EP3087129A1 - Method for recycling plastic products - Google Patents

Method for recycling plastic products

Info

Publication number
EP3087129A1
EP3087129A1 EP14828458.1A EP14828458A EP3087129A1 EP 3087129 A1 EP3087129 A1 EP 3087129A1 EP 14828458 A EP14828458 A EP 14828458A EP 3087129 A1 EP3087129 A1 EP 3087129A1
Authority
EP
European Patent Office
Prior art keywords
poly
plastic product
depolymerase
plastic
binding
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP14828458.1A
Other languages
German (de)
French (fr)
Inventor
Enrique Herrero Acero
Georg Guebitz
Doris Ribitsch
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Carbios SA
Original Assignee
Carbios SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Carbios SA filed Critical Carbios SA
Priority to EP14828458.1A priority Critical patent/EP3087129A1/en
Publication of EP3087129A1 publication Critical patent/EP3087129A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C08ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08JWORKING-UP; GENERAL PROCESSES OF COMPOUNDING; AFTER-TREATMENT NOT COVERED BY SUBCLASSES C08B, C08C, C08F, C08G or C08H
    • C08J11/00Recovery or working-up of waste materials
    • C08J11/04Recovery or working-up of waste materials of polymers
    • C08J11/10Recovery or working-up of waste materials of polymers by chemically breaking down the molecular chains of polymers or breaking of crosslinks, e.g. devulcanisation
    • C08J11/105Recovery or working-up of waste materials of polymers by chemically breaking down the molecular chains of polymers or breaking of crosslinks, e.g. devulcanisation by treatment with enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/40Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/44Polycarboxylic acids
    • CCHEMISTRY; METALLURGY
    • C08ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08JWORKING-UP; GENERAL PROCESSES OF COMPOUNDING; AFTER-TREATMENT NOT COVERED BY SUBCLASSES C08B, C08C, C08F, C08G or C08H
    • C08J2367/00Characterised by the use of polyesters obtained by reactions forming a carboxylic ester link in the main chain; Derivatives of such polymers
    • C08J2367/02Polyesters derived from dicarboxylic acids and dihydroxy compounds
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02WCLIMATE CHANGE MITIGATION TECHNOLOGIES RELATED TO WASTEWATER TREATMENT OR WASTE MANAGEMENT
    • Y02W30/00Technologies for solid waste management
    • Y02W30/50Reuse, recycling or recovery technologies
    • Y02W30/62Plastics recycling; Rubber recycling

Definitions

  • the present invention relates to a method for recycling plastic products, such as waste plastics. More particularly, the invention relates to a biological method for depolymerizing at least one polymer of a plastic product and recovering the resulting monomers, which may be further reprocessed for synthesizing new polymers and manufacturing new plastic products.
  • Plastics are inexpensive and durable materials, which can be used to manufacture a variety of products that find use in a wide range of applications, so that the production of plastics has increased dramatically over the last decades. About 40% of these plastics are used for single- use disposable applications, such as packaging, agricultural films, disposable consumer items or for short-lived products that are discarded within a year of manufacture. Because of the durability of the polymers involved, substantial quantities of plastics are piling up in landfill sites and in natural habitats worldwide, generating increasing environmental problems. Even degradable and biodegradable plastics may persist for decades depending on local environmental factors, like levels of ultraviolet light exposure, temperature, presence of suitable microorganisms, etc.
  • PET polyethylene terephthalate
  • PET wastes are subjected to successive treatments leading to food-contact-approved recycled PET (rPET), which is collected, sorted, pressed into bales, crushed, washed, chopped into flakes, melted and extruded in pellets and offered for sale.
  • rPET food-contact-approved recycled PET
  • these recycled PET may be used to create fabrics for the clothing industry or new packaging such as bottles or blister packs, etc.
  • plastic wastes are generally collected all together, so that plastic bales contain a mixture of different plastics, the composition of which may vary from source to source, and the proportions of which may vary from bale to bale. Consequently, recycling processes require preliminary selection to sort out the plastic products according to their composition, size, resin type, color, functional additives used, etc.
  • Another potential process for recycling plastic consists of chemical recycling allowing recovering the chemical constituents of the polymer. The resulting monomers may then be used to re-manufacture plastic or to make other synthetic chemicals.
  • recycling process has only been performed on purified polymers and is not efficient on raw plastic products constituted of a mix of semi-crystalline and amorphous polymers and additives.
  • the invention provides a biological process for depolymerizing at least one polymer of at least one plastic product with low energy consumption.
  • the invention proposes an improved method for degrading or recycling plastic products by treatment with a depolymerase having enhanced plastic -binding properties.
  • the process of the invention allows recovering monomers that result from degradation of polymers of a plastic product, so that said monomers may be reprocessed to synthesize new polymer chains and new articles.
  • an object of the invention relates to a method for recycling a plastic product, comprising exposing the plastic product to a depolymerase under conditions favoring binding of said depolymerase to said plastic product, and recovering monomers.
  • the invention further provides a method for recycling a plastic product comprising depolymerizing at least one polymer of said plastic product to monomers by exposing the plastic product to a depolymerase under conditions favoring binding of said depolymerase to said plastic product.
  • the conditions favoring binding of the depolymerase include the use of a depolymerase comprising a binding module having affinity to a polymer in said plastic product, and/or combining the depolymerase with a plastic binding protein, and/or using a modified (e.g., mutated) depolymerase having e.g., improved surface binding capacity.
  • the method of the invention is implemented by exposing the plastic product to one or more microorganisms expressing and, preferably, excreting the depolymerase and/or the plastic binding protein. Preferentially, said microorganisms have a (modified) metabolism preventing consumption of the resulting monomers.
  • the invention may be used with any plastic product, particularly with plastic products comprising amorphous and/or semi-crystalline polyester(s) or polyamide(s), or a combination thereof.
  • the invention may be used with any suitable depolymerases depending on the nature of the plastic products, as will be disclosed further in the present application.
  • the monomers resulting from depolymerization may be recovered, optionally purified, and may be reprocessed to synthesize new polymer(s).
  • Figure 1 shows the recovery of terephthalic acid from PET bottle using native cutinase Thc_Cut2 from Thermobifida cellulosilytica compared to the recovery of terephthalic acid from PET bottle using a double mutant (DM) or a triple mutant (TM) with improved surface binding sites;
  • Figure 2 shows the recovery of terephthalic acid from PET bottle using a cutinase together with different concentrations of hydrophobins from Trichoderma reseei and Trichoderma virens.
  • the present invention relates generally to a biological process for recycling plastic products.
  • the process of the invention comprises depolymerizing at least one polymer constituting said plastic product, wherein a repolymerizable monomer mixture is generated and may be further recovered.
  • the present invention relates to the use of depolymerases having enhanced binding affinity to plastic, allowing improved depolymerization of at least one polymer of said plastic product up to monomers.
  • the invention discloses the use of depolymerases containing at least one binding module and/or having a mutated surface binding site and/or combined with a plastic-binding protein, leading to improved plastic degradation and recovery and recycling of monomers.
  • plastic product refers to any item made from at least one plastic material, such as plastic sheet, tube, rod, profile, shape, massive block, fiber, etc., which contains at least one polymer, and possibly other substances or additives, such as plasticizers, mineral or organic fillers.
  • the plastic product is constituted of a mix of semi-crystalline and/or amorphous polymers, or semi-crystalline polymers and additives. More preferably, the plastic product is a manufactured product like packaging, agricultural films, disposable items or the like.
  • the plastic materials of the invention include synthetic, degradable and biodegradable plastics. Within the context of the invention, natural and synthetic rubbers are not considered as plastic material, and rubber products are excluded from the scope of the invention.
  • a "polymer” refers to a chemical compound or mixture of compounds whose structure is constituted of multiple repeating units linked by covalent chemical bonds.
  • the term polymer includes natural or synthetic polymers, made of a single type of repeat unit (i.e., homopolymers) or of a mixture of different repeat units (i.e., block copolymers and random copolymers).
  • a "recycling process” in relation to a plastic product refers to a process by which at least one polymer of said plastic product is degraded to yield a repolymerizable monomer, which may be retrieved in order to be reused.
  • binding module refers to a consecutive amino acid sequence of a protein which is involved in the binding of the protein to a substrate.
  • a binding module refers more particularly to a polypeptide that has a high affinity for or binds to a polymer of interest and that may be connected to an enzyme via a flexible linker, or spacer.
  • the binding module allows attachment of the depolymerase to a polymer chain and allows the active site of the depolymerase to co-ordinate towards the plastic product.
  • the binding module can also partially disrupt the structure of the polymer, the targeted bonds being then more accessible to the active site of the depolymerase.
  • a binding module is most often capable of binding to a range of polymers.
  • the binding module generally forms hydrophobic interactions via tryptophan residues or specific hydrophobic amino acids.
  • the depolymerase can naturally comprise a binding module.
  • wild-type (hemi)cellulases and chitinases contain carbohydrate binding modules, and poly(hydroxyalkanoic acid) depolymerase contains polyester binding module.
  • the binding module can be an exogenous (i.e., not naturally present in the enzyme sequence) binding module fused to the depolymerase of interest to improve its sorption and thereby hydrolysis.
  • a "plastic binding protein” refers to a protein, essentially devoid of (e.g., without) enzymatic activity, that facilitates the depolymerase adsorption on a plastic product.
  • biosurfactants such as hydrophobins, that can naturally absorb to hydrophobic substances and to interfaces between hydrophobic (plastic) and hydrophilic (aqueous medium) phases, or disrupting proteins such as expansins and swollenin that act by weakening the linkages such as hydrogen bonds between adjacent polymeric chains, may be used as plastic binding proteins.
  • the plastic binding protein may be fused to the depolymerase, or combined with (e.g., mixed with) the depolymerase.
  • the plastic binding protein generally binds to a hydrophobic surface of the plastic product and cooperates with the depolymerase to promote binding of the enzyme and/or degradation of the plastic product.
  • a “mutant” in relation to an enzyme refers to an enzyme wherein at least one amino acid is different from the wild- type enzyme.
  • a "recombinant microorganism” refers to a microorganism whose genome has been modified by insertion of at least one nucleic acid sequence or unit. Typically, the inserted nucleic acid sequence or unit is not naturally present in the genome of the microorganism. Said nucleic acid sequence or unit has been assembled and/or inserted in said microorganism or an ancestor thereof, using recombinant DNA technology, (also called gene cloning or molecular cloning) which refers to techniques of transfer of DNA from one organism to another.
  • the nucleic acid sequence or unit may be integrated into the microbial chromosome, or present on a plasmid.
  • a "recombinant microorganism” further refers to a microorganism whose genome has been modified by inactivation or deletion of at least one nucleic acid sequence or unit.
  • the resulting recombinant microorganism can be manufactured by a variety of methods, and once made, can be reproduced without use of further recombinant DNA technology. Otherwise, the recombinant microorganism may be issued from a metagenomic library.
  • the term "derived from a microorganism" in relation to an enzyme or (poly)peptide indicates that the enzyme or (poly)peptide has been isolated from such a microorganism, or that the enzyme or (poly)peptide comprises all or a biologically active part of the amino acid sequence of an enzyme or (poly)peptide isolated or characterized from such a microorganism.
  • vector refers to DNA molecule used as a vehicle to transfer recombinant genetic material into a host cell.
  • the major types of vectors are plasmids, bacteriophages, viruses, cosmids, and artificial chromosomes.
  • Vectors called expression vectors are specifically adapted for the expression of the heterologous sequences in the target cell, and generally have a promoter sequence that drives expression of the heterologous sequences encoding a polypeptide.
  • the regulatory elements that are present in an expression vector include a transcriptional promoter, a ribosome binding site, a terminator, and optionally present operator.
  • an expression vector also contains an origin of replication for autonomous replication in a host cell, a selectable marker, a limited number of useful restriction enzyme sites, and a potential for high copy number.
  • expression vectors are cloning vectors, modified cloning vectors, specifically designed plasmids and viruses. Expression vectors providing suitable levels of polypeptide expression in different hosts are well known in the art. Bacterial expression vectors well known in the art include pETl la (Novagen), lamda gtl l (Invitrogen).
  • Expression vectors may be introduced into host cells using standard techniques. Examples of such techniques include transformation, transfection, lipotransfection, protoplast fusion, and electroporation. Examples of techniques for introducing nucleic acid into a cell and expressing the nucleic acid to produce protein are provided in references such as Ausubel, Current Protocols in molecular biology, John wiley, 1987-1998, and Sambrook, et al., in Molecular cloning, A laboratory Manual 2 nd Edition, Cold Spring Harbor Laboratory Press, 1989.
  • the present invention discloses novel methods allowing degradation of plastic products up to the monomer level, so that said monomers may be reused for repolymerizing polymers and further fabricating new plastic products.
  • the methods of the invention may be used for recycling plastic products made with several different plastic materials.
  • the plastic product may comprise successive layers of different plastic materials.
  • the recycling process of the invention may be used for treating all kinds of plastic products, without the necessity of preliminary plastic sorting and/or cleaning. More particularly, the process of the invention may be directly applied to plastic products coming from plastic wastes collection. For example, the process of the invention may be applied on a mix of domestic plastic wastes, including plastic bottles, plastic bags, plastic packaging, textile waste, etc.
  • the plastic products used in the process of the invention may comprise different kinds of plastic materials, including synthetic plastic materials, derived from petrochemicals, or biobased plastic materials (i.e. composed in whole or significant part of biological products).
  • the plastic products may contain one or several polymers, and additives.
  • One plastic product may be made up of several kinds of polymers arranged in different layers or melted together.
  • the plastic product may be constituted of semi-crystalline polymers or a mix of semi-crystalline and amorphous polymers as well as additives.
  • the plastic product consists of polymers containing a main saturated linear carbon chain, which may further contain saturated or unsaturated cycle(s), such as aromatic cycle(s).
  • the plastic products comprise polyesters and/or polyamides.
  • the plastic products contain only polyesters and/or polyamides.
  • Preferred polyesters are polyethylene terephthalate (PET), polytrimethylene terephthalate (PTT), polybutylen terephthalate (PBT), polyethylene isosorbide terephthalate (PEIT), polylactic acid (PLA), poly(L-lactic acid) (PLLA), poly(D-lactic acid) (PDLA), poly(D,L- lactic acid) (PDLLA), PLA stereocomplex (scPLA), polyhydroxy alkanoate (PHA), poly(3- hydroxybutyrate) (P(3HB)/PHB), poly(3 -hydroxy valerate) (P(3HV)/PHV), poly(3- hydroxyhexanoate) (P(3HHx)), poly(3-hydroxyoctanoate) (P(3HO)), poly(3- hydroxydecanoate) (P(3HD
  • Preferred polyamides are polyamide-6 or poly(e-caprolactam) or polycaproamide (PA6), polyamide-6,6 or poly(hexamethylene adipamide) (PA6,6), poly(l l-aminoundecanoamide) (PA11), polydodecanolactam (PA12), poly(tetramethylene adipamide) (PA4,6), poly(pentamethylene sebacamide) (PA5,10 ), poly(hexamethylene azelaamide) (PA6,9), poly(hexamethylene sebacamide) (PA6,10), poly(hexamethylene dodecanoamide) (PA6,12), poly(m-xylylene adipamide) (PAMXD6), polyhexamethylene adipamide/polyhexamethyleneterephtalamide copolymer (PA66/6T), polyhexamethylene adipamide/polyhexamethyleneisophtalamide copolymer (PA66/6I) and blends/mixtures of these
  • the plastic product is constituted of aromatic polyesters, such as polyethylene terephthalate (PET) and/or polytrimethylene terephthalate (PTT), more particularly semi-crystalline ones.
  • the plastic product is constituted of polyamides, such as PA6.6, more particularly semi-crystalline ones.
  • the present invention provides improved depolymerizing compositions and methods suitable for cutting chemical bonds between monomers of at least one polymer of a plastic product. More particularly, the invention discloses method wherein enhanced depolymerization is obtained by favoring interaction and cooperation between enzymes and a plastic product, so that at least one polymer constituting the plastic product is depolymerized up to monomers.
  • the invention shows that, by modulating the hydrophilicity of enzymes, to favor their solubility in an aqueous medium; and their hydrophobicity, to promote their binding on hydrophobic plastic surfaces, an improved catalyzed depolymerization can be obtained, even from raw plastic products.
  • the method of the invention promotes a good balance between adsorption and desorption of the enzyme to the plastic product so that the polymer is more readily depolymerized up to the monomers.
  • the depolymerase may be selected from any active depolymerase, depending on the nature of the polymer to hydrolyze, such as a cutinase, lipase, esterase, carboxylesterase, p- nitrobenzylesterase, serine protease, protease, amidase, aryl-acylamidase, oligomer hydrolase, peroxidase, or laccase.
  • active depolymerase such as a cutinase, lipase, esterase, carboxylesterase, p- nitrobenzylesterase, serine protease, protease, amidase, aryl-acylamidase, oligomer hydrolase, peroxidase, or laccase.
  • a plastic product containing polylactic acid (PLA) a serine protease (e.g., proteinase K from Tritirachium album or PLA depolymerase from Amycolatopsis sp.), a lipase (e.g., from Candida antarctica or Cryptococcus sp. or Aspergillus niger) or an esterase (e.g., from Thermobifida halotolerans) are preferably used.
  • PLA polylactic acid
  • a serine protease e.g., proteinase K from Tritirachium album or PLA depolymerase from Amycolatopsis sp.
  • a lipase e.g., from Candida antarctica or Cryptococcus sp. or Aspergillus niger
  • an esterase e.g., from Thermobifida halotolerans
  • a cutinase e.g., from Thermobifida fusca, or Thermobifida cellulosilytica, or Thermobifida alba or Fusarium solani pisi
  • a lipase e.g., PS from Burkholderia cepacia
  • a cutinase e.g., from Fusarium solani
  • an aryl- acylamidase e.g., from Nocardia farcinica
  • an oligomer hydrolase e.g., endo-type 6- aminohexanoate oligomer hydrolase from Arthrobacter sp. KI72, Pseudomonas sp. NK87, Kocuria sp. KY2 - Yasuhira et al., 2010 The Journal of Biological Chemistry 285, 1239-1248
  • an amidase e.g., from Beauveria brongniartii
  • an amidase e.g., from Beauveria brongniartii
  • the enzyme is used under conditions favoring its binding to the plastic product.
  • the depolymerase may be a mutated enzyme having improved affinity for the plastic product compared to a wild-type enzyme and/or may be used with plastic -binding proteins that enhance the binding between the depolymerase and the plastic product, and/or may be used with a plastic binding module.
  • the depolymerase comprises a binding module that enhances the binding of the depolymerase to the plastic product, compared to the depolymerase without said binding module.
  • the binding module may be an exogenous peptide fused to the depolymerase via a linker, to promote the sorption of the enzyme to the substrate.
  • the resulting depolymerase has enhanced depolymerization activity compared to the wild-type depolymerase.
  • the exogenous binding module enhances the depolymerization of a targeted polymer by at least 1.01 -fold, e.g. at least 1.025-fold, at least 1.05-fold, at least 1 .075-fold, at least 1 .
  • binding module is chosen depending on the targeted polymer. Genetic engineering for modifying an enzyme is documented and can be easily implemented by those skilled in the art.
  • binding modules include the binding module of the poly(3-hydroxybutyrate) depolymerase from Ralstonia pickettii (Hiraishi et al, 2010 Biomacromolecules 11, 113-119) and the binding module of the cutinase from Thermobifida fusca (Zhang et al., 2013 Carbohydrate Polymers 97, 124-129).
  • the invention can use wild-type depolymerases that naturally contain a binding module.
  • (hemi )cellulases and chitinases contain carbohydrate binding modules and the poly(hydroxyalkanoic acid) depolymerase contains a polyester binding module.
  • the sequence of the binding module may further be modified to increase its binding properties. For instance, a mutation at S445C in the sequence of the binding module of the poly(3-hydroxybutyrate) depolymerase from Ralstonia pickettii, enhances PHB depolymerisation ⁇ Hiraishi et ah, 2010 Biomacromolecules 11, 113-119).
  • the depolymerase is used with a plastic-binding protein that is able to enhance the depolymerization efficiency by facilitating the depolymerase adsorption on the plastic product or increasing its accessibility.
  • a plastic-binding protein may enhance the depolymerization of a targeted polymer by at least 1.01 -fold. e.g. at least 1.025- fold, at least 1.05-fold, at least 1 .075-fold, at least 1 . 10-fold, at least 1.25-fold, at least 1 .5- fold. at least 2- fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold, or at least 20-fold, compared to same depolymerization without plastic-binding protein.
  • the plastic -binding protein is fused to the depolymerase.
  • the plastic -binding protein is combined with the enzyme and used simultaneously with said depolymerase.
  • "Simultaneously" means applied at the same time or substantially the same time, i .e.. within 30 seconds, one minute, two minutes, three minutes, four minutes, or five minutes. Alternati vely, the plastic-binding protein and the depolymerase can be applied sequentially. For example, the plastic-binding protein can be appl ied first, followed by the depolymerase. In some embodiments, the depolymerase is applied at least five minutes or more after application of the plastic-binding protein.
  • the plastic-binding protein is selected from hydrophobins, expansins and swollenins.
  • Swollenin are a protein that have been first characterized in the saprophytic fungus Trichoderma reesei ("Swollenin, a Trichoderma reesei protein with sequence similarity to the plant expansins, exhibits disruption activity on cellulosic materials. " Eur J Biochem 269: 4202-4211).
  • the protein has a N- terminal fungal-type carbohydrate -binding module family 1 domain (CBD) with cellulose-binding function, connected by a linker region to an expansin- like domain with homology to the group 1 grass pollen allergens ( pfam 01357).
  • CBD carbohydrate -binding module family 1 domain
  • Expansins are closely related to non -enzymatic proteins found in the cells of various plants.
  • Expansin are bel ieved to promote cell expansion and thus cell growth by allowing slippage or movement of the cellulose, pectin, and/or hemicellulose chains within the plant fibers. Expansins have been shown to weaken the hydrogen bonds between paper fibers of recycled paper, including commercial papers, such as coated papers from magazines and catalogs, which can be di ficult to recycle. Expansins and swollenins act by weakening the linkages such as hydrogen bonds between adjacent polymeric chains, then facilitating the accessibility of depolymerase to plastic.
  • hydrophobins refer to small secreted fungal proteins containing 8 positionally conserved cysteine residues, and a distinct hydrophobic patch foxed by 4 intramolecular disulphide bonds. Hydrophobins can naturally absorb to hydrophobic substances and to interfaces between hydrophobic (plastic) and hydrophilic (aqueous medium) phases. More particularly, hydrophobins assembly into amphiphilic structures and reduce the interface energy between the plastic and the depolymerase (Takahashi et al., 2005 Mol. Microbiol. 57, 1780-1796 ; Espino-Rammer et al., 2013 AEM 79, 4230-4238).
  • the hydrophobins are rigid enough to keep the hydrophobic patch exposed when fused to a protein (Paananen et al., 2013 Soft Matter 9, 1612-1619).
  • a hydrophobin from Trichoderma sp. is used.
  • a hydrophobin from Trichoderma reseei is used in a preferred embodiment, a hydrophobin from Trichoderma reseei (Accession number XP_00694739; Locus EGR49614) is used
  • a hydrophobin from Trichoderma virens (Accession number EO053458; Locus ABS59373) is used.
  • such hydrophobins allow a substantial improvement of the activity of a depolymerase, such as a cutinase, on a polyester containing plastic, such as PET containing plastic.
  • the hydrophobin is used simultaneously with the enzyme.
  • the hydrophobin is mixed with the enzyme in such a condition that a hydrophobic interaction between the enzyme and the hydrophobin or between the plastic and the hydrophobin is strengthened and the enzyme will efficiently attach to the plastic.
  • the ratio depolymerase/hydrophobin is between 0,01 and 100, preferably between 0,01 and 20, more preferably between 0,01 and 10, more preferably between 0,01 and 5.
  • the method of the invention comprises the steps of: exposing a PET containing plastic product to a cutinase and a hydrophobin from Trichoderma, preferably at a pH between 4 and 10, more preferably at a pH between 6 and 8, and at a temperature between 30°C and 90° for at least 10 hours, preferably 24 hours ; and Recovering terephthalic acid(s).
  • the ratio cutinase/hydrophobin is between 0,01 and 10, more preferably about 10.
  • the method uses a recombinant depolymerase exhibiting a mutated active site and/or binding site.
  • the active site may be enlarged compared to the wild-type enzyme to enhance the catalytic activity of the enzyme.
  • the active site of the depolymerase can be broadened by site-directed mutagenesis, in order to better fit a larger polymer chain.
  • a cutinase from Fusarium solani pisi with mutations at L81A or L189A increases 4 and 5 fold respectively the PET depolymerisation compared to the wild-type enzyme; and the mutation at L182A allows a 2 fold increased PA6,6 depolymerization (Araujo et al., 2007 Journal of Biotechnology 128, 849-857).
  • the amino acids located on the surface of the depolymerase and especially those near the active site of the enzyme can also be mutated to improve the adsorption of said enzyme to plastic products.
  • Such mutations advantageously increase the hydrophobic interactions and decrease the surface positive charge.
  • a neutral electrostatic potential on the surface of the region bound to the plastic can be favorable to the depolymerization.
  • the recombinant depolymerase may combine two or more site- directed mutagenesis.
  • the double mutant Q132A / T101A of the cutinase Tfu_0883 from Thermobifida fusca with a broader active site and higher hydrophobicity may be advantageously implemented in the method of the invention for PET depolymerization.
  • the depolymerases are used in an isolated or purified form.
  • enzymes of the invention are expressed, derived, secreted, isolated, or purified from a microorganism, including recombinant microorganisms.
  • the depolymerases may also be produced by recombinant techniques, or it may be isolated or purified from natural sources, when naturally-occurring, or it may be artificially produced.
  • the enzymes may be purified by techniques known per se in the art, and stored under conventional techniques.
  • the depolymerases may be further modified to improve e.g., their stability or activity.
  • the plastic product to recycle is contacted with a microorganism that synthesizes and excretes the depolymerase.
  • the enzyme may be excreted in the culture medium or towards the cell membrane of the microorganism wherein said enzyme may be anchored.
  • Said microorganism may naturally synthesize the depolymerase, or it may be a recombinant microorganism, wherein a recombinant nucleotide sequence encoding the depolymerase has been inserted, using for example a vector.
  • the depolymerase may be a mutated enzyme, with mutations and/or exogenous binding modules or a wild-type depolymerase naturally synthesized by another microorganism.
  • the plastic-binding protein may be naturally synthesized by the microorganism, or it may be a recombinant microorganism, wherein a recombinant nucleotide sequence encoding the protein has been inserted, optionally with a nucleotide sequence encoding the depolymerase.
  • a same microorganism synthesizes both the depolymerase and the plastic- binding protein.
  • two different microorganisms synthesizing the binding-plastic protein and the depolymerase respectively may also be used.
  • a nucleotide molecule encoding a recombinant depolymerase with a binding module and/or a binding-plastic protein, is inserted into a vector, e.g. plasmid, recombinant virus, phage, episome, artificial chromosome, and the like.
  • a vector e.g. plasmid, recombinant virus, phage, episome, artificial chromosome, and the like.
  • the nucleotide molecule is under the control of a specific promoter.
  • the vector is then transfected into host microorganisms to form recombinant microorganisms.
  • the hosts are further cultured under culture conditions suitable for the hosts to thereby obtain recombinant cells containing the enzyme of the present invention. Culture conditions suitable for the host are well known to those skilled in the art.
  • the nucleotide molecule of the invention can be in isolated or purified form, and made, isolated and/or manipulated by techniques known per se in the art, e.g., cloning and expression of cDNA libraries, amplification, enzymatic synthesis or recombinant technology.
  • the nucleotide molecule can also be synthesized in vitro by well-known chemical synthesis techniques.
  • Nucleotide molecules of this invention may comprise additional nucleotide sequences, such as regulatory regions, i.e., promoters, enhancers, silencers, terminators, and the like that can be used to cause or regulate expression of the enzyme in a selected host cell or system.
  • the recombinant microorganisms may be used directly.
  • recombinant enzymes may be purified from the culture medium. Any commonly used separation/purification means, such as salting-out, gel filtration, hydrophobic interaction chromatography or ion exchange chromatography, may be used for this purpose.
  • microorganisms known to synthesize and excrete depolymerases may be used. For example Aspergillus oryzae, Humicola insolens, Penicillium citrinum, Fusarium solani and Thermobifida cellulolysitica, synthesizing and excreting a cutinase, may be used for degrading a plastic product containing PET.
  • Amycolatopsis sp. K104-1 and K104-2, Tritirachium album ATCC 22563, Paenibacillus amylolyticus TB-13, Kibdelosporangium aridum JCM 7912, Saccharothrix waywayandensis JCM 9114, Amycolatopsis orientalis IFO 12362, Actinomadura keratinilytica T16-1 may be used for degrading a plastic product containing PLA.
  • Bionectria ochroleuca BFM-X1 may be used for degrading a plastic product containing PBS.
  • Thermomonospora fusca K13g and K7a-3, Isaria fumosorosea NKCM1712 may be used for degrading a plastic product containing PBAT.
  • Bjerkandera adusta producing a manganese peroxidase may be used for degrading a plastic product containing PA.
  • microorganisms and/or purified enzymes and/or synthetic enzymes may be used together or sequentially to depolymerize different kinds of polymers contained in a same plastic product or in different plastic products.
  • the enzyme may be in soluble form, or on solid phase.
  • it may be bound to cell membranes or lipid vesicles, or to synthetic supports such as glass, plastic, polymers, filter, membranes, e.g., in the form of beads, columns, plates and the like.
  • the microorganism of the invention exhibits a modified metabolism in order to prevent the consumption of the monomers obtained from the degraded polymer.
  • the microorganism is a recombinant microorganism, wherein the enzymes degrading said monomers have been deleted or knocked out.
  • the process of the invention may be performed in a culture medium containing at least one carbon source usable by the microorganism so that said microorganism preferentially consumes this carbon source instead of the monomers.
  • the plastic product is contacted with a culture medium containing the microorganisms, glucose or the like as a carbon source, as well as a nitrogen source assimilable by the microorganisms, including an organic nitrogen source (e.g., peptone, meat extract, yeast extract, corn steep liquor) or an inorganic nitrogen source (e.g., ammonium sulfate, ammonium chloride).
  • an organic nitrogen source e.g., peptone, meat extract, yeast extract, corn steep liquor
  • an inorganic nitrogen source e.g., ammonium sulfate, ammonium chloride
  • the culture medium may further contain inorganic salts (e.g., sodium ion, potassium ion, calcium ion, magnesium ion, sulfate ion, chlorine ion, phosphate ion).
  • the medium may also be supplemented with trace components such as vitamins, oligo-elements and amino acids.
  • the process of the invention is particularly useful for degrading a semi-crystalline polymer contained in a plastic product which contains said semi-crystalline polymer and eventually one or several other semi-crystalline and/or amorphous polymers and/or additives.
  • the plastic product may be preliminary treated to physically change its structure, so as to increase the surface of contact between the polymers and the depolymerase.
  • the plastic product may be transformed to an emulsion or a powder, which is added to a liquid medium containing the microorganisms and/or enzymes.
  • the plastic product may be mechanically grinded, granulated, pelleted etc. to reduce the shape and size of the material prior to be added to a liquid medium containing the microorganisms and/or enzymes.
  • the degradation reaction may be performed in any reaction system, including aqueous solution (e.g., plastic emulsion) and solid system (e.g., plastic solid pellet or powder), and any conditions known to those skilled in the art depending on its purpose and scale.
  • aqueous solution e.g., plastic emulsion
  • solid system e.g., plastic solid pellet or powder
  • the time required for degradation of a plastic product may vary depending on the plastic product itself (i.e., nature and origin of the plastic product, its composition, shape etc.), the type and amount of microorganisms/enzymes used, as well as various process parameters (i.e., temperature, pH, additional agents, etc.).
  • process parameters i.e., temperature, pH, additional agents, etc.
  • the process is implemented at a temperature comprised between 20°C and 80°C, more preferably between 25°C and 60°C.
  • the temperature is maintained between 25°C and 50°C at least during the depolymerization step.
  • the temperature is maintained below an inactivating temperature, which corresponds to the temperature at which the enzyme is inactivated and/or the microorganism does no more synthesize the degrading enzyme.
  • the process of the invention may be implemented at a temperature below the Tg of the targeted polymer.
  • the added amount of enzyme for the depolymerization step may be at least 0.005% by weight of plastic products, preferably at least 0.1% and more preferably at least 1%.
  • the added amount is advantageously at more 15% by weight of plastic products and more preferably at more 5%.
  • the amount of degradation enzyme is in a range of 0.005% to 15% by weight of plastic product, preferably in a range of 0.1% to 10% and more preferably in a range of 1% to 5%.
  • the pH of the medium may be in the range of 4 to 10.
  • the pH is adjusted according to the couple targeted polymer/enzyme for improving the process efficiency. More particularly, the pH is adjusted to be maintained at the optimal pH of the enzyme. Indeed, depolymerization of polyesters and polyamides produces acidic monomers that induce a pH decrease. An addition of a diluted alkali can be used to compensate this acidification and maintain the pH to the optimal one.
  • the process is performed under violent agitation, preferably comprised between 100 rpm and 5000 rpm, in order to favor contact between depolymerase and plastic product and so adsorption of the enzyme on the plastic.
  • At least a lipophilic agent and/or hydrophilic agent is added to the medium for improving the depolymerization step.
  • An inductor such as gelatin can be added to the medium to improve enzyme production.
  • a surfactant such as Tween can be added to the medium to modify interface energy between the polymer and the enzyme or microorganism and improve depolymerization efficiency.
  • An organic substance could be used to swell the polymer and increase its accessibility to the microorganism or enzyme.
  • the process of the invention is performed without any degradation accelerator.
  • the process of the invention is performed in a liquid containing only the depolymerase and water.
  • the process of the invention is performed without organic solvent.
  • the reaction time for depolymerization of at least one polymer of the plastic product is advantageously comprised between 5 and 72 hours. Such reaction time may allow the depolymerization to advance sufficiently, and will not be economically detrimental.
  • a mixture of monomers resulting from the depolymerization of the targeted polymers may be recovered at the end of the depolymerization step, sequentially or continuously.
  • a single monomer or several different monomers may be recovered, depending of the depolymerized polymers and/or of the recycled plastic products.
  • the monomers may be further purified, using all suitable purifying method and conditioned in a re-polymerizable form.
  • purifying methods include stripping process, separation by aqueous solution, steam selective condensation, filtration and concentration of the medium after the bioprocess, separation, distillation, vacuum evaporation, extraction, electrodialysis, adsorption, ion exchange, precipitation, crystallization, concentration and acid addition, dehydration and precipitation, nanofiltration, acid catalyst treatment, semi continuous mode distillation or continuous mode distillation, solvent extraction, evaporative concentration, evaporative crystallization, liquid/liquid extraction, hydrogenation, azeotropic distillation process, adsorption, column chromatography, simple vacuum distillation and microfiltration, combined or not.
  • the re-polymerizable monomers may then be reused to synthesize polymers.
  • polymers of same nature are repolymerized.
  • repolymerization is conducted using a hydrolase in appropriate conditions for allowing polymerization reaction.
  • Initiators may be added to the monomer solution to favour the polymerization reaction.
  • One skilled in the art may easily adapt the process parameters to the monomers and the polymers to synthesize.
  • Example 1 Aromatic polyester recycling using recombinant cutinases with improved binding properties
  • Plastic products containing aromatic polyester such as PET formulated with additives can be recycled thanks to the process of the invention.
  • the present experiment shows the recovery of terephthalic acid by treating plastic product constituted of semi-crystalline PET with mutants of the cutinase Thc_Cut2 from Thermobifida cellulosilytica DSM 44535. These multiple mutants, the double mutant (DM) Arg29Asn_Ala30Val and the triple mutant (TM) Argl9Ser_Arg29Asn_Ala30Val, have surface properties that enhance the cutinase adsorption on PET and thus increase the depolymerization efficiency.
  • Thermobifida cellulosilytica DSM44535 was obtained from the German Resource Centre for Biological Material (DSMZ, Germany). The strain was maintained on LB agar plates and cultivated in 500 mL shaking flasks (200 mL LB medium) at 37 °C and 160 rpm for 24 h. Cells were harvested by centrifugation at 3,200 g and 4 °C for 20 min.
  • THC_Cut2 Thermobifida cellulosytica in Escherichia coli BL21-Gold (DE3) (Stratagene, Germany).
  • the gene Thc_cut2 coding for cutinase was amplified from the genomic DNA of T. cellulosilytica DSM44535 by standard polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • fusca YX (Genbank accession numbers YP_288944 and YP_288943,33) two primers were designed, 5'- CCCCCGCTCATATGGCCAACCCCTACGAGCG-3' (forward primer - SEQ ID N°l) and 5'-
  • the designed primers included restriction sites Ndel and Hindlll for cloning the gene into the vector pET26b(b).
  • the PCR was done in a volume of 50 with genomic DNA as template, 0.4 ⁇ of each primer, 0.2 mM dNTP's, 5 units Phusion DNA polymerase (Finnzymes) and IX reaction buffer provided by the supplier.
  • the PCR was performed in a Gene Amp PCR 2200 thermocycler (Applied Biosystems, USA). 35 cycles were done, each cycle with sequential exposure of the reaction mixture to 98 °C (30 s, denaturation), 63 °C (30 s, annealing), and 72 °C (30 s, extension). Plasmids and DNA fragments were purified by Qiagen DNA purification kits (Qiagen, Germany).
  • the purified amplified PCR-products thus obtained were digested with restriction endonucleases Ndel and Hindlll (New England Biolabs, USA), dephosphorylated with alkaline phosphatase (Roche, Germany) and ligated to pET26b(b) with T4 DNA-ligase (Fermentas, Germany) and transformed in E. coli BL21- Gold(DE3) in accordance to the manufacturer's instructions.
  • the sequence of the gene was determined by DNA sequencing using the primers 5'- GAGCGGATAACAATTCCCCTCTAGAA-3 ' (SEQ ID N°3) and 5'- CAGCTTCCTTTCGGGCTTTGT-3 ' (SEQ ID N°4). DNA was sequenced as custom service (Agowa, Germany). Analysis and handling of DNA sequences was performed with Vector NTi Suite 10 (Invitrogen, USA). Sequences of proteins were aligned using the Clustal W program (Swiss EMBnet node server). The nucleotide sequence of the isolated gene has been deposited in the GenBank database under accession number HQ147786 (Thc_cut2).
  • Thc_Cut2 Site-directed mutagenesis of Thc_Cut2 was carried out by the QuikChange multisite-directed mutagenesis kit (Stratagene) using pET26b(+)_Thc_cut2 as template (Herrero Acero et al., 2011 Macromol 44, 4640) and megaprimers carrying the appropriate mutation (Thc_Cut2_Asn29_Val30.FW - SEQ ID N°5; Thc_Cut2_Asn29_Val30.Rev- SEQ ID N°6; Thc_Cut2_Asn29_Val30_Serl9.FW- SEQ ID N°7 and Thc_Cut2_Asn29_Val30_Serl9.Rev- SEQ ID N°8).
  • the PCR-products were transferred in E. coli BL21-Gold (DE3). Expression and purification
  • Cell pellet from 200 mL cell culture was resuspended in 30 mL binding buffer (20 mM NaH2P04*2H20, 500mM NaCl, lOmM imidazole, pH 7.4).
  • the resuspended cells were sonicated with three-times 30-s pulses under ice cooling (Vibra Cell, Sonics Materials, Meryin/ Satigny, Switzerland).
  • the lysates were centrifuged (30 min, 4°C, 4,000 g) and filtered through a 0.2 ⁇ membrane.
  • the cell lysate was purified using an Akta purification system with HisTrap FF columns (elution buffer 20 mM NaH2P04*2H20, 500 mM NaCl, 500 mM imidazole, pH 7.4).
  • HisTrap FF columns elution buffer 20 mM NaH2P04*2H20, 500 mM NaCl, 500 mM imidazole, pH 7.4
  • HisTag elution buffer was exchanged with 100 mM Tris HCl pH 7.0 by the use of PD-10 desalting columns (GE Healthcare).
  • Protein concentrations were determined by the Bio-Rad protein assay kit (Bio-Rad Laboratories GmbH) and bovine serum albumin as protein standard. SDS-PAGE was performed corresponding to Laemmli (Laemmli, U. K. Nature 1970, 227 (5259), 680-685) and proteins were stained with Coomassie Brillant Blue R-250.
  • DSC tests were used in order to determine glass temperature (Tg) and crystallinity of PET in plastic product, using a Q100 TA-RCS 90 Instrument under nitrogen atmosphere (50 mL/min) at a scanning rate of 10°C/min from -50°C to 300°C in aluminium pans on around 8 mg samples.
  • PET bottle powder had a Tg of 77.2°C and was semi-crystalline with 30% of crystallinity.
  • 10 mg plastic product was incubated with 5 ⁇ recombinant cutinase in 1 mL buffer Tris/HCl 100 mM, pH 7.0 for 24 h at 50°C with 300 rpm shaking. All experiments were carried out in triplicates. Controls were performed using lmL buffer without enzyme.
  • proteins were precipitated using 1: 1 (v/v) absolute methanol (Merck) on ice.
  • Samples were centrifuged (Hettich MIKRO 200 R, Tuttlingen, Germany) at 16,000 g at 0°C for 15 min.
  • the supernatant for measurement was brought to an HPLC vial and acidified by adding 3.5 of 6N HC1.
  • the HPLC used was a DIONEX P-580 PUMP (Dionex Cooperation, Sunnyvale, USA), with an ASI-100 automated sample injector and a PDA- 100 photodiode array detector.
  • a reversed phase column RP-C18 (Discovery HS-C18, 5 ⁇ , 150 x 4.6 mm with precolumn, Supelco, Bellefonte, USA) was used. Analysis was carried out with 60% water, 10% 0.01N H2S04 and 30% methanol as eluent, gradual (15min) to 50% methanol and 10% acid, gradual (to 20 min) 90% methanol and acid, staying 2 min and then gradual to starting position, 5 min post run. The flow rate was set to 1 mL/min and the column was maintained at a temperature of 25 °C. The injection volume was 10 ⁇ ⁇ . Detection of TA was performed with a photodiode array detector at the wavelength of 241 nm.
  • Example 2 Aromatic polyester recycling using cutinase and hydrophobin
  • Thermobifida cellulosilytica DSM44535 was obtained from the German Resource Centre for Biological Material (DSMZ, Germany). The strain was maintained on LB agar plates and cultivated in 500 mL shaking flasks (200 mL LB medium) at 37 °C and 160 rpm for 24 h. Cells were harvested by centrifugation at 3,200 g and 4 °C for 20 min.
  • Vector pET26b(+) (Novagen, Germany) was used for expression of cutinase THC_Cutl from Thermobifida cellulosytica in Escherichia coli BL21-Gold (DE3) (Stratagene, Germany).
  • Thc_cutl coding for cutinase was amplified from the genomic DNA of T. cellulosilytica DSM44535 by standard polymerase chain reaction (PCR).
  • Cell pellet from 200 mL cell culture was resuspended in 30 mL binding buffer (20 mM NaH2P04*2H20, 500mM NaCl, lOmM imidazole, pH 7.4).
  • the resuspended cells were sonicated with three-times 30-s pulses under ice cooling (Vibra Cell, Sonics Materials, Meryin/ Satigny, Switzerland).
  • the lysates were centrifuged (30 min, 4°C, 4,000 g) and filtered through a 0.2 ⁇ membrane.
  • the cell lysate was purified using an Akta purification system with HisTrap FF columns (elution buffer 20 mM NaH2P04*2H20, 500 mM NaCl, 500 mM imidazole, pH 7.4).
  • HisTrap FF columns elution buffer 20 mM NaH2P04*2H20, 500 mM NaCl, 500 mM imidazole, pH 7.4
  • the HisTag elution buffer was exchanged with 100 mM Tris HCl pH 7.0 by the use of PD-10 desalting columns (GE Healthcare).
  • Protein concentration was determined by the Bio-Rad protein assay kit (Bio-Rad Laboratories GmbH) and bovine serum albumin as protein standard. SDS-PAGE was performed corresponding to Laemmli (Laemmli, U. K. Nature 1970, 227 (5259), 680-685) and proteins were stained with Coomassie Brillant Blue R-250.
  • Hydrophobins HFB4 (accession number EGR49614 from Trichoderma reseei) and HFB7 (accession number ABS59373 from Trichoderma virens), 101 and 93 amino acids polypeptides respectively, were expressed in Pichia pastoris. Supernatant was recovered and used either without any further purification or after a purification to eliminate salts.
  • PET bottles previously containing mineral water under trademark Cristalline®, were treated.
  • 100 mg plastic product was incubated with 5 ⁇ cutinase in 1 mL buffer KH2P04/K2HP04 100 mM, pH 7.0 for 24 h at 60°C with 100 rpm shaking.
  • 0.5 to 5 ⁇ HFB was also added to improve the cutinase adsorption on PET.
  • the material and methods were same as in example 1.
  • HFB4 and HFB7 allowed a release of terephtalic acid higher than with cutinase alone.
  • the terephtalic acid release was three fold increased with HFB4.
  • this effect was significant at a concentration of HFB ten time lower than concentration of enzyme.
  • the increase of the HFB concentration also allowed an increase of hydrolysis efficiency.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Sustainable Development (AREA)
  • Medicinal Chemistry (AREA)
  • Polymers & Plastics (AREA)
  • Separation, Recovery Or Treatment Of Waste Materials Containing Plastics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention relates to a method for recycling at least one plastic product, the method comprising depolymerizing at least one polymer of said plastic product to monomers by exposing the plastic product to a depolymerase under conditions favoring binding of said depolymerase to said plastic product. The method of the invention may be used for degrading, simultaneously or sequentially at least two different polymers of the plastic product, and/or for recycling at least two plastic products.

Description

METHOD FOR RECYCLING PLASTIC PRODUCTS
The present invention relates to a method for recycling plastic products, such as waste plastics. More particularly, the invention relates to a biological method for depolymerizing at least one polymer of a plastic product and recovering the resulting monomers, which may be further reprocessed for synthesizing new polymers and manufacturing new plastic products.
Context of the invention
Plastics are inexpensive and durable materials, which can be used to manufacture a variety of products that find use in a wide range of applications, so that the production of plastics has increased dramatically over the last decades. About 40% of these plastics are used for single- use disposable applications, such as packaging, agricultural films, disposable consumer items or for short-lived products that are discarded within a year of manufacture. Because of the durability of the polymers involved, substantial quantities of plastics are piling up in landfill sites and in natural habitats worldwide, generating increasing environmental problems. Even degradable and biodegradable plastics may persist for decades depending on local environmental factors, like levels of ultraviolet light exposure, temperature, presence of suitable microorganisms, etc.
One solution to reduce environmental and economic impacts correlated to the accumulation of plastic is closed-loop recycling wherein plastic material is mechanically reprocessed to manufacture new products. For example, one of the most common closed-loop recycling is the polyethylene terephthalate (PET) recycling. PET wastes are subjected to successive treatments leading to food-contact-approved recycled PET (rPET), which is collected, sorted, pressed into bales, crushed, washed, chopped into flakes, melted and extruded in pellets and offered for sale. Then, these recycled PET may be used to create fabrics for the clothing industry or new packaging such as bottles or blister packs, etc.
However, plastic wastes are generally collected all together, so that plastic bales contain a mixture of different plastics, the composition of which may vary from source to source, and the proportions of which may vary from bale to bale. Consequently, recycling processes require preliminary selection to sort out the plastic products according to their composition, size, resin type, color, functional additives used, etc.
In addition, the actual plastic recycling processes use huge amounts of electricity, particularly during the extruding step, and the equipment used is also expensive, leading to high prices which may be non-competitive compared to virgin plastic.
Another potential process for recycling plastic consists of chemical recycling allowing recovering the chemical constituents of the polymer. The resulting monomers may then be used to re-manufacture plastic or to make other synthetic chemicals. However, up to now, such recycling process has only been performed on purified polymers and is not efficient on raw plastic products constituted of a mix of semi-crystalline and amorphous polymers and additives.
Thus, a need exists for an upgraded process for recycling plastic products that does not require preliminary sorting and expensive pretreatments and that may be used for recycling different plastic materials.
Summary of the invention
The invention provides a biological process for depolymerizing at least one polymer of at least one plastic product with low energy consumption. In particular, the invention proposes an improved method for degrading or recycling plastic products by treatment with a depolymerase having enhanced plastic -binding properties. The process of the invention allows recovering monomers that result from degradation of polymers of a plastic product, so that said monomers may be reprocessed to synthesize new polymer chains and new articles.
In this regard, an object of the invention relates to a method for recycling a plastic product, comprising exposing the plastic product to a depolymerase under conditions favoring binding of said depolymerase to said plastic product, and recovering monomers. The invention further provides a method for recycling a plastic product comprising depolymerizing at least one polymer of said plastic product to monomers by exposing the plastic product to a depolymerase under conditions favoring binding of said depolymerase to said plastic product. According to particular embodiments, the conditions favoring binding of the depolymerase include the use of a depolymerase comprising a binding module having affinity to a polymer in said plastic product, and/or combining the depolymerase with a plastic binding protein, and/or using a modified (e.g., mutated) depolymerase having e.g., improved surface binding capacity. Also, in a particular embodiment, the method of the invention is implemented by exposing the plastic product to one or more microorganisms expressing and, preferably, excreting the depolymerase and/or the plastic binding protein. Preferentially, said microorganisms have a (modified) metabolism preventing consumption of the resulting monomers.
It is a further object of the invention to provide a method for recycling a plastic product using at least one depolymerase under conditions favoring binding of said depolymerase to said product, wherein at least two different polymers of the plastic product are depolymerized, simultaneously or sequentially.
It is a further object of the invention to provide a method for recycling a plastic product using at least one depolymerase under conditions favoring binding of said depolymerase to said product, wherein at least two plastic products are recycled, simultaneously or sequentially.
The invention may be used with any plastic product, particularly with plastic products comprising amorphous and/or semi-crystalline polyester(s) or polyamide(s), or a combination thereof. The invention may be used with any suitable depolymerases depending on the nature of the plastic products, as will be disclosed further in the present application. The monomers resulting from depolymerization may be recovered, optionally purified, and may be reprocessed to synthesize new polymer(s).
Legend to the figures Figure 1 shows the recovery of terephthalic acid from PET bottle using native cutinase Thc_Cut2 from Thermobifida cellulosilytica compared to the recovery of terephthalic acid from PET bottle using a double mutant (DM) or a triple mutant (TM) with improved surface binding sites;
Figure 2 shows the recovery of terephthalic acid from PET bottle using a cutinase together with different concentrations of hydrophobins from Trichoderma reseei and Trichoderma virens.
Detailed description of the invention The present invention relates generally to a biological process for recycling plastic products. The process of the invention comprises depolymerizing at least one polymer constituting said plastic product, wherein a repolymerizable monomer mixture is generated and may be further recovered. More particularly, the present invention relates to the use of depolymerases having enhanced binding affinity to plastic, allowing improved depolymerization of at least one polymer of said plastic product up to monomers. The invention discloses the use of depolymerases containing at least one binding module and/or having a mutated surface binding site and/or combined with a plastic-binding protein, leading to improved plastic degradation and recovery and recycling of monomers.
Definitions
The present disclosure will be best understood by reference to the following definitions.
Within the context of the invention, the term "plastic product" refers to any item made from at least one plastic material, such as plastic sheet, tube, rod, profile, shape, massive block, fiber, etc., which contains at least one polymer, and possibly other substances or additives, such as plasticizers, mineral or organic fillers. Preferably the plastic product is constituted of a mix of semi-crystalline and/or amorphous polymers, or semi-crystalline polymers and additives. More preferably, the plastic product is a manufactured product like packaging, agricultural films, disposable items or the like. The plastic materials of the invention include synthetic, degradable and biodegradable plastics. Within the context of the invention, natural and synthetic rubbers are not considered as plastic material, and rubber products are excluded from the scope of the invention. A "polymer" refers to a chemical compound or mixture of compounds whose structure is constituted of multiple repeating units linked by covalent chemical bonds. Within the context of the invention, the term polymer includes natural or synthetic polymers, made of a single type of repeat unit (i.e., homopolymers) or of a mixture of different repeat units (i.e., block copolymers and random copolymers). A "recycling process" in relation to a plastic product refers to a process by which at least one polymer of said plastic product is degraded to yield a repolymerizable monomer, which may be retrieved in order to be reused.
A "binding module" (BM) or "binding domain" refers to a consecutive amino acid sequence of a protein which is involved in the binding of the protein to a substrate. In the context of the invention, a binding module refers more particularly to a polypeptide that has a high affinity for or binds to a polymer of interest and that may be connected to an enzyme via a flexible linker, or spacer. Advantageously, the binding module allows attachment of the depolymerase to a polymer chain and allows the active site of the depolymerase to co-ordinate towards the plastic product. The binding module can also partially disrupt the structure of the polymer, the targeted bonds being then more accessible to the active site of the depolymerase. A binding module is most often capable of binding to a range of polymers. The binding module generally forms hydrophobic interactions via tryptophan residues or specific hydrophobic amino acids. According to the invention, the depolymerase can naturally comprise a binding module. For instance, wild-type (hemi)cellulases and chitinases contain carbohydrate binding modules, and poly(hydroxyalkanoic acid) depolymerase contains polyester binding module. Otherwise, the binding module can be an exogenous (i.e., not naturally present in the enzyme sequence) binding module fused to the depolymerase of interest to improve its sorption and thereby hydrolysis.
In the context of the invention, a "plastic binding protein" refers to a protein, essentially devoid of (e.g., without) enzymatic activity, that facilitates the depolymerase adsorption on a plastic product. For instance, biosurfactants such as hydrophobins, that can naturally absorb to hydrophobic substances and to interfaces between hydrophobic (plastic) and hydrophilic (aqueous medium) phases, or disrupting proteins such as expansins and swollenin that act by weakening the linkages such as hydrogen bonds between adjacent polymeric chains, may be used as plastic binding proteins. The plastic binding protein may be fused to the depolymerase, or combined with (e.g., mixed with) the depolymerase. The plastic binding protein generally binds to a hydrophobic surface of the plastic product and cooperates with the depolymerase to promote binding of the enzyme and/or degradation of the plastic product.
A "mutant" in relation to an enzyme refers to an enzyme wherein at least one amino acid is different from the wild- type enzyme.
In the present description, a "recombinant microorganism" refers to a microorganism whose genome has been modified by insertion of at least one nucleic acid sequence or unit. Typically, the inserted nucleic acid sequence or unit is not naturally present in the genome of the microorganism. Said nucleic acid sequence or unit has been assembled and/or inserted in said microorganism or an ancestor thereof, using recombinant DNA technology, (also called gene cloning or molecular cloning) which refers to techniques of transfer of DNA from one organism to another. The nucleic acid sequence or unit may be integrated into the microbial chromosome, or present on a plasmid. A "recombinant microorganism" further refers to a microorganism whose genome has been modified by inactivation or deletion of at least one nucleic acid sequence or unit. The resulting recombinant microorganism can be manufactured by a variety of methods, and once made, can be reproduced without use of further recombinant DNA technology. Otherwise, the recombinant microorganism may be issued from a metagenomic library.
Within the context of the invention, the term "derived from a microorganism" in relation to an enzyme or (poly)peptide indicates that the enzyme or (poly)peptide has been isolated from such a microorganism, or that the enzyme or (poly)peptide comprises all or a biologically active part of the amino acid sequence of an enzyme or (poly)peptide isolated or characterized from such a microorganism.
The term "vector" refers to DNA molecule used as a vehicle to transfer recombinant genetic material into a host cell. The major types of vectors are plasmids, bacteriophages, viruses, cosmids, and artificial chromosomes. Vectors called expression vectors (expression constructs) are specifically adapted for the expression of the heterologous sequences in the target cell, and generally have a promoter sequence that drives expression of the heterologous sequences encoding a polypeptide. Generally, the regulatory elements that are present in an expression vector include a transcriptional promoter, a ribosome binding site, a terminator, and optionally present operator. Preferably, an expression vector also contains an origin of replication for autonomous replication in a host cell, a selectable marker, a limited number of useful restriction enzyme sites, and a potential for high copy number. Examples of expression vectors are cloning vectors, modified cloning vectors, specifically designed plasmids and viruses. Expression vectors providing suitable levels of polypeptide expression in different hosts are well known in the art. Bacterial expression vectors well known in the art include pETl la (Novagen), lamda gtl l (Invitrogen).
Expression vectors may be introduced into host cells using standard techniques. Examples of such techniques include transformation, transfection, lipotransfection, protoplast fusion, and electroporation. Examples of techniques for introducing nucleic acid into a cell and expressing the nucleic acid to produce protein are provided in references such as Ausubel, Current Protocols in molecular biology, John wiley, 1987-1998, and Sambrook, et al., in Molecular cloning, A laboratory Manual 2nd Edition, Cold Spring Harbor Laboratory Press, 1989.
Plastic products
The present invention discloses novel methods allowing degradation of plastic products up to the monomer level, so that said monomers may be reused for repolymerizing polymers and further fabricating new plastic products. The methods of the invention may be used for recycling plastic products made with several different plastic materials. For example, the plastic product may comprise successive layers of different plastic materials. The recycling process of the invention may be used for treating all kinds of plastic products, without the necessity of preliminary plastic sorting and/or cleaning. More particularly, the process of the invention may be directly applied to plastic products coming from plastic wastes collection. For example, the process of the invention may be applied on a mix of domestic plastic wastes, including plastic bottles, plastic bags, plastic packaging, textile waste, etc.
The plastic products used in the process of the invention may comprise different kinds of plastic materials, including synthetic plastic materials, derived from petrochemicals, or biobased plastic materials (i.e. composed in whole or significant part of biological products). The plastic products may contain one or several polymers, and additives. One plastic product may be made up of several kinds of polymers arranged in different layers or melted together. Furthermore, the plastic product may be constituted of semi-crystalline polymers or a mix of semi-crystalline and amorphous polymers as well as additives. In a particular embodiment, the plastic product consists of polymers containing a main saturated linear carbon chain, which may further contain saturated or unsaturated cycle(s), such as aromatic cycle(s).
In a particular embodiment, the plastic products comprise polyesters and/or polyamides. Preferably, the plastic products contain only polyesters and/or polyamides. Preferred polyesters are polyethylene terephthalate (PET), polytrimethylene terephthalate (PTT), polybutylen terephthalate (PBT), polyethylene isosorbide terephthalate (PEIT), polylactic acid (PLA), poly(L-lactic acid) (PLLA), poly(D-lactic acid) (PDLA), poly(D,L- lactic acid) (PDLLA), PLA stereocomplex (scPLA), polyhydroxy alkanoate (PHA), poly(3- hydroxybutyrate) (P(3HB)/PHB), poly(3 -hydroxy valerate) (P(3HV)/PHV), poly(3- hydroxyhexanoate) (P(3HHx)), poly(3-hydroxyoctanoate) (P(3HO)), poly(3- hydroxydecanoate) (P(3HD)), poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (P(3HB-co- 3HV)/PHBV), poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) (P(3HB-co-3HHx)/ (PHBHHx)), poly(3-hydroxybutyrate-co-5-hydroxyvalerate) (PHB5HV), poly(3- hydroxybutyrate-co-3-hydroxypropionate) (PHB3HP), polyhydroxybutyrate-co- hydroxyoctonoate (PHBO), polyhydroxybutyrate-co-hydroxyoctadecanoate (PHBOd), poly(3-hydroxybutyrate-co-3-hydroxyvalerate-co-4-hydroxybutyrate) (P(3HB-co-3HV-co- 4HB)), polybutylene succinate (PBS), polybutylen succinate adipate (PBSA), polybutylen adipate terephthalate (PBAT), polyethylene furanoate (PEF), polycaprolactone (PCL), poly(ethylene adipate) (PEA) and blends/mixtures of these materials. Preferred polyamides are polyamide-6 or poly(e-caprolactam) or polycaproamide (PA6), polyamide-6,6 or poly(hexamethylene adipamide) (PA6,6), poly(l l-aminoundecanoamide) (PA11), polydodecanolactam (PA12), poly(tetramethylene adipamide) (PA4,6), poly(pentamethylene sebacamide) (PA5,10 ), poly(hexamethylene azelaamide) (PA6,9), poly(hexamethylene sebacamide) (PA6,10), poly(hexamethylene dodecanoamide) (PA6,12), poly(m-xylylene adipamide) (PAMXD6), polyhexamethylene adipamide/polyhexamethyleneterephtalamide copolymer (PA66/6T), polyhexamethylene adipamide/polyhexamethyleneisophtalamide copolymer (PA66/6I) and blends/mixtures of these materials. In a particular embodiment, the plastic product is constituted of aliphatic polyesters, such as polylactic acid, and more particularly semi-crystalline polylactic acid.
In another embodiment, the plastic product is constituted of aromatic polyesters, such as polyethylene terephthalate (PET) and/or polytrimethylene terephthalate (PTT), more particularly semi-crystalline ones. In another particular embodiment, the plastic product is constituted of polyamides, such as PA6.6, more particularly semi-crystalline ones.
Plastic degradation
The present invention provides improved depolymerizing compositions and methods suitable for cutting chemical bonds between monomers of at least one polymer of a plastic product. More particularly, the invention discloses method wherein enhanced depolymerization is obtained by favoring interaction and cooperation between enzymes and a plastic product, so that at least one polymer constituting the plastic product is depolymerized up to monomers. The invention shows that, by modulating the hydrophilicity of enzymes, to favor their solubility in an aqueous medium; and their hydrophobicity, to promote their binding on hydrophobic plastic surfaces, an improved catalyzed depolymerization can be obtained, even from raw plastic products. The method of the invention promotes a good balance between adsorption and desorption of the enzyme to the plastic product so that the polymer is more readily depolymerized up to the monomers.
The depolymerase may be selected from any active depolymerase, depending on the nature of the polymer to hydrolyze, such as a cutinase, lipase, esterase, carboxylesterase, p- nitrobenzylesterase, serine protease, protease, amidase, aryl-acylamidase, oligomer hydrolase, peroxidase, or laccase.
Preferably, for depolymerizing a plastic product containing polylactic acid (PLA), a serine protease (e.g., proteinase K from Tritirachium album or PLA depolymerase from Amycolatopsis sp.), a lipase (e.g., from Candida antarctica or Cryptococcus sp. or Aspergillus niger) or an esterase (e.g., from Thermobifida halotolerans) are preferably used. For depolymerizing a plastic product containing PET or PTT, a cutinase (e.g., from Thermobifida fusca, or Thermobifida cellulosilytica, or Thermobifida alba or Fusarium solani pisi) or a lipase (e.g., PS from Burkholderia cepacia) are preferably used. For depolymerizing a plastic product containing PA6 or PA6,6, a cutinase (e.g., from Fusarium solani), an aryl- acylamidase (e.g., from Nocardia farcinica), or an oligomer hydrolase (e.g., endo-type 6- aminohexanoate oligomer hydrolase from Arthrobacter sp. KI72, Pseudomonas sp. NK87, Kocuria sp. KY2 - Yasuhira et al., 2010 The Journal of Biological Chemistry 285, 1239-1248) or an amidase (e.g., from Beauveria brongniartii) are preferably used.
According to the invention, the enzyme is used under conditions favoring its binding to the plastic product. In particular, the depolymerase may be a mutated enzyme having improved affinity for the plastic product compared to a wild-type enzyme and/or may be used with plastic -binding proteins that enhance the binding between the depolymerase and the plastic product, and/or may be used with a plastic binding module.
In an embodiment, the depolymerase comprises a binding module that enhances the binding of the depolymerase to the plastic product, compared to the depolymerase without said binding module.
In this regard, the binding module may be an exogenous peptide fused to the depolymerase via a linker, to promote the sorption of the enzyme to the substrate. The resulting depolymerase has enhanced depolymerization activity compared to the wild-type depolymerase. For instance, the exogenous binding module enhances the depolymerization of a targeted polymer by at least 1.01 -fold, e.g. at least 1.025-fold, at least 1.05-fold, at least 1 .075-fold, at least 1 . 10-fold, at least 1.25-fold, at least 1.5-fold, at least 2- fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold, or at least 20-fold, compared to the same depolymerization without binding module. The binding module is chosen depending on the targeted polymer. Genetic engineering for modifying an enzyme is documented and can be easily implemented by those skilled in the art. Examples of suitable binding modules include the binding module of the poly(3-hydroxybutyrate) depolymerase from Ralstonia pickettii (Hiraishi et al, 2010 Biomacromolecules 11, 113-119) and the binding module of the cutinase from Thermobifida fusca (Zhang et al., 2013 Carbohydrate Polymers 97, 124-129).
Alternatively or in addition, the invention can use wild-type depolymerases that naturally contain a binding module. For instance, (hemi )cellulases and chitinases contain carbohydrate binding modules and the poly(hydroxyalkanoic acid) depolymerase contains a polyester binding module. In a particular embodiment, the sequence of the binding module may further be modified to increase its binding properties. For instance, a mutation at S445C in the sequence of the binding module of the poly(3-hydroxybutyrate) depolymerase from Ralstonia pickettii, enhances PHB depolymerisation {Hiraishi et ah, 2010 Biomacromolecules 11, 113-119). In the same way, mutations at W68L and W68Y in the binding module of the cutinase from Thermobifida fusca fused with the carbohydrate binding module of cellulose CenA from Cellulomonas fimi enhance by 1.5 fold the PET depolymerization compared to the wild-type (Zhang et al., 2013 Carbohydrate Polymers 97, 124-129).
In another embodiment, the depolymerase is used with a plastic-binding protein that is able to enhance the depolymerization efficiency by facilitating the depolymerase adsorption on the plastic product or increasing its accessibility. The use of a plastic-binding protein may enhance the depolymerization of a targeted polymer by at least 1.01 -fold. e.g. at least 1.025- fold, at least 1.05-fold, at least 1 .075-fold, at least 1 . 10-fold, at least 1.25-fold, at least 1 .5- fold. at least 2- fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold, or at least 20-fold, compared to same depolymerization without plastic-binding protein. In a first embodiment, the plastic -binding protein is fused to the depolymerase. In another embodiment, the plastic -binding protein is combined with the enzyme and used simultaneously with said depolymerase. "Simultaneously" , as used herein, means applied at the same time or substantially the same time, i .e.. within 30 seconds, one minute, two minutes, three minutes, four minutes, or five minutes. Alternati vely, the plastic-binding protein and the depolymerase can be applied sequentially. For example, the plastic-binding protein can be appl ied first, followed by the depolymerase. In some embodiments, the depolymerase is applied at least five minutes or more after application of the plastic-binding protein. Preferably, the plastic-binding protein is selected from hydrophobins, expansins and swollenins.
Swollenin are a protein that have been first characterized in the saprophytic fungus Trichoderma reesei ("Swollenin, a Trichoderma reesei protein with sequence similarity to the plant expansins, exhibits disruption activity on cellulosic materials. " Eur J Biochem 269: 4202-4211). The protein has a N- terminal fungal-type carbohydrate -binding module family 1 domain (CBD) with cellulose-binding function, connected by a linker region to an expansin- like domain with homology to the group 1 grass pollen allergens ( pfam 01357). Expansins are closely related to non -enzymatic proteins found in the cells of various plants. Expansin are bel ieved to promote cell expansion and thus cell growth by allowing slippage or movement of the cellulose, pectin, and/or hemicellulose chains within the plant fibers. Expansins have been shown to weaken the hydrogen bonds between paper fibers of recycled paper, including commercial papers, such as coated papers from magazines and catalogs, which can be di ficult to recycle. Expansins and swollenins act by weakening the linkages such as hydrogen bonds between adjacent polymeric chains, then facilitating the accessibility of depolymerase to plastic.
As used herein, "hydrophobins" refer to small secreted fungal proteins containing 8 positionally conserved cysteine residues, and a distinct hydrophobic patch foxed by 4 intramolecular disulphide bonds. Hydrophobins can naturally absorb to hydrophobic substances and to interfaces between hydrophobic (plastic) and hydrophilic (aqueous medium) phases. More particularly, hydrophobins assembly into amphiphilic structures and reduce the interface energy between the plastic and the depolymerase (Takahashi et al., 2005 Mol. Microbiol. 57, 1780-1796 ; Espino-Rammer et al., 2013 AEM 79, 4230-4238). Preferably, the hydrophobins are rigid enough to keep the hydrophobic patch exposed when fused to a protein (Paananen et al., 2013 Soft Matter 9, 1612-1619). In a particular embodiment, a hydrophobin from Trichoderma sp. is used. In a preferred embodiment, a hydrophobin from Trichoderma reseei (Accession number XP_00694739; Locus EGR49614) is used In another embodiment, a hydrophobin from Trichoderma virens (Accession number EO053458; Locus ABS59373) is used. As illustrated in the examples, such hydrophobins allow a substantial improvement of the activity of a depolymerase, such as a cutinase, on a polyester containing plastic, such as PET containing plastic.
Advantageously, the hydrophobin is used simultaneously with the enzyme. For instance, the hydrophobin is mixed with the enzyme in such a condition that a hydrophobic interaction between the enzyme and the hydrophobin or between the plastic and the hydrophobin is strengthened and the enzyme will efficiently attach to the plastic. According to the invention, the ratio depolymerase/hydrophobin is between 0,01 and 100, preferably between 0,01 and 20, more preferably between 0,01 and 10, more preferably between 0,01 and 5.
In a particular embodiment, the method of the invention comprises the steps of: exposing a PET containing plastic product to a cutinase and a hydrophobin from Trichoderma, preferably at a pH between 4 and 10, more preferably at a pH between 6 and 8, and at a temperature between 30°C and 90° for at least 10 hours, preferably 24 hours ; and Recovering terephthalic acid(s).
Advantageously, the ratio cutinase/hydrophobin is between 0,01 and 10, more preferably about 10. In another embodiment, the method uses a recombinant depolymerase exhibiting a mutated active site and/or binding site. In particular, the active site may be enlarged compared to the wild-type enzyme to enhance the catalytic activity of the enzyme. Advantageously, the active site of the depolymerase can be broadened by site-directed mutagenesis, in order to better fit a larger polymer chain. For instance, a cutinase from Fusarium solani pisi with mutations at L81A or L189A increases 4 and 5 fold respectively the PET depolymerisation compared to the wild-type enzyme; and the mutation at L182A allows a 2 fold increased PA6,6 depolymerization (Araujo et al., 2007 Journal of Biotechnology 128, 849-857). Alternatively, or in addition, the amino acids located on the surface of the depolymerase and especially those near the active site of the enzyme can also be mutated to improve the adsorption of said enzyme to plastic products. Such mutations advantageously increase the hydrophobic interactions and decrease the surface positive charge. A neutral electrostatic potential on the surface of the region bound to the plastic can be favorable to the depolymerization.
In a particular embodiment, the recombinant depolymerase may combine two or more site- directed mutagenesis. For instance, the double mutant Q132A / T101A of the cutinase Tfu_0883 from Thermobifida fusca with a broader active site and higher hydrophobicity (Silva et al., 2011 Biotech. J. 6, 1230-1239) may be advantageously implemented in the method of the invention for PET depolymerization.
In an embodiment, the depolymerases are used in an isolated or purified form. For instance, enzymes of the invention are expressed, derived, secreted, isolated, or purified from a microorganism, including recombinant microorganisms.
The depolymerases may also be produced by recombinant techniques, or it may be isolated or purified from natural sources, when naturally-occurring, or it may be artificially produced. The enzymes may be purified by techniques known per se in the art, and stored under conventional techniques. The depolymerases may be further modified to improve e.g., their stability or activity.
In another embodiment, the plastic product to recycle is contacted with a microorganism that synthesizes and excretes the depolymerase. In the context of the invention the enzyme may be excreted in the culture medium or towards the cell membrane of the microorganism wherein said enzyme may be anchored. Said microorganism may naturally synthesize the depolymerase, or it may be a recombinant microorganism, wherein a recombinant nucleotide sequence encoding the depolymerase has been inserted, using for example a vector. The depolymerase may be a mutated enzyme, with mutations and/or exogenous binding modules or a wild-type depolymerase naturally synthesized by another microorganism.
In the same way, the plastic-binding protein may be naturally synthesized by the microorganism, or it may be a recombinant microorganism, wherein a recombinant nucleotide sequence encoding the protein has been inserted, optionally with a nucleotide sequence encoding the depolymerase. Advantageously, a same microorganism synthesizes both the depolymerase and the plastic- binding protein. However, two different microorganisms synthesizing the binding-plastic protein and the depolymerase respectively may also be used.
For example, a nucleotide molecule, encoding a recombinant depolymerase with a binding module and/or a binding-plastic protein, is inserted into a vector, e.g. plasmid, recombinant virus, phage, episome, artificial chromosome, and the like. Advantageously, the nucleotide molecule is under the control of a specific promoter. The vector is then transfected into host microorganisms to form recombinant microorganisms. The hosts are further cultured under culture conditions suitable for the hosts to thereby obtain recombinant cells containing the enzyme of the present invention. Culture conditions suitable for the host are well known to those skilled in the art.
The nucleotide molecule of the invention can be in isolated or purified form, and made, isolated and/or manipulated by techniques known per se in the art, e.g., cloning and expression of cDNA libraries, amplification, enzymatic synthesis or recombinant technology. The nucleotide molecule can also be synthesized in vitro by well-known chemical synthesis techniques. Nucleotide molecules of this invention may comprise additional nucleotide sequences, such as regulatory regions, i.e., promoters, enhancers, silencers, terminators, and the like that can be used to cause or regulate expression of the enzyme in a selected host cell or system. The recombinant microorganisms may be used directly. Otherwise, or in addition, recombinant enzymes may be purified from the culture medium. Any commonly used separation/purification means, such as salting-out, gel filtration, hydrophobic interaction chromatography or ion exchange chromatography, may be used for this purpose. In particular embodiments, microorganisms known to synthesize and excrete depolymerases may be used. For example Aspergillus oryzae, Humicola insolens, Penicillium citrinum, Fusarium solani and Thermobifida cellulolysitica, synthesizing and excreting a cutinase, may be used for degrading a plastic product containing PET. In the same way, Candida antarctica, Thermomyces lanuginosus, Burkholderia sp. and Triticum aestivum synthesize a lipase depolymerizing PET. Amycolatopsis sp. K104-1 and K104-2, Tritirachium album ATCC 22563, Paenibacillus amylolyticus TB-13, Kibdelosporangium aridum JCM 7912, Saccharothrix waywayandensis JCM 9114, Amycolatopsis orientalis IFO 12362, Actinomadura keratinilytica T16-1 may be used for degrading a plastic product containing PLA. Aspergillus fumigatus NKCM1706, Bionectria ochroleuca BFM-X1 may be used for degrading a plastic product containing PBS. Thermomonospora fusca K13g and K7a-3, Isaria fumosorosea NKCM1712 may be used for degrading a plastic product containing PBAT. Bjerkandera adusta producing a manganese peroxidase may be used for degrading a plastic product containing PA.
According to the invention, several microorganisms and/or purified enzymes and/or synthetic enzymes may be used together or sequentially to depolymerize different kinds of polymers contained in a same plastic product or in different plastic products.
The enzyme may be in soluble form, or on solid phase. In particular, it may be bound to cell membranes or lipid vesicles, or to synthetic supports such as glass, plastic, polymers, filter, membranes, e.g., in the form of beads, columns, plates and the like. Advantageously, the microorganism of the invention exhibits a modified metabolism in order to prevent the consumption of the monomers obtained from the degraded polymer. For example, the microorganism is a recombinant microorganism, wherein the enzymes degrading said monomers have been deleted or knocked out. Otherwise, the process of the invention may be performed in a culture medium containing at least one carbon source usable by the microorganism so that said microorganism preferentially consumes this carbon source instead of the monomers.
Advantageously, the plastic product is contacted with a culture medium containing the microorganisms, glucose or the like as a carbon source, as well as a nitrogen source assimilable by the microorganisms, including an organic nitrogen source (e.g., peptone, meat extract, yeast extract, corn steep liquor) or an inorganic nitrogen source (e.g., ammonium sulfate, ammonium chloride). If necessary, the culture medium may further contain inorganic salts (e.g., sodium ion, potassium ion, calcium ion, magnesium ion, sulfate ion, chlorine ion, phosphate ion). Moreover, the medium may also be supplemented with trace components such as vitamins, oligo-elements and amino acids.
Recycling process parameters
The process of the invention is particularly useful for degrading a semi-crystalline polymer contained in a plastic product which contains said semi-crystalline polymer and eventually one or several other semi-crystalline and/or amorphous polymers and/or additives.
In a particular embodiment, the plastic product may be preliminary treated to physically change its structure, so as to increase the surface of contact between the polymers and the depolymerase. For example, the plastic product may be transformed to an emulsion or a powder, which is added to a liquid medium containing the microorganisms and/or enzymes. Alternatively, the plastic product may be mechanically grinded, granulated, pelleted etc. to reduce the shape and size of the material prior to be added to a liquid medium containing the microorganisms and/or enzymes.
The degradation reaction may be performed in any reaction system, including aqueous solution (e.g., plastic emulsion) and solid system (e.g., plastic solid pellet or powder), and any conditions known to those skilled in the art depending on its purpose and scale. The time required for degradation of a plastic product may vary depending on the plastic product itself (i.e., nature and origin of the plastic product, its composition, shape etc.), the type and amount of microorganisms/enzymes used, as well as various process parameters (i.e., temperature, pH, additional agents, etc.). One skilled in the art may easily adapt the process parameters to the plastic products and/or degrading enzymes.
Advantageously, the process is implemented at a temperature comprised between 20°C and 80°C, more preferably between 25°C and 60°C. Preferably, the temperature is maintained between 25°C and 50°C at least during the depolymerization step. More generally, the temperature is maintained below an inactivating temperature, which corresponds to the temperature at which the enzyme is inactivated and/or the microorganism does no more synthesize the degrading enzyme. Surprisingly, the inventors discovered that the process of the invention may be implemented at a temperature below the Tg of the targeted polymer. According to the invention, the added amount of enzyme for the depolymerization step may be at least 0.005% by weight of plastic products, preferably at least 0.1% and more preferably at least 1%. And the added amount is advantageously at more 15% by weight of plastic products and more preferably at more 5%. Advantageously, the amount of degradation enzyme is in a range of 0.005% to 15% by weight of plastic product, preferably in a range of 0.1% to 10% and more preferably in a range of 1% to 5%.
The pH of the medium may be in the range of 4 to 10. Advantageously, the pH is adjusted according to the couple targeted polymer/enzyme for improving the process efficiency. More particularly, the pH is adjusted to be maintained at the optimal pH of the enzyme. Indeed, depolymerization of polyesters and polyamides produces acidic monomers that induce a pH decrease. An addition of a diluted alkali can be used to compensate this acidification and maintain the pH to the optimal one. In a particular embodiment, the process is performed under violent agitation, preferably comprised between 100 rpm and 5000 rpm, in order to favor contact between depolymerase and plastic product and so adsorption of the enzyme on the plastic.
In a particular embodiment, at least a lipophilic agent and/or hydrophilic agent is added to the medium for improving the depolymerization step. An inductor such as gelatin can be added to the medium to improve enzyme production. A surfactant such as Tween can be added to the medium to modify interface energy between the polymer and the enzyme or microorganism and improve depolymerization efficiency. An organic substance could be used to swell the polymer and increase its accessibility to the microorganism or enzyme.
Advantageously, the process of the invention is performed without any degradation accelerator. In a particular embodiment, the process of the invention is performed in a liquid containing only the depolymerase and water. In a particular embodiment, the process of the invention is performed without organic solvent.
The reaction time for depolymerization of at least one polymer of the plastic product is advantageously comprised between 5 and 72 hours. Such reaction time may allow the depolymerization to advance sufficiently, and will not be economically detrimental.
Treatment and reuse of the recovered monomers
A mixture of monomers resulting from the depolymerization of the targeted polymers may be recovered at the end of the depolymerization step, sequentially or continuously. A single monomer or several different monomers may be recovered, depending of the depolymerized polymers and/or of the recycled plastic products.
The monomers may be further purified, using all suitable purifying method and conditioned in a re-polymerizable form. Examples of purifying methods include stripping process, separation by aqueous solution, steam selective condensation, filtration and concentration of the medium after the bioprocess, separation, distillation, vacuum evaporation, extraction, electrodialysis, adsorption, ion exchange, precipitation, crystallization, concentration and acid addition, dehydration and precipitation, nanofiltration, acid catalyst treatment, semi continuous mode distillation or continuous mode distillation, solvent extraction, evaporative concentration, evaporative crystallization, liquid/liquid extraction, hydrogenation, azeotropic distillation process, adsorption, column chromatography, simple vacuum distillation and microfiltration, combined or not. The re-polymerizable monomers may then be reused to synthesize polymers. Advantageously, polymers of same nature are repolymerized. However, it is possible to mix the recovered monomers with other monomers and/or oligomers, in order to synthesize new copolymers.
In a particular embodiment, repolymerization is conducted using a hydrolase in appropriate conditions for allowing polymerization reaction. Initiators may be added to the monomer solution to favour the polymerization reaction. One skilled in the art may easily adapt the process parameters to the monomers and the polymers to synthesize.
Further aspects and advantages of the invention will be disclosed in the following example, which should be considered as illustrative and do not limit the scope of this application.
EXAMPLES
Example 1: Aromatic polyester recycling using recombinant cutinases with improved binding properties
Plastic products containing aromatic polyester such as PET formulated with additives can be recycled thanks to the process of the invention. The present experiment shows the recovery of terephthalic acid by treating plastic product constituted of semi-crystalline PET with mutants of the cutinase Thc_Cut2 from Thermobifida cellulosilytica DSM 44535. These multiple mutants, the double mutant (DM) Arg29Asn_Ala30Val and the triple mutant (TM) Argl9Ser_Arg29Asn_Ala30Val, have surface properties that enhance the cutinase adsorption on PET and thus increase the depolymerization efficiency.
General recombinant DNA techniques
Thermobifida cellulosilytica DSM44535 was obtained from the German Resource Centre for Biological Material (DSMZ, Germany). The strain was maintained on LB agar plates and cultivated in 500 mL shaking flasks (200 mL LB medium) at 37 °C and 160 rpm for 24 h. Cells were harvested by centrifugation at 3,200 g and 4 °C for 20 min.
Vector pET26b(+) (Novagen, Germany) was used for expression of cutinase THC_Cut2 from Thermobifida cellulosytica in Escherichia coli BL21-Gold (DE3) (Stratagene, Germany). The gene Thc_cut2 coding for cutinase was amplified from the genomic DNA of T. cellulosilytica DSM44535 by standard polymerase chain reaction (PCR). On the basis of the known sequence of genes coding for cutinases from T. fusca YX (Genbank accession numbers YP_288944 and YP_288943,33) two primers were designed, 5'- CCCCCGCTCATATGGCCAACCCCTACGAGCG-3' (forward primer - SEQ ID N°l) and 5'-
GTGTTCTAAGCTTCAGTGGTGGTGGTGGTGGTGCTCGAGTGCCAGGCACTGAGAG TAGT-3' (reverse primer - SEQ ID N°2), allowing amplification of the respective gene without signal peptide and introduction of the 6xHis-Tag at the C-terminus of the cutinase. The designed primers included restriction sites Ndel and Hindlll for cloning the gene into the vector pET26b(b). The PCR was done in a volume of 50 with genomic DNA as template, 0.4 μΜ of each primer, 0.2 mM dNTP's, 5 units Phusion DNA polymerase (Finnzymes) and IX reaction buffer provided by the supplier. The PCR was performed in a Gene Amp PCR 2200 thermocycler (Applied Biosystems, USA). 35 cycles were done, each cycle with sequential exposure of the reaction mixture to 98 °C (30 s, denaturation), 63 °C (30 s, annealing), and 72 °C (30 s, extension). Plasmids and DNA fragments were purified by Qiagen DNA purification kits (Qiagen, Germany). The purified amplified PCR-products thus obtained were digested with restriction endonucleases Ndel and Hindlll (New England Biolabs, USA), dephosphorylated with alkaline phosphatase (Roche, Germany) and ligated to pET26b(b) with T4 DNA-ligase (Fermentas, Germany) and transformed in E. coli BL21- Gold(DE3) in accordance to the manufacturer's instructions.
The sequence of the gene was determined by DNA sequencing using the primers 5'- GAGCGGATAACAATTCCCCTCTAGAA-3 ' (SEQ ID N°3) and 5'- CAGCTTCCTTTCGGGCTTTGT-3 ' (SEQ ID N°4). DNA was sequenced as custom service (Agowa, Germany). Analysis and handling of DNA sequences was performed with Vector NTi Suite 10 (Invitrogen, USA). Sequences of proteins were aligned using the Clustal W program (Swiss EMBnet node server). The nucleotide sequence of the isolated gene has been deposited in the GenBank database under accession number HQ147786 (Thc_cut2).
Site-directed mutagenesis of The Cut2
Site-directed mutagenesis of Thc_Cut2 was carried out by the QuikChange multisite-directed mutagenesis kit (Stratagene) using pET26b(+)_Thc_cut2 as template (Herrero Acero et al., 2011 Macromol 44, 4640) and megaprimers carrying the appropriate mutation (Thc_Cut2_Asn29_Val30.FW - SEQ ID N°5; Thc_Cut2_Asn29_Val30.Rev- SEQ ID N°6; Thc_Cut2_Asn29_Val30_Serl9.FW- SEQ ID N°7 and Thc_Cut2_Asn29_Val30_Serl9.Rev- SEQ ID N°8). The PCR-products were transferred in E. coli BL21-Gold (DE3). Expression and purification
Freshly transformed E. coli BL21-Gold (DE3) cells were used to inoculate 20 mL of LB- medium supplemented with 40 μg/mL kanamycin and cultivated overnight at 37° C and 160 rpm. The overnight culture was used to inoculate 200 mL of LB-medium with 40 μg/mL kanamycin to OD600=0.1 and incubated until an OD600=0.6-0.8 was reached. Afterwards the culture was cooled to 20°C and induced with IPTG at a final concentration of 0.05 mM. Induction was done for 20 h at 20°C and 160 rpm. The cells were harvested by centrifugation (20 min, 4°C, 3,200 g).
Cell pellet from 200 mL cell culture was resuspended in 30 mL binding buffer (20 mM NaH2P04*2H20, 500mM NaCl, lOmM imidazole, pH 7.4). The resuspended cells were sonicated with three-times 30-s pulses under ice cooling (Vibra Cell, Sonics Materials, Meryin/ Satigny, Switzerland). The lysates were centrifuged (30 min, 4°C, 4,000 g) and filtered through a 0.2 μιη membrane. The cell lysate was purified using an Akta purification system with HisTrap FF columns (elution buffer 20 mM NaH2P04*2H20, 500 mM NaCl, 500 mM imidazole, pH 7.4). For characterization of cutinase the HisTag elution buffer was exchanged with 100 mM Tris HCl pH 7.0 by the use of PD-10 desalting columns (GE Healthcare).
Protein concentrations were determined by the Bio-Rad protein assay kit (Bio-Rad Laboratories GmbH) and bovine serum albumin as protein standard. SDS-PAGE was performed corresponding to Laemmli (Laemmli, U. K. Nature 1970, 227 (5259), 680-685) and proteins were stained with Coomassie Brillant Blue R-250.
All chemicals were of analytical grade from Sigma (Germany).
Hydrolysis of plastic product PET bottles, previously containing mineral water under trademark Cristalline®, were treated. The whole bottles were pre-treated to increase the surface of contact between PET and the enzyme. They were mechanically ground into powders using a cutting mill SM-2000 (Retsch) during 5 min. Collected powder was then sieved with a siever AS 200 (Retsch) during 10 min with an amplitude of 1.5 mm to obtains powder of 250 μιη particle size. Differential Scanning Calorimetry (DSC) tests were used in order to determine glass temperature (Tg) and crystallinity of PET in plastic product, using a Q100 TA-RCS 90 Instrument under nitrogen atmosphere (50 mL/min) at a scanning rate of 10°C/min from -50°C to 300°C in aluminium pans on around 8 mg samples.
PET bottle powder had a Tg of 77.2°C and was semi-crystalline with 30% of crystallinity. In each sample, 10 mg plastic product was incubated with 5 μΜ recombinant cutinase in 1 mL buffer Tris/HCl 100 mM, pH 7.0 for 24 h at 50°C with 300 rpm shaking. All experiments were carried out in triplicates. Controls were performed using lmL buffer without enzyme.
Terephthalic acid (TA) assay
After enzymatic treatment, proteins were precipitated using 1: 1 (v/v) absolute methanol (Merck) on ice. Samples were centrifuged (Hettich MIKRO 200 R, Tuttlingen, Germany) at 16,000 g at 0°C for 15 min. The supernatant for measurement was brought to an HPLC vial and acidified by adding 3.5 of 6N HC1. The HPLC used was a DIONEX P-580 PUMP (Dionex Cooperation, Sunnyvale, USA), with an ASI-100 automated sample injector and a PDA- 100 photodiode array detector. For analysis of TA, a reversed phase column RP-C18 (Discovery HS-C18, 5 μιη, 150 x 4.6 mm with precolumn, Supelco, Bellefonte, USA) was used. Analysis was carried out with 60% water, 10% 0.01N H2S04 and 30% methanol as eluent, gradual (15min) to 50% methanol and 10% acid, gradual (to 20 min) 90% methanol and acid, staying 2 min and then gradual to starting position, 5 min post run. The flow rate was set to 1 mL/min and the column was maintained at a temperature of 25 °C. The injection volume was 10 μΐ^. Detection of TA was performed with a photodiode array detector at the wavelength of 241 nm.
Result PET powder was hydrolyzed by recombinant cutinases Thc_Cut2, and terephthalic acid was recovered in only 24h, whereas no terephthalic acid was detected in controls. As shown in Figure 1, the mutants allowed a TA release more important than the wild- type cutinase (13 + 1 μΜ). Furthermore, the triple mutant was more efficient than the double mutant: 30 + 1 μΜ TA was obtained with the triple mutant instead of 25 + 1 μΜ with the double mutant.
Example 2: Aromatic polyester recycling using cutinase and hydrophobin
Cutinase production
Thermobifida cellulosilytica DSM44535 was obtained from the German Resource Centre for Biological Material (DSMZ, Germany). The strain was maintained on LB agar plates and cultivated in 500 mL shaking flasks (200 mL LB medium) at 37 °C and 160 rpm for 24 h. Cells were harvested by centrifugation at 3,200 g and 4 °C for 20 min.
Vector pET26b(+) (Novagen, Germany) was used for expression of cutinase THC_Cutl from Thermobifida cellulosytica in Escherichia coli BL21-Gold (DE3) (Stratagene, Germany).
The gene Thc_cutl coding for cutinase was amplified from the genomic DNA of T. cellulosilytica DSM44535 by standard polymerase chain reaction (PCR).
Freshly transformed E. coli BL21-Gold (DE3) cells were used to inoculate 20 mL of LB- medium supplemented with 40 μg/mL kanamycin and cultivated overnight at 37° C and 160 rpm. The overnight culture was used to inoculate 200 mL of LB-medium with 40 μg/mL kanamycin to OD600=0.1 and incubated until an OD600=0.6-0.8 was reached. Afterwards the culture was cooled to 20°C and induced with IPTG at a final concentration of 0.05 mM. Induction was done for 20 h at 20°C and 160 rpm. The cells were harvested by centrifugation (20 min, 4°C, 3,200 g).
Cell pellet from 200 mL cell culture was resuspended in 30 mL binding buffer (20 mM NaH2P04*2H20, 500mM NaCl, lOmM imidazole, pH 7.4). The resuspended cells were sonicated with three-times 30-s pulses under ice cooling (Vibra Cell, Sonics Materials, Meryin/ Satigny, Switzerland). The lysates were centrifuged (30 min, 4°C, 4,000 g) and filtered through a 0.2 μιη membrane. The cell lysate was purified using an Akta purification system with HisTrap FF columns (elution buffer 20 mM NaH2P04*2H20, 500 mM NaCl, 500 mM imidazole, pH 7.4). For characterization of cutinase, the HisTag elution buffer was exchanged with 100 mM Tris HCl pH 7.0 by the use of PD-10 desalting columns (GE Healthcare).
Protein concentration was determined by the Bio-Rad protein assay kit (Bio-Rad Laboratories GmbH) and bovine serum albumin as protein standard. SDS-PAGE was performed corresponding to Laemmli (Laemmli, U. K. Nature 1970, 227 (5259), 680-685) and proteins were stained with Coomassie Brillant Blue R-250.
All chemicals were of analytical grade from Sigma (Germany).
Hydrophobin production
Hydrophobins HFB4 (accession number EGR49614 from Trichoderma reseei) and HFB7 (accession number ABS59373 from Trichoderma virens), 101 and 93 amino acids polypeptides respectively, were expressed in Pichia pastoris. Supernatant was recovered and used either without any further purification or after a purification to eliminate salts.
Hydrolysis of plastic product
PET bottles, previously containing mineral water under trademark Cristalline®, were treated. In each sample, 100 mg plastic product was incubated with 5 μΜ cutinase in 1 mL buffer KH2P04/K2HP04 100 mM, pH 7.0 for 24 h at 60°C with 100 rpm shaking. 0.5 to 5 μΜ HFB was also added to improve the cutinase adsorption on PET. For the rest, the material and methods were same as in example 1.
All experiments were carried out in triplicates. Controls were performed using ImL buffer without enzyme. Results
Both unpurified hydrophobins (0.5 μΜ HFB4 supernatant and 0.5 μΜ HFB7 supernatant) improved the hydrolysis efficiency of cutinase without hydrophobins : with HFB7 supernatant, terephtalic acid release was nearly doubled (1950 μιη TA released).
As expected, purified hydrophobins were more efficient than unpurified ones, since they were in a better conformation.
Both HFB4 and HFB7 allowed a release of terephtalic acid higher than with cutinase alone. However, the terephtalic acid release was three fold increased with HFB4. Moreover this effect was significant at a concentration of HFB ten time lower than concentration of enzyme. The increase of the HFB concentration also allowed an increase of hydrolysis efficiency. These results confirm that hydrophobins can improve biological depolymerization of plastic products.

Claims

1- A method for recycling a plastic product comprising exposing the plastic product to a depolymerase under conditions favoring binding of said depolymerase to said plastic product, and recovering monomers.
2- The method of claim 1, comprising exposing the plastic product to a depolymerase comprising a binding module having affinity to a polymer in said plastic product.
3- The method of claim 2, wherein the binding module is an exogenous peptide fused to the depolymerase.
4- The method of anyone of claims 1 to 3, comprising exposing the plastic product to a depolymerase and a plastic binding protein.
5- The method of claim 4, wherein the plastic binding protein is fused to the depolymerase.
6- The method of anyone of the previous claims, comprising exposing the plastic product to a depolymerase comprising one or several mutations improving the binding of said polymerase to a polymer of the plastic product.
7- The method of anyone of the previous claims, wherein the depolymerase is selected from a cutinase (EC 3.1.1.74), lipase (EC 3.1.1.3), esterase, carboxylesterase (EC 3.1.1.1), p- nitrobenzylesterase, serine protease (EC 3.4.21.64), protease, amidase, aryl-acylamidase (EC 3.5.1.13), oligomer hydrolase, such as 6-aminohexanoate cyclic dimer hydrolase (EC 3.5.2.12), 6-aminohexanoate dimer hydrolase (EC 3.5.1.46), 6-aminohexanoate- oligomer hydrolase (EC 3.5.1.B17-.-), peroxidase, laccase (EC 1.10.3.2), or a combination thereof.
8- The method of anyone of the previous claims, comprising the following steps: exposing the plastic product to the depolymerase under conditions and for a time suitable for the depolymerase to depolymerize at least one polymer of said plastic product;
recovering resulting monomers; and optionally
reprocessing recovered monomers into one or several polymers. 9- The method of anyone of the previous claims, comprising a pretreatment step of the plastic product, prior to exposure to the depolymerase, to modify mechanically and/or physically and/or chemically the plastic product.
10- The method of claim 9, wherein the plastic product is at least partially granulated prior to depolymerization.
11- The method of anyone of the previous claims, further comprising purifying monomers resulting from the depolymerization and reprocessing said purified monomers.
12- The method of anyone of the previous claims, wherein the plastic product comprises at least one polymer chosen among amorphous and/or semi-crystalline polyesters and polyamides.
13- The method of claim 12, wherein the polyester is selected from polyethylene terephthalate (PET), polytrimethylene terephthalate (PTT), polybutylen terephthalate (PBT), polyethylene isosorbide terephthalate (ΡΕΓΓ), polylactic acid (PLA), poly(L-lactic acid) (PLLA), poly(D- lactic acid) (PDLA), poly(D,L-lactic acid) (PDLLA), PLA stereocomplex (scPLA), polyhydroxy alkanoate (PHA), poly(3 -hydroxybutyrate) (P(3HB)/PHB), poly(3- hydroxyvalerate) (P(3HV)/PHV), poly(3-hydroxyhexanoate) (P(3HHx)), poly(3- hydroxyoctanoate) (P(3HO)), poly(3-hydroxydecanoate) (P(3HD)), poly(3-hydroxybutyrate- co-3-hydroxyvalerate) (P(3HB-co-3HV)/PHBV), poly(3-hydroxybutyrate-co-3- hydroxyhexanoate) (P(3HB-co-3HHx)/ (PHBHHx)), poly(3-hydroxybutyrate-co-5- hydroxyvalerate) (PHB5HV), poly(3-hydroxybutyrate-co-3-hydroxypropionate) (PHB3HP), polyhydroxybutyrate-co-hydroxyoctonoate (PHBO), polyhydroxybutyrate-co- hydroxyoctadecanoate (PHBOd), poly(3-hydroxybutyrate-co-3-hydroxyvalerate-co-4- hydroxybutyrate) (P(3HB-co-3HV-co-4HB)), polybutylene succinate (PBS), polybutylen succinate adipate (PBSA), polybutylen adipate terephthalate (PBAT), polyethylene furanoate (PEF), Polycaprolactone (PCL), poly(ethylene adipate) (PEA) and blends/mixtures of these materials.
14- The method of claim 12, wherein the polyamide is selected from polyamide-6 or ροΓν(β- caprolactam) or polycaproamide (PA6), polyamide-6, 6 or poly(hexamethylene adipamide) (PA6,6), poly(l l-aminoundecanoamide) (PA11), polydodecanolactam (PA12), poly(tetramethylene adipamide) (PA4,6), poly(pentamethylene sebacamide) (PA5,10 ), poly(hexamethylene azelaamide) (PA6,9), poly(hexamethylene sebacamide) (PA6,10), poly(hexamethylene dodecanoamide) (PA6,12), poly(m-xylylene adipamide) (PAMXD6), polyhexamethylene adipamide/polyhexamethyleneterephtalamide copolymer (PA66/6T), polyhexamethylene adipamide/polyhexamethyleneisophtalamide copolymer (PA66/6I) and blends/mixtures of these materials.
15- The method of anyone of the previous claims, wherein at least two different polymers of the plastic product are depolymerized, simultaneously or sequentially.
16- The method of anyone of the previous claims, wherein at least two plastic products are recycled, simultaneously or sequentially.
EP14828458.1A 2013-12-23 2014-12-19 Method for recycling plastic products Withdrawn EP3087129A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP14828458.1A EP3087129A1 (en) 2013-12-23 2014-12-19 Method for recycling plastic products

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP13306836 2013-12-23
PCT/EP2014/078877 WO2015097104A1 (en) 2013-12-23 2014-12-19 Method for recycling plastic products
EP14828458.1A EP3087129A1 (en) 2013-12-23 2014-12-19 Method for recycling plastic products

Publications (1)

Publication Number Publication Date
EP3087129A1 true EP3087129A1 (en) 2016-11-02

Family

ID=49989463

Family Applications (1)

Application Number Title Priority Date Filing Date
EP14828458.1A Withdrawn EP3087129A1 (en) 2013-12-23 2014-12-19 Method for recycling plastic products

Country Status (2)

Country Link
EP (1) EP3087129A1 (en)
WO (1) WO2015097104A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3483337A1 (en) 2017-11-14 2019-05-15 Arjo Wiggins Fine Papers Limited Recyclable and repulpable translucent or transparent paper - use for packaging applications

Families Citing this family (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
LT3143075T (en) 2014-05-16 2022-09-12 Carbios Process of recycling mixed pet plastic articles
PL3209771T3 (en) 2014-10-21 2021-05-31 Carbios Polypeptide having a polyester degrading activity and uses thereof
US10626242B2 (en) 2014-12-19 2020-04-21 Carbios Plastic compound and preparation process
BR112017016060A2 (en) 2015-01-30 2018-04-03 Resinate Mat Group Inc integrated process for the treatment of pet and ptt recycles
EP3268469A1 (en) 2015-03-13 2018-01-17 Carbios New polypeptide having a polyester degrading activity and uses thereof
CN107709457B (en) 2015-06-12 2021-05-25 卡比奥斯公司 Biodegradable polyester composition and use thereof
US10717996B2 (en) 2015-12-21 2020-07-21 Carbios Recombinant yeast cells producing polylactic acid and uses thereof
CN116199935A (en) * 2016-05-19 2023-06-02 卡比奥斯公司 Method for degrading plastic products
FR3088070B1 (en) 2018-11-06 2021-11-26 Carbios ENZYMATIC DEGRADATION PROCESS OF POLYETHYLENE TEREPHTHALATE
FR3088069B1 (en) 2018-11-06 2021-11-26 Carbios INDUSTRIAL SCALE TEREPHTHALIC ACID PRODUCTION PROCESS
CN114829474B (en) 2019-12-19 2025-11-11 卡比奥斯公司 Method for degrading plastic products
EP3838976B1 (en) 2019-12-19 2025-02-12 Carbios Process for degrading plastic products
GB202005073D0 (en) 2020-04-06 2020-05-20 Mellizyme Biotechnology Ltd Enzymatic degradation of plastics
US20240301160A1 (en) * 2020-12-24 2024-09-12 Societe Des Produits N Éstlé S.A. Enzymatic recycling of recycled polyethylene terephthalate by cutinases
CA3218310A1 (en) 2021-05-20 2022-11-24 Carbios Process for degrading a plastic product comprising at least one polyester
US20240228732A1 (en) 2021-05-20 2024-07-11 Carbios Process for degrading a plastic product comprising at least one polyester
AU2022280785A1 (en) * 2021-05-28 2024-01-04 Kimberly-Clark Worldwide, Inc. Methods and systems for single-step decontamination and enzymatic degradation of bio-based polymers
EP4347855A4 (en) * 2021-05-28 2025-11-05 Kimberly Clark Co BIOREACTOR AND PROCESS FOR FORMING POLYHYDROXYBUTYRATE DIRECTLY FROM DEPOLYMERIZED POLYHYDROXYBUTYRATE
CN117500921A (en) * 2021-05-28 2024-02-02 金伯利-克拉克环球有限公司 Optimization of halophilic PHB depolymerase for industrial applications
EP4408913A4 (en) 2021-09-30 2026-03-18 Kimberly Clark Co DEPOLYMERIZATION OF A POLYHYDROXYALKANOATE AND RECYCLING OF A POLYHYDROXYALKANOATE MONOMER OBTAINED BY A METABOLIC PROCESS
CN118369423A (en) 2021-11-16 2024-07-19 卡比奥斯公司 Uses of esterase
KR20250023516A (en) 2022-06-13 2025-02-18 까르비오 Method for purifying monoethylene glycol
CN115057942B (en) * 2022-06-15 2025-03-11 天津大学 A class of ICCG fusion proteins and their application in the degradation of polyethylene terephthalate
FR3144996A1 (en) * 2023-01-18 2024-07-19 Carbiolice ENZYME MASTERBATCH INCLUDING PROTEINS

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100359171B1 (en) * 2000-05-16 2002-10-31 한국과학기술원 Recombinant Microorganism Expressing Polyhydroxyalkanoate Biosynthesis Gene and Intracellular PHA Depolymerase Gene, and Process for Preparing (R)-Hydroxycarboxylic Acid Using the Same
JP4273504B2 (en) * 2002-10-23 2009-06-03 株式会社 東北テクノアーチ Method for decomposing plastics and method for producing useful substances using the same

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3483337A1 (en) 2017-11-14 2019-05-15 Arjo Wiggins Fine Papers Limited Recyclable and repulpable translucent or transparent paper - use for packaging applications
WO2019096848A1 (en) 2017-11-14 2019-05-23 Arjo Wiggins Fine Papers Limited Recyclable and repulpable translucent or transparent paper - use for packaging applications
CN111655929A (en) * 2017-11-14 2020-09-11 Aw品牌有限公司 Recyclable and repulpable translucent or transparent paper and its packaging applications

Also Published As

Publication number Publication date
WO2015097104A1 (en) 2015-07-02

Similar Documents

Publication Publication Date Title
WO2015097104A1 (en) Method for recycling plastic products
CA2890828C (en) Method for recycling plastic products
US10385183B2 (en) Process of recycling mixed PET plastic articles
US11377533B2 (en) Process for degrading plastic products
US10508269B2 (en) Polypeptide having a polyester degrading activity and uses thereof
CN106852154B (en) Polypeptide with polyester degradation activity and use thereof
KR20200103757A (en) Novel protease and uses thereof

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20160630

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20170424

R17C First examination report despatched (corrected)

Effective date: 20170706

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20210701