EP2859094A1

EP2859094A1 - Genetically modified schmallenberg virus (sbv) for use as vaccine

Info

Publication number: EP2859094A1
Application number: EP13729797.4A
Authority: EP
Inventors: Richard M ELLIOT; Gjon BLAKQORI; Elina KOUDRIAKOVA; Beryl MAZEL-SANCHEZ; Xiaohong Shi
Original assignee: University of Glasgow
Current assignee: University of Glasgow
Priority date: 2012-06-11
Filing date: 2013-06-07
Publication date: 2015-04-15
Also published as: GB201210226D0; WO2013186539A1

Abstract

The present invention provides attenuated viruses for use as vaccines and for the treatment and/or prevention of viral diseases and/or infections.

Description

GENETICALLY MODIFIED SCHMALLENBERG VIRUS (SBV) FOR USE AS

VACCINE

FIELD OF THE INVENTION

BACKGROUND OF THE INVENTION

In summer 2011 dairy cows in North Rhine -Westphalia in Germany showed transient fever, diarrhoea, reduced milk yield and inappettence, and in August/September 2011 similar symptoms were observed in dairy-cow herds in The Netherlands. In November 2011 researchers at the Friedrich-Loeffler Institute in Germany announced identification of a new orthobunyavirus by next generation sequencing and metagenome analysis which they called "Schmallenberg virus" (SBV) (Hoffmann et al., 2012). The virus is genetically related to Simbu serogroup viruses, and subsequently shown most probably to be a reassortant between Shamonda virus (providing the L and S genome segments) and Sathuperi virus (providing the M genome segment) (Yanase et al., in press). Later in 2011 a high number of lambs were reported to be born with congenital defects in The Netherlands; brain tissue revealed the presence of Schmallenberg virus. Schmallenberg virus has now been reported in 8 European countries (Belgium, France, Germany, Italy, Luxemburg, The Netherlands, Spain, United Kingdom), with more than 1400 cattle or sheep herds affected. This is the first time a Simbu serogroup virus has been found in Europe. No vaccine is yet available.

The Bunyaviridae family contains more than 350 viruses classified into 5 genera: Orthobunyavirus, Hantavirus, Nairovirus, Phlebovirus and Tospovirus. The viruses are characterised by possession of a tripartite single stranded RNA genome. The genome segments are termed large (L), medium (M) and small (S). Each genome segment comprises 3' and 5' non-coding sequences that flank the coding sequences for the viral proteins. Apart from the very terminal sequences that are conserved between all genome segments, the non- coding sequences are unique for each segment. All bunyaviruses code for 4 structural proteins: L protein (RNA-dependent RNA polymerase) by the L segment, glycoproteins Gn and Gc on the M segment, and nucleocapsid protein N on the S segment. In addition, non- structural proteins are encoded by some viruses on the S segment (called NSs) or M segment (called NSm) (Plyusnin and Elliott, 2011).

The Othobunyavirus genus contains >170 viruses that can be conveniently subdivided among 18 serogroups. The Simbu serogroup currently contains 25 viruses distributed across South America, Africa, Asia and Australia: Aino, Akabane, Buttonwillow, Douglas, Facey's Paddock, Ingwavuma, Inini, Jatobal, Kaikalur, Manzanilla, Mermet, Oropouche, Para, Peaton, Sabo, Sango, Sathuperi, Shamonda, Shuni, Simbu, Tinaroo, Utinga, Utive and Yaba 7 (Calisher, 1996). Aino, Akabane, Shamonda and Sathuperi viruses cause disease in ruminants, resulting in stillbirths or congenital abnormalities in offspring (Kurogi et al., 1977, Parsonson et al., 1977, Parsonson and McPhee, 1985, Tsuda et al., 2004).

It is amongst the objects of the present invention to provide a modified Schmallenberg virus and/or vectors for generating such a virus, which may find application in prevention and/or treatment of conditions caused by Schmallenberg virus infection.

SUMMARY OF THE INVENTION

The present invention relates modified viruses for raising immune responses in animals. In particular, the invention provides a genetically modified Schmallenberg virus modified so as to be genetically distinct from corresponding wild-type (or un-modified) Schmallenberg viruses. That is to say, when compared to the genome of a corresponding wild-type species, the genomes of the modified viruses provided by this invention comprise one or more nucleic acid alterations/modifications.

The modified viruses described herein may, for example, find application to immunise, raise an immune response or otherwise be useful for the treatment and/or prevention of conditions or diseases caused, or contributed to, by members the Simbu serogroup of viruses more particularly members belonging to the Schmallenberg virus species of the Orthobunyavirus genus.

As such, according to a first aspect, this invention provides a genetically modified Schmallenberg virus. Genetically modified is to be understood to be distinguishable from viruses which become modified through natural mutation, for example. Thus, the viruses of the present invention have been modified through intervention of molecular , typically recombinant technology methods known to the skilled addressee.

Schmallenberg virus is a member of the Bunyaviridae family of viruses, which are characterised by possession of a segmented RNA genome comprising single-stranded RNA. In most cases the genome comprises three negative sense RNA segments. In some cases, at least one of the RNA segments has an ambisense arrangement. More specifically, the bunyavirus family (otherwise known as the Bunyaviridae) comprises a number of different viral genera including, for example, the Hantavirus genus, the Nairovirus genus, the Tospovirus genus, the Orthobunyavirus genus (of which Schmallenberg virus is a member of) and the Phlebovirus genus.

As stated, modified viruses, provided by this invention are genetically distinct from wild-type Schmallenberg virus, which harbour a tripartite genome comprising L (large), M (medium) and S (small) RNA segments. In wild-type Schmallenberg virus, these three RNA segments are expected to encode six proteins. Specifically, the L segment encodes a RNA- dependent RNA polymerase, the M segment encodes two glycoproteins (Gn and Gc) and a non-structural protein designated NSm in a single open reading frame. The S segment encodes a nucleocapsid protein (N) and another non-structural protein termed, NSs, in an overlapping reading frame; both proteins are translated form the same mRNA species.

In one embodiment, the L segment of the modified virus described herein is a wild- type L segment encoding a viral RNA-dependent RNA polymerase. In a further embodiment, the L segment of the modified viral genome, may include one or more modifications. For example, the nucleic acid of the L segment may be modified to include one or more nucleic acid insertions (additions), deletions and/or inversions (see definitions below). In one embodiment, the nucleic acid of the L segment may be modified to include one or more nucleic acid sequences encoding amino acid, peptide, polypeptide or protein moieties which may be used as tags or labels. For example, the amino acid, peptide, polypeptide or protein tag or label may define one or more epitopes. One of skill will appreciate that by modifying L genome segments to include some form or detectable tag or label, it is possible to screen viral isolates and determine their genetic origin.

Additions, deletions and/or inversion mutations are well known to the skilled reader and may correspond to single nucleic acid/amino acid modifications, or comprise a modification which covers a few nucleotides/amino acids, such as 2 -20, or 2 - 10, or many nucleotides/amino acids, such as greater than 20, 30, 50, 100, or more, such as 250 or 500. As well as additions, deletions and inversions, the present invention also relates to rearrangements, where a portion of the genome from one region, may be swapped with another portion from another region of genome. For example, a non-coding region of the L segment may be swapped with a non-coding region of the M segment. Many other mutations may be envisaged by the skilled addressee and all mutations are encompassed by the present invention, providing the resulting modified virus becomes attenuated, that is the modified virus is reduced in virulence as compared to wild-type virus, as can be tested by the skilled addressee. This includes reduction of yield of virus in cultured cells, reduced ability to shut- off of host cell metabolic functions in infected cultured cells, or a difference in plaque phenotype compared to wild type virus.

Additionally or alternatively the M and/or S segments may be modified as described above in relation to the L segment. As well as the coding sequences of the L, M and/or S segments, modifications may be carried out optionally and/or alternatively in the non-coding sequence of the L, M, S segments, the 3' and/or 5' ends of the genome.

The M segment may be modified in such a way so as to disrupt the sequence encoding the NSm proteins (referred to hereinafter as the NSm sequence). It should be understood that disruption of the NSm sequence may prevent, ablate or reduce expression of one or more of the NSm proteins by the modified virus. One of skill in this field will understand that disrupted NSm sequences may comprise one or more nucleic acid additions (or insertions), deletions and/or inversions. Exemplary mutations include introduction of one or more deletions into the NSm coding sequence in order to prevent/reduce NSm protein expression or lead to truncated forms of NSm being expressed.

In one embodiment, the NSs sequence will be modified in order to prevent, reduce or ablate NSs expression. In other embodiments, one or more nucleic acid sequences (including one or more single or polynucleotide sequences) will be changed in order to introduce translation termination codons into the NSs coding sequence.

In other embodiments, the modified virus provided by this invention comprises an S segment modified such that one or more heterologous sequence(s) or one or more sequence(s) normally encoded by another Bunyavirus family member or genome segment - for example, one or more gene sequences from the L and/or M segments.

Where, for example, the modified virus comprises a heterologous nucleic acid sequence, it should be understood that the term "heterologous" nucleic acid sequence encompasses sequences not normally encoded by the Schmallenberg virus genome. For example, the heterologous nucleic acid sequence may encode proteins normally encoded by the L, M and/or S segments from another virus of the Bunyavirus family or orthobunya virus genome. Additionally or alternatively, the heterologous nucleic acid sequences may encode proteins not normally encoded by the viral genome such as, for example, marker proteins such as GFP, eGFP (enhanced GFP), or hREN (humanised Renilla Lucif erase).

Genetic modifications as described herein may result in the generation of viruses which confer temperature sensitivity to virus replication. Such viruses, may be able to be grown and replicate at say 25-35C, such as 33C, but are unable to replicate and may be restricted at 37C, which would be the normal body temperature of the host animal. Such modifications, may occur in the nucleocapsid or L protein, for example.

The inventors have observed that modified virus produced according to this invention exhibits attenuated growth in mammalian cell culture. Furthermore, while the modified virus is able to synthesise all proteins necessary for the production of infectious virus particles, it is unable to inhibit host protein synthesis. In view of the above, the modified virus provided by the first aspect of this invention, may otherwise be referred to as an attenuated Schmallenberg virus.

In a second aspect, the present invention provides a modified virus according to the first aspect of this invention, for raising an immune response.

In one embodiment, the second aspect of this invention provides vaccines or vaccine compositions comprising the modified virus described herein for raising immune responses. Vaccines of this type may be known as attenuated vaccines.

Vaccines or vaccine compositions provided by the second aspect of this invention may be used prophylactically to prevent infection by Schmallenberg virus. In some cases the vaccines provided by this invention may be used to reduce infection or the symptoms thereof. In yet further embodiments, the vaccine or vaccine compositions provided by this invention may be used to reduce colonisation of a host by Schmallenberg virus. Subjects exposed to the vaccines provided by this invention, may produce antibodies which bind to (or which exhibit affinity or specificity for) the Schmallenberg virus or antigens thereof - such antibodies may otherwise be referred to as "protective" antibodies. Accordingly, the vaccines or vaccine compositions provided by this invention may be used to induce, elicit or raise a protective immune response or antibodies in an animal.

The viruses and compositions described are particularly suitable for administration to ruminant, for example bovine or ovine animals and the vaccines and compositions described herein may be used to treat and/or prevent diseases caused or contributed to, by Schmallenberg virus. It should be understood that the term "animal" encompasses mammalian species including, for example, ungulate or ruminant (for example ovine or bovine) species as well as primates including, for example, humans. Schmallenberg virus infection is thought to be transmitted by vectors typically affecting livestock (ruminants) e.g. midges. Treatment of diseases or conditions is to be understood in a wide sense. In adult animals, infection by Schmallenberg virus may manifest itself as a fever, diarrhoea and/or reduced milk production and prevention or treatment may eliminate one or more of these symptoms. However, infection of animals with Schmallenberg virus may also lead to still births or birth defects in newborn animals and as such vaccinations may be designed to prevent or minimise such birth defects and/or congenital malformations. Consequently it may be desirable to vaccinate animals before reaching off-spring baring age and it may only be necessary, when seeking to minimise birth defects to vaccinate female animals.

The modified viruses provided by this invention may be formulated as vaccine compositions (preferably sterile vaccine compositions) comprising a pharmaceutically acceptable carrier or excipient. Such carriers or excipients are well known to one of skill in the art and may include, for example, water, saline, phosphate buffered saline, dextrose, glycerol, ethanol, ion exchangers, alumina, aluminium stearate, lecithin, serum proteins, such as serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water salts or electrolytes, such as protamine sulphate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polypropylene-block polymers, polyethylene glycol and wool fat and the like, or combinations thereof. The vaccine compositions provided by this invention may be formulated for oral, parenteral (including subcutaneous, intradermal, intramuscular and intravenous), and mucosal (for example nasal) administration. By way of example, vaccine compositions for parenteral administration include sterile solutions or suspensions of modified virus in aqueous or oleaginous vehicles. Injectable preparations may be adapted for bolus injection or continuous infusion. Such preparations are conveniently presented in unit dose or multi-dose containers, which are sealed after introduction of the formulation until required for use.

It should be understood that in addition to the aforementioned carrier ingredients the vaccine compositions described above may comprise one or more additional carrier ingredients such as diluents, buffers, flavouring agents, binders, surface active agents, thickeners, lubricants, preservatives (including anti-oxidants) and the like, and substances included for the purpose of rendering the composition isotonic with the blood of the intended recipient.

Pharmaceutically acceptable carriers are well known to those skilled in the art and include, but are not limited to, 0.1 M and preferably 0.05 M phosphate buffer or 0.8% saline. Additionally, pharmaceutically acceptable carriers may be aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils. Preservatives and other additives may also be present, such as, for example, antimicrobials, antioxidants, chelating agents, inert gases and the like.

One of skill will appreciate that the dose and/or administration regime used to vaccinate any given animal or animal population may vary depending on, for example, the modified virus to be used as a vaccine and the host to be immunised. Generally speaking the dose should be sufficient to induce at least a temporary immunity to a Schmallenberg virus. One of skill in the art will appreciate that by administering a number of doses over a period of time, it may be possible to increase the length of time a vaccinated host retains immunity to Schmallenberg virus infection/disease. Typically, the dose is sufficient to raise, elicit or induce an immune response and/or protective antibodies.

Modified virus for use in the present invention may be obtained using recombinant techniques. One of skill will appreciate that, for example, PCR based techniques can be used to change or excise specific nucleotide sequences from larger nucleic acid sequences. As such, PCR based mutagenesis techniques may be used to, for example, modify the NSs gene sequence from Schmallenberg virus S segment to prevent its expression. Furthermore, using restriction enzymes, cloning and PCR technology, it is possible to introduce another sequence, for example a sequence encoding another orthobunyavirus Gc and Gn glycoproteins, into the Schmallenberg virus genome. Further information regarding such techniques may be found in "Molecular Cloning: A Laboratory Manual" by Sambrook and Russell (Pub: CSHL Press).

One of skill in this field will appreciate that template nucleic acid for use in generating the modified viruses described herein may take the form of a vector or vectors comprising one or more Schmallenberg genome sequences. For example, the template nucleic acid may comprise sequences encoding the L, M and/or S genome segments. Modified Schmallenberg viruses according to the present invention may be generated in accordance with a reverse genetics system developed for orthobunyaviruses that allows specific modification of the viral genome as described previously (Bridgen and Elliott, 1996, Lowen et al., 2004). In brief, mammalian cells constitutively expressing bacteriophage T7 RNA polymerase are transfected with a mixture of three plasmids that express exact copy, positive- sense RNAs corresponding the three genome segments (L, M and S), one or more of which comprise a mutation as described herein, with or without co-transfection of plasmids that express the viral proteins. Infectious virus is generated in the cells and is isolated and maintained by standard virological procedures. This system has been applied to the study of the prototype orthobunyavirus, Bunyamwera virus, to produce a range of mutant viruses with attenuated phenotypes. These include viruses that do not express the NSs protein (Bridgen et al., 2001), viruses in which the coding sequence of one segment is flanked the non-coding sequence of another segment (rearranged genome; (Lowen et al., 2005)), viruses carrying deletions within the non-coding sequences (Lowen and Elliott, 2005, Mazel-Sanchez, 2012), and viruses carrying temperature-sensitive mutations in N (Eifan and Elliott, 2009) or L (Mazel-Sanchez, 2012) proteins. These latter viruses can replicate at 33°C but are restricted at 37°C or higher temperatures. These techniques can be applied with respect to Schmallenberg virus in order to generate a variety of attenuated modified Schmallenberg viruses in accordance with the present invention. The skilled reader is directed to the above citations, all of which are hereby incorporated herein in their entirety, by way of reference. The invention further relates to methods for producing modified virus according to this invention, said method comprising the steps of:

(a) transfecting a cell with one or more vectors encoding a modified Schmallenberg virus genome segment and/or protein and one or more vectors encoding wild type Schmallenberg virus genome segments and/or proteins;

(b) maintaining the transfected cell under conditions suitable to promote or induce production of virus; and

(c) rescuing virus;

wherein the rescued virus is a modified virus according to the first aspect of this invention (and or any of the embodiments thereof).

By way of example, a cell may be transfected with a vector encoding, or capable of expressing, the modified genome segments described herein. For example, the vector to be transfected may comprise (and express) a nucleic acid sequence providing a modified S segment (mS) from which the sequence encoding the NSs protein has been modified to prevent its expression. Additionally, the cell may be transfected with one or more vectors encoding, or capable of expressing, genomic S, M and/or L segments.

The methods provided by this aspect of the invention may be further supplemented with the use of Lipofectamine 2000 (Invitrogen), or alternative formulations to introduce nucleic acids into cells.

The term cell, as used in the third aspect of this invention (above) may encompass eukaryotic or prokaryotic cells, such as, for example, plant, insect, mammalian, fungal and/or bacterial cells. For example, suitable cells to be transfected with the vectors described herein may include mammalian cells such as Vero cells such as, for example BHK-21 or BSR-T7/5 cells.

Maintaining transfected cells under conditions suitable to promote or induce production of virus may include, for example, cells being left for approximately 5-7 days or until a cytopathic effect is observed. To rescue virus, the media in which the cells have been maintained may be collected - the collected media containing rescued (modified) virus. A vector provided by this invention may be circular or linear, single stranded or double stranded and can include DNA, RNA or a combination or modification thereof. Furthermore, vectors of this invention may be, for example, plasmids, cosmids or viral vectors (for example retroviral or bacteriophage vectors). Vectors provided by this invention may further comprise selection or marker elements, for example antibiotic resistance genes and/or optically detectable tags. A large number of suitable vectors are known and further information may be obtained from Pouwels et al. Cloning Vectors: a Laboratory Manual (1985 and supplements), Elsevier, N.Y.; and Rodriquez, et al. (ads.) Vectors: a Survey of Molecular Cloning Vectors and their Uses, Buttersworth, Boston, Mass (1988) - both of which are incorporated herein by reference.

In a fifth aspect, the present invention provides host cells transfected with a vector as described herein. Eukaryotic or prokaryotic cells, such as, for example, plant, insect, mammalian, fungal and/or bacterial cells, may be transfected with one or more of the vectors described herein. By way of example, suitable cells to be transfected with the vectors described herein may include mammalian cells such as Vero cells such as, for example BHK- 21 or BSR-T7/5 cells.

One of skill in this field will be familiar with the techniques used to introduce heterologous or foreign nucleic acid sequences, such as expression vectors, into cells and these may include, for example, heat-shock treatment, use of one or more chemicals (such as calcium phosphate) to induce transformation/transfection, the use of viral carriers, microinjection and/or techniques such as electroporation. Further information regarding transformation/transfection techniques may be found in Current Protocols in Molecular Biology, Ausuble, F.M., ea., John Wiley & Sons, N.Y. (1989) which is incorporated herein by reference.

In one embodiment, the modified viruses described herein may be admixed with another component, such as, for example, another polypeptide and/or an adjuvant, diluent or excipient. Vaccines or vaccine compositions provided by this invention may contain fungal, viral and/or bacterial antigens used to control other diseases. For example, the vaccine or vaccine composition may be included within a multivalent vaccine which includes antigens against other diseases.

In a still further aspect, the present invention provides an ungulate or ruminant population treated or immunised with a vaccine or composition described herein. In one embodiment, the ruminant population is an ovine or bovine population.

The present invention also relates to methods of producing immune serum and/or antibodies. The methods may comprise the step of administering a modified Schmallenberg virus to test animal and, after a suitable period of time, obtaining serum. One of skill will appreciate that serum (i.e. polyclonal serum) from animals administered a modified virus according to this invention may comprise immunoglobulin (IgG, IgM, IgE, IgD, IgA and/or other isotyopes variants - depending on the site of administration (systemic/mucosal etc) and/or the animal being immunised) having affinity for or specific to, antigens of the modified virus. Since the modified viruses provided by this invention have been shown to be attenuated, the methods provided by this aspect of the invention have advantages over prior art methods of producing immune sera where modified viruses may have caused significant illness in animals, posed a serious health risk to human handlers and could easily have reverted to virulence through reassortment with other modified/wild-type strains.

The present invention further provides a vaccine for use in preventing or controlling disease or conditions (such as leading to birth issues and for defects) in animal or mammalian hosts such as, for example, bovine or ovine hosts, wherein said diseases are caused or contributed to, by Schmallenberg virus.

The invention further provides a method for immunising subjects, for example animals (in particular ovine or bovine mammals) against a Schmallenberg virus infection, said method comprising the step of administering to the subject a vaccine of the invention.

DETAILED DESCRIPTION

The present invention will now be described in detail and with reference to the Figures which show: Figure 1 shows plaque morphologies in BHK cells of authentic Schmallenberg virus (SBV), recombinant Schmallenberg virus (rSBV) and recombinant Schmallenberg virus (rSBV) lacking the NSs gene (rSBV-delNSs3stop);

Figure 2 shows the time course of N protein expression in BHK and A549 cells infected with authentic SBV, recombinant SBV (rSBV), or rSBV-delNSc3stop (del) as indicated. Cell extracts were fractionated by SDS-PAGE, transferred to a nylon membrane and incubated with anti-tubulin (tub) or anti-SBV N protein (N) antibodies as indicated;

Figure 3 shows metabolic labelling of infected cells. BHK or A549 cells were infected with authentic SBV (wt), rSBV (rec) or rSBV-delNSs (del) and at different times after infection the cells were radiolabeled with ³⁵S-methionine for 1 hour. Cell extracts were fractionated by SDS-PAGE; and

Figure 4 shows the results of an interferon assy. A549 cells were treated for 24 hr with UV- inactivated supernatant from A549 cells infected with wild-type SBV or Bunyamwera virus, or recombinant SBV or Bunyamwera virus lacking NSs, or from mock infected cell. The cells were then infected with IFN-sensitive encephalomyocarditis virus, incubated for 3 days at 37C and then the cells were fixed and stained with crystal violet.

Creation of cDNA clones.

BHK cells were infected with SBV (obtained from Friedrich-Loeffler Institute) and supernatant fluid containing virus was harvested. Viral RNA was extracted using QiaAmp Viral RNA minikit (Qiagen) according to the manufacturer's instructions. cDNA was synthesised using reverse transcriptase and a primer specific for each segment, followed by PCR to specifically amplify each genome segment . As the available sequences of the SBV genome (accession numbers HE649912, HE649913 and HE649914) did not include the complete terminal nucleotide sequences, comparison of available sequences from other Simbu serogroup viruses was used to predict the terminal sequences for primer design. The primers used were:

For S segment SB VSFg 5 ' GGGGT ACCCGTCTC ATATAGAGT AGTGAACTCC ACT ATT AAC

SB VSR 5 ' GCTCTAGACGTCTCTACCC AGTAGTGTTCTCCACTTATTAAC

For M segment

SB VMFg 5 ' GGGGT ACCCGTCTC ATATAGAGT AGTGAACT ACC AC AATCAAA SBVMR 5' GCTCTAGACGTCTCTACCC AGTAGTGTTCTACCACATGAAAAAC For L segment

SBVLFgBfuAI

5' ggggtacc acctgc caca tata gagtagtgtaccc ctaattacaatc

SBVLRBfuAI

5' gctctaga acctgc cact accc agtagtgtgc ccctaattacatgaaac

The full length PCR products were then digested with BsmBI (S and M segments) or BfuAI (L segment) and ligated to plasmid TVT7 (Johnson et al., 2000) that had been digested with Bbsl. Recombinant plasmids containing full-length cDNA clones were identified and their nucleotide sequences confirmed as matching the database entries. Plasmids were designated pTVT7SBVS, pTVT7SBVM and pTVT7SBVL, which contain the cloned S, M and L sequences respectively.

Generation of recombinant virus by reverse genetics.

The method described by Lowen et al (2004) was followed. In brief, semi-confluent monolayers of BSR-T7/5 cells in 6-well plates were transfected with 0^g of each plasmid using 5μ1 Lipofectamine 2000 ίη500μ1 OptiMEM (Invitrogen). After 5 days incubation at 37°C, the supernatant fluid was harvested and virus stocks were expanded by growth in BHK- 21 cells. The complete nucleotide sequence of the recombinant virus genome was confirmed after RT-PCR amplification of cDNA as described above.

Plaque assays

Viruses were titrated by plaque assay in various cell lines under an overlay containing Glasgow modified minimal essential medium supplemented with 2% newborn calf serum and 0.6% Avicell (FMC Ltd), and incubated at 37°C for 3 to 4 days. Cell monolayers were fixed with 4% formaldehyde in PBS and plaques visualised by staining with crystal violet.

Generation of mutant viruses

Plasmids containing full-length SBV cDNAs were altered by a PCR-mediated mutagenesis approach to create the following mutant viruses:

rSBV-delNSs3stop: 3 mutations were introduced into the S segment cDNA at positions 96 (C to A), 106 (G to A) and 115 (T to A) to introduce translational stop codons into the NSs open reading frame, thus abrogating NSs expression, using mutational PCR primer pairs

SBdNSs2ST_FW

5 ' CCCGGAGGTAGGGT ATGTAGC ATTTATTGG

SBdNSs2ST_RV

5' CCA ATA AAT GCT AC A TAC CCT ACC TCC GGG SBdNSs3ST_FW

5' CCCGGAGGTAGGGT ATGTAGC ATTTATAGGTAAGTATGG

SBdNSs3ST_RV

5' CCA TAC TTA CCT ATA AAT GCT ACA TAC CCT ACC TCC GGG rSBVN-N74N-S. Base 255 of the SBV S segment cDNA was changed from A to G to change amino acid residue 74 of the N protein from asparagine (N) to serine (S) using mutagenic primers

SBV-N74S-FW2

GGT CAA ATT TAC AGT GGT TAG TAA CCA TTT TCC CC SBVN-N74S-RV2

GGG GAA AAT GGT TAC TAA CCA CTG TAA ATT TGA CC rSBVN-S96G. Base 320 of the SBV S segment cDNA was changed from G to C to change amino acid residue 96 of the N protein from serine (S) to glycine (G) using mutagenic primers SBVN-S96G-FW

5' CA CTT CAC AGG ATG GGA GGA TAT CTA GCA C

SBVN-S96G-RV

5' GTG CTA GAT ATC CTC CCA TCC TGT GAA GTG rSBVN-G230R. Base 719 of the SBV S segment cDNA was changed from G to C to change amino acid residue 230 of the N protein from glycine (G) to arginine (R) using mutagenic primers

SBVN-G230R-FW

CC TTC TTG CAG CAA TTC CGT ATC AAC ATC TAA ACC SBVN-G230R-RV

GGT TTA GAT GTT GAT ACG GAA TTG CTG CAA GAA GG rSBVN-N74S, S96G and rSBVN-N74S, G230R combine two amino acid changes in the N protein as indicated.

Mutations of the N protein were made in the S segment plasmid in which the NSs open reading frame had been disrupted (delNSs3stop described above). rSBVL-E1428Q. Base 4909 of the SBV L segment cDNA was changed from G to C to change amino acid residue 1428 of the L protein from glutamic acid (E) to glutamine (Q) using mutagenic primers

SBVL-EQ.for

5' GGGATGGAGCCAGATCAAATGCGGAGAG

SBVL-EQ.rev

5' CTCTCCGCATTTGATCTTGGCTCCATCCC rSBV-MLM: The L segment untranslated regions (UTRs) were entirely substituted by the M segment UTRs to create a hybrid segment. rSBV-MSM: The S segment UTRs were entirely substituted by the M segment UTRs to create a hybrid segment. rSBV-SLS: The L segment untranslated regions (UTRs) were entirely substituted by the S segment UTRs to create a hybrid segment.

In each case, excision (outward-facing) PCR was used to generate a plasmid containing just the appropriate UTR sequences, and then the appropriate coding sequence, amplified by PCR, was combined using a restriction-free cloning technique (In-fusion HD Cloning Kit, Clontech).

Interferon assay.

A biological assay for the secretion of IFN into the medium of cells infected with SBV was employed. Medium from infected A549 cells was clarified, and then treated with UV light to inactivate any infectious virus. A549 cells in a 96-well plate were treated with 2-fold dilutions of the supernatant and incubated for 24 h at 37°C. The medium was removed and the cells infected with IFN-sensitive encephalomyocarditis virus. Following incubation at 37°C for 48 h, the cells were fixed with formaldehyde and then stained with crystal violet.

Results

Generation of recombinant virus.

Recombinant SBV (rSBV), generated by reverse genetics, showed similar plaque morphology to authentic SBV (designated wtSBV) in BHK cells (Fig. 1). rSBV replicated similarly to authentic virus in BHK cells as monitored by expression of N protein (Fig. 2) or by metabolic labelling (Fig. 3). Both wtSBV and rSBV induced shut-off of host cell protein synthesis (Fig. 3).

The recombinant virus lacking NSs expression, rBUNdelNSs3stop, (delNSs for short) gave a small indistinct plaque phenotype in BHK cells (Fig. 1). The virus replicated well in BHK cells (Fig. 2) but did not cause shut-off of host cell protein synthesis (Fig. 3). rBUNdelNSs3stop is thus regarded as attenuated.

Interferon production.

The ability of SBV to induce interferon (IFN) was assessed in A549 cells, which have a competent IFN system, using an assay that involved protecting cells from infection with encephalomyocarditis virus (EMCV), which is highly sensitive to IFN and is unable to grow in cells in an IFN-induced antiviral state. As shown in Fig. 4, cells treated with medium from wtSBV-infected cells were not protected from cytopathic effects of EMCV infection. In contrast, medium from cells infected with the mutant virus unable to express NSs, were protected form EMCV infection. As controls supernatants from cells infected with wild type Bunyamwera virus or Bunyamwera virus lacking NSs were used. This result indicated that the SBV delNSs mutant virus is an efficient inducer of IFN, whereas wtSBV is not, implying that, like other orthobunyaviruses, the NSs protein is an IFN-antagonist.

REFERENCES

BRIDGEN, A. & ELLIOTT, R. M. 1996. Rescue of a segmented negative-strand RNA virus entirely from cloned complementary DNAs. Proc Natl Acad Sci USA, 93, 15400- 15404.

BRIDGEN, A., WEBER, F., FAZAKERLEY, J. K. & ELLIOTT, R. M. 2001. Bunyamwera bunyavirus nonstructural protein NSs is a nonessential gene product that contributes to viral pathogenesis. Proc Natl Acad Sci USA, 98, 664-669.

CALISHER, C. H. 1996. History, Classification and Taxonomy of Viruses in the Family Bunyaviridae. In: ELLIOTT, R. M. (ed.) The Bunyaviridae. New York: Plenum Press.

EIFAN, S. A. & ELLIOTT, R. M. 2009. Mutational analysis of the Bunyamwera orthobunyavirus nucleocapsid protein gene. Journal of Virology, 83, 11307-11317. HOFFMANN, B., SCHEUCH, M., HOPER, D., JUNGBLUT, R., HOLSTEG, M., SCHIRRMEIER, H., ESCHBAUMER, M., GOLLER, K. V., WERNIKE, K., FISCHER, M., BREITHAUPT, A., METTENLEITER, T. C. & BEER, M. 2012.

Novel orthobunyavirus in cattle, Europe, 2011. . Emerg Infect Dis, DOI: 10.3201/eidl803.111905.

JOHNSON, K. N., ZEDDAM, J. L. & BALL, L. A. 2000. Characterization and construction of functional cDNA clones of Pariacoto virus, the first Alphanodavirus isolated outside Australasia. / Virol, 74, 5123-32.

KUROGI, H., INABA, Y., TAKAHASHI, E., SATO, K. & SATODA, K. 1977. Congenital abnormalities in newborn calves after inoculation of pregnant cows with Akabane virus. Infect Immun, 17, 338-43. LOWEN, A. C, BOYD, A., FAZAKERLEY, J. K. & ELLIOTT, R. M. 2005. Attenuation of bunyavirus replication by rearrangement of viral coding and noncoding sequences. / Virol, 79, 6940-6.

LOWEN, A. C. & ELLIOTT, R. M. 2005. Mutational analyses of the nonconserved sequences in the Bunyamwera orthobunyavirus S segment untranslated regions. /.

Virol, 79, 12861-12870.

LOWEN, A. C, NOON AN, C, MCLEES, A. & ELLIOTT, R. M. 2004. Efficient bunyavirus rescue from cloned cDNA. Virology, 330, 493-500.

MAZEL-SANCHEZ, B. 2012. PhD Thesis, University of St Andrews.

PARSONSON, I. M., DELLA-PORTA, A. J. & SNOWDON, W. A. 1977. Congenital abnormalities in newborn lambs after infection of pregnant sheep with Akabane virus.

Infect Immun, 15, 254-62.

PARSONSON, I. M. & MCPHEE, D. A. 1985. Bunyavirus pathogenesis. Adv Virus Res, 30,

279-316.

PLYUSNIN, A. & ELLIOTT, R. M. (eds.) 2011. Bunyaviridae. Molecular and Cellular

Biology, Norfolk.: Caister Academic Press.

TSUDA, T., YOSHIDA, K., OHASHI, S., YANASE, T., SUEYOSHI, M., KAMIMURA, S.,

MISUMI, K., HAMANA, K., SAKAMOTO, H. & YAMAKAWA, M. 2004.

Arthrogryposis, hydranencephaly and cerebellar hypoplasia syndrome in neonatal calves resulting from intrauterine infection with Aino virus. Vet Res, 35, 531-8.

Claims

1. A genetically modified Schmallenberg virus.

2. The genetically modified virus according to claim 1 wherein one or more of the L, M, S segments of the viral genome, the non-coding sequence of the L, M, S segments, the coding sequence of the L, M, S segments, the 3' and/or 5' ends of the genome, includes one or more modifications, such as one or more nucleic acid modifications, insertions (additions), deletions, rearrangements and/or inversions.

3. The genetically modified virus according to claim 2 which has been modified to include one or more nucleic acid sequences encoding an amino acid, peptide, polypeptide or protein moiety which may be used as a tag or label.

4. The genetically modified virus of any preceding claim wherein the M segment is modified so as to disrupt the sequence encoding the NSm proteins.

5. The genetically modified virus according to any preceding claim wherein the S segment sequence has been modified in order to prevent, reduce or ablate NSs expression.

6. The genetically modified virus according to any preceding claim which comprises an S segment modified to include one or more heterologous sequence(s) or one or more sequence(s) normally encoded by another Bunyavirus family member or genome segment - for example, one or more gene sequences from the L and/or M segments.

7. A genetically modified virus according to any preceding claim, for use in a method for raising an immune response.

8. A vaccine or vaccine composition comprising a genetically modified virus according to any one of claims 1-6 for raising an immune response.

9. The modified virus, vaccine, or vaccine composition according to claims 7 or 8 for use in inducing, eliciting or raising a protective immune response or antibodies in an animal.

10. The modified virus, vaccine, or vaccine composition according to claims 7-9 for administration to a ruminant, such as a bovine or ovine animal.

11. A method for producing a modified Schmallenberg virus, said method comprising the steps of:

(a) transfecting a cell with one or more vectors encoding a modified cDNA to the Schmallenberg virus genome segment and/or protein and one or more vectors encoding cDNA to the wild type Schmallenberg virus genome segments and/or proteins;

(c) rescuing virus;

wherein the rescued virus is a modified virus according to any of claims 1-6.

12. The method according to claim 11 wherein the cell has been transfected with a vector encoding, or capable of expressing, one or more modified genome segments non-coding regions, 3' and/or 5' ends of the genome.

13. The method according to claim 12 wherein, the cell is further transfected with one or more vectors encoding, or capable of expressing, genomic S, M and/or L segments.

14. Three vectors which each individually express, a positive sense RNA corresponding to three genome segments L, M, and S respectively, wherein one or more of the genome segments include a mutation as compared to a wild-type sequence.

15. An ungulate or ruminant population treated or immunised with a modified virus, vaccine or vaccine composition according to any of claims 7-9.