EP3191506A1 - Modified spider silk - Google Patents

Modified spider silk

Info

Publication number
EP3191506A1
EP3191506A1 EP15766930.0A EP15766930A EP3191506A1 EP 3191506 A1 EP3191506 A1 EP 3191506A1 EP 15766930 A EP15766930 A EP 15766930A EP 3191506 A1 EP3191506 A1 EP 3191506A1
Authority
EP
European Patent Office
Prior art keywords
spidroin
modified
methionine
spider silk
azide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP15766930.0A
Other languages
German (de)
French (fr)
Inventor
Neil Thomas
David Harvey
Sara GOODACRE
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Nottingham
Original Assignee
University of Nottingham
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Nottingham filed Critical University of Nottingham
Publication of EP3191506A1 publication Critical patent/EP3191506A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43513Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae
    • C07K14/43518Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae from spiders

Definitions

  • This invention relates to spider silk composites; their methods of manufacture and applications thereof.
  • Spiders can produce up to seven different types of silk, each intended for a specific purpose.
  • Dragline silk is the strongest type of silk and is used by the spider to create the structural 'spokes' of a web, and as a life line to evade predators.
  • Dragline silk also exhibits intrinsic biodegradability, biocompatibility and minimal bacterial adherence (Leal-Egana, A. and Scheibel, T. (2010), Silk-based materials for biomedical applications. Biotechnology and Applied Biochemistry, 55 : 155-167. doi: 10.1042/BA20090229).
  • RGD functionalised variants of dragline silk have been created by genetic fusion or chemical modification of cysteine residues, improving fibroblast adhesion and proliferation to match that of fibronectin coated plates acting as positive controls.
  • using these techniques to create functionalised silk has inherent problems. Genetic manipulation of silk sequences is difficult because of the highly repetitive nature and high GC content of the gene. Furthermore, altering the protein primary sequence may cause mis-folding of the entire protein, resulting in reduced protein yield. Furthermore genetic manipulation can only integrate functional peptide motif sequences, resulting in a protein that contains a linear functional peptide which may not be accessible to impart function if the functionalised region is hidden upon polymerisation or fabrication into macroscopic structures for example.
  • cysteine residues offer and alternative route to modify the silk protein with peptides or other functional molecules with good selectivity and reasonable efficiency. Unfortunately, modifying cysteine residues is not appropriate for functionalising silk proteins that self-assemble via C-terminal domain dimerization, since the formation of an essential disulphide bridge would be prevented, thus destroying the self-assembly process.
  • An aim of the present invention is to provide improved functionalised spider silk material and improved methods of functionalising spider silk material.
  • a modified spidroin comprising spidroin modified to comprise azide, alkyne, allyl or amine moieties.
  • a spider silk material comprising:
  • -a modified spidroin comprising spidroin modified to comprise one or more azide, alkyne, allyl or amine moieties.
  • the invention advantageously provides a biomedically applicable functionalised silk biomaterial by a simple and benign chemical method that preserves self-assembly properties. Incorporation of the non-natural amino acid L-azidohomoalanine (L-Aha) into the methionine sites of a self-assembling miniature dragline silk spidroin, 4RepCT, to give 4RepCT AHA .
  • L-Aha non-natural amino acid L-azidohomoalanine
  • 4RepCT self-assembling miniature dragline silk spidroin
  • These unique azide functional groups allow highly specific and efficient conjugation to peptides or molecules bearing a chemical group that is reactive to azide, such as a terminal alkyne moiety.
  • the reaction may be via a Copper (I) (Cu(I)) catalysed Huisgen 1-3, dipolar cycloaddition, or 'click reaction' to give a 1-4 triazole product, which is a technique previously not used to modify silks.
  • the 1-4 triazole formed in the Huisgen cycloaddition is a good bioisostere of an amide and is chemically more robust than the reaction between a cysteine thiol and a maleimide.
  • Modifying spider silk using click chemistry offers a novel and versatile way to produce functionalised silk protein structures; custom designed to best fit an intended application.
  • the spider silk material or conjugate is biocompatible.
  • biocompatible is understood to include non-toxic to the human or animal body.
  • the spider silk material may not cause an immune response.
  • the spider silk material or conjugate may be biodegradeable.
  • biodegradeable is understood to include the ability to breakdown over time in the tissue or body of a human or animal, and/or in the environment.
  • the "spidroin” may be "major ampullate spidroin” and encompass all known major ampullate spidroin proteins, typically abbreviated "MaSp", or "ADF” in the case of Araneus diadematus.
  • the spidroin may comprise dragline silk spidroin.
  • the spidroin may comprise 4repCT spidroin.
  • the modified spidroin may comprise the sequence of SEQ ID NO: 5.
  • the modified spidroin may comprise the sequence of SEQ ID NO: 5, or a variant thereof having at least 50% sequence similarity to SEQ ID NO: 5.
  • the variant may have at least 80% similarity to SEQ ID NO: 5.
  • the variant may have at least 90% similarity to SEQ ID NO: 5.
  • the variant may have at least 95% similarity to SEQ ID NO: 5.
  • the variant may have at least 98% similarity to SEQ ID NO: 5.
  • the variant may have at least 99% similarity to SEQ ID NO: 5.
  • the variant may comprise one or more non-natural azido amino acid residues in place of one or more methionine residues of an equivalent non-modified or wild-type sequence.
  • the modified spidroin may comprise the sequence of SEQ ID NO: 5, or a variant thereof having at least 50% sequence identity to SEQ ID NO: 5. In another embodiment, the variant may have at least 80% identity to SEQ ID NO: 5. The variant may have at least 90% identity to SEQ ID NO: 5. The variant may have at least 95% identity to SEQ ID NO: 5. The variant may have at least 98% identity to SEQ ID NO: 5. The variant may have at least 99% identity to SEQ ID NO: 5.
  • the modified spidroin may comprise the sequence of SEQ ID NO: 3 or 4, further modified to comprise one or more non-natural amino acid residues comprising azide, alkyne, allyl or amine moieties in place of the one or more amino acid residues.
  • the modified spidroin may comprise the sequence of SEQ ID NO: 3 or 4, further modified to comprise one or more non-natural amino acid residues comprising azide, alkyne, allyl or amine moieties in place of the one or more methionine residues.
  • sequence identity or similarity may be across the entire length of the sequence of SEQ ID NO: 5. Sequence identity may be determined using BLAST alignment (NCBI) under standard parameters.
  • the spidroin may be spidroin 1 or 2. It is understood that spidroin 2 has an additional lysine handle in addition to the azide. This would allow two sites of possible modification if desired.
  • the skilled person may select an appropriate spidroin for modification according to the invention.
  • the spidroin may be from an unmapped species, having differing physical properties than other known spidroins. The skilled person may determine the properties required for any particular application and apply the modification of the invention to the spidroin.
  • the spidroin may comprise a spidroin capable of self-assembly, for example with or without a modification according to the invention.
  • the spidroin may comprise any spidroin without structurally important (e.g. secondary or tertiary structurally important) methionine residues.
  • the spidroin may comprise non-natural modified spidroin, for example, spidroin comprising one or more non-natural amino acids.
  • the spidroin may be encoded in a gene with an amber codon, for a specific incorporation of a non-natural amino acid comprising a linking moiety.
  • the spidroin may comprise a lysine residue, which provides an amine group to modify. For example, for at least two points of linkage/functionalisation.
  • the lysine amine may be modified using standard peptide coupling reagents to form an amide.
  • the lysine residue may be oxidised in the presence of a nitrous acid to convert the amine to an azide.
  • the lysine side chain may also be reacted with aldehydes/ketones to form Imines that can then be reduced to amines or the amine can act as a nucleophiles reacting with alpha-halo acetate or acetamide to give an amine linkage.
  • Other reactions of amines in proteins will be well known to those skilled in the art.
  • the spidroin may be fused to a fusion partner.
  • Fusion partners according to the invention include any protein fragment which improves the solubility and/or stability of its partner protein fragment, here the spidroin protein according to the invention.
  • the fusion partner may also provide a suitable handle for affinity purification.
  • examples of fusion partners according to the invention include thioredoxin, maltose-binding protein, glutathione S-transferase (GST), MTB32-C, Gbl, ZZ, His-tag, Avi-tag and Nus A.
  • GST glutathione S-transferase
  • MTB32-C glutathione S-transferase
  • Gbl glutathione S-transferase
  • ZZ His-tag
  • Avi-tag Avi-tag
  • Nus A Nus A.
  • the fusion partner may be a thioredoxin moiety (ThrX).
  • the fusion partner may be a thioredoxin moiety (ThrX) in combination with a His tag and/or an S tag.
  • the spidroin and fusion partner may comprise a cleavage enzyme recognition site.
  • the cleavage enzyme recognition site may be situated between the spidroin and the fusion partner such that cleavage at the recognition site results in a spidroin protein and a separated fusion partner.
  • Examples of the cleavage agent recognition site according to the invention include an enterokinase recognition site, a Lys-C recognition site, or a thrombin recognition site. The skilled person will recognise that alternative cleavage enzymes are available, which will recognise their appropriate cleavage enzyme recognition site.
  • the cleavage agent recognition site may comprise an enterokinase recognition site.
  • enterokinase acts at a DDDK cleavage site and will not break down sensitive groups such as peptides that may be attached to the spidroin.
  • the azide moiety may be arranged to react in a 'click' reaction.
  • the azide moiety may be arranged to react with an alkyne moiety, for example presented on an active molecule to be linked, and form a triazole linkage.
  • the alkyne moiety may be arranged to react in a 'click' reaction.
  • the alkyne moiety may be arranged to react with an azide moiety, for example presented on an active molecule to be linked, and form a triazole linkage.
  • Such triazole linkages are formed through the process of chemical ligation methods, such as a Cul-catalysed [3+2] Azide-Alkyne Cycloaddition (CuAAC) reaction, Iodine or heat catalysed Huisgen cycloaddition or the Strain-Promoted Alkyne Azide Cycloaddition (SPAAC) reaction between azide and cyclooctyne-modified molecules (copper-free click ligation).
  • the triazole linkage may be a result of a copper-free SPAAC click reaction, which advantageously does not require copper catalysis.
  • the copper free click ligation is compatible with large biomolecules and can be carried out in any biologically compatible buffer. The presence of copper causes degradation of long DNA and RNA molecules, so the avoidance of copper is advantageous. Copper-free click ligation can also be carried out in conditions under which some molecules may be unstable.
  • the alkyne group may be strained by being part of a ring, for example a cycloalkyne such as a cyclooctyne.
  • a dibenzocyclooctyne is highly suitable for use attached to biomolecules that are used in fast SPAAC reactions with azides.
  • the conjugated aromatic rings impose ring strain and electron withdrawing properties on the alkyne, making it react very quickly with azides. Substituents to the ring may be used to increase or decrease the reactivity of the alkyne.
  • the strained alkyne group may comprise a substituted cyclooctyne.
  • the strained alkyne used in the present invention may be any strained alkyne group.
  • the strained alkyne may be within a ring structure, for example a cycloalkyne or a cyclic compound where the ring comprises carbon atoms and one or more heteroatoms, for example, one or more nitrogen, sulphur or oxygen atoms in the ring.
  • the strained alkyne group may comprise a 7 to 9 membered ring.
  • the strained alkyne group may comprise a substituted 7 to 9 membered ring.
  • the strained alkyne may comprise an 8 membered ring, or a substituted 8 membered ring.
  • the substituted or unsubstituted 8 membered ring may comprise 8 carbon atoms in the ring or may comprise one or more nitrogen, sulphur or oxygen atoms in the ring in addition to carbon atoms.
  • the strained alkyne group may comprise a cyclooctyne.
  • the strained alkyne group may comprise a substituted cyclooctyne.
  • the strained alkyne group may comprise a cyclic compound having at least one heteroatom in the ring.
  • the strained alkyne group may comprise a dibenzocyclooctyne (DIBO) group.
  • DIBO dibenzocyclooctyne
  • the heteroatom may be at any position in the ring. In one embodiment there is one heteroatom in the ring.
  • a strained alkyne that is reactive enough to perform the SPAAC reaction under laboratory conditions, for example because it can react in water or buffer at normal room temperature, for example 20°C, but that is also stable under laboratory conditions, for example it is stable in water, oxygen stable and stable at normal room temperature.
  • the azide moiety may be arranged to form a triazole linkage with an alkyne group provided by a molecule, such as an active molecule.
  • the azide moiety may be arranged to provide a Staudinger ligation with a phosphine or phosphite group provided on a molecule, such as an active molecule.
  • the alkyne moiety may be arranged to form a triazole linkage with an azide group provided by a molecule, such as an active molecule.
  • the non-natural amino acid may comprise an amino acid modified with an azide group, an alkyne group, an allyl group, or an amine group.
  • the non-natural amino acid may comprise an amino acid azide.
  • the non-natural amino acid may comprise an alkyne- comprising amino acid.
  • the non-natural amino acid may comprise an allyl-comprising amino acid.
  • the non-natural amino acid may comprise an amine-comprising amino acid.
  • the non-natural amino acid may be a methionine analogue.
  • the non-natural amino acid may be an analogue of any one of the 20 natural amino acids.
  • the amino acid azide may be a methionine analogue or derivative having an azide group.
  • the non-natural amino acid may comprise L-azidohomoalanine (L-Aha), azidoalanine, L- homopropargylglycine (L-Hpg), L-homoallylglycine (L-Hag),Jra «s-crotonylglycine (L- Tcg), Azidonorvaline.
  • a range of non-natural amino acids may be provided by the mutagenesis methods of Wang et al. (2001. Science, Vol. 292 pp498-500 - incorporated herein by reference) or Chin J.W. et al. (2002. PNAS Vol. 99 No. 17, ppl 1020-11024- incorporated herein by reference), which allow the incorporation of a large range of un-natural/non-canonical amino acids.
  • the modified spidroin may be formed by incorporation of a non-natural amino acid comprising azide moieties into spidroin.
  • the modified spidroin may be formed by incorporation of a non-natural amino acid comprising alkyne moieties into spidroin.
  • the modified spidroin may be formed by incorporation of a non-natural amino acid comprising allyl moieties into spidroin.
  • the modified spidroin may be formed by incorporation of a non-natural amino acid comprising amine moieties into spidroin.
  • the non-natural amino acids may substitute one or more natural amino acid residues in spidroin.
  • the non-natural amino acids may substitute one or more methionine residues in spidroin.
  • the spider silk material may comprise a plurality of modified spidroins arranged in a fibre.
  • Spider silk material may comprise a plurality of fibres.
  • the plurality of fibres may be aligned, meshed, interlaced, entwined, braided, weaved or twisted together, or produced by 3D printing.
  • a spider silk material comprising
  • the linking moiety may be a triazole, amine, amide, ether, or carbon-carbon linkage.
  • the active molecule may be linked to the spidroin by a triazole or amide linkage.
  • the active molecule may be linked to the spidroin by a triazole linkage.
  • the triazole linkage may be a 1,4- or 1,5-triazole linkage.
  • the linkage may be provided by any one of a range of reactions known to those skilled in the art including oxidation, epoxidation, 'ene' and Diels-Alder reaction, 1,3-dipolar cycloaddition 'click' reactions cyclopropanation, light dependent 2+2 cycloaddition.
  • a conjugate of spidroin and an active molecule linked by a triazole, amine, amide, ether or carbon- carbon linkage is provided.
  • the active molecule may be linked by a triazole or amide.
  • the active molecule may be linked by a triazole, such as a 1,4- or 1,5-triazole linkage.
  • the linkage or linking moiety on the spidroin may be located on the conserved c- terminal domain of the spidroin.
  • the active molecule may be a therapeutically, prophylactically or diagnostically active substance.
  • the active agent may be a bioactive substance.
  • the active molecule may be selected from the group comprising a drug, pro-drug, peptide, protein, and nucleic acid, or combinations thereof.
  • the active molecule may be a label, such as a fluorescent label.
  • the active molecule may comprise or consist of a biomolecule.
  • the active molecule may be a drug, a cell, signalling molecule, such as a growth factor, or any other suitable active agent.
  • the active molecule may comprise amino acids, peptides, proteins, sugars, antibodies, nucleic acid, antibiotics, such as levofloxacin, antimycotics, growth factors, nutrients, enzymes, hormones, steroids, synthetic material, synthetic polymers, ceramic beads or surfaces, glass beads or surface, organometallic agents/metal chelates, PEG, PLGA, drugs, nanoparticles (such as gold, silver, quantum dots, and/or carbon nanotubes), adhesion molecules, small molecule and protein based fluorophores, colourants/dyes (which may be used for identification), radioisotopes (which may be for X-ray detection and/or monitoring of degradation), spectroscopic probes (such as gadolinium, manganese and iron contract agents), nitroxyl single electron paramagnetic agents, PET agents and other suitable constituents, or combinations thereof.
  • the active molecule may comprise levofloxacin. Combinations of active molecules may be linked to the spidroin. Additionally or alternatively different spidroins may be linked to different active molecules and the different spidroins combined into the same fibre.
  • the active molecule may be heat stable, for example, the active molecule may be capable of autoclaving under sterilising conditions.
  • the active molecule may be heat sensitive and/or pH sensitive.
  • the active molecule may be labile, degraded, inactivated, or denatured at temperatures above at least about 30°C.
  • the active molecule may be labile, degraded, inactivated, or denatured at temperatures above at least about 50°C.
  • the active molecule may be labile, degraded, inactivated, or denatured at temperatures above at least about 70°C.
  • the active molecule may be labile, degraded, inactivated, or denatured at temperatures above at least about 100°C.
  • the active molecule may be labile, degraded, inactivated, or denatured at temperatures above at least about 150°C.
  • the active molecule may be labile, degraded, inactivated, or denatured at a pH ⁇ 6.
  • the active molecule may be labile, degraded, inactivated, or denatured at a pH >8.
  • the active molecule may be released from the fibre by exposure to light, heat, sound, enzymes, oxygen, fluoride ions and/or pH changes.
  • the active molecule may comprise a linker for reacting and forming a link with the azide, alkyne, allyl or amine moieties on the modified spidroin.
  • the linker may comprise a moiety capable of reacting and forming a link with one of azide, alkyne, allyl or amine moieties on the modified spidroin.
  • the linker may comprise an alkyne, for example to form a link by reaction with an opposing azide group on the spidroin.
  • the linker may comprise an azide, for example to form a link by reaction with an opposing alkyne group on the spidroin.
  • the linker may comprise glycidyl propargyl ether.
  • the active molecule may be linked to the linker by a covalent bond, for example via an ester bond.
  • tissue scaffold, implant, wound dressing, or suture comprising the spider silk material or conjugate of the invention herein.
  • a substrate suitable for site specific delivery and/or localisation of an active molecule comprising the spider silk material of the invention herein.
  • a method of modifying spidroin with azide moieties comprising expressing a gene encoding spidroin in a methionine auxotrophic cell in the presence of methionine-analogous non- natural amino acid residues comprising an azide moiety, such that the methionine- analogous non-natural amino acids are incorporated in place of methionine residues.
  • a method of modifying spidroin with a linking moiety such as an azide, alkyne, allyl or amine, comprising expressing a gene encoding spidroin in a methionine auxotrophic cell in the presence of methionine-analogous non-natural amino acid residues comprising the linking moiety, such that the methionine-analogous non-natural amino acids are incorporated in place of methionine residues.
  • the methionine auxotrophic cell may be E. coli, such as, E. coli DL41.
  • the cell may be cultured in a methionine-free medium.
  • the methionine-free medium may comprise the methionine-analogous non-natural amino acid.
  • the methionine-analogous non-natural amino acid may comprise L-azidohomoalanine (L-Aha) or azidoalanine.
  • the methionine-analogous non-natural amino acid may comprise L-azidohomoalanine (L- Aha).
  • the gene may encode spidroin with a fusion partner according to the invention.
  • a method of modifying spidroin with a linking moiety comprising expressing a gene encoding spidroin in a cell with an orthogonal set of tRNA, aminoacyl tRNA synthetase, and codon, wherein the tRNA bears a non-natural amino acid residue comprising the linking moiety, such that the non-natural amino acid comprising the linking moiety is incorporated into the spidroin.
  • the method may use the mutagenesis methods of Wang et al. (2001. Science, Vol. 292 pp498-500) or Chin J.W. et al.
  • the method may comprise the use of an exogenous tRNA synthetase pair.
  • the codon may be an amber codon encoded in the spidroin gene.
  • a method of forming a spider silk material of the invention herein comprising:
  • spidroin with a fusion partner in a methionine auxotrophic cell in the presence of methionine-analogous non-natural amino acid residues comprising a linking moiety, such that the methionine-analogous non-natural amino acids are incorporated in place of methionine residues to form modified spidroin with a fusion partner;
  • the linking moiety may comprise azide, alkyne, allyl or amine.
  • Extracting the modified spidroin may comprise purification of the modified spidroin and fusion partner.
  • the modified spidroin and fusion partner may be affinity tagged, such that it can be purified on an affinity column.
  • the affinity tag may comprise a His- tag, avi-tag, biotin, sortase tag, glutatione S-transferase (GST), maltose-binding protein (MBP).
  • Cleaving the fusion partner from the modified spidroin may be by the addition of a cleavage enzyme recognising a cleavage enzyme recognition site between the modified spidroin and the fusion partner.
  • the cleavage may be mediated by thrombin, enterokinase,Lys-C, TEV, Factor Xa, or Lysostaphin.
  • the modified spidroin may be formed into fibres ranging from 5 nm to at least 10 cm in length.
  • the method may further comprise twisting, weaving, braiding, interlacing or 3D printing the one or more fibres to form a multiple -fib ered spider silk or mesh of spider silk fibres.
  • the method may further comprise reacting the linking moiety on the modified spidroin with an active molecule comprising a reactive group capable of reacting with linking moiety and forming a link between the spidroin and the active molecule.
  • the linking of the active molecule may be before fibre formation, for example, before cleavage of the fusion partner, or after fibre formation. In one embodiment, the linking is carried out after fibre formation.
  • a method of treatment comprising the administration of the spider silk material or conjugate according to the invention to a subject.
  • the treatment may be for treatment or prevention of a disease, tissue repair or tissue replacement.
  • the treatment may be wound treatment.
  • the subject may be a mammal.
  • the subject may be human.
  • the spider silk material or the conjugate according to the invention for use in the treatment or prevention of a disease, tissue repair or tissue replacement.
  • the spider silk material or conjugate of the invention may be used in an implant; medical product, such as wound closure system, band-aid, suture, wound dressing; or scaffold for tissue engineering and guided cell regeneration.
  • medical product such as wound closure system, band-aid, suture, wound dressing; or scaffold for tissue engineering and guided cell regeneration.
  • wound closure system such as wound closure system, band-aid, suture, wound dressing
  • scaffold for tissue engineering and guided cell regeneration.
  • optional features of one embodiment or aspect of the invention may be applicable, where appropriate, to other embodiments or aspects of the invention.
  • the term "fibre” as used herein relates to polymers having a thickness of at least 5 nm, preferably macroscopic polymers that are visible to the human eye, i.e. having a thickness of at least 5 nm, and have a considerable extension in length compared to its thickness, preferably above 5 mm.
  • the term "fibre” does not encompass unstructured aggregates or precipitates.
  • Figure 1 An overview of the insertion of L-Aha into methionine sites of 4repCT AHA , subsequent click chemistry labelling with fluorophore (FAM) and processing into fibres following incubation with thrombin, enterokinase or Lys- C.
  • FAM fluorophore
  • Figure 3 A 15% SDS PAGE gel showing the enzymatic digestion of the
  • Figure 4 A 15% SDS PAGE gel showing soluble 4RepCTAha labelled with FAM and resulting fibre after enzymatic digestion, (a) A fluorescent band at 37 kDa corresponding to 4RepCTAha fusion protein, (b) A ⁇ 3 cm fibre produced from FAM labelled 4RepCTAha glowing green upon exposure to UV.
  • Figure 5 Fluorescence light microscope images of 4RepCTAha fibres and control fibres.
  • the labelled 4RepCTAha fibres in the left hand panel display fine details of fibrillar bundles.
  • Control fibres, located in the right hand panel, display the same fibrillar bundling with less detail and do not show any fluorescence.
  • Figure 6 Structures of (a) glycidyl propargyl ether linker, (b) levofloxacin and (c) levofloxacin conjugated to the linker via an ester bond.
  • Figure 7 A bar chart showing optical densities of E. coli NCTC 12242 liquid cultures after 28 hours incubation with non- functionalised (non mod silk), levofloxacin control (lev Ctrl silk) and levofloxacin-functionalised (lev mod silk) fibres. Data is the mean of 3 replicates, error bars show standard error of the mean. A two tailed t-test was used to determine significance.
  • Figure 8 Muller-Hinton agar plates showing zones of inhibition of E. coli NCTC 12242 in the presence of levofloxacin control and levofloxacin- functionalised fibres. Incubation periods are displayed on the left and fibre types displayed above.
  • the present study aims create biomedically applicable functionalised silk biomaterials using a simple and benign chemical method that preserves self-assembly properties.
  • the non-natural amino acid L-azidohomoalanine (L-Aha) was incorporated into the methionine sites of a self-assembling miniature dragline silk spidroin, 4RepCT, to give 4RepCT AHA .
  • E. coli DL41 were transformed with pJExpress401 plasmid containing the silk fusion protein gene (SEQ ID NO: 5)
  • the gene was codon optimised for E. Coli and encoded the following; His6 tag/ sol tag/ Thioredoxin/ Enterokinase site/ Lys-C site/ Thrombin site/ 4RepCT.
  • Transformed bacteria were streaked onto LB agar plates containing kanamycin and incubated at 37 °C.
  • Das enzymatic cleavage sites that release thioredoxin, triggering fibre formation.
  • Fibres were made from labelled and un-labelled silk protein by incubation with thrombin, Lys-C or Enterokinase at an enzyme: fusion protein ratio of 1 : 1000 w/w. Cleavage was achieved at a fusion protein concentration of approximately 2 mg/ml, 1 mM potassium phosphate and a total volume of 1- 3 ml. Reaction was incubated at 30°C with gentle rocking for a period of 4 hours, after which 1-10 cm long fibres were visible. Samples of the reaction were analysed by SDS PAGE.
  • Soluble TRX GS MaSpl Aha + was labelled with 0.1 mM FAM alkyne (3'-Hydroxy-6'-(2- propyn-l-yloxy)-3H-spiro[2-benzofuran-l,9'-xanthen]-3-one)) or 0.1 mM Alexa Fluor 594 alkyne (carboxamido-(5-(and 6-)propargyl), bis(triethylammonium salt)).
  • Cu[I] was generated in situ by addition of THPTA (3 [tris(3-hydroxypropyltriazolylmethyl)amine) and sodium ascorbate to 5 mM and CuS0 4 to 0.5 mM.
  • Preformed 4RepCT Aha fibres were labelled with FAM alkyne or Alexa Fluor 594 similarly to soluble protein, however an increased concentration of Cu[I] was used (5.0 mM). Reactions were protected from light and incubated at room temperature with gentle rocking for a period of 4 hours. After the incubation period the fibres were removed to 15 ml Falcon tubes and washed thoroughly with 20 mM Tris pH 7.5 three times after which the Tris buffer was replaced with 10% DMSO in water and incubated overnight at room temperature with gentle rocking.
  • L-Aha was incorporated into three methionine sites located in the C-terminal domain of 4RepCT distant from the essential cysteine residue ( Figure 2b). Incorporation of L-Aha did not affect expression of the protein which was purified as described previously yielding around 20-30 mg/L with high purity.Fibre formation was initiated by thrombin, enterokinase or Lys-C removing thioredoxin from the fusion protein. SDS PAGE analysis revealed free thioredoxin present in the thrombin and enterokinase digestions ( Figure 3a lanes 1 and 2).
  • Fluorophore labelled soluble 4RepCT AHA retains the ability to form fibres
  • linker-labelled and levofloxacin control fibres were placed into UPLC grade methanol containing 50 mM levofloxacin and refluxed at 65 °C for 18 hours (non-functionalised fibre was refluxed in methanol only).
  • Post reflux fibres were removed and washed with 2 ml of methanol four times and 2 ml of buffer containing 20 mM Tris pH 7.5, 1 mM EDTA twice. Fibres were stored in methanol. Zone of inhibition assay
  • the ability of the Levofloxacin functionalised fibres to inhibit growth of E. coli NCTC 12242 was tested by means of a zone of inhibition assay and by monitoring cell density of liquid cultures.
  • a culture of E. coli NCTC 12242 was grown with shaking (180 rpm) at 37°C in Mueller Hinton broth (Oxoid) to an OD 6 oo 0.1 and diluted 100 x in the same medium.
  • the diluted culture was thoroughly spread onto Mueller-Hinton agar (Oxoid) plates using a cotton swab.
  • the levofloxacin functionalised and control fibre types both gave zones of inhibition after 24 hours incubation, however the non- functionalised fibre did not produce a zone ( Figure 8).
  • the levofloxacin functionalised fibre yielded a 3.5 cm diameter zone whereas the control fibre yielded a 2 cm diameter zone.
  • colonies were growing in the previously clear zone of the levofloxacin control fibre but not in the zone generated by the levofloxacin functionalised fibre as shown in Figure 7.
  • the levofloxacin functionalised fibres displayed a sustained release of antibiotic over at least 5 days, preventing the re-colonisation of the initial zone of inhibition. This observation indicates that the inhibition zone was not simply caused by 'burst release' of adsorbed levofloxacin as also displayed by the 4RepCT control fibre, but the successful breakdown of the covalent linker to the conjugated levofloxacin over time.
  • N.B. constructs with and without the Lysine (K) are available.
  • an Arginine(R) takes its place.
  • the extra Lysine provides an amine group to modify; it does not take the place of a methionine as azidohomoalanine does, therefore spidroin can be made to contain azides and a unique amine i.e. two points of functionalisation. Spider silks have either no or a very small number of lysine residues and these are normally non-critical hence these can be removed leaving lysines only at positions for attaching ligands.
  • the lysine amine can be modified using standard peptide coupling reagents to form amides. It could also be oxidised in the presence of a nitrous acid to convert the amine to an azide.
  • the lysine side chain can also react with aldehydes/ketones to form Imines that can then be reduced to amines or the amine can act as a nucleophiles reacting with alpha-halo acetate or acetamide to give an amine linkage.
  • Other reactions of amines in proteins will be well known to those skilled in the art.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Insects & Arthropods (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The invention relates to a modified spidroin, comprising spidroin modified to comprise azide, alkyne, allyl or amine moieties; a spider silk material; a conjugate of spidroin and an active molecule linked by a triazole or amide; a tissue scaffold, implant, wound dressing, or suture, comprising the modified spidroin; methods of forming and modifying spidroin; and methods of treatment comprising the administration of the modified spidroin.

Description

MODIFIED SPIDER SILK
This invention relates to spider silk composites; their methods of manufacture and applications thereof.
Spiders can produce up to seven different types of silk, each intended for a specific purpose. Dragline silk is the strongest type of silk and is used by the spider to create the structural 'spokes' of a web, and as a life line to evade predators. ("The Biology of Spiders" by Rainer F. Foelix, 2nd ed. New York: Oxford University Press; 1996). As well as strength, dragline silk also exhibits intrinsic biodegradability, biocompatibility and minimal bacterial adherence (Leal-Egana, A. and Scheibel, T. (2010), Silk-based materials for biomedical applications. Biotechnology and Applied Biochemistry, 55 : 155-167. doi: 10.1042/BA20090229). These attributes make dragline silk an attractive candidate for use in biomedical applications, and was in fact used by the ancient Greeks as a wound dressing (as reviewed in Goodacre 2012. Conservation and Diversification of Spider Silk: An Evolutionary Perspective and in Silk: properties, production and uses; Nova Publishers & WRIGHT, SIMON and GOODACRE, SARA L, 2012 Evidence for antimicrobial activity associated with common house spider silk. BMC research notes. 5, 326). Current research has expanded this principle and targeted applications such as cell matrices for tissue engineering and drug delivery are two examples of its modern day application (Lammel A, et al : Recombinant spider silk particles as drug delivery vehicles. Biomaterials, 2011, 32:2233-2240; Allmeling C, et al. : Use of spider silk fibres as an innovative material in a biocompatible artificial nerve conduit, Journal of Cellular and Molecular Medicine 2006, 10(3):770-777).
Unfortunately the availability of silk is limited as the territorial and cannibalistic nature of spiders prevents large scale farming. To overcome this problem, several groups have established differing methodologies to produce dragline silk proteins recombinantly in E. coli, and have successfully processed them into a variety of solid structures including fibres, meshes and foams. Importantly, these structures were shown to support the growth of several human cell lines, including human embryonic kidney (HEK) cells and primary chondrocytes. Furthermore subcutaneous implantation of silk fibres into Wistar Rats does not induce a macroscopic immune response; demonstrating that recombinantly produced dragline silks retain their biocompatibility, and as such their potential as biomaterials. However not all cells can be successfully cultured on silk; cells which require specific matrices e.g. fibroblasts, do not adhere or proliferate very well on silk structures. This is because the silk surface does not confer the intermediate wettability properties which fibroblasts prefer to adhere to. A similar problem has been identified in other cell types which need specific surface properties that silk cannot provide. A solution to this is to modify the silk surface with chemical functional groups or biomolecules such as growth factors or cell adhesion peptides. One such peptide that has been successfully use is the arginine-glycine-aspartate (RGD) peptide, a known integrin ligand, commonly found in the extra cellular matrix (ECM). RGD functionalised variants of dragline silk have been created by genetic fusion or chemical modification of cysteine residues, improving fibroblast adhesion and proliferation to match that of fibronectin coated plates acting as positive controls. However using these techniques to create functionalised silk has inherent problems. Genetic manipulation of silk sequences is difficult because of the highly repetitive nature and high GC content of the gene. Furthermore, altering the protein primary sequence may cause mis-folding of the entire protein, resulting in reduced protein yield. Furthermore genetic manipulation can only integrate functional peptide motif sequences, resulting in a protein that contains a linear functional peptide which may not be accessible to impart function if the functionalised region is hidden upon polymerisation or fabrication into macroscopic structures for example.
Chemical modification of cysteine residues offers and alternative route to modify the silk protein with peptides or other functional molecules with good selectivity and reasonable efficiency. Unfortunately, modifying cysteine residues is not appropriate for functionalising silk proteins that self-assemble via C-terminal domain dimerization, since the formation of an essential disulphide bridge would be prevented, thus destroying the self-assembly process.
An aim of the present invention is to provide improved functionalised spider silk material and improved methods of functionalising spider silk material. According to a first aspect of the invention, there is provided a modified spidroin, comprising spidroin modified to comprise azide, alkyne, allyl or amine moieties. According to another aspect of the present invention, there is provided a spider silk material comprising:
-a modified spidroin, comprising spidroin modified to comprise one or more azide, alkyne, allyl or amine moieties. The invention advantageously provides a biomedically applicable functionalised silk biomaterial by a simple and benign chemical method that preserves self-assembly properties. Incorporation of the non-natural amino acid L-azidohomoalanine (L-Aha) into the methionine sites of a self-assembling miniature dragline silk spidroin, 4RepCT, to give 4RepCTAHA. These unique azide functional groups allow highly specific and efficient conjugation to peptides or molecules bearing a chemical group that is reactive to azide, such as a terminal alkyne moiety. The reaction may be via a Copper (I) (Cu(I)) catalysed Huisgen 1-3, dipolar cycloaddition, or 'click reaction' to give a 1-4 triazole product, which is a technique previously not used to modify silks. The 1-4 triazole formed in the Huisgen cycloaddition is a good bioisostere of an amide and is chemically more robust than the reaction between a cysteine thiol and a maleimide. Modifying spider silk using click chemistry offers a novel and versatile way to produce functionalised silk protein structures; custom designed to best fit an intended application. Advantageously, the spider silk material or conjugate is biocompatible. The term "biocompatible" is understood to include non-toxic to the human or animal body. To be biocompatible, the spider silk material may not cause an immune response. The spider silk material or conjugate may be biodegradeable. The term "biodegradeable" is understood to include the ability to breakdown over time in the tissue or body of a human or animal, and/or in the environment. The "spidroin" may be "major ampullate spidroin" and encompass all known major ampullate spidroin proteins, typically abbreviated "MaSp", or "ADF" in the case of Araneus diadematus. The spidroin may comprise dragline silk spidroin. The spidroin may comprise 4repCT spidroin. The modified spidroin may comprise the sequence of SEQ ID NO: 5. The modified spidroin may comprise the sequence of SEQ ID NO: 5, or a variant thereof having at least 50% sequence similarity to SEQ ID NO: 5. In another embodiment, the variant may have at least 80% similarity to SEQ ID NO: 5. The variant may have at least 90% similarity to SEQ ID NO: 5. The variant may have at least 95% similarity to SEQ ID NO: 5. The variant may have at least 98% similarity to SEQ ID NO: 5. The variant may have at least 99% similarity to SEQ ID NO: 5. The variant may comprise one or more non-natural azido amino acid residues in place of one or more methionine residues of an equivalent non-modified or wild-type sequence. The modified spidroin may comprise the sequence of SEQ ID NO: 5, or a variant thereof having at least 50% sequence identity to SEQ ID NO: 5. In another embodiment, the variant may have at least 80% identity to SEQ ID NO: 5. The variant may have at least 90% identity to SEQ ID NO: 5. The variant may have at least 95% identity to SEQ ID NO: 5. The variant may have at least 98% identity to SEQ ID NO: 5. The variant may have at least 99% identity to SEQ ID NO: 5. The modified spidroin may comprise the sequence of SEQ ID NO: 3 or 4, further modified to comprise one or more non-natural amino acid residues comprising azide, alkyne, allyl or amine moieties in place of the one or more amino acid residues. The modified spidroin may comprise the sequence of SEQ ID NO: 3 or 4, further modified to comprise one or more non-natural amino acid residues comprising azide, alkyne, allyl or amine moieties in place of the one or more methionine residues.
Reference to sequence identity or similarity may be across the entire length of the sequence of SEQ ID NO: 5. Sequence identity may be determined using BLAST alignment (NCBI) under standard parameters. The spidroin may be spidroin 1 or 2. It is understood that spidroin 2 has an additional lysine handle in addition to the azide. This would allow two sites of possible modification if desired. The skilled person may select an appropriate spidroin for modification according to the invention. For example, the spidroin may be from an unmapped species, having differing physical properties than other known spidroins. The skilled person may determine the properties required for any particular application and apply the modification of the invention to the spidroin.
The spidroin may comprise a spidroin capable of self-assembly, for example with or without a modification according to the invention. The spidroin may comprise any spidroin without structurally important (e.g. secondary or tertiary structurally important) methionine residues.
The spidroin may comprise non-natural modified spidroin, for example, spidroin comprising one or more non-natural amino acids. The spidroin may be encoded in a gene with an amber codon, for a specific incorporation of a non-natural amino acid comprising a linking moiety.
The spidroin may comprise a lysine residue, which provides an amine group to modify. For example, for at least two points of linkage/functionalisation. The lysine amine may be modified using standard peptide coupling reagents to form an amide. The lysine residue may be oxidised in the presence of a nitrous acid to convert the amine to an azide. The lysine side chain may also be reacted with aldehydes/ketones to form Imines that can then be reduced to amines or the amine can act as a nucleophiles reacting with alpha-halo acetate or acetamide to give an amine linkage. Other reactions of amines in proteins will be well known to those skilled in the art. The spidroin may be fused to a fusion partner. Fusion partners according to the invention include any protein fragment which improves the solubility and/or stability of its partner protein fragment, here the spidroin protein according to the invention. The fusion partner may also provide a suitable handle for affinity purification. Without being limited thereto, examples of fusion partners according to the invention include thioredoxin, maltose-binding protein, glutathione S-transferase (GST), MTB32-C, Gbl, ZZ, His-tag, Avi-tag and Nus A. The skilled person is well aware of alternative suitable fusion partners.
The fusion partner may be a thioredoxin moiety (ThrX). The fusion partner may be a thioredoxin moiety (ThrX) in combination with a His tag and/or an S tag.
The spidroin and fusion partner may comprise a cleavage enzyme recognition site. The cleavage enzyme recognition site may be situated between the spidroin and the fusion partner such that cleavage at the recognition site results in a spidroin protein and a separated fusion partner. Examples of the cleavage agent recognition site according to the invention include an enterokinase recognition site, a Lys-C recognition site, or a thrombin recognition site. The skilled person will recognise that alternative cleavage enzymes are available, which will recognise their appropriate cleavage enzyme recognition site. The cleavage agent recognition site may comprise an enterokinase recognition site. Advantageously, enterokinase acts at a DDDK cleavage site and will not break down sensitive groups such as peptides that may be attached to the spidroin. The azide moiety may be arranged to react in a 'click' reaction. The azide moiety may be arranged to react with an alkyne moiety, for example presented on an active molecule to be linked, and form a triazole linkage. The alkyne moiety may be arranged to react in a 'click' reaction. The alkyne moiety may be arranged to react with an azide moiety, for example presented on an active molecule to be linked, and form a triazole linkage.
Such triazole linkages are formed through the process of chemical ligation methods, such as a Cul-catalysed [3+2] Azide-Alkyne Cycloaddition (CuAAC) reaction, Iodine or heat catalysed Huisgen cycloaddition or the Strain-Promoted Alkyne Azide Cycloaddition (SPAAC) reaction between azide and cyclooctyne-modified molecules (copper-free click ligation). The triazole linkage may be a result of a copper-free SPAAC click reaction, which advantageously does not require copper catalysis. The copper free click ligation is compatible with large biomolecules and can be carried out in any biologically compatible buffer. The presence of copper causes degradation of long DNA and RNA molecules, so the avoidance of copper is advantageous. Copper-free click ligation can also be carried out in conditions under which some molecules may be unstable.
The alkyne group may be strained by being part of a ring, for example a cycloalkyne such as a cyclooctyne. In particular, a dibenzocyclooctyne is highly suitable for use attached to biomolecules that are used in fast SPAAC reactions with azides. The conjugated aromatic rings impose ring strain and electron withdrawing properties on the alkyne, making it react very quickly with azides. Substituents to the ring may be used to increase or decrease the reactivity of the alkyne. The strained alkyne group may comprise a substituted cyclooctyne.
The strained alkyne used in the present invention may be any strained alkyne group. In one embodiment the strained alkyne may be within a ring structure, for example a cycloalkyne or a cyclic compound where the ring comprises carbon atoms and one or more heteroatoms, for example, one or more nitrogen, sulphur or oxygen atoms in the ring. The strained alkyne group may comprise a 7 to 9 membered ring. The strained alkyne group may comprise a substituted 7 to 9 membered ring. In one embodiment the strained alkyne may comprise an 8 membered ring, or a substituted 8 membered ring. The substituted or unsubstituted 8 membered ring may comprise 8 carbon atoms in the ring or may comprise one or more nitrogen, sulphur or oxygen atoms in the ring in addition to carbon atoms. The strained alkyne group may comprise a cyclooctyne. The strained alkyne group may comprise a substituted cyclooctyne. The strained alkyne group may comprise a cyclic compound having at least one heteroatom in the ring. The strained alkyne group may comprise a dibenzocyclooctyne (DIBO) group. The heteroatom may be at any position in the ring. In one embodiment there is one heteroatom in the ring. It is advantageous to provide a strained alkyne that is reactive enough to perform the SPAAC reaction under laboratory conditions, for example because it can react in water or buffer at normal room temperature, for example 20°C, but that is also stable under laboratory conditions, for example it is stable in water, oxygen stable and stable at normal room temperature.
The azide moiety may be arranged to form a triazole linkage with an alkyne group provided by a molecule, such as an active molecule. In an alternative embodiment, the azide moiety may be arranged to provide a Staudinger ligation with a phosphine or phosphite group provided on a molecule, such as an active molecule. Alternatively, the alkyne moiety may be arranged to form a triazole linkage with an azide group provided by a molecule, such as an active molecule.
The chemistry of linking using allyl groups is well known to those skilled in the art.
Azide, alkyne, allyl or amine moieties may be provided on non-natural amino acids. The non-natural amino acid may comprise an amino acid modified with an azide group, an alkyne group, an allyl group, or an amine group. The non-natural amino acid may comprise an amino acid azide. The non-natural amino acid may comprise an alkyne- comprising amino acid. The non-natural amino acid may comprise an allyl-comprising amino acid. The non-natural amino acid may comprise an amine-comprising amino acid. The non-natural amino acid may be a methionine analogue. The non-natural amino acid may be an analogue of any one of the 20 natural amino acids. The amino acid azide may be a methionine analogue or derivative having an azide group. The non-natural amino acid may comprise L-azidohomoalanine (L-Aha), azidoalanine, L- homopropargylglycine (L-Hpg), L-homoallylglycine (L-Hag),Jra«s-crotonylglycine (L- Tcg), Azidonorvaline.
A range of non-natural amino acids (e.g. capable of providing linking groups such as azide, alkyne, allyl or amine) may be provided by the mutagenesis methods of Wang et al. (2001. Science, Vol. 292 pp498-500 - incorporated herein by reference) or Chin J.W. et al. (2002. PNAS Vol. 99 No. 17, ppl 1020-11024- incorporated herein by reference), which allow the incorporation of a large range of un-natural/non-canonical amino acids.
The modified spidroin may be formed by incorporation of a non-natural amino acid comprising azide moieties into spidroin. The modified spidroin may be formed by incorporation of a non-natural amino acid comprising alkyne moieties into spidroin. The modified spidroin may be formed by incorporation of a non-natural amino acid comprising allyl moieties into spidroin. The modified spidroin may be formed by incorporation of a non-natural amino acid comprising amine moieties into spidroin. The non-natural amino acids may substitute one or more natural amino acid residues in spidroin. The non-natural amino acids may substitute one or more methionine residues in spidroin.
The spider silk material may comprise a plurality of modified spidroins arranged in a fibre. Spider silk material may comprise a plurality of fibres. The plurality of fibres may be aligned, meshed, interlaced, entwined, braided, weaved or twisted together, or produced by 3D printing.
According to another aspect of the present invention, there is provided a spider silk material comprising
-spidroin; and
-an active molecule linked to the spidroin by a linking moiety. The linking moiety may be a triazole, amine, amide, ether, or carbon-carbon linkage.
The active molecule may be linked to the spidroin by a triazole or amide linkage. The active molecule may be linked to the spidroin by a triazole linkage. The triazole linkage may be a 1,4- or 1,5-triazole linkage. The linkage may be provided by any one of a range of reactions known to those skilled in the art including oxidation, epoxidation, 'ene' and Diels-Alder reaction, 1,3-dipolar cycloaddition 'click' reactions cyclopropanation, light dependent 2+2 cycloaddition. According to another aspect of the present invention, there is provided a conjugate of spidroin and an active molecule linked by a triazole, amine, amide, ether or carbon- carbon linkage.
The active molecule may be linked by a triazole or amide. The active molecule may be linked by a triazole, such as a 1,4- or 1,5-triazole linkage.
The linkage or linking moiety on the spidroin may be located on the conserved c- terminal domain of the spidroin.
The active molecule may be a therapeutically, prophylactically or diagnostically active substance. The active agent may be a bioactive substance. The active molecule may be selected from the group comprising a drug, pro-drug, peptide, protein, and nucleic acid, or combinations thereof. The active molecule may be a label, such as a fluorescent label. The active molecule may comprise or consist of a biomolecule. The active molecule may be a drug, a cell, signalling molecule, such as a growth factor, or any other suitable active agent. For example, the active molecule may comprise amino acids, peptides, proteins, sugars, antibodies, nucleic acid, antibiotics, such as levofloxacin, antimycotics, growth factors, nutrients, enzymes, hormones, steroids, synthetic material, synthetic polymers, ceramic beads or surfaces, glass beads or surface, organometallic agents/metal chelates, PEG, PLGA, drugs, nanoparticles (such as gold, silver, quantum dots, and/or carbon nanotubes), adhesion molecules, small molecule and protein based fluorophores, colourants/dyes (which may be used for identification), radioisotopes (which may be for X-ray detection and/or monitoring of degradation), spectroscopic probes (such as gadolinium, manganese and iron contract agents), nitroxyl single electron paramagnetic agents, PET agents and other suitable constituents, or combinations thereof. In one embodiment, the active molecule may comprise levofloxacin. Combinations of active molecules may be linked to the spidroin. Additionally or alternatively different spidroins may be linked to different active molecules and the different spidroins combined into the same fibre. The active molecule may be heat stable, for example, the active molecule may be capable of autoclaving under sterilising conditions. The active molecule may be heat sensitive and/or pH sensitive. The active molecule may be labile, degraded, inactivated, or denatured at temperatures above at least about 30°C. The active molecule may be labile, degraded, inactivated, or denatured at temperatures above at least about 50°C. The active molecule may be labile, degraded, inactivated, or denatured at temperatures above at least about 70°C. The active molecule may be labile, degraded, inactivated, or denatured at temperatures above at least about 100°C. The active molecule may be labile, degraded, inactivated, or denatured at temperatures above at least about 150°C. The active molecule may be labile, degraded, inactivated, or denatured at a pH <6. The active molecule may be labile, degraded, inactivated, or denatured at a pH >8. The active molecule may be released from the fibre by exposure to light, heat, sound, enzymes, oxygen, fluoride ions and/or pH changes.
The active molecule may comprise a linker for reacting and forming a link with the azide, alkyne, allyl or amine moieties on the modified spidroin. The linker may comprise a moiety capable of reacting and forming a link with one of azide, alkyne, allyl or amine moieties on the modified spidroin. The linker may comprise an alkyne, for example to form a link by reaction with an opposing azide group on the spidroin. In another embodiment, the linker may comprise an azide, for example to form a link by reaction with an opposing alkyne group on the spidroin. In one embodiment, the linker may comprise glycidyl propargyl ether. The active molecule may be linked to the linker by a covalent bond, for example via an ester bond.
According to another aspect of the present invention, there is provided a tissue scaffold, implant, wound dressing, or suture, comprising the spider silk material or conjugate of the invention herein. According to another aspect of the present invention, there is provided a substrate suitable for site specific delivery and/or localisation of an active molecule, the substrate comprising the spider silk material of the invention herein. According to another aspect of the present invention, there is provided a method of modifying spidroin with azide moieties, comprising expressing a gene encoding spidroin in a methionine auxotrophic cell in the presence of methionine-analogous non- natural amino acid residues comprising an azide moiety, such that the methionine- analogous non-natural amino acids are incorporated in place of methionine residues.
According to another aspect of the present invention, there is provided a method of modifying spidroin with a linking moiety, such as an azide, alkyne, allyl or amine, comprising expressing a gene encoding spidroin in a methionine auxotrophic cell in the presence of methionine-analogous non-natural amino acid residues comprising the linking moiety, such that the methionine-analogous non-natural amino acids are incorporated in place of methionine residues.
The methionine auxotrophic cell may be E. coli, such as, E. coli DL41. The cell may be cultured in a methionine-free medium. The methionine-free medium may comprise the methionine-analogous non-natural amino acid. The methionine-analogous non-natural amino acid may comprise L-azidohomoalanine (L-Aha) or azidoalanine. The methionine-analogous non-natural amino acid may comprise L-azidohomoalanine (L- Aha). The gene may encode spidroin with a fusion partner according to the invention. According to another aspect of the present invention, there is provided a method of modifying spidroin with a linking moiety, such as an azide, alkyne, allyl or amine, comprising expressing a gene encoding spidroin in a cell with an orthogonal set of tRNA, aminoacyl tRNA synthetase, and codon, wherein the tRNA bears a non-natural amino acid residue comprising the linking moiety, such that the non-natural amino acid comprising the linking moiety is incorporated into the spidroin. The method may use the mutagenesis methods of Wang et al. (2001. Science, Vol. 292 pp498-500) or Chin J.W. et al. (2002. PNAS Vol. 99 No. 17, ppl 1020-11024). The method may comprise the use of an exogenous tRNA synthetase pair. The codon may be an amber codon encoded in the spidroin gene.
According to another aspect of the present invention, there is provided a method of forming a spider silk material of the invention herein, comprising:
the expression of spidroin with a fusion partner in a methionine auxotrophic cell in the presence of methionine-analogous non-natural amino acid residues comprising a linking moiety, such that the methionine-analogous non-natural amino acids are incorporated in place of methionine residues to form modified spidroin with a fusion partner;
extracting the modified spidroin with the fusion partner; and
cleaving the fusion partner from the modified spidroin to form one or more fibres from a plurality of the modified spidroins.
The linking moiety may comprise azide, alkyne, allyl or amine.
Extracting the modified spidroin may comprise purification of the modified spidroin and fusion partner. The modified spidroin and fusion partner may be affinity tagged, such that it can be purified on an affinity column. The affinity tag may comprise a His- tag, avi-tag, biotin, sortase tag, glutatione S-transferase (GST), maltose-binding protein (MBP). Cleaving the fusion partner from the modified spidroin may be by the addition of a cleavage enzyme recognising a cleavage enzyme recognition site between the modified spidroin and the fusion partner. The cleavage may be mediated by thrombin, enterokinase,Lys-C, TEV, Factor Xa, or Lysostaphin. The modified spidroin may be formed into fibres ranging from 5 nm to at least 10 cm in length. The method may further comprise twisting, weaving, braiding, interlacing or 3D printing the one or more fibres to form a multiple -fib ered spider silk or mesh of spider silk fibres. The method may further comprise reacting the linking moiety on the modified spidroin with an active molecule comprising a reactive group capable of reacting with linking moiety and forming a link between the spidroin and the active molecule. The linking of the active molecule may be before fibre formation, for example, before cleavage of the fusion partner, or after fibre formation. In one embodiment, the linking is carried out after fibre formation.
According to another aspect of the invention, there is provided a method of treatment comprising the administration of the spider silk material or conjugate according to the invention to a subject.
The treatment may be for treatment or prevention of a disease, tissue repair or tissue replacement. The treatment may be wound treatment.
The subject may be a mammal. The subject may be human.
According to another aspect of the invention, there is provided the spider silk material or the conjugate according to the invention for use in the treatment or prevention of a disease, tissue repair or tissue replacement. According to another aspect of the invention, there is provided the use of the spider silk material or the conjugate according to the invention for tissue engineering, tissue repair, tissue support, tissue replacement, cavity filling, or drug delivery.
The spider silk material or conjugate of the invention may be used in an implant; medical product, such as wound closure system, band-aid, suture, wound dressing; or scaffold for tissue engineering and guided cell regeneration. The skilled person will understand that optional features of one embodiment or aspect of the invention may be applicable, where appropriate, to other embodiments or aspects of the invention. The term "fibre" as used herein relates to polymers having a thickness of at least 5 nm, preferably macroscopic polymers that are visible to the human eye, i.e. having a thickness of at least 5 nm, and have a considerable extension in length compared to its thickness, preferably above 5 mm. The term "fibre" does not encompass unstructured aggregates or precipitates.
Embodiments of the invention will now be described in more detail, by way of example only, with reference to the accompanying drawings.
Figure 1: An overview of the insertion of L-Aha into methionine sites of 4repCTAHA, subsequent click chemistry labelling with fluorophore (FAM) and processing into fibres following incubation with thrombin, enterokinase or Lys- C.
Figure 2 Non-natural amino acids and a schematic representation of 4RepCTAha. (a) The non-natural amino acid methionine surrogates, J-azidohomoalanine
(left) and L- homopropargylglycine (right), (b) Composition of 4RepCTAha; the light grey boxes represent poly-alanine blocks and the dark grey box represents a serine and alanine rich tract. Lines represent glycine rich tracts. The non- repetitive C-terminal domain is represented by a circle. Non-natural amino acid substitution sites are shown in the primary sequence of the C-terminal domain as underlined methionines.
Figure 3: A 15% SDS PAGE gel showing the enzymatic digestion of the
Aha
4RepCT fusion protein and a resulting fibre, (a) Removal of thioredoxin using thrombin (lane 1), enterokinase (lane 2) and Lys-C (lane 3). Molecular weight markers are shown on the left in kDa. (b) A fibre of 6.5 cm in length
Aha
made from 2ml of soluble 4RepCT at ~ 2 mg/ml. Figure 4: A 15% SDS PAGE gel showing soluble 4RepCTAha labelled with FAM and resulting fibre after enzymatic digestion, (a) A fluorescent band at 37 kDa corresponding to 4RepCTAha fusion protein, (b) A ~3 cm fibre produced from FAM labelled 4RepCTAha glowing green upon exposure to UV.
Figure 5: Fluorescence light microscope images of 4RepCTAha fibres and control fibres. The labelled 4RepCTAha fibres in the left hand panel display fine details of fibrillar bundles. Control fibres, located in the right hand panel, display the same fibrillar bundling with less detail and do not show any fluorescence.
Figure 6: Structures of (a) glycidyl propargyl ether linker, (b) levofloxacin and (c) levofloxacin conjugated to the linker via an ester bond.
Figure 7: A bar chart showing optical densities of E. coli NCTC 12242 liquid cultures after 28 hours incubation with non- functionalised (non mod silk), levofloxacin control (lev Ctrl silk) and levofloxacin-functionalised (lev mod silk) fibres. Data is the mean of 3 replicates, error bars show standard error of the mean. A two tailed t-test was used to determine significance.
Figure 8: Muller-Hinton agar plates showing zones of inhibition of E. coli NCTC 12242 in the presence of levofloxacin control and levofloxacin- functionalised fibres. Incubation periods are displayed on the left and fibre types displayed above.
The present study aims create biomedically applicable functionalised silk biomaterials using a simple and benign chemical method that preserves self-assembly properties. To achieve this, the non-natural amino acid L-azidohomoalanine (L-Aha) was incorporated into the methionine sites of a self-assembling miniature dragline silk spidroin, 4RepCT, to give 4RepCTAHA. These unique azide functional groups allow highly specific and efficient conjugation to peptides or molecules bearing a terminal alkyne moiety, via a Copper (I) (Cu(I)) catalysed Huisgen 1-3, dipolar cycloaddition, or 'click reaction', or similar, to give a 1-4 triazole product; a technique previously not used to modify silks. This study demonstrates the labelling of 4RepCTAHA with alkyne fluorophores without destroying the self-assembly capabilities of the miniature spidroin.
Methods and Materials
Transformation of methionine auxotroph DL41
E. coli DL41 were transformed with pJExpress401 plasmid containing the silk fusion protein gene (SEQ ID NO: 5) The gene was codon optimised for E. Coli and encoded the following; His6 tag/ sol tag/ Thioredoxin/ Enterokinase site/ Lys-C site/ Thrombin site/ 4RepCT. Transformed bacteria were streaked onto LB agar plates containing kanamycin and incubated at 37 °C. Das = enzymatic cleavage sites that release thioredoxin, triggering fibre formation.
Expression and purification of silk spidroin fusion protein.
For non-azido-containing silk protein, 4RepCT, selected DL41 colonies were grown at 37°C in Luria-Bertani media containing kanamycin (LB1^1^) to an OD6oo of 1.0 - 1.4, induced with 1 mM IPTG and incubated for a further 4 hours at 37°C with added serine, alanine and glycine (1.6 g/1, 0.4 g/1, 0.4 g/1). For azido-containing silk protein 4RepCTAhaDL41 cells were grown at 37°C in M9 minimal media containing kanamycin and all amino acids (M9KANMet+) to an OD600 of 1.0 - 1.4 (Strub et al, Structure, 2003, 11, 1359 - 1367). Cells were then transferred to M9 minimal media with 50mg/L L- azidohomoalanine in place of methionine (M9KANAha+), induced with 1 mM IPTG and incubated overnight at 25 °C. After respective induction periods cells were harvested by centrifugation and lysed by sonication in buffer containing 20 mM Tris pH 7.5, 400 mM NaCl, 15 mM imidazole (buffer A). Lysate was then clarified by centrifugation and loaded onto a Ni-IMAC column (GE life sciences). Loosely bound proteins were washed off the column by buffer A. Tightly bound silk protein was eluted from the column with approximately 250 mM imidazole in buffer containing 20 mM Tris pH 7.5 and 400 mM NaCl. Elution fractions identified by SDS PAGE to contain silk protein were pooled and dialysed against 20 mM Tris pH 8.0.
Fibre formation
Fibres were made from labelled and un-labelled silk protein by incubation with thrombin, Lys-C or Enterokinase at an enzyme: fusion protein ratio of 1 : 1000 w/w. Cleavage was achieved at a fusion protein concentration of approximately 2 mg/ml, 1 mM potassium phosphate and a total volume of 1- 3 ml. Reaction was incubated at 30°C with gentle rocking for a period of 4 hours, after which 1-10 cm long fibres were visible. Samples of the reaction were analysed by SDS PAGE.
Click chemistry
Soluble TRXGSMaSpl Aha+ was labelled with 0.1 mM FAM alkyne (3'-Hydroxy-6'-(2- propyn-l-yloxy)-3H-spiro[2-benzofuran-l,9'-xanthen]-3-one)) or 0.1 mM Alexa Fluor 594 alkyne (carboxamido-(5-(and 6-)propargyl), bis(triethylammonium salt)). Cu[I] was generated in situ by addition of THPTA (3 [tris(3-hydroxypropyltriazolylmethyl)amine) and sodium ascorbate to 5 mM and CuS04 to 0.5 mM.
Preformed 4RepCTAha fibres were labelled with FAM alkyne or Alexa Fluor594 similarly to soluble protein, however an increased concentration of Cu[I] was used (5.0 mM). Reactions were protected from light and incubated at room temperature with gentle rocking for a period of 4 hours. After the incubation period the fibres were removed to 15 ml Falcon tubes and washed thoroughly with 20 mM Tris pH 7.5 three times after which the Tris buffer was replaced with 10% DMSO in water and incubated overnight at room temperature with gentle rocking.
Fluorescence imaging
Labelled fibres were placed onto glass cover slips of 1.5 mm thickness and imaged using a Nikon Eclipse Ti fluorescence microscope with FITC (467-498 excitation 513- 556 emission) and Texas Red (542-582 excitation 604-644 emission) filter cubes. Silks were observed under 60 X (Nikon Apo TIRF NA 1.49 oil immersion objective) and 4 X (Nikon Plan Fluor NA 0.13 objective) magnification. Results
4RepCT forms macroscopic fibres
Under the transcriptional control of the T5 promoter, L-Aha was incorporated into three methionine sites located in the C-terminal domain of 4RepCT distant from the essential cysteine residue (Figure 2b). Incorporation of L-Aha did not affect expression of the protein which was purified as described previously yielding around 20-30 mg/L with high purity.Fibre formation was initiated by thrombin, enterokinase or Lys-C removing thioredoxin from the fusion protein. SDS PAGE analysis revealed free thioredoxin present in the thrombin and enterokinase digestions (Figure 3a lanes 1 and 2). Due to the presence of multiple Lys-C cleavage sites in thioredoxin this band was not evident in the Lys-C digestion (Figure 3a lane 3). A small amount of un-cleaved protein was observed across all three reactions, which can be attributed to not allowing enough time for complete digestion. Fibres of 6-10 cm in length were produced after 4 hours incubation with each enzyme (Figure 3b). These fibres remained intact after autoclaving.
Fluorophore labelled soluble 4RepCTAHA retains the ability to form fibres
To assess whether labelling would prevent self-assembly of the spidroin into macroscopic fibres, soluble 4RepCTAHA (spidroin and thioredoxin) was first labelled with FAM. There was no evidence of precipitation of protein or click reagents during the labelling procedure. Samples of the labelling reaction were loaded onto an SDS PAGE gel and visualised under UV light revealing a fluorescent band of corresponding weight to thioredoxin fused 4RepCTAHA(Figure 4a). This indicated that a successful click reaction had taken place and subsequently the reaction was dialysed to remove excess labelling reagents. Enzymatic removal of thioredoxin resulted in the formation of a fluorescent fibre approximately 3 cm in length (Figure 4b). This demonstrated that self-assembly was unperturbed, and the C-terminal domain was still able to form homo- dimers and the disulphide bridge essential for polymerisation.
Click Chemistry can be performed on preformed 4RepCTAha fibres Pre-formed 4RepCTAha fibres were also labelled with either FAM or Alexa Fluor (Figure 5). Instead of dialysis, vigorous washing in 10% DMSO followed by storage in 40% methanol was used to remove excess labelling reagents, with no deleterious effects to fibre structure observed. To the naked eye modified fibres retained fluorescence deep colouration after washing, whereas control silks that did not contain L-Aha, rapidly reverted to the colour of the undyed fibres (Figure 5). Visualisation with excitation of the fluorophores under identical conditions of labelled and control fibres at 60 X magnification revealed their fibrillar structure. Labelled fibres showed uniform fluorescence throughout the fibre structure; whereas control fibres did not display any fluorescence (Figure 5).
The data presented here demonstrates that our novel method permits click chemistry mediated functionalisation of spider silk protein. Additionally we have shown the successful modification of preformed fibres and soluble 4RepCTAha protein with alkyne fluorophores under physiological conditions. Being able to functionalise the silk protein using benign reaction conditions broadens the potential to decorate silk structures with sensitive functional molecules e.g. other proteins or enzymes that may become inactive if exposed to anything other than physiological conditions. Conjugation 4RepCT a with levofloxacin
To produce levofloxacin functionalised 4RepCT3Aha fibres 9.27 mM of the alkyne bearing linker (glycidyl propargyl ether ) (see figure 6) was first conjugated (Cu [I] was generated in situ as described in 'conjugation with fluorophores') at room temperature for four hours with gentle rocking (In the case of non- functionalised and levofloxacin control fibres, linker was replaced with water). After incubation, fibres were removed from the reaction mixture and washed with 1 ml of buffer containing 20 mM Tris pH 7.5, 1 mM EDTA four times. After washing, linker-labelled and levofloxacin control fibres were placed into UPLC grade methanol containing 50 mM levofloxacin and refluxed at 65 °C for 18 hours (non-functionalised fibre was refluxed in methanol only). Post reflux, fibres were removed and washed with 2 ml of methanol four times and 2 ml of buffer containing 20 mM Tris pH 7.5, 1 mM EDTA twice. Fibres were stored in methanol. Zone of inhibition assay
The ability of the Levofloxacin functionalised fibres to inhibit growth of E. coli NCTC 12242 was tested by means of a zone of inhibition assay and by monitoring cell density of liquid cultures. A culture of E. coli NCTC 12242 was grown with shaking (180 rpm) at 37°C in Mueller Hinton broth (Oxoid) to an OD6oo 0.1 and diluted 100 x in the same medium. The diluted culture was thoroughly spread onto Mueller-Hinton agar (Oxoid) plates using a cotton swab. Approximately 1 cm of non- functionalised, levofloxacin control and levofloxacin-functionalised fibres (previously purged of methanol by Pasteur pipette aspiration, washed twice in 2ml buffer containing 20 mM Tris pH 7.5 and 1 mM EDTA and soaked for 72 hours in buffer containing 50 mM MES pH 5.5) were placed in the centre of the agar plate. Plates were incubated at 37°C for 120 hours.
Inhibition of bacterial growth in liquid medium
Approximately 1 cm of non- functionalised, levofloxacin control and levofloxacin- functionalised fibres (previously purged of methanol and washed twice in buffer containing 20 mM Tris pH 7.5 and 1 mM EDTA) were equilibrated in tubes containing 2 ml LB broth and incubated at 37°C for 18 hours (triplicate of each fibre type). After incubation, 10 μΐ of an overnight LB broth culture of E. coli NCTC 12242 was added to each 2 ml of LB broth containing fibres and LB alone, again in triplicate. Tubes were incubated at 37°C with shaking (180 rpm) and OD6oo measured after 28 hours.
After a 28 hour incubation period of liquid cultures, the levofloxacin functionalised fibre had significantly reduced bacterial cell density to -50% of the other fibre types and LB alone (two tailed t-test p= <0.01) (Figure 7). The levofloxacin functionalised and control fibre types both gave zones of inhibition after 24 hours incubation, however the non- functionalised fibre did not produce a zone (Figure 8). The levofloxacin functionalised fibre yielded a 3.5 cm diameter zone whereas the control fibre yielded a 2 cm diameter zone. Upon further incubation (120 hours), colonies were growing in the previously clear zone of the levofloxacin control fibre but not in the zone generated by the levofloxacin functionalised fibre as shown in Figure 7. Thus the levofloxacin functionalised fibres displayed a sustained release of antibiotic over at least 5 days, preventing the re-colonisation of the initial zone of inhibition. This observation indicates that the inhibition zone was not simply caused by 'burst release' of adsorbed levofloxacin as also displayed by the 4RepCT control fibre, but the successful breakdown of the covalent linker to the conjugated levofloxacin over time.
Nucleic acid sequences
Thioredoxin 4RepCT with EntK, Lys-C and Thrombin cleavage sites (without unique Lysine) (SEP ID NO: 1)
ATGGCACATCATCACCACCACCACAAAGAAACCGCGGCTGCAAAATTCGAACGTCAACACATGGACAGCTCCAGCGGT CTGGTTCCGCAGGGATCTATGAGCGATAAAATTATTCACCTGACTGACGACAGTTTTGACACGGATGTACTCAAAGCG GACGGGGCGATCCTCGTCGATTTCTGGGCAGAGTGGTGCGGTCCGTGCAAAATGATCGCCCCGATTCTGGATGAAATC GCTGACGAATATCAGGGCAAACTGACCGTTGCAAAACTGAACATCGATCAAAACCCTGGCACTGCGCCGAAATATGGC ATCCGTGGTATCCCGACTCTGCTGCTGTTCAAAAACGGTGAAGTGGCGGCAACCAAAGTGGGTGCACTGTCTAAAGGT CAGTTGAAAGAGTTCCTCGACGCTAACCTGGCCggtaccgatgatgatgataagCTtGTTCCGCGTGGaTCCGGTAAC TCGGGTATCCAAGGCCAAGGTGGCTACGGTGGTCTGGGCCAGGGCGGCTATGGCCAAGGCGCTGGCAGCTCCGCGGCA GCTGCAGCGGCCGCAGCTGCGGCCGCCGCCGGTGGCCAGGGTGGTCAGGGCCAAGGCGGCTACGGCCAAGGTAGCGGC GGTAGCGCTGCCGCAGCAGCAGCGGCGGCAGCCGCCGCAGCCGCAGCGGCAGGCCGTGGTCAAGGTGGTTACGGTCAG GGTAGCGGTGGTAATGCGGCAGCGGCGGCAGCAGCCGCAGCGGCAGCCGCCGCGGCGGCGGGTCAGGGTGGTCAGGGC GGTTATGGCCGCCAGTCCCAAGGTGCGGGTAGCGCAGCAGCAGCAGCTGCAGCGGCTGCTGCTGCAGCCGCGGCCGGT TCCGGTCAAGGCGGTTACGGCGGTCAAGGCCAGGGTGGCTATGGTCAAAGCAGCGCAAGCGCGAGCGCGGCCGCGTCT GCGGCGAGCACCGTTGCGAACAGCGTTAGCCGTCTGTCCAGCCCGAGCGCCGTGAGCCGCGTTAGCTCGGCTGTCAGC AGCCTGGTGAGCAATGGCCAGGTCAATATGGCTGCCCTGCCGAACATCATTAGCAATATCAGCAGCTCTGT GTCTGCG AGCGCTCCGGGTGCGAGCGGTTGCGAGGTGATCGTACAGGCGCTGCTGGAAGTCATCACGGCGTTGGTGCAGATTGTC AGCTCTAGCAGCGTTGGTTACATTAACCCAAGCGCGGTTAATCAGATTACTAACGTTGTGGCGAACGCGATGGCCCAG GTCATGGGTTAA
Thioredoxin 4RepCT with EntK, Lys-C and Thrombin cleavage sites (with unique Lysine) (SEP ID NO: 2)
ATGGCACATCATCACCACCACCACAAAGAAACCGCGGCTGCAAAATTCGAACGTCAACACATGGACAGCTCCAGCGGT CTGGTTCCGCAGGGATCTATGAGCGATAAAATTATTCACCTGACTGACGACAGTTTTGACACGGATGTACTCAAAGCG GACGGGGCGATCCTCGTCGATTTCTGGGCAGAGTGGTGCGGTCCGTGCAAAATGATCGCCCCGATTCTGGATGAAATC GCTGACGAATATCAGGGCAAACTGACCGTTGCAAAACTGAACATCGATCAAAACCCTGGCACTGCGCCGAAATATGGC ATCCGTGGTATCCCGACTCTGCTGCTGTTCAAAAACGGTGAAGTGGCGGCAACCAAAGTGGGTGCACTGTCTAAAGGT CAGTTGAAAGAGTTCCTCGACGCTAACCTGGCCggtaccgatgatgatgataagCTtGTTCCGCGTGGaTCCGGTAAC TCGGGTATCCAAGGCCAAGGTGGCTACGGTGGTCTGGGCCAGGGCGGCTATGGCCAAGGCGCTGGCAGCTCCGCGGCA GCTGCAGCGGCCGCAGCTGCGGCCGCCGCCGGTGGCCAGGGTGGTCAGGGCCAAGGCGGCTACGGCCAAGGTAGCGGC GGTAGCGCTGCCGCAGCAGCAGCGGCGGCAGCCGCCGCAGCCGCAGCGGCAGGCAAAGGTCAAGGTGGTTACGGTCAG GGTAGCGGTGGTAATGCGGCAGCGGCGGCAGCAGCCGCAGCGGCAGCCGCCGCGGCGGCGGGTCAGGGTGGTCAGGGC GGTTATGGCCGCCAGTCCCAAGGTGCGGGTAGCGCAGCAGCAGCAGCTGCAGCGGCTGCTGCTGCAGCCGCGGCCGGT TCCGGTCAAGGCGGTTACGGCGGTCAAGGCCAGGGTGGCTATGGTCAAAGCAGCGCAAGCGCGAGCGCGGCCGCGTCT GCGGCGAGCACCGTTGCGAACAGCGTTAGCCGTCTGTCCAGCCCGAGCGCCGTGAGCCGCGTTAGCTCGGCTGTCAGC AGCCTGGTGAGCAATGGCCAGGTCAATATGGCTGCCCTGCCGAACATCATTAGCAATATCAGCAGCTCTGT GTCTGCG AGCGCTCCGGGTGCGAGCGGTTGCGAGGTGATCGTACAGGCGCTGCTGGAAGTCATCACGGCGTTGGTGCAGATTGTC AGCTCTAGCAGCGTTGGTTACATTAACCCAAGCGCGGTTAATCAGATTACTAACGTTGTGGCGAACGCGATGGCCCAG GTCATGGGTTAA
Protein amino acid sequences
Stark 2007 4RepCT sequence (aka construct I) (SEQ ID NP: 3) (Stark, M et al (2007). Biomacromolecules, 5(5), 1695-1701. doi: 10.1021/bm070049y).
GSAMGYLWI QGQGGYGGLGQGGYGQGAGS SAAAAAAAAAAAAGGQGGQGQGGYGQGSGGSAAAAAAAAAAAAAAAGRG QGGYGQGSGGNAAAAAAAAAAAAAAAGQGGQGGYGRQSQGAGSAAAAAAAAAAAAAAGSGQGGYGGQGQGGYGQS SAS ASAAASAASTVANSVSRLS S P SAVS RVS SAVS SLVSNGQVNMAALPNI I SNI S S SVSASAPGAS GCEVI VQALLEVI T ALVQ I VS S S SVGY I N P SAVNQ I TNWANAMAQVMG
Hedhammer 2008 4RepCT sequence (SEQ ID NP: 4)
GGS GNSGIQGQGGYGGLGQGGYGQGAGS SAAAAAAAAAAAAGGQGGQGQGGYGQGS GGSAAAAAAAAAAAAAAAGRGG GYGQGSGGNAAAAAAAAAAAAAAAGQGGQGGYGRQSQGAGSAAAAAAAAAAAAAAGSGQGGYGGQGQGGYGQS SASAS AAASAASTVANSVSRLS S P SAVS RVS SAVS SLVSNGQVNMAALPNI I SNI S S SVSASAPGASGCEVIVQALLEVI TAL VQ I VS S S SVGY I N P SAVNQ I TNWANAMAQVMG N. R. Thomas group 2014 4RepCTAHA sequence (SEQ ID NO: 5)
GSGNSGIQGQGGYGGLGQGGYGQGAGS SAAAAAAAAAAAAGGQGGQGQGGYGQGSGGSAAAAAAAAAAAAAAAGKGQG GYGQGSGGNAAAAAAAAAAAAAAAGQGGQGGYGRQSQGAGSAAAAAAAAAAAAAAGSGQGGYGGQGQGGYGQS SASAS AAASAASTVANSVSRLS SPSAVSRVS SAVS S LVSNGQVNZAAL PNI I SNI S S S VS AS AP GAS GCEVI VQALLEVI TAL VQIVS SS SVGYINPSAVNQITNWANAZAQVZG
Z = L-Azidohomoalanine
K = Lysine
N.B. constructs with and without the Lysine (K) are available. In cases where lysine is not included, an Arginine(R) takes its place.
The extra Lysine provides an amine group to modify; it does not take the place of a methionine as azidohomoalanine does, therefore spidroin can be made to contain azides and a unique amine i.e. two points of functionalisation. Spider silks have either no or a very small number of lysine residues and these are normally non-critical hence these can be removed leaving lysines only at positions for attaching ligands. The lysine amine can be modified using standard peptide coupling reagents to form amides. It could also be oxidised in the presence of a nitrous acid to convert the amine to an azide. The lysine side chain can also react with aldehydes/ketones to form Imines that can then be reduced to amines or the amine can act as a nucleophiles reacting with alpha-halo acetate or acetamide to give an amine linkage. Other reactions of amines in proteins will be well known to those skilled in the art.

Claims

1. A modified spidroin, comprising spidroin modified to comprise azide, alkyne, allyl or amine moieties.
2. The modified spidroin according to claim 1, wherein the spidroin is major ampullate spidroin.
3. The modified spidroin according to claim 1 or claim 2, wherein the spidroin comprises 4repCT spidroin.
4. The modified spidroin according to any preceding claim, wherein the spidroin comprises or consists of the sequence of SEQ ID NO: 5, or a variant thereof having at least 50% sequence similarity to SEQ ID NO: 5.
5. The modified spidroin according to any preceding claim, wherein the azide, alkyne, allyl or amine moiety is arranged to react in a 'click' reaction or amide bond forming reaction; and optionally, wherein the 'click reaction' comprises a Cul-catalysed [3+2] Azide- Alkyne Cycloaddition (CuAAC) reaction, an iodine or heat catalysed Huisgen cycloaddition, the Strain-Promoted Alkyne Azide Cycloaddition (SPAAC) reaction between azide and cyclooctyne-modified molecules (copper-free click ligation), or a Staudinger ligation with a phosphine or phosphite group provided on a molecule, such as an active molecule.
6. The modified spidroin according to any preceding claim, wherein the azide, alkyne, allyl or amine moieties are provided on non-natural amino acids.
7. The modified spidroin according to claim 6, wherein the non-natural amino acid comprises an amino acid azide or amino acid alkyne.
8. The modified spidroin according to claim 1, wherein the amino acid azide is a methionine analogue or derivative having an azide group.
9. The modified spidroin according to any preceding claim, wherein the spidroin is fused to a fusion partner.
10. The modified spidroin according to claim 9, wherein the fusion partner is a thioredoxin moiety (ThrX) in combination with a His tag and/or an S tag.
11. The modified spidroin according to claim 9 or 10, wherein the spidroin and fusion partner comprises a cleavage enzyme recognition site.
12. The modified spidroin according to claim 11, wherein the cleavage enzyme recognition site comprises an enterokinase recognition site.
13. A spider silk material comprising:
-a modified spidroin according to any of claims 1 to 8.
14. A spider silk material comprising
-spidroin; and
-an active molecule linked to the spidroin by a triazole, amine, amide, ether, or carbon-carbon linkage.
15. The spider silk material according to claim 13 or claim 14, wherein the spider silk material comprises a plurality of modified spidroins arranged in a fibre, and optionally, wherein the spider silk material comprises a plurality of fibres.
16. The spider silk material according to claim 14, wherein the plurality of fibres are aligned, meshed, interlaced, entwined, braided, weaved or twisted together.
17. A conjugate of spidroin and an active molecule linked by a triazole or amide.
18. A tissue scaffold, implant, wound dressing, or suture, comprising the modified spidroin according to any of claims 1 to 12, the spider silk material according to any of claims 13 to 16, or the conjugate according to claim 17.
19. A substrate suitable for site specific delivery and/or localisation of an active molecule, the substrate comprising the modified spidroin according to any of claims 1 to 12, the spider silk material according to any of claims 13 to 16, or the conjugate according to claim 17.
20. A method of modifying spidroin with a linking moiety, comprising expressing a gene encoding spidroin in a methionine auxotrophic cell in the presence of methionine- analogous non-natural amino acid residues comprising a linking moiety, such that the methionine-analogous non-natural amino acids are incorporated in place of methionine residues.
21. The method according to claim 20, wherein the methionine auxotrophic cell is E. coli, optionally E. coli DL41.
22. The method according to claim 20 or claim 21, wherein the cell is cultured in a methionine-free medium, and optionally wherein the methionine-free medium comprises the methionine-analogous non-natural amino acid.
23. The method according to any of claims 20 to 22, wherein the gene encodes a modified spidroin according to any of claims 1 to 12.
24. A method of forming a spider silk material according to any of claims 13 to 16, comprising:
the expression of spidroin with a fusion partner in a methionine auxotrophic cell in the presence of methionine-analogous non-natural amino acid residues comprising a linking moiety, such that the methionine-analogous non-natural amino acids are incorporated in place of methionine residues to form modified spidroin with a fusion partner; extracting the modified spidroin with the fusion partner; and cleaving the fusion partner from the modified spidroin to form one or more fibres from a plurality of the modified spidroins.
25. The method according to claim 24, wherein the method further comprises reacting the linking moiety on the modified spidroin with an active molecule comprising a reactive group capable of reacting with the linking moiety and forming a link between the spidroin and the active molecule.
26. The method according to claim 24 or 25, wherein the linking of the active molecule is before fibre formation, for example, before cleavage of the fusion partner, or after fibre formation.
27. A method of treatment comprising the administration of the modified spidroin according to any of claims 1 to 12, the spider silk material according to any of claims 13 to 16, or the conjugate according to claim 17, to a subject.
28. The modified spidroin according to any of claims 1 to 12, the spider silk material according to any of claims 13 to 16, or the conjugate according to claim 17, for use in the treatment or prevention of a disease, tissue repair or tissue replacement.
29. The use of the modified spidroin according to any of claims 1 to 12, the spider silk material according to any of claims 13 to 16, or the conjugate according to claim 17, for tissue engineering, tissue repair, tissue support, tissue replacement, cavity filling, or drug delivery.
30. The modified spidroin, the spider silk material, the conjugate, the method, or the use substantially as described herein, and optionally with reference to the accompanying drawings.
EP15766930.0A 2014-09-11 2015-09-11 Modified spider silk Withdrawn EP3191506A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB1416089.9A GB201416089D0 (en) 2014-09-11 2014-09-11 Modified spider silk
PCT/GB2015/052638 WO2016038387A1 (en) 2014-09-11 2015-09-11 Modified spider silk

Publications (1)

Publication Number Publication Date
EP3191506A1 true EP3191506A1 (en) 2017-07-19

Family

ID=51869467

Family Applications (1)

Application Number Title Priority Date Filing Date
EP15766930.0A Withdrawn EP3191506A1 (en) 2014-09-11 2015-09-11 Modified spider silk

Country Status (3)

Country Link
EP (1) EP3191506A1 (en)
GB (1) GB201416089D0 (en)
WO (1) WO2016038387A1 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2017218794B2 (en) 2016-02-11 2021-07-22 Seevix Material Sciences Ltd. Composite materials comprising synthetic dragline spider silk
CN109553673B (en) * 2017-09-25 2023-04-25 中国科学院上海微系统与信息技术研究所 Biological protein building block and preparation method thereof
AU2021259692A1 (en) 2020-04-23 2022-10-27 Seevix Material Sciences Ltd. Cosmetic compositions comprising dragline spider silk
US20260028378A1 (en) * 2022-05-26 2026-01-29 Latvian Institute Of Organic Synthesis Chemically modified engineered spider silk proteins

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2795541C (en) * 2010-04-12 2020-05-26 Spiber Technologies Ab Spider silk protein scaffolds for eukaryotic cell culture

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
None *
See also references of WO2016038387A1 *

Also Published As

Publication number Publication date
GB201416089D0 (en) 2014-10-29
WO2016038387A1 (en) 2016-03-17

Similar Documents

Publication Publication Date Title
Wang et al. Protein‐engineered functional materials
CN105764920B (en) Modified bacterial collagen-like proteins
Debabov et al. Recombinant spidroins as the basis for new materials
Loo et al. Self‐assembled proteins and peptides as scaffolds for tissue regeneration
US9382310B2 (en) Expression of triple-helical collagen-like products in E. coli
CA2957501A1 (en) Advanced macromolecule transduction domain (amtd) sequences for improvement of cell-permeability, polynucleotides encoding the same, method to identify the unique features of amtds comprising the same, method to develop the amtd sequences comprising the same
WO2016038387A1 (en) Modified spider silk
US20040137622A1 (en) Modular transfection systems
EP2844360B1 (en) Spider silk fusion protein structures without repetitive fragment for binding to an organic target
EP2844361B1 (en) Spider silk fusion protein structures incorporating immunoglobulin fragments as affinity ligands
CN109477252A (en) Composite material including synthetic dragline spider silk
CN116082516A (en) Recombinant spider silk protein, spider silk fiber and application thereof
Seroski et al. Self-assembled peptide and protein nanofibers for biomedical applications
JP6810470B2 (en) Silk fiber containing fusion protein and method for producing the silk fiber
Yao et al. Luminescent lanthanide–collagen peptide framework for pH-controlled drug delivery
US12060398B2 (en) Fibrous proteinaceous networks and methods of use thereof
Mendes et al. Genetic functionalization of protein-based biomaterials via protein fusions
Ford et al. Rapid production of multifunctional self-assembling peptides for incorporation and visualization within hydrogel biomaterials
Köszagová et al. Inclusion bodies in biotechnology
Xie et al. Secretion‐Catalyzed Assembly of Protein Biomaterials on a Bacterial Membrane Surface
Gregorio et al. PhoCoil: An injectable and photodegradable single-component recombinant protein hydrogel for localized therapeutic cell delivery
EP3658572A1 (en) Self-healing fabric
Law et al. From Peptides to Silk-Inspired Proteins: Self-Assembling Systems for Functional Biomaterials
CN105218633B (en) Formate cleavage site peptides and related biomaterials and their application in the production of calcitonin
Wang Triblock Protein-Engineered Hydrogel

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20170330

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20180713

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20250401