EP3297702A2 - Methods and compositions for treating aging-associated impairments - Google Patents
Methods and compositions for treating aging-associated impairmentsInfo
- Publication number
- EP3297702A2 EP3297702A2 EP16797159.7A EP16797159A EP3297702A2 EP 3297702 A2 EP3297702 A2 EP 3297702A2 EP 16797159 A EP16797159 A EP 16797159A EP 3297702 A2 EP3297702 A2 EP 3297702A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- aging
- cognitive
- mammal
- disease
- young
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/14—Blood; Artificial blood
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2833—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against MHC-molecules, e.g. HLA-molecules
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61M—DEVICES FOR INTRODUCING MEDIA INTO, OR ONTO, THE BODY; DEVICES FOR TRANSDUCING BODY MEDIA OR FOR TAKING MEDIA FROM THE BODY; DEVICES FOR PRODUCING OR ENDING SLEEP OR STUPOR
- A61M1/00—Suction or pumping devices for medical purposes; Devices for carrying-off, for treatment of, or for carrying-over, body-liquids; Drainage systems
- A61M1/14—Dialysis systems; Artificial kidneys; Blood oxygenators ; Reciprocating systems for treatment of body fluids, e.g. single needle systems for hemofiltration or pheresis
- A61M1/16—Dialysis systems; Artificial kidneys; Blood oxygenators ; Reciprocating systems for treatment of body fluids, e.g. single needle systems for hemofiltration or pheresis with membranes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61M—DEVICES FOR INTRODUCING MEDIA INTO, OR ONTO, THE BODY; DEVICES FOR TRANSDUCING BODY MEDIA OR FOR TAKING MEDIA FROM THE BODY; DEVICES FOR PRODUCING OR ENDING SLEEP OR STUPOR
- A61M1/00—Suction or pumping devices for medical purposes; Devices for carrying-off, for treatment of, or for carrying-over, body-liquids; Drainage systems
- A61M1/36—Other treatment of blood in a by-pass of the natural circulatory system, e.g. temperature adaptation, irradiation ; Extra-corporeal blood circuits
- A61M1/3621—Extra-corporeal blood circuits
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
- A61P25/16—Anti-Parkinson drugs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01D—SEPARATION
- B01D11/00—Solvent extraction
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61M—DEVICES FOR INTRODUCING MEDIA INTO, OR ONTO, THE BODY; DEVICES FOR TRANSDUCING BODY MEDIA OR FOR TAKING MEDIA FROM THE BODY; DEVICES FOR PRODUCING OR ENDING SLEEP OR STUPOR
- A61M2202/00—Special media to be introduced, removed or treated
- A61M2202/07—Proteins
Definitions
- AD Alzheimer's disease
- ⁇ -2 microglobulin is a component of the class I major histocompatibility complex (MHC), a multi- protein complex found on the surface of nearly all nucleated mammalian cells. These complexes function by presenting foreign antigens or peptide fragments on the cell surface so that the immune system may recognize and destroy infected cells.
- MHC major histocompatibility complex
- the protein components of the class I MHC are encoded by several genes, each with multiple alleles, and the types of expressed class I MHCs vary among individuals. Because the MHC is polymorphic, it is an important factor for consideration during organ transplant as the host immune system may reject organs with foreign MHCs. In cancerous cells, MHC expression may be defective, allowing such cells to escape immune detection and destruction.
- Free extracellular B2M is also found in human physiological fluids such as the blood serum, urine, and cerebral spinal fluid. Due to its small size, the protein is normally filtered from the blood and then reabsorbed in some amount by the kidney. High serum
- B2M B2M concentrations often accompany the presence of several diseases such as non- Hodgkin lymphoma and meningitis (Hallgren et al. , "Lactoferrin, lysozyme, and beta 2- microglobulin levels in cerebrospinal fluid: differential indices of CNS inflammation," Inflammation (1982) 6:291 -304; et al. , “Prognostic significance of serum beta-2 microglobulin in patients with non-Hodgkin lymphoma,” Oncology (2014) 87:40-7).
- diseases such as non- Hodgkin lymphoma and meningitis (Hallgren et al. , "Lactoferrin, lysozyme, and beta 2- microglobulin levels in cerebrospinal fluid: differential indices of CNS inflammation," Inflammation (1982) 6:291 -304; et al. , “Prognostic significance of serum beta-2 microglobulin in patients with non-Hod
- Urine B2M levels are measured to indicate kidney damage and filtration disorders (Acchiardo et al., "Beta 2-microglobulin levels in patients with renal insufficiency,” American Journal of Kidney Diseases (1989) 13:70-4; Astor et al., "Serum Beta-2-microglobulin at discharge predicts mortality and graft loss following kidney transplantation,” Kidney International (2013) 84:810-817).
- the protein has been implicated in neuronal development, normal hippocampus dependent memory and synapse formation and plasticity (Bilousova et al., "Major histocompatibility complex class I molecules modulate embryonic neuritogenesis and neuronal polarization," Journal of Neuroimmunology (2012) 247: 1 -8; Harrison et al., "Human brain weight is correlated with expression of the 'housekeeping genes' beta-2-microglobulin and TATA-binding protein," Neuropathology and Applied Neurobiology (2010) 36:498-504).
- B2M serves as a molecular marker that can be used to determine immune compromise or central nervous system immune activation (Svatonova et al., "Beta2-microglobulin as a diagnostic marker in cerebrospinal fluid: a follow-up study,” Disease Markers (2014) 2014). Levels of the protein may signify the extent of the central nervous system inflammatory response.
- B2M and its use as a disease marker states that elevated levels of B2M in the cerebral spinal fluid is reflective of multiple sclerosis, neuro-Behcet's disease, sarcoidosis, acquired immunodeficiency syndrome- dementia complex and meningeal metastasis of malignant tumors (Adachi, "Beta-2- microglobulin levels in the cerebrospinal fluid: their value as a disease marker.
- a review of the recent literature European Neurology (1991) 31 : 181 -5).
- B2M could potentially serve as a clinical marker for cognitive impairment risk or a tool for disease prognosis for individuals experiencing a range of diseases including kidney failure, HIV infection, and Alzheimer's (Almeida, "Cognitive impairment and major depressive disorder in HIV infection and cerebrospinal fluid biomarkers,” Arquivos de Neuro-Psiquiatria (2013) 71 :689-92; Annunziata et al. , "Serum beta-2-microglobulin levels and cognitive function in chronic dialysis patients," Clinica Chimica Acta (1991 ) 201 : 139-41 ; Doecke et al.
- B2M has been the target of disease therapies (Morabito et al. , "Analysis and clinical relevance of human leukocyte antigen class I , heavy chain, and beta2- microglobulin down regulation in breast cancer," Human Immunology (2009) 70:492-5; Yang et al. , "Identification of beta2-microglobulin as a potential target for ovarian cancer,” Cancer Biology & Therapy (2009) 8:232-8).
- Methods of treating an adult mammal for an aging-associated impairment are provided. Aspects of the methods include reducing the p2-microglobulin (B2M) level in the mammal in a manner sufficient to treat the mammal for the aging-associated impairment.
- B2M p2-microglobulin
- a variety of aging-associated impairments may be treated by practice of the methods, which impairments include cognitive impairments.
- FIGS. 1 a & 1 c Schematic of unpaired young versus aged mice (FIG. 1 a), and young isochronic versus heterochronic parabionts (FIG. 1 c).
- FIGS. 1 b & 1 c Changes in plasma concentration of B2M with age at 3, 6, 12, 18 and 24 months (FIG . 1 b) and between young isochronic and young heterochronic parabionts five weeks after parabiosis (FIG . 1 d) . Data from 5 mice per group.
- FIGS. 1 g & 1 k Young adult (3 months) mice were injected intraorbitally with B2M or PBS (vehicle) control five times over 12 days.
- FIG . 1 g Schematic of illustrating the chronological order used for B2M treatment and cognitive testing.
- FIGS. 1 h & 1 i Schematic of illustrating the chronological order used for B2M treatment and cognitive testing.
- FIG. 1 h Number of entry arm errors prior to finding platform
- i Percent freezing time 24h after training. Data from 9-10 mice per group.
- FIG . 1j
- FIG. 1 k Quantification of neurogenesis in the dentate gyrus (DG) after treatment. Data from 7-8 mice per group. All data represented as dot plots with Mean or bar graphs with MeaniSEM ; *P ⁇ 0.05; **P ⁇ 0.01 ; ***P ⁇ 0.001 t-test (FIGS. 1 d, 1 f, 1 i & 1 k), ANOVA, Tukey's post-hoc test (FIG. 1 b) , Mann-Whitney U Test (e) and repeated measures ANOVA, Bonferroni post- hoc test (FIG . 1 k).
- FIGS. 2a-2e Hippocampal dependent learning and memory.
- FIG. 2a Old mice demonstrate impaired learning and memory for platform location during the testing phase of the RAWM task. Cognitive deficits were quantified as the number of entry arm errors made prior to finding the target platform.
- FIG . 2b No differences in swim speeds of were detected between young and old animals.
- FIG . 2c Young and old animals exhibited similar baseline freezing time during fear conditioning training .
- FIG. 2d During contextual fear conditioning old mice demonstrate decreased freezing time during contextual memory testing.
- FIG. 2e No differences in cued memory were detected 24 hours after training. Data represented as mean ⁇ s.e. m. ; *P ⁇ 0.05; **P ⁇ 0.01 ; n.s. , not significant; t-test (FIGS. 2a-2c & 2e), repeated measures ANOVA, Bonferroni post-hoc test (FIG . 2d).
- FIGS. 3a-3d Weight, swim speeds and cued memory are not altered by systemic B2M administration.
- FIGS. 3a-3d Young adult (3 months) mice were injected intraorbitally with B2M or PBS (vehicle) control five times over 10 days prior to behavioral testing.
- FIG . 3a Average mouse weight of B2M and vehicle treated groups.
- FIG . 3b Swim speeds of mice injected with B2M or vehicle during the testing phase of the RAWM .
- FIGS. 3c & 3d Conditioned fear was displayed as freezing behavior.
- FIG. 3c Animals from all treatment groups exhibited similar baseline freezing time during training.
- FIGS. 5a-5h Local B2M expression increases in the hippocampus during aging and impairs hippocampal-dependent cognitive function and adult neurogenesis.
- FIGS. 5a & 5b Representative Western blot and quantification of hippocampal lysates probed with anti- B2M and anti-Actin antibodies from young (3 months) and old (18 months) unpaired animals (FIG . 5a), or young isochronic and young heterochronic parabionts five weeks after parabiosis (FIG. 5b).
- FIGS. 5c-5e Young adult (3 months) wild type (WT) and transporter associated with antigen processing 1 knock out (Tap1 -/-) mice were given unilateral stereotaxic injections of B2M or vehicle control FIG.
- FIGS. 5c Representative field of Dcx-positive cells in adjacent sides of the DG within the same section are shown for WT and Tap1 -/- treatment groups.
- FIGS. 5d & 5e Quantification of neurogenesis in the DG of WT (d) and Tap1 -/- (FIG . 5e) mice after stereotaxic B2M administration. Data from five mice per group.
- FIGS. 5f-5h Young adult mice were given bilateral stereotaxic injections of B2M or vehicle six days prior to behavioral testing.
- FIG. 5f Schematic illustrating chronological order used for local B2M administration and cognitive testing.
- FIG . 5g & 5h Learning and memory was assessed by RAWM (FIG. 5h) and contextual fear conditioning (FIG.
- FIGS. 6a-6c Swim speeds and cued memory are not altered by local B2M administration.
- FIGS. 6a-6c Young adult mice were given bilateral stereotaxic injections of B2M or PBS (vehicle) control six days prior to behavioral testing.
- FIG . 6a Swim speeds of mice injected with B2M or vehicle during the testing phase of the RAWM .
- FIG . 6b Animals from all treatment groups exhibited similar baseline freezing time during fear conditioning training.
- FIG . 6c No differences in cued memory were detected between groups when re- exposed to the conditioned stimulus (tone and light) in a novel context 24 hours after training. Data from 10 mice per group. All data represented as Mean+SEM ; n.s. not significant; t-test.
- FIG. 7a Quantification of
- FIG. 7b Schematic of young WT and Tap1 -/- isochronic parabionts.
- FIGS. 7c-7e Quantification of Dcx, T-box transcription factor Tbr2, and BrdU immunostaining of young WT and Tap1 -/- isochronic parabionts five weeks after parabiosis. Data from 6-8 mice per group. All data represented as Mean+SEM; n.s. not significant; t-test (FIG. 7a); ANOVA, Tukey's post-hoc test (FIGS. 7c-7e).
- FIGS. 8a-8d Reducing endogenous MHC I surface expression mitigates in part the negative effects of heterochronic parabiosis on adult neurogenesis in young animals.
- FIG. 8a Schematic of young wild type (WT) and Tap1 knock out (Tap1 -/-) isochronic parabionts and young WT and Tap1 -/- heterochronic parabionts.
- FIGS. 8b & 8c are diagrammatic of young wild type (WT) and Tap1 knock out (Tap1 -/-) isochronic parabionts and young WT and Tap1 -/- heterochronic parabionts.
- FIG. 8d Prior to euthanasia animals were injected with Bromodeoxyuridne (BrdU) for three days, and proliferating cells having incorporated BrdU were quantified in DG after parabiosis. Data from 8 young isochronic WT, 6 young isochronic Tap1 -/-, 8 young heterochronic WT, and 8 young heterochronic Tap1 -/- parabionts. All data represented as Mean ⁇ SEM; *P ⁇ 0.05; ANOVA, Tukey's post- hoc test.
- FIG. 9a Schematic of young wild type (WT) and Tap1 knock out (Tap1 -/-) isochronic parabionts and young WT and Tap1 -/- heterochronic parabionts.
- FIGS. 10a-1 Oj Absence of endogenous B2M enhances hippocampal-dependent cognitive function and adult neurogenesis in old animals.
- FIGS. 10a-10d Learning and memory was assessed in young (3 months) and old (15-16 months) wild type (WT) and B2M knock out (B2M-/-) mice by RAWM (FIGS. 10a, 10c) and contextual fear conditioning (FIGS. 10b & 10d). Data from 10 young and 8-12 old mice per genotype.
- FIGS. 10e - 10j Neurogenesis was analyzed by immunostaining for Dcx-positive cells in the DG of young and old WT and B2M-/- mice. Representative field and quantification of Dcx-positive cells are shown for young (FIGS.
- FIGS. 10e & 10f and old ( FIGS. 10e & 10g) WT and B2M-/- animals (arrowheads point to individual immature neurons, scale bar: 100 ⁇ ).
- FIGS. 10h & 10j WT and B2M-/- mice were administered BrdU by intraperitoneal injections for six days and euthanized 28 days later.
- FIG. 10h Representative confocal microscopy from the DG of brain sections immunostained for BrdU (red) in combination with NeuN (green) .
- FIGS. 10i & 10j Quantification of the relative number of BrdU and NeuN-double positive cells out of the total BrdU-positive cells in the young (FIG.
- FIGS. 1 1 a-1 1 f Swim speeds and cued memory are not altered in old B2M-/- animals.
- FIGS. 1 1 a-1 1 f Hippocampal learning and memory was assessed old adult (17 months) WT and during the testing phase of the RAWM . Animals exhibited similar baseline freezing time during fear conditioning training regardless of genotype. No differences in cued memory were detected between genotypes when mice were re-exposed to the conditioned stimulus (tone and light) in a novel context 24 hours after training. Data from 12 WT and 8 B2M-/- mice. All data represented as Mean+SEM ; n.s. not significant; t-test.
- FIGS. 12a- 12e Absence of endogenous B2M increases proliferation but not astrocyte differentiation in an age-dependent manner in vivo.
- FIGS. 12a- 12c To assess proliferation young (3 months) and old (15-16 months) wild type (WT) and B2M knock out (B2M-/-) mice were administered BrdU by intraperitoneal injections for three days prior to euthanasia.
- FIGS. 12b & 12c Immunostaining of BrdU-positive cells was quantified in the DG of young (FIG . 12b) and old (FIG . 12c) animals. Data from 8 young and 10 old mice per genotype.
- FIG. 12c Representative confocal microscopy from the DG of brain sections
- FIGS. 12d & 12e
- FIG. 13 Relative levels of beta2-microglobulin were determined in plasma samples of healthy male human donors of 18, 30, 45, 55, and 66 years of age by the SomaScan Proteomic Assay (Somalogic, Inc, Boulder, CO). For each age group, plasma from 40 individuals was analyzed as 8 pools of 5 individuals per pool. Statistical analysis was performed by two-sided Student's t-test of log-transformed values, and also by trend- analysis of untransformed data using the Jonckheere-Terpstra test.
- Methods of treating an adult mammal for an aging-associated impairment are provided. Aspects of the methods include reducing the p2-microglobulin (B2M) level in the mammal in a manner sufficient to treat the mammal for the aging-associated impairment.
- B2M p2-microglobulin
- a variety of aging-associated impairments may be treated by practice of the methods, which impairments include cognitive impairments.
- aspects of the invention include methods of treating an aging-associated impairment in an adult mammal.
- the aging-associated impairment may manifest in a number of different ways, e.g. , as aging-associated cognitive impairment and/or physiological impairment, e.g.
- organs of the body in the form of damage to central or peripheral organs of the body, such as but not limited to: cell injury, tissue damage, organ dysfunction, aging- associated lifespan shortening and carcinogenesis, where specific organs and tissues of interest include, but are not limited to skin, neuron, muscle, pancreas, brain, kidney, lung, stomach, intestine, spleen, heart, adipose tissue, testes, ovary, uterus, liver and bone; in the form of decreased neurogenesis, etc.
- the aging-associated impairment is an aging-associated impairment in cognitive ability in an individual, i.e. , an aging-associated cognitive impairment.
- cognitive ability or “cognition” it is meant the mental processes that include attention and concentration, learning complex tasks and concepts, memory (acquiring, retaining, and retrieving new information in the short and/or long term), information processing (dealing with information gathered by the five senses) , visuospatial function (visual perception, depth perception, using mental imagery, copying drawings, constructing objects or shapes) , producing and understanding language, verbal fluency (word-finding), solving problems, making decisions, and executive functions (planning and prioritizing).
- cognitive decline it is meant a progressive decrease in one or more of these abilities, e.g. , a decline in memory, language, thinking, judgment, etc.
- an impairment in cognitive ability and “cognitive impairment” it is meant a reduction in cognitive ability relative to a healthy individual, e.g. , an age-matched healthy individual, or relative to the ability of the individual at an earlier point in time, e.g. , 2 weeks, 1 month, 2 months, 3 months, 6 months, 1 year, 2 years, 5 years, or 10 years or more previously.
- Aging-associated cognitive impairments include impairments in cognitive ability that are typically associated with aging, including, for example, cognitive impairment associated with the natural aging process, e.g.
- M .C. I. mild cognitive impairment
- cognitive impairment associated with an aging- associated disorder that is, a disorder that is seen with increasing frequency with increasing senescence, e.g. , a neurodegenerative condition such as Alzheimer's disease, Parkinson's disease, frontotemporal dementia, Huntington's disease, amyotrophic lateral sclerosis, multiple sclerosis, glaucoma, myotonic dystrophy, vascular dementia, and the like.
- treatment it is meant that at least an amelioration of one or more symptoms associated with an aging-associated impairment afflicting the adult mammal is achieved, where amelioration is used in a broad sense to refer to at least a reduction in the magnitude of a parameter, e.g. , a symptom associated with the impairment being treated.
- amelioration also includes situations where a pathological condition, or at least symptoms associated therewith, are completely inhibited, e.g. , prevented from happening, or stopped, e.g. , terminated, such that the adult mammal no longer suffers from the impairment, or at least the symptoms that characterize the impairment.
- treatment includes situations where a pathological condition, or at least symptoms associated therewith, are completely inhibited, e.g. , prevented from happening, or stopped, e.g. , terminated, such that the adult mammal no longer suffers from the impairment, or at least the symptoms that characterize the impairment.
- treating and the like refer to obtaining a desired pharmacologic and/or physiologic effect.
- the effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disease and/or adverse effect attributable to the disease.
- Treatment may be any treatment of a disease in a mammal, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e. , arresting its development; or (c) relieving the disease, i.e. , causing regression of the disease.
- Treatment may result in a variety of different physical manifestations, e.g. , modulation in gene expression, increased neurogenesis, rejuvenation of tissue or organs, etc.
- Treatment of ongoing disease where the treatment stabilizes or reduces the undesirable clinical symptoms of the patient, occurs in some embodiments.
- Such treatment may be performed prior to complete loss of function in the affected tissues.
- the subject therapy may be administered during the symptomatic stage of the disease, and in some cases after the symptomatic stage of the disease.
- treatment by methods of the present disclosure slows, or reduces, the progression of aging-associated cognitive decline.
- cognitive abilities in the individual decline more slowly, if at all, following treatment by the disclosed methods than prior to or in the absence of treatment by the disclosed methods.
- treatment by methods of the present disclosure stabilizes the cognitive abilities of an individual.
- the progression of cognitive decline in an individual suffering from aging-associated cognitive decline is halted following treatment by the disclosed methods.
- cognitive decline in an individual e.g. , an individual 40 years old or older, that is projected to suffer from aging-associated cognitive decline, is prevented following treatment by the disclosed methods. In other words, no (further) cognitive impairment is observed.
- treatment by methods of the present disclosure reduces, or reverses, cognitive impairment, e.g. , as observed by improving cognitive abilities in an individual suffering from aging-associated cognitive decline.
- the cognitive abilities of the individual suffering from aging-associated cognitive decline following treatment by the disclosed methods are better than they were prior to treatment by the disclosed methods, i.e. , they improve upon treatment.
- treatment by methods of the present disclosure abrogates cognitive impairment.
- the cognitive abilities of the individual suffering from aging-associated cognitive decline are restored, e.g. , to their level when the individual was about 40 years old or less, following treatment by the disclosed methods, e.g. , as evidenced by improved cognitive abilities in an individual suffering from aging-associated cognitive decline.
- treatment of an adult mammal in accordance with the methods results in a change in a central organ, e.g. , a central nervous system organ, such as the brain, spinal cord, etc. , where the change may manifest in a number of different ways, e.g. , as described in greater detail below, including but not limited to molecular, structural and/or functional, e.g. , in the form of enhanced neurogenesis.
- a central organ e.g. , a central nervous system organ, such as the brain, spinal cord, etc.
- the change may manifest in a number of different ways, e.g. , as described in greater detail below, including but not limited to molecular, structural and/or functional, e.g. , in the form of enhanced neurogenesis.
- methods described herein are methods of treating an aging- associated impairment, e.g. , as described above, in an adult mammal.
- adult mammal is meant a mammal that has reached maturity, i.e. , that is fully developed. As such, adult mammals are not juvenile.
- Mammalian species that may be treated with the present methods include canines and felines; equines; bovines; ovines; etc. , and primates, including humans.
- the subject methods, compositions, and reagents may also be applied to animal models, including small mammals, e.g. , murine, lagomorpha, etc. , for example, in experimental investigations.
- small mammals e.g. , murine, lagomorpha, etc.
- the age of the adult mammal may vary, depending on the type of mammal that is being treated. Where the adult mammal is a human, the age of the human is generally 18 years or older. In some instances, the adult mammal is an individual suffering from or at risk of suffering from an aging-associated impairment, such as an aging-associated cognitive impairment, where the adult mammal may be one that has been determined, e.g. , in the form of receiving a diagnosis, to be suffering from or at risk of suffering from an aging- associated impairment, such as an aging-associated cognitive impairment.
- the phrase "an individual suffering from or at risk of suffering from an aging-associated cognitive impairment" refers to an individual that is about 50 years old or older, e.g.
- the individual may suffer from an aging associated condition, e.g. , cognitive impairment, associated with the natural aging process, e.g. , M .C. I .
- the individual may be 50 years old or older, e.g. , 60 years old or older, 70 years old or older, 80 years old or older, 90 years old or older, and sometimes no older than 100 years old, i.e.
- the individual may be of any age where the individual is suffering from a cognitive impairment due to an aging-associated disease, e.g. , Alzheimer's disease, Parkinson's disease, frontotemporal dementia, Huntington's disease, amyotrophic lateral sclerosis, multiple sclerosis, glaucoma, myotonic dystrophy, dementia, and the like.
- an aging-associated disease e.g. , Alzheimer's disease, Parkinson's disease, frontotemporal dementia, Huntington's disease, amyotrophic lateral sclerosis, multiple sclerosis, glaucoma, myotonic dystrophy, dementia, and the like.
- the individual is an individual of any age that has been diagnosed with an aging-associated disease that is typically accompanied by cognitive impairment, e.g. , Alzheimer's disease, Parkinson's disease, frontotemporal dementia, progressive supranuclear palsy, Huntington's disease, amyotrophic lateral sclerosis, spinal muscular atrophy, multiple sclerosis, multi-system atrophy, glaucoma, ataxias, myotonic dystrophy, dementia, and the like, where the individual has not yet begun to show symptoms of cognitive impairment.
- cognitive impairment e.g. , Alzheimer's disease, Parkinson's disease, frontotemporal dementia, progressive supranuclear palsy, Huntington's disease, amyotrophic lateral sclerosis, spinal muscular atrophy, multiple sclerosis, multi-system atrophy, glaucoma, ataxias, myotonic dystrophy, dementia, and the like, where the individual has not yet begun to show symptoms of cognitive impairment.
- aspects of the methods include reducing the ⁇ 2- microglobulin (B2M) level in the mammal in a manner sufficient to treat the aging impairment in the mammal, e.g. , as described above.
- B2M ⁇ 2- microglobulin
- reducing the B2M level is meant lowering the amount of B2M in the mammal, such as the amount of extracellular B2M in the mammal.
- the magnitude of the reduction may vary, in some instances the magnitude is 2-fold or greater, such as 5-fold or greater, including 10-fold or greater, e.g.
- the magnitude is such that the amount of detectable free B2M in the circulatory system of the individual is 50% or less, such as 25 % or less, including 10% or less, e.g. , 1 % or less, relative to the amount that was detectable prior to intervention according to the invention, and in some instances the amount is undetectable following intervention.
- the B2M level may be reduced using any convenient protocol.
- the B2M level is reduced by removing systemic B2M from the adult mammal, e.g. , by removing B2M from the circulatory system of the adult mammal.
- any convenient protocol for removing circulatory B2M may be employed.
- blood may be obtained from the adult mammal and extra-corporeally processed to remove B2M from the blood to produce B2M depleted blood, which resultant B2M depleted blood may then be returned to the adult mammal.
- Such protocols may employ a variety of different techniques in order to remove B2M from the obtained blood.
- the obtained blood may be contacted with a filtering component, e.g.
- the obtained blood may be contacted with a B2M absorptive component, e.g. , porous bead or particulate composition, which absorbs B2M from the blood.
- the obtained blood may be contacted with a B2M binding member stably associated with a solid support, such that B2M binds to the binding member and is thereby immobilized on the solid support, thereby providing for separation of B2M from other blood constituents.
- the protocol employed may or may not be configured to selectively remove B2M from the obtained blood, as desired.
- a number of different technologies are known for removing B2M from blood, and may be employed in embodiments of the invention, where such technologies include those described in U.S. Patent Nos. 4,872,983; 5,240,614;
- the B2M level is reduced by administering to the mammal an effective amount of a B2M level reducing agent.
- an effective amount of the active agent e.g. , B2M modulatory agent, is provided to the adult mammal.
- the agent modulates expression of the RNA and/or protein from the gene, such that it changes the expression of the RNA or protein from the target gene in some manner. In these instances, the agent may change expression of the RNA or protein in a number of different ways. In certain embodiments, the agent is one that reduces, including inhibits, expression of a B2M protein.
- Inhibition of B2M protein expression may be accomplished using any convenient means, including use of an agent that inhibits B2M protein expression, such as, but not limited to: RNAi agents, antisense agents, agents that interfere with a transcription factor binding to a promoter sequence of the B2M gene, or inactivation of the B2M gene, e.g. , through recombinant techniques, etc.
- an agent that inhibits B2M protein expression such as, but not limited to: RNAi agents, antisense agents, agents that interfere with a transcription factor binding to a promoter sequence of the B2M gene, or inactivation of the B2M gene, e.g. , through recombinant techniques, etc.
- the transcription level of a B2M protein can be regulated by gene silencing using RNAi agents, e.g. , double-strand RNA (see e.g. , Sharp, Genes and
- RNAi such as double-stranded RNA interference (dsRNAi) or small interfering RNA (siRNA)
- dsRNAi double-stranded RNA interference
- siRNA small interfering RNA
- RNAi agents may be dsRNA or a transcriptional template of the interfering ribonucleic acid which can be used to produce dsRNA in a cell.
- the transcriptional template may be a DNA that encodes the interfering ribonucleic acid.
- RNAi can be prepared according to any of a number of methods that are known in the art, including in vitro and in vivo methods, as well as by synthetic chemistry approaches. Examples of such methods include, but are not limited to, the methods described by Sadher et al. , Biochem. Int. (1987) 14: 1015; Bhattacharyya, Nature (1990) 343:484; and U.S. Pat. No. 5,795,715, the disclosures of which are incorporated herein by reference.
- Single-stranded RNA can also be produced using a combination of enzymatic and organic synthesis or by total organic synthesis.
- the use of synthetic chemical methods enable one to introduce desired modified nucleotides or nucleotide analogs into the dsRNA.
- dsRNA can also be prepared in vivo according to a number of established methods (see, e.g. , Sambrook, et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed. ; Transcription and Translation (B. D. Hames, and S. J. Higgins, Eds. , 1984); DNA Cloning, volumes I and I I (D. N. Glover, Ed. , 1985) ; and Oligonucleotide Synthesis (M .
- RNA can be directly introduced intracellularly.
- Various physical methods are generally utilized in such instances, such as administration by microinjection (see, e.g. , Zernicka-Goetz, et al.
- RNA delivery includes permeabilizing the cell membrane and electroporation in the presence of the dsRNA, liposome-mediated transfection, or transfection using chemicals such as calcium phosphate.
- a number of established gene therapy techniques can also be utilized to introduce the dsRNA into a cell. By introducing a viral construct within a viral particle, for instance, one can achieve efficient introduction of an expression construct into the cell and transcription of the RNA encoded by the construct.
- RNAi agents that may be employed to reduce B2M expression include, but are not limited to: dsRNA and short interfering RNA (siRNA) corresponding to B2M with the following sense and antisense sequences (sense) 5'- GAUUCAGGUUUACUCACGUdTdT-3' (SEQ I D NO:01 ) and (antisense) 5'-
- ACGUGAGUAAACCUGAAUCdTdT-3' (SEQ ID NO:02)(as described in Matin, et al. , "Specific knockdown of Oct4 and beta2-microglobulin expression by RNA interference in human embryonic stem cells and embryonic carcinoma cells," Stem Cells (2004) 22: 659- 68) and WO/2004/085654; shRNA (GCCACTCCCACCCTTTCTCAT)(SEQ ID NO:03) (as disclosed in Goyos, et al.
- antisense molecules can be used to down-regulate expression of a B2M gene in the cell.
- the anti-sense reagent may be antisense oligodeoxynucleotides (ODN) , particularly synthetic ODN having chemical modifications from native nucleic acids, or nucleic acid constructs that express such anti-sense molecules as RNA.
- ODN antisense oligodeoxynucleotides
- the antisense sequence is complementary to the mRNA of the targeted protein, and inhibits expression of the targeted protein.
- Antisense molecules inhibit gene expression through various mechanisms, e.g. , by reducing the amount of mRNA available for translation, through activation of RNAse H, or steric hindrance.
- One or a combination of antisense molecules may be administered, where a combination may include multiple different sequences.
- Antisense molecules may be produced by expression of all or a part of the target gene sequence in an appropriate vector, where the transcriptional initiation is oriented such that an antisense strand is produced as an RNA molecule.
- the antisense molecule is a synthetic oligonucleotide.
- Antisense oligonucleotides will generally be at least about 7, usually at least about 12, more usually at least about 20 nucleotides in length, and not more than about 500, usually not more than about 50, more usually not more than about 35 nucleotides in length, where the length is governed by efficiency of inhibition, specificity, including absence of cross- reactivity, and the like. Short oligonucleotides, of from 7 to 8 bases in length, can be strong and selective inhibitors of gene expression (see Wagner et al. , Nature Biotechnol. (1996) 14:840-844).
- a specific region or regions of the endogenous sense strand mRNA sequence are chosen to be complemented by the antisense sequence.
- Selection of a specific sequence for the oligonucleotide may use an empirical method, where several candidate sequences are assayed for inhibition of expression of the target gene in an in vitro or animal model.
- a combination of sequences may also be used, where several regions of the mRNA sequence are selected for antisense complementation.
- Antisense oligonucleotides may be chemically synthesized by methods known in the art (see Wagner et al. (1993), supra.) Oligonucleotides may be chemically modified from the native phosphodiester structure, in order to increase their intracellular stability and binding affinity. A number of such modifications have been described in the literature, which alter the chemistry of the backbone, sugars or heterocyclic bases. Among useful changes in the backbone chemistry are phosphorothioates; phosphorodithioates, where both of the non-bridging oxygens are substituted with sulfur; phosphoroamidites; alkyl phosphotriesters and boranophosphates.
- Achiral phosphate derivatives include 3'-0-5'-S-phosphorothioate, 3'-S-5'-0-phosphorothioate, 3'-CH.sub.2-5'-0-phosphonate and 3'-NH-5'-0- phosphoroamidate.
- Peptide nucleic acids replace the entire ribose phosphodiester backbone with a peptide linkage.
- Sugar modifications are also used to enhance stability and affinity.
- the a-anomer of deoxyribose may be used, where the base is inverted with respect to the natural ⁇ -anomer.
- the 2'-OH of the ribose sugar may be altered to form 2'-0-methyl or 2'-0-allyl sugars, which provides resistance to degradation without comprising affinity.
- Modification of the heterocyclic bases must maintain proper base pairing.
- Some useful substitutions include deoxyuridine for deoxythymidine; 5-methyl-2'-deoxycytidine and 5- bromo-2'-deoxycytidine for deoxycytidine.
- 5-propynyl-2'-deoxyuridine and 5-propynyl-2'- deoxycytidine have been shown to increase affinity and biological activity when substituted for deoxythymidine and deoxycytidine, respectively.
- Specific examples of antisense agents that may be employed to reduce B2M expression include, but are not limited to:
- catalytic nucleic acid compounds e.g. ribozymes, anti-sense conjugates, etc. may be used to inhibit gene expression.
- Ribozymes may be synthesized in vitro and administered to the patient, or may be encoded on an expression vector, from which the ribozyme is synthesized in the targeted cell (for example, see International patent application WO 9523225, and Beigelman et al. Nucl. Acids Res. (1995) 23:4434-42). Examples of oligonucleotides with catalytic activity are described in WO 9506764.
- Conjugates of anti-sense ODN with a metal complex, e.g. terpyridylCu(l l), capable of mediating mRNA hydrolysis are described in Bashkin et al. Appl. Biochem. Biotechnol. (1995) 54:43-56.
- the B2M gene is inactivated so that it no longer expresses a functional protein.
- inactivated is meant that the gene, e.g. , coding sequence and/or regulatory elements thereof, is genetically modified so that it no longer expresses a functional B2M protein, e.g. , at least with respect to B2M aging impairment activity.
- the alteration or mutation may take a number of different forms, e.g. , through deletion of one or more nucleotide residues, through exchange of one or more nucleotide residues, and the like.
- One means of making such alterations in the coding sequence is by homologous recombination.
- Also of interest in certain embodiments are dominant negative mutants of B2M proteins, where expression of such mutants in the cell result in a modulation, e.g. , decrease, in B2M mediated aging impairment.
- Dominant negative mutants of B2M are mutant proteins that exhibit dominant negative B2M activity.
- the term "dominant-negative B2M activity" or “dominant negative activity” refers to the inhibition, negation, or diminution of certain particular activities of B2M , and specifically to B2M mediated aging impairment.
- Dominant negative mutations are readily generated for corresponding proteins. These may act by several different mechanisms, including mutations in a substrate-binding domain; mutations in a catalytic domain; mutations in a protein binding domain (e.g.
- a mutant polypeptide may interact with wild-type polypeptides (made from the other allele) and form a non-functional multimer. In certain embodiments, the mutant polypeptide will be overproduced. Point mutations are made that have such an effect.
- fusion of different polypeptides of various lengths to the terminus of a protein, or deletion of specific domains can yield dominant negative mutants.
- General strategies are available for making dominant negative mutants (see for example, Herskowitz, Nature (1987) 329:219, and the references cited above) . Such techniques are used to create loss of function mutations, which are useful for determining protein function.
- RNA capable of encoding gene product sequences may be chemically synthesized using, for example, synthesizers. See, for example, the techniques described in "Oligonucleotide Synthesis", 1984, Gait, M . J. ed. , IRL Press, Oxford.
- the agent is an agent that modulates, e.g. , inhibits, B2M activity by binding to B2M and/or inhibiting binding of B2M to a second protein, e.g. , a protein member of MHC1 .
- small molecules that bind to the B2M and inhibit its activity are of interest.
- Naturally occurring or synthetic small molecule compounds of interest include numerous chemical classes, such as organic molecules, e.g. , small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons.
- Candidate agents comprise functional groups for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups.
- the candidate agents may include cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
- Candidate agents are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof. Such molecules may be identified, among other ways, by employing the screening protocols described below. Specific examples of small molecule agents agents that may be employed to reduce B2M expression include, but are not limited to: Riamycin SV:
- the administered active agent is a B2M specific binding member.
- useful B2M specific binding members exhibit an affinity (Kd) for a target B2M , such as human B2M, that is sufficient to provide for the desired reduction in aging associated impairment B2M activity.
- affinity refers to the equilibrium constant for the reversible binding of two agents; “affinity” can be expressed as a dissociation constant (Kd).
- Affinity can be at least 1 -fold greater, at least 2-fold greater, at least 3-fold greater, at least 4-fold greater, at least 5-fold greater, at least 6-fold greater, at least 7-fold greater, at least 8-fold greater, at least 9-fold greater, at least 10-fold greater, at least 20-fold greater, at least 30-fold greater, at least 40-fold greater, at least 50-fold greater, at least 60-fold greater, at least 70-fold greater, at least 80-fold greater, at least 90- fold greater, at least 100-fold greater, or at least 1000-fold greater, or more, than the affinity of an antibody for unrelated amino acid sequences.
- Affinity of a specific binding member to a target protein can be, for example, from about 100 nanomolar (nM) to about 0.1 nM , from about 100 nM to about 1 picomolar (pM), or from about 100 nM to about 1 femtomolar (fM) or more.
- binding refers to a direct association between two molecules, due to, for example, covalent, electrostatic, hydrophobic, and ionic and/or hydrogen-bond interactions, including interactions such as salt bridges and water bridges.
- the antibodies bind human B2M with nanomolar affinity or picomolar affinity.
- the antibodies bind human B2M with a Kd of less than about 100 nM , 50 nM , 20 nM , 20 nM , or 1 nM .
- B2M specific binding members include B2M antibodies and binding fragments thereof.
- Non-limiting examples of such antibodies include antibodies directed against any epitope of B2M .
- bispecific antibodies i.e. , antibodies in which each of the two binding domains recognizes a different binding epitope.
- the amino acid sequence of human B2M is disclosed in Cunningham, et al. , "The complete amino acid sequence of beta-2-microglobulin," Biochemistry (1973) 12: 481 1 -4821 .
- Antibody specific binding members that may be employed include full antibodies or immunoglobulins of any isotype, as well as fragments of antibodies which retain specific binding to antigen, including, but not limited to, Fab, Fv, scFv, and Fd fragments, chimeric antibodies, humanized antibodies, single-chain antibodies, and fusion proteins comprising an antigen-binding portion of an antibody and a non-antibody protein.
- the antibodies may be detectably labeled, e.g. , with a radioisotope, an enzyme which generates a detectable product, a fluorescent protein, and the like.
- the antibodies may be further conjugated to other moieties, such as members of specific binding pairs, e.g.
- an antibody may be monovalent or bivalent.
- Antibody fragments comprise a portion of an intact antibody, for example, the antigen binding or variable region of the intact antibody.
- antibody fragments include Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies (Zapata et al. , Protein Eng. 8(10): 1057- 1062 (1995)); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.
- Papain digestion of antibodies produces two identical antigen-binding fragments, called “Fab” fragments, each with a single antigen- binding site, and a residual "Fc” fragment, a designation reflecting the ability to crystallize readily.
- Pepsin treatment yields an F(ab')2 fragment that has two antigen combining sites and is still capable of cross-linking antigen.
- Fv is the minimum antibody fragment which contains a complete antigen- recognition and -binding site. This region consists of a dimer of one heavy- and one light- chain variable domain in tight, non-covalent association. It is in this configuration that the three CDRS of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer.
- the six CDRs confer antigen-binding specificity to the antibody.
- a single variable domain or half of an Fv comprising only three CDRs specific for an antigen has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site.
- the "Fab” fragment also contains the constant domain of the light chain and the first constant domain (CH 1 ) of the heavy chain.
- Fab fragments differ from Fab' fragments by the addition of a few residues at the carboxyl terminus of the heavy chain CH 1 domain including one or more cysteines from the antibody hinge region.
- Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group.
- F(ab')2 antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.
- immunoglobulins The "light chains" of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa and lambda, based on the amino acid sequences of their constant domains. Depending on the amino acid sequence of the constant domain of their heavy chains, immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG , and IgM , and several of these may be further divided into subclasses (isotypes), e.g. , lgG 1 , lgG2, lgG3, lgG4, IgA, and lgA2.
- immunoglobulins There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG , and IgM , and several of these may be further divided into subclasses (isotypes), e.g. , l
- Single-chain Fv or “sFv” antibody fragments comprise the VH and VL domains of antibody, wherein these domains are present in a single polypeptide chain.
- the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains, which enables the sFv to form the desired structure for antigen binding.
- Antibodies that may be used in connection with the present disclosure thus can encompass monoclonal antibodies, polyclonal antibodies, bispecific antibodies, Fab antibody fragments, F(ab)2 antibody fragments, Fv antibody fragments (e.g. , VH or VL), single chain Fv antibody fragments and dsFv antibody fragments.
- the antibody molecules may be fully human antibodies, humanized antibodies, or chimeric antibodies. In some embodiments, the antibody molecules are monoclonal, fully human antibodies.
- the antibodies that may be used in connection with the present disclosure can include any antibody variable region, mature or unprocessed, linked to any immunoglobulin constant region. If a light chain variable region is linked to a constant region, it can be a kappa chain constant region. If a heavy chain variable region is linked to a constant region, it can be a human gamma 1 , gamma 2, gamma 3 or gamma 4 constant region, more preferably, gamma 1 , gamma 2 or gamma 4 and even more preferably gamma 1 or gamma 4.
- Fully human monoclonal antibodies directed against B2M are generated using transgenic mice carrying parts of the human immune system rather than the mouse system.
- amino acid sequences of antibodies or immunoglobulin molecules are encompassed by the present invention, providing that the variations in the amino acid sequence maintain at least 75%, e.g. , at least 80% , 90%, 95%, or 99% of the sequence. In particular, conservative amino acid replacements are contemplated.
- Conservative replacements are those that take place within a family of amino acids that are related in their side chains. Whether an amino acid change results in a functional peptide can readily be determined by assaying the specific activity of the polypeptide derivative. Fragments (or analogs) of antibodies or immunoglobulin molecules, can be readily prepared by those of ordinary skill in the art. Preferred amino- and carboxy-termini of fragments or analogs occur near boundaries of functional domains. Structural and functional domains can be identified by comparison of the nucleotide and/or amino acid sequence data to public or proprietary sequence databases. Preferably, computerized comparison methods are used to identify sequence motifs or predicted protein conformation domains that occur in other proteins of known structure and/or function. Methods to identify protein sequences that fold into a known three-dimensional structure are known. Sequence motifs and structural conformations may be used to define structural and functional domains in accordance with the invention.
- antibody agents that may be employed to reduce B2M expression include, but are not limited to: Anti-B2m B1 -1 G6 (immunoglobulin G2a [lgG2]), B2-62-2 (lgG2a), and C21 -48A (lgG2b) from Immunotech S.A.
- the active agent(s) may be administered to the adult mammal using any convenient administration protocol capable of resulting in the desired activity.
- the agent can be incorporated into a variety of formulations, e.g. , pharmaceutically acceptable vehicles, for therapeutic administration. More particularly, the agents of the present invention can be formulated into pharmaceutical compositions by combination with appropriate,
- pharmaceutically acceptable carriers or diluents may be formulated into preparations in solid, semi-solid, liquid or gaseous forms, such as tablets, capsules, powders, granules, ointments (e.g. , skin creams), solutions, suppositories, injections, inhalants and aerosols.
- administration of the agents can be achieved in various ways, including oral, buccal, rectal, parenteral, intraperitoneal, intradermal, transdermal, intracheal, etc. , administration.
- the agents may be administered in the form of their pharmaceutically acceptable salts, or they may also be used alone or in appropriate association, as well as in combination, with other pharmaceutically active compounds.
- the following methods and excipients are merely exemplary and are in no way limiting.
- the agents can be used alone or in combination with appropriate additives to make tablets, powders, granules or capsules, for example, with conventional additives, such as lactose, mannitol, corn starch or potato starch; with binders, such as crystalline cellulose, cellulose derivatives, acacia, corn starch or gelatins; with disintegrators, such as corn starch, potato starch or sodium carboxymethylcellulose; with lubricants, such as talc or magnesium stearate; and if desired, with diluents, buffering agents, moistening agents, preservatives and flavoring agents.
- conventional additives such as lactose, mannitol, corn starch or potato starch
- binders such as crystalline cellulose, cellulose derivatives, acacia, corn starch or gelatins
- disintegrators such as corn starch, potato starch or sodium carboxymethylcellulose
- lubricants such as talc or magnesium stearate
- the agents can be formulated into preparations for injection by dissolving, suspending or emulsifying them in an aqueous or nonaqueous solvent, such as vegetable or other similar oils, synthetic aliphatic acid glycerides, esters of higher aliphatic acids or propylene glycol; and if desired, with conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifying agents, stabilizers and preservatives.
- an aqueous or nonaqueous solvent such as vegetable or other similar oils, synthetic aliphatic acid glycerides, esters of higher aliphatic acids or propylene glycol
- solubilizers isotonic agents
- suspending agents emulsifying agents, stabilizers and preservatives.
- the agents can be utilized in aerosol formulation to be administered via inhalation.
- the compounds of the present invention can be formulated into pressurized acceptable propellants such as dichlorodifluoromethane, propane, nitrogen and the like.
- the agents can be made into suppositories by mixing with a variety of bases such as emulsifying bases or water-soluble bases.
- bases such as emulsifying bases or water-soluble bases.
- the compounds of the present invention can be administered rectally via a suppository.
- the suppository can include vehicles such as cocoa butter, carbowaxes and polyethylene glycols, which melt at body temperature, yet are solidified at room temperature.
- Unit dosage forms for oral or rectal administration such as syrups, elixirs, and suspensions may be provided wherein each dosage unit, for example, teaspoonful, tablespoonful, tablet or suppository, contains a predetermined amount of the composition containing one or more inhibitors.
- unit dosage forms for injection or intravenous administration may comprise the inhibitor(s) in a composition as a solution in sterile water, normal saline or another pharmaceutically acceptable carrier.
- unit dosage form refers to physically discrete units suitable as unitary dosages for human and animal subjects, each unit containing a predetermined quantity of compounds of the present invention calculated in an amount sufficient to produce the desired effect in association with a pharmaceutically acceptable diluent, carrier or vehicle.
- the specifications for the novel unit dosage forms of the present invention depend on the particular compound employed and the effect to be achieved, and the pharmacodynamics associated with each compound in the host.
- the pharmaceutically acceptable excipients such as vehicles, adjuvants, carriers or diluents, are readily available to the public.
- pharmaceutically acceptable auxiliary substances such as pH adjusting and buffering agents, tonicity adjusting agents, stabilizers, wetting agents and the like, are readily available to the public.
- the agent is a polypeptide, polynucleotide, analog or mimetic thereof
- it may be introduced into tissues or host cells by any number of routes, including viral infection, microinjection, or fusion of vesicles. Jet injection may also be used for intramuscular administration, as described by Furth et al. , Anal Biochem. (1992) 205:365-368.
- the DNA may be coated onto gold microparticles, and delivered intradermal ⁇ by a particle bombardment device, or "gene gun" as described in the literature (see, for example, Tang et al. , Nature (1992) 356: 152-154), where gold microprojectiles are coated with the DNA, then bombarded into skin cells.
- a number of different delivery vehicles find use, including viral and non-viral vector systems, as are known in the art.
- dose levels can vary as a function of the specific compound, the nature of the delivery vehicle, and the like. Preferred dosages for a given compound are readily determinable by those of skill in the art by a variety of means.
- an effective amount of an active agent is administered to the adult mammal
- the amount or dosage is effective when administered for a suitable period of time, such as one week or longer, including two weeks or longer, such as 3 weeks or longer, 4 weeks or longer, 8 weeks or longer, etc. , so as to evidence a reduction in the impairment, e.g. , cognition decline and/or cognitive improvement in the adult mammal.
- an effective dose is the dose that, when administered for a suitable period of time, such as at least about one week, and maybe about two weeks, or more, up to a period of about 3 weeks, 4 weeks, 8 weeks, or longer, will slow e.g. , by about 20% or more, e.g.
- an effective amount or dose of active agent will not only slow or halt the progression of the disease condition but will also induce the reversal of the condition, i.e. , will cause an improvement in cognitive ability.
- an effective amount is the amount that when administered for a suitable period of time, usually at least about one week, and maybe about two weeks, or more, up to a period of about 3 weeks, 4 weeks, 8 weeks, or longer will improve the cognitive abilities of an individual suffering from an aging- associated cognitive impairment by, for example 1 .5-fold, 2-fold, 3-fold, 4-fold, 5-fold, in some instances 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold or more relative to cognition prior to administration of the blood product.
- cognitivitative tests and IQ test for measuring cognitive ability, e.g. , attention and concentration, the ability to learn complex tasks and concepts, memory, information processing, visuospatial function, the ability to produce and understanding language, the ability to solve problems and make decisions, and the ability to perform executive functions, are well known in the art, any of which may be used to measure the cognitive ability of the individual before and/or during and after treatment with the subject blood product, e.g. , to confirm that an effective amount has been administered.
- GPCG General Practitioner Assessment of Cognition
- MMSE Mini Mental State Examination
- ADAS-Cog Alzheimer's Disease Assessment Scale
- ADAS-Cog Alzheimer's Disease Assessment Scale
- the method comprises the step of measuring cognitive ability, and detecting a decreased rate of cognitive decline, a stabilization of cognitive ability, and/or an increase in cognitive ability after administration of the blood product as compared to the cognitive ability of the individual before the blood product was
- Such measurements may be made a week or more after administration of the blood product, e.g., 1 week, 2 weeks, 3 weeks, or more, for instance, 4 weeks, 6 weeks, or 8 weeks or more, e.g. , 3 months, 4 months, 5 months, or 6 months or more.
- an "effective amount” or “effective dose” of active agent is meant an amount of active agent that will inhibit, antagonize, decrease, reduce, or suppress by about 20% or more, e.g. , by 30% or more, by 40% or more, or by 50% or more, in some instances by 60% or more, by 70% or more, by 80% or more, or by 90% or more, in some cases by about 100% , i.e. , to negligible amounts, and in some instances reverse, the reduction in synaptic plasticity and loss of synapses that occurs during the natural aging process or during the progression of an aging-associated disorder.
- cells present in adult mammals treated in accordance with methods of the invention will become more responsive to cues, e.g. , activity cues, which promote the formation and maintenance of synapses.
- Performance of methods of the invention may manifest as improvements in observed synaptic plasticity, both in vitro and in vivo as an induction of long term potentiation.
- the induction of LTP in neural circuits may be observed in awake individuals, e.g. , by performing non-invasive stimulation techniques on awake individuals to induce LTP-like long-lasting changes in localized neural activity (Cooke SF, Bliss TV (2006) Plasticity in the human central nervous system. Brain. 129(Pt 7) : 1659- 73) ; mapping plasticity and increased neural circuit activity in individuals, e.g.
- positron emission tomography by using positron emission tomography, functional magnetic resonance imaging, and/or transcranial magnetic stimulation (Cramer and Bastings, "Mapping clinically relevant plasticity after stroke,” Neuropharmacology (2000)39:842-51 ); and by detecting neural plasticity following learning, i.e. , improvements in memory, e.g. , by assaying retrieval-related brain activity (Buchmann et al. , "Prion protein M 129V polymorphism affects retrieval-related brain activity,” Neuropsychologia. (2008) 46:2389-402) or, e.g. , by imaging brain tissue by functional magnetic resonance imaging (fMRI) following repetition priming with familiar and unfamiliar objects (Soldan et al.
- fMRI functional magnetic resonance imaging
- the method includes the step of measuring synaptic plasticity, and detecting a decreased rate of loss of synaptic plasticity, a stabilization of synaptic plasticity, and/or an increase in synaptic plasticity after administration of the blood product as compared to the synaptic plasticity of the individual before the blood product was administered.
- Such measurements may be made a week or more after administration of the blood product, e.g. , 1 week, 2 weeks, 3 weeks, or more, for instance, 4 weeks, 6 weeks, or 8 weeks or more, e.g. , 3 months, 4 months, 5 months, or 6 months or more.
- the methods result in a change in expression levels of one or more genes in one or more tissues of the host, e.g. , as compared to a suitable control (such as described in the Experimental section, below).
- the change in expression level of a given gene may be 0.5 fold or greater, such as 1 .0 fold or greater, including 1 .5 fold or greater.
- the tissue may vary, and in some instances is nervous system tissue, e.g. , central nervous system tissue, including brain tissue, e.g. , hippocampal tissue.
- the modulation of hippocampal gene expression is manifested as enhanced hippocampal plasticity, e.g. , as compared to a suitable control.
- treatment results in an enhancement in the levels of one or more proteins in one or more tissues of the host, e.g. , as compared to a suitable control (such as described in the Experimental section, below) .
- the change in protein level of a given protein may be 0.5 fold or greater, such as 1 .0 fold or greater, including 1 .5 fold or greater, where in some instances the level may approach that of a healthy wild-type level, e.g. , within 50% or less, such as 25% or less, including 10% or less, e.g. , 5% or less of the healthy wild-type level.
- the tissue may vary, and in some instances is nervous system tissue, e.g. , central nervous system tissue, including brain tissue, e.g. , hippocampal tissue.
- the methods result in one or more structural changes in one or more tissues.
- the tissue may vary, and in some instances is nervous system tissue, e.g. , central nervous system tissue, including brain tissue, e.g. , hippocampal tissue.
- Structure changes of interest include an increase in dendritic spine density of mature neurons in the dentate gyrus (DG) of the hippocampus, e.g. , as compared to a suitable control.
- DG dentate gyrus
- the modulation of hippocampal structure is manifested as enhanced synapse formation, e.g. , as compared to a suitable control.
- the methods may result in an enhancement of long term potentiation, e.g. , as compared to a suitable control.
- practice of the methods results in an increase in neurogenesis in the adult mammal.
- the increase may be identified in a number of different ways, e.g., as described below in the Experimental section.
- the increase in neurogenesis manifests as an increase the amount of Dcx-positive immature neurons, e.g., where the increase may be 2-fold or greater.
- the increase in neurogenesis manifests as an increase in the number of BrdU/NeuN positive cells, where the increase may be 2-fold or greater.
- Enhancement in learning and memory may be evaluated in a number of different ways, e.g., the contextual fear conditioning and/or radial arm water maze (RAWM) paradigms described in the experimental section, below.
- RAWM radial arm water maze
- treatment results in some instances in increased freezing in contextual, but not cued, memory testing.
- RAWM radial arm water maze
- treatment results in some instances in enhanced learning and memory for platform location during the testing phase of the task.
- treatment is manifested as enhanced cognitive improvement in hippocampal-dependent learning and memory, e.g., as compared to a suitable control.
- B2M level reduction may be performed in conjunction with an active agent having activity suitable to treat aging- associated cognitive impairment.
- an active agent having activity suitable to treat aging- associated cognitive impairment.
- active agents e.g., cholinesterase inhibitors (e.g., Donepezil, Rivastigmine, Galantamine, Tacrine), Memantine, and Vitamin E.
- citalopram Celexa
- fluoxetine Prozac
- paroxeine Paxil
- sertraline Zoloft
- trazodone Desyrel
- lorazepam Ativan
- oxazepam Serax
- aripiprazole Ability
- clozapine Clozaril
- haloperidol Haldol
- olanzapine Zyprexa
- quetiapine Seeroquel
- risperidone Rosinal
- ziprasidone ziprasidone
- the method further comprises the step of measuring cognition and/or synaptic plasticity after treatment, e.g., using the methods described herein or known in the art, and determining that the rate of cognitive decline or loss of synaptic plasticity have been reduced and/or that cognitive ability or synaptic plasticity have improved in the individual.
- the determination is made by comparing the results of the cognition or synaptic plasticity test to the results of the test performed on the same individual at an earlier time, e.g., 2 weeks earlier, 1 month earlier, 2 months earlier, 3 months earlier, 6 months earlier, 1 year earlier, 2 years earlier, 5 years earlier, or 10 years earlier, or more.
- the subject methods further include diagnosing an individual as having a cognitive impairment, e.g. , using the methods described herein or known in the art for measuring cognition and synaptic plasticity, prior to administering the subject plasma- comprising blood product.
- the diagnosing will comprise measuring cognition and/or synaptic plasticity and comparing the results of the cognition or synaptic plasticity test to one or more references, e.g. , a positive control and/or a negative control.
- the reference may be the results of the test performed by one or more age- matched individuals that experience aging-associated cognitive impairments (i.e. , positive controls) or that do not experience aging-associated cognitive impairments (i.e. , negative controls) .
- the reference may be the results of the test performed by the same individual at an earlier time, e.g. , 2 weeks earlier, 1 month earlier, 2 months earlier, 3 months earlier, 6 months earlier, 1 year earlier, 2 years earlier, 5 years earlier, or 10 years earlier, or more.
- the subject methods further comprise diagnosing an individual as having an aging-associated disorder, e.g. , Alzheimer's disease, Parkinson's disease, frontotemporal dementia, progressive supranuclear palsy, Huntington's disease, amyotrophic lateral sclerosis, spinal muscular atrophy, multiple sclerosis, multi-system atrophy, glaucoma, ataxias, myotonic dystrophy, dementia, and the like.
- an aging-associated disorder e.g. , Alzheimer's disease, Parkinson's disease, frontotemporal dementia, progressive supranuclear palsy, Huntington's disease, amyotrophic lateral sclerosis, spinal muscular atrophy, multiple sclerosis, multi-system atrophy, glaucoma, ataxias, myotonic dystrophy, dementia, and the like.
- Methods for diagnosing such aging-associated disorders are well-known in the art, any of which may be used by the ordinarily skilled artisan in diagnosing the individual.
- the subject methods
- the subject methods find use in treating, including preventing, aging-associated impairments and conditions associated therewith, such as impairments in the cognitive ability of individuals.
- Individuals suffering from or at risk of developing an aging-associated cognitive impairments include individuals that are about 50 years old or older, e.g. , 60 years old or older, 70 years old or older, 80 years old or older, 90 years old or older, and usually no older than 100 years old, i.e. , between the ages of about 50 and 100, e.g. , 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or about 100 years old, and are suffering from cognitive impairment associated with natural aging process, e.g. , mild cognitive impairment (M .C.
- Mild cognitive impairment is a modest disruption of cognition that manifests as problems with memory or other mental functions such as planning, following instructions, or making decisions that have worsened over time while overall mental function and daily activities are not impaired.
- M.C. I . Mild cognitive impairment
- neurons in the aging brain are vulnerable to sub-lethal age-related alterations in structure, synaptic integrity, and molecular processing at the synapse, all of which impair cognitive function.
- Individuals suffering from or at risk of developing an aging-associated cognitive impairment that will benefit from treatment with the subject plasma-comprising blood product, e.g. , by the methods disclosed herein, also include individuals of any age that are suffering from a cognitive impairment due to an aging-associated disorder; and individuals of any age that have been diagnosed with an aging-associated disorder that is typically accompanied by cognitive impairment, where the individual has not yet begun to present with symptoms of cognitive impairment.
- aging-associated disorders include the following:
- Alzheimer's disease is a progressive, inexorable loss of cognitive function associated with an excessive number of senile plaques in the cerebral cortex and subcortical gray matter, which also contains b-amyloid and neurofibrillary tangles consisting of tau protein.
- the common form affects persons > 60 yr old, and its incidence increases as age advances. It accounts for more than 65% of the dementias in the elderly.
- Alzheimer's disease The cause of Alzheimer's disease is not known. The disease runs in families in about 15 to 20% of cases. The remaining, so-called sporadic cases have some genetic determinants. The disease has an autosomal dominant genetic pattern in most early-onset and some late-onset cases but a variable late-life penetrance. Environmental factors are the focus of active investigation.
- Cerebral glucose use and perfusion is reduced in some areas of the brain (parietal lobe and temporal cortices in early-stage disease, prefrontal cortex in late-stage disease) .
- Neuritic or senile plaques composed of neurites, astrocytes, and glial cells around an amyloid core) and
- Parkinson's Disease is an idiopathic, slowly progressive, degenerative CNS disorder characterized by slow and decreased movement, muscular rigidity, resting tremor, and postural instability. Originally considered primarily a motor disorder, PD is now recognized to also affect cognition, behavior, sleep, autonomic function, and sensory function. The most common cognitive impairments include an impairment in attention and concentration, working memory, executive function, producing language, and visuospatial function.
- Secondary parkinsonism results from loss of or interference with the action of dopamine in the basal ganglia due to other idiopathic degenerative diseases, drugs, or exogenous toxins.
- the most common cause of secondary parkinsonism is ingestion of antipsychotic drugs or reserpine, which produce parkinsonism by blocking dopamine receptors.
- Less common causes include carbon monoxide or manganese poisoning, hydrocephalus, structural lesions (tumors, infarcts affecting the midbrain or basal ganglia), subdural hematoma, and degenerative disorders, including striatonigral degeneration.
- Frontotemporal dementia is a condition resulting from the progressive deterioration of the frontal lobe of the brain. Over time, the frontal lobe of the brain.
- bvFTD Behavioural variant FTD
- PNFA progressive nonfluent aphasia
- SD semantic dementia
- FTD can be diagnosed by observation of reveal frontal lobe and/or anterior temporal lobe atrophy in structural MRI scans.
- SD Semantic Dementia
- SA is characterized by a loss of semantic memory in both the verbal and non-verbal domains.
- SD patients often present with the complaint of word-finding difficulties.
- Clinical signs include fluent aphasia, anomia, impaired comprehension of word meaning, and associative visual agnosia (the inability to match semantically related pictures or objects) .
- Structural MRI imaging shows a characteristic pattern of atrophy in the temporal lobes (predominantly on the left) , with inferior greater than superior involvement and anterior temporal lobe atrophy greater than posterior.
- Pd Pick's disease
- a defining characteristic of the disease is build-up of tau proteins in neurons, accumulating into silver-staining, spherical aggregations known as "Pick bodies”.
- Symptoms include loss of speech (aphasia) and dementia.
- Patients with orbitofrontal dysfunction can become aggressive and socially inappropriate. They may steal or demonstrate obsessive or repetitive stereotyped behaviors.
- Patients with dorsomedial or dorsolateral frontal dysfunction may demonstrate a lack of concern, apathy, or decreased spontaneity. Patients can demonstrate an absence of self-monitoring, abnormal self- awareness, and an inability to appreciate meaning.
- Patients with gray matter loss in the bilateral posterolateral orbitofrontal cortex and right anterior insula may demonstrate changes in eating behaviors, such as a pathologic sweet tooth. Patients with more focal gray matter loss in the anterolateral orbitofrontal cortex may develop hyperphagia. While some of the symptoms can initially be alleviated, the disease progresses and patients often die within two to ten years.
- Huntington's disease is a hereditary progressive neurodegenerative disorder characterized by the development of emotional, behavioral, and psychiatric abnormalities; loss of intellectual or cognitive functioning; and movement abnormalities (motor disturbances) .
- the classic signs of HD include the development of chorea - involuntary, rapid, irregular, jerky movements that may affect the face, arms, legs, or trunk - as well as cognitive decline including the gradual loss of thought processing and acquired intellectual abilities.
- HD is transmitted within families as an autosomal dominant trait.
- the disorder occurs as the result of abnormally long sequences or "repeats" of coded instructions within a gene on chromosome 4 (4p16.3).
- the progressive loss of nervous system function associated with HD results from loss of neurons in certain areas of the brain, including the basal ganglia and cerebral cortex.
- Amyotrophic lateral sclerosis is a rapidly progressive, invariably fatal neurological disease that attacks motor neurons. Muscular weakness and atrophy and signs of anterior horn cell dysfunction are initially noted most often in the hands and less often in the feet. The site of onset is random, and progression is asymmetric. Cramps are common and may precede weakness. Rarely, a patient survives 30 years; 50% die within 3 years of onset, 20% live 5 years, and 10% live 10 years. Diagnostic features include onset during middle or late adult life and progressive, generalized motor involvement without sensory abnormalities. Nerve conduction velocities are normal until late in the disease. Recent studies have documented the presentation of cognitive impairments as well, particularly a reduction in immediate verbal memory, visual memory, language, and executive function.
- MS Multiple Sclerosis.
- Multiple Sclerosis is characterized by various symptoms and signs of CNS dysfunction, with remissions and recurring exacerbations. The most common presenting symptoms are paresthesias in one or more extremities, in the trunk, or on one side of the face; weakness or clumsiness of a leg or hand; or visual disturbances, e.g., partial blindness and pain in one eye (retrobulbar optic neuritis), dimness of vision, or scotomas.
- Common cognitive impairments include impairments in memory (acquiring, retaining, and retrieving new information), attention and concentration (particularly divided attention), information processing, executive functions, visuospatial functions, and verbal fluency.
- Glaucoma is a common neurodegenerative disease that affects retinal ganglion cells (RGCs). Evidence supports the existence of compartmentalized degeneration programs in synapses and dendrites, including in RGCs. Recent evidence also indicates a correlation between cognitive impairment in older adults and glaucoma (Yochim BP, et al. Prevalence of cognitive impairment, depression, and anxiety symptoms among older adults with glaucoma. J Glaucoma. 2012;21 (4):250-254).
- Myotonic dystrophy is an autosomal dominant multisystem disorder characterized by dystrophic muscle weakness and myotonia.
- the molecular defect is an expanded trinucleotide (CTG) repeat in the 3 ' untranslated region of the myotonin-protein kinase gene on chromosome 19q.
- CCG trinucleotide
- Symptoms can occur at any age, and the range of clinical severity is broad. Myotonia is prominent in the hand muscles, and ptosis is common even in mild cases. In severe cases, marked peripheral muscular weakness occurs, often with cataracts, premature balding, hatchet fades, cardiac arrhythmias, testicular atrophy, and endocrine abnormalities (e.g., diabetes mellitus).
- Dementia describes class of disorders having symptoms affecting thinking and social abilities severely enough to interfere with daily functioning.
- Other instances of dementia in addition to the dementia observed in later stages of the aging- associated disorders discussed above include vascular dementia, and dementia with Lewy bodies, described below.
- vascular dementia In vascular dementia, or "multi-infarct dementia", cognitive impairment is caused by problems in supply of blood to the brain, typically by a series of minor strokes, or sometimes, one large stroke preceded or followed by other smaller strokes.
- vascular lesions can be the result of diffuse cerebrovascular disease, such as small vessel disease, or focal lesions, or both.
- Patients suffering from vascular dementia present with cognitive impairment, acutely or subacutely, after an acute cerebrovascular event, after which progressive cognitive decline is observed.
- Cognitive impairments are similar to those observed in Alzheimer's disease, including impairments in language, memory, complex visual processing, or executive function, although the related changes in the brain are not due to AD pathology but to chronic reduced blood flow in the brain, eventually resulting in dementia.
- Single photon emission computed tomography (SPECT) and positron emission tomography (PET) neuroimaging may be used to confirm a diagnosis of multi-infarct dementia in conjunction with evaluations involving mental status examination.
- SPECT single photon emission
- Lewy body dementia also known under a variety of other names including Lewy body dementia, diffuse Lewy body disease, cortical Lewy body disease, and senile dementia of Lewy type
- Lewy body dementia a type of dementia characterized anatomically by the presence of Lewy bodies (clumps of alpha-synuclein and ubiquitin protein) in neurons, detectable in post mortem brain histology. Its primary feature is cognitive decline, particularly of executive functioning. Alertness and short term memory will rise and fall. Persistent or recurring visual hallucinations with vivid and detailed pictures are often an early diagnostic symptom.
- DLB it is often confused in its early stages with Alzheimer's disease and/or vascular dementia, although, where Alzheimer's disease usually begins quite gradually, DLB often has a rapid or acute onset. DLB symptoms also include motor symptoms similar to those of Parkinson's. DLB is distinguished from the dementia that sometimes occurs in Parkinson's disease by the time frame in which dementia symptoms appear relative to Parkinson symptoms. Parkinson's disease with dementia (PDD) would be the diagnosis when dementia onset is more than a year after the onset of Parkinson's. DLB is diagnosed when cognitive symptoms begin at the same time or within a year of Parkinson symptoms.
- PDD Parkinson's disease with dementia
- Progressive supranuclear palsy is a brain disorder that causes serious and progressive problems with control of gait and balance, along with complex eye movement and thinking problems.
- One of the classic signs of the disease is an inability to aim the eyes properly, which occurs because of lesions in the area of the brain that coordinates eye movements. Some individuals describe this effect as a blurring.
- Affected individuals often show alterations of mood and behavior, including depression and apathy as well as progressive mild dementia.
- the disorder's long name indicates that the disease begins slowly and continues to get worse (progressive), and causes weakness (palsy) by damaging certain parts of the brain above pea-sized structures called nuclei that control eye movements ( ⁇ .
- PSP was first described as a distinct disorder in 1964, when three scientists published a paper that distinguished the condition from Parkinson's disease. It is sometimes referred to as Steele-Richardson- Olszewski syndrome, reflecting the combined names of the scientists who defined the disorder. Although PSP gets progressively worse, no one dies from PSP itself.
- Ataxia People with ataxia have problems with coordination because parts of the nervous system that control movement and balance are affected. Ataxia may affect the fingers, hands, arms, legs, body, speech, and eye movements.
- the word ataxia is often used to describe a symptom of incoordination which can be associated with infections, injuries, other diseases, or degenerative changes in the central nervous system. Ataxia is also used to denote a group of specific degenerative diseases of the nervous system called the hereditary and sporadic ataxias which are the National Ataxia Foundation's primary emphases.
- MSA Multiple-system atrophy.
- MSA is a degenerative neurological disorder.
- MSA is associated with the degeneration of nerve cells in specific areas of the brain. This cell degeneration causes problems with movement, balance, and other autonomic functions of the body such as bladder control or blood-pressure regulation.
- the cause of MSA is unknown and no specific risk factors have been identified.
- the subject methods and compositions find use in slowing the progression of aging-associated cognitive impairment.
- cognitive abilities in the individual will decline more slowly following treatment by the disclosed methods than prior to or in the absence of treatment by the disclosed methods.
- the subject methods of treatment include measuring the progression of cognitive decline after treatment, and determining that the progression of cognitive decline is reduced.
- the determination is made by comparing to a reference, e.g., the rate of cognitive decline in the individual prior to treatment, e.g., as determined by measuring cognition prior at two or more time points prior to administration of the subject blood product.
- the subject methods and compositions also find use in stabilizing the cognitive abilities of an individual, e.g., an individual suffering from aging-associated cognitive decline or an individual at risk of suffering from aging-associated cognitive decline.
- the individual may demonstrate some aging-associated cognitive impairment, and progression of cognitive impairment observed prior to treatment with the disclosed methods will be halted following treatment by the disclosed methods.
- the individual may be at risk for developing an aging-associated cognitive decline (e.g., the individual may be aged 50 years old or older, or may have been diagnosed with an aging- associated disorder), and the cognitive abilities of the individual are substantially unchanged, i.e., no cognitive decline can be detected, following treatment by the disclosed methods as compared to prior to treatment with the disclosed methods.
- the subject methods and compositions also find use in reducing cognitive impairment in an individual suffering from an aging-associated cognitive impairment.
- cognitive ability is improved in the individual following treatment by the subject methods.
- the cognitive ability in the individual is increased, e.g., by 2-fold or more, 5-fold or more, 10-fold or more, 15-fold or more, 20-fold or more, 30-fold or more, or 40-fold or more, including 50-fold or more, 60-fold or more, 70-fold or more, 80-fold or more, 90-fold or more, or 100-fold or more, following treatment by the subject methods relative to the cognitive ability that is observed in the individual prior to treatment by the subject methods.
- treatment by the subject methods and compositions restores the cognitive ability in the individual suffering from aging-associated cognitive decline, e.g., to their level when the individual was about 40 years old or less. In other words, cognitive impairment is abrogated.
- reagents, devices and kits thereof for practicing one or more of the above-described methods.
- the subject reagents, devices and kits thereof may vary greatly.
- Reagents and devices of interest include those mentioned above with respect to the methods of reducing B2M levels in an adult mammal.
- the subject kits will further include instructions for practicing the subject methods. These instructions may be present in the subject kits in a variety of forms, one or more of which may be present in the kit.
- One form in which these instructions may be present is as printed information on a suitable medium or substrate, e.g., a piece or pieces of paper on which the information is printed, in the packaging of the kit, in a package insert, etc.
- a suitable medium or substrate e.g., a piece or pieces of paper on which the information is printed, in the packaging of the kit, in a package insert, etc.
- Yet another means would be a computer readable medium, e.g., diskette, CD, portable flash drive, etc., on which the information has been recorded.
- Yet another means that may be present is a website address which may be used via the internet to access the information at a removed site. Any convenient means may be present in the kits.
- mice were housed under specific pathogen-free conditions under a 12 h light-dark cycle and all animal handling and use was in accordance with institutional guidelines approved by the University of California San Francisco IACUC and the VA Palo Alto Committee on Animal Research.
- mice were single-housed and monitored during recovery.
- Carrier free purified human p2-Microglobulin (Lee Biosolutions) was dissolved in PBS and administered systemically (100 ⁇ g/kg) via intraorbital in young (3 months) wild type animals, or stereotaxically (0.50 ⁇ ; 0.1 g/ l) into the DG of the hippocampus in young (3 months) wild type and TapT mutant.
- B2M and vehicle were administered into contralateral DG of the same animal.
- B2M or vehicle were administered bilaterally into the DG and mice were allowed to recover for six or 30 days prior to cognitive testing.
- Brdu labeling 50 mg/kg of BrdU was injected intraperitoneally into mice daily either three or six days before sacrifice.
- BrdU labeling 50 mg/kg of BrdU was injected into mice once a day for six days and animals were sacrificed 28 days after first administration.
- DAB staining for BrdU on every sixth hemibrain section for a total of six sections.
- the number of BrdU-positive cells in the granule cell and subgranular cell layer of the DG were counted and multiplied by 12 to estimate the total number of BrdU-positive cells in the entire DG .
- mice were anesthetized with 400 mg/kg chloral hydrate (Sigma-Aldrich) and transcardially perfused with 0.9% saline. Brains were removed and fixed in phosphate- buffered 4% paraformaldehyde, pH 7.4, at 4°C for 48 h before they were sunk through 30% sucrose for cryoprotection.
- Primary antibodies were: goat anti-Dcx (1 :500; Santa Cruz Biotechnology; sc-8066, clone: C-18), rat anti-BrdU (1 :5000, Accurate Chemical and Scientific Corp.; ab6326, clone: BU1/75), mouse anti-Nestin (1 :500; Millipore; MAB353; clone: rat-401) MCM2 (1 :500, BD Biosciences;
- immunopositive cells in the granule cell and subgranular cell layer of the DG were counted in every sixth coronal hemibrain section through the hippocampus for a total of six sections and multiplied by 12.
- Mouse hippocampi were dissected after perfusion of animals, snap frozen and lysed in RIPA lysis buffer (500 mM Tris, pH 7.4, 150 mM NaCI, 0.5% Na deoxycholate, 1 % NP40, 0.1 % SDS, and complete protease inhibitors; Roche). Tissue lysates were mixed with 4* NuPage LDS loading buffer (Invitrogen) and loaded on a 4-12% SDS polyacrylamide gradient gel (Invitrogen) and subsequently transferred onto a nitrocellulose membrane.
- RIPA lysis buffer 500 mM Tris, pH 7.4, 150 mM NaCI, 0.5% Na deoxycholate, 1 % NP40, 0.1 % SDS, and complete protease inhibitors; Roche.
- Tissue lysates were mixed with 4* NuPage LDS loading buffer (Invitrogen) and loaded on a 4-12% SDS polyacrylamide gradient gel (Invitrogen) and subsequently transferred onto a nitrocellulose membrane.
- the blots were blocked in 5% milk in Tris-Buffered Saline with Tween (TBST) and incubated with rabbit anti-actin (1 :5000, Sigma; A5060) and rabbit anti-B2M (1 :2500, Abeam;
- Horseradish peroxidase-conjugated secondary antibodies (1 :5000, GE Healthcare; NA934) and an ECL kit (GE Healthcare/Amersham Pharmacia Biotech) were used to detect protein signals. Multiple exposures were taken to select images within the dynamic range of the film (GE Healthcare Amersham HyperfilmTM ECL). Selected films were scanned (300 dpi) and quantified using ImageJ software (Version 1.46k). Actin bands were used for normalization.
- NSC/progenitors were purified using a 65% Percoll gradient and plated on uncoated tissue culture dishes at a density of 10 s cells/cm 2 . NPCs were cultured under standard conditions for 48 hours in NeuroBasal A medium supplemented with penicillin
- incorporation was measured using a cell proliferation assay system that uses a peroxidase- coupled anti-BrdU antibody together with a color substrate for detection (Fisher).
- Dcx-luciferase activity was measured using a luciferase assay system (Promega). Differentiation was assessed by immunocytochemistry using mouse anti-MAP2 (1 : 1000, Sigma; M9942; clone: HM-2) and rabbit anti-GFAP (1 :500, DAKO; Z0334) antibodies.
- Cytotoxicity was measured by lactate dehydrogenase (LDH) detection using a Pierce LDH Cytotoxicity Assay system (Life Technologies).
- mice learned to associate the environmental context (fear conditioning chamber) with an aversive stimulus (mild foot shock; unconditioned stimulus, US) enabling testing for hippocampal-dependent contextual fear conditioning.
- contextual fear conditioning is hippocampus and amygdala dependent
- the mild foot shock was paired with a light and tone cue (conditioned stimulus, CS) in order to also assess amygdala-dependent cued fear conditioning.
- Conditioned fear was displayed as freezing behavior.
- Specific training parameters are as follows: tone duration is 30 seconds; level is 70 dB, 2 kHz; shock duration is 2 seconds; intensity is 0.6 mA. This intensity is not painful and can easily be tolerated but will generate an unpleasant feeling.
- each mouse was placed in a fear-conditioning chamber and allowed to explore for 2 minutes before delivery of a 30-second tone (70 dB) ending with a 2-second foot shock (0.6mA). Two minutes later, a second CS-US pair was delivered.
- each mouse was first placed in the fear-conditioning chamber containing the same exact context, but with no CS or foot shock. Freezing was analyzed for 1 -3 minutes.
- the mice were placed in a new context containing a different odor, cleaning solution, floor texture, chamber walls and shape. Animals were allowed to explore for 2 minutes before being re-exposed to the CS. Freezing was analyzed for 1 -3 minutes. Freezing was measured using a FreezeScan video tracking system and software (Cleversys, Inc).
- RAWM radial arm water maze
- Mouse blood was collected into EDTA coated tubes via tail vein bleed, mandibular vein bleed, or intracardial bleed at time of sacrifice.
- EDTA plasma was generated by centrifugation at 1000g of freshly collected blood and aliquots were stored at -80°C until use.
- Human plasma and CSF samples were obtained from University of Washington School of Medicine, Veterans Affairs Northwest Network Mental Illness Research, Education, and Clinical Center, Oregon Health Science University and University of California San Diego. Subjects were chosen based on standardized inclusion and exclusion criteria as previously described (Villeda, S.A., et al. , "The ageing systemic milieu negatively regulates
- Age Subject meets age cutoffs for entry to the • Vision and/or hearing too impaired (even with specific diagnostic group. correction) to allow compliance with psychometric
- Permitted medications include: AChE-inhibitors, disorder, use of Coumadin, heparin or similar Memantine, HRT (estrogen +/- progesterone, anticoagulant, platelets ⁇ 100,000; deformity or Lupron), Thyroid hormone, Antidepressants, statins. surgery affecting lumbosacral spine which is severe Normal basic laboratory tests: BUN, creatinine (will enough to make lumbar puncture difficult, cutaneous allow creatinine up to 1.5), B12, TSH. sepsis at lumbosacral region.
- Neurological exam is normal, i.e. no evidence of epilepsy
- Psychiatric disorders schizophrenia, bipolar affective disorder
- Cortisone oral prohibited - topical or inhaler use allowed
- anti-immune drugs e.g. methotrexate, Cytoxan, IVIg, tacrolimus, cyclosporine
- antineoplastic drugs e.g. methotrexate, Cytoxan, IVIg, tacrolimus, cyclosporine
- antineoplastic drugs e.g. methotrexate, Cytoxan, IVIg, tacrolimus, cyclosporine
- neurodegenerative diseases such as Alzheimer's disease (Hedden & Gabrieli, "Insights into the ageing mind: a view from cognitive neuroscience.,” Nature reviews. Neuroscience (2004) 5:87-96; Mattson & Magnus, “Ageing and neuronal vulnerability.,” Nature reviews. Neuroscience (2006) 7:278-294; Small et al., “A pathophysiological framework of hippocampal dysfunction in ageing and disease.,” Nature reviews. Neuroscience (201 1) 12:585-601). As such, it is imperative to gain mechanistic insight into what drives aging phenotypes in the brain in order to maintain cognitive integrity in the elderly, and consequently counteract vulnerability to neurodegenerative disease.
- heterochronic parabiosis studies have revealed an age-dependent bi-directionality in the influence of the systemic environment indicating pro-youthful factors in young blood elicit rejuvenation while pro-aging factors in old blood drive aging (Katsimpardi et al., "Vascular and neurogenic rejuvenation of the aging mouse brain by young systemic factors.," Science (2014) 344:630-634; Villeda et al. , "The ageing systemic milieu negatively regulates neurogenesis and cognitive function. ,” Nature (201 1 ) 477: 90-94; Ruckh et al. ,
- B2M represents the light chain of the MHC I molecules that form an active part of the adaptive immune system (Zijlstra et al. , "Beta 2-microglobulin deficient mice lack CD4-8+ cytolytic T cells. ,” Nature (1990) 344:742-746) .
- B2M and MHC I can act independent of their canonical immune function to regulate normal brain development, synaptic plasticity and even behavior (Lee et al. Synapse elimination and learning rules co-regulated by MHC class I H2-Db. Nature (2014) 509: 195-200; Loconto et al.
- mice receiving B2M exhibited impaired learning and memory deficits, committing significantly more errors in locating the target platform than animals receiving vehicle control (FIG . 1 H).
- fear conditioning training all mice, regardless of treatment, exhibited no differences in baseline freezing time (FIG. 3C) .
- mice receiving B2M demonstrated decreased freezing time during contextual (FIG . 1 1), but not cued (FIG. 3D), memory testing compared to vehicle treated control animals. Together, these behavioral data demonstrate that systemic administration of exogenous B2M can impair learning and memory.
- Impairments in hippocampal-dependent learning and memory have been previously linked with decreased adult neurogenesis (Clelland et al. , "A functional role for adult hippocampal neurogenesis in spatial pattern separation. ,” Science (2009) 325:210-213; Kitamura et al. , "Adult neurogenesis modulates the hippocampus-dependent period of associative fear memory. ,” Cell (2009) 139:814-827; Zhang et al. , “A role for adult TLX- positive neural stem cells in learning and behaviour. ,” Nature (2008) 451 : 1004-1007) . While a causal link between age-related cognitive decline and decreased adult neurogenesis remains obfuscated (Drapeau et al.
- Bromodeoxyuridne (BrdU) in animals injected with B2M compared to vehicle (FIG. 4B). These data indicate that systemic exposure to exogenous B2M is sufficient to decrease adult neurogenesis.
- mice receiving B2M demonstrated decreased freezing time during contextual (FIG . 5E) , but not cued (FIG. 6C), memory testing. These functional data indicate that local exposure to B2M in the DG impairs learning and memory.
- the transporter associated with antigen processing 1 (Tap1 ) protein is required for transport of MHC I molecules to the cell surface, and absence of Tap1 results in very few classical MHC I molecules reaching the cell surface (Boulanger & Shatz, "Immune signalling in neural development, synaptic plasticity and disease,” Nature reviews. Neuroscience (2004) 5:521 -531 ; Shatz, "MHC class I : an unexpected role in neuronal plasticity. ,” Neuron (2009) 64:40-45; Van Kaer et al. , "TAP1 mutant mice are deficient in antigen presentation, surface class I molecules, and CD4-8+ T cells. ,” Cell (1992) 71 : 1205-1214) .
- B2M knockout mice B2M knockout mice
- In young animals no difference in spatial learning and memory were observed between B2M-/- and WT controls during RAWM training or testing (FIG. 10A).
- aged B2M-/- mice showed enhanced spatial learning capacity during the training phase of the RAWM paradigm, as well as enhanced learning and memory for platform location during the testing phase of the task compared to WT controls (FIG. 10C).
- Beta2-microglobulin Relative levels of beta2-microglobulin were determined in plasma samples of healthy male human donors of 18, 30, 45, 55, and 66 years of age by the SomaScan Proteomic Assay (Somalogic, Inc, Boulder, CO). For each age group, plasma from 40 individuals was analyzed as 8 pools of 5 individuals per pool. Statistical analysis was performed by two-sided Student's t-test of log-transformed values, and also by trend- analysis of untransformed data using the Jonckheere-Terpstra test.
- a method of treating an adult mammal for an aging-associated impairment comprising:
- B2M p2-microglobulin
- the B2M binding agent comprises an antibody or binding fragment thereof. 8. The method according to Clause 6, wherein the B2M binding agent comprises a small molecule.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Pharmacology & Pharmacy (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Biotechnology (AREA)
- Epidemiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Heart & Thoracic Surgery (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Vascular Medicine (AREA)
- Hematology (AREA)
- Anesthesiology (AREA)
- Psychiatry (AREA)
- Hospice & Palliative Care (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Urology & Nephrology (AREA)
- Mycology (AREA)
Abstract
Description
Claims
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP21162695.7A EP3892315A1 (en) | 2015-05-18 | 2016-05-17 | Methods and compositions for treating aging-associated impairments |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201562163222P | 2015-05-18 | 2015-05-18 | |
| PCT/US2016/032907 WO2016187217A2 (en) | 2015-05-18 | 2016-05-17 | Methods and compositions for treating aging-associated impairments |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP21162695.7A Division EP3892315A1 (en) | 2015-05-18 | 2016-05-17 | Methods and compositions for treating aging-associated impairments |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP3297702A2 true EP3297702A2 (en) | 2018-03-28 |
| EP3297702A4 EP3297702A4 (en) | 2019-01-16 |
Family
ID=57320543
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP16797159.7A Withdrawn EP3297702A4 (en) | 2015-05-18 | 2016-05-17 | METHODS AND COMPOSITIONS FOR TREATING CONDITIONS ASSOCIATED WITH AGING |
| EP21162695.7A Withdrawn EP3892315A1 (en) | 2015-05-18 | 2016-05-17 | Methods and compositions for treating aging-associated impairments |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP21162695.7A Withdrawn EP3892315A1 (en) | 2015-05-18 | 2016-05-17 | Methods and compositions for treating aging-associated impairments |
Country Status (11)
| Country | Link |
|---|---|
| EP (2) | EP3297702A4 (en) |
| JP (2) | JP7134089B2 (en) |
| KR (1) | KR20180030965A (en) |
| CN (2) | CN107921188A (en) |
| AU (4) | AU2016265948B2 (en) |
| CA (1) | CA2984645C (en) |
| EA (2) | EA202091057A3 (en) |
| HK (1) | HK1248153A1 (en) |
| IL (1) | IL255319B2 (en) |
| NZ (1) | NZ738184A (en) |
| WO (1) | WO2016187217A2 (en) |
Families Citing this family (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10626399B2 (en) | 2010-01-28 | 2020-04-21 | The Board Of Trustees Of The Leland Stanford Junior University | Methods of treating cognitive symptoms of an aging-associated impairment by modulating C-C chemokine receptor type 3 (CCR3) |
| US10487148B2 (en) | 2010-01-28 | 2019-11-26 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and compositions for treating aging-associated impairments |
| US20160208011A1 (en) | 2010-01-28 | 2016-07-21 | The Board Of Trustees Of The Leland Stanford Junior University | Ccr3 modulation in the treatment of aging-associated impairments, and compositions for practicing the same |
| US9161968B2 (en) | 2011-04-08 | 2015-10-20 | The Board Of Trustees Of The Leland Stanford Junior University | Methods of neuroprotection involving macrophage colony stimulating factor receptor agonists |
| NZ720949A (en) | 2013-12-09 | 2019-03-29 | Univ Leland Stanford Junior | Methods and compositions for treating aging-associated conditions |
| US10905779B2 (en) | 2013-12-09 | 2021-02-02 | The Board Of Trustees Of The Leland Stanford Junior University | Methods for screening human blood products comprising plasma using immunocompromised rodent models |
| AU2016279804B2 (en) | 2015-06-15 | 2019-03-07 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and compositions for treating aging-associated conditions |
| AU2016371598B2 (en) * | 2015-12-15 | 2021-05-13 | The Board Of Trustees Of The Leland Stanford Junior University | Method for preventing and/or treating aging-associated cognitive impairment and neuroinflammation |
| EP3995141B1 (en) | 2016-04-28 | 2024-01-03 | Alkahest, Inc. | Plasma fractions as therapy for thymic cancer |
| EA039316B1 (en) | 2016-10-24 | 2022-01-12 | Алкахест, Инк. | Blood plasma fractions as a treatment for aging-associated cognitive disorders |
| US11040068B2 (en) | 2017-04-26 | 2021-06-22 | Alkahest, Inc. | Dosing regimen for treatment of cognitive and motor impairments with blood plasma and blood plasma products |
| MX2019012795A (en) | 2017-04-26 | 2020-02-13 | Alkahest Inc | Dosing regimen for treatment of cognitive and motor impairments with blood plasma and blood plasma products. |
| SG11202103696XA (en) | 2018-10-26 | 2021-05-28 | Alkahest Inc | Use of plasma and plasma fractions for improvement of pain, wound healing, and postoperative recovery |
| CN113081079B (en) * | 2021-03-30 | 2022-04-22 | 中国科学院生态环境研究中心 | Blood bridge limiter |
| KR20260016896A (en) * | 2024-07-26 | 2026-02-04 | 주식회사 아델 | Anti-β2-Microglobulin Antibody and Uses Thereof |
Family Cites Families (43)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0236509B1 (en) | 1985-09-19 | 1993-02-10 | Toray Industries, Inc. | B2-microglobulin-removing column |
| ES2048191T3 (en) | 1987-12-11 | 1994-03-16 | Akzo Nv | CELLULOSE BASED BIOCOMPATIBLE DIALYSIS MEMBRANE WITH INCREASED ADSORPTION OF BETA-2-MICROGLOBULIN. |
| FR2646607B1 (en) | 1989-05-03 | 1991-08-30 | Inst Nat Sante Rech Med | ANTI-B2 MICROGLOBULIN MONOCLONAL ANTIBODIES |
| US5614396A (en) | 1990-06-14 | 1997-03-25 | Baylor College Of Medicine | Methods for the genetic modification of endogenous genes in animal cells by homologous recombination |
| DE69133557D1 (en) | 1990-08-29 | 2007-03-15 | Pharming Intellectual Pty Bv | HOMOLOGOUS RECOMBINATION IN MAMMALIAN CELLS |
| FR2685346B1 (en) | 1991-12-18 | 1994-02-11 | Cis Bio International | PROCESS FOR THE PREPARATION OF DOUBLE-STRANDED RNA, AND ITS APPLICATIONS. |
| US5240614A (en) | 1992-01-10 | 1993-08-31 | Baxter International Inc. | Process for removing unwanted materials from fluids and for producing biological products |
| WO1995006764A2 (en) | 1993-09-03 | 1995-03-09 | Vpi Holdings Ltd. | Oligonucleotides with rna cleavage activity |
| EP0746614A1 (en) | 1994-02-23 | 1996-12-11 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for inhibiting the expression of disease related genes |
| FR2722411B1 (en) | 1994-07-18 | 1996-10-04 | Union Pharma Scient Appl | IMMUNONANOPARTICLES COATED WITH ANTI-BETA2 MICROGLOBULIN MONOCLONAL ANTIBODIES AND THEIR USE FOR PROPHYLAXIS AND / OR THE TREATMENT OF PATHOLOGIES DUE TO HIV VIRUS INFECTION |
| US5780296A (en) | 1995-01-17 | 1998-07-14 | Thomas Jefferson University | Compositions and methods to promote homologous recombination in eukaryotic cells and organisms |
| AU705616B2 (en) | 1995-04-21 | 1999-05-27 | Cell Genesys, Inc. | Generation of large genomic DNA deletions |
| US5776744A (en) | 1995-06-07 | 1998-07-07 | Yale University | Methods and compositions for effecting homologous recombination |
| US5925544A (en) | 1996-11-18 | 1999-07-20 | Novo Nordisk A/S | Method of homologous recombination followed by in vivo selection of DNA amplification |
| US5830698A (en) | 1997-03-14 | 1998-11-03 | Idec Pharmaceuticals Corporation | Method for integrating genes at specific sites in mammalian cells via homologous recombination and vectors for accomplishing the same |
| US5948653A (en) | 1997-03-21 | 1999-09-07 | Pati; Sushma | Sequence alterations using homologous recombination |
| US5904663A (en) | 1997-07-30 | 1999-05-18 | Braverman; Andrew | Method of removing beta-2 microglobulin from blood |
| US6416487B1 (en) * | 1997-07-30 | 2002-07-09 | Renal Tech International Llc | Method of removing beta-2 microglobulin from blood |
| US20020159995A1 (en) | 1997-07-30 | 2002-10-31 | Renal Tech International | Devices, systems, and methods for reducing levels of pro-inflammatory or anti-inflammatory stimulators or mediators in the blood, generated as a result of extracorporeal blood processing |
| US7066900B2 (en) | 1998-12-23 | 2006-06-27 | Life Therapeutics | Removal of metabolic components from blood |
| AUPR748501A0 (en) | 2001-09-04 | 2001-09-27 | Life Therapeutics Limited | Renal dialysis |
| AUPP790898A0 (en) | 1998-12-23 | 1999-01-28 | Life Therapeutics Limited | Renal dialysis |
| EP2189213A1 (en) | 1999-01-22 | 2010-05-26 | Dow Global Technologies Inc. | Method for producing a surface modified divinylbenzene resin having a hemocompatible coating |
| EP1272630A2 (en) | 2000-03-16 | 2003-01-08 | Genetica, Inc. | Methods and compositions for rna interference |
| US7553484B2 (en) | 2001-06-05 | 2009-06-30 | The Regents Of The University Of California | Modulating neuronal outgrowth via the major histocompatibility complex class I (MHC I) molecule |
| DK2280070T3 (en) | 2001-07-23 | 2015-08-24 | Univ Leland Stanford Junior | Methods and compositions for use in RNAi-mediated inhibition of gene expression in mammals |
| US20030180811A1 (en) | 2002-03-11 | 2003-09-25 | Montero-Julian Felix A. | Immunoassays for beta2-microglobulin |
| WO2003086307A2 (en) | 2002-04-12 | 2003-10-23 | The Board Of Trustees Of The University Of Arkansas | β2-MICROGLOBILIN (β2m) AND ANTI-β2m BINDING AGENTS AS ANTI-CANCER THERAPEUTICS |
| US7037276B2 (en) | 2002-07-02 | 2006-05-02 | Precision Medical Devices, Inc. | Biopsy device |
| US20040127445A1 (en) | 2002-08-28 | 2004-07-01 | Chondrogene Limited | Beta-2 microglobulin (B2M) and B2M related gene products for the regulation of osteoarthritis pathogenesis and chondrocyte proliferation |
| US20050014166A1 (en) | 2002-11-22 | 2005-01-20 | Institut Clayton De La Recherche | Compositions and systems for the regulation of genes |
| GB0307206D0 (en) | 2003-03-28 | 2003-04-30 | Axordia Ltd | Hyperproliferation |
| WO2006004824A1 (en) * | 2004-06-30 | 2006-01-12 | Regents Of The University Of Minnesota | Soluble oligomers of amyloid beta for disrupting cognitive function |
| WO2006130949A1 (en) | 2005-06-08 | 2006-12-14 | Replicor Inc. | Anti amyloid-related disease molecules and their uses |
| US8211310B2 (en) | 2006-11-20 | 2012-07-03 | Cytosorbents, Inc. | Size-selective polymer system |
| CN101888863B (en) * | 2007-12-06 | 2012-11-28 | 旭化成医疗株式会社 | Porous Hollow Fiber Membranes for Blood Treatment |
| WO2010017443A2 (en) | 2008-08-07 | 2010-02-11 | Da Zen Group, Llc | Anti-beta-2-microglobulin agents and the use thereof |
| WO2010040029A1 (en) | 2008-10-02 | 2010-04-08 | Celtaxsys, Inc. | Methods of modulating the negative chemotaxis of immune cells |
| US8754034B2 (en) | 2009-02-06 | 2014-06-17 | The Regents Of The University Of California | Structure-based design of peptide inhibitors of amyloid fibrillation |
| WO2011094535A2 (en) | 2010-01-28 | 2011-08-04 | The Board Of Trustees Of The Leland Stanford Junior University | Biomarkers of aging for detection and treatment of disorders |
| US20130331327A1 (en) | 2012-06-08 | 2013-12-12 | Vittorio Bellotti | Variant Beta2-microglobulin, characterization of the same and applications thereof |
| EP2781523A1 (en) | 2013-03-18 | 2014-09-24 | Miltenyi Biotec GmbH | Lipophilic oligonucleotide analogs |
| AU2014354808A1 (en) * | 2013-11-26 | 2016-06-02 | University Of North Texas Health Science Center At Fort Worth | Personalized medicine approach for treating cognitive loss |
-
2016
- 2016-05-17 JP JP2018512817A patent/JP7134089B2/en active Active
- 2016-05-17 CA CA2984645A patent/CA2984645C/en active Active
- 2016-05-17 EP EP16797159.7A patent/EP3297702A4/en not_active Withdrawn
- 2016-05-17 EA EA202091057A patent/EA202091057A3/en unknown
- 2016-05-17 NZ NZ73818416A patent/NZ738184A/en not_active IP Right Cessation
- 2016-05-17 HK HK18107779.2A patent/HK1248153A1/en unknown
- 2016-05-17 CN CN201680028881.5A patent/CN107921188A/en active Pending
- 2016-05-17 AU AU2016265948A patent/AU2016265948B2/en not_active Ceased
- 2016-05-17 CN CN202310374205.5A patent/CN116687969A/en active Pending
- 2016-05-17 WO PCT/US2016/032907 patent/WO2016187217A2/en not_active Ceased
- 2016-05-17 EA EA201792437A patent/EA035799B1/en unknown
- 2016-05-17 KR KR1020177035957A patent/KR20180030965A/en not_active Ceased
- 2016-05-17 EP EP21162695.7A patent/EP3892315A1/en not_active Withdrawn
-
2017
- 2017-10-30 IL IL255319A patent/IL255319B2/en unknown
-
2019
- 2019-02-26 AU AU2019201337A patent/AU2019201337B9/en not_active Ceased
-
2020
- 2020-07-28 AU AU2020210181A patent/AU2020210181B2/en not_active Ceased
-
2021
- 2021-01-29 JP JP2021013639A patent/JP7323561B2/en active Active
-
2022
- 2022-08-25 AU AU2022221494A patent/AU2022221494A1/en not_active Abandoned
Also Published As
| Publication number | Publication date |
|---|---|
| HK1248153A1 (en) | 2018-10-12 |
| WO2016187217A2 (en) | 2016-11-24 |
| NZ738184A (en) | 2019-09-27 |
| KR20180030965A (en) | 2018-03-27 |
| JP2021073264A (en) | 2021-05-13 |
| IL255319B (en) | 2022-11-01 |
| AU2020210181A1 (en) | 2020-08-13 |
| CA2984645A1 (en) | 2016-11-24 |
| CA2984645C (en) | 2023-01-10 |
| AU2016265948A1 (en) | 2018-01-04 |
| EA201792437A1 (en) | 2018-04-30 |
| IL255319B2 (en) | 2023-03-01 |
| EA202091057A2 (en) | 2020-12-30 |
| CN107921188A (en) | 2018-04-17 |
| EA035799B1 (en) | 2020-08-12 |
| AU2019201337A1 (en) | 2019-03-21 |
| IL255319A0 (en) | 2017-12-31 |
| CN116687969A (en) | 2023-09-05 |
| EA202091057A3 (en) | 2021-03-31 |
| WO2016187217A3 (en) | 2017-01-05 |
| AU2020210181B2 (en) | 2022-05-26 |
| JP2018518530A (en) | 2018-07-12 |
| EP3892315A1 (en) | 2021-10-13 |
| AU2022221494A1 (en) | 2022-09-29 |
| AU2016265948B2 (en) | 2018-12-06 |
| JP7134089B2 (en) | 2022-09-09 |
| AU2019201337B2 (en) | 2020-05-14 |
| JP7323561B2 (en) | 2023-08-08 |
| AU2019201337B9 (en) | 2020-05-21 |
| EP3297702A4 (en) | 2019-01-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2020210181B2 (en) | Methods and compositions for treating aging-associated impairments | |
| US11912998B2 (en) | Method of treating aging-associated cognitive impairment by reducing CCR3 | |
| US10626399B2 (en) | Methods of treating cognitive symptoms of an aging-associated impairment by modulating C-C chemokine receptor type 3 (CCR3) | |
| Wang et al. | Nogo receptor impairs the clearance of fibril amyloid‐β by microglia and accelerates Alzheimer’s‐like disease progression | |
| Rivagorda et al. | A primary cilia–autophagy axis in hippocampal neurons is essential to maintain cognitive resilience | |
| Jiang et al. | CRISPR-Cas9-mediated deletion of carbonic anhydrase 2 in the ciliary body to treat glaucoma | |
| US20210171626A1 (en) | Methods and Compositions for Treating Aging-Associated Impairments with Trefoil Factor Family Member 2 Modulators | |
| US10487148B2 (en) | Methods and compositions for treating aging-associated impairments | |
| TW202206093A (en) | Use of seam3d antagonist for preventing or treating neurodegenerative disease and increasing lifespan | |
| US20210301013A1 (en) | Methods and Compositions for Treating Aging-Associated Impairments with Trefoil Factor Family Member 2 Modulators | |
| EA045040B1 (en) | METHODS AND COMPOSITIONS FOR TREATING DISORDERS ASSOCIATED WITH AGING | |
| WO2022240649A1 (en) | Methods and compositions for treating aging-associated impairments with trefoil factor family member 2 modulators | |
| Smits et al. | Activity of translation regulator eukaryotic elongation factor-2 kinase is increased in Parkinson disease brain and its inhibition reduces alpha synuclein toxicity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20171123 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| AX | Request for extension of the european patent |
Extension state: BA ME |
|
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: U.S. GOVERNMENT REPRESENTED BY THE DEPARTMENT OF V Owner name: THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIO Owner name: ALKAHEST, INC. Owner name: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: ALKAHEST, INC. Owner name: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA Owner name: U.S. GOVERNMENT REPRESENTED BY THE DEPARTMENT OF V Owner name: THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIO |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20181219 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: A61P 25/28 20060101ALI20181213BHEP Ipc: A61M 1/36 20060101AFI20181213BHEP Ipc: C12N 15/113 20100101ALI20181213BHEP Ipc: A61K 31/7088 20060101ALI20181213BHEP |
|
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIO Owner name: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA Owner name: ALKAHEST, INC. Owner name: U.S. GOVERNMENT REPRESENTED BY THE DEPARTMENT OF V |
|
| 17Q | First examination report despatched |
Effective date: 20200203 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN |
|
| 18W | Application withdrawn |
Effective date: 20210316 |