EP3004165A1 - Kir3dl2 is a biomarker and a therapeutic target useful for respectively preventing and treating a subset of cutaneous and non-cutaneous peripheral t-cell lymphomas - Google Patents

Kir3dl2 is a biomarker and a therapeutic target useful for respectively preventing and treating a subset of cutaneous and non-cutaneous peripheral t-cell lymphomas

Info

Publication number
EP3004165A1
EP3004165A1 EP14732966.8A EP14732966A EP3004165A1 EP 3004165 A1 EP3004165 A1 EP 3004165A1 EP 14732966 A EP14732966 A EP 14732966A EP 3004165 A1 EP3004165 A1 EP 3004165A1
Authority
EP
European Patent Office
Prior art keywords
kir3dl2
lymphoma
cell lymphoma
cell
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP14732966.8A
Other languages
German (de)
French (fr)
Inventor
Philippe GAULARD
Nicolas Ortonne
Anne Marie-Cardine
Armand Bensussan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Assistance Publique Hopitaux de Paris APHP
Institut National de la Sante et de la Recherche Medicale INSERM
Universite Paris Diderot Paris 7
Universite Paris Est Creteil Val de Marne
Original Assignee
Assistance Publique Hopitaux de Paris APHP
Institut National de la Sante et de la Recherche Medicale INSERM
Universite Paris Diderot Paris 7
Universite Paris Est Creteil Val de Marne
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Assistance Publique Hopitaux de Paris APHP, Institut National de la Sante et de la Recherche Medicale INSERM, Universite Paris Diderot Paris 7, Universite Paris Est Creteil Val de Marne filed Critical Assistance Publique Hopitaux de Paris APHP
Priority to EP14732966.8A priority Critical patent/EP3004165A1/en
Priority claimed from PCT/IB2014/061786 external-priority patent/WO2014191936A1/en
Publication of EP3004165A1 publication Critical patent/EP3004165A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation

Definitions

  • KIR3DL2 IS A BIOMARKER AND A THERAPEUTIC TARGET USEFUL FOR RESPECTIVELY PREVENTING AND TREATING A SUBSET OF CUTANEOUS AND NON-CUTANEOUS PERIPHERAL T-CELL LYMPHOMAS FIELD OF THE INVENTION
  • the present invention relates to the field of diagnosis or therapeutic treatment of T-cell lymphomas.
  • PTCLs Peripheral T-cell lymphomas
  • PTCLs Today, the World Health Organization recognizes several subtypes of PTCLs, as registered at the International Classification of Diseases for Oncology (ICDO, 3 rd Edition), such as (i) disseminated lymphomas; (ii) cutaneous lymphomas; (iii) nodal non-cutaneous lymphomas; and (iv) extra nodal non-cutaneous lymphomas.
  • ICDO International Classification of Diseases for Oncology
  • Sezary syndrome presents an aggressive clinical behaviour, with widespread skin involvement, resulting in an erythroderma, enlarged lymph nodes and the presence of a significant number of malignant lymphocytes, called Sezary cells.
  • Sezary cells Oppositely, mycosis fungoides presents an indolent clinical behaviour but in about 10% of patients, the disease progresses to a large T-cell lymphoma ("transformed mycosis fungoides") resulting in large skin, often ulcerated, skin tumours, sometimes with lymph nodes or internal organs involvement.
  • these approaches comprise: drug therapy and chemotherapy, including topical corticosteroids, imiquimod, retinoids bexarotene, interferon-alpha, histone deacetylase inhibitors (HDACi, such as vorinostat and romidepsin), oral methotrexate, denileukin diftitox (an antineoplastic agent, combining Interleukin-2 and diphtheria toxin), proteasome inhibitors, immunomodulatory agents (lenalidomide) ; phototherapy, including UVB phototherapy ; - photodynamic therapy, including psoralen+ ultraviolet A (PUVA) ; radiotherapy ; - total skin electron beam (TSEB) ; extracorporeal photopheresis (ECP) ; autologous stem cell transplantation ; - allogenic stem cell transplantation.
  • drug therapy and chemotherapy including topical corticosteroids, imiquimod, retinoids bexarotene, interferon-alpha, histone deacetylase
  • alemtuzumab a monoclonal antibody directed towards CD52, a peptide found at the surface of mature lymphocytes, monocytes and dendritic cells.
  • KIR3DL2 should be considered as a relevant biomarker for Sezary syndrome and transformed mycosis fungoides.
  • KIR3DL2 was also found in the art to be down-regulated in Sezary cells, when assessed by measuring the level of KIR3DL2 mRNA by quantitative RT-PCR (see WO 2007/071829).
  • ezary syndrome is a unique cutaneous T-cell lymphoma as identified by an expanded gene signature including diagnostic marker molecules CDOl and DNM3.
  • Leukemia. 2008 (22), 393-399) reported that KIR3DL2 is only expressed in a subpopulation of patient having a Sezary syndrome.
  • KIR3DL2 Molecular signature to improve diagnosis in peripheral T-cell lymphoma and prognostication in angioimmunoblastic T-cell lymphoma; Blood, 2010, 115(5): 1026-36) reported KIR3DL2 as a putative biomarker for a subset of PTCL "not otherwise specified" (PTCL/NOS), but remained silent about the cutaneous lymphoma, such as Sezary syndrome and transformed mycosis fungoides.
  • Nebozhyn et al. Quantitative PCR on 5 genes reliably identifies CTCL patients with 5% to 99% circulating tumor cells with 90% accuracy.
  • Blood. 2006 Apr 15; 107(8):3189-96 suggested a set of 5 reliable biomarkers, i.e. STAT4, GATA-3, PLS3, CD ID, and TRAIL, hence discarding KIR3DL2 from being a valuable biomarker for the diagnosis of Sezary syndrome.
  • KIR3DL2 was also found to be overexpressed at the surface of some T-cells from patient having been diagnosed with adult T-cell leukaemia (ATCL), as disclosed in Obama et al. (Killer cell immunoglobulin-like receptor/3DL2 expression in adult T-cell leukaemia. Br J Haematol. 2007 Sep; 138(5):666-7). However, according to this study, KIR3DL2 is believed not to be a highly specific biomarker for ATCL.
  • Killer immunoglobulin-like receptors represent a family of receptors that are used by human Natural Killer (NK) cells and T-lymphocyte subsets to specifically recognize MHC class I molecules.
  • KIR3DL2 belongs to the KIR receptor family displaying 3 immunoglobulin-like domains and a long cytoplasmic tail.
  • KIR3DL2 has been reported to be a candidate for target therapy, since a monoclonal antibody that binds to KIR3DL2 is able to induce an antibody-dependent cellular cytotoxicity (ADCC) against malignant T-cells expressing KIR3DL2 (WO 2010/081890).
  • ADCC antibody-dependent cellular cytotoxicity
  • the invention describes a ligand molecule, that specifically binds to KTR3DL2 for the prevention and/or the treatment of a KIR3DL2 expressing malignant T- cells lymphoma selected from the group comprising Sezary syndrome, transformed mycosis fungoides, sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T- cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • a KIR3DL2 expressing malignant T- cells lymphoma selected from the group comprising Sezary syndrome, transformed mycosis fungoides, sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T- cell lymphoma, adult T-cell le
  • the invention relates to a ligand molecule, that specifically binds to KTR3DL2 for the prevention and/or the treatment of a KIR3DL2 expressing malignant T- cells lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T- cell lymphoma.
  • the present invention describes a pharmaceutical composition
  • a pharmaceutical composition comprising a ligand molecule as defined in the present invention and a pharmaceutically acceptable carrier for the prevention and/or the treatment of a KIR3DL2 expressing malignant T-cells lymphoma selected from the group comprising Sezary syndrome, transformed mycosis fungoides, sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy- associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma- delta T-cell lymphoma.
  • a KIR3DL2 expressing malignant T-cells lymphoma selected from the group comprising Sezary syndrome, transformed mycosis fungoides, sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a ligand molecule as defined in the present invention and a pharmaceutically acceptable carrier for the prevention and/or the treatment of a KIR3DL2 expressing malignant T-cells lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T- cell lymphoma.
  • Another aspect of the invention describes a method for a treating KIR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a ligand molecule that specifically binds to KTR3DL2, wherein said lymphoma is selected from the group comprising transformed mycosis fungoides, subcutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • Another aspect of the invention retates to a method for a treating KTR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a ligand molecule that specifically binds to KIR3DL2, wherein said lymphoma is selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T- cell lymphoma.
  • a method for treating a KIR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof comprising administering to said individual a pharmaceutical composition comprising a ligand molecule that specifically binds to KIR3DL2, and a pharmaceutically acceptable carrier, wherein said lymphoma is selected from the group comprising transformed mycosis fungoides, sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma, preferably sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy- associated T-cell lymphoma and hepatosplenic gamm
  • a still further aspect of the invention relates to an in vitro use of a level of expression of KIR3DL2 as a biomarker for diagnosing and/or monitoring a lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T- cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • the invention in another aspect, relates to an in vitro method for diagnosing and/or monitoring a lymphoma in an individual comprising at least a step of quantifying the level of expression of KTR3DL2, said lymphoma being selected from the group comprising subcutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • the invention also relates to a method for monitoring the effectiveness of treatment against a lymphoma, in an individual in need thereof, with a therapeutic agent, said method comprising the steps of:
  • lymphoma is selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • the present invention relates to a method for monitoring the effectiveness of treatment against a lymphoma, in an individual in need thereof, with a therapeutic agent, said method comprising the steps of: (i) providing a pre-administration biological sample from an individual prior to administration of the therapeutic agent;
  • lymphoma is selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, and hepatosplenic gamma-delta T-cell lymphoma.
  • the invention also relates to a method for adapting a treatment against a lymphoma in an individual in need thereof, wherein said method comprises at least the steps of :
  • lymphoma is selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • Another aspect of the invention relates to a method for screening a compound candidate that affects KIR3DL2 expression level, said method comprising the step of:
  • step c) measuring the KIR3DL2 expression level by the KIR3DL2 expressing at least one T-cell of step c), whereby a second KTR3DL2 expression value is obtained; e) comparing the said first KIR3DL2 expression value with the said second KTR3DL2 expression value;
  • a further aspect of the present invention relates to a method for the screening of a candidate compound that affects KTR3DL2 biological activity, said method comprising the step of:
  • step b) incubating KIR3DL2 expressing T-cell with a candidate compound to be tested; d) measuring the KTR3DL2 biological activity in the KTR3DL2 expressing T-cell obtained at the end of step b), whereby a second activity value is obtained;
  • kits for diagnosing and/or monitoring a lymphoma in an individual which kit comprises means for quantifying the level of expression of KTR3DL2 or the levels of expression of KIR3DL1 and KIR3DL2, said lymphoma being selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T- cell lymphoma.
  • the invention has for advantages to provide a simple, cost-effective, and reliable assay to diagnose and/or monitor a subset of cutaneous lymphomas and nodal and extra nodal non- cutaneous lymphomas. According to another of its advantages, the invention allows for monitoring a therapeutic treatment presumed effective for preventing and/or treating a subset of cutaneous lymphomas and nodal and extra nodal non-cutaneous lymphomas or for screening drug candidate presumed effective for preventing and/or treating a subset of cutaneous lymphomas and nodal and extra nodal non-cutaneous lymphomas.
  • Figure 1 KIR3DL2 protein expression in tissue samples of a subset of cutaneous PTCL.
  • the inventors assume that the labelling obtained with antibodies from the 5.133 clone (Miltenyi-Biotec), that specifically react with both KIR3DL2 and KIR3DL1, actually identified KIR3DL2 as RT-PCR studies showed no or a very low expression of KIR3DL1 transcripts, as compared to KIR3DL2.
  • CTCL Primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma
  • TCL Sub-cutaneous 'panniculitis-like' T-cell lymphoma
  • Figure 2 KIR3DL2 expression in tissue samples of a subset of non-cutaneous PTCL.
  • Peripheral T-cell lymphoma not otherwise specified (PTCL/NOS) showed no significant expression of KIR3DL2, with only scattered positive cells, that may correspond to reactive CD8+ effector T-cells and/or natural killer cells (arrowheads).
  • Enteropathy-associated T-cell lymphoma showed a diffuse and strong KIR3DL2 positivity.
  • An intra-tumoral vessel is seen (V), showing labelling neither in the endothelium (arrow) nor in the pericytes.
  • Hepatosplenic T-cell lymphoma displayed a diffuse expression of KTR3DL2.
  • FIG. 3 KIR3DL2 transcript expression in hepatosplenic T-cell lymphomas (HSTL).
  • Figure 4 Down-modulation of KTR3DL2 expression on tumoral Sezary cells upon CpG ODN-C treatment.
  • PBMC Peripheral blood mononuclear cells
  • CpG ODN-C 10 g/ml
  • AZ158 mAb 2 ⁇
  • cells were labelled with anti-KIR3DL2 mAb (Q66) plus FITC-conjugated goat anti-mouse IgM secondary antibodies, anti-TCRV-PE, -CD3-PC5 and CD4-PC7 mAbs. Shown are the TCRV B/KIR3DL2 stainings corresponding to the gated CD3+CD4+ T lymphocyte population. The mean fluorescence intensity (MFI) of KIR3DL2 labelling is indicated.
  • MFI mean fluorescence intensity
  • PBMC from Sezary patient were pre-loaded with carboxyfluorescein succinimidyl ester (CFSE) and further left untreated or incubated with anti-CD3 mAb, AZ158 mAb or CpG ODN-C alone or in combination, as indicated. After 4 days of culture, cells were collected and subjected to flow cytometry analyses. Shown are the CFSE staining of the gated TCRV 3+ CD4+ tumoral T cell clone.
  • CFSE carboxyfluorescein succinimidyl ester
  • FIG. 7 CpG ODN-C treatment of Sezary cells results in STAT3 dephosphorylation.
  • Figure 8 GpC ODN treatment of Sezary cells results in apoptosis.
  • PBMCs from a Sezary patient were incubated without any oligonucleotide (curve 1) or with CpG ODN-C (curve 2), GpC (curve 3) or control ODN (curve 4) for 7 days at
  • PBMCs from a Sezary patient were incubated with CpG ODN-C, GpC or control ODN for 7 days at 37°C. Stainings for the detection of apoptotic TCRVB1+ CD4+ tumoral T cells, i.e. early (7AADlow) and late (7AADhigh) apoptotic cells, were performed as previously described (see Figure 5B).
  • C Percentages of early (7AADlow) and late (7AADhigh) apoptotic cells from (B) are plotted for each type of treatment.
  • the present invention relies upon the findings that KIR3DL2 is found to be overexpressed at the surface of T-cells from several individuals having a cutaneous PTCL such as Sezary syndrome, transformed mycosis fungoides and adult T-cell leukaemia/lymphoma as well as, most surprisingly, a subset of both cutaneous and non-cutaneous nodal and extra nodal lymphomas.
  • KIR3DL2 could be identified, for the first time, as a relevant and specific biomarker for two cutaneous PTCLs, such as sub-cutaneous panniculitis-like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T- cell lymphoma, and two non-cutaneous PTCLs, namely enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • KIR3DL2 could not be identified as a significant, relevant and specific biomarker for some cutaneous PTCLs, such as primary cutaneous CD30+ T-cell lymphoproliferative disorders, and for some non-cutaneous PTCLs, such as angioimmunoblastic T-cell lymphoma, anaplastic large cell lymphomas, both ALK negative and ALK positive, extranodal K/T cell lymphomas nasal type and peripheral T- cell lymphomas not otherwise specified.
  • KIR3DL2 has revealed to consist of a relevant biomarker for diagnosing and/or monitoring these specific lymphomas, as well as an advantageous biomarker for providing a first screen of a defined subset of both cutaneous and non-cutaneous PTCL diseases.
  • cutaneous PTCLs other than Sezary syndrome or transformed mycosis fungoides, which were discussed above, may be distinguished as follows: primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphomas are aggressive T-cell type lymphomas featured by localized or disseminated eruptive papules, nodules or tumors that show central ulceration and necrosis or superficial, hyperkeratotic patches and plaques;
  • sub-cutaneous panniculitis-like T-cell lymphomas represent rare forms of indolent T-cell lymphomas; patients are often seen with solitary or multiple nodules and plaques, usually involving the legs; ulceration of the nodules and plaques are rather not common.
  • cutaneous PTCLs one may distinguish: adult T-cell leukaemias/lymphomas are associated with the human T-cell leukaemia virus- 1, which may be transmitted during unprotected sexual activity, childbirth, breast feeding, blood transfusion; usually their prognosis is poor;
  • anaplastic large cell non cutaneous lymphomas are rare lymphomas, affecting mainly nodal sites; they are subdivided as ALK negative and ALK positive lymphomas, depending on, respectively, the absence or the presence of a protein called "anaplastic lymphoma kinase" (ALK); ALK negative patients usually require more aggressive treatment, whereas ALK positive patients are much responsive to chemotherapy;
  • angioimmunoblastic T-cell lymphomas are common PTCLs and present an aggressive course; they affect mainly lymph nodes, and may affect the skin, the liver or the spleen;
  • enteropathy-associated T-cell lymphomas are significantly associated with celiac disease, caused by a hypersensitivity to gluten; they are characterized by stomach pain, weight loss, gastrointestinal bleeding or bowel perforation;
  • extranodal K/T cell lymphomas are affecting the nasal and the paranasal sinus areas behind the nose and the cheeks, and may affect also the skin, the gastrointestinal tract and testes; these lymphomas are associated with the Epstein-Barr virus;
  • hepatosplenic gamma-delta T-cell lymphomas are rare and aggressive diseases that originate from the liver or the spleen;
  • peripheral T-cell lymphomas are the most common
  • PTCLs and comprise various aggressive T-cell lymphomas that cannot be encompassed by the other subcategories of PTCLs; most patients are affected at nodal sites, although extranodal sites may be also affected, such as the bone marrow, the liver, the gastrointestinal tract or the skin.
  • Frozen skin samples of patient with a cutaneous PTCL such as Sezary syndrome; transformed mycosis fungoides; primary cutaneous CD30+ T-cell lymphoproliferative disorder (cutaneous anaplastic large cell lymphoma and lymphomatoid papulosis); subcutaneous panniculitis-like T-cell lymphoma; primary cutaneous nasal-type K/T-cell lymphoma ; and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma were assessed for KTR3DL2 overexpression at the surface of T-cells.
  • a cutaneous PTCL such as Sezary syndrome
  • transformed mycosis fungoides such as Sezary syndrome
  • primary cutaneous CD30+ T-cell lymphoproliferative disorder cutaneous anaplastic large cell lymphoma and lymphomatoid papulosis
  • subcutaneous panniculitis-like T-cell lymphoma primary cutaneous nasal-type K/T-cell lymphoma
  • Tissue sample obtained from patients with a nodal or extra nodal non-cutaneous PTCL such as angioimmunoblastic T-cell lymphoma (AITL); anaplastic large cell lymphoma, ALK negative; anaplastic large cell lymphoma, ALK positive; enteropathy-associated T- cell lymphoma (EATL); adult T-cell leukaemia/lymphoma (ATLL); extra nodal K/T cell lymphomas nasal-type; hepatosplenic gamma-delta T-cell lymphomas (HSTL); and peripheral T-cell lymphoma, not otherwise specified (PTCL/NOS) were also assessed for KTR3DL2 overexpression at the surface of T-cells.
  • AITL angioimmunoblastic T-cell lymphoma
  • ALK negative anaplastic large cell lymphoma
  • ALK positive enteropathy-associated T- cell lymphoma
  • ATLL adult T-cell leukaemia/lymphoma
  • T-cells obtained from all 7 Sezary syndrome patients expressed KIR3DL2 at the surface of T-cells (see EXAMPLE 1).
  • cutaneous malignant T cells lymphomas sub-cutaneous panniculitis-like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma were shown expressing KIR3DL2. Moreover, both enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma were shown to represent two non-cutaneous KIR3DL2 expressing malignant T cells lymphomas.
  • KIR3DL2 expression as a biomarker
  • a first aspect of the present invention relates to an in vitro use of a level of expression of KIR3DL2 as a biomarker for diagnosing and/or monitoring a lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, and hepatosplenic gamma-delta T-cell lymphoma.
  • a further aspect of the invention relates to an in vitro use of a ratio of levels of expression of KIR3DL2/KIR3DL1 as a biomarker for diagnosing and/or monitoring a lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, and hepatosplenic gamma-delta T-cell lymphoma.
  • a lymphoma is a cutaneous KIR3DL2 expressing malignant T cells lymphoma being selected from the group comprising sub-cutaneous panniculitis- like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma.
  • a lymphoma is a non-cutaneous KIR3DL2 expressing malignant T cells lymphoma being selected from the group comprising enteropathy- associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • a ratio of levels of expression of KIR3DL2/KIR3DL1 encompasses both (i) a value of the ratio between the measured expression level of KIR3DL2 and the measured expression level of KTR3DL1 and (ii) a value of the ratio between the measured expression level of KTR3DL1 and the measured expression level of KIR3DL2.
  • a ratio of levels of expression of KIR3DL2/KTR3DL1 consists of a value of the ratio between the measured expression level of KIR3DL2 and the measured expression level of KIR3DL1.
  • KTR3DL2 is also known as CD158k and KAT4 gene, or CD158k/KIR3DL2.
  • KIR3DL1 is also known as CD158e, NKB 1, NKAT3 and AMB11, or CD158e/KIR3DLl .
  • CD158e NKB 1
  • NKAT3 and AMB11 CD158e/KIR3DLl
  • KIR3DL1 and KIR3DL2 both refer to the internationally recognized names of the corresponding genes, and proteins in the sequences databases, including the database from the HUGO (Human Genome Organisation) Gene Nomenclature Committee (available notably at http://www.gene.ucl.ac.uk/nomenclature/index.html).
  • KIR3DL1 was poorly synthesized in T-cells, when mRNA analyses were conducted in healthy individuals and in individuals having a PTCL. A ratio between the respective expression levels of KIR3DL2 and KIR3DL1 thus provides a value that can be directly compared from one individual to another.
  • the levels of expression of KIR3DL1 and KIR3DL2 are advantageously quantified by measuring the level of mRNA expression.
  • Any method for measuring the mRNA expression known from the skilled artisan is suitable for implementing the present invention, which includes the well-known RT-PCR method using a specific pair of primers for each target marker.
  • the levels of expression of KIR3DL1 and KIR3DL2 are quantified by measuring the level of cellular protein expression, preferably the level of protein surface expression.
  • the use according to the present invention further comprises measuring the expression levels of a combination of biomarkers, namely KIR3DL2 and one or more additional biomarkers known to be associated with the said cutaneous lymphomas and the nodal and extra nodal non-cutaneous lymphomas that are within the scope of the present invention.
  • the said one or more additional biomarkers encompass, but are not limited to, the surface membrane complex CD3, the surface membrane proteins CD8, CD30, CD56 and PD1, the CXCL13 chemokine and the cytotoxic proteins granzyme B (GrB) and T-cell intracellular antigen (TiAl), together with the EBV (Epstein-Barr virus) specific EBER (EBV-encoded RNA) transcripts.
  • the level of cellular protein expression may be performed notably (i) by measuring the amount of the said protein contained in a whole cell sample or (ii) by measuring the amount of the said protein that is present at the cell surface, preferably at the T-cell surface.
  • Measuring the amount of a protein marker of interest contained in a whole cell sample may be performed by Western blotting starting from the soluble fraction of a cell lysate and using an antibody directed against the said protein marker of interest, according to methods that are well known by the one skilled in the art.
  • each biomarker of interest including the expression values of each of KTR3DL2 and KTR3DL1
  • the expression value of a biomarker of interest may be expressed as a ratio between (i) the measured expression value of the said biomarker (e.g. KTR3DL2 or KIR3DL1) and (ii) the measured expression value of a gene whose expression level is constant, such as the expression value of CD36.
  • Measuring the amount of a protein marker of interest that is present at the cell surface may be performed by immunochemistry, either by immuno-labelling of fixed cells or by flow immunocytometry, according to methods that are well known by the skilled person in the art.
  • quantifying the selected markers according to the in vitro diagnosis method described herein encompasses those wherein:
  • the selected markers are quantified by immunochemical methods, which include quantification of one or more protein markers of interest by immunodetection methods, for example using antibodies directed specifically against each of the said one or more protein markers, according to well-known immuno-detection methods, for example flow cytometry, and
  • the selected markers are quantified by gene expression analysis, which include quantification of one or more marker mRNAs of interest, for example by performing a Real-Time PCR Taqman PCR analysis. Marker quanti fication by measuring the level of mRNA expression
  • the said markers are quantified by measuring the level of mRNA expression.
  • the KIR3DL2 marker and KIR3DL1 expression may be measured by performing the well-known quantitative real-time PCR (RT-PCR) amplification technique, wherein primers specific for each of the genes KIR3DL2 and KIR3DL1 are used.
  • RT-PCR quantitative real-time PCR
  • the level of mRNA expression for each of the markers tested is performed using the well-known technique of RT-PCR, then forming complexes between the double-stranded nucleic acids resulting from amplification and fluorescent SYBR® molecules and then by measuring the fluorescence signal generated by the SYBR® molecules complexed with the said amplified nucleic acids.
  • Primers specific for each of the genes mRNA consists of a routine work for the one skilled in the art. Illustratively, the one skilled in the art may use the specific primers for each of KIR3DL2 and KTR3DL1 that are disclosed in the examples herein.
  • quantification of KIR3DL2 may be performed by using the pair of primers of SEQ ID N°l and 2:
  • SEQ ID NO: 1 forward 5'- CAACTTCTCCATCGGTCCCTTGATG -3';
  • quantification of KIR3DL1 may be performed by using the pair of primers of SEQ ID N°3 and 4:
  • SEQ ID NO: 3 forward 5'- GGACATCGTGGTCACAGGTCC -3';
  • SEQ ID NO: 4 reverse 5'- GCCTGGAATGTTCTGTTGACCTTGC -3'.
  • Such techniques include detection and quantification of protein-type markers with any type of ligand molecule that specifically binds thereto, including nucleic acids (for example nucleic acids selected for binding through the well-known SELEX method), antibodies and antibody fragments.
  • nucleic acids for example nucleic acids selected for binding through the well-known SELEX method
  • antibodies are presently already available for the biomarker consisting of KIR3DL2 and for KIR3DL1, as described in the present specification.
  • the one skilled in the art may use the monoclonal anti-KIR3DL2 antibody marketed by the company Aviva Systems Biology, under the Reference number OAAB050807.
  • the one skilled in the art may use the monoclonal anti-KIR3DLl antibody marketed by the company Novus Biologicals under the reference number NPB- 147006.
  • the one skilled in the art may use a mouse IgGl monoclonal antibody that binds to both KIR3DL2 and KIR3DL1.
  • the expression level value of KIR3DL2 consists of the expression level value of both KIR3DL2 and KIR3DL1.
  • antibodies to said given marker may be easily obtained with the conventional techniques, including generation of antibody-producing hybridomas.
  • Hybridomas prepared by conventional techniques are then screened using standard methods to identify one or more hybridomas which produce an antibody which specifically binds with the biological marker protein or a fragment thereof.
  • the invention also encompasses hybridomas made by this method and antibodies made using such hybridomas. Polyclonal antibodies may be used as well.
  • expression of a marker is assessed using for example:
  • a radio-labelled antibody in particular, a radioactive moiety suitable for the invention may for example be selected within the group comprising H, 121 I,
  • a luminescent marker and in particular a fluorescent marker, suitable for the invention may be any marker commonly used in the field such as fluorescein, BODIPY, fluorescent probes type ALEXA, coumarin and its derivatives, phycoerythrin and its derivatives, or fluorescent proteins such as GFP or the DsRed;
  • said labelling enzyme suitable for the invention may be an alkaline phosphatase, a tyrosinase, a peroxydase, or a glucosidase; for example, suitable avidin-labelled enzyme may be an avidin- Horse Radish Peroxydase (HRP), and a suitable substrate may be AEC, 5- bromo-4-chloro-3-indolyl phosphate (BCIP), nitro blue tetrazolium chloride (NBT);
  • HRP avidin- Horse Radish Peroxydase
  • suitable substrate may be AEC, 5- bromo-4-chloro-3-indolyl phosphate (BCIP), nitro blue tetrazolium chloride (NBT);
  • an antibody derivative for example an antibody conjugated with a substrate or with the protein or ligand of a protein-ligand pair, in particular a biotin, a streptavidin or an antibody binding the polyhistidine tag;
  • an antibody fragment for example a single-chain antibody, an isolated antibody hypervariable domain, etc., which binds specifically to a marker protein or a fragment thereof, including a marker protein which has undergone all or a portion of its normal post-translational modification.
  • In vitro techniques for detection of a biological marker protein include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations and immunofluorescence.
  • ELISAs enzyme linked immunosorbent assays
  • Western blots Western blots
  • immunoprecipitations immunofluorescence.
  • the level of expression of KIR3DL2 is expressed as a ratio of levels of expression of KIR3 DL2/KIR3 DL 1.
  • the present invention relates to an in vitro method for diagnosing and/or monitoring a lymphoma in an individual comprising at least a step of quantifying the level of expression of KIR3DL2, said lymphoma being selected from the group comprising subcutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, and hepatosplenic gamma-delta T-cell lymphoma.
  • the methods for in vitro diagnosing and/or monitoring encompass diagnosing and/or monitoring of a cutaneous or a non-cutaneous KIR3DL2 expressing malignant T cells lymphoma.
  • a lymphoma is a cutaneous KIR3DL2 expressing malignant T cells lymphoma being selected from the group comprising sub-cutaneous panniculitis- like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma.
  • a lymphoma is a non-cutaneous KIR3DL2 expressing malignant T cells lymphoma being selected from the group comprising enteropathy- associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • an "individual" to be considered within the present invention may be any subject presenting clinical risks of having a lymphoma, or any subject having been already diagnosed for a lymphoma.
  • an individual may be a mammal, and more preferably an animal of economic importance, for example farms, laboratories or food industries animals, such as sheep, swine, cattle, goats, dogs, cats, horses, poultry, mice, rats.
  • an individual according to the invention may be a human. And more preferably, an individual is a human.
  • the present invention also relates to an in vitro method for diagnosing and/or monitoring a lymphoma in an individual comprising at least a step of quantifying the levels of expression of KTR3DL1 and KTR3DL2, said lymphoma being selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, and hepatosplenic gamma-delta T-cell lymphoma.
  • the in vitro methods according to the present invention comprise the steps of:
  • the method further relies upon quantifying the level of expression of one or more additional biomarkers known to be associated with the said cutaneous lymphomas and the nodal and extra nodal non-cutaneous lymphomas that are within the scope of the present invention, in combination with quantifying the level of expression of KIR3DL2.
  • Such one or more additional biomarkers may be selected in the group comprising CD3, CD8, CD30, granzyme B and TiAl .
  • a biological sample generally refers to a biological sample obtained, reached, collected or isolated from an individual, in vivo or in situ. Such samples may be, but not limited to, organs, tissues, fractions and cells isolated from a mammal. Exemplary biological samples include but are not limited to a cell culture, a cell line, a tissue biopsy such as a skin biopsy, a nasal tissue biopsy, a gastrointestinal tissue biopsy or lymph node tissue biopsy, an organ, a biological fluid, a blood sample, and the like.
  • Preferred biological samples include but are not limited to a blood sample, peripheral blood mononuclear cells (PBMC) sample or a tissue biopsy, including a skin biopsy, a nasal mucosa biopsy, an intestine biopsy or a lymph node biopsy).
  • PBMC peripheral blood mononuclear cells
  • the sample can be a crude sample, or can be purified to various degrees prior to storage, processing, or measurement.
  • An isolated biological sample of the invention comprises T-cells.
  • the step of collecting biological samples for the uses and methods of the invention may represent the first step of a use or a method in accordance with the invention.
  • the step of collecting biological samples for the uses and methods of the invention is performed before carrying out the invention and is not a step of a use or a method in accordance with the invention.
  • an isolated biological sample suitable for the invention comprising T- cells may be selected from the group consisting of a blood sample, a tissue biopsy, a fluid sample.
  • the samples suitable for the invention can be purified prior to testing.
  • the blood mononuclear cells, and preferably the T-cells can be isolated from the remaining cell contents prior to testing.
  • the separating the blood mononuclear cells or the T-cells may be performed by any methods known in the art, for example by density gradient centrifugation.
  • peripheral blood mononuclear cells comprising lymphocyte cells and monocyte cells
  • PBMC peripheral blood mononuclear cells
  • plasma non-cellular components
  • polynuclear cells such as neutrophil cells and eosinophil cells
  • erythrocytes any known method in the art to separate peripheral blood mononuclear cells (PBMC) from the other blood cell types and non-cellular components may be implemented.
  • centrifugation methods such as centrifugations methods.
  • gradient density for example using Ficoll®.
  • immunological separation methods such as, for example, magnetic beads and flow cytometry.
  • a threshold value for the specific marker KIR3DL2 or the ratio KIR3 DL2/KTR3 DL 1 may be determined for each specific lymphoma, by carrying out a method comprising the steps of:
  • a) providing (i) a collection of biological samples from individuals already diagnosed for being positive towards at least one of the subset of cutaneous lymphomas or to nodal and extra nodal non-cutaneous lymphomas within the scope of the present invention and (ii) a collection of biological samples from individuals diagnosed for being negative towards said lymphomas,
  • step b calculating, from the said first collection of quantification values obtained at the end of step b), the mean quantification value for the said marker in lymphoma- negative individuals,
  • step b calculating, from the said second collection of quantification values obtained at the end of step b), the mean quantification value for the said marker in one of the said lymphoma-positive individuals,
  • the lymphoma-positive individuals from step f) of the above- described method is intended to be selected in the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • the expression « optimally discriminates » that is used for describing step f) of the method above means that the said threshold value is calculated and the said value lies between (i) the mean quantification value that is obtained at step d) and the mean quantification value that is obtained at step e) and is the most discriminating between lymphoma-positive and lymphoma-negative individuals.
  • a threshold value described above shall be performed for each lymphoma in the in vitro diagnosis method of the invention, for the purpose of performing a reliable diagnosis of a lymphoma, from a subset of lymphoma candidates, in an individual.
  • the diagnosis methods from the present invention are intended to provide a first approach to discriminate a subset of specifically defined cutaneous lymphomas and nodal and extra nodal non-cutaneous lymphomas, from the bulk of the PTCL diseases.
  • the threshold values that may be used when performing the in vitro diagnosis method disclosed herein may be expressed as arbitrary units that reflect the expression level of the KTR3DL2 marker in the analysed biological sample, the said expression level either consisting of a protein expression level, for example a cell surface expression level, or a gene expression level, for example a mRNA expression level.
  • the in vitro methods according to the present invention comprise the steps of:
  • step b) diagnosing said lymphoma if the value found at step b) is distinct from a predetermined threshold value for the said ratio is indicative of a lymphoma positive individual.
  • the method further encompasses quantifying the level of expression of one or more additional biomarkers already known to be associated with the said cutaneous lymphomas and the nodal and extra nodal non-cutaneous lymphomas that are within the scope of the present invention.
  • Another aspect of the invention relates to a method for monitoring the effectiveness of treatment against a lymphoma, in an individual in need thereof, with a therapeutic agent, said method comprising the steps of:
  • lymphoma being selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • the invention relates to a method for monitoring the effectiveness of treatment against a lymphoma, in an individual in need thereof, with a therapeutic agent, said method comprising the steps of:
  • lymphoma being selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • a method for monitoring the effectiveness of treatment against a lymphoma within the scope of the present invention may comprise measuring the level of one or more additional bio markers that have been already been identified in the art to be specific for each kind of lymphoma.
  • a worse diagnosis that is determined by assessing the expression level of the KTR3DL2 biomarker or the KIR3DL2/KIR3DL1 ratio, during the course of treatment may indicate ineffective dosage and the desirability of increasing the dosage.
  • a better diagnosis that is determined by assessing the expression level of the selected markers, namely the level of expression of KIR3DL2 or the ratio KIR3DL2/KIR3DL 1 may indicate efficient treatment and hence the absence of a need to change dosage.
  • the present invention also relates to a method for adapting a treatment against a lymphoma in an individual in need thereof, wherein said method comprises at least the steps of:
  • lymphoma being selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • a suitable therapy may include chemotherapy, radiotherapy and bone marrow transplantation.
  • chemotherapy suitable for treating the cutaneous lymphomas and the nodal and extra nodal non-cutaneous lymphomas within the scope of the present invention
  • KTRD3DL2 expression level is specifically correlated with a subset of cutaneous and nodal and extra nodal non-cutaneous lymphomas
  • isolating, screening and administering compounds that affect KIR3DL2 expression levels and/or biological activities may be useful in treating and/or preventing the occurrence of such hyper- proliferative T-cell lymphomas.
  • Compounds of interest are especially those which induce an inhibition of the expression of KIR3DL2 in T cells.
  • another aspect of the present invention relates to a method for screening a compound candidate that affects KTR3DL2 expression level, said method comprising the step of:
  • step c) measuring the KIR3DL2 expression level by the KIR3DL2 expressing at least one T-cell of step c), whereby a second KTR3DL2 expression value is obtained; e) comparing the said first KIR3DL2 expression value with the said second KTR3DL2 expression value, and
  • both KTR3DL1 and KIR3DL2 expression levels may be measured at steps b) and d) of the above described screening method, and the ratios KIR3DL2/KTR3DL1 corresponding to the first and the second values are calculated at the end of steps b) and d) respectively and compared at the end of step e).
  • the second KIR3DL2 expression value is lowered as compared to the quantitative first value by a factor at least of about 2, for example of about 3, for example of about 4, for example of about 5, for example of about 10, for example of about 20 or for example of about 50.
  • candidate compounds encompass small organic molecules that may be obtained either after purification from a natural source or after semi- or whole chemical synthesis.
  • small molecules or other natural products may be identified and employed to inhibit the transcription in vivo of the KIR3DL2 gene.
  • candidate compounds encompass a ribozyme, an antisense oligonucleotide, a triple helix DNA, a RNA aptamer and/or double-stranded RNA directed to an appropriate nucleotide sequence of KIR3DL2 nucleic acid.
  • These compounds may be identified, isolated or synthesized de novo, using conventional techniques known from a skilled person in the art without undue burden or experimentation.
  • inhibition of KTR3DL2 gene expression can be obtained by designing antisense molecules, of DNA- or RNA-type, targeted towards the important regions of the gene encoding the KIR3DL2 protein.
  • the present invention relates to a method for the screening of a candidate compound that affects KIR3DL2 biological activity, said method comprising the step of: a) providing at least one T-cell able to express KIR3DL2;
  • step b) incubating KIR3DL2 expressing T-cell with a candidate compound to be tested; d) measuring the KTR3DL2 biological activity in the KTR3DL2 expressing T-cell obtained at the end of step b), whereby a second activity value is obtained;
  • the said candidate compound is selected at a further step f), when the said second activity value is lower than the said first activity value.
  • the second value is lowered as compared to the quantitative first value by a factor at least of about 2, for example of about 3, for example of about 4, for example of about 5, for example of about 10, for example of about 20 or for example of about 50.
  • the biological activity represents, but is not limited to, KTR3DL2 localization at the membrane compartment or KIR3DL2 ability to bind and/or interact with its cellular and/or extracellular partners molecules.
  • the invention in another aspect, relates to a method for treating or ameliorating a condition of an individual having one of the lymphoma selected within the subset of cutaneous and nodal and extra nodal non-cutaneous lymphoma herein described, comprising administering to said individual in need thereof a pharmaceutical composition comprising an effective amount of at least a compound that affects KIR3DL2 expression levels and/or biological activity, and most preferably of at least a compound that inhibits KIR3DL2 expression levels, or biological activity.
  • a compound that affects KIR3DL2 biological activity encompasses antagonists directed towards the KTR3DL2 protein activity.
  • the decreased biological activity which is aimed as a consequence of the antagonist administration, may be caused by, but is not limited to, a decrease of KIR3DL2 amount in the cellular environment, a defect of KIR3DL2 localization at the membrane compartment, a decrease of KJR3DL2 ability to bind and/or interact with its cellular and/or extracellular partner molecules.
  • the term "antagonist” refers to a molecule which decreases the biological activity of KJR3DL2.
  • Antagonists can include, but are not limited to, peptides, proteins, nucleic acids (DNA- and RNA-type aptamers), carbohydrates, antibodies or any molecules which decrease the amount or the biological activity of the KIR3DL2 protein.
  • the antagonist is an antibody, or an active fragment thereof, such as Fab, F(ab)2, Fab', F(ab')2, Fv and the like that are capable of binding an epitopic determinant, which is involved in said biological activity.
  • Antibodies or active fragment thereof can be prepared according to the well-known methods available to the skilled person in the art.
  • the inhibitory compounds encompassed by the present invention can be administered as pharmaceutical compositions.
  • Such pharmaceutical compositions for use in accordance with the present invention may be formulated in a conventional manner using one or more physiologically acceptable carriers or excipients.
  • the compounds and their physiologically acceptable salts and solvates may be formulated for any possible route of administration, including but not limited to topical, oral, buccal, systemic, parenteral or rectal administration.
  • kits for diagnosing and/or monitoring a lymphoma in an individual which kit comprises means for quantifying the level of expression of KTR3DL2 or alternatively the levels of expression of KIR3DL1 and KIR3DL2, said lymphoma being selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • the kit further comprises means for quantifying the level of expression of one or more additional biomarkers already correlated with the said cutaneous lymphomas and the nodal and extra nodal non-cutaneous lymphomas that are within the scope of the present invention.
  • the present invention relates to a kit for diagnosing and/or monitoring a cutaneous KIR3DL2 expressing malignant T cells lymphoma in an individual, which kit comprises means for quantifying the level of expression of KIR3DL2 or alternatively the levels of expression of KIR3DL1 and KIR3DL2, said lymphoma being selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma.
  • the present invention relates to a kit for diagnosing and/or monitoring a non-cutaneous KIR3DL2 expressing malignant T cells lymphoma in an individual, which kit comprises means for quantifying the level of expression of KTR3DL2 or alternatively the levels of expression of KIR3DL1 and KIR3DL2, said lymphoma being selected from the group comprising enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • additional biomarkers which have been shown to be correlated with one or more of the lymphoma(s) encompassed by the present invention.
  • additional biomarkers are not limited to CD3, CD8, CD30, CD56, PD1, CXCL13, granzyme B, TiAl .
  • Suitable reagents for binding with a marker nucleic acid include complementary nucleic acids.
  • the nucleic acid reagents may include oligonucleotides (labelled or non-labelled) fixed to a substrate, labelled oligonucleotides not bound with a substrate, pairs of PCR primers, molecular beacon probes, and the like.
  • the kit according to the present invention enables to quantify the level of expression KIR3DL2 and/or KIR3DL1 by measuring the level of mRNA expression.
  • the kit comprises at least a set of 2 primers that hybridize specifically to a portion of KIR3DL2 or KIR3DL1 mRNAs. These primers enable a skilled artisan to implement the RT-PCR technique.
  • the kit according to the present invention enables to quantify the level of expression of KIR3DL2 and/or KIR3DL1 by measuring the level of cellular protein expression, preferably the level of protein surface expression.
  • Protein expression may be quantified by specific antibodies.
  • suitable antibodies for the invention may be a polyclonal or monoclonal type IgG, IgA, IgM, or IgE.
  • An antibody suitable for the invention may be selected from antibodies from mouse, rat, rabbit, goat, horse, llama, human or other primate.
  • antibody fragment having binding properties defined above may also be suitable for the invention.
  • antibody fragment is meant a portion of an antibody such as Fab, Fab', F(ab)2, F(ab')2 fragments and other similar.
  • Fab fragment of an antibody
  • Fab' fragment of an antibody
  • F(ab)2 fragment of an antibody
  • F(ab')2 fragments fragments and other similar.
  • These terms also include any synthetic or genetically engineered protein that can act as an antibody by binding to a detectable protein of the invention, in a protein complex as defined above.
  • An antibody or antibody fragment suitable for the invention may be prepared by any method known to those skilled in the art, as described, for example, in “Making and using antibodies: a practical handbook” (Howard & Kaser, Ed CRC, 2006).
  • the kit may comprise a plurality of reagents, each of which is capable of binding specifically with the nucleic acid marker or the protein marker KIR3DL2 and optionally the nucleic acid or the protein KIR3DL1.
  • Suitable reagents for binding with a marker protein include antibodies, antibody derivatives, antibody fragments, and the like.
  • kits for the diagnosis of the occurrence of a subset of cutaneous and nodal and extra nodal non-cutaneous lymphomas which kit comprises means for quantifying at least one marker, i.e. KIR3DL2 and optionally KTR3DL1.
  • the kit of the invention may optionally comprise additional components useful for performing the methods of the invention.
  • the kit may comprise fluids (e.g. SSC buffer) suitable for annealing complementary nucleic acids or for binding an antibody with a protein with which it specifically binds, one or more sample compartments, an instructional material which describes performance of the in vitro diagnosis method of the invention, and the like.
  • kit described above may be useful for screening a compound candidate that affects KIR3DL2 expression level and/or biological activity, as described above.
  • KTR3DL2 has been reported to be considered as a valuable target for Sezary syndrome therapy.
  • a monoclonal antibody specifically targeted against KIR3DL2 was shown to inhibit cellular proliferation and to further promote specific cell death of the KIR3DL2 expressing malignant T-cells, by a mechanism involving antibody-dependent cellular cytotoxicity (ADCC) (WO 2010/081890).
  • CpG ODN CpG dinucleotides
  • CpG ODN have been reported to induce tumor regression by activating innate immunity, to enhance antigen-dependent cellular cytotoxicity (ADCC), and to be a valuable vaccine adjuvant that elicit a specific, protective immune response, and to be also good candidates for the treatment of various types of cancerous and non-cancerous diseases (Bodera et al Synthetic immunostimulatory oligonucleotides in experimental and clinical practice. Pharmacol Rep. 2012 Sep;64(5): 1003-10). Furthermore, GpC ODN (oligonucleotides that are rich in GpC dinucleotides), often used as controls ODN, were also tested.
  • the present invention describes a ligand molecule that specifically binds to KTR3DL2 for the prevention and/or the treatment of a KIR3DL2+ lymphoma selected from the group comprising Sezary syndrome, transformed mycosis fungoides, subcutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • a KIR3DL2+ lymphoma selected from the group comprising Sezary syndrome, transformed mycosis fungoides, subcutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatos
  • the present invention relates to a ligand molecule that specifically binds to KTR3DL2 for the prevention and/or the treatment of a KIR3DL2+ lymphoma selected from the group comprising transformed mycosis fungoides, sub-cutaneous panniculitis- like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T- cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • a KIR3DL2+ lymphoma selected from the group comprising transformed mycosis fungoides, sub-cutaneous panniculitis- like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T- cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma
  • the present invention relates to a ligand molecule that specifically binds to KTR3DL2 for the prevention and/or the treatment of a KIR3DL2+ lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy- associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • a KIR3DL2+ lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy- associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • the present invention relates to a ligand molecule that specifically binds to KTR3DL2 for the prevention and/or the treatment of a cutaneous KIR3DL2+ lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma.
  • the present invention relates to a ligand molecule that specifically binds to KIR3DL2 for the prevention and/or the treatment of a non-cutaneous KIR3DL2+ lymphoma selected from the group comprising enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • the ligand molecule according to the present invention is capable of specifically inducing the death of KTR3DL2 expressing malignant T-cells.
  • the death of KIR3DL2 expressing malignant T-cells is mediated by a process selected from the group comprising apoptosis, antigen-dependent cellular cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC).
  • the ligand molecule according to the present invention is selected from the group comprising an antibody, a fragment of an antibody and an oligodeoxynucleotide.
  • the present invention relates to an anti-KIR3DL2 antibody that specifically binds to KIR3DL2 for the prevention and/or the treatment of a KIR3DL2+ lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T- cell lymphoma.
  • a KIR3DL2+ lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T- cell lymphoma.
  • the present invention relates to an anti-KIR3DL2 antibody that specifically binds to KIR3DL2 for the prevention and/or the treatment of a cutaneous KTR3DL2+ lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma.
  • the present invention relates to an anti-KIR3DL2 antibody that specifically binds to KIR3DL2 for the prevention and/or the treatment of a non-cutaneous KTR3DL2+ lymphoma selected from the group comprising enteropathy- associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • Anti-KIR3DL2 antibodies within the scope of the present invention can be obtained according to methods known from a skilled person in the art, such as, for example, the hybridoma method.
  • Various adjuvants known in the art can be employed to enhance antibody production.
  • Anti-KIR3DL2 antibodies may be polyclonal, although monoclonal antibodies are preferred.
  • anti-KIR3DL2 antibodies suitable to deplete malignant T-cells expressing KIR3DL2 at their surface for example anti-KIR3DL2 antibodies that deplete malignant KIR3DL2 expressing T-cells via antibody-dependent cell mediated cytotoxicity (ADCC), complement dependent cytotoxicity (CDC), inhibition of cell proliferation or induction of cell death (e.g. via apoptosis).
  • ADCC antibody-dependent cell mediated cytotoxicity
  • CDC complement dependent cytotoxicity
  • inhibition of cell proliferation or induction of cell death e.g. via apoptosis.
  • Antigen-dependent cellular cytotoxicity may be assessed according to the protocol disclosed by, for example, Nelson et al. ( 51 Cr release assay of antibody- dependent cell-mediated cytotoxicity (ADCC). Curr Protoc Immunol. 2001 May; Chapter 7: Unit 7.27); Broussas et al. (Evaluation of antibody-dependent cell cytotoxicity using lactate dehydrogenase (LDH) measurement. Methods Mol Biol. 2013; 988:305-17.
  • Complement-dependent cytotoxicity may be assessed according to the protocol disclosed by, for example, Harmer et al (A highly sensitive, rapid screening method for the detection of antibodies directed against HLA class I and class II antigens. Transpl Int 1993; 6:277-80); Robson et al. (A comparison of flow cytometry screening methods. Eur J Immunogenetics 1999; 26:43-80); Broyer et al. (Evaluation of complement-dependent cytotoxicity using ATP measurement and Clq/C4b binding. Methods Mol Biol. 2013; 988:319-29).
  • Apoptosis may be assessed by numerous protocols or kits well known from the skilled person in the art.
  • apoptosis may be assessed by assaying caspase induced activity, for example by using one of the commercially available kits such as Caspase 3 Activity Assay (Roche Applied Science), Apo-O E® Homogeneous Caspase-3/7 Assay (Promega), EnzChek® Caspase-3 Assay Kit #1 (Invitrogen), following the manufacturer's instructions.
  • Caspase 3 Activity Assay Roche Applied Science
  • Apo-O E® Homogeneous Caspase-3/7 Assay Promega
  • EnzChek® Caspase-3 Assay Kit #1 Invitrogen
  • Apoptosis may also be assessed by assaying tunel and DNA fragmentation, for example by using one of the commercially available kits such as Apoptotic DNA Ladder Kit (Roche Applied Science), DeadEndTM Fluorometric TUNEL System (Promega), APO- BrdUTM TUNEL Assay Kit (Invitrogen), Apoptotic DNA Ladder Kit (Genotech), following the manufacturer' s instructions.
  • Apoptotic DNA Ladder Kit Roche Applied Science
  • DeadEndTM Fluorometric TUNEL System Promega
  • APO- BrdUTM TUNEL Assay Kit Invitrogen
  • Apoptotic DNA Ladder Kit Genotech
  • apoptosis for example measuring cell permeability, staining phosphatisylserine by Annexin V, measuring mitochondrial membrane potential, etc.
  • the ability of the ligand molecule, within the scope of the instant invention, to elicit the death of KIR3DL2 expressing malignant T-cells may be assessed in vitro on an isolated cell line.
  • HUT-78 available at the American Type Culture Collection (ATCC), as ATCC TIB- 161; HH (ATCC CRL-2105), SeAx (Kaltoft et al A continuous T-cell line from a patient with Sezary syndrome. Arch Dermatol Res.
  • Anti-KIR3DL2 antibodies which include humanized antibodies, and antibody fragments thereof, may be prepared according to known techniques.
  • the anti-KIR3DL2 antibody is a chimeric, a humanized or a full-human anti-KIR3DL2 antibody.
  • the anti-KIR3DL2 antibody is an antibody fragment selected from the group of F(ab')2, F(ab)2, Fab', Fab, Fv, scFv, i.e. a fragment bearing the minimal recognition moieties.
  • the anti-KIR3DL2 antibody is a monoclonal antibody selected from the group consisting of a human antibody, a humanized antibody, and a chimeric antibody.
  • the anti-KIR3DL2 antibody induces antibody-dependent cellular cytotoxicity (ADCC).
  • ADCC antibody-dependent cellular cytotoxicity
  • the anti-KIR3DL2 antibody is an IgGl or IgG3 human isotype antibody. In other embodiments, the anti-KIR3DL2 antibody is an IgG2 or IgG4 human isotype antibody.
  • the anti-KIR3DL2 antibody induces complement cell toxicity mechanism (CDC). In another preferred embodiment, the anti-KIR3DL2 antibody induces apoptosis.
  • the ligand molecule is the AZ158 monoclonal antibody mAb, as previously described in Parolini et al (The AZ158 mAb specifically reacts with p70 and pi 40 inhibitory K receptors for HLA-B and HLA-A alleles. Leukocyte Typing VII. 2002. In: (Mason D, Andre P, Bensussan A, Buckley C, Civin C, Clark E et al, eds) Oxford: Oxford University Press, 415-417).
  • the ligand molecule is the Q66 monoclonal antibody (Pende et al.
  • the natural killer cell receptor specific for HLA-A allotypes a novel member of the p58/p70 family of inhibitory receptors that is characterized by three immunoglobulin-like domains and is expressed as a 140-kD disulphide-linked dimer. J Exp Med. 1996; 184:505- 18).
  • the ligand molecule according to the instant invention is selected from the group comprising AZ158 and Q66 monoclonal antibodies.
  • the present invention describes an oligodeoxynucleotide that specifically binds to KIR3DL2 for the prevention and/or the treatment of a KIR3DL2+ lymphoma selected from the group comprising Sezary syndrome, transformed mycosis fungoides, sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • a KIR3DL2+ lymphoma selected from the group comprising Sezary syndrome, transformed mycosis fungoides, sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphom
  • the present invention relates to an oligodeoxynucleotide that specifically binds to KIR3DL2 for the prevention and/or the treatment of a KIR3DL2+ lymphoma selected from the group comprising transformed mycosis fungoides, sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • a KIR3DL2+ lymphoma selected from the group comprising transformed mycosis fungoides, sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosple
  • the present invention relates to an oligodeoxynucleotide that specifically binds to KTR3DL2 for the prevention and/or the treatment of a KIR3DL2+ lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • a KIR3DL2+ lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • the present invention relates to an oligodeoxynucleotide that specifically binds to KTR3DL2 for the prevention and/or the treatment of a cutaneous KIR3DL2+ lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma.
  • the present invention relates to an oligodeoxynucleotide that specifically binds to KIR3DL2 for the prevention and/or the treatment of a non-cutaneous KIR3DL2+ lymphoma selected from the group comprising enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • CpG ODN treatment of T-cells from Sezary individuals results in (i) the binding of CpG ODN to the KIR3DL2 at the surface of the T- cells; (ii) the internalization of KTR3DL2, hence its depletion from the surface of the T- cells; and unexpectedly (iii) the induction of a caspase-dependent apoptotic pathway.
  • the ligand molecule according to the instant invention may be an oligodeoxynucleotide selected from the group comprising CpG ODN-A of sequence SEQ ID NO: 5; CpG ODN-B of sequence SEQ ID NO: 6; CpG ODN-C of sequence SEQ ID NO: 7, mixtures thereof and/or analogs thereof.
  • Analogs of the oligodeoxynucleotides selected from the group comprising CpG ODN-A of sequence SEQ ID NO: 5; CpG ODN-B of sequence SEQ ID NO: 6; CpG ODN-C of sequence SEQ ID NO: 7 comprise oligonucleotides with a nucleotide sequence at least 50% identical, for example at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, at least 95% identical, to either SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7.
  • the ligand molecule according to the instant invention may be the oligodeoxynucleotide CpG ODN-C of sequence SEQ ID NO: 7.
  • GpC ODN often used as a CpG ODN negative control
  • KIR3DL2 expressing malignant T-cells treatment for inducing apoptosis it was found to be as active as the CpG ODN-C.
  • GpC ODN is a ligand molecule inducing KIR3DL2 expressing malignant T-cells apoptosis.
  • GpC ODN of sequence SEQ ID NO: 8 may be used as a ligand molecule to treat KIR3DL2 expressing malignant T-cells.
  • analogs of the oligodeoxynucleotides GpC ODN of sequence SEQ ID NO: 8, comprising oligonucleotides with a nucleotide sequence at least 50% identical, for example at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, at least 95% identical to SEQ ID NO: 8 may be used as a ligand molecule to treat KIR3DL2 expressing malignant T-cells.
  • the ligand molecule according to the instant invention may thus be an oligodeoxynucleotide selected from the group comprising CpG ODN-A of sequence SEQ ID NO: 5; CpG ODN-B of sequence SEQ ID NO: 6; CpG ODN-C of sequence SEQ ID NO: 7; GpC ODN of sequence SEQ ID NO: 8, mixtures thereof and/or analogs thereof.
  • an anti-KIR3DL2 antibody is in a mixture with an oligonucleotide, or an analog thereof, as to potentiate the effects of both ligand molecules.
  • the ligand molecule within the scope of the instant invention is capable of inducing at least about 10%, for example about 20%, for example about 30%, for example about 40%, for example about 50%, for example about 60%, for example about 70%), for example about 80%, for example about 90% of cell death, as assessed in a cytotoxic assay.
  • a pharmaceutical composition comprising a ligand molecule, as defined in the instant invention, and a pharmaceutically acceptable carrier for the prevention and/or the treatment of a KIR3DL2+ lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, and hepatosplenic gamma-delta T-cell lymphoma.
  • a KIR3DL2+ lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, and hepatosplenic gamma-delta T-cell lymphoma.
  • the present invention also relates to a ligand molecule that specifically binds to the extracellular domain of KTR3DL2 and is able to induce the cell death of the malignant T-cell s, for the prevention and/or treatment of a subset of cutaneous lymphomas and a subset of non-cutaneous nodal and extra nodal lymphomas.
  • the invention further results from the discovery that ligand molecules that bind KIR3DL2 receptor, and in particular the extracellular domain of KIR3DL2 receptor, are capable to induce a decrease of the proliferation of KIR3DL2-expressing malignant T cells, i.e. by inducing a KIR3DL2-mediated inhibitory signal.
  • therapeutic compositions and regimens are herein disclosed and used for treating individuals previously diagnosed with KTR3DL2 expressing malignant T- cells lymphomas such as sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy- associated T-cell lymphoma, and hepatosplenic gamma-delta T-cell lymphoma.
  • KTR3DL2 expressing malignant T- cells lymphomas such as sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy- associated T-cell lymphoma, and hepatosplenic gamma-delta T-cell lymphoma.
  • a further aspect of the invention relates to a method for treating a KIR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a ligand molecule that specifically binds to KIR3DL2.
  • said KTR3DL2 expressing malignant T-cells lymphoma is selected from the group comprising transformed mycosis fungoides, sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • a further aspect of the invention relates to a method for treating a cutaneous KIR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a ligand molecule that specifically binds to KTR3DL2.
  • said cutaneous KTR3DL2 expressing malignant T-cells lymphoma is selected from the group comprising transformed sub-cutaneous panniculitis-like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma.
  • a further aspect of the invention relates to a method for treating a non-cutaneous KTR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a ligand molecule that specifically binds to KTR3DL2.
  • said non-cutaneous KIR3DL2 expressing malignant T-cells lymphoma is selected from the group comprising enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • the present invention relates to a method for treating a KIR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a pharmaceutical composition comprising a ligand molecule that specifically binds to KTR3DL2, and a pharmaceutically acceptable carrier.
  • the present invention relates to a method for treating a KTR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a pharmaceutical composition comprising a ligand molecule that specifically binds to KIR3DL2, and a pharmaceutically acceptable carrier, wherein said lymphoma is selected from the group comprising transformed mycosis fungoides, sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T- cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • the present invention relates to a method for treating a cutaneous KTR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a pharmaceutical composition comprising a ligand molecule that specifically binds to KIR3DL2, and a pharmaceutically acceptable carrier, wherein said lymphoma is selected from the group comprising subcutaneous panniculitis-like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma.
  • the present invention relates to a method for treating a non-cutaneous KTR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a pharmaceutical composition comprising a ligand molecule that specifically binds to KIR3DL2, and a pharmaceutically acceptable carrier, wherein said lymphoma is selected from the group comprising enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • the present invention concerns a method for treating a KTR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a ligand molecule that specifically binds to KTR3DL2, in an amount sufficient to deplete T-cells.
  • said ligand molecule that binds specifically to KIR3DL2 depletes circulating and/or organ-localized malignant T-cells.
  • the dosage regimen of the ligand molecule or the pharmaceutical composition disclosed herein is established by a physician.
  • the specific therapeutically effective dosage regimen, and the amount sufficient to deplete T-cells, for a particular individual in need of the treatment will be dependent upon a variety of factors including, but not limited to: the T-cell lymphoma being treated and the severity of the disorder; the age; the body weight; general health; the sex; the diet; the time course of administration; the route of administration; the duration of the treatment; the drugs that are concomitantly administered in combination with the ligand molecule or pharmaceutical composition within the scope of the present invention.
  • the dosage regimen of the ligand molecule or the pharmaceutical composition herein disclosed may range from about 0.01 to about 1,000 mg per adult per day.
  • the patient is administered with an amount of about 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the ligand molecule in order to adjust the dosage regimen that is the most suitable to a particular individual in need of the treatment.
  • a pharmaceutical composition within the scope of the present invention may contain from about 0.01 mg to about 500 mg of the ligand molecule, preferably from about 1 mg to about 100 mg of the ligand molecule.
  • an effective amount of the ligand molecule is routinely administered at a dosage regimen from about 0.0002 mg/kg to about 20 mg/kg of body weight per day, especially from about 0.001 mg/kg to 7 mg/kg of body weight per day.
  • the optimal amount of ligand molecule to be comprised in a pharmaceutical dosage unit according to the invention may be easily adapted by the one skilled in the art using routine known protocols or methods.
  • the ligand molecule and the pharmaceutical composition disclosed herein are administered by any suitable route, i.e. including, but not limited to, an oral, sublingual, buccal, subcutaneous, transdermal, topical, intraperitoneal, intramuscular, intravenous, subdermal, intrathecal and intranasal and rectal administration.
  • the method for treating a KIR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, as disclosed in the instant invention is capable of inducing at least about 10%, for example about 20%, for example about 30%, for example about 40%, for example about 50%, for example about 60%, for example about 70%), for example about 80%>, for example about 90%> of cell death.
  • EXAMPLE 1 Expression of KIR3DL2 in cutaneous, non-cutaneous peripheral extra nodal and nodal T-cell lymphomas
  • Tissue samples were retrieved from various collections, and diagnoses were done in all cases following the current classification (Swerdlow SH, Campo E, Harris L, et al. In: press IARC, ed. WHO Classification of Tumours of Haematopoietic and Lymphoid tissues (ed 4th). Lyon; 2008).
  • the international classification of diseases for oncology (ICDO) code is given in parenthesis for each lymphoma group disclosed in the following list. a) cutaneous T-cell lymphomas
  • angioimmunoblastic T-cell lymphomas (AITL, 9705/3): TENOMIC 060, 268, 424, 415;
  • enteropathy-associated T-cell lymphomas (EATL, 9717/3): TENOMIC 046, 418, 441, 210, 319, 358, 413;
  • T- 8 adult T-cell leukaemia/lymphoma ATLL, 9827/3: TENOMIC 285, 257, 340, 361, 066, 256, 540, 560;
  • hepatosplenic gamma-delta T-cell lymphomas (HSTL, 9716/3): TENOMIC 014, 037, 181, 014, 037, 181, 183;
  • peripheral T-cell lymphomas not otherwise specified (PTCL/NOS, 9702/3) : TENOMIC 214 , 225, 232, 469.
  • ALK positive (9702/3) were obtained from Dr Laurence LAMANT, from the department of Pathology of the Institut Universitaire du Cancer dedoch - Oncopole : P9710730, P055401, P0016632, P00113872, P126370.
  • KTR3DL2 immunostaining was done manually in a humid chamber using a mouse IgGl monoclonal antibody (clone 5.133, Miltenyi Biotec, Paris, France) at a 1 :50 dilution with 1 hour incubation. This antibody reacts with both KIR3DL2 and IR3DL1.
  • the staining was performed using the En Vision® amplification system conjugated to peroxydase (Dako SA, Glostrup, Denmark).
  • the peroxydase reaction was revealed by aminoethylcarbazole and sections were counterstained in blue with hematoxylin.
  • T-cell markers for all samples (CD3), CD30 for anaplastic large cell lymphomas and primary cutaneous CD30+ T-cell lymphoproliferative disorders, CD8 and granzyme B for sub-cutaneous panniculitis-like T-cell lymphomas and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, CD56 and granzyme B for cutaneous and extra nodal K/T cell lymphomas nasal -type, CXCL13 and PDl for AITL, CD25 for ATLL, CD 5 and TiAl for HSTL.
  • CD3 T-cell markers for all samples
  • CD30 for anaplastic large cell lymphomas and primary cutaneous CD30+ T-cell lymphoproliferative disorders
  • CD8 and granzyme B for sub-cutaneous panniculitis-like T-cell lymphomas and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma
  • CD56 and granzyme B for cutaneous and extra nodal K
  • Quantitative PCR reactions for CD3 (delta chain), KIR3DL2 and KIR3DL1 were performed in a LightCycler 2.0 System (Roche Diagnostics, Meylan, France) using a SYBR Green PCR kit from Roche Diagnostics (Meylan, France). Melting curves and agarose gel electrophoresis established the purity of the amplified product. Normalization was achieved by quantification of the mRNA expression of the SF3A1 gene, encoding for the 120 kDa subunit of the splicing factor 3 a, chosen as control housekeeping gene for its stable expression in lymphocytes, as previously described.
  • PCR samples contained 4 mM MgCL 2 , 0.4 ⁇ of each primer, and amplification cycling conditions were as following: 94°C for denaturation, 10 seconds at 60°C for hybridization and 25 seconds at 72°C for elongation for 40 cycles.
  • the expression of transcripts was measured by the relative quantification of real time-PCR, as previously described. All PCR conditions were adjusted in order to obtain equivalent optimal amplification efficiency between the different assays.
  • the differences in C t values were determined for each sample and were expressed as relative percentage of mRNA present in the calibrator sample, according to the ⁇ method, after adjustment of PCR efficiency with the Light Cycler software 4.0 (Roche). Quantification was considered to be unreliable when the presence of non-specific products was detected on the control agarose gel.
  • RNA extraction was performed on frozen sections, transferred into Trizol, and immediately homogenized before chloroform/isopropanol precipitation. Total mRNA was then reverse transcribed by using the High Capacity cDNA Reverse Transcription with RNase inhibitor kit (Applied Biosystems), according to the manufacturer's instructions. Primers used to quantify KTR3DL2 may be of SEQ ID NO: 1 and SEQ ID NO: 2:
  • SEQ ID NO: 1 forward 5'- CAACTTCTCCATCGGTCCCTTGATG -3'
  • SEQ ID NO: 2 reverse 5'- GTTTGACCACACGCAGGGCAG -3'.
  • Primers used to quantify KTR3DL1 may be of SEQ ID N°3 and 4:
  • SEQ ID NO: 3 forward 5 '- GGACATCGTGGTCACAGGTCC -3 '
  • SEQ ID NO: 4 reverse 5'- GCCTGGAATGTTCTGTTGACCTTGC -3'.
  • the SF3A1 housekeeping gene was used as calibrator.
  • the levels of expression of the KTR3DL1 and KTR3DL2 receptors were finally expressed as a ratio to CD36 to avoid the potential bias due to differences in T-cell lymphocytic densities.
  • mRNA levels of KIR3DL2 was studied by transcriptomic analysis (Affymetrix U133 Plus 2.0) after total mRNA extraction from frozen specimens and compared to all HSTL and AITL.
  • Table 1 phenotypic study and proportion of cases displaying a positive ratio expression KTR3DL1/2 (cohort of 44 individuals).
  • ⁇ CDO International Classification of Diseases for Oncology
  • 2 IHC stands for ImmunoHistoChemistry
  • GrB stands for granzyme B
  • KTR3DL1/2 staining in all the Sezary syndrome skin samples showed as expected a membrane staining in the neoplastic infiltrates, with no background staining (figures 1A and IB). No staining was evidence in irrelevant structures, including the epidermis, the cutaneous adenexae, normal dermal cells and hypodermis. A strong and diffuse staining was also evidenced in the lymph nodes from two cases.
  • Table 2 phenotypic study and proportion of cases displaying a positive ratio of expression KTR3DL1/2 (as in Table 1 , but with results obtained from an additional cohort of 16 individuals).
  • - two cutaneous PTCLs namely sub-cutaneous panniculitis-like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma
  • - two non-cutaneous PTCLs namely enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
  • KIR3DL2 may thus be a biomarker for diagnosing a sub-population of patients having a lymphoma such as a transformed mycosis fungoides, an enteropathy-associated T-cell lymphoma and an adult T-cell leukaemia/lymphoma. It could also be suggested that KIR3DL2 might be a good candidate to assess the prognosis of these particular cutaneous and non-cutaneous nodal and extra nodal lymphomas.
  • Table 3 RT-PCR studies for KIR3DL1 and KIR3DL2 in positively stained cutaneous T- cell lymphomas.
  • KTR3DL2 ⁇ values (xlO) for the Sezary syndrome samples were 5.83, 31.6 and 6.4, while for KTR3DL1, the values were 0.03, 0 and 0.43, respectively.
  • the ⁇ values were 15.16 for KTR3DL2 and 0.23 for KTR3DL1.
  • KIR3DL2 transcripts also appeared to be expressed at a much higher rate than KIR3DL1, with a KIR3D2/KIR3DL1 ratio of 130.14.
  • KIR3DL2 transcripts were also more expressed than but the difference with KIR3DL1 was less marked. It can be therefore conclude that these cases rather expressed KIR3DL2 than KIR3DL1 and that the anti- KIR3DL1/2 clone 5.133 stained KIR3DL2 at the surface of the neoplastic cells.
  • transcriptomic analyzes also identified significant KIR3DL2 mRNA expression, at much higher levels than in other peripheral T-cell lymphomas, as shown in figure 3. It is to be noted that the present results seem contradictory with the results obtained by Iqbal et al.
  • PTCL/NOS Molecular signature to improve diagnosis in peripheral T-cell lymphoma and prognostication in angioimmunoblastic T-cell lymphoma; Blood, 2010, 115(5): 1026-36) reported KIR3DL2 as a putative biomarker for a subset of PTCL "not otherwise specified" (PTCL/NOS).
  • PTCL/NOS encompass a variety of lymphomas of distinct nature, as they could not be assigned to one specific defined subcategory.
  • T-cell lymphomas sub-cutaneous panniculitis-like T-cell lymphomas, and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma
  • extra-cutaneous peripheral T-cell lymphomas some hepatosplenic T-cell lymphomas and enteropathy-associated T-cell lymphomas expressed KIR3DL2 and thus appear to be good candidates for a targeted therapy.
  • KIR3DL2 transcripts were detected, at much higher levels than KTR3DL1.
  • the identification of KIR3DL2 expression in tissue samples using the anti-human KIR3DL1/2 mouse IgGl monoclonal antibody was reliable for the identification of KIR3DL2+ lymphomas.
  • EXAMPLE 2 Monoclonal antibody (MAb) AZ158 or CPG ODN binding to KIR3DL2 induces distinct cellular death pathways in Sezary syndrome malignant T cells
  • PBMCs Peripheral blood mononuclear cells
  • CD4 + T cells were purified by MACS using the CD4 + T cell isolation kit according to the manufacturer s protocol (Miltenyi Biotech). The Sezary cell line used in this study was established and amplified as described previously, and maintained a stable phenotype. Cells were cultured in RPMI 1640 medium, supplemented with 2 mM L-glutamine, 1% penicillin-streptomycin (Invitrogen) and 10% human serum (Jacques Boy Biotechnologies Institute). 1.2) CpG ODN, GpC ODN or antibodies cell treatment
  • CpG ODN and GpC ODN treatments cells were cultured for the indicated time (1, 4 or 7 days) in 24-well plates at a concentration of 2xl0 6 /ml.
  • the following CpG ODNs and or GpC ODN were used at a final concentration of 10 ⁇ g/ml: CpG class- A (ODN 2336), CpG class-B (ODN 2006), CpG class-C (ODN 2395), GpC (ODN 2395 control) and control ODN (ODN TTAGGG) (all from Invivogen).
  • Cells were either left untreated or incubated in the presence of CpG ODN-C, FITC- labelled CpG ODN-C or control ODN for 24 h at 37 ° C .
  • Cell s were subj ected to KIR3DL2 immunolabelling with Q66 mAb and FITC-coupled goat anti-mouse IgM Abs, washed and immobilized on poly-L-lysine coated coverslips. After a methanol fixation step at -20 ° C, cells were mounted in polyvinyl alcohol mounting medium with DABCO (Fluka).
  • Activated cells were subjected to lysis and post-nuclear supernatants prepared and processed as described elsewhere. For Western blotting, samples were separated by SDS- PAGE and transferred onto a nitrocellulose membrane. Immunoprecipitates were probed with anti-phospho-CD3 mAb (Santa Cruz Biotechnology, Santa Cruz, CA) and anti-CD3 mAb (Cell Signaling). Post-nuclear lysates analyses were performed using antibodies specific for the following molecules: cleaved-caspase 3, -caspase 7 and -PARP, phospho- STAT3, STAT3, Erkl/2 (all from Cell Signaling Technology) and phospho-Erkl/2 (Sigma- Aldrich).
  • KIR3DL2 internalization is induced upon its engagement with CpG ODN, but not with anti-KIR3DL2 mAb AZ158
  • KIR3DL2 as a reliable cell surface marker of the tumoral CD4 + T lymphocytes of patients with Sezary syndrome.
  • engagement of the receptor was achieved by using either the anti-KTR3DL2 monoclonal antibody (mAb) AZ158 or its newly identified ligand CpG ODN. Note that both AZ158 and CpG ODN-C sites of interaction were mapped within the DO extracellular domain of the receptor. Because CpG ODNs were shown to promote KIR3DL2 cell surface down- modulation on NK cells (Sivori et al.
  • Table 5 Down-modulation of KIR3DL2 by CpG ODN on Sezary patients malignant T cell clone.
  • CpG ODN-C induced efficient cell surface modulation of KIR3DL2 and combined the immune effects of class-A and -B ODN (CpG ODN-A et CpG ODN-B) on immune cells it was preferentially used for the following experiments.
  • the expression level of KIR3DL2 by Sezary patients tumoral T cell clone was next monitored in parallel on ODN-C or AZ158 mAb treated cells.
  • the resulting data clearly demonstrated that while ODN-C promoted KIR3DL2 down-modulation, ligation of KIR3DL2 with AZ158 mAb did not affect the level of receptor detected on malignant T cells (identified by means of their clonal TCRVB rearrangement) ( Figure 4A).
  • GpC ODN differs from CpG ODN by the presence of GpC dinucleotides instead of CpGs, and is usually used as a negative control for CpG ODN.
  • KIR3DL2 In NK cells, KIR3DL2 internalization leads to the co-localization of the CpG ODN-linked receptors with TLR9 in the endosomal compartment 14. It has therefore been suggested that in these cells, KIR3DL2 may act as a carrier protein that brings CpG ODN to their receptor TLR9, resulting in NK cell activation. Despite the detection of TLR9 transcripts in Sezary cell lines and Sezary patient tumoral cells, we did not detect any TLR9 expression in these cells (data not shown). In addition, it has been recently reported that CpG and non-CpG ODN can co-stimulate mouse and human CD4+ T cells through a TLR9- and MyD88- independent mechanism 28.

Landscapes

  • Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a ligand molecule that specifically binds to KTR3DL2 at the surface of KTR3DL2 expressing malignant T-cells for the treatment of lymphomas. It also relates to the in vitro use of a level of expression of KIR3DL2 is a biomarker useful for diagnosing and/or monitoring a lymphoma.

Description

KIR3DL2 IS A BIOMARKER AND A THERAPEUTIC TARGET USEFUL FOR RESPECTIVELY PREVENTING AND TREATING A SUBSET OF CUTANEOUS AND NON-CUTANEOUS PERIPHERAL T-CELL LYMPHOMAS FIELD OF THE INVENTION
The present invention relates to the field of diagnosis or therapeutic treatment of T-cell lymphomas.
BACKGROUND OF THE INVENTION
Peripheral T-cell lymphomas (PTCLs) are heterogeneous and uncommon non-Hodgkin's tumor diseases characterized by an aggressive clinical course and a mostly poor outcome with current treatment strategies.
One of the most urgent difficulties is to properly classify these diseases in order to provide the patient with the most adapted treatment, such as cell-targeted chemotherapy, radiotherapy and/or marrow bone transplantation. Several attempts for classifying the PTCLs diseases have been made in the past, taking into account clinical symptoms and gene expression profiles.
Today, the World Health Organization recognizes several subtypes of PTCLs, as registered at the International Classification of Diseases for Oncology (ICDO, 3rd Edition), such as (i) disseminated lymphomas; (ii) cutaneous lymphomas; (iii) nodal non-cutaneous lymphomas; and (iv) extra nodal non-cutaneous lymphomas.
Among the cutaneous PTCL, Sezary syndrome and transformed mycosis fungoides are the most prevalent cutaneous T-cell lymphomas. Sezary syndrome presents an aggressive clinical behaviour, with widespread skin involvement, resulting in an erythroderma, enlarged lymph nodes and the presence of a significant number of malignant lymphocytes, called Sezary cells. Oppositely, mycosis fungoides presents an indolent clinical behaviour but in about 10% of patients, the disease progresses to a large T-cell lymphoma ("transformed mycosis fungoides") resulting in large skin, often ulcerated, skin tumours, sometimes with lymph nodes or internal organs involvement. Although there is currently no cure for Sezary syndrome and transformed mycosis fungoides, several palliative approaches can be undertaken in order to ameliorate the patient's life. For example, these approaches comprise: drug therapy and chemotherapy, including topical corticosteroids, imiquimod, retinoids bexarotene, interferon-alpha, histone deacetylase inhibitors (HDACi, such as vorinostat and romidepsin), oral methotrexate, denileukin diftitox (an antineoplastic agent, combining Interleukin-2 and diphtheria toxin), proteasome inhibitors, immunomodulatory agents (lenalidomide) ; phototherapy, including UVB phototherapy ; - photodynamic therapy, including psoralen+ ultraviolet A (PUVA) ; radiotherapy ; - total skin electron beam (TSEB) ; extracorporeal photopheresis (ECP) ; autologous stem cell transplantation ; - allogenic stem cell transplantation.
Most of these approaches present limitations mostly because of the side effects that are endured by normal non-pathogenic cells and may affect the patient's benefits of such treatments.
There is hence a need for targeted therapy. This concept has been recently implemented by using alemtuzumab, a monoclonal antibody directed towards CD52, a peptide found at the surface of mature lymphocytes, monocytes and dendritic cells (Lundin et al. Phase 2 study of alemtuzumab (anti-CD52 monoclonal antibody) in patients with advanced mycosis fungoides/Sezary syndrome. Blood. 2003 Jun 1; 101(11):4267-72).
Previous studies demonstrated that treatment of Sezary cells with the Janus kinase (JAK) inhibitor tyrphostin AG490, as well as with Cucurbitacin I or Curcumin, efficiently promotes phospho-STAT3 dephosphorylation and induces Sezary cell apoptosis (Eriksen et al. Constitutive STAT3 -activation in Sezary syndrome: tyrphostin AG490 inhibits STAT3 -activation, interleukin-2 receptor expression and growth of leukemic Sezary cells. Leukemia. 2001; 15:787-793; van Kester et al. Cucurbitacin I inhibits Stat3 and induces apoptosis in Sezary cells. J Invest Dermatol. 2008; 128: 1691-1695; Zhang et al. Curcumin selectively induces apoptosis in cutaneous T-cell lymphoma cell lines and patients' PBMCs: potential role for STAT-3 and F-kappaB signaling. J Invest Dermatol. 2010;130:2110-2119).
Regarding some physiological aspects of Sezary' s syndrome, it has notably been shown in the art that, among the biomarkers that may be relevant in Sezary' s individuals, a combination of 4 biomarkers are of special interest, since PSL3, TWIST, KTR3DL2 and Kp46 were shown to be overexpressed in T-cells from Sezary and transformed mycosis fungoides individuals (Michel et al. Combination of PSL3, Twist, CD158/KIR3DL2 and Kp46 gene expression for the diagnosis of Sezary syndrome. J Invest Dermatol. 2012; 132(2), page S50).
However, there are confusing data whenever KIR3DL2 should be considered as a relevant biomarker for Sezary syndrome and transformed mycosis fungoides.
Indeed, Bagot et al. (CD4(+) cutaneous T-cell lymphoma cells express the pl40-killer cell immunoglobulin-like receptor. Blood. 2001 Mar 1; 97(5): 1388-91), Poszepczynska- Guigne et al. (CD158k/KIR3DL2 is a new phenotypic marker of Sezary cells: relevance for the diagnosis and follow-up of Sezary syndrome. J Invest Dermatol. 2004 Mar; 122(3):820-3) and Ortonne et al. (CD158k/KIR3DL2 and Kp46 are frequently expressed in transformed mycosis fungoides. Exp Dermatol. 2012 Jun; 21(6):461-3) reported an overexpression of KTR3DL2 at the surface of T-cells from patients having a Sezary syndrome or a transformed mycosis fungoides.
In complete contradiction with the above studies, the expression of KIR3DL2 was also found in the art to be down-regulated in Sezary cells, when assessed by measuring the level of KIR3DL2 mRNA by quantitative RT-PCR (see WO 2007/071829).
Booken et al. (Sezary syndrome is a unique cutaneous T-cell lymphoma as identified by an expanded gene signature including diagnostic marker molecules CDOl and DNM3. Leukemia. 2008 (22), 393-399) reported that KIR3DL2 is only expressed in a subpopulation of patient having a Sezary syndrome.
In addition, Iqbal et al. (Molecular signature to improve diagnosis in peripheral T-cell lymphoma and prognostication in angioimmunoblastic T-cell lymphoma; Blood, 2010, 115(5): 1026-36) reported KIR3DL2 as a putative biomarker for a subset of PTCL "not otherwise specified" (PTCL/NOS), but remained silent about the cutaneous lymphoma, such as Sezary syndrome and transformed mycosis fungoides.
Finally, Nebozhyn et al. (Quantitative PCR on 5 genes reliably identifies CTCL patients with 5% to 99% circulating tumor cells with 90% accuracy. Blood. 2006 Apr 15; 107(8):3189-96) suggested a set of 5 reliable biomarkers, i.e. STAT4, GATA-3, PLS3, CD ID, and TRAIL, hence discarding KIR3DL2 from being a valuable biomarker for the diagnosis of Sezary syndrome.
It is to be noted that KIR3DL2 was also found to be overexpressed at the surface of some T-cells from patient having been diagnosed with adult T-cell leukaemia (ATCL), as disclosed in Obama et al. (Killer cell immunoglobulin-like receptor/3DL2 expression in adult T-cell leukaemia. Br J Haematol. 2007 Sep; 138(5):666-7). However, according to this study, KIR3DL2 is believed not to be a highly specific biomarker for ATCL.
Killer immunoglobulin-like receptors (KIR) represent a family of receptors that are used by human Natural Killer (NK) cells and T-lymphocyte subsets to specifically recognize MHC class I molecules.
KIR3DL2 belongs to the KIR receptor family displaying 3 immunoglobulin-like domains and a long cytoplasmic tail.
KIR3DL2 has been reported to be a candidate for target therapy, since a monoclonal antibody that binds to KIR3DL2 is able to induce an antibody-dependent cellular cytotoxicity (ADCC) against malignant T-cells expressing KIR3DL2 (WO 2010/081890).
Furthermore, Sivori et al. (A novel KIR-associated function: evidence that CpG DNA uptake and shuttling to early endosomes is mediated by KIR3DL2; Blood, 2010, 116(10): 1637-1647) discloses the use of CpG oligodeoxynucleoside to treat NK-cells (Natural killer) and to induce the NK-cells to produce and to release various cytokins. There is a need in the art for novel therapeutic strategies against T-cell lymphomas, as well as for reliable tools for diagnosing these diseases.
SUMMARY OF THE INVENTION
In a first aspect, the invention describes a ligand molecule, that specifically binds to KTR3DL2 for the prevention and/or the treatment of a KIR3DL2 expressing malignant T- cells lymphoma selected from the group comprising Sezary syndrome, transformed mycosis fungoides, sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T- cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
In one aspect, the invention relates to a ligand molecule, that specifically binds to KTR3DL2 for the prevention and/or the treatment of a KIR3DL2 expressing malignant T- cells lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T- cell lymphoma.
In another aspect, the present invention describes a pharmaceutical composition comprising a ligand molecule as defined in the present invention and a pharmaceutically acceptable carrier for the prevention and/or the treatment of a KIR3DL2 expressing malignant T-cells lymphoma selected from the group comprising Sezary syndrome, transformed mycosis fungoides, sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy- associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma- delta T-cell lymphoma. In one aspect, the present invention relates to a pharmaceutical composition comprising a ligand molecule as defined in the present invention and a pharmaceutically acceptable carrier for the prevention and/or the treatment of a KIR3DL2 expressing malignant T-cells lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T- cell lymphoma.
Another aspect of the invention describes a method for a treating KIR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a ligand molecule that specifically binds to KTR3DL2, wherein said lymphoma is selected from the group comprising transformed mycosis fungoides, subcutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma. Another aspect of the invention retates to a method for a treating KTR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a ligand molecule that specifically binds to KIR3DL2, wherein said lymphoma is selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T- cell lymphoma.
In another aspect of the present invention relates to a method for treating a KIR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a pharmaceutical composition comprising a ligand molecule that specifically binds to KIR3DL2, and a pharmaceutically acceptable carrier, wherein said lymphoma is selected from the group comprising transformed mycosis fungoides, sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma, preferably sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy- associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
A still further aspect of the invention relates to an in vitro use of a level of expression of KIR3DL2 as a biomarker for diagnosing and/or monitoring a lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T- cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
In another aspect, the invention relates to an in vitro method for diagnosing and/or monitoring a lymphoma in an individual comprising at least a step of quantifying the level of expression of KTR3DL2, said lymphoma being selected from the group comprising subcutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
In another aspect, the invention also relates to a method for monitoring the effectiveness of treatment against a lymphoma, in an individual in need thereof, with a therapeutic agent, said method comprising the steps of:
(i) providing a pre-administration biological sample from an individual prior to administration of the therapeutic agent;
(ii) measuring the level of expression of KIR3DL2 in the pre-administration biological sample;
(iii) providing one or more post-administration biological samples from the individual;
(iv) measuring the level of expression of KIR3DL2 in the post-administration biological samples;
(v) comparing the level of expression of KIR3DL2 measured for the pre- administration biological sample with the level of expression of KIR3DL2 measured for the post-administration biological sample or samples; and
(vi) altering the administration of the therapeutic agent to the individual accordingly, wherein said lymphoma is selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
In a further aspect, the present invention relates to a method for monitoring the effectiveness of treatment against a lymphoma, in an individual in need thereof, with a therapeutic agent, said method comprising the steps of: (i) providing a pre-administration biological sample from an individual prior to administration of the therapeutic agent;
(ii) measuring the ratio of the levels of expression of KIR3DL2/KIR3DL1 in the pre- administration biological sample;
(iii) providing one or more post-administration biological samples from the individual;
(iv) measuring the ratio of the levels of expression of KIR3DL2/KIR3DL1 in the post-administration biological samples;
(v) comparing the ratio of the levels of expression of KIR3DL2/KIR3DL1 in the pre- administration biological sample with the ratio of the levels of expression of
KIR3DL2/KIR3DL1 in the post-administration biological sample or samples; and
(vi) altering the administration of the therapeutic agent to the individual accordingly, wherein said lymphoma is selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, and hepatosplenic gamma-delta T-cell lymphoma.
In another aspect, the invention also relates to a method for adapting a treatment against a lymphoma in an individual in need thereof, wherein said method comprises at least the steps of :
a) performing, on at least one biological sample collected from said individual, the in vitro diagnosis method according to the present invention; and
b) adapting the treatment against the lymphoma of said individual by administering to said individual a suitable therapy,
wherein said lymphoma is selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
Another aspect of the invention relates to a method for screening a compound candidate that affects KIR3DL2 expression level, said method comprising the step of:
a) providing at least one T-cell able to express KIR3DL2; b) measuring KIR3DL2 expression level by the at least one T-cell provided at step a), whereby a first KIR3DL2 expression value is obtained;
c) incubating the said KIR3DL2 expressing at least one T-cell with a candidate compound to be tested;
d) measuring the KIR3DL2 expression level by the KIR3DL2 expressing at least one T-cell of step c), whereby a second KTR3DL2 expression value is obtained; e) comparing the said first KIR3DL2 expression value with the said second KTR3DL2 expression value; and
f) selecting the said candidate compound when the said second KTR3DL2 expression value is lower than the said first KIR3DL2 expression value.
A further aspect of the present invention relates to a method for the screening of a candidate compound that affects KTR3DL2 biological activity, said method comprising the step of:
a) providing at least one T-cell able to express KIR3DL2;
b) measuring KTR3DL2 biological activity in the at least one T-cell provided at step a), whereby a first activity value is obtained;
c) incubating KIR3DL2 expressing T-cell with a candidate compound to be tested; d) measuring the KTR3DL2 biological activity in the KTR3DL2 expressing T-cell obtained at the end of step b), whereby a second activity value is obtained;
e) comparing the said first activity value with the said second activity value.
Finally, another aspect of the present invention relates to a kit for diagnosing and/or monitoring a lymphoma in an individual, which kit comprises means for quantifying the level of expression of KTR3DL2 or the levels of expression of KIR3DL1 and KIR3DL2, said lymphoma being selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T- cell lymphoma.
The invention has for advantages to provide a simple, cost-effective, and reliable assay to diagnose and/or monitor a subset of cutaneous lymphomas and nodal and extra nodal non- cutaneous lymphomas. According to another of its advantages, the invention allows for monitoring a therapeutic treatment presumed effective for preventing and/or treating a subset of cutaneous lymphomas and nodal and extra nodal non-cutaneous lymphomas or for screening drug candidate presumed effective for preventing and/or treating a subset of cutaneous lymphomas and nodal and extra nodal non-cutaneous lymphomas.
LEGEND OF THE FIGURES
Figure 1: KIR3DL2 protein expression in tissue samples of a subset of cutaneous PTCL.
The inventors assume that the labelling obtained with antibodies from the 5.133 clone (Miltenyi-Biotec), that specifically react with both KIR3DL2 and KIR3DL1, actually identified KIR3DL2 as RT-PCR studies showed no or a very low expression of KIR3DL1 transcripts, as compared to KIR3DL2.
(A) and (B). Sezary syndrome samples from the PHRC KIRs, with a dense neoplastic infiltrate (A) or a slight perivascular infiltrate (B) labelled with the anti-KIR3DL2 monoclonal antibody, showing both a membrane positivity with no background labelling. Epidermotropic neoplastic cells can be identified in A (arrowheads)
(C) and (D). A case of transformed mycosis fungoides (MF) showed strong membrane expression of KTR3DL2, including in epidermotropic neoplastic cells within the epidermis (Ep, arrowheads).
(E) and (F). Primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma (CTCL) showed diffuse expression of KIR3DL2 by the neoplastic cells, in both the dermis and the epidermotropic cells (arrowheads).
(G) and (H). Sub-cutaneous 'panniculitis-like' T-cell lymphoma (TCL) displayed scattered KIR3DL2+ cells. Some stained cells are in the vicinity of adipocytes where the neoplastic cells usually localize, but the staining is heterogeneous.
Original magnifications: A, B, D, F, G and H : x 200; C and E : x 100.
Figure 2: KIR3DL2 expression in tissue samples of a subset of non-cutaneous PTCL.
Although no data regarding KIR3DL1 transcripts are available in this group, the correlation between KIR3DL2 transcript detection using transcriptomic analyses and labelling with the 5.133 monoclonal antibody suggests that only KIR3DL2 was actually labelled at the surface of neoplastic T-cells.
(A) and (B). Peripheral T-cell lymphoma, not otherwise specified (PTCL/NOS) showed no significant expression of KIR3DL2, with only scattered positive cells, that may correspond to reactive CD8+ effector T-cells and/or natural killer cells (arrowheads).
(C) and (D). Enteropathy-associated T-cell lymphoma (EATL) showed a diffuse and strong KIR3DL2 positivity. An intra-tumoral vessel is seen (V), showing labelling neither in the endothelium (arrow) nor in the pericytes.
(E) and (F). Adult T-cell leukemia lymphoma (ATLL) showed a strong and diffuse expression of KTR3DL2. As in the preceding case, intra-tumoral vessels taken as negative controls are not stained (negative endothelial cells, arrow).
(G) and (H). Hepatosplenic T-cell lymphoma (HSTL) displayed a diffuse expression of KTR3DL2.
Original magnifications: A, B, E, G and H : x 200; D and F : x 100.
Figure 3: KIR3DL2 transcript expression in hepatosplenic T-cell lymphomas (HSTL).
In this graph are presented the relative KTR3DL2 mRNA levels in the hepatosplenic T-cell lymphoma (HSTL), enteropathy-associated T-cell lymphoma (EATL) and adult T-cell leukemia lymphoma (ATLL) samples shown to be positive for KIR3DL1/2 using immunohistochemistry (grey), in all the HSTL and angioimmunoblastic T-cell lymphoma (AITL) samples from the PHRC TENOMIC group (white).
Figure 4: Down-modulation of KTR3DL2 expression on tumoral Sezary cells upon CpG ODN-C treatment.
(A) Peripheral blood mononuclear cells (PBMC) from Sezary patients were left untreated or incubated in the presence of CpG ODN-C (10 g/ml) or AZ158 mAb (2 μ^ηιΐ). After 24 h of incubation, cells were labelled with anti-KIR3DL2 mAb (Q66) plus FITC-conjugated goat anti-mouse IgM secondary antibodies, anti-TCRV-PE, -CD3-PC5 and CD4-PC7 mAbs. Shown are the TCRV B/KIR3DL2 stainings corresponding to the gated CD3+CD4+ T lymphocyte population. The mean fluorescence intensity (MFI) of KIR3DL2 labelling is indicated. (B) Graphical representation of KIR3DL2 MFI observed on the CD3+CD4+ cells from Sezary patients (n=12) following incubation with CpG ODN-C, control (Ctrl) ODN or AZ158 mAb. Figure 5: KIR3DL2 binding with AZ158 mAb, but not CpG ODN-C, down- modulates the CD3-induced proliferation and induces cell death of Sezary cells.
(A) PBMC from Sezary patient were pre-loaded with carboxyfluorescein succinimidyl ester (CFSE) and further left untreated or incubated with anti-CD3 mAb, AZ158 mAb or CpG ODN-C alone or in combination, as indicated. After 4 days of culture, cells were collected and subjected to flow cytometry analyses. Shown are the CFSE staining of the gated TCRV 3+ CD4+ tumoral T cell clone.
(B) Cells treatment was conducted as in (A). Immunolabellings were performed using anti-TCRV3-PE and -CD4-FITC mAb and 7AAD. The % of early (7AADlow) and late (7AADhigh) apoptotic cells within the TCRV3+CD4+ tumoral cells are indicated. The results shown in (A) and (B) are representative of experiments performed on 4 Sezary patients.
(C) Freshly isolated Sezary syndrome cells were incubated with anti-CD3 and/or AZ158 mAb, as indicated. An isotype matched control mAb (anti-CD 16) was used to equalize the amount of antibodies used in each condition. Cross-linking was induced by addition of goat anti-mouse Igs except for resting condition (NT). After lysis, the antibodies-targeted molecules were collected and the resulting immunoprecipitates subjected to electrophoresis and Western blotting procedures. The immunoblot was revealed with an anti- phospho-CD3 mAb (upper panel), and re-probed after de-hybridization using an anti- CD3 mAb to assess efficient immunoprecipitation (lower panel).
(D) Sezary patient CD4+ T-cells were activated with anti-CD3 alone or together with AZ158 mAb or CpG ODN-C and subjected to lysis. Post-nuclear lysates were prepared, resolved by SDS-10% PAGE and analyzed by Western blotting using an anti-phospho-Erk mAb. Equal loading of the samples was assessed after stripping and reprobing with anti- Erkl/2 antibodies. Figure 6: CpG ODN-C induces malignant Sezary cells apoptosis.
(A) Sezary patient PBMCs were incubated with CpG ODN-C, AZ158 mAb or control ODN for 7 days at 37°C. Stainings for the detection of apoptotic TCRV B+ CD4+ tumoral T cells were performed as described in the legend of Figure 5B.
(B) Graphical representation of the % of early (7AADlow) and late (7AADhigh) apoptotic cells within the TCRV+CD4+ population of Sezary patients (n=8) following incubation with CpG ODN-C or control ODN (Ctrl).
(C) Sezary cell line was incubated for the indicated time with CpG ODN-C. Post-nuclear lysates were prepared and processed for SDS-PAGE and immunoblotting. Blots were probed successively with anti- cleaved-caspase 7, -caspase 3, -PARP and Erkl/2 antibodies.
Figure 7: CpG ODN-C treatment of Sezary cells results in STAT3 dephosphorylation.
(A) Sezary cell line was incubated for the indicated time with CpG ODN-C. Cellular lysates were subjected to gel electrophoresis and transferred to nitrocellulose membrane. Blots were then revealed using anti-phospho-STAT3 antibodies, de-hybridized and re- probed with STAT3 antibodies.
(B) Sorted CD4+ T-cells (98% of which were KIR3DL2+) from a Sezary patient were incubated in medium alone or supplemented with CpG ODN-C, AZ158 mAb or control
ODN for 24h at 37°C. Lysates were then analysed as in (A).
Figure 8: GpC ODN treatment of Sezary cells results in apoptosis.
(A) PBMCs from a Sezary patient were incubated without any oligonucleotide (curve 1) or with CpG ODN-C (curve 2), GpC (curve 3) or control ODN (curve 4) for 7 days at
37°C. KTR3DL2 expression on the malignant CD4+ T cells (identified as TCR νβ1+ cells) was assessed for each condition of incubation.
(B) PBMCs from a Sezary patient were incubated with CpG ODN-C, GpC or control ODN for 7 days at 37°C. Stainings for the detection of apoptotic TCRVB1+ CD4+ tumoral T cells, i.e. early (7AADlow) and late (7AADhigh) apoptotic cells, were performed as previously described (see Figure 5B). (C) Percentages of early (7AADlow) and late (7AADhigh) apoptotic cells from (B) are plotted for each type of treatment.
DETAILED DESCRIPTION OF THE INVENTION
Taking into account the high degree of discrepancy between the various experimental data available in the art, the present inventors have initiated experimental work ab initio with the view of determining the feasibility of providing diagnosis and/or therapeutic tools for T-cell lymphomas.
The present invention relies upon the findings that KIR3DL2 is found to be overexpressed at the surface of T-cells from several individuals having a cutaneous PTCL such as Sezary syndrome, transformed mycosis fungoides and adult T-cell leukaemia/lymphoma as well as, most surprisingly, a subset of both cutaneous and non-cutaneous nodal and extra nodal lymphomas.
To the inventor's knowledge, KIR3DL2 could be identified, for the first time, as a relevant and specific biomarker for two cutaneous PTCLs, such as sub-cutaneous panniculitis-like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T- cell lymphoma, and two non-cutaneous PTCLs, namely enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
However, KIR3DL2 could not be identified as a significant, relevant and specific biomarker for some cutaneous PTCLs, such as primary cutaneous CD30+ T-cell lymphoproliferative disorders, and for some non-cutaneous PTCLs, such as angioimmunoblastic T-cell lymphoma, anaplastic large cell lymphomas, both ALK negative and ALK positive, extranodal K/T cell lymphomas nasal type and peripheral T- cell lymphomas not otherwise specified.Hence KIR3DL2 has revealed to consist of a relevant biomarker for diagnosing and/or monitoring these specific lymphomas, as well as an advantageous biomarker for providing a first screen of a defined subset of both cutaneous and non-cutaneous PTCL diseases.
KIR3DL2 ASA BIOMARKER
Considering the results from Michel et al. (Combination of PSL3, Twist, CD158/KIR3DL2 and Kp46 gene expression for the diagnosis of Sezary syndrome. J Invest Dermatol. 2012; 132(2), page S50), Bagot et al (CD4(+) cutaneous T-cell lymphoma cells express the pl40-killer cell immunoglobulin-like receptor. Blood. 2001 Mar 1; 97(5): 1388-91), Poszepczynska-Guigne et al (CD158k/KIR3DL2 is a new phenotypic marker of Sezary cells: relevance for the diagnosis and follow-up of Sezary syndrome. J Invest Dermatol. 2004 Mar; 122(3):820-3) Ortonne et al (CD158k/KIR3DL2 and Kp46 are frequently expressed in transformed mycosis fungoides. Exp Dermatol. 2012 Jun; 21(6):461-3) and the teaching of WO 02/50122 and WO 2010/081890, in contradiction with the results from Booken et al (Sezary syndrome is a unique cutaneous T-cell lymphoma as identified by an expanded gene signature including diagnostic marker molecules CDOl and D M3. Leukemia. 2008 (22), 393-399), Iqbal et al (Molecular signature to improve diagnosis in peripheral T-cell lymphoma and prognostication in angioimmunoblastic T-cell lymphoma; Blood, 2010, 115(5): 1026-36) and the teaching of WO 2007/071829, the inventors assessed the overexpression of KIR3DL2 in T-cells from Sezary syndrome and transformed mycosis fungoides. As a negative control for KTR3DL2 expression, the inventors' first approach was to select other lymphoma types from the cutaneous PTCL sub-group, as well as lymphoma types from the non-cutaneous nodal and extra nodal PTCL sub-group. Because, at the time of the instant invention, systematic biomarker approaches performed by several research teams did not provide any specific correlation between a change in expression of KTR3DL2 and the occurrence of any of these PTCLs, except for Sezary syndrome, transformed mycosis fungoides and adult T-cell lymphoma, said other types of lymphomas were assumed not to express KTR3DL2 at the surface of the malignant T-cells.
As mentioned already, except for the fact that all PTCLs are characterized by alterations in the T-cell cellular type, their physiological, histological, clinical and prognosis features of are quite various and different, which explain the difficulty to classify these various diseases.
For example, cutaneous PTCLs, other than Sezary syndrome or transformed mycosis fungoides, which were discussed above, may be distinguished as follows: primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphomas are aggressive T-cell type lymphomas featured by localized or disseminated eruptive papules, nodules or tumors that show central ulceration and necrosis or superficial, hyperkeratotic patches and plaques;
sub-cutaneous panniculitis-like T-cell lymphomas represent rare forms of indolent T-cell lymphomas; patients are often seen with solitary or multiple nodules and plaques, usually involving the legs; ulceration of the nodules and plaques are rather not common. cutaneous PTCLs, one may distinguish: adult T-cell leukaemias/lymphomas are associated with the human T-cell leukaemia virus- 1, which may be transmitted during unprotected sexual activity, childbirth, breast feeding, blood transfusion; usually their prognosis is poor;
anaplastic large cell non cutaneous lymphomas are rare lymphomas, affecting mainly nodal sites; they are subdivided as ALK negative and ALK positive lymphomas, depending on, respectively, the absence or the presence of a protein called "anaplastic lymphoma kinase" (ALK); ALK negative patients usually require more aggressive treatment, whereas ALK positive patients are much responsive to chemotherapy;
angioimmunoblastic T-cell lymphomas are common PTCLs and present an aggressive course; they affect mainly lymph nodes, and may affect the skin, the liver or the spleen;
enteropathy-associated T-cell lymphomas are significantly associated with celiac disease, caused by a hypersensitivity to gluten; they are characterized by stomach pain, weight loss, gastrointestinal bleeding or bowel perforation;
extranodal K/T cell lymphomas, nasal type, are affecting the nasal and the paranasal sinus areas behind the nose and the cheeks, and may affect also the skin, the gastrointestinal tract and testes; these lymphomas are associated with the Epstein-Barr virus;
hepatosplenic gamma-delta T-cell lymphomas are rare and aggressive diseases that originate from the liver or the spleen;
peripheral T-cell lymphomas, not otherwise specified are the most common
PTCLs and comprise various aggressive T-cell lymphomas that cannot be encompassed by the other subcategories of PTCLs; most patients are affected at nodal sites, although extranodal sites may be also affected, such as the bone marrow, the liver, the gastrointestinal tract or the skin.
Frozen skin samples of patient with a cutaneous PTCL such as Sezary syndrome; transformed mycosis fungoides; primary cutaneous CD30+ T-cell lymphoproliferative disorder (cutaneous anaplastic large cell lymphoma and lymphomatoid papulosis); subcutaneous panniculitis-like T-cell lymphoma; primary cutaneous nasal-type K/T-cell lymphoma ; and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma were assessed for KTR3DL2 overexpression at the surface of T-cells. Tissue sample obtained from patients with a nodal or extra nodal non-cutaneous PTCL, such as angioimmunoblastic T-cell lymphoma (AITL); anaplastic large cell lymphoma, ALK negative; anaplastic large cell lymphoma, ALK positive; enteropathy-associated T- cell lymphoma (EATL); adult T-cell leukaemia/lymphoma (ATLL); extra nodal K/T cell lymphomas nasal-type; hepatosplenic gamma-delta T-cell lymphomas (HSTL); and peripheral T-cell lymphoma, not otherwise specified (PTCL/NOS) were also assessed for KTR3DL2 overexpression at the surface of T-cells.
The results unambiguously confirmed that T-cells obtained from all 7 Sezary syndrome patients expressed KIR3DL2 at the surface of T-cells (see EXAMPLE 1).
However, and surprisingly, besides Sezary syndrome and transformed mycosis fungoides, a subset of both cutaneous and non-cutaneous nodal and extra nodal PTCL was shown to overexpress KIR3DL2 at the surface of T-cells.
As for cutaneous malignant T cells lymphomas, sub-cutaneous panniculitis-like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma were shown expressing KIR3DL2. Moreover, both enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma were shown to represent two non-cutaneous KIR3DL2 expressing malignant T cells lymphomas. Uses of KIR3DL2 expression as a biomarker
Hence, a first aspect of the present invention relates to an in vitro use of a level of expression of KIR3DL2 as a biomarker for diagnosing and/or monitoring a lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, and hepatosplenic gamma-delta T-cell lymphoma.
A further aspect of the invention relates to an in vitro use of a ratio of levels of expression of KIR3DL2/KIR3DL1 as a biomarker for diagnosing and/or monitoring a lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, and hepatosplenic gamma-delta T-cell lymphoma.
In one preferred embodiment, a lymphoma is a cutaneous KIR3DL2 expressing malignant T cells lymphoma being selected from the group comprising sub-cutaneous panniculitis- like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma.
In another preferred embodiment, a lymphoma is a non-cutaneous KIR3DL2 expressing malignant T cells lymphoma being selected from the group comprising enteropathy- associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
As used herein, a ratio of levels of expression of KIR3DL2/KIR3DL1 encompasses both (i) a value of the ratio between the measured expression level of KIR3DL2 and the measured expression level of KTR3DL1 and (ii) a value of the ratio between the measured expression level of KTR3DL1 and the measured expression level of KIR3DL2. Preferably herein, a ratio of levels of expression of KIR3DL2/KTR3DL1 consists of a value of the ratio between the measured expression level of KIR3DL2 and the measured expression level of KIR3DL1.
KTR3DL2 is also known as CD158k and KAT4 gene, or CD158k/KIR3DL2. KIR3DL1 is also known as CD158e, NKB 1, NKAT3 and AMB11, or CD158e/KIR3DLl . For the purpose of the present invention, the inventors consider that these names are equivalent.
KIR3DL1 and KIR3DL2 both refer to the internationally recognized names of the corresponding genes, and proteins in the sequences databases, including the database from the HUGO (Human Genome Organisation) Gene Nomenclature Committee (available notably at http://www.gene.ucl.ac.uk/nomenclature/index.html).
It has been shown that KIR3DL1 was poorly synthesized in T-cells, when mRNA analyses were conducted in healthy individuals and in individuals having a PTCL. A ratio between the respective expression levels of KIR3DL2 and KIR3DL1 thus provides a value that can be directly compared from one individual to another.
In the present invention, the levels of expression of KIR3DL1 and KIR3DL2 are advantageously quantified by measuring the level of mRNA expression.
Any method for measuring the mRNA expression known from the skilled artisan is suitable for implementing the present invention, which includes the well-known RT-PCR method using a specific pair of primers for each target marker.
In another preferred embodiment, the levels of expression of KIR3DL1 and KIR3DL2 are quantified by measuring the level of cellular protein expression, preferably the level of protein surface expression. In a preferred embodiment, the use according to the present invention further comprises measuring the expression levels of a combination of biomarkers, namely KIR3DL2 and one or more additional biomarkers known to be associated with the said cutaneous lymphomas and the nodal and extra nodal non-cutaneous lymphomas that are within the scope of the present invention. Illustratively, the said one or more additional biomarkers encompass, but are not limited to, the surface membrane complex CD3, the surface membrane proteins CD8, CD30, CD56 and PD1, the CXCL13 chemokine and the cytotoxic proteins granzyme B (GrB) and T-cell intracellular antigen (TiAl), together with the EBV (Epstein-Barr virus) specific EBER (EBV-encoded RNA) transcripts. According to general embodiments of the present invention described herein, the level of cellular protein expression may be performed notably (i) by measuring the amount of the said protein contained in a whole cell sample or (ii) by measuring the amount of the said protein that is present at the cell surface, preferably at the T-cell surface. Measuring the amount of a protein marker of interest contained in a whole cell sample may be performed by Western blotting starting from the soluble fraction of a cell lysate and using an antibody directed against the said protein marker of interest, according to methods that are well known by the one skilled in the art.
The expression values of each biomarker of interest, including the expression values of each of KTR3DL2 and KTR3DL1, may be expressed as arbitrary units. Illustratively, the expression value of a biomarker of interest may be expressed as a ratio between (i) the measured expression value of the said biomarker (e.g. KTR3DL2 or KIR3DL1) and (ii) the measured expression value of a gene whose expression level is constant, such as the expression value of CD36. Measuring the amount of a protein marker of interest that is present at the cell surface may be performed by immunochemistry, either by immuno-labelling of fixed cells or by flow immunocytometry, according to methods that are well known by the skilled person in the art.
Thus, in specific embodiment, quantifying the selected markers according to the in vitro diagnosis method described herein encompasses those wherein:
(i) the selected markers are quantified by immunochemical methods, which include quantification of one or more protein markers of interest by immunodetection methods, for example using antibodies directed specifically against each of the said one or more protein markers, according to well-known immuno-detection methods, for example flow cytometry, and
(ii) the selected markers are quantified by gene expression analysis, which include quantification of one or more marker mRNAs of interest, for example by performing a Real-Time PCR Taqman PCR analysis. Marker quanti fication by measuring the level of mRNA expression
In a preferred embodiment, the said markers are quantified by measuring the level of mRNA expression.
As shown in the examples herein, the KIR3DL2 marker and KIR3DL1 expression may be measured by performing the well-known quantitative real-time PCR (RT-PCR) amplification technique, wherein primers specific for each of the genes KIR3DL2 and KIR3DL1 are used.
In a preferred embodiment, the level of mRNA expression for each of the markers tested is performed using the well-known technique of RT-PCR, then forming complexes between the double-stranded nucleic acids resulting from amplification and fluorescent SYBR® molecules and then by measuring the fluorescence signal generated by the SYBR® molecules complexed with the said amplified nucleic acids.
Primers specific for each of the genes mRNA consists of a routine work for the one skilled in the art. Illustratively, the one skilled in the art may use the specific primers for each of KIR3DL2 and KTR3DL1 that are disclosed in the examples herein.
In some preferred embodiments, quantification of KIR3DL2 may be performed by using the pair of primers of SEQ ID N°l and 2:
SEQ ID NO: 1: forward 5'- CAACTTCTCCATCGGTCCCTTGATG -3'; and
SEQ ID NO: 2: reverse 5'- GTTTGACCACACGCAGGGCAG -3'. In some preferred embodiments, quantification of KIR3DL1 may be performed by using the pair of primers of SEQ ID N°3 and 4:
SEQ ID NO: 3: forward 5'- GGACATCGTGGTCACAGGTCC -3'; and
SEQ ID NO: 4: reverse 5'- GCCTGGAATGTTCTGTTGACCTTGC -3'.
Marker quantification by measuring the level of protein expression
Such techniques include detection and quantification of protein-type markers with any type of ligand molecule that specifically binds thereto, including nucleic acids (for example nucleic acids selected for binding through the well-known SELEX method), antibodies and antibody fragments. Noticeably, antibodies are presently already available for the biomarker consisting of KIR3DL2 and for KIR3DL1, as described in the present specification.
Illustratively, the one skilled in the art may use the monoclonal anti-KIR3DL2 antibody marketed by the company Aviva Systems Biology, under the Reference number OAAB050807.
Further illustratively, the one skilled in the art may use the monoclonal anti-KIR3DLl antibody marketed by the company Novus Biologicals under the reference number NPB- 147006.
Yet illustratively, the one skilled in the art may use a mouse IgGl monoclonal antibody that binds to both KIR3DL2 and KIR3DL1. In these embodiments, the expression level value of KIR3DL2" consists of the expression level value of both KIR3DL2 and KIR3DL1.
As it is shown in the examples herein, there is a low expression level of KIR23DL1 as compared with the expression level of KIR3DL2. This is why measuring only the expression level of KIR3DL2 consists of a relevant biomarker according to the invention.
Further, antibodies to said given marker may be easily obtained with the conventional techniques, including generation of antibody-producing hybridomas.
Hybridomas prepared by conventional techniques are then screened using standard methods to identify one or more hybridomas which produce an antibody which specifically binds with the biological marker protein or a fragment thereof. The invention also encompasses hybridomas made by this method and antibodies made using such hybridomas. Polyclonal antibodies may be used as well.
Thus, in preferred embodiments, expression of a marker is assessed using for example:
- a radio-labelled antibody, in particular, a radioactive moiety suitable for the invention may for example be selected within the group comprising H, 121I,
123I, "mTc, 14C or 32P;
- a chromophore-labelled or a fluorophore-labelled antibody, wherein a luminescent marker, and in particular a fluorescent marker, suitable for the invention may be any marker commonly used in the field such as fluorescein, BODIPY, fluorescent probes type ALEXA, coumarin and its derivatives, phycoerythrin and its derivatives, or fluorescent proteins such as GFP or the DsRed;
- a polymer-backbone-antibody,
- an enzyme-labelled antibody, said labelling enzyme suitable for the invention may be an alkaline phosphatase, a tyrosinase, a peroxydase, or a glucosidase; for example, suitable avidin-labelled enzyme may be an avidin- Horse Radish Peroxydase (HRP), and a suitable substrate may be AEC, 5- bromo-4-chloro-3-indolyl phosphate (BCIP), nitro blue tetrazolium chloride (NBT);
- an antibody derivative, for example an antibody conjugated with a substrate or with the protein or ligand of a protein-ligand pair, in particular a biotin, a streptavidin or an antibody binding the polyhistidine tag;
- an antibody fragment, for example a single-chain antibody, an isolated antibody hypervariable domain, etc., which binds specifically to a marker protein or a fragment thereof, including a marker protein which has undergone all or a portion of its normal post-translational modification.
In vitro techniques for detection of a biological marker protein include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations and immunofluorescence.
In another preferred embodiment, the level of expression of KIR3DL2 is expressed as a ratio of levels of expression of KIR3 DL2/KIR3 DL 1.
Method for in vitro diagnosing and/or monitoring
In another aspect, the present invention relates to an in vitro method for diagnosing and/or monitoring a lymphoma in an individual comprising at least a step of quantifying the level of expression of KIR3DL2, said lymphoma being selected from the group comprising subcutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, and hepatosplenic gamma-delta T-cell lymphoma. Within the scope of the instant invention, the methods for in vitro diagnosing and/or monitoring encompass diagnosing and/or monitoring of a cutaneous or a non-cutaneous KIR3DL2 expressing malignant T cells lymphoma.
In one preferred embodiment, a lymphoma is a cutaneous KIR3DL2 expressing malignant T cells lymphoma being selected from the group comprising sub-cutaneous panniculitis- like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma.
In another preferred embodiment, a lymphoma is a non-cutaneous KIR3DL2 expressing malignant T cells lymphoma being selected from the group comprising enteropathy- associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
An "individual" to be considered within the present invention may be any subject presenting clinical risks of having a lymphoma, or any subject having been already diagnosed for a lymphoma. Preferably, an individual may be a mammal, and more preferably an animal of economic importance, for example farms, laboratories or food industries animals, such as sheep, swine, cattle, goats, dogs, cats, horses, poultry, mice, rats. Also, an individual according to the invention may be a human. And more preferably, an individual is a human.
The present invention also relates to an in vitro method for diagnosing and/or monitoring a lymphoma in an individual comprising at least a step of quantifying the levels of expression of KTR3DL1 and KTR3DL2, said lymphoma being selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, and hepatosplenic gamma-delta T-cell lymphoma.
The in vitro methods according to the present invention comprise the steps of:
a) providing a biological sample from an individual to be tested,
b) measuring in the said biological sample the expression level of KIR3DL2, c) diagnosing said lymphoma if the value found at step b) is distinct from a predetermined threshold value for the said expression level and is indicative of a lymphoma positive individual. In an advantageous embodiment, the method further relies upon quantifying the level of expression of one or more additional biomarkers known to be associated with the said cutaneous lymphomas and the nodal and extra nodal non-cutaneous lymphomas that are within the scope of the present invention, in combination with quantifying the level of expression of KIR3DL2.
Such one or more additional biomarkers may be selected in the group comprising CD3, CD8, CD30, granzyme B and TiAl .
Uses and methods in accordance with the invention are preferably performed with an isolated biological sample. A "biological sample," as used herein, generally refers to a biological sample obtained, reached, collected or isolated from an individual, in vivo or in situ. Such samples may be, but not limited to, organs, tissues, fractions and cells isolated from a mammal. Exemplary biological samples include but are not limited to a cell culture, a cell line, a tissue biopsy such as a skin biopsy, a nasal tissue biopsy, a gastrointestinal tissue biopsy or lymph node tissue biopsy, an organ, a biological fluid, a blood sample, and the like. Preferred biological samples include but are not limited to a blood sample, peripheral blood mononuclear cells (PBMC) sample or a tissue biopsy, including a skin biopsy, a nasal mucosa biopsy, an intestine biopsy or a lymph node biopsy). The sample can be a crude sample, or can be purified to various degrees prior to storage, processing, or measurement. An isolated biological sample of the invention comprises T-cells.
In a preferred embodiment, the step of collecting biological samples for the uses and methods of the invention may represent the first step of a use or a method in accordance with the invention.
In another preferred embodiment, the step of collecting biological samples for the uses and methods of the invention is performed before carrying out the invention and is not a step of a use or a method in accordance with the invention.
In one embodiment, an isolated biological sample suitable for the invention comprising T- cells may be selected from the group consisting of a blood sample, a tissue biopsy, a fluid sample. The samples suitable for the invention can be purified prior to testing. In some embodiments, the blood mononuclear cells, and preferably the T-cells, can be isolated from the remaining cell contents prior to testing. The separating the blood mononuclear cells or the T-cells may be performed by any methods known in the art, for example by density gradient centrifugation.
According to one embodiment, when using an isolated whole blood sample, peripheral blood mononuclear cells (PBMC), comprising lymphocyte cells and monocyte cells, may be separated from plasma (non-cellular components), polynuclear cells, such as neutrophil cells and eosinophil cells, and erythrocytes. Any known method in the art to separate peripheral blood mononuclear cells (PBMC) from the other blood cell types and non-cellular components may be implemented.
For example, as suitable method, one may cite physical separation methods, such as centrifugations methods. As example of suitable centrifugation methods one may cite gradient density, for example using Ficoll®. Also one may use immunological separation methods, such as, for example, magnetic beads and flow cytometry.
A threshold value for the specific marker KIR3DL2 or the ratio KIR3 DL2/KTR3 DL 1 may be determined for each specific lymphoma, by carrying out a method comprising the steps of:
a) providing (i) a collection of biological samples from individuals already diagnosed for being positive towards at least one of the subset of cutaneous lymphomas or to nodal and extra nodal non-cutaneous lymphomas within the scope of the present invention and (ii) a collection of biological samples from individuals diagnosed for being negative towards said lymphomas,
b) quantifying for each sample from collection (i) provided at step a) the level of expression of KTR3DL2, and optionally KIR3DL1 (to obtain a ratio KIR3DL2/KIR3DL1), whereby a first collection of quantification values for the said marker(s) is obtained,
c) quantifying for each sample from collection (ii) provided at step a) the level of expression of KTR3DL2, and optionally KIR3DL1 (to obtain a ratio KIR3DL2/KIR3DL1), whereby a second collection of quantification values for the said marker(s) is obtained,
d) calculating, from the said first collection of quantification values obtained at the end of step b), the mean quantification value for the said marker in lymphoma- negative individuals,
e) calculating, from the said second collection of quantification values obtained at the end of step b), the mean quantification value for the said marker in one of the said lymphoma-positive individuals,
f) calculating, a threshold value that optimally discriminates between said lymphoma-positive and lymphoma-negative individuals from the mean quantification values obtained at steps d) and e), respectively.
It has to be understood that the lymphoma-positive individuals from step f) of the above- described method is intended to be selected in the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
Furthermore and for the sake of clarity, the expression « optimally discriminates » that is used for describing step f) of the method above means that the said threshold value is calculated and the said value lies between (i) the mean quantification value that is obtained at step d) and the mean quantification value that is obtained at step e) and is the most discriminating between lymphoma-positive and lymphoma-negative individuals.
A threshold value described above shall be performed for each lymphoma in the in vitro diagnosis method of the invention, for the purpose of performing a reliable diagnosis of a lymphoma, from a subset of lymphoma candidates, in an individual. The diagnosis methods from the present invention are intended to provide a first approach to discriminate a subset of specifically defined cutaneous lymphomas and nodal and extra nodal non-cutaneous lymphomas, from the bulk of the PTCL diseases.
Indeed, the threshold values that may be used when performing the in vitro diagnosis method disclosed herein may be expressed as arbitrary units that reflect the expression level of the KTR3DL2 marker in the analysed biological sample, the said expression level either consisting of a protein expression level, for example a cell surface expression level, or a gene expression level, for example a mRNA expression level.
In some embodiments, the in vitro methods according to the present invention comprise the steps of:
a) providing a biological sample from an individual to be tested,
b) measuring in the said biological sample the ratio of levels of expression of KIR3DL2/KIR3DL 1 ,
c) diagnosing said lymphoma if the value found at step b) is distinct from a predetermined threshold value for the said ratio is indicative of a lymphoma positive individual.
In a preferred embodiment, the method further encompasses quantifying the level of expression of one or more additional biomarkers already known to be associated with the said cutaneous lymphomas and the nodal and extra nodal non-cutaneous lymphomas that are within the scope of the present invention. Another aspect of the invention relates to a method for monitoring the effectiveness of treatment against a lymphoma, in an individual in need thereof, with a therapeutic agent, said method comprising the steps of:
(i) providing a pre-administration biological sample from an individual prior to administration of the therapeutic agent;
(ii) measuring the level of expression of KIR3DL2 in the pre-administration biological sample;
(iii) providing one or more post-administration biological samples from the individual;
(iv) measuring the level of expression of KIR3DL2 in the post-administration biological samples;
(v) comparing the level of expression of KIR3DL2 in the pre- administration biological sample with the level of expression of KIR3DL2 in the post- administration biological sample or samples; and
(vi) altering the administration of the therapeutic agent to the individual accordingly, said lymphoma being selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
In a preferred embodiment, the invention relates to a method for monitoring the effectiveness of treatment against a lymphoma, in an individual in need thereof, with a therapeutic agent, said method comprising the steps of:
(i) providing a pre-administration biological sample from an individual prior to administration of the therapeutic agent;
(ii) measuring the ratio of the levels of expression of KIR3DL2/KTR3DL1 in the pre- administration biological sample;
(iii) providing one or more post-administration biological samples from the individual;
(iv) measuring the ratio of the levels of expression of KIR3DL2/KIR3DL1 in the post-administration biological samples;
(v) comparing the ratio of the levels of expression of KIR3DL2/KTR3DL1 in the pre-administration biological sample with the ratio of the levels of expression of
KIR3DL2/KIR3DL1 in the post-administration biological sample or samples; and
(vi) altering the administration of the therapeutic agent to the individual accordingly, said lymphoma being selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
Advantageously, a method for monitoring the effectiveness of treatment against a lymphoma within the scope of the present invention may comprise measuring the level of one or more additional bio markers that have been already been identified in the art to be specific for each kind of lymphoma.
For example, a worse diagnosis that is determined by assessing the expression level of the KTR3DL2 biomarker or the KIR3DL2/KIR3DL1 ratio, during the course of treatment may indicate ineffective dosage and the desirability of increasing the dosage. Conversely, a better diagnosis that is determined by assessing the expression level of the selected markers, namely the level of expression of KIR3DL2 or the ratio KIR3DL2/KIR3DL 1 , may indicate efficient treatment and hence the absence of a need to change dosage. The present invention also relates to a method for adapting a treatment against a lymphoma in an individual in need thereof, wherein said method comprises at least the steps of:
a) performing, on at least one biological sample collected from said individual, the in vitro diagnosis method according to the present invention; and
b) adapting the treatment against the lymphoma of said individual by administering to said individual a suitable therapy,
said lymphoma being selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
A suitable therapy may include chemotherapy, radiotherapy and bone marrow transplantation.
As examples of chemotherapy suitable for treating the cutaneous lymphomas and the nodal and extra nodal non-cutaneous lymphomas within the scope of the present invention one may cite cyclophosphamide, doxorubicin, vincristine, prednisone, etoposide, ifosfamide, carboplatin, gemcitabine, vinorelbine, dexamethasone, cytarabine, cisplatin and the like.
Methods for screening compounds of therapeutic interest
As an increase of KTRD3DL2 expression level is specifically correlated with a subset of cutaneous and nodal and extra nodal non-cutaneous lymphomas, isolating, screening and administering compounds that affect KIR3DL2 expression levels and/or biological activities may be useful in treating and/or preventing the occurrence of such hyper- proliferative T-cell lymphomas. Compounds of interest are especially those which induce an inhibition of the expression of KIR3DL2 in T cells.
Hence, another aspect of the present invention relates to a method for screening a compound candidate that affects KTR3DL2 expression level, said method comprising the step of:
a) providing at least one T-cell able to express KIR3DL2; b) measuring KIR3DL2 expression level by the at least one T-cell provided at step a), whereby a first KIR3DL2 expression value is obtained;
c) incubating the said KIR3DL2 expressing at least one T-cell with a candidate compound to be tested;
d) measuring the KIR3DL2 expression level by the KIR3DL2 expressing at least one T-cell of step c), whereby a second KTR3DL2 expression value is obtained; e) comparing the said first KIR3DL2 expression value with the said second KTR3DL2 expression value, and
f) selecting the said candidate compound when the said second KTR3DL2 expression value is lower than the said first KIR3DL2 expression value.
Alternatively, both KTR3DL1 and KIR3DL2 expression levels may be measured at steps b) and d) of the above described screening method, and the ratios KIR3DL2/KTR3DL1 corresponding to the first and the second values are calculated at the end of steps b) and d) respectively and compared at the end of step e). In a preferred embodiment, the second KIR3DL2 expression value is lowered as compared to the quantitative first value by a factor at least of about 2, for example of about 3, for example of about 4, for example of about 5, for example of about 10, for example of about 20 or for example of about 50.
In some embodiments, candidate compounds encompass small organic molecules that may be obtained either after purification from a natural source or after semi- or whole chemical synthesis. In addition to the above described compounds aimed for inhibiting the gene expression of KTR3DL2, it is envisioned that small molecules or other natural products may be identified and employed to inhibit the transcription in vivo of the KIR3DL2 gene.
In some embodiments, candidate compounds encompass a ribozyme, an antisense oligonucleotide, a triple helix DNA, a RNA aptamer and/or double-stranded RNA directed to an appropriate nucleotide sequence of KIR3DL2 nucleic acid. These compounds may be identified, isolated or synthesized de novo, using conventional techniques known from a skilled person in the art without undue burden or experimentation. For example, inhibition of KTR3DL2 gene expression can be obtained by designing antisense molecules, of DNA- or RNA-type, targeted towards the important regions of the gene encoding the KIR3DL2 protein.
In another aspect, the present invention relates to a method for the screening of a candidate compound that affects KIR3DL2 biological activity, said method comprising the step of: a) providing at least one T-cell able to express KIR3DL2;
b) measuring KIR3DL2 biological activity in the at least one T-cell provided at step a), whereby a first activity value is obtained;
c) incubating KIR3DL2 expressing T-cell with a candidate compound to be tested; d) measuring the KTR3DL2 biological activity in the KTR3DL2 expressing T-cell obtained at the end of step b), whereby a second activity value is obtained;
e) comparing the said first activity value with the said second activity value.
In preferred embodiments, the said candidate compound is selected at a further step f), when the said second activity value is lower than the said first activity value.
Advantageously, the second value is lowered as compared to the quantitative first value by a factor at least of about 2, for example of about 3, for example of about 4, for example of about 5, for example of about 10, for example of about 20 or for example of about 50.
In the method described above, the biological activity represents, but is not limited to, KTR3DL2 localization at the membrane compartment or KIR3DL2 ability to bind and/or interact with its cellular and/or extracellular partners molecules.
In another aspect, the invention relates to a method for treating or ameliorating a condition of an individual having one of the lymphoma selected within the subset of cutaneous and nodal and extra nodal non-cutaneous lymphoma herein described, comprising administering to said individual in need thereof a pharmaceutical composition comprising an effective amount of at least a compound that affects KIR3DL2 expression levels and/or biological activity, and most preferably of at least a compound that inhibits KIR3DL2 expression levels, or biological activity.
In another preferred embodiment, a compound that affects KIR3DL2 biological activity encompasses antagonists directed towards the KTR3DL2 protein activity. The decreased biological activity, which is aimed as a consequence of the antagonist administration, may be caused by, but is not limited to, a decrease of KIR3DL2 amount in the cellular environment, a defect of KIR3DL2 localization at the membrane compartment, a decrease of KJR3DL2 ability to bind and/or interact with its cellular and/or extracellular partner molecules.
As it is used herein, the term "antagonist" refers to a molecule which decreases the biological activity of KJR3DL2. Antagonists can include, but are not limited to, peptides, proteins, nucleic acids (DNA- and RNA-type aptamers), carbohydrates, antibodies or any molecules which decrease the amount or the biological activity of the KIR3DL2 protein. In a preferred embodiment, the antagonist is an antibody, or an active fragment thereof, such as Fab, F(ab)2, Fab', F(ab')2, Fv and the like that are capable of binding an epitopic determinant, which is involved in said biological activity.
Antibodies or active fragment thereof can be prepared according to the well-known methods available to the skilled person in the art. The inhibitory compounds encompassed by the present invention can be administered as pharmaceutical compositions. Such pharmaceutical compositions for use in accordance with the present invention may be formulated in a conventional manner using one or more physiologically acceptable carriers or excipients.
Thus, the compounds and their physiologically acceptable salts and solvates may be formulated for any possible route of administration, including but not limited to topical, oral, buccal, systemic, parenteral or rectal administration.
Kits
Another aspect of the present invention relates to a kit for diagnosing and/or monitoring a lymphoma in an individual, which kit comprises means for quantifying the level of expression of KTR3DL2 or alternatively the levels of expression of KIR3DL1 and KIR3DL2, said lymphoma being selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma. In a preferred embodiment, the kit further comprises means for quantifying the level of expression of one or more additional biomarkers already correlated with the said cutaneous lymphomas and the nodal and extra nodal non-cutaneous lymphomas that are within the scope of the present invention. Hence, in one preferred embodiment, the present invention relates to a kit for diagnosing and/or monitoring a cutaneous KIR3DL2 expressing malignant T cells lymphoma in an individual, which kit comprises means for quantifying the level of expression of KIR3DL2 or alternatively the levels of expression of KIR3DL1 and KIR3DL2, said lymphoma being selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma.
In another preferred embodiment, the present invention relates to a kit for diagnosing and/or monitoring a non-cutaneous KIR3DL2 expressing malignant T cells lymphoma in an individual, which kit comprises means for quantifying the level of expression of KTR3DL2 or alternatively the levels of expression of KIR3DL1 and KIR3DL2, said lymphoma being selected from the group comprising enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
In a still preferred embodiment, one may take advantage of additional biomarkers, which have been shown to be correlated with one or more of the lymphoma(s) encompassed by the present invention. Such additional biomarkers are not limited to CD3, CD8, CD30, CD56, PD1, CXCL13, granzyme B, TiAl .
Suitable reagents for binding with a marker nucleic acid (e.g. a genomic DNA, an mRNA, a spliced mRNA, a cDNA, or the like) include complementary nucleic acids. For example, the nucleic acid reagents may include oligonucleotides (labelled or non-labelled) fixed to a substrate, labelled oligonucleotides not bound with a substrate, pairs of PCR primers, molecular beacon probes, and the like.
Advantageously, the kit according to the present invention enables to quantify the level of expression KIR3DL2 and/or KIR3DL1 by measuring the level of mRNA expression. In a preferred embodiment, the kit comprises at least a set of 2 primers that hybridize specifically to a portion of KIR3DL2 or KIR3DL1 mRNAs. These primers enable a skilled artisan to implement the RT-PCR technique.
In a still preferred embodiment, the kit according to the present invention enables to quantify the level of expression of KIR3DL2 and/or KIR3DL1 by measuring the level of cellular protein expression, preferably the level of protein surface expression.
Protein expression may be quantified by specific antibodies. Yet, suitable antibodies for the invention may be a polyclonal or monoclonal type IgG, IgA, IgM, or IgE. An antibody suitable for the invention may be selected from antibodies from mouse, rat, rabbit, goat, horse, llama, human or other primate.
An antibody fragment having binding properties defined above may also be suitable for the invention. By "antibody fragment" is meant a portion of an antibody such as Fab, Fab', F(ab)2, F(ab')2 fragments and other similar. These terms also include any synthetic or genetically engineered protein that can act as an antibody by binding to a detectable protein of the invention, in a protein complex as defined above.
An antibody or antibody fragment suitable for the invention may be prepared by any method known to those skilled in the art, as described, for example, in "Making and using antibodies: a practical handbook" (Howard & Kaser, Ed CRC, 2006).
The kit may comprise a plurality of reagents, each of which is capable of binding specifically with the nucleic acid marker or the protein marker KIR3DL2 and optionally the nucleic acid or the protein KIR3DL1.
Suitable reagents for binding with a marker protein include antibodies, antibody derivatives, antibody fragments, and the like.
Thus, a further object of this invention consists of a kit for the diagnosis of the occurrence of a subset of cutaneous and nodal and extra nodal non-cutaneous lymphomas, which kit comprises means for quantifying at least one marker, i.e. KIR3DL2 and optionally KTR3DL1. The kit of the invention may optionally comprise additional components useful for performing the methods of the invention. By way of example, the kit may comprise fluids (e.g. SSC buffer) suitable for annealing complementary nucleic acids or for binding an antibody with a protein with which it specifically binds, one or more sample compartments, an instructional material which describes performance of the in vitro diagnosis method of the invention, and the like.
Alternatively, the kit described above may be useful for screening a compound candidate that affects KIR3DL2 expression level and/or biological activity, as described above.
The examples presented hereafter are for illustrating purpose of the invention and should not be construed as limiting the scope of the invention.
KIR3DL2 ASA THERAPEUTIC TARGET
KTR3DL2 has been reported to be considered as a valuable target for Sezary syndrome therapy.
Indeed, a monoclonal antibody specifically targeted against KIR3DL2 was shown to inhibit cellular proliferation and to further promote specific cell death of the KIR3DL2 expressing malignant T-cells, by a mechanism involving antibody-dependent cellular cytotoxicity (ADCC) (WO 2010/081890).
Moreover, several oligodeoxynucleosides that are rich in CpG dinucleotides (CpG ODN) were shown to bind to KTR3DL2 from both T-cells from Sezary individuals and NK cells (Natural Killer lymphocytes), and may elicit cytokines release from KIR3DL2 expressing NK cells, as disclosed in Sivori et al (A novel KIR-associated function: evidence that CpG DNA uptake and shuttling to early endosomes is mediated by KIR3DL2; Blood, 2010, 116(10): 1637-1647).
CpG ODN have been reported to induce tumor regression by activating innate immunity, to enhance antigen-dependent cellular cytotoxicity (ADCC), and to be a valuable vaccine adjuvant that elicit a specific, protective immune response, and to be also good candidates for the treatment of various types of cancerous and non-cancerous diseases (Bodera et al Synthetic immunostimulatory oligonucleotides in experimental and clinical practice. Pharmacol Rep. 2012 Sep;64(5): 1003-10). Furthermore, GpC ODN (oligonucleotides that are rich in GpC dinucleotides), often used as controls ODN, were also tested.
Compounds or pharmaceutical composition for KIR3DL2+ lymphomas treatment
The inventors' findings disclosed herein according to which a plurality of specific T-cell lymphomas express KTR3DL2 at the T-cell surface has allowed them to design novel therapeutic tools for treating these specific T-cell lymphomas.
More precisely, the inventors' findings disclosed herein have allowed designing therapeutic tools that are ligands binding to KIR3DL2 and wherein the binding event of the said ligands to KIR3DL2 causes the death of the malignant T-cells. In another aspect, the present invention describes a ligand molecule that specifically binds to KTR3DL2 for the prevention and/or the treatment of a KIR3DL2+ lymphoma selected from the group comprising Sezary syndrome, transformed mycosis fungoides, subcutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
In another aspect, the present invention relates to a ligand molecule that specifically binds to KTR3DL2 for the prevention and/or the treatment of a KIR3DL2+ lymphoma selected from the group comprising transformed mycosis fungoides, sub-cutaneous panniculitis- like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T- cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
In another aspect, the present invention relates to a ligand molecule that specifically binds to KTR3DL2 for the prevention and/or the treatment of a KIR3DL2+ lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy- associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
In a still another aspect, the present invention relates to a ligand molecule that specifically binds to KTR3DL2 for the prevention and/or the treatment of a cutaneous KIR3DL2+ lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma.
In another aspect, the present invention relates to a ligand molecule that specifically binds to KIR3DL2 for the prevention and/or the treatment of a non-cutaneous KIR3DL2+ lymphoma selected from the group comprising enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
The ligand molecule according to the present invention is capable of specifically inducing the death of KTR3DL2 expressing malignant T-cells. In particular, the death of KIR3DL2 expressing malignant T-cells is mediated by a process selected from the group comprising apoptosis, antigen-dependent cellular cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC).
The ligand molecule according to the present invention is selected from the group comprising an antibody, a fragment of an antibody and an oligodeoxynucleotide.
In a preferred embodiment the present invention relates to an anti-KIR3DL2 antibody that specifically binds to KIR3DL2 for the prevention and/or the treatment of a KIR3DL2+ lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T- cell lymphoma. In another preferred embodiment the present invention relates to an anti-KIR3DL2 antibody that specifically binds to KIR3DL2 for the prevention and/or the treatment of a cutaneous KTR3DL2+ lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma. In a still another preferred embodiment the present invention relates to an anti-KIR3DL2 antibody that specifically binds to KIR3DL2 for the prevention and/or the treatment of a non-cutaneous KTR3DL2+ lymphoma selected from the group comprising enteropathy- associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma. Anti-KIR3DL2 antibodies within the scope of the present invention can be obtained according to methods known from a skilled person in the art, such as, for example, the hybridoma method. Various adjuvants known in the art can be employed to enhance antibody production. Anti-KIR3DL2 antibodies may be polyclonal, although monoclonal antibodies are preferred.
A skilled person in the art can easily select anti-KIR3DL2 antibodies suitable to deplete malignant T-cells expressing KIR3DL2 at their surface, for example anti-KIR3DL2 antibodies that deplete malignant KIR3DL2 expressing T-cells via antibody-dependent cell mediated cytotoxicity (ADCC), complement dependent cytotoxicity (CDC), inhibition of cell proliferation or induction of cell death (e.g. via apoptosis).
Antigen-dependent cellular cytotoxicity (ADCC) may be assessed according to the protocol disclosed by, for example, Nelson et al. (51Cr release assay of antibody- dependent cell-mediated cytotoxicity (ADCC). Curr Protoc Immunol. 2001 May; Chapter 7: Unit 7.27); Broussas et al. (Evaluation of antibody-dependent cell cytotoxicity using lactate dehydrogenase (LDH) measurement. Methods Mol Biol. 2013; 988:305-17.
Complement-dependent cytotoxicity (CDC) may be assessed according to the protocol disclosed by, for example, Harmer et al (A highly sensitive, rapid screening method for the detection of antibodies directed against HLA class I and class II antigens. Transpl Int 1993; 6:277-80); Robson et al. (A comparison of flow cytometry screening methods. Eur J Immunogenetics 1999; 26:43-80); Broyer et al. (Evaluation of complement-dependent cytotoxicity using ATP measurement and Clq/C4b binding. Methods Mol Biol. 2013; 988:319-29).
Apoptosis may be assessed by numerous protocols or kits well known from the skilled person in the art.
For example, apoptosis may be assessed by assaying caspase induced activity, for example by using one of the commercially available kits such as Caspase 3 Activity Assay (Roche Applied Science), Apo-O E® Homogeneous Caspase-3/7 Assay (Promega), EnzChek® Caspase-3 Assay Kit #1 (Invitrogen), following the manufacturer's instructions. Apoptosis may also be assessed by assaying tunel and DNA fragmentation, for example by using one of the commercially available kits such as Apoptotic DNA Ladder Kit (Roche Applied Science), DeadEnd™ Fluorometric TUNEL System (Promega), APO- BrdU™ TUNEL Assay Kit (Invitrogen), Apoptotic DNA Ladder Kit (Genotech), following the manufacturer' s instructions.
Other methods are available to assess apoptosis, for example measuring cell permeability, staining phosphatisylserine by Annexin V, measuring mitochondrial membrane potential, etc.
Advantageously, the ability of the ligand molecule, within the scope of the instant invention, to elicit the death of KIR3DL2 expressing malignant T-cells may be assessed in vitro on an isolated cell line.
As an illustrative example for a Sezary syndrome cell line available for such an assay, also non limiting, one can mention HUT-78 (available at the American Type Culture Collection (ATCC), as ATCC TIB- 161); HH (ATCC CRL-2105), SeAx (Kaltoft et al A continuous T-cell line from a patient with Sezary syndrome. Arch Dermatol Res. 1987; 279(5):293-8.); MyLa 2059 (Kaltoft, University of Aahrus, Denmark); PI (Marie- Cardine et al Killer cell Ig-like receptors CD158a and CD158b display a coactivatory function, involving the c-Jun NH2-terminal protein kinase signaling pathway, when expressed on malignant CD4+ T cells from a patient with Sezary syndrome. Blood 2007; 109: 5064-5); PNO (Poszepczynska et al Functional characterization of an IL-7- dependent CD4(+)CD8alphaalpha(+) Th3-type malignant cell line derived from a patient with a cutaneous T-cell lymphoma. Blood 2000; 96: 1056-1063).
Anti-KIR3DL2 antibodies, which include humanized antibodies, and antibody fragments thereof, may be prepared according to known techniques. In a particular embodiment, the anti-KIR3DL2 antibody is a chimeric, a humanized or a full-human anti-KIR3DL2 antibody.
In another particular embodiment, the anti-KIR3DL2 antibody is an antibody fragment selected from the group of F(ab')2, F(ab)2, Fab', Fab, Fv, scFv, i.e. a fragment bearing the minimal recognition moieties. In a still preferred embodiment, the anti-KIR3DL2 antibody is a monoclonal antibody selected from the group consisting of a human antibody, a humanized antibody, and a chimeric antibody.
Preferably, the anti-KIR3DL2 antibody induces antibody-dependent cellular cytotoxicity (ADCC). In certain embodiments, the anti-KIR3DL2 antibody is an IgGl or IgG3 human isotype antibody. In other embodiments, the anti-KIR3DL2 antibody is an IgG2 or IgG4 human isotype antibody.
In another preferred embodiment, the anti-KIR3DL2 antibody induces complement cell toxicity mechanism (CDC). In another preferred embodiment, the anti-KIR3DL2 antibody induces apoptosis.
In a preferred embodiment, the ligand molecule is the AZ158 monoclonal antibody mAb, as previously described in Parolini et al (The AZ158 mAb specifically reacts with p70 and pi 40 inhibitory K receptors for HLA-B and HLA-A alleles. Leukocyte Typing VII. 2002. In: (Mason D, Andre P, Bensussan A, Buckley C, Civin C, Clark E et al, eds) Oxford: Oxford University Press, 415-417).
In a preferred embodiment, the ligand molecule is the Q66 monoclonal antibody (Pende et al. The natural killer cell receptor specific for HLA-A allotypes: a novel member of the p58/p70 family of inhibitory receptors that is characterized by three immunoglobulin-like domains and is expressed as a 140-kD disulphide-linked dimer. J Exp Med. 1996; 184:505- 18).
In a preferred embodiment, the ligand molecule according to the instant invention is selected from the group comprising AZ158 and Q66 monoclonal antibodies.
In another aspect, the present invention describes an oligodeoxynucleotide that specifically binds to KIR3DL2 for the prevention and/or the treatment of a KIR3DL2+ lymphoma selected from the group comprising Sezary syndrome, transformed mycosis fungoides, sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma. In one aspect, the present invention relates to an oligodeoxynucleotide that specifically binds to KIR3DL2 for the prevention and/or the treatment of a KIR3DL2+ lymphoma selected from the group comprising transformed mycosis fungoides, sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
In one aspect, the present invention relates to an oligodeoxynucleotide that specifically binds to KTR3DL2 for the prevention and/or the treatment of a KIR3DL2+ lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
In another aspect, the present invention relates to an oligodeoxynucleotide that specifically binds to KTR3DL2 for the prevention and/or the treatment of a cutaneous KIR3DL2+ lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma.
In another aspect, the present invention relates to an oligodeoxynucleotide that specifically binds to KIR3DL2 for the prevention and/or the treatment of a non-cutaneous KIR3DL2+ lymphoma selected from the group comprising enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
It is shown in the examples herein that CpG ODN treatment of T-cells from Sezary individuals results in (i) the binding of CpG ODN to the KIR3DL2 at the surface of the T- cells; (ii) the internalization of KTR3DL2, hence its depletion from the surface of the T- cells; and unexpectedly (iii) the induction of a caspase-dependent apoptotic pathway.
Documents WO 01/22972 and EP 2 290 078 may be mentioned as relating to the use of CpG ODN for their immunostimulatory functions, and notably for treating various type of cancers. Advantageously, the ligand molecule according to the instant invention may be an oligodeoxynucleotide selected from the group comprising CpG ODN-A of sequence SEQ ID NO: 5; CpG ODN-B of sequence SEQ ID NO: 6; CpG ODN-C of sequence SEQ ID NO: 7, mixtures thereof and/or analogs thereof. Analogs of the oligodeoxynucleotides selected from the group comprising CpG ODN-A of sequence SEQ ID NO: 5; CpG ODN-B of sequence SEQ ID NO: 6; CpG ODN-C of sequence SEQ ID NO: 7 comprise oligonucleotides with a nucleotide sequence at least 50% identical, for example at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, at least 95% identical, to either SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7.
In a preferred embodiment, the ligand molecule according to the instant invention may be the oligodeoxynucleotide CpG ODN-C of sequence SEQ ID NO: 7.
Surprisingly, when GpC ODN, often used as a CpG ODN negative control, was used to assess for KIR3DL2 expressing malignant T-cells treatment for inducing apoptosis, it was found to be as active as the CpG ODN-C.
Hence, in another embodiment of the instant invention, GpC ODN is a ligand molecule inducing KIR3DL2 expressing malignant T-cells apoptosis.
In a preferred embodiment, GpC ODN of sequence SEQ ID NO: 8 may be used as a ligand molecule to treat KIR3DL2 expressing malignant T-cells. In another further embodiment, analogs of the oligodeoxynucleotides GpC ODN of sequence SEQ ID NO: 8, comprising oligonucleotides with a nucleotide sequence at least 50% identical, for example at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, at least 95% identical to SEQ ID NO: 8 may be used as a ligand molecule to treat KIR3DL2 expressing malignant T-cells. More advantageously, the ligand molecule according to the instant invention may thus be an oligodeoxynucleotide selected from the group comprising CpG ODN-A of sequence SEQ ID NO: 5; CpG ODN-B of sequence SEQ ID NO: 6; CpG ODN-C of sequence SEQ ID NO: 7; GpC ODN of sequence SEQ ID NO: 8, mixtures thereof and/or analogs thereof. In a still preferred embodiment, an anti-KIR3DL2 antibody is in a mixture with an oligonucleotide, or an analog thereof, as to potentiate the effects of both ligand molecules.
In a preferred embodiment, the ligand molecule within the scope of the instant invention is capable of inducing at least about 10%, for example about 20%, for example about 30%, for example about 40%, for example about 50%, for example about 60%, for example about 70%), for example about 80%, for example about 90% of cell death, as assessed in a cytotoxic assay.
A pharmaceutical composition comprising a ligand molecule, as defined in the instant invention, and a pharmaceutically acceptable carrier for the prevention and/or the treatment of a KIR3DL2+ lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, and hepatosplenic gamma-delta T-cell lymphoma.
Furthermore, the present invention also relates to a ligand molecule that specifically binds to the extracellular domain of KTR3DL2 and is able to induce the cell death of the malignant T-cell s, for the prevention and/or treatment of a subset of cutaneous lymphomas and a subset of non-cutaneous nodal and extra nodal lymphomas.
The invention further results from the discovery that ligand molecules that bind KIR3DL2 receptor, and in particular the extracellular domain of KIR3DL2 receptor, are capable to induce a decrease of the proliferation of KIR3DL2-expressing malignant T cells, i.e. by inducing a KIR3DL2-mediated inhibitory signal.
In some embodiments, therapeutic compositions and regimens are herein disclosed and used for treating individuals previously diagnosed with KTR3DL2 expressing malignant T- cells lymphomas such as sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy- associated T-cell lymphoma, and hepatosplenic gamma-delta T-cell lymphoma. Methods for treating a KIR3DL2 expressing malignant T-cells lymphoma
A further aspect of the invention relates to a method for treating a KIR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a ligand molecule that specifically binds to KIR3DL2. In particular, said KTR3DL2 expressing malignant T-cells lymphoma is selected from the group comprising transformed mycosis fungoides, sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma. A further aspect of the invention relates to a method for treating a cutaneous KIR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a ligand molecule that specifically binds to KTR3DL2.
In particular, said cutaneous KTR3DL2 expressing malignant T-cells lymphoma is selected from the group comprising transformed sub-cutaneous panniculitis-like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma.
A further aspect of the invention relates to a method for treating a non-cutaneous KTR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a ligand molecule that specifically binds to KTR3DL2. In particular, said non-cutaneous KIR3DL2 expressing malignant T-cells lymphoma is selected from the group comprising enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
In another aspect, the present invention relates to a method for treating a KIR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a pharmaceutical composition comprising a ligand molecule that specifically binds to KTR3DL2, and a pharmaceutically acceptable carrier.
In a preferred embodiment, the present invention relates to a method for treating a KTR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a pharmaceutical composition comprising a ligand molecule that specifically binds to KIR3DL2, and a pharmaceutically acceptable carrier, wherein said lymphoma is selected from the group comprising transformed mycosis fungoides, sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T- cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
In another preferred embodiment, the present invention relates to a method for treating a cutaneous KTR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a pharmaceutical composition comprising a ligand molecule that specifically binds to KIR3DL2, and a pharmaceutically acceptable carrier, wherein said lymphoma is selected from the group comprising subcutaneous panniculitis-like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma.
In a still another preferred embodiment, the present invention relates to a method for treating a non-cutaneous KTR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a pharmaceutical composition comprising a ligand molecule that specifically binds to KIR3DL2, and a pharmaceutically acceptable carrier, wherein said lymphoma is selected from the group comprising enteropathy-associated T-cell lymphoma, adult T-cell leukaemia/lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
In a preferred embodiment, the present invention concerns a method for treating a KTR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a ligand molecule that specifically binds to KTR3DL2, in an amount sufficient to deplete T-cells. In a preferred embodiment, said ligand molecule that binds specifically to KIR3DL2 depletes circulating and/or organ-localized malignant T-cells.
In a preferred embodiment, the dosage regimen of the ligand molecule or the pharmaceutical composition disclosed herein is established by a physician. The specific therapeutically effective dosage regimen, and the amount sufficient to deplete T-cells, for a particular individual in need of the treatment will be dependent upon a variety of factors including, but not limited to: the T-cell lymphoma being treated and the severity of the disorder; the age; the body weight; general health; the sex; the diet; the time course of administration; the route of administration; the duration of the treatment; the drugs that are concomitantly administered in combination with the ligand molecule or pharmaceutical composition within the scope of the present invention.
In a most preferred embodiment, the dosage regimen of the ligand molecule or the pharmaceutical composition herein disclosed may range from about 0.01 to about 1,000 mg per adult per day. Preferably, the patient is administered with an amount of about 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the ligand molecule in order to adjust the dosage regimen that is the most suitable to a particular individual in need of the treatment. A pharmaceutical composition within the scope of the present invention may contain from about 0.01 mg to about 500 mg of the ligand molecule, preferably from about 1 mg to about 100 mg of the ligand molecule.
In a preferred embodiment, an effective amount of the ligand molecule is routinely administered at a dosage regimen from about 0.0002 mg/kg to about 20 mg/kg of body weight per day, especially from about 0.001 mg/kg to 7 mg/kg of body weight per day.
The optimal amount of ligand molecule to be comprised in a pharmaceutical dosage unit according to the invention may be easily adapted by the one skilled in the art using routine known protocols or methods. The ligand molecule and the pharmaceutical composition disclosed herein are administered by any suitable route, i.e. including, but not limited to, an oral, sublingual, buccal, subcutaneous, transdermal, topical, intraperitoneal, intramuscular, intravenous, subdermal, intrathecal and intranasal and rectal administration.
Advantageously, the method for treating a KIR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, as disclosed in the instant invention is capable of inducing at least about 10%, for example about 20%, for example about 30%, for example about 40%, for example about 50%, for example about 60%, for example about 70%), for example about 80%>, for example about 90%> of cell death. EXAMPLES
EXAMPLE 1 : Expression of KIR3DL2 in cutaneous, non-cutaneous peripheral extra nodal and nodal T-cell lymphomas
1) Material and methods 1.1) Material and methods
Tissue samples were retrieved from various collections, and diagnoses were done in all cases following the current classification (Swerdlow SH, Campo E, Harris L, et al. In: press IARC, ed. WHO Classification of Tumours of Haematopoietic and Lymphoid tissues (ed 4th). Lyon; 2008). The international classification of diseases for oncology (ICDO) code is given in parenthesis for each lymphoma group disclosed in the following list. a) cutaneous T-cell lymphomas
Frozen skin samples of patient with Sezary syndrome (9701/3) KI04028, KI10025 and KI18027 were collected from the national research project PHRC (programme hospitalier de recherche clinique) KIRs, with Dr Nicolas ORTONNE as principal investigator and coordinator. They were selected from patients with Sezary syndrome, in which strong KTR3DL2 mRNA transcript expression was demonstrated using quantitative RT-PCR both in the blood and in the skin, while no significant expression of KIR3DL1 was found. In addition, two other Sezary syndrome cases from the department of Pathology (routine practice) were studied, with both a skin and involved lymph node specimen.
Frozen skin samples from other cutaneous T-cell lymphomas were retrieved from the archival files of the department of Pathology of the hospital Henri Mondor (AP-HP, groupe hospitalier Henri Mondor Albert Chenevier). These samples included:
- 3 transformed mycosis fungoides (9700/3t);
- 4 primary cutaneous CD30+ T-cell lymphoproliferative disorders with 2 cutaneous anaplastic large cell lymphomas (9718/3) and 2 cases of lymphomatoid papulosis (9718/1);
- 4 sub-cutaneous panniculitis-like T-cell lymphomas (9708/3);
- 1 primary cutaneous nasal-type NK/T-cell lymphoma (9719/3); - 2 primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma (9709/3). b) nodal and non-cutaneous extra nodal lymphomas
Frozen skin samples from nodal and non-cutaneous extra nodal lymphomas were collected from the research project PHRC TENOMIC, with Philippe GAULARD as principal investigator and coordinator. We selected cases with more than 70% of neoplastic cells in the routine histological control. These samples included:
- 4 angioimmunoblastic T-cell lymphomas (AITL, 9705/3): TENOMIC 060, 268, 424, 415;
- 3 anaplastic large cell lymphomas, ALK negative (9702/3): TENOMIC 105, 213, 238;
- 6 enteropathy-associated T-cell lymphomas (EATL, 9717/3): TENOMIC 046, 418, 441, 210, 319, 358, 413;
- 8 adult T-cell leukaemia/lymphoma (ATLL, 9827/3): TENOMIC 285, 257, 340, 361, 066, 256, 540, 560;
- 4 extra nodal NK/T cell lymphomas nasal-type (9719/3): TENOMIC 053, 246, 419, 579;
- 7 hepatosplenic gamma-delta T-cell lymphomas (HSTL, 9716/3): TENOMIC 014, 037, 181, 014, 037, 181, 183;
- 4 peripheral T-cell lymphomas, not otherwise specified (PTCL/NOS, 9702/3) : TENOMIC 214 , 225, 232, 469. In addition frozen sections of 5 anaplastic large cell lymphomas, ALK positive (9702/3) were obtained from Dr Laurence LAMANT, from the department of Pathology of the Institut Universitaire du Cancer de Toulouse - Oncopole : P9710730, P055401, P0016632, P00113872, P126370.
1.2) Immunohistochemistry
For immunostaining procedures, 3 μιη-thick sections were applied on Superfrost plus slides (CML, Angers, France). In each case a section was stained with hematoxylin eosin and saffron (HES) to check the quality of the tissue samples (necrosis) and confirm the presence of the neoplastic infiltrate. KTR3DL2 immunostaining was done manually in a humid chamber using a mouse IgGl monoclonal antibody (clone 5.133, Miltenyi Biotec, Paris, France) at a 1 :50 dilution with 1 hour incubation. This antibody reacts with both KIR3DL2 and IR3DL1. The staining was performed using the En Vision® amplification system conjugated to peroxydase (Dako SA, Glostrup, Denmark). The peroxydase reaction was revealed by aminoethylcarbazole and sections were counterstained in blue with hematoxylin.
Other immunostainings were done to check for the expression of the classical phenotypic markers in each case, including T-cell markers for all samples (CD3), CD30 for anaplastic large cell lymphomas and primary cutaneous CD30+ T-cell lymphoproliferative disorders, CD8 and granzyme B for sub-cutaneous panniculitis-like T-cell lymphomas and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, CD56 and granzyme B for cutaneous and extra nodal K/T cell lymphomas nasal -type, CXCL13 and PDl for AITL, CD25 for ATLL, CD 5 and TiAl for HSTL. These additional stainings were done either manually using a biotin/avidine system conjugated to peroxydase (Vectastain ® ABC-P kit from Vector, Burlingame, USA) or using the Bond-Max automated device (Menarini, Leica). The peroxydase reaction was revealed by diaminobenzidine (Sigma-Aldrich, Saint Quentin Fallavier, France) and sections were counterstained in blue with hematoxylin.
Slides were analyzed using the Axioskop 2 microscope (Zeiss, Germany) and pictures were taken using the digital camera EOS 600D (Canon, France).
1.3) RT-PCR studies
Quantitative PCR reactions for CD3 (delta chain), KIR3DL2 and KIR3DL1 were performed in a LightCycler 2.0 System (Roche Diagnostics, Meylan, France) using a SYBR Green PCR kit from Roche Diagnostics (Meylan, France). Melting curves and agarose gel electrophoresis established the purity of the amplified product. Normalization was achieved by quantification of the mRNA expression of the SF3A1 gene, encoding for the 120 kDa subunit of the splicing factor 3 a, chosen as control housekeeping gene for its stable expression in lymphocytes, as previously described. PCR samples contained 4 mM MgCL2, 0.4μΜ of each primer, and amplification cycling conditions were as following: 94°C for denaturation, 10 seconds at 60°C for hybridization and 25 seconds at 72°C for elongation for 40 cycles. The expression of transcripts was measured by the relative quantification of real time-PCR, as previously described. All PCR conditions were adjusted in order to obtain equivalent optimal amplification efficiency between the different assays. By using the obtained linear graphs, the differences in Ct values were determined for each sample and were expressed as relative percentage of mRNA present in the calibrator sample, according to the ΔΔΟ method, after adjustment of PCR efficiency with the Light Cycler software 4.0 (Roche). Quantification was considered to be unreliable when the presence of non-specific products was detected on the control agarose gel.
Quantitative RT-PCR studies were done in the positively stained cutaneous T-cell lymphomas: one primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma and two sub-cutaneous panniculitis-like T-cell lymphomas.
Total RNA extraction was performed on frozen sections, transferred into Trizol, and immediately homogenized before chloroform/isopropanol precipitation. Total mRNA was then reverse transcribed by using the High Capacity cDNA Reverse Transcription with RNase inhibitor kit (Applied Biosystems), according to the manufacturer's instructions. Primers used to quantify KTR3DL2 may be of SEQ ID NO: 1 and SEQ ID NO: 2:
SEQ ID NO: 1: forward 5'- CAACTTCTCCATCGGTCCCTTGATG -3'
SEQ ID NO: 2: reverse 5'- GTTTGACCACACGCAGGGCAG -3'.
Primers used to quantify KTR3DL1 may be of SEQ ID N°3 and 4:
SEQ ID NO: 3: forward 5 '- GGACATCGTGGTCACAGGTCC -3 '
SEQ ID NO: 4: reverse 5'- GCCTGGAATGTTCTGTTGACCTTGC -3'.
Amplification was done using newly designed primers and SYBR® green, allowing the specific detection of KTR3DL1 and KIR3DL2 transcripts, as in a previous publication (Ortonne et ah CD158k/KTR3DL2 and NKp46 are frequently expressed in transformed mycosis fungoides. Exp Dermatol. 2012 Jun; 21(6):461-3) and the ABI 7900HT device (Applied Biosystems).
The SF3A1 housekeeping gene was used as calibrator. The levels of expression of the KTR3DL1 and KTR3DL2 receptors were finally expressed as a ratio to CD36 to avoid the potential bias due to differences in T-cell lymphocytic densities. In two HSTL and one EATL and ATLL (PHRC TENOMIC), mRNA levels of KIR3DL2 was studied by transcriptomic analysis (Affymetrix U133 Plus 2.0) after total mRNA extraction from frozen specimens and compared to all HSTL and AITL.
2) Results 2.1) Immunohistochemistry
The results from Figures 1 and 2 are summarized in the Table 1 below.
Table 1: phenotypic study and proportion of cases displaying a positive ratio expression KTR3DL1/2 (cohort of 44 individuals).
otherwise specified
^CDO stands for International Classification of Diseases for Oncology; 2IHC stands for ImmunoHistoChemistry; GrB stands for granzyme B; 4Only scattered positive cells were identified, which may be neoplastic and/or reactive; 5One case was a primary cutaneous form, and the three others were from the nasal cavity; 6EBER transcripts.
In all cases, the standard staining with HES showed no or only little tissue necrosis and presence of the T-cell neoplastic infiltrate. Expression of classical phenotypic markers was demonstrated in all samples (data not shown).
KTR3DL1/2 staining in all the Sezary syndrome skin samples showed as expected a membrane staining in the neoplastic infiltrates, with no background staining (figures 1A and IB). No staining was evidence in irrelevant structures, including the epidermis, the cutaneous adenexae, normal dermal cells and hypodermis. A strong and diffuse staining was also evidenced in the lymph nodes from two cases. In the cutaneous T-cell lymphomas group, a significant diffuse and strong staining was evidenced in a transformed mycosis fungoides (n=l/3, figures 1C and ID) and in the primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma (figures IE and IF). In all sub-cutaneous panniculitis-like T-cell lymphomas, scattered KTR3DL1/2+ cells were present but the staining was not positive in the majority of the neoplastic cells that are mostly localized around adipocytes.
In the peripheral T-cell lymphoma group, most cases were not stained with only scattered KIR3DL1/2+ cells, as shown for a PTCL/NOS sample in Figures 2B. One case of EATL (n=l/3, figures 2C and 2D) and one case of ATLL (n=l/4, figures 2E and 2F) showed strong and diffuse KTR3DL1/2 expression, while all samples of HSTL studied showed a diffuse and strong KIR3DL1/2 expression (figures 2G and 2H).
Table 2: phenotypic study and proportion of cases displaying a positive ratio of expression KTR3DL1/2 (as in Table 1 , but with results obtained from an additional cohort of 16 individuals).
Results obtained by a cohort of 16 additional individuals confirmed that KIR3DL2 is a relevant biomarker for:
- two cutaneous PTCLs, namely sub-cutaneous panniculitis-like T-cell lymphoma and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, and - two non-cutaneous PTCLs, namely enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
KIR3DL2 may thus be a biomarker for diagnosing a sub-population of patients having a lymphoma such as a transformed mycosis fungoides, an enteropathy-associated T-cell lymphoma and an adult T-cell leukaemia/lymphoma. It could also be suggested that KIR3DL2 might be a good candidate to assess the prognosis of these particular cutaneous and non-cutaneous nodal and extra nodal lymphomas.
2.2) RT-PCR studies
Quantitative RT-PCR studies showed significant expression of KIR3DL2 with markedly less KIR3DL1 in all cutaneous T-cell lymphomas studied (Table 3).
Table 3: RT-PCR studies for KIR3DL1 and KIR3DL2 in positively stained cutaneous T- cell lymphomas.
RT-PCR experiments were conducted with specific primers, as previously done (Ortonne et ah CD158K/KTR3DL2 Transcript detection in lesional skin of patients with erythroderma is a tool for the diagnosis of Sezary syndrome. J Invest Dermatol 2007; 128: 465-72). The expression of each receptor was calibrated with the SF3A1 housekeeping gene, and the data shown in column 3 and 4 represent the ratios of the ΔΔΟ values between each receptor and the CD36 chain.
The KTR3DL2 ΔΔΟ values (xlO) for the Sezary syndrome samples were 5.83, 31.6 and 6.4, while for KTR3DL1, the values were 0.03, 0 and 0.43, respectively. Similarly, in the positively stained transformed mycosis fungoides, the ΔΔΟ values were 15.16 for KTR3DL2 and 0.23 for KTR3DL1. In the primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, KIR3DL2 transcripts also appeared to be expressed at a much higher rate than KIR3DL1, with a KIR3D2/KIR3DL1 ratio of 130.14.
In the two subcutanous panniculitis-like lymphomas, KIR3DL2 transcripts were also more expressed than but the difference with KIR3DL1 was less marked. It can be therefore conclude that these cases rather expressed KIR3DL2 than KIR3DL1 and that the anti- KIR3DL1/2 clone 5.133 stained KIR3DL2 at the surface of the neoplastic cells. In 2 HSTL samples, and in the EATL and ATLL samples showing a positive staining, transcriptomic analyzes also identified significant KIR3DL2 mRNA expression, at much higher levels than in other peripheral T-cell lymphomas, as shown in figure 3. It is to be noted that the present results seem contradictory with the results obtained by Iqbal et al. (Molecular signature to improve diagnosis in peripheral T-cell lymphoma and prognostication in angioimmunoblastic T-cell lymphoma; Blood, 2010, 115(5): 1026-36) reported KIR3DL2 as a putative biomarker for a subset of PTCL "not otherwise specified" (PTCL/NOS). However, one may observe that the PTCL/NOS encompass a variety of lymphomas of distinct nature, as they could not be assigned to one specific defined subcategory.
3) Conclusion
A subset of cutaneous T-cell lymphomas (sub-cutaneous panniculitis-like T-cell lymphomas, and primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma) and extra-cutaneous peripheral T-cell lymphomas (some hepatosplenic T-cell lymphomas and enteropathy-associated T-cell lymphomas) expressed KIR3DL2 and thus appear to be good candidates for a targeted therapy.
With the exception of subcutaneous 'panniculitis-like' T-cell lymphomas, the vast majority of neoplastic cells were stained with the anti-KIR3DLl/2 monoclonal antibody. In all the cases with available RT-PCR results KIR3DL2 transcripts were detected, at much higher levels than KTR3DL1. The identification of KIR3DL2 expression in tissue samples using the anti-human KIR3DL1/2 mouse IgGl monoclonal antibody (clone 5.133, Miltenyi Biotec, Paris, France) was reliable for the identification of KIR3DL2+ lymphomas.
EXAMPLE 2: Monoclonal antibody (MAb) AZ158 or CPG ODN binding to KIR3DL2 induces distinct cellular death pathways in Sezary syndrome malignant T cells
1) Materials and Methods 1.1) Patients and cells
Sezary syndrome diagnosis was established on recognized international clinical, histological and bi o logi cal criteria . B lood from 1 5 S ezary syndrom e p ati ents with more than 90% of CD3+CD4+KIR3DL2+ cells was collected for the present study, which was approved by the institutional ethics committee (Saint Louis Hospital, Paris).
Peripheral blood mononuclear cells (PBMCs) were isolated from heparinized venous blood by density gradient centrifugation over lymphocytes separating medium (LSM; PAA Laboratories, Les Mureaux, France).
CD4+ T cells were purified by MACS using the CD4+ T cell isolation kit according to the manufacturer s protocol (Miltenyi Biotech). The Sezary cell line used in this study was established and amplified as described previously, and maintained a stable phenotype. Cells were cultured in RPMI 1640 medium, supplemented with 2 mM L-glutamine, 1% penicillin-streptomycin (Invitrogen) and 10% human serum (Jacques Boy Biotechnologies Institute). 1.2) CpG ODN, GpC ODN or antibodies cell treatment
For CpG ODN and GpC ODN treatments, cells were cultured for the indicated time (1, 4 or 7 days) in 24-well plates at a concentration of 2xl06/ml. The following CpG ODNs and or GpC ODN were used at a final concentration of 10 μg/ml: CpG class- A (ODN 2336), CpG class-B (ODN 2006), CpG class-C (ODN 2395), GpC (ODN 2395 control) and control ODN (ODN TTAGGG) (all from Invivogen).
Table 4: Sequences of the CpG ODNs and GpC ODN used:
1 Bases in capital letters are phosphodiester, those in lower case are phosphorothioate. Incubation was processed for up to 12 days.
For short-time stimulation, cells were left untreated or treated with anti-CD3 (CD3x3, IgGl; locally produced), anti-KIR3DL2 (AZ 158, IgG2a; kindly provided by Innate Pharma, Marseille, France) or CpG ODN-C alone or in combination, followed by cross-linking with goat anti-mouse IgG Ab 5 min at 37°C (Beckman Coulter). Proliferation and apoptosis assays were performed on cells cultured for 4 (Figure 5) or 7 days (Figures 6 and 8) at 37°C in 96-well plates pre-coated with the indicated antibodies CpG ODN and/or GpC ODN. After incubation, cells were processed for flow cytometry or biochemical analysis, as described below. 1.3) Flow cytometry
Sezary cell staining was performed according to a standard procedure using the anti- KTR3DL2 mAb Q66 (IgM; kindly provided by Dr A. Moretta, Genova, Italy) plus goat anti-mouse IgM-FITC antibodies, anti-CD3-PC7, -TCRV-PE and -CD4-PC5 mAbs (Beckman Coulter, Marseille, France). For proliferation assays, cells were pre-loaded with 0.5 μΜ of CFSE (Invitrogen) prior to activation while detection of apoptotic cells was performed using PE-conjugated 7AAD (BD Biosciences), according to the suppliers' protocols. Cells were analysed on an FC500 cytometer (Beckman Coulter).
1.4) Immunofluorescence
Cells were either left untreated or incubated in the presence of CpG ODN-C, FITC- labelled CpG ODN-C or control ODN for 24 h at 37°C . Cell s were subj ected to KIR3DL2 immunolabelling with Q66 mAb and FITC-coupled goat anti-mouse IgM Abs, washed and immobilized on poly-L-lysine coated coverslips. After a methanol fixation step at -20°C, cells were mounted in polyvinyl alcohol mounting medium with DABCO (Fluka). For KIR3DL2 intracellular staining, cells were adhered to poly-L lysine coverslips, fixed in methanol and permeabilized with PBS/0.1% Tween 20 prior to KIR3DL2 labelling. After washes, coverslips were mounted and analysed on a Leica DMRB microscope.
1.5) Immunoprecipitation and Western blotting
Activated cells were subjected to lysis and post-nuclear supernatants prepared and processed as described elsewhere. For Western blotting, samples were separated by SDS- PAGE and transferred onto a nitrocellulose membrane. Immunoprecipitates were probed with anti-phospho-CD3 mAb (Santa Cruz Biotechnology, Santa Cruz, CA) and anti-CD3 mAb (Cell Signaling). Post-nuclear lysates analyses were performed using antibodies specific for the following molecules: cleaved-caspase 3, -caspase 7 and -PARP, phospho- STAT3, STAT3, Erkl/2 (all from Cell Signaling Technology) and phospho-Erkl/2 (Sigma- Aldrich). When performing detection in series, a stripping procedure between each revelation step was done. After incubation with the appropriate horseradish peroxidase- conjugated secondary antibodies (Jackson Immunoresearch), the detection was performed using an ECL system (Perbio Science, Brebieres, France) and an ImageQuant LAS 400 system (GE Healthcare). 2) Results
2.1) KIR3DL2 internalization is induced upon its engagement with CpG ODN, but not with anti-KIR3DL2 mAb AZ158
We previously identified KIR3DL2 as a reliable cell surface marker of the tumoral CD4+ T lymphocytes of patients with Sezary syndrome. To establish if KIR3DL2 exerts any function in Sezary CD4+ T cells, engagement of the receptor was achieved by using either the anti-KTR3DL2 monoclonal antibody (mAb) AZ158 or its newly identified ligand CpG ODN. Note that both AZ158 and CpG ODN-C sites of interaction were mapped within the DO extracellular domain of the receptor. Because CpG ODNs were shown to promote KIR3DL2 cell surface down- modulation on NK cells (Sivori et al. A novel KIR-associated function: evidence that CpG DNA uptake and shuttling to early endosomes is mediated by KIR3DL2; Blood, 2010, 116(10): 1637- 1647), we first tested whether such observation also applied to malignant Sezary cells. We observed that incubation of Sezary patients PBMCs with type A, B or C CpG ODNs, but not with a control ODN, led to a substantial down-modulation of KIR3DL2, corresponding to a 50% reduction of the receptor mean fluorescence intensity, at the surface of Sezary patients CD4+ T cells (Table 5).
Table 5: Down-modulation of KIR3DL2 by CpG ODN on Sezary patients malignant T cell clone.
1 not treated; 2 control.
Because CpG ODN-C induced efficient cell surface modulation of KIR3DL2 and combined the immune effects of class-A and -B ODN (CpG ODN-A et CpG ODN-B) on immune cells it was preferentially used for the following experiments. The expression level of KIR3DL2 by Sezary patients tumoral T cell clone was next monitored in parallel on ODN-C or AZ158 mAb treated cells. The resulting data clearly demonstrated that while ODN-C promoted KIR3DL2 down-modulation, ligation of KIR3DL2 with AZ158 mAb did not affect the level of receptor detected on malignant T cells (identified by means of their clonal TCRVB rearrangement) (Figure 4A). Identical results were obtained in 12 different Sezary patients who were analysed (Figure 4B). Finally, fluorescence microscopy analysis on an established Sezary cell line showed that KIR3DL2, which is evenly distributed at the plasma membrane in resting cells or after contact with a control ODN, is partially internalized following CpG ODN-C cell treatment. Similarly, when using a FITC-conjugated CpG ODN-C, this latter was detected both at the plasma membrane and at the intracellular level after cell incubation. Altogether, these data established that binding of CpG ODN-C, but not of AZ158 mAb, to KIR3DL2 promotes the receptor internalization in Sezary cells.
2.2) AZ158 mAb, but not CpG ODN-C, promotes KIR3DL2 co-receptor inhibitory function To further investigate the consequences of KIR3DL2 triggering on Sezary cells, we first evaluated its potential function on the processes of CD3-induced malignant T cell proliferation and apoptosis. To this aim, PBMCs from Sezary patients were activated for 4 days with an anti-CD3 mAb alone or in association with AZ158 mAb or CpG ODN- C. The malignant T cell clone proliferation and apoptosi s status was further assessed by immunolabelling. Representative results obtained on PBMCs from patient 1 are shown in Figure 5A and B. We observed that the CD3-dependent proliferation of the malignant T cell clone (identified as TCRV8+CD4+ T cells) was strongly inhibited upon binding of AZ158 mAb to KIR3DL2 but not with CpG ODN-C (Figure 5A). Consequently, the CD3- induced tumoral cell death was also found impaired in the presence of AZ158 mAb while CpG ODN-C had no effect (Figure 5B). In agreement with these observations, a down-modulation of the CD3 chain phosphorylation and Erkl/2 activation, that is induced upon CD3 targeting, was observed when AZ158 mAb was bound to KIR3DL2 (Figure 5, C and D). In contrast, no notable modification of the CD3 -mediated Erkl/2 activation was observed in the presence of CpG ODN-C. Thus, it seems that binding of CpG ODN-C to KIR3DL2 did not interfere with the CD3-dependent activation process while binding of AZ158 mAb to KTR3DL2 revealed its co-receptor inhibitory function. 2.3) Long-term CpG ODN-C/KIR3DL2 interaction leads to Sezary cells apoptosis
We initially did not observe any impact of CpG ODN-C on the tumoral cell viability when performing a 4 days-incubation assay (see Figure 5B). Incubation times were therefore extended to up to 12-days. Representative results obtained on PBMCs from patient 15 at day 7 are shown in Figure 6A.
Remarkably, at day 7 while the tumoral cell viability was not affected by the length of the treatment (non-treated/NT panel) or by the presence of AZ158 mAb or control ODN (all conditions resulting in the detection of 5 to 6% of spontaneous apoptosis), addition of CpG ODN-C led to a significant increase in the malignant cell mortality, with the detection of 29% of 7AAD-positive cells within the tumoral population.
In contrast, similar experiments performed on PBMCs isolated from healthy donors revealed that although normal CD4+ T-cells appeared to be more sensitive to the experimental time length, with 15% of this population undergoing apoptosis during the time course, cell death was not amplified by the presence of CpG ODN-C or AZ 158 mAb.
Results obtained with patient 15 (Figure 6 A) were confirmed with 7 additional patients (Figure 6B), with maximal CpG ODN-C induced apoptosis detected after 7 to 12-days of treatment according to the patient.
Finally, the induction of a caspase-dependent apoptotic pathway following incubation with CpG ODN-C was confirmed by immunoblotting. As shown in Figure 6C, the levels of cleaved forms of caspase-7 and -3, and of their substrate PARP, were found increased upon incubation of a Sezary cell line with CpG ODN-C, with maximum levels being reached after 6 h of treatment. Altogether, these results established that a specific apoptosis of Sezary malignant cells could be induced through treatment with CpG ODN-C. 2.4) CpG ODN-C treatment of Sezary cells results in phospho-STAT3 dephosphorylation
Previous studies have established that STAT3 can be constitutively phosphorylated in Sezary cells and that treatments promoting its dephosphorylation led to malignant cell death. We therefore investigated the phosphorylation status of STAT3 in CpG ODN-C treated cells. Kinetic experiments performed on a Sezary cell line showed that a significant time-dependent STAT3 dephosphorylation occurred upon CpG ODN treatment that is not correlated to the degradation of the protein (Figure 7A). This dephosphorylation process was further confirmed on sorted CD4+ T-cells of patients whose all CD4+ T- lymphocytes were KTR3DL2 (Figure 7B). In these cells, a complete dephosphorylation of STAT3 was visualized after 24 h of ODN-C incubation while phospho-STAT3 level was not modified in the presence of AZ158 mAb or control ODN. It therefore appeared that the CpG ODN-C-induced apoptosis of Sezary cells might be correlated to STAT3 dephosphorylation.
2.5) GpC ODN treatment
GpC ODN differs from CpG ODN by the presence of GpC dinucleotides instead of CpGs, and is usually used as a negative control for CpG ODN.
Unexpectedly, a treatment of Sezary cells cultured for 7 days in the presence of GpC ODN was hereby shown to be as active on Sezary cells apoptosis as a treatment of Sezary cells cultured with CpG ODN-C (see Figure 8 A through 8C).
Both CpG ODN-C (Figure 8A, curve 2) and GpC (Figure 8A, curve 3) treatment of Sezary cells results in a decrease of KJR3DL2 expression as compared to Sezary cells either left untreated (Figure 8 A, curve 1) or treated with the control ODN (Figure 8 A, curve 4).
However, the effect of GpC ODN on Sezary cells seems different as compared to CpG ODN.
Indeed, early apoptosis represents 21 % and late apoptosis 6% of the apoptosis events in Sezary cells treated with GpC ODN, whereas Sezary cells treated with CpG ODN-C display as many early apoptosis events as late apoptosis events (16 %) (Figures 8B and 8C). 3) Conclusion
While binding to the same extracellular domain of KIR3DL2, namely the DO domain, AZ158 mAb and CpG ODN effects on Sezary cells are clearly distinct. We showed that the co-engagement of CD3 and KIR3DL2 through CpG ODN did not lead to the delivery of KJR3DL2-dependent negative signals. Moreover, we observed that unlike AZ158 mAb, CpG ODN promote the internalization of the receptor. For all patients tested, we experienced an averaged 50% reduction of KIR3DL2 MFI following CpG ODN treatment, this threshold not being over-passed when using higher concentrations of CpG ODN (up to 25 μg/ml) or longer exposure time (up to 12 days) (data not shown). In NK cells, KIR3DL2 internalization leads to the co-localization of the CpG ODN-linked receptors with TLR9 in the endosomal compartment 14. It has therefore been suggested that in these cells, KIR3DL2 may act as a carrier protein that brings CpG ODN to their receptor TLR9, resulting in NK cell activation. Despite the detection of TLR9 transcripts in Sezary cell lines and Sezary patient tumoral cells, we did not detect any TLR9 expression in these cells (data not shown). In addition, it has been recently reported that CpG and non-CpG ODN can co-stimulate mouse and human CD4+ T cells through a TLR9- and MyD88- independent mechanism 28. Together with our observations, these data suggested the possibility of a KJR3DL2/ODN CpG-mediated effect with no TLR9 involvement in Sezary cells. This also points towards a distinct role for KIR3DL2 as CpG ODN receptor in NK and Sezary cells (activating receptor vs apoptosis-mediating receptor, respectively) depending on TLR9 expression.
Unexpectedly, while maximal but only partial internalization of KIR3DL2 (corresponding to a loss of 50% of the receptor at the cell surface) and complete dephosphorylation of STAT3 are observed 24 h after exposure of Sezary patients tumoral cells to CpG ODN-C, detection of the tumoral T cell clone apoptosis requires 7 to 12 days of treatment. In contrast, experiments performed on proliferating Sezary cell lines showed a complete internalization of the receptor 2 to 4 h after addition of the CpG ODN (data not shown) with STAT3 dephosphorylation and cell apoptosis detected 6 to 8 h later (Figure 4A and SI). It remains to determine if these time course discrepancies are the consequence of peripheral blood tumoral cells low metabolic turnover, as compared to an established and proliferating Sezary cell line, and the need for days to shutdown phospho-STAT3- dependent anti-apoptotic pathways. Nevertheless, the results show that in Sezary cells, KIR3DL2/CpG ODN association and internalization led to phospho-STAT3 dephosphorylation and tumoral cell death. Previous studies demonstrated that treatment of Sezary cells with the Janus kinase (JAK) inhibitor tyrphostin AG490, as well as with Cucurbitacin I or Curcumin, efficiently promotes phospho-STAT3 dephosphorylation and induces Sezary cell apoptosis. It has been recently established that constitutive activation of STAT3 in Sezary cells is not due to a loss of SHP-1, but is mediated by a constitutive aberrant activation of JAK family members. Efforts are currently made to determine how CpG ODN binding to KIR3DL2 in Sezary cells may influence JAK activity.

Claims

1. A ligand molecule, that specifically binds to KIR3DL2 for the prevention and/or the treatment of a KIR3DL2 expressing malignant T-cells lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T- cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
2. The ligand molecule according to claim 1, wherein said ligand molecule is capable of specifically inducing the death of KIR3DL2 expressing malignant T-cells, and wherein the death of KIR3DL2 expressing malignant T-cells is mediated by a process selected from the group comprising apoptosis, antigen-dependent cellular cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC).
3. The ligand molecule according to claim 1 or 2, wherein said ligand molecule is selected from the group comprising an antibody, a fragment of an antibody and an oligodeoxynucleotide.
4. The ligand molecule according to claim 3, wherein said antibody is selected from the group comprising AZ158 and Q66 monoclonal antibodies.
5. The ligand molecule according to claim 3, wherein the oligodeoxynucleotide is selected from the group comprising CpG ODN-A of sequence SEQ ID NO: 5, CpG ODN-B of sequence SEQ ID NO: 6, CpG ODN-C of sequence SEQ ID NO: 7 and GpC ODN of sequence SEQ ID NO: 8.
6. A pharmaceutical composition comprising a ligand molecule as defined in any of claim 1 to 5 and a pharmaceutically acceptable carrier for the prevention and/or the treatment of a KTR3DL2+ lymphoma selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
7. A method for treating a KIR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a ligand molecule that specifically binds to KTR3DL2, wherein said lymphoma is selected from the group comprising transformed sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy- associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
8. A method for treating a KIR3DL2 expressing malignant T-cells lymphoma in an individual in need thereof, comprising administering to said individual a pharmaceutical composition comprising a ligand molecule that specifically binds to KIR3DL2, and a pharmaceutically acceptable carrier, wherein said lymphoma is selected from the group comprising, sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy- associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
9. An in vitro use of a level of expression of KIR3DL2 as a biomarker for diagnosing and/or monitoring a lymphoma selected from the group comprising subcutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, and hepatosplenic gamma-delta T-cell lymphoma.
10. An in vitro method for diagnosing and/or monitoring a lymphoma in an individual comprising at least a step of quantifying the level of expression of KIR3DL2, said lymphoma being selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma, and hepatosplenic gamma-delta T- cell lymphoma.
11. The in vitro method according to claim 10, wherein the level of expression is quantified by measuring the level of mRNA expression.
12. The in vitro method according to claim 10, wherein the level of expression is quantified by measuring the level of cellular protein expression, preferably the level of protein surface expression.
13. The in vitro method according to any one of claims 10 to 12, comprising the steps of:
a) providing a biological sample from an individual to be tested, b) measuring in the said biological sample the expression level of KIR3DL2, c) diagnosing said lymphoma if the value found at step b) is distinct from a predetermined threshold value for the said expression level and is indicative of a lymphoma positive individual.
14. A method for monitoring the effectiveness of treatment against a lymphoma, in an individual in need thereof, with a therapeutic agent, said method comprising the steps of:
(i) providing a pre-administration biological sample from an individual prior to administration of the therapeutic agent;
(ii) measuring the level of expression of KIR3DL2 in the pre-administration biological sample;
(iii) providing one or more post-administration biological samples from the individual;
(iv) measuring the level of expression of KIR3DL2 in the post-administration biological samples;
(v) comparing the level of expression of KIR3DL2 measured for the pre- administration biological sample with the level of expression of KIR3DL2 measured for the post-administration biological sample or biological samples; and
(vi) altering the administration of the therapeutic agent to the individual accordingly, said lymphoma being selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
15. The method according to claim 14, wherein the therapeutic agent is selected from the group comprising the ligand molecule according to claim 1 and the pharmaceutical composition according to claim 6.
16. A method for adapting a treatment against a lymphoma in an individual in need thereof, wherein said method comprises at least the steps of:
a) performing, on at least one biological sample collected from said individual, the in vitro diagnosis method according to any one of claims 10 to 12; and b) adapting the treatment against the lymphoma of said individual by administering to said individual a suitable therapy,
wherein said lymphoma is selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T-cell lymphoma.
17. The method according to claim 16, wherein the suitable therapy comprises the administration of a ligand molecule according to claim 1 or a pharmaceutical composition according to claim 6.
18. A method for screening a compound candidate that affects KIR3DL2 expression level, said method comprising the step of:
a) providing at least one T-cell able to express KIR3DL2;
b) measuring KTR3DL2 expression level by the at least one T-cell provided at step a), whereby a first KIR3DL2 expression value is obtained;
c) incubating the said KTR3DL2 expressing at least one T-cell with a candidate compound to be tested;
d) measuring the KIR3DL2 expression level by the KIR3DL2 expressing at least one T-cell of step c), whereby a second KTR3DL2 expression value is obtained; e) comparing the said first KIR3DL2 expression value with the said second KTR3DL2 expression value; and
f) selecting the said candidate compound when the said second KTR3DL2 expression value is lower than the said first KIR3DL2 expression value.
19. A method for the screening of a candidate compound that affects KIR3DL2 biological activity, said method comprising the step of:
a) providing at least one T-cell able to express KIR3DL2;
b) measuring KTR3DL2 biological activity in the at least one T-cell provided at step a), whereby a first activity value is obtained;
c) incubating KIR3DL2 expressing T-cell with a candidate compound to be tested; d) measuring the KTR3DL2 biological activity in the KTR3DL2 expressing T-cell obtained at the end of step b), whereby a second activity value is obtained;
e) comparing the said first activity value with the said second activity value.
20. A kit for diagnosing and/or monitoring a lymphoma in an individual, which kit comprises means for quantifying the level of expression of KIR3DL2, said lymphoma being selected from the group comprising sub-cutaneous panniculitis-like T-cell lymphoma, primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma, enteropathy-associated T-cell lymphoma and hepatosplenic gamma-delta T- cell lymphoma.
21. The kit according to claim 20, wherein the level of expression is quantified by measuring the level of mRNA expression.
22. The kit according to claim 20, wherein the level of expression is quantified by measuring the level of cellular protein expression, preferably the level of protein surface expression.
EP14732966.8A 2013-05-29 2014-05-28 Kir3dl2 is a biomarker and a therapeutic target useful for respectively preventing and treating a subset of cutaneous and non-cutaneous peripheral t-cell lymphomas Withdrawn EP3004165A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP14732966.8A EP3004165A1 (en) 2013-05-29 2014-05-28 Kir3dl2 is a biomarker and a therapeutic target useful for respectively preventing and treating a subset of cutaneous and non-cutaneous peripheral t-cell lymphomas

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP2013061107 2013-05-29
EP14732966.8A EP3004165A1 (en) 2013-05-29 2014-05-28 Kir3dl2 is a biomarker and a therapeutic target useful for respectively preventing and treating a subset of cutaneous and non-cutaneous peripheral t-cell lymphomas
PCT/IB2014/061786 WO2014191936A1 (en) 2013-05-29 2014-05-28 Kir3dl2 is a biomarker and a therapeutic target useful for respectively preventing and treating a subset of cutaneous and non-cutaneous peripheral t-cell lymphomas

Publications (1)

Publication Number Publication Date
EP3004165A1 true EP3004165A1 (en) 2016-04-13

Family

ID=55442571

Family Applications (1)

Application Number Title Priority Date Filing Date
EP14732966.8A Withdrawn EP3004165A1 (en) 2013-05-29 2014-05-28 Kir3dl2 is a biomarker and a therapeutic target useful for respectively preventing and treating a subset of cutaneous and non-cutaneous peripheral t-cell lymphomas

Country Status (1)

Country Link
EP (1) EP3004165A1 (en)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
S. SIVORI ET AL: "A novel KIR-associated function: evidence that CpG DNA uptake and shuttling to early endosomes is mediated by KIR3DL2", BLOOD, vol. 116, no. 10, 10 February 2010 (2010-02-10), US, pages 1637 - 1647, XP055577559, ISSN: 0006-4971, DOI: 10.1182/blood-2009-12-256586 *

Similar Documents

Publication Publication Date Title
US20180291102A1 (en) Kir3dl2 is a biomarker and a therapeutic target useful for respectively preventing and treating a subset of cutaneous and non-cutaneous peripheral t-cell lymphomas
US20240043541A1 (en) Methods for treating hematologic cancers
Klement et al. An osteopontin/CD44 immune checkpoint controls CD8+ T cell activation and tumor immune evasion
AU2017266686B2 (en) Markers selectively deregulated in tumor-infiltrating regulatory T cells
US11207393B2 (en) Regulatory T cell PD-1 modulation for regulating T cell effector immune responses
JP7843113B2 (en) Method for regulating regulatory T cells, regulatory B cells, and immune responses using an APRIL-TACI interaction modulator
EP4093513A1 (en) Uses of biomarkers for improving immunotherapy
WO2018184003A1 (en) Modulating dsrna editing, sensing, and metabolism to increase tumor immunity and improve the efficacy of cancer immunotherapy and/or modulators of intratumoral interferon
US20160208246A1 (en) Compositions and methods for treating a hematological malignancy associated with an altered runx1 activity or expression
US12109266B2 (en) Modulating gabarap to modulate immunogenic cell death
AU2019227641B2 (en) Methods for treating cancer using combinations of anti-BTNL2 and immune checkpoint blockade agents
US20250206791A1 (en) Use of ire1alpha-xbp1 signaling pathway biomarkers for modulating immune responses
EP3265179A1 (en) Beta-catenin inhibitors in cancer immunotherapy
KR20220110176A (en) Anti-KIR3DL3 antibodies and uses thereof
US20220289854A1 (en) Methods for treating cancer using combinations of anti-cx3cr1 and immune checkpoint blockade agents
Ghazi et al. KIR3DL2/CpG ODN interaction mediates Sezary syndrome malignant T cell apoptosis
WO2022067032A9 (en) Cancer therapeutic compositions and methods targeting dnase1l3
WO2019136621A1 (en) Nr4a1 as key mediator of t cell tolerance
CN114729052B (en) Anti-KIR3DL3 antibodies and their uses
CA3023980C (en) Markers selectively deregulated in tumor-infiltrating regulatory t cells
Ward The selective recruitment of regulatory t cells to human colorectal cancer

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20151120

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20170331

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20211201