EP2959002A1 - Resistance to arthropod pest in tomatoes - Google Patents

Resistance to arthropod pest in tomatoes

Info

Publication number
EP2959002A1
EP2959002A1 EP14706037.0A EP14706037A EP2959002A1 EP 2959002 A1 EP2959002 A1 EP 2959002A1 EP 14706037 A EP14706037 A EP 14706037A EP 2959002 A1 EP2959002 A1 EP 2959002A1
Authority
EP
European Patent Office
Prior art keywords
snp
plant
allele
chromosome
solcap
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP14706037.0A
Other languages
German (de)
French (fr)
Inventor
Tjeerd Adrianus Lambertus Snoeren
Einat Sitbon
David Levy
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Vilmorin SA
Original Assignee
Vilmorin SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from EP13305205.0A external-priority patent/EP2770059B1/en
Priority claimed from US13/828,187 external-priority patent/US9644242B2/en
Application filed by Vilmorin SA filed Critical Vilmorin SA
Priority to EP14706037.0A priority Critical patent/EP2959002A1/en
Publication of EP2959002A1 publication Critical patent/EP2959002A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8286Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the present invention relates to tolerance or resistance in plants of Solarium lycopersicum, also known as Lycopersicum esculentum, to arthropod pests, especially to the South American tomato pinworm, Tuta absoluta.
  • the resistance or tolerance is provided by DNA sequences, introgressed from S. galapagense at corresponding specific loci in the genome of a S. lycopersicum plant.
  • the introgressed sequences can be present homozygously or heterozygously in the genome of the S. lycopersicum plant, and they confer tolerance or resistance to said pests.
  • T. absoluta (Lepidoptera— Gelechiidae also known as Scrobipalpula absoluta, Scrobipalpuloides absoluta, Gnorimoschema absoluta, and Phthorimaea absoluta) is one of the most severe pests for solanaceous plants, especially tomatoes. According to Maluf et al. (Euphytica, 2010, 176:1 13-123), T. absoluta is an insect of neotropical distribution considered as a major tomato pest in several Latin American countries, including Argentina, Chile, Peru, Peru, Ecuador, Colombia, Venezuela, Brazil and Brazil.
  • T. absoluta attacks the plants in all of their developmental stages, damaging the leaf mesophyll, stems, stem apexes, flowers and fruits.
  • oviposition of T. absoluta is predominantly on leaflets (on both abaxial and adaxial surfaces) of the upper third of the plant, but can also occur in stems and flowers.
  • Leaf mining can evolve until all the parenchyma tissue of the leaves is consumed and only leaf veins and insect frass are left. Severe pinworm attack can cause yield losses of up to 100%.
  • T. absoluta is thus considered as a limiting factor for tomato production in several Latin American countries, wherein it accounts for about 70% of the losses and it becomes an increasing concern in Europe.
  • T. absoluta in tomatoes may be an important component of pest management programs. Resistance to T. absoluta has been found in several wild tomato accessions, inter alia in S. pennellii (corresponding to L. pennellii) LA716, S. peruvianum NAV29 and NAV 1 15, S. habrochaites (also named L. hirsutum) var. glabratum PI 134418 and PI 134417, S. habrochaites (also named L. hirsutum) var. hirsutum PI 127826, and L. hirsutum f. typicum LA1777 (autoimmune, 2001 ).
  • S. pennellii corresponding to L. pennellii
  • LA716 S. peruvianum NAV29 and NAV 1
  • S. habrochaites also named L. hirsutum var. glabratum PI 134418 and PI 134417
  • S. habrochaites also named L. hirsut
  • allelochemicals with pest-deterrent activities such as methyl-ketones in PI 134417 (Maluf et al. 1997), sesquiterpenes (zingiberene) in PI127826 (Azevedo et al. 2003), and acylsugars (acylglucoses, acylfructoses) in LA 716 (Resende et al. 2006; Maluf et al. 2010).
  • the present invention provides commercial S. lycopersicum plants that display important tolerance or resistance to T. absoluta infestation, as well as methods that produce or identify S. lycopersicum plants or populations (germplasm) that display resistance to T. absoluta infestation.
  • the present invention also discloses molecular genetic markers, especially SNPs, linked to the resistance loci.
  • the present inventors have identified a wild tomato accession in S. galapagense (also known as L. cheesmanii) which displays an important tolerance or resistance to T. absoluta infestation and they have been able to introgress into S. lycopersicum background the S. galapagense sequences conferring this resistance and/or tolerance, thus obtaining commercial tomatoes resistant and/or tolerant to arthropod pests, especially to T. absoluta.
  • S. galapagense also known as L. cheesmanii
  • the present inventors have identified a source of T. absoluta resistance which has never been tested before, namely in a S. galapagense accession.
  • the inventors have made the main selection steps on the basis of T. absoluta resistance and they have determined the best parameter to be followed for this selection.
  • the prior art discloses numerous different parameters, such as arthropod eggs and offspring counts, number of large mines per leaf, number of small mines per leaf, percentage of leaves mined, overall plant damage, leaflet lesion type, percent of attacked leaflets, overall leaf damage, and insect survival.
  • direct selection was not feasible since the nature of the resistance is not entirely clear, likely combining non-preference, antibiosis, antixenosis and tolerance.
  • the inventors have indeed detected variance in between lines in terms of number of leaflets per total marked leaf fed on (PLA) and the total amount of plant tissue fed on (OPD). This observation could have been caused by differences in amount of eggs the plant was exposed to or the quality of the leaf tissue fed on. The amount of eggs has been ruled out by the inventors, since egg counts per marked leaves indicated no differences between lines.
  • the only causal factor for the non-preference is the quality of the leaf tissue that influences negatively the feeding behavior of the pest, and especially the South American tomato pinworm.
  • the plants according to the invention thus present an improved tolerance or resistance to arthropod pests by comparison to any commercial S. lycopersicum plant, all the commercial tomatoes before the present invention being indeed susceptible to arthropod pests, especially to T. absoluta.
  • the present invention is thus directed to a S. lycopersicum plant, which is tolerant or resistant to an arthropod pest, comprising in its genome introgressed sequences or intervals from S. galapagense conferring resistance to said arthropod pest.
  • the term "Resistance” is as defined by the ISF (International Seed Federation) Vegetable and Ornamental Crops Section for describing the reaction of plants to pests or pathogens, and abiotic stresses for the Vegetable Seed Industry.
  • resistance it is meant the ability of a plant variety to restrict the growth and development of a specified pest or pathogen and/or the damage they cause when compared to susceptible plant varieties under similar environmental conditions and pest or pathogen pressure. Resistant varieties may exhibit some disease symptoms or damage under heavy pest or pathogen pressure.
  • Insect-resistance refers to insect-plant interactions that comprise insect-responses and plant characteristics
  • Non-preference refers to insect responses subject to plant characteristics that lead away from the use of a particular plant for oviposition, for food or for shelter, or for combinations of the three.
  • Antixenosis refers to plant characteristics evoking a negative response or a total avoidance by insects.
  • Antibiosis refers to plant characteristics that adversely affect the physiology of a herbivore insect species. Those plant properties denote reduced fecundity, decreased size, reduced longevity and increased mortality of the pest insect species (Schoonhoven et al. 1998).
  • tolerance means the ability of a plant variety to endure biotic and abiotic stress without serious consequences for growth, appearance and yield.
  • Susceptibility The inability of a plant variety to restrict the growth and development of a specified pest or pathogen. Plants from for example the lines Rehovot-13 ⁇ LYC02), Komeett, Plaisance or F1 Daniela (HA144) are susceptible S. lycopersicum plants. A plant according to the invention has thus at least improved resistance or tolerance with respect to these plants, and more generally with respect to any commercial variety of tomato.
  • introgression it is meant the infiltration of the genes or of genomic sequences of one species into the gene pool of another one from an initial interspecific hybrid between these species.
  • introgressed sequences or intervals from S. galapagense conferring the tolerance or resistance in S. lycopersicum, they are chosen from those present in the genome of a plant of the tomato seed TUT1 15. A sample of this tomato seed has been deposited by Hazera Genetics Ltd, Berurim, M.P.
  • a deposit of this tomato seed is maintained by Hazera Genetics Ltd, Berurim, M.P. Shikmim 79837, Israel.
  • the deposited seeds and plants thereof have been obtained from an initial interspecific cross between a plant of S. galapagense GALA1, i.e. the introgression partner displaying the phenotype of interest, and a plant of the line S. lycopersicum LYC01, the recurrent susceptible parent.
  • the deposited seeds thus represent a reservoir of introgressed sequences from S. galapagense in the S. lycopersicum genome.
  • the introgressed sequences conferring resistance and/or tolerance to pest arthropods according to the invention are chosen from this reservoir.
  • a S. lycopersicum plant according to the invention is a commercial plant or line.
  • Such a commercial plant or line preferably also exhibits resistance to ToMV (tomato mosaic virus), for example due to the presence of a Tm-2 (allele Tm-2 or Tm-2 2 (also known as 7m- 2 a )) or Tm-1 resistance gene, which also confers resistance to TMV (Tobacco Mosaic Virus).
  • Tm-2 allele Tm-2 or Tm-2 2 (also known as 7m- 2 a )
  • Tm-1 resistance gene which also confers resistance to TMV (Tobacco Mosaic Virus).
  • a plant according to this aspect of the invention preferably has also the following additional features: nematode resistance trait (Mi-1 or Mi-j).
  • the commercial plant of the invention gives rise to fruits in suitable conditions, which are at least 10 grams at maturity, preferably at least 25 g at full maturity and or even more preferred at least 50 g at full maturity.
  • such a phenotype is conferred by introgressed sequences or intervals from S. galapagense, chosen from the introgressed sequences found in the genome of the deposited plants TUT1 15.
  • Said introgressed sequences or intervals may form part of larger introgression fragments from S. galapagense into the genome of a S. lycopersicum plant of the invention.
  • Introgression fragments or introgressed intervals from S. galapagense comprising sequences conferring resistance or tolerance to said pest can be found preferably on chromosomes 1 , 5, 6, 9 and 12 of a S. lycopersicum plant of the invention.
  • said introgression fragments and thus said introgressed sequences conferring resistance and/ or tolerance to arthropod pests are to be found at one or more of the following loci:
  • the genomic interval found at this given locus has the same sequence as the genomic interval found in S. galapagense donor, the introgression partner, at the same locus; thus at least the allele of the SNP is the allele found in the genome of S. galapagense donor, and that the 5' flanking region, or the 3' flanking region, or both, are identical to S. galapagense sequences in this region. Therefore, the SNP may form part of the 3' border or 5' border of the introgressed interval, or may be within the introgressed interval conferring the desired phenotype.
  • Said introgressed sequences or intervals are preferably at least 5 kilobases long, and preferably at least 8, 10 or 15 kb long.
  • the introgressed sequences or intervals from S. galapagense are not too long in order to avoid introgression of non-commercial features associated with the S. galapagense genotype. It is thus preferred according to the invention that the introgressed sequences mentioned above are less than 25 cM each in length, preferably less than 10 cM and most preferably less than 5 cM in order to avoid or limit linkage drag.
  • said introgressed sequences are minimized to contain as few as possible sequences unrelated to the desired phenotype. More generally, insofar as resistance or tolerance to arthropod pest can be seen as a quantitative phenotype, the specific chromosomal intervals (or QTL for quantitative trait loci) that correlate with the desired phenotype can be mapped by the 12 SNPs recited above. The introgressed sequences at the 12 loci mentioned above thus constitute Quantitative Trait Loci (QTL) underlying the desired trait.
  • QTL Quantitative Trait Loci
  • introgressed sequences or intervals from S. galapagense conferring the tolerance or resistance they are chosen from those present in the genome of a plant corresponding to the deposited material TUT1 15 (NCIMB 42109) at the corresponding loci. Plants corresponding to the deposited material indeed have introgressed sequences from the S. galapagense donor GALA1 at said 12 loci.
  • a plant according to this embodiment thus encompasses in its genome introgressed sequences from S. galapagense at one locus or more of the 12 loci recited above; such a plant thus presents the allele specific of the donor S. galapagense for at least one of the 12 SNPs recited above.
  • a plant of the invention has thus at least one of the following alleles: allele G of SNP solcap_snp_sl_18619 on chromosome 1 , allele C of SNP solcap_snp_sl_12348 on chromosome 1 ; allele C of SNP EP_1592_LC7762 on chromosome 1 , allele T of SNP EE_0301 on chromosome 5, allele G of SNP EE_4363_LC7656 on chromosome 6, allele A of SNP CL016475-0340 on chromosome 9; allele C of SNP EP_0502 on chromosome 9, allele A of SNP EE_4969_LC7529 on chromosome 9, allele T of SNP EE_2332 on chromosome 9, allele C of SNP SL10204_1269 on chromosome 12, allele A of SNP SGN-U573565_snp665 on chromosome 12 and allele T of SNP
  • said introgression fragments and thus said introgressed sequences conferring resistance and/ or tolerance to arthropod pests are alternatively to be found at one or more of the following loci:
  • QTL Quantitative Trait Loci
  • the preferred minimal length of the introgressed sequences are as defined in the preceding section with respect to the first embodiment of the invention, in connection with the 12 loci of the invention.
  • a plant according to this embodiment thus encompasses in its genome introgressed sequences from S. galapagense at one locus or more of the 12 alternative loci recited above; such a plant thus exhibits the allele specific of the donor S. galapagense for at least one of the 12 alternative SNPs.
  • a plant of the invention according to this embodiment has thus at least one of the following alleles: allele A of SNP solcap_snp_sl_59890 on chromosome 1 , allele C of SNP solcap_snp_sl_15339 on chromosome 1 ; not allele T or G of SNP solcap_snp_sl_40154 on chromosome 1 , allele C of SNP solcap_snp_sl_32320 on chromosome 6, allele A of SNP SL10187_425 on chromosome 6, allele C of SNP EE_2362 on chromosome 6; allele C of SNP EE_2996 on chromosome 6, allele T of SNP SL10539_786_LC7260 on chromosome 6, allele C of SNP EP_0489_LC7684 on chromosome 9, not allele T or C of SNP IL2_5178 on chromosome 9, allele C of SNP EE_
  • the 12 SNPs detailed for the first and second embodiments are used as markers for the detection of introgressed sequence from S. galapagense.
  • a plant according to the invention has introgressed sequences from S. galapagense at at least one of the 24 loci defined according to the first and second embodiments.
  • the 12 SNP markers according to the 1 st or 2 nd embodiment of the invention are marker loci linked to chromosomal regions or QTL that are involved in or associated with the tolerance or resistance phenotype.
  • the allele of these markers thus indicates whether the sequences surrounding the markers are introgressed from S. galapagense or not, introgressed sequences at this locus being correlated to resistance or tolerance to arthropod pest whereas S. lycopersicum sequences at this locus are not indicative of resistance or tolerance to arthropod pests.
  • a single of this chromosomal region may impart the desired phenotype.
  • the present invention is directed to plant having introgressed sequences from S. galapagense at a single locus of the 12 loci or of the 12 alternative loci recited above, however conferring resistance or tolerance to arthropod pest.
  • a plant of the invention has introgressed sequences at 2 of the 12 loci or of the 12 alternative loci, and preferably at 3, 4, 5, 6, 8, 10 of the 12 loci or of the 12 alternative loci, or of the 24 loci constituted by the 12 loci and 12 alternative loci.
  • a plant of the invention has at least one of the following alleles: allele G of SNP solcap_snp_sl_18619 on chromosome 1 , allele C of SNP solcap_snp_sl_12348 on chromosome 1 ; allele C of SNP EP_1592_LC7762 on chromosome 1 , allele T of SNP EE_0301 on chromosome 5, allele G of SNP EE_4363_LC7656 on chromosome 6, allele A of SNP CL016475-0340 on chromosome 9; allele C of SNP EP_0502 on chromosome 9, allele A of SNP EE_4969_LC7529 on chromosome 9, allele T of SNP EE_2332 on chromosome 9, allele C of SNP SL10204
  • Preferred combinations of alleles correspond inter alia to combinations of SNPs found on the same chromosome, for example allele G of SNP solcap_snp_sl_18619, allele C of SNP solcap_snp_sl_12348 and allele C of SNP EP_1592_LC7762 on chromosome 1 , or the combination of allele A of SNP CL016475-0340; allele C of SNP EP_0502, allele A of SNP EE_4969_LC7529 and allele T of SNP EE_2332 on chromosome 9, or the combination of allele C of SNP SL10204J269, allele A of SNP SGN-U573565_snp665 and allele T of SNP EE_0924 on chromosome 12.
  • a plant according to the invention displays introgressed sequences from S. galapagense, in at least one of the chromosomes 1 , 5, 6, 9 and 12, preferably on at least two of said chromosomes, and preferably at least 3 or 4, or on the 5 chromosomes, at the loci defined above.
  • the S. lycopersicum plant of the invention comprises, introgressed in its genome, a chromosomal region or fragment from S. galapagense, conferring resistance or tolerance to arthropod pest, especially to T. absoluta infestation.
  • a chromosomal region or fragment corresponds to or includes:
  • a plant according to the invention comprises, introgressed in its genome, at least one chromosomal fragment having S. galapagense sequences and corresponding to or comprising one of the chromosomal regions recited above.
  • a plant of the invention comprises at least two chromosomal fragments corresponding or comprising at least two of the regions recited above, preferably at least 3 or 4.
  • a plant of the invention comprises, introgressed in its genome, sequences corresponding to or comprising the 5 chromosomal regions defined above.
  • Said introgressed chromosomal regions from S. galapagense are present in the genome of plants of the deposited seeds (deposited at the NCIMB under accession number 42109) and can thus be defined with respect to these plants.
  • a plant of the invention does not comprise any introgression fragment from S. galapagense on a chromosome different from chromosomes 1 , 5, 6, 9 and 12.
  • any introgression fragment or introgressed sequences from S. galapagense are within one of the following chromosomal segments:
  • F The region delimited by the telomeric region of the short arm (in north of chromosome 12) and SNP solcap_snp_sl_1495 on chromosome 12 of said plant.
  • a plant of the invention preferably does not comprise any introgressed sequences from S. galapagense donor located outside of the chromosomal segments A to F mentioned above. Moreover, a particularly preferred plant comprises introgressed sequences from S. galapagense donor in every segment A to F and does not comprise introgressed sequences outside of these segments.
  • the introgressed sequences from S. galapagense conferring resistance and / or tolerance to arthropod pest according to the present invention are preferably homozygoulsy present in the genome of a plant. Accordingly, such a plant preferably exhibits, on both homologues of chromosome 1 , and/or of chromosome 5, and /or of chromosome 6, and/or of chromosome 9 and/or of chromosome 12, introgressed sequences from S. galapagense capable of conferring resistance or tolerance to arthropod pest. It must be borne in mind that this thus not necessarily imply that the introgression fragments from S. galapagense on both chromosome homologues are identical.
  • one of the homologue may comprise only the introgressed sequences necessary and sufficient to confer resistance or tolerance, whereas the other homologue comprises a larger introgression fragment, comprising said sequences in addition to further sequences from S. galapagense unrelated to resistance or tolerance.
  • a plant of the invention is homozygous for at least one of the following alleles: allele G of SNP solcap_snp_sl_18619 on chromosome 1 , allele C of SNP solcap_snp_sl_12348 on chromosome 1 ; allele C of SNP EP_1592_LC7762 on chromosome 1 , allele T of SNP EE_0301 on chromosome 5, allele G of SNP EE_4363_LC7656 on chromosome 6, allele A of SNP CL016475-0340 on chromosome 9; allele C of SNP EP_0502 on chromosome 9, allele A of SNP EE_4969_LC7529 on chromosome 9, allele T of SNP EE_2332 on chromosome 9, allele C of SNP SL10204J269 on chromosome 12, allele A of SNP SGN-U573565_snp665 on chromosome 12 and allele
  • a plant comprises introgressed sequences from S. galapagense conferring the desired trait on only one of the two chromosome homologues, i.e. the introgressed sequences conferring resistance or tolerance are present heterozygously in the genome of such a plant.
  • sequences conferring resistance or tolerance present at any one of the 12 loci or 12 alternative loci defined above, are present homozygously in the genome of a plant of the invention, whereas other introgressed sequences, present at other ones of the 12 loci or alternative loci are present heterozygously in the genome of a plant according to the invention.
  • the improved tolerance or resistance to arthropod pest is advantageously determined by comparison to a susceptible (commercial) line, for example Rehovot-13 ⁇ LYC02) tomato plants. It is preferably determined on the basis of Percent Leaflet Attacked rating.
  • the present inventors have indeed identified this rating as the best criterion to represent the tolerance or resistance of the plants toward T. absoluta attacks.
  • this criterion is determined a few days after infestation; a perfectly suitable time-limit is between 3 to 15 days post infestation by the pest, for example 8 days post infestation.
  • the tolerance or resistance to arthropod pest is for example determined at 8 days after exposure to the pest population, and is considered as “improved” if the difference between the test plant and a susceptible plant is a significant reduction of the PLA.
  • “significant” it is meant a reduction which is significant from a statistical point of view.
  • the significant reduction is a reduction of at least 5% of the PLA for the test plant; preferably, the reduction is of at least 10% or even preferably a reduction by almost 25 or 30%.
  • Plants obtained by the inventors as described in the experimental section display a reduction of at least 50 % of the PLA determined at 8 days post infestation.
  • a plant according to the invention preferably displays a PLA score at 8 days post exposure to the pest population which is reduced by at least 30%, preferably at least 50% and most preferably at least 70% with respect to a susceptible commercial S. lycopersicum line.
  • the PLA is scored preferably in a greenhouse or a nethouse, in presence of an abundant pest population.
  • the climactic conditions in the greenhouse are typical conditions for tomato culture.
  • the PLA score is determined according to the scale defined in Maluf et al. 1997, and detailed in the experimental section.
  • a plant according to the invention is preferably a plant deriving from a plant grown from the deposited seed under accession number NCIMB 42109, for example a plant derived from one of the deposited seed by one or several backcrosses to a S. lycopersicum line.
  • a progeny of a plant obtained from the deposited seed can be identified by one skilled in the art, for example by comparison of the introgression edges.
  • a plant of the invention is also advantageously obtainable by a process comprising an interspecific cross between a S. galapagense parent, and a S. lycopersicum parent, followed by at least one selfing step and at least two backcrossing steps, whereas the progeny is selected at each stage on the basis of one or more of the alleles of the markers marking the 12 loci; i.e.
  • SNP solcap_snp_sl_18619 on chromosome 1 SNP solcap_snp_sl_12348 on chromosome 1 , SNP EP_1592_LC7762 on chromosome 1 , SNP EE_0301 on chromosome 5, SNP EE_4363_LC7656 on chromosome 6, SNP CL016475-0340 on chromosome 9, SNP EP_0502 on chromosome 9, SNP EE_4969_LC7529 on chromosome 9, SNP EE_2332 on chromosome 9, SNP SL10204_1269 on chromosome 12, SNP SGN-U573565_snp665 on chromosome 12 and SNP EE_0924 on chromosome 12.
  • the selection may be carried out on the basis of the alleles of the markers marking the 12 alternative loci, i.e. SNP solcap_snp_sl_59890 on chromosome 1 , SNP solcap_snp_sl_15339 on chromosome 1 , SNP solcap_snp_sl_40154 on chromosome 1 , SNP solcap_snp_sl_32320 on chromosome 6, SNP SL10187_425 on chromosome 6, SNP EE_2362 on chromosome 6, SNP EE_2996 on chromosome 6, SNP SL10539_786_LC7260 on chromosome 6, SNP EP_0489_LC7684 on chromosome 9, SNP IL2_5178 on chromosome 9, SNP EE_3482_LC7808 on chromosome 9, and SNP EE_1452 on chromosome 9.
  • the plants as defined are resistant or tolerant to arthropod pest, wherein said arthropods are more specifically insect arthropods, inter alia Lepidoptera or Hemiptera, or acari arthropods.
  • arthropods in the context of the present invention are pinworms, and especially the South American pinworm T. absoluta.
  • plants according to the invention are resistant or tolerant to one or more of the following arthropods: aphids, whitefly, thrips, leafminers ⁇ Liriomyza), caterpillars (Spodoptera), tomato psyllids, spider mites, rust mites and nematodes, in addition to or in place of resistance to T. absoluta.
  • a plant of the invention is simultaneously resistant to pinworms, white flies, spider mites, Tomato Russet mites and thrips.
  • the present invention is directed to parts of a plant as defined according to the first aspect of the invention, namely parts of a plant resistant or tolerant to an arthropod pest due to the presence in its genome of introgressed sequences from S. galapagense.
  • a part of a plant is preferably a plant cell; the invention is thus concerned with a plant cell of S. lycopersicum comprising in its genome introgressed sequences from S. galapagense conferring resistance to said arthropod pest, at one or more of said 12 loci or of said 12 alternative loci.
  • a plant cell of the invention has preferably introgressed sequences from S. galapagense at more than one of said loci, preferably at at least 2 or 3 loci, preferably at least 5, 8 or 10.
  • Particularly preferred plant cells are those comprising introgressed sequences from S. galapagense conferring said resistance or tolerance at the 12 loci defined above, or at the 12 alternative loci, or at the 24 loci.
  • a plant cell according to this aspect of the invention is thus characterized by the presence in its genome of at least one of the following alleles: allele G of SNP solcap_snp_sl_18619 on chromosome 1 , allele C of SNP solcap_snp_sl_12348 on chromosome 1 ; allele C of SNP EP_1592_LC7762 on chromosome 1 , allele T of SNP EE_0301 on chromosome 5, allele G of SNP EE_4363_LC7656 on chromosome 6, allele A of SNP CL016475-0340 on chromosome 9; allele C of SNP EP_0502 on chromosome 9, allele A of SNP EE_4969_LC7529 on chromosome 9, allele T of SNP EE_2332 on chromosome 9, allele C of SNP SL10204_1269 on chromosome 12, allele A of SNP SGN-U573565_snp665
  • a plant cell according to the invention may also comprise introgression fragments corresponding to or including one or more of the 5 regions i) to v) defined with respect to the first aspect of the invention.
  • a plant cell of the invention does not comprise introgressed sequences from S. galapagense in chromosomes other than chromosomes 1 , 5, 6, 9 and 12. More preferably, a plant cell does not comprise introgressed sequences located outside of the chromosomal segments A to F mentioned above, but comprised introgressed sequences from the S. galapagense donor within all these 6 segments.
  • a plant cell of the invention may have the capacity to be regenerated into a whole plant.
  • the invention is also directed to plant cells which are not regenerable, and thus are not capable of giving rise to a whole plant.
  • the plant part is any other part of a plant of the invention, it may be in particular seeds, reproductive material, roots, flowers, fruits, rootstock or scion.
  • a part comprises a cell as defined above, i.e. having introgressed sequences from S. galapagense capable of conferring resistance or tolerance to arthropod pest to a S. lycopersicum plant.
  • the invention is more particularly concerned with seed of a S. lycopersicum plant, giving rise when grown up to S. lycopersicum plant tolerant or resistant to arthropod pest as defined above, which is preferably a commercial plant also resistant to ToMV (Tomato Mosaic Virus).
  • S. lycopersicum plant tolerant or resistant to arthropod pest as defined above, which is preferably a commercial plant also resistant to ToMV (Tomato Mosaic Virus).
  • ToMV Tomato Mosaic Virus
  • the invention is also concerned with seed from a plant of the invention, i.e. obtained from such a plant after selfing or crossing, provided however that the plant obtained from said seed is resistant or tolerant to arthropod pest due to introgressed sequences from S. galapagense conferring said trait.
  • GISH genetic in situ hybridization
  • GISH is indeed a powerful technique for detection of the introgression of chromatin material from one species onto another species.
  • the advantage of GISH is that the introgression process is visualized by means of 'pictures of the introgressed genome'. With this technique, it is also possible to establish if a particular region of the genome is homozygous or heterozygous, thanks to the use of molecular cytogenetic markers which are co-dominant. By this technique, it is also possible to determine in which chromosome an introgressed gene of interest is present.
  • the present invention is also directed to the use of a tomato plant as detailed according to the first aspect of the invention, i.e. tolerant and/ or resistant to arthropod pest, especially to T. absoluta, as a breeding partner in a breeding program for obtaining S. lycopersicum plants tolerant or resistant to pest arthropods.
  • a tomato plant according to the first aspect harbors in its genome introgressed sequences from S. galapagense, conferring said tolerance or resistance. By crossing this plant with susceptible or less resistant plants, it is thus possible to transfer these sequences, conferring the desired phenotype, to the progeny.
  • a plant according to the invention can thus be used as a breeding partner for introgressing sequences conferring the desired phenotype into a S. lycopersicum plant or germplasm.
  • the invention is also directed to the same use with plants or seed of TUT1 15 as deposited at NCIMB under accession number 42109. Said plants are also suitable as introgression partners in a breeding program aiming at conferring the desired phenotype to a S. lycopersicum plant or germplasm.
  • the selection of the progeny displaying the desired phenotype, or bearing sequences linked to the desired phenotype can advantageously be carried out on the basis of the allele of the SNP markers.
  • the progeny is preferably selected on the presence of one or more of the following specific alleles: allele G of SNP solcap_snp_sl_18619 on chromosome 1 , allele C of SNP solcap_snp_sl_12348 on chromosome 1 ; allele C of SNP EP_1592_LC7762 on chromosome 1 , allele T of SNP EE_0301 on chromosome 5, allele G of SNP EE_4363_LC7656 on chromosome 6, allele A of SNP CL016475-0340 on chromosome 9; allele C of SNP EP_0502 on chromosome 9, allele A of SNP EE_4969_LC7529 on chromosome 9, allele T of SNP EE_
  • the selection of the progeny having the desired phenotype can also be made on conditions of pest infestation, as disclosed inter alia in example 1 for T. absoluta.
  • a plant according to the invention is thus particularly valuable in a marker assisted selection for obtaining commercial tomato lines and varieties resistant and/or tolerant to arthropod pest, especially to T. absoluta.
  • the invention is also directed to the use of said plants in a program aiming at identifying, sequencing and / or cloning the genes conferring the desired phenotype, i.e. resistance and / or tolerance to arthropod pest, especially to T. absoluta.
  • any specific embodiment described for the 1 st and 2 nd aspects of the invention is also applicable to this aspect of the invention, especially with regard to any combination of SNPs amongst the 12 SNPs of the invention, or amongst the 12 alternative SNPs.
  • the invention also concerns methods for the production of S. lycopersicum plants having the desired phenotype, especially commercial plants. Preferably such plants are also resistant to ToMV (Tomato Mosaic Virus).
  • ToMV Tomato Mosaic Virus
  • a method or process for the production of a plant having these features comprises the following steps:
  • step b) Optionally self-pollinating one or several times the resistant plant obtained at step b) and selecting a plant resistant to arthropod pest in the progeny thus obtained; in one embodiment, such a plant is also resistant to ToMV; d) Backcrossing the resistant plant selected in step b) or c) with a susceptible S. lycopersicum plant (i.e. susceptible to arthropod pest), preferably, such a susceptible plant is resistant to ToMV ;
  • a susceptible S. lycopersicum plant i.e. susceptible to arthropod pest
  • the method or process may comprise the following steps:
  • a1 Crossing a plant corresponding to the deposited seeds (NCIMB 42109) and a susceptible or less resistant S. lycopersicum plant, in which the desired phenotype is to be imported or improved, thus generating the F1 population.
  • Said susceptible plant may possess or not the feature of resistance to ToMV.
  • step b) Optionally self-pollinating one or several times the resistant plant obtained at step b) and selecting a resistant plant in the progeny thus obtained; in one embodiment, such a plant is also resistant to ToMV;
  • step c) or d) Backcrossing the resistant plant selected in step c) or d) with a susceptible S. lycopersicum plant (i.e. susceptible to arthropod pest), preferably, such a susceptible plant is resistant to ToMV ;
  • a susceptible S. lycopersicum plant i.e. susceptible to arthropod pest
  • a plant resistant to arthropod pest and preferably also resistant to ToMV. According to another embodiment, it can be selected at steps b), c) and e) either plant tolerant to arthropod pest or resistant to arthropod pest.
  • the plant selected at step e) is preferably a commercial plant, especially a plant having fruits which weigh at least 25 g, or at least 50 g at full maturity in normal culture conditions.
  • steps d) and e) are repeated at least twice and preferably three times, not necessarily with the same susceptible S. lycopersicum plant.
  • Said susceptible S. lycopersicum plant is preferably a breeding line.
  • Resistance to nematode trait may be used in place of or in addition to resistance to ToMV in the processes disclosed above.
  • the self-pollination and backcrossing steps may be carried out in any order and can be intercalated, for example a backcross can be carried out before and after one or several self- pollinations, and self-pollinations can be envisaged before and after one or several backcrosses.
  • Such a method is advantageously carried out by using SNPs markers for one or more of the selections carried out at steps b), c) and/or e) for selecting plants resistant to arthropod pest.
  • the SNP markers are preferably one or more of the 12 SNP markers of the invention, or of the 12 alternative SNP markers, or of a combination of the 24 SNP markers.
  • the selection is at least partly made on the basis of the allele of one or more SNP solcap_snp_sl_18619 on chromosome 1 , SNP solcap_snp_sl_12348 on chromosome 1 ; SNP EP_1592_LC7762 on chromosome 1 , SNP EE_0301 on chromosome 5, SNP EE_4363_LC7656 on chromosome 6, SNP CL016475- 0340 on chromosome 9; SNP EP_0502 on chromosome 9, SNP EE_4969_LC7529 on chromosome 9, SNP EE_2332 on chromosome 9, SNP SL10204_1269 on chromosome 12, SNP SGN-U573565_snp665 on chromosome 12 and SNP EE_0924 on chromosome 12.
  • the selection is preferably carried out by detecting the alleles of at least 2 or 3 of these SNPs, preferably at least 5, 8 or 10, or on the basis of the 12 SNP markers.
  • said set preferably, when only a partial set of the 12 markers is used, said set combines SNPs on different chromosomes.
  • partial sets of the 12 markers combine markers which are found in the same region i) to iv) as defined with respect to the first aspect of the invention.
  • the plant selected at any one of steps b), c) and/or e) is preferably selected on the presence of one or more of the following specific alleles: allele G of SNP solcap_snp_sl_18619 on chromosome 1 , allele C of SNP solcap_snp_sl_12348 on chromosome 1 ; allele C of SNP EP_1592_LC7762 on chromosome 1 , allele T of SNP EE_0301 on chromosome 5, allele G of SNP EE_4363_LC7656 on chromosome 6, allele A of SNP CL016475-0340 on chromosome 9; allele C of SNP EP_0502 on chromosome 9, allele A of SNP EE_4969_LC7529 on chromosome 9, allele T of SNP EE_2332 on chromosome 9, allele C of SNP SL10204_1269 on chromosome 12, allele A of SNP SGN-U57
  • the selection of the progeny having the desired phenotype can also be made on conditions of pest infestation, as disclosed inter alia in example 1 for T. absoluta.
  • the method used for allele detection can be based on any technique allowing the distinction between two different alleles of a SNP, on a specific chromosome.
  • the invention is also directed to a method or process for obtaining S. lycopersicum plants having the desired phenotype, wherein said method comprises the steps of:
  • step b) or c) Backcrossing the resistant hybrid selected in step b) or c) with a susceptible S. lycopersicum plant (i.e. susceptible to arthropod pest); such a susceptible plant may be resistant to ToMV;
  • a susceptible S. lycopersicum plant i.e. susceptible to arthropod pest
  • steps d) to g) can be repeated and wherein SNPs markers are used in steps b), c), e) and/or g) for selecting plants resistant to arthropod pest, as detailed for the previous method. According to another embodiment, it can be selected plants tolerant to arthropod pest.
  • the plant selected at step g) is preferably a commercial plant, especially a plant having fruits which weigh at least 25 g, or at least 50 g, at full maturity in normal culture conditions.
  • the invention also concerns a method wherein steps a) to c) are not carried out and wherein step d) is carried out with a plant obtained from the deposited seed (NCIMB accession number 42109) instead of the resistant hybrid mentioned above in step d).
  • Resistance to nematode trait may be used in place of or in addition to resistance to ToMV in the processes disclosed above.
  • steps d) and e) can be repeated, they are preferably carried out twice, or three times.
  • steps f) and g) which are preferably carried out twice, three times or more.
  • the present invention also concerns a plant obtained or obtainable by such a method.
  • a plant is indeed a S. lycopersicum plant having the desired phenotype according to the first aspect of the invention and is preferably also resistant to ToMV.
  • the invention is also directed to a method for obtaining commercial tomato plants, having the desired phenotype, comprising the steps of:
  • a S. lycopersicum plant obtained by germinating the deposited seeds TUT1 15 (NCIMB accession number 42109), with a S. lycopersicum plant, for example a S. lycopersicum plant susceptible to arthropod pest; such a S. lycopersicum plant may be resistant to ToMV;
  • the selection in the second step is preferably carried out as detailed above for the other methods of the invention. Said selection is preferably carried out on the presence of one or more of the specific alleles of the SNPs of the invention, as found in TUT1 15.
  • the plant selected is preferably a commercial plant, especially a plant having fruits which weigh at least 25 g, or at least 50 g, at full maturity in normal culture conditions.
  • the invention is moreover directed to a method for detecting and/or selecting S. lycopersicum plants having introgressed sequences from S. galapagense conferring resistance to arthropod pest, on the basis of the allele detection of at least one SNP chosen amongst the group of SNPs comprising SNP solcap_snp_sl_18619 on chromosome 1 , SNP solcap_snp_sl_12348 on chromosome 1 ; SNP EP_1592_LC7762 on chromosome 1 , SNP EE_0301 on chromosome 5, SNP EE_4363_LC7656 on chromosome 6, SNP CL016475-0340 on chromosome 9; SNP EP_0502 on chromosome 9, SNP EE_4969_LC7529 on chromosome 9, SNP EE_2332 on chromosome 9, SNP SL10204_1269 on chromosome 12, SNP SGN- U573565_snp665
  • tolerant or resistant plants are selected if at least one of the following markers is detected: allele G of SNP solcap_snp_sl_18619, allele C of SNP solcap_snp_sl_12348; allele C of SNP EP_1592_LC7762, allele T of SNP EE_0301 , allele G of SNP EE_4363_LC7656, allele A of SNP CL016475-0340; allele C of SNP EP_0502, allele A of SNP EE_4969_LC7529, allele T of SNP EE_2332, allele C of SNP SL10204_1269, allele A of SNP SGN-U573565_snp665 and allele T of SNP EE_0924, in a genetic material sample of the plant to be selected.
  • the allele of interest which is detected is present homozygously in the selected plant, i.e. no other allele of said SNP is
  • the selection is thus made on the simultaneous presence of the 12 following alleles: allele G of SNP solcap_snp_sl_18619, allele C of SNP solcap_snp_sl_12348; allele C of SNP EP_1592_LC7762, allele T of SNP EE_0301 , allele G of SNP EE_4363_LC7656, allele A of SNP CL016475-0340; allele C of SNP EP_0502, allele A of SNP EE_4969_LC7529, allele T of SNP EE_2332, allele C of SNP SL10204J269, allele A of SNP SGN-U573565_snp665 and allele T of SNP EE_0924, and the concomitant absence of the following alleles: allele T of SNP solcap_snp_sl_18619, allele T of SNP solcap_snp_sl_12348
  • sequences conferring resistance or tolerance to arthropod pest can also be introduced into S. lycopersicum background by genetic engineering in order to obtain a commercial S. lycopersicum plant resistant or tolerant to said pest.
  • the identification and cloning of the introgressed sequences from S. galapagense conferring the desired phenotype, inter alia from the deposit, are routine for the skilled person.
  • the present invention is also directed to hybrid plant of S. lycopersicum, obtainable by crossing a tolerant or resistant plant according to the first aspect of the invention, or a tolerant or resistant plant obtainable by the method disclosed according to the fourth aspect, with a plant of S.
  • lycopersicum for example a plant susceptible to arthropod pest, or a plant with a different level of resistance or tolerance to arthropod pest.
  • a particularly preferred hybrid S. lycopersicum plant is a plant which displays a cytoplasmic male sterility, or any other trait or phenotype of agronomical interest.
  • FIG.1 illustrates the Pinworm oviposition per leaf, for different germplasms in a multiple choice experiment.
  • the pinworm under test is T. absoluta.
  • FIG.2 illustrates the Pinworm oviposition per leaf, for the rearing variety for T. absoluta, the recurrent line LYC01 and the germplasm GALA1, in a three choice experiment.
  • the pinworm under test is T. absoluta.
  • FIG. 3 illustrates the pinworm feeding per leaf.
  • the pinworm under test is T. absoluta.
  • FIG. 4 illustrates the spider mite feeding damage scaling.
  • Example 1 Test of a possible source of resistance to T. absoluta.
  • Tomato germplasm was sown and reared in nursery trays (187 holes of 1 .5" / tray). Seedlings having 3-4 true leaves were transplanted into 1 L pots containing soil mixture of peat and volcano soil (2:1 ). Plants were transferred to an insect free greenhouse for further development. Plants were regularly watered and fertilizer was added (6:6:6 NPK + micro elements). Temperatures varied between day and night and over seasons: namely 26°C at day and 17°C at night in winter, and 27°C at day and 23°C at night in summer. No insecticides were applied, and after three weeks plants were treated with the fungicide PROPAMOCARB- HCL. Plants having at least 6 true leaves were used for experiments, these plants were approximately 6 weeks old and 30-45 cm of height.
  • CHMIE2 S. chmielewskii South American tomato pinworm rearing
  • the South American tomato pinworm population is reared on LYC02 tomato plants. Plants having at least 6 true leaves were placed in an insect cage (45 * 45 * 90cm; 150 mesh gauze), 5 to which adult pinworms were added. Pinworm adults were collected from infested commercial greenhouse tomato plants. Insects were reared at approximately 25°C and under 16hr:8hr (L:D) (TLD 840 36W Philips) light conditions. Under these growing conditions the pest life cycle lasts approximately 28 days. For transferring adult tomato pinworms an insect vacuum collector was used.
  • Tomato pinworm oviposition experiment Multiple choice experiment
  • a selection of 15 different genotypes were tested for differences in oviposition attractiveness for pinworm females.
  • One plant originating from one genotype was randomly placed in an insect cage (45 * 45 * 90cm; 150 mesh gauze). Experimental plants were 15 exposed to 100 adult moths.
  • Two days post infestation (2dpi) the total number of eggs per leaves present per genotype were scored (24-26°C, 50-70%RH; 8hr darkness and 16hr light (Philips reflex TLD 840 36W)).
  • Tomato pinworm oviposition experiment Three choice experiment
  • Pinworm larval feeding behavior was studied by exposing a selection of tomato genotypes to adult moths in a choice set-up. Plants were positioned in an insect cage (45 * 45 * 90cm; 150 mesh gauze). One cage contained 15 randomly placed individual plants from different
  • a mine is the space created in leaf tissue between the epidermal layers by herbivore feeding (24-26°C, 50-70%RH; 8hr darkness and
  • the internal rows were divided into 14 different sections (plots) with 16 pots each (15L), in between plots also some LYC02 tomato plants were positioned.
  • Leaflet Lesion Type Leaflet Lesion Type
  • PPA Percent Leaflet Attacked
  • OPD Overall Plant Damage
  • Pinworm oviposition preferences were studied under climatized lab-conditions. For each tested genotype one plant was positioned in an experimental cage. Plants were approximately of the same height, while number of leaves ranged between 6 and 1 1. Plants were exposed to 100 adult moths for 2 days, after which number of eggs per leaf per plant were scored. Per tested genotype the average number of eggs per leaf were calculated.
  • Plants were positioned in an experimental cage (one plant per genotype) under controlled lab-conditions. Plants were approximately of the same height, while number of leaves ranged between 7 and 1 1 . Plants were exposed to 50 adult moths for 3 days. Three days post infestation the exact number of eggs on the first fully developed leaf per plant was counted.
  • Results are presented in figure 2, which illustrates that GALA1 is far less susceptible to pinworm feeding than the variety LYC02 on which the pinworm was reared, and LYC01.
  • Pinworm larval feeding behaviour was studied by exposing tomato genotypes to 100 adult moths in a choice experiment. Tested tomato genotypes were positioned in a cage under climatized lab-conditions (two replicates with one plant per genotype).
  • Plants were approximately of the same height, while number of leaves ranged between 6 and
  • Results are presented in figure 3. This figure illustrates that GALA1 is far less susceptible to pinworm feeding than most of the tested other germplasms. Conclusion: In the conducted tests, the present inventors demonstrated a level of resistance for several genotypes against the pinworm. Based on these results, the inventors selected GALA1 as the most suitable candidate for further experiments.
  • RIL population was an interspecific population derived from a cross between S. lycorpersicum (inbred cultivar LYC01) and S. galapagense GALA1. LYC01 was verified as susceptible to South American Pinworm. This population consisted of F8 Recombinant Inbred Lines (RILs) developed by Single Seed Descent. RIL lines per sub-experiment with significant higher levels of resistance than their recurrent parent, LYC01, are listed below in table 3. Means for distinct parameters from RIL's were statistically compared with the mean of the recurrent parent per plantation date.
  • RIL-lines TUT1 15, TUT1 10 and TUT1 1 1 demonstrated strongest immediate, at PLA1 , resistance against oviposition.
  • the inventors conclude that they have identified resistance (comprising inter alia non-feeding-preference) indicated by PLA and to a lower extend also by LLT and OPD.
  • TUT1 15 has been deposited by Hazera Genetics Ltd, Berurim, M.P. Shikmim 79837, Israel, with the NCIMB (NCIMB Ltd, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, United Kingdom), on 1 1 th February 2013, under accession number NCIMB 42109.
  • Phenotypic information shows that both line TUT1 15 and TUT101 display a significant reduction in leaves affected by T. absoluta.
  • Genotypic information show no difference between line TUT1 15 and
  • One experimental cage contained 4 RIL lines for testing (i.e TUT101 , TUT1 10, TUT1 15 and TUT103) in replica, 2 recurrent parent plants and 1 donor plant. From each plant 3 consecutive fully developed leaves positioned in the upper third part of the plant were tagged. Plants were infested by introducing 100 adult tomato pinworms per experimental cage.
  • One experiment contained 8 experimental cages (24-26°C; 50-70%RH; 8hr darkness: 16hr light (Philips reflex TLD 840 36W).
  • RILs were compared against the recurrent parent LYC01. Means from individual lines were adjusted by introducing a cage-effect into the linear model. Individual lines were compared using the Tukey Kramer test. The analysis confirmed for OPD2, PLA 1 & PLA 2 the earlier obtained observations in the RIL selection experiment (section 3/).
  • Recurrent parent LYC01 is significantly more susceptible compared to wild type donor GALA1, as well as individual RIL lines TUT101 and TUT1 15.
  • RIL line TUT1 10 is not different compared to LYC01, and for both PLA measurements (i.e. timepoints one and two) TUT103 does not significantly differ from LYC01.
  • Example 2 Development of molecular markers and identification of the underlying genetic. Materials and methods
  • the discovery population for the experiment was an interspecific population derived from a cross between S. lycorpersicum (inbred cultivar LYC01) and S. galapagense GALA1.
  • LYC01 was verified as susceptible to South American Pinworm, and GALA1 was identified as resistant to South American Pinworm (example 1 ).
  • This population consisted of F8 Recombinant Inbred Lines (RILs) developed by Single Seed Descent.
  • Genomic DNA from tomato leaves was extracted using Qiagen DNeasy plant DNA extraction kit. SNP genotyping
  • a set of 737-SNPs combination was selected based on their allelic variation and evenly spaced along the genome.
  • High-throughput SNP genotyping was carried out with the GoldenGate assays and the BeadXpress reader from lllumina. The genotypes (of the RILs 5 and of the two parental lines) were screened with 384 markers in a single plate. SNP genotyping data was scored using the lllumina GenomeStudio genotyping software with a no- call threshold of 0.25. lllumina GoldenGate technology details
  • a SNP set was designed for the lllumina GoldenGate assay, which used locus and allele- specific oligos with cy3/cy5 labeling to detect SNP alleles at each locus. These custom Oligo Pool Assay (OPA) sets were then run on the lllumina BeadXpress Reader as 384-plex VeraCode assays. Veracode uses cylinder microbeads with an internal barcode to differentiate bead types which correspond to different SNP loci (384 bead types are used for a
  • GenomeStudio software from lllumina was used for clustering alleles based on the ratio of the cy3/cy5 signal intensities to call the three genotype classes.
  • Phenotypic data was collected as described in example 1.
  • the resistance phenotype was identified by several measurement methods: 1 ) percent leaflet attacked (PLA), 2) leaflet lesion type (LLT) and 3) overall plant damage (OPD) ⁇ Maluf, 1997 ⁇ . Each was measured in two time points. The first PLA measurement was the only one that distributes normally, and therefore it was used for marker identification. Information from the two other measurement
  • Phenotypic data was normalized using a mixed linear model ⁇ Zar, 2010 ⁇ , including planting and measurement date as fixed effects. The adjusted means from the model were used as input for the association study described below.
  • the genotyping information described in the SNP genotyping section, and the adjusted mean of the phenotypic measurements were used as input to association mapping via one way ANOVA, using R ⁇ Broman 2009 ⁇ . Each marker was considered independently in order to detect significant markers. The significant markers were then analyzed in the same model in order to retrieve their combined R 2 .
  • the inventors investigated the LD (Linkage Disequilibrium) patterns in the RIL population. Pairwise LD estimation for all marker combinations in each chromosome was conducted using Haploview software ⁇ Barrett, 2005 ⁇ . Pairwise LD was measured as the D' statistic ⁇ Lewontin, 1964 ⁇ .
  • Haplotype-blocks were defined using the "solid-spine” option which was defined as a “spine” of strong LD running from one marker to its adjacent markers in the LD chart, meaning that the first and last markers in a block were in strong LD with all intermediate markers although the intermediate markers were not necessarily in LD with each other.
  • RILs were phenotyped and genotyped using 310 polymorphic SNPs.
  • the SNPs were physically mapped to the tomato genome version 2.1 ⁇ Bombarely, 201 1 ⁇ and then adjusted to the tomato genome version 2.40.
  • the broad sense heritability of the resistance to South America tomato pinworm as defined by the first PLA measurement is 0.6. This means 60% of the trait as observed by this experiment can be explained by genetic factors, either additive or dominant.
  • association analysis identified a set of markers significantly linked to resistance to South America tomato pinworm as defined by the first PLA measurement.
  • the list of associated markers and their significance are summarized in table 5.
  • This table comprises all significant markers resulting from the analysis of the phenotypic data, associated to SNP markers by an ANOVA model.
  • the combined R 2 of the listed markers amounts to 0.55, meaning all markers together explain 55% of observed phenotypic variance.
  • the allelic state of the significant markers is identical in the resistant parent and the most resistant RIL, namely TUT1 15, as described in example 1.
  • Haplotype Block Adjacent markers with a low recombination rate between them belong to the same haplotype block. Markers from the same chromosome and haplotype block are marked by a gray background. In addition, the occurrence of several markers in one haplotype was investigated. Several markers were found adjacent to each other on the same chromosome, suggesting a low recombination rate between them. Therefore they were inherited as a single haplotype block. In table 5, the relevant haplotype block (if available) is listed for each SNP.
  • the chromosome position is by reference to the tomato genome version 2.40. Table 7:
  • IL3_1821 T/T T/T C/C 1 2349120 2 solcap_snp_sl_59890 As A A G/G A/A 1 4597950 1 solcap_snp_sl_19066 C/C T/T C/C 1 381 18500 1 solcap_snp_sl_14042 T/T C/C T/T 1 38274900 1 solcap_snp_sl_18619 * GIG T/T G/G 1 68232900 1 solcap_snp_sl_12348 * C/C T/T C/C 1 72528600 1
  • EP_0109_LC7882 A A A A G/G 7 61 194700 2
  • EP_0489_LC7684 As c/c T T C/C 9 3897960 1
  • markers were significantly associated with the PLA measure of resistance to South America tomato pinworm, together explaining 55% of the observed phenotypic variance.
  • markers are also significantly associated with other measures of resistance, namely LLT and OPD, which reinforce the confidence of these markers.
  • LLT and OPD measures of resistance
  • Markers are validated by crossing line TUT1 15, which displayed the highest resistance relative to all tested RILs, with a susceptible line. The resulting F1 is selfed, and a large population of F2 seeds is collected. Plants are grown and genotyped. A selection of the F2 progeny is selfed to F3. The F3 families are phenotyped as described in example 1. The linkage of each marker to the resistance phenotype is assessed.
  • Each F2 plant carry a subset of the validated markers, where all selected F2 plants together cover all validated markers.
  • Each F2 plant is backcrossed to a breeding line in a marker assisted backcross scheme. Plants having the relevant markers as well as the highest percentage of breeding line markers are selected to a second round of backcrossing. This process is repeated to a third backcross round resulting in a set of lines with a high percentage of breeding line background, each having a homozygous subset of the markers linked to the required resistance. Next the lines are crossed in turn in order to accumulate (“pyramid”) all required markers into one line or commercial variety.
  • the resistance to South American Pinworm is a complex trait, probably defined by several genes ⁇ Maluf 1997, 2010a ⁇ .
  • the inventors describe here the identification of a resistant source, and resistant recombinant inbred lines devised from this source. In addition, they identified a group of markers significantly correlated with the resistance, identifying the resistant line.
  • Example 3 Determine resistance of identified RIL's of GALA1 against additional organisms Spider mites (Tetranychus urticae)
  • Test plants were infested three weeks after sowing by placing heavily infested leaves from the spidermite rearing face down on the test plants. The leaves used for infestation were placed close to each other in order to create a surface of leaves above the test plants. After infestation, plants were irrigated using a flooding system. Two days after infestation the leaves that were used for infestation were removed.
  • the spidermite population reached a peak after two to three weeks. Three weeks post infestation feeding damage levels were scored.
  • the susceptible or resistant plants were defined by the amount and the distribution of the population and were indexed by a scale from 0-3 (see below):
  • Plant symptoms from 0-1 indicate resistant plants. Plants symptoms from 2-3 indicate susceptible plants (see FIG.4 for illustration).
  • Resistance levels for the individual RIL-lines were compared to resistance levels from the recurrent parent, i.e. LYC01, using an Hsu-Dunnett LSMeans Difference test. The mean score from each tested line was adjusted by entering observation notes as an effect into the linear model. Obtained data indicated that almost all tested RIL lines were significantly more resistant against spider mites when compared to the recurrent parent (see FIG.5).
  • RIL lines were mostly resistant, but these lines were less resistant compared to donor GALA1. Therefore it is concluded that the donor and also most of the RIL lines contain resistance traits that hamper population build up for the tested spidermite species, which is determined by scoring the population distribution per genotype using feeding symptoms and mite and webbing density as parameters.
  • RIL leads were tested for resistance against the Hemiptera white fly. As a measure of resistance the success of building up a white fly population on a plant was scored by counting numbers of newly developed white fly nymphs.
  • Experimental plants were randomly divided over three experimental cages (0,9m width * 8,0m length *0,6m height) in a greenhouse (temperature: +/-30°C day and +/-20°C night). Experimental cages hosted at least 6 plants per tested germplasm. Three consecutive fully developed leaves were marked starting at the top of a plant.
  • nymphs were counted from the bottom side of the prior marked leaves. For this end, five randomly 2 cm 2 areas per leave were screened for nymphs using a magnifying glass (6X).
  • Table 8 Tomato resistance against white fly.
  • Germplasm Mean number of nymphs SE Least Sq mean Sign, grouping
  • tested genotypes were more resistant against white flies compared to recurrent parent LYC01. Moreover, this bioassay indicate that tested RIL line TUT1 12 is more resistant against white fly population build (i.e. nymph presence) compared to donor GALA1.
  • Resistance levels for the individual RIL-lines were compared to resistance levels from the recurrent parent, i.e. LYC01, using an Hsu-Dunnett LSMeans Difference test (see FIG.6). The mean score from each tested line was adjusted by entering observation notes as an effect into the linear model.
  • RIL-lines TUT101 and TUT1 15 were significantly more resistant against thrips damage compared to recurrent parent LYC01. These two RIL-lines showed GALA1 levels of resistance against thrips.
  • Tomato Russet mite (Aculopus lycopersici)
  • Test plants were infested six weeks after sowing by placing heavily infested leaves from a tomato russet mite rearing face down on the test plants. After infestation, plants were regularly irrigated using 20:20:20 NPK. Two days post infestation used leaves for infestation were removed (26°C; 16hr light : 8hr dark regime).
  • the tomato russet mite population was scored 2 weeks after infestation by determining the severeness of the present russet mite population and the observed feeding symptoms.
  • Table 9 Resistance against the tomato russet mite.
  • TUT1 15 contain the resistance characteristics from donor GALA1 that could cause non-preference.
  • Example 4 flanking sequences of the SNPs of the invention.
  • flanking sequences of the 12 SNPs of the invention and of the 12 alternative SNPs of the invention are hereby given in table 10.
  • IL2_5178 TTACTCTTCGGTGTTTGAGGATCT CTTTG CGTTG AAACACCG ATGG GTTCT (SEQ ID N.63) TGTTGCAGAGGGTTTTTTGAGCCC GATGTTTTTGCGTTGAGGGAAATTGGG
  • AAATTCAAAAAC (SEQ ID N.29) GTAGCC (SEQ ID N.30)
  • EP_0489_LC76 AAACCCCAATTTCTCCGGCCGATC GATCACTTTACAGATCCGATTTCGAGTC 84 AGTTCTCCTCTTTGTTGATCTCATT ACTTCCG AATCG G ATCCGG GTCAG ATG

Landscapes

  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Pest Control & Pesticides (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Insects & Arthropods (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The present invention is directed to a commercial tomato, namely S. lycopersicumplant, which is resistant to an arthropod pest comprising in its genome introgressed sequences from S. galapagenseconferring resistance to said arthropod pest, wherein the introgressed sequences are chosen from those present in the genome of a plant of the line TUT11 NCIMB accession number 42109. The commercial tomato of the invention is preferably resistant to ToMV (Tomato Mosaic Virus). The introgressed sequences are preferably found at one or more of the 12 loci defined by the following SNP markers: SNP solcap_snp_sl_59890 on chromosome 1, SNP solcap_snp_sl_15339 on chromosome 1, SNP solcap_snp_sl_40154 on chromosome 1, SNP solcap_snp_sl_32320 on chromosome 6, SNP SL10187_425on chromosome 6, SNP EE_2362on chromosome 6, SNP EE_2996 on chromosome 6, SNP SL10539_786_LC7260 on chromosome 6, SNP EP_0489_LC7684 on chromosome 9, SNP IL2_5178 on chromosome 9, SNP EE_3482_LC7808 on chromosome 9 and SNP EE_1452 on chromosome 9.

Description

Resistance to arthropod pest in tomatoes
The present invention relates to tolerance or resistance in plants of Solarium lycopersicum, also known as Lycopersicum esculentum, to arthropod pests, especially to the South American tomato pinworm, Tuta absoluta. According to the invention, the resistance or tolerance is provided by DNA sequences, introgressed from S. galapagense at corresponding specific loci in the genome of a S. lycopersicum plant. The introgressed sequences can be present homozygously or heterozygously in the genome of the S. lycopersicum plant, and they confer tolerance or resistance to said pests.
Background of the invention
The South American tomato pinworm, T. absoluta (Lepidoptera— Gelechiidae also known as Scrobipalpula absoluta, Scrobipalpuloides absoluta, Gnorimoschema absoluta, and Phthorimaea absoluta) is one of the most severe pests for solanaceous plants, especially tomatoes. According to Maluf et al. (Euphytica, 2010, 176:1 13-123), T. absoluta is an insect of neotropical distribution considered as a major tomato pest in several Latin American countries, including Argentina, Chile, Peru, Bolivia, Ecuador, Colombia, Venezuela, Uruguay and Brazil. It was reported for the first time in Europe in 2006, in the Spanish province of Castellon, and has since been reported in other parts of Spain (Valencia, Ibiza, Almeria, Murcia and Catalunya) and of the Mediterranean basin, including tomato-producing areas of Morocco and Algeria, and more recently in Israel, Turkey, Syria, Germany, Hungary, Lithuania and Serbia.
T. absoluta attacks the plants in all of their developmental stages, damaging the leaf mesophyll, stems, stem apexes, flowers and fruits. According to Maluf et al., oviposition of T. absoluta is predominantly on leaflets (on both abaxial and adaxial surfaces) of the upper third of the plant, but can also occur in stems and flowers. Larvae feed predominantly on leaf parenchyma tissue, on tender portions of the stems (especially axillary buds), and in both developing and mature fruit. Leaf mining can evolve until all the parenchyma tissue of the leaves is consumed and only leaf veins and insect frass are left. Severe pinworm attack can cause yield losses of up to 100%.
T. absoluta is thus considered as a limiting factor for tomato production in several Latin American countries, wherein it accounts for about 70% of the losses and it becomes an increasing concern in Europe.
Control of this pest currently requires heavy application of insecticides. However, the increase of resistance of this pinworm to insecticides is reported. Moreover, blanket spraying of insecticides is harmful to both man and the environment. Therefore, enhanced resistance of commercial tomato against the pinworm by introducing antixenosis and/or antibiosis resistance traits, or enhanced tolerance, is increasingly appreciated by commercial growers. So far such resistance or tolerance in a commercial tomato has not been reported against the pinworm.
In this context, varietal resistance to T. absoluta in tomatoes may be an important component of pest management programs. Resistance to T. absoluta has been found in several wild tomato accessions, inter alia in S. pennellii (corresponding to L. pennellii) LA716, S. peruvianum NAV29 and NAV 1 15, S. habrochaites (also named L. hirsutum) var. glabratum PI 134418 and PI 134417, S. habrochaites (also named L. hirsutum) var. hirsutum PI 127826, and L. hirsutum f. typicum LA1777 (Ecole, 2001 ). Resistance in these species is thought to be largely mediated by allelochemicals with pest-deterrent activities, such as methyl-ketones in PI 134417 (Maluf et al. 1997), sesquiterpenes (zingiberene) in PI127826 (Azevedo et al. 2003), and acylsugars (acylglucoses, acylfructoses) in LA 716 (Resende et al. 2006; Maluf et al. 2010).
These accessions were used extensively to develop commercial lines of S. lycopersicum with good levels of pest-resistance, especially resistance to T. absoluta. Maluf et al. (2010a and 2010b) report three proprietary precommercial breeding lines with high leaf acylsugars contents, presenting resistance to the South American tomato pinworm T. absoluta. The lines are however not commercial S. lycopersicum. Moreover, the resistance level of these lines and hybrid combinations made with them is far less than the resistant parent. No commercial hybrid varieties have apparently been obtained up to now from these 3 lines.
A few QTL analyses carried out in the progeny of some interspecific crosses between resistant wild tomato accessions and S. lycopersicum are also reported in the literature (Momotaz et al., 2010). They mainly emphasized the complexity of the resistance traits.
Therefore, in spite of intensive work in this respect and the importance of tomato production in the world, currently no tomato cultivars resistant to pinworm have been obtained though introgression of the trait from a wild tomato accession.
The difficulties encountered by breeders trying to develop commercial varieties from the wild tomato accessions have been so far explained by complex resistance traits, undesirable linkages, or both, and they have hampered efforts to incorporate the pinworm resistance to L. esculentum breeding lines and cultivars (see Eigenbrode et al., 1993).
In order to circumvent these difficulties, some authors have proposed as an alternative to use genetic resources of cultivated S. lycopersicum maintained in the germplasm banks. It was indeed hypothesized that the absence of known cultivated tomato variety resistant to T. absoluta could be associated with reduced genetic variability introduced during tomato domestication, leading to the loss of genes that control the production of allelochemicals involved in plant defenses. Recovery of this lost genetic variability was thus expected to improve plant resistance to pests and diseases (Oliveira et al., 2009). From this study, only two out of 57 accessions appear to present an allegedly promising resistance. The transfer of resistance factors from these accessions to commercial tomato has however not been carried out and no resistant commercial cultivar obtained to date.
There is thus an important need in the art to identify a reliable source of resistance or tolerance, which could be used to obtain resistant or tolerant commercial plants, and a need for improved commercial S. lycopersicum plants that are resistant to T. absoluta infestation. The present invention provides commercial S. lycopersicum plants that display important tolerance or resistance to T. absoluta infestation, as well as methods that produce or identify S. lycopersicum plants or populations (germplasm) that display resistance to T. absoluta infestation. The present invention also discloses molecular genetic markers, especially SNPs, linked to the resistance loci.
Detailed description of the invention:
The present inventors have identified a wild tomato accession in S. galapagense (also known as L. cheesmanii) which displays an important tolerance or resistance to T. absoluta infestation and they have been able to introgress into S. lycopersicum background the S. galapagense sequences conferring this resistance and/or tolerance, thus obtaining commercial tomatoes resistant and/or tolerant to arthropod pests, especially to T. absoluta. In this process, the present inventors have identified a source of T. absoluta resistance which has never been tested before, namely in a S. galapagense accession. Moreover, in the transfer of the resistance sequences, the inventors have made the main selection steps on the basis of T. absoluta resistance and they have determined the best parameter to be followed for this selection.
It is indeed to be noted that, in the prior art, a direct selection for pest resistance has generally not been carried out in programs for introgression of arthropod resistance into tomato cultivars, due to difficulties in maintaining the uniform infestations necessary to select for resistance and because direct selection for pest resistance is usually an expensive and slow process. Therefore, the prior art is replete with indirect selection techniques, based generally on correlated traits with high heritability to speed up introgression, especially presence of given allelochemicals or type of trichomes.
However, during the selection process of lines and hybrids on the basis of high allelochemical content only, other resistance-related traits that are present in the wild accessions are probably lost and thus not recovered in the selected lines and hybrids. The introgression programs disclosed in the prior art have thus failed to provide a high level of resistance in a commercial tomato line or variety. By selection directly at the level of pest resistance, the present inventors have been able to introgress the main S. galapagense sequences responsible for resistance, and not only a subset conferring only insufficient resistance. This direct selection has been made possible thanks to the identification of the best parameters to be followed during selection of resistant plants. In this respect, it is noted that the prior art discloses numerous different parameters, such as arthropod eggs and offspring counts, number of large mines per leaf, number of small mines per leaf, percentage of leaves mined, overall plant damage, leaflet lesion type, percent of attacked leaflets, overall leaf damage, and insect survival. Without prior identification of the most powerful parameter, direct selection was not feasible since the nature of the resistance is not entirely clear, likely combining non-preference, antibiosis, antixenosis and tolerance. The inventors have indeed detected variance in between lines in terms of number of leaflets per total marked leaf fed on (PLA) and the total amount of plant tissue fed on (OPD). This observation could have been caused by differences in amount of eggs the plant was exposed to or the quality of the leaf tissue fed on. The amount of eggs has been ruled out by the inventors, since egg counts per marked leaves indicated no differences between lines. Thus the only causal factor for the non-preference is the quality of the leaf tissue that influences negatively the feeding behavior of the pest, and especially the South American tomato pinworm.
On the basis of the PLA rating, the plants according to the invention thus present an improved tolerance or resistance to arthropod pests by comparison to any commercial S. lycopersicum plant, all the commercial tomatoes before the present invention being indeed susceptible to arthropod pests, especially to T. absoluta.
According to a first aspect, the present invention is thus directed to a S. lycopersicum plant, which is tolerant or resistant to an arthropod pest, comprising in its genome introgressed sequences or intervals from S. galapagense conferring resistance to said arthropod pest. The term "Resistance" is as defined by the ISF (International Seed Federation) Vegetable and Ornamental Crops Section for describing the reaction of plants to pests or pathogens, and abiotic stresses for the Vegetable Seed Industry.
Specifically, by resistance, it is meant the ability of a plant variety to restrict the growth and development of a specified pest or pathogen and/or the damage they cause when compared to susceptible plant varieties under similar environmental conditions and pest or pathogen pressure. Resistant varieties may exhibit some disease symptoms or damage under heavy pest or pathogen pressure.
Insect-resistance refers to insect-plant interactions that comprise insect-responses and plant characteristics, • Non-preference: refers to insect responses subject to plant characteristics that lead away from the use of a particular plant for oviposition, for food or for shelter, or for combinations of the three.
• Antixenosis: refers to plant characteristics evoking a negative response or a total avoidance by insects.
• Antibiosis: refers to plant characteristics that adversely affect the physiology of a herbivore insect species. Those plant properties denote reduced fecundity, decreased size, reduced longevity and increased mortality of the pest insect species (Schoonhoven et al. 1998).
By tolerance is meant the ability of a plant variety to endure biotic and abiotic stress without serious consequences for growth, appearance and yield.
Susceptibility: The inability of a plant variety to restrict the growth and development of a specified pest or pathogen. Plants from for example the lines Rehovot-13 {LYC02), Komeett, Plaisance or F1 Daniela (HA144) are susceptible S. lycopersicum plants. A plant according to the invention has thus at least improved resistance or tolerance with respect to these plants, and more generally with respect to any commercial variety of tomato.
By introgression, it is meant the infiltration of the genes or of genomic sequences of one species into the gene pool of another one from an initial interspecific hybrid between these species. Regarding the introgressed sequences or intervals from S. galapagense conferring the tolerance or resistance in S. lycopersicum, they are chosen from those present in the genome of a plant of the tomato seed TUT1 15. A sample of this tomato seed has been deposited by Hazera Genetics Ltd, Berurim, M.P. Shikmim 79837, Israel, pursuant to, and in satisfaction of, the requirements of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure (the "Budapest treaty") with the National Collection of Industrial, Food and Marine Bacteria (NCIMB), (NCIMB Ltd, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, United Kingdom), on 1 1th February 2013, under accession number NCIMB42109.
A deposit of this tomato seed is maintained by Hazera Genetics Ltd, Berurim, M.P. Shikmim 79837, Israel.
The deposited seeds and plants thereof have been obtained from an initial interspecific cross between a plant of S. galapagense GALA1, i.e. the introgression partner displaying the phenotype of interest, and a plant of the line S. lycopersicum LYC01, the recurrent susceptible parent. The deposited seeds thus represent a reservoir of introgressed sequences from S. galapagense in the S. lycopersicum genome. The introgressed sequences conferring resistance and/or tolerance to pest arthropods according to the invention are chosen from this reservoir. Preferably, a S. lycopersicum plant according to the invention is a commercial plant or line. Such a commercial plant or line preferably also exhibits resistance to ToMV (tomato mosaic virus), for example due to the presence of a Tm-2 (allele Tm-2 or Tm-22 (also known as 7m- 2a)) or Tm-1 resistance gene, which also confers resistance to TMV (Tobacco Mosaic Virus). A plant according to this aspect of the invention preferably has also the following additional features: nematode resistance trait (Mi-1 or Mi-j).
Moreover, the commercial plant of the invention gives rise to fruits in suitable conditions, which are at least 10 grams at maturity, preferably at least 25 g at full maturity and or even more preferred at least 50 g at full maturity.
With regard to the desired phenotype, i.e. tolerance or resistance to arthropod pest, of a plant according to the invention, such a phenotype is conferred by introgressed sequences or intervals from S. galapagense, chosen from the introgressed sequences found in the genome of the deposited plants TUT1 15. Said introgressed sequences or intervals may form part of larger introgression fragments from S. galapagense into the genome of a S. lycopersicum plant of the invention.
Introgression fragments or introgressed intervals from S. galapagense comprising sequences conferring resistance or tolerance to said pest can be found preferably on chromosomes 1 , 5, 6, 9 and 12 of a S. lycopersicum plant of the invention. According to a first embodiment of the invention, said introgression fragments and thus said introgressed sequences conferring resistance and/ or tolerance to arthropod pests are to be found at one or more of the following loci:
a) Locus encompassing SNP solcap_snp_sl_18619 (SEQ ID N.49) on chromosome 1 , b) Locus encompassing SNP solcap_snp_sl_12348 (SEQ ID N.50) on chromosome 1 , c) Locus encompassing SNP EP_1592_LC7762 (SEQ ID N.51 ) on chromosome 1 , d) Locus encompassing SNP EE_0301 (SEQ ID N.52) on chromosome 5,
e) Locus encompassing SNP EE_4363_LC7656 (SEQ ID N.53) on chromosome 6, f) Locus encompassing SNP CL016475-0340 (SEQ ID N.54) on chromosome 9, g) Locus encompassing SNP EP_0502 (SEQ ID N.55) on chromosome 9,
h) Locus encompassing SNP EE_4969_LC7529 (SEQ ID N.56) on chromosome 9, i) Locus encompassing SNP EE_2332 (SEQ ID N.57) on chromosome 9,
j) Locus encompassing SNP SL10204J 269 (SEQ ID N.58) on chromosome 12, k) Locus encompassing SNP SGN-U573565_snp665 (SEQ ID N.59) on chromosome
12 and
I) Locus encompassing SNP EE_0924 (SEQ ID N.60) on chromosome 12. The 12 SNPs mentioned above are referred to in the following as the 12 SNPs of the invention. Their location in the tomato genome sequence build SL2.40 is indicated in table 7, and their flanking sequences are illustrated in table 10.
On the basis of the tomato genome version SL2.40, said introgressed sequences are to be found at one or more of the following 12 loci:
a) Locus encompassing position 68 232 900 on chromosome 1 ,
b) Locus encompassing position 72 528 600 on chromosome 1 ,
c) Locus encompassing position 83 766 400 on chromosome 1 ,
d) Locus encompassing position 3 636 270 on chromosome 5,
e) Locus encompassing position 166 755 on chromosome 6,
f) Locus encompassing position 22 094 800 on chromosome 9,
g) Locus encompassing position 41 847 000 on chromosome 9,
h) Locus encompassing position 49 173 600 on chromosome 9,
i) Locus encompassing position 54 692 600 on chromosome 9,
j) Locus encompassing position 124 598 on chromosome 12,
k) Locus encompassing position 155 493 on chromosome 12 and
I) Locus encompassing position 1 166 000 on chromosome 12.
By "introgressed sequences or intervals from S.galapagense at a given locus" or "introgressed sequences or intervals from S. galapagense present/found at a given locus", it is to be understood that the genomic interval found at this given locus has the same sequence as the genomic interval found in S. galapagense donor, the introgression partner, at the same locus; thus at least the allele of the SNP is the allele found in the genome of S. galapagense donor, and that the 5' flanking region, or the 3' flanking region, or both, are identical to S. galapagense sequences in this region. Therefore, the SNP may form part of the 3' border or 5' border of the introgressed interval, or may be within the introgressed interval conferring the desired phenotype.
Said introgressed sequences or intervals are preferably at least 5 kilobases long, and preferably at least 8, 10 or 15 kb long.
Preferably, the introgressed sequences or intervals from S. galapagense are not too long in order to avoid introgression of non-commercial features associated with the S. galapagense genotype. It is thus preferred according to the invention that the introgressed sequences mentioned above are less than 25 cM each in length, preferably less than 10 cM and most preferably less than 5 cM in order to avoid or limit linkage drag.
According to a preferred embodiment, said introgressed sequences are minimized to contain as few as possible sequences unrelated to the desired phenotype. More generally, insofar as resistance or tolerance to arthropod pest can be seen as a quantitative phenotype, the specific chromosomal intervals (or QTL for quantitative trait loci) that correlate with the desired phenotype can be mapped by the 12 SNPs recited above. The introgressed sequences at the 12 loci mentioned above thus constitute Quantitative Trait Loci (QTL) underlying the desired trait.
Regarding the introgressed sequences or intervals from S. galapagense conferring the tolerance or resistance, they are chosen from those present in the genome of a plant corresponding to the deposited material TUT1 15 (NCIMB 42109) at the corresponding loci. Plants corresponding to the deposited material indeed have introgressed sequences from the S. galapagense donor GALA1 at said 12 loci.
A plant according to this embodiment thus encompasses in its genome introgressed sequences from S. galapagense at one locus or more of the 12 loci recited above; such a plant thus presents the allele specific of the donor S. galapagense for at least one of the 12 SNPs recited above. A plant of the invention has thus at least one of the following alleles: allele G of SNP solcap_snp_sl_18619 on chromosome 1 , allele C of SNP solcap_snp_sl_12348 on chromosome 1 ; allele C of SNP EP_1592_LC7762 on chromosome 1 , allele T of SNP EE_0301 on chromosome 5, allele G of SNP EE_4363_LC7656 on chromosome 6, allele A of SNP CL016475-0340 on chromosome 9; allele C of SNP EP_0502 on chromosome 9, allele A of SNP EE_4969_LC7529 on chromosome 9, allele T of SNP EE_2332 on chromosome 9, allele C of SNP SL10204_1269 on chromosome 12, allele A of SNP SGN-U573565_snp665 on chromosome 12 and allele T of SNP EE_0924 on chromosome 12.
According to a second embodiment of the invention, said introgression fragments and thus said introgressed sequences conferring resistance and/ or tolerance to arthropod pests are alternatively to be found at one or more of the following loci:
a') Locus encompassing SNP solcap_snp_sl_59890 (SEQ ID N.69) on chromosome 1 , b') Locus encompassing SNP solcap_snp_sl_15339 (SEQ ID N.66) on chromosome 1 , c') Locus encompassing SNP solcap_snp_sl_40154 (SEQ ID N.68) on chromosome 1 , d') Locus encompassing SNP solcap_snp_sl_32320 (SEQ ID N.67) on chromosome 6, e') Locus encompassing SNP SL10187_425 (SEQ ID N.65) on chromosome 6, f ) Locus encompassing SNP EE_2362 (SEQ ID N.64) on chromosome 6,
g') Locus encompassing SNP EE_2996 (SEQ ID N.62) on chromosome 6,
h') Locus encompassing SNP SL10539_786_LC7260 (SEQ ID N.72) on chromosome 6, i') Locus encompassing SNP EP_0489_LC7684 (SEQ ID N.70) on chromosome 9, j') Locus encompassing SNP IL2 5178 (SEQ ID N.63) on chromosome 9,
k') Locus encompassing SNP EE_3482_LC7808 (SEQ ID N.71 ) on chromosome 9 , and Γ) Locus encompassing SNP EE_1452 (SEQ ID N.61 ) on chromosome 9. These 12 SNPs will be referred to in the following as the 12 alternative SNPs of the invention. Their location in the tomato genome sequence build SL2.40 is indicated in table 7, and their flanking sequences are illustrated in table 10.
On the basis of the tomato genome version SL2.40, said introgressed sequences are to be found at one or more of the following 12 loci:
a') Locus encompassing position 4 597 950 on chromosome 1 ,
b') Locus encompassing position 77 1 12 400 on chromosome 1 ,
C) Locus encompassing position 83 517 400 on chromosome 1 ,
d') Locus encompassing position 5 388 530 on chromosome 6,
e') Locus encompassing position 12 751 900 on chromosome 6,
f) Locus encompassing position 29 418 200 on chromosome 6,
9') Locus encompassing position 34 459 100 on chromosome 6,
h') Locus encompassing position 35 194 800 on chromosome 6,
i') Locus encompassing position 3 897 960 on chromosome 9,
j') Locus encompassing position 7 854 930 on chromosome 9,
k') Locus encompassing position 63 350 800 on chromosome 9 , and
I') Locus encompassing position 63 642 500 on chromosome 9.
More generally, insofar as resistance or tolerance to arthropod pest can be seen as a quantitative phenotype, the specific chromosomal intervals (or QTL) that correlate with the desired phenotype can be mapped by the 12 alternative SNPs recited above.
The introgressed sequences at the 12 alternative loci mentioned above thus constitute Quantitative Trait Loci (QTL) underlying the desired trait.
Regarding the introgressed sequences or intervals from S. galapagense conferring the tolerance or resistance, they are chosen from those present in the genome of a plant corresponding to the deposited material TUT1 15, NCIMB accession number 42109.
The preferred minimal length of the introgressed sequences, as well as the preferred maximal length of such sequences, are as defined in the preceding section with respect to the first embodiment of the invention, in connection with the 12 loci of the invention.
A plant according to this embodiment thus encompasses in its genome introgressed sequences from S. galapagense at one locus or more of the 12 alternative loci recited above; such a plant thus exhibits the allele specific of the donor S. galapagense for at least one of the 12 alternative SNPs. A plant of the invention according to this embodiment has thus at least one of the following alleles: allele A of SNP solcap_snp_sl_59890 on chromosome 1 , allele C of SNP solcap_snp_sl_15339 on chromosome 1 ; not allele T or G of SNP solcap_snp_sl_40154 on chromosome 1 , allele C of SNP solcap_snp_sl_32320 on chromosome 6, allele A of SNP SL10187_425 on chromosome 6, allele C of SNP EE_2362 on chromosome 6; allele C of SNP EE_2996 on chromosome 6, allele T of SNP SL10539_786_LC7260 on chromosome 6, allele C of SNP EP_0489_LC7684 on chromosome 9, not allele T or C of SNP IL2_5178 on chromosome 9, allele C of SNP EE_3482_LC7808 on chromosome 9 and allele T of SNP EE_1452 on chromosome 9.
Preferably, the 12 SNPs detailed for the first and second embodiments are used as markers for the detection of introgressed sequence from S. galapagense.
According to a preferred embodiment, a plant according to the invention has introgressed sequences from S. galapagense at at least one of the 24 loci defined according to the first and second embodiments.
The 12 SNP markers according to the 1st or 2nd embodiment of the invention are marker loci linked to chromosomal regions or QTL that are involved in or associated with the tolerance or resistance phenotype. The allele of these markers thus indicates whether the sequences surrounding the markers are introgressed from S. galapagense or not, introgressed sequences at this locus being correlated to resistance or tolerance to arthropod pest whereas S. lycopersicum sequences at this locus are not indicative of resistance or tolerance to arthropod pests.
Regarding the QTL or chromosomal regions marked by the SNPs of the invention, either according to the first or second embodiment, and correlated with the phenotype, a single of this chromosomal region may impart the desired phenotype. According to the invention, it is preferred that at least two and preferably several of the chromosomal regions are present in a plant of the invention, as determined by the SNP markers detailed above. Indeed, the more of these markers are present in a plant of the invention, the more a plant can be expected to have tolerance or resistance to arthropod pest. In addition, the more of the markers are present, the more tolerant are the plants.
The present invention is directed to plant having introgressed sequences from S. galapagense at a single locus of the 12 loci or of the 12 alternative loci recited above, however conferring resistance or tolerance to arthropod pest. Preferably, a plant of the invention has introgressed sequences at 2 of the 12 loci or of the 12 alternative loci, and preferably at 3, 4, 5, 6, 8, 10 of the 12 loci or of the 12 alternative loci, or of the 24 loci constituted by the 12 loci and 12 alternative loci.
Insofar as the introgressed sequences from S. galapagense conferring resistance to said pest can be marked by the specific alleles of the SNP markers of the invention, a plant of the invention has at least one of the following alleles: allele G of SNP solcap_snp_sl_18619 on chromosome 1 , allele C of SNP solcap_snp_sl_12348 on chromosome 1 ; allele C of SNP EP_1592_LC7762 on chromosome 1 , allele T of SNP EE_0301 on chromosome 5, allele G of SNP EE_4363_LC7656 on chromosome 6, allele A of SNP CL016475-0340 on chromosome 9; allele C of SNP EP_0502 on chromosome 9, allele A of SNP EE_4969_LC7529 on chromosome 9, allele T of SNP EE_2332 on chromosome 9, allele C of SNP SL10204_1269 on chromosome 12, allele A of SNP SGN-U573565_snp665 on chromosome 12 and allele T of SNP EE_0924 on chromosome 12; and preferably at least 2, or 3, 4, 5, 6, 8, 10 of said alleles. The allele combination can be any combination of the above-recited alleles.
Preferred combinations of alleles correspond inter alia to combinations of SNPs found on the same chromosome, for example allele G of SNP solcap_snp_sl_18619, allele C of SNP solcap_snp_sl_12348 and allele C of SNP EP_1592_LC7762 on chromosome 1 , or the combination of allele A of SNP CL016475-0340; allele C of SNP EP_0502, allele A of SNP EE_4969_LC7529 and allele T of SNP EE_2332 on chromosome 9, or the combination of allele C of SNP SL10204J269, allele A of SNP SGN-U573565_snp665 and allele T of SNP EE_0924 on chromosome 12. Other combinations also envisaged in the context of the invention combine at least one allele on each involved chromosomes 1 , 5, 6, 9 and 12, for example allele G of SNP solcap_snp_sl_18619 on chromosome 1 , allele T of SNP EE_0301 on chromosome 5, allele G of SNP EE_4363_LC7656 on chromosome 6, allele A of SNP CL016475-0340 on chromosome 9 and allele C of SNP SL10204_1269 on chromosome 12, or allele C of SNP solcap_snp_sl_12348 on chromosome 1 ; allele T of SNP EE_0301 on chromosome 5, allele G of SNP EE_4363_LC7656 on chromosome 6, allele C of SNP EP_0502 on chromosome 9 and allele A of SNP SGN-U573565_snp665 on chromosome 12. According to a preferred embodiment, a plant according to the invention displays introgressed sequences from S. galapagense, in at least one of the chromosomes 1 , 5, 6, 9 and 12, preferably on at least two of said chromosomes, and preferably at least 3 or 4, or on the 5 chromosomes, at the loci defined above.
According to a preferred embodiment, the S. lycopersicum plant of the invention comprises, introgressed in its genome, a chromosomal region or fragment from S. galapagense, conferring resistance or tolerance to arthropod pest, especially to T. absoluta infestation. Such a chromosomal region or fragment corresponds to or includes:
i. The region delimited by SNPs solcap_snp_sl_59890 and solcap_snp_sl_15339 in chromosome 1 of a plant corresponding to the deposited material, NCIMB accession number 42109; such a region comprises inter alia the following SNPs solcap_snp_sl_19066, solcap_snp_sl_14042, solcap_snp_sl_18619, solcap_snp_sl_12348, EP_0180_LC7488, EE_2741_LC7681 and EP_0350_LC6805, ii. The region delimited by SNPs solcap_snp_sl_40154 and EP_1592_LC7762 in chromosome 1 of a plant corresponding to the deposited material, NCIMB accession number 42109,
iii. The region delimited by SNPs EE_4363_LC7656 and SL10539_786_LC7260 in chromosome 6 of a plant corresponding to the deposited material, NCIMB accession number 42109; such a region comprises inter alia the following SNPs IL3_2569_LC7566, EE_1008_LC7515, solcap_snp_sl_65595, solcap_snp_sl_32320, solcap_snp_sl_30498, solcap_snp_sl_3051 1 , solcap_snp_sl_31 156, SL10187_425, Le004790_246, EP_0572_LC7445, EE_2362, SL10768_133, EE_2996 and solcap_snp_sl_14452,
iv. The region delimited by SNPs EP_0489_LC7684 and EE_1452 in chromosome 9 of a plant corresponding to the deposited material, NCIMB accession number 42109; such a region comprises inter alia the following SNPs : SL10004_409_LC7341 , IL2_5178, EE_1577_LC7366, EE_1758_LC7427, CL016475-0340, EP_0502,
EE_4969_LC7529, EE_2332, IL2J262, EE_1817_LC6849, EE_3482_LC7808 and EE_5152_LC7199,
v. The region delimited by SNPs SL10204_1269 and EE_0924 in chromosome 12 of a plant corresponding to the deposited material, NCIMB accession number 42109; such a region comprises inter alia the SNP SGN-U573565_snp665.
Preferably, a plant according to the invention comprises, introgressed in its genome, at least one chromosomal fragment having S. galapagense sequences and corresponding to or comprising one of the chromosomal regions recited above. In a most preferred embodiment, a plant of the invention comprises at least two chromosomal fragments corresponding or comprising at least two of the regions recited above, preferably at least 3 or 4. Most preferably, a plant of the invention comprises, introgressed in its genome, sequences corresponding to or comprising the 5 chromosomal regions defined above.
Said introgressed chromosomal regions from S. galapagense are present in the genome of plants of the deposited seeds (deposited at the NCIMB under accession number 42109) and can thus be defined with respect to these plants.
Preferably, a plant of the invention does not comprise any introgression fragment from S. galapagense on a chromosome different from chromosomes 1 , 5, 6, 9 and 12. Most preferably, in the genome of a plant of the invention, any introgression fragment or introgressed sequences from S. galapagense are within one of the following chromosomal segments:
A. The region delimited by SNPs IL3_1821 and EE_4184_LC7793 in chromosome 1 on said plant;
B. The region delimited by SNPs SL10259_474_LC7727 and EP_1027_LC7889 on chromosome 1 of said plant;
C. The region delimited by the telomeric region of the short arm (in north of chromosome
5) and SNP EE_3810_LC7374 on chromosome 5 of said plant;
D. The region delimited by the telomeric region of the long arm (in south of chromosome
6) and SNP solcap_snp_sl_12646 on chromosome 6 of said plant, E. The region between positions 3 897 900 and 63 642 560, according to the tomato genome sequence build SL2.40, on chromosome 9 of said plant, and
F. The region delimited by the telomeric region of the short arm (in north of chromosome 12) and SNP solcap_snp_sl_1495 on chromosome 12 of said plant.
Therefore, a plant of the invention preferably does not comprise any introgressed sequences from S. galapagense donor located outside of the chromosomal segments A to F mentioned above. Moreover, a particularly preferred plant comprises introgressed sequences from S. galapagense donor in every segment A to F and does not comprise introgressed sequences outside of these segments.
The introgressed sequences from S. galapagense conferring resistance and / or tolerance to arthropod pest according to the present invention are preferably homozygoulsy present in the genome of a plant. Accordingly, such a plant preferably exhibits, on both homologues of chromosome 1 , and/or of chromosome 5, and /or of chromosome 6, and/or of chromosome 9 and/or of chromosome 12, introgressed sequences from S. galapagense capable of conferring resistance or tolerance to arthropod pest. It must be borne in mind that this thus not necessarily imply that the introgression fragments from S. galapagense on both chromosome homologues are identical. Indeed, one of the homologue may comprise only the introgressed sequences necessary and sufficient to confer resistance or tolerance, whereas the other homologue comprises a larger introgression fragment, comprising said sequences in addition to further sequences from S. galapagense unrelated to resistance or tolerance. Therefore a plant of the invention is homozygous for at least one of the following alleles: allele G of SNP solcap_snp_sl_18619 on chromosome 1 , allele C of SNP solcap_snp_sl_12348 on chromosome 1 ; allele C of SNP EP_1592_LC7762 on chromosome 1 , allele T of SNP EE_0301 on chromosome 5, allele G of SNP EE_4363_LC7656 on chromosome 6, allele A of SNP CL016475-0340 on chromosome 9; allele C of SNP EP_0502 on chromosome 9, allele A of SNP EE_4969_LC7529 on chromosome 9, allele T of SNP EE_2332 on chromosome 9, allele C of SNP SL10204J269 on chromosome 12, allele A of SNP SGN-U573565_snp665 on chromosome 12 and allele T of SNP EE_0924 on chromosome 12, and preferably homozygous for all these 12 alleles.
Alternatively, according to another embodiment of the present invention, a plant comprises introgressed sequences from S. galapagense conferring the desired trait on only one of the two chromosome homologues, i.e. the introgressed sequences conferring resistance or tolerance are present heterozygously in the genome of such a plant.
It is also envisaged that some of the sequences conferring resistance or tolerance, present at any one of the 12 loci or 12 alternative loci defined above, are present homozygously in the genome of a plant of the invention, whereas other introgressed sequences, present at other ones of the 12 loci or alternative loci are present heterozygously in the genome of a plant according to the invention.
The improved tolerance or resistance to arthropod pest is advantageously determined by comparison to a susceptible (commercial) line, for example Rehovot-13 {LYC02) tomato plants. It is preferably determined on the basis of Percent Leaflet Attacked rating. The present inventors have indeed identified this rating as the best criterion to represent the tolerance or resistance of the plants toward T. absoluta attacks. Preferably, this criterion is determined a few days after infestation; a perfectly suitable time-limit is between 3 to 15 days post infestation by the pest, for example 8 days post infestation.
The tolerance or resistance to arthropod pest is for example determined at 8 days after exposure to the pest population, and is considered as "improved" if the difference between the test plant and a susceptible plant is a significant reduction of the PLA. By "significant", it is meant a reduction which is significant from a statistical point of view. Preferably, the significant reduction is a reduction of at least 5% of the PLA for the test plant; preferably, the reduction is of at least 10% or even preferably a reduction by almost 25 or 30%. Plants obtained by the inventors as described in the experimental section display a reduction of at least 50 % of the PLA determined at 8 days post infestation.
Therefore, a plant according to the invention preferably displays a PLA score at 8 days post exposure to the pest population which is reduced by at least 30%, preferably at least 50% and most preferably at least 70% with respect to a susceptible commercial S. lycopersicum line.
With regard to the experimental conditions for rating the PLA, potential suitable conditions are detailed in the experimental section of the present description. Namely, the PLA is scored preferably in a greenhouse or a nethouse, in presence of an abundant pest population. The climactic conditions in the greenhouse are typical conditions for tomato culture. The PLA score is determined according to the scale defined in Maluf et al. 1997, and detailed in the experimental section.
Other criteria such as LLT (Leaflet Lesion Type) and OPD (Overall Plant Damage) criteria, as defined in the experimental section, can alternatively be used. They are preferably used in addition to the PLA rating, for example to reinforce the confidence on the detected markers. A plant according to the invention is preferably a plant deriving from a plant grown from the deposited seed under accession number NCIMB 42109, for example a plant derived from one of the deposited seed by one or several backcrosses to a S. lycopersicum line. A progeny of a plant obtained from the deposited seed can be identified by one skilled in the art, for example by comparison of the introgression edges. Indeed, the specificity of the location of the introgression edges allows the detection of plants deriving from the deposited plants. A plant of the invention is also advantageously obtainable by a process comprising an interspecific cross between a S. galapagense parent, and a S. lycopersicum parent, followed by at least one selfing step and at least two backcrossing steps, whereas the progeny is selected at each stage on the basis of one or more of the alleles of the markers marking the 12 loci; i.e. SNP solcap_snp_sl_18619 on chromosome 1 , SNP solcap_snp_sl_12348 on chromosome 1 , SNP EP_1592_LC7762 on chromosome 1 , SNP EE_0301 on chromosome 5, SNP EE_4363_LC7656 on chromosome 6, SNP CL016475-0340 on chromosome 9, SNP EP_0502 on chromosome 9, SNP EE_4969_LC7529 on chromosome 9, SNP EE_2332 on chromosome 9, SNP SL10204_1269 on chromosome 12, SNP SGN-U573565_snp665 on chromosome 12 and SNP EE_0924 on chromosome 12. Alternatively, the selection may be carried out on the basis of the alleles of the markers marking the 12 alternative loci, i.e. SNP solcap_snp_sl_59890 on chromosome 1 , SNP solcap_snp_sl_15339 on chromosome 1 , SNP solcap_snp_sl_40154 on chromosome 1 , SNP solcap_snp_sl_32320 on chromosome 6, SNP SL10187_425 on chromosome 6, SNP EE_2362 on chromosome 6, SNP EE_2996 on chromosome 6, SNP SL10539_786_LC7260 on chromosome 6, SNP EP_0489_LC7684 on chromosome 9, SNP IL2_5178 on chromosome 9, SNP EE_3482_LC7808 on chromosome 9, and SNP EE_1452 on chromosome 9.
Such a process is described more in detail below with respect to the fourth aspect of the present invention.
In a further embodiment of the invention, the plants as defined are resistant or tolerant to arthropod pest, wherein said arthropods are more specifically insect arthropods, inter alia Lepidoptera or Hemiptera, or acari arthropods.
Particularly preferred arthropods in the context of the present invention are pinworms, and especially the South American pinworm T. absoluta.
Alternatively, plants according to the invention are resistant or tolerant to one or more of the following arthropods: aphids, whitefly, thrips, leafminers {Liriomyza), caterpillars (Spodoptera), tomato psyllids, spider mites, rust mites and nematodes, in addition to or in place of resistance to T. absoluta. Preferably, a plant of the invention is simultaneously resistant to pinworms, white flies, spider mites, Tomato Russet mites and thrips.
According to a second aspect, the present invention is directed to parts of a plant as defined according to the first aspect of the invention, namely parts of a plant resistant or tolerant to an arthropod pest due to the presence in its genome of introgressed sequences from S. galapagense.
A part of a plant is preferably a plant cell; the invention is thus concerned with a plant cell of S. lycopersicum comprising in its genome introgressed sequences from S. galapagense conferring resistance to said arthropod pest, at one or more of said 12 loci or of said 12 alternative loci.
The different features of the introgressed sequences have been defined in relation with the first aspect of the invention and apply mutatis mutandis to this aspect of the invention. The introgressed sequences are thus preferably chosen from those present in the genome of a plant corresponding to the deposited material TUT1 15 (NCIMB accession number 42109). Moreover, as detailed extensively in relation to the first aspect, a plant cell of the invention has preferably introgressed sequences from S. galapagense at more than one of said loci, preferably at at least 2 or 3 loci, preferably at least 5, 8 or 10. Particularly preferred plant cells are those comprising introgressed sequences from S. galapagense conferring said resistance or tolerance at the 12 loci defined above, or at the 12 alternative loci, or at the 24 loci.
A plant cell according to this aspect of the invention is thus characterized by the presence in its genome of at least one of the following alleles: allele G of SNP solcap_snp_sl_18619 on chromosome 1 , allele C of SNP solcap_snp_sl_12348 on chromosome 1 ; allele C of SNP EP_1592_LC7762 on chromosome 1 , allele T of SNP EE_0301 on chromosome 5, allele G of SNP EE_4363_LC7656 on chromosome 6, allele A of SNP CL016475-0340 on chromosome 9; allele C of SNP EP_0502 on chromosome 9, allele A of SNP EE_4969_LC7529 on chromosome 9, allele T of SNP EE_2332 on chromosome 9, allele C of SNP SL10204_1269 on chromosome 12, allele A of SNP SGN-U573565_snp665 on chromosome 12 and allele T of SNP EE_0924 on chromosome 12.
A plant cell according to the invention may also comprise introgression fragments corresponding to or including one or more of the 5 regions i) to v) defined with respect to the first aspect of the invention.
Preferably, a plant cell of the invention does not comprise introgressed sequences from S. galapagense in chromosomes other than chromosomes 1 , 5, 6, 9 and 12. More preferably, a plant cell does not comprise introgressed sequences located outside of the chromosomal segments A to F mentioned above, but comprised introgressed sequences from the S. galapagense donor within all these 6 segments.
A plant cell of the invention may have the capacity to be regenerated into a whole plant. Alternatively, the invention is also directed to plant cells which are not regenerable, and thus are not capable of giving rise to a whole plant.
According to another embodiment, the plant part is any other part of a plant of the invention, it may be in particular seeds, reproductive material, roots, flowers, fruits, rootstock or scion. Such a part comprises a cell as defined above, i.e. having introgressed sequences from S. galapagense capable of conferring resistance or tolerance to arthropod pest to a S. lycopersicum plant. All the preferred embodiments detailed in the preceding section in connection with the first aspect of the invention are also preferred embodiments according to this second aspect of the invention.
The invention is more particularly concerned with seed of a S. lycopersicum plant, giving rise when grown up to S. lycopersicum plant tolerant or resistant to arthropod pest as defined above, which is preferably a commercial plant also resistant to ToMV (Tomato Mosaic Virus). Such seed are thus 'seed of a plant of the invention', i.e. seed giving rise to a plant of the invention. The invention is also concerned with seed from a plant of the invention, i.e. obtained from such a plant after selfing or crossing, provided however that the plant obtained from said seed is resistant or tolerant to arthropod pest due to introgressed sequences from S. galapagense conferring said trait.
The presence of introgressed sequences into the genome of a S. lycopersicum plant, seed or cell may for example be shown by GISH (genetic in situ hybridization). GISH is indeed a powerful technique for detection of the introgression of chromatin material from one species onto another species. The advantage of GISH is that the introgression process is visualized by means of 'pictures of the introgressed genome'. With this technique, it is also possible to establish if a particular region of the genome is homozygous or heterozygous, thanks to the use of molecular cytogenetic markers which are co-dominant. By this technique, it is also possible to determine in which chromosome an introgressed gene of interest is present.
According to a third aspect, the present invention is also directed to the use of a tomato plant as detailed according to the first aspect of the invention, i.e. tolerant and/ or resistant to arthropod pest, especially to T. absoluta, as a breeding partner in a breeding program for obtaining S. lycopersicum plants tolerant or resistant to pest arthropods. Indeed, such a tomato plant according to the first aspect harbors in its genome introgressed sequences from S. galapagense, conferring said tolerance or resistance. By crossing this plant with susceptible or less resistant plants, it is thus possible to transfer these sequences, conferring the desired phenotype, to the progeny. A plant according to the invention can thus be used as a breeding partner for introgressing sequences conferring the desired phenotype into a S. lycopersicum plant or germplasm. The invention is also directed to the same use with plants or seed of TUT1 15 as deposited at NCIMB under accession number 42109. Said plants are also suitable as introgression partners in a breeding program aiming at conferring the desired phenotype to a S. lycopersicum plant or germplasm.
In such a breeding program, the selection of the progeny displaying the desired phenotype, or bearing sequences linked to the desired phenotype, can advantageously be carried out on the basis of the allele of the SNP markers. The progeny is preferably selected on the presence of one or more of the following specific alleles: allele G of SNP solcap_snp_sl_18619 on chromosome 1 , allele C of SNP solcap_snp_sl_12348 on chromosome 1 ; allele C of SNP EP_1592_LC7762 on chromosome 1 , allele T of SNP EE_0301 on chromosome 5, allele G of SNP EE_4363_LC7656 on chromosome 6, allele A of SNP CL016475-0340 on chromosome 9; allele C of SNP EP_0502 on chromosome 9, allele A of SNP EE_4969_LC7529 on chromosome 9, allele T of SNP EE_2332 on chromosome 9, allele C of SNP SL10204_1269 on chromosome 12, allele A of SNP SGN-U573565_snp665 on chromosome 12 and allele T of SNP EE_0924 on chromosome 12. The selection can alternatively be made on the basis of the alleles of the 12 alternative SNP markers.
The selection of the progeny having the desired phenotype can also be made on conditions of pest infestation, as disclosed inter alia in example 1 for T. absoluta.
A plant according to the invention, or as deposited under accession number NCIMB 42109, is thus particularly valuable in a marker assisted selection for obtaining commercial tomato lines and varieties resistant and/or tolerant to arthropod pest, especially to T. absoluta.
The invention is also directed to the use of said plants in a program aiming at identifying, sequencing and / or cloning the genes conferring the desired phenotype, i.e. resistance and / or tolerance to arthropod pest, especially to T. absoluta.
Any specific embodiment described for the 1st and 2nd aspects of the invention is also applicable to this aspect of the invention, especially with regard to any combination of SNPs amongst the 12 SNPs of the invention, or amongst the 12 alternative SNPs.
According to a third aspect, the invention also concerns methods for the production of S. lycopersicum plants having the desired phenotype, especially commercial plants. Preferably such plants are also resistant to ToMV (Tomato Mosaic Virus).
A method or process for the production of a plant having these features comprises the following steps:
a) Crossing a plant corresponding to the deposited seeds (NCIMB 42109) and a susceptible or less resistant S. lycopersicum plant, in which the desired phenotype is to be imported or improved. Said susceptible plant may possess or not the feature of resistance to ToMV.
b) Selecting one resistant plant to arthropod pest in the progeny thus obtained, or one plant bearing sequences linked to the desired phenotype; in one embodiment, such a plant is also resistant to ToMV;
c) Optionally self-pollinating one or several times the resistant plant obtained at step b) and selecting a plant resistant to arthropod pest in the progeny thus obtained; in one embodiment, such a plant is also resistant to ToMV; d) Backcrossing the resistant plant selected in step b) or c) with a susceptible S. lycopersicum plant (i.e. susceptible to arthropod pest), preferably, such a susceptible plant is resistant to ToMV ;
e) Selecting a plant resistant to arthropod pest and preferably also resistant to ToMV. Alternatively, the method or process may comprise the following steps:
a1 ) Crossing a plant corresponding to the deposited seeds (NCIMB 42109) and a susceptible or less resistant S. lycopersicum plant, in which the desired phenotype is to be imported or improved, thus generating the F1 population. Said susceptible plant may possess or not the feature of resistance to ToMV.
a2) Increasing the F1 hybrid to create F2 population;
b) Selecting resistant individuals in the progeny thus obtained; in one embodiment, such an individual is also resistant to ToMV.
c) Optionally self-pollinating one or several times the resistant plant obtained at step b) and selecting a resistant plant in the progeny thus obtained; in one embodiment, such a plant is also resistant to ToMV;
d) Backcrossing the resistant plant selected in step c) or d) with a susceptible S. lycopersicum plant (i.e. susceptible to arthropod pest), preferably, such a susceptible plant is resistant to ToMV ;
e) Selecting a plant resistant to arthropod pest and preferably also resistant to ToMV. According to another embodiment, it can be selected at steps b), c) and e) either plant tolerant to arthropod pest or resistant to arthropod pest.
The plant selected at step e) is preferably a commercial plant, especially a plant having fruits which weigh at least 25 g, or at least 50 g at full maturity in normal culture conditions.
Preferably, steps d) and e) are repeated at least twice and preferably three times, not necessarily with the same susceptible S. lycopersicum plant. Said susceptible S. lycopersicum plant is preferably a breeding line.
Resistance to nematode trait may be used in place of or in addition to resistance to ToMV in the processes disclosed above.
The self-pollination and backcrossing steps may be carried out in any order and can be intercalated, for example a backcross can be carried out before and after one or several self- pollinations, and self-pollinations can be envisaged before and after one or several backcrosses.
Moreover, such a method is advantageously carried out by using SNPs markers for one or more of the selections carried out at steps b), c) and/or e) for selecting plants resistant to arthropod pest. The SNP markers are preferably one or more of the 12 SNP markers of the invention, or of the 12 alternative SNP markers, or of a combination of the 24 SNP markers. According to a preferred embodiment, the selection is at least partly made on the basis of the allele of one or more SNP solcap_snp_sl_18619 on chromosome 1 , SNP solcap_snp_sl_12348 on chromosome 1 ; SNP EP_1592_LC7762 on chromosome 1 , SNP EE_0301 on chromosome 5, SNP EE_4363_LC7656 on chromosome 6, SNP CL016475- 0340 on chromosome 9; SNP EP_0502 on chromosome 9, SNP EE_4969_LC7529 on chromosome 9, SNP EE_2332 on chromosome 9, SNP SL10204_1269 on chromosome 12, SNP SGN-U573565_snp665 on chromosome 12 and SNP EE_0924 on chromosome 12. The selection is preferably carried out by detecting the alleles of at least 2 or 3 of these SNPs, preferably at least 5, 8 or 10, or on the basis of the 12 SNP markers. Preferably, when only a partial set of the 12 markers is used, said set combines SNPs on different chromosomes. Alternatively, partial sets of the 12 markers combine markers which are found in the same region i) to iv) as defined with respect to the first aspect of the invention.
The plant selected at any one of steps b), c) and/or e) is preferably selected on the presence of one or more of the following specific alleles: allele G of SNP solcap_snp_sl_18619 on chromosome 1 , allele C of SNP solcap_snp_sl_12348 on chromosome 1 ; allele C of SNP EP_1592_LC7762 on chromosome 1 , allele T of SNP EE_0301 on chromosome 5, allele G of SNP EE_4363_LC7656 on chromosome 6, allele A of SNP CL016475-0340 on chromosome 9; allele C of SNP EP_0502 on chromosome 9, allele A of SNP EE_4969_LC7529 on chromosome 9, allele T of SNP EE_2332 on chromosome 9, allele C of SNP SL10204_1269 on chromosome 12, allele A of SNP SGN-U573565_snp665 on chromosome 12 and allele T of SNP EE_0924 on chromosome 12. The selection can alternatively be made on the basis of the alleles of the 12 alternative SNP markers.
The selection of the progeny having the desired phenotype can also be made on conditions of pest infestation, as disclosed inter alia in example 1 for T. absoluta.
The method used for allele detection can be based on any technique allowing the distinction between two different alleles of a SNP, on a specific chromosome.
The invention is also directed to a method or process for obtaining S. lycopersicum plants having the desired phenotype, wherein said method comprises the steps of:
a) Making an interspecific cross between a S. galapagense plant and a susceptible S. lycopersicum plant,
b) Selecting one resistant hybrid in the progeny thus obtained or one plant bearing sequences linked to the desired phenotype,
c) Optionally self-pollinating one or several times the resistant plant obtained at step b) and selecting a resistant hybrid in the progeny thus obtained;
d) Backcrossing the resistant hybrid selected in step b) or c) with a susceptible S. lycopersicum plant (i.e. susceptible to arthropod pest); such a susceptible plant may be resistant to ToMV;
e) Selecting a plant resistant to arthropod pest, f) Self-pollinating the resistant plant obtained at step e), and
g) Selecting a plant resistant to pest arthropods and being preferably also resistant to ToMV,
wherein steps d) to g) can be repeated and wherein SNPs markers are used in steps b), c), e) and/or g) for selecting plants resistant to arthropod pest, as detailed for the previous method. According to another embodiment, it can be selected plants tolerant to arthropod pest.
The plant selected at step g) is preferably a commercial plant, especially a plant having fruits which weigh at least 25 g, or at least 50 g, at full maturity in normal culture conditions.
The invention also concerns a method wherein steps a) to c) are not carried out and wherein step d) is carried out with a plant obtained from the deposited seed (NCIMB accession number 42109) instead of the resistant hybrid mentioned above in step d).
Resistance to nematode trait may be used in place of or in addition to resistance to ToMV in the processes disclosed above.
All preferred embodiments recited above for the previous method apply mutatis mutandis to this alternative method. Especially, steps d) and e) can be repeated, they are preferably carried out twice, or three times. The same applies to steps f) and g) which are preferably carried out twice, three times or more.
The present invention also concerns a plant obtained or obtainable by such a method. Such a plant is indeed a S. lycopersicum plant having the desired phenotype according to the first aspect of the invention and is preferably also resistant to ToMV.
The invention is also directed to a method for obtaining commercial tomato plants, having the desired phenotype, comprising the steps of:
- Backcrossing a plant, obtained by germinating the deposited seeds TUT1 15 (NCIMB accession number 42109), with a S. lycopersicum plant, for example a S. lycopersicum plant susceptible to arthropod pest; such a S. lycopersicum plant may be resistant to ToMV;
Selecting a plant tolerant or resistant to arthropod pest and being preferably also resistant to ToMV.
The selection in the second step is preferably carried out as detailed above for the other methods of the invention. Said selection is preferably carried out on the presence of one or more of the specific alleles of the SNPs of the invention, as found in TUT1 15.
The plant selected is preferably a commercial plant, especially a plant having fruits which weigh at least 25 g, or at least 50 g, at full maturity in normal culture conditions.
The invention is moreover directed to a method for detecting and/or selecting S. lycopersicum plants having introgressed sequences from S. galapagense conferring resistance to arthropod pest, on the basis of the allele detection of at least one SNP chosen amongst the group of SNPs comprising SNP solcap_snp_sl_18619 on chromosome 1 , SNP solcap_snp_sl_12348 on chromosome 1 ; SNP EP_1592_LC7762 on chromosome 1 , SNP EE_0301 on chromosome 5, SNP EE_4363_LC7656 on chromosome 6, SNP CL016475-0340 on chromosome 9; SNP EP_0502 on chromosome 9, SNP EE_4969_LC7529 on chromosome 9, SNP EE_2332 on chromosome 9, SNP SL10204_1269 on chromosome 12, SNP SGN- U573565_snp665 on chromosome 12 and SNP EE_0924 on chromosome 12. Preferably, tolerant or resistant plants are selected if at least one of the following markers is detected: allele G of SNP solcap_snp_sl_18619, allele C of SNP solcap_snp_sl_12348; allele C of SNP EP_1592_LC7762, allele T of SNP EE_0301 , allele G of SNP EE_4363_LC7656, allele A of SNP CL016475-0340; allele C of SNP EP_0502, allele A of SNP EE_4969_LC7529, allele T of SNP EE_2332, allele C of SNP SL10204_1269, allele A of SNP SGN-U573565_snp665 and allele T of SNP EE_0924, in a genetic material sample of the plant to be selected. According to a preferred embodiment, the allele of interest which is detected is present homozygously in the selected plant, i.e. no other allele of said SNP is present.
According to a particularly preferred embodiment, the selection is thus made on the simultaneous presence of the 12 following alleles: allele G of SNP solcap_snp_sl_18619, allele C of SNP solcap_snp_sl_12348; allele C of SNP EP_1592_LC7762, allele T of SNP EE_0301 , allele G of SNP EE_4363_LC7656, allele A of SNP CL016475-0340; allele C of SNP EP_0502, allele A of SNP EE_4969_LC7529, allele T of SNP EE_2332, allele C of SNP SL10204J269, allele A of SNP SGN-U573565_snp665 and allele T of SNP EE_0924, and the concomitant absence of the following alleles: allele T of SNP solcap_snp_sl_18619, allele T of SNP solcap_snp_sl_12348; allele T of SNP EP_1592_LC7762, allele G of SNP EE_0301 , allele T of SNP EE_4363_LC7656, allele G of SNP CL016475-0340; allele A of SNP EP_0502, allele G of SNP EE_4969_LC7529, allele C of SNP EE_2332, allele T of SNP SL10204J269, allele T of SNP SGN-U573565_snp665 and allele C of SNP EE_0924.
Such a combination of alleles is to be found in plants grown up from to the deposited seed. Any specific combination of alleles described in the other parts of the application is also applicable to the present aspect of the invention.
In addition to introgression of the sequences conferring resistance or tolerance to arthropod pest, as detailed in the methods of the invention, said sequences can also be introduced into S. lycopersicum background by genetic engineering in order to obtain a commercial S. lycopersicum plant resistant or tolerant to said pest. The identification and cloning of the introgressed sequences from S. galapagense conferring the desired phenotype, inter alia from the deposit, are routine for the skilled person. According to a further aspect, the present invention is also directed to hybrid plant of S. lycopersicum, obtainable by crossing a tolerant or resistant plant according to the first aspect of the invention, or a tolerant or resistant plant obtainable by the method disclosed according to the fourth aspect, with a plant of S. lycopersicum, for example a plant susceptible to arthropod pest, or a plant with a different level of resistance or tolerance to arthropod pest. A particularly preferred hybrid S. lycopersicum plant, is a plant which displays a cytoplasmic male sterility, or any other trait or phenotype of agronomical interest.
Legend of figures
FIG.1 illustrates the Pinworm oviposition per leaf, for different germplasms in a multiple choice experiment. The pinworm under test is T. absoluta.
FIG.2 illustrates the Pinworm oviposition per leaf, for the rearing variety for T. absoluta, the recurrent line LYC01 and the germplasm GALA1, in a three choice experiment. The pinworm under test is T. absoluta.
FIG. 3 illustrates the pinworm feeding per leaf. The pinworm under test is T. absoluta.
FIG. 4 illustrates the spider mite feeding damage scaling.
FIG. 5: tomato resistance against spider mites. Feeding damage was analyzed using a Hsu- Dunett LSMeans Difference test for significance. Solid dots indicate if an individual RIL line is significantly different compared to recurrent parent LYC01. UDL=Upper Decision Limit, LDL=Lower Decision Limit. The grey area emphasizes decision limits indicating a significant difference compared to the LYC01 LSMean.
FIG. 6: tomato resistance against thrips. Feeding damage was analyzed using a Hsu-Dunett LSMeans Difference test for significance. Solid dots indicate if an individual RIL line is significantly different compared to recurrent parent LYC01. UDL=Upper Decision Limit, LDL=Lower Decision Limit. The grey area emphasizes decision limits indicating a significant difference compared to the LYC01 LSMean.
Experimental section:
Example 1 : Test of a possible source of resistance to T. absoluta.
As a starting point of the realization of the invention, the present inventors have conducted several experiments to screen for tomato pinworm resistance amongst several tomato species. As of today, S. galapagense has not been identified as a possible source of resistance to T. absoluta.
Materials and methods:
Tomato germplasm rearing
Tomato germplasm was sown and reared in nursery trays (187 holes of 1 .5" / tray). Seedlings having 3-4 true leaves were transplanted into 1 L pots containing soil mixture of peat and volcano soil (2:1 ). Plants were transferred to an insect free greenhouse for further development. Plants were regularly watered and fertilizer was added (6:6:6 NPK + micro elements). Temperatures varied between day and night and over seasons: namely 26°C at day and 17°C at night in winter, and 27°C at day and 23°C at night in summer. No insecticides were applied, and after three weeks plants were treated with the fungicide PROPAMOCARB- HCL. Plants having at least 6 true leaves were used for experiments, these plants were approximately 6 weeks old and 30-45 cm of height.
Germplasms tested are mentioned in table 1 : Table 1
Name Species
LYC03 S. lycopersicum
LYC04 S. lycopersicum
LYC05 S. lycopersicum
LYC01 S. lycopersicum
LYC06 S. lycopersicum
LYC02 (Rehovot-13) S. lycopersicum
HABR01 S. habrochaites
PENN1 S. pennellii
PERU1 S. peruvian um
HABR02 S. habrochaites
PIMP1 S. pimpinellifolium
NEORI S. neorickii
PENN2 S. pennellii
PERU2 S. peruvianum
CHMIE1 S. chmielewskii
GALA1 S. cheesmaniae or S. galapagense
HABR03 S. habrochaites
HABR04 S. habrochaites glabratum
ARCA1 S. arcanum
PERU3 S. peruvianum
CHMIE2 S. chmielewskii South American tomato pinworm rearing
The South American tomato pinworm population is reared on LYC02 tomato plants. Plants having at least 6 true leaves were placed in an insect cage (45*45*90cm; 150 mesh gauze), 5 to which adult pinworms were added. Pinworm adults were collected from infested commercial greenhouse tomato plants. Insects were reared at approximately 25°C and under 16hr:8hr (L:D) (TLD 840 36W Philips) light conditions. Under these growing conditions the pest life cycle lasts approximately 28 days. For transferring adult tomato pinworms an insect vacuum collector was used.
10
Tomato pinworm oviposition experiment : Multiple choice experiment
A selection of 15 different genotypes (see also table 1 ) were tested for differences in oviposition attractiveness for pinworm females. One plant originating from one genotype was randomly placed in an insect cage (45*45*90cm; 150 mesh gauze). Experimental plants were 15 exposed to 100 adult moths. Two days post infestation (2dpi) the total number of eggs per leaves present per genotype were scored (24-26°C, 50-70%RH; 8hr darkness and 16hr light (Philips reflex TLD 840 36W)).
Tomato pinworm oviposition experiment : Three choice experiment
20 Differences in pinworm oviposition behavior between three genotypes, i.e. LYC02, LYC01, and GALA1 (see table 1 ), were studied. Plants were positioned in an insect cage (45*45*90cm; 150 mesh gauze), and were exposed to 50 adult moths. Three days post infestation (3dpi) the number of eggs laid on the first fully developed leaf per genotype were counted (24-26°C, 50-70%RH; 8hr darkness and 16hr light (Philips reflex TLD 840 36W)).
25
Pinworm feeding behavior experiment
Pinworm larval feeding behavior was studied by exposing a selection of tomato genotypes to adult moths in a choice set-up. Plants were positioned in an insect cage (45*45*90cm; 150 mesh gauze). One cage contained 15 randomly placed individual plants from different
30 germplasm, the experiment consisted out of two replicates. Per replicate the genotypes under testing (see also table 1 ) were exposed to 100 adult moths. Seven days post infestation the exact number of mines per leaf were counted, since number of mines are indicative for feeding attractiveness by the pinworm larvae. A mine is the space created in leaf tissue between the epidermal layers by herbivore feeding (24-26°C, 50-70%RH; 8hr darkness and
35 16hr light (Philips reflex TLD 840 36W)). Identification of the resistant recombinant inbred lines developed from GALA1 and LYC01 Greenhouse
Experiments were conducted in a plastic greenhouse of approximately 300m2. Inside the greenhouse LYC02 tomato plants were used for building up a tomato pinworm population, for this end on regular basis new LYC02 plants obtained from the nursery were transplanted in the greenhouse in 15L pots filled with clean volcano soil. LYC02 tomato plants were grown on both long outer rows of the greenhouse.
The internal rows were divided into 14 different sections (plots) with 16 pots each (15L), in between plots also some LYC02 tomato plants were positioned.
Plant preparation used for identification experiments:
All plants that were used in the choice experiment were sown and reared in the nursery in trays (187 holes of 1.5" / tray), without the application of insecticides. Seedlings having 3-4 true leaves were transplanted into 1 L pots containing soil mixture of peat and volcano soil (2:1 ). Plants were transferred to an insect free greenhouse for further development until they reached at least 6 true leaves up to 10 true leaves. This variation in number of true leaves was caused by differences in plant growth between tomato germplasm. Plants were supported by bamboo sticks using plastic clips.
Set-up of the greenhouse experiments:
When tomato pinworms reared on LYC02 plants were abundantly present in the greenhouse, tomato germplasm ready for testing were transferred into the greenhouse. Selected plants for testing were roughly one meter of height (+/- BBCH-18: 8 true leaves: 7 weeks after sowing) (Zadoks et ai, 1974). Plants were directly positioned with their 1 L plastic pots into the 15L pots, and a drip irrigation dropper was positioned in the 1 L pot. The tomato plants were placed in the greenhouse in a plot design with 7 experimental repetitions. Within each plot plants were positioned randomly. Temperatures varied between 17°C at night and 40°C during the day. The total RIL population screen experiment was divided in sub-experiments by plantation date.
From each plant in BBCH-18, 3 consecutive fully developed leaves positioned in the upper third part of the plant were tagged. Three days after positioning in the greenhouse, eggs were counted on all tagged leaves. Approximately 8 and 13 days after exposure to the pinworm population in the greenhouse, the Leaflet Lesion Type (LLT), the Percent Leaflet Attacked (PLA) were scored per prior tagged leaflets, and Overall Plant Damage (OPD) was noticed (see: Maluf et ai, 1997, table 1 ). Analysis of means using a Dunnett's method. For this, the susceptible recurrent parent of the RIL population, LYC01, was used as a control. Table 2. Indexing system used to score the parameters Leaflet Lesion Type (LLT), Overall Plant Damage (OPD) and Percent Leaflets Attacked (PLA) in plants infested by the pinworm. LLT (= Leaflet Lesion Type) Scores:
0 = no lesion.
1 = lesions small, rare.
2 = small to medium-size lesions, usually towards the leaflet borders.
3 = medium to large-size lesions, coalescent; foliar borders deformed.
4 = large-size lesions, coalescent; leaflets deformed.
5 = whole leaflet surface lesioned.
OPD (= Overall Plant Damage) Scores:
0 = no leaf damage.
1 = up to 5% total leaf area damaged; small, non-coalescent lesions.
2 = > 5% up to 20% total leaf area damaged; small, non-coalescent lesions.
3 = > 20% to 50% total leaf area damaged; medium to large-size lesions.
4 = > 50% up to 80% total leaf area damaged; lesions numerous, large, coalescent.
5 = > 80% to 100% total leaf area damaged.
PLA (= Percent Leaflets Attacked) Scores:
0 = no leaflets attacked.
1 = 0% to 5% leaflets attacked.
2 = 5% to 20% leaflets attacked.
3 = 20% to 50% leaflets attacked.
4 = 50% to 80% leaflets attacked.
5 = 80% to 100% leaflets attacked Results
1/ Pinworm oviposition behaviour
1.1/ Multiple-choice experiment
Pinworm oviposition preferences were studied under climatized lab-conditions. For each tested genotype one plant was positioned in an experimental cage. Plants were approximately of the same height, while number of leaves ranged between 6 and 1 1. Plants were exposed to 100 adult moths for 2 days, after which number of eggs per leaf per plant were scored. Per tested genotype the average number of eggs per leaf were calculated.
Results are presented in figure 1. As can be seen from this figure, GALA1 presents very low number of eggs per leaf in this type of experiment. I.2/ Three-choice experimen
Different tomato genotypes were tested in a choice experiment for oviposition preferences by the pinworm. Plants were positioned in an experimental cage (one plant per genotype) under controlled lab-conditions. Plants were approximately of the same height, while number of leaves ranged between 7 and 1 1 . Plants were exposed to 50 adult moths for 3 days. Three days post infestation the exact number of eggs on the first fully developed leaf per plant was counted.
Results are presented in figure 2, which illustrates that GALA1 is far less susceptible to pinworm feeding than the variety LYC02 on which the pinworm was reared, and LYC01.
2/ Pinworm feeding behaviour
Pinworm larval feeding behaviour was studied by exposing tomato genotypes to 100 adult moths in a choice experiment. Tested tomato genotypes were positioned in a cage under climatized lab-conditions (two replicates with one plant per genotype).
Plants were approximately of the same height, while number of leaves ranged between 6 and
I I . At 7 dpi the exact numbers of mines per leaf were counted.
Results are presented in figure 3. This figure illustrates that GALA1 is far less susceptible to pinworm feeding than most of the tested other germplasms. Conclusion: In the conducted tests, the present inventors demonstrated a level of resistance for several genotypes against the pinworm. Based on these results, the inventors selected GALA1 as the most suitable candidate for further experiments.
3/ Identification of the resistant f?/L-varieties developed from GALA1 and LYCQ1
Aim: In this experiment the inventors studied direct and indirect life cycle parameters like oviposition and feeding of the pinworm on donor GALA1 (L. galapagense), recurrent parent LYC01 (L. esculentum), the rearing variety for the pinworm, i.e. LYC02, and the individual RIL-lines.
Results:
The RIL population created with donor GALA1 and recurrent parent LYC01, was screened for resistance against the tomato pinworm.
More specifically, the used RIL population was an interspecific population derived from a cross between S. lycorpersicum (inbred cultivar LYC01) and S. galapagense GALA1. LYC01 was verified as susceptible to South American Pinworm. This population consisted of F8 Recombinant Inbred Lines (RILs) developed by Single Seed Descent. RIL lines per sub-experiment with significant higher levels of resistance than their recurrent parent, LYC01, are listed below in table 3. Means for distinct parameters from RIL's were statistically compared with the mean of the recurrent parent per plantation date. A ranking of only the significantly different resistant RIL-lines per parameter was performed by normalization using the recurrent parent as the denominator (if the normalized mean is <1 , the plant is resistant; if the normalized mean is≥ 1 , the plant is susceptible). Within this invention the inventors characterized as most robust resistance RIL lines TUT101 , TUT103, TUT1 10 and TUTU 7. RIL-lines TUT1 15, TUT1 10 and TUT1 1 1 demonstrated strongest immediate, at PLA1 , resistance against oviposition.
Table 3. Identified RIL's with a higher resistance level than the recurrent parent (LYC01). Displayed are only the RIL's with a significant lower mean score for a given parameter at two time points per sub-experiment (n=number of plants).
Observed resistance could be seen as one trait or as a combination of traits that influence the performance of the pest and or the damage caused by the pest. Several underlying plant- characteristics might explain the observed non-feeding-preference.
Therefore, the inventors conclude that they have identified resistance (comprising inter alia non-feeding-preference) indicated by PLA and to a lower extend also by LLT and OPD.
TUT1 15 has been deposited by Hazera Genetics Ltd, Berurim, M.P. Shikmim 79837, Israel, with the NCIMB (NCIMB Ltd, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, United Kingdom), on 1 1th February 2013, under accession number NCIMB 42109. Phenotypic information based on PLA:
Phenotypic information (based on PLA) shows that both line TUT1 15 and TUT101 display a significant reduction in leaves affected by T. absoluta. Line TUT1 15 is at the level of the donor and line TUT101 only at 1/5th of the recurrent (=susceptible) parent.
Genotypic information (see example 2) show no difference between line TUT1 15 and
TUT101.
4/ Validation experiments promising RIL-leads
In this experiment, the inventors validated in a growth-chamber the earlier detected resistance levels of promising RIL-leads from the greenhouse screen.
Promising resistant tomato RIL-lines, the donor and the recurrent parent were reared as described in example 1 (see par. Tomato germplasm rearing from Materials and Methods). In one experimental cage (90cm*90cm*130cm (H*W*L) ; 150 mesh gauze) 1 1 plants (6-10 true leaves, 5-8 weeks old, height 30-60 cm) were tested for resistance.
One experimental cage contained 4 RIL lines for testing (i.e TUT101 , TUT1 10, TUT1 15 and TUT103) in replica, 2 recurrent parent plants and 1 donor plant. From each plant 3 consecutive fully developed leaves positioned in the upper third part of the plant were tagged. Plants were infested by introducing 100 adult tomato pinworms per experimental cage. One experiment contained 8 experimental cages (24-26°C; 50-70%RH; 8hr darkness: 16hr light (Philips reflex TLD 840 36W).
Three days after tomato pinworm introduction, eggs were counted on all tagged leaves. Approximately 8 and 13 days after introducing the adult moths, the Leaflet Lesion Type (LLT), the Percent Leaflet Attacked (PLA), and Overall Leaf Damage (OLD) were scored per prior tagged leaflets, and Overall Plant Damage (OPD) was noticed. Test parameters were analyzed for significant differences with an Oneway Analysis of means using a Dunnett's method. For this, the susceptible recurrent parent of the RIL population, LYC01, was used as a control. (See table 2 for the indexing system).
Results
In this choice experiment selected RILs were compared against the recurrent parent LYC01. Means from individual lines were adjusted by introducing a cage-effect into the linear model. Individual lines were compared using the Tukey Kramer test. The analysis confirmed for OPD2, PLA 1 & PLA 2 the earlier obtained observations in the RIL selection experiment (section 3/). Recurrent parent LYC01 is significantly more susceptible compared to wild type donor GALA1, as well as individual RIL lines TUT101 and TUT1 15. Regarding parameter OPD1 , RIL line TUT1 10 is not different compared to LYC01, and for both PLA measurements (i.e. timepoints one and two) TUT103 does not significantly differ from LYC01.
For measured parameters OLD1 , LLT2 and the actual egg counting numbers, the obtained data for the RIL-lines indicate no significant differences compared with the recurrent parent. Donor GALA1, did also not differ significantly from the validated RIL lines and LYC01 for the actual egg-counts, but did show more significant resistance for the OLD and LLT measurements. This clearly shows the difficulty one may encounter to identify the appropriate parameter to measure the resistance.
Table 4:
Tested parameters that indicate significant differences with LYC01 (Oneway Analysis of means using a Dunett's method;P <0.05)
Example 2: Development of molecular markers and identification of the underlying genetic. Materials and methods
Plant materials and DNA extraction:
The discovery population for the experiment was an interspecific population derived from a cross between S. lycorpersicum (inbred cultivar LYC01) and S. galapagense GALA1. LYC01 was verified as susceptible to South American Pinworm, and GALA1 was identified as resistant to South American Pinworm (example 1 ). This population consisted of F8 Recombinant Inbred Lines (RILs) developed by Single Seed Descent.
Genomic DNA from tomato leaves was extracted using Qiagen DNeasy plant DNA extraction kit. SNP genotyping
A set of 737-SNPs combination was selected based on their allelic variation and evenly spaced along the genome. High-throughput SNP genotyping was carried out with the GoldenGate assays and the BeadXpress reader from lllumina. The genotypes (of the RILs 5 and of the two parental lines) were screened with 384 markers in a single plate. SNP genotyping data was scored using the lllumina GenomeStudio genotyping software with a no- call threshold of 0.25. lllumina GoldenGate technology details
10 A SNP set was designed for the lllumina GoldenGate assay, which used locus and allele- specific oligos with cy3/cy5 labeling to detect SNP alleles at each locus. These custom Oligo Pool Assay (OPA) sets were then run on the lllumina BeadXpress Reader as 384-plex VeraCode assays. Veracode uses cylinder microbeads with an internal barcode to differentiate bead types which correspond to different SNP loci (384 bead types are used for a
15 384-plex SNP set), and each microbead was coated with oligos that contain a unique address that hybridizes with the labeled products. During scanning on the BeadXpress Reader, the beads were aligned in a groove plate, and the bead codes and cy3/cy5 signal intensities were measured across replicated sets of beads to assign the SNP alleles. This procedure allowed a rapid, high-quality SNP calling of 96 samples by 384 SNPs without requiring fixed arrays.
20 The GenomeStudio software from lllumina was used for clustering alleles based on the ratio of the cy3/cy5 signal intensities to call the three genotype classes.
310 SNPs were retained as technically valid and polymorphic markers.
Selection of polymorphic SNPs
25 SNPs with call rate below 70% or with no polymorphism between donor and recurrent parents were removed from the analysis, resulting in 310 SNPs for further analysis.
Identifying markers significantly linked with each phenotypic trait
Phenotypic data
30 Phenotypic data was collected as described in example 1. In short, the resistance phenotype was identified by several measurement methods: 1 ) percent leaflet attacked (PLA), 2) leaflet lesion type (LLT) and 3) overall plant damage (OPD) {Maluf, 1997}. Each was measured in two time points. The first PLA measurement was the only one that distributes normally, and therefore it was used for marker identification. Information from the two other measurement
35 methods was used to reinforce the confidence in the associated markers. Heritability
Broad sense heritability was calculated by dividing the sum of squares of the difference from the mean for all RILs by the total sum of squares.
Phenotypic data normalization
Since plants were grown and measured in different dates, normalization was required. Phenotypic data was normalized using a mixed linear model {Zar, 2010}, including planting and measurement date as fixed effects. The adjusted means from the model were used as input for the association study described below.
Association
The genotyping information described in the SNP genotyping section, and the adjusted mean of the phenotypic measurements were used as input to association mapping via one way ANOVA, using R {Broman 2009}. Each marker was considered independently in order to detect significant markers. The significant markers were then analyzed in the same model in order to retrieve their combined R2.
LD analysis and haplotype-blocks identification
In order to define the boundaries of the resistant-donor genomic segments that were introduced into the RIL population (i.e. segments that were introduced to the recurrent background as a single continuous segment with almost no recombination in the population) the inventors investigated the LD (Linkage Disequilibrium) patterns in the RIL population. Pairwise LD estimation for all marker combinations in each chromosome was conducted using Haploview software {Barrett, 2005}. Pairwise LD was measured as the D' statistic {Lewontin, 1964}. Haplotype-blocks were defined using the "solid-spine" option which was defined as a "spine" of strong LD running from one marker to its adjacent markers in the LD chart, meaning that the first and last markers in a block were in strong LD with all intermediate markers although the intermediate markers were not necessarily in LD with each other.
Results
Some RILs were phenotyped and genotyped using 310 polymorphic SNPs. The SNPs were physically mapped to the tomato genome version 2.1 {Bombarely, 201 1} and then adjusted to the tomato genome version 2.40.
The broad sense heritability of the resistance to South America tomato pinworm as defined by the first PLA measurement is 0.6. This means 60% of the trait as observed by this experiment can be explained by genetic factors, either additive or dominant.
Association analysis identified a set of markers significantly linked to resistance to South America tomato pinworm as defined by the first PLA measurement. The list of associated markers and their significance are summarized in table 5. This table comprises all significant markers resulting from the analysis of the phenotypic data, associated to SNP markers by an ANOVA model. The combined R2 of the listed markers amounts to 0.55, meaning all markers together explain 55% of observed phenotypic variance. The allelic state of the significant markers is identical in the resistant parent and the most resistant RIL, namely TUT1 15, as described in example 1.
Table 5:
a P-value The probability to obtain the result by chance. P value below 0.05 is considered significant. b Haplotype Block - Adjacent markers with a low recombination rate between them belong to the same haplotype block. Markers from the same chromosome and haplotype block are marked by a gray background. In addition, the occurrence of several markers in one haplotype was investigated. Several markers were found adjacent to each other on the same chromosome, suggesting a low recombination rate between them. Therefore they were inherited as a single haplotype block. In table 5, the relevant haplotype block (if available) is listed for each SNP.
In table 6 is given the allele of the 12 markers, for different resistant lines, as identified in example 1.
Table 6:
* neither T, nor C was detected by the assay.
The genotype of all the 310 SNP markers used in this study is given for TUT1 15 in table 7. In the last column of table 6, "1 " means that the allele of the SNP marker corresponds to the resistant donor parent, wherein "2" means that the allele of the SNP marker corresponds to the recurrent susceptible parent. The SNPs with an asterisk (*) and in italics are the 12 SNP markers mentioned in tables 5 and 6.
The SNP in bold with the symbol "Δ" indicate the « edge », in terms of SNPs, of the introgression fragment, start ("As") or end ("Ae").
The chromosome position is by reference to the tomato genome version 2.40. Table 7:
CHROMODonor/
SNP TUT115 LYC01 POSITION
SOME recurrent
EE_4663_LC7672 T/T T/T C/C 1 1558580 2
EE_2169_LC7254 A/A A/A G/G 1 2204620 2
IL3_1821 T/T T/T C/C 1 2349120 2 solcap_snp_sl_59890 As A A G/G A/A 1 4597950 1 solcap_snp_sl_19066 C/C T/T C/C 1 381 18500 1 solcap_snp_sl_14042 T/T C/C T/T 1 38274900 1 solcap_snp_sl_18619 * GIG T/T G/G 1 68232900 1 solcap_snp_sl_12348 * C/C T/T C/C 1 72528600 1
EP_0180_LC7488 A/A C/C A/A 1 74360500 1
EE_2741_LC7681 C/C A/A C/C 1 75365100 1
EP_0350_LC6805 A/A G/G A/A 1 76649200 1 solcap_snp_sl_15339 Ae C/C T T C/C 1 771 12400 1
EE_4184_LC7793 A/A A/A A/G 1 77540500 2
SL10357_122_LC6821 A/A G/G A/A 1 77950400 1
EE_2138_LC7257 C/C G/G C/C 1 78104200 1
IL3_1952_LC7796 G/G A/A G/G 1 78158000 1
SL10693_51_LC7809 C/C T/T C/C 1 78236200 1
EE_3245_LC6799 T/T A/A T/T 1 78602500 1
SL10489_373_LC7781 G/G A/A G/G 1 79286800 1
SL10018_198 A/A G/G A/A 1 80408100 1
SL10259_474_LC7727 T/T T/T C/C 1 81000900 2 solcap_snp_sl_40154 As NA T T NA 1 83517400 1
EP_1592_LC7762 Ae * C/C T/T C/C 1 83766400 f
EP_1027_LC7889 NA NA T/T 1 84256600 2
EE_4621_LC7272 G/G G/G A/A 1 86580700 2 solcap_snp_sl_14323 T/T T/T C/C 1 86675700 2
EE_2225_LC7481 C/C C/C T/T 1 89810700 2 solcap_snp_sl_15058 A/A A/A G/G 1 2
SL20284_556_LC7915 A/A A/A G/G 2 7194740 2 solcap_snp_sl_12647 T/T T/T C/C 2 21285100 2
EE_1649_LC6737 G/G G/G A/A 2 29006800 2 solcap_snp_sl_26072 C/C C/C T/T 2 29095800 2 solcap_snp_sl_12372 T/T T/T G/G 2 29750900 2
SL10173_770_LC6727 C/C C/C T/T 2 29820500 2 solcap_snp_sl_15698 A/A A/A G/G 2 31368100 2
EP_1969_LC7960 A/A A/A C/C 2 33261500 2 solcap_snp_sl_10557 C/C C/C A/A 2 34683500 2
SL10153_153_LC7506 A/A A/A C/C 2 36959600 2 SL10360_663 G/G G/G C/C 2 37860200 2
SL10735_869_LC7741 A/A A/A NA 2 40095800 2
IL2_5828_LC5919 A/A A/A G/G 2 43801800 2 solcap_snp_sl_12841 T/T T/T C/C 2 43801800 2
SL10040_1076_LC7739 T/T T/T G/G 2 47239000 2
CLO 17436-0294 C/C T/T C/C 2 48687200 1
EE_3579_LC7227 C/C C/C T/T 2 2 solcap_snp_sl_19040 NA NA C/C 2 2
EE_4397_LC7630 T/T T/T C/C 3 771 15 2 solcap_snp_sl_9690 G/G G/G A/A 3 2073090 2 solcap_snp_sl_14355 C/C C/C T/T 3 7085130 2
IL2_3177_LC6317 T/T T/T A/A 3 7669140 2 solcap_snp_sl_12718 T/T T/T C/C 3 8904650 2 solcap_snp_sl_12722 G/G G/G A/A 3 8943250 2 solcap_snp_sl_4937 T/T A/A T/T 3 12866900 1 solcap_snp_sl_4932 A/A G/G A/A 3 15380400 1
EP_0398_LC7890 G/G A/A G/G 3 38800900 1
EE_2302 G/G T/T G/G 3 43641500 1 solcap_snp_sl_1779 G/G T/T G/G 3 43641500 1
EE_2301_LC7799 C/C T/T C/C 3 43641700 1
EE_3215_LC7337 A/A G/G A/A 3 45613700 1
EE_2132_LC7726 G/G A/A G/G 3 46645300 1
EE_4940_LC7305 G/G T/T G/G 3 57629400 1
SL10019_376_LC7274 G/G A/A G/G 3 58095800 1
IL2_3047_LC7278 G/G A/A G/G 3 58127400 1
IL2_3855_LC6626 C/C A/A C/C 3 58199700 1
EE_3777_LC7270 G/G A/A G/G 3 58210300 1
EE_0718_LC7273 G/G A/A G/G 3 58226900 1
SL10385_861_LC7255 C/C T/T C/C 3 58365800 1
SL20269_959 C/C T/T C/C 3 58405600 1
EE_3736_LC7608 T/T C/C T/T 3 58640000 1
EE_2254 T/T C/C T/T 3 58746500 1
SGN-U565536_snp46769 P/P G/G P/P 3 59935400 1 solcap_snp_sl_15173 T/T T/T A/A 3 60806800 2
EE_0928_LC7606 T/T T/T C/C 3 60856300 2
EE_0775_LC7309 G/G G/G A/A 3 60862400 2
IL3_0122 T/T T/T C/C 3 60934800 2
EE_5812 T/T T/T C/C 3 61275100 2
SL10976_673_LC7290 G/G G/G A/A 3 62094000 2
SL10772_850_LC6617 G/G G/G A/A 3 62815100 2 EE_2571_LC8007 T/T T/T C/C 3 63616800 2
EE_3501_LC8061 A/A A/A C/C 3 63766900 2
EE_2924_LC7831 G/G G/G C/C 3 64397100 2
EP_1717_LC8068 A/A A/A G/G 3 64800700 2 solcap_snp_sl_55187 T/T T/T C/C 3 2
CL016669-0383 C/C T/T C/C 3 1
SL10428_501 C/C C/C T/T 4 2146360 2
EE_3260 NA NA C/C 4 9492130 2
CL017721-0135 A/A A/A G/G 4 9603600 2
EE_4973_LC7241 C/C C/C A/A 4 51709700 2
EE_4974_LC7242 G/G G/G A/A 4 51709900 2
EE_2179 G/G G/G P/P 4 54197200 2 solcap_snp_sl_58921 G/G G/G T/T 4 54409600 2
EE_1504 T/T T/T C/C 4 54754300 2
EE_1675_LC7556 A/A A/A G/G 4 54846200 2 solcap_snp_sl_13133 A/A A/A G/G 4 55086600 2
EE_0519_LC7259 G/G G/G A/A 4 55717100 2
SL10207_600_LC7235 C/C C/C T/T 4 56139200 2
SL10101_673_LC6864 G/G G/G A/A 4 57223700 2
EP_0368 A/A A/A G/G 4 57402600 2 solcap_snp_sl_1 1515 A/A A/A G/G 4 57896200 2
EE_4324_LC7699 C/C C/C A/A 4 58075600 2
EE_4325_LC7718 G/G G/G A/A 4 58075700 2
EE_6012_LC7239 NA C/C NA 4 58790800 1
SGN-U594049_snp94598 A/A G/G A/A 4 60551900 1
IL2_0224_LC7658 A/A A/A G/G 4 62610300 2
SL20205_697_LC7245 G/G G/G T/T 4 63672200 2 solcap_snp_sl_201 1 A/A A/A T/T 4 2
EE_1982 A/A G/G A/A 4 1
EE_0301 Ae As * T/T G/G T/T 5 3636270 1
EE_3810_LC7374 G/G G/G A/A 5 4146540 2
EE_4099_LC6860 C/C C/C T/T 5 5887820 2
IL2_1979_LC8095 T/T T/T C/C 5 5971710 2
EE_2637_LC7698 A/A A/A G/G 5 6160880 2
EE_0853_LC6863 A/A A/A T/T 5 6226660 2
IL2_4587_LC7087 G/G G/G NA 5 6388250 2
EE_0954_LC7212 C/C C/C T/T 5 6457710 2
EE_4155_LC6841 C/C C/C T/T 5 6979790 2
EE_3256 A/A A/A G/G 5 7492620 2 solcap_snp_sl_13798 C/C C/C T/T 5 8156640 2 SL10639_108 G/G G/G A/A 5 8215150 2
IL3_2338 T/T T/T C/C 5 8967100 2
EE_4380 G/G G/G A/A 5 10095100 2
IL2_4686_LC5993 G/G G/G T/T 5 10702300 2
SL10469_816_LC7368 T/T T/T C/C 5 13142000 2
SL10469_202_LC7365 A A A/A C/C 5 13142700 2
EP_0159 C/C C/C T/T 5 16804800 2
SL10526_459_LC7321 A/A A/A T/T 5 18738900 2
SL10526_144_LC7578 T/T T/T A/A 5 18738900 2
IL3_1559_LC7546 C/C C/C A/A 5 19274800 2
SL10100_95_LC7314 T/T T/T C/C 5 20574100 2
SL10100_757 G/G G/G A/A 5 20574700 2
EE_1486_LC7518 G/G G/G A/A 5 23877100 2
IL1_6687_LC7317 T/T T/T C/C 5 23878300 2
CL015854-0378 T/T T/T C/C 5 25878300 2
IL2_4983 T/T T/T C/C 5 25878300 2
KGe1 103_LC7548 G/G G/G T/T 5 39648500 2
EE_2817 A/A A/A G/G 5 43177000 2
KGe2770_LC7361 T/T T/T C/C 5 45414700 2
KGe1882 G/G G/G A/A 5 49402500 2
SL10373_526 T/T T/T C/C 5 50849700 2
Le001857_68 C/C C/C T/T 5 59037000 2
KGe1995 T/T T/T C/C 5 59037100 2
SL10724_1217_LC7835 C/C C/C T/T 5 59655900 2 solcap_snp_sl_12181 T/T T/T C/C 5 60197900 2
Le006551_63 G/G G/G C/C 5 62103800 2
EE_5750 C/C C/C T/T 5 62495900 2
EE_4363_LC7656 As * G/G T/T G/G 6 166755 f
IL3_2569_LC7566 G/G T/T G/G 6 1649290 1
EE_1008_LC7515 T/T C/C T/T 6 1674080 1 solcap_snp_sl_65595 A/A C/C A/A 6 3299310 1 solcap_snp_sl_32320 C/C T/T C/C 6 5388530 1 solcap_snp_sl_30498 G/G T/T G/G 6 6794900 1 solcap_snp_sl_3051 1 G/G A/A G/G 6 8159800 1 solcap_snp_sl_31 156 G/G T/T G/G 6 12040400 1
SL10187_425 A/A G/G A/A 6 12751900 1
Le004790_246 T/T C/C T/T 6 20347900 1
EP_0572_LC7445 T/T C/C T/T 6 21806900 1
EE_2362 C/C T/T C/C 6 29418200 1
SL10768_133 C/C T/T C/C 6 33808800 1 EE_2996 C/C T/T C/C 6 34459100 1 solcap_snp_sl_14452 A/A G/G A A 6 35101900 1
SL10539_786_LC7260 Δθ T T G/G T T 6 35194800 1 solcap_snp_sl_12646 T/T T/T C/C 6 35677700 2 solcap_snp_sl_12638 G/G T/T G/G 6 36179000 1 solcap_snp_sl_12746 C/C T/T C/C 6 36927900 1
EE_0212_LC7755 G/G A A G/G 6 41542800 1
EE_5803_LC7716 T/T T/T C/C 6 44134700 2
EP_1913_LC7870 A/A A A G/G 6 44542800 2
SL20164_562_LC7140 C/C C/C T/T 6 44857700 2
EE_0497_LC7340 T/T T/T C/C 6 2 solcap_snp_sl_1 1233 C/C T/T C/C 7 670304 1
EE_371 1_LC101 16 T/T C/C T/T 7 994270 1 solcap_snp_sl_1 1205 C/C A A C/C 7 1375140 1
EE_1788_LC7194 T/T C/C T/T 7 2240720 1
EE_2398_LC7918 G/G T/T G/G 7 2893460 1
IL2_1573_LC6628 T/T C/C T/T 7 3147390 1
EE_4619_LC7594 G/G A A G/G 7 3835460 1 solcap_snp_sl_26437 T/T C/C T/T 7 54697000 1
EE_0993_LC7772 C/C T/T C/C 7 55130300 1 solcap_snp_sl_14172 C/C A A C/C 7 58092200 1
CLO 16778-0295 T/T A A T/T 7 591 14500 1
3081_1_53 C/C A A C/C 7 60325200 1
SL10719_49_LC7694 A A A A C/C 7 61079400 2
SL10041_719_LC7675 A A A A G/G 7 61094800 2
EP_0109_LC7882 A A A A G/G 7 61 194700 2
EE_4765_LC7703 A A A A G/G 7 62265100 2
EE_2310_LC7448 A A A A G/G 7 62465700 2
EE_5773_LC7638 T/T T/T NA 7 62473000 2
EE_5366 G/G G/G A A 7 2
EE_6087_LC7761 T/T T/T C/C 8 602770 2 solcap_snp_sl_4431 G/G C/C G/G 8 50440200 1 solcap_snp_sl_21394 G/G A A G/G 8 55659500 1
EE_1326_LC6848 T/T C/C T/T 8 55997400 1
EP_0889_LC6813 T/T C/C T/T 8 56053100 1 solcap_snp_sl_21401 C/C G/G C/C 8 56202000 1
EE_3574_LC7825 T/T T/T C/C 8 58036300 2
IL3_0456 T/T T/T G/G 8 59248400 2 solcap_snp_sl_15432 A A T/T A A 8 60016900 1
EE_1024 A A G/G A A 8 60035000 1 solcap_snp_sl_10181 T/T A/A T/T 8 61303500 1 solcap_snp_sl_29404 G/G T/T G/G 8 1
CL015323-021 1 A/A C/C A/A 8 1
EP_0489_LC7684 As c/c T T C/C 9 3897960 1
SL10004_409_LC7341 A/A G/G A/A 9 4063240 1
IL2_5178 NA T/T NA 9 7854930 1
EE_1577_LC7366 G/G A/A G/G 9 1 1226500 1
EE_1758_LC7427 NA A/A NA 9 18614700 1
CL016475-0340 * A/A G/G A/A 9 22094800 1
EPJ0502 * C/C A/A C/C 9 41847000 1
EE_4969_LC7529 * A/A GIG A/A 9 49173600 1
EE_2332 * T/T C/C T/T 9 54692600 1
IL2_1262 T/T C/C T/T 9 62444900 1
EE_1817_LC6849 A/A G/G A/A 9 62491400 1
EE_3482_LC7808 C/C A/A C/C 9 63350800 1
EE_5152_LC7199 A/A G/G A/A 9 63473800 1
EE_1452 Ae T T C/C T T 9 63642500 1
EE_1806_LC7215 C/C C/C T/T 10 274856 2
CL015614-0412 G/G C/C G/G 10 468922 1 solcap_snp_sl_13200 C/C G/G C/C 10 1058430 1
EE_0324 T/T T/T C/C 10 2746430 2
SGN-U603133_snp167 T/T T/T C/C 10 3092680 2
EE_2689 A/A A/A NA 10 7364210 2
CLO 17204-0355 A/A A/A NA 10 7364210 2
EP_1264_LC7935 NA NA A/A 10 28869300 2
EE_6135 A/A A/A G/G 10 49992900 2 solcap_snp_sl_5191 G/G G/G C/C 10 51 147000 2 solcap_snp_sl_5186 T/T T/T C/C 10 52254300 2
EE_4309 A/A A/A C/C 10 52670500 2 solcap_snp_sl_16501 C/C C/C G/G 10 57997200 2
SL10843_69_LC7861 T/T T/T C/C 10 59085800 2 solcap_snp_sl_131 13 G/G G/G T/T 10 59255100 2
EP_0902_LC6716 G/G G/G A/A 10 60698100 2
IL3_2005_LC7733 T/T T/T NA 10 61823700 2
EE_3505_LC771 1 A/A A/A G/G 10 61957300 2
IL2_1 143_LC7218 G/G G/G A/A 10 62066300 2
EE_0009_LC7600 T/T T/T C/C 10 62724400 2
SL10786_261_LC7236 C/C C/C T/T 10 62802900 2
SL20016_1557_LC7848 T/T T/T C/C 10 64632700 2
EE_3347_LC7683 T/T T/T C/C 10 64633300 2 solcap_snp_sl_15641 C/C G/G C/C 1 1 436090 1
EE_0570 A/A G/G A/A 1 1 502389 1 solcap_snp_sl_1061 1 T/T T/T A/A 1 1 1988860 2
EP_1258_LC7710 T/T T/T C/C 1 1 3626710 2 solcap_snp_sl_15269 G/G G/G A/A 1 1 5389480 2
SL10640_256_LC7686 A/A A/A C/C 1 1 64101 10 2
SL10640_602_LC7666 T/T T/T C/C 1 1 6410460 2 solcap_snp_sl_14367 A/A A/A C/C 1 1 7715560 2 solcap_snp_sl_13506 C/C C/C T/T 1 1 8640020 2
EE_4860_LC7564 G/G G/G C/C 1 1 8753140 2
EE_1605_LC7308 A/A A/A G/G 1 1 9837710 2
EE_4181_LC7643 G/G G/G A/A 1 1 10019300 2
EE_2849_LC7237 A/A A/A NA 1 1 15654300 2
CL016179-0556 A/A A/A G/G 1 1 35287700 2 solcap_snp_sl_13126 C/C C/C T/T 1 1 35863500 2 solcap_snp_sl_13123 T/T T/T C/C 1 1 36376700 2 solcap_snp_sl_10890 C/C C/C T/T 1 1 45230400 2 solcap_snp_sl_10899 C/C C/C T/T 1 1 45816700 2 solcap_snp_sl_10900 C/C C/C T/T 1 1 45816800 2 solcap_snp_sl_10969 G/G G/G A/A 1 1 46395700 2
EE_4526 A/A A/A C/C 1 1 47595400 2
EP_1594_LC6817 C/C C/C A/A 1 1 49928100 2
IL3_1995_LC6827 G/G G/G A/A 1 1 50098600 2
EE_3018_LC7246 C/C C/C T/T 1 1 51502700 2
EE_4777_LC7555 T/T T/T C/C 1 1 52142200 2
EE_1598_LC6842 G/G G/G A/A 1 1 52225900 2
EE_1639_LC8071 T/T T/T C/C 1 1 52645000 2
SL10027_680_LC7770 A/A A/A T/T 1 1 53186500 2 solcap_snp_sl_15247 A/A A/A G/G 1 1 2
EE_5199_LC7352 T/T T/T C/C 1 1 2
SL10204_1269 As * C/C T/T C/C 12 124598 1
SGN-U573565_snp665 * A/A T/T A/A 12 155493 1
EE_0924 Ae * T/T C/C T/T 12 1 166000 1 solcap_snp_sl_1495 A/A A/A G/G 12 3252080 2
SL10795_222 A/A A/A G/G 12 3767860 2 solcap_snp_sl_14758 T/T T/T C/C 12 4462020 2
IL3_0004 A/A A/A G/G 12 4462020 2 solcap_snp_sl_9707 A/A A/A C/C 12 5718730 2 solcap_snp_sl_59718 A/A A/A G/G 12 6660010 2 solcap_snp_sl_24755 G/G G/G C/C 12 7801440 2 EE_3447 C/C C/C T/T 12 8948060 2 solcap_snp_sl_40598 G/G G/G A/A 12 8948060 2 solcap_snp_sl_1289 G/G G/G A/A 12 9917930 2 solcap_snp_sl_1295 T/T T/T C/C 12 12758600 2 solcap_snp_sl_40622 T/T T/T G/G 12 12760400 2
SL10352_214_LC7623 T/T T/T C/C 12 12871800 2
EE_4807_LC7624 T/T T/T C/C 12 14337200 2
EE_5237 NA NA G/G 12 14640400 2
EE_5238_LC7619 A/A A/A G/G 12 14640600 2 solcap_snp_sl_53084 T/T T/T C/C 12 17503100 2 solcap_snp_sl_53090 T/T T/T C/C 12 19452500 2 solcap_snp_sl_17184 G/G G/G A/A 12 23240100 2 solcap_snp_sl_42961 A/A A/A T/T 12 24101300 2
EE_0461 T/T T/T C/C 12 37136500 2 solcap_snp_sl_52407 T/T T/T C/C 12 37672700 2 solcap_snp_sl_59087 T/T T/T G/G 12 39221700 2
EP_0926_LC7289 G/G G/G A/A 12 40771200 2 solcap_snp_sl_59093 T/T T/T C/C 12 40776000 2 solcap_snp_sl_52539 G/G G/G A/A 12 42568300 2
EP_0768_LC7607 A/A A/A G/G 12 43619100 2
EE_0865_LC7616 T/T T/T C/C 12 43643700 2
3132_3_136 C/C C/C T/T 12 43645100 2
EE_3443_LC7302 G/G G/G A/A 12 43799100 2
EE_5488 A/A A/A C/C 12 44347200 2
EE_4018_LC7618 A/A A/A G/G 12 44634400 2 solcap_snp_sl_12389 T/T T/T C/C 12 44709600 2
EP_1486_LC7832 A/A A/A G/G 12 63255200 2
SL10823_84_LC7816 A/A A/A G/G 12 63538200 2
SL10329_708_LC6736 C/C C/C A/A 12 63612300 2
EE_3321_LC7974 A/A A/A G/G 12 64623500 2
SL10284_439 A/A A/A G/G 12 65136500 2
EE_5042_LC6684 C/C C/C T/T 12 65148800 2
Conclusion
Twelve markers were significantly associated with the PLA measure of resistance to South America tomato pinworm, together explaining 55% of the observed phenotypic variance. Nine of these markers are also significantly associated with other measures of resistance, namely LLT and OPD, which reinforce the confidence of these markers. The significant correlation to different measures of the traits suggests these markers are linked to a general resistance mechanism.
Marker validation
Markers are validated by crossing line TUT1 15, which displayed the highest resistance relative to all tested RILs, with a susceptible line. The resulting F1 is selfed, and a large population of F2 seeds is collected. Plants are grown and genotyped. A selection of the F2 progeny is selfed to F3. The F3 families are phenotyped as described in example 1. The linkage of each marker to the resistance phenotype is assessed.
Breeding plan
From the above described F2 plants, a set is selected. Each F2 plant carry a subset of the validated markers, where all selected F2 plants together cover all validated markers. Each F2 plant is backcrossed to a breeding line in a marker assisted backcross scheme. Plants having the relevant markers as well as the highest percentage of breeding line markers are selected to a second round of backcrossing. This process is repeated to a third backcross round resulting in a set of lines with a high percentage of breeding line background, each having a homozygous subset of the markers linked to the required resistance. Next the lines are crossed in turn in order to accumulate ("pyramid") all required markers into one line or commercial variety.
Discussion
The resistance to South American Pinworm is a complex trait, probably defined by several genes {Maluf 1997, 2010a}. The inventors describe here the identification of a resistant source, and resistant recombinant inbred lines devised from this source. In addition, they identified a group of markers significantly correlated with the resistance, identifying the resistant line.
Since this trait is highly affected by environment {Resende 2002}, not all the observed variance is however explained by the genetic markers as shown by the calculated heritability of 0.6.
Example 3 : Determine resistance of identified RIL's of GALA1 against additional organisms Spider mites (Tetranychus urticae)
Materials and methods
Experimental design
In an experimental choice setting, 19 genotypes were tested for their suitability to rear spider mites on. Test plants were grown, as described in section Tomato germplasm rearing (Example 1), until plants reached the stage of having 4 true leaves. A genotype's suitability for spider mite rearing was measured by scoring feeding symptoms in combination with observed mites and webbings constructed by the mite species under testing. The experiment contained two experimental repetitions over time, per experimental repetition there were 3 repeats with each 1 1 seedlings per genotype (26°C; 16hr light : 8hr dark).
Infestation method:
Test plants were infested three weeks after sowing by placing heavily infested leaves from the spidermite rearing face down on the test plants. The leaves used for infestation were placed close to each other in order to create a surface of leaves above the test plants. After infestation, plants were irrigated using a flooding system. Two days after infestation the leaves that were used for infestation were removed.
Scoring method:
The spidermite population reached a peak after two to three weeks. Three weeks post infestation feeding damage levels were scored. The susceptible or resistant plants were defined by the amount and the distribution of the population and were indexed by a scale from 0-3 (see below):
0 - A clean leaf without mites or tissue-feeding damage. Note: a number of mites centered on one place on the leaf could still be observed.
1 - Presence of mites in a defined area that did not cover the entire leaf. In this area feeding symptoms were observed. Leaves continued to develop, but the mite population did not grow.
2 - A leaf surface was covered with mites and clear feeding damage symptoms were noticed.
3 - A leaf is covered with mites and webs. Leaves showed clear chlorosis or necrosis symtomps.
Plant symptoms from 0-1 indicate resistant plants. Plants symptoms from 2-3 indicate susceptible plants (see FIG.4 for illustration).
Results:
Resistance levels for the individual RIL-lines were compared to resistance levels from the recurrent parent, i.e. LYC01, using an Hsu-Dunnett LSMeans Difference test. The mean score from each tested line was adjusted by entering observation notes as an effect into the linear model. Obtained data indicated that almost all tested RIL lines were significantly more resistant against spider mites when compared to the recurrent parent (see FIG.5).
Conclusion:
Tested RIL lines were mostly resistant, but these lines were less resistant compared to donor GALA1. Therefore it is concluded that the donor and also most of the RIL lines contain resistance traits that hamper population build up for the tested spidermite species, which is determined by scoring the population distribution per genotype using feeding symptoms and mite and webbing density as parameters.
White fly (Bemicia tabaci)
Materials and methods
Experimental design
In a choice assay RIL leads were tested for resistance against the Hemiptera white fly. As a measure of resistance the success of building up a white fly population on a plant was scored by counting numbers of newly developed white fly nymphs. Tested RIL-lines TUT103, TUT1 12, TUT1 15, and the donor GALA 1, the recurrent parent LYC01 and pinworm rear line LYC02, were grown as described in section Tomato germplasm rearing (Example 1). Experimental plants were randomly divided over three experimental cages (0,9m width * 8,0m length *0,6m height) in a greenhouse (temperature: +/-30°C day and +/-20°C night). Experimental cages hosted at least 6 plants per tested germplasm. Three consecutive fully developed leaves were marked starting at the top of a plant.
Infestation method:
For infestation an on cotton reared white fly colony was used. Infestation was conducted by introducing approximately one hundred 5-10 days old adult white flies per test plant. Introduced adults were allowed to oviposit for seven days after which they were killed with insecticide Talstar (pyrethroid Bifenthrin).
Scoring method:
Fourteen days after infestation nymphs were counted from the bottom side of the prior marked leaves. For this end, five randomly 2 cm2 areas per leave were screened for nymphs using a magnifying glass (6X).
Results:
Number of nymphs per leaf were measured. Mean number of nymphs per genotype were adjusted by using the table and the leaf position as an effect in a linear model. Obtained data was compared using a Tukey Kramer test. All RIL lines were significantly more resistant
Table 8: Tomato resistance against white fly.
Mean number of white fly nymphs were analyzed using a Tukey Kramer HSD test: genotypes with the same sign. grouping letter do not differ significantly.
Germplasm Mean number of nymphs SE Least Sq mean Sign, grouping
GALA1 12,23 1 .87 1 1 .76 C TUT112 4,59 1.46 4.79 D
TUT115 10,15 1.52 9.95 D C
TUT103 19,45 1.36 19.27 B
LYC01 26,05 1.52 25. 85 A
Conclusion
All tested genotypes were more resistant against white flies compared to recurrent parent LYC01. Moreover, this bioassay indicate that tested RIL line TUT1 12 is more resistant against white fly population build (i.e. nymph presence) compared to donor GALA1.
Western Flower Thrips (Franklienella occidentalis)
Materials and methods
Resistance traits from identified promising RIL leads were tested against the Thysanoptera insect F. occidentalis. Promising resistant tomato RIL-lines, the donor and the recurrent parent were sown and reared in nursery trays (54 holes of 2" / tray) filled with rockwool plugs. Seedlings having 1-2 true leaves were transplanted on rockwool (10*10*6, 5cm). Sixteen plants per germplasm were transferred to an insect free greenhouse for further development, and divided over two cages. When plants had 5-8 true leaves, they were infested with 20 thrips per plant. Feeding damage was scored by scoring the number of leaflets infested for consecutive true leaves A, B, & C, started counting from the cotyledons.
Results
Resistance levels for the individual RIL-lines were compared to resistance levels from the recurrent parent, i.e. LYC01, using an Hsu-Dunnett LSMeans Difference test (see FIG.6). The mean score from each tested line was adjusted by entering observation notes as an effect into the linear model.
Conclusion:
RIL-lines TUT101 and TUT1 15 were significantly more resistant against thrips damage compared to recurrent parent LYC01. These two RIL-lines showed GALA1 levels of resistance against thrips.
Tomato Russet mite (Aculopus lycopersici)
Materials and methods
Experimental design
In a non-choice experimental setting, 5 genotypes were tested for its suitability to build up a russet mite population. Test plants were grown, as described in section Tomato germplasm rearing (Example 1), until plants reached the stage of having 6-8 true leaves. A genotype's suitability for population build up was measured by scoring feeding symptoms in combination with observed severeness of the russet mite population.
Infestation method:
Test plants were infested six weeks after sowing by placing heavily infested leaves from a tomato russet mite rearing face down on the test plants. After infestation, plants were regularly irrigated using 20:20:20 NPK. Two days post infestation used leaves for infestation were removed (26°C; 16hr light : 8hr dark regime).
Scoring method:
The tomato russet mite population was scored 2 weeks after infestation by determining the severeness of the present russet mite population and the observed feeding symptoms.
Results:
Table 9: Resistance against the tomato russet mite.
Conclusion:
Obtained qualitative data suggested that TUT1 15 contain the resistance characteristics from donor GALA1 that could cause non-preference.
Example 4: flanking sequences of the SNPs of the invention.
The flanking sequences of the 12 SNPs of the invention and of the 12 alternative SNPs of the invention are hereby given in table 10.
Table 10:
SNP 5' flanking sequence 3' flanking sequence
solcap_snp_sl_ CAAAATTTGG G AG AG CTG AAG CA AGCTAGTCAAAAGTATGCCAGTTGTGTC 18619 GAG I I I CCCACTCAAG GTAAATGT CTGTTGCTTGTGTATATAGTTC
(SEQ ID N.49) ATA (SEQ ID N.1 ) (SEQ ID N.2)
solcap_snp_sl_ AGTCTCTAACAATCAAGTTGGTGG ACATTCATCTGATTCCGATCAAGAAGTT 12348 GGATATAGGCTCAGACATTGAGC GATGATTACGATGACCTTCCAC
(SEQ ID N.50) TGG (SEQ ID N.3) (SEQ ID N.4) EP_1592_LC77 GAGAAAAAGACCATTAGACAAAGA ATAGAGAAAAAAAGCAAAACAGGGAGA 62 AAAGGTG I I I I GATAGCTACGGAG TG AAAG GG GTCTCTAATGG GAG ATCCA
(SEQ ID N.51 ) AAAAAGAGAAAG (SEQ ID N.5) TTCCCT (SEQ ID N.6)
EE_0301 TAAACTAAAGTCTCCTTTTATTTTT AGGCAATTTTTATCCACACCAAATATAA (SEQ ID N.52) CATCAATAACCTTATAACTAACTTA AACTAAACTTAAATCCCCA I I I I CCAAG
ACTAAAAACA (SEQ ID N.7) ACAT (SEQ ID N.8)
EE_4363_LC76 CTGAAGGTCCAGACCACCTGTAC CTAAAGCTGAGTCTTTGATGGAAAAAAT 56 TGCCCTTCTCCACACCTATGTCCA GTCTGAATGCGGGGTTCTGAAGTACCC
(SEQ ID N.53) GCATAAGGACACT (SEQ ID N.9) TCTTC (SEQ ID N.10)
CL016475-0340 AATAATCTCCCCTCCTTTAAACTT CTTATGTNACCTATTTAATTACCACACA (SEQ ID N.54) GGAGTATTTGAATATCACTG I M C AACCAA I I I ACCTGATTATGGAGGAACC
CGATCCACACAAGGAAATACAAG GATTTCANTGTTCGTAGACGCTTTAAAG CATCCCCCTCAATTGTTCCTGGCA ACATTGTTAC I I I ATC (SEQ ID N.12) CTAAT (SEQ ID N.1 1 )
EP_0502 GATGATGAAAAGGTGGATTATTCA TCACTGCTGTTGCTGCTCTTTCTCACCC (SEQ ID N.55) CAAGTAC I I I CTG CATTG CTTCCT TTCAAC I I I CACATGGGTTTCTAAAGAT
I I I GTTGTGGCC (SEQ ID N.13) TTGT (SEQ ID N.14)
EE_4969_LC75 GCCGGGGATAGCTAACACACCAA ATGGGAACTCAAATGATGTTCTTCACAT 29 TATTATTAA I I I AGAGAATCAATTA AGTTTTGTTCCCTTTTTTTCGCATTTGGT
(SEQ ID N.56) TGGAGATC (SEQ ID N.15) CAT (SEQ ID N.16)
EE_2332 AAGTTG CAAG AGTTGCTTTTG CCT GAATGGGTTCCTACCATTGACCAAATG (SEQ ID N.57) CGCTTCTCTTGTTGATGCTGATGC CTTCTCATGACCAGCATAGTCCTTACAT
TATAGTAACTTC (SEQ ID N.17) ATATA (SEQ ID N.18)
SL10204_1269 GTCTAGTATTGTTGTAAGAATGCT GATATAGGTTATAACACAGCATAAATCT (SEQ ID N.58) GGAAGAGGCA I I I GTGATTATAAA ATATCTAATTCACTTGAACATTACACAA
AGAAACTTGGCA (SEQ ID N.19) GAAG (SEQ ID N.20)
SGN- GGCTTCAATATTGACTGTAATGAA GCCTGTCGTGATTTTTAATCCTAAATGG
U573565_snp6 GGAGA I I I CTGATACATTGTACCC GG I I I I GATGAAGAGAGTAGTT 65 AA (SEQ ID N.21 ) (SEQ ID N.22)
(SEQ ID N.59)
EE_0924 TATTACGGAATCTACTGTAACGTT GAAGGTGGTTCTATATCCCTAGATGCCT (SEQ ID N.60) ATCAGAAGCTCTGTCTGAACTTCC TGTCTTGCGAGAACCATGAAATAAAGAA
AGGTGAAAGGAC (SEQ ID N.23) GATG (SEQ ID N.24)
EE_1452 GTCG CAAG ATG CGTG AG ATCATG CCTG AAGTTCATTCCTG AATCAATCG GT (SEQ ID N.61 ) GTTAACCAGGCACAATCGTGTGAT AGAGAGATTGAGAAGGCAACTTCAAGC
TTG AAAG ACTTG G (SEQ ID N.25) ATCTA (SEQ ID N.26) EE_2996 ATGGGTTGGTTTTGGAGAACATAT AGATAGTCACTCTTTGTTGACTGAGGAA (SEQ ID N.62) CGTATGGGCAGCTTCAGGCGCTT AGAGGCGGGGAAGGTAGTGGGAGTGG
TC AG CTGTG CCTG (SEQ ID N.27) TTCATA (SEQ ID N.28)
IL2_5178 TTACTCTTCGGTGTTTGAGGATCT CTTTG CGTTG AAACACCG ATGG GTTCT (SEQ ID N.63) TGTTGCAGAGGGTTTTTTGAGCCC GATGTTTTTGCGTTGAGGGAAATTGGG
AAATTCAAAAAC (SEQ ID N.29) GTAGCC (SEQ ID N.30)
EE_2362 AGTTCCAATTCACGAAATCGAAGC CTTGGGGACCGGCGATAATGGTGACTT (SEQ ID N.64) CTTCCAACTCTCATCCACGCTTGG TGAACA I I I I ACAGCTACACCTAACAAG
TGATTGCAAAGG (SEQ ID N.31 ) A N N (SEQ ID N.32)
SL10187_425 TTTTTACTTTTAAATTTTGCTGTTT TTGGTCCCTTCTTGTACAATAGGAATGT
GTGAAGTAGGGATATGAATAAAAT AAGAACTAGCATATGAGGGATC
(SEQ ID N.65) T (SEQ ID N.33) (SEQ ID N.34)
solcap_snp_sl_ AAGAGGGCAAAAAATGGCTGTAG CTCCATGCCTTCTATATCTTCCCCTTCT 15339 CACTCTTGGGGAGTATTTCCTTTT CTCCAACACCC I I I CAACTTCA
(SEQ ID N.66) CCT (SEQ ID N.35) (SEQ ID N.36)
solcap_snp_sl_ AACGCCAGCAATGGAAAAGCAAC GGTTGCTAAATCCAACCAGCCCAATGA 32320 TTG AG ATCG CGTCCACAGTTG GT AGTAGGTGA I I I I GGTGGTAGTT
(SEQ ID N.67) GCAT (SEQ ID N.37) (SEQ ID N.38)
solcap_snp_sl_ GGCGCCTAGAACTGCTTCTTCTTT TCTCATCCAACCACTCACTGCTGGAATC 40154 TCTTGTG ACG CG AACTTCTGTCTC TGTATTACGATCTTCCTTGCTA
(SEQ ID N.68) TT (SEQ ID N.39) (SEQ ID N.40)
solcap_snp_sl_ ATGTTAACTGAAATTGCATACATC CTTCTAGCAAGAACTTTTTACCCTGTAA 59890 CACGTTAACAGGAAAACATCGTAG I I I GAAATCCAACAAACCCAGA
(SEQ ID N.69) TC (SEQ ID N.41 ) (SEQ ID N.42)
EP_0489_LC76 AAACCCCAATTTCTCCGGCCGATC GATCACTTTACAGATCCGATTTCGAGTC 84 AGTTCTCCTCTTTGTTGATCTCATT ACTTCCG AATCG G ATCCGG GTCAG ATG
(SEQ ID N.70) I I I CGATTCTC (SEQ ID N.43) GCGGC (SEQ ID N.44)
EE_3482_LC78 CTAGACAGTAGTGACCAAACTCTT AGGACTCGAAAAACATTAGCTCAGATG 08 GGTGTTCCGCGTAAG I I I I AGAGT ATGATGACCTTGTGTAAA I I I I CGTATT
(SEQ ID N.71 ) ATAATAAACCCA (SEQ ID N.45) GGTAT (SEQ ID N.46)
SL10539_786_ CTCTAGCCCATCCTTTATACACAG AGCATGGAGTCAAGTTTTTGCTGAATCT LC7260 AAGGGCGCAGCCACATCGGGAGT TCTGTTA I I I AAAATTGATAGAGACTTAC (SEQ ID N.72) TCCTGGACGAACA (SEQ ID N.47) CAC (SEQ ID N.48)
References
De Azevedo et al. ; Euphytica 134:347-351 (2003)
Barrett et al. Bioinformatics 21 (2): 263-265(2005) Bombarely et al.; Nucleic Acids Res. January; 39: D1 149-D1 155 (201 1 ) Broman and Sen; A guide to QTL Mapping with R/qtl. Springer (2009) Ecole et al. ; J. Appl. Ent. 125, 193-200 (2001 )
Eigenbrode and Trumble; J. Amer. Soc. Hort. Sci 1 18(4): 525-530 (1993) Lewontin. Genetics 49 (1 ): 49-67, (1964)
Maluf et al. Euphytica 93 (2): 189-194 ; (1997)
Maluf et al. Euphytica 176:1 13-123 ; (2010a)
Maluf et al. Crop Science, vol 50, 439-450 ; (2010b)
Momotaz et al. , J . Amer. Soc. Sci . 135(2) : 134- 142 (2010)
Oliveira et al., Scientia Horticulturae 199 ; 182-187 (2009)
Resende et al. Genet. Mol. Res. 1 (2): 106-1 16; (2002)
Resende et al.; Sci. Agric, v.63, n.1 ; 20-25; (2006)
Schoonhoven et al. Insect-Plant Biology. Chapmann & Hall (1998) Zar, Biostatistical Analysis. Fifth Edition. Prentice Hall, (2010)
Zadoks et al. (1974). Weed Research 14 (6): 415-421

Claims

CLAIMS:
1. A S. lycopersicum plant, which is resistant to an arthropod pest and resistant to ToMV (Tomato Mosaic Virus), comprising in its genome introgressed sequences from S. galapagense conferring resistance to said arthropod pest,
wherein the introgressed sequences are chosen from those present in the genome of a plant of the line TUT1 15 NCIMB accession number 42109.
A S. lycopersicum plant according to claim 1 , wherein said introgressed sequences are at one or more of the following loci:
a) Locus encompassing SNP solcap_snp_sl_18619 (SEQ ID N.49) on chromosome 1 ,
b) Locus encompassing SNP solcap_snp_sl_12348 (SEQ ID N.50) on chromosome 1 ,
c) Locus encompassing SNP EP_1592_LC7762 (SEQ ID N.51 ) on chromosome 1 , d) Locus encompassing SNP EE_0301 (SEQ ID N.52) on chromosome 5, e) Locus encompassing SNP EE_4363_LC7656 (SEQ ID N.53) on chromosome 6, f) Locus encompassing SNP CL016475-0340 (SEQ ID N.54) on chromosome 9, g) Locus encompassing SNP EP_0502 (SEQ ID N.55) on chromosome 9, h) Locus encompassing SNP EE_4969_LC7529 (SEQ ID N.56) on chromosome 9, i) Locus encompassing SNP EE_2332 (SEQ ID N.57) on chromosome 9, j) Locus encompassing SNP SL10204_1269 (SEQ ID N.58) on chromosome 12, k) Locus encompassing SNP SGN-U573565_snp665 (SEQ ID N.59) on chromosome 12 and
I) Locus encompassing SNP EE_0924 (SEQ ID N.60) on chromosome 12, and wherein the introgressed sequences are chosen from those present in the genome of a plant of the line TUT1 15 NCIMB accession number 42109.
3. A S. lycopersicum plant according to claim 1 , wherein said introgressed sequences are at one or more of the following loci:
a') Locus encompassing SNP solcap_snp_sl_59890 (SEQ ID N.69) on chromosome 1 ,
b') Locus encompassing SNP solcap_snp_sl_15339 (SEQ ID N.66) on chromosome 1 ,
c') Locus encompassing SNP solcap_snp_sl_40154 (SEQ ID N.68) on chromosome 1 , d') Locus encompassing SNP solcap_snp_sl_32320 (SEQ ID N.67) on chromosome 6,
e') Locus encompassing SNP SL10187_425 (SEQ ID N.65) on chromosome 6, f ) Locus encompassing SNP EE_2362 (SEQ ID N.64) on chromosome 6, g') Locus encompassing SNP EE_2996 (SEQ ID N.62) on chromosome 6, h') Locus encompassing SNP SL10539_786J_C7260 (SEQ ID N.72) on chromosome 6,
i') Locus encompassing SNP EP_0489_LC7684 (SEQ ID N.70) on chromosome 9, j') Locus encompassing SNP IL2_5178 (SEQ ID N.63) on chromosome 9, k') Locus encompassing SNP EE_3482_LC7808 (SEQ ID N.71 ) on chromosome 9, and
Γ) Locus encompassing SNP EE_1452 (SEQ ID N.61 ) on chromosome 9, and wherein the introgressed sequences are chosen from those present in the genome of a plant TUT1 15 NCIMB accession number 42109.
A S. lycopersicum plant according to any one of claims 1 to 3, wherein the introgressed sequences from S. galapagense are homozygously present in the genome of the plant.
A S. lycopersicum plant according to any one of claims 1 to 4, characterized by the presence in the genome of said S. lycopersicum plant of at least one of the following alleles:
allele G of SNP solcap_snp_sM 8619,
allele C of SNP solcap_snp_sl_12348;
allele C of SNP EP_1592_LC7762,
allele T of SNP EE_0301 ,
allele G of SNP EE_4363_LC7656,
allele A of SNP CL016475-0340;
allele C of SNP EP_0502,
allele A of SNP EE_4969_LC7529,
allele T of SNP EE_2332,
allele C of SNP SL10204J269,
allele A of SNP SGN-U573565_snp665 and
allele T of SNP EE_0924.
6. A S. lycopersicum plant according to any one of claims 1 to 5, wherein the introgressed sequences from S. galapagense comprise at least 5 kb.
7. The plant according to any one of claims 1 to 6, wherein said introgressed sequences are less than 25 cM each in length, preferably less than 10 cM, most preferably less than 5 cM.
8. The plant according to any one of claims 1 to 7, wherein said introgressed sequences constitute Quantitative Trait Loci (QTL) underlying the trait corresponding to resistance to arthropod pest. 9. The plant according to any one of claims 1 to 8, comprising introgressed sequences at 2 loci or more, preferably at 3, 5 or 8 of said loci.
10. The plant according to any one of claims 1 to 9 comprising, introgressed in its genome:
- a sequence corresponding to that comprised between SNPs solcap_snp_sl_59890 and solcap_snp_sl_15339 in chromosome 1 of a plant of the line TUT1 15 NCIMB accession number 42109 and /or
- a sequence corresponding to that comprised between SNPs solcap_snp_sl_40154 and EP_1592_LC7762 in chromosome 1 of a plant of the line TUT1 15 NCIMB accession number 42109, and/or
- a sequence corresponding to that comprised between SNPs EE_4363_LC7656 and SL10539_786_LC7260 in chromosome 6 of a plant of the line TUT1 15 NCIMB accession number 42109, and/or
- a sequence corresponding to that comprised between SNPs EP_0489_LC7684 and EE_1452 in chromosome 9 of a plant of the line TUT1 15 NCIMB accession number 42109, and/or
- a sequence corresponding to that comprised between SNPs SL10204_1269 and EE_0924 in chromosome 12 of a plant of the line TUT1 15 NCIMB accession number 42109.
1 1. The plant according to any one of claims 2 and 4 to 10 comprising, introgressed in its genome, sequences from S. galapagense conferring resistance to said arthropod pest, at the 12 loci, preferably comprising allele G of SNP solcap_snp_sl_18619, allele C of SNP solcap_snp_sl_12348, allele C of SNP EP_1592_LC7762, allele T of SNP EE_0301 , allele G of SNP EE_4363_LC7656, allele A of SNP CL016475-0340; allele C of SNP EP_0502, allele A of SNP EE_4969_LC7529, allele T of SNP EE_2332, allele C of SNP SL10204_1269, allele A of SNP SGN-U573565_snp665 and allele T of SNP EE 0924.
12. The plant according to any one of claims 1 to 1 1 , wherein said plant is a progeny of a plant of line TUT1 15 (NCIMB accession number 42109). 13. The plant according to any one of claims 1 to 12, wherein said arthropods are insects.
14. The plant according to any one of claims 1 to 13, wherein the arthropod is the South American pinworm T. absoluta. 15. The plant according to any one of claims 1 to 13, wherein the arthropods are chosen from whitefly, thrips and spider mites.
16. The plant according to any one of claims 1 to 15, wherein said resistance is measured by Percent Leaflet Attacked, preferably at 8 days post infestation.
17. A cell of a S. lycopersicum plant according to any one of claims 2 to 16, comprising in its genome introgressed sequences from S. galapagense conferring resistance to said arthropod pest, at one or more of said 12 loci,
wherein the introgressed sequences are chosen from those present in the genome of a plant of the line TUT1 15 (NCIMB accession number 42109).
18. Plant part of a S. lycopersicum plant according to any one of claims 1 to 16, in particular seeds, reproductive material, roots, flowers, fruits, rootstock or scion, said plant part comprising cells according to claim 17.
19. Seed of a S. lycopersicum plant, giving rise when grown up to a plant according to any one of claims 1 to 16.
20. A method for detecting and/or selecting S. lycopersicum plants having introgressed sequences from S. galapagense as found in the genome of a plant of the line TUT1 15
(NCIMB accession number 42109), said introgressed sequences conferring resistance to arthropods, comprising detection of at least one of the following markers: allele G of SNP solcap_snp_sl_18619, allele C of SNP solcap_snp_sl_12348; allele C of SNP EP_1592_LC7762, allele T of SNP EE_0301 , allele G of SNP EE_4363_LC7656, allele A of SNP CL016475-0340; allele C of SNP EP_0502, allele
A of SNP EE_4969_LC7529, allele T of SNP EE_2332, allele C of SNP SL10204J269, allele A of SNP SGN-U573565_snp665 and allele T of SNP EE_0924, in a genetic material sample of the plant to be selected.
21. Hybrid plant of S. lycopersicum, obtainable by crossing a plant of S. lycopersicum with a resistant plant according to any one of claims 1 to 16.
22. Use of a plant or seed of the line TUT1 15, NICMB accession number 42109, as a breeding partner in a breeding program for obtaining S. lycopersicum plants tolerant or resistant to arthropod pest.
23. A method for the production of S. lycopersicum plants tolerant or resistant to arthropod pest comprising the steps of :
a) Crossing a plant grown from a deposited seed NCIMB 42109 and a susceptible S. lycopersicum plant,
b) Selecting one tolerant or resistant plant in the progeny thus obtained, or one plant bearing the sequences linked to the tolerance or resistance to arthropod pest;
c) Optionally self-pollinating one or several times the tolerant or resistant plant obtained at step b) and selecting a plant tolerant or resistant to arthropod pest in the progeny thus obtained;
d) Backcrossing the tolerant or resistant plant selected in step b) or c) with a susceptible S. lycopersicum plant,
e) Selecting a plant tolerant or resistant to arthropod pest,
wherein SNPs markers are used in steps b), c) and/or e) for selecting plants tolerant or resistant to arthropod pest.
24. A method for the production of S. lycopersicum plants tolerant or resistant to arthropod pest comprising the steps of :
a1 ) Crossing a plant grown from a deposited seed NCIMB 42109 and a
susceptible S. lycopersicum plant, thus generating the F1 population, a2) Advancing the F1 population to create F2 population,
b) Selecting one tolerant or resistant plant in the progeny thus obtained; c) Optionally self-pollinating one or several times the tolerant or resistant plant obtained at step b) and selecting a plant tolerant or resistant to arthropod pest in the progeny thus obtained;
d) Backcrossing the tolerant or resistant plant selected in step b) or c) with a susceptible S. lycopersicum plant, e) Selecting a plant tolerant or resistant to arthropod pest,
wherein SNPs markers are used in steps b), c) and/or e) for selecting plants tolerant or resistant to arthropod pest.
25. A method for obtaining commercial tomato plants, tolerant or resistant to arthropod pest comprising the steps of:
a) Backcrossing a plant obtained by germinating a deposited seed TUT1 15 NCIMB accession number 42109, with a S. lycopersicum plant susceptible to arthropod pest,
b) Selecting a plant tolerant or resistant to arthropod pest.
26. The method according to any one of claims 23 to 25, wherein the selection in step b), c) and/or e) is carried out by detection of at least one of the following alleles: allele G of SNP solcap_snp_sl_18619, allele C of SNP solcap_snp_sl_12348; allele C of SNP EP_1592_LC7762, allele T of SNP EE_0301 , allele G of SNP EE_4363_LC7656, allele A of SNP CL016475-0340; allele C of SNP EP_0502, allele A of SNP EE_4969_LC7529, allele T of SNP EE_2332, allele C of SNP SL10204J 269, allele A of SNP SGN-U573565_snp665 and allele T of SNP EE_0924.
27. The method according to any one of claims 23 to 26, wherein the plant to be selected is also resistant to Tomato Mosaic Virus.
28. A S. lycopersicum plant obtainable by the method according to any one of claims 22 to 27.
EP14706037.0A 2013-02-22 2014-02-21 Resistance to arthropod pest in tomatoes Withdrawn EP2959002A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP14706037.0A EP2959002A1 (en) 2013-02-22 2014-02-21 Resistance to arthropod pest in tomatoes

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP13305205.0A EP2770059B1 (en) 2013-02-22 2013-02-22 Resistance to arthropod pest in tomatoes
US13/828,187 US9644242B2 (en) 2013-03-14 2013-03-14 Resistance to arthropod pest in tomatoes
PCT/EP2014/053459 WO2014128268A1 (en) 2013-02-22 2014-02-21 Resistance to arthropod pest in tomatoes
EP14706037.0A EP2959002A1 (en) 2013-02-22 2014-02-21 Resistance to arthropod pest in tomatoes

Publications (1)

Publication Number Publication Date
EP2959002A1 true EP2959002A1 (en) 2015-12-30

Family

ID=50156772

Family Applications (1)

Application Number Title Priority Date Filing Date
EP14706037.0A Withdrawn EP2959002A1 (en) 2013-02-22 2014-02-21 Resistance to arthropod pest in tomatoes

Country Status (3)

Country Link
EP (1) EP2959002A1 (en)
MX (1) MX370778B (en)
WO (1) WO2014128268A1 (en)

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
None *
See also references of WO2014128268A1 *

Also Published As

Publication number Publication date
MX370778B (en) 2020-01-03
MX2015010828A (en) 2016-07-08
WO2014128268A1 (en) 2014-08-28

Similar Documents

Publication Publication Date Title
US10064351B2 (en) F. oxysporum F.sp. melonis race 1,2-resistant melons
CN114144058B (en) Brassica plants resistant to downy mildew
US8841516B2 (en) Fusarium resistant cucumber plants
US12268144B2 (en) Melon plants with maturity indicator
US11629386B2 (en) Resistance to arthropod pest in tomatoes
US20250008902A1 (en) Novel squash plants with downy mildew resistance
US12600980B2 (en) Disease resistant melon plants
US9644242B2 (en) Resistance to arthropod pest in tomatoes
EP2770059B1 (en) Resistance to arthropod pest in tomatoes
CA3189300A1 (en) Novel disease resistant watermelon plants
EP2959002A1 (en) Resistance to arthropod pest in tomatoes
WO2023156569A1 (en) Novel tomato plants with tobrfv resistance
WO2026022319A1 (en) Celery plants resistant to fusarium race 4
CN121548346A (en) Melon resistance to CYSDV

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20150921

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20171017

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20250103