techniques known in the art, such as by polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA) and nucleic acid sequence based amplification (NASBA). These techniques can be performed using commercially available reagents and protocols.
  • Preferred techniques use allele-specific PCR or PCR-SSCP.
  • Nucleic acid primers useful for amplifying sequences from the gene locus of interest are able to specifically hybridize with a portion of the gene locus that flank a target region of said locus, said target region being altered in subjects predisposed to develop an injury- induced chronic mechanical pain or an inflammatory- induced chronic thermal pain.
  • nucleic acid primer useful for amplifying sequences from the Myola gene or locus of interest including surrounding regions.
  • Such primers are preferably complementary to, and hybridize specifically to nucleic acid sequences in the gene locus.
  • Particular primers are able to specifically hybridize with a portion of the gene locus that flank a target region of said locus, said target region being altered in subjects predisposed to develop an injury- induced chronic mechanical pain or an inflammatory-induced chronic thermal pain.
  • Primers that can be used to amplify a target region comprising SNPs may be designed based on their sequence or on the genomic sequence of the Myola gene.
  • the invention also relates to a nucleic acid primer, said primer being complementary to and hybridizing specifically to a portion of the Myola gene locus coding sequence (e.g., gene or RNA) altered in certain subjects predisposed to develop an injury-induced chronic mechanical pain or an inflammatory-induced chronic thermal pain.
  • a portion of the Myola gene locus coding sequence e.g., gene or RNA
  • particular primers of this invention are specific for altered sequences in a Myola gene locus or RNA.
  • the invention also concerns the use of a nucleic acid primer or a pair of nucleic acid primers as mentioned above, and as herein identified, in a method of assessing the predisposition of a subject to develop an injury- induced chronic mechanical pain or an inflammatory- induced chronic thermal pain.
  • Hybridization detection methods are based on the formation of specific hybrids between complementary nucleic acid sequences that serve to detect nucleic acid sequence alteration(s).
  • a particular detection technique involves the use of a nucleic acid probe specific for wild-type (or a functional variant thereof) or altered gene or corresponding RNA, followed by the detection of the presence of a hybrid.
  • the probe may be in suspension or immobilized on a substrate or support (as in nucleic acid array or chips technologies).
  • the probe is typically labeled to facilitate detection of hybrids.
  • a particular embodiment of this invention comprises contacting the sample from the subject with a nucleic acid probe specific for an altered Myola gene locus, and assessing the formation of an hybrid.
  • the method comprises contacting simultaneously the sample with a set of probes that are specific, respectively, for wild type Myola gene locus and for various altered forms thereof.
  • a set of probes that are specific, respectively, for wild type Myola gene locus and for various altered forms thereof.
  • various samples from a single subject or from various subjects may be treated in parallel.
  • a probe refers to a polynucleotide sequence which is complementary to and capable of specific hybridization with a (target portion of) the Myola gene or RNA, and which is suitable for detecting mutations associated with the gene alleles which predispose to an injury-induced chronic mechanical pain or an inflammatory-induced chronic thermal pain ("mutated allele").
  • Probes are preferably perfectly complementary to the particular Myola gene, RNA, or target portion thereof. Probes typically comprise single-stranded nucleic acids of between 8 to 1000 nucleotides in length, for instance of between 10 and 800, more preferably of between 15 and 700, typically of between 20 and 500. It should be understood that longer probes may be used as well.
  • a preferred probe of this invention is a single stranded nucleic acid molecule of between 8 to 500 nucleotides in length, which can specifically hybridize to a region of a Myola gene locus or RNA that carries an alteration.
  • the method of the invention employs a nucleic acid probe specific for an altered (e.g., a mutated) Myola gene or RNA, i.e., a nucleic acid probe that specifically hybridizes to said altered Myola gene or RNA and essentially does not hybridize to a Myola gene or RNA lacking said alteration.
  • a nucleic acid probe specific for an altered (e.g., a mutated) Myola gene or RNA i.e., a nucleic acid probe that specifically hybridizes to said altered Myola gene or RNA and essentially does not hybridize to a Myola gene or RNA lacking said alteration.
  • the invention also concerns the use of a nucleic acid probe as described above, and as herein identified, in a method of assessing the predisposition of a subject to develop an injury-induced chronic mechanical pain or an inflammatory- induced chronic thermal pain.
  • alteration in the Myola gene locus may also be detected by screening for alteration(s) in Myola polypeptide sequence or expression levels in a sample of a tissue expressing the protein of interest (Myosin IA).
  • immunohistochemistry for example in a biopsy
  • immunoblotting in particular Western blot
  • proteomics or antibody-based biosensors directed against the protein of interest (Myosin IA)
  • Myosin IA antibody-based biosensors directed against the protein of interest
  • ligands may be used, such as specific antibodies.
  • the sample is contacted with an antibody specific for a Myosin IA encoded by a particular nucleic acid and the formation of a complex is determined.
  • Various methods for detecting such a complex can be used, such as ELISA, radio-immunoassays ( IA) and immuno- enzymatic assays (IEMA).
  • an antibody designates a polyclonal antibody, a monoclonal antibody, as well as fragments or derivatives thereof having substantially the same antigen specificity. Fragments include Fab, Fab'2, CDR regions, etc. Derivatives include single-chain antibodies, humanized antibodies, poly- functional antibodies, etc.
  • An antibody specific for a polypeptide encoded by a particular gene designates an antibody that selectively binds said polypeptide, i.e., an antibody raised against said polypeptide or an epitope-containing fragment thereof.
  • the methods according to the invention of assessing the predisposition of a subject to develop an injury-induced chronic mechanical pain or an inflammatory-induced chronic thermal pain are preferably performed on a subject before any surgical procedure.
  • kits to assess the predisposition of a subject to develop an injury-induced chronic mechanical pain or an inflammatory-induced chronic thermal pain comprising products and reagents for detecting in a sample from a subject the presence of an alteration in a Myola gene locus or in the corresponding polypeptide or protein; in the Myola gene or corresponding polypeptide or protein expression; and/or in the Myola gene activity.
  • kits comprise any nucleic acid, typically any primer, any pair of primers and/or any nucleic acid probes (wild-type and mutant); any ligand, preferably antibody, described in the present invention; and/or any device comprising such nucleic acid(s) and/or ligand(s) immobilized on a support.
  • the herein described kits can further comprise reagents and/or protocols for performing a hybridization, amplification or antigen-antibody immune reaction.
  • kits may further comprise a micro-array to be used for the herein described methods and read through quantitative PCR or multiplex technology.
  • a particular device comprises at least one complementary nucleic acid, preferably several complementary nucleic acids, that bind all or part of the Myola gene or of a Myola gene locus immobilized on a support
  • kits typically kits for assessing the predisposition of a subject to develop an injury- induced chronic mechanical pain or an inflammatory- induced chronic thermal pain, are the following kits:
  • kits for sequencing the Myola nucleic acid obtained from a biological sample of a subject comprising nucleic acid sequences, typically oligonucleotides, for example primers or pair(s) of primers;
  • treatment designates delaying, stabilizing, curing, healing, alleviating, relieving, altering, ameliorating, improving, remedying or affecting any form of pain in a subject as described herein, or any disease or condition associated with pain (in particular any inflammatory or neuropathic condition associated with pain), or any symptom of such a disease or condition, after the application or administration of a suitable compound or a composition according to the invention.
  • treatment also refers to any indicator of success in the treatment of pain (which may be associated with any injury, pathology or condition), including any objective or subjective parameter such as abatement, remission, slowing progression or severity, stabilization, diminishing of symptoms of pain, or making it more tolerable to the subject.
  • treating also includes increasing pain tolerance and/or decreasing perceived pain.
  • the methods, compounds and composition of the invention are for increasing pain tolerance and/or for decreasing perceived pain.
  • pain tolerance refers to the amount of pain that a subject can perceive and withstand before breaking down emotionally and/or physically. Pain tolerance is distinct from pain threshold (the minimum stimulus necessary to produce pain).
  • increasing pain tolerance generally refers to a situation where a subject can develop a greater pain tolerance (that is, less perceived pain) when compared to a previous state, for instance, following administration of suitable compounds or compositions to a subject.
  • preventing or “prevention” in relation to pain in a subject, refers to at least the reduction of likelihood of the risk of (or susceptibility to) acquiring any kind of pain by a subject, after the application or administration of a suitable compound or a composition according to the invention.
  • "preventing” includes causing at least one of the clinical symptoms of pain, typically chronic pain, not to develop in a subject, typically in a subject identified as predisposed to chronic pain, in particular to an injury-induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain, but does not yet experience or display symptoms of pain.
  • the adapted treatment of pain according to the present invention typically involves the exogenous supply, administration for example, to the subject, of a nucleic acid sequence (typically a DNA or a mRNA) encoding Myola, and/or of an agonist of the Myosin la protein.
  • Administration can be for example an intrathecal (i.t.) administration.
  • An object of the invention therefore concern a nucleic acid sequence (typically a DNA or a mRNA) encoding Myola, and/or an agonist of the Myosin la protein, Myola being a functional Myola, for use for preventing or treating pain, in particular an injury-induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain, in a subject as herein defined.
  • a nucleic acid sequence typically a DNA or a mRNA
  • Myola being a functional Myola
  • the term "agonist of the Myosin 1 a protein” is used to designate any protein capable of activating or stimulating the biological function of the wild-type Myosin IA protein or of restoring the function of a functionally altered Myosin IA protein.
  • Such an agonist can be a natural or recombinant protein or a protein fragment that exhibits the properties of the corresponding wild-type protein, in particular that is able to activate or stimulate the biological function of the wild-type Myosin IA protein or of restoring the function of a functionally altered Myosin IA protein.
  • the present invention also concerns the use of a DNA encoding Myola, a mRNA encoding Myola, or an agonist of the Myosin la protein, Myola being a functional Myola, for preparing a composition, typically a pharmaceutical composition, for preventing or treating pain, in particular an injury- induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain, in a subject.
  • the present invention further concerns a composition
  • a composition comprising a DNA encoding Myola, a mRNA encoding Myola, or an agonist of the Myosin la protein and a pharmaceutically acceptable carrier or support, typically a composition for use for preventing or treating pain, in particular an injury- induced chronic mechanical pain and/or an inflammatory- induced chronic thermal pain, in a subject.
  • a pharmaceutically acceptable carrier or support typically a composition for use for preventing or treating pain, in particular an injury- induced chronic mechanical pain and/or an inflammatory- induced chronic thermal pain, in a subject.
  • Appropriate excipient, diluant or carrier usable in the all present invention may be selected for example from saline, isotonic, sterile or buffered solutions, etc. They can further comprise stabilizing, sweetening and/or surface-active agents, etc. They can be formulated in the form of ampoules, flasks, tablets, or capsules, by using techniques of galenic known
  • the present invention also relates to a method for preventing or treating pain, in particular injury- induced chronic mechanical pain and/or an inflammatory- induced chronic thermal pain, comprising the administration to the subject, typically a mammal, in particular a human being, in need thereof, of at least one compound selected from the previously described product.
  • a subject in need of a treatment or prophylaxis is subject that has been tested and identified as predisposed to develop an injury- induced chronic mechanical pain and/or an inflammatory- induced chronic thermal pain according to the method described above.
  • the present invention also provides:
  • an in vitro, in vivo or ex vivo method for screening or selecting a compound that is able to prevent the conversion of acute pain into chronic pain, in particular the occurrence of an injury-induced chronic mechanical pain and/or an inflammatory- induced chronic thermal pain in a subject identified as predisposed to such a pain the method comprising a step of assessing the expression of Myola by a particular cell, tissue or animal model in the presence of a test compound, wherein an increased expression of functional Myola by the particular cell, tissue or animal model, in comparison with a control cell, tissue or animal model that has not been exposed to or contacted with the test compound, is indicative of the capacity of said compound to prevent the conversion of acute pain into chronic, in particular the occurrence of an injury- induced chronic mechanical pain and/or an inflammatory- induced chronic thermal pain in a subject identified as predisposed to such a pain,
  • an in vitro, in vivo or ex vivo screening method of a Myola modulator comprising determining the ability of a drug candidate to activate or stimulate, or on the contrary to decrease or suppress, Myola functional expression and/or biological function, and, if the ability is confirmed, the identification of the drag candidate as a Myola agonist (activator), and potentially as a drag candidate for preventing, reducing or treating pain, or on the contrary as a Myola antagonist (inhibitor), and
  • an in vitro or ex vivo screening method of a drag candidate for preventing, reducing or treating pain comprising determining the ability of a drag candidate to activate or stimulate, or on the contrary to decrease or suppress, Myola functional expression, and, if the ability is confirmed, the identification of the drag candidate as a Myo 1 a agonist and as a drag candidate for preventing, reducing or treating pain, or on the contrary as a Myola antagonist.
  • the compounds identified with one of the herein described screening methods may be used, in the context of the present invention, for preventing or treating pain in a subject, in particular injury- induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain.
  • Myola KO mice Myola -/- mice
  • This mouse model is described in Tyska et al. (2005).
  • An object of the invention thus concerns the use of such a Myola KO (Myola -/- ) animal model for screening for Myola modulators and/or for drags for preventing, reducing or inhibiting pain.
  • Myola KO Myola -/-
  • This model can be used to design appropriate pharmacological therapies to prevent the onset and establishment of chronic pain.
  • This model can further be used to as a laboratory tool for use in research to deepen the understanding of the cellular and molecular mechanisms that trigger the transition from acute to chronic pain.
  • A-C Characterization of Myo la-expressing neurons in adult lumbar Dorsal Root Ganglion (DRG).
  • ISH using Myola antisense probe (red) followed by double immunolabeling with anti-GINIP (blue) antibody and IB4 (green) (A) or anti-Ret antibody (blue) (C).
  • B Double-ISH using Myola (red) and TrkB antisense probes (green). Scale bars: 100 ⁇ m.
  • A Venn diagram representing the number of differentially expressed (DE) genes (5% false discover rate) in KO mice with respect to WT in DRG (97 DE genes) and SC (31 DE genes) neurons. Genes differentially expressed only in DRG are represented in red (84 genes), only in SC in blue (18 genes) or in both DRG and SC neurons in yellow (13 genes).
  • (C) Quantification of Wdfyl, Gabra2 and Nnt transcripts in DRG and SC tissues from WT and KO mice. Data represent the mean fold-change of KO vs WT ⁇ SEM (n 3 independent experiments).
  • C-F Whole cell recordings of spontaneous EPSC in laminae II interneurons after Muse application in naive (C-D) and in zymosan-inflammed WT and KO mice (E-F).
  • Middle panels Cumulative distribution of EPSC intervals (in seconds) for the experiments shown in the left panels. Note the shift of the Musc/blue curves towards the left (C, D, E middle panels), indicating a reversible increase in EPSC frequency.
  • FIG. 5 Adult DRG neurons survival, specification, central and peripheral innervation are not impaired in absence of MYOIA.
  • A-B Cell counts of total PGP9.5 + (A) and of indicated subsets (B) realized on adult lumbar L4 DRG sections from WT and KO mice. Data represent the mean absolute values (A) or the mean % of PGP9.5 neurons (B) ⁇ SEM of three independent experiments. No statistically significant differences were observed between genotypes.
  • the graph represents the number of Action Potentials (AP) evoked by depolarizing current steps of increasing amplitude ( ⁇ 10 pA, 1000 ms) of WT (black) and KO C-LTMRs (grey).
  • the cell capacitance (upper panel) and resting membrane potential (lower panel) of WT and KO ⁇ - LTMRs are shown in E.
  • APs were evoked by depolarizing (F-G upper panels) or hyperpolarizing (F-G lower panels) current injection (1000 ms, ⁇ . ⁇ or ⁇ -0.1 ⁇ , respectively).
  • F The figure shows representative traces obtained for WT (black) and KO (red) ⁇ -LTMRs.
  • G The curves represent the probability of AP firing as function of the injected current during depolarizing (upper panels) or following hyperpolarizing (lower panels) current injection, respectively.
  • the AP rebound observed at the termination of the hyperpolarizing pulse is a characteristic of ⁇ - LTMRs.
  • Peak amplitude (I-peak) was normalized to obtain the current /probe displacement curve.
  • the curves show the normalized peak current (I-peak) as function of the probe displacement.
  • Mean normalized amplitudes do not differ between WT and KO ⁇ -LTMRs.
  • Figure 7 Behavioral characterization of naive Myola KO mice and Myola +/" mice and thermal and mechanical hypersensitivity post-injury.
  • the graphs represent the average membrane potential (A), the membrane resistance (B), the capacitance (C), the Sag ratio in response to -25pA hyperpolarizing pulse (D), the number of rebound AP in response to -25 current pulses (E) and the number of AP in response of +25 pA current pulses
  • FIGs 1 A, B, C, D, E, Figures 3 D, E, G and Figures 5 C, D, E, F, G are each shown twice (identical figures showing colors with different contrasts).
  • mice were maintained under standard housing conditions (23 °C, 40% humidity, 12 h light cycles, and free access to food and water). Special effort was made to minimize the number as well as the stress and suffering of mice used in this study. All protocols are in agreement with European Union recommendations for animal experimentation.
  • Myola KO mice were generated by Tyska et al., 2005 (Tyska et al., 2005). Control wild-type (WT)
  • WT Tafa4 + Venus
  • Myola KO Tafa4 + Venus mice were generated by crossing WT and Myola KO mice respectively with Tafa4 Venus/Venus (Delfini et al . ,
  • mice were deeply anesthetized with a mix of ketamine/xylazine and then transcardially perfused with an ice-cold solution of paraformaldehyde 4% in 0.1 M phosphate buffer (4% PFA). Tissues were further fixed for 24h in ice-cold 4% PFA. Newborn P0 mice were sacrificed, rapidly washed in ice-cold PBS, eviscerated and fixed for 24h in ice-cold 4% PFA.
  • ISH in situ hybridization
  • Digoxigenin-labeled Myola and Gabra2 antisense probes and Fluorescein-labeled TrkB probe were synthetized using gene-specific PCR primers and cDNA templates from adult mouse DRG and in situ hybridization or double in situ hybridization was carried as described in (Reynders et al., 2015).
  • the primers used for probe synthesis are listed below:
  • Myola Fl GAAAATACTTCCGGTCAGGTG
  • Myola Rl CAAGGGTTCTTCATCTCTGAGT
  • Myola F2 TACCAGTGGAAGTGCAAGAAGT
  • Myola R2+T7 TAATACGACTCACTATAGGGACACTACGAAGTTCTGCTCCAG
  • Gabra2 F1/F2 ACTTGGTTACTTTTGGGCTGT
  • Gabra2 Rl TGA TTGAA GTGA GCTGAAA GGT
  • Gabra2 R2+T7 TAA TACGA CTCA CTA TA GGGAA CA TCCTTTCA TGGTGA CTCA
  • TrkB-Fl CTGAGAGGGCCAGTCACTTC
  • TrkB-Rl CATGGCAGGTCAACAAGCTA
  • TrkB-F2 CAGTGGGTCTCAGCACAGAA
  • TrkB-R2+T7 TAATACGACTCACTATAGGGCTAGGACCAGGATGGCTCTG
  • Immunostainings were done with rat anti-GINIP (1 :500, Moqrich laboratory), goat anti-Ret (1 :500, R&D Systems), rabbit anti-TrkA (1 :1000, generous gift from Dr. L. Reichardt, University of California), goat anti- TrkC (1 :500, R&D Systems), rabbit anti-CGRP (1 :1000, ImmunoStar), rabbit anti-PKCy (1 :500, Santa Cruz), rabbit anti- PGP9.5 (1 :200, Thermo Scientific), rabbit-anti S100 (1 :1000, Darko), rabbit anti-GABRA2 (1 :2000, Synaptic Systems) and guinea pig anti-GABRAl (1 :1000, Synaptic Systems).
  • IB4 labelling was performed with Alexa Fluor 488-conjugated IB4 from Invitrogen. Slides were mounted with ImmuMount (Thermo Scientific) prior to observation under Axiolmager Zl (Zeiss) fluorescence microscope. Contrast was adjusted using Photoshop software. For the comparison of Gabra2 expression between WT and Myola KO, images were acquired using the same exposure parameters and contrast was adjusted equivalently.
  • the intensity of fluorescence (mean florescence of pixels in the region of interest) per mm 2 related to GABRA2 expression was determined in the laminae I-III of WT and Myola KO SC sections using ImageJ software. For each genotype, three independent experiments were performed and 5-10 SC sections were analyzed and the fold change in the intensity of fluorescence of Myola KO versus WT specimens was calculated.
  • SNC80 (Tocris Bioscience) was dissolved in a lOOmM HC1 solution, DAMGO (Sigma Aldrich) was dissolved in saline (0.9% NaCl), Baclofen (Sigma Aldrich) was dissolved in H 2 0 (pH7.6), recombinant human TAFA4 (R&D Systems) was dissolved in saline, Diazepam (DZP, Roche) was dissolved in 10% dimethyl sulfoxide (DMSO) / 90%> saline, Muscimol (Tocris Bioscience), Taurine (Sigma Aldrich), Bicuculline (Sigma Aldrich) and Pregabalin (Sigma Aldrich) were dissolved in Phosphate Buffer (PB, 50 mM, pH 7.4).
  • PB Phosphate Buffer
  • pregabalin All drugs were administrated via intratechal (i.t) injection. The dosages are indicated in the figure legends.
  • Pregabalin was injected intra-peritoneally (i.p). Response to mechanical stimulations was recorded 30 min up to 6h after drug administration as indicated in the figure legends.
  • Acetone drop evaporation assay (Hulse et al., 2012) was used to assess na ' ive mice sensitivity to innocuous skin cooling. A drop of acetone was applied on the left hind paw using a 1 ml syringe. The duration of flinching/pain like behavior (seconds) was recorded immediately following acetone application for a total period of 2 minutes. The test was repeated twice and the mean duration of flinching/pain behavior was calculated. Heat hypersensitivity
  • Hind paw heat hypersensitivity was determined prior and after carrageenan inflammation as well as after paw incision surgery, using Hargr eaves test, as described in Gaillard et al., 2014.
  • the test was performed at several time points (see legend) starting from one day and up to 60 days after inflammation.
  • the test was performed at several time points (see legend) starting from one day and up to 30 days after inflammation.
  • Unilateral peripheral mono-neuropathy was induced in ketamin/xylasin-anesthetized mice by performing three loosely tied ligatures (with about 1mm spacing) around the common sciatic nerve (Bennett and Xie, 1988) using monocryl resorbable suture filaments (6-0, Ethicon, Piscataway, NJ, USA). The nerve was constricted to a barely discernable degree, so that circulation through the epineurial vasculature was not interrupted. After surgery, the animals were allowed to recover in a warming chamber, and then they were returned to their home cages. Mechanical thresholds were measured before CCI and at several time-points (see legend) starting from 3 day and up to 60 days after surgery.
  • mice were anesthetised with ketamin/xylasin and a 5 mm longitudinal incision of the plantar face of the right hindpaw, starting from 2-5 mm from the proximal edge of the heel was performed.
  • the plantar muscle was then carefully elevated with forceps and incised longitudinally with a blade, while leaving muscle's origins intact.
  • the wound was closed with one horizontal mattress suture using 6.0 silk monofilament (Ethicon, Piscataway, NJ, USA) and the wound site was covered with betadine ointment. After surgery, the animals were allowed to recover in a warming chamber, and returned to their home cages. Mechanical thresholds were determined prior to and up to 60 days after surgery (see legend) starting from 6 hours post-injury.
  • SNI Spared-nerve injury
  • mice were anesthetized with a mix of ketamine/xylazine and an incision was made through the skin and thigh muscle at the level of the trifur cation of the sciatic nerve.
  • the common sural and peroneal nerves were ligated using a 6.0 silk filament (Ethicon, Piscataway, NJ, USA) and transected, while leaving the tibial nerve intact.
  • the animals were allowed to recover in a warming chamber, and then they were returned to their home cages. Mechanical thresholds were determined at days 7, 9 and 14 post-surgery, before and after drug administration.
  • RNAs were loaded on a RNA NanoChip (Agilent) and processed with 2100 Bioanalyzer system (Agilent technology).
  • RNA-seq libraries were prepared using the TruSeq RNA Sample Preparation Kit (Illumina). All libraries were validated for concentration and fragment size using Agilent DNA1000 chips. Sequencing was performed on a HiSeq 2000 (Illumina), base calling performed using RTA (Illumina) and quality control performed using FastQC (FASTQC, 2010) and RSeQC (Wang et al., 2012). Sequences were uniquely mapped to the mmlO genome using Subread (Liao et al., 2013) (C version 1.4.6-p2) using default values.
  • RNA obtained from each sample was converted into cDNA using Superscript III Reverse Transcriptase (Invitrogen). Gene expression was assessed by quantitative PCR (qPCR), using qPCR Sybr-Green master mix (ThermoFisher). Samples were run for 40 cycles on a StepOne qPCR apparatus (Applied Biosystems). The relative quantity of transcripts encoding each gene was determined by normalization to ⁇ -actin using the standard ACt or AACt method.
  • Myola F CTACGAGCAGCTTCCCATCT Myola R: CCACATTTGCCAAAGCATAG
  • Gabra2 F ACAAAAAGAGGATGGGCTTG
  • Gabra2 R TCATGACGGAGCCTTTCTCT
  • Wfdyl F AAAGGCCGGACACTCCTC
  • Nnt F CCTGGTGGCACCTTCGTA
  • DRGs were washed twice with HBSS-glu and resuspended in NBc medium (NBc: Neurobasal (Gibco), 1% (v/v) B27 (Gibco), lOOOU/ml penicillin (Invitrogen), 1000 ⁇ g/ml streptomycin (Invitrogen)).
  • NBc Neurobasal (Gibco), 1% (v/v) B27 (Gibco), lOOOU/ml penicillin (Invitrogen), 1000 ⁇ g/ml streptomycin (Invitrogen)).
  • Single cell suspensions were obtained by passages through 3 needle tips of decreasing diameter (gauge 18, 21, 26).
  • C- LTMRs were identified through to live Venus fluorescence and Ad-LTMRs were identified thanks to their "rosette"- like morphology (Dubreuil et al, 2004). Patch-Clamp recordings were performed 18-30h after plating.
  • Electrophysiological recordings were performed using an Axopatch 200B amplifier. Data were analyzed by pCLAMP 10.5 (Molecular Devices).
  • Patch clamp recordings of cultured ⁇ -LTMRs were performed with 1 to 3 ⁇ pipettes filled with a KCl-based solution containing (in mM): 105 K Aspartate, 10 NaCl, 27 KCl, 4 Mg-ATP, 0.4 Na-GTP, 5 Creatine-Phosphate (sodium salt), 1 CaCl 2 , 10 EGTA, 1 MgCl 2 , 10 HEPES (pH 7.2 with KOH, «329mOsm).
  • Neurons were perfused at a flow rate of 2-3 ml/min with standard external solution containing (in mM): 140 NaCl, 4 KCl, 2 MgCl 2 , 2 CaCl 2 , 10 HEPES and 10 glucose (pH 7.4).
  • Muscimol (Tocris Bioscience) was prepared in water and dissolved in the external solution at the desired concentration. Muscimol was applied in the bath for 10s. Mechanical-activated currents
  • Transverse spinal cord slices with attached dorsal roots from juvenile (P24 to P45) Myola KO and WT mice were prepared for whole-cell recording. Briefly, the animals were anesthetized using Pentobarbital (200mg/kg), perfused with ice cold oxygenated low calcium artificial cerebrospinal fluid (ACSF; in mM: NaCl 101; KC1 3.8; MgCl 2 18.7, MgS0 4 1.3; KH 2 P0 4 1.2; HEPES 10; CaCl 2 1 ; Glucose 1), and then beheaded. The vertebral column and surrounding muscles were quickly removed and immersed in ice cold oxygenated ACSF.
  • Pentobarbital 200mg/kg
  • ice cold oxygenated low calcium artificial cerebrospinal fluid in mM: NaCl 101; KC1 3.8; MgCl 2 18.7, MgS0 4 1.3; KH 2 P0 4 1.2; HEPES 10; CaCl 2 1 ;
  • mice To gain insights into the role of MYOIA in sensory physiology, inventors sought to analyze Myola KO mice (Tyska et al., 2005). These mice are viable, fertile and most of the perturbations described were related to the intestine biology where this atypical myosin protein is highly expressed (Kravtsov et al., 2012; Mazzolini et al., 2012). However nothing was known about the role of MYOIA in the somatosensory system.
  • Myola KO mice had normal behavior in the open filed and rotarod tests ( Figures 7A-C), they exhibited no difference in their ability to sense noxious heat stimuli in the hot plate test and displayed normal response to the acetone test ( Figures 7D and 7E). They then tested the mechanical sensitivity of their mice under acute and 3 different pathological conditions: Carrageenan-induced inflammation, the chronic constriction injury model (CCI) (Bennett and Xie, 1988), and the Brennan test (Brennan, 1999).
  • CCI chronic constriction injury model
  • Myola KO mice resistance to the analgesic effect of muscimol was also confirmed in the zymosan A-induced inflammatory pain model (Witschi et al., 2011). Inventors first showed that zymosan-induced inflammation also resulted in a prolonged and irreversible mechanical hypersensitivity in Myola KO mice ( Figure 2E). IT administration of muscimol or the GABA A -Rs positive allosteric modulator diazepam (DZP) strongly reversed zymosan-induced mechanical hypersensitivity in WT mice but had no effect on Myola KO mice ( Figures 2F and 2G). Importantly, injection of SNC80 strongly reversed the mechanical pain in both genotypes ( Figure 2H). Together, these data demonstrate that Myola KO mice predisposition to develop injury-induced chronic mechanical pain is due to a selective impairment of the ionotropic GABAergic inhibitory neurotransmission.
  • DZP GABA A -Rs positive allosteric modulator diazep
  • GABAergic inhibition may be altered by several means both in peripheral and central nervous systems. These include altered subunit composition of GABA A -Rs, altered levels of GABA, GABA release probability and the speed of its removal from the synaptic cleft, and change in chloride gradient that switches GABA-mediated inhibition into excitation (Sandkuhler, 2009). In order to unravel which of these mechanisms are affected in Myola KO mice we used an unbiased RNA deep sequencing screen.
  • Table 1 Summary of read mappings from RNA-seq of polyA mRNA prepared from DRG and SC of WT and Myola KO mice.
  • Table 3 Differentially expressed genes in SC of Myola KO vs WT mice.
  • Myola KO mice selective alteration of the ionotropic GABAergic neurotransmission revealed by inventors' behavioral experiments prompted them to focus on Gabra2 gene.
  • Gabra2 was the only GABA receptor subunit that displayed altered expression in Myola KO mice (Table 4).
  • Muscimol-evoked increase in excitatory glutamatergic activity of lamina II interneurons is severely impaired in inflamed Myola KO mice.
  • Chronic pain is a serious and highly heterogeneous medical problem with a prevalence varying from 20 to 30% of the world population (Bouhassira et al., 2008; Breivik et al., 2006). Given that only a fraction of individuals develop chronic pain, the contribution of genetic factors has been postulated (Belfer et al., 2015; Devor, 2004; Macrae, 2008; Tegeder et al., 2006; Voscopoulos and Lema, 2010). Here, using four different pain paradigms, inventors showed that Myola KO mice developed irreversible chronic pain after injury, demonstrating a causal link between loss of MYOIA and the development of chronic pain.
  • Inventors' study also provides a powerful preclinical animal model that can be used (i) to deepen our understanding of the molecular and cellular mechanisms that trigger the transition from acute to chronic pain and (ii) to the design "a la carte” pharmacological therapies to prevent the establishment of chronic pain.
  • PGE(2) selectively blocks inhibitory glycinergic neurotransmission onto rat superficial dorsal horn neurons. Nat Neurosci 5, 34- 40.
  • BDNF from microglia causes the shift in neuronal anion gradient underlying neuropathic pain. Nature 438, 1017-1021.
  • Gaillard S., Lo Re, L., Mantilleri, A, Hepp, R., Urien, L., Malapert, P., Alonso, S., Deage, M., Kambrun, C, Landry, M., et al. (2014).
  • GINIP a Galphai-interacting protein, functions as a key modulator of peripheral GABAB receptor-mediated analgesia. Neuron 84, 123-136.
  • GlyR alpha3 an essential target for spinal PGE2-mediated inflammatory pain sensitization. Science 304, 884-887.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • Environmental Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Animal Husbandry (AREA)
  • Toxicology (AREA)
  • Biophysics (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to the identification of Myo1a as a biomarker of conversion of acute pain into chronic pain, and as a therapeutic target. The invention in particular relates to products and methods for assessing the predisposition of a subject to develop an injury-induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain, and is particularly suited for mammals, preferably human subjects. The present invention more specifically relates to the assessment of the predisposition of a subject to develop an injury-induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain using preferably the MYO1A gene as a biomarker. Inventors herein provide binding reagents specific for MYO1A, compositions, devices, kits containing the same and animal model, and further describe their uses for assessing the predisposition of a subject to suffer from chronic pain. The invention also relates to products and methods for diagnosing, preventing, managing or treating chronic pain.

Description

MY01 A FOR PREDICTING CONVERSION OF ACUTE PAIN INTO CHRONIC PAIN
AND USE OF MY01 A FOR THERAPY OF PAIN
The present invention relates to the identification of Myola as a biomarker of conversion of acute pain into chronic pain, and as a therapeutic target. The invention in particular relates to products and methods for assessing the predisposition of a subject to develop an injury- induced chronic mechanical pain and/or an inflammatory- induced chronic thermal pain, and is particularly suited for mammals, preferably human subjects. The present invention more specifically relates to the assessment of the predisposition of a subject to develop an injury- induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain using preferably the MYOIA gene as a biomarker. Inventors herein provide binding reagents specific for MYOIA, compositions, devices, kits containing the same and animal model, and further describe their uses for assessing the predisposition of a subject to suffer from chronic pain. The invention also relates to products and methods for diagnosing, preventing, managing or treating chronic pain.
BACKGROUND
Pain is commonly classified into acute and chronic. Acute pain is short lasting and is essential for the maintenance of our physical integrity, whereas chronic pain persists beyond the normal time of healing and adversely impacts on our well-being. Chronic inflammatory or neuropathic pain gives rise to highly debilitating and long lasting sensory abnormities such as hyperalgesia, allodynia and spontaneous pain (Munro et al., 2009). These symptoms occur as a consequence of aberrantly prolonged sensitization of pain pathways both in the peripheral and central nervous systems, causing either increased facilitation or loss of inhibition in pain-transmitting circuits (Sandkuhler, 2009; Zeilhofer et al., 2012). Diminished spinal inhibition occurs in the setting of inflammation and nerve injury through various mechanisms. These include prostaglandin E2-mediated inhibition of the inhibitory glycine receptor (Ahmadi et al., 2002; Harvey et al., 2004; Muller et al., 2003; Zeilhofer et al., 2012) and brain-derived neurotrophic factor (BDNF)-mediated downregulation of the potassium chloride exporter KCC2 that perturbs chloride homeostasis thus altering GABAergic and glycinergic inhibitory functions (Coull et al., 2005; Coull et al., 2003; Zeilhofer et al., 2012). More recently studies deciphered several micro-circuits involving distinct subsets of spinal cord (SC) excitatory and inhibitory interneurons involved in the control of acute and injury-induced persistent pain (Bourane et al., 2015a; Bourane et al., 2015b; Duan et al., 2014; Foster et al., 2015; Peirs et al., 2015; Petitjean et al., 2015). Together, these data demonstrate that we know a great deal about the molecular and cellular mechanisms that underlie both peripheral and central sensitization that control the onset of injury- induced acute pain. However, our knowledge on the molecular and cellular events that trigger the transition from acute to chronic pain is still limited. For example, it is well-established that acute post- operative pain is followed by persistent pain in about 10 to 50% of individuals after common surgical procedures such as breast and thoracic surgery, leg amputation and coronary arteries bypass (Gilron et al., 2013; Kehlet et al., 2006). How and why only a fraction of these patients develop chronic postsurgical pain (CPSP) is unknown. In the clinic, several risk factors predicting the development of CPSP have been suggested. These include age, sex, and the type of surgery, the preoperative and postoperative assessment of the response of patients to evoked painful stimuli as well as their genetic susceptibility to develop CPSP (Kehlet et al., 2006).
In the light of the lack of information about the development, prevention and treatment of chronic pain, there is a clear need for identifying new biomarkers allowing its adequate management, and for new therapeutic compounds allowing its prevention, attenuation or treatment.
BRIEF DESCRIPTION OF THE INVENTION
Surprisingly, inventors herein demonstrate for the first time that loss of Myola or an altered expression thereof is associated to the predisposition of a subject to develop an injury- induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain.
A first object of the invention thus relates to the use of the DNA or mRNA encoding Myosin IA (Myola), preferably the Myola gene, or of the Myola protein, as a biomarker for assessing the predisposition of a subject to develop an injury- induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain.
The present invention also relates to an in vitro method of assessing the predisposition of a subject to develop an injury-induced chronic mechanical pain or an inflammatory-induced chronic thermal pain, wherein the method comprises a step of analyzing, typically sequencing, the Myola nucleic acid sequence obtained from a biological sample of the subject, the detection of an alteration of the nucleic acid sequence of Myola in the subject when compared to the Myola wild-type nucleic acid sequence as identified in SEQ ID NO: 1 indicating that the subject is predisposed to develop an injury- induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain whereas the absence of alteration indicates that the subject is not predisposed to develop an injury- induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain.
Further objects of the invention relates to the DNA encoding Myola, mRNA encoding Myola, or an agonist of the Myola protein ("Myosin IA") for use for preventing or treating pain, in particular an injury-induced chronic mechanical pain and/or an inflammatory- induced chronic thermal pain, in a subject, to a composition comprising an agonist of the Myola protein together with a pharmaceutically acceptable carrier or support, and to uses thereof for preventing or treating pain in a subject, in particular an injury- induced chronic mechanical pain and/or an inflammatory- induced chronic thermal pain. Also herein described is an in vitro or ex vivo screening method of a Myola modulator, comprising determining the ability of a drug candidate to activate or stimulate, or on the contrary to decrease or suppress, Myola functional expression and/or biological function, and, if the ability is confirmed, the identification of the drug candidate as a Myola agonist (activator), and potentially as a drug candidate for preventing, reducing or treating pain, or on the contrary as a Myola antagonist (inhibitor).
Inventors herein reveal the possible use of a Myola KO (Myola -1- ) animal model for screening for Myola modulators and/or for drugs for preventing, reducing or inhibiting pain.
The invention also relates to kits and devices suitable for implementing the above methods, for example a device comprising at least one complementary nucleic acid that binds all or part of the Myola gene or of a Myola gene locus immobilized on a support, typically oligonucleotides for sequencing the Myola nucleic acid, or a kit for assessing the predisposition of a subject to develop an injury-induced chronic mechanical pain or an inflammatory-induced chronic thermal pain comprising oligonucleotides for sequencing the Myola nucleic acid obtained from a biological sample of the subject.
In a particular aspect, the invention relates to the use of a device comprising at least one complementary nucleic acid that binds all or part of the Myola gene or of a Myola gene locus immobilized on a support for assessing the predisposition of a subject to develop an injury- induced chronic mechanical pain or an inflammatory- induced chronic thermal pain.
In another particular aspect, the invention relates to the use of a kit for assessing the predisposition a subject to develop an injury-induced chronic mechanical pain or an inflammatory- induced chronic thermal pain, wherein the kit comprises oligonucleotides for sequencing the Myola nucleic acid obtained from a biological sample of the subject.
In the context of the invention, the subject is any mammalian subject, particularly a human subject. DETAILED DESCRIPTION OF THE INVENTION
Pain is an unpleasant sensory experience associated with actual or potential tissue damage. Thus, pain is the most common symptom of various injuries and diseases. There exists different classifications of pain, for example nociceptive pain is generally distinguished from inflammatory pain and from pathological pain which is a disease state caused by damage to the nervous system (i.e., neuropathic pain) or by its abnormal function (dysfunctional pain, like in fibromyalgia, irritable bowel syndrome, tension type headache, etc.).
Pain is usually transitory, lasting only until the noxious stimulus is removed or the underlying damage or pathology has healed, but some painful conditions, such as rheumatoid arthritis, peripheral neuropathy, cancer and idiopathic pain (pain that persists after the trauma or pathology has healed, or that arises without any apparent cause), may persist for years. Pain that lasts a long time is called chronic, and pain that resolves quickly is called acute. Traditionally, the distinction between acute and chronic pain has relied upon an arbitrary interval of time from onset; the two most commonly used markers being 3 months and 6 months since the onset of pain (Turk, Okifuji, Pain terms and taxonomies of pain; In: Bonica, Loeser, Chapman, Turk, Butler, Bonica's management of pain. Hagerstwon: Lippincott Williams & Wilkins, 2001), though some theorists and researchers have placed the transition from acute to chronic pain at 12 months (Spanswick, Main, Pain management: an interdisciplinary approach. Edinburgh: Churchill Livingstone, 2000). Others apply acute to pain that lasts less than 30 days, chronic to pain of more than six months duration, and subacute to pain that lasts from one to six months (Thienhaus, Cole, Classification of pain. In: Weiner, Pain management: a practical guide for clinicians. Boca Raton: CRC Press, 2002). A popular alternative definition of chronic pain, involving no arbitrarily fixed durations is "pain that extends beyond the expected period of healing" (Turk, Okifuji, 2001, Pain terms and taxonomies. In Loeser, Butler, Chapman, et al. Bonica's management of pain, Lippincott Williams&Wilkins. ISBN 0-683-30462-3). Chronic pain may be classified as cancer pain or benign (Thienhaus, Cole, 2002, Classification of pain. In Weiner, Pain management: A practical guide for clinicians, American Academy of Pain Management, ISBN 0- 8493-0926-3).
Pain sensation is conveyed to the brain by sensory neurons which are also called nociceptors. Nociceptors are considered as polymodal since they may respond to multiple forms of noxious or intense stimuli, such as thermal (heat/cold), mechanical, and chemical stimuli. Sensory afferent fibers of nociceptors are heterogeneous in many aspects. For example, sensory nerves are classified as Aa, - β, -δ and C-fibers according to their diameter and degree of myelination. Then, sensory inputs from the periphery are processed and conveyed to higher brain regions by complex circuits involving excitatory and inhibitory interneurons within the spinal cord (Basbaum et al., 2009; Todd, 2010). The balance between excitation and inhibition is crucial for maintenance of normal sensory function, and dysfunction of these circuits leads to the development of pain such as inflammatory and neuropathic pain.
Treatment of pain includes the use of local anesthetics, which block neuronal transmission and affect sensation as well as pain, and analgesics, which relieve pain and additionally may interfere with the activity of chemical mediators of inflammation. Acute pain is usually managed with medications such as analgesics and anesthetics. Management of chronic pain, however, is much more difficult. In addition, inadequate treatment of pain is widespread throughout surgical wards, intensive care units, accident and emergency departments, in general practice, in the management of all forms of chronic pain including cancer pain, and in end of life care. This neglect is extended to all ages, from neonates to the frail elderly. Improved treatments of pain are up to date still highly requested by patients in particular when considering neuropathic, inflammatory and/or chronic pains for which treatment remains incomplete whatever the selected known analgesic molecule. The purpose of the present invention is to distinguish between subjects those who are prone to develop chronic pain in order to help the practitioner optimizing pain treatment for them.
In the context of the present invention, the patient or subject is an animal, preferably a vertebrate, typically a mammal. In a preferred embodiment, the mammal is a human being, whatever its age or sex. The mammal may further be an animal, in particular a domestic or breeding animal, in particular a horse, a dog, a cat, etc.
Inventors herein demonstrate that in Myola KO mice, a short lasting and reversible inflammatory, neuropathic and post-operative pain is converted into an irreversible chronic pain, indicating that loss of Myola predisposes the mice to develop chronic pain regardless the etiology of the incurred lesion. Using behavioral pharmacology, they found that Myola KO mice were selectively insensitive to the analgesic effects of the GABAA-R agonist muscimol in the setting of inflammation and nerve injury, demonstrating that loss of Myola impaired the ionotropic GABAergic signaling. Accordingly, electrophysiological recordings on SC slices demonstrated that under inflammatory conditions, muscimol-evoked increase in excitatory glutamatergic activity of lamina II interneurons was completely abolished in Myola KO mice. Using an unbiased RNA deep sequencing screen, they uncovered a selective upregulation of the a2 subunit of the GABAA-R (GABRA2) both in DRG and SC neurons. Together, their data identify Myola gene as a predictive genetic factor for the development of injury- induced chronic pain and inflammatory- induced chronic thermal pain through a selective alteration of ionotropic GABAergic signaling.
Inventors now herein describe the use of a nucleic acid sequence encoding Myosin IA (Myola), typically the DNA or the mRNA encoding Myol a, preferably the Myola gene, as a biomarker (or predictive genetic factor) for assessing the predisposition of a subject to develop an injury- induced chronic mechanical pain, and/or an inflammatory- induced chronic thermal pain. The mechanical or thermal pain can be a mechanical or thermal allodynia (pain caused by a stimulus that normally is not painful) or hyperalgesia (exaggerated response to a stimulus which is normally painful).
The injury-induced chronic mechanical pain is typically an inflammatory-, a neuropathic- and/or a post-operative-chronic mechanical pain. Each of these three classically distinguished kinds of pain is triggered by an injury, i.e. is associated with tissue damage. More particularly, in the context of the invention:
- inflammatory chronic mechanical pain is associated with tissue damage and with the infiltration of immune cells;
- neuropathic chronic mechanical pain is triggered by an injury which impacts the nervous system and may or may not involve actual damage to the nervous system, i.e. nerves can be infiltrated or compressed by tumors, strangulated by scar tissue, or inflamed by infection. The pain frequently has burning, lancinating, or electric shock qualities. Persistent allodynia is also a common characteristic of neuropathic pain. The pain may persist for months or years beyond the apparent healing of any damaged tissues.
Examples of neuropathic pain include post herpetic (or post-shingles) neuralgia, reflex sympathetic dystrophy / causalgia (nerve trauma), components of cancer pain, phantom limb pain, entrapment neuropathy (e.g., carpal tunnel syndrome), and peripheral neuropathy (widespread nerve damage). Among the many causes of peripheral neuropathy, diabetes is the most common, but the condition can also be caused by chronic alcohol use, exposure to other toxins (including many chemotherapies), vitamin deficiencies, and a large variety of other medical conditions— it is not unusual for the cause of the condition to go undiagnosed; and
- post-operative chronic mechanical pain directly results from a tissue damage which occurred during surgery.
The Myola gene encodes a member of the myosin superfamily, Myosin- la (herein also identified as "Myola"). The protein represents an unconventional myosin. It should not be confused with the conventional skeletal muscle myosin- 1 (MYH1). Unconventional myosins contain the basic domains characteristic of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Myosin IA is known to be expressed in neurons of the spinal cord [more specifically in LTMR neurons from the adult lumbar Dorsal Root Ganglion (DRG) also herein identified as "lumbar LTMRs"] and in neurons of specific area of the intestine. Myosin IA is also expressed in the trigeminal nerve (Tyska, M.J. et al.).
The Myola gene has been identified as highly polymorphic. More variants than expected were indeed observed (Synonymous: 153.1 expected, 158 observed, z = -0.25. Missense: 363.9 expected, 405 observed, z = -1.05).
In a typical embodiment of the invention, the absence, a reduced or insufficient expression or a nonfunctional expression of Myosin IA (Myola) in a subject when compared to the expression observed in a Myola homozygote (Myola+l+) reference subject expressing a functional Myosin la (Myola), predisposes the subject to develop an injury- induced chronic mechanical pain and/or an inflammatory- induced chronic thermal pain.
The reference subject expressing a functional Myosin la is a Myola homozygote (Myola +/+) subject. The Myola gene of the reference subject consists in SEQ ID NO: 1 or in a functional variant thereof. A functional Myola variant of SEQ ID NO:l encodes a functional Myosin la (SEQ ID NO: 2). Functional Myola variants can for example, and without limitations, be selected from orthologs of SEQ ID NO: 1 such as SEQ ID NO: 3 (dog) and SEQ ID NO: 5 (cat). A non- functional expression of Myosin IA is typically associated to a selective upregulation of the a2 subunit of the GABA receptor (GABA-R) in the dorsal root ganglia (DRG) and spinal cord, and can thus be indirectly detected by the skilled person. As well, a detected alteration of the GABAergic signaling in a subject should be a reason for verifying the expression of Myosin IA or for sequencing Myola in said subject.
Methods usable by the man of the art to detect or quantify a protein, typically Myosin la, are well- known by the skilled man of the art and further identified below in the description.
A preferred method of assessing the predisposition of a subject to develop an injury-induced chronic mechanical pain or an inflammatory-induced chronic thermal pain is an in vitro method comprising a step of analyzing, preferably sequencing, the Myola nucleic acid sequence obtained from a biological sample of the subject, the detection of an alteration of the nucleic acid sequence of Myola in the subject when compared to the Myola wild-type nucleic acid sequence as identified in SEQ ID NO: 1 , indicating that the subject is predisposed to develop an injury-induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain whereas the absence of alteration indicates that the subject is not predisposed to develop an injury- induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain.
The alteration of the nucleic acid sequence is responsible for an abnormal expression of the Myola nucleic acid, typically a reduced, decreased or insufficient expression when compared to the expression observed in a Myola homozygote (Myola+l+) reference subject expressing a functional Myola, or of an abnormal, typically a non- functional, expression or activity of the protein (Myola) encoded by the nucleic acid.
Typically, the alteration in a nucleic acid sequence may be determined at the level of the Myola gene, typically DNA, cDNA or RNA. Preferably, the detection is performed by sequencing all or part of the gene locus or by selective hybridization or amplification of all or part of the gene locus. More preferably a gene locus specific amplification is carried out before the alteration identification step. The altered nucleic acid or gene locus is typically a nucleic acid or gene locus sequence comprising a mutation or combination of mutations in the coding and/or non-coding region of the locus.
The mutation is typically a point mutation, or a deletion or insertion of two or more residues (bases). The point mutation can be a substitution that exchanges one base for another, an insertion in which an extra base is inserted into a new place in the nucleic acid sequence. The point mutation can be a missense mutation, which is a point mutation where a single nucleotide is changed to cause substitution of a different amino acid , or a nonsense mutation, for example a frameshift mutation, that results in a premature stop codon or a nonsense codon in the transcribed mRNA and in a truncated or incomplete protein product.
Deletions may encompass any region of two or more residues in a coding or non-coding portion of the gene locus, such as from two residues up to the entire gene or locus. Typical deletions affect smaller regions, such as domains (introns) or repeated sequences or fragments of less than about 50 consecutive base pairs, although larger deletions may occur as well. Insertions may encompass the addition of one or several residues in a coding or non-coding portion of the gene locus. Insertions may typically comprise an addition of between 1 and 50 base pairs in the gene locus. Rearrangement includes inversion of sequences. The gene locus alteration may result in the creation of stop codons, frameshift mutations, amino acid substitutions, particular RNA splicing or processing, product instability, truncated polypeptide production, etc.
In all cases encountered in the context of the invention, the mutation stops or decreases the production of a functional protein product or results in a non- functional protein product. The mutation is typically a loss-of- function mutation.
A variation or polymorphism which does not impact the functional expression of Myosin la will not be identified by the skilled person as an alteration of the nucleic acid sequence.
Within the context of this invention, the "Myola gene locus" designates all sequences or products in a cell or organism including the Myola coding sequences, Myola non-coding sequences (e.g., introns), Myola regulatory sequences controlling transcription and/or translation (e.g., promoter, enhancer/silencer regions, terminator, 5'UTR, 3'UTR, etc.), all corresponding expression products, such as Myola RNAs (e.g., mRNAs); as well as surrounding sequences of 20 kb region, preferably 15.3 kb region, upstream the starting codon (flanking the 5'UTR region) of the Myola gene and 20 kb region, preferably 14.1 kb region, downstream the untranslated region (flanking the 3'UTR region). In a particular embodiment most alterations are not in the promoter sequence.
In a particular embodiment, the altered Myola nucleic acid is a Myola wild-type nucleic acid comprising at least one point mutation, preferably a single nucleotide polymorphism (SNP), for example a loss-of-function SNP, i.e., a SNP responsible for the absent or abnormal (non-functional) expression of the protein encoded by the nucleic acid. The Myola wild-type nucleic acid may also comprise several single nucleotide polymorphism(s) (SNPs).
Once a first SNP has been identified in the genomic region of interest comprising Myola other additional SNPs in linkage disequilibrium with this first SNP can be identified. Indeed, any SNP in linkage disequilibrium with a first SNP associated with chronic pain predisposition phenotype will be associated with this trait. Therefore, once the association has been demonstrated between a given SNP and chronic pain predisposition phenotype, the discovery of additional SNPs associated with this trait can be of great interest in order to increase the density of SNPs in this particular region. Identification of additional SNPs in linkage disequilibrium with a given SNP involves: (a) amplifying a fragment from the genomic region comprising or surrounding a first SNP from a plurality of individuals; (b) identifying of second SNP in the genomic region harboring or surrounding said first SNP; (c) conducting a linkage disequilibrium analysis between said first SNP and second SNP; and (d) selecting said second SNP as being in linkage disequilibrium with said first marker. Sub-combinations comprising steps (b) and (c) are also contemplated. These SNPs in linkage disequilibrium can also be used in the methods according to the present invention, and more particularly in the methods of assessing the predisposition of a subject to develop an injury- induced chronic mechanical pain or an inflammatory-induced chronic thermal pain according to the present invention. Mutations in a gene locus which are responsible for chronic pain predisposition phenotype may be identified by comparing the sequences of the gene locus from patients presenting chronic pain predisposition phenotype to the sequences of the gene locus from reference patients (as defined herein above containing SEQ ID NO: l or a functional variant thereof). Based on the identified SNPs or association of SNPs of the Myola gene, the identified locus can be scanned for mutations. In a preferred embodiment, functional regions such as exons and splice sites, promoters and other regulatory regions of the gene locus are scanned for mutations. Preferably, patients presenting chronic pain predisposition phenotype carry a mutation or a mutated allele shown to be associated with chronic pain predisposition phenotype and referent patients do not carry the mutation or mutated allele associated with chronic pain predisposition phenotype. The method used to detect such mutations generally comprises the following steps: amplification of a region of the gene locus of interest comprising a SNP or a group of SNPs associated with chronic pain predisposition phenotype from DNA samples of the gene locus from patients presenting chronic pain predisposition and from referent patients; sequencing of the amplified region; comparison of DNA sequences of the Myola genes from patients presenting chronic pain predisposition phenotype and from patients presenting referent phenotype; determination of mutations specific to patients presenting chronic pain predisposition phenotype.
In a particular embodiment, the method of assessing the predisposition of a subject to develop an injury-induced chronic mechanical pain or an inflammatory- induced chronic thermal pain is an in vitro method comprising the following steps of (a) obtaining from the subject a test sample of Myola DNA, cDNA or RNA, preferably DNA, (b) contacting the test sample with at least one nucleic acid probe, wherein said nucleic acid is complementary to and specifically hybridises with a targeted altered Myola nucleic acid sequence preferably comprising at least one mutation, typically a point mutation, for example a single nucleotide polymorphism (SNP), to form a hybridization sample, (c) maintaining the hybridization sample under conditions sufficient for the specific hybridization of the targeted nucleic acid sequence with the nucleic acid probe to occur, and (d) detecting whether there is specific hybridization of the altered targeted nucleic acid sequence with the nucleic acid probe, such a specific hybridization revealing the predisposition of the subject to develop an injury- induced chronic mechanical pain or an inflammatory- induced chronic thermal pain.
Most of the herein described preferred methods of assessing the predisposition of a subject to develop an injury-induced chronic mechanical pain or an inflammatory-induced chronic thermal pain are performed on the nucleic acid obtained from cells of a biological sample which is typically a blood sample, a plasma sample or a serum sample of the subject.
Although less preferred, the alteration may also be determined at the level of the Myosin IA polypeptide (e.g., a pre-protein and the mature protein).
Examples of particular techniques the aim of which is to determine the abnormal (in particular low or absent) expression of a particular nucleic acid, or the abnormal expression of the corresponding Myosin IA polypeptide or protein are detailed in the present description.
The presence of an alteration in a nucleic acid may be easily detected by the man skilled in the art using methods of the art such as restriction digestion, sequencing, selective hybridisation (for example with a nucleic acid probe present on a nucleotide array), and/or selective amplification, as further explained below.
Alterations in a gene may also be detected by determining the presence of an altered RNA expression. Altered RNA expression includes the presence of an altered RNA sequence, the presence of an altered RNA splicing or processing, the presence of an altered quantity of RNA, etc. These may be detected by various techniques known in the art, including by sequencing all or part of the RNA or by selective hybridisation or selective amplification of all or part of said RNA, for instance.
The presence of an abnormal expression of a target nucleic acid, such as Myola, may be detected in particular by real time quantitative reverse transcription PCR (qRT-PCR) using probes designed to hybridize within the target nucleic acid sequence (see O'Driscoll L. et al., 1993 and Yajima T. et al, 1998).
In a further variant, the method comprises detecting the presence of an altered expression of the polypeptide or protein encoded by the gene of interest. Altered polypeptide expression includes the presence of an altered polypeptide sequence, the presence of an altered quantity of polypeptide, the presence of an altered tissue distribution, etc. These may be detected by various techniques known in the art, including by sequencing and/or binding to specific ligands (such as antibodies), for instance.
In a particular embodiment, the detection of an abnormal protein expression may be easily performed, by the man skilled in the art, by measuring the cellular level of mRNA encoding a normal protein, a decreased level compared to a control or standard level being correlated to an abnormal protein expression.
Sequencing can be carried out using techniques well known in the art, using automatic sequencers. The sequencing may be performed on the complete gene locus or, more preferably, on specific domains thereof, typically those known or suspected to carry deleterious mutations or other alterations. Amplification is based on the formation of specific hybrids between complementary nucleic acid sequences that serve to initiate nucleic acid reproduction. Amplification may be performed according to various techniques known in the art, such as by polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA) and nucleic acid sequence based amplification (NASBA). These techniques can be performed using commercially available reagents and protocols. Preferred techniques use allele-specific PCR or PCR-SSCP. Amplification usually requires the use of specific nucleic acid primers, to initiate the reaction. Nucleic acid primers useful for amplifying sequences from the gene locus of interest are able to specifically hybridize with a portion of the gene locus that flank a target region of said locus, said target region being altered in subjects predisposed to develop an injury- induced chronic mechanical pain or an inflammatory- induced chronic thermal pain.
Another particular object of this invention resides in a nucleic acid primer useful for amplifying sequences from the Myola gene or locus of interest including surrounding regions. Such primers are preferably complementary to, and hybridize specifically to nucleic acid sequences in the gene locus. Particular primers are able to specifically hybridize with a portion of the gene locus that flank a target region of said locus, said target region being altered in subjects predisposed to develop an injury- induced chronic mechanical pain or an inflammatory-induced chronic thermal pain. Primers that can be used to amplify a target region comprising SNPs may be designed based on their sequence or on the genomic sequence of the Myola gene.
The invention also relates to a nucleic acid primer, said primer being complementary to and hybridizing specifically to a portion of the Myola gene locus coding sequence (e.g., gene or RNA) altered in certain subjects predisposed to develop an injury-induced chronic mechanical pain or an inflammatory-induced chronic thermal pain. In this regard, particular primers of this invention are specific for altered sequences in a Myola gene locus or RNA. By using such primers, the detection of an amplification product indicates the presence of an alteration in the gene locus. In contrast, the absence of amplification product indicates that the specific alteration is not present in the considered sample.
The invention also concerns the use of a nucleic acid primer or a pair of nucleic acid primers as mentioned above, and as herein identified, in a method of assessing the predisposition of a subject to develop an injury- induced chronic mechanical pain or an inflammatory- induced chronic thermal pain.
Hybridization detection methods are based on the formation of specific hybrids between complementary nucleic acid sequences that serve to detect nucleic acid sequence alteration(s). A particular detection technique involves the use of a nucleic acid probe specific for wild-type (or a functional variant thereof) or altered gene or corresponding RNA, followed by the detection of the presence of a hybrid. The probe may be in suspension or immobilized on a substrate or support (as in nucleic acid array or chips technologies). The probe is typically labeled to facilitate detection of hybrids.
In this regard, a particular embodiment of this invention comprises contacting the sample from the subject with a nucleic acid probe specific for an altered Myola gene locus, and assessing the formation of an hybrid.
In a particularly preferred embodiment, the method comprises contacting simultaneously the sample with a set of probes that are specific, respectively, for wild type Myola gene locus and for various altered forms thereof. In this embodiment, it is possible to detect directly the presence of various forms of alterations in the gene locus in the sample. Also, various samples from a single subject or from various subjects may be treated in parallel.
Within the context of this invention, a probe refers to a polynucleotide sequence which is complementary to and capable of specific hybridization with a (target portion of) the Myola gene or RNA, and which is suitable for detecting mutations associated with the gene alleles which predispose to an injury-induced chronic mechanical pain or an inflammatory-induced chronic thermal pain ("mutated allele").
Probes are preferably perfectly complementary to the particular Myola gene, RNA, or target portion thereof. Probes typically comprise single-stranded nucleic acids of between 8 to 1000 nucleotides in length, for instance of between 10 and 800, more preferably of between 15 and 700, typically of between 20 and 500. It should be understood that longer probes may be used as well. A preferred probe of this invention is a single stranded nucleic acid molecule of between 8 to 500 nucleotides in length, which can specifically hybridize to a region of a Myola gene locus or RNA that carries an alteration.
The method of the invention employs a nucleic acid probe specific for an altered (e.g., a mutated) Myola gene or RNA, i.e., a nucleic acid probe that specifically hybridizes to said altered Myola gene or RNA and essentially does not hybridize to a Myola gene or RNA lacking said alteration.
Specificity indicates that hybridization to the target sequence generates a specific signal which can be distinguished from the signal generated through non-specific hybridization. Perfectly complementary sequences are preferred to design probes according to this invention. It should be understood, however, that certain mismatch may be tolerated, as long as the specific signal may be distinguished from non-specific hybridization.
The invention also concerns the use of a nucleic acid probe as described above, and as herein identified, in a method of assessing the predisposition of a subject to develop an injury-induced chronic mechanical pain or an inflammatory- induced chronic thermal pain. As indicated above, alteration in the Myola gene locus may also be detected by screening for alteration(s) in Myola polypeptide sequence or expression levels in a sample of a tissue expressing the protein of interest (Myosin IA). In order to detect a protein, immunohistochemistry (for example in a biopsy), immunoblotting (in particular Western blot), proteomics, or antibody-based biosensors directed against the protein of interest (Myosin IA), as well as any other method known from the man of the art, can be applied to a biological sample containing Myosin IA from the subject of interest. Contacting the sample with a ligand specific for a Myosin IA encoded by a particular nucleic acid sequence and determining the formation of a complex is also described.
Different types of ligands may be used, such as specific antibodies. In a specific embodiment, the sample is contacted with an antibody specific for a Myosin IA encoded by a particular nucleic acid and the formation of a complex is determined. Various methods for detecting such a complex can be used, such as ELISA, radio-immunoassays ( IA) and immuno- enzymatic assays (IEMA).
Within the context of this invention, an antibody designates a polyclonal antibody, a monoclonal antibody, as well as fragments or derivatives thereof having substantially the same antigen specificity. Fragments include Fab, Fab'2, CDR regions, etc. Derivatives include single-chain antibodies, humanized antibodies, poly- functional antibodies, etc. An antibody specific for a polypeptide encoded by a particular gene designates an antibody that selectively binds said polypeptide, i.e., an antibody raised against said polypeptide or an epitope-containing fragment thereof. Although non-specific binding towards other antigens may occur, binding to the target polypeptide occurs with a higher affinity and can be reliably discriminated from non-specific binding.
The methods according to the invention of assessing the predisposition of a subject to develop an injury-induced chronic mechanical pain or an inflammatory-induced chronic thermal pain are preferably performed on a subject before any surgical procedure.
It is also disclosed kits to assess the predisposition of a subject to develop an injury-induced chronic mechanical pain or an inflammatory-induced chronic thermal pain comprising products and reagents for detecting in a sample from a subject the presence of an alteration in a Myola gene locus or in the corresponding polypeptide or protein; in the Myola gene or corresponding polypeptide or protein expression; and/or in the Myola gene activity.
Such kits comprise any nucleic acid, typically any primer, any pair of primers and/or any nucleic acid probes (wild-type and mutant); any ligand, preferably antibody, described in the present invention; and/or any device comprising such nucleic acid(s) and/or ligand(s) immobilized on a support. The herein described kits can further comprise reagents and/or protocols for performing a hybridization, amplification or antigen-antibody immune reaction. These kits may further comprise a micro-array to be used for the herein described methods and read through quantitative PCR or multiplex technology. A particular device comprises at least one complementary nucleic acid, preferably several complementary nucleic acids, that bind all or part of the Myola gene or of a Myola gene locus immobilized on a support Particular kits, typically kits for assessing the predisposition of a subject to develop an injury- induced chronic mechanical pain or an inflammatory- induced chronic thermal pain, are the following kits:
- a kit for sequencing the Myola nucleic acid obtained from a biological sample of a subject, wherein the kit comprises nucleic acid sequences, typically oligonucleotides, for example primers or pair(s) of primers;
- a kit to detect the abnormal/altered expression, in a biological sample of the subject, typically a blood sample, of the Myola gene of the subject, the kit comprising (i) at least one pair of primers and (ii) at least one labelled/detectable (for example fluorescent) probe, for example two different probes, allowing the quantitative detection of the expression of Myola, and (iii) a leaflet providing the control quantitative expression value corresponding to Myola in a control population; and
- a kit to detect the abnormal/altered expression, in a biological sample of the subject, typically a blood sample, of the Myola gene of the subject, the kit comprising (i) at least one pair of primers, and (ii) at least two differently labelled probes, the first probe recognizing the wild-type allele and the second probe recognizing the mutated allele of Myola.
When a subject do not express or abnormally express Myosin la, i.e. insufficiently express Myosin la or express a non-functional Mysosin la, inventors herein indicate that an "adapted treatment of pain" has to be applied to the subject to prevent or treat pain. Indeed, inventors have discovered that once the injury-induced chronic pain is established in said subject, said pain cannot be reversed by alkaloids, in particular GABAA- agonists such as muscimol, and becomes irreversible.
Within the context of the present invention, the term "treatment" or "treating" pain in a subject, designates delaying, stabilizing, curing, healing, alleviating, relieving, altering, ameliorating, improving, remedying or affecting any form of pain in a subject as described herein, or any disease or condition associated with pain (in particular any inflammatory or neuropathic condition associated with pain), or any symptom of such a disease or condition, after the application or administration of a suitable compound or a composition according to the invention. The term "treatment" or "treating" also refers to any indicator of success in the treatment of pain (which may be associated with any injury, pathology or condition), including any objective or subjective parameter such as abatement, remission, slowing progression or severity, stabilization, diminishing of symptoms of pain, or making it more tolerable to the subject. The term "treating" pain, also includes increasing pain tolerance and/or decreasing perceived pain. In particular embodiments, the methods, compounds and composition of the invention are for increasing pain tolerance and/or for decreasing perceived pain. As used herein, the term "pain tolerance" refers to the amount of pain that a subject can perceive and withstand before breaking down emotionally and/or physically. Pain tolerance is distinct from pain threshold (the minimum stimulus necessary to produce pain). As used herein, "increasing pain tolerance" generally refers to a situation where a subject can develop a greater pain tolerance (that is, less perceived pain) when compared to a previous state, for instance, following administration of suitable compounds or compositions to a subject.
Within the context of this invention, "preventing" or "prevention" in relation to pain in a subject, refers to at least the reduction of likelihood of the risk of (or susceptibility to) acquiring any kind of pain by a subject, after the application or administration of a suitable compound or a composition according to the invention. For example, "preventing" includes causing at least one of the clinical symptoms of pain, typically chronic pain, not to develop in a subject, typically in a subject identified as predisposed to chronic pain, in particular to an injury-induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain, but does not yet experience or display symptoms of pain.
The adapted treatment of pain according to the present invention typically involves the exogenous supply, administration for example, to the subject, of a nucleic acid sequence (typically a DNA or a mRNA) encoding Myola, and/or of an agonist of the Myosin la protein. Administration can be for example an intrathecal (i.t.) administration.
An object of the invention therefore concern a nucleic acid sequence (typically a DNA or a mRNA) encoding Myola, and/or an agonist of the Myosin la protein, Myola being a functional Myola, for use for preventing or treating pain, in particular an injury-induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain, in a subject as herein defined.
In the present invention, the term "agonist of the Myosin 1 a protein" is used to designate any protein capable of activating or stimulating the biological function of the wild-type Myosin IA protein or of restoring the function of a functionally altered Myosin IA protein. Such an agonist can be a natural or recombinant protein or a protein fragment that exhibits the properties of the corresponding wild-type protein, in particular that is able to activate or stimulate the biological function of the wild-type Myosin IA protein or of restoring the function of a functionally altered Myosin IA protein.
The present invention also concerns the use of a DNA encoding Myola, a mRNA encoding Myola, or an agonist of the Myosin la protein, Myola being a functional Myola, for preparing a composition, typically a pharmaceutical composition, for preventing or treating pain, in particular an injury- induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain, in a subject.
The present invention further concerns a composition comprising a DNA encoding Myola, a mRNA encoding Myola, or an agonist of the Myosin la protein and a pharmaceutically acceptable carrier or support, typically a composition for use for preventing or treating pain, in particular an injury- induced chronic mechanical pain and/or an inflammatory- induced chronic thermal pain, in a subject. Appropriate excipient, diluant or carrier usable in the all present invention may be selected for example from saline, isotonic, sterile or buffered solutions, etc. They can further comprise stabilizing, sweetening and/or surface-active agents, etc. They can be formulated in the form of ampoules, flasks, tablets, or capsules, by using techniques of galenic known per se.
The present invention also relates to a method for preventing or treating pain, in particular injury- induced chronic mechanical pain and/or an inflammatory- induced chronic thermal pain, comprising the administration to the subject, typically a mammal, in particular a human being, in need thereof, of at least one compound selected from the previously described product.
A subject in need of a treatment or prophylaxis is subject that has been tested and identified as predisposed to develop an injury- induced chronic mechanical pain and/or an inflammatory- induced chronic thermal pain according to the method described above. The present invention also provides:
- an in vitro, in vivo or ex vivo method for screening or selecting a compound that is able to prevent the conversion of acute pain into chronic pain, in particular the occurrence of an injury-induced chronic mechanical pain and/or an inflammatory- induced chronic thermal pain in a subject identified as predisposed to such a pain, the method comprising a step of assessing the expression of Myola by a particular cell, tissue or animal model in the presence of a test compound, wherein an increased expression of functional Myola by the particular cell, tissue or animal model, in comparison with a control cell, tissue or animal model that has not been exposed to or contacted with the test compound, is indicative of the capacity of said compound to prevent the conversion of acute pain into chronic, in particular the occurrence of an injury- induced chronic mechanical pain and/or an inflammatory- induced chronic thermal pain in a subject identified as predisposed to such a pain,
- an in vitro, in vivo or ex vivo method for screening a compound usable for preventing or treating pain, in particular an injury-induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain, in a subject having an altered Myola nucleic acid, an altered Myola nucleic acid expression, or an altered/abnormal expression or activity of the corresponding Myosin IA protein, said method comprising determining in vitro, in vivo or ex vivo the ability of a test compound to (i) restore a functional expression of said altered or abnormal Myosin IA protein (ii) induce or increase the expression or activity of said protein, or (iii) induce or increase the expression or activity of an agonist ligand of said protein.
- an in vitro, in vivo or ex vivo screening method of a Myola modulator, comprising determining the ability of a drug candidate to activate or stimulate, or on the contrary to decrease or suppress, Myola functional expression and/or biological function, and, if the ability is confirmed, the identification of the drag candidate as a Myola agonist (activator), and potentially as a drag candidate for preventing, reducing or treating pain, or on the contrary as a Myola antagonist (inhibitor), and
- an in vitro or ex vivo screening method of a drag candidate for preventing, reducing or treating pain, comprising determining the ability of a drag candidate to activate or stimulate, or on the contrary to decrease or suppress, Myola functional expression, and, if the ability is confirmed, the identification of the drag candidate as a Myo 1 a agonist and as a drag candidate for preventing, reducing or treating pain, or on the contrary as a Myola antagonist.
The compounds identified with one of the herein described screening methods may be used, in the context of the present invention, for preventing or treating pain in a subject, in particular injury- induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain.
Inventors further herein describe, the first animal model, a Myola KO (Myola -/- ) mice, in which a loss-of- function mutation leads to an irreversible pain state after injury. This mouse model is described in Tyska et al. (2005).
An object of the invention thus concerns the use of such a Myola KO (Myola-/- ) animal model for screening for Myola modulators and/or for drags for preventing, reducing or inhibiting pain.
This model can be used to design appropriate pharmacological therapies to prevent the onset and establishment of chronic pain.
This model can further be used to as a laboratory tool for use in research to deepen the understanding of the cellular and molecular mechanisms that trigger the transition from acute to chronic pain.
Other characteristics and advantages of the invention are given in the following experimental section (with reference to figures 1-8 and Tables 1-4), which should be regarded as illustrative and not limiting the scope of the present application.
FIGURES
Figure 1. Loss of LTMRs-enriched Myola converts injury induced acute mechanical pain into chronic pain.
(A-C) Characterization of Myo la-expressing neurons in adult lumbar Dorsal Root Ganglion (DRG). ISH using Myola antisense probe (red) followed by double immunolabeling with anti-GINIP (blue) antibody and IB4 (green) (A) or anti-Ret antibody (blue) (C). (B) Double-ISH using Myola (red) and TrkB antisense probes (green). Scale bars: 100μm.
(D-E) Analysis of Myola expression by ISH (red) in El 5 and new-born (P0) DRG and SC tissues. Scale bars: 50μιη (D) and ΙΟΟμιη (E). (F) ISH using Myola probe (in white, left panel) or no probe (right panel) on adult SC tissue. Dashed area delimitates laminae I-IIo of SC.
(G) Quantification of Myola transcripts in adult DRG and SC (relative to β-actin). Data represent the mean ± SEM of 3 independent experiments.
(H-J) Mechanical responses of WT and KO mice following carrageenan- induced inflammation (n=l 1 for WT and n=13 for KO) (H), CCI surgery (n=9 for WT and n=10 for KO) (I) and paw incision surgery (n= 10 for WT and n=10 for KO) (J). Data are presented as mean ± SEM for each group (*p < 0.05; ** p < 0.01 ; *** p < 0.001). (See also Figures 5-7).
Figure 2. Muscimol- and Diazepam-mediated analgesia is impaired in Myola KO mice.
(A-D) Mechanical responses of WT and KO mice following SNI surgery and i.t administration at indicated time-points of 10 nmol of SNC80, 0.2 nmol of DAMGO (A), 0.1 μg of baclofen, 2μg of TAFA4 (n=6 mice per genotype) (B), 40 μg of taurine, i.p administration of 3mg/kg of pregabalin (n=8 mice per genotype) (C) and i.t administration of 0.15 μg of muscimol (n=8 mice per genotype)
(D) .
(E-G) Mechanical responses of WT and KO mice following zymosan-induced inflammation (n=9 mice per genotype) (E) and i.t administration at indicated time-points of 0.15 μg of muscimol, 10 nmol of SNC80 (n=9 mice per genotype) (F) and 0.09 mg/kg of DZP (G) (n=7 mice per genotype). Data are presented as mean ± SEM for each group (*p < 0.05; ** p < 0.01 ; *** p < 0.001 ; ns: non-significant) Figure 3. Transcriptional analysis of DRG and SC tissue from WT and Myola KO mice reveals an increased Gabra2 expression.
(A) Venn diagram representing the number of differentially expressed (DE) genes (5% false discover rate) in KO mice with respect to WT in DRG (97 DE genes) and SC (31 DE genes) neurons. Genes differentially expressed only in DRG are represented in red (84 genes), only in SC in blue (18 genes) or in both DRG and SC neurons in yellow (13 genes).
(B) Heatmap representation of DE genes in both DRG and SC neurons, where genes showing increased expression are shown in red and those showing decreased expression in green. Scale represents the Log2 fold change in expression observed in KO mice with respect to WT.
(C) Quantification of Wdfyl, Gabra2 and Nnt transcripts in DRG and SC tissues from WT and KO mice. Data represent the mean fold-change of KO vs WT ± SEM (n=3 independent experiments). (D) Gabra2 transcripts expression assessed by ISH (red) in L5 DRG (upper panels) and in lumbar SC (lower panels) from WT (left) and KO (right) mice. Scale bars: ΙΟΟμιη.
(E) Immunostaining showing GABRA2 protein expression (green) in the dorsal horn of lumbar SC from WT (left) and KO (right) mice. Scale bars: 50μm.
(F) Quantification of GABRA2 immunofluorescence intensity in the laminae I-III of SC from WT and KO mice. Data represent the mean fold change of KO vs WT ± SEM (n=3 independent experiments)
(G) Immunostaining showing GABRA1 protein expression (red) in lumbar SC dorsal horn of WT (left) and KO (right) mice. Scale bars: 50μm . (See also Tables 1-4). Figure 4: Muscimol-induced increase in EPSC frequency is lost in Myola KO mice after zymosan inflammation.
(A) Representative traces of whole-cell recordings of musicmol-induced currents (Muse) in dissociated C-LTMRs.
(B) Current amplitude (mean ± SEM) after bath application of indicated doses of Muse, recorded in C- LTMRs from WT:Tafa4+ Venus and KO:Tafa4+ Venus mice. The number of recorded cells is indicated on the histograms.
(C-F) Whole cell recordings of spontaneous EPSC in laminae II interneurons after Muse application in naive (C-D) and in zymosan-inflammed WT and KO mice (E-F).
Left panels: representative traces of EPSC obtained under ACSF (black traces), following superfusion of 5μΜ Muse (blue traces) and during wash (brown traces).
Middle panels: Cumulative distribution of EPSC intervals (in seconds) for the experiments shown in the left panels. Note the shift of the Musc/blue curves towards the left (C, D, E middle panels), indicating a reversible increase in EPSC frequency.
Right panels: Normalized EPSC frequency (mean ± SEM) under ACSF, following superfusion of 5μΜ Muse and during wash. Note the absence of effect of Muse in slices from zymosan inflamed mice. The number of recorded cells is indicated in the right panels (*p < 0.05; ** p < 0.01 ; ns: nonsignificant). (See also Figure 8).
Figure 5: Adult DRG neurons survival, specification, central and peripheral innervation are not impaired in absence of MYOIA.
(A-B) Cell counts of total PGP9.5+ (A) and of indicated subsets (B) realized on adult lumbar L4 DRG sections from WT and KO mice. Data represent the mean absolute values (A) or the mean % of PGP9.5 neurons (B) ± SEM of three independent experiments. No statistically significant differences were observed between genotypes.
(C-E) Sensory neurons innervation of the SC is preserved in Myola KO mice.
Immunostainings of SC transversal sections from WT (upper panels) and KO (lower panels) mice with anti-CGRP (red, C), GINIP (blue C-E), IB4 (green, D) and anti-PKCy (red, E). Scale bars: ΙΟΟμιη.
(F-G) Sensory neurons innervation of the hairy skin is preserved in Myola KO mice.
Immunostainings of hairy skin sections from WT (upper panels) and KO (lower panels) mice with anti-PGP9.5 (red, F) and anti-SlOO (red, G). Scale bars: PGP9.5 and SI 00 showing hairy skin innervation: 50μm PGP9.5 showing epidermis innervation: 15μιη. (Related to Figure 1).
Figure 6: C-LTMRs and Αδ-LTMRs electrophysiological properties are preserved in absence of MYOIA.
(A-D) Electrophysiological properties of C-LTMRs.
(A-B) The graphs show the capacitance and the resting membrane potential of WT and KO C-LTMRs. (C) Representative traces illustrating the response of WT and KO C-LTMRs to depolarizing current pulse (50 pA, 1000 ms).
(D) The graph represents the number of Action Potentials (AP) evoked by depolarizing current steps of increasing amplitude (Δ10 pA, 1000 ms) of WT (black) and KO C-LTMRs (grey).
(E-I) Electrophysiological properties of Αδ-LTMRs.
The cell capacitance (upper panel) and resting membrane potential (lower panel) of WT and KO Αδ- LTMRs are shown in E. APs were evoked by depolarizing (F-G upper panels) or hyperpolarizing (F-G lower panels) current injection (1000 ms, ΔΟ.ΙηΑ or Δ-0.1ηΑ, respectively). (F) The figure shows representative traces obtained for WT (black) and KO (red) Αδ-LTMRs. (G) The curves represent the probability of AP firing as function of the injected current during depolarizing (upper panels) or following hyperpolarizing (lower panels) current injection, respectively. The AP rebound observed at the termination of the hyperpolarizing pulse is a characteristic of Αδ- LTMRs.
(H) Representative mechano-activated (MA) currents in WT (black) and KO (red) Αδ-LTMRs elicited by incremented mechanical stimulations of the soma at a holding potential of -60mV.
(I) Peak amplitude (I-peak) was normalized to obtain the current /probe displacement curve. The curves show the normalized peak current (I-peak) as function of the probe displacement.
Mean normalized amplitudes do not differ between WT and KO Αδ-LTMRs.
No statistically significant differences were observed between genotypes in C-LTMRs and Αδ- LTMRs. Data are expressed as mean ± SEM. (Related to Figure 1).
Figure 7: Behavioral characterization of naive Myola KO mice and Myola+/" mice and thermal and mechanical hypersensitivity post-injury.
Behavior of WT and KO in the open field (A) and rotarod (B: time and C: speed) tests. Thermal sensitivity to paw cooling (D: acetone test) and noxioux heat (E: hotplate test) show no difference between genotypes.
(F) The graph illustrates WT and KO mice pain behavior in formalin test. The histograms represent the response duration during the 1st and the 2nd phase. Note that KO mice exhibit increased response duration in this test (*** p < 0.001).
(G-H) Thermal hypersensitivity of WT and KO mice following carrageenan-induced inflammation (G) and paw incision surgery (H) was determined in Hargreaves test (*** p < 0.001, ns: non significant).
(I) Mechanical responses of WT, Myola+/- and KO mice following carrageenan-induced inflammation (*** p < 0.001, Myola+/- versus WT).
(J) Mechanical responses of WT and KO mice after i.t injection of bicuculline (0.01 μg in 10μL) (ns: non significant).
Data are presented as mean ± SEM for each group. (Related to Figure 1). Figure 8: Electrophysiological characterization of SC lamina II neurons passive, active and synaptic properties in Myola KO naive or inflamed mice.
(A-F) The graphs represent the average membrane potential (A), the membrane resistance (B), the capacitance (C), the Sag ratio in response to -25pA hyperpolarizing pulse (D), the number of rebound AP in response to -25 current pulses (E) and the number of AP in response of +25 pA current pulses
(F) of SC lamina II interneurons from WT and KO mice under naive and in carrageenan- (Carra.) and zymosan- (Zymo.) -induced inflammation. The numbers of recorded cells are: Naive: 16 WT and 26 KO, Carra.: 29 WT and 23 KO and Zymo. : 10 WT and 12 KO.
(G) The graph illustrates the paired pulse ratio recorded in SC lamina II interneurons of WT and KO mice under naive and in Carra. and Zymo -induced inflammation. The numbers of recorded cells are:
Naive: 19 WT and 33 KO, Carra.: 9 WT and 13 KO and Zymo. : 9 WT and 9 KO.
Data are presented as mean ± SEM for each group. No significant differences were observed between genotypes. (Related to Figure 4).
Figures 1 A, B, C, D, E, Figures 3 D, E, G and Figures 5 C, D, E, F, G are each shown twice (identical figures showing colors with different contrasts).
EXPERIMENTAL PART
Materials & methods
Mice
Mice were maintained under standard housing conditions (23 °C, 40% humidity, 12 h light cycles, and free access to food and water). Special effort was made to minimize the number as well as the stress and suffering of mice used in this study. All protocols are in agreement with European Union recommendations for animal experimentation.
Myola KO mice were generated by Tyska et al., 2005 (Tyska et al., 2005). Control wild-type (WT)
C57BL/6 mice were bred in-house. WT: Tafa4+ Venus and Myola KO: Tafa4+ Venus mice were generated by crossing WT and Myola KO mice respectively with Tafa4 Venus/Venus (Delfini et al . ,
2013) and Myola +/-: Tafa4+/Venus mice.
Histology
To obtain adult Dorsal Root Ganglia (DRGs) and Spinal Cord (SC) specimens for in situ hybridization (ISH) and immunostainings, mice were deeply anesthetized with a mix of ketamine/xylazine and then transcardially perfused with an ice-cold solution of paraformaldehyde 4% in 0.1 M phosphate buffer (4% PFA). Tissues were further fixed for 24h in ice-cold 4% PFA. Newborn P0 mice were sacrificed, rapidly washed in ice-cold PBS, eviscerated and fixed for 24h in ice-cold 4% PFA. El 5 embryos were collected in ice-cold PBS and fixed for 24h in ice-cold 4% PFA. Adult back hairy skin was excised and fixed for 2h in ice-cold 4% PFA. For GABRAl and GABRA2 immunostainings, lumbar SC (L1-L3) was rapidly dissected and fixed for 30 min in ice-cold 4% PFA. Specimens were transferred into a 30% (w/v) sucrose solution for cryoprotection before being frozen in OCT mounting medium. 12μιη cryosections (DRGs) and 18-20 μιη cryosections (SC, E15 and PO) were obtained using a standard cryostat (Leica).
In situ hybridization
Digoxigenin-labeled Myola and Gabra2 antisense probes and Fluorescein-labeled TrkB probe were synthetized using gene-specific PCR primers and cDNA templates from adult mouse DRG and in situ hybridization or double in situ hybridization was carried as described in (Reynders et al., 2015). The primers used for probe synthesis are listed below:
Myola Fl: GAAAATACTTCCGGTCAGGTG
Myola Rl: CAAGGGTTCTTCATCTCTGAGT
Myola F2: TACCAGTGGAAGTGCAAGAAGT
Myola R2+T7: TAATACGACTCACTATAGGGACACTACGAAGTTCTGCTCCAG
Gabra2 F1/F2: ACTTGGTTACTTTTGGGCTGT
Gabra2 Rl: TGA TTGAA GTGA GCTGAAA GGT
Gabra2 R2+T7: TAA TACGA CTCA CTA TA GGGAA CA TCCTTTCA TGGTGA CTCA
TrkB-Fl: CTGAGAGGGCCAGTCACTTC,
TrkB-Rl: CATGGCAGGTCAACAAGCTA,
TrkB-F2: CAGTGGGTCTCAGCACAGAA,
TrkB-R2+T7: TAATACGACTCACTATAGGGCTAGGACCAGGATGGCTCTG
Immunostaining
Immunostainings were done with rat anti-GINIP (1 :500, Moqrich laboratory), goat anti-Ret (1 :500, R&D Systems), rabbit anti-TrkA (1 :1000, generous gift from Dr. L. Reichardt, University of California), goat anti- TrkC (1 :500, R&D Systems), rabbit anti-CGRP (1 :1000, ImmunoStar), rabbit anti-PKCy (1 :500, Santa Cruz), rabbit anti- PGP9.5 (1 :200, Thermo Scientific), rabbit-anti S100 (1 :1000, Darko), rabbit anti-GABRA2 (1 :2000, Synaptic Systems) and guinea pig anti-GABRAl (1 :1000, Synaptic Systems). IB4 labelling was performed with Alexa Fluor 488-conjugated IB4 from Invitrogen. Slides were mounted with ImmuMount (Thermo Scientific) prior to observation under Axiolmager Zl (Zeiss) fluorescence microscope. Contrast was adjusted using Photoshop software. For the comparison of Gabra2 expression between WT and Myola KO, images were acquired using the same exposure parameters and contrast was adjusted equivalently.
For SC and skin innervation as well as GABRA staining, image acquisition was performed using an LSM-780 confocal microscope (Zeiss) and same pinhole aperture, lasers intensities as well as gain parameters were respected between WT and Myola KO specimens.
Cell counts and statistical analysis
Total and subsets of DRG neurons were counted on lumbar L4 DRG from adult WT and Myola KO mice, as described in Gaillard et al., 2014. Briefly, 12 μιη serial sections of L4 DRG were distributed on 6 slides which were subjected to different markers, including the pan-neuronal marker PGP9.5. This approach allowed us to refer all countings to the total number of neurons (PGP9.5). For each genotype, three independent experiments were performed. Data are presented as the mean ± standard error of the mean (SEM).
GABRA2 fluorescence intensity
The intensity of fluorescence (mean florescence of pixels in the region of interest) per mm2 related to GABRA2 expression was determined in the laminae I-III of WT and Myola KO SC sections using ImageJ software. For each genotype, three independent experiments were performed and 5-10 SC sections were analyzed and the fold change in the intensity of fluorescence of Myola KO versus WT specimens was calculated.
Drugs
SNC80 (Tocris Bioscience) was dissolved in a lOOmM HC1 solution, DAMGO (Sigma Aldrich) was dissolved in saline (0.9% NaCl), Baclofen (Sigma Aldrich) was dissolved in H20 (pH7.6), recombinant human TAFA4 (R&D Systems) was dissolved in saline, Diazepam (DZP, Roche) was dissolved in 10% dimethyl sulfoxide (DMSO) / 90%> saline, Muscimol (Tocris Bioscience), Taurine (Sigma Aldrich), Bicuculline (Sigma Aldrich) and Pregabalin (Sigma Aldrich) were dissolved in Phosphate Buffer (PB, 50 mM, pH 7.4).
Except for pregabalin, all drugs were administrated via intratechal (i.t) injection. The dosages are indicated in the figure legends. Pregabalin was injected intra-peritoneally (i.p). Response to mechanical stimulations was recorded 30 min up to 6h after drug administration as indicated in the figure legends.
Behavioral tests and statistical analysis
All behavioral analyses were conducted on 8-12 weeks old Myola KO and WT males. All experiments were carried at room temperature (~22°C). Animals were acclimated for one hour to their testing environment prior to all experiments. Experimenters were blind to the genotype of the mice during testing. The number of tested animals is indicated in the figure legends section. All error bars represent SEM. All statistical analysis was carried using Two Way Repeated Measures ANOVA followed by Bonferroni's post-hoc test. Openfield, Rotarod, Hot plate and Formalin tests were carried as described in Gaillard et al., 2014 (Gaillard et al., 2014).
Acetone test
Acetone drop evaporation assay (Hulse et al., 2012) was used to assess na'ive mice sensitivity to innocuous skin cooling. A drop of acetone was applied on the left hind paw using a 1 ml syringe. The duration of flinching/pain like behavior (seconds) was recorded immediately following acetone application for a total period of 2 minutes. The test was repeated twice and the mean duration of flinching/pain behavior was calculated. Heat hypersensitivity
Hind paw heat hypersensitivity was determined prior and after carrageenan inflammation as well as after paw incision surgery, using Hargr eaves test, as described in Gaillard et al., 2014. For the carrageenan inflammatory pain model, the test was performed at several time points (see legend) starting from one day and up to 60 days after inflammation. For the paw incision pain model, the test was performed at several time points (see legend) starting from one day and up to 30 days after inflammation.
Mechanical thresholds
Mechanical thresholds of the plantar surface were determined using Von Frey's filaments with the up- down method (Chap lan et al., 1994), previously as described (Gaillard et al., 2014) prior to and at several time-points after inflammation, neuropathy and paw-incision surgery.
Injury-induced pain models
Carrageenan and Zymosan-A induced inflammation
20μ1 of a solution containing 1% carrageenan in H20 (weight/vol, Sigma) or 20μ1 of a solution containing 0.06 mg Zymosan-A in 0.9% NaCl (weight/vol, Sigma), were injected subcutaneous ly into the plantar side of the left hindpaw, using a 30G needled syringe.
For carrageenan-induced inflammation, mechanical thresholds were determined prior to inflammation and at several time-points (see legend) starting from 1 hour and up to 60 days after inflammation. For zymosan inflammation, mechanical thresholds were measured prior to injection, at day 1 and at several time-points (see legend) up day 60. In addition, mechanical thresholds in the zymosan model were measured before inflammation, at day 1 and day 2, before and after drug administration. Chronic constriction injury (CCI)
Unilateral peripheral mono-neuropathy was induced in ketamin/xylasin-anesthetized mice by performing three loosely tied ligatures (with about 1mm spacing) around the common sciatic nerve (Bennett and Xie, 1988) using monocryl resorbable suture filaments (6-0, Ethicon, Piscataway, NJ, USA). The nerve was constricted to a barely discernable degree, so that circulation through the epineurial vasculature was not interrupted. After surgery, the animals were allowed to recover in a warming chamber, and then they were returned to their home cages. Mechanical thresholds were measured before CCI and at several time-points (see legend) starting from 3 day and up to 60 days after surgery.
Paw incision
The paw incision pain model was performed as described in Brennan (1999). Briefly, mice were anesthetised with ketamin/xylasin and a 5 mm longitudinal incision of the plantar face of the right hindpaw, starting from 2-5 mm from the proximal edge of the heel was performed. The plantar muscle was then carefully elevated with forceps and incised longitudinally with a blade, while leaving muscle's origins intact. The wound was closed with one horizontal mattress suture using 6.0 silk monofilament (Ethicon, Piscataway, NJ, USA) and the wound site was covered with betadine ointment. After surgery, the animals were allowed to recover in a warming chamber, and returned to their home cages. Mechanical thresholds were determined prior to and up to 60 days after surgery (see legend) starting from 6 hours post-injury.
Spared-nerve injury (SNI)
Spared nerve injury surgery was performed as described (Shields et al., 2003). Briefly, mice were anesthetized with a mix of ketamine/xylazine and an incision was made through the skin and thigh muscle at the level of the trifur cation of the sciatic nerve. The common sural and peroneal nerves were ligated using a 6.0 silk filament (Ethicon, Piscataway, NJ, USA) and transected, while leaving the tibial nerve intact. After surgery, the animals were allowed to recover in a warming chamber, and then they were returned to their home cages. Mechanical thresholds were determined at days 7, 9 and 14 post-surgery, before and after drug administration.
RNA extraction
Mice were deeply anesthetized with a mix of ketamine/xylazine and transcardially perfused with 5-10 mL RNA Later (Qiagen). L3 to L5 DRGs and SC were rapidly dissected and RNA was extracted by using RNeasy Micro Kit (Qiagen), according to manufacturer's instructions. For quality control, RNAs were loaded on a RNA NanoChip (Agilent) and processed with 2100 Bioanalyzer system (Agilent technology).
High-throughput sequencing and analyses
WT and Myola KO DRG and SC RNAs were extracted in experimental duplicates from 2-3 mice each. RNA-seq libraries were prepared using the TruSeq RNA Sample Preparation Kit (Illumina). All libraries were validated for concentration and fragment size using Agilent DNA1000 chips. Sequencing was performed on a HiSeq 2000 (Illumina), base calling performed using RTA (Illumina) and quality control performed using FastQC (FASTQC, 2010) and RSeQC (Wang et al., 2012). Sequences were uniquely mapped to the mmlO genome using Subread (Liao et al., 2013) (C version 1.4.6-p2) using default values. Reads mapping to gene exons (GRCm38.p4 gene assembly) were counted using featureCounts (Liao et al., 2014) (C version 1.4.6-p2). Differential gene expression was performed using exon counts from biological replicates using the DESeq2 BioConductor R package (Love et al., 2014), using a 5% false discovery rate (FDR) cutoff.
qRT-PCR
RNA obtained from each sample was converted into cDNA using Superscript III Reverse Transcriptase (Invitrogen). Gene expression was assessed by quantitative PCR (qPCR), using qPCR Sybr-Green master mix (ThermoFisher). Samples were run for 40 cycles on a StepOne qPCR apparatus (Applied Biosystems). The relative quantity of transcripts encoding each gene was determined by normalization to β-actin using the standard ACt or AACt method.
All experiments were performed in triplicates and data represent the fold change (mean ± SEM) in transcript expression level of Myola KO versus WT. The primers sequences used for qPCR are:
Myola F: CTACGAGCAGCTTCCCATCT Myola R: CCACATTTGCCAAAGCATAG
Gabra2 F: ACAAAAAGAGGATGGGCTTG
Gabra2 R: TCATGACGGAGCCTTTCTCT
Wfdyl F: AAAGGCCGGACACTCCTC
Wdfyl R: TGA GCTGCA GGTA GCA CA GT
Nnt F: CCTGGTGGCACCTTCGTA
Nnt R: CTGAGCCCAGGTACATGATTT
DRG neuron dissociation and culture
Adult WT, Myola KO, WT:Tafa4+ Venus and Myola KO: Tafa4+ Venus mice were deeply anesthetized (ketamine/xylazine) and DRGs were rapidly dissected, collected in ice-cold HBSS-glu (HBSS lx (Gibco), 0,1M D-glucose (Sigma), 50mM HEPES (Gibco), ph7,4) and subjected twice to enzymatic digestion using 2mg/ml type 1 collagenase (Gibco) and 5mg/ml dispase (both from Gibco) for 20 min at 37°C. DRGs were washed twice with HBSS-glu and resuspended in NBc medium (NBc: Neurobasal (Gibco), 1% (v/v) B27 (Gibco), lOOOU/ml penicillin (Invitrogen), 1000μg/ml streptomycin (Invitrogen)). Single cell suspensions were obtained by passages through 3 needle tips of decreasing diameter (gauge 18, 21, 26). Cells were plated on polyornithin- laminin coated dishes and kept at 37°C for 1-2 hours before adding lOng/ml Neurotrophin 4 (NT4, Peprotech) and 2ng/ml glial c e l l l in e - derived neurotrophic factor (GDNF, Invitrogen). C- LTMRs were identified through to live Venus fluorescence and Ad-LTMRs were identified thanks to their "rosette"- like morphology (Dubreuil et al, 2004). Patch-Clamp recordings were performed 18-30h after plating.
Electrophysiology on cultured DRGs
Electrophysiological recordings were performed using an Axopatch 200B amplifier. Data were analyzed by pCLAMP 10.5 (Molecular Devices).
Whole cell recordings of C-LTMRs and Αδ-LTMRs
Patch-clamp recordings of cultured C-LTMRs were performed with 1 to 2 ΜΩ pipettes filled with a KCl-based solution containing (in mM): 134 KCl, 1 MgCl2, 4.8 CaCl¾ 10 HEPES, 4 Mg-ATP, 0.4 Na- GTP and 10 EGTA (pH 7.3). Patch clamp recordings of cultured Αδ-LTMRs were performed with 1 to 3 ΜΩ pipettes filled with a KCl-based solution containing (in mM): 105 K Aspartate, 10 NaCl, 27 KCl, 4 Mg-ATP, 0.4 Na-GTP, 5 Creatine-Phosphate (sodium salt), 1 CaCl2, 10 EGTA, 1 MgCl2, 10 HEPES (pH 7.2 with KOH, «329mOsm).
Neurons were perfused at a flow rate of 2-3 ml/min with standard external solution containing (in mM): 140 NaCl, 4 KCl, 2 MgCl2, 2 CaCl2, 10 HEPES and 10 glucose (pH 7.4).
Stock solution of the GABAA receptor agonist, Muscimol (Tocris Bioscience) was prepared in water and dissolved in the external solution at the desired concentration. Muscimol was applied in the bath for 10s. Mechanical-activated currents
Mechanical stimulation has been realized with a sealed, fire-polished glass micropipette attached to a piezo- electric actuator (Step Driver PZ-150 M; Burleigh) that was positioned at an angle of 45 degrees from horizontal and used as mechanical probe. Downward movement of the probe toward the cell was driven by pClamp software (Molecular Devices). Voltage-clamped mechano-activated currents were recorded at a holding potential of -60mV with the same solutions as for whole patch clamp recordings of Αδ-LTMRs. Baseline for mechanical stimulation was defined in μιη as the distance of probe displacement inducing a mechano-activated current minus 0.5μιη.
Whole-Cell patch-clamp recording from spinal cord slices with attached dorsal root
Transverse spinal cord slices with attached dorsal roots from juvenile (P24 to P45) Myola KO and WT mice were prepared for whole-cell recording. Briefly, the animals were anesthetized using Pentobarbital (200mg/kg), perfused with ice cold oxygenated low calcium artificial cerebrospinal fluid (ACSF; in mM: NaCl 101; KC1 3.8; MgCl2 18.7, MgS04 1.3; KH2P04 1.2; HEPES 10; CaCl2 1 ; Glucose 1), and then beheaded. The vertebral column and surrounding muscles were quickly removed and immersed in ice cold oxygenated ACSF. Following laminectomy, the spinal cord was gently removed and its lumbar part was placed into a small 3% agarose block. Spinal slices (300μιη thick) were cut using a Leica VTS1000 vibratome, and transferred in warm (31 °C) ACSF (in mM: NaCl 130.5; KC1 2.4;CaC12 2.4; NaHC03 19.5; MgS04 1.3;KH2P04 1.2; HEPES 1.25; glucose 10; pH 7.4) equilibrated with 95%02-5%C02 for at least one hour before starting patch clamp recordings. Spinal slices were placed in a recoding chamber bathed with warmed (31°C) ACSF Electrophysiological measurements were performed under the control of an Olympus BX51 microscope using a multiclamp 2B (Molecular devices). Patch pipettes (7-11 Ω) were filled with C- based pipette solution (in mM: CsMethaneSulfonate 120; CsCl 20; CaC12 0.1 ; MgC12 1.3; EGTA 1 ; HEPES 10; GTP 0.1; cAMP 0.2; Leupeptin 0.1 ; Na2ATP 3; D-Manitol 77; pH 7.3). A glass suction electrode connected to a Master 8 (A.M.P. Instrument Ltd) stimulator was used to stimulate dorsal roots. Typically, a pair of high duration (500μs) high intensity stimulations (350μΑ) was used to recruit most primary afferent fibers in the recorded slice. All drugs were purchased from Sigma. Statistical comparison of EPSC frequencies was assessed for each cell using Kolmogorov-Smirnov test.
Results
Injury-induced acute mechanical pain is converted into chronic pain in Myola KO mice.
In a recent study, inventors identified Myola to be highly enriched in adult C-LTMRs (Reynders et al., 2015). Co-expression analysis showed that Myola was indeed expressed in GINIP+/IB4- C-LTMRs (Figure 1A), but its expression also occurred in Αδ LTMRs marked by TrkB and in a subset of Αβ Ret+ LTMRs (Figures IB and 1C), and totally excluded from peptidergic TrkA+ and proprioceptive TrkC+ neurons (data not shown). At the developmental level, Myola is expressed in a subset of large DRG neurons at El 5 (Figure ID) and its expression extends to the majority of DRG neurons at birth (Figure IE). Myola level of expression in SC during development and in adult is almost undetectable as confirmed by in situ hybridization and q-RT-PCR (Figures 1D-G).
To gain insights into the role of MYOIA in sensory physiology, inventors sought to analyze Myola KO mice (Tyska et al., 2005). These mice are viable, fertile and most of the perturbations described were related to the intestine biology where this atypical myosin protein is highly expressed (Kravtsov et al., 2012; Mazzolini et al., 2012). However nothing was known about the role of MYOIA in the somatosensory system.
To test whether loss of MYOIA altered DRG neurons development, inventors performed a series of quantitative and qualitative analyses. They found no difference in the total number of lumbar DRG neurons or in the number of TrkA+, TrkB+, TrkC+, Ret+ and TH+ neurons between WT and Myola KO mice (Figures 5A and 5B). At the anatomical level, double and triple staining experiments on SC sections showed that peptidergic CGRP+ and the subset of nonpeptidergic GINIP+ afferents displayed normal central projections to their respective laminae in the dorsal horn of the SC (Figures 5C-E). Peripherally, PGP9.5 and SI 00 staining revealed normal peripheral target innervation of all DRG neurons and hair follicles-innervating LTMRs (Figures 5F and 1G). Finally, to test whether loss of MYOIA affected neuronal excitability of DRG neurons, inventors performed patch-clam recordings on cultured C-LTMRs and D-hair Αδ mechanoreceptors. The C-LTMRs were visualized by crossing Myola KO mice with Tafa4Venus mice and the D-hair neurons were identified by their rosette-like shape. In both types of neurons, there were no differences between the two genotypes in passive and intrinsic electrical properties (Figures 6A-G). Furthermore, they found no difference in the sensitivity of cultured D-hair neurons from WT and Myola KO mice to a piezo-driven mechanical stimulation (Figures 6H and 61). Together these data demonstrate that MYOIA is dispensable for the survival, the molecular maturation, the anatomical organization and the electrophysiological properties of DRG neurons.
To gain insights into the role of MYOIA in somatosensation, inventors subjected Myola KO mice to a large battery of somatosensory tests under acute and injury conditions. Myola KO mice had normal behavior in the open filed and rotarod tests (Figures 7A-C), they exhibited no difference in their ability to sense noxious heat stimuli in the hot plate test and displayed normal response to the acetone test (Figures 7D and 7E). They then tested the mechanical sensitivity of their mice under acute and 3 different pathological conditions: Carrageenan-induced inflammation, the chronic constriction injury model (CCI) (Bennett and Xie, 1988), and the Brennan test (Brennan, 1999). Mechanical sensitivity was tested using the up-down method at basal conditions and at several time points after injury (Figures 1F-H). In all three paradigms mechanical thresholds at baseline levels were similar between the two genotypes (Figures 1F-H). Intraplantar injection of carrageenan induced a massive drop in mechanical thresholds in both genotypes starting at one hour post- inflammation (Figure IF). Impressively, three days post-inflammation, WT mice returned to baseline levels, whereas mechanical hypersensitivity was prolonged as long as 60 days post-inflammation in Myola KO mice, demonstrating that an acute and reversible inflammation-induced mechanical pain is converted into a long lasting and irreversible chronic pain. The same behavioral responses were observed in the nerve injury and in the postoperative models. Significant reversal of CCI-induced mechanical hypersensitivity started at day 30 and returned to baseline levels around day 40 in the WT mice, whereas, as in the Carrageenan-induced inflammation, mechanical hypersensitivity in the Myola KO mice persisted for as long as 60 days post-CCI (Figure 1G). Finally, in the Brenan test, incision- induced mechanical hypersensitivity was irreversible in the Myola KO mice, whereas it lasted for less than 10 days in the WT mice (Figure 1H). Thermal hypersensitivity was assessed in the Carrageenan and in the Brenan paradigms using the Hargreaves test. In the Carrageenan model, thermal hypersensitivity was prolonged in Myola KO mice but returned to baseline levels at day 60 post- inflammation (Figure 7G). However, in the Brenan model there was no difference between WT and Myola KO mice in the postsurgical-induced thermal hypersensitivity (Figure 7H). Finally, Myola KO mice exhibited a significant enhancement of formalin- evoked nocifensive behavior during both phases (Figure 7F). Together, these data demonstrate that Myola KO mice are predisposed to develop injury- induced chronic mechanical pain and suggest that these mice can be used as an excellent model system to decipher the mechanisms that trigger the transition from acute to chronic pain.
Loss of MYOIA specifically alters the ionotropic GABAergic signaling
It is well established that injury-induced chronic pain is caused by an imbalance between the excitatory and inhibitory neurotransmission in the SC, and that the concurrent exaggerated pain can be transiently reversed by a variety of compounds such as opioid, GABA and glycine receptors agonists, calcium channels antagonists and inventors' recently identified TAFA4. To unravel which of these signaling pathways are dysfunctional in Myola KO mice, inventors tested the analgesic effect of these compounds using the spared nerved injury (SNI) neuropathic pain model (Decosterd and Woolf, 2000). The SNI model was chosen because it's highly reproducible and also induces a long lasting and irreversible mechanical pain. Using this paradigm, they showed that intrathecal (IT) administration of delta and mu opioid receptors agonists SNC80 and DAMGO (Figure 2A), GABAB receptor agonist baclofen and TAFA4 (Figure 2B), α2δ voltage gated calcium channel inhibitor pregabalin and the glycine receptor agonist taurine (Figure 3C) significantly reversed SNI-induced mechanical hypersensitivity in both genotypes. However, in contrast to WT mice, IT administration of the GABAA agonist muscimol completely failed to reverse SNI-induced mechanical pain in Myola KO mice (Figure 2D). Myola KO mice resistance to the analgesic effect of muscimol was also confirmed in the zymosan A-induced inflammatory pain model (Witschi et al., 2011). Inventors first showed that zymosan-induced inflammation also resulted in a prolonged and irreversible mechanical hypersensitivity in Myola KO mice (Figure 2E). IT administration of muscimol or the GABAA-Rs positive allosteric modulator diazepam (DZP) strongly reversed zymosan-induced mechanical hypersensitivity in WT mice but had no effect on Myola KO mice (Figures 2F and 2G). Importantly, injection of SNC80 strongly reversed the mechanical pain in both genotypes (Figure 2H). Together, these data demonstrate that Myola KO mice predisposition to develop injury-induced chronic mechanical pain is due to a selective impairment of the ionotropic GABAergic inhibitory neurotransmission.
Loss of MOY1 A resulted in a selective upregulation of GABRA2 both in DRG and SC neurons
It is well established that loss of GABAergic inhibition may be altered by several means both in peripheral and central nervous systems. These include altered subunit composition of GABAA-Rs, altered levels of GABA, GABA release probability and the speed of its removal from the synaptic cleft, and change in chloride gradient that switches GABA-mediated inhibition into excitation (Sandkuhler, 2009). In order to unravel which of these mechanisms are affected in Myola KO mice we used an unbiased RNA deep sequencing screen. Biological replicates of polyA mRNA prepared from DRG and SC neurons of WT and Myola KO mice were subjected to high-throughput sequencing to very high sequencing depth (an average of 112xl06 exome-mapped reads per replicate), representing an average 250x whole-ex ome coverage (Table 1).
Table 1 : Summary of read mappings from RNA-seq of polyA mRNA prepared from DRG and SC of WT and Myola KO mice.
Highly significant differentially expressed (DE) genes upon loss of Myola expression were called (< 5% FDR; < p 0.00025), resulting in the identification of 98 DE genes in DRG neurons (Figure 3A and Table 2), and 32 DE genes (Figure 3A and Table 3) in SC neurons. Table 2: Differentially expressed genes in DRG of Myola KO vs WT mice.
Table 3 : Differentially expressed genes in SC of Myola KO vs WT mice.
While not surprising that the majority of DE genes were unique to DRG neurons where Myola is normally expressed (Figures 1A-G), a small number (14) of DE genes were deregulated in both DRG and SC neurons and 18 DE genes were unique to SC neurons (Figures 3 A and 3B). To confirm the RNA seq data inventors focused on few genes that were differentially expressed in both tissues using quantitative reverse transcription polymerase chain reaction (qRT-PCR). In both tissues, Nnt, Gabra2 and Wdfyl displayed a highly significant increase in Myola KO mice (Figure 3C). However, inventors were unable to confirm the differential expression of the downregulated genes (data not shown). Myola KO mice selective alteration of the ionotropic GABAergic neurotransmission revealed by inventors' behavioral experiments prompted them to focus on Gabra2 gene. Gabra2 was the only GABA receptor subunit that displayed altered expression in Myola KO mice (Table 4).
Table 4:
To complement the qRT-PCR results, they used in situ hybridization and immunohistochemistry. Using in situ hybridization they found that Gabra2 upregulation is much evident in DRG, with a very strong upregulation in large size neurons, than in SC (Figure 3D). Using immunohistochemistry, they confirmed that Gabra2 upregulation was accompanied by a significant increase in GABRA2 protein in the dorsal horn of SC where primary afferent endings and local interneurons are intermingled (Figures 3E and 3F). Importantly, in line with the selective upregulation of GABRA2 (Table 4), they found no difference in the immunoreactivity of GABRA1 (al subunit) between the two genotypes (Figure 3G). Finally, to test whether GABRA2 upregulation impacted GABAA-Rs function, they performed whole- cell patch clamp recordings on cultured WT and Myola KO Venus-expressing C-LTMRs. They found that bath application of increasing concentrations of muscimol triggered similar current amplitudes in both genotypes (Figures 4A and 4B), demonstrating that GABRA2 upregulation did not alter GABAA- Rs response to its selective agonist muscimol.
Muscimol-evoked increase in excitatory glutamatergic activity of lamina II interneurons is severely impaired in inflamed Myola KO mice.
In an attempt to provide a rational explanation to the insensitivity of Myola KO mice to the analgesic effect of muscimol, inventors used whole cell patch-clamp recordings on SC slices. First, a thorough characterization of a large panel of electrophysiological properties of inner lamina II neurons under acute conditions and after inflammation (Carrageenan and Zymozan) revealed no difference between WT and Myola KO mice (Figure 8). They then investigated the incidence of bath application of muscimol on spontaneous excitatory post-synaptic currents (sEPSC) in laminae II neurons in WT and Myola KO mice, under acute conditions and after zymosan inflammation. Under these conditions the overall average amplitude of sEPSC was similar between the two genotypes (data not shown). In naive WT mice, bath application of 5μΜ muscimol induced a significant increase in sEPSC frequency, as indicated by the shift of the sEPSC interval cumulative distribution curve towards the left (Figure 4C). This effect was almost doubled in slices from WT mice inflamed with zymosan (Figure 4E). Interestingly, in naive slices from Myola KO mice, muscimol induced a drastic 544% increase in sEPSC frequency (Figure 4D). However, this effect was completely lost in slices obtained from zymosan inflamed KO mice as bath application of muscimol had no effect on sEPSC frequency (Figure 4F), further supporting inventors observed insensitivity of Myola KO mice to the analgesic effect of muscimol after injury (Figures 2D and 2F).
Conclusions
In these experiments, inventors showed that loss of MYOIA converted an injury- induced acute and reversible pain into a long lasting and irreversible pain. This pain chronicity was selective to mechanical sensitivity in two inflammatory, one neuropathic and one post-operative pain models, suggesting that loss of MYOIA predisposes an individual to develop injury- induced chronic pain and revealing these mice as an ideal animal model to uncover the cellular and molecular mechanisms that trigger the transition from acute to chronic pain Indeed, inventors found that loss of MYOIA selectively impaired the ionotropic GABAergic signaling as injury-induced mechanical hypersensitivity in Myola KO mice could be transiently reversed by opioids, baclofen, pregabalin, TAFA4 and taurine but not by muscimol and diazepam. They also found that loss of MYOIA resulted in a constitutive upregulation of the a2 subunit of GABAA-Rs, suggesting a possible participation of the altered expression of this subunit in the process of injury- induced pain chronicity.
Chronic pain is a serious and highly heterogeneous medical problem with a prevalence varying from 20 to 30% of the world population (Bouhassira et al., 2008; Breivik et al., 2006). Given that only a fraction of individuals develop chronic pain, the contribution of genetic factors has been postulated (Belfer et al., 2015; Devor, 2004; Macrae, 2008; Tegeder et al., 2006; Voscopoulos and Lema, 2010). Here, using four different pain paradigms, inventors showed that Myola KO mice developed irreversible chronic pain after injury, demonstrating a causal link between loss of MYOIA and the development of chronic pain. Very importantly, inventors found that loss of one copy of Myola gene in Myola+/" mice induced a long lasting and irreversible mechanical pain in the setting of inflammation, further supporting a contribution of Myola as a predisposition gene to develop injury- induced chronic pain (Figure 71).
Using behavioral pharmacology, inventors showed that injury-induced mechanical hypersensitivity could not be reversed in Myola KO mice by muscimol. This impaired ionotropic GABAergic signaling was further demonstrated by their electrophysiological recordings in which they showed that under acute conditions, muscimol evoked a drastic increase in the excitatory glutamatergic activity of lamina II interneurons, whereas after inflammation, this effect was completely abolished. They also showed that the selective antagonist of GABAA-Rs biccuculine evoked similar mechanical hypersensitivity in naive WT and Myola KO mice (Figure 7J), demonstrating that GABAA-Rs are functional in Myola KO mice under acute conditions. Together, these data indicate that injury causes a shift of spinal GABAA-Rs from active to inactive state, further silencing the ionotropic GABAergic inhibitory neurotransmission in Myola KO mice, thus leading to the development of chronic pain. One plausible explanation to this phenomenon is that injury induces a massive internalization of GABAA- Rs in Myola KO mice. Indeed, decreases in synaptic GABAA-Rs, resulting from enhanced endocytosis, have been observed in animals in which the life-threatening refractory convulsive status epilepticus (SE) has been experimentally induced (Naylor et al., 2005; Terunuma et al., 2008). Interestingly, this decrease in surface receptors mainly targets GABAA-Rs containing benzodiazepine- sensitive subunits, which explains both the pharmaco-resistance of SE patients to benzodiazepines and the non-terminating nature of the seizures. Remarkably, inventors demonstrated that under injury conditions, Myola KO mice were totally insensitive to muscimol and DZP, and under these same conditions, once the injury- induced mechanical hypersensitivity is established; it becomes irreversible in these mice.
Another possible explanation to the observed phenotype came from inventors' RNA deep sequencing data. They found that loss of MYOIA was accompanied by a massive and selective upregulation of Gabra2 both in DRG and SC neurons at steady state, indicating that this altered expression likely participate to the observed injury-induced pain chronicity. Although they confirmed that gabra2 upregulation resulted in a significant increase in GABRA2 protein, this increase has no effect on the amplitude of muscimol-evoked currents in Myola KO CLTMRs. Given that GABRA2 was the only GABAA-Rs subunit to be differentially expressed in DRG and SC neurons, inventors' data suggest that GABRA2 upregulation likely contribute to shifting the balance towards more GABAA-Rs containing a2 subunit. In this case, the a2/al ratio will be mainly impacted in large size primary afferent neurons (See Figure 3D) as a2 and al are the main subunits expressed in DRG. In line with this hypothesis, a recent study demonstrated that patients with refractory convulsive status epilepticus and refractory epilepsy had significantly more a2-containing GABAA-Rs at the expense of al -containing receptors (Loddenkemper et al., 2014). Future studies exploring whether a2-containing GABAA-RS are prone to excessive internalization than GABAA-Rs containing other alpha subunits are warranted.
In conclusion, although it did not decipher the precise mechanisms that impair GABAA-Rs function under injury conditions in Myola KO mice, inventors describe the first mouse model in which a loss- of-function mutation leads to an irreversible pain state after injury. They also provide strong arguments that Myola gene should be seriously considered as a predictive genetic factor for the development of injury-induced chronic pain and points out the ionotropic GABAergic system as the main mechanism that contributes to the transition from acute to chronic pain. Inventors' study also provides a powerful preclinical animal model that can be used (i) to deepen our understanding of the molecular and cellular mechanisms that trigger the transition from acute to chronic pain and (ii) to the design "a la carte" pharmacological therapies to prevent the establishment of chronic pain.
REFERENCES
Ahmadi, S., Lippross, S., Neuhuber, W.L., and Zeilhofer, H.U. (2002). PGE(2) selectively blocks inhibitory glycinergic neurotransmission onto rat superficial dorsal horn neurons. Nat Neurosci 5, 34- 40.
Belfer, I., Dai, F., Kehlet, H., Finelli, P., Qin, L., Bittner, R., and Aasvang, E.K. (2015). Association of functional variations in COMT and GCH1 genes with postherniotomy pain and related impairment. Pain 156, 273-279.
Bennett, G.J., and Xie, Y.K. (1988). A peripheral mononeuropathy in rat that produces disorders of pain sensation like those seen in man. Pain 33, 87-107.
Bouhassira, D., Lanteri-Minet, M., Attal, N., Laurent, B., and Touboul, C. (2008). Prevalence of chronic pain with neuropathic characteristics in the general population. Pain 136, 380-387.
Bourane, S., Duan, B., Koch, S.C., Dalet, A., Britz, O., Garcia-Campmany, L., Kim, E., Cheng, L., Ghosh, A., Ma, Q., and Goulding, M. (2015a). Gate control of mechanical itch by a subpopulation of spinal cord interneurons. Science 350, 550-554.
Bourane, S., Grossmann, K.S., Britz, O., Dalet, A., Del Barrio, M.G., Stam, F.J., Garcia-Campmany, L., Koch, S., and Goulding, M. (2015b). Identification of a spinal circuit for light touch and fine motor control. Cell 160, 503-515.
Braathen, G.J., Hoyer, H., Busk, O.L., Tveten, K., Skjelbred, C.F., and Russell, M.B. (2015). Variants in the genes DCTN2, DNAH10, LRIG3, and MYOIA are associated with intermediate Charcot- Marie-Tooth disease in a Norwegian family. Acta neurologica Scandinavica.
Breivik, H., Collett, B., Ventafridda, V., Cohen, R., and Gallacher, D. (2006). Survey of chronic pain in Europe: prevalence, impact on daily life, and treatment. Eur J Pain 10, 287-333.
Brennan, T.J. (1999). Postoperative Models of Nociception. ILAR journal / National Research Council, Institute of Laboratory Animal Resources 40, 129-136.
Chaplan, S.R., Bach, F.W., Pogrel, J.W., Chung, J.M., and Yaksh, T.L. (1994). Quantitative assessment of tactile allodynia in the rat paw. J Neurosci Methods 53, 55-63.
Coull, J.A., Beggs, S., Boudreau, D., Boivin, D., Tsuda, M., Inoue, K., Gravel, C, Salter, M.W., and De Koninck, Y. (2005). BDNF from microglia causes the shift in neuronal anion gradient underlying neuropathic pain. Nature 438, 1017-1021.
Coull, J.A., Boudreau, D., Bachand, K., Prescott, S.A., Nault, F., Sik, A., De Koninck, P., and De Koninck, Y. (2003). Trans-synaptic shift in anion gradient in spinal lamina I neurons as a mechanism of neuropathic pain. Nature 424, 938-942.
Decosterd, I., and Woolf, C.J. (2000). Spared nerve injury: an animal model of persistent peripheral neuropathic pain. Pain 87, 149-158. Delfini, M.C., Mantilleri, A., Gaillard, S., Hao, J., Reynders, A, Malapert, P., Alonso, S., Francois, A, Barrere, C, Seal, R., et al. (2013). TAFA4, a chemokine-like protein, modulates injury- induced mechanical and chemical pain hypersensitivity in mice. Cell Rep 5, 378-388.
Devor, M. (2004). Evidence for heritability of pain in patients with traumatic neuropathy. Pain 108, 200-201 ; author reply 202.
Donaudy, F., Ferrara, A., Esposito, L., Hertzano, R., Ben-David, O., Bell, R.E., Melchionda, S., Zelante, L., Avraham, K.B., and Gasparini, P. (2003). Multiple mutations of MYOIA, a cochlear- expressed gene, in sensorineural hearing loss. Am J Hum Genet 72, 1571-1577.
Duan, B., Cheng, L., Bourane, S., Britz, O., Padilla, C, Garcia-Campmany, L., Krashes, M., Knowlton, W., Velasquez, T., Ren, X., et al. (2014). Identification of spinal circuits transmitting and gating mechanical pain. Cell 159, 1417-1432.
Eisenberger, T., Di Donato, N., Baig, S.M., Neuhaus, C, Beyer, A., Decker, E., Murbe, D., Decker, C, Bergmann, C, and Bolz, H.J. (2014). Targeted and genomewide NGS data disqualify mutations in MYOIA, the "DFNA48 gene", as a cause of deafness. Hum Mutat 35, 565-570.
FASTQC (2010). FastQC: A quality control tool for high throughput sequence data v. 0.11.3 (http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/, 2010).
Foster, E., Wildner, H., Tudeau, L., Haueter, S., Ralvenius, W.T., Jegen, M., Johannssen, H., Hosli, L., Haenraets, K., Ghanem, A., et al. (2015). Targeted ablation, silencing, and activation establish glycinergic dorsal horn neurons as key components of a spinal gate for pain and itch. Neuron 85, 1289-1304.
Gaillard, S., Lo Re, L., Mantilleri, A, Hepp, R., Urien, L., Malapert, P., Alonso, S., Deage, M., Kambrun, C, Landry, M., et al. (2014). GINIP, a Galphai-interacting protein, functions as a key modulator of peripheral GABAB receptor-mediated analgesia. Neuron 84, 123-136.
Gilron, I., Jensen, T.S., and Dickenson, A.H. (2013). Combination pharmacotherapy for management of chronic pain: from bench to bedside. The Lancet Neurology 12, 1084-1095.
Harvey, R.J., Depner, U.B., Wassle, H., Ahmadi, S., Heindl, C, Reinold, H., Smart, T.G., Harvey, K., Schutz, B., Abo-Salem, O.M., et al. (2004). GlyR alpha3: an essential target for spinal PGE2-mediated inflammatory pain sensitization. Science 304, 884-887.
Hulse, R.P., Donaldson, L.F., and Wynick, D. (2012). Differential roles of galanin on mechanical and cooling responses at the primary afferent nociceptor. Mol Pain 8, 41.
Kehlet, H., Jensen, T.S., and Woolf, C.J. (2006). Persistent postsurgical pain: risk factors and prevention. Lancet 367, 1618-1625.
Kravtsov, D.V., Caputo, C, Collaco, A., Hoekstra, N., Egan, M.E., Mooseker, M.S., and Ameen, N.A. (2012). Myosin la is required for CFTR brush border membrane trafficking and ion transport in the mouse small intestine. Traffic 13, 1072-1082.
Liao, Y, Smyth, G.K., and Shi, W. (2013). The Subread aligner: fast, accurate and scalable read mapping by seed-and-vote. Nucleic Acids Res 41, el 08. Liao, Y., Smyth, G.K., and Shi, W. (2014). featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923-930.
Loddenkemper, T., Talos, D.M., Cleary, R.T., Joseph, A., Sanchez Fernandez, I., Alexopoulos, A., Kotagal, P., Najm, I., and Jensen, F.E. (2014). Subunit composition of glutamate and gamma- aminobutyric acid receptors in status epilepticus. Epilepsy research 108, 605-615.
Love, M.I., Huber, W., and Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550.
Macrae, W.A. (2008). Chronic post-surgical pain: 10 years on. Br J Anaesth 101, 77-86.
Mazzolini, R., Dopeso, H., Mateo-Lozano, S., Chang, W., Rodrigues, P., Bazzocco, S., Alazzouzi, H., Landolfi, S., Hernandez-Losa, J., Andretta, E., et al. (2012). Brush border myosin la has tumor suppressor activity in the intestine. Proc Natl Acad Sci U S A 109, 1530-1535.
Muller, F., Heinke, B., and Sandkuhler, J. (2003). Reduction of glycine receptor-mediated miniature inhibitory postsynaptic currents in rat spinal lamina I neurons after peripheral inflammation.
Neuroscience 122, 799-805.
Munro, G., Ahring, P.K., and Mirza, N.R. (2009). Developing analgesics by enhancing spinal inhibition after injury: GABAA receptor subtypes as novel targets. Trends Pharmacol Sci 30, 453-459.
Naylor, D.E., Liu, H., and Wasterlain, C.G. (2005). Trafficking of GABA(A) receptors, loss of inhibition, and a mechanism for pharmacoresistance in status epilepticus. J Neurosci 25, 7724-7733.
Peirs, C, Williams, S.P., Zhao, X., Walsh, C.E., Gedeon, J.Y., Cagle, N.E., Goldring, A.C., Hioki, FL, Liu, Z., Marell, P.S., and Seal, R.P. (2015). Dorsal Horn Circuits for Persistent Mechanical Pain.
Neuron 87, 797-812.
Petitjean, H., Pawlowski, S.A., Fraine, S.L., Sharif, B., Hamad, D., Fatima, T., Berg, J., Brown, CM., Jan, L.Y., Ribeiro-da-Silva, A., et al. (2015). Dorsal Horn Parvalbumin Neurons Are Gate-Keepers of Touch-Evoked Pain after Nerve Injury. Cell reports 13, 1246-1257.
Reynders, A., Mantilleri, A., Malapert, P., Rialle, S., Nidelet, S., Laffray, S., Beurrier, C, Bourinet, E., and Moqrich, A. (2015). Transcriptional Profiling of Cutaneous MRGPRD Free Nerve Endings and C-LTMRs. Cell reports.
Sandkuhler, J. (2009). Models and mechanisms of hyperalgesia and allodynia. Physiol Rev 89, 707- 758.
Reynders, A, Mantilleri, A, Malapert, P., Rialle, S., Nidelet, S., Laffray, S., Beurrier, C, Bourinet, E., and Moqrich, A. (2015). Transcriptional Profiling of Cutaneous MRGPRD Free Nerve Endings and C-LTMRs. Cell reports.
Shields, S.D., Eckert, W.A, 3rd, and Basbaum, AL (2003). Spared nerve injury model of neuropathic pain in the mouse: a behavioral and anatomic analysis. J Pain 4, 465-470.
Tegeder, I., Costigan, M., Griffin, R.S., Abele, A., Belfer, I., Schmidt, H., Ehnert, C, Nejim, J., Marian, C, Scholz, J., et al. (2006). GTP cyclohydrolase and tetrahydrobiopterin regulate pain sensitivity and persistence. Nat Med 12, 1269-1277. Terunuma, M., Xu, J., Vithlani, M., Sieghart, W., Kittler, J., Pangalos, M., Haydon, P.G., Coulter, D.A., and Moss, S.J. (2008). Deficits in phosphorylation of GABA(A) receptors by intimately associated protein kinase C activity underlie compromised synaptic inhibition during status epilepticus. J Neurosci 28, 376-384.
Tyska, M.J., Mackey, A.T., Huang, J.D., Copeland, N.G., Jenkins, N.A., and Mooseker, M.S. (2005). Myosin-la is critical for normal brush border structure and composition. Mol Biol Cell 16, 2443-2457. Voscopoulos, C, and Lema, M. (2010). When does acute pain become chronic? Br J Anaesth 105 Suppl 1, i69-85.
Wang, L., Wang, S., and Li, W. (2012). RSeQC: quality control of RNA-seq experiments. Bioinformatics 28, 2184-2185.
Witschi, R., Punnakkal, P., Paul, J., Walczak, J.S., Cervero, F., Fritschy, J.M., Kuner, R., Keist, R., Rudolph, U., and Zeilhofer, H.U. (2011). Presynaptic alpha2-GABAA receptors in primary afferent depolarization and spinal pain control. J Neurosci 31, 8134-8142.
Zeilhofer, H.U., Wildner, H., and Yevenes, G.E. (2012). Fast synaptic inhibition in spinal sensory processing and pain control. Physiol Rev 92, 193-235.

Claims

1. Use of the DNA encoding Myosin IA (Myol a), of the m NA encoding Myol a or of the Myol a protein, as a biomarker for assessing the predisposition of a subject to develop an injury-induced chronic mechanical pain and/or an inflammatory- induced chronic thermal pain.
2. Use according to claim 1 , wherein the absence, a reduced expression or a non- functional expression of Myosin IA (Myol a) in a subject when compared to the expression observed in a Myol a homozygote (Myola+l+) reference subject expressing a functional Myol a, predisposes the subject to develop an injury- induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain.
3. Use according to claim 1 or 2, wherein the injury- induced chronic mechanical pain is an inflammatory, a neuropathic or a post-operative chronic mechanical pain.
4. An in vitro method of assessing the predisposition of a subject to develop an injury-induced chronic mechanical pain or an inflammatory-induced chronic thermal pain, wherein the method comprises a step of analyzing, typically sequencing, the Myola nucleic acid sequence obtained from a biological sample of the subject, the detection of an alteration of the nucleic acid sequence of Myola in the subject when compared to the Myola wild-type nucleic acid sequence as identified in SEQ ID NO: 1 indicating that the subject is predisposed to develop an injury- induced chronic mechanical pain and/or an inflammatory- induced chronic thermal pain whereas the absence of alteration indicates that the subject is not predisposed to develop an injury-induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain.
5. The method according to claim 4, wherein the biological sample is a blood, plasma or serum sample.
6. DNA encoding Myol a, mRNA encoding Myol a, or agonist of the Myosin IA protein for use for preventing or treating pain, in particular an injury-induced chronic mechanical pain and/or an inflammatory-induced chronic thermal pain, in a subject.
7. A composition comprising an agonist of the Myosin IA protein and a pharmaceutically acceptable carrier.
8. The composition of claim 7 for use for preventing or treating pain, in particular an injury-induced chronic mechanical pain and/or an inflammatory- induced chronic thermal pain, in a subject.
9. The use according to anyone of claims 1-3, the method according to claim 4 or 5, the DNA encoding Myol a, mRNA encoding Myola, or agonist of the Myosin IA protein for use according to claim 6, or the composition for use of claim 8, wherein the subject is a mammal, preferably a human being.
10. Device comprising at least one complementary nucleic acid that binds all or part of the Myola gene immobilized on a support.
1 l .A kit for assessing the predisposition of a subject to develop an injury-induced chronic mechanical pain or an inflammatory-induced chronic thermal pain comprising oligonucleotides for sequencing the Myola nucleic acid obtained from a biological sample of the subject.
12. An in vitro or ex vivo screening method of a drug candidate for preventing, reducing or treating pain, comprising determining the ability of a drug candidate to activate or stimulate, or on the contrary to decrease or suppress, Myola functional expression, and, if the ability is confirmed, the identification of the drug candidate as a Myola agonist and as a drug candidate for preventing, reducing or treating pain, or on the contrary as a Myola antagonist.
13. Use of a Myola KO (Myola-/- ) animal model for screening for Myola modulators and/or for drugs for preventing, reducing or inhibiting pain.
EP17710176.3A 2016-03-08 2017-03-07 Myo1a for predicting conversion of acute pain into chronic pain and use of myo1a for therapy of pain Withdrawn EP3426798A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP2016305257 2016-03-08
PCT/EP2017/055354 WO2017153424A1 (en) 2016-03-08 2017-03-07 Myo1a for predicting conversion of acute pain into chronic pain and use of myo1a for therapy of pain

Publications (1)

Publication Number Publication Date
EP3426798A1 true EP3426798A1 (en) 2019-01-16

Family

ID=64604402

Family Applications (1)

Application Number Title Priority Date Filing Date
EP17710176.3A Withdrawn EP3426798A1 (en) 2016-03-08 2017-03-07 Myo1a for predicting conversion of acute pain into chronic pain and use of myo1a for therapy of pain

Country Status (1)

Country Link
EP (1) EP3426798A1 (en)

Similar Documents

Publication Publication Date Title
JP7030685B2 (en) Methods for Treating Autoimmune Status in Patients with Gene Mutations in DCR3 or DCR3 Network Genes
KR101437718B1 (en) Markers for predicting gastric cancer prognostication and Method for predicting gastric cancer prognostication using the same
US9850543B2 (en) Biomarkers associated with BRM inhibition
CN105431549A (en) TERT (Telomerase Reverse Transcriptase) Gene Promoter Mutations in Cancer
KR20190095074A (en) Animal model of brain tumor and manufacturing method of animal model
Lehman et al. Astroblastomas exhibit radial glia stem cell lineages and differential expression of imprinted and X-inactivation escape genes
US20150118243A1 (en) Methods and Compositions for Identifying, Diagnosing, and Treating Neuroblastoma
JP2025164768A (en) Determine cancer response to treatment
WO2015118338A1 (en) Methods for exploiting synthetic lethality and chemo-sensitisation in dna damage response (ddr) pathways
WO2022006667A1 (en) Diagnosis and treatment of chronic diabetic complications using long non-coding rnas as targets
Milinkovic et al. The impact of TP53 and RAS mutations on cerebellar glioblastomas
US11180791B2 (en) MYO1A for predicting conversion of acute pain into chronic pain and use of MYO1A for therapy of pain
EP3126521B1 (en) Hnf4g-rspo2 fusion gene
US11510911B2 (en) Method for prediction of susceptibility to sorafenib treatment by using SULF2 gene, and composition for treatment of cancer comprising SULF2 inhibitor
WO2022159852A1 (en) Methods and compositions for treating adenoid cystic carcinoma
Su et al. Deregulation of the planar cell polarity genes CELSR3 and FZD3 in Hirschsprung disease
US9481910B2 (en) Methods and compositions for the detection of drug resistant BRAF isoforms
Boldrini et al. Mutations of Fas (APO-1/CD95) and p53 genes in nonmelanoma skin cancer
Zhu et al. A drug-screening platform based on organotypic cultures identifies vulnerabilities to prevent local relapse and treat established brain metastasis
Knillová et al. The significance of key regulators of apoptosis in the development and prognosis of prostate carcinoma. I. Proteins of the Bcl-2 family and protein p53
US9260754B2 (en) Connexin mutation detection for lymphatic variation and disease
KR20110095878A (en) How to optimize the treatment of chronic myelogenous leukemia with AI tyrosine kinase inhibitors
Li et al. Transmembrane protein 9 as a novel biomarker promotes oral squamous cell carcinoma growth via IL1RN and serves as an immune therapeutic target
JP2024543181A (en) Minor spliceosome targeting compositions and their use in cancer treatment
Tognon et al. Expression of the ETV6-NTRK3 gene fusion in human secretory breast carcinoma

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20180921

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20201022

REG Reference to a national code

Ref country code: DE

Ref legal event code: R079

Free format text: PREVIOUS MAIN CLASS: C12Q0001680000

Ipc: C12Q0001688300

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: GRANT OF PATENT IS INTENDED

RIC1 Information provided on ipc code assigned before grant

Ipc: A01K 67/027 20060101ALI20221209BHEP

Ipc: G01N 33/50 20060101ALI20221209BHEP

Ipc: A61K 31/713 20060101ALI20221209BHEP

Ipc: A61K 31/7088 20060101ALI20221209BHEP

Ipc: C12Q 1/6883 20180101AFI20221209BHEP

INTG Intention to grant announced

Effective date: 20230113

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20230524