EP3341487A1 - Means and methods for production of organic compounds - Google Patents
Means and methods for production of organic compoundsInfo
- Publication number
- EP3341487A1 EP3341487A1 EP16767152.8A EP16767152A EP3341487A1 EP 3341487 A1 EP3341487 A1 EP 3341487A1 EP 16767152 A EP16767152 A EP 16767152A EP 3341487 A1 EP3341487 A1 EP 3341487A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- seq
- bacteria
- gene
- host cell
- ptuf
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/44—Polycarboxylic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
- C12P7/06—Ethanol, i.e. non-beverage
- C12P7/08—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate
- C12P7/10—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate substrate containing cellulosic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y113/00—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13)
- C12Y113/11—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13) with incorporation of two atoms of oxygen (1.13.11)
- C12Y113/11001—Catechol 1,2-dioxygenase (1.13.11.1)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/54—Improvements relating to the production of bulk chemicals using solvents, e.g. supercritical solvents or ionic liquids
Definitions
- biomass i.e. biological material derived from living, or recently living organisms
- biomass is a renewable, carbon-neutral resource. It has been estimated that biomass could provide about 25% of global energy requirements.
- biomass can also be a source of valuable and value-added chemicals, pharmaceuticals and food additives.
- Lignocellulose describes the main constituents in most plants, namely cellulose, hemicelluloses, and lignin.
- Lignocellulosic biomass as present in waste from food and paper production and forestry as well as municipal solid waste (MSW), is mostly destroyed as low- grade fuel by burning or used as a low-value products (e.g. as flocculating and dispersing agents).
- MSW municipal solid waste
- cellulose contains large reservoirs of energy and is already used industrially for conversion into biofuels.
- Lignin constitutes 15-35% of the weight and carries the highest internal energy content of all the three fractions. Efficient conversion of lignin is, however, not trivial due to its complex, irregular structure, which complicates chemical conversion efforts.
- lignin valorization technologies are substantially less developed than those for the polysaccharides. (Pinkowska et al. Chem Eng J. 2012, 187: 410-414). However, economic viability of lignocellulosic biorefineries depends, besides the conversion of cellulose and hemicellulose, also on the conversion of lignin to value-added compounds.
- lignin can be partially separated from lignocellulosic biomass. These processes can be classified into two general groups: (i) processes in which lignin is degraded into soluble fragments and is removed by separating the solid residue from the spent liquor (including pulping processes, such as kraft, sulfite, soda, and organosolv) and (ii) processes that selectively hydrolyze polysaccharides and leave lignin along with some condensed carbohydrate deconstruction products as a solid residue (e.g. dilute acid hydrolysis of lignocellulose to yield sugar monomers, furfural and levulinic acid) (Azadi et al. Renewable and Sustainable Energy Reviews. 2013; 21 : 506-523).
- pulping processes such as kraft, sulfite, soda, and organosolv
- processes that selectively hydrolyze polysaccharides and leave lignin along with some condensed carbohydrate deconstruction products as a solid residue e.g. dilute acid hydrolysis of
- depolymerization is an important next step for many lignin valorization strategies, in order to generate valuable aromatic chemicals and/or provide a source of low-molecular-mass feedstocks suitable for downstream processing.
- Considerable amount of research has been done to convert lignin into renewable fuels and chemicals using pyrolysis and gasification methods.
- Biochemical depolymerization of lignin, such as depolymerisation by fungi, is hampered by its low efficiency.
- Chemical depolymerization methods including acid- and base-catalyzed methods and depolymerisation in the presence of transition metal-based catalysts such as Ni and Ct, are also available, but mostly require harsh reaction conditions and are rather complicated to handle due to toxicity and flammability,. (Azadi et al. Renewable and Sustainable Energy Reviews. 2013; 21 : 506-523).
- Organic products from lignin depolymerisation can advantageously be employed as renewable sources of chemicals.
- adipic acid can e.g. be obtained from catechol via a variety of organic intermediate products, such as cis-cis-muconic acid, and is a value-added compound used primarily as a precursor for the synthesis of nylon, coatings, and plastics which is today produced mainly in chemical processes from petrochemicals like benzene. Because of the strong environmental impact of the conventional petrochemical production processes due to high energy costs and the dependence on fossil resources, biotechnological production processes would provide an attractive alternative.
- Lignin valorization into useful chemical compounds is however hampered by the fact that described lignin depolymerization techniques (pyrolysis, gasification, hydrogenolysis, chemical oxidation) typically result in a complex mixture of aromatic compounds in which the individual mass fraction of each compound barely exceeds few percent.
- lignin depolymerization techniques pyrolysis, gasification, hydrogenolysis, chemical oxidation
- some organisms have evolved metabolic pathways that enable the utilization of lignin-derived aromatic molecules as carbon sources.
- aromatics obtained from common lignin depolymerisation techniques are utilizable by said organisms.
- biocatalytic funneling as reported by Vardon et al. Energy & Environmental Science. 2015 (8): 617-628- typically requires extensive genetic modification of the biocatalyst, which can be complicated and time-consuming. Further, due to a specific conversion rate for each compound obtained after the depolymerization of lignin with the engineered biocatalyst, intermediates do accumulate and may polymerize leading to a dark coloration of the medium.
- the present invention provides novel and advantageous approaches for conversion of organic compounds into useful products.
- the present invention provides a method of producing an organic product, comprising i) Fluid-assisted decomposition of an organic educt under sub- and/or supercritical conditions ii) obtaining an intermediate product from step i) iii) subjecting the intermediate product to biocatalytic conversion
- step (ii) steam bath distillation can be employed in obtaining the intermediate product in step (ii). It is envisaged that intermediate product obtained from step ii) has a degree of purity of 70% w/w or more, 75% w/w or more, 80% w/w or more, 85% w/w or more, 90% w/w or more, preferably 95% w/w or more, more preferably of 99% w/w or more.
- the intermediate product may comprise, e.g., catechol, phenol, m-cresol, p-cresol and/or o-cresol, in particular when the organic educt is selected from lignin, or guaiacol.
- any organic educt is suitable to be processed according to the method of the invention.
- Particularly envisaged educts comprise lignin, guaiacol, p-coumaryl alcohol, coniferyl alcohol, sinapyl alcohol, catechol, m-cresol, p-cresol, o-cresol, phenol, polysaccharides, cellulose, hemicellulose, xylose, glucose, fructose, proteins, amino acids, triacylglycerides, and/or fatty acids.
- the product obtained from the method of the invention may be c/s-c/s-muconic acid.
- said c/s-c/s-muconic acid may be white in color.
- the yield of cis-cis-muconic acid from catechol is greater than 50 % w/w, greater than 60 % w/w, greater than 70% w/w, greater than 80% w/w, greater than 90 % w/w, preferably greater than 95 % w/w, even more preferred greater than 99% w/w.
- the yield of cis-cis-muconic acid from phenol is greater than 50 % w/w, greater than 60 % w/w, greater than 70% w/w, greater than 80% w/w, greater than 90 % w/w, preferably greater than 95 % w/w, preferably even more preferred greater than 99% w/w.
- the yield of cis-cis-muconic acid from cresol is greater than 50 % w/w, greater than 60 % w/w, greater than 70% w/w, greater than 80% w/w, greater than 90 % w/w, preferably greater than 95 % w/w, even more preferred greater than 99% w/w.
- the yield of cis-cis-muconic acid from guaiacol is greater than 50 % w/w, greater than 60 % w/w, greater than 70% w/w, greater than 80% w/w, greater than 90 % w/w, preferably greater than 95 % w/w, even more preferred greater than 99% w/w.
- step (iii) subjecting the intermediate product obtained before comprises contacting the intermediate product obtained in step ii) with a biocatalyst, in particular a biocatalyst selected from the group consisting of bacteria, yeast, filamentous fungi, cyanobacteria, algae, and plant cells.
- a biocatalyst in particular a biocatalyst selected from the group consisting of bacteria, yeast, filamentous fungi, cyanobacteria, algae, and plant cells.
- Pseudomonas in particular Pseudomonas putida, such as the Pseudomonas putida strain KT2440 may be preferred host cells.
- the host cell may in general be a non-genetically modified host cell or a genetically modified host cell (recombinant host cell) comprising at least one heterologous gene which may be stably integrated into the host cell's genome.
- Said at least one heterologous gene in particular a catA gene and/or catA2 gene, may be derived from Pseudomonas, preferably Pseudomonas putida, more preferably Pseudomonas putida strain KT2440.
- the host cell may comprise at least one gene encoding a polypeptide having catechol 1 ,2-dioxygenase activity.
- Said gene may be endogenous or heterologous to the host cell. More specifically, the host cell may comprise at least one (optionally heterologous) catA gene and/or at least one (optionally heterologous) catA2 gene.
- Said catA gene is envisaged to encode a catA polypeptide, e.g. a polypeptide comprising a sequence corresponding to SEQ ID No. 1 .
- Said catA gene may comprise a sequence corresponding to SEQ ID No. 2.
- Said catA2 gene is envisaged to encode a catA2 polypeptide, e.g. a polypeptide comprising a sequence corresponding to SEQ ID No. 3.
- Said catA2 gene may comprise a sequence corresponding to SEQ ID No. 4.
- the host cell may thus comprise: i) at least one (optionally heterologous) catA gene encoding a catA polypeptide comprising a sequence corresponding to SEQ ID No. 1 ; and ii) at least one (optionally heterologous) catA2 gene encoding a catA2 polypeptide comprising a sequence corresponding to SEQ ID No. 3
- the host cell may comprise a promoter sequence corresponding to i) SEQ ID No. 5 [Pem7]; or ii) SEQ ID No. 6 [Pem7*]; or iii) SEQ ID No. 7 [Ptuf]; or iv) SEQ ID No. 8 [PrpoD]; or v) SEQ ID No. 9 [Plac]; or vi) SEQ ID No. 10 [PgyrB]; or vii) SEQ ID No. 1 1 ; or
- Promoter sequences corresponding to SEQ ID Nos. 88-100 relate to derivatives of Ptuf with increased activity compared to the original Sequence, created by random mutagenesis as described herein.
- Promoter sequences corresponding to SEQ ID Nos. 102- 105 relate to derivatives of Pgro with increased activity compared to the original Sequence, created by random mutagenesis as described herein.
- the host cell may express the at least one (optionally heterologous) gene, which may be a (optionally heterologous) catA gene and/or a (optionally heterologous) catA2 gene, constitutively.
- the host cell may further be characterized in that it does not express a functional catB polypeptide, a functional catC polypeptide and/or a functional pcaB polypeptide. This may be accomplished by the catB gene, catC gene and/or pcaB gene being for instance silenced, preferably knocked-down or knocked-out, or deleted from the chromosome.
- a host cell for the production of cis, c/s-muconic acid from catechol which host cell comprises i) at least one (optionally heterologous) catA gene; ii) and at least one (optionally heterologous) catA2 gene
- Said at least one (optionally heterologous) catA gene is envisaged to encode for a catA polypeptide comprising a sequence corresponding to SEQ ID No. 1 .
- the catA gene may comprise a sequence corresponding to SEQ ID No. 2.
- Said at least one (optionally heterologous) catA2 gene is envisaged to encode for a catA2 polypeptide comprising a sequence corresponding to SEQ ID No. 3.
- the catA2 gene may comprise a sequence corresponding to SEQ ID No. 4.
- Said host cell may further comprise, operably linked to, e.g. upstream of, the at least one (optionally heterologous) catA gene and/or catA2 gene a promoter sequence corresponding to i) SEQ ID No. 5 [Pem7]; or ii) SEQ ID No. 6 [Pem7*]; or iii) SEQ ID No. 7 [Ptuf]; or
- SEQ ID No. 9 [Plac]; vi) SEQ ID No. 10 [PgyrB].
- the host cell may be further characterized in that it does not express a functional catB polypeptide; and/or does not express a functional catC polypeptide, and/or does not express a functional pcaB polypeptide.
- the host cell may further not comprise a functional catB gene; and/or does a functional catC gene, and/or a functional pcaB gene.
- the host cell may be selected from the group consisting of bacteria, yeast, filamentous fungi, cyanobacteria, algae, and plant cells.
- the host cell may be selected from Pseudomona, preferably Pseudomonas putida, more preferably Pseudomonas putida strain KT2440.
- the host cell is selected from another type of cell, and comprises at least one (optionally heterologous) catA gene and/or at least one (optionally heterologous) catA2 gene
- said catA gene and/or catA2 gene may be derived from Pseudomonas, preferably Pseudomonas putida, more preferably Pseudomonas putida strain KT2440.
- the term “less than” or “greater than” includes the concrete number. For example, less than 20 means less than or equal to. Similarly, more than or greater than means more than or equal to, or greater than or equal to, respectively.
- Figure 1 shows the reaction pathway of catechol conversion in P. putida KT2440.
- Figure 2 shows the product of biocatalytic conversion of catechol, cis-cis-muconic acid, obtained by the lignin processing method as described herein. Cultivation of Pseudomonas putida strain JD1 in the presence of catechol may result in catechol accumulation and polymerization due to the sole expression of catA2, resulting in yellow and sometimes dark coloration of the medium (left).
- Figure 3 is a depiction of SEQ ID No.1 to SEQ ID No. 16 referenced herein.
- Figure 5 Concentrations of catechol, phenol, guaiacol and ⁇ -, ⁇ -, m-cresol (cresol) after hydrothermal conversion at different temperatures in °C (first number of labeling on x- axis) and water density in g/cm 3 (second number of labeling on x-axis).
- Figure 6 Yields of catechol and the sum of catechol, phenol, guaiacol and o, p, m- cresol after hydrothermal conversion at different temperatures in °C (first number of labeling on x-axis) and water density in g/cm 3 (second number of labeling on x-axis).
- Figure 7 3D-plot showing the outcome of the DoE experiment, which represents the relation between the yield of catechol in % w/w, and the temperature in °C and the water density in g/cm 3 during the hydrothermal conversion of lignin.
- Figure 8 Concentrations of catechol, phenol, guaiacol and o-, p, m-cresol (cresol) after hydrothermal conversion at 400 °C and 0.50 g/cm 3 water density with various retention times using Kraft lignin from Sigma Aldrich, USA
- Figure 9 Promoter library for constitutive gene expression of Ptuf and Pgro in P. putida. The activity of the promoter is measured as RFU per OD600. The data are the means and standard deviations of results from three independent experiments. The last three balks indicate negative controls (medium control, P. putida Wt KT2440, empty vector pSEVA247R).
- Figure 10 Specific catechol conversion rates (mmol g-1 h-1 ; indicated as bars) and catechol 1 ,2-dioxygenase activities (U mg-1 ; indicated as lines) in selected producer strains. In all producer strains, a complete conversion of catechol to the product cis, cis-muconic acid within diverse periods could be detected. The data are the means and standard deviations of results from three independent experiments.
- Figure 11 is a depiction of SEQ ID No.88 to SEQ ID No. 107 referenced herein.
- This approach is new and advantageous in that it achieves a high yield of useful organic end products from a biomass feedstock on a reproducible basis and can potentially be conducted with suitable genetically modified or non-genetically modified biocatalysts, advantageously resulting in a high yield and purity of organic end product obtainable under high reaction rates, and hence easy and efficient production.
- the present invention provides a method of producing an organic product, said method comprising the steps of
- step iii subjecting the intermediate product from step ii) to biocatalytic conversion.
- the present inventors provide a novel method of processing, e.g., complex and/or polymeric organic feedstock that may commonly be seen as waste material or a useless or low-value by-product of processing other organic compounds into useful organic compounds.
- the method of the present invention advantageously yields extraordinary high concentrations of the final product.
- catechol was used as an intermediate product, the present inventors were able to yield cis,cis-muconic acid concentrations of more than 60 g/l.
- sub- and/or supercritical fluid-assisted conversion refers to the chemical conversion of organic compounds in sub- und supercritical fluids acting as solvents.
- the term may also involve decomposition of polymers into their multi- and/or monomeric constituents (also referred to as "depolymerisation” herein).
- An exemplary protocol for supercritical fluid-assisted conversion employing supercritical water as a solvent is described in the appended examples.
- “Hydrothermal conversion” refers to conversion of organic compounds with sub- and/or supercritical water as a solvent.
- solvents including: C0 2 , methane, ethane, propane, ethylene, propylene, methanol, ethanol, acetone, 2-propanol, acetic acid, formic acid, and nitrous oxide.
- C0 2 methane, ethane, propane, ethylene, propylene, methanol, ethanol, acetone, 2-propanol, acetic acid, formic acid, and nitrous oxide.
- Hydrothermal conversion in general comprises introducing an organic educt and an effective amount of water into a suitable reaction vessel, operated at a temperature from about 200° C to about 500° C, at a pressure greater than the saturated water vapor pressure within the reaction vessel, and at a suitable residence time (also referred to as “retention time” or “reaction time” herein), thereby resulting in the conversion of the organic educt into one or more intermediate products.
- Fluid-assisted conversion under sub- and/or supercritical conditions may also involve stirring of the reactor contents.
- the critical point for pure water is 374 °C (647,1 K) and 22,1 MPa. Above this temperature and pressure, water is in its supercritical phase. Without wishing to be bound by theory, it is thought that above its critical point, physical properties of water drastically change. The dielectric constant and ion product of water can be changed based on variations in water density and temperature. Above its supercritical point, the dielectric constant of water decreases further as well as the ion product. Water is thought to start behaving like an organic, non-polar solvent which results in poor solubility for inorganics, and complete miscibility with gases and many hydrocarbons. Due to this miscibility, phase boundaries do not exist anymore or are substantially reduced. This absence is thought to lead to fast and complete homogeneous reactions of water with organic compounds, such as the organic educts exemplified herein.
- reaction temperature may be 250°C and above, such as about 260°C, about 270°C, about 280°C, about 290°C, about 300°C, about 310°C, about 320°C, about 330°C, about 340°C, and about 350°C.
- the pressure may be 5 Mpa or higher, such as about 10 MPa, about 15 MPa, about 20 MPa, or about 25 MPa.
- reaction temperatures of 350°C and above are envisaged, such as about 360°C, about 370°C, about 380°C, about 390°C, about 400°C, about 410°C, about 420°C, about 430°C, about 440°C, about 450°C, about 460°C, about 470°C, about 480°C, about 490°C, about 500°C, about 510°C, about 520°C, about 530°C, about 540°C, about 550°C, about 560°C, about 570°C, about 580°C, about 590°C, or about 600°C.
- the pressure may be 25 Mpa or higher, such as about 30 MPa, about 35 MPa, about 40 MPa, about 45 MPa, or about 50 MPa.
- Other parameters for sub- and supercritical water have been reviewed in Toor SS et al. Energy 201 1 ; 36: 2328-42. Further parameters for sub- and supercritical water for the decomposition of lignin have been disclosed by Wahyudiono et al (Chemical Engineering and Processing; 2008, vol. 47, p. 1609-1619) resulting in the generation of more than 28 wt% catechol.
- Wahyudiono et al Chemical Engineering and Processing; 2008, vol. 47, p. 1609-1619
- the skilled person will readily be able to select suitable reaction conditions, preferably resulting in a high yield of desired intermediate products.
- reaction conditions will vary depending on the organic educt subjected to sub- and/or supercritical fluid-assisted conversion, the size and properties of the reaction container, and the desired nature and yield of intermediate product that is to be obtained.
- Reaction conditions can be adjusted, e.g. by the addition of salts, solvents (e.g. methanol, phenol or p-cresol), different concentrations of organic educt (e.g. lignin), and various retention times.
- the present invention is considered to be particular advantageous for converting lignin into cis-cis-muconic acid via catechol.
- This process is also termed "lignin processing" hereinafter.
- a preferred protocol for the first step in lignin processing i.e. lignin conversion using sub- and/or supercritical fluids, is described in the following.
- the present inventors have discovered that in order to convert the organic educt lignin into the intermediate product catechol, reaction temperatures 300°C and above, such as about 320°C, about 340°C, about 360°C, about 380°C, about 400°C, about 420°C, about 440°C about 460°C or about 470°C may be favorable.
- Reaction temperatures of between about 350°C and about 420°C may be particularly preferred.
- the reactor contents may be stirred, e.g. at about 150 rpm.
- reaction conditions including e.g. the residence time, concentration of organic educt, addition of salts and/or solvents may be adjusted in order to increase catechol yield and decrease the production of unwanted organic by-products.
- concentration of organic educt, addition of salts and/or solvents may be adjusted in order to increase catechol yield and decrease the production of unwanted organic by-products.
- the skilled person will readily be able to adjust the retention time in order to obtain a desired amount of catechol, e.g. depending on the size of the reactor.
- Exemplary retention times at sub and/or supercritical conditions applied in the methods of the invention may in general be between 10 and 160 min.
- reaction times include for instance reaction times between 0,5 hours and 4 hours, such as between 1 hour and 3,5 hours, 1 ,5 hours and 3 hours, e.g. 2 hours (for instance with heat-up time 1 hour, maintenance of reaction temperature 30 min ("reaction phase"), cooling down 30 min).
- reaction phase maintenance of reaction temperature 30 min
- altered reaction conditions including altered residence time, reaction time and reaction temperature are also conceivable, for example a reduction in retention time before and after the reaction phase (i.e. shortened heating and cooling time of the reactor before and after the hydrothermal conversion), a reduction or increase of the reaction time itself, an increase in temperature and/or water density, and/or addition of salts and solvents.
- salts to the reactor may shift the reaction equilibrium towards the intermediate compounds.
- Illustrative examples for useful salts that can be added to the reaction include alkali salts, e.g. Na 2 S0 4 , NaCI, KCI, CaCI 2 , and CaS0 4 .
- catalysts such as CaO, NaHC0 3 , bOH, CsOH, LiOH, Ca(OH)2, CaC0 3 , Na 2 C0 3 , K 2 C0 3 , KOH, Ni, Zr0 2 , H 2 S0 4 , Ti0 2 , Zr0 2 , Ru, Pt, Rh, Pd FeCI 3 , and/or NiCI 2 , NaOH, HCI can be added.
- Addition of hydrogen donor solvents such as tetralin, ethyl acetate, coal tar and reducing gas such as and H 2 , CO, and Ar can further be applied to increase the liquid reaction product.
- Biomass and its constituents are particularly envisaged for use as feedstock in the methods of the invention and generally include biological material derived from living, or recently living organisms, such as waste from wood processing industry (e.g.
- Biomass constituents envisaged for use according to the methods of the invention include, without limitation, lignocellulose, lignin, guaiacol, p-coumaryl, coniferyl, sinapyl alcohols, catechol, phenol, m-cresol, p-cresol, o-cresol, cellulose, hemicellulose, starch, glucose, fructose, xylose, triacylglycerides, fatty acids, proteins, amino acids and derivatives thereof.
- Cellulose is a polysaccharide composed of units of glucose.
- the basic repeating unit of the cellulose polymer consists of two glucose anhydride units, called a cellobiose unit.
- the glucose monomers are connected via
- Cellulose derivatives such as carboxymethylcellulose are also encompassed by the term.
- Hemicellulose is a heteropolymer composed of sugar monomers, including xylose, mannose, glucose, galactose and others, which can also have side chains.
- hemicellulose consists of various polymerized monosaccharides including five- carbon sugars (usually xylose and arabinose), six-carbon sugars (galactose, glucose, and mannose), and 4-O-methyl glucuronic acid and galacturonic acid residues. The ratios of these monomers can change quite dramatically for different feedstock sources.
- Starch is a polysaccharide consisting of glucose monomers bound with o(1/4) and o (1/6) bonds.
- Fats and oils in biological systems are typically in the form of triacylglycerides (TAGs, also termed “triglycerides”), which consist of three fatty acids bound via ester linkages to a glycerol backbone.
- TAGs triacylglycerides
- the term comprises saturated and unsaturated triacylglyerides.
- Lignin is a cross-linked amorphous copolymer synthesized from random polymerization of aromatic monomers, in particular the three primary phenylpropane monomers p-coumaryl alcohols, coniferyl alcohols, and sinapyl alcohols containing zero, one, and two methoxyl groups, respectively.
- An exemplary lignin structure is shown in formula (1 )., However, the exact structure may vary depending on the source and pre- treatment of the compound.
- lignin includes naturally occurring lignin (a water-insoluble macromolecule comprised of three monolignol monomers: p-coumaryl alcohol, coniferyl alcohol, and sinapyl alcohol) and also processed lignin derivatives, for example the following compounds obtainable from Sigma-Aldrich: alkali lignin (CAS Number 8068-05-1 ), organosolv lignin (CAS Number: 8068-03-9), hydrolytic lignin (CAS Number: 8072-93-3) lignosulfonic acid sodium salt (CAS Number: 8061-51-6) and guaiacol (CAS Number: 90-05-1 ).
- alkali lignin CAS Number 8068-05-1
- organosolv lignin CAS Number: 8068-03-9
- hydrolytic lignin CAS Number: 8072-93-3
- lignosulfonic acid sodium salt CAS Number: 8061-51-6
- guaiacol guaiacol
- Sub- and/or supercritical fluid-assisted conversion of an organic educt is envisaged herein to yield a liquid reaction product comprising the desired intermediate product intended for biocatalyzation and optionally further by-products, solvents and remaining organic educt.
- the relative amount of desired intermediate product in the reaction product may vary depending on the organic educt and the reaction conditions.
- catechol is envisaged to be present in the liquid reaction product in an amount of 5% w/w or more, such as 10% w/w, 15% w/w, 20% w/w, 25% w/w, 30% w/w, 35% w/w, 40% w/w, 45% w/w, 50% w/w, 55 % w/w, 60% w/w, 70% w/w, 80% w/w, 85% w/w, 90% w/w, 95% w/w or 100% w/w.
- Further components may be phenol, cresol and/or guaiacol.
- cresol as used herein generally comprises m-cresol, p- cresol and o-cresol.
- supercritical fluid-assisted conversion of guaiacol has been reported to yield up to 90% catechol in the liquid reaction product. It is in principle also conceivable to modify the methods of the invention for biocatalytic conversion of lignin via the intermediate product phenol.
- phenol is envisaged to be present in the liquid reaction product in an amount of 5% w/w or more, such as 10% w/w, 15% w/w, 20% w/w, 25% w/w, 30% w/w, 35% w/w, 40% w/w, 45% w/w, 50% w/w, 55 % w/w, 60% w/w, 70% w/w, 80% w/w, 85% w/w, 90% w/w, 95% w/w or 100% w/w.
- Other components may include catechol, guaiacol and/or cresol. Further components may be phenol and/or cresol.
- cresol is envisaged to be present in the liquid reaction product in an amount of 5% w/w or more, such as 10% w/w, 15% w/w, 20% w/w, 25% w/w, 30% w/w, 35% w/w, 40% w/w, 45% w/w, 50% w/w, 55 % w/w, 60% w/w, 70% w/w, 80% w/w, 85% w/w, 90% w/w, 95% w/w or 100% w/w.
- Other components may include catechol, guaiacol and/or phenol.
- guaiacol is envisaged to be present in the liquid reaction product in an amount of 5% w/w or more, such as 10% w/w, 15% w/w, 20% w/w, 25% w/w, 30% w/w, 35% w/w, 40% w/w, 45% w/w, 50% w/w, 55 % w/w, 60% w/w, 70% w/w, 80% w/w, 85% w/w, 90% w/w, 95% w/w or 100% w/w.
- Other components may include catechol, cresol and/or phenol.
- step of obtaining an intermediate product from step (i) of the method of the invention may involve separating said intermediate product from the liquid reaction product of sub- and/or supercritical fluid-assisted conversion. Separation of said intermediate product includes complete separation (i.e. purification), and partial separation of said product. "Complete separation” means that a product is yielded in essentially pure form (i.e. without the presence of other by-products or solvents). "Partial separation” means that other by-products or solvents are present.
- the step of ii) obtaining an intermediate product from sub- and/or supercritical fluid- assisted conversion of the organic educt may involve a variety of process steps depending on the characteristics of the intermediate product to be recovered, the presence and nature of potential by-products and the desired purity of the intermediate product.
- obtaining the intermediate product may involve distillation of the reaction product obtained after sub- and/or supercritical fluid-assisted conversion.
- distillation is a process of separating components from a liquid mixture by selective evaporation and condensation. Distillation includes e.g. simple distillation, fractional distillation, steam distillation (also referred to as "steam bath distillation" herein).
- Step (ii) of the inventive method may vary depending on the organic educt and reaction parameters.
- Some exemplary intermediate products envisaged for further biocatalyzation according to the inventive method are listed in the following.
- the intermediate product may be selected from one or more of the following: Glucose, Fructose, 5-(Hydroxymethyl)furfural (5-HMF), Glycolaldehyde, Glyceraldehyde, Dihydroxyacetone, 1 ,6-Anhydroglucose,Erythrose, Pyruvaldehyde, 2-furaldehyde, Acetic acid, Formic acid, Lactic acid, Acrylic acid, 1 ,2,4-Benzenetriol, 4-oxopentanoic acid, o-, m-, or p-xylene, ethylbenzene, n-propylbenzene, 1-methyl-2-ethylbenzene, 3-ethylbenzene, Phenol, o-,m-,p-cresol, 2-phenoxyethanol, Oligomers (cellobiose.
- 5-(Hydroxymethyl)furfural (5-HMF) 5-(Hydroxymethyl)
- the intermediate product may be selected from one or more of the following: xylose, glucose, fructose, arabinose.
- the intermediate product may be selected from one or more of the following: Glucose, Fructose, 5-(Hydroxymethyl)furfural (5-HMF), Glycolaldehyde, Glyceraldehyde, Dihydroxyacetone, 1 ,6-Anhydroglucose,Erythrose, Pyruvaldehyde, 2-furaldehyde, Acetic acid, Formic acid, Lactic acid, Acrylic acid, 1 ,2,4-Benzenetriol, 4-oxopentanoic acid, o-, m-, or p-xylene, ethylbenzene, n-propylbenzene, 1-methyl-2-ethylbenzene, 3-ethylbenzene, Phenol, o-,m-,p-cresol, 2-phenoxyethanol, Oligomers (cellobiose.
- 5-(Hydroxymethyl)furfural (5-HMF) 5-(Hydroxymethyl)
- the intermediate product may be selected from glucose, fructose, Dihydroxyacetone, Glyceraldehyde, Erythrose, Glycolaldehyde, Pyruvaldehyde, Lactic acid, 1 ,6-Anhydroglucose, Acetic acid, formic acid, 5-HMF, 2-furaldehyde, Acrylic acid, 1 ,2,4- Benzenetriol, Levulinic acid, 4-oxopentanoic acid .
- the intermediate product may be selected from glucose, fructose, Dihydroxyacetone, Glyceraldehyde, Erythrose, Glycolaldehyde, Pyruvaldehyde, Lactic acid, 1 ,6-Anhydroglucose, Acetic acid, formic acid, 5-HMF, 2-furaldehyde, Acrylic acid, 1 ,2,4- Benzenetriol, Levulinic acid, 4-oxopentanoic acid.
- the intermediate product may be selected from Xylose, Furfural, Formic acid, Glucolaldehyde, Glyceraldehyde, Dihydroxyacetone, Pyruvaldehyde, Hydroxyacetone, Lactic acid.
- the intermediate product may be selected from Acrolein, Methanol, Acetaldehyde, Propionaldehyde, Acrolein, Allyl Technology, Ethanol, Formaldehyde, CO, C02, H2, Alkanes.
- the intermediate product may be selected from Alkanes.
- the intermediate product may be selected from C0 2 , CO, H 2 , CH 4 , Acetic acid, Propanoic acid, n-butyric acid, iso-butyric acid, iso-valeric acid.
- the intermediate product may be selected from C0 2 , CO, H 2 , CH 4 , Acetic acid, Propanoic acid, n-butyric acid, iso-butyric acid, iso-valeric acid.
- the intermediate product may be selected from NH3, C02, CO, Propane, Butane, Isobutene, Isopentane, 3-methyl-1 -butane, 2-methyl-1 -butane, Propane, Butene, Isobutylene, Acetone, Iso-butylamine.
- the intermediate product When using Glycine or Alanine as a feedstock for sub- and/or supercritical fluid- assisted decomposition, the intermediate product may be selected from Acetaldehyde, Acetaldehyde-hydrate, Diketopiperazine, Ethylamine, Methylamine, Formaldehydes, Lactic acid, Propionic acid.
- the intermediate product When using Alanine as a feedstock for sub- and/or supercritical fluid-assisted decomposition, the intermediate product may be selected from NH3, Carbonic acid, Lactic acid, Pyruvic acid, Acrylic acid, Acetic acid, Propionic acid, Formic acid.
- the intermediate products may be selected from acid intermediates,amine compounds, acrolein, methanol, acetaldehyde, propionaldehyde, acrolein, allyl alcohol, ethanol, formaldehyde, carbon CO, C0 2 , H 2 , C-17 alkane, NH 3 , propane, butane, isobutane, isopentane, 3-methyl-1 -butene, 2-methyl-1 -butene, propene, butene, isobutylene, acetone, iso-butylamine, Acetaldehyde, acetaldehyde-hydrate, diketopiperazine, ethylamine, methylamine, formaldehydes, lactic acid, propionic acid, carbonic acid, lactic acid, pyruvic acid, acrylic acid, acetic acid, propionic acid, formic acid,
- the intermediate products may be selected from guaiacol, catechol, phenol, m,p- cresol and o-cresol.
- Processing of lignin in sub- or supercritical fluid e.g. water is thought to produce smaller fragments (intermediate products) through breakage of the (ether) linkages and produce larger fragments through cross linking between the reactive fragments, predominantly by Friedel-Craft mechanism (repolymerization). Dealkylation and demethoxylation may also occur when processing lignin in a hydrothermal medium.
- reaction parameters such as reaction temperature, pressure and reaction time, can be readily adjusted in order to shift the reaction towards favorable intermediate products.
- the intermediate product obtained in step ii) of the inventive method is subjected to biocatalytic conversion, i.e. contacted with a biocatalyst, in particular a host cell that produces the desired organic product.
- a biocatalyst in particular a host cell that produces the desired organic product.
- Contacting the intermediate product will, as will be well understood by the person skilled in the art, be conducted under conditions that allow the biocatalyst to catalyze production of the desired organic product from the intermediate product.
- the exact conditions, including concentration of the intermediate product, concentration and growth state of the biocatalyst, culture conditions including culture medium composition, pH, temperature, aeration, agitation and container, will depend greatly on the biocatalyst, the intermediate product and the organic product to be obtained and will be readily ascertainable by the skilled person in the art.
- a host cell of the present invention includes any suitable host cell that is capable of producing the desired organic product from the intermediate product it is supplied with.
- the skilled person will readily acknowledge that feasibility of using a given host cell as a biocatalyst in the methods of the invention primarily depends on whether the host cell comprises the genetic constitution required to catalyze production of the desired end product.
- the host cell preferably expresses enzymes capable of converting the intermediate product (e.g., catechol) obtained in step (ii) of the invention into the desired organic end product (e.g., cis-cis-muconic acid).
- Polypeptides required for production of the desired organic end product (which may include, e.g., enzymes catalyzing the conversion and proteins required for import and/or export of the reactants into or out of the cell, respectively), will also be referred to as “polypeptides of interest” or “ ⁇ herein.
- Genes encoding said polypeptides of interest are also termed “genes of interest” or “GOT' herein.
- the host cell may be a prokaryotic or eukaryotic host cell and may be selected from bacteria, yeast, filamentous fungi, cyanobacteria, algae, and plant cells.
- the host cell is envisaged to be a single cell organism, which is typically capable of dividing and proliferating.
- a host cell can include one or more of the following features: aerobe, anaerobe, filamentous, non-filamentous, monoploid, dipoid, auxotrophic and/or non- auxotrophic.
- Suitable prokaryotic host cells include Gram negative or Gram positive bacteria and may be selected from, e.g., Bacillus bacteria (e.g., B. subtilis, B. megaterium), Acinetobacter bacteria, Norcardia baceteria, Xanthobacter bacteria, Escherichia bacteria (e.g., E. coli (e.g., strains DH10B, Stbl2, DH5-alpha, DB3, DB3.1 ), DB4, DB5, JDP682 and ccdA-over (e.g., U.S. Application No. 09/518,188), Streptomyces bacteria, Erwinia bacteria, Klebsiella bacteria, Serratia bacteria (e.g., S.
- Bacillus bacteria e.g., B. subtilis, B. megaterium
- Acinetobacter bacteria Norcardia baceteria
- Xanthobacter bacteria Escherichia bacteria
- Escherichia bacteria e.g., E. coli
- marcescens Pseudomonas bacteria (e.g., P. aeruginosa, P. putida), Salmonella bacteria (e.g., S. typhimurium, S. typhi), Megasphaera bacteria (e.g., Megasphaera elsdenii).
- Bacteria also include, but are not limited to, photosynthetic bacteria (e.g., green non- sulfur bacteria (e.g., Choroflexus bacteria (e.g., C. aurantiacus), Chloronema bacteria (e.g., C. gigateum)), green sulfur bacteria (e.g., Chlorobium bacteria (e.g., C. limicola), Pelodictyon bacteria (e.g., P. luteolum), purple sulfur bacteria (e.g., Chromatium bacteria (e.g., C. okenii))), and purple non-sulfur bacteria (e.g., hodospirillum bacteria (e.g., R. rubrum), Rhodobacter bacteria (e.g., R. sphaeroides, R. capsulatus), and Rhodomicrobium bacteria (e.g., R. vanellii)).
- photosynthetic bacteria e.g., green non- sulfur bacteria (e.g., Chor
- Any suitable yeast may be selected as a host cell, including without limitation Yarrowia yeast (e.g., Y. lipolytica (formerly classified as Candida lipolytica)), Candida yeast (e.g., C. revkaufi, C. pulcherrima, C. tropicalis, C. utilis), Rhodotorula yeast (e.g., R. glutinus, R. graminis), Rhodosporidium yeast (e.g., R. toruloides), Saccharomyces yeast (e.g., S. cerevisiae, S. bayanus, S. pastorianus, S. carlsbergensis), Cryptococcus yeast, Trichosporon yeast (e.g., T.
- T. cutaneum Pichia yeast (e.g., P. pastoris) Kluyveromyces yeast (e.g. K. marxianus), and Lipomyces yeast (e.g., L. starkeyii, L. lipoferus).
- Pichia yeast e.g., P. pastoris
- Kluyveromyces yeast e.g. K. marxianus
- Lipomyces yeast e.g., L. starkeyii, L. lipoferus
- Any suitable fungus may be selected as a host cell, including without limitation Aspergillus fungi (e.g., A. parasiticus, A. nidulans), Thraustochytrium fungi, Schizochytrium fungi and Rhizopus fungi (e.g., R. arrhizus, R. oryzae, R. nigricans).
- the fungus may for example be an A. parasiticus strain such as strain ATCC24690, or an A. nidulans strain such as strain ATCC38163.
- Eukaryotic host cells from non-microbial organisms can also be utilized as host cells in accordance with the present invention.
- examples of such cells include, without limitation, insect cells (e.g., Drosophila (e.g., D. melanogaster), Spodoptera (e.g., S. frugiperda Sf9 or Sf21 cells) and Trichoplusa (e.g., High-Five cells); nematode cells (e.g., C.
- elegans cells e.g., elegans cells
- avian cells e.g., amphibian cells (e.g., Xenopus laevis cells); reptilian cells; and mammalian cells (e.g., NIH3T3, 293, CHO, COS, VERO, C127, BHK, Per-C6, Bowes melanoma and HeLa cells).
- amphibian cells e.g., Xenopus laevis cells
- reptilian cells e.g., NIH3T3, 293, CHO, COS, VERO, C127, BHK, Per-C6, Bowes melanoma and HeLa cells.
- mammalian cells e.g., NIH3T3, 293, CHO, COS, VERO, C127, BHK, Per-C6, Bowes melanoma and HeLa cells.
- the aforementioned host cells are commercially available, for example, from Invitrogen Corporation, (Carlsbad, CA), American Type Culture Collection (Manassas, Virginia), and Agricultural Research Culture Collection (NRRL; Peoria, Illinois).
- Suitable host cells are selected for their capability of converting the provided substrate (i.e. intermediate product) into the desired organic end product. Therefore, the host cell must be capable of channeling the substrate in and preferably of channeling the product out of the cell. In addition, the host cell should be tolerant to both the substrate and especially the accumulated product.
- the host cell can cope with the pH and temperature changes occurring during cultivation in the presence of the substrate.
- the host cell preferably provides for a high reaction rate, high yield and purity of the end product.
- a host cell which is non-pathogenic, in particular non-pathogenic for humans, for example when the organic end product obtained from said host cell is intended for further processing in the pharmaceutical, cosmetic or food industry.
- the host cell is a genetically modified (i.e. recombinant) or a non-genetically modified host cell.
- Non-genetically modified host cells are host cells whose genetic material has not been altered using recombinant DNA technology techniques in contrast to genetically modified host cells (also termed "GMO" herein).
- the term “non-GMO” includes both wild-type host cells and host cells comprising mutations.
- Said non-GMO is preferably capable of catalyzing the conversion of the intermediate product obtained from step (ii) of the inventive method to the desired organic end product. That is, said non-GMO preferably comprises endogenous genes encoding for the polypeptide(s) of interest required for biocatalytic conversion of the intermediate products into the desired organic end products according to the methods of the invention.
- schindleri CIP 107287 A schindleri CIP 107287
- Amycolatopsis mediterranei U32 Arthrobacter sp., Aspergillus sp. (e.g. A. niger CBS 513.88, A. oryzae RIB40), Bordetella holmesii ATCC 51541 , Bradyrhizobium sp. (e.g. B. diazoefficiens USDA 1 10, B. genosp. SA-4 str. CB756), Burkholderia sp. (e.g. B. cenocepacia J2315, B. glumae BGR1 , B. mallei ATCC 23344, B.
- host cells will typically be selected for ease of handling, tolerance to culture conditions, and (high) substrate concentrations, insensitivity towards accumulated end product and capability of producing the end product at high reaction rates in high yields and purity.
- host cells selected from Pseudomonas, preferably P. putida, and more preferably from P. putida strain KT2440.
- Recombinant host cells also referred to as genetically modified organisms or GMOs are also envisaged for use in accordance with the methods of the invention.
- Recombinant host cells are host cells whose genetic material has been altered using recombinant DNA technologies. It is in particular envisaged that recombinant host cells comprise at least one heterologous nucleic acid sequence.
- the heterologous nucleic acid sequence may e.g. be a heterologous gene regulation element, or a heterologous gene.
- Useful heterologous genes in the context of the present invention encode polypeptides of interest, i.e. polypeptides aiding in the production of the desired organic end product from the intermediate product obtained in step (ii) of the method of the invention.
- the intermediate product is envisaged to be catechol, and a host cell comprising at least one (optionally heterologous) gene encoding a polypeptide having catechol- 1 ,2-dioxygenase activity is envisaged, in particular a catA gene and/or a catA2 gene.
- Further heterologous genes that may advantageously be present in the host cell include genes for the metabolic funneling of aromats, e.g. phenol and cresol.
- heterologous or “exogenous” nucleic acid sequence is used herein to refer to a nucleic acid sequence not naturally occurring in, i.e. foreign to, the host cell. In other words, a heterologous nucleic acid sequence is not found in wild-type host cells.
- the term includes nucleic acid sequences such as heterologous regulatory sequences (e.g. promoters) and heterologous genes.
- the heterologous nucleic acid sequences may be derived from another "donor" cell, or be a synthetic or artificial nucleic acid sequences.
- Heterologous gene(s) in the context of the present invention are in particular envisaged to encode for the polypeptide(s) of interest required for catalyzing conversion of said compound into a product (i.e. the desired organic end product), and optionally also for channeling in of the substrate (i.e. the intermediate product), and exporting the product from the host cell.
- Recombinant host cells can be prepared using genetic engineering methods known in the art. The process of introducing nucleic acids into a recipient host cell is also termed “transformation” or “transfection” hereinafter. The terms are used interchangeably herein.
- Host cell transformation typically involves opening transient pores or "holes" in the cell wall and/or cell membrane to allow the uptake of material.
- Illustrative examples of transformation protocols involve the use of calcium phosphate, electroporation, cell squeezing, dendrimers, liposomes, cationic polymers such as DEAE-dextran or polyethylenimine, sonoporation, optical transfection, impalefection, nanoparticles (gene gun), magnetofection, particle bombardement, alkali cations (cesium, lithium), enzymatic digestion, agitation with glass beads, viral vectors, or others.
- the choice of method is generally dependent on the type of cell being transformed, the nucleic acid to be introduced into the cell and the conditions under which the transformation is taking place.
- a nucleic acid molecule encoding a polypeptide of interest for instance a polypeptide having catechol-1 ,2-dioxygenase activity
- an operably linked regulatory sequence such as a promoter
- a recipient host cell either as a non-replicating DNA or RNA molecule, which may be a linear molecule or a closed covalent circular molecule.
- Such molecules are incapable of autonomous replication, and the expression of the gene occurs through the transient expression of the introduced sequence.
- the heterologous nucleic acid sequence in particular gene (for instance a gene encoding for a polypeptide having catechol-1 ,2-dioxygenase activity such as a catA or catA2 gene) may be stably integrated into the host cell's genome. Permanent (stable) expression of the gene encoding the polypeptide of interest may be achieved by integration of the introduced DNA sequence into the host cell chromosome. Stable expression may also be achieved by providing the gene of interest in a vector capable of autonomously replicating in the host cell.
- the vector employed for delivery of the heterologous nucleic acid sequence to be expressed stably is envisaged to be capable of integrating the desired gene sequences into the host cell chromosome, or of autonomously replicating within the host cell; thereby ensuring maintenance of the heterologous nucleic acid sequence in the host cell and stable integration into the host cell's genome.
- Cells with DNA stably integrated into their genomes can be selected by also introducing one or more markers into the vector, e.g. providing for prototrophy to an auxotrophic host, biocide (e.g. antibiotics or heavy metal) resistance, or the like.
- the selectable marker gene sequence can either be directly linked to the DNA gene sequences to be expressed, or introduced into the same cell by co-transfection. Additional elements may also be needed for optimal synthesis of mRNA. These elements may include splice signals, as well as transcription promoters, enhancers, and termination signals.
- the heterologous nucleic acid molecule of interest can be delivered to the host cell in the form of a vector, e.g. a plasmid or viral vector. If said heterologous nucleic acid molecule is e.g. a DNA molecule and comprises a gene of interest, it is envisaged that said vector comprises regulatory sequences that allow for the expression of said gene of interest.
- the vector may or may not comprise sequences enabling autonomous replication of said vector in the host cell, depending on whether transient or stable expression of the gene is intended, as explained above.
- any of a wide variety of vectors may be employed for this purpose.
- the person skilled in the art will readily understand that selection of a particular vector include depends, e.g., on the nature of the host cell, the intended number of copies of the vector, whether transient or stable expression of the gene of interest is envisaged, and so on.
- vectors conceivable for use in accordance with the invention include, without limitation, viral origin vectors (M13 vectors, bacterial phage ⁇ vectors, baculovirus vectors, adenovirus vectors, and retrovirus vectors), high, low and adjustable copy number vectors, eukaryotic episomal replication vectors (pCDM8), and prokaryotic expression vectors such as pcDNA II, pSL301 , pSE280, pSE380, pSE420, pTrcHisA, B, and C, pRSET A, B, and C (Invitrogen, Inc.), pGEMEX-1 , and pGEMEX-2 (Promega, Inc.), the pET vectors (Novagen, Inc.), pTrc99A, pKK223-3, the pGEX vectors, pEZZ18, pRIT2T, and pMC1871 (Pharmacia, Inc.), p
- Vectors can also be eukaryotic expression vectors such as pFastBac, pFastBac HT, pFastBac DUAL, pSFV, and pTet- Splice (Life Technologies, Inc.), pEUK-CI, pPUR, pMAM, pMAMneo, pBI 101 , pBI 121 , pDR2, pCMVEBNA, and pYACneo (Clontech), pSVK3, pSVL, pMSG, pCH 1 10, and pKK232-8 (Pharmacia, Inc.), p3'SS, pXTI, pSG5, pPbac, pMbac, pMCI neo, and pOG44 (Stratagene, Inc.), and pYES2, pAC360, pBlueBacHis A, B, and C, pVL1392, pBsu
- Further vectors of interest include pUC 18, pUC 19, pBlueScript, pSPORT, cosmids, phagemids, fosmids (pFOSI), YAC's (yeast artificial chromosomes), BAC's (bacterial artificial chromosomes), pBAC 108L, pBACe3.6, pBeloBACH (Research Genetics), PACs, P1 (E.
- coli phage pQE70, pQE60, pQE9 (Qiagen), pBS vectors, PhageScript vectors, BlueScript vectors, pNH8A, pNH 16A, pNH18A, pNH46A (Stratagene), pcDNA3 (InVitrogen), pGEX, pTrsfus, pTrc99A, pET-5, pET-9, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pSPORTI , pSPORT2, pCMVSPORT2.0, pSV-SPORT1 (Life Technologies, Inc.), and the vectors described in Provisional Patent Application No. 60/065,930, filed Oct. 24, 1997, the entire contents of which is herein incorporated by reference, and variants or derivatives thereof.
- the vector may comprise regulatory sequences as exemplified elsewhere herein, preferably operably linked to, e.g. upstream of, the gene of interest.
- recipient cells can be grown in a selective medium, which selects for the growth of vector-containing cells.
- Expression of the heterologous gene(s) of interest e.g. a catA or catA2 gene
- a polypeptide of interest e.g. a polypeptide having catechol-1 ,2-dioxygenase activity.
- the (optionally heterologous) gene of interest preferably encodes a polypeptide of interest having a desired capability that beneficially enables biocatalytic conversion of the intermediate product into the organic end product according to the methods of the invention.
- the host cell preferably expresses at least one (optionally heterologous) gene encoding a polypeptide having catechol-1 ,2-dioxygenase activity.
- Said (optionally heterologous) gene may be a catA gene or a catA2 gene. It is also envisioned herein to use host cells comprising both at least one catA gene and at least one catA2 gene.
- Catechol-1 ,2-dioxygenase (EC 1 .13.1 1 .1 ) catalyzes intradiol (or ortho-) cleavage of catechol as, thereby producing cis-cis muconic acid.
- Said gene of interest encoding a polypeptide having catechol-1 ,2-dioxygenase activity is envisaged to be a catA or catA2 gene.
- the protein encoded by a catA gene or a catA2 gene may be identified in a database as a catechoM ,2-dioxygenase.
- variants include variants.
- variants or with reference to a nucleic acid or polypeptide refers to polymorphisms, i.e. the exchange, deletion, or insertion of one or more nucleotides or amino acids, respectively, compared to the predominant form of the respective nucleic acid or polypeptide.
- a “variant” may refer to a contiguous sequence of at least about 50, such as about 100, about 200, or about 300 amino acids set forth in the amino acid sequence of a protein named herein (cf. e.g.
- the sequence may even be shorter than the corresponding wild type protein.
- Variants of genes of interest as described herein, in particular catA and/or catA2 may be orthologs.
- An ortholog, or orthologous gene is a gene with a sequence that has a portion with similarity to a portion of the sequence of a known gene, but found in a different species than the known gene.
- An ortholog and the known gene originated by vertical descentfrom a single gene of a common ancestor.
- a variant or ortholog of the catA or catA2 gene is envisaged to encode a protein having catechol-1 ,2-dioxygenase activity and having at least about 60 %, at least about 65 %, at least about 70 %, at least about 75 %, at least about 80 % or at least about 90 %, including at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity or 100% sequence identity with a known catA gene, in particular PP_3713 of P. putida KT2440, or a known catA2 gene, in particular PP_3166 of P. putida KT2440, respectively.
- a sequence that is substantially similar to a catA or catA2 polypeptide may have at least about 60 %, at least about 65 %, at least about 70 %, at least about 75 %, at least about 80 % or at least about 90 %, including at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity or 100% sequence identity with the sequence of a known catA or catA2 or polypeptide, respectively.
- % identity is meant a property of sequences that measures their similarity or relationship. Identity is measured by dividing the number of identical residues by the total number of residues and gaps and multiplying the product by 100. Preferably, identity is determined over the entire length of the sequences being compared. "Gaps" are spaces in an alignment that are the result of additions or deletions of amino acids. Thus, two copies of exactly the same sequence have 100% identity, but sequences that are less highly conserved, and have deletions, additions, or replacements, may have a lower degree of identity. Those skilled in the art will recognize that several computer programs are available for determining sequence identity using standard parameters, for example Blast (Altschul, et al. (1997) Nucleic Acids Res.
- mutated or mutant in reference to a nucleic acid or a polypeptide refers to the exchange, deletion, or insertion of one or more nucleotides or amino acids, respectively, compared to the naturally occurring nucleic acid or polypeptide.
- Sequence identity refers to the percentage of residue matches between at least two polypeptide or polynucleotide sequences aligned using a standardized algorithm. Such an algorithm may insert, in a standardized and reproducible way, gaps in the sequences being compared in order to optimize alignment between two sequences, and therefore achieve a more meaningful comparison of the two sequences. Sequence comparisons can be performed using standard software programs such as the NCBI BLAST program.
- position corresponding to another position is based on the convention of numbering according to nucleotide or amino acid position number and then aligning the sequences in a manner that maximizes the percentage of sequence identity. Because not all positions within a given "corresponding region” need be identical, non- matching positions within a corresponding region may be regarded as "corresponding positions.” Accordingly, as used herein, referral to an "amino acid position corresponding to amino acid position [X]" of a specified protein sequence represents, in addition to referral to amino acid positions of the specified protein sequence, referral to a collection of equivalent positions in other recognized protein and structural homologues and families.
- nucleotides/amino acids may differ in terms of the specified numeral but may still have similar neighbouring nucleotides/amino acids. Such nucleotides/amino acids which may be exchanged, deleted or added are also included in the term "corresponding position".
- a skilled artisan can use means and methods well-known in the art, e.g., alignments, either manually or by using computer programs such as BLAST2.0, which stands for Basic Local Alignment Search Tool or ClustalW or any other suitable program which is suitable to generate sequence alignments.
- BLAST2.0 stands for Basic Local Alignment Search Tool or ClustalW or any other suitable program which is suitable to generate sequence alignments.
- a known wild-type catA or catA2 polypeptide may serve as “subject sequence” or “reference sequence”, while the amino acid sequence of a catA or catA2 polypeptide (or nucleic acid sequence encoding the same) different from the wild-type can serve as "query sequence”.
- reference sequence and “wild type sequence” are used interchangeably herein.
- a host cell employed in the methods of the invention -in particular in the lignin processing method as described herein- may comprise a catA gene.
- the catA gene may be an endogenous gene or a heterologous gene. Said catA gene may be under the control of an endogenous promoter, either a wild-type promoter or a mutated promoter, or a heterologous promoter.
- the host cell may comprise a catA2 gene.
- the catA2 gene may be an endogenous gene or a heterologous gene.
- Said catA2 gene may be under the control of an endogenous promoter, either a wild-type promoter or a mutated promoter, or a heterologous promoter. Said promoter may be different from the promoter that controls expression of the catA gene.
- the catA gene may be under the control of a promoter that is similar or identical to the promoter that controls the catA2 gene.
- the host cell may comprise a (optionally heterologous) catA gene and a (optionally heterologous) catA2 gene.
- the host cell may comprise an endogenous catA gene and an endogenous catA2 gene.
- a host cell comprising a heterologous catA gene and a heterologous catA2 gene is also conceivable.
- host cells comprising an endogenous catA gene and a heterologous catA2 gene, and vice versa.
- schindleri CIP 107287 Amycolatopsis mediterranei U32, Arthrobacter sp., Aspergillus sp. (e.g. A. niger CBS 513.88, A. oryzae RIB40), Bordetella holmesii ATCC 51541 , Bradyrhizobium sp. (e.g. B. diazoefficiens USDA 1 10, B. genosp. SA-4 str. CB756), Burkholderia sp. (e.g. B. cenocepacia J2315, B. glumae BGR1 , B. mallei ATCC 23344, B. multivorans, B. pseudomallei K96243, B.
- Bradyrhizobium sp. e.g. B. diazoefficiens USDA 1 10, B. genosp. SA-4 str. CB756
- Burkholderia sp. e.g. B. cenocepacia
- Candida dubliniensis CD36 Candida dubliniensis CD36, Corynebacterium glutamicum ATCC 13032, Cupriavidus metallidurans CH34, Delftia acidovorans SPH-1 , Enterobacter aerogenes KCTC 2190, Herbaspirillum seropedicae SmR1 , Klebsiella pneumoniae subsp. pneumoniae HS1 1286, Mycobacterium smegmatis str. MC2 155, Neorhizobium galegae bv. orientalis str. HAMBI 540, Neurospora crassa OR74A, Pseudomonas sp. (e.g. P. aeruginosa PA01 , P.
- fluorescens SBW25, P. fragi B25, P. putida KT2440, P. stutzeri A1501 ), Ralstonia sp. (e.g. R. eutropha H 16, R. pickettii 12J), Rhizobium sp. (e.g. R. etli CFN 42, R. leguminosarum bv. trifolii CB782), Rhodococcus sp. (e.g. R erythropolis PR4), R. fascians NBRC 12155 LMG 3623, R. jostii RHA1 ), Sinorhizobium sp. (e.g. S. fredii NGR234, S. meliloti 1021 , S. wenxiniae), Sphingomonas sp. KA1 , Thermus thermophilus HB8, Verticillium albo-atrum VaMs.102.
- Particularly preferred host cells for use in lignin processing as described herein are selected from Pseudomonas, preferably P. putida, and more preferably from P. putida strain KT2440..
- the GOI encoding a polypeptide of interest may be encoded by a heterologous gene.
- Said heterologous gene may be a catA gene or a catA2 gene.
- the host cell comprising the heterologous gene is also termed "recipient host cell” herein, whereas the host cell from which the heterologous gene is obtained is also referred to as "donor host cell”: Suitable donor host cells include host cells comprising an endogenous gene encoding for a polypeptide of interest, e.g.
- a polypeptide having catechol-1 ,2-dioxygenase activity such as a catA polypeptide and/or a catA2 polypeptide.
- heterologous genes encoding for polypeptides of interest e.g. polypeptides having catechoM ,2-dioxygenase activity
- host cells expressing said gene endogenously e.g. host cells expressing an endogenous catechol-1 ,2-dioxygenase as listed above.
- Exemplary donor cells can be selected from Pseudomonas, preferably P. putida, more preferably P. putida strain KT2440.
- the heterologous gene encoding the polypeptide of interest (for instance a polypeptide having catechoM ,2-dioxygenase activity) can be introduced using into the recipient host cell using recombinant DNA technology as described elsewhere herein.
- Any of the various host cells specified herein is in principle suitable as a recipient host cell.
- host cells not expressing an endogenous catA and/or catA2 gene may be selected as recipient host cells.
- the catA gene is in particular envisaged to be the gene PP_3713 encoding the catA polypeptide of Pseudomonas putida, strain KT2240, with Uniprot accession No. Q88GK8 (Version 79 of 04 Feb 2015), and may also be referred to as PP_3713. Variants of PP_3713 may also be used. It is further envisaged that said the catA gene may encode for a polypeptide comprising a sequence corresponding to SEQ ID No. 1 . Said catA gene may comprise a sequence corresponding to SEQ ID No. 2.
- the catA2 gene is in particular envisaged to be the gene PP_3166 encoding the catA2 polypeptide of Pseudomonas putida, strain KT2240, with Uniprot accession No. Q88I35 (Version 70 of 22 Jul 2015). Variants of PP_3166 may also be used. It is envisaged that said the catA2 gene may encode for a polypeptide comprising a sequence corresponding to SEQ ID No. 3. Said catA2 gene may comprise a sequence corresponding to SEQ ID No. 4.
- the host cell may comprise at least one (optionally heterologous) catA gene, optionally comprising a sequence corresponding to SEQ ID No. 2; and/or at least one (optionally heterologous) catA2 gene, optionally comprising a sequence corresponding to SEQ ID No. 4.
- Said host cell may thus express a (optionally heterologous) catA polypeptide comprising a sequence corresponding to SEQ ID No. 1 ; and/or a (optionally heterologous) catA2 polypeptide comprising a sequence corresponding to SEQ ID No. 3.
- the host cell may be equipped with further (optionally heterologous) genes which advantageously aid in converting (by-)products obtained during sub- and/or supercritical fluid-assisted conversion.
- An exemplary (by-)product would be protocatechuate, a key intermediate in degradation of the lignin and other aromic compounds, such as vanillate, benzoate, coumarate and ferulate.
- Protocatechuate decarboxylase (AroY, EC 4.1.1 .63) is an enzyme which catalyzes the conversion of protocatechuate to catechol and therefore enables the use of multiple aromatic compounds as carbon sources.
- the host cell may further comprise an (optionally heterologous) gene encoding for a polypeptide having protocatechuate decarboxylase (EC 4.1 .1.63) activity.
- a polypeptide having protocatechuate decarboxylase EC 4.1 .1.63 activity.
- An illustrative example is the AroY polypeptide of Klebsiella pneunomia, strain A170-10, with Uniprot accession No. B9A9M6 (version 14 of 24 July 2015) or a variant thereof.
- Said polypeptide may comprise a sequence corresponding to SEQ ID No. 17.
- the gene may be an AroY gene of K pneunomia, strain A170-10 comprising a sequence corresponding to SEQ ID No. 18 or a variant thereof.
- an exemplary codon-optimized version of the AroY gene according to SEQ ID No. 33 may also be used.
- the host cell may comprise an (optionally heterologous) gene encoding for a polypeptide having 4 hydroxybenzoate decarboxylase subunit B activity (KpdB, EC 4.1 .1 .61 ).
- KpdB polypeptide having 4 hydroxybenzoate decarboxylase subunit B activity
- An illustrative example is the KpdB polypeptide of Klebsiella pneunomia NB C 1 14940, with Uniprot accession No. X5I148 (version 5 of 22 July 2015) or a variant thereof.
- Said polypeptide may comprise a sequence corresponding to SEQ ID No. 19.
- the gene may be the kdpb gene of K. pneunomia NBRC 1 14940 comprising a sequence corresponding to SEQ ID No. 20 or a variant thereof.
- an exemplary codon-optimized version of the kpdB gene according to SEQ ID No. 34 may be used.
- Phenol and cresol are the two main by-products that accumulate during sub- and/or supercritical fluid-assisted conversion of lignin.
- the host cell may further comprise an (optionally heterologous) gene encoding for a polypeptide having phenol 2-monooxygenase activity.
- a polypeptide having phenol 2-monooxygenase activity is the pheA polypeptide of P. putida sp. EST1001 with Uniprot Acc. No. Q52159 (version 54 of 24 June 2015) comprising a sequence corresponding to SEQ ID No. 21 .
- Said polypeptide may be encoded by a gene comprising a sequence corresponding to SEQ ID No. 22 or a variant thereof.
- the host cell may further comprise an (optionally heterologous) gene encoding for a polypeptide having p-cresol methylhydroxylase activity.
- An illustrative example is the pcmh polypeptide comprising the pchF subunit of Pseudomonas putida (Arthrobacter siderocapsulatus) with Uniprot Acc. R9WN81 (version 12 of May 27, 2015) and the pchC subunit of Pseudomonas putida (Arthrobacter siderocapsulatus) with Uniprot Acc. No. P09787 (version 94 of April 1 , 2015).
- Said pchF subunit may comprise a sequence corresponding to SEQ ID No. 23.
- Said pchC subunit may comprise a sequence corresponding to SEQ ID No. 25.
- the pchF subunit may be encoded by a gene comprising a sequence corresponding to SEQ ID No. 24 or a variant thereof.
- the pchC subunit may be encoded by a gene comprising a sequence corresponding to SEQ ID No. 26 or a variant thereof.
- genes described herein may be operable linked to an (optionally heterologous) promoter, said promoter may comprise a sequence corresponding to SEQ ID No. 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15 or 16.
- An optional construct comprising aroY and kdpb operably linked to, e.g. upstream of, suitable promoter sequences is disclosed in SEQ ID No. 35.
- An optional construct comprising pheA and pcmh operably linked to, e.g. upstream of, suitable promoter sequences is disclosed in SEQ ID No. 36.
- nucleic acid is DNA
- expression refers to the transcription of a sequence of the DNA into RNA and the translation of the RNA into protein.
- a nucleic acid molecule, such as DNA is said to be “capable of expressing" a peptide/protein if it contains nucleotide sequences which contain transcriptional and translational regulatory information and such sequences are operably linked to nucleotide sequences which encode the polypeptide.
- An operable linkage is a linkage in which a nucleotide sequence encoding a polypeptide of interest is linked to one or more regulatory sequence(s) such that expression of said nucleotide sequence can take place.
- a regulatory sequence operably linked to a coding sequence is capable of effecting the expression of the coding sequence, for instance in an in vitro transcription/ translation system or in a cell when the vector is introduced into the cell.
- a respective regulatory sequence need not be contiguous with the coding sequence, as long as it functions to direct the expression thereof.
- intervening untranslated yet transcribed sequences may be present between a promoter sequence and the coding sequence and the promoter sequence can still be considered "operably linked" to the coding sequence.
- regulatory sequence includes controllable transcriptional promoters, operators, enhancers, silencers, transcriptional terminators, 5' and 3' untranslated regions which interact with host cellular proteins to carry out transcription and translation and other elements that may control gene expression including initiation and termination codons.
- the regulatory sequences can be native (endogenous), or can be foreign (heterologous) to the cell.
- the precise nature of the regulatory regions needed for gene sequence expression may vary from organism to organism, but shall in general include a promoter region which, in prokaryotes, contains both the promoter (which directs the initiation of RNA transcription) as well as the DNA sequences which, when transcribed into RNA, will signal synthesis initiation.
- promoter refers to a nucleic acid sequence that operates gene expression.
- the promoter region contains both the promoter (which directs the initiation of RNA transcription) as well as the DNA sequences which, when transcribed into RNA, will signal synthesis initiation.
- Such regions will normally include those 5'-non-coding sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence or the CAAT sequence. Promoter regions vary from organism to organism, but are well known to persons skilled in the art.
- the promoter operably linked to and thus driving the expression of the gene of interest in the host cell may be an endogenous, i.e. wild-type or mutated, promoter, or a heterologous promoter.
- Two nucleic acid sequences (such as a promoter region sequence and a sequence encoding a catA or catA2 polypeptide) are said to be operably linked if the nature of the linkage between the two DNA sequences does not (1 ) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region sequence to direct the transcription of a gene sequence encoding the polypeptide of interest, in particular a catA or catA2 polypeptide, or (3) interfere with the ability of the gene sequence of a polypeptide of interest, in particular a catA or catA2 polypeptide to be transcribed by the promoter region sequence.
- a promoter region is operably linked to a gene if the promoter is capable of driving transcription of said gene.
- Promoters are regarded as molecular tools that enable the modulation and regulation of expression of genes of interest in homologous organisms as well as in heterologous organisms.
- advantageously promoters allowing for standardized and constitutive expression (i.e. continuous gene transcription) control the expression of the genes of interest (i.e. genes involved in intermediate product processing).
- Said promoters can be heterologous promoters or endogenous promoters. It is in particular envisaged that such promoters enable constitutive and/or standardized expression of the downstream genes, and preferably abolish the need for induction of the genes of interest.
- the promoter may also be equipped with a regulatory sequence/element that makes the promoter inducible and/or repressible.
- constitutive promoters are envisaged to operably linked to, e.g. upstream of, the (optionally heterologous) catA gene and/or the (optionally heterologous) catA2 gene. It is envisioned that constitutive expression of preferably catA and catA2 under the control of said promoters allows for efficient conversion of catechol into the desired end product cis-cis-muconic acid, thereby preventing accumulation of the (toxic) intermediate product.
- a constitutive promoter may also be pesent or introduced operably linked to, e.g. upstream of, said genes.
- Suitable promoters may be strong constitutive promoters, such as promoters naturally controlling the expression of housekeeping genes which typically constitutive genes that are transcribed at a relatively constant level as their products are typically needed for maintenance of the cell and their expression (PrpoD, PgyrB, Ptuf and PgroES) is usually unaffected by experimental conditions.
- Promoter strength may be tuned to be appropriately responsive to activation or inactivation.
- the promoter strength may also be tuned to constitutively allow an optimal level of expression of a gene of interest or of a plurality of gene of interest.
- Strength of expression can, for example, be determined by the amount/yield of organic end product production and/or by quantitative reverse transcriptase PC (qRT-PCR).
- Illustrative examples of a strong constitutive promoter include, but are not limited to, the T7 promoter, the T5 promoter, the Escherichia coii lac promoter, the trc promoter, the tac promoter, the recA promoter, the adenyl methyltransferase (AMT) promoters AMT-1 and AMT-2, and synthetic promoters derived from the foregoing promoters or e.g. Pcp7 as disclosed in Spexard et al (Biotechnol Lett (2010) 32, 243-248).
- AMT adenyl methyltransferase
- the present inventors further provide a promoter library comprising particulary suitable promoters for regulating the expression of the genes of interest, especially catA and/or catA2.
- Said promoters favorably allow constitutive expression, and preferably strong and standardized expression, of catA and/or catA2, and are envisaged to comprise a sequence corresponding to
- a host cell such as P. putida comprising at least one (optionally heterologous) catA gene and/or at least one (optionally heterologous) catA2 gene as described elsewhere herein, each or any of said genes under the control of an (optionally heterologous) promoter comprising a sequence corresponding to SEQ ID No. 5 [Pem7]; or SEQ I D No. 6 [Pem7*]; or SEQ ID No. 7 [Ptuf]; or SEQ ID No. 8 [PrpoD]; or SEQ ID No. 9 [Plac]; SEQ ID No. 10 [PgyrB], or SEQ ID No.
- Host cells comprising endogenous genes of interest and endogenous promoters (i.e., non-genetically modified host cells) are thus easy to work with and may be advantageous in a variety of applications.
- endogenous genes of interest i.e., non-genetically modified host cells
- Pseudomonas sp. e.g., Pseudomonas putida comprising an endogenous catA gene and an endogenous catA2 gene, both under the control of endogenous promoters, can be utilized.
- the promoter may, however, also be heterologous to the host cell.
- a heterologous promoter can be introduced operably linked to, e.g. upstream of, the gene(s) of interest into the genome of a host cell which naturally harbors said genes using common genetic engineering techniques.
- the heterologous promoter may also be introduced operably linked to, e.g. upstream of, heterologous genes of interest and inserted as an expression cassette/unit into the genome of a host cell.
- the expression cassette may also be present in an extrachromosomal element such as a vector, e.g. a plasmid. Culture conditions
- Host cells and recombinant host cells may be provided in any suitable form.
- such host cells may be provided in liquid culture or solid culture (e.g., agar-based medium), which may be a primary culture or may have been passaged (e.g., diluted and cultured) one or more times.
- Host cells also may be provided in frozen form or dry form (e.g., lyophilized).
- Host cells may be provided at any suitable concentration.
- Host cells are preferably cultured under conditions that allow production of the desired organic end product, e.g. cis-cis-muconic acid in the lignin processing method as described herein. Suitable conditions are within the routine knowledge of the skilled artisan.
- the term "cultivation of cells” or “culturing of cells” in medium in the context of the host cells of the present invention generally refers to the seeding of the cells into a culture vessel, to the growing of the cells in medium in the logarithmic phase until a sufficient cell density is established and/or to the maintenance of the cells in medium, respectively. Cultuiing can be performed in any container suitable for culturing cells.
- culture conditions will vary depending on the host cell, and the characteristics of the intermediate product and organic end product. Suitable conditions for culturing the host cell typically include culturing the same in an aqueous medium that is suitable for sustaining cell viability and cell growth and allows the host cell to produce the desired organic product.
- suitable culture conditions that enable the biocatalyst, in particular Pseudomonas sp., preferably P. putida and more preferably P.
- putida KT2440 to convert the substrate catechol into the desired organic product cis-cis-muconic acid, may comprise E-2 minimal medium with glucose as a carbon source (pH 7) and a reaction temperature of about 30°C as described in the appended examples.
- E-2 minimal medium with glucose as a carbon source (pH 7) and a reaction temperature of about 30°C as described in the appended examples.
- expression of the catA2 polypeptide may require induction.
- an agent for induction e.g. benzoic acid, may be required.
- Illustrative examples of a suitable cell culture medium for example for culturing a bacterial host such as a Pseudomonas sp. host or a Burkholderia sp. host, include, but are not limited to, Luria-Bertani (LB) complex medium, Inkas-medium, phosphate-limited protease peptone-glucose-ammonium salt medium (PPGAS), Minimal medium E (MME), nitrogen-limited minimal medium or mineral salt medium.
- the media used may include a factor selected from growth factors and/or attachment factors or may be void of such a factor.
- the media may contain serum or be serum-free.
- a variety of carbon sources may be used such as a monosaccharide, e.g. glucose, a disaccharide, e.g. sucrose, an alcohol, e.g. glycerol, an alkane, e.g. n-hexane, a fatty acid such as caprylic acid (also termed octanoate), or mixtures thereof.
- the bacterial host cell may for instance be in the logarithmic growth phase or in the stationary phase.
- Suitable cell culture media may further include salts, vitamins, buffers, energy sources, amino acids and other substances. Any medium may be used that is suitable to sustain cell viability and in which the selected host cell is capable of producing the desired organic end product (e.g. cis-cis-muconat), as explained above. Recovery of organic end product
- the host cells may be removed, for example by way of centrifugation or filtration, before recovering the one or more organic end products produced in a method according to the invention.
- host cells may be recovered, e.g. concentrated, captured, harvested and/or enriched in/on a separation or filter unit.
- host cells as employed in the present invention may be enriched before they are collected and/or are concentrated before they are collected and/or are captured before they are collected. Enriching may, for example, be achieved by batch centrifugation, flow through centrifugation and/or tangential flow filtration.
- the organic end product e.g. cis-cis-muconic acid
- cis-cis-muconic acid may be advantageously secreted from the host cell, so that its formation can be easily analysed and/or monitored by standard techniques of cell culture broth analysis, including chromatographic techniques such as HPLC.
- the host cells used in accordance with the present invention may further be characterized in that they do not express genes that catalyze downstream metabolization of the desired organic end product. As the host cells are employed for production of a specFic desired target compound, further processing and degradation of the same should advantageously be avoided.
- genes encoding downstream processing factors for a given organic product will typically be present in cells that are capable of processing said organic product.
- the catB and catC genes encode enzymes that catalyze consecutive reactions in the catechol branch of the beta-ketoadipate pathway synthesis of 5-oxo-4,5-dihydro-2-furylacetate from catechol.
- Another P. putida gene catalyzing downstream metabolization of catechol is pcaB which converts cis, cis-muconic acid to carboxy muconolactone in the structurally related protocatechuate branch.
- Other host cells capable of processing catechol may also comprise functional catB and/or catC and/or pcaB genes that may advantageously be removed or "turned off” in order to allow for accumulation of cis-cis-muconate. .
- the host cell does not express a functional catB polypeptide and/or that the host cell does not express a functional catC polypeptide and/or that the host cell does not express a functional pcaB polypeptide. It is therefore envisioned that said host cell does not comprise a functional catB gene and/or a functional catC gene and/or a functional pcaB gene, respectively.
- the catB gene is in particular envisaged to encode a catB polypeptide having muconate cycloisomerase activity (EC 5.5.1.1 ), i.e. which is capable of synthesizing (S)-5- oxo-2,5-dihydro-2-furylacetate from cis-cis-muconic acid.
- An illustrative example of a catB polypeptide is the catB polypeptide of Pseudomonas putida, strain KT2240, with Uniprot accession No. Q88GK6 (version 67 of 22 July 2015).
- Said catB polypeptide may comprise a sequence corresponding to SEQ ID No. 27.
- An illustrative example of a catB gene is PP_3715 (SEQ ID No. 28).
- the term catB gene and catB polypeptide also comprises variants as defined elsewhere herein.
- the catC gene is in particular envisaged to be encode a catC polypeptide having muconolactone Delta-isomerase activity (E.C. 5.3.3.4), i.e. which is capable of synthesizing 5-0X0-4, 5-dihydrofuran-2-acetate from (S)-5-oxo-2,5-dihydrofuran-2-acetate.
- An illustrative example is the catC polypeptide of Pseudomonas putida, strain KT2240, with Uniprot accession No. Q88GK7 (version 67 of 22 July 2015).
- Said catC polypeptide may comprise a sequence corresponding to SEQ ID No. 29.
- An illustrative example of a catC gene is PP_3714 (SEQ ID No. 30).
- the term catC gene and catC polypeptide also comprises variants as defined elsewhere herein.
- the pcaB gene is in particular envisaged to encode a pcaB polypeptide having 3- carboxy-cis,cis-muconate cycloisomerase activity, i.e. which is capable of synthesizing carboxy muconolactone from cis-cis-muconic acid.
- An illustrative example is the pcaB polypeptide of Pseudomonas putida, strain KT2240, with Uniprot accession No. Q88N37 (version 89 of 22 July 2015).
- Said pcaB polypeptide may comprise a sequence corresponding to SEQ ID No. 31 .
- An illustrative example of a pcaB gene is PP_1379 (SEQ ID No.
- a host cell not comprising a functional catB/catC/pcaBgene
- a host cell may either lack an endogenous cafS/catC/pcaB gene, or it naturally comprises an endogenous catB/catC/pcaB gene, which is however silenced, preferably knocked-down or knocked-out, or deleted from the host cell chromosome.
- the skilled person is well aware of suitable methods for silencing endogenous genes, e.g. by manipulating the promoter region at a gene. It is preferred that the endogenous gene is knocked-down or knocked-out using by way of known methods, e.g. by recombinase techniques. Alternatively, the endogenous gene may be deleted from the chromosome by allelic substitution etc.
- the term "silenced” is used herein to generally indicate that the expression of a gene is suppressed or inhibited as ascertainable e.g. by a reduced level of production or accumulation of the transcript or a processed product, for example of an m NA, or of a translation product of the mRNA.
- the level of expression of catB/catC/pcaB may be reduced by at least about 10%, by at least about 15%, by at least about 20%, by at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85% or more, including about 90% or more, about 95% or more including about 100%.
- Genes encoding for downstream metaboliation of the desired organic products may for instance be knocked-out, i.e. made inoperable, resulting in an inhibition of gene expression, or translation of a non-functional protein product.
- Knock-out techniques are well- known in the art and include, e.g., introduction of one or more mutations into the catB/catC/pcaB gene, or into a regulatory sequence to which the respective gene is operably linked. Other methods include recombination techniques, e.g. resulting in the insertion of a foreign sequence to disrupt the gene or a deletion from the host cell's genome. Such a catB/catC/pcaB gene may be partially or fully inactivated, disrupted or otherwise blocked.
- a knock-down of the catB/catC/pcaB gene, resulting in a reduced expression of said gene(s), is also conceivable.
- Several methods for gene knock-down are known in the art, and may involve either genetic modification or treatment with a reactant (the latter resulting in a transient knock-down).
- Genetic modifications resulting in a gene knock-down include, e.g., the incorporation of mutations into the target gene or a regulatory element operably linked thereto.
- a heterologous molecule such as a nucleic acid molecule, can be introduced into the host cell and upon introduction into a host cell reduces the expression of a target gene, typically through transcriptional and/or post- transcriptional silencing.
- Said reactant may be a nucleic acid molecule may be a silencing RNA, e.g. so-called "antisense RNA".
- Said antisense RNA typically includes a sequence of at least 20 consecutive nucleotides having at least 95% sequence identity to the complement of the sequence of the target nucleic acid, such as the coding sequence of the target gene, but may as well be directed to regulatory sequences of target genes, including the promoter sequences and transcription termination and polyadenylation signals.
- RNAs small interfering RNAs
- aptamers aptamers
- Spiegelmers® nc-RNAs (including anti-sense-RNAs, L-RNA Spiegelmer
- silencer RNAs micro-RNAs
- miRNAs micro-RNAs
- shRNAs short hairpin RNAs
- siRNAs small interfering RNAs
- rasiRNA repeat-associated small interfering RNA
- piRNA Piwi proteins
- Such non-coding nucleic acid molecules can for instance be employed to direct mRNA degradation or disrupt mRNA translation.
- a respective reactant, in particular RNA molecule may in principle be directly synthesized within the host cell, or may be introduced into the host cell.
- CRISPRs 'Clustered Regularly Interspaced Short Palindromic Repeats', or CRISPRs.
- Proteins called 'CRISPR-associated genes' encode cellular machinery that cuts exogenous DNA into small fragments and inserts them into a CRISPR repeat locus.
- cas genes encode cellular machinery that cuts exogenous DNA into small fragments and inserts them into a CRISPR repeat locus.
- the small RNAs produced from the exogenous DNA inserts serve as a template sequence that other Cas proteins use to silence this same exogenous sequence.
- the transcripts of the short exogenous sequences are used as a guide to silence these foreign DNA when they are present in the cell.
- TALENs transcription activator-like effector nucleases
- the DNA binding domain is a sequence- specific transcription activator-like effector sequence while the DNA cleaving domain originates from a bacterial endonuclease and is non-specific.
- TALENs can be designed to cleave a sequence specified by the sequence of the transcription activator-like effector portion of the construct. Once designed, a TALEN is introduced into a cell as a plasmid or mRNA. The TALEN is expressed, localizes to its target sequence, and cleaves a specific site.
- the cell After cleavage of the target DNA sequence by the TALEN, the cell uses nonhomologous end joining as a DNA repair mechanism to correct the cleavage.
- the cell's attempt at repairing the cleaved sequence can render the encoded protein non-functional, as this repair mechanism introduces insertion or deletion errors at the repaired site.
- the capability of the host cell to degrade cis-cis-muconic acid to downstream products in particular (S)-5-oxo-2,5-dihydro-2-furylacetate (in case of catB silencing or deletion) and/or 5-oxo-4,5-dihydrofuran-2-acetate (in case of catC silencing or deletion) and/or carboxy muconolactone (in case of pcaB silencing or deletion) may thus be reduced in comparison to a wild type cell, including entirely absent.
- the nature and characteristics of the organic product obtained from the methods of the invention depends on the choice of organic educt, the obtained intermediate product and the biocatalyst contacted with said intermediate product to catalyze its conversion.
- cis-cis- muconic acid ((2Z,4Z)-2,4-Hexadienedioate, also referred to as muconate or cis-cis- muconate) according to formula (2) which can advantageously be used, e.g., as raw material for new functional resins, pharmaceuticals, and agrochemicals.
- cis-cis-muconic acid can be easily converted to adipic acid, caprolactam, and terephthalic acid which are used as a commodity chemical for production of value-added or valuable products including nylon-6 (fibers and resins), nylon-6,6, polyurethane, PVC, polyethylene terephthalate (PET), polyesters and/or polyamides.
- nylon-6 fibers and resins
- nylon-6,6, polyurethane polyVC
- PET polyethylene terephthalate
- polyesters and/or polyamides polyamides
- highly stereoregular polymers, useful functional resins can be produced through topochemical polymerization of muconic acid esters.
- Verrucarin is an antibiotic that can be synthesized from cis-cis-muconic acid by organic synthesis.
- an organic product is recovered.
- the organic product(s) e.g. cis-cis-muconic acid
- the biocatalyst in particular a bacterial host cell
- recovering the fermentation/culture medium includes recovering the organic product(s).
- the method may include a step of purifying the organic product(s). Purification of the organic product(s) preferably results in an increased concentration of organic product(s) compared to the starting solution and may include membrane filtration, for example for clarification, buffer exchange or concentration purposes, filtration or dialysis, which may e.g.
- the cell culture medium can be acidified.
- the solvability of cis cis-muconate in water is ⁇ 5% or at a pH of 2.0 measured at 25°C the solvability of cis, cis-muconate in water is 1 %.
- the insoluble product may sediment over time. Subsequently the supernatant can be discarded.
- the product obtained by lignin processing as described herein is of high purity and white in color.
- Chromatography may for example be carried out in the form of a liquid chromatography such as capillary electrochromatography, HPLC (high performance liquid chromatography) or UPLC (ultrahigh pressure liquid chromatography) or as a gas chromatography.
- the chromatography technique may be a process of column chromatography, of batch chromatography, of centrifugal chromatography or a method of expanded bed chromatography, as well as electrochromatographic, electrokinetic chromatography.
- adsorption chromatography hydrophobic interaction chromatography or hydrophobic charge induction chromatography, size exclusion chromatography (also termed gel-filtration), ion exchange chromatography or affinity chromatography and may also be a method of capillary gas chromatography.
- an electrophoretic technique such as preparative capillary electrophoresis including isoelectric focusing. Examples of electrophoretic methods are for instance free flow electrophoresis (FFE), polyacrylamide gel electrophoresis (PAGE), capillary zone or capillary gel electrophoresis.
- An isolation may include may include the combination of similar methods.
- a host cell for the production of cis,cis-muconic acid from catechol comprising at least one (optionally heterologous) catA gene as defined elsewhere herein and at least one (optionally heterologous) catA2 gene as defined elsewhere herein.
- the catA gene may in particular be PP_3713 of P. putida KT2440 and comprise a sequence corresponding to SEQ ID No. 2 or a variant thereof, and the catA2 gene may in particular be PP_3166 of P. putida KT2440 and comprise a sequence corresponding to SEQ ID No. 4 or a variant thereof.
- Said host cell may further comprise at least one (optionally heterologous) promoter sequence operably linked to e.g. upstream of, the (optionally heterologous) catA gene, the (optionally heterologous) catA2 gene, or both.
- Said promoter sequence is envisaged to comprise a sequence selected from a sequence corresponding to SEQ ID No. 5, SEQ ID NO. 6, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9 SEQ ID No. 10, SEQ ID No. 1 1 , SEQ ID No. 12, SEQ ID No. 13, SEQ ID No. 14, SEQ ID No. 15, or SEQ ID No. 16, or SEQ ID No. 88, or SEQ ID No. 89, or SEQ ID No. 90, or SEQ ID No.
- the host cell may in particular be characterized in that it does not comprise a functional catB gene; a functional catC gene and/or a functional pcaB gene.
- the host cell may be selected from any type of host cell as described herein, including bacteria, yeast, filamentous fungi, cyanobacteria, algae, and plant cells.
- the host cell is in particular be envisaged to be selected from Pseudomonas spec, e.g. the host cell may be Pseudomonas putida. Otherwise, if the host cell is a recombinant host cell comprising heterologous nucleic acid sequences, in particular heterologous catA and/or heterologous catA2 genes, said genes are preferably derived from Pseudomonas putida.
- the host cell may comprise further (optionally heterologous) genes that enable utilization of by-products, e.g. AroY, KpdB, pheA and/or pcmh as described elsewhere herein.
- the skilled person will readily acknowledge that all details provided in the context of the methods of the invention apply to the host cell provided herein, mutatis mutandis.
- the present invention relates to means and methods for converting organic compounds into preferably useful organic end products.
- One particularly preferred field of application is the valorization of lignin.
- Lignin processing according to the invention may preferably be achieved as follows:
- Lignin for example, guaiacol, alkali lignin namely kraft lignin, and organosolv lignin
- hydrothermal conversion i.e. supercritical-water assisted conversion
- lignin is subjected to conversion in sub- and supercritical water at a temperature between about 350°C-420°C (e.g. about 380°C) and a pressure of 22 mPa-40mPa, such as 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, or 39 mPa.
- a suitable retention time is 0-160 minutes or preferably 0-60 minutes. Further parameters for sub- and supercritical water for the decomposition of lignin are disclosed by Wahyudiono et al (Chemical Engineering and Processing; 2008, vol. 47, p. 1609-1619) resulting in the generation of more than 28 wt% catechol.
- a reaction product that comprises catechol as an intermediate product.
- the catechol yield is preferably envisaged to exceed 5 % w/w, 10 % w/w, 15% w/w, 20% w/w, 25% w/w, 30% w/w.
- Other potential by-products comprise (m-, p-, o-)cresol, phenol and guaiacol.
- Catechol is recovered from the reaction product using suitable measures, e.g. steam bath distillation. After distillation, the amount of catechol is preferably higher than 90% w/w, higher than 95% w/w or higher than 99% w/w.
- a suitable biocatalyst is employed, using catechol as a substrate to generate cis-cis-muconic acid.
- Said biocatalyst is preferably a host cell as described in the foregoing.
- Said host cell preferably comprises at least one (optionally heterologous) catA gene as defined elsewhere herein and at least one (optionally heterologous) catA2 gene as defined elsewhere herein.
- the catA gene may in particular be PP_3713 of P. putida KT2440 or a variant thereof and comprise a sequence corresponding to SEQ ID No. 1
- the catA2 gene may in particular be PP_3166 of P.
- Said host cell may further comprise at least one (optionally heterologous) promoter sequence operably linked to, e.g. upstream of, the (optionally heterologous) catA gene, the (optionally heterologous) catA2 gene, or both.
- the promoter preferably enables constitutive expression of the genes operably linked thereto.
- Said promoter sequence is envisaged to comprise a sequence selected from a sequence corresponding to SEQ ID No. 5, SEQ ID NO. 6, SEQ ID No. 7, SEQ ID No. 8, SEQ I D No. 9 SEQ ID No. 10, SEQ ID No. 1 1 , SEQ ID No. 12, SEQ ID No. 13, SEQ ID No.
- SEQ ID No. 15 or SEQ ID No. 16, or SEQ ID No. 88, or SEQ ID No. 89, or SEQ ID No. 90, or SEQ ID No. 91 , or SEQ I D No. 92, or SEQ I D No. 93, or SEQ I D No. 94, or SEQ I D No. 95, or SEQ ID No. 96, or SEQ ID No. 97, or SEQ ID No. 98, or SEQ ID No. 99, or SEQ ID No. 100, or SEQ ID No. 101 , or SEQ ID No. 102, or SEQ ID No. 103, or SEQ ID No. 104, or SEQ ID No. 105.
- the host cell may in particular be characterized in that it does not comprise a functional catB gene; a functional catC gene and/or a functional pcaB gene.
- the host cell may be selected from any type of host cell as described herein, including bacteria, yeast, filamentous fungi, cyanobacteria, algae, and plant cells.
- the host cell is in particular be envisaged to be selected from Pseudomonas spec, e.g. the host cell may be Pseudomonas putida.
- the host cell is a recombinant host cell comprising heterologous nucleic acid sequences, in particular heterologous catA and/or heterologous catA2 genes, said genes are preferably derived from Pseudomonas putida.
- the host cell may comprise further (optionally heterologous) genes that enable utilization of by-products such as protochatechuate, phenol and/or cresol, e.g. AroY, KpdB, pheA and/or pcmh as described elsewhere herein.
- the bacterial strains used in this study are listed in Table 1 . Unless otherwise stated bacteria were usually grown in LB (10 g/l tryptone, 5.0 g/l yeast extract, 5 g/l NaCI, dissolve in H 2 0 and autoclave). Batch cultivations were done in Erlenmeyer flasks that were shaken at 200 rpm. Escherichia coli cells were grown at 37°C while Pseudomonas putida was cultured at 30°C. Selection of P. putida cells was performed by plating onto M9 minimal medium with citrate (2 g/L) as a sole carbon source.
- antibiotics were added at the following final concentration: ampicillin (Amp) 100 ⁇ g/ml for E. coli cells and at 500 ⁇ g/ml for P. putida; kanamycin (Km) 50 ⁇ g/ml.
- Other supplements were added in following concentrations: 5-bromo-4-chloro-3-indolyl-3-D-galactopyranoside (X-gal) 80 ⁇ g/ml; isopropyl-3-D-1 -thiogalactopyrano side (IPTG) 0.48 g/L; 3-methyl-benzoate (3MB) 2.25 g/L; 102.69 g/L sucrose.
- the cultivation of P. putida or E. coli cells were monitored during growth by OD 6 oo using UV-1600PC Spectrophotometers (Radnor, Pennsylvania, USA).
- the pEMG plasmid was generally used to perform modifications in the genome of P. putida KT2440. The procedure is based on the homologous recombination forced by double- strand breaks in the genome of the P. putida after cleavage in vivo by l-Scel. (encoded on the plasmid pSW-l). Transient expression of the nuclease is controlled in pSW-l by Pm, a promoter induced in presence of 3-methylbenzoate-inducible.
- TS1 and TS2 were joined together by using Gibson assemply.
- the fused fragment was ligated into Smal linearized plasmid pEMG, resulting in pEMG-AcatB/catC and pEMG- ApcaB -for the construction of KT2440 JD2S and KT2440 BN14.
- Pem7 and Pem7* upsteam of catA catA2 downstream of catA and the copy of Peat: catA: catA2, TS1 , TS2 and the to be inserted fragments were ligated into Smal digested pEMG via Gibson assembly.
- Each of the resulting plasmids pEMG-AcatB/catC, pEMG-ApcaB, pEMG- Pem7, pEMG-Pem7*, pEMG-catA2 and pEMG-Pcat:catA:catA2 were transformed separately into E. coli DH5aApir via electroporation and the culture was plated onto LB-Km plates supplemented with Xgal and IPTG to discriminate potential positive clones by visual screening. Putative positive clones were checked for the presence of the TS1/TS2 insertions by colony PC using pEMG-F/pEMG-R (see table 3) and confirmed by sequencing the corresponding plasmids.
- the pEMG derivates were isolated form E. coli DH5aAp/ ' r with Miniprep Kit (Quiagen) and transformed into E. coli CC1 18lp/r for the delivery into P. putida KT2440 via mating as described in (de Lorenzo and Timmis, Methods Enzymol., 1994; 235:386-405; Martinez-Garcia and de Lorenzo, Environ Microbiol., 201 1 , 13(10):2702-16).
- putida was done by electroporation of 50 ng of pSW-l in the Km resistant cells as described in (Martinez-Garcia and de Lorenzo, Environ Microbiol., 201 1 , 13(10):2702-16) and plated onto LB-Km 50 ⁇ g/ml + Amp 500 ⁇ g/ml.
- the induction of the l-Scel enzyme in cointegrated clones that harbors the pSW-l plasmid was started by adding 15 mM 3-methylbenzoate in a 5 ml LB-Amp medium. The culture was incubated for 14 h at 30 °C and plated on LB-Amp 500 plates.
- the loss of cointegrated plasmid were checked by selecting kanamycin sensitive clones on LB-Kan 50 ⁇ g/ml plates. Deletions and insertions into the genome were generally confirmed by PCR with primer that hybridize upstream of TS1-F and downstream of TS2-R in the genome. The curation of pSW-l from P. putida was achieved by several passages of the deleted clone in LB without antibiotics.
- the pJNNmod plasmid was used for the episomal expression of catA under control of PGro and PGro_2 in P. putida BN15.
- Each of the three resulting plasmids pJNNmod-Gro:caf/A and pJNNmod-Gro_2:caM were transformed separately into E. coli DH5aAp/ ' r via electroporation and the culture was plated onto LB-Amp plates. Putative positive clones were checked for the presence of the promoter/caf/A insertions by colony PCR using pJNNmod- F/pJNNmod-R (see table 3) and confirmed by sequencing the corresponding plasmids.
- Primer Sequence Function SEQ ID NO: pEMG-F CC ATTC AG G CTG CG C AACTGTTG Vector primer pEMG 37 pEMG- CTTTACACTTTATGCTTCCGGC Vector primer pEMG 38 pSW-F GGACGCTTCGCTGAAAACTA Check of plasmid curation 39 pSW-R AACGTCGTGACTGGGAAAAC Check of plasmid curation 40
- TS2_catB/C-F C ATATGTGTTG CCAGGTCCCGTCAGGTC Amplification TS2 catB/C 45
- TS2_catB/C-R A AA AAC ATATG C AG CTC A AG G CCG ACG A AA AG Amplification TS2 catB/C 46
- TSl_Pem7-F TGAATTCGAGCTCGGTACCCTGGGCGATGTGC Amplification TS1 Pem7 47
- TS2_Pem7-F TTAAAGAGGAGAAATTAAGCATGACCGTGAAA Amplification TS2 Pem7 49
- TS2_Pem7-R GTCGACTCTAGAGGATCCCCTCGAAGTACGAA Amplification TS2 Pem7 50
- Pem7-F GCCTGACAAGAACAATACGAGGTAAGCACGTT Amplification of Pem7 51
- TSl_pcaB-F TGAATTCGAGCTCGGTACCCACACCGCGGGCA Amplification TS1 for pcaB 66
- TS2_pcaB-F ATGATGATTAAGGACGCTGCAGGAGACCGCTG Amplification TS2 for pcaB 68
- TS2_pcaB-R GTCGACTCTAGAGGATCCCCCTGGGCAAAGCC Amplification TS2 for pcaB 69
- CAAATTG PGro_2 (BN20/21) pJNN-F CGCGAATTGCAAGCTGATCC Check primer forward 86
- the reactor was loaded with the suspension, closed and purged 5 times with nitrogen. Subsequently, the reactor was heated up to the desired temperature of either 383 °C and 24 MPa with the addition of 5 g NaCI, or 383°C and 25 MPa without the addition of NaCI, while being stirred with 150 - 400 rpm. Additionally, the reactor was heated to 350 °C, 383 °C and 395 °C in experiment 16, 17, and 21 , which lead to the particular pressures of 24, 23.5 and 30 MPa, respectively. The heat-up time was about 1 hour, the final temperature was held for 30 - 60 minutes, and the cooled down time was about 1 .5 hours.
- liquid phase of the reactor was either used for concentration or distillation.
- the liquid phase was concentrated in a vacuum evaporator (AVC 2-33 IR, Christ, Germany).
- the evaporator was heated up for 15 min before loading.
- the evaporation process lasted for 3 hours at 40 °C and a reduced pressure of 15 mbar.
- the resulting concentrate was stored at -20 °C.
- the reactors were purged with nitrogen or argon as inert gas, sealed and incubated in a preheated sand bath in an oven (Nabertherm, Germany) installed at 300 or 400 °C. After the desired reaction time plus 15 min for heat up, which was measured once with a thermocouple in one reactor, the reactors were quickly quenched in a water bath.
- the amount of remaining ash was determined by weighing the centrifuged pellets after 24 h.
- Catechol yield refers to the mass of the produced catechol in relation to the initial substrate mass (wt %).
- the total yield relates to yield obtained when besides catechol also phenol, guaiacol, and o, p, m-cresol (cresol total) were taken into account.
- Table 7 Distillation.
- the substrate is the amount of catechol provided for distillation and catechol is the remaining amount after distillation.
- Table 8 Cultivation. The concentration of catechol and cis, cis-muconic acid at the beginning and end of the cultivation, respectively.
- catechol from lignin by the described hydrothermal conversion can be used for the metabolic production of cis, cis-Muconic acid with the P. putida BN6 strain.
- the catechol substrate and other compounds can be enriched with this method in order to provide a mixture of aromatics that can metabolically be converted by the cells.
- Example 3 pH-controlled fed-batch process using glucose as growth substrate to convert catechol to cis,cis muconic acid
- the glucose feed was composed of E2 minimal medium with 600 g L-1 glucose and 50 g L-1 of ammonium sulfate.
- Catechol feed contained E2 minimal medium buffer and 2.5 M catechol, and was degassed using nitrogen to prevent oxidation. To avoid foaming 0.02% antifoam 204 (Sigma-Aldrich, Tauf Wegn, Germany) was added to batch medium and all feeds. During fed-batch operation pH control was coupled to separate addition of catechol and 6 M NaOH.
- Ptuf is a translation elongation factor known as a housekeeping gene in many organisms (Patek et al., Microb Biotechnol. 2013; 6(2):103-17; Becker and Wittmann, Curr Opin Biotechnol. 2012; 23(5):718-26; Kim et al., Appl Microbiol Biotechnol. 2009; 81 (6):1097-106).
- Two versions of the Ptuf have been randomly mutated (i) whole 500 bp sequence of Ptuf (SEQ ID No. 7) and (ii) a short version of 1 18 bp containing the consensus sequence (-10 and -35 region) predicted by bioinformatic tools (SEQ ID No. 89).
- Pgro-co-chaperonin GroES (PP_1360) is responsible for mediating the folding and assembly of many proteins in Pseudomonas (Venturi et al., Mol Gen Genet. 1994; 245(1 ): 126-32).
- PgroES was identified as a strong promoter under various conditions using RNAseq analysis.
- a promoter library of Pgro has been constructed using random mutagenesis.
- JBS dNTP mutagenesis kit (Jena Bioscience GmbH, Jena, Germany) was used, which contains the dNTP analogues 8-Oxo-dGTP and dPTP.
- 8-Oxo-dGTP causes transitions from adenine to cytosine and thymine to guanine according at a rate of mutagenesis of approximately 2 % (Zaccolo et al., J Mol Biol. 1996; 255(4):589-603; Cadwell and Joyce, PCR Methods Appl. 1992; 2(1 ):28-33).
- DPTP can be inserted in place of any nucleotide with a rate of mutagenesis of approximately 19 %.
- Both analogues combined raise the mutation rate of over 20 %.
- the parameter of the PCR was set-up to cause a mutagenesis rate of 2-20 %, according to manufactures recommendations.
- the analysis of further promoters was performed using the red fluorescence protein (RFP) mCherry as reporter. Therefore, the high copy plasmid pSEVA247R was used for the fusion of the promoter with mCherry.
- fluorescence micro scale cultivations (150 ⁇ ) were performed in E2 minimal medium in a micro bioreactor system that performs high-throughput batch cultivation. Cultivation temperature was 30 °C and 1300 rpm.
- the activity of the promoter is measured as RFU per OD600. Results of the measurements are shown in Figure 9.
- Table 10 further shows the promoter activity of native and mutated versions of Ptuf and Pgro in Fluorescence units (RFUs) normalized to optical density. S (short), SD (standard deviation)
- a method of producing an organic product comprising
- step (ii) comprises steam bath distillation, thereby obtaining the intermediate product.
- the organic educt comprises lignin, guaiacol; p- coumaryl alcohol; coniferyl alcohol; sinapyl alcohol; cresol; phenol; catechol; polysaccharides; cellulose hemicellulose; xylose; glucose; fructose; proteins; amino acids; triacylglycerides; and/or fatty acids.
- step iii) comprises contacting the intermediate product obtained in step ii) with a biocatalyst
- biocatalyst is a host cell selected from the group consisting of bacteria, yeast, filamentous fungi, cyanobacteria, algae, and plant cells.
- said host cell is selected from Pseudomonas, preferably Pseudomonas putida, more preferably Pseudomonas putida strain KT2440.
- the host cell is a bacterial host cell selected from the group consisting of Bacillus bacteria (e.g., B. subtilis, B. megaterium), Acinetobacter bacteria, Norcardia baceteria, Xanthobacter bacteria, Escherichia bacteria (e.g., E. coli (e.g., strains DH10B, Stbl2, DH5-alpha, DB3, DB3.1 , DB4, DB5, JDP682 and ccdA-over (e.g., U.S. Application No.
- Bacillus bacteria e.g., B. subtilis, B. megaterium
- Acinetobacter bacteria Norcardia baceteria
- Xanthobacter bacteria Escherichia bacteria
- Escherichia bacteria e.g., E. coli (e.g., strains DH10B, Stbl2, DH5-alpha, DB3, DB3.1 , DB4, DB5, JDP682 and ccdA
- Streptomyces bacteria Erwinia bacteria, Klebsiella bacteria, Serratia bacteria (e.g., S. marcescens), Pseudomonas bacteria (e.g., P. aeruginosa, P. putida), Salmonella bacteria (e.g., S. typhimurium, S. typhi), Megasphaera bacteria (e.g., Megasphaera elsdenii), photosynthetic bacteria (e.g., green non-sulfur bacteria (e.g., Choroflexus bacteria (e.g., C. aurantiacus), Chloronema bacteria (e.g., C.
- green sulfur bacteria e.g., Chlorobium bacteria (e.g., C. limicola)
- Pelodictyon bacteria e.g., P. luteolum
- purple sulfur bacteria e.g., Chromatium bacteria (e.g., C. okenii)
- purple non-sulfur bacteria e.g., Rhodospirillum bacteria (e.g., R. rubrum)
- Rhodobacter bacteria e.g., R. sphaeroides, R. capsulatus
- Rhodomicrobium bacteria e.g., R. vanellii
- the host cell is a yeast host cell selected from the group consisting of Yarrowia yeast (e.g., Y. lipolytica (formerly classified as Candida lipolytica)), Candida yeast (e.g., C. revkaufi, C. pulcherrima, C. tropicalis, C. utilis), Rhodotorula yeast (e.g., R. glutinus, R. graminis), Rhodosporidium yeast (e.g., R. toruloides), Saccharomyces yeast (e.g., S. cerevisiae, S. bayanus, S. pastorianus, S.
- yeast host cell selected from the group consisting of Yarrowia yeast (e.g., Y. lipolytica (formerly classified as Candida lipolytica)), Candida yeast (e.g., C. revkaufi, C. pulcherrima, C. tropicalis, C. utilis), Rhodotorula yeast (e.g., R. glutinus, R.
- the host cell is a fungal host cell selected from the group consisting of Aspergillus fungi (e.g., A. parasiticus, A. nidulans), Thraustochytrium fungi, Schizochytrium fungi and Rhizopus fungi (e.g., R. arrhizus, R. oryzae, R.
- Aspergillus fungi e.g., A. parasiticus, A. nidulans
- Thraustochytrium fungi Thraustochytrium fungi
- Schizochytrium fungi e.g., R. arrhizus, R. oryzae, R.
- any one of items 7 to 14 wherein said host cell comprises at least one (optionally heterologous) gene encoding a polypeptide having catechol 1 ,2- dioxygenase activity.
- said host cell comprises at least one (optionally heterologous) catA gene and/or at least one (optionally heterologous) catA2 gene.
- said at least one (optionally heterologous) catA gene encodes a polypeptide comprising a sequence corresponding to SEQ ID No.
- At least one (optionally heterologous) catA2 gene encodes a polypeptide comprising a sequence corresponding to SEQ ID No. 3.
- the host cell comprises iv) at least one (optionally heterologous) catA gene encoding a catA polypeptide comprising a sequence corresponding to SEQ ID No. 1 ; and v) at least one (optionally heterologous) catA2 gene encoding a catA2 polypeptide comprising a sequence corresponding to SEQ ID No. 3.
- any of items 7 to 19, wherein said host cell comprises, operably linked to, e.g. upstream of, the at least one (optionally heterologous) gene, a promoter sequence corresponding to i) SEQ ID No. 5 [Pem7]; or ii) SEQ ID No. 6 [Pem7 * ]; or iii) SEQ ID No. 7 [Ptuf]; or iv) SEQ ID No. 8 [PrpoD]; or v) SEQ ID No. 9 [Plac]; or vi) SEQ ID No. 10 [PgyrB]; vii) SEQ ID No. 1 1 ; or viii) SEQ ID No. 12; or ix) SEQ ID No.
- any of items 10 to 21 wherein said at least one heterologous gene is derived from Pseudomonas, preferably Pseudomonas putida, more preferably Pseudomonas putida strain KT2440
- said host cell is further characterized in that it does not express a functional catB polypeptide, and/or in that it does not express a functional catC polypeptide, and/or in that it does not express a functional pcaB polypeptide.
- the method of item 23 wherein the catB gene, catC gene or pcaB gene is silenced, preferably knocked-down or knocked-out, or deleted from the chromosome.
- the method of item 25 yielding cis-cis-muconic acid which is white in color.
- a host cell for the production of cis, c/s-muconic acid from catechol which host cell comprises i) at least one (optionally heterologous) catA gene; and ii) at least one (optionally heterologous) catA2 gene
- the host cell of item 28 wherein the at least one (optionally heterologous) catA gene encodes a catA polypeptide comprising a sequence corresponding to SEQ ID No. 1 ; and/or the at least one (optionally heterologous) catA2 gene encodes a catA2 polypeptide comprising a sequence corresponding to SEQ ID No. 3.
- the at least one (optionally heterologous) gene a promoter sequence corresponding to i) SEQ ID No. 5 [Pem7]; or ii) SEQ ID No. 6 [Pem7 * ]; or iii) SEQ ID No. 7 [Ptuf]; or iv) SEQ ID No. 8 [PrpoD]; or v) SEQ ID No. 9 [Plac]; or vi) SEQ ID No. 10 [PgyrB]; or vii) SEQ ID No. 1 1 ; or viii) SEQ ID No. 12; or ix) SEQ ID No. 13; or x) SEQ ID No. 14; or xi) SEQ ID No.
- the host cell of any of items 28 to 31 which is a selected from the group consisting of bacteria, yeast, filamentous fungi, cyanobacteria, algae, and plant cells.
- the host cell of item 32 which is a bacterial host cell selected from the group consisting of Bacillus bacteria (e.g., B. subtilis, B.
- E. coli e.g., strains DH10B, Stbl2, DH5-alpha, DB3, DB3.1 , DB4, DB5, JDP682 and ccdA-over (e.g., U.S. Application No. 09/518,188 )
- Streptomyces bacteria Erwinia bacteria, Klebsiella bacteria, Serratia bacteria (e.g., S. marcescens), Pseudomonas bacteria (e.g., P. aeruginosa, P. putida), Salmonella bacteria (e.g., S.
- Megasphaera bacteria e.g., Megasphaera elsdenii
- photosynthetic bacteria e.g., green non-sulfur bacteria (e.g., Choroflexus bacteria (e.g., C. aurantiacus), Chloronema bacteria (e.g., C. gigateum)), green sulfur bacteria (e.g., Chlorobium bacteria (e.g., C. limicola)), Pelodictyon bacteria (e.g., P. luteolum), purple sulfur bacteria (e.g., Chromatium bacteria (e.g., C.
- Rhodospirillum bacteria e.g., R. rubrum
- Rhodobacter bacteria e.g., R. sphaeroides, R. capsulatus
- Rhodomicrobium bacteria e.g., R. vanellii
- heterologous genes are derived from Pseudomonas, preferably Pseudomonas putida, more preferably Pseudomonas putida strain KT2440.
Landscapes
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP15002547 | 2015-08-28 | ||
| LU92822 | 2015-09-08 | ||
| PCT/EP2016/070307 WO2017037013A1 (en) | 2015-08-28 | 2016-08-29 | Means and methods for production of organic compounds |
Publications (4)
| Publication Number | Publication Date |
|---|---|
| EP3341487A1 true EP3341487A1 (en) | 2018-07-04 |
| EP3341487C0 EP3341487C0 (en) | 2025-10-01 |
| EP3341487B1 EP3341487B1 (en) | 2025-10-01 |
| EP3341487B8 EP3341487B8 (en) | 2025-11-12 |
Family
ID=56958873
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP16767152.8A Active EP3341487B8 (en) | 2015-08-28 | 2016-08-29 | Means and methods for production of organic compounds |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US20180282768A1 (en) |
| EP (1) | EP3341487B8 (en) |
| CA (1) | CA2996728A1 (en) |
| WO (1) | WO2017037013A1 (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3592858B1 (en) * | 2017-03-09 | 2024-06-12 | Universität des Saarlandes | Means and methods for lignin pyrolysis |
| CN107858334A (en) * | 2017-11-23 | 2018-03-30 | 浙江海洋大学 | One kind extraction and purification Catechol 2, method of 3 dioxygenases from microalgae |
| CN109182233B (en) * | 2018-08-09 | 2021-09-24 | 天津大学 | A kind of polycyclic aromatic hydrocarbon degrading engineering bacteria and its engineering modification method and application |
| CN114317538B (en) * | 2021-12-30 | 2024-02-13 | 江苏澳创生物科技有限公司 | A heat-resistant component Ptuf-TTHA0571 for Corynebacterium glutamicum and its application |
| WO2024180222A1 (en) | 2023-03-02 | 2024-09-06 | Universitaet Des Saarlandes | Methods for producing l-pipecolic acid |
| CN119709574B (en) * | 2024-12-27 | 2025-11-11 | 天津大学 | Microorganism cell factory for producing catechol |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BR112012025090A2 (en) * | 2010-03-30 | 2015-10-06 | Univ Cornell | water pretreatment with lignocellulosic biomass biphasic supercritical carbon dioxide |
| WO2012075053A2 (en) * | 2010-11-30 | 2012-06-07 | Strategic Enzyme Applications, Inc. | Lignin oxidation and products thereof |
| WO2013005202A1 (en) * | 2011-07-06 | 2013-01-10 | Hollingford Limited | Anaerobic digestion with supercritical water hydrolysis as pretreatment |
| EP2861745A2 (en) * | 2012-06-15 | 2015-04-22 | Invista Technologies S.à.r.l. | Methods for biosynthesizing 1,3 butadiene |
-
2016
- 2016-08-29 WO PCT/EP2016/070307 patent/WO2017037013A1/en not_active Ceased
- 2016-08-29 US US15/756,445 patent/US20180282768A1/en not_active Abandoned
- 2016-08-29 CA CA2996728A patent/CA2996728A1/en active Pending
- 2016-08-29 EP EP16767152.8A patent/EP3341487B8/en active Active
Non-Patent Citations (3)
| Title |
|---|
| HAN LI ET AL: "Engineering catechol 1, 2-dioxygenase by design for improving the performance of the cis, cis-muconic acid synthetic pathway in Escherichia coli", SCIENTIFIC REPORTS, vol. 5, no. 1, 26 August 2015 (2015-08-26), XP093106702, Retrieved from the Internet <URL:https://www.nature.com/articles/srep13435.pdf> DOI: 10.1038/srep13435 * |
| KOHLSTEDT MICHAEL ET AL: "From lignin to nylon: Cascaded chemical and biochemical conversion using metabolically engineered Pseudomonas putida", METABOLIC ENGINEERING, vol. 47, 1 May 2018 (2018-05-01), AMSTERDAM, NL, pages 279 - 293, XP093262646, ISSN: 1096-7176, Retrieved from the Internet <URL:https://pdf.sciencedirectassets.com/272595/1-s2.0-S1096717618X00032/1-s2.0-S1096717617304615/main.pdf> DOI: 10.1016/j.ymben.2018.03.003 * |
| See also references of WO2017037013A1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2017037013A1 (en) | 2017-03-09 |
| US20180282768A1 (en) | 2018-10-04 |
| EP3341487C0 (en) | 2025-10-01 |
| CA2996728A1 (en) | 2017-03-09 |
| EP3341487B1 (en) | 2025-10-01 |
| EP3341487B8 (en) | 2025-11-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3341487B1 (en) | Means and methods for production of organic compounds | |
| Mitra et al. | Current developments on polyhydroxyalkanoates synthesis by using halophiles as a promising cell factory | |
| Tomizawa et al. | Understanding the limitations in the biosynthesis of polyhydroxyalkanoate (PHA) from lignin derivatives | |
| US10174349B2 (en) | Recombinant cell producing 2-hydroxyisobutyric acid | |
| Joo et al. | Production of 5-aminovaleric acid in recombinant Corynebacterium glutamicum strains from a Miscanthus hydrolysate solution prepared by a newly developed Miscanthus hydrolysis process | |
| TWI801327B (en) | Process for the biological production of methacrylic acid | |
| US20130017583A1 (en) | Methods for producing polyhydroxyalkanoate copolymer with high medium chain length monomer content | |
| HUE027066T2 (en) | Genetically modified cell and process for use of said cell | |
| AU2010291208A1 (en) | Polypeptides having oxidoreductase activity and their uses | |
| KR20150014941A (en) | Microorganisms and processes for the production of isoprene | |
| CN114008211A (en) | Method for producing high value-added compounds from polyethylene terephthalate | |
| EP3592858B1 (en) | Means and methods for lignin pyrolysis | |
| Liang et al. | Lignin valorization through microbial production of polyhydroxyalkanoates: recent trends, challenges and opportunities | |
| WO2017013438A1 (en) | Methods for extracting sugars and lignin derived products from lignocellulosic biomass material | |
| EP2048231B1 (en) | Plasmid, transformant, and method for production of 3-carboxymuconolactone | |
| US20240102057A1 (en) | Methods and compositions useful for the production of 4-vinylphenol | |
| CN115380109B (en) | D-psicose 3-epimerase for bioconversion of D-fructose to D-psicose | |
| US11098306B1 (en) | Promoters and uses thereof | |
| WO2014102280A1 (en) | A microbial organism for producing terephthalate from biomass | |
| US20250101441A1 (en) | Microorganisms and methods for producing cis,cis-muconic acid | |
| WO2016094526A1 (en) | Genetically modified microbes for the biological conversion of carbonaceous materials to diols | |
| US20260125731A1 (en) | Microorganisms and methods for producing carotenoids and other compounds | |
| DK202470228A9 (en) | Novel lipid peroxidation system and method for preparing biofuel and biopolymer using same | |
| JP5678356B2 (en) | Method for producing phenolic acid | |
| US20210180095A1 (en) | Methods of producing 2,5-furandicarboxylic acid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20180323 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| AX | Request for extension of the european patent |
Extension state: BA ME |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: EXAMINATION IS IN PROGRESS |
|
| 17Q | First examination report despatched |
Effective date: 20220629 |
|
| GRAP | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOSNIGR1 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: GRANT OF PATENT IS INTENDED |
|
| INTG | Intention to grant announced |
Effective date: 20250407 |
|
| GRAS | Grant fee paid |
Free format text: ORIGINAL CODE: EPIDOSNIGR3 |
|
| GRAA | (expected) grant |
Free format text: ORIGINAL CODE: 0009210 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE PATENT HAS BEEN GRANTED |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: VAN DUUREN, JOZEF Inventor name: STOLZENBERGER, JESSICA Inventor name: KOHLSTEDT, MICHAEL Inventor name: STARCK, SOEREN Inventor name: SELZER, MIRJAM Inventor name: FRITZ, MICHEL Inventor name: HOELTZEN, HEIKE Inventor name: RICHTER, RUDOLF Inventor name: WITTMANN, CHRISTOPH |
|
| GRAT | Correction requested after decision to grant or after decision to maintain patent in amended form |
Free format text: ORIGINAL CODE: EPIDOSNCDEC |
|
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R081 Ref document number: 602016093711 Country of ref document: DE Owner name: UNIVERSITAET DES SAARLANDES KOERPERSCHAFT DES , DE Free format text: FORMER OWNER: UNIVERSITAET DES SAARLANDES, 66123 SAARBRUECKEN, DE |
|
| AK | Designated contracting states |
Kind code of ref document: B1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| REG | Reference to a national code |
Ref country code: GB Ref legal event code: FG4D Ref country code: CH Ref legal event code: F10 Free format text: ST27 STATUS EVENT CODE: U-0-0-F10-F00 (AS PROVIDED BY THE NATIONAL OFFICE) Effective date: 20251001 |
|
| REG | Reference to a national code |
Ref country code: CH Ref legal event code: Q17 Free format text: ST27 STATUS EVENT CODE: U-0-0-Q10-Q17 (AS PROVIDED BY THE NATIONAL OFFICE) Effective date: 20251015 |
|
| RAP4 | Party data changed (patent owner data changed or rights of a patent transferred) |
Owner name: UNIVERSITAET DES SAARLANDES, KOERPERSCHAFT DESOEFFENTLICHEN RECHTS |
|
| REG | Reference to a national code |
Ref country code: IE Ref legal event code: FG4D |
|
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R096 Ref document number: 602016093711 Country of ref document: DE |
|
| U01 | Request for unitary effect filed |
Effective date: 20251031 |
|
| U07 | Unitary effect registered |
Designated state(s): AT BE BG DE DK EE FI FR IT LT LU LV MT NL PT RO SE SI Effective date: 20251106 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: ES Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20251001 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: NO Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20260101 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: HR Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20251001 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: RS Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20260101 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: IS Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20260201 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: CZ Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20251001 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: PL Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20251001 |