EP3052121A2 - Wnt compositions and methods for purification - Google Patents
Wnt compositions and methods for purificationInfo
- Publication number
- EP3052121A2 EP3052121A2 EP14851390.6A EP14851390A EP3052121A2 EP 3052121 A2 EP3052121 A2 EP 3052121A2 EP 14851390 A EP14851390 A EP 14851390A EP 3052121 A2 EP3052121 A2 EP 3052121A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- bone marrow
- marrow cells
- composition
- polypeptide
- mammalian
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/18—Growth factors; Growth regulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/10—Dispersions; Emulsions
- A61K9/127—Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/14—Macromolecular materials
- A61L27/22—Polypeptides or derivatives thereof, e.g. degradation products
- A61L27/227—Other specific proteins or polypeptides not covered by A61L27/222, A61L27/225 or A61L27/24
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/36—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix
- A61L27/3641—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix characterised by the site of application in the body
- A61L27/3645—Connective tissue
- A61L27/365—Bones
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/36—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix
- A61L27/3683—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix subjected to a specific treatment prior to implantation, e.g. decellularising, demineralising, grinding, cellular disruption/non-collagenous protein removal, anti-calcification, crosslinking, supercritical fluid extraction, enzyme treatment
- A61L27/3687—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix subjected to a specific treatment prior to implantation, e.g. decellularising, demineralising, grinding, cellular disruption/non-collagenous protein removal, anti-calcification, crosslinking, supercritical fluid extraction, enzyme treatment characterised by the use of chemical agents in the treatment, e.g. specific enzymes, detergents, capping agents, crosslinkers, anticalcification agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/36—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix
- A61L27/38—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells
- A61L27/3804—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells characterised by specific cells or progenitors thereof, e.g. fibroblasts, connective tissue cells, kidney cells
- A61L27/3834—Cells able to produce different cell types, e.g. hematopoietic stem cells, mesenchymal stem cells, marrow stromal cells, embryonic stem cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/36—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix
- A61L27/38—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells
- A61L27/3839—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells characterised by the site of application in the body
- A61L27/3843—Connective tissue
- A61L27/3847—Bones
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/50—Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials
- A61L27/54—Biologically active materials, e.g. therapeutic substances
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/50—Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials
- A61L27/58—Materials at least partially resorbable by the body
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01D—SEPARATION
- B01D15/00—Separating processes involving the treatment of liquids with solid sorbents; Apparatus therefor
- B01D15/08—Selective adsorption, e.g. chromatography
- B01D15/26—Selective adsorption, e.g. chromatography characterised by the separation mechanism
- B01D15/36—Selective adsorption, e.g. chromatography characterised by the separation mechanism involving ionic interaction, e.g. ion-exchange, ion-pair, ion-suppression or ion-exclusion
- B01D15/361—Ion-exchange
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
- C07K1/14—Extraction; Separation; Purification
- C07K1/16—Extraction; Separation; Purification by chromatography
- C07K1/18—Ion-exchange chromatography
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
- C12N5/0669—Bone marrow stromal cells; Whole bone marrow
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2121/00—Preparations for use in therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L2300/00—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices
- A61L2300/40—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices characterised by a specific therapeutic activity or mode of action
- A61L2300/412—Tissue-regenerating or healing or proliferative agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L2300/00—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices
- A61L2300/60—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices characterised by a special physical form
- A61L2300/602—Type of release, e.g. controlled, sustained, slow
- A61L2300/604—Biodegradation
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L2300/00—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices
- A61L2300/60—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices characterised by a special physical form
- A61L2300/62—Encapsulated active agents, e.g. emulsified droplets
- A61L2300/626—Liposomes, micelles, vesicles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L2430/00—Materials or treatment for tissue regeneration
- A61L2430/02—Materials or treatment for tissue regeneration for reconstruction of bones; weight-bearing implants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/40—Regulators of development
- C12N2501/415—Wnt; Frizzeled
Definitions
- Wnt proteins form a family of highly conserved secreted signaling molecules that bind to cell surface receptors encoded by the Frizzled and low-density lipoprotein receptor related proteins (LRPs).
- LRPs low-density lipoprotein receptor related proteins
- the WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Once bound, the ligands initiate a cascade of intracellular events that eventually lead to the transcription of target genes through the nuclear activity of ⁇ - catenin and the DNA binding protein TCF (Clevers H, 2004 Wnt signaling: Ig-norrin the dogma.
- Wnt proteins are also involved in a wide variety of cellular decisions associated with the program of osteogenesis. For example, Wnt proteins regulate the expression level of sox9, which influences the commitment of mesenchymal progenitor cells to a skeletogenic fate. Wnt proteins influence the differentiation of cells, into either osteoblasts or chondrocytes. In adult animals, there is evidence that Wnt signaling regulates bone mass. For example, mutations in the human Wnt co-receptor LRP5 are associated with several high bone mass syndromes, including osteoporosis type I, and endosteal hyperostosis or autosomal dominant osteosclerosis, as well as a low bone mass disease, osteoporosis- pseudoglioma.
- Increased production of the Wnt inhibitor Dkkl is associated with multiple myeloma, a disease that has increased bone resorption as one of its distinguishing features.
- S. Minear et al. Wnt proteins promote bone regeneration. Sci. Transl. Med. 2, 29ra30 (2010); and Zhao et al., Controlling the in vivo activity of Wnt liposomes, Methods Enzyrnol 465: 331-47 (2009).
- composition comprising a functionally active Wnt3a polypeptide and an aqueous solution comprising liposomes, wherein the functionally active Wnt3a polypeptide comprises a lipid modification at an amino acid position corresponding to amino acid residue 209 as set forth in SEQ ID NO:1 .
- the functionally active Wnt3a polypeptide is not lipid modified at an amino acid position corresponding to amino acid residue 77 as set forth in SEQ ID NO:1.
- the functionally active Wnt3a polypeptide is integrated into the l liposomal membrane.
- the functionally active Wnt3a polypeptide protrudes from the liposomal membrane onto the outer surface of the lipid membrane. In some embodiments, the functionally active Wnt3a polypeptide is not incorporated into the aqueous core of the liposome. In some embodiments, the functionally active Wnt3a polypeptide comprises at least about 30%, about 40%, about 50%, about 60% , about 70%, about 80%, about 90%, or about 95% sequence identity to the amino acid sequence as set forth in SEQ ID NO: 1. In some embodiments, the functionally active Wnt3a polypeptide comprises the amino acid sequence as set forth in SEQ ID NO:1.
- the concentration of the functionally active Wnt3a polypeptide is between about 5 ⁇ g/ ⁇ L and about 15 ⁇ / ⁇ -, or about 8 ⁇ / ⁇ . and about 12 ⁇ / ⁇ ..
- the phospholipid comprising the liposome has a tail carbon length of between about 12 carbons and about 14 carbons.
- the phospholipid comprising the liposome has a phase transition temperature from about 10°C to about 25°C, about 15°C to about 25°C, or about 20°C to about 25°C.
- the liposome has a net charge of 0 at a pH of between about 6.5 and about 8.0, about 7.0 and about 7.8, or about 7.2 and about 7.6.
- the phospholipid is 1 ,2-dimyristoyl-sn-glycero-3- phosphocholine (DMPC).
- the liposome further comprises cholesterol.
- the concentration of DMPC and cholesterol is defined by a ratio of between about 70:30 and about 100:0.
- the Wnt3a polypeptide is mammalian Wnt3a polypeptide.
- the mammal is a human.
- the lipid modification is palmitoylation.
- the Wnt3a polypeptide is further glycosylated.
- the composition is a stable composition. In some embodiments, the composition is stable up to about 106 days without substantial loss of activity. In some embodiments, the composition is stable at a temperature between about 1 °C and about 8°C. In some embodiments, the composition is stable under nitrogen.
- compositions comprising a functionally active mammalian Wnt polypeptide and an aqueous solution comprising liposomes, wherein the phospholipids comprising the liposomes have a phase transition temperature from about 10°C to about 25°C.
- a composition comprising a functionally active mammalian Wnt polypeptide and an aqueous solution comprising liposomes, wherein the phospholipids comprising the liposomes have a tail carbon length of between about 12 carbons and about 14 carbons.
- the Wnt polypeptide is integrated into the liposomal membrane.
- the Wnt polypeptide protrudes from the liposomal membrane onto the outer surface of the lipid membrane. In some embodiments, the Wnt polypeptide is not incorporated into the aqueous core of the liposome. In some embodiments, the Wnt polypeptide is Wnt3a polypeptide. In some embodiments, the Wnt3a polypeptide comprises at least about 30%, about 40%, about 50%, about 60% , about 70%, about 80%, about 90%, or about 95% sequence identity to the amino acid sequence as set forth in SEQ ID NO:1. In some embodiments, the Wnt3a polypeptide comprises the amino acid sequence as set forth in SEQ ID NO:1.
- the Wnt3a polypeptide is lipid modified at an amino acid position corresponding to amino acid residue 209 as set forth in SEQ ID NO:1 and is not lipid modified at an amino acid position corresponding to amino acid residue 77 as set forth in SEQ ID NO:1 .
- the Wnt polypeptide is Wnt5a polypeptide or Wnt10b polypeptide.
- the concentration of the Wnt polypeptide is between about 5 ⁇ g ⁇ L and about 15 ⁇ g ⁇ L, or about 8 ⁇ g ⁇ L and about 12 ⁇ g ⁇ L.
- the liposome has a net charge of 0 at a pH of between about 6.5 and about 8.0.
- the liposome has a net positive charge or a net negative charge at a pH of between about 6.5 and about 8.0.
- the phospholipid is 1 ,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC).
- the liposome further comprises cholesterol.
- the concentration of DMPC and cholesterol is defined by a ratio of between about 70:30 and about 100:0.
- the mammal is a human.
- the lipid modification is palmitoylation.
- the Wnt polypeptide is further glycosylated.
- the composition is a stable composition. In some embodiments, the composition is stable up to about 106 days without substantial loss of activity. In some embodiments, the composition is stable at a temperature between about 1°C and about 8°C. In some embodiments, the composition is stable under nitrogen.
- a method of preparing a liposomal Wnt3a polypeptide comprising: (a) harvesting Wnt3a polypeptides from a conditioned media comprising mammalian cells; (b) introducing the Wnt3a polypeptides to an ion- exchange column immobilized with a sulfonated polyaromatic compound; (c) eluting the Wnt3a polypeptides from the ion-exchange column utilizing a step gradient; and (d) contacting the Wnt3a polypeptides from step (c) with an aqueous solution of liposomes.
- the contacting occurs at a temperature between about 21 °C and about 25°C. In some embodiments, the time of contacting is between about 30 minutes and about 24 hours.
- the step gradient comprises a first gradient and a second gradient.
- the first gradient comprises a buffer solution comprising 50mM potassium chloride
- the second gradient comprises a buffer solution comprising between about 150mM potassium chloride and about 1 .5M potassium chloride.
- the buffer solution further comprises a detergent.
- the detergent is CHAPS or Triton X-100.
- the conditioned media comprises up to 10% fetal bovine serum.
- the mammalian cells are Chinese hamster ovary (CHO) cells.
- the yield of the Wnt3a polypeptides after step (c) is between about 60% and about 90%.
- the phospholipid comprising the liposome has a tail carbon length of between about 12 carbons and about 14 carbons.
- the phospholipid comprising the liposome has a phase transition temperature from about 10°C to about 25°C, about 15°C to about 25°C, or about 20°C to about 25°C.
- the liposome has a net charge of 0 at a pH of between about 6.5 and about 8.0, about 7.0 and about 7.8, or about 7.2 and about 7.6.
- the phospholipid is 1 ,2-dimyristoyl-sn-glycero-3- phosphocholine (DMPC).
- the liposome further comprises cholesterol.
- the concentration of DMPC and cholesterol is defined by a ratio of between about 70:30 and about 100:0.
- the Wnt3a polypeptide comprises at least about 30%, about 40%, about 50%, about 60% , about 70%, about 80%, about 90%, or about 95% sequence identity to the amino acid sequence as set forth in SEQ ID NO:1.
- the Wnt3a polypeptide comprises the amino acid sequence as set forth in SEQ ID NO:1.
- the Wnt3a polypeptide is lipid modified at an amino acid position corresponding to amino acid residue 209 as set forth in SEQ ID NO:1 and is not lipid modified at an amino acid position corresponding to amino acid residue 77 as set forth in SEQ ID NO:1.
- the Wnt3a polypeptide is mammalian Wnt3a polypeptide.
- the mammal is a human.
- the conditioned media comprises a serum or a serum substitute.
- the conditioned media comprises a serum.
- the serum is a fetal bovine serum.
- the serum concentration is between about 0.1 % and about 15% in the conditioned media.
- the conditioned media comprises a serum substitute.
- the serum substitute is a lipid based substitute.
- the conditioned media is a serum-free media.
- the lipid modification is palmitoylation.
- the Wnt3a polypeptide is further glycosylated.
- the Wnt3a product is separated from the sample mixture by centrifugation. In some embodiments, the centrifugation time is up to 1 hour at a temperature of between about 1°C and about 8°C.
- the Wnt3a product after centrifugation is resuspended in sterile 1X phosphate buffered saline (PBS).
- the Wnt3a product is stable under nitrogen. In some embodiments, the Wnt3a product is stable at a temperature between about 1°C and about 8°C.
- a method of preparing a liposomal Wnt polypeptide comprising contacting a sample comprising Wnt polypeptides to an aqueous solution of liposomes, wherein the phospholipids comprising the liposomes have a phase transition temperature from about 10°C to about 25°C. Also disclosed herein, in certain embodiments, is a method of preparing a liposomal Wnt polypeptide, comprising contacting a sample comprising Wnt polypeptides to an aqueous solution of liposomes, wherein the phospholipids comprising the liposome have a tail carbon length of between about 12 carbons and about 14 carbons.
- the contacting occurs at a temperature between about 21 °C and about 25°C. In some embodiments, the time of contacting is between about 6 hours and about 24 hours.
- the method further comprises an additional purification step prior to contacting the Wnt polypeptides to an aqueous solution of liposomes.
- the additional purification step is an ion-exchange purification step, a hydrophobic purification step, or an affinity purification step. In some embodiments, the additional purification step is an ion- exchange purification step.
- the ion-exchange purification step comprises contacting the sample with sulfonated polyaromatic compound immobilized beads or a column immobilized with a sulfonated polyaromatic compound.
- the ion-exchange purification step comprises a step-gradient.
- the ion-exchange purification buffer comprises a detergent.
- the detergent is CHAPS or Triton X-100.
- the additional purification step is a hydrophobic purification step.
- the hydrophobic purification step comprises Protein A immobilized beads, or a Protein A column.
- the yield of the Wnt polypeptides after the additional purification step is between about 60% and about 99%.
- the method further comprises harvesting Wnt polypeptides from a conditioned media comprising cells from an expression cell line.
- the expression cell line is a mammalian expression cell line.
- the mammalian expression cell line is Chinese hamster ovary (CHO) cell line.
- the conditioned media comprises a serum or a serum substitute.
- the serum is a fetal bovine serum.
- the serum concentration is between about 0.1 % and about 15% in the conditioned media.
- the conditioned media comprises a serum substitute.
- the serum substitute is a lipid based substitute.
- the conditioned media is a serum-free media.
- the Wnt polypeptide is Wnt3a polypeptide.
- the Wnt3a polypeptide comprises at least about 30%, about 40%, about 50%, about 60% , about 70%, about 80%, about 90%, or about 95% sequence identity to the amino acid sequence as set forth in SEQ ID NO:1.
- the Wnt3a polypeptide comprises the amino acid sequence as set forth in SEQ ID NO:1.
- the Wnt3a polypeptide is lipid modified at an amino acid position corresponding to amino acid residue 209 as set forth in SEQ ID NO:1 and is not lipid modified at an amino acid position corresponding to amino acid residue 77 as set forth in SEQ ID NO:1.
- the Wnt polypeptide is Wnt5a polypeptide or Wntl Ob polypeptide.
- the liposome has a net charge of 0 at a pH of between about 6.5 and about 8.0, about 7.0 and about 7.8, or about 7.2 and about 7.6.
- the phospholipid is 1 ,2-dimyristoyl-sn-glycero-3- phosphocholine (DMPC).
- the liposome further comprises cholesterol.
- the concentration of DMPC and cholesterol is defined by a ratio of between about 70:30 and about 100:0.
- the Wnt polypeptide is mammalian Wnt polypeptide. In some embodiments, the mammal is a human. In some embodiments, the lipid modification is palmitoylation. In some embodiments, the Wnt polypeptide is further glycosylated. In some embodiments, the Wnt product is separated from the sample mixture by centrifugation. In some embodiments, the centrifugation time is up to 1 hour at a temperature of between about 1°C and about 8°C.
- the Wnt product after centrifugation is resuspended in sterile 1X PBS.
- the Wnt product is stable under nitrogen.
- the Wnt product is stable at a temperature between about 1°C and about 8°C.
- a composition of isolated enhanced mammalian bone marrow cells wherein the cells have an enhanced expression level in one or more of the biomarkers selected from the group consisting of: Runx2, Osterix, Osteocalcin, Osteopontin, alkaline phosphatase, collagen type I, Axin2, Lef1 , and Tcf4, after treatment with a liposomal Wnt polypeptide.
- the mammalian bone marrow cells are rodent bone marrow cells.
- the rodent bone marrow cells are harvested from a rodent that is older than 10 months.
- the mammalian bone marrow cells are human bone marrow cells.
- the human bone marrow cells are obtained from a subject at or older than 35 years of age.
- the biomarkers are selected from Osteocalcin, Osteopontin, Axin2, Lef1 , and Tcf4.
- the biomarkers are selected from Osteocalcin, and Osteopontin.
- the enhanced expression level is compared to untreated mammalian bone marrow cells. In some embodiments, the enhanced expression level is between about 2% and about 20% or about 4% and about 10% compared to untreated mammalian bone marrow cells.
- the mammalian bone marrow cells further have a decreased expression level in a biomarker selected from SOX9 and PPARy after treatment with liposomal Wnt polypeptide.
- the decreased expression level in the mammalian bone marrow cells are compared to untreated mammalian bone marrow cells.
- the bone marrow cells further comprises a decrease in apoptosis level compared to untreated mammalian bone marrow cells. In some embodiments, the decrease in apoptosis level is about 50%.
- the mammalian bone marrow cells comprise enhanced osteogenic potential compared to untreated mammalian bone marrow cells.
- the enhanced osteogenic potential comprises new bone growth level at the site of bone defect after transplanting treated mammalian bone marrow cells.
- the new bone growth level is compared to new bone growth level of transplanted untreated mammalian bone marrow cells.
- the new bone growth level of transplanted treated mammalian bone marrow cells is between about 1 % and about 20% or about 5% and about 12% compared to the new bone growth level of transplanted untreated mammalian bone marrow cells.
- the mammalian bone marrow cells include adherent and non-adherent bone marrow cells.
- the mammalian bone marrow cells are adherent bone marrow cells.
- the adherent bone marrow cells include bone marrow stem cells and bone marrow progenitor cells. In some embodiments, the adherent bone marrow cells include bone marrow stromal cells. In some embodiments, the mammalian bone marrow cells are autologous bone marrow cells. In some embodiments, the autologous bone marrow cells include adherent and non-adherent bone marrow cells. In some embodiments, the autologous bone marrow cells are adherent bone marrow cells. In some embodiments, the autologous bone marrow cells include bone marrow stem cells and bone marrow progenitor cells. In some embodiments, the autologous bone marrow cells include bone marrow stromal cells.
- the mammalian bone marrow cells are allogeneic bone marrow cells.
- the allogeneic bone marrow cells include adherent and nonadherent bone marrow cells.
- the allogeneic bone marrow cells are adherent bone marrow cells.
- the allogeneic bone marrow cells include bone marrow stem cells and bone marrow progenitor cells.
- the allogeneic bone marrow cells include bone marrow stromal cells.
- the human bone marrow cells post treatment with liposomal Wnt polypeptide exhibit biomarker expression levels that are observed in a human subject younger than 35 years of age.
- the liposomal Wnt polypeptide comprises Wnt polypeptides and an aqueous solution of liposomes.
- the phospholipids comprising the liposomes have a phase transition temperature from about 10°C to about 25°C.
- the phospholipids comprising the liposomes have a tail carbon length of between about 12 carbons and about 14 carbons.
- the Wnt polypeptide is Wnt3a polypeptide.
- the Wnt3a polypeptide comprises at least about 30%, about 40%, about 50%, about 60% , about 70%, about 80%, about 90%, or about 95% sequence identity to the amino acid sequence as set forth in SEQ ID NO:1.
- the Wnt3a polypeptide comprises the amino acid sequence as set forth in SEQ ID NO:1. In some embodiments, the Wnt3a polypeptide is lipid modified at an amino acid position corresponding to amino acid residue 209 as set forth in SEQ ID NO:1 , and is not lipid modified at an amino acid position corresponding to amino acid residue 77 as set forth in SEQ ID NO:1 . In some embodiments, the Wnt polypeptide is Wnt5a polypeptide or Wnt10b polypeptide.
- compositions of mammalian bone marrow cells obtained from a human subject at or older than 35 years of age wherein the mammalian bone marrow cells express an enhanced expression level in one or more of the biomarkers selected from the group consisting of: Runx2, Osterix, Osteocalcin, Osteopontin, alkaline phosphatase, collagen type I, Axin2, Lef1 , and Tcf4, after treatment with a liposomal Wnt polypeptide.
- the biomarkers are selected from Osteocalcin, Osteopontin, Axin2, Lef1 , and Tcf4.
- the biomarkers are selected from Osteocalcin, and Osteopontin.
- the enhanced expression level is compared to untreated mammalian bone marrow cells. In some embodiments, the enhanced expression level is between about 2% and about 20% or about 4% and about 10% compared to untreated mammalian bone marrow cells.
- the mammalian bone marrow cells further have a decreased expression level in a biomarker selected from SOX9 and PPARy after treatment with liposomal Wnt polypeptide. In some embodiments, the decreased expression level in the mammalian bone marrow cells are compared to untreated mammalian bone marrow cells.
- the bone marrow cells further comprises a decrease in apoptosis level compared to untreated mammalian bone marrow cells. In some embodiments, the decrease in apoptosis level is about 50%.
- the mammalian bone marrow cells comprise enhanced osteogenic potential compared to untreated mammalian bone marrow cells. In some embodiments, the enhanced osteogenic potential comprises new bone growth level at the site of bone defect after transplanting treated mammalian bone marrow cells. In some embodiments, the new bone growth level is compared to new bone growth level of transplanted untreated mammalian bone marrow cells.
- the new bone growth level of transplanted treated mammalian bone marrow cells is between about 1 % and about 20% or about 5% and about 12% compared to the new bone growth level of transplanted untreated mammalian bone marrow cells.
- the mammalian bone marrow cells include adherent and non-adherent bone marrow cells.
- the mammalian bone marrow cells are adherent bone marrow cells.
- the adherent bone marrow cells include bone marrow stem cells and bone marrow progenitor cells.
- the adherent bone marrow cells include bone marrow stromal cells.
- the mammalian bone marrow cells are autologous bone marrow cells.
- the autologous bone marrow cells include adherent and non-adherent bone marrow cells.
- the autologous bone marrow cells are adherent bone marrow cells.
- the autologous bone marrow cells include bone marrow stem cells and bone marrow progenitor cells.
- the autologous bone marrow cells include bone marrow stromal cells.
- the mammalian bone marrow cells are allogeneic bone marrow cells.
- the allogeneic bone marrow cells include adherent and non-adherent bone marrow cells. In some embodiments, the allogeneic bone marrow cells are adherent bone marrow cells. In some embodiments, the allogeneic bone marrow cells include bone marrow stem cells and bone marrow progenitor cells. In some embodiments, the allogeneic bone marrow cells include bone marrow stromal cells. In some embodiments, the human bone marrow cells post treatment with liposomal Wnt polypeptide exhibit biomarker expression levels that are observed in a human subject younger than 35 years of age.
- the liposomal Wnt polypeptide comprises Wnt polypeptides and an aqueous solution of liposomes.
- the phospholipids comprising the liposomes have a phase transition temperature from about 10°C to about 25°C.
- the phospholipids comprising the liposomes have a tail carbon length of between about 12 carbons and about 14 carbons.
- the Wnt polypeptide is Wnt3a polypeptide.
- the Wnt3a polypeptide comprises at least about 30%, about 40%, about 50%, about 60% , about 70%, about 80%, about 90%, or about 95% sequence identity to the amino acid sequence as set forth in SEQ ID NO:1.
- the Wnt3a polypeptide comprises the amino acid sequence as set forth in SEQ ID NO:1. In some embodiments, the Wnt3a polypeptide is lipid modified at an amino acid position corresponding to amino acid residue 209 as set forth in SEQ ID NO:1 , and is not lipid modified at an amino acid position corresponding to amino acid residue 77 as set forth in SEQ ID NO:1. In some embodiments, the Wnt polypeptide is Wnt5a polypeptide or Wnt10b polypeptide.
- a mammalian bone marrow composition produced by a process comprising contacting isolated mammalian bone marrow cells ex-vivo with a liposomal Wnt polypeptide, wherein the contacting time is between about 30 minutes and about 4 hours.
- the contacting temperature is at between about 0°C and about 37°C, or about 20°C, and about 25°C.
- the process further comprises a washing step after contacting to remove free liposomal Wnt polypeptide.
- the process further comprises transplanting the liposomal Wnt polypeptide to a site of bone defect.
- the bone marrow cells have an enhanced expression level in one or more of the biomarkers selected from the group consisting of: Runx2, Osterix, Osteocalcin, Osteopontin, alkaline phosphatase, collagen type I, Axin2, Lef1 , and Tcf4, compared to untreated mammalian bone marrow cells.
- the biomarkers are selected from Osteocalcin, Osteopontin, Axin2, Lef1 , and Tcf4.
- the biomarkers are selected from Osteocalcin, and Osteopontin.
- the enhanced expression level is between about 2% and about 20% or about 4% and about 10% compared to untreated mammalian bone marrow cells.
- the mammalian bone marrow cells further have a decreased expression level in a biomarker selected from SOX9 and PPARv after treatment with liposomal Wnt polypeptide.
- the decreased expression level in the mammalian bone marrow cells are compared to untreated mammalian bone marrow cells.
- the bone marrow cells further comprises decrease in apoptosis level compared to untreated mammalian bone marrow cells. In some embodiments, the decrease in apoptosis level is about 50%.
- the mammalian bone marrow cells comprise enhanced osteogenic potential compared to untreated mammalian bone marrow cells.
- the enhanced osteogenic potential comprises new bone growth level at the site of bone defect after transplanting treated mammalian bone marrow cells.
- the new bone growth level is compared to new bone growth level of transplanted untreated mammalian bone marrow cells.
- the new bone growth level of transplanted treated mammalian bone marrow cells is between about 1 % and about 20% or about 5% and about 12% compared to the new bone growth level of transplanted untreated mammalian bone marrow cells.
- the mammalian bone marrow cells include adherent and non-adherent bone marrow cells. In some embodiments, the mammalian bone marrow cells are adherent bone marrow cells. In some embodiments, the adherent bone marrow cells include bone marrow stem cells and bone marrow progenitor cells. In some embodiments, the adherent bone marrow cells include bone marrow stromal cells. In some embodiments, the mammalian bone marrow cells are autologous bone marrow cells. In some embodiments, the autologous bone marrow cells are harvested from femurs, tibiae, and/or iliac crest.
- the autologous bone marrow cells include adherent and non-adherent bone marrow cells. In some embodiments, the autologous bone marrow cells are adherent bone marrow cells. In some embodiments, the autologous bone marrow cells include bone marrow stem cells and bone marrow progenitor cells. In some embodiments, the autologous bone marrow cells include bone marrow stromal cells. In some embodiments, the isolated mammalian bone marrow cells are allogeneic bone marrow cells. In some embodiments, the allogeneic bone marrow cells include adherent and non-adherent bone marrow cells.
- the allogeneic bone marrow cells are adherent bone marrow cells.
- the allogeneic bone marrow cells include bone marrow stem cells and bone marrow progenitor cells.
- the allogeneic bone marrow cells include bone marrow stromal cells.
- the mammalian bone marrow cells are rodent bone marrow cells.
- the rodent bone marrow cells are harvested from a rodent that is older than 10 months.
- the mammalian bone marrow cells are human bone marrow cells.
- the human bone marrow cells are harvested from a subject at or older than 35 years of age.
- the human bone marrow cells post treatment with liposomal Wnt polypeptide exhibit biomarker expression levels that are observed in a subject younger than 35 years of age.
- the liposomal Wnt polypeptide comprises Wnt polypeptides and an aqueous solution of liposomes.
- the phospholipids comprising the liposomes have a phase transition temperature from about 10°C to about 25°C.
- the phospholipids comprising the liposomes have a tail carbon length of between about 12 carbons and about 14 carbons.
- the Wnt polypeptide is Wnt3a polypeptide.
- the Wnt3a polypeptide comprises at least about 30%, about 40%, about 50%, about 60% , about 70%, about 80%, about 90%, or about 95% sequence identity to the amino acid sequence as set forth in SEQ ID NO:1 .
- the Wnt3a polypeptide comprises the amino acid sequence as set forth in SEQ ID NO:1.
- the Wnt3a polypeptide is lipid modified at an amino acid position corresponding to amino acid residue 209 as set forth in SEQ ID NO:1 and is not lipid modified at an amino acid position corresponding to amino acid residue 77 as set forth in SEQ ID NO:1.
- the Wnt polypeptide is Wnt5a polypeptide or Wnt10b polypeptide.
- a method of treating a bone defect in a subject comprising: (a) contacting a sample comprising mammalian bone marrow cells ex- vivo with a liposomal Wnt3a polypeptide; (b) washing the sample to remove free liposomal Wnt3a polypeptide; and (c) transplanting the liposomal Wnt3a polypeptide treated bone graft materials into a site of bone defect.
- the contacting temperature is at between about 0°C and about 37°C, or about 20°C and about 25°C.
- the contacting time is between about 30 minutes and about 4 hours.
- the bone marrow cells have an enhanced expression level in one or more of the biomarkers selected from the group consisting of: Runx2, Osterix, Osteocalcin, Osteopontin, alkaline phosphatase, collagen type I, Axin2, Lef1 , and Tcf4, compared to untreated mammalian bone marrow cells.
- the biomarkers are selected from Osteocalcin, Osteopontin, Axin2, Lef1 , and Tcf4.
- the biomarkers are selected from Osteocalcin, and Osteopontin.
- the enhanced expression level is between about 2% and about 20% or about 4% and about 10% compared to untreated mammalian bone marrow cells.
- the mammalian bone marrow cells further have a decreased expression level in a biomarker selected from SOX9 and PPARy after treatment with liposomal Wnt3a polypeptide.
- the decreased expression level in the mammalian bone marrow cells are compared to untreated mammalian bone marrow cells.
- the bone marrow cells further comprises decrease in apoptosis level compared to untreated mammalian bone marrow cells. In some embodiments, the decrease in apoptosis level is about 50%.
- the mammalian bone marrow cells comprise enhanced osteogenic potential compared to untreated mammalian bone marrow cells.
- the enhanced osteogenic potential comprises new bone growth level at the site of bone defect after transplanting treated mammalian bone marrow cells.
- the new bone growth level is compared to new bone growth level of transplanted untreated mammalian bone marrow cells.
- the new bone growth level of transplanted treated mammalian bone marrow cells is between about 1 % and about 20% or about 5% and about 12% compared to the new bone growth level of transplanted untreated mammalian bone marrow cells.
- the mammalian bone marrow cells include adherent and non-adherent bone marrow cells. In some embodiments, the mammalian bone marrow cells are adherent bone marrow cells. In some embodiments, the adherent bone marrow cells include bone marrow stem cells and bone marrow progenitor cells. In some embodiments, the adherent bone marrow cells include bone marrow stromal cells. In some embodiments, the mammalian bone marrow cells are autologous bone marrow cells. In some embodiments, the autologous bone marrow cells are harvested from femurs, tibiae, and/or iliac crest.
- the autologous bone marrow cells include adherent and non-adherent bone marrow cells. In some embodiments, the autologous bone marrow cells are adherent bone marrow cells. In some embodiments, the autologous bone marrow cells include bone marrow stem cells and bone marrow progenitor cells. In some embodiments, the autologous bone marrow cells include bone marrow stromal cells. In some embodiments, the isolated mammalian bone marrow cells are allogeneic bone marrow cells. In some embodiments, the allogeneic bone marrow cells include adherent and non-adherent bone marrow cells.
- the allogeneic bone marrow cells are adherent bone marrow cells.
- the allogeneic bone marrow cells include bone marrow stem cells and bone marrow progenitor cells.
- the allogeneic bone marrow cells include bone marrow stromal cells.
- the mammalian bone marrow cells are rodent bone marrow cells.
- the rodent bone marrow cells are harvested from a rodent that is older than 10 months.
- the mammalian bone marrow cells are human bone marrow cells.
- the human bone marrow cells are harvested from a subject at or older than 35 years of age.
- the human bone marrow cells post treatment with liposomal Wnt3a polypeptide exhibit biomarker expression levels that are observed in a subject younger than 35 years of age.
- the liposomal Wnt3a polypeptide comprises Wnt3a polypeptides and an aqueous solution of liposomes.
- the phospholipids comprising the liposomes have a phase transition temperature from about 10°C to about 25°C. In some embodiments, the phospholipids comprising the liposomes have a tail carbon length of between about 12 carbons and about 14 carbons.
- the Wnt3a polypeptide comprises at least about 30%, about 40%, about 50%, about 60% , about 70%, about 80%, about 90%, or about 95% sequence identity to the amino acid sequence as set forth in SEQ ID NO:1. In some embodiments, the Wnt3a polypeptide comprises the amino acid sequence as set forth in SEQ ID NO:1. In some embodiments, the Wnt3a polypeptide is lipid modified at an amino acid position corresponding to amino acid residue 209 as set forth in SEQ ID NO:1 and is not lipid modified at an amino acid position corresponding to amino acid residue 77 as set forth in SEQ ID NO:1 .
- a method of treating a bone defect in a subject comprising: (a) contacting a sample comprising mammalian bone marrow cells ex- vivo with a liposomal Wnt polypeptide; (b) washing the sample to remove free liposomal Wnt polypeptide; and (c) transplanting the liposomal Wnt polypeptide treated bone graft materials into a site of bone defect.
- the contacting temperature is at between about 0°C and about 37°C or about 20°C and about 25°C.
- the contacting time is between about 30 minutes and about 4 hours.
- the bone marrow cells have an enhanced expression level in one or more of the biomarkers selected from the group consisting of: Runx2, Osterix, Osteocalcin, Osteopontin, alkaline phosphatase, collagen type I, Axin2, Lef1 , and Tcf4, compared to untreated mammalian bone marrow cells.
- the biomarkers are selected from Osteocalcin, Osteopontin, Axin2, Lef1 , and Tcf4.
- the biomarkers are selected from Osteocalcin, and Osteopontin.
- the enhanced expression level is between about 2% and about 20% or about 4% and about 10% compared to untreated mammalian bone marrow cells.
- the mammalian bone marrow cells further have a decreased expression level in a biomarker selected from SOX9 and PPARy after treatment with liposomal Wnt polypeptide.
- the decreased expression level in the mammalian bone marrow cells are compared to untreated mammalian bone marrow cells.
- the bone marrow cells further comprises decrease in apoptosis level compared to untreated mammalian bone marrow cells. In some embodiments, the decrease in apoptosis level is about 50%.
- the mammalian bone marrow cells comprise enhanced osteogenic potential compared to untreated mammalian bone marrow cells.
- the enhanced osteogenic potential comprises new bone growth level at the site of bone defect after transplanting treated mammalian bone marrow cells.
- the new bone growth level is compared to new bone growth level of transplanted untreated mammalian bone marrow cells.
- the new bone growth level of transplanted treated mammalian bone marrow cells is between about 1 % and about 20% or about 5% and about 12% compared to the new bone growth level of transplanted untreated mammalian bone marrow cells.
- the mammalian bone marrow cells include adherent and non-adherent bone marrow cells. In some embodiments, the mammalian bone marrow cells are adherent bone marrow cells. In some embodiments, the adherent bone marrow cells include bone marrow stem cells and bone marrow progenitor cells. In some embodiments, the adherent bone marrow cells include bone marrow stromal cells. In some embodiments, the mammalian bone marrow cells are autologous bone marrow cells. In some embodiments, the autologous bone marrow cells are harvested from femurs, tibiae, and/or iliac crest.
- the autologous bone marrow cells include adherent and non-adherent bone marrow cells. In some embodiments, the autologous bone marrow cells are adherent bone marrow cells. In some embodiments, the autologous bone marrow cells include bone marrow stem cells and bone marrow progenitor cells. In some embodiments, the autologous bone marrow cells include bone marrow stromal cells. In some embodiments, the isolated mammalian bone marrow cells are allogeneic bone marrow cells. In some embodiments, the allogeneic bone marrow cells include adherent and non-adherent bone marrow cells.
- the allogeneic bone marrow cells are adherent bone marrow cells.
- the allogeneic bone marrow cells include bone marrow stem cells and bone marrow progenitor cells.
- the allogeneic bone marrow cells include bone marrow stromal cells.
- the mammalian bone marrow cells are rodent bone marrow cells.
- the rodent bone marrow cells are harvested from a rodent that is older than 10 months.
- the mammalian bone marrow cells are human bone marrow cells.
- the human bone marrow cells are harvested from a subject at or older than 35 years of age.
- the human bone marrow cells post treatment with liposomal Wnt polypeptide exhibit biomarker expression levels that are observed in a subject younger than 35 years of age.
- the liposomal Wnt polypeptide comprises Wnt polypeptides and an aqueous solution of liposomes.
- the phospholipids comprising the liposomes have a phase transition temperature from about 10°C to about 25°C.
- the phospholipids comprising the liposomes have a tail carbon length of between about 12 carbons and about 14 carbons.
- the Wnt polypeptide is Wnt3a polypeptide.
- the Wnt3a polypeptide comprises at least about 30%, about 40%, about 50%, about 60% , about 70%, about 80%, about 90%, or about 95% sequence identity to the amino acid sequence as set forth in SEQ ID NO:1 .
- the Wnt3a polypeptide comprises the amino acid sequence as set forth in SEQ ID NO:1.
- the Wnt3a polypeptide is lipid modified at an amino acid position corresponding to amino acid residue 209 as set forth in SEQ ID NO:1 and is not lipid modified at an amino acid position corresponding to amino acid residue 77 as set forth in SEQ ID NO:1.
- the Wnt polypeptide is Wnt5a polypeptide or Wnt10b polypeptide.
- the liposomal Wnt polypeptide is a composition comprising a functionally active mammalian Wnt polypeptide and an aqueous solution comprising liposomes, wherein the phospholipids comprising the liposomes have a phase transition temperature from about 10°C to about 25°C.
- the liposomal Wnt polypeptide is a composition comprising a functionally active mammalian Wnt polypeptide and an aqueous solution comprising liposomes, wherein the phospholipids comprising the liposomes have a tail carbon length of between about 12 carbons and about 14 carbons.
- the Wnt polypeptide is integrated into the liposomal membrane.
- the Wnt polypeptide protrudes from the liposomal membrane onto the outer surface of the lipid membrane.
- the Wnt polypeptide is not incorporated into the aqueous core of the liposome.
- the Wnt polypeptide is Wnt3a polypeptide.
- the Wnt3a polypeptide comprises at least about 30%, about 40%, about 50%, about 60% , about 70%, about 80%, about 90%, or about 95% sequence identity to the amino acid sequence as set forth in SEQ ID NO:1 .
- the Wnt3a polypeptide comprises the amino acid sequence as set forth in SEQ ID NO:1.
- the Wnt3a polypeptide is lipid modified at an amino acid position corresponding to amino acid residue 209 as set forth in SEQ ID NO:1 and is not lipid modified at an amino acid position corresponding to amino acid residue 77 as set forth in SEQ ID NO:1.
- the Wnt polypeptide is Wnt5a polypeptide or Wnt10b polypeptide. In some embodiments, the concentration of the Wnt polypeptide is between about 5 ⁇ g ⁇ L and about 15 ⁇ g ⁇ L, or about 8 ⁇ g ⁇ L and about 12 ⁇ g ⁇ L. In some embodiments, the liposome has a net charge of 0 at a pH of between about 6.5 and about 8.0. In some embodiments, the liposome has a net positive charge or a net negative charge at a pH of between about 6.5 and about 8.0. In some embodiments, the phospholipid is 1 ,2- dimyristoyl-sn-glycero-3-phosphocholine (DMPC).
- DMPC dimyristoyl-sn-glycero-3-phosphocholine
- the liposome further comprises cholesterol.
- the concentration of DMPC and cholesterol is defined by a ratio of between about 70:30 and about 100:0.
- the mammal is a human.
- the lipid modification is palmitoylation.
- the Wnt polypeptide is further glycosylated.
- the composition is a stable composition. In some embodiments, the composition is stable up to about 106 days without substantial loss of activity. In some embodiments, the composition is stable at a temperature between about 1°C and about 8°C. In some embodiments, the composition is stable under nitrogen.
- the liposomal Wnt3a polypeptide is a composition comprising a functionally active Wnt3a polypeptide and an aqueous solution comprising liposomes, wherein the functionally active Wnt3a polypeptide comprises a lipid modification at an amino acid position corresponding to amino acid residue 209 as set forth in SEQ ID NO:1.
- the functionally active Wnt3a polypeptide is not lipid modified at an amino acid position corresponding to amino acid residue 77 as set forth in SEQ ID NO:1.
- the functionally active Wnt3a polypeptide is integrated into the liposomal membrane. In some embodiments, the functionally active Wnt3a polypeptide protrudes from the liposomal membrane onto the outer surface of the lipid membrane. In some embodiments, the functionally active Wnt3a polypeptide is not incorporated into the aqueous core of the liposome. In some embodiments, the functionally active Wnt3a polypeptide comprises at least about 30%, about 40%, about 50%, about 60% , about 70%, about 80%, about 90%, or about 95% sequence identity to the amino acid sequence as set forth in SEQ ID NO:1.
- the functionally active Wnt3a polypeptide comprises the amino acid sequence as set forth in SEQ ID NO:1.
- the concentration of the functionally active Wnt3a polypeptide is between about 5 ⁇ g ⁇ L and about 15 ⁇ g ⁇ L, or about 8 ⁇ g ⁇ L and about 12 ⁇ g ⁇ L.
- the phospholipid comprising the liposome has a tail carbon length of between about 12 carbons and about 14 carbons.
- the phospholipid comprising the liposome has a phase transition temperature from about 10°C to about 25°C, about 15°C to about 25°C, or about 20°C to about 25°C.
- the liposome has a net charge of 0 at a pH of between about 6.5 and about 8.0, about 7.0 and about 7.8, or about 7.2 and about 7.6.
- the phospholipid is 1 ,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC).
- the liposome further comprises cholesterol.
- the concentration of DMPC and cholesterol is defined by a ratio of between about 70:30 and about 100:0.
- the Wnt3a polypeptide is mammalian Wnt3a polypeptide.
- the mammal is a human.
- the lipid modification is palmitoylation.
- the Wnt3a polypeptide is further glycosylated.
- the composition is a stable composition. In some embodiments, the composition is stable up to about 106 days without substantial loss of activity. In some embodiments, the composition is stable at a temperature between about 1°C and about 8°C. In some embodiments, the composition is stable under nitrogen. ] Disclosed herein, in certain embodiments, is a kit for generating bone graft materials comprising an isolated enhanced mammalian bone marrow cell composition.
- the isolated enhanced mammalian bone marrow cell composition is a composition of mammalian bone marrow cells obtained from a human subject at or older than 35 years of age, wherein the mammalian bone marrow cells express an enhanced expression level in one or more of the biomarkers selected from the group consisting of: Runx2, Osterix, Osteocalcin, Osteopontin, alkaline phosphatase, collagen type I, Axin2, Lef1 , and Tcf4, after treatment with a liposomal Wnt polypeptide.
- the biomarkers are selected from Osteocalcin, Osteopontin, Axin2, Lef1 , and Tcf4.
- the biomarkers are selected from Osteocalcin, and Osteopontin.
- the enhanced expression level is compared to untreated mammalian bone marrow cells. In some embodiments, the enhanced expression level is between about 2% and about 20% or about 4% and about 10% compared to untreated mammalian bone marrow cells.
- the mammalian bone marrow cells further have a decreased expression level in a biomarker selected from SOX9 and PPARy after treatment with liposomal Wnt polypeptide. In some embodiments, the decreased expression level in the mammalian bone marrow cells are compared to untreated mammalian bone marrow cells.
- the bone marrow cells further comprises a decrease in apoptosis level compared to untreated mammalian bone marrow cells. In some embodiments, the decrease in apoptosis level is about 50%.
- the mammalian bone marrow cells comprise enhanced osteogenic potential compared to untreated mammalian bone marrow cells. In some embodiments, the enhanced osteogenic potential comprises new bone growth level at the site of bone defect after transplanting treated mammalian bone marrow cells. In some embodiments, the new bone growth level is compared to new bone growth level of transplanted untreated mammalian bone marrow cells.
- the new bone growth level of transplanted treated mammalian bone marrow cells is between about 1 % and about 20% or about 5% and about 12% compared to the new bone growth level of transplanted untreated mammalian bone marrow cells.
- the mammalian bone marrow cells include adherent and nonadherent bone marrow cells.
- the mammalian bone marrow cells are adherent bone marrow cells.
- the adherent bone marrow cells include bone marrow stem cells and bone marrow progenitor cells.
- the adherent bone marrow cells include bone marrow stromal cells.
- the mammalian bone marrow cells are autologous bone marrow cells.
- the autologous bone marrow cells include adherent and non-adherent bone marrow cells.
- the autologous bone marrow cells are adherent bone marrow cells.
- the autologous bone marrow cells include bone marrow stem cells and bone marrow progenitor cells.
- the autologous bone marrow cells include bone marrow stromal cells.
- the mammalian bone marrow cells are allogeneic bone marrow cells.
- the allogeneic bone marrow cells include adherent and non-adherent bone marrow cells. In some embodiments, the allogeneic bone marrow cells are adherent bone marrow cells. In some embodiments, the allogeneic bone marrow cells include bone marrow stem cells and bone marrow progenitor cells. In some embodiments, the allogeneic bone marrow cells include bone marrow stromal cells. In some embodiments, the human bone marrow cells post treatment with liposomal Wnt polypeptide exhibit biomarker expression levels that are observed in a human subject younger than 35 years of age.
- the liposomal Wnt polypeptide comprises Wnt polypeptides and an aqueous solution of liposomes.
- the phospholipids comprising the liposomes have a phase transition temperature from about 10°C to about 25°C.
- the phospholipids comprising the liposomes have a tail carbon length of between about 12 carbons and about 14 carbons.
- the Wnt polypeptide is Wnt3a polypeptide.
- the Wnt3a polypeptide comprises at least about 30%, about 40%, about 50%, about 60% , about 70%, about 80%, about 90%, or about 95% sequence identity to the amino acid sequence as set forth in SEQ ID NO:1 .
- the Wnt3a polypeptide comprises the amino acid sequence as set forth in SEQ ID NO:1. In some embodiments, the Wnt3a polypeptide is lipid modified at an amino acid position corresponding to amino acid residue 209 as set forth in SEQ ID NO:1 , and is not lipid modified at an amino acid position corresponding to amino acid residue 77 as set forth in SEQ ID NO:1. In some embodiments, the Wnt polypeptide is Wnt5a polypeptide or Wnt10b polypeptide.
- FIG. 1 illustrates a purification scheme of the present invention.
- Fig. 2 indicates SDS PAGE and Coomassie blue staining analyses of Wnt3a.
- Fig. 3 exemplifies a mass spectroscopy data.
- FIG. 4 illustrates TEM characterization of L-Wnt3a. TEM was used to visualize L-
- Fig. 5 illustrates quantification of human Wnt3a and L-Wnt3a activities.
- Fig. 6 indicates the stability of L-Wnt3a at 4°C. The liposome-Wnt3a interaction was examined. Liposomal Wnt3a (L-Wnt3a) was incubated at 4°C for up to 48 days. Human L- Wnt3a polypeptide was then tested in a LSL assay for activity. L-Wnt3a polypeptide showed no loss of activity over the 48-day test period.
- Fig. 7 indicates the stability of L-Wnt3a at 23°C.
- Fig. 8 illustrates the stability of L-Wnt3a at 37°C.
- the association of human Wnt3a with a DMPC:cholesterol liposome was tested to determine whether it would provide stability to Wnt3a polypeptide.
- Data from multiple time points were fit to a single exponential decay, which showed that after 10h, L-Wnt3a retained half of its activity at 37°C (blue line, Fig. 8A) whereas Wnt3a lost its activity within 5 min (red line, Fig. 8A).
- the loss of activity in human Wnt3a was due to proteolysis.
- Wnt3a + CHAPS solutions smaller molecular weight bands were detectable in the immunoblots (Fig. 8B).
- An immunoblot of L-Wnt3a preparations did not detect smaller molecular weight bands corresponding to Wnt3a (Fig. 8C).
- Fig. 9 exemplifies human Wnt3a polypeptide produced from cells grown in suspension versus adherent cultures.
- Fig. 10 illustrates doxycycline concentration-dependent induction of human Wnt3a polypeptide secretion. Doxycycline was added to the media at a range of concentrations
- Fig. 1 1 exemplifies that fetal bovine serum was used for human Wnt3a polypeptide secretion from CHO cells.
- Fig. 12 illustrates human Wnt3a secretion from CHO cells as a function of days in culture.
- Fig. 13 illustrates robustness, precision, limit of detection and specificity of the LSL cellular reporter assay.
- Fig. 14 illustrates L-Wnt3a dose response curves using primary cells.
- A In mouse embryonic fibroblasts (MEFs), the linear range of effective concentration was 0.025-0.1 ng/ ⁇ human Wnt3a.
- B L-Wnt3a activity in bone marrow-derived stem cells, and determined that the linear range of effective concentrations ranged from 0.004-0.08 ng ⁇ L.
- Fig. 15 illustrates human Wnt3a activity under different lipid formulations.
- DMPC and cholesterol lipids were substituted for CHAPS to maintain Wnt3a activity but liposomes fabricated with lipids such as MPPC, DPPC, DMPS, DMPG, and DMGE were inactive.
- Fig. 16 exemplifies a sucrose density gradient.
- Fig. 17 exemplifies human Wnt3a affinity toward liposome membranes.
- Wnt3a/Frizzled binding affinity was about 3.6nM.
- the Wnt3a/LRP6 binding affinity was about 9nM.
- the binding affinity between Wnt3a and the liposomal membrane was about ⁇ 6nM, based on pull-down assays between Wnt3a, Frizzled (Fz), and Lrp6.
- Fig. 18 illustrates kinetics of human Wnt3a association with liposomes.
- Fig. 19 illustrates Wnt5a and Wnt10b polypeptide bindings to neutral DMPC liposomes.
- Fig. 20 illustrates individual components of the bone graft material.
- the bone graft material contains stem and progenitor cell populations.
- Fig. 20A indicates Gomori staining of BGM harvested from rat femur, (Fig. 20B) the iliac crest, and (Fig. 20C) the tibia.
- Fig. 20D is the quantitative RT-PCR analyses of endogenous osteogenic gene expression in freshly harvested rat BGM from the indicated sources.
- Fig. 20E illustrates a schematic of experimental design, where autologous BGM is transplanted into the SRC of rats.
- Fig. 20F exemplifies representative tissue sections of iliac crest BGM on post-transplant day 7, stained to detect BrdU incorporation.
- Fig. 20G, Fig. 20H, and Fig. 201 are Runx2, Sox9, and PPARy expressions, respectively.
- Fig. 20J shows representative tissue sections of BGM stained with Aniline blue to detect osteoid matrix; asterisks indicate new bone matrix as opposed to old bone chips (yellow dotted line). The kidney surface is indicated with a dotted white line in this panel, and in Fig. 20G.
- Fig. 20K is Safranin O/Fast green histology to detect proteoglycan-rich cartilage (red), and
- Fig. 20L is Gomori trichrome staining to detect adipocytes.
- Fig. 21 illustrates bone graft material as Wnt responsive.
- Fig. 21A indicates GFP +ve cells in Axin2 CreERT2 ;R26 mTmG mice, visualized by immunostaining of the periosteum and
- Fig. 21 B is endosteum.
- Fig. 21 C is quantification of GFP +ve cells/total cells within specified microscopic fields of view.
- Fig. 21 D indicates GFP +ve cells in the BGM were visualized by fluorescence.
- Fig. 21 E is quantitative absolute RT-PCR results for endogenous Axin2, Lef1, and GAPDH expression in BGM young (green bars) and BGM aged (grey bars).
- Fig. 21 F illustrates western blot analyses for Wnt3a, total beta catenin, Axin2, and beta actin in in
- Fig. 22 shows osteogenic differentiation potential of BGM declines with age.
- FIG. 22A indicates quantitative RT-PCR analyses for expression of alkaline phosphatase, Osterix, and Osteocalcin in BGM young (green bars) and BGM aged (grey bars).
- Fig. 22B is BGM harvested from ACTB-eGFP mice, transplanted into the SRC and visualized under brightfield and
- Fig. 22C is the detection of the GFP signal in BGM utilizing fluorescent light.
- Fig. 22F indicates histomorphometric analyses of Aniline blue +ve pixels within the total area occupied by the BGM on post-transplant day 7.
- Fig. 22A indicates quantitative RT-PCR analyses for expression of alkaline phosphatase, Osterix, and Osteocalcin in BGM young (green bars) and BGM aged (grey bars).
- Fig. 22I indicates quantification of ALP +ve pixels within the total area occupied by the BGM on post- transplant day 7.
- Fig. 22L shows quantification of GFP +ve pixels within the total area occupied by the BGM on post-transplant day 7.
- Asterisks p ⁇ 0.05; double asterisks: p ⁇ 0.01.
- Fig. 23 shows osteogenic differentiation of BGM that requires an endogenous Wnt signal.
- Fig. 23A shows representative tissue sections stained for ALP activity in BGM treated with the murine lgG2a Fc fragment (Ad-Fc) or (Fig. 23B) adenovirus expressing the soluble Wnt antagonist Dkk1 (Ad-Dkk1 ).
- Fig. 23C shows representative tissue sections immunostained for PPARy in BGM treated with Ad-Fc or (Fig. 23D) Ad-Dkk1.
- Fig. 23E illustrates representative tissue sections immunostained for Dlk1 in BGM treated with Ad-Fc or (Fig. 23F) Ad-Dkk1.
- Fig. 23A shows representative tissue sections stained for ALP activity in BGM treated with the murine lgG2a Fc fragment (Ad-Fc) or (Fig. 23B) adenovirus expressing the soluble Wnt antagonist Dkk1 (Ad-Dkk1 ).
- FIG. 23G illustrates micro-CT reconstruction to detect bone formation in defect sites that received BGM treated with Ad-Fc or (Fig. 23H) Ad-Dkk1.
- Original defect is indicated with a dotted red circle.
- Fig. 23J indicates aniline blue staining on representative tissue sections from defect sites that received BGM treated with Ad-Fc or (Fig. 23K) Ad-Dkk1.
- Fig. 23L indicates quantification of new bone volume using histomorphometric analyses.
- Fig. 23I is PPAR- ⁇ expression in BM grafts treated with Ad-Fc or (Fig. 23J) Ad-Dkk1. Single asterisk p ⁇ 0.05. Scale bars: A-B, 200 ⁇ , C-F,J-K, ⁇ , G-H, 2mm.
- Fig. 24 illustrates human Wnt3a activation of BGM aged and restoration of its osteogenic differentiation potential.
- Fig. 24A indicates BGMs from aged ACTB-eGFP mice, treated with L-PBS or L-WNT3A (O. ⁇ g/ml) for 1 h then either assayed by qRT-PCR for target gene expression 24h later, or immediately transplanted into the SRC for 7 days.
- Fig. 24B illustrates fold change in Axin2 and Lef1 expression in BGM aged treated with either L- PBS (grey bars) or L-WNT3A (blue bars).
- Fig. 24A indicates BGMs from aged ACTB-eGFP mice, treated with L-PBS or L-WNT3A (O. ⁇ g/ml) for 1 h then either assayed by qRT-PCR for target gene expression 24h later, or immediately transplanted into the SRC for 7 days.
- Fig. 24B illustrates fold change in Axin2
- FIG. 24C are western blot analysis of total beta catenin, Axin2, and beta actin in BGM aged treated with either L-PBS (grey bars) or L-WNT3A (blue bars).
- L-PBS grey bars
- L-WNT3A blue bars
- Fig. 24F indicates quantification of BrdU +ve pixels within a microscopic field of view centered in the middle of the bone grafts.
- FIG. 24I illustrates quantification of BrdU +ve pixels as above.
- Fig. 24L shows quantification of Dlk1 +ve pixels within the total area occupied by the BGM on post-transplant day 7.
- Fig. 24R indicates histomorphometric quantification of new bone matrix. Abbreviations are described as elsewhere herein. Scale bars: ⁇ ⁇ . Asterisks: p ⁇ 0.05; double asterisks: p ⁇ 0.01.
- FIG. 25 illustrates L-Wnt3a stimulation of BGM stem cells and improvement of spinal fusion.
- Fig. 25A shows human MSC cultures were treated with L-PBS or L-WNT3A at 37°C for the time points indicated and qRT-PCR for Axin2 expression was used to determine Wnt-response.
- Fig. 25B shows murine SSC were treated with L-PBS or L- WNT3A for 12h at 37°C and Wnt response was assayed with qRT-PCR for Axin2 expression.
- Fig. 25A shows human MSC cultures were treated with L-PBS or L-WNT3A at 37°C for the time points indicated and qRT-PCR for Axin2 expression was used to determine Wnt-response.
- Fig. 25B shows murine SSC were treated with L-PBS or L- WNT3A for 12h at 37°C and Wnt response was assayed with qRT-PCR for A
- FIG. 25C illustrates quantitative absolute RT-PCR analyses for Axin2 and Lef1 expression in response to 1 h incubation at room temperature with L-PBS (dashed line) or L- WNT3A (0.15 ⁇ g mL; blue line). Data is expressed as a ratio of RNA copies/total RNA content over a 24h period.
- Fig. 25D indicates rat spinous processes were exposed via minimal incisions and standardized volumes of autologous BGM from the iliac crest were treated with L-PBS or L-WNT3A for 1 hr then (Fig. 25E) transplanted between the transverses processes of the L4 and L5 vertebrae.
- Fig. 25D indicates rat spinous processes were exposed via minimal incisions and standardized volumes of autologous BGM from the iliac crest were treated with L-PBS or L-WNT3A for 1 hr then (Fig. 25E) transplanted between the transverses processes of the L4 and L5 vertebra
- FIG. 25F indicates at POD2 Micro-CT acquisitions were performed for graft (pink) treated with L-PBS and (G) L-WNT3A.
- Fig. 25H indicates at POD49 Micro-CT acquisitions were again performed to evaluate the bone growth of the transplants treated with L-PBS (gray) and (Fig. 25I) L-WNT3A (blue).
- Fig. 25J indicates transplant growth that was graphed for each of the treatment groups as fold volume, comparing each graft size on POD2 to its size on POD49 (indicated by the colors as stated above).
- Fig. 26 illustrates quantification of BGM volume.
- BGM harvested from the tibiae and femurs was divided into 5 aliquots of about ⁇ 20 ⁇ then DNA concentration was evaluated as a means to quantify cellular density in the heterogeneous mixture of cells, stroma, and bone fragments.
- the DNA concentration in sample #1 was set as at 100, and the relative DNA concentration of the other 4 aliquots were determined.
- Fig. 27 illustrates engraftment efficiency of BGM. L-Wnt3a treatment improves BGM engraftment efficiency.
- Fig. 27A illustrates GFP immunostaining of BGM aged and (Fig. 27B) BGM ACT after 4d in the SRC.
- Fig. 27C shows quantification of GFP +ve pixels over total pixels occupied by the BGM on post-transplant day 4.
- Fig. 27D shows TUNEL staining of BGM aged and (Fig. 27E) BGM ACT after 4d in the SRC.
- Fig. 27F shows quantification of TUNEL +ve cells over total DAPI +ve pixels within the total area occupied by the BGMs on post-transplant days 4.
- FIG. 27G shows TUNEL staining of BGM aged and (Fig. 27H) BGM ACT after 7d in the SRC.
- Fig. 271 shows quantification of TUNEL +ve cells over total DAPI +ve pixels within the total area occupied by the BGMs on post-transplant day 7.
- Fig. 27J illustrates tissue sections stained for tartrate resistant acid phosphatase (TRAP) activity to detect osteoclasts in BGM aged and (Fig. 27K) BGM ACT after 7d in the SRC.
- compositions, methods, processes, and kits for use in generating a liposomal Wnt polypeptide are also disclosed herein.
- compositions, methods, processes, and kits for generating bone graft materials are also disclosed herein.
- a composition comprises a functionally active mammalian Wnt polypeptide and an aqueous solution comprising liposomes, wherein the phospholipids comprising the liposomes have a phase transition temperature from about 10°C to about 25°C.
- a composition comprises a functionally active mammalian Wnt polypeptide and an aqueous solution comprising liposomes, wherein the phospholipids comprising the liposomes have a tail carbon length of between about 12 carbons and about 14 carbons.
- a composition also comprises a functionally active Wnt3a polypeptide and an aqueous solution comprising liposomes, wherein the functionally active Wnt3a polypeptide comprises a lipid modification at an amino acid position corresponding to amino acid residue 209 as set forth in SEQ ID NO:1.
- described herein is a method of preparing a liposomal Wnt polypeptide, which comprises the steps of contacting a sample comprising Wnt polypeptides to an aqueous solution of liposomes, wherein the phospholipids comprising the liposomes have a phase transition temperature from about 10°C to about 25°C.
- described herein is a method of preparing a liposomal Wnt polypeptide, which comprises the steps of contacting a sample comprising Wnt polypeptides to an aqueous solution of liposomes, wherein the phospholipids comprising the liposome have a tail carbon length of between about 12 carbons and about 14 carbons.
- a method of preparing a liposomal Wnt3a polypeptide which comprises the steps of (a) harvesting Wnt3a polypeptides from a conditioned media comprising Chinese hamster ovary (CHO) cells; (b) introducing the Wnt3a polypeptides to an ion-exchange column immobilized with a sulfonated polyaromatic compound; (c) eluting the Wnt3a polypeptides from the ion-exchange column utilizing a step gradient; and (d) contacting the Wnt3a polypeptides from step (c) with an aqueous solution of liposomes.
- described herein is a composition of isolated enhanced mammalian bone marrow cells wherein the cells have an enhanced expression level in one or more of the biomarkers selected from the group consisting of: Runx2, Osterix, Osteocalcin, Osteopontin, alkaline phosphatase, collagen type I, Axin2, Lef1 , and Tcf4, after treatment with a liposomal Wnt polypeptide.
- the biomarkers selected from the group consisting of: Runx2, Osterix, Osteocalcin, Osteopontin, alkaline phosphatase, collagen type I, Axin2, Lef1 , and Tcf4, after treatment with a liposomal Wnt polypeptide.
- compositions of mammalian bone marrow cells obtained from a human subject at or older than 35 years of age, wherein the mammalian bone marrow cells express an enhanced expression level in one or more of the biomarkers selected from the group consisting of: Runx2, Osterix, Osteocalcin, Osteopontin, alkaline phosphatase, collagen type I , Axin2, Lef1 , and Tcf4, after treatment with a liposomal Wnt polypeptide.
- a mammalian bone marrow composition produced by a process which comprises the step of contacting isolated mammalian bone marrow cells ex-vivo with a liposomal Wnt polypeptide, wherein the contacting time is between about 30 minutes and about 4 hours.
- a method of treating a bone defect in a subject which comprises the steps of (a) contacting a sample comprising mammalian bone marrow cells ex-vivo with a liposomal Wnt polypeptide; (b) washing the sample to remove free liposomal Wnt polypeptide; and (c) transplanting the liposomal Wnt polypeptide treated bone graft materials into a site of bone defect.
- Also described herein is a method of treating a bone defect in a subject, which comprises the steps of (a) contacting a sample comprising mammalian bone marrow cells ex-vivo with a liposomal Wnt3a polypeptide; (b) washing the sample to remove free liposomal Wnt3a polypeptide; and (c) transplanting the liposomal Wnt3a polypeptide treated bone graft materials into a site of bone defect.
- a method of generating bone graft materials which comprises the steps of (a) contacting a sample comprising mammalian bone marrow cells ex-vivo with a liposomal Wnt polypeptide; (b) washing the sample to remove free liposomal Wnt polypeptide; and (c) transplanting the liposomal Wnt polypeptide treated bone graft materials into a site of bone defect.
- Also described herein is a method of generating bone graft materials, which comprises the steps of (a) contacting a sample comprising mammalian bone marrow cells ex-vivo with a liposomal Wnt3a polypeptide; (b) washing the sample to remove free liposomal Wnt3a polypeptide; and (c) transplanting the liposomal Wnt3a polypeptide treated bone graft materials into a site of bone defect.
- composition which comprises at least about 60%, or at least about 70% or at least about 80%, or at least about 85%, or at least about 90%, or at least about 95% of functionally active Wnt3a polypeptide of SEQ ID NO: 1 lipid modified at Ser209, or at a corresponding conserved Ser of a non-human mammalian Wnt3a polypeptide in the absence of lipid modification at Cys77; or at a corresponding conserved Cys of a non- human mammalian Wnt3a polypeptide.
- composition which comprises at least about 60%, or at least about 70% or at least about 80%, or at least about 85%, or at least about 90%, or at least about 95% of functionally active human Wnt polypeptide other than Wnt3A, which is lipid modified at a conserved Ser corresponding to Wnt3A ser209 in the absence of lipid modification at a corresponding conserved Cys to Wnt3A Cys77.
- the Wnt polypeptide is Wnt3a or a functionally active variant therof. In other aspects, the Wnt polypeptide is human Wnt3a or a functionally active variant thereof. In yet another aspect, the Wnt polypeptide is Wnt3a of SEQ ID NO: 1 or a functionally active variant therof. In a further aspect, the lipid modification is palmitoylation.
- the Wnt polypeptide is a human Wnt protein other than Wnt3A, such as a Wnt1 , Wnt2, Wnt2b (or Wnt13), Wnt3, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a (Wnt14, or Wnt14b), Wnt9b (Wnt14b, or Wnt15), Wnt10a, Wnt10b (or Wnt12), Wnt1 1 , Wnt-16a, Wnt-16b polypeptide or a functionally active variant therof.
- the polypeptide is Wnt5A or Wnt10b or a functionally active variant therof.
- the Wnt polypeptide is formulated into a liposome, e.g. a liposome comprising DMPC and/or cholesterol.
- a method for the purification of a Wnt polypeptide from mammalian cell culture including without limitation, recombinant Chinese Hamster Ovary (CHO) cells, which comprises subjecting a culture medium of said cells that contains the Wnt polypeptide to purification utilizing a separation step such as for example on a chromatographic column (e.g. Blue Sepharose ion-exchange column) in the absence of alternative purification steps such as a gel filtration purification step.
- a separation step such as for example on a chromatographic column (e.g. Blue Sepharose ion-exchange column) in the absence of alternative purification steps such as a gel filtration purification step.
- the purification is performed also in the absence of a purification step of a heparin sulfate column.
- the cells are adherent cells and the culture medium further comprises serum, such as fetal bovine serum (FBS).
- serum such as fetal bovine serum (FBS).
- purification on columns such as the Blue Sepharose ion-exchange column is performed using a salt gradient of 150 mM to 1 .5 M, where the salt can, for example be sodium or potassium chloride.
- the purification scheme is followed by a further purification step such as for example using pre-fabricated liposomes which can comprise lipids such as DPMC and/or cholesterol, for example at a 90:10 mokmol ratio.
- pre-fabricated liposomes takes advantage of the hydrophobicity of Wnt polypeptides and eliminates the need for further purification steps, such as gel filtration and/or heparin sulfate column purification steps.
- the Wnt polypeptide can be Wnt3a, such as human Wnt3a, e.g. human Wnt3a of SEQ ID NO: 1 or a functionally active variant therof; or the Wnt polypeptide can be a human Wnt polypeptide other than Wnt3A, e.g.
- the polypeptide is Wnt5A or Wnt10b or a functionally active variant therof.
- the invention concerns a Wnt composition purified by the foregoing method.
- the Wnt composition comprises a Wnt polypeptide that is Wnt3a or a functionally active variant therof.
- the Wnt composition comprises a Wnt polypeptide that is human Wnt3a or a functionally active variant therof.
- the Wnt composition comprises a Wnt polypeptide that is human Wnt3a of SEQ ID NO: 1 or a functionally active variant therof.
- kits for generating bone graft materials which comprise the liposomal Wnt polypeptide, the liposomal Wnt3a polypeptide, or the isolated enhanced mammalian bone marrow cell compositions.
- Wnts or “Wnt gene product” or “Wnt polypeptide” when used herein encompasses native sequence Wnt polypeptides, Wnt polypeptide fragments .chimeric Wnt polypeptides or functionally active variants of the foregoing.
- WNT and “Wnt” are used interchangeably herein.
- WNT3A WNT3a
- Wnt3A Wnt3A
- Wnt3a are used interchangeably herein.
- a "native sequence" polypeptide is one that has the same amino acid sequence as a Wnt polypeptide derived from nature. Such native sequence polypeptides can be isolated from cells producing endogenous Wnt protein or can be produced by recombinant or synthetic means. Thus, a native sequence polypeptide can have the amino acid sequence of, e.g. naturally occurring human polypeptide, murine polypeptide, or polypeptide from any other mammalian species, or from non-mammalian species, e.g. Drosophila, C. elegans, or the like. In some instances, the "native sequence” polypeptide also includes the N-terminal methionine. In some instances, it does not include the N-terminal methionine.
- Wnt polypeptide includes, without limitation, mammalian Wnt polypeptides, such as human or murine Wnt polypeptides.
- Human Wnt polypeptides include Wnt1 , Wnt2, Wnt2b (or Wnt13), Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a (Wnt14, or Wnt14b), Wnt9b (Wnt14b, or Wnt15), Wnt10a, Wnt10b (or Wnt12), Wnt1 1 , Wnt-16a, or Wnt-16b polypeptide.
- Wnt1 can be referred by the Genbank references NP005421 .1 and AAH74799.1.
- Wnt2 can be referred by the Genbank references NP003382.1 and AAH78170.1
- Wnt2 can be expressed in the brain, thalamus, in both fetal and adult lungs, or in the placenta.
- Wnt2B has two isoforms and their Genbank reference Nos. are NP004176.2 and NP078613.1 , respectively.
- Isoform 1 can be expressed in adult heart, brain, placenta, lung, prostate, testis, ovary, small intestine and/or colon.
- Isoform 2 can be expressed in fetal brain, fetal lung, fetal kidney, caudate nucleus, testis and/or cancer cell lines.
- Wnt3 and Wnt3a play distinct roles in cell-cell signaling during morphogenesis of the developing neural tube.
- Wnt3 has the Genbank reference AB060284.1 (see also GenBank Nos. BAB61052.1 and AAI03924.1.
- Wnt3a has the amino acid sequence as set forth in SEQ ID NO:1 and the nucleic acid sequence as set forth in SEQ ID NO:2.
- the native human Wnt3a amino acid and nucleotide sequences are also disclosed in Genbank reference NM_033131 , and the protein sequence at Genbank reference NP_149122.
- the Wnt3a protein precursor has the Genbank reference NP_149122.1.
- the native Wnt3a is 352 amino acid residues in length.
- the term "native human Wnt3a" polypeptide refers to the native human Wnt3a polypeptide of SEQ ID NO:1 , with or without its N-terminal methionine (Met), and with or without the native signal sequence.
- Wnt4 has the Genbank references NP1 10388.2 and BAC23080.1.
- Wnt 5a has the Genbank references NP003383.1
- NP003383.2.Wnt5b has the Genbank references BAB62039.1 and AAG38659.
- Wnt 6 has the Genbank references NP006513.1 and BAB55603.1.
- Wnt 7a has the Genbank references NP004616.2 and BAA82509.1 . It can be expressed in the placenta, kidney, testis, uterus, fetal lung, fetal brain, or adult brain.
- Wnt 7b has the Genbank references NP4 78679.1 and BAB68399.1.
- Wnt 8A has at least two alternative transcripts, Genbank references NP 1 14139.1 and NP490645.1 .
- Wnt 8B can be expressed in the forebrain. It has the Genbank reference NP003384.1.
- Wnt 10A has the Genbank references AAG45153 and NP079492.2.
- Wnt 10B is detected in most adult tissues, with highest levels in the heart and skeletal muscles. It has the Genbank reference NP003385.2.
- Wnt 1 1 can be expressed in fetal lung, kidney, adult heart, liver, skeletal muscle, and pancreas. It has the Genbank reference NP004617 .2.
- Wnt 14 has the Genbank reference NP003386.1 .
- Wnt 15 can be expressed in fetal kidney or adult kidney. It can also be expressed in the brain. It has the Genbank reference NP003387.1 .
- Wnt 16 has two isoforms, Wnt-16a and Wnt-16b, produced by alternative splicing. Isoform Wnt-16a can be expressed in the pancreas. Isoform Wnt-16b can be expressed in peripheral lymphoid organs such as spleen, appendix, and lymph nodes, or in the kidney. However, it cannot be expressed in bone marrow.
- the Genbank references are NP476509.1 and NP057171.2, respectively, for Wnt16a and Wnt16b. All GenBank, SwissProt and other database sequences listed are expressly incorporated by reference herein.
- a "variant" polypeptide means a functionally active polypeptide as defined below having less than 100% sequence identity with a native sequence polypeptide. Such variants include polypeptides longer or shorter polypeptides, for example wherein one or more amino acid residues are added at the N- or C terminus of, or within, the native sequence; from about one to 300 amino acid residues are deleted. , Variant polypeptides include polypeptides with one or more amino acid substitutions in comparison to the native polypeptide sequence, or derivatives of a polypeptide sequence, wherein an amino acid residue has been covalently modified so that the resulting product has a non-naturally occurring amino acid.
- a "functionally active" Wnt polypeptide retains the effector functions that are directly or indirectly caused or performed by native sequence Wnt polypeptides. Effector functions of native sequence Wnt polypeptides include stabilization of ⁇ -catenin, stimulation of stem cell self-renewal, C57MG transformation and induction of target genes in Xenopus animal cap assays, as well as target gene expression in human teratocarcinoma cells.
- the purified Wnt compositions find use in a variety of therapeutic methods, including the maintenance and growth of stem cells, tissue regeneration, and the like.
- a functionally active Wnt variant will have an amino acid sequence that has at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 99% amino acid sequence identity with a native sequence Wnt polypeptide.
- the native sequence Wnt polypeptide is a mammalian (e.g., human) Wnt polypeptide such as Wnt3a.
- amino acid refers to a molecule containing both an amino group and a carboxyl group. Suitable amino acids include, without limitation, both the D- and L-isomers of the naturally-occurring amino acids, as well as non-naturally occurring amino acids prepared by organic synthesis or other metabolic routes.
- amino acid as used herein, includes, without limitation, oarmino acids, natural amino acids, non-natural amino acids, and amino acid analogs.
- oarmino acid refers to a molecule containing both an amino group and a carboxyl group bound to a carbon which is designated the ocarbon.
- ⁇ -amino acid refers to a molecule containing both an amino group and a carboxyl group in a ⁇ configuration.
- Naturally occurring amino acid refers to any one of the twenty amino acids commonly found in peptides synthesized in nature, and known by the one letter abbreviations A, R, N, C, D, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y and V.
- Hydrophobic amino acids include small hydrophobic amino acids and large hydrophobic amino acids.
- Small hydrophobic amino acid are glycine, alanine, proline, and analogs thereof
- Large hydrophobic amino acids are valine, leucine, isoieucine, phenylalanine, methionine, tryptophan, and analogs thereof.
- Poly amino acids are serine, threonine, asparagine, glutamine, cysteine, tyrosine, and analogs thereof
- Chargeged amino acids are lysine, arginine, histidine, aspartate, glutamate, and analogs thereof.
- amino acid analog refers to a molecule which is structurally similar to an amino acid and which can be substituted for an amino acid in the formation of a peptidomimetic macrocycle
- Amino acid analogs include, without limitation, ⁇ -amino acids and amino acids where the amino or carboxy group is substituted by a similarly reactive group (e.g., substitution of the primary amine with a secondary or tertiary amine, or substitution of the carboxy group with an ester).
- non-natural amino acid refers to an amino acid which is not one of the twenty amino acids commonly found in peptides synthesized in nature, and known by the one letter abbreviations A, R, N, C, D, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y and V.
- Non-natural amino acids or amino acid analogs include, without limitation, structures according to the following:
- Amino acid analogs include ⁇ -amino acid analogs.
- ⁇ -amino acid analogs include, but are not limited to, the following: cyclic ⁇ -amino acid analogs; ⁇ -alanine; (R) ⁇ -phenylalanine; (R)-1 ,2,3,4-tetrahydro-isoquinoline-3-acetic acid; (R)-3-amino-4-(1- naphthyl)-butyric acid; (R)-3-amino-4-(2,4-dichlorophenyl)butyric acid; (R)-3-amino-4-(2- chlorophenyl)-butyric acid; (R)-3-amino-4-(2-cyanophenyl)-butyric acid; (R)-3-amino-4-(2- fluorophenyl)-butyric acid; (R)-3-amino-4-(2-furyl)-butyric acid; (R)-3-amino
- Amino acid analogs include analogs of alanine, valine, glycine or leucine.
- Examples of amino acid analogs of alanine, valine, glycine, and leucine include, but are not limited to, the following: a-methoxyglycine; a-allyl-L-alanine; a-aminoisobutyric acid; a-methyl-leucine;
- 2- aminocaproic acid dicyclohexyl-ammonium salt L-2-indanylglycine; L- allylglycine.dicyclohexyl ammonium salt; L-cyclohexylglycine; L-phenylglycine; L- propargylglycine; L-norvaline; N-a-aminomethyl-L-alanine; D-a,Y-diaminobutyric acid; L- ⁇ , ⁇ - diaminobutyric acid; ⁇ -cyclopropyl-L-alanine; (N- ⁇ -(2,4-dinitrophenyl))-L- ⁇ , ⁇ - diaminopropionic acid; (N- ⁇ -1-(4,4-dimethyl-2,6-dioxocyclohex-1-ylidene)ethyl)-D- ⁇ , ⁇ - diaminopropionic acid; (N- ⁇ -1-(4,4-dimethyl-2,6-d
- Amino acid analogs include analogs of arginine or lysine.
- amino acid analogs of arginine and lysine include, but are not limited to, the following: citrulline; L-2- amino-3-guanidinopropionic acid; L-2-amino-3-ureidopropionic acid; L-citrulline; Lys(Me) 2 - OH; Lys(N 3 )— OH; ⁇ -benzyloxycarbonyl-L-ornithine; ⁇ -nitro-D-arginine; ⁇ -nitro-L- arginine; a-methyl-ornithine; 2,6-diaminoheptanedioic acid; L-ornithine; (N5-1 -(4,4-dimethyl- 2,6-dioxo-cyclohex-1 -ylidene)ethyl)-D-ornithine; (N5-1-(4,4-dimethyl-
- Amino acid analogs include analogs of aspartic or glutamic acids.
- Examples of amino acid analogs of aspartic and glutamic acids include, but are not limited to, the following: omethyl-D-aspartic acid; omethyl-glutamic acid; omethyl-L-aspartic acid; ⁇ - methylene-glutamic acid; (N-Y-ethyl)-L-glutamine; [N-a-(4-aminobenzoyl)]-L-glutamic acid; 2,6-diaminopimelic acid; L-oaminosuberic acid; D-2-aminoadipic acid; D-a-aminosuberic acid; a-aminopimelic acid; iminodiacetic acid; L-2-aminoadipic acid; threo-3-methyl-aspartic acid; ⁇ -carboxy-D-glutamic acid ⁇ , ⁇ -di-t-butyl ester; ⁇ -carboxy
- Amino acid analogs include analogs of cysteine and methionine.
- amino acid analogs of cysteine and methionine include, but are not limited to, Cys(farnesyl)- OH, Cys(farnesyl)-OMe, a-methyl-methionine, Cys(2-hydroxyethyl)-OH, Cys(3- aminopropyl)-OH, 2-amino-4-(ethylthio)butyric acid, buthionine, buthioninesulfoximine, ethionine, methionine methylsulfonium chloride, selenomethionine, cysteic acid, [2-(4- pyridyl)ethyl]-DL-penicillamine, [2-(4-pyridyl)ethyl]-L-cysteine, 4-methoxybenzyl-D- penicillamine, 4-methoxybenzyl-L-penicillamine, 4-
- Amino acid analogs include analogs of phenylalanine and tyrosine.
- amino acid analogs of phenylalanine and tyrosine include ⁇ -methyl-phenylalanine, ⁇ - hydroxyphenylalanine, a-methyl-3-methoxy-DL-phenylalanine, omethyl-D-phenylalanine, o methyl-L-phenylalanine, 1 ,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, 2,4-dichloro- phenylalanine, 2-(trifluoromethyl)-D-phenylalanine, 2-(trifluoromethyl)-L-phenylalanine, 2- bromo-D-phenylalanine, 2-bromo-L-phenylalanine, 2-chloro-D-phenylalanine, 2-chloro-L- phenylalanine, 2-cyano-D-phenylalanine, 2-cyano-L-pheny
- Amino acid analogs include analogs of proline.
- Examples of amino acid analogs of proline include, but are not limited to, 3,4-dehydro-proline, 4-fluoro-proline, cis-4-hydroxy- proline, thiazolidine-2-carboxylic acid, and trans-4-fluoro-proline.
- Amino acid analogs include analogs of serine and threonine.
- Examples of amino acid analogs of serine and threonine include, but are not limited to, 3-amino-2-hydroxy-5- methylhexanoic acid, 2-amino-3-hydroxy-4-methylpentanoic acid, 2-amino-3-ethoxybutanoic acid, 2-amino-3-methoxybutanoic acid, 4-amino-3-hydroxy-6-methylheptanoic acid, 2- amino-3-benzyloxypropionic acid, 2-amino-3-benzyloxypropionic acid, 2-amino-3- ethoxypropionic acid, 4-amino-3-hydroxybutanoic acid, and omethylserine.
- Amino acid analogs include analogs of tryptophan.
- Examples of amino acid analogs of tryptophan include, but are not limited to, the following: omethyl-tryptophan; ⁇ -(3- benzothienyl)-D-alanine; 3-(3-benzothienyl)-L-alanine; 1-methyl-tryptophan; 4-methyl- tryptophan; 5-benzyloxy-tryptophan; 5-bromo-tryptophan; 5-chloro-tryptophan; 5-fluoro- tryptophan; 5-hydroxy-tryptophan; 5-hydroxy-L-tryptophan; 5-methoxy-tryptophan; 5- methoxy-L-tryptophan; 5-methyl-tryptophan; 6-bromo-tryptophan; 6-chloro-D-tryptophan; 6- chloro-tryptophan; 6-fluoro-tryptophan; 6-methyl-tryptophan; 7-benzyloxy-tryptophan; 7
- amino acid analogs are racemic.
- the D isomer of the amino acid analog is used.
- the L isomer of the amino acid analog is used.
- the amino acid analog comprises chiral centers that are in the R or S configuration.
- the amino group(s) of a ⁇ -amino acid analog is substituted with a protecting group, e.g., tert-butyloxycarbonyl (BOC group), 9-fluorenylmethyloxycarbonyl (FMOC), tosyl, and the like.
- the carboxylic acid functional group of a ⁇ -amino acid analog is protected, e.g., as its ester derivative.
- the salt of the amino acid analog is used.
- a "non-essential" amino acid residue is a residue that can be altered from the wild- type sequence of a polypeptide without abolishing or substantially altering its essential biological or biochemical activity (e.g., receptor binding or activation).
- An "essential” amino acid residue is a residue that, when altered from the wild-type sequence of the polypeptide, results in abolishing or substantially abolishing the polypeptide's essential biological or biochemical activity.
- a “conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain.
- Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., K, R, H), acidic side chains (e.g., D, E), uncharged polar side chains (e.g., G, N, Q, S, T, Y, C), nonpolar side chains (e.g., A, V, L, I, P, F, M, W), beta-branched side chains (e.g., T, V, I) and aromatic side chains (e.g., Y, F, W, H).
- basic side chains e.g., K, R, H
- acidic side chains e.g., D, E
- uncharged polar side chains e.g., G, N, Q, S, T, Y, C
- nonpolar side chains e.g., A, V, L
- a predicted nonessential amino acid residue in a polypeptide is replaced with another amino acid residue from the same side chain family.
- Other examples of acceptable substitutions are substitutions based on isosteric considerations (e.g. norleucine for methionine) or other properties (e.g. 2-thienylalanine for phenylalanine, or 6- Cl-tryptophan for tryptophan).
- Wnt3a The molecular cloning and characterization of Wnt3a was described by Saitoh et al., Biochem Biophys Res Commun, 2001 , 29; 284(5): 1 168-75.
- Native human Wnt3a is a lipid modified growth factor, composed of 352 amino acids (SEQ ID NO:1 ), that is effective in activating stem cells or stimulating their self-renewal. In some cases, due to its hydrophobic nature the active Wnt3a polypeptide or other Wnt polypeptides are difficult to purify to homogeneity at scaleable levels.
- described herein is a method for purification of Wnt polypeptides.
- the purification method improves the purity and yield of human Wnt polypeptides.
- the purified Wnt polypeptide is used as part of a therapeutic regimen. In some embodiments, the purified Wnt polypeptide is used as a therapeutic polypeptide.
- Wnt polypeptides form a family of highly conserved secreted signaling molecules.
- Wnt polypeptides can be mammalian, such as a human Wnt polypeptide.
- Wnt polypeptides include Wnt1 , Wnt2, Wnt2b (or Wnt13), Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a (Wnt14, or Wnt14b), Wnt9b (Wnt14b, or Wnt15), Wnt10a, Wnt10b (or Wnt12), Wnt1 1 , Wnt- 16a, or a Wnt-16b polypeptide sequences or a functionally active variants therof.ln some embodiments, a Wnt polypeptide is
- the Wnt polypeptide is a Wnt5a polypeptide or a functionally active variant therof. In some embodiments, the Wnt polypeptide is a Wnt10b polypeptide or a functionally active variant therof. In some embodiments, the Wnt3a polypeptide is a human Wnt3a polypeptide or a functionally active variant therof.
- sequence identity of a functionally active variant Wnt3a polypeptide is at least about 30%, about 40%, about 50%, about 60% , about 70%, about 80%, about 90%, about 95%, or about 99% identical to a native Wnt3a polypeptide sequence, such as a human Wnt3a polypeptide sequence (e.g., SEQ ID NO:1 ).
- sequence identity of a functionally active variant Wnt3a polypeptide is at most about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 100% identical to a native Wnt3a polypeptide sequence, such as a human Wnt3a polypeptide sequence (e.g., SEQ I D NO: 1 ).
- a native Wnt3a polypeptide sequence such as a human Wnt3a polypeptide sequence (e.g., SEQ I D NO: 1 ).
- amino acid sequence of the Wnt3a polypeptide is as set forth in SEQ ID NO:1 , or the Wnt3a polypeptide is encoded by the nucleic acid sequence of SEQ ID NO:2.
- the purification scheme described herein is simple, and inexpensive. In some cases, the purification scheme described herein enables purification of an functionally active form of Wnt polypeptide with higher purity. In some embodiments, the purification methods described herein enable purification of Wnt polypeptides from culture media of recombinant host cells.
- the recombinant host cell or the expression cell line is a prokaryotic host cell or expression cell line, a yeast host cell or expression cell line, an insect host cell or expression cell line, or a mammalian host cell or expression cell line.
- the recombinant host cell or expression cell line is a yeast host cell or expression cell line.
- yeast host cells include, but are not limited to, Pichia pastoris yeast strains such as GS1 15, KM71 H, SMD1 168, SMD1 168H, and X-33; and Saccharomyces cerevisiae yeast strain such as INVSd .
- the recombinant host cell or expression cell line is an insect host cell or expression cell line.
- exemplary insect cell lines include, but are not limited to, Drosop ila S2 cells, Sf9 cells, Sf21 cells, High FiveTM cells, and expresSF+® cells.
- the recombinant host cell or expression cell line is a mammalian host cell or expression cell line.
- mammalian cell lines is a stable cell lines, or a cell line that has incorporated a genetic material of interest into its own genome and has the capability to express the products of the genetic material after many generations of cell division.
- the mammalian cell line is a Current Good Manufacturing Practices (cGMP) compliant cell line.
- cGMP Current Good Manufacturing Practices
- Exemplary mammalian cell lines include, but are not limited to, 293A cell line, 293FT cell line, 293F cells , 293 H cells, CHO DG44 cells, CHO-S cells, CHO-K1 cells, Expi293FTM cells, Flp-lnTM T-RExTM 293 cell line, Flp-lnTM-293 cell line, Flp-lnTM-3T3 cell line, Flp-lnTM-BHK cell line, Flp-lnTM-CHO cell line, Flp-lnTM-CV-1 cell line, Flp-lnTM-Jurkat cell line, FreeStyleTM 293-F cells, FreeStyleTM CHO- S cells, GripTiteTM 293 MSR cell line, GS-CHO cell line, HepaRGTM cells, T-RExTM Jurkat cell line, Per.C6 cells, T-RExTM-293 cell line, T-RExTM-CHO cell line, and T-RExTM-Hel_a cell line.
- the mammalian cell line is a CHO cell line. In some embodiments, the mammalian cell line is a CHO-S cell line.
- CHO cells or "CHO cell line” is a generic term that encompasses the different types of CHO cells and CHO cell lines.
- the mammalian host cells are grown as a liquid suspension culture, in soft agar, on top of soft agar, or as monolayer.
- the CHO cells are grown as a liquid suspension culture, in soft agar, on top of soft agar, or as monolayer.
- the CHO cells are cultured in liquid suspension culture.
- the culture medium contains a serum.
- serum include fetal bovine serum (FBS), HyClone FetalClone II and III, iron-supplemented bovine calf serum (ICS), and human platelet lysates.
- FBS fetal bovine serum
- ICS iron-supplemented bovine calf serum
- human platelet lysates include human platelet lysates.
- the serum is FBS.
- the FBS presents in the medium is at most about 0.1 %, 0.5%, 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1 %, 12%, 13%, 14%, 15%, or less. In some embodiments, the FBS presents in the medium is at least about 0.1 %, 0.5%, 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1 %, 12%, 13%, 14%, 15%, or more.
- the serum e.g. FBS
- Wnt polypeptides e.g. Wnt3a polypeptide
- the serum provides one or more essential factors that are used for lipid modification on a Wnt polypeptide (e.g. residues such as Ser 209 in Wnt3a).
- the serum provides one or more chaperone proteins and lipophilic molecules that are used for the transportation of Wnt polypeptide (e.g. Wnt3a) from the endoplasmic reticulum (ER) to the Golgi and then to the cell membrane.
- the serum is modified to remove the lipid components.
- a defined set of lipids is then introduced into the modified serum.
- a stripping agent such as charcoal, is used to remove non-polar lipophilic materials (e.g. viruses, growth factors, and hormones) from the serum.
- a lipid supplement is introduced into the modified serum.
- Non-limiting examples of lipid supplement include Lipid Mixture 1 (Sigma-Aldrich), Lipid Mixture 2 (Sigma-Aldrich), Lipogro® (Rocky Mountain Biologicals), and Chemically Defined Lipid Concentration (Life Technologies).
- the mammalian host cells are cultured in a serum-free medium.
- serum-free media include CD CHO medium, CD CHO AGTTM medium, CD OptiCHOTM medium, CHO-S-SFM II (optionally including hypoxanthine and thymidine), CD 293 AGTTM medium, Adenovirus Expression Medium (AEM), FreeStyleTM 293 Expression medium, EX-CELL® 302 Serum- Free medium, EX-CELL® 325 PF CHO Serum-Free medium, EX-CELL® CD CHO-2 medium animal-component free, EX-CELL® CD CHO-3 medium, and EX-CELL® CDHO DHFR " medium animal-component free.
- the serum-free medium contains one or more additional supplement.
- the additional supplement is a serum.
- the serum is FBS.
- the FBS presents in the serum-free medium is at most about 0.1 %, 0.5%, 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1 %, 12%, 13%, 14%, 15%, or less.
- the FBS presents in the serum-free medium is at least about 0.1 %, 0.5%, 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1 %, 12%, 13%, 14%, 15%, or more.
- the additional supplement is a lipid supplement.
- lipid supplement include Lipid Mixture 1 (Sigma-Aldrich), Lipid Mixture 2 (Sigma-Aldrich), Lipogro® (Rocky Mountain Biologicals), and Chemically Defined Lipid Concentration (Life Technologies).
- the serum-free medium contains a lipid supplement.
- the additional supplement is a serum substitute.
- the serum substitute is selected from EXCYTE (Millipore), EX-CYTE + human serum albumin + AOF ITS (Insulin, transferrin, and selenium, Millipore), Human serum albumin (Millipore), Heparin sulfate (Sigma), lipids such as described elsewhere herein and not limiting to DMPC and cholesterol, Cell-ess (Essential Pharmaceuticals), and the like.
- the Wnt polypeptide in the presence of a serum substitute is secreted into the conditioned medium.
- the Wnt polypeptide in the presence of a serum substitute is not secreted into the conditioned medium.
- the Wnt3a polypeptide in the presence of a serum substitute is secreted into the conditioned medium.
- the Wnt3a polypeptide in the presence of a serum substitute is not secreted into the conditioned medium.
- an expression vector that is tolerant of a serum-free medium condition is used.
- the expression vector leads to a high copy number of the desired transcript and secretion of the polypeptide of interest.
- the expression vector is compatible with cGMP compatible mammalian cell lines.
- mammalian expression vectors include pOptivec vector, pTargeTTM vector, BacMam pCMV-Dest vector, Flp-lnTM core system, Gateway® suite of vectors, HaloTag® vector, Flexi® vector, pCMVTNTTM vector, and pcDNATM4/TO vector.
- the expression vector is selected from pOptivec and pTargeTTM vectors.
- the pOptivec vector is a TOPO® adapted bicistronic plasmid which allows rapid cloning of a gene containing a mammalian secretion signal and the gene of interest downstream of the CMV promoter.
- the dihydrofolate reductase selection markers allows for rapid selection.
- this vector is used for transient transfection of CHO-S cells.
- the pTargeTTM vector is used for transient transfection of CHO-S cells and for creating a stable cell line expressing a Wnt polypeptide (e.g. Wnt3a).
- acidification of the culture condition is used to aid in Wnt secretion. In some instances, acidification of the culture condition is used to aid in Wnt3a secretion. In some instances, acidification mimics vesicular acidification. In some instances, acidification is an acidification of the cytoplasm. In some instances, acidification occurs naturally such as acids secreted by the cells growning in the conditioned media, or artifically such as the addition of acids such as for example acetic acid. In some instances, acidification aids in secretion of Wnt polypeptide. In some instances, acidification aids in secretion of Wnt3a polypeptide.
- the expression method of a Wnt polypeptide in yeast cells, insect cells, or mammalian cells follows protocols well known in the art.
- the Wnt polypeptide is expressed in mammalian cells.
- a transcriptional induction agent is used to induce expression of the Wnt polypeptide.
- the transcriptional induction agent includes doxycycline, tetracycline, and coumermycin.
- the expression is constitutive, or that the polypeptide is expressed without an induction agent.
- the Wnt polypeptide is secreted into the medium.
- the conditioned medium is harvested and an additional agent is added to solubilize the Wnt polypeptide.
- the additional agent is a detergent.
- the detergent is a nonionic detergent, an anionic detergent, or a zwitterionic detergent.
- Exemplary detergents include, but are not limited to, Brij-35, Brij-58, 3-[(3-Cholamidopropyl)dimethylammonio]-1 -propanesulfonate (CHAPS), 3-([3-Cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO), nonyl phenoxypolethoxylethanol (NP-40), Octyl glucoside, Octyl thioglucoside, sodium dodecyl sulfate (SDS), Triton X-100, Triton X-1 14, Tween 20, and Tween 80.
- the detergent is CHAPS or Triton X-100. In some embodiments, the detergent is CHAPS. CHAPS is a zwitterionic detergent useful for membrane protein solubilization. In some embodiments, the Wnt polypeptide is also post-translationally modified by glycosylation and palmitoylation.
- Palmitoylation is covalent attachment of fatty acids, such as palmitic acid, to cysteine, serin, and threonine residues. In some instances, palmitoylation enhances the hydrophobicity of proteins and contribute to their membrane association. For example, Nusse et al.
- the Wnt polypeptide is palmitoylated at a cysteine, serine, and/or threonine residue. In some embodiments, the Wnt3a polypeptide is palmitoylated at a cysteine, serine, and/or threonine residue. In some instances, the Wnt3a polypeptide is palmitoylated at C77, S139, S181 , S209, or S21 1 , as set forth in SEQ ID NO:1 .
- the Wnt3a polypeptide is palmitoylated at one or more of the amino acid positions selected from C77, S139, S181 , S209, or S21 1 , as set forth in SEQ ID NO:1. In some cases, the Wnt3a polypeptide is palmitoylated at C77, as set forth in SEQ ID NO:1. In some cases, the Wnt3a polypeptide is palmitoylated at S209, as set forth in SEQ ID NO:1. In some cases, the Wnt3a polypeptide is palmitoylated at C77 and at S209, as set forth in SEQ I D NO:1 .
- the Wnt3a protein is not palmitoylated at C77, as set forth in SEQ ID NO:1. In some cases, the Wnt3a protein is palmitoylated at S209 and is not palmitoylated at C77, as set forth in SEQ ID NO: 1.
- the Wnt polypeptide comprising palmitoylated residues are functionally active variant polypeptides, such as a functionally active variant of a Wnt3a native polypeptide (e.g., human Wnt3a).
- the Wnt3a functionally active variant polypeptide comprises palmitoylated residues selected from C77, S139, S181 , S209, and S21 1 , as set forth in SEQ ID NO:1.
- the Wnt3a functionally active variant polypeptide has a palmitoylated residue at S139 as set forth in SEQ I D NO:1 .
- the functionally active variant Wnt3a polypeptide has a palmitoylated residue at S181 as set forth in SEQ ID NO:1. In some embodiments, the functionally active variant Wnt3a polypeptide has a palmitoylated residue at S209 as set forth in SEQ ID NO:1 ln some embodiments, the functionally active variant Wnt3a polypeptide has a palmitoylated residue at S21 1 as set forth in SEQ ID NO:1 . In some embodiments, the functionally active variant Wnt3a polypeptide has a palmitoylated residue at S209 and one other residue as set forth in SEQ ID NO:1. In some embodiments, the one other residue does not include 0,11. In some embodiments, the functionally active variant Wnt3a polypeptide is palmitoylated at S209 and is not palmitoylated at C77, as set forth in SEQ ID NO:1.
- the purification scheme described herein pertains to a Wnt polypeptide selected from Wnt1 , Wnt2, Wnt2b (or Wnt13), Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a (Wnt14, or Wnt14b), Wnt9b (Wnt14b, or Wnt15), Wnt10a, Wnt10b (or Wnt12), Wnt1 1 , Wnt-16a, and Wnt-16b polypeptide.
- the purification scheme described herein pertains to Wnt3a polypeptide, a Wnt5a polypeptide, or a Wnt10b polypeptide. In some cases, the purification scheme described herein pertains to a Wnt3a polypeptide. In some cases, the purification scheme described herein pertains to a Wnt5a polypeptide. In some cases, the purification scheme described herein pertains to a Wnt10b polypeptide.
- the purification scheme described herein pertains to a Wnt3a polypeptide that has palmitoylation at a cysteine residue that correspond to the cysteine at amino acid position 77 as set forth in SEQ ID NO:1 or a serine residue that correspond to the serine at amino acid position 209 as set forth in SEQ ID NO:1.
- the purification scheme described herein selects a Wnt3a polypeptide that has palmitoylation at the cysteine residue that correspond to the cysteine at amino acid position 77 as set forth in SEQ ID NO:1.
- the purification scheme described herein selects a Wnt3a polypeptide that has palmitoylation at the serine residue that correspond to the serine at amino acid position 209 as set forth in SEQ ID NO:1 . In some embodiments, the purification scheme described herein selects a Wnt3a polypeptide that has palmitoylation at the serine residue that correspond to the serine at amino acid position 209 as set forth in SEQ ID NO:1 and at least one other palmitoylated residue. In some embodiments, the at least one other palmitoylated residue is not C77 as set forth in SEQ ID NO:1. In some embodiments, the purification scheme described herein does not select a Wnt3a polypeptide that has palmitoylation at the cysteine residue that correspond to the cysteine at amino acid position 77 as set forth in SEQ ID NO:1.
- the purification scheme described herein utilizes a separation step.
- the separation step is an ion-exchange purification step, a hydrophobic purification step, or an affinity purification step.
- the separation step is an ion-exchange purification step.
- the ion-exchange purification step utilizes beads immobilized with one or more sulfonated polyaromatic compounds.
- the ion-exchange purification step utilizes a column immobilized with one or more sulfonated polyaromatic compounds.
- a non-limiting example of a sulfonated polyaromatic compound is Cibacron blue F3GA.
- Cibacron blue F3GA is a triazinyl dye. In some instances, beads and/or columns immobilized with a triazinyl dye is used during the ion-exchange purification step.
- a non- limiting example of a chromatographic column immobilized with Cibacron blue F3GA is a Blue Sepharose column.
- purification is carried out in batch mode with the use of beads immobilized with a sulfonated polyaromatic compound.
- the Wnt polypeptide is bound to the sulfonated polyaromatic compound immobilized beads in a binding buffer containing a low concentration of salt.
- High salt destabilizes the non-covalent ionic interactions between protein and the beads, thereby allow elution of the Wnt polypeptide.
- the concentration of the salt used in the binding buffer is at most 0, 0.01 , 5, 10, 15, 20, 25, 30, 40, 50 mM, or less.
- the concentration of the salt used in the binding buffer is at least 0, 0.01 , 5, 10, 15, 20, 25, 30, 40, 50 mM, or more.
- one or more wash buffers are used to remove unbound impurities.
- at most 1 , 2, 3, 4, 5, or more wash steps are used.
- at least 1 , 2, 3, 4, 5 or less wash steps are used.
- the concentration of the salt used in the wash buffer is at least 30, 40, 50, 60, 70, 80, 90, 100 mM, more.
- the concentration of the salt used in the wash buffer is at most 30, 40, 50, 60, 70, 80, 90, 100 mM, less.
- the concentration of the salt in the elution buffer is at least 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000 mM, or more.
- the concentration of the salt in the elution buffer is at most 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000 mM, or less.
- Exemplary salt include sodium chloride, potassium chloride, magnesium chloride, calcium chloride, calcium phosphate, potassium phosphate, magnesium phosphate, sodium phosphate, ammonium sulfate, ammonium chloride, ammonium phosphate, and the like.
- a detergent is also formulated into the binding buffer, wash buffer, and/or elution buffer.
- the detergent is CHAPS or Triton X-100.
- the percentage of CHAPS or Triton X-100 is at least 0.01 %, 0.1 %, 0.5%, 1 %, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, or more.
- the percentage of CHAPS or Triton X-100 is at most 0.01 %, 0.1 %, 0.5%, 1 %, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, or less.
- buffer components such as tris(hydroxymethyl)methylamine HCI (Tris-HCI), 3- ⁇ [tris(hydroxymethyl)methyl]amino ⁇ propanesulfonic acid (TAPS), N,N-bis(2- hydroxyethyl)glycine (Bicine), N-tris(hydroxymethyl)methylglycine (Tricine), 3-[N- Tris(hydroxymethyl)methylamino]-2-hydroxypropanesulfonic acid (TAPSO), 4-2- hydroxyethyl-1 -piperazineethanesulfonic acid (HEPES), 3-(N-morpholino)propanesulfonic acid (MOPS), piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES), 2-(N- morpholino)ethanesulfonic acid (MES), and the like, are used.
- Tris-HCI tris(hydroxymethyl)methylamine HCI
- TAPS 3- ⁇ [tris(hydroxymethyl)methyl]amino ⁇ prop
- the pH of the buffer is at least 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, or more. In some instances, the pH of the buffer is at most 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, or less.
- the Wnt polypeptide is Wnt3a polypeptide, Wnt5a polypeptide, or Wnt10b polypeptide. In some embodiments, the Wnt polypeptide is Wnt3a polypeptide.
- purification is carried out using a column immobilized with a sulfonated polyaromatic compound.
- the Wnt polypeptide is bound to the column immobilized with the sulfonated polyaromatic compound in a binding buffer containing a low concentration of salt.
- High salt destabilizes the non-covalent ionic interactions between the polypeptide and the column beads, thereby allow elution of the Wnt polypeptide.
- the concentration of the salt used in the binding buffer is at most 0, 0.01 , 5, 10, 15, 20, 25, 30, 40, 50 mM, or less.
- the concentration of the salt used in the binding buffer is at least 0, 0.01 , 5, 10, 15, 20, 25, 30, 40, 50 mM, or more.
- one or more wash buffers are used to remove unbound impurities.
- at most 1 , 2, 3, 4, 5, or more wash steps are used.
- at least 1 , 2, 3, 4, 5 or less wash steps are used.
- the concentration of the salt used in the wash buffer is at least 30, 40, 50, 60, 70, 80, 90, 100 mM, more.
- the concentration of the salt used in the wash buffer is at most 30, 40, 50, 60, 70, 80, 90, 100 mM, less.
- the concentration of the salt in the elution buffer is at least 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000 mM, or more.
- the concentration of the salt in the elution buffer is at most 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000 mM, or less.
- Exemplary salt include sodium chloride, potassium chloride, magnesium chloride, calcium chloride, calcium phosphate, potassium phosphate, magnesium phosphate, sodium phosphate, ammonium sulfate, ammonium chloride, ammonium phosphate, and the like.
- a detergent is also formulated into the binding buffer, wash buffer, and/or elution buffer.
- the detergent is CHAPS or Triton X-100.
- the percentage of CHAPS or Triton X-100 is at least 0.01 %, 0.1 %, 0.5%, 1 %, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, or more.
- the percentage of CHAPS or Triton X-100 is at most 0.01 %, 0.1 %, 0.5%, 1 %, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, or less.
- buffer components such as tris(hydroxymethyl)methylamine HCI (Tris-HCI), 3- ⁇ [tris(hydroxymethyl)methyl]amino ⁇ propanesulfonic acid (TAPS), N,N- bis(2-hydroxyethyl)glycine (Bicine), N-tris(hydroxymethyl)methylglycine (Tricine), 3-[N- Tris(hydroxymethyl)methylamino]-2-hydroxypropanesulfonic acid (TAPSO), 4-2- hydroxyethyl-1-piperazineethanesulfonic acid (HEPES), 3-(N-morpholino)propanesulfonic acid (MOPS), piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES), 2-(N- morpholino)ethanesulfonic acid (MES), and the like, are used.
- Tris-HCI tris(hydroxymethyl)methylamine HCI
- TAPS 3- ⁇ [tris(hydroxymethyl)methyl]amino ⁇ propanesulf
- the pH of the buffer is at least 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, or more. In some instances, the pH of the buffer is at most 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, or less.
- the Wnt polypeptide is Wnt3a polypeptide, Wnt5a polypeptide, or Wnt10b polypeptide. In some embodiments, the Wnt polypeptide is Wnt3a polypeptide.
- the separation step is a hydrophobic purification step.
- the hydrophobic purification step utilizes either beads immobilized with a hydrophobic ligand or a column immobilized with a hydrophobic ligand.
- the ligands include butyl, octyl, phenyl, Protein A, and the like.
- the separation step is an affinity purification step.
- the affinity purification step utilizes either beads immobilized with an affinity ligand or a column immobilized with an affinity ligand.
- Exemplary ligands include Frizzled receptor (Fzd) or its fragments thereof, and low-density lipoprotein receptor-related protein 6 (LRP6), or its fragments thereof.
- the concentration and yield of the eluted Wnt polypeptide is measured prior to subjecting to a further purification step.
- the yield is at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more. In some embodiments, the yield is at most about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or less.
- the purity is at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more. In some embodiments, the purity is at most about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or less.
- the purified Wnt polypeptide is Wnt3a polypeptide.
- the Wnt3a polypeptide containing a palmitoylation at an amino acid residue corresponding to Serine 209 as set forth in SEQ ID NO:1 is purified from the separation step.
- the Wnt3a polypeptide containing a palmitoylation at an amino acid residue corresponding to Cysteine 77 as set forth in SEQ ID NO:1 is purified from the separation step.
- the Wnt3a polypeptide containing a palmitoylation at an amino acid residue corresponding to Cysteine 77 and a palmitoylation at an amino acid residue corresponding to Serine 209 as set forth in SEQ ID NO: 1 is purified from the separation step.
- the Wnt3a polypeptide containing a palmitoylation at an amino acid residue corresponding to Serine 209 as set forth in SEQ ID NO:1 and a palmitoylation at at least one other amino acid residue is purified from the separation step.
- the at least one other amino acid residue is not C77 as set forth in SEQ ID NO:1.
- the concentration of the Wnt3a specie containing the Serine 209 palmitoylation is high in the eluted product than the Wnt3a specie containing the Cysteine 77 palmitoylation.
- the concentration of the two Wnt3a species is defined by a value, such as a ratio.
- the ratio of the Wnt3a Serine 209 specie to the Wnt3a Cysteine 77 specie is between about 50:50, about 55:45, about 60:40, about 65:35, about 70:30, about 75:25, about 80:20, about 85:15, about 90:10, about 95:5, about 99:1 , or about 100:0.
- the concentration of the Wnt3a specie containing the Serine 209 palmitoylation is high in the eluted product than the Wnt3a specie containing the Cysteine 77 and the Serine 209 palmitoylations.
- the concentration of the two Wnt3a species is defined by a value, such as a ratio.
- the ratio of the Wnt3a Serine 209 specie to the Wnt3a Cysteine 77/Serine 209 specie is between about 50:50, about 55:45, about 60:40, about 65:35, about 70:30, about 75:25, about 80:20, about 85:15, about 90:10, about 95:5, about 99:1 , or about 100:0.
- the further purification step is a step that utilizes prefabricated liposomes.
- the liposome eliminates the serum (FBS) from the polypeptide preparation.
- this latter step takes advantage of the hydrophobicity of the Wnt polypeptide, and eliminates the need for additional or subsequent purification steps, such as for example, subsequent gel filtration and/or chromatographic purification steps (e.g. heparin sulfate immobilized columns).
- the liposome is fabricated using methods well known in the art.
- Liposomes are artificially-prepared spherical vesicles that compose a lamellar phase lipid bilayer and an aqueous core.
- liposomes are formed by phospholipids.
- phospholipids are separated into those with diacylglyceride structures or those derived from phosphosphingolipids.
- the diacylglyceride structures include phosphatidic acid (phosphatidate) (PA), phosphatidylethanolamine (cephalin) (PE), phosphatidylcholine (lecithin) (PC), phosphatidylserine (PS), and phosphoinositides such as phosphatidylinositol (PI), phosphatidylinositol phosphate (PIP), phosphatidylinositol bisphosphate (PIP2), and phosphatidylinositol triphosphate (PIP3).
- phosphosphingolipids include ceramide phosphorylcholine, ceramide phosphorylethanolamine, and ceramide phospholipid.
- the liposomes are formed from phosphatidylcholines.
- the lipids are also selected based on its transition phase temperature (T m ), or the temperature interface between the liquid crystalline phase and the gel phase.
- T m is governed by the head group species, hydrocarbone length, unsaturation, and the charge.
- short lipids lipids containing 8, 10, or 12 tail carbon chain length
- liposomes manufactured from these short chain carbon lipids are toxic to cells because they dissolve cell membranes. Liposomes manufactured from longer carbon-chain lipids are not toxic to cells, but their transition temperatures are higher.
- 1 ,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) which has a 16 tail carbon length has a T m of about 41°C.
- the lipids used herein have a T m of between about 10°C and about 37°C, 15°C and about 30°C, 18°C and about 27°C, or 21 °C and about 25°C.
- the lipids used herein have a T m of at least 22°C, 23°C, 24°C, or more.
- the lipids used herein have a T m of at most 22°C, 23°C, 24°C, or less.
- the lipids used herein have a tail carbon length of at least about 12, 13, 14, or more.
- the lipids used herein have a tail carbon length of at most about 12, 13, 14, or less.
- the lipids are further selected based on the net charge of the liposome.
- the liposome has a net charge of 0 at a pH of between about 4.0 and about 10.0, about 5.0 and about 9.0, about 6.5 and about 8.0, about 7.0 and about 7.8, or about 7.2 and about 7.6.
- the liposome has a net charge of 0 at a pH of about 7.3, about 7.4, or about 7.5.
- the liposome has a net positive charge at a pH of between about 4.0 and about 10.0, about 5.0 and about 9.0, about 6.5 and about 8.0, about 7.0 and about 7.8, or about 7.2 and about 7.6.
- the liposome has a net positive charge at a pH of about 7.3, about 7.4, or about 7.5. In some embodiments, the liposome has a net negative charge at a pH of between about 4.0 and about 10.0, about 5.0 and about 9.0, about 6.5 and about 8.0, about 7.0 and about 7.8, or about 7.2 and about 7.6. In some embodiments, the liposome has a net negative charge at a pH of about 7.3, about 7.4, or about 7.5.
- lipids are selected from 1 ,2-dimyristoyl-sn-glycero-3- phosphocholine (DMPC), 1 ,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1- tetradecanoyl-2-hexadecanoyl-sn-glycero-3-phosphocholine (MPPC), 1 ,2-dimyristoyl-sn- glycero-3-phospho-L-serine (DMPS), and 1 ,2-dihexanoyl-sn-glycero-3-phosphocholine (DMPG).
- DMPC 1,2-dimyristoyl-sn-glycero-3- phosphocholine
- DPPC 1- tetradecanoyl-2-hexadecanoyl-sn-glycero-3-phosphocholine
- MPPC 1- tetradecanoyl-2-hexadecanoyl-sn-glycero
- an additional lipid is fabricated into the liposome.
- the additional lipid is cholesterol.
- the concentration of a phosphatidylcholine such as DMPC and cholesterol is defined by a value such as a ratio.
- the ratio of the concentrations of phosphatidylcholine such as DMPC and cholesterol is between about 50:50, about 55:45, about 60:40, about 65:35, about 70:30, about 75:25, about 80:20, about 85:15, about 90:10, about 95:5, about 99:1 , or about 100:0.
- the ratio of the concentrations of phosphatidylcholine such as DMPC and cholesterol is about 90:10.
- the concentration unit is moles. In some embodiments, the ratio is mole:mole.
- the Wnt polypeptide is reconstituted with a liposome at a concentration of at least about 0.01 , 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1 , 0.15, 0.2, 0.25, 0.3, 0.4, 0.5 ng/ ⁇ . or more.
- the Wnt polypeptide is reconstituted with a liposome at a concentration of at most about 0.01 , 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1 , 0.15, 0.2, 0.25, 0.3, 0.4, 0.5 ng/ ⁇ . or less.
- the Wnt polypeptide is Wnt3a polypeptide, Wnt5a polypeptide, or Wnt10b polypeptide. In some embodiments, the Wnt polypeptide is Wnt3a polypeptide.
- the Wnt polypeptide is reconstituted with a liposome at a ratio of at least about 0.1 :50, 0.5:30, 1 :20, or 1 :14 Wnt polypeptide to liposome, or more. In some embodiments, the Wnt polypeptide is reconstituted with a liposome at a ratio of at most about 0.1 :50, 0.5:30, 1 :20, or 1 :14 Wnt polypeptide to liposome, or less. In some instances, the ratio is a weight to weight ratio. In some instances, the unit of Wnt polypeptide is nanogram unit.
- the temperature at which the Wnt polypeptide is reconstituted with a liposome is at least between about 15°C and about 37°C, about 18°C and about 33°C, or about 20°C and about 28°C. In some embodiments, the temperature is at least about 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, or more. In some embodiments, the temperature is at most about 21 °C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, or less.
- the Wnt polypeptide is Wnt3a polypeptide, Wnt5a polypeptide, or Wnt10b polypeptide. In some embodiments, the Wnt polypeptide is Wnt3a polypeptide.
- the Wnt polypeptide is integrated into the liposomal membrane. In some cases, the Wnt polypeptide protrudes from the liposomal membrane onto the surface of the lipid membrane. In some instances, the Wnt polypeptide is not incorporated into the aqueous core of the liposome. In some embodiments, the Wnt polypeptide is Wnt3a polypeptide, Wnt5a polypeptide, or Wnt10b polypeptide. In some embodiments, the Wnt polypeptide is Wnt3a polypeptide. In some embodiments, the Wnt3a polypeptide is integrated into the liposomal membrane. In some cases, the Wnt3a polypeptide protrudes from the liposomal membrane onto the surface of the lipid membrane. In some instances, the Wnt3a polypeptide is not incorporated into the aqueous core of the liposome.
- the Wnt polypeptide reconstituted with a liposome is referred to as liposomal Wnt polypeptide or L-Wnt.
- the Wnt polypeptide is Wnt3a polypeptide, Wnt5a polypeptide, or Wnt10b polypeptide.
- the Wnt polypeptide is Wnt3a polypeptide.
- the Wnt3a polypeptide reconstituted with a liposome is referred to as liposomal Wnt3a polypeptide or L-Wnt3a.
- the Wnt polypeptide is Wnt5a polypeptide.
- the Wnt5a polypeptide reconstituted with a liposome is referred to as liposomal Wnt5a polypeptide or L-Wnt5a.
- the Wnt polypeptide is Wnt10b polypeptide.
- the Wnt10b polypeptide reconstituted with a liposome is referred to as liposomal Wnt10b polypeptide or L-Wnt10b.
- the L-Wnt undergoes a centrifugation step and is then suspended in a buffer such as phosphate buffered saline (PBS).
- PBS phosphate buffered saline
- the L- Wnt is stored under nitrogen.
- the L-Wnt is stable under nitrogen without substantial loss of activity.
- the L-Wnt is stored at a temperature of between about 1°C and about 8°C.
- the L-Wnt is stable at a temperature of at least about 1°C, 2°C, 3°C, 4°C, 5°C, 6°C, 7°C, 8°C, or more without substantial loss of activity.
- the L-Wnt is stable at a temperature of at most about 1°C, 2°C, 3°C, 4°C, 5°C, 6°C, 7°C, 8°C, or less without substantial loss of activity. In some embodiments, the L-Wnt is stable for at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 101 , 102, 103, 104, 105, 106, 107, 108, 109, 1 10, 1 15, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 356, 400, 700, 1000 days, or more without substantial loss of activity.
- the L-Wnt is stable for at most about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 101 , 102, 103, 104, 105, 106, 107, 108, 109, 1 10, 1 15, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 356, 400, 700, 1000 days, or less without substantial loss of activity.
- the L-Wnt3a undergoes a centrifugation step and is then suspended in a buffer such as phosphate buffered saline (PBS).
- PBS phosphate buffered saline
- the L- Wnt3a is stored under nitrogen.
- the L-Wnt3a is stable under nitrogen without substantial loss of activity.
- the L-Wnt3a is stored at a temperature of between about 1 °C and about 8°C.
- the L-Wnt3a is stable at a temperature of at least about 1 °C, 2°C, 3°C, 4°C, 5°C, 6°C, 7°C, 8°C, or more without substantial loss of activity.
- the L-Wnt3a is stable at a temperature of at most about 1 °C, 2°C, 3°C, 4°C, 5°C, 6°C, 7°C, 8°C, or less without substantial loss of activity. In some embodiments, the L-Wnt3a is stable for at least about 10, 20, 30, 40, 50, 60, 70, 80 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 356, 400, 700, 1000 days, or more without substantial loss of activity.
- the L-Wnt3a is stable for at most about 10, 20, 30, 40, 50, 60, 70, 80 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 356, 400, 700, 1000 days, or less without substantial loss of activity.
- the term "without substantial loss of activity” refers to the functional activity of a liposomal Wnt polypeptide is near to that of the corresponding native Wnt polypeptide in the absence of a liposome. In some instances, the functional activity of the liposomal Wnt polypeptide is at least about 100%, 99%, 95%, 90%, 85%, 80%, 75%, 70%, 60%, 50%, 40%, or more compared to the functional activity of the native Wnt polypeptide.
- the functional activity of the liposomal Wnt polypeptide is at most about 100%, 99%, 95%, 90%, 85%, 80%, 75%, 70%, 60%, 50%, 40%, or less compared to the functional activity of the native Wnt polypeptide.
- the functional activity of the Wnt polypeptides is detected using assays such as for example mass spectroscopy, assays associated with biomarker analysis which are described elsewhere herein, transplant surgery such as sub-renal capsule transplant surgery, spinal fusion surgery, ALP, TRAP, and TUNEL staining, immunohistochemistry, and Micro-CT analyses and quantification of graft growth.
- the term “stable” refers to Wnt polypeptides as in a folded state and is not unfolded or degraded. In some instances, the term “stable” also refers to Wnt polypeptides retaining functional activity without substantial loss of activity. In some instances, assays used to determine stability assays that establish the activity of the Wnt polypeptides, as such those described above, and also include such as LSL cell-based assays such as mice LSL cell-based assay.
- the purification method described herein exploits the hydrophobic domains of the Wnt polypeptide and does not interfere with Wnt polypeptide conformation or functional activity.
- the Wnt polypeptide is Wnt3a polypeptide, Wnt5a polypeptide, or Wnt10b polypeptide.
- the Wnt polypeptide is Wnt3a polypeptide.
- the hydrophobic domain of the Wnt3a polypeptide contains a palmitoylation on a serine residue corresponding to the Serine 209 as set forth in SEQ ID NO:1.
- the affinity of Wnt polypeptide to liposome is lower than the Wnt polypeptide binding partners.
- the Wnt polypeptide is Wnt3a polypeptide, Wnt5b polypeptide, or Wnt10b polypeptide.
- the Wnt polypeptide is Wnt3a polypeptide.
- the affinity of Wnt3a polypeptide to liposome is lower than the Wnt3a polypeptide binding partners.
- the Wnt3a polypeptide binding partners include Frizzled protein, its fragments thereof, LRP6 protein, and its fragments thereof.
- the affinity of Wnt3a to liposome is between about 4nM and about 50nM, and about 4.5nM and about 20nM, and about 5nM and about 15nM. In some embodiments, the affinity of Wnt3a to liposome is at least about 5.5nM, 6nM, 6.5nM, 7nM, 7.5nM, 8nM, 8.5nM, 9nM, 9.5nM, 10nM, 1 1 nM, 12nM, 13nM, 14nM, or more.
- the affinity of Wnt3a to liposome is at most about 5.5nM, 6nM, 6.5nM, 7nM, 7.5nM, 8nM, 8.5nM, 9nM, 9.5nM, 10nM, 1 1 nM, 12nM, 13nM, 14nM, or less. In some embodiments, the affinity of Wnt3a polypeptide to its binding partners is between about 0.01 nM to about 4nM, about 0.1 nM to about 4nM, or about 1 nM to about 4nM.
- the affinity of Wnt3a polypeptide to its binding partners is at least about 1.1 nM, 1.3nM, 1 .5nM, 1.7nM, 2nM, 2.3nM, 2.5nM, 2.7nM, 3nM, 3.1 nM, 3.2nM, 3.3nM, 3.4nM, 3.5nM, 3.6nM, 3.7nM, 3.8nM, 3.9nM, or more.
- the affinity of Wnt3a polypeptide to its binding partners is at most about 1.1 nM, 1 .3nM, 1 .5nM, 1.7nM, 2nM, 2.3nM, 2.5nM, 2.7nM, 3nM, 3.1 nM, 3.2nM, 3.3nM, 3.4nM, 3.5nM, 3.6nM, 3.7nM, 3.8nM, 3.9nM, or less.
- the Wnt3a polypeptide containing a palmitoylation at an amino acid residue that correspond to Cysteine 77 as set forth in SEQ ID NO:1 is the active form. In some embodiments, the Wnt3a polypeptide containing a palmitoylation at an amino acid residue that correspond to Serine 209 as set forth in SEQ ID NO:1 is the active form. In some embodiments, the Wnt3a polypeptide containing a palmitoylation at an amino acid residue that correspond to Serine 209 and a palmitoylation at an amino acid residue that correspond to Cysteine 77 as set forth in SEQ ID NO:1 is the active form.
- the Wnt3a polypeptide containing a palmitoylation at an amino acid residue that correspond to Serine 209 and a palmitoylation at an amino acid residue that correspond to Cysteine 77 as set forth in SEQ ID NO:1 is not the active form. In some embodiments, the Wnt3a polypeptide containing a palmitoylation at an amino acid residue that correspond to Cysteine 77 as set forth in SEQ ID NO:1 is not the active form. In some embodiments, mass spectrometry coupled with additional assays for detecting or measuring the activity of the Wnt polypeptide (e.g. Wnt3a polypeptide) are used to identify the active specie.
- the additional assays include assays associated with biomarker analysis which are described elsewhere herein, transplant surgery such as sub-renal capsule transplant surgery, spinal fusion surgery, ALP, TRAP, and TUNEL staining, immunohistochemistry, and Micro-CT analyses and quantification of graft growth.
- the concentration of the liposomal Wnt3a specie containing the Serine 209 palmitoylation is higher in the eluted product than the Wnt3a specie containing the Cysteine 77 palmitoylation.
- the concentration of the two Wnt3a species is defined by a value, such as a ratio.
- the ratio of the Wnt3a Serine 209 specie to the Wnt3a Cysteine 77 specie is between about 50:50, about 55:45, about 60:40, about 65:35, about 70:30, about 75:25, about 80:20, about 85:15, about 90:10, about 95:5, about 99:1 , or about 100:0.
- the concentration of the liposomal Wnt3a specie containing the Serine 209 palmitoylation is high in the eluted product than the Wnt3a specie containing the Cysteine 77 and the Serine 209 palmitoylations.
- the concentration of the two Wnt3a species is defined by a value, such as a ratio.
- the ratio of the Wnt3a Serine 209 specie to the Wnt3a Cysteine 77/Serine 209 specie is between about 50:50, about 55:45, about 60:40, about 65:35, about 70:30, about 75:25, about 80:20, about 85:15, about 90:10, about 95:5, about 99:1 , or about 100:0.
- previous purification schemes yield a mixture of the two species (e.g. 1 :5 single modified/active:dual modified/inactive).
- the predominant polypeptide specie is in the single modified (at Ser209), active configuration.
- the purification method described herein provides a Wnt3a composition that contains predominantly an active form of the polypeptide that contains lipid modification at Ser209.
- the purification method described herein provides a Wnt3a composition that is not contaminated by other polypeptide species such as Cys77 Wnt3a specie.
- described herein is a method of preparing a liposomal Wnt polypeptide that comprises the steps of contacting a sample comprising Wnt polypeptides to an aqueous solution of liposomes, wherein the phospholipids comprising the liposomes have a phase transition temperature from about 10°C to about 25°C.
- described herein is a method of preparing a liposomal Wnt polypeptide that comprises the steps of contacting a sample comprising Wnt polypeptides to an aqueous solution of liposomes, wherein the phospholipids comprising the liposome have a tail carbon length of between about 12 carbons and about 14 carbons.
- the Wnt polypeptide is Wnt3a polypeptide, Wnt5a polypeptide, or Wnt10b polypeptide.
- the Wnt polypeptide is Wnt3a polypeptide.
- a method of preparing a liposomal Wnt3a polypeptide which comprises the steps of (a) harvesting Wnt3a polypeptides from a conditioned media comprising Chinese hamster ovary (CHO) cells; (b) introducing the Wnt3a polypeptides to an ion-exchange column immobilized with a sulfonated polyaromatic compound; (c) eluting the Wnt3a polypeptides from the ion-exchange column utilizing a step gradient; and (d) contacting the Wnt3a polypeptides from step (c) with an aqueous solution of liposomes.
- a method of preparing a liposomal Wnt5a polypeptide which comprises the steps of (a) harvesting Wnt5a polypeptides from a conditioned media comprising Chinese hamster ovary (CHO) cells; (b) introducing the Wnt5a polypeptides to an ion-exchange column immobilized with a sulfonated polyaromatic compound; (c) eluting the Wnt5a polypeptides from the ion-exchange column utilizing a step gradient; and (d) contacting the Wnt5a polypeptides from step (c) with an aqueous solution of liposomes.
- a method of preparing a liposomal Wnt10b polypeptide which comprises the steps of (a) harvesting Wnt10b polypeptides from a conditioned media comprising Chinese hamster ovary (CHO) cells; (b) introducing the Wnt10b polypeptides to an ion-exchange column immobilized with a sulfonated polyaromatic compound; (c) eluting the Wnt10b polypeptides from the ion-exchange column utilizing a step gradient; and (d) contacting the Wnt10b polypeptides from step (c) with an aqueous solution of liposomes.
- Functional assays to determine the biological activity of Wnt polypeptides are well known in the art and can include, for example, stabilization of ⁇ -catenin, growth promotion of stem cells, quantitation of the amount of Wnt polypeptide present in a non-functional assay, e.g. immunostaining, ELISA, quantitation on Coomasie or silver stained gel, etc., and analysis of the ratio of functionally active Wnt to total Wnt.
- An exemplary assay for biological activity includes contacting a Wnt composition with cells, e.g. mouse L cells and then culturing the cells for a period of time sufficient to stabilize ⁇ -catenin, such as for at least about 1 hour.
- the cells are then lysed and the cell lysate is resolved by SDS PAGE.
- the resolved cell lysate components from the SDS PAGE is subsequently transferred to a nitrocellulose and then probed with antibodies specific for ⁇ -catenin.
- Other assays for analysis of Wnt activity include C57MG transformation and Xenopus animal cap assays for induction of target genes. See U.S. Patent No. 7,335,643, for additional exemplary assays.
- the bone defect refers to a bone injury such as a bone fracture in which grafting materials are needed to stimulate and guide reparative growth of natural bone.
- the method refers to a method of generating bone graft materials, which comprises the steps of (a) contacting a sample comprising mammalian bone marrow cells ex-vivo with a liposomal WNT polypeptide; (b) washing the sample to remove free liposomal WNT polypeptide; and (c) transplanting the liposomal WNT polypeptide treated bone graft materials into a site of bone defect.
- the Wnt polypeptide is Wnt3a polypeptide, Wnt5a polypeptide, or Wnt10b polypeptide.
- the Wnt polypeptide is Wnt3a polypeptide.
- the method refers to a method of generating bone graft materials, which comprises the steps of (a) contacting a sample comprising mammalian bone marrow cells ex-vivo with a liposomal WNT3a polypeptide; (b) washing the sample to remove free liposomal WNT3a polypeptide; and (c) transplanting the liposomal WNT3a polypeptide treated bone graft materials into a site of bone defect.
- the Wnt polypeptide is Wnt5a polypeptide.
- the method refers to a method of generating bone graft materials, which comprises the steps of (a) contacting a sample comprising mammalian bone marrow cells ex-vivo with a liposomal WNT5a polypeptide; (b) washing the sample to remove free liposomal WNT5a polypeptide; and (c) transplanting the liposomal WNT5a polypeptide treated bone graft materials into a site of bone defect.
- the Wnt polypeptide is Wnt10b polypeptide.
- the method refers to a method of generating bone graft materials, which comprises the steps of (a) contacting a sample comprising mammalian bone marrow cells ex-vivo with a liposomal WNT10b polypeptide; (b) washing the sample to remove free liposomal WNT10b polypeptide; and (c) transplanting the liposomal WNT10b polypeptide treated bone graft materials into a site of bone defect.
- the process refers to a mammalian bone marrow composition produced by a process that comprises the step of contacting isolated mammalian bone marrow cells ex-vivo with a liposomal WNT polypeptide, wherein the contacting time is between about 30 minutes and about 4 hours.
- the Wnt polypeptide is Wnt3a polypeptide, Wnt5a polypeptide, or Wnt10b polypeptide.
- the Wnt polypeptide is Wnt3a polypeptide.
- the process refers to a mammalian bone marrow composition produced by a process which comprises the step of contacting isolated mammalian bone marrow cells ex- vivo with a liposomal WNT3a polypeptide, wherein the contacting time is between about 30 minutes and about 4 hours.
- the Wnt polypeptide is Wnt5a polypeptide.
- the process refers to a mammalian bone marrow composition produced by a process which comprises the step of contacting isolated mammalian bone marrow cells ex- vivo with a liposomal WNT5a polypeptide, wherein the contacting time is between about 30 minutes and about 4 hours.
- the Wnt polypeptide is Wnt10b polypeptide.
- the process refers to a mammalian bone marrow composition produced by a process which comprises the step of contacting isolated mammalian bone marrow cells ex- vivo with a liposomal WNT10b polypeptide, wherein the contacting time is between about 30 minutes and about 4 hours.
- the composition refers to a composition of isolated enhanced mammalian bone marrow cells wherein the cells have an enhanced expression level in one or more of the biomarkers selected from the group consisting of: Runx2, Osterix, Osteocalcin, Osteopontin, alkaline phosphatase, collagen type I , Axin2, Lef1 , and Tcf4, after treatment with a liposomal WNT polypeptide.
- the biomarkers are selected from Osteocalcin, Osteopontin, Axin2, Lef1 , and Tcf4.
- the biomarkers are selected from Osteocalcin, and Osteopontin.
- the Wnt polypeptide is Wnt3a polypeptide, Wnt5a polypeptide, or Wnt10b polypeptide.
- the Wnt polypeptide is Wnt3a polypeptide.
- the composition refers to a composition of isolated enhanced mammalian bone marrow cells wherein the cells have an enhanced expression level in one or more of the biomarkers selected from the group consisting of: Runx2, Osterix, Osteocalcin, Osteopontin, alkaline phosphatase, collagen type I , Axin2, Lef1 , and Tcf4, after treatment with a liposomal WNT3a polypeptide.
- the biomarkers are selected from Osteocalcin, Osteopontin, Axin2, Lef1 , and Tcf4.
- the biomarkers are selected from Osteocalcin, and Osteopontin.
- the Wnt polypeptide is Wnt5a polypeptide.
- the composition refers to a composition of isolated enhanced mammalian bone marrow cells wherein the cells have an enhanced expression level in one or more of the biomarkers selected from the group consisting of: Runx2, Osterix, Osteocalcin, Osteopontin, alkaline phosphatase, collagen type I , Axin2, Lef1 , and Tcf4, after treatment with a liposomal WNT5a polypeptide.
- the biomarkers are selected from Osteocalcin, Osteopontin, Axin2, Lef1 , and Tcf4.
- the biomarkers are selected from Osteocalcin, and Osteopontin.
- the Wnt polypeptide is Wnt10b polypeptide.
- the composition refers to a composition of isolated enhanced mammalian bone marrow cells wherein the cells have an enhanced expression level in one or more of the biomarkers selected from the group consisting of: Runx2, Osterix, Osteocalcin, Osteopontin, alkaline phosphatase, collagen type I , Axin2, Lef1 , and Tcf4, after treatment with a liposomal WNT10b polypeptide.
- the biomarkers are selected from Osteocalcin, Osteopontin, Axin2, Lef1 , and Tcf4.
- the biomarkers are selected from Osteocalcin, and Osteopontin.
- the composition also refers to a composition of mammalian bone marrow cells obtained from a human subject at or older than 35 years of age, wherein the mammalian bone marrow cells express an enhanced expression level in one or more of the biomarkers selected from the group consisting of: Runx2, Osterix, Osteocalcin, Osteopontin, alkaline phosphatase, collagen type I, Axin2, Lef1 , and Tcf4, after treatment with a liposomal WNT polypeptide.
- the biomarkers are selected from Osteocalcin, Osteopontin, Axin2, Lef1 , and Tcf4. In some embodiments, the biomarkers are selected from Osteocalcin, and Osteopontin.
- the Wnt polypeptide is Wnt3a polypeptide, Wnt5a polypeptide, or Wnt10b polypeptide.
- the Wnt polypeptide is Wnt3a polypeptide.
- the composition also refers to a composition of mammalian bone marrow cells obtained from a human subject at or older than 35 years of age, wherein the mammalian bone marrow cells express an enhanced expression level in one or more of the biomarkers selected from the group consisting of: Runx2, Osterix, Osteocalcin, Osteopontin, alkaline phosphatase, collagen type I, Axin2, Lef1 , and Tcf4, after treatment with a liposomal Wnt3a polypeptide.
- the biomarkers are selected from Osteocalcin, Osteopontin, Axin2, Lef1 , and Tcf4. In some embodiments, the biomarkers are selected from Osteocalcin, and Osteopontin.
- the Wnt polypeptide is Wnt5a polypeptide.
- the composition also refers to a composition of mammalian bone marrow cells obtained from a human subject at or older than 35 years of age, wherein the mammalian bone marrow cells express an enhanced expression level in one or more of the biomarkers selected from the group consisting of: Runx2, Osterix, Osteocalcin, Osteopontin, alkaline phosphatase, collagen type I, Axin2, Lef1 , and Tcf4, after treatment with a liposomal Wnt5a polypeptide.
- the biomarkers are selected from Osteocalcin, Osteopontin, Axin2, Lef1 , and Tcf4. In some embodiments, the biomarkers are selected from Osteocalcin, and Osteopontin.
- the Wnt polypeptide is Wnt10b polypeptide.
- the composition also refers to a composition of mammalian bone marrow cells obtained from a human subject at or older than 35 years of age, wherein the mammalian bone marrow cells express an enhanced expression level in one or more of the biomarkers selected from the group consisting of: Runx2, Osterix, Osteocalcin, Osteopontin, alkaline phosphatase, collagen type I, Axin2, Lef1 , and Tcf4, after treatment with a liposomal Wnt10b polypeptide.
- the biomarkers are selected from Osteocalcin, Osteopontin, Axin2, Lef1 , and Tcf4. In some embodiments, the biomarkers are selected from Osteocalcin, and Osteopontin. [00163] In some embodiments, the enhanced expression level is compared to untreated mammalian bone marrow cells. In some instances, the enhanced expression level is between about 1 % and about 100%, about 1 % and about 50%, about 2% and about 20%, about 3% and about 15%, or about 4% and about 10% compared to untreated mammalian bone marrow cells.
- the enhanced expression level is at least about 5%, 5.5% 6%, 6.5% 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or more compared to untreated mammalian bone marrow cells. In some instances, the enhanced expression level is at most about 5%, 5.5% 6%, 6.5% 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or less compared to untreated mammalian bone marrow cells.
- the mammalian bone marrow cells further have a decreased expression level in a biomarker selected from SOX9 and PPARy after treatment with liposomal WNT polypeptide.
- the decreased expression level in the mammalian bone marrow cells are compared to untreated mammalian bone marrow cells.
- the decreased expression level is between about 1 % and about 100%, about 2% and about 80%, about 3% and about 50%, about 3% and about 30%, or about 4% and about 20% compared to untreated mammalian bone marrow cells.
- the bone marrow cells further comprise a decrease in apoptosis level compared to untreated mammalian bone marrow cells.
- the decrease in apoptosis level is at least about 1 %, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, or more compared to untreated mammalian bone marrow cells.
- the decrease in apoptosis level is at most about 1 %, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, or less compared to untreated mammalian bone marrow cells.
- the mammalian bone marrow cells comprise enhanced osteogenic potential compared to untreated mammalian bone marrow cells.
- the enhanced osteogenic potential comprises new bone growth level at the site of bone defect after transplanting treated mammalian bone marrow cells.
- the new bone growth level of transplanted treated mammalian bone marrow cells is between about 1 % and about 20% or about 5% and about 12% compared to the new bone growth level of transplanted untreated mammalian bone marrow cells.
- the new bone growth level of transplanted treated mammalian bone marrow cells is increased by about 1.5-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 10-fold, about 20-fold, about 50-fold, about 100-fold, or more compared to the new bone growth level of transplanted untreated mammalian bone marrow cells.
- the bone graft material refers to a cellular composition obtained from a donor, in which the donor can be living or cadaveric.
- Bone graft material typically comprises complex cell populations, and includes stem cells such as mesenchymal stem cells, and in some instances, also comprises osteocytes and progenitors thereof.
- the cells are adherent bone marrow cells or non-adherent bone marrow cells.
- the bone marrow cells are adherent bone marrow cells.
- the adherent bone marrow cells are bone marrow stem cells or bone marrow progenitor cells.
- the adherent bone marrow cells are bone marrow stromal cells.
- the donor is allogeneic. In some instances, the donor is autologous relative to the recipient.
- the quantity of cells for a bone graft can vary with the donor, the recipient, purpose of graft, and the like.
- a bone graft can comprise up to about 10 3 , up to about 10 4 , up to about 10 5 , up to about 10 6 , up to about 10 7 , up to about 10 8 , up to about 10 9 , up to about 10 10 or more cells.
- the bone graft material is obtained from the donor, for example from the iliac crest, from the mandibular symphysis (chin area), from reaming, aspirating, and irrigating the femur and/or tibia, fibula, ribs, anterior mandibular ramus; parts of spinal bone, e.g. those removed during surgery, cadaver bones, etc.
- the graft material is harvested from bone marrow, for example scraped from the endosteal surface of a suitable bone, or from a block graft containing marrow and a small block of bone.
- allograft bone is taken from cadavers, bone banks, etc. for example from a femoral head from hip replacement surgery.
- the bone graft material is fresh, or is cryo-preserved as known in the art until it is needed.
- the cells of the bone graft are suspended in a suitable culture medium in the presence of an effective dose of a liposomal Wnt polypeptide, e.g. L- Wnt3a, L-Wnt5a, or L-Wnt10b.
- a liposomal Wnt polypeptide e.g. L- Wnt3a, L-Wnt5a, or L-Wnt10b.
- Any suitable medium can be used, e.g. DMEM, RPMI, PBS, etc.
- Cells are typically resuspended at a concentration that maintains viability during the incubation procedure, e.g. up to about 10 4 /ml, up to about 10 5 /ml, up to about 10 6 /ml, up to about 10 7 /ml.
- the contacting temperature is between about 0°C and about 37°C, or about 20°C and about 25°C. In some embodiments, the contacting temperature is lower, e.g. up to about 32°C, up to about 25°C, up to about 15°C, up to about 10°C, up to about 8°C, up to about 4°C, up to about 1 °C, but typically above freezing unless specifically prepared for cryopreservation.
- the incubation temperature is at least about 20°C, 21 °C, 22°C, 23°C, 24°C, 25°C, or more. In some instances, the incubation temperature is at most about 20°C, 21 °C, 22°C, 23°C, 24°C, 25°C, or less.
- the bone graft material contacts with the Wnt polypeptide for at least about 10 minutes, at least about 30 minutes, at least about 1 hour, at least about 2 hours, at least about 3 hours, and up to about 36 hours, up to about 24 hours, up to about 18 hours, up to about 15 hours, up to about 12 hours, up to about 8 hours, up to about 6 hours, or up to about 4 hours.
- the effective dose of the Wnt polypeptide can vary depending on the source, purity, preparation method, etc.
- the effective dose of the Wnt polypeptide is at least about O.O ⁇ g/ml, ⁇ . ⁇ / ⁇ , O. ⁇ g/ml, 0.1 ⁇ g/ml, O ⁇ g/ml, 0.25 ⁇ g/ml, O ⁇ g/ml, 0.35 ⁇ g/ml, O ⁇ g/ml, 0.45 ⁇ g/ml, O ⁇ g/ml, 0.6 ⁇ gml, 0.7 ⁇ gml, 0.8 ⁇ gml, 0.9 ⁇ gml, 1.C ⁇ g/ml, 1.5 ⁇ gml, 2.0 ⁇ gml, 2.5 ⁇ gml, 3.0 ⁇ gml, 3 ⁇ g/ml, 4.0 ⁇ gml, 4.5 ⁇ gml, 5.0 ⁇ gml, 7.5 ⁇ gml, 1C ⁇ g/ml, 15 ⁇ gml, 25 ⁇ gml, 50 ⁇ gml, 100 ⁇ gml, or more.
- the effective dose of the Wnt polypeptide is at most about O.O ⁇ g/ml, O.C ⁇ g/ml, 0.1 g/ml, 0. ⁇ 5 ⁇ glm ⁇ , O ⁇ g/ml, 0.25 ⁇ gml, 0.3 ⁇ gml, 0.35 ⁇ gml, 0.4 ⁇ gml, 0.45 ⁇ g/ml, 0.5 ⁇ gml, 0.6 ⁇ gml, 0.
- the Wnt polypeptide is L-Wnt3a
- the effective dose of the Wnt3a polypeptide is at least about O.O ⁇ g/ml, O.C ⁇ g/ml, O. ⁇ g/ml, 0.15 ⁇ gml, 0.2 ⁇ gml, 0.25 ⁇ gml, 0.3 ⁇ gml, 0.35 ⁇ g/ml, 0.4 ⁇ gml, 0.45 ⁇ gml, 0.5 ⁇ gml, 0.6 ⁇ gml, 0.
- ⁇ g/ml 0.8 ⁇ gml, 0.9 ⁇ gml, 1.0 ⁇ gml, 1.5 ⁇ gml, 2.C ⁇ g/ml, 2.5 ⁇ gml, 3.0 ⁇ gml, 3.5 ⁇ gml, 4.0 ⁇ gml, 4 ⁇ g/ml, 5.0 ⁇ gml, 7.5 ⁇ gml, 10 ⁇ gml, 15 ⁇ gml, 25 ⁇ g/ml, 50 ⁇ gml, 100 ⁇ gml, or more.
- the effective dose of the Wnt3a polypeptide is at most about O.O ⁇ g/ml, O.C ⁇ g/ml, 0. ⁇ glm ⁇ , 0.15 ⁇ gml, 0.2 ⁇ gml, 0.25 ⁇ gml, O ⁇ g/ml, 0.35 ⁇ gml, 0.4 ⁇ gml, 0.45 ⁇ gml, 0.5 ⁇ gml, O ⁇ g/ml, 0.
- ⁇ gml 0.8 ⁇ gml, 0.9 ⁇ gml, 1.0 ⁇ gml, ⁇ . ⁇ / ⁇ , 2.0 ⁇ gml, 2.5 ⁇ gml, 3.0 ⁇ gml, 3.5 ⁇ gml, 4.C ⁇ g/ml, 4.5 ⁇ gml, 5.0 ⁇ gml, 7.5 ⁇ gml, 10 ⁇ gml, 15 ⁇ g/ml, 25 ⁇ gml, 50 ⁇ gml, 100 ⁇ gml, or less.
- the Wnt polypeptide is L-Wnt5a
- the effective dose of the Wnt5a polypeptide is at least about O.O ⁇ g/ml, O.C ⁇ g/ml, O. ⁇ g/ml, 0.15 ⁇ gml, O ⁇ g/ml, 0.25 ⁇ gml, 0.3 ⁇ gml, 0.35 ⁇ gml, 0.4 ⁇ gml, 0.45 ⁇ g/ml, 0.5 ⁇ gml, 0.6 ⁇ gml, 0.7 ⁇ gml, 0.8 ⁇ gml, O ⁇ g/ml, 1.0 ⁇ gml, 1.5 ⁇ gml, 2.0 ⁇ gml, 2.5 ⁇ gml, 3.C ⁇ g/ml, 3.5 ⁇ gml, 4.0 ⁇ gml, 4.5 ⁇ gml, 5.0 ⁇ gml, 7 ⁇ g/ml, 10 ⁇ gml, 15 ⁇ gml, 25 ⁇ gml, 50 ⁇ gml, 10C ⁇ g/ml, or more.
- the effective dose of the Wnt5a polypeptide is at most about O.O ⁇ g/ml, O.C ⁇ g/ml, 0. ⁇ glm ⁇ , 0. ⁇ 5 ⁇ glm ⁇ , 0.2 ⁇ gml, 0.25 ⁇ gml, 0.3 ⁇ gml, 0.35 ⁇ gml, O ⁇ g/ml, 0.45 ⁇ gml, 0.5 ⁇ gml, 0.6 ⁇ gml, 0.
- the Wnt polypeptide is L-Wnt10b
- the effective dose of the WntlOb polypeptide is at least about O.O ⁇ g/ml, O.C ⁇ g/ml, O. ⁇ g/ml, 0.15 ⁇ gml, 0.2 ⁇ gml, 0.25 ⁇ gml, O ⁇ g/ml, 0.35 ⁇ gml, 0.4 ⁇ gml, 0.45 ⁇ gml, 0.5 ⁇ gml, O ⁇ g/ml, 0.
- ⁇ gml 0.8 ⁇ gml, 0.9 ⁇ gml, 1.0 ⁇ gml, ⁇ . ⁇ / ⁇ , 2.0 ⁇ gml, 2.5 ⁇ gml, 3.0 ⁇ gml, 3.5 ⁇ gml, 4.C ⁇ g/ml, 4 ⁇ g/ml, 5.0 g/ml, 7 ⁇ g/ml, ⁇ ⁇ / ⁇ , ⁇ ⁇ / ⁇ , 25 ⁇ 9 ⁇ , 50 ⁇ g/ml, 100 ⁇ g/ml, or more.
- the effective dose of the Wntl Ob polypeptide is at most about ⁇ . ⁇ ⁇ / ⁇ , ⁇ . ⁇ / ⁇ , 0. ⁇ ⁇ glm ⁇ , 0. ⁇ 5 ⁇ glm ⁇ , O ⁇ g/ml, 0.25 ⁇ 9/ ⁇ , O ⁇ g/ml, 0.35 ⁇ 9/ ⁇ , O ⁇ g/rml, 0.45 ⁇ 9/ ⁇ , 0.5 ⁇ 9/ ⁇ , 0.6 ⁇ 9/ ⁇ , 0.7 ⁇ 9/ ⁇ , ⁇ . ⁇ / ⁇ , ⁇ . ⁇ / ⁇ , 1. ⁇ -g/ml, 1 .5( g/ml, 2.0 g/ml, 2.5 ⁇ 9/ ⁇ , 3.0 ⁇ 9/ ⁇ , 3.5 ⁇ 9/ ⁇ , 4.0 g/ml, 4 ⁇ g/ml, 5.0 ⁇ 9/ ⁇ , 7.5 ⁇ 9/ ⁇ , 10 ⁇ -g/ml, 15 ⁇ g/ml, 25 9/ ⁇ ⁇ , 50 9/ ⁇ ⁇ , 100( g/ml, or less.
- the bone graft material is incubated with aWnt polypeptide for a period of time sufficient to enhance osteogenic capacity.
- the enhancement can be measured in various ways such as the use of biomarkers described herein, e.g. by increased expression of Axin2, by increased mitotic activity in the bone graft material (measured at from about day 2 to about day 6 post-transplantation); by increased bone formation post-transplantation, by increased expression of Runx2 or Osteocalcin, by reduced apoptosis post-transplantation; or by volume of bone produced posttransplantation.
- the bone graft material can be transplanted into a recipient following conventional protocols, e.g. for repair of spinal bone, fractures, dental supports, and the like.
- a wash step is performed to remove any free liposomal Wnt polypeptides.
- at least about 1 , 2, 3, 4, 5 wash times or more is performed.
- at most about 1 , 2, 3, 4, 5 wash times or less is performed.
- any suitable buffer is used for washing, such as for example phosphate buffered saline solution.
- the remaining liposomal Wnt after the washing step is at most about 0.01 pg (picogram), 0.05 pg, 0.1 pg, 0.5pg, 1 pg, 1.5pg, 2pg, 2.5pg, 3pg, 3.5pg, 4pg, 4.5pg, 5pg, 5.5pg, 6pg, or less.
- the remaining liposomal Wnt after the washing step is at least about 0.01 pg (picogram), 0.05 pg, 0.1 pg, 0.5pg, 1 pg, 1.5pg, 2pg, 2.5pg, 3pg, 3.5pg, 4pg, 4.5pg, 5pg, 5.5pg, 6pg, or more.
- the method described herein for treatment of bone graft materials with Wnt allows for control of exposure time of the Wnt polypeptide to cells, duration of the exposure, concentration of exposure, and/or toxicity.
- the method described herein for treatment of bone graft materials with Wnt3a allows for control of exposure time of the Wnt3a polypeptide to cells, duration of the exposure, concentration of exposure, and/or toxicity.
- osteogenic potential is restored to aged bone grafts by incubation with a Wnt polypeptide, such as for example L-Wnt3a, L-Wnt5a, or L-Wnt10b.
- a Wnt polypeptide such as for example L-Wnt3a, L-Wnt5a, or L-Wnt10b.
- liposomal Wnt3a treatment reduces cell death in aged bone grafts.
- bone grafts treated with liposomal Wnt3a gave rise to more bone (p ⁇ 0.05).
- liposomal Wnt3a treatment enhanced cell survival in the graft and re-established the bone-forming ability of grafts from aged animals.
- mammalian bone marrow cells are obtained from any mammal, including but not limited to a human.
- the donor is a rodent, such as a mice, or rat.
- the donor is a rabbit.
- the donor is a human.
- the donor is self and the bone marrow cells are autologous.
- autologous bone marrow cells include adherent and non-adherent bone marrow cells.
- the autologous bone marrow cells are adherent bone marrow cells.
- the autologous bone marrow cells include bone marrow stem cells and bone marrow progenitor cells.
- the autologous bone marrow cells include bone marrow stromal cells.
- the donor is another individual and the bone marrow cells are allogeneic.
- the allogeneic bone marrow cells are obtained from a living donor or a cadaveric donor.
- the allogenic bone marrow cells include adherent and non-adherent bone marrow cells.
- the allogeneic bone marrow cells are adherent bone marrow cells.
- the allogeneic bone marrow cells include bone marrow stem cells and bone marrow progenitor cells.
- the allogeneic bone marrow cells include bone marrow stromal cells.
- the donor is an individual at or older than 35 years of age. In some instances, the bone marrow cells obtained from an individual at or older than 35 years of age is considered old bone marrow cells or aged bone marrow cells. In some embodiments, the donor is an individual younger than 35 years of age. In some instances, the bone marrow cells obtained from an individual younger than 35 years of age is considered young bone marrow cells. . In some instances, the bone marrow cells obtained from an individual at or older than 35 years of age is autologous bone marrow cells or allogeneic bone marrow cells. In some instances, the bone marrow cells obtained from an individual younger than 35 years of age is autologous bone marrow cells or allogenic bone marrow cells. As used herein, the terms "individual(s)", “subject(s)”, “donor(s)”, and “patient(s)” are used interchangeably herein, and means any mammal, including but not limited to a human.
- the methods, compositions, processes, and kits described herein provide a clinically applicable regenerative medicine-based strategy for revitalizing bone grafts from aged patients, and from other patients with diminished healing potential, such as, for example, smokers, diabetics, or patients, with nutritional deficits.
- biomarkers such as Runx2, Osterix, Osteocalcin, Osteopontin, alkaline phosphatase, collagen type I, Axin2, Lef1 , Tcf4, SOX9 and PPARy are well known in the art.
- the expression level or the presence of biomarkers are measured, for example, by flow cytometry, immunohistochemistry, Western Blot, immunoprecipitation, magnetic bead selection, and quantification of cells expressing either of these biomarkers.
- Biomarker RNA or DNA expression levels could be measured by RT-PCR, Qt-PCR, microarray, Northern blot, or other similar technologies.
- biomarker and “marker” are used interchangeably.
- determining the expression or presence of the biomarker of interest at the polypeptide or nucleotide level is accomplished using any detection method known to those of skill in the art.
- detecting expression or “detecting the level of” is intended to determine the expression level or presence of a biomarker protein or gene in the biological sample.
- detecting expression encompasses instances where a biomarker is determined not to be expressed, not to be detectably expressed, expressed at a low level, expressed at a normal level, or overexpressed.
- the expression or presence of these various biomarkers and any clinically useful prognostic markers in a biological sample are detected at the protein or nucleic acid level, using, for example, immunohistochemistry techniques or nucleic acid- based techniques such as in situ hybridization and RT-PCR.
- the expression or presence of one or more biomarkers is carried out by a means for nucleic acid amplification, a means for nucleic acid sequencing, a means utilizing a nucleic acid microarray (DNA and RNA), or a means for in situ hybridization using specifically labeled probes.
- the determining the expression or presence of one or more biomarkers is carried out through gel electrophoresis. In one embodiment, the determination is carried out through transfer to a membrane and hybridization with a specific probe.
- the determining the expression or presence of one or more biomarkers is carried out by a diagnostic imaging technique.
- the determining the expression or presence of one or more biomarkers is carried out by a detectable solid substrate.
- the detectable solid substrate is paramagnetic nanoparticles functionalized with antibodies.
- expression of a biomarker is detected on a protein level using, for example, antibodies that are directed against specific biomarker proteins. These antibodies are used in various methods such as Western blot, ELISA, multiplexing technologies, immunoprecipitation, or immunohistochemistry techniques.
- detection of biomarkers is accomplished by ELISA.
- detection of biomarkers is accomplished by electrochemiluminescence (ECL).
- labeled antibodies, binding portions thereof, or other binding partners are used.
- label when used herein refers to a detectable compound or composition that is conjugated directly or indirectly to the antibody so as to generate a "labeled" antibody.
- the label is detectable by itself (e.g., radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, catalyzes chemical alteration of a substrate compound or composition that is detectable.
- the antibodies for detection of a biomarker protein are either monoclonal or polyclonal in origin, or are synthetically or recombinantly produced.
- the amount of complexed protein for example, the amount of biomarker protein associated with the binding protein, for example, an antibody that specifically binds to the biomarker protein, is determined using standard protein detection methodologies known to those of skill in the art.
- a detailed review of immunological assay design, theory and protocols are found in numerous texts in the art (see, for example, Ausubel et al., eds. (1995) Current Protocols in Molecular Biology) (Greene Publishing and Wiley-lnterscience, NY)); Coligan et al., eds. (1994) Current Protocols in Immunology (John Wiley & Sons, Inc., New York, N.Y.).
- the choice of marker used to label the antibodies will vary depending upon the application. However, the choice of the marker is readily determinable to one skilled in the art. These labeled antibodies are used in immunoassays as well as in histological applications to detect the presence of any biomarker or protein of interest.
- the labeled antibodies are either polyclonal or monoclonal. Further, the antibodies for use in detecting a protein of interest are labeled with a radioactive atom, an enzyme, a chromophoric or fluorescent moiety, or a colorimetric tag as described elsewhere herein.
- the choice of tagging label also will depend on the detection limitations desired.
- Enzyme assays typically allow detection of a colored product formed by interaction of the enzyme-tagged complex with an enzyme substrate.
- Radionuclides that serve as detectable labels include, for example, 1-131 , 1 -123, 1-125, Y-90, Re-188, Re-186, At-21 1 , Cu-67, Bi-212, and Pd- 109.
- Examples of enzymes that serve as detectable labels include, but are not limited to, horseradish peroxidase, alkaline phosphatase, beta-galactosidase, and glucose-6- phosphate dehydrogenase.
- Chromophoric moieties include, but are not limited to, fluorescein and rhodamine.
- the antibodies are conjugated to these labels by methods known in the art.
- enzymes and chromophoric molecules are conjugated to the antibodies by means of coupling agents, such as dialdehydes, carbodiimides, dimaleimides, and the like.
- conjugation occurs through a ligand-receptor pair.
- suitable ligand-receptor pairs are biotin-avidin or biotin-streptavidin, and antibody-antigen.
- antibody is used in the broadest sense and covers fully assembled antibodies, antibody fragments that can bind antigen (e.g., Fab, F(ab') 2 , Fv, single chain antibodies, diabodies, antibody chimeras, hybrid antibodies, bispecific antibodies, humanized antibodies, and the like), and recombinant peptides comprising the forgoing.
- antigen e.g., Fab, F(ab') 2 , Fv, single chain antibodies, diabodies, antibody chimeras, hybrid antibodies, bispecific antibodies, humanized antibodies, and the like
- recombinant peptides comprising the forgoing.
- the terms "monoclonal antibody” and "mAb” as used herein refer to an antibody obtained from a substantially homogeneous population of antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that can be present in minor amounts.
- Native antibodies" and "native immunoglobulins" are usually heterotetrameric glycoproteins of about 150,000 daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide linkages varies among the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has at one end a variable domain (V H ) followed by a number of constant domains.
- V H variable domain
- Each light chain has a variable domain at one end (V L ) and a constant domain at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light chain variable domain is aligned with the variable domain of the heavy chain. Particular amino acid residues are believed to form an interface between the light and heavy-chain variable domains.
- variable refers to the fact that certain portions of the variable domains differ extensively in sequence among antibodies. Variable regions confer antigen-binding specificity. However, the variability is not evenly distributed throughout the variable domains of antibodies. It is concentrated in three segments called complementarity determining regions (CDRs) or hypervariable regions, both in the light chain and the heavy-chain variable domains. The more highly conserved portions of variable domains are celled in the framework (FR) regions.
- CDRs complementarity determining regions
- FR framework
- the variable domains of native heavy and light chains each comprise four FR regions, largely adopting a ⁇ -pleated-sheet configuration, connected by three CDRs, which form loops connecting, and in some cases forming part of, the ⁇ - pleated-sheet structure.
- the CDRs in each chain are held together in close proximity by the FR regions and, with the CDRs from the other chain, contribute to the formation of the antigen-binding site of antibodies (see, Kabat et al. (1991 ) NIH PubL. No. 91 -3242, Vol. I, pages 647-669).
- the constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as Fc receptor (FcR) binding, participation of the antibody in antibody-dependent cellular toxicity, initiation of complement dependent cytotoxicity, and mast cell degranulation.
- FcR Fc receptor
- hypervariable region refers to the amino acid residues of an antibody that are responsible for antigen-binding.
- the hypervariable region comprises amino acid residues from a "complementarily determining region” or "CDR" (i.e., residues 24-34 (L1 ), 50-56 (L2), and 89-97 (L3) in the light-chain variable domain and 31 -35 (H1 ), 50-65 (H2), and 95-102 (H3) in the heavy-chain variable domain; Kabat et al. (1991 ) Sequences of Proteins of Immunological Interest, 5th Ed.
- CDR complementarily determining region
- Antibody fragments comprise a portion of an intact antibody, preferably the antigen-binding or variable region of the intact antibody.
- antibody fragments include Fab, Fab, F(ab')2, and Fv fragments; diabodies; linear antibodies (Zapata et al. (1995) Protein Eng. 10:1057-1062); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.
- Papain digestion of antibodies produces two identical antigen-binding fragments, called “Fab” fragments, each with a single antigen- binding site, and a residual "Fc” fragment, whose name reflects its ability to crystallize readily.
- Pepsin treatment yields an F(ab')2 fragment that has two antigen-combining sites and is still capable of cross-linking antigen.
- Fv is the minimum antibody fragment that contains a complete antigen recognition and binding site. This region consists of a dimer of one heavy- and one light-chain variable domain in tight, non-covalent association. It is in this configuration that the three CDRs of each variable domain interact to define an antigen-binding site on the surface of the V H -V L dimer. Collectively, the six CDRs confer antigen-binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site.
- the Fab fragment also contains the constant domain of the light chain and the first constant domain (C H i ) of the heavy chain.
- Fab fragments differ from Fab' fragments by the addition of a few residues at the carboxy terminus of the heavy chain C H i domain including one or more cysteines from the antibody hinge region.
- Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group.
- Fab' fragments are produced by reducing the F(ab')2 fragment's heavy chain disulfide bridge. Other chemical couplings of antibody fragments are also known.
- immunoglobulins The "light chains" of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa ( ⁇ ) and lambda ( ⁇ ), based on the amino acid sequences of their constant domains. [00203] Depending on the amino acid sequence of the constant domain of their heavy chains, immunoglobulins can be assigned to different classes.
- IgA immunoglobulins
- IgD immunoglobulins
- IgE immunoglobulins
- IgG immunoglobulins
- IgM immunoglobulins
- subclasses e.g., lgG1 , lgG2, lgG3, lgG4, lgA1 , and lgA2.
- the heavy-chain constant domains that correspond to the different classes of immunoglobulins are called alpha, delta, epsilon, gamma, and mu, respectively.
- the subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known. Different isotypes have different effector functions. For example, human lgG1 and lgG3 isotypes have ADCC (antibody dependent cell-mediated cytotoxicity) activity.
- ADCC antibody dependent cell-mediated cytotoxicity
- expression or presence of one or more biomarkers or other proteins of interest within a biological sample is determined by radioimmunoassays or enzyme-linked immunoassays (ELISAs), competitive binding enzyme-linked immunoassays, dot blot (see, for example, Promega Protocols and Applications Guide, Promega Corporation (1991 ), Western blot (see, for example, Sambrook et al. (1989) Molecular Cloning, A Laboratory Manual, Vol. 3, Chapter 18 (Cold Spring Harbor Laboratory Press, Plainview, N.Y.), chromatography such as high performance liquid chromatography (HPLC), or other assays known in the art.
- the detection assays involve steps such as, but not limited to, immunoblotting, immunodiffusion, Immunoelectrophoresis, or immunoprecipitation.
- the expression or presence of one or more of the biomarkers described herein are also determined at the nucleic acid level.
- Nucleic acid- based techniques for assessing expression are well known in the art and include, for example, determining the level of biomarker mRNA in a biological sample.
- Many expression detection methods use isolated RNA. Any RNA isolation technique that does not select against the isolation of mRNA is utilized for the purification of RNA (see, e.g., Ausubel et al., ed. (1987-1999) Current Protocols in Molecular Biology (John Wiley & Sons, New York). Additionally, large numbers of tissue samples are readily processed using techniques well known to those of skill in the art, such as, for example, the single-step RNA isolation process disclosed in U.S. Pat. No. 4,843,155.
- nucleic acid probe refers to any molecule that is capable of selectively binding to a specifically intended target nucleic acid molecule, for example, a nucleotide transcript. Probes are synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes are specifically designed to be labeled, for example, with a radioactive label, a fluorescent label, an enzyme, a chemiluminescent tag, a colorimetric tag, or other labels or tags that are discussed above or that are known in the art. Examples of molecules that are utilized as probes include, but are not limited to, RNA and DNA.
- isolated mRNA are used in hybridization or amplification assays that include, but are not limited to, Southern or Northern analyses, polymerase chain reaction analyses and probe arrays.
- One method for the detection of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that hybridize to the mRNA encoded by the gene being detected.
- the nucleic acid probe comprises of, for example, a full-length cDNA, or a portion thereof, such as an oligonucleotide of at least 7, 15, 30, 50, 100, 250 or 500 nucleotides in length and sufficient to specifically hybridize under stringent conditions to an mRNA or genomic DNA encoding a biomarker, biomarker described herein above. Hybridization of an mRNA with the probe indicates that the biomarker or other target protein of interest is being expressed.
- the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose.
- the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in a gene chip array.
- a skilled artisan readily adapts known mRNA detection methods for use in detecting the level of mRNA encoding the biomarkers or other proteins of interest.
- An alternative method for determining the level of an mRNA of interest in a sample involves the process of nucleic acid amplification, e.g., by RT-PCR (see, for example, U.S. Pat. No. 4,683,202), ligase chain reaction (Barany (1991 ) Proc. Natl. Acad. Sci. USA 88:189 193), self-sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci.
- biomarker expression is assessed by quantitative fluorogenic RT- PCR (i.e., the TaqManO System).
- RNA of interest Expression levels of an RNA of interest are monitored using a membrane blot (such as used in hybridization analysis such as Northern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support comprising bound nucleic acids). See U.S. Pat. Nos. 5,770,722, 5,874,219, 5,744,305, 5,677,195 and 5,445,934, which are incorporated herein by reference in its entirety.
- the detection of expression also comprises using nucleic acid probes in solution.
- microarrays are used to determine expression or presence of one or more biomarkers. Microarrays are particularly well suited for this purpose because of the reproducibility between different experiments.
- DNA microarrays provide one method for the simultaneous measurement of the expression levels of large numbers of genes. Each array consists of a reproducible pattern of capture probes attached to a solid support. Labeled RNA or DNA is hybridized to complementary probes on the array and then detected by laser scanning Hybridization intensities for each probe on the array are determined and converted to a quantitative value representing relative gene expression levels. See, U.S. Pat. Nos. 6,040,138, 5,800,992 and 6,020,135, 6,033,860, and 6,344,316, which are incorporated herein by reference in its entirety. High-density oligonucleotide arrays are particularly useful for determining the gene expression profile for a large number of RNA's in a sample.
- an array is fabricated on a surface of virtually any shape or even a multiplicity of surfaces.
- an array is a planar array surface.
- arrays include peptides or nucleic acids on beads, gels, polymeric surfaces, fibers such as fiber optics, glass or any other appropriate substrate, see U.S. Pat. Nos. 5,770,358, 5,789,162, 5,708,153, 6,040,193 and 5,800,992, each of which is hereby incorporated in its entirety.
- arrays are packaged in such a manner as to allow for diagnostics or other manipulation of an all-inclusive device.
- kits and articles of manufacture for use with one or more methods, processes, and compositions described herein.
- Such kits include a carrier, package, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements to be used in a method described herein.
- Suitable containers include, for example, bottles, vials, syringes, and test tubes.
- the containers are formed from a variety of materials such as glass or plastic.
- the articles of manufacture provided herein contain packaging materials.
- packaging materials include, but are not limited to, bottles, tubes, bags, containers, bottles, and any packaging material suitable for a selected formulation and intended mode of administration and treatment.
- the container(s) include L-Wnt polypeptides.
- kits optionally include an identifying description or label or instructions relating to its use in the methods described herein.
- a kit typically includes labels listing contents and/or instructions for use, and package inserts with instructions for use. A set of instructions will also typically be included.
- a label is on or associated with the container.
- a label is on a container when letters, numbers or other characters forming the label are attached, molded or etched into the container itself; a label is associated with a container when it is present within a receptacle or carrier that also holds the container, e.g., as a package insert.
- a label is used to indicate that the contents are to be used for a specific therapeutic application. The label also indicates directions for use of the contents, such as in the methods described herein.
- Human WNT3A is a lipid-modified human stem cell growth factor that is effective in activating adult stem cells and stimulating their self-renewal and survival.
- the native human WNT3A 352 amino acid polypeptide is post-translationally modified by glycosylation and palmitoylation.
- the hydrophobic polypeptide can be difficult to purify to homogeneity at scalable levels.
- Human WNT3A is secreted from CHO cells and purified using an ion exchange (blue sepharose) column. Following purification, recombinant Human WNT3A is reconstituted into lipid vesicles consisting of DMPC and cholesterol. Sucrose density gradient data demonstrates a physical association between WNT3A and the liposome. Further, the liposomal Human Wnt3a polypeptide (L-WNT3A) can be stable under physiologic, aqueous conditions. In some instances, the formation of a liposomal structure is not a prerequisite for this interaction. In some instances, lipids with random structural characteristics are capable of interacting with Human WNT3A and stabilizing the polypeptide in an aqueous environment.
- ion exchange blue sepharose
- a L-WNT3A formulation is to be used in an investigational new drug (IND) Phase I study to treat bone defects in patients at high risk for delayed bone healing.
- BGM autologous bone graft material
- activated BGM e.g., BGM ACT
- L-WNT3A will not be directly administered to the patient but will be used to activate the autologous cells ex vivo.
- FDA U.S. Food and Drug Administration
- WNT3A-transformed CHO cells were grown in DMEM plus Glutamax, antibiotics, and serum.
- the WNT3A plasmid was inducible; and a range of doxycycline concentrations was tested ( Figure 10). It was observed that doxycycline concentration could modulate the amount of Wnt3a secretion by CHO cells. Cells could be grown for up to 10 days, after which a new aliquot of cells was used.
- Fetal bovine serum was used for WNT3A secretion from CHO cells ( Figure 1 1 ).
- CM Conditioned media
- CM Prior to purification, the CM was filtered (0.22 micron filter) and 1% TritonX-100 was added. CM (40 ml.) was applied to a blue Sepharose column (1.6ml) equilibrated in 20mM TrisCI pH 7.5 and 1 % CHAPS. Flow-through was collected and the column was washed with 4 column volumes of 20mM TrisCI pH 7.5,1 % CHAPS, 50mM KCI. The column was washed again with 4 column volumes of 20mM TrisCI pH 7.5,1 % CHAPS, 100mM KCI.
- the column was then washed with 3 column volumes of 20mM TrisCI pH 7.5, 1 % CHAPS, 150mM KCI; in which from this wash the human WNT3A was eluted.
- the column was washed again with 4 column volumes of 20mM TrisCI pH 7.5,1 % CHAPS, 250mM KCI. From a 40ml_ CM, the yield was 12 ⁇ g of polypeptide at approximately 60% purity. Compared to other purification schemes, this method produced WNT3A with higher purity and higher yield. In some cases, the purity was 70%.
- WNT3A characterization SDS-PAGE / Western blot. SDS PAGE and Coomassie blue staining analyses of WNT3A purification fractions were collected and analyzed for WNT3A polypeptide purity by 12% SDS polyacrylamide gel stained with Coomassie brilliant blue and silver nitrate ( Figure 2). Shown in Figure 2, Purification fractions were collected and analyzed for WNT3A polypeptide purity by 12% SDS polyacrylamide gel stained with coomassie brilliant blue and silver nitrate. The estimated purity of WNT3A was 70%. Pierce 660 protein assay kit and absorbance at 280nm were used to measure the total protein concentration. In each assay a BSA standard curve was generated to estimate the total protein concentration.
- WNT3A polypeptide concentration was determined using a quantitative Western blot and a WNT3A standard curve. [00228] Mass spectroscopy. Mass spectrometry analysis verified that WNT3A polypeptide was lipidated and glycosylated ( Figure 3). The polypeptide was observed to be palmitolyated at S209.
- LCMS Liquid chromatograph and mass spectrometry
- Liposomal Wnt3a (L-Wnt3a) polypeptides containing net positive, negative, or neutral charges were manufactured by incubating either positive charged lipids, negatively charged lipids, or neutral charged lipids at room temperature, with purified Wnt3a for at least about 6h and up to about 24h. The lipid to cholesterol ratio was maintained at 90:10. Following incubation, L-Wnt3a was separated from CHAPS and other impurities by centrifuging at force ranging from 16,000-150,000 x g for up to 1 h at 4°C. The L-Wnt3a pellet was then resuspended in sterile 1X PBS, overlaid with nitrogen gas and stored at 4°C.
- Mouse LSL cell-based assay Mouse LSL cells were stably transfected with a Wnt-responsive luciferase reporter plasmid pSuperTOPFIash (Addgene) and a constitutive LacZ expression construct pEF/Myc/His/LacZ (Invitrogen) for normalizing beta galactosidase activity to cell number.
- Human embryonic kidney epithelial (HEK293T) cells were stably transfected with the above two plasmids.
- Cells (50000 cells/well, 96-well plate) were treated with L-WNT3A in DMEM supplemented with 10% FBS (Gibco) and 1 % P/S (Cellgro) at a concentration of 10uL in 150uL total volume, unless otherwise stated. Included also was a serial dilution of purified WNT3A polypeptide.
- the LSL reporter cell line was used to assess activity of Wnt polypeptides and agonists.
- the following characterizations of L-WNT3A were made using the following reporter assay. Cells were plated at 5.0x10 4 per assay well and the activity of WNT3A and L-WNT3A were quantified using LSL and HEK293 reporter lines. Under these conditions, WNT3A and L-WNT3A showed similar ability to activate Wnt signaling (Figure 13).
- LSL and HEK293T cells were engineered to be sensitive to Wnt and Wnt agonists and therefore provide little meaningful data on the relationship between dose, drug effect, and clinical response.
- mouse embryonic fibroblasts was assayed using expression of the Wnt target gene Axin2 as a measure of pathway activity.
- lipids can substitute for CHAPS to maintain WNT3A.
- DMPC and cholesterol lipids could substitute for CHAPS to maintain WNT3A activity.
- Wnt3a dissociated from the liposome pellet and preferentially associated with Frizzled in the supernatant ( Figure 17B).
- the affinity of Wnt3a for the liposomal membrane was lower than the affinity of Wnt3a for Frizzled.
- Wnt3a Based on the LSL reporter cell assay and PAGE-Western blot analyses, Wnt3a rapidly associated with the liposome and this association was responsible for maintaining the polypeptide's activity. Initially, Wnt3a activity was observed in the supernatant. Over the course of about 30 minutes, Wnt3a polypeptide transferred from the supernatant to the pellet at a rate of about 3x10 "3 nM/sec (Fig. 18A). By 6h, 90% of the Wnt3a activity was observed in the pellet. Similarily, western blot analysis showed that 90% of the polypeptide were found in the pellet (Fig. 18B).
- Figure 19 illustrates Wnt5a and Wnt10b interactions with liposomes (Figure 19).
- Plasmid vector Promega
- BGM bone graft material
- BGM ACT L-WNT3A activated bone graft material
- HEK Human embryonic kidney
- LSL mouse L cells
- L-WNT3A liposomal WNT3A
- MEF Mouse embryonic fibroblast
- Human Wnt3a polypeptide was produced by transfection of a genetically engineered Chinese hamster ovary (CHO) cell line with a plasmid carrying human Wnt3a nucleic acid. A lipofectin-based transfection method was used. The plasmid was under the control of a doxycycline-inducible promoter.
- the Wnt3a-transformed CHO cells were grown in adherent or suspension culture in a culture medium containing DMEM (Dulbecco's Modified Eagle Medium)+ 10% fetal bovine serum (FBS), GlutaMaxTM (a glutamine-based dipeptide), antibiotic (e.g.
- doxycycline doxycycline
- G418, non-essential amino acids blasticidine and serum
- temperatures ranging from about 32-37°C The amount of Wnt3a secreted from CHO cells depended on whether they were grown as adherent or suspended cultures. Doxycycline was added to the media at a range of concentrations, which could modulate the amount of human Wnt3a produced by CHO cells.
- the culture medium included Fetal bovine serum (FBS) which was present throughout the culture period during which the CHO cells secreted Wnt3a. Cells can be grown for up to 10 days, after which a new aliquot of cells was used.
- FBS Fetal bovine serum
- the present purification scheme uses a step gradient, which produces higher purity and higher yield as shown in Tables 1 and 2.
- the continuous salt gradient was run on a blue Sepharose column from 150 mM to 1.5 M NaCI, followed by gel filtration and a heparin sulfate column.
- the present scheme also utilizes a hydrophobic purification step such as a hydrophobic column (e.g. a Protein A- Sepharose column).
- Table 1 shows results obtained by the purification step of the present invention and Table 2 shows results obtained by the purification scheme using either a continuous gradient or a gel filtration purification step.
- mice All procedures followed protocols approved by the Stanford Committee on Animal Research. Beta-actin-enhanced green fluorescent protein (ACTB-eGFP; The Jackson Laboratory, Sacramento, California) and CD1 wild type, syngeneic mice were used. Mice ⁇ 3 months old were considered young; mice >10 months were considered aged. Axin2 CreERT/+ and R26R mTmG/+ mice were purchased from Jackson Labs. Aged wild type Lewis rats ("retired breeders" from Charles Rivers, MA), were utilized for spinal fusion surgeries according to AAUC and lUPAC guidelines.
- ACTB-eGFP The Jackson Laboratory, Sacramento, California
- BGM bone graft material
- L-PBS phosphate-buffered saline
- Tissue samples were homogenized in TRIzol solution. RNA was isolated and reverse transcription was performed. Quantitative real-time PCR was carried out using Prism 7900HT Sequence Detection System and Power SYBR Green PCR Master Mix (Applied Biosystems). Levels of gene expression were determined by the AACT method and normalizing to their GAPDH values. All reactions were performed in triplicate, means and standard deviations were calculated.
- Primers sequences (5' to 3') are as follows: Axin2, [for- TCATTTTCCGAGAACCCACCGC], [re v-G CT C CAGTTT C AGTTT CT C CAG C C] ; Lef1, [for- AGGAGCCCAAAAGACCTCAT], [rev-CGTGCACTCAGCTATGACAT]; GAPDH, [for- ACCCAGAAGACTGTGGATGG [rev- GGATGCAGGGATGATGTTCT]; ALP [for- ACCTTG ACTGTG GTTACTG C , [rev- CATATAGGATGGCCGTGAAGG]; Osterix, [for- GGAGACCTTGCTCGTAGATTTC], [rev- G G G ATCTTAGTG ACT G C CTAAC] ; Osteocalcin, [for- TGTGACGAGCTATCAAACCAG], [rev- GAGGATCAAGTTCTGGAGAGC].
- the sub-renal capsular assay was employed to assay its differentiation potential. Following inhalation of anesthesia by the syngeneic host mice, a skin incision was made on the left flank directly caudal to the rib cage. The peritoneal cavity was opened to expose the kidney. A small incision was created in the renal capsule and the BGMs were carefully placed under the capsule using soft plastic tubing. The kidney was then returned to the peritoneal cavity, and the peritoneum and skin were closed with sutures. Buprenorphine (0.05mg/kg) was used for analgesia.
- DKK1 and the negative control Fc adenoviral constructs were generated.
- the adenoviral constructs were transfected into 293T cells. After 2 days, cells were collected, lysed, and precipitated by centrifugation. The purified adenovirus was aliquoted and stored at -80°C. Wnt inhibition was achieved by in vitro incubation of BGMs with Ad-Dkk1 and the control Ad-Fc for 2 hours, and the BGM aliquots were then transplanted into calvarial defects.
- mice were anesthetized, and a 3-mm incision was made to expose the parietal bone. A circumferential, full-thickness defect with a 2-mm diameter was created with the use of a micro-dissecting trephine; the dura mater was not disturbed. BGM aliquots were incubated with Ad-Dkk1 and the control Ad-Fc for 2 hours. BGM aliquots were then transplanted into the calvarial defect and the skin was closed with sutures Following recovery from surgery, mice received Buprenorphine for analgesia.
- Micro-computed tomography analyses were performed as follows. Mice were anesthetized with 2% isoflurane and scanned with use of a multimodal positron emission tomography-computed tomography data-acquisition system (Inveon PET-CT) at 40- ⁇ resolution. Data were analyzed with MicroView software. The three-dimensional region-of-interest tool was used to assign the structure and bone volume for each sample.
- Lewis Rats were anesthetized using a cocktail of Ketamine 70-100 mg/kg and Xylazine 5-10 mg/kg. The lumbar region of the rats were shaved then disinfected with Betadine-soaked gauze. Prior to the skin incision, the rats were injected with the analgesia buprenorphine 0.02 mg/kg SC/IP. First, bone graft material (BGM) was harvested from the iliac crest; briefly, the left iliac spine was palpated and a vertical cutaneous incision was made; the dorsal crest of the iliac spine was accessed and exposed through blunt dissection.
- BGM bone graft material
- BGM The attached muscle and periosteum were elevated and 0.3g of BGM was harvested with rongeur forceps and morselized. BGM was then incubated with either 100 ⁇ _ L-PBS or with 100 ⁇ _ of [O.' ⁇ g/mL] L-Wnt3a while the transverse processes were exposed.
- Tissues were fixed in 4% paraformaldehyde (PFA) overnight at 4°C. Samples were decalcified in 19% EDTA for 1 day. Specimens were dehydrated through an ascending ethanol series prior to paraffin embedding. Eight-micron-thick longitudinal sections were cut and collected on Superfrost-plus slides for histology. Safranin O, Aniline blue and Gomori staining were performed. Tissue sections were photographed using a Leica DM5000B digital imaging system.
- PFA paraformaldehyde
- Alkaline phosphatase (ALP) activity was detected by incubation in nitro blue tetrazolium chloride (NBT), 5-bromo-4-chloro-3-indolyl phosphate (BCIP), and NTM buffer ("l OOmM NaCI, "l OOmM Tris pH9.5, 5mM MgCI).
- NBT nitro blue tetrazolium chloride
- BCIP 5-bromo-4-chloro-3-indolyl phosphate
- NTM buffer l OOmM NaCI, "l OOmM Tris pH9.5, 5mM MgCI.
- TRIP Tartrate-resistant acid phosphatase activity was observed using a Leukocyte acid phosphatase staining kit following manufacturer's instructions. After developing, slides were dehydrated in a series of ethanol, cleaned in Citrisolv, and cover-slipped with Permount mounting media.
- TUNEL staining sections were permeabilized using 0.1 % Triton X-100 and 0.1 % sodium citrate, and incubated with TUNEL reaction mixture (In situ Cell Death Detection Kit). Sections were mounted with DAPI mounting medium and visualized under an epifluorescence microscope.
- mice were given intraperitoneal injections of BrdU labeling reagent (Invitrogen, CA, USA) and euthanized 4 hours post-injection. BrdU detection was carried out using BrdU Staining Kit following the manufacturer's instructions. Immunohistochemistry
- Tissue sections were deparaffinized and rehydrated in PBS. Endogenous peroxidase activity was quenched by 3% hydrogen peroxide for 5 min, and then washed in PBS. Slides were blocked with 5% goat serum for 1 hour at room temperature. The appropriate primary antibody was added and incubated overnight at 4°C. Samples were then incubated with appropriate biotinylated secondary antibodies and advidin/biotinylated enzyme complex and developed by a DAB substrate kit. Antibodies used included GFP and DLK Runx2, Sox9 and PPAR- ⁇ .
- Photoshop CS5 was used to determine the number of pixels in the region of interest (ROI), at the injury site.
- the magic wand tool was used to assign the area of positive pixels within the ROI.
- the ratio of pixels of positive signals to pixels of ROI was expressed as a percentage.
- Bone graft material contains multiple stem/progenitor cell populations
- the optimal anatomical site for harvesting autografts depends upon a number of factors including donor site morbidity and the availability of bone stock.
- the BGM was harvested from three anatomical sites using a modified reamer-irrigator-aspirator (RIA) technique and noted that the femur, iliac crest, and tibia yielded BGM with distinctly different histological appearances.
- femur BGM contained adipocytes, even when harvested from young animals (Fig. 20A).
- Iliac crest BGM was largely comprised of trabecular bone fragments covered in tightly adherent cells (Fig. 20B).
- BGM from the tibia contained a considerable amount of fibrous stroma and small, anucleated cells (Fig. 20C).
- a quantitative RT-PCR was used to evaluate endogenous osteogenic gene expression and found that of the three sources, iliac crest BGM expressed alkaline phosphatase and Osteocalcin at significantly higher levels (Fig. 20D).
- BGM bone graft material
- SRC sub-renal capsule
- the SRC provides a vascular supply to the transplanted tissue and supports the differentiation of cells into multiple kinds of tissues including bone, skin, muscle, teeth, organs, and tumors.
- BGM was harvested from the iliac crest, then transplanted beneath the animal's kidney capsule (Fig. 20A) and allowed to develop there for 7 days.
- BrdU incorporation demonstrated the high mitotic activity of cells in the autologous BGM (Fig. 20B).
- Immunostaining for Runx2 (Fig. 20C), Sox9 (Fig. 20D) and PPARy (Fig. 20E) demonstrated that subsets of cells in the BGM expressed gene markers associated with osteogenic, chondrogenic and adipogenic commitment.
- Fig. 20F a sub-population of BGM-derived cells had differentiated into bone
- cartilage Fig. 20G
- fat Fig. 20H
- Axin2 CreERT2 ;R26 mTmG reporter mice were used to induce recombination which lead to the identification of GFP +ve pre-osteoblasts in the periosteum (Fig. 21 A) and the endosteum (Fig. 21 B). The frequency of GFP +ve cells in the endosteum was -0.1 % (Fig. 21 C). GFP +ve cells were also identified in freshly harvested BGM (Fig. 21 D). Thus, a subset of cells in the heterogeneous BGM is Wnt responsive.
- BGM was harvested and analyzed for evidence of bone formation.
- Aniline blue stained osteoid matrix was evident in BGM young (Fig. 22D) but absent in BGM aged (Fig. 22E; quantified in Fig. 22F).
- the osteoid matrix in BGM young was undergoing mineralization as shown by ALP staining (Fig. 22G) whereas BGM aged showed no ALP staining (Fig. 22H; quantified in I).
- the GFP immunostaining demonstrated that in both BGM young (Fig. 22J) and BGM aged (Fig. 22K) there were a similar number of surviving donor cells (quantified in Fig. 22L). Together these data indicated that osteogenic gene expression and osteogenic capacity of BGM declined with age.
- Endogenous Wnt responsiveness and the osteogenic capacity of BGM diminish with age.
- endogenous Wnt signaling in BGM was blocked.
- Over-expression of the Wnt inhibitor, Dkk1 was also used to transiently abolish Wnt signaling in vivo.
- Either Ad-Dkk1 or Ad-Fc (control) was delivered to the bone marrow cavity of young mice then harvested BGM young 24h later and transplanted the aliquots into critical size (non-healing) skeletal defects.
- Ad-Dkk1 treated BGM young showed minimal activity (Fig. 23B). Instead, Ad-Dkk1 treated BGM young showed widespread expression of the adipogenic proteins PPAR- ⁇ (Fig. 23C, Fig. 23D) and Dlk1 (Fig. 23E, Fig. 23F). Bone formation was repressed by Ad-Dkk1 treatment, as shown by micro-CT (Fig. 23G, Fig. 23H; quantified in Fig. 23I) and histomorphometric analyses of the BGM (Fig. 23J, Fig. 23K; quantified in Fig. 23L). Thus, the osteogenic capacity of BGM relies upon an endogenous Wnt signal.
- Fig. 23J-Fig. 23L showed that endogenous Wnt signaling could activate osteogenic capacity of BGM.
- a Wnt stimulus was also tested for sufficiency to enhance BGM efficacy.
- BGM aged was harvested, treated with L-WNT3A or liposomal PBS (L-PBS), and then incubated at 37°C (Fig. 24A).
- Absolute qRT-PCR analyses revealed a small elevation in Axin2 expression (Fig. 24B).
- Lef1 was modestly elevated in response to L-WNT3A (Fig. 24B).
- Western analyses indicated that both beta catenin and Axin2 proteins were elevated in response to L-WNT3A (Fig. 24C).
- L-WNT3A activates stem cells in BGM aged and improves bone generation in a spinal fusion model
- BGM ACT The activated state of the BGM was shown by qRT-PCR.
- BGM aged was harvested, treated with L-WNT3A or L-PBS, then analyzed using Axin2 and Lef1 expression for its Wnt responsive status (Fig. 25C). Within 12h an elevation in Lef1 was detectable. Within 24h, both Axin2 and Lef1 were elevated (Fig. 25C). These analyses confirm a WNT-mediated activation state of BGM; hereafter refers to this material as BGM ACT .
- the transverse processes of the fourth and fifth lumbar (e.g., L4-5) vertebrae were decorticated (Fig. 25D) and during this procedure, autologous BGM aged from the iliac crest was harvested and treated with L-WNT3A (or L-PBS) for 1 h. The resulting material, BGM ACT (or BGM aged ) was then transplanted onto and between the L4-5 processes (Fig. 25E). On post-operation day 2 the volume of the BGM was evaluated by micro-CT. These analyses verified that BGM aged (Fig. 25F) and BGM ACT (Fig. 25G) contained comparable amounts of mineralized tissue at the outset (see also Fig. 26).
- Wnt3a secreting CHO suspension (CHO-S) cells could be also cultured under serum-free conditions in suitable expression media, such as expression media from Invitogen.
- suitable expression media such as expression media from Invitogen.
- a cGMP compatible CHO-S cells line, and two types of vectors to clone WNT3A were used.
- One vector was pOptivec, which is a TOPO® adapted bicistronic plasmid which allows rapid cloning of a gene containing a mammalian secretion signal and the gene of interest downstream of the CMV promoter. The dihydrofolate reductase selection markers allows for rapid selection.
- This vector was used for transient transfection of CHO-S cells.
- Another vector was pTargeT. This vector was used for transient transfection of CHO-S cells and also to create a stable cell line expressing WNT3A
- CM Conditioned media
- lipid components in serum are tested to determine whether they could be replaced with a defined set of lipids. Charcoal stripping removes non-polar lipophilic materials (viruses, growth factors, hormones) from serum. In comparison to control conditions where CHO cells are grown in 10% FBS, CHO cells grown in charcoal-stripped FBS do not secrete Wnt3a. These data support the conclusion that a lipophilic component of serum is required for Wnt3a secretion.
- Lipid Mixture 1 (Sigma) containing cholesterol, tocopherol, and non-animal derived fatty (inoleic, linolenic, myristic, oleic, palmitic and stearic) acids will improve CHO cell growth rate and will restore Wnt3a secretion to CHO cells.
- a sequential culturing as a means to reach a serum independent process for WNT3A production is also tested.
- CHO cell growth rate is reduced simultaneous with serum reduction; consequently, it is important to shift the time frame for the collection of conditioned media.
- cells are adapted to 0.5% FBS.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Biomedical Technology (AREA)
- Pharmacology & Pharmacy (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Cell Biology (AREA)
- Transplantation (AREA)
- Oral & Maxillofacial Surgery (AREA)
- Dermatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Developmental Biology & Embryology (AREA)
- Gastroenterology & Hepatology (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biotechnology (AREA)
- Hematology (AREA)
- Biochemistry (AREA)
- Dispersion Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Marine Sciences & Fisheries (AREA)
- Biophysics (AREA)
- Physical Education & Sports Medicine (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Wood Science & Technology (AREA)
- Vascular Medicine (AREA)
- Virology (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361885827P | 2013-10-02 | 2013-10-02 | |
| PCT/US2014/058833 WO2015051122A2 (en) | 2013-10-02 | 2014-10-02 | Wnt compositions and methods for purification |
Publications (3)
| Publication Number | Publication Date |
|---|---|
| EP3052121A2 true EP3052121A2 (en) | 2016-08-10 |
| EP3052121A4 EP3052121A4 (en) | 2017-04-05 |
| EP3052121B1 EP3052121B1 (en) | 2023-02-22 |
Family
ID=52779289
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP14851390.6A Active EP3052121B1 (en) | 2013-10-02 | 2014-10-02 | Wnt compositions and methods for purification |
Country Status (11)
| Country | Link |
|---|---|
| US (3) | US9937126B2 (en) |
| EP (1) | EP3052121B1 (en) |
| JP (2) | JP6559687B2 (en) |
| KR (1) | KR102392423B1 (en) |
| CN (2) | CN116445398A (en) |
| AU (2) | AU2014329547B2 (en) |
| CA (1) | CA2920313C (en) |
| GB (1) | GB2534315B (en) |
| IL (1) | IL244026B (en) |
| MX (1) | MX372810B (en) |
| WO (1) | WO2015051122A2 (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017132494A1 (en) * | 2016-01-28 | 2017-08-03 | The Board Of Trustees Of The Leland Stanford Junior University | Wnt compositions and methods for serum-free synthesis |
| WO2017142069A1 (en) * | 2016-02-18 | 2017-08-24 | 学校法人慶應義塾 | Cell culture medium, culture method, and organoid |
| KR102536879B1 (en) | 2016-07-19 | 2023-05-26 | 아셀라타 리미티드 | Culture medium for culturing pluripotent stem cells in suspension |
| KR101887432B1 (en) | 2016-10-17 | 2018-08-10 | 한림대학교 산학협력단 | Medicine for disease related with human cornea endothelial cell with Transcription factor 4 |
| CN111182880B (en) * | 2017-08-01 | 2024-01-09 | 安卡萨再生疗法公司 | WNT compositions and processes from serum-free culture conditions |
| US20250205286A1 (en) * | 2022-03-25 | 2025-06-26 | Vitro Biopharma, Inc. | Compositions, reagents, and methods for treating pitt-hopkins syndrome |
Family Cites Families (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4843155A (en) | 1987-11-19 | 1989-06-27 | Piotr Chomczynski | Product and process for isolating RNA |
| AU631377B2 (en) * | 1988-08-25 | 1992-11-26 | Liposome Company, Inc., The | Affinity associated vaccine |
| US5143854A (en) | 1989-06-07 | 1992-09-01 | Affymax Technologies N.V. | Large scale photolithographic solid phase synthesis of polypeptides and receptor binding screening thereof |
| US6040138A (en) | 1995-09-15 | 2000-03-21 | Affymetrix, Inc. | Expression monitoring by hybridization to high density oligonucleotide arrays |
| US5800992A (en) | 1989-06-07 | 1998-09-01 | Fodor; Stephen P.A. | Method of detecting nucleic acids |
| US5744101A (en) | 1989-06-07 | 1998-04-28 | Affymax Technologies N.V. | Photolabile nucleoside protecting groups |
| US5770358A (en) | 1991-09-18 | 1998-06-23 | Affymax Technologies N.V. | Tagged synthetic oligomer libraries |
| CA2124087C (en) | 1991-11-22 | 2002-10-01 | James L. Winkler | Combinatorial strategies for polymer synthesis |
| US5384261A (en) | 1991-11-22 | 1995-01-24 | Affymax Technologies N.V. | Very large scale immobilized polymer synthesis using mechanically directed flow paths |
| US5556752A (en) | 1994-10-24 | 1996-09-17 | Affymetrix, Inc. | Surface-bound, unimolecular, double-stranded DNA |
| US5545531A (en) | 1995-06-07 | 1996-08-13 | Affymax Technologies N.V. | Methods for making a device for concurrently processing multiple biological chip assays |
| US5854033A (en) | 1995-11-21 | 1998-12-29 | Yale University | Rolling circle replication reporter systems |
| EP0880598A4 (en) | 1996-01-23 | 2005-02-23 | Affymetrix Inc | Nucleic acid analysis techniques |
| DE69829402T2 (en) | 1997-10-31 | 2006-04-13 | Affymetrix, Inc. (a Delaware Corp.), Santa Clara | EXPRESSION PROFILES IN ADULTS AND FOLDS ORGANS |
| US6020135A (en) | 1998-03-27 | 2000-02-01 | Affymetrix, Inc. | P53-regulated genes |
| WO2004004687A2 (en) * | 2002-07-03 | 2004-01-15 | Aphton Corporation | Liposomal vaccine |
| AU2003298738A1 (en) * | 2002-11-26 | 2004-06-18 | Su-Ming Chiang | Liposomal formulations |
| WO2004091647A1 (en) | 2003-04-07 | 2004-10-28 | The Board Of Trustees Of The Leland Stanford Junior University | Compositions of active wnt protein |
| JP4500203B2 (en) | 2004-04-30 | 2010-07-14 | 株式会社ワイビーエム | Ground drilling device |
| EP2134352A4 (en) * | 2007-03-05 | 2011-05-25 | Univ Leland Stanford Junior | WNT COMPOSITIONS AND METHODS FOR THEIR USE |
| AR076634A1 (en) * | 2008-11-21 | 2011-06-29 | Medgenesis Therapeutix Inc | COMPOSITIONS AND METHOD TO TREAT CENTRAL NERVOUS SYSTEM DISORDERS |
| EA020604B1 (en) * | 2008-12-17 | 2014-12-30 | Онкотиреон, Инк. | Composition containing small liposomes and method for preparation thereof |
| US8809272B2 (en) | 2010-09-09 | 2014-08-19 | The Board Of Trustees Of The Leland Stanford Junior University | Use of liposomal Wnt composition to enhance osseointegration |
| AU2012205583B2 (en) | 2011-01-11 | 2016-01-21 | Fate Therapeutics, Inc. | Novel Wnt compositions and therapeutic uses of such compositions |
| US20130149741A1 (en) * | 2011-06-29 | 2013-06-13 | Salk Institute For Biological Studies | Methods for improved production of bioactive wnt proteins |
| JP2014527818A (en) * | 2011-09-16 | 2014-10-23 | フェイト セラピューティクス,インコーポレイテッド | Wnt compositions and therapeutic uses of such compositions |
| EP2976044A4 (en) * | 2013-03-21 | 2016-11-23 | Univ Columbia | COMPOSITIONS AND METHODS FOR PROMOTING REGENERATION OF DENTAL TISSUE |
| NL2011170C2 (en) | 2013-07-15 | 2015-01-21 | Univ Erasmus Medical Ct | Method and culture medium for in vitro culturing of stem cells. |
-
2014
- 2014-10-02 MX MX2016001821A patent/MX372810B/en active IP Right Grant
- 2014-10-02 KR KR1020167006665A patent/KR102392423B1/en not_active Expired - Fee Related
- 2014-10-02 CA CA2920313A patent/CA2920313C/en active Active
- 2014-10-02 WO PCT/US2014/058833 patent/WO2015051122A2/en not_active Ceased
- 2014-10-02 GB GB1604725.0A patent/GB2534315B/en not_active Expired - Fee Related
- 2014-10-02 EP EP14851390.6A patent/EP3052121B1/en active Active
- 2014-10-02 JP JP2016546882A patent/JP6559687B2/en not_active Expired - Fee Related
- 2014-10-02 AU AU2014329547A patent/AU2014329547B2/en not_active Ceased
- 2014-10-02 US US14/910,616 patent/US9937126B2/en active Active
- 2014-10-02 CN CN202310072821.5A patent/CN116445398A/en active Pending
- 2014-10-02 CN CN201480051425.3A patent/CN105555297A/en active Pending
-
2016
- 2016-02-08 IL IL244026A patent/IL244026B/en active IP Right Grant
-
2018
- 2018-02-27 US US15/906,438 patent/US10813884B2/en active Active
-
2019
- 2019-07-17 JP JP2019131882A patent/JP6910078B2/en not_active Expired - Fee Related
- 2019-07-24 AU AU2019208196A patent/AU2019208196B2/en not_active Ceased
-
2020
- 2020-09-22 US US17/028,648 patent/US11957787B2/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| JP6559687B2 (en) | 2019-08-14 |
| GB2534315B (en) | 2020-08-05 |
| IL244026A0 (en) | 2016-04-21 |
| GB2534315A (en) | 2016-07-20 |
| KR20160063326A (en) | 2016-06-03 |
| JP6910078B2 (en) | 2021-07-28 |
| WO2015051122A3 (en) | 2015-06-04 |
| US20180193264A1 (en) | 2018-07-12 |
| CA2920313C (en) | 2024-02-13 |
| EP3052121A4 (en) | 2017-04-05 |
| IL244026B (en) | 2019-05-30 |
| JP2017501207A (en) | 2017-01-12 |
| MX2016001821A (en) | 2016-05-24 |
| CA2920313A1 (en) | 2015-04-09 |
| AU2014329547B2 (en) | 2019-05-16 |
| MX372810B (en) | 2020-07-03 |
| AU2019208196B2 (en) | 2021-08-05 |
| AU2019208196A1 (en) | 2019-08-08 |
| US20210007987A1 (en) | 2021-01-14 |
| CN105555297A (en) | 2016-05-04 |
| WO2015051122A2 (en) | 2015-04-09 |
| EP3052121B1 (en) | 2023-02-22 |
| US20160310424A1 (en) | 2016-10-27 |
| US9937126B2 (en) | 2018-04-10 |
| CN116445398A (en) | 2023-07-18 |
| KR102392423B1 (en) | 2022-05-02 |
| AU2014329547A1 (en) | 2016-02-18 |
| US11957787B2 (en) | 2024-04-16 |
| GB201604725D0 (en) | 2016-05-04 |
| JP2019206551A (en) | 2019-12-05 |
| US10813884B2 (en) | 2020-10-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11957787B2 (en) | Wnt compositions and methods for purification | |
| Scheiber et al. | Endoplasmic reticulum stress is induced in growth plate hypertrophic chondrocytes in G610C mouse model of osteogenesis imperfecta | |
| BR112013003587B1 (en) | ENGINEERED OSTEOGENIC PROTEINS, THEIR USES, THEIR METHOD OF PRODUCTION AND ISOLATED NUCLEIC ACID MOLECULE | |
| US20220325238A1 (en) | Wnt compositions and methods for serum-free synthesis | |
| AU2019222935B2 (en) | Enhancement of osteogenic potential of bone grafts | |
| US20020151486A1 (en) | Osteoactivin protein and nucleic acids encoding the same, compositions and methods of stimulating bone differentiation | |
| Ehring et al. | Two-way Dispatched function in Sonic hedgehog shedding and transfer to high-density lipoproteins | |
| WO2011077086A2 (en) | Agents having tissue generative activity | |
| Cressman | Investigating Mechanisms of Impaired Mineralization Due to Deficient Spermine Synthase Activity | |
| KR20260060365A (en) | Method of using brain-derived osteomorphic factor CCN3 for the treatment of bone and cartilage degeneration | |
| Teng | Mineralized tissue engineering, stem cell therapies and proteomics approaches | |
| Javanmardi | Doctor of Medical Science | |
| Abuhantash | Comprehensive Proteomic Analysis of Mesenchymal Stem Cells-and Osteoblasts-derived Extracellular Vesicles of Osteogenesis Imperfecta Patients | |
| Villa | Biochemical characterization of matrix Gla protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20160321 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| AX | Request for extension of the european patent |
Extension state: BA ME |
|
| DAX | Request for extension of the european patent (deleted) | ||
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20170308 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: A61K 9/127 20060101ALI20170302BHEP Ipc: A61K 38/17 20060101AFI20170302BHEP Ipc: A61P 19/08 20060101ALI20170302BHEP |
|
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIO |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: EXAMINATION IS IN PROGRESS |
|
| 17Q | First examination report despatched |
Effective date: 20191119 |
|
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R079 Ref document number: 602014086292 Country of ref document: DE Free format text: PREVIOUS MAIN CLASS: A61K0038190000 Ipc: A61P0019000000 |
|
| GRAP | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOSNIGR1 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: A61P 19/08 20060101ALI20210129BHEP Ipc: A61P 43/00 20060101ALI20210129BHEP Ipc: A61K 38/17 20060101ALI20210129BHEP Ipc: A61P 19/00 20060101AFI20210129BHEP Ipc: A61K 9/127 20060101ALI20210129BHEP |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: GRANT OF PATENT IS INTENDED |
|
| INTG | Intention to grant announced |
Effective date: 20210311 |
|
| GRAJ | Information related to disapproval of communication of intention to grant by the applicant or resumption of examination proceedings by the epo deleted |
Free format text: ORIGINAL CODE: EPIDOSDIGR1 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: EXAMINATION IS IN PROGRESS |
|
| INTC | Intention to grant announced (deleted) | ||
| GRAP | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOSNIGR1 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: GRANT OF PATENT IS INTENDED |
|
| INTG | Intention to grant announced |
Effective date: 20210906 |
|
| GRAJ | Information related to disapproval of communication of intention to grant by the applicant or resumption of examination proceedings by the epo deleted |
Free format text: ORIGINAL CODE: EPIDOSDIGR1 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: EXAMINATION IS IN PROGRESS |
|
| GRAP | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOSNIGR1 |
|
| INTC | Intention to grant announced (deleted) | ||
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: GRANT OF PATENT IS INTENDED |
|
| INTG | Intention to grant announced |
Effective date: 20220224 |
|
| GRAJ | Information related to disapproval of communication of intention to grant by the applicant or resumption of examination proceedings by the epo deleted |
Free format text: ORIGINAL CODE: EPIDOSDIGR1 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: EXAMINATION IS IN PROGRESS |
|
| INTC | Intention to grant announced (deleted) | ||
| GRAP | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOSNIGR1 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: GRANT OF PATENT IS INTENDED |
|
| INTG | Intention to grant announced |
Effective date: 20220831 |
|
| GRAS | Grant fee paid |
Free format text: ORIGINAL CODE: EPIDOSNIGR3 |
|
| GRAA | (expected) grant |
Free format text: ORIGINAL CODE: 0009210 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE PATENT HAS BEEN GRANTED |
|
| AK | Designated contracting states |
Kind code of ref document: B1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| REG | Reference to a national code |
Ref country code: GB Ref legal event code: FG4D |
|
| REG | Reference to a national code |
Ref country code: CH Ref legal event code: EP |
|
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R096 Ref document number: 602014086292 Country of ref document: DE |
|
| REG | Reference to a national code |
Ref country code: AT Ref legal event code: REF Ref document number: 1549135 Country of ref document: AT Kind code of ref document: T Effective date: 20230315 Ref country code: IE Ref legal event code: FG4D |
|
| REG | Reference to a national code |
Ref country code: LT Ref legal event code: MG9D |
|
| REG | Reference to a national code |
Ref country code: NL Ref legal event code: MP Effective date: 20230222 |
|
| P01 | Opt-out of the competence of the unified patent court (upc) registered |
Effective date: 20230525 |
|
| REG | Reference to a national code |
Ref country code: AT Ref legal event code: MK05 Ref document number: 1549135 Country of ref document: AT Kind code of ref document: T Effective date: 20230222 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: RS Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 Ref country code: PT Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230622 Ref country code: NO Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230522 Ref country code: NL Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 Ref country code: LV Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 Ref country code: LT Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 Ref country code: HR Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 Ref country code: ES Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 Ref country code: AT Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: SE Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 Ref country code: PL Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 Ref country code: IS Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230622 Ref country code: GR Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230523 Ref country code: FI Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: SM Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 Ref country code: RO Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 Ref country code: EE Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 Ref country code: DK Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 Ref country code: CZ Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: GB Payment date: 20230914 Year of fee payment: 10 |
|
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R097 Ref document number: 602014086292 Country of ref document: DE |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: SK Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: FR Payment date: 20230921 Year of fee payment: 10 |
|
| PLBE | No opposition filed within time limit |
Free format text: ORIGINAL CODE: 0009261 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT |
|
| 26N | No opposition filed |
Effective date: 20231123 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: SI Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: DE Payment date: 20230912 Year of fee payment: 10 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: IT Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 Ref country code: MC Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 |
|
| REG | Reference to a national code |
Ref country code: CH Ref legal event code: PL |
|
| REG | Reference to a national code |
Ref country code: BE Ref legal event code: MM Effective date: 20231031 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: LU Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20231002 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: LU Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20231002 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: CH Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20231031 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: CH Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20231031 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: BE Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20231031 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: IE Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20231002 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: IE Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20231002 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: BG Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: BG Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 |
|
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R119 Ref document number: 602014086292 Country of ref document: DE |
|
| GBPC | Gb: european patent ceased through non-payment of renewal fee |
Effective date: 20241002 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: DE Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20250501 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: GB Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20241002 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: FR Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20241031 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: CY Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT; INVALID AB INITIO Effective date: 20141002 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: HU Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT; INVALID AB INITIO Effective date: 20141002 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: TR Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230222 |