EP2847332B1 - Rna products and uses thereof - Google Patents

Rna products and uses thereof Download PDF

Info

Publication number
EP2847332B1
EP2847332B1 EP13721970.5A EP13721970A EP2847332B1 EP 2847332 B1 EP2847332 B1 EP 2847332B1 EP 13721970 A EP13721970 A EP 13721970A EP 2847332 B1 EP2847332 B1 EP 2847332B1
Authority
EP
European Patent Office
Prior art keywords
dicer
cells
cell
dna
rna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
EP13721970.5A
Other languages
German (de)
French (fr)
Other versions
EP2847332A1 (en
Inventor
Fabrizio D'adda Di Fagagna
Sofia FRANCIA
Flavia Michelini
Francesca ROSSIELLO
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
IFOM Fondazione Istituto FIRC di Oncologia Molecolare
Original Assignee
IFOM Fondazione Istituto FIRC di Oncologia Molecolare
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by IFOM Fondazione Istituto FIRC di Oncologia Molecolare filed Critical IFOM Fondazione Istituto FIRC di Oncologia Molecolare
Publication of EP2847332A1 publication Critical patent/EP2847332A1/en
Application granted granted Critical
Publication of EP2847332B1 publication Critical patent/EP2847332B1/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes
    • C12N2320/11Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/31Combination therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present invention relates to small RNAs (DDRNAs), inhibitors thereof, inhibitors of enzymes producing thereof, and their use to modulate the response of a cell to a DNA damaging event.
  • DDRNAs small RNAs
  • the invention concerns also a method to detect the presence or quantify DNA damage.
  • the DNA damage response is a coordinate set of events that promptly follows the generation of a lesion in the DNA double helix. Detection of DNA discontinuities by specialized factors initiates a signaling cascade that, stemming from the site of DNA damage, amplifies the signal and reaches the whole nuclear space and the entire cell 1 . DDR signaling cascade initiation establishes a local self-feeding loop that leads to focal accumulation of upstream DDR factors in the form of cytologically detectable DDR foci at damaged sites. Specifically, detection of a DNA double-strand break (DSB) triggers the activity of the protein kinase ATM that, among other factors, phosphorylates the histone variant H2AX ( ⁇ H2AX) at the DNA damage site.
  • DRB DNA double-strand break
  • DDR activation can be triggered by exogenous DNA damaging agents such as ionizing radiations and chemotherapeutic agents (i.e. including but not limited to bleomycin) and by endogenous physiological events such as meiotic recombination, V(D)J recombination at the immunoglobulins and T cell receptor loci, telomere shortening and reactive oxygen species, as well as pathological events such as oncogene activation, viral integration in the genome, viral replication and bacterial infection 1 , 82 .
  • exogenous DNA damaging agents such as ionizing radiations and chemotherapeutic agents (i.e. including but not limited to bleomycin)
  • endogenous physiological events such as meiotic recombination, V(D)J recombination at the immunoglobulins and T cell receptor loci, telomere shortening and reactive oxygen species, as well as pathological events such as oncogene activation, viral integration in the genome, viral replication and bacterial infection 1
  • telomeres dysfunction and oncogene activation can generate a sustained DDR leading to a permanent cell-cycle arrest known as cellular senescence 2 .
  • bacteria have been shown to generate persistent DNA damage and cellular senescence in mammals 82 .
  • pathologies associated with altered telomere functions have been reported as "telomeropathies" 85 .
  • ncRNAs non-coding RNAs
  • RNA interference RNA interference pathway
  • Some ncRNAs may be processed by ribonucleases of the RNA interference (RNAi) pathway, giving rise to short double-stranded RNA products that participate in various cellular functions.
  • RNAi RNA interference pathway
  • the RNAi pathway is a conserved machinery, whose components are thought to have evolved to preserve genome integrity from the attacks of viruses and mobile genetic elements 14 .
  • RNA molecules including small interfering RNAs (siRNAs), microRNAs, repeat-associated small interfering RNAs (rasiRNAs), Piwi-interacting RNAs (piRNAs) 15 and QDE-2 interacting RNAs (qiRNA) in Neurospora crassa 16 .
  • small interfering RNAs small interfering RNAs
  • microRNAs microRNAs
  • rasiRNAs repeat-associated small interfering RNAs
  • piRNAs Piwi-interacting RNAs
  • qiRNA QDE-2 interacting RNAs
  • piRNAs and qiRNAs have been implicated in genome stability maintenance 16 and a family of microRNAs (miR-34) has been shown to act downstream of p53 19 . It is presently unknown whether any RNAs have any direct role in the control of DDR activation at sites of DNA damage.
  • US2006105384 is focused on a technique for detecting and diagnosing disease conditions, as well as health conditions due to exposure to environmental conditions by detecting and identifying DNA or RNA damage markers. This technique is based on measurement of free levels of nucleotide excision products resulting from DNA or RNA damage.
  • the DDRNAs of the instant invention are not nucleotide excision products.
  • JP2009171895 concerns a method for analyzing the function of a non-coding RNA (ncRNA) existing in a nucleus by destroying the ncRNA by introducing an antisense oligo-molecule containing substantially the same sequence as a sequence complementary to a single-stranded region in the secondary structure of the target ncRNA to a cell nucleus and destroying the RNA molecule.
  • ncRNA non-coding RNA
  • WO2012/013821 relates to the field of cancer, particularly cancers wherein p53 tumour suppression function is lost or impaired. It is shown herein that Dicer is a synthetic lethal partner of p53, allowing the selective targeting and killing of cancer cells. The effects of Dicer on survival on cancer cells are mediated through the miR17-92 cluster and inhibition of members of this miRNA cluster is an attractive treatment strategy in cancer. Most particularly, these findings are of importance in the field of retinoblastoma.
  • WO2011/157294 relates to compositions comprising an inhibitor of a polynucleotide, said polynucleotide to be inhibited being capable of decreasing or suppressing expression of Dicer or a biologically active derivative thereof for use in treating or preventing cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto. Furthermore, the present invention also relates to methods of treating or preventing cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto. DDRNAs are not mentioned nor the impact of Dicer modulation on DNA damage related events and DDR modulation.
  • WO2009/102225 relates to compositions and methods for cancer diagnosis, research and therapy, including but not limited to, cancer markers.
  • the present invention relates to ncRNAs as diagnostic markers and clinical targets for prostate, lung, breast and pancreatic cancer.
  • US2012289581 relates to long non-coding RNAs (lncRNAs) and methods of using them diagnostically and therapeutically for treatment of cancer, stem cell therapy, or regenerative medicine are disclosed.
  • the invention relates to IncRNAs that play roles in regulation of genes involved in cell proliferation, differentiation, and apoptosis.
  • Such IncRNAs can be used as biomarkers to monitor cell proliferation and differentiation during cancer progression or tissue regeneration.
  • PANDA a P21-Associated NcRNA, DNA damage Activated
  • Inhibitors of PANDA sensitize cancerous cells to chemotherapy and can be used in combination with chemotherapeutic agents for treatment of cancer.
  • Limmer Ket al. (2013) used a Molecular Force Assay (MFA) to measure the activity of Dicer.
  • MFA Molecular Force Assay
  • RNA sequence that forms an aptamer-binding site for paromomycin, a 615-dalton aminoglycoside.
  • Dicer activity is modulated as a function of concentration and incubation time: the addition of paromomycin leads to a decrease of Dicer activity according to the amount of ligand.
  • the measured dissociation constant of paromomycin to its aptamer was found to agree well with literature values.
  • the parallel format of the MFA allows a large-scale search and analysis for ligands for any RNA sequence.
  • DDRNA of the instant invention have been characterized for distinct functions: DDRNAs control DDR signaling, whereas diRNA of Wei et al are not shown to have any role in DDR signaling: Wei et al show no evidence of altered DDR activation, as detected by nuclear DDR foci formation or of DDR proteins activation, for instance by phosphorylation, or of altered DNA damage checkpoint functions or modulation of cellular senescence. Thus there is no demonstrated overlap between their functions.
  • Bu et al discloses the use of siRNA to knock down Dicer and increase the sensitivity of breast cancer cells to a DNA damaging agent.
  • Francia et al. (Nature 488: 231-235, 2012 ) refers to site-specific DICEr and DROSHA RNA products that control the DNA-damage response.
  • DICER (Gene ID: 23405; Official Symbol: DICER1 Name: dicer 1, ribonuclease type III [Homo sapiens] Other Aliases: DCR1, Dicer, HERNA, KIAA0928, MNG1; Other Designations: Dicer1, Dcr-1 homolog; K12H4.8-LIKE; dicer 1, double-stranded RNA25 specific endoribonuclease; endoribonuclease Dicer; helicase MOI; helicase with RNAse motif; helicase-moi, Chromosome: 14; Location: 14q32.13, Annotation: Chromosome 14, NC_000014.8 (95552565..95623759, complement), MIM: 606241, NCBI version May 4, 2012) and DROSHA (Gene ID: 29102; Official Symbol: DROSHA Name: drosha, ribonuclease type III [Homo sapiens], Other Aliases: ETOHI2, HSA2429
  • RNAi Components of RNAi are thought to have evolved to preserve genome stability from the attacks of viruses and mobile genetic elements.
  • RNA products generated by DICER and DROSHA are involved in chromatin assembly in Schizosaccharomyces pombe, gene silencing and cancer.
  • the DNA damage response (DDR) is a signaling pathway that arrests the proliferation of cells undergoing genotoxic events to preserve genome stability. So far, RNAi and DDR signaling pathways have not been demonstrated to directly interact.
  • the authors show that oncogene-induced senescent cells, cells thus bearing oncogene-induced DNA damage and consequent DDR activation, require DICER and DROSHA to maintain DDR activation and cell-cycle arrest.
  • DICER and DROSHA are also necessary to activate DDR upon exogenous DNA damage, and DDR checkpoint functions depend on the ribonuclease activity of DICER.
  • DICER is required for irradiation-induced DDR activation in vivo in zebrafish.
  • DDR foci stability is sensitive to RNase A treatment, and DICER- and DROSHA-dependent small RNA products are required to restore DDR foci in RNase A-treated cells.
  • Study of DDR activation at a DNA double-strand break within a unique and traceable exogenous integrated locus reveals that DDR focus formation requires locus-specific RNA molecules.
  • DDRNAs short or small RNAs
  • DDRNAs act differently from microRNAs and canonical RNAi mechanisms because:
  • DDRNAs small RNAs
  • the method comprises inhibiting the function and/or impairing the production of small RNAs (DDRNAs), said small RNAs being generated in cis by processing by DICER and/or DROSHA of a RNA transcript synthesized using the specific damaged genomic locus as template for transcription, wherein inhibiting the function of DDRNAs and/or impairing the production thereof is performed by a sequence-specific inhibitory oligonucleotide that specifically binds to said small RNAs (DDRNAs).
  • DDRNAs small RNAs
  • the method further comprises the step of exposing said cell to a DNA damaging treatment.
  • a DNA damaging treatment belongs to the group of: radiotherapy, chemotherapy, for instance hydroxyurea treatment or bleomycin treatment, a treatment that impairs DNA repair, or any genotoxic treatment.
  • the radiotherapy is any ionizing radiation.
  • the DNA-damaging treatment is a radiotherapy.
  • the mammalian cell is damaged by a genotoxic event, preferably the genotoxic event belongs to the group of: cellular transformation, cellular senescence, oncogene activation, DNA replication stress, reactive oxygen species, ionizing radiation, chemotherapeutic agents, for instance bleomycin, or telomere shortening, damaged telomere, dysfunctional telomere, viral integration in the genome, viral infection or bacterial infection.
  • a genotoxic event belongs to the group of: cellular transformation, cellular senescence, oncogene activation, DNA replication stress, reactive oxygen species, ionizing radiation, chemotherapeutic agents, for instance bleomycin, or telomere shortening, damaged telomere, dysfunctional telomere, viral integration in the genome, viral infection or bacterial infection.
  • sequence-specific inhibitor oligonucleotide is a LNA molecule, a 2'-O-Methyl-modified oligonucleotide or a phosphorothioate-modified oligonucleotide.
  • the mammalian cell is a human cell, preferably the cell is a pre-cancerous cell, a cancer cell, a senescent cell or a virally-infected cell, preferably the senescent cell has critically short and/or damaged and/or dysfunctional telomeres.
  • DDRNAs small RNAs
  • said small RNAs being generated in cis by processing by DICER and/or DROSHA of a RNA transcript synthesized following DNA damage in at least one sequence-specific genomic locus in a cell, wherein the DNA damage occurs at telomeres and/or is caused by a sequence-specific DNA endonuclease, wherein said RNA transcript is synthesized using the specific damaged genomic locus as template for transcription, wherein said inhibitor is a sequence-specific inhibitory oligonucleotide that specifically binds to said small RNAs (DDRNAs), for use as a medicament.
  • DDRNAs small RNAs
  • the inhibitor is for use for the treatment of a condition induced by the sequence-specific damaged genomic locus, preferably the condition is cancer and/or aging and/or a viral infection, preferably aging is associated with critically short and/or damaged and/or dysfunctional telomeres.
  • the inhibitor for use is a LNA molecule, a 2'-O-Methyl-modified oligonucleotide or a phosphorothioate-modified oligonucleotide.
  • the oligonucleotide inhibits the DNA damage response in the cell at the damaged sequence-specific genomic locus.
  • the inhibitor sensitizes the cell to the effect of a DNA-damaging treatment, said use further comprising the step of exposing said cell to an effective amount of the DNA-damaging treatment.
  • It is a further object of the invention a method to detect the presence of damage to DNA in a sequence-specific genomic locus in a cell comprising the steps of:
  • It is a further object of the invention a method to identify the genomic location of a damage to DNA in a sequence-specific genomic locus in a cell comprising the steps of:
  • It is a further object of the invention a method to quantify the DNA damage in a specific genomic locus in a cell or an in vitro method for the diagnosis and/or prognosis of a condition associated with and/or induced by the generation of DNA damage in at least one sequence specific genomic locus or an in vitro method for monitoring the efficacy of therapy directed to a condition associated with and/or induced by the generation of DNA damage in at least one sequence specific genomic locus in a subject comprising the steps of:
  • condition associated with and/or induced by the generation of DNA damage in at least one sequence specific genomic locus is selected from the group consisting of: cancer, aging, viral infection, preferably aging is associated with critically short and/or damaged and/or dysfunctional telomeres.
  • It is a further object of the invention a method of screening for an agent able to inhibit small RNAs (DDRNAs), said small RNAs being generated in cis by processing by DICER and/or DROSHA of a RNA transcript synthesized using the specific damaged genomic locus as template for transcription in a cell comprising the step of measuring the amount of a sequence comprising said small RNAs upon exposure of the cell to said agent, and comparing to a proper control.
  • DDRNAs small RNAs
  • the cell is a mammalian cell.
  • a human cell Preferably a human cell.
  • the pharmaceutical composition comprises carriers, diluents and/or excipients.
  • the composition may be administered by parenteral, oral, intravenous, intranasal, intramuscular route or any suitable route.
  • the pharmaceutical composition mya be administered in any effective amount to elicit the desired therapeutic effect.
  • the composition may be in any forms: solution, tablet, ointment etc.
  • DDRNAs are small RNAs, with the potential to form double-stranded pairs, that are generated by processing by DICER and/or DROSHA of a sequence specific RNA transcript synthesized upon transcription of a damaged DNA locus.
  • DDRNAs are small RNAs of a length between 10 and 50 nucleotides. For example of a length between 17 and 32 nucleotides. For example of a length between 20 and 25 nucleotides. For example of a length between 22 and 23 nucleotides.
  • Said DDRNAs function by favoring the sequence-specific accumulation of DDR factors at specific sites of DNA damage and promote DDR signaling (i.e. comprising but not limiting to protein phosphorylation events).
  • a critically short telomere is a telomere able to engage the DDR machinery due to its critical short length.
  • a damaged telomere is a telomere carrying a DNA lesion able to engage the DDR machinery.
  • a dysfunctional telomere is a telomere that due to its altered protein and/or nucleic acid structure engages the DDR machinery
  • an oncogenic stress may be a genotoxic stress (i.e. comprising but not limiting to DNA lesions, impaired DNA replication forks progression) due to oncogene activation, amplification, gain of function mutation, increased levels and activity.
  • a cell carrying a DNA damage is a cell whose DNA damage is not exogenously induced (i.e. a cell comprising but not limiting to critically short telomere and damaged telomere, oncogenic stress, oxidative DNA damage).
  • Aging is associated with telomeric DNA damage and DDR activation 2, 84 .
  • Genotoxic treatments commonly used in cancer therapy are treatments associated with the generation of DNA damage (i.e. comprising but not limiting to radiotherapy and chemotherapy).
  • a radiotherapy is a therapy based on the exposure to ionizing radiation.
  • An effective dose of ionizing radiation is a dose of ionizing radiation able to generate the desired outcome.
  • the skilled person in the art using common routine techniques knows how to determine such dose.
  • a senescent cell is a cell retaining persistent DDR activation (usually following oncogenic stress and/or telomere shortening/DNA damage).
  • DDRNAs short RNAs
  • control cell may be a non-damaged cell or a healthy cell.
  • the analysis may be carried out by quantitative Reverse Transcriptase-PCR, northern blot hybridization, next generation sequencing (Illumina etc), ion torrent technology or by any other means available, appropriated and known to the skilled person in the art. It may be performed on a cell or the blood or other biological fluids. It can also be performed in tissue lysates.
  • DDRNAs short RNAs
  • control may be a non-damaged cell or a healthy cell.
  • the analysis may be carried out by qRT-PCR, northern blot hybridization, next generation sequencing (Illumina etc), ion torrent technology or by any other means available, appropriated and known to the skilled person in the art. It may be performed on a cell or the blood or other biological fluids. It can also be performed in tissue lysates.
  • an inhibitor of DICER and/or DROSHA is able to have at least one of the above activities.
  • “inhibiting small RNAs, said small RNAs being generated by processing by DICER and/or DROSHA of a RNA transcript synthesized upon transcription of the damaged genomic locus” means: preventing DDRNAs functions and/or impairing DDRNAs production by the use of a sequence specific inhibitory oligonucleotide able to avidly and specifically bind to DDRNAs.
  • oligonucleotides comprise but are not limiting to locked nucleic acids (LNA), phosphorothioate modified oligonucleotides, 2'-O-methoxyethyl modified oligonucleotides, 2' O-Methyl modified oligonucleotides, methylphosphonates, morpholino oligonucleotides, LNA-DNA-LNA gapmer oligonucleotides, Chimeric 2'-O-methyl RNA-DNA gapmer, N3'-P5' Phosphoroamidate, 2'-fluoro-arabino nucleic acid, Phosphoroamidate Morpholino, Cyclohexene nucleic acid, Tricyclo-DNA, Peptide nucleic acid, Unlocked nucleic acid, Hexitol nucleic acid, Boranophosphate oligonucleotides, Phosphoroamidate oligonucleotides and/or oligonucleot
  • a DICER and/or DROSHA inhibitor is an agent or molecule able to display at least one DICER and/or DROSHA inhibiting function as described above (inhibiting the enzymatic activity of DICER and/or DROSHA, inhibiting the synthesis of DICER and/or DROSHA, destabilizing the proteins DICER and/or DROSHA, inhibiting DICER and/or DROSHA activity by the expression of DICER and/or DROSHA alleles with dominant negative functions and/or; targeting the genomic loci responsible for DICER and/or DROSHA synthesis).
  • An inhibitor of DDRNAs is an agent or molecule able to display at least one DICER and/or DROSHA inhibiting function as described above (preventing their synthesis, preventing their proper localization in the cell to prevent their processing and/or functions, preventing their accumulation, preventing their functions, preventing them to act as they would and/or preventing any modification of DDRNAs).
  • DICER and/or DROSHA inhibiting function as described above (preventing their synthesis, preventing their proper localization in the cell to prevent their processing and/or functions, preventing their accumulation, preventing their functions, preventing them to act as they would and/or preventing any modification of DDRNAs).
  • RKO, HCT116 and DLD1 colon cancer cell lines 25 were cultured in Mc'Coy 5A medium +10% fetal calf serum, 1% penicillin/streptomycin.
  • NIH2/4 35 where grown in DMEM, supplemented with 10% fetal bovine serum, 1% glutamine, gentamicine (40 ⁇ g/ml), and hygromycin (400 ⁇ g/ml).
  • H-RasV12 overexpressing senescent BJ cells were generated as in 20 .
  • BrdU incorporation assays were carried at least a week after cultures had fully entered the senescent state, as determined by ceased proliferation, DDR activation, SAHF formation, and senescence-associated ⁇ -galactosidase expression.
  • Ionizing radiation (IR) was induced by a high-voltage X-rays generator tube (Faxitron X-Ray Corporation). In general, cultured cells were exposed to 2 Grays for the foci formation assay. The authors used 5 Grays for the G2/M checkpoint assays and 10 Grays for the G1/S checkpoint assays.
  • Cherry-Lac and I-Sce I-restriction endonuclease expressing vector were transfected by lipofectamine 2000 (Invitrogen) in a ratio of 3:1. 16h post transfection around 70% of the cells were scored positive for DDR markers at the Lac array.
  • Dicer and Drosha knocked-down NIH2/4 cells were infected with Lentiviral particles carrying pLKO.1, shDicer or shDrosha vectors. After 48 hours cells were superinfected with Adeno Empty Vector or Adeno I-Sce I [ Anglana et al. Nucl Ac Res 1999 ]. Nuclei were isolated the day after the adenoviral infection.
  • ER-I-PpoI endonucleases Transient expression of ER-I-PpoI endonucleases in HeLa cells was carried out by Lipofectamine 2000 transfection and 16 hours later tamoxifen (0.1 ⁇ M) was added to culture medium to induce the activation of the endonuclease. 4 hours later cells were fixed for immunostaining or used for RNA extraction. Cherry-Lac transfected (mock) cells were used as control in these experiments.
  • NIH2/4 cells where grown in DMEM, supplemented with 10% fetal bovine serum, 1% glutamine, gentamicine (40mg/ml), and hygromycin (400mg/ml).
  • Cherry-Lac and I-Sce I-restriction endonuclease expressing vectors were transfected with Lipofectamine 2000 (Invitrogen) with a 3:1 ratio.
  • LNA were first boiled at 90°C for 5 minutes and quickly chilled at 4°C for 5 minutes and then added in different combinations to the Cherry-Lac and I-Sce I transfection mix, at the final concentration of 200pM. 24h post transfection cells were scored for DDR markers at the Lac array.
  • T19 fibrosarcoma cells (van Steensel, Cell 1998) were grown in DMEM supplemented with 10% fetal bovine serum, 1% glutamine and doxycycline (100 ng/ml). For induction, cells were grown without doxycycline for at least 7-8 days.
  • CRE-ER TRF2 flox/flox MEFs (Lazzerini Denchi and de Lange, Nature 2007) were grown in DMEM supplemented with 10% fetal bovine serum and 1% glutamine.
  • cells were grown in presence of 4-hydroxytamoxifen (600 nM) for 48 hours.
  • BrdU incorporation cells were labeled with 10 ⁇ g/ml bromodeoxyuridine (BrdU, Sigma) for 16 hours and incorporation was evaluated by immunofluorescence after DNA denaturation.
  • Antibodies Mouse anti-yH2AX, anti-H3K9me3, rabbit polyclonal anti-PH3 (Upstate Biotechnology); anti-pS/TQ (Cell Signaling Technology); anti-H2AX, anti-H3 and anti DICER (13D6) (Abcam); rabbit polyclonal anti-53BP1 (Novus Biological) and mouse monoclonal anti-53BP1 (a gift from Thanos Halazonetis); anti-MRE11 (a gift from S.
  • Comparative immunofluorescence analyses were performed in parallel with identical acquisition parameters; at least 100 cells were screened for each antigen. Cells with more than 2 DDR foci were scored positive. Foci intensity quantifications were performed using Cell Profiler software 2.0. Confocal sections were obtained with a Leica TCS SP2 AOBS confocal laser microscope by sequential scanning.
  • Immunofluorescence for the experiments in Figs. 35-36 .
  • Cells were fixed with 1:1 methanol/acetone solution for 2 minutes at room temperature, or 4% paraformaldehyde for 10 minutes at room temperature. After blocking, cells were stained with primary antibodies for 1h at room temperature, washed and incubated with conjugated secondary antibodies for 40 minutes at RT. Nuclei were stained with DAPI (1 ⁇ g/ml).
  • Flag-DICER, Flag-DICER44ab and Flag-DICERl 10ab were a kind gift of R. Shiekhattar.
  • pLKO.1 shDICER expressing vector was a kind gift of WC. Hahn.
  • Short hairpin sequence for DICER is: CCG GCC ACA CAT CTT CAA GAC TTA ACT CGA GTT AAG TCT TGA AGA TGT GTG GTT TTT G (SEQ ID NO:1).
  • pRETROSUPER shp53 as in 20 Short hairpin sequence for p53 was: AGT AGA TTA CCA CTG GAG TCT T (SEQ ID NO:2).
  • siRNA The DHARMACON siGENOME SMARTpool siRNA oligonucleotide sequences for human 53BP1, ATM, DICER, DROSHA were:
  • the DHARMACON siGENOME si RNA sequences for Human TNRC6A, B and C were:
  • siRNAs were transfected by Oligofectamine (Invitrogen) at a final concentration of 200 nM in OIS cells and 100nM in HNF.
  • Oligofectamine Invitrogen
  • RNA samples were isolated from cells using TRIzol (Invitrogen) or RNAeasy kit (Qiagen) according to the manufacturer's instructions, and treated with DNAse before reverse transcription. For microRNA isolation the authors used mir VanaTM miRNA Isolation Kit (Ambion). cDNA was generated using the Superscript II Reverse Transcriptase (Invitrogen). cDNA was used as template in TaqMan® Gene Expression Assays (Applied Biosystems) for the evaluation of DICER (Assay ID: Hs00998580_m1) and DROSHA (Assay ID: Hs01095030_m1) mRNA levels.
  • TaqMan® MicroRNA Assays were used for the evaluation of mature miR-21 and rnu44 and rnu19 expression levels (Assay ID: 000397, 001094 and 001003). 18S or ⁇ -actin was used as a control gene for normalization. miR21 and rnu44 enrichment in the small RNA-enriched fraction was evaluated as the ratio between PCR cycles (ct) for miR-21 or rnu44 and for ⁇ -actin mRNA after normalization to the same ratio in total RNA fraction.
  • Primer sequences for real-time quantitative PCR were:
  • NIH2/4 cells were incubated at this point also with 100 ⁇ M mirin (SIGMA) or DMSO for 15 minutes. Then, RNase A-treated cells were incubated with total, small or gel extracted RNA, or the same amount of tRNA, for additional 15 minutes at room temperature. If using mirin, NIH2/4 cells were incubated with total RNA in the presence of 100 ⁇ M mirin or DMSO for 25 minutes at room temperature. Cell were then fixed with 4% paraformaldehyde or methanol:acetone 1:1.
  • RNA oligonucleotides In complementation experiments with synthetic RNA oligonucleotides, eight RNA oligonucleotides with the potential to form four pairs were chosen among the sequences obtained by deep sequencing that map at the integrated locus in NIH2/4 cells.
  • Synthetic RNA oligonucleotides were generated by SIGMA with a monophosphate modification at the 5' end. Sequences map to different regions of the integrated locus: two pairs map to a unique sequence flanking the I-Sce I restriction site (Oligo 1+Oligo 2 and Oligos 3+ Oligo 4), one to the Lac-operator (Oligo 5 + Oligo 6) and one to the Tet-repressor repetitive sequences (Oligo 7 +Oligo 8). Two paired RNA oligonucleotides with the sequences of GFP were used as negative control (Oligo GFP 1+ Oligo GFP 2). Sequences are reported below.
  • RNAs were resuspended in 60mM KCl, 6mM HEPES-pH 7.5, 0.2mM MgCl2, at the stock concentration of 12.5 ⁇ M, denatured at 95°C for 5 minutes and annealed for 10minutes at room temperature.
  • DICER RNA products were generated as follows. A 550 bp DNA fragment carrying the central portion of the genomic locus studied (three Lac repeats, the I-Sce I site and two Tet repeats) was flanked by T7 promoters at both ends and was used as a template for in vitro transcription with the TurboScript T7 transcription kit (AMSBIO). The 500nt long RNA obtained was purified and incubated with human recombinant DICER enzyme (AMSBIO) to generate 22-23nt RNAs. RNA products were purified, quantified and checked on a polyacrylamide or an agarose gel. As a control, the same procedure was followed with a 700bp construct containing the RFP DNA sequence. Equal amounts of DICER products generated in this way were used in complementation experiment in NIH2/4 cells following RNase treatment.
  • AMSBIO TurboScript T7 transcription kit
  • RNaseA treatment for the experiments in Figs. 35 ).
  • CRE-ER TRF2 flox/flox MEFs Lazzerini Denchi and de Lange, Nature 2007 ) were induced to generate TRF2 knockout and telomere uncapping.
  • 48 hours later cells were permeabilized with 0.6% Tween 20 in PBS for 15 min at room temperature.
  • RNase A treatment was carried out in 1ml of 1 mg/ml ribonuclease A from bovine pancreas (Sigma-Aldrich catalogue no. R5503) in PBS for 30 minutes at room temperature.
  • LNA Transfection for the experiments in Fig. 36 .
  • LNA were first boiled at 90°C for 5 minutes, chilled at 4°C for 5 minutes and transfected with Lipofectamine RNAiMAX (Invitrogen) at the final concentration of 200 nM.
  • Lipofectamine RNAiMAX Invitrogen
  • RNA preparation Total RNA was isolated from cells using TRIzol (Invitrogen) according to the manufacturer's instructions. To generate small RNA-enriched fraction and small RNA-devoid fraction the authors used mir VanaTM microRNA Isolation Kit (Ambion) according to the manufacturer's instructions.
  • the mir Vana microRNA isolation kit employs an organic extraction followed by immobilization of RNA on glass-fiber (silica-fibers) filters to purify either total RNA, or RNA enriched for small species. For total RNA extraction ethanol is added to samples, and they are passed through a Filter Cartridge containing a glass-fiber filter, which immobilizes the RNA.
  • RNA is eluted with a low ionic-strength solution.
  • ethanol is added to bring the samples to 25% ethanol.
  • this lysate/ethanol mixture is passed through a glass-fiber filter, large RNAs are immobilized, and the small RNA species are collected in the filtrate.
  • the ethanol concentration of the filtrate is then increased to 55%, and it is passed through a second glass-fiber filter where the small RNAs become immobilized.
  • This RNA is washed a few times, and eluted in a low ionic strength solution.
  • an RNA fraction highly enriched in RNA species ⁇ 200 nt can be obtained 25,66 .
  • RNA extraction from gel Total RNA samples were heat-denatured, loaded and resolved on a 15% denaturing acrylamide gel [1X TBE, 7 M urea, 15% acrylamide (29:1 acryl:bis-acryl)]. Gel was run for 1 hour at 180 V and stained in GelRed solution. Gel slices were excised according to the molecular weight marker, moved to a 2 ml clean tube, smashed and RNA was eluted in 2 ml of ammonium acetate 0.5 M, EDTA 0.1 M in RNase-free water, rocking overnight at 4°C. Tubes were then centrifuged 5 minutes at top speed, the acqueous phase was recovered and RNA was precipitated and resuspended in RNase free water.
  • HEK 293 calcium phosphate transfected cells were irradiated with 5 Gy and allowed to respond to IR-induced DNA damage in a cell culture incubator for 12, 24 or 36 hours. Then, at these three time points post irradiation, together with not irradiated cells, 1X10 6 cells were collected for Fluorescence Activated Cell Sorting (FACS) analysis, fixed in 75% ethanol in PBS, 30 minutes on ice. Afterwards, cells were treated 12 hours with 40 ⁇ g/ml of RNase A and incubated at least 1h with propidium iodide (PI). FACS profiles were obtained by the analysis of at least 5X10 5 cells. In the complementation experiments HEK 293 were transfected using Lipofectamine RNAi Max (Invitrogen) and 48 hours later irradiated with 5 Gy. Cells were then treated as explained above.
  • FACS Fluorescence Activated Cell Sorting
  • zebrafish immunoblotting protein analysis 72 hours post fertilization (hpf) larvae were deyolked in Krebs Ringer's solution containing ImM EDTA, 3mM PMSF and proteases inhibitor (Roche complete protease inhibitor cocktail). Embryos were then homogenized in SDS sample buffer containing ImM EDTA with a pestle, boiled 5 min and centrifuged 13000 rpm for 1 min.
  • Protein concentration was measured with the BCA method (Pierce) and proteins (50 ⁇ g-900 ⁇ g) were loaded in an SDS-12% (for yH2AX and H3) and SDS-6% polyacrylamide gel (for pATM and ATM), transferred to a nitrocellulose membrane, and incubated with anti-yH2AX (1:2000, a gift from J. Amatruda 67 ), H3 (1:10000, Abcam), pATM (1:1000, Rockland), ATM (1:1000, Sigma). Immunoreactive bands were detected with horseradish peroxidase-conjugated anti-rabbit or anti-mouse IgG and an ECL detection kit (Pierce, Springfield, IL, USA). Protein loading was normalized to equal amounts of total ATM and H3.
  • oligonucleotides carrying the binding sites for miR126 used for construction of pCS2:RFPmiR126 sensor are:
  • RNA encoding for RFPmiR126 sensor was injected alone or in combination with Dicer1 morpholino at a concentration of 10 pg/nl.
  • Dicer morpholino was injected at a concentration of 5 ng/nl, and a volume of 2 nl/embryo.
  • the authors injected donor embryos with a mixture of dicer1 morpholino and mRNA encoding for GFP (5 pg/nl). Approximately 20 cells were transplanted from donor embryos at dome (5 hpf) stage to uninjected host at the same stage.
  • RNA sequencing Nuclear RNA shorter than 200 nt was purified using mir VanaTM microRNA Isolation Kit. RNA quality was checked on a small RNA chip (Agilent) before library preparation (Supplementary Figure 23 a) .
  • spike RNA was added to each RNA sample in the RNA : spike ratio of 10,000 :1 before library preparation and libraries for Illumina GA IIX were prepared without spike.
  • An improved short RNA library preparation protocol was used to prepare libraries 68 .
  • adenylated 3' adapters were ligated to 3' ends of 3'-OH short RNAs using a truncated RNA ligase enzyme followed by 5' adapter ligation to 5'-monophosphate ends using RNA ligase enzyme, ensuring specific ligation of undegraded short RNAs.
  • cDNA was prepared using a primer specific to the 3'adapter in the presence of Dimer eliminator and amplified for 12-15 PCR cycles using a special forward primer targeting the 5' adapter containing additional sequence for sequencing and a reverse primer targeting the 3' adapter.
  • the amplified cDNA library was run on a 6% polyacrylamide gel and the 100 bp band containing cDNAs up to 33 nt was extracted using standard extraction protocols. Libraries were sequenced after quality check on a DNA high sensitivity chip (Agilent). Multiplexed barcode sequencing was performed on Illumina GA-IIX (35 bp Single end reads) and Illumina Hi seq version3 (51 bp single end reads). Sequences of all the DDRNAs identified in this study will be available for free downloading by the time of publication at short read archive.
  • Results are shown as means plus/minus standard error (s.e.m.). p-value was calculated by Chi-squared test. QRT-PCR results are shown as means of a triplicate plus/minus standard deviation (s.d.) and p-value was calculated by Student's t-test as indicated. * indicates p-value ⁇ 0.05.
  • the differences in the fraction of 22-23 nt vs total short RNAs at the locus between the wildtype, Dicer knockdown, and Drosha knockdown before and after cut was calculated by fitting a negative binomial model to the sRNA count data and performing a likelihood ratio test, keeping the fraction of 22-23 nt vs total short RNAs at the locus fixed across conditions under the null hypothesis and allowing it to vary between conditions under the alternative hypothesis.
  • Oncogene-induced senescence is a non-proliferative state characterized by a sustained DDR 20,21 (caused by high level of endogenous DNA damage) and senescence-associated heterochromatic foci (SAHF) 22 . Since the RNAi-machinery has been involved in heterochromatin formation 23 , the authors investigated whether the inactivation of components of the RNAi machinery could have an impact on escape from senescence induced in human fibroblasts by transduction of H-RasV12 (referred here as OIS cells).
  • DICER or DROSHA knockdown as well as ATM knockdown used as positive control for escape from senescence 20 ( Figure S1 a)
  • Figure 7b DICER or DROSHA knockdown, as well as ATM knockdown used as positive control for escape from senescence 20
  • Figure 7c-e re-expression of markers of chromosomal DNA replication
  • Figure 7f-g entry into mitosis
  • DDR plays a crucial role in the maintenance of the proliferative arrest in OIS cells 20,21 .
  • the authors stained cells for markers of active DDR such as the autophosphorylated form of ATM (pATM), phosphorylated substrates of ATM and ATR (pS/TQ), 53BP1 and yH2AX.
  • pATM autophosphorylated form of ATM
  • pS/TQ phosphorylated substrates of ATM and ATR
  • 53BP1 and yH2AX phosphorylated substrates of ATM and yH2AX.
  • the authors observed that DICER or DROSHA inactivation significantly reduces the number of 53BP1, pATM and pS/TQ foci positive cells ( Figures 1a, b and 9a ) even though 53BP1, ATM or H2AX protein levels are not reduced ( Figure 9c ).
  • DICER or DROSHA inactivation impairs ionizing radiation-induced DDR foci formation.
  • DICER and DROSHA in DDR activation are specific for the senescence condition or whether DICER or DROSHA inactivation has also an impact on ionizing radiation (IR)-induced DDR activation in proliferating non-senescent cells. Therefore, the authors transiently inactivated DICER or DROSHA by a pool of siRNA in human normal fibroblasts (HNF - WI38; Figure 12a and b), exposed them to IR and a few hours later the authors stained them for markers of activated DDR.
  • HNF - WI38 human normal fibroblasts
  • DICER exon5 a colon cancer cell line carrying a homozygotic genetic deletion of exon 5 in DICER gene and therefore expressing a hypomorphic allele of DICER ( DICER exon5 ); this cell line is defective in microRNAs maturation 25 .
  • DICER exon5 -hypomorphic cells the level of expression of ATM, MDC1, 53BP1 or H2AX proteins is not reduced ( Figure 16a ).
  • DNA damage elicits DDR signal transduction leading to checkpoint-dependent cell-cycle arrest at two critical transition steps: the G1/S checkpoint and the G2/M checkpoint 1 .
  • DICER exon5 -hypomorphic cells from two distinct cell lines (RKO and HCT116; Figure 2b and 20a , respectively), also show an impaired G1/S transition arrest.
  • the authors re-expressed wild-type DICER-cDNA in DICER exon5 -hypomorphic cells.
  • DICER cDNA expression restored the G1/S checkpoint in both DICER exon5 -hypomorphic cell lines ( Figure 2b and 20a ).
  • DICER irradiated empty-vector (EV) transfected cells progressively accumulate in the G2 phase of the cell cycle, as a consequence of the checkpoint enforcement.
  • DICER as well as p53 knocked-down cells, did not arrest upon DNA damage and passed through the G2/M transition ( Figure 2 c and d ).
  • DDR foci are sensitive to RNase A and DICER and DROSHA RNA products allow DDR foci reformation.
  • RNA in DDR activation IR-exposed human cells (HeLa) were permeabilized by a mild detergent and treated with the broad-specificity RNA nuclease RNase A.
  • IR may induce different kinds of DNA lesions
  • RNA molecules involved in DDR focus reformation To gauge the length of the RNA molecules involved in DDR focus reformation, the authors enriched total HeLa RNA for short RNAs by chromatography ( ⁇ 200nt; Figure 25a ) and the authors used proportional volumes of total and short RNA to restore DDR foci in RNase A treated cells. The authors observed that the short RNAs-enriched fraction was sufficient to restore pATM, pS/TQ and 53BP1 foci indicating that this fraction contains the active RNA molecules ( Figure 25b, c ). To attain better RNA size separation, the authors resolved total RNA on a polyacrylamide gel and recovered RNAs of different lengths: longer than 100nt, between 100nt and 35nt and between 35nt and 20nt ( Figure 4c and 26 ).
  • RNA components required for DDR foci assembly are short and in the size range of the RNA products generated by DICER and DROSHA.
  • DICER RNA products directly contribute to DDR foci formation. To do so, the authors extracted total RNA from wild-type and DICER exon5 -hypomorphic cells and the authors used these two RNA preparations to restore DDR foci in RNase A-treated irradiated cells. Total RNA preparations from the two cell lines are expected to have the same composition apart from the population of DICER RNA products 25 .
  • RNA extracted from wild-type cells does restore pATM, pS/TQ or 53BP1 foci
  • RNA extracted from DICER exon5 hypomorphic cells does not ( Figure 4d, e ).
  • RNA from DICER exon5 hypomorphic cells transfected with a vector expressing wild-type but not mutant DICER allows DDR foci reformation ( Figure 27 ).
  • RNA purified from DROSHA-inactivated cells is unable to restore DDR foci
  • the authors knocked-down DROSHA, and GFP as control, by siRNA in HeLa cells, purified RNA and used these RNA preparations to attempt to restore DDR foci.
  • DDR focus formation at a defined damaged genomic site requires damage site-specific RNAs.
  • Ionizing radiations induce the formation of DNA lesions that are heterogeneous in nature and random in their location.
  • the authors studied a single DSB at a unique, defined and traceable genomic locus. The authors therefore took advantage of NIH2/4 mouse cells carrying an integrated copy of the I-Sce I restriction site flanked by an array of Lac-repressor (Lac) binding sites and Tet repeats 35 .
  • the expression of the I-Sce I restriction enzyme together with the fluorescent protein Cherry-Lac-repressor (Cherry-Lac) allows the visualization in the nucleus of the site-specific DSB generated by the nuclease.
  • RNA was added to the RNase A-treated samples NIH2/4 cells re-acquired a bright 53BP1 focus co-localizing with the Cherry-Lac-repressor in a manner dependent on the RNA amount used ( Figure 5a and b ). Therefore, the very same DDR focus generated on a defined DSB can disassemble and reassemble in a manner dependent on RNA.
  • RNA extracted from either cell lines to attempt to restore 53BP1 focus formation in RNase A-treated NIH2/4 cells that had experienced the I-Sce I-induced DSB: the two RNA preparations are expected to differ only in the potential presence of RNA transcripts generated from the exogenous integrated construct carrying the Lac and Tet repeats and the I-Sce I site.
  • MRE11/RAD50/NBS1 (MRN) complex is a key DNA damage sensor and a necessary cofactor of the apical DDR regulator ATM 1 .
  • MRE11 focus formation upon I-Sce I induction is sensitive to RNase A-treatment ( Figure 29a ).
  • mirin a specific small molecule inhibitor of MRN 36 which, as expected, prevents ATM activation also following I-Sce I induction ( Figure 29b ).
  • the authors therefore tested whether RNAs involved in DDR modulation engage MRN.
  • the authors observed that in the presence of mirin, NIH2/4 RNA is unable to induce 53BP1 or pATM focus reformation ( Figure 5d and e). This result demonstrates that RNAs at sites of DNA damage modulate DDR in a MRN-dependent manner.
  • RNAs originating from the integrated locus To detect potential short RNAs originating from the integrated locus, the authors isolated nuclear RNA from parental NIH 3T3 cells transfected with the I-Sce I (mock), NIH 2/4 cells transfected with Cherry-Lac-repressor (uncut) and from NIH 2/4 cells transfected with the I-Sce I (cut) and further selected them for length ( ⁇ 200 nt) - this procedure enriches for RNAs active in DDR foci reformation 40 folds (data not shown). Libraries prepared from these samples were sequenced by Illumina GAII-X to obtain 15-32bp cDNA reads ( Figure 30a-d ).
  • RNAs are biologically active both when added to the cells together with total RNA from parental cells (cells not carrying the integrated endogenous locus; Figure 6a ) or with yeast tRNA ( Figure 30f ), thus in the absence of any additional mammalian RNA.
  • RNAs generated at the locus were performed deeper sequencing experiments of nuclear RNAs ⁇ 200 nt from wildtype NIH 2/4 samples before and after cut using the Illumina Hi seq Version3 ( Figure 31 ). To study the biogenesis of these RNAs, the authors also sequenced ⁇ 200 nt nuclear RNAs from NIH 2/4 cells following Dicer or Drosha knockdown (WT uncut, Dicer KD uncut, Drosha KD uncut, WT cut, Dicer KD cut, Drosha KD cut) ( Figure 32a ). To ease normalization, each RNA preparation was spiked with a short RNA "spike" before library preparation.
  • the authors compared the fraction of 22-23 nt vs total RNAs at the locus to the same fraction at non-miRNA genomic loci - at such loci, any 22-23 nt RNAs are most likely products of random degradation or Dicer/Drosha independent enzymatic processing.
  • RNAs are the bulk of the RNA species detected at the locus, they depend on Dicer and, to an extent, on Drosha, and their proportion increases upon DNA damage. Their unlikelihood to be random degradation products is further indicated by their differential abundance compared to the rest of non-miRNA loci and the observed 5' and 3' base bias.
  • LNAs Sequence-specific inhibitory oligonuncleotides
  • DDRNAs identified by deep sequencing are biologically active and have a causative role in sequence-specific DDR focus reformation at the damaged site, following removal of all cellular RNAs by RNaseA treatment ( Fig. 6a ; Fig. 30f ).
  • LNA Locked Nucleic Acids
  • Cells carrying the integrated locus were co-transfected with Cherry-Lac and I-Sce I-restriction endonuclease-expressing vectors and with either no LNA (sample 1), control LNA carrying an unrelated sequence which is not part of the locus (sample 2) or different sets of LNA (samples 3-7) ( Fig. 34b ). 24 hours post transfection, cells were fixed and stained for DDR markers. The authors analyzed the samples at the confocal microscope and scored as positive those cells that showed a DDR signal at the locus. As shown in Figure 34b , the portion of cells showing a specific yH2AX focus co-localizing with the Cherry-Lac signal was not significantly affected by the transfection of any LNA.
  • Sequence-specific inhibitory oligonucleotides i.e. LNAs
  • a telomeric sequence reduce DDR activation at dysfunctional telomeres.
  • DDRNAs short RNAs with the sequence of a damaged locus
  • Figs. 4 , 5 RNAs with the sequence of a damaged locus
  • Figs. 4 , 5 RNAs with the sequence of a damaged locus
  • Figs. 4 , 5 RNAs with the sequence of a damaged locus
  • TRF2 flox/flox mouse embryonic fibroblasts (MEFs) ( Lazzerini Denchi and de Lange, Nature 2007 ). Cells were grown in presence of 4-hydroxytamoxifen to induce cre recombinase localization into the nucleus, thus generating a TRF2-knockout (TRF2 -/- ) cell line. TRF2 is one of the shelterin component and its removal induces a strong DDR activation at telomeres ( Lazzerini Denchi and de Lange, Nature 2007 ).
  • DDRNAs with telomeric sequence are generated and they are necessary for DDR cascade activation.
  • telomeres can accumulate damaged telomeres during ageing, due to telomeric shortening ( Harley, Nature 1990 ; Herbig, Mol Cell 2004 ; d'Adda di Fagagna, Nature 2003 ) or to endogenous or exogenous DNA damage occurred at telomeres. DNA damage accumulate and DDR signaling persists at telomeres as they are not repairable ( Fumagalli, Nat Cell Biol 2012 ). In both cases this persistent DDR activation at telomeres leads to cellular senescence. If DDRNAs are necessary for DDR at damaged telomeres, inhibiting their action could suppress DDR activation and potentially prevent or revert the senescence phenotype.
  • T19 fibrosarcoma cells that express an inducible dominant negative (DN) allele of flag-tagged TRF2 ( van Steensel, Cell 1998 ).
  • DN inducible dominant negative
  • telomeres are dysfunctional and cells show a strong DDR activation at telomeres (data not shown and van Steensel, Cell 1998 ).
  • Induced cells, in which Flag-DN TRF2 was expressed, are positive for Flag immunostaining (Flag +).
  • DDRNAs DDR-regulating RNAs
  • Oncogene activation can trigger DDR and DDR-induced cellular senescence acts as tumor suppressive mechanism 2,37 .
  • DICER inactivation enhances tumor development in a K-Ras-induced mouse model of lung cancer 38,39 and inactivation of various components of DICER and DROSHA complexes stimulate cell transformation and tumorigenesis 38 .
  • mutations of DICER and TARBP2 a DICER cofactor affecting its stability, have been described in human carcinomas 40,41 .
  • individual microRNAs have been reported both to promote and to reduce cell proliferation by regulating stability and translation of mRNAs encoding proteins with different roles in cell proliferation 18 : it is therefore presently unclear how RNAi apparatus inactivation favors tumorigenesis.
  • RNA sequencing confirmed the presence of short RNAs arising from the integrated exogenous locus which are induced upon cut. Comparison with short RNAs generated at other non miRNA genomic loci indicates that they are distinct from products of RNA degradation and their nucleotide bias at 5' end and 3' end indicates that these RNAs are processed at preferential RNA precursors sites.
  • RNA molecules in DDR display genetic interactions with the RNAi machinery 56 and components of the large DROSHA complex have been identified in a ATM-dependent phosphoproteome screen 57 .
  • Drosophila repeated DNA integrity is dependent on RNAi pathway 58 .
  • DICER is specifically cleaved by caspases during apoptosis 63 .
  • ATM has been shown to directly modulate the biogenesis of DICER and DROSHA RNA products by phosphorylating KSRP 64 .

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Plant Pathology (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Description

    TECHNICAL FIELD
  • The present invention relates to small RNAs (DDRNAs), inhibitors thereof, inhibitors of enzymes producing thereof, and their use to modulate the response of a cell to a DNA damaging event. The invention concerns also a method to detect the presence or quantify DNA damage.
  • BACKGROUND ART
  • The DNA damage response (DDR) is a coordinate set of events that promptly follows the generation of a lesion in the DNA double helix. Detection of DNA discontinuities by specialized factors initiates a signaling cascade that, stemming from the site of DNA damage, amplifies the signal and reaches the whole nuclear space and the entire cell1. DDR signaling cascade initiation establishes a local self-feeding loop that leads to focal accumulation of upstream DDR factors in the form of cytologically detectable DDR foci at damaged sites. Specifically, detection of a DNA double-strand break (DSB) triggers the activity of the protein kinase ATM that, among other factors, phosphorylates the histone variant H2AX (γH2AX) at the DNA damage site. This modification recruits DDR-mediators like MDC1 and 53BP1 that boost ATM activity. DDR activation can be triggered by exogenous DNA damaging agents such as ionizing radiations and chemotherapeutic agents (i.e. including but not limited to bleomycin) and by endogenous physiological events such as meiotic recombination, V(D)J recombination at the immunoglobulins and T cell receptor loci, telomere shortening and reactive oxygen species, as well as pathological events such as oncogene activation, viral integration in the genome, viral replication and bacterial infection 1,82. Telomeres dysfunction and oncogene activation can generate a sustained DDR leading to a permanent cell-cycle arrest known as cellular senescence2. Recently also bacteria have been shown to generate persistent DNA damage and cellular senescence in mammals 82. Several pathologies associated with altered telomere functions have been reported as "telomeropathies" 85.
  • It has recently been appreciated that mammalian genomes are pervasively transcribed and the vast majority of DNA sequences can be found in primary, often overlapping, transcripts most of which apparently not associated with coding functions 3. These non-coding RNAs (ncRNAs) may remain associated with chromatin, and some aggregate in subnuclear structures such as speckles and paraspeckles4. An unsuspected increasing number of these ncRNA transcripts have been shown to be evolutionarily conserved among related species5,6 and play a variety of relevant cellular functions by regulating the localization and the activity of proteins and/or providing structural support for cellular and sub-cellular structures 7 and controlling chromatin-modification 4,8 and enhancer-like functions9. These activities may be exerted despite estimated very low levels of expression, few molecules per cell, for some of these RNA molecules10,11,12,13. Some ncRNAs may be processed by ribonucleases of the RNA interference (RNAi) pathway, giving rise to short double-stranded RNA products that participate in various cellular functions. The RNAi pathway is a conserved machinery, whose components are thought to have evolved to preserve genome integrity from the attacks of viruses and mobile genetic elements 14. It involves different types of short double-stranded RNA molecules including small interfering RNAs (siRNAs), microRNAs, repeat-associated small interfering RNAs (rasiRNAs), Piwi-interacting RNAs (piRNAs)15 and QDE-2 interacting RNAs (qiRNA) in Neurospora crassa16. It is commonly thought that only microRNA maturation is dependent on both DROSHA and DICER endonucleases, two RNase type III enzymes that process hairpin structures to generate double-stranded microRNAs17. In mammals, microRNAs modulate gene expression usually by their ability to regulate mRNA translation and stability and have been involved in several processes such as cell fate determination, transformation, proliferation and cell death18. piRNAs and qiRNAs have been implicated in genome stability maintenance 16 and a family of microRNAs (miR-34) has been shown to act downstream of p5319. It is presently unknown whether any RNAs have any direct role in the control of DDR activation at sites of DNA damage.
  • US2006105384 is focused on a technique for detecting and diagnosing disease conditions, as well as health conditions due to exposure to environmental conditions by detecting and identifying DNA or RNA damage markers. This technique is based on measurement of free levels of nucleotide excision products resulting from DNA or RNA damage. The DDRNAs of the instant invention are not nucleotide excision products.
  • JP2009171895 concerns a method for analyzing the function of a non-coding RNA (ncRNA) existing in a nucleus by destroying the ncRNA by introducing an antisense oligo-molecule containing substantially the same sequence as a sequence complementary to a single-stranded region in the secondary structure of the target ncRNA to a cell nucleus and destroying the RNA molecule.
  • WO2012/013821 relates to the field of cancer, particularly cancers wherein p53 tumour suppression function is lost or impaired. It is shown herein that Dicer is a synthetic lethal partner of p53, allowing the selective targeting and killing of cancer cells. The effects of Dicer on survival on cancer cells are mediated through the miR17-92 cluster and inhibition of members of this miRNA cluster is an attractive treatment strategy in cancer. Most particularly, these findings are of importance in the field of retinoblastoma.
  • WO2011/157294 relates to compositions comprising an inhibitor of a polynucleotide, said polynucleotide to be inhibited being capable of decreasing or suppressing expression of Dicer or a biologically active derivative thereof for use in treating or preventing cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto. Furthermore, the present invention also relates to methods of treating or preventing cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto. DDRNAs are not mentioned nor the impact of Dicer modulation on DNA damage related events and DDR modulation.
  • WO2009/102225 relates to compositions and methods for cancer diagnosis, research and therapy, including but not limited to, cancer markers. In particular, the present invention relates to ncRNAs as diagnostic markers and clinical targets for prostate, lung, breast and pancreatic cancer.
  • US2012289581 relates to long non-coding RNAs (lncRNAs) and methods of using them diagnostically and therapeutically for treatment of cancer, stem cell therapy, or regenerative medicine are disclosed. In particular, the invention relates to IncRNAs that play roles in regulation of genes involved in cell proliferation, differentiation, and apoptosis. Such IncRNAs can be used as biomarkers to monitor cell proliferation and differentiation during cancer progression or tissue regeneration. One of the identified IncRNAs, referred to as PANDA (a P21-Associated NcRNA, DNA damage Activated), inhibits the expression of apoptotic genes normally activated by the transcription factor NF-YA. Inhibitors of PANDA sensitize cancerous cells to chemotherapy and can be used in combination with chemotherapeutic agents for treatment of cancer.
  • Limmer Ket al. (2013) used a Molecular Force Assay (MFA) to measure the activity of Dicer. As a model system, they used an RNA sequence that forms an aptamer-binding site for paromomycin, a 615-dalton aminoglycoside. They have shown that Dicer activity is modulated as a function of concentration and incubation time: the addition of paromomycin leads to a decrease of Dicer activity according to the amount of ligand. The measured dissociation constant of paromomycin to its aptamer was found to agree well with literature values. The parallel format of the MFA allows a large-scale search and analysis for ligands for any RNA sequence.
  • Wei et al, (2012) reports the existence in plants and in a human cancer cell line of small RNAs, named diRNAs, generated in proximity to DNA DSB sites81. The authors show that genetic inactivation of Dicer-like RNA endonucleases results in a specific defect in DNA repair by homologous recombination. Authors observe some correlation between diRNAs accumulation and DNA repair by homologous recombination, and propose that diRNAs control DNA repair. However there is no support by the data shown in the article by Wei et al. to such hypothesis. As a matter of fact there is no evidence that diRNA play a biologically active role in the process of DNA repair. Prior art data in Wei et al are not in contrast with diRNAs being generated following the degradation of a RNA transcript spanning the DSB site.
  • In addition, it is not demonstrated in the Wei et al article that the proposed effect of the inactivation of Dicer-like genes and DNA repair is not indirect, possibly mediated by canonical RNA interference mechanisms. Although the authors show that the abundance of few DNA repair factors is not affected, it is not demonstrated that other DNA repair factors, not tested by the authors, are unaffected and not targeted by RNA interference mechanisms and thus potentially making an indirect impact on DNA repair.
  • Finally, correlation is not always maintained and at least in plants the authors show cases in which diRNAs are decreased (Fig3a, mutants RDR2 and RDR6) and DNA repair is unaltered (Fig3b).
  • DDRNA of the instant invention have been characterized for distinct functions: DDRNAs control DDR signaling, whereas diRNA of Wei et al are not shown to have any role in DDR signaling: Wei et al show no evidence of altered DDR activation, as detected by nuclear DDR foci formation or of DDR proteins activation, for instance by phosphorylation, or of altered DNA damage checkpoint functions or modulation of cellular senescence. Thus there is no demonstrated overlap between their functions.
  • Bu et al (Oncology reports, 21:13-17, 2009 ) discloses the use of siRNA to knock down Dicer and increase the sensitivity of breast cancer cells to a DNA damaging agent.
  • Darzynkiewicz et al. (Eur. J. of Pharmacol., 625:143-150, 2009 ) discloses strategies to sensitize cancer cells to DNA-damage by targeting.
  • Francia et al. (Nature 488: 231-235, 2012 ) refers to site-specific DICEr and DROSHA RNA products that control the DNA-damage response.
  • In cultured Drososphila cells, Michalik et al.79, showed that the transfection of a linearized plasmid leads to the generation of short (21nt) RNAs with the sequence of the plasmid DNA ends. The small RNAs in this system are produced by active transcription of plasmid genes in the vicinity of the break. The function proposed for them was the repression of the marker gene encoded by the plasmid. Inactivation of some of the factors involved in the RNA interference pathway relieves the observed repression. Such effect has been interpreted as RNA interference activity of the short RNAs acting as endo-siRNAs. A causal relation between the production of short RNA and DDR activation or DNA repair is lacking in this study. This set of observation support the notion that small RNA are produced at DNA ends in cultured Drosophila cells, but it does not provide a function of this novel RNA molecule in the DNA damage response pathway.
  • SUMMARY OF THE INVENTION
  • DICER (Gene ID: 23405; Official Symbol: DICER1 Name: dicer 1, ribonuclease type III [Homo sapiens] Other Aliases: DCR1, Dicer, HERNA, KIAA0928, MNG1; Other Designations: Dicer1, Dcr-1 homolog; K12H4.8-LIKE; dicer 1, double-stranded RNA25 specific endoribonuclease; endoribonuclease Dicer; helicase MOI; helicase with RNAse motif; helicase-moi, Chromosome: 14; Location: 14q32.13, Annotation: Chromosome 14, NC_000014.8 (95552565..95623759, complement), MIM: 606241, NCBI version May 4, 2012) and DROSHA (Gene ID: 29102; Official Symbol: DROSHA Name: drosha, ribonuclease type III [Homo sapiens], Other Aliases: ETOHI2, HSA242976, RANSE3L, 30 RN3, RNASE3L, RNASEN; Other Designations: RNase III; drosha, double-stranded RNA-specific endoribonuclease; nuclear RNase III Drosha; p241; protein Drosha; putative protein p241 which interacts with transcription factor Sp1; putative ribonuclease III; ribonuclease 3; ribonuclease III, nuclear; ribonuclease type III, nuclear; Chromosome: 5; Location: 5p13.3, Annotation: Chromosome 5, NC_000005.9 (31400601..31532282, complement), MIM: 608828, NCBI version May 4, 2012) are crucial ribonucleases involved in RNA interference (RNAi). Components of RNAi are thought to have evolved to preserve genome stability from the attacks of viruses and mobile genetic elements. RNA products generated by DICER and DROSHA are involved in chromatin assembly in Schizosaccharomyces pombe, gene silencing and cancer. The DNA damage response (DDR) is a signaling pathway that arrests the proliferation of cells undergoing genotoxic events to preserve genome stability. So far, RNAi and DDR signaling pathways have not been demonstrated to directly interact. Here the authors show that oncogene-induced senescent cells, cells thus bearing oncogene-induced DNA damage and consequent DDR activation, require DICER and DROSHA to maintain DDR activation and cell-cycle arrest. DICER and DROSHA are also necessary to activate DDR upon exogenous DNA damage, and DDR checkpoint functions depend on the ribonuclease activity of DICER. DICER is required for irradiation-induced DDR activation in vivo in zebrafish. In an in vitro cellular system, DDR foci stability is sensitive to RNase A treatment, and DICER- and DROSHA-dependent small RNA products are required to restore DDR foci in RNase A-treated cells. Study of DDR activation at a DNA double-strand break within a unique and traceable exogenous integrated locus reveals that DDR focus formation requires locus-specific RNA molecules. The authors provide evidence through RNA sequencing that short or small RNAs, that the authors call DDRNAs, originate at the locus and carry the sequence of the damaged locus. When chemically synthesized or generated in vitro by DICER cleavage of transcripts spanning the locus, DDRNAs promote DDR activation at the DNA damage site in RNase A-treated cells also in the absence of other mammalian RNAs. All together, the authors' results reveal an unanticipated direct role of short or small RNAs (DDRNAs) in the control of DDR activation at sites of DNA damage.
  • DDRNAs act differently from microRNAs and canonical RNAi mechanisms because:
    • DDRNAs act without the need for any other cellular RNA (see the results obtained with gel-extracted RNA and synthetic RNAs in RNAse A-treated cells experiments).
    • DDRNAs can have a sequence (LAC or TET repeats) that has no endogenous cellular transcripts match and still be biological active
    • DDRNAs can act fast (in minutes) at room temperature in cells inhibited for transcription and translation (see the results obtained in RNAse A-treated cells experiments).
    • Inactivation of GW proteins (effectors of canonical miRNA) does not affect DDR foci.
  • It is therefore an object of the present invention an in vitro method to inhibit the DNA damage response in a mammalian cell damaged in at least one sequence-specific genomic locus, wherein the DNA damage occurs at telomeres and/or is caused by a sequence-specific DNA endonuclease, wherein the method comprises inhibiting the function and/or impairing the production of small RNAs (DDRNAs), said small RNAs being generated in cis by processing by DICER and/or DROSHA of a RNA transcript synthesized using the specific damaged genomic locus as template for transcription, wherein inhibiting the function of DDRNAs and/or impairing the production thereof is performed by a sequence-specific inhibitory oligonucleotide that specifically binds to said small RNAs (DDRNAs).
  • Preferably, the method further comprises the step of exposing said cell to a DNA damaging treatment. Preferably the DNA-damaging treatment belongs to the group of: radiotherapy, chemotherapy, for instance hydroxyurea treatment or bleomycin treatment, a treatment that impairs DNA repair, or any genotoxic treatment. Still preferably the radiotherapy is any ionizing radiation.
  • It is a further object of the invention an in vitro method for sensitizing a mammalian cell to DNA damage in at least one sequence-specific genomic locus, wherein the DNA damage occurs at telomeres and/or is caused by a sequence-specific DNA endonuclease, wherein the method comprises:
    1. a) inhibiting the function and/or impairing the production of small RNAs (DDRNAs), said small RNAs being generated in cis by processing by DICER and/or DROSHA of a RNA transcript synthesized using the specific damaged genomic locus as template for transcription, wherein inhibiting the function of DDRNAs and/or impairing the production thereof is performed by a sequence-specific inhibitory oligonucleotide that specifically binds to said small RNAs (DDRNAs);
    2. b) exposing said cell to an effective amount of the DNA-damaging treatment,
    wherein step a) and step b) are performed in any order.
  • Preferably the DNA-damaging treatment is a radiotherapy.
  • In a preferred embodiment the mammalian cell is damaged by a genotoxic event, preferably the genotoxic event belongs to the group of: cellular transformation, cellular senescence, oncogene activation, DNA replication stress, reactive oxygen species, ionizing radiation, chemotherapeutic agents, for instance bleomycin, or telomere shortening, damaged telomere, dysfunctional telomere, viral integration in the genome, viral infection or bacterial infection.
  • Preferably the sequence-specific inhibitor oligonucleotide is a LNA molecule, a 2'-O-Methyl-modified oligonucleotide or a phosphorothioate-modified oligonucleotide.
  • Still preferably the mammalian cell is a human cell, preferably the cell is a pre-cancerous cell, a cancer cell, a senescent cell or a virally-infected cell, preferably the senescent cell has critically short and/or damaged and/or dysfunctional telomeres.
  • It is a further object of the invention an inhibitor of small RNAs (DDRNAs), said small RNAs being generated in cis by processing by DICER and/or DROSHA of a RNA transcript synthesized following DNA damage in at least one sequence-specific genomic locus in a cell, wherein the DNA damage occurs at telomeres and/or is caused by a sequence-specific DNA endonuclease, wherein said RNA transcript is synthesized using the specific damaged genomic locus as template for transcription, wherein said inhibitor is a sequence-specific inhibitory oligonucleotide that specifically binds to said small RNAs (DDRNAs), for use as a medicament.
  • Preferably the inhibitor is for use for the treatment of a condition induced by the sequence-specific damaged genomic locus, preferably the condition is cancer and/or aging and/or a viral infection, preferably aging is associated with critically short and/or damaged and/or dysfunctional telomeres.
  • Preferably the inhibitor for use is a LNA molecule, a 2'-O-Methyl-modified oligonucleotide or a phosphorothioate-modified oligonucleotide.
  • Still preferably the oligonucleotide inhibits the DNA damage response in the cell at the damaged sequence-specific genomic locus.
  • More preferably the inhibitor sensitizes the cell to the effect of a DNA-damaging treatment, said use further comprising the step of exposing said cell to an effective amount of the DNA-damaging treatment.
  • It is a further object of the invention a pharmaceutical composition comprising the inhibitor for use as defined above.
  • It is a further object of the invention a method to detect the presence of damage to DNA in a sequence-specific genomic locus in a cell comprising the steps of:
    1. a) detecting the presence of small RNAs (DDRNAs), said small RNAs being generated in cis by processing by DICER and/or DROSHA of a RNA transcript synthesized using the specific damaged genomic locus as template for transcription in said cell;
    2. b) comparing the result to a control cell with undamaged DNA genomic locus.
  • It is a further object of the invention a method to identify the genomic location of a damage to DNA in a sequence-specific genomic locus in a cell comprising the steps of:
    1. a) isolating and/or purifying small RNAs (DDRNAs) from a sample, said small RNAs being generated in cis by processing by DICER and/or DROSHA of a RNA transcript synthesized using the specific damaged genomic locus as template for transcription in said cell;
    2. b) sequencing said isolated and/or purified small RNAs (DDRNAs).
  • It is a further object of the invention a method to quantify the DNA damage in a specific genomic locus in a cell or an in vitro method for the diagnosis and/or prognosis of a condition associated with and/or induced by the generation of DNA damage in at least one sequence specific genomic locus or an in vitro method for monitoring the efficacy of therapy directed to a condition associated with and/or induced by the generation of DNA damage in at least one sequence specific genomic locus in a subject comprising the steps of:
    1. a) measuring the amount of a sequence comprising small RNAs (DDRNAs) sequence, said small RNAs being generated in cis by processing by DICER and/or DROSHA of a RNA transcript synthesized using the specific damaged genomic locus as template for transcription in said cell;
    2. b) comparing the result to a proper control.
  • Preferably the condition associated with and/or induced by the generation of DNA damage in at least one sequence specific genomic locus is selected from the group consisting of: cancer, aging, viral infection, preferably aging is associated with critically short and/or damaged and/or dysfunctional telomeres.
  • It is a further object of the invention a method of screening for an agent able to inhibit small RNAs (DDRNAs), said small RNAs being generated in cis by processing by DICER and/or DROSHA of a RNA transcript synthesized using the specific damaged genomic locus as template for transcription in a cell comprising the step of measuring the amount of a sequence comprising said small RNAs upon exposure of the cell to said agent, and comparing to a proper control.
  • In a preferred embodiment of all of the above, the cell is a mammalian cell. Preferably a human cell.
  • The pharmaceutical composition comprises carriers, diluents and/or excipients. The composition may be administered by parenteral, oral, intravenous, intranasal, intramuscular route or any suitable route. The pharmaceutical composition mya be administered in any effective amount to elicit the desired therapeutic effect. The composition may be in any forms: solution, tablet, ointment etc.
  • In the present invention, DDRNAs are small RNAs, with the potential to form double-stranded pairs, that are generated by processing by DICER and/or DROSHA of a sequence specific RNA transcript synthesized upon transcription of a damaged DNA locus. DDRNAs are small RNAs of a length between 10 and 50 nucleotides. For example of a length between 17 and 32 nucleotides. For example of a length between 20 and 25 nucleotides. For example of a length between 22 and 23 nucleotides.
  • Said DDRNAs function by favoring the sequence-specific accumulation of DDR factors at specific sites of DNA damage and promote DDR signaling (i.e. comprising but not limiting to protein phosphorylation events).
  • A critically short telomere is a telomere able to engage the DDR machinery due to its critical short length. A damaged telomere is a telomere carrying a DNA lesion able to engage the DDR machinery. A dysfunctional telomere is a telomere that due to its altered protein and/or nucleic acid structure engages the DDR machinery
  • In the present invention an oncogenic stress may be a genotoxic stress (i.e. comprising but not limiting to DNA lesions, impaired DNA replication forks progression) due to oncogene activation, amplification, gain of function mutation, increased levels and activity. A cell carrying a DNA damage is a cell whose DNA damage is not exogenously induced (i.e. a cell comprising but not limiting to critically short telomere and damaged telomere, oncogenic stress, oxidative DNA damage).
  • Aging is associated with telomeric DNA damage and DDR activation 2, 84.
  • Genotoxic treatments commonly used in cancer therapy are treatments associated with the generation of DNA damage (i.e. comprising but not limiting to radiotherapy and chemotherapy).
  • A radiotherapy is a therapy based on the exposure to ionizing radiation.
  • An effective dose of ionizing radiation is a dose of ionizing radiation able to generate the desired outcome. The skilled person in the art using common routine techniques knows how to determine such dose.
  • A senescent cell is a cell retaining persistent DDR activation (usually following oncogenic stress and/or telomere shortening/DNA damage).
  • The presence of DNA damage is concluded by the presence of said short RNAs (DDRNAs); in the absence of said DDRNAs, it is concluded that cells do not have DNA damage.
  • In qualitative analysis, control cell may be a non-damaged cell or a healthy cell. The analysis may be carried out by quantitative Reverse Transcriptase-PCR, northern blot hybridization, next generation sequencing (Illumina etc), ion torrent technology or by any other means available, appropriated and known to the skilled person in the art. It may be performed on a cell or the blood or other biological fluids. It can also be performed in tissue lysates.
  • The quantity of said short RNAs (DDRNAs) is proportional to DNA damage, higher quantities of said RNAs indicate larger amount of DNA damage.
  • In quantitative analysis, the control may be a non-damaged cell or a healthy cell. The analysis may be carried out by qRT-PCR, northern blot hybridization, next generation sequencing (Illumina etc), ion torrent technology or by any other means available, appropriated and known to the skilled person in the art. It may be performed on a cell or the blood or other biological fluids. It can also be performed in tissue lysates.
  • In the present invention, "inhibiting DICER and/or DROSHA" means:
    1. 1. Inhibiting the enzymatic (nuclease and/or helicase) activity of DICER and/or DROSHA by means of a small molecule compound and/or ;
    2. 2. Inhibiting the synthesis of DICER and/or DROSHA by RNA interference means and/or;
    3. 3. Destabilizing the proteins DICER and/or DROSHA by targeting by various means protein cofactors that bind and are necessary for DICER and/or DROSHA activities and/or;
    4. 4. Inhibiting DICER and/or DROSHA activity by the expression of DICER and/or DROSHA alleles with dominant negative functions and/or;
    5. 5. Inhibiting DICER and/or DROSHA by targeting the genomic loci responsible for their synthesis.
  • An inhibitor of DICER and/or DROSHA is able to have at least one of the above activities. In the present invention "inhibiting small RNAs, said small RNAs being generated by processing by DICER and/or DROSHA of a RNA transcript synthesized upon transcription of the damaged genomic locus" means:
    preventing DDRNAs functions and/or impairing DDRNAs production by the use of a sequence specific inhibitory oligonucleotide able to avidly and specifically bind to DDRNAs. These oligonucleotides comprise but are not limiting to locked nucleic acids (LNA), phosphorothioate modified oligonucleotides, 2'-O-methoxyethyl modified oligonucleotides, 2' O-Methyl modified oligonucleotides, methylphosphonates, morpholino oligonucleotides, LNA-DNA-LNA gapmer oligonucleotides, Chimeric 2'-O-methyl RNA-DNA gapmer, N3'-P5' Phosphoroamidate, 2'-fluoro-arabino nucleic acid, Phosphoroamidate Morpholino, Cyclohexene nucleic acid, Tricyclo-DNA, Peptide nucleic acid, Unlocked nucleic acid, Hexitol nucleic acid, Boranophosphate oligonucleotides, Phosphoroamidate oligonucleotides and/or oligonucleotides expressed by plasmid-encoded genes delivered by different means (comprising but not limited to plasmid transfection, viral infection).
  • A DICER and/or DROSHA inhibitor is an agent or molecule able to display at least one DICER and/or DROSHA inhibiting function as described above (inhibiting the enzymatic activity of DICER and/or DROSHA, inhibiting the synthesis of DICER and/or DROSHA, destabilizing the proteins DICER and/or DROSHA, inhibiting DICER and/or DROSHA activity by the expression of DICER and/or DROSHA alleles with dominant negative functions and/or; targeting the genomic loci responsible for DICER and/or DROSHA synthesis).
  • An inhibitor of DDRNAs is an agent or molecule able to display at least one DICER and/or DROSHA inhibiting function as described above (preventing their synthesis, preventing their proper localization in the cell to prevent their processing and/or functions, preventing their accumulation, preventing their functions, preventing them to act as they would and/or preventing any modification of DDRNAs).The invention will be now described by way of non-limiting examples referring to the following figures.
    • Figure 1 | DICER or DROSHA inactivation impairs DDR foci stability and formation in OIS and in irradiated cells. a. DICER and DROSHA knockdown by siRNA pools in OIS cells impairs DDR foci maintenance as detected by 53BP1, pATM, pS/TQ, yH2AX immunostaining. b. Histograms show quantification of the percentage of cells positive for 53BP1, pATM, pS/TQ and yH2AX or H3K9me3, a marker of SAHF formation. c. DICER or DROSHA knockdown by siRNA pools in WI38 human fibroblasts impairs pATM, pS/TQ, MDC1, but not yH2AX, foci assembly. Cells were irradiated (10Gy) and fixed 7h later. d. Histograms show percentage of WI38 cells positive for pATM, pS/TQ, MDC1 and yH2AX foci. e. pATM, pS/TQ and MDC1, but not yH2AX, foci formation is impaired in DICERexon5 -hypomorphic cells. Cells were irradiated (2Gy) and fixed 2h later. f. Histograms show the percentage of cells positive for DDR foci. Error bars indicate s.e.m. (n ≥ 3). Differences (*) are statistically significant (p-value<0.001).
    • Figure 2 | DICER-inactivated cells have impaired G1/S and G2/M checkpoint. a. DICER, DROSHA or 53BP1 knockdown by siRNA pools in WI38 impairs irradiation-induced G1/S checkpoint. siGFP was used as control. Cells were irradiated (10Gy) and labeled with BrdU for 7 hours before fixation. Histograms show the percentage of BrdU-positive cells in not-irradiated (-) and in irradiated (+) cells. b. DICERexon5 -hypomorphic cells have impaired G1/S checkpoint. Cells were irradiated (2Gy) and labeled with BrdU for 2 hours before fixation. Histograms show the percentage of BrdU-positive cells in not-irradiated (-) and in irradiated (+) cells. Wild-type DICER-flag cDNA expression restores the G1/S checkpoint while cDNAs of DICER endonuclease mutants DICER44ab-flag and DICER110ab-flag do not. Error bars indicate s.e.m. (n=3). Differences (*) are statistically significant (p-value<0.01). c. DICER knocked-down cells have impaired G2/M checkpoint. FACS profiles of HEK293 cells transfected with an shRNA against DICER and p53 at 12, 24 and 36 hours post irradiation (5Gy). shGFP is used as control. d. The table shows the percentage of cells in G1, S and G2 phase of the cell cycle at different time points post IR.
    • Figure 3 | Irradiation induces pATM and γH2AX nuclear accumulation in control but not in Dicer1 morpholino-injected zebrafish embryos, a. Images illustrating the location of the sections from the head of 3 days post fertilization (dpf) WT (not injected) and Dicer1-morpholino injected zebrafish larvae stained for pATM and yH2AX before and after irradiation (12 Gy). Sections were stained with DAPI (blue) and pATM or yH2AX antibody (green). b. Immunoblot analysis of pATM and yH2AX accumulation in extracts from not irradiated and irradiated wild-type embryos or Dicer1 morpholino-injected embryos. Total ATM and histone H3 were used as loading control. c. Schematic drawing of the transplantation procedure. GFP-positive Dicer1 morpholino transplanted cells, integrated in various locations in the host, show reduced yH2AX signals following IR. d. Schematic drawing of the reverse transplantation procedure: control cells from embryos injected with mRNA encoding for GFP were transplanted into Dicer1 morpholino injected embryos. Dicer1-expressing cells display yH2AX signals, while the surrounding Dicer1 morpholino-injected cells do not.
    • Figure 4 | Irradiation-induced DDR foci are sensitive to RNase A treatment and are restored by short and DICER RNA products. a. Irradiated HeLa cells (2 Gy) were treated with PBS (-) or RNase A (+) and probed for 53BP1, pATM, pS/TQ, MDC1 and yH2AX foci. 53BP1, pATM, pS/TQ and MDC1, but not yH2AX, foci are strongly reduced upon RNase A treatment. b. Histograms report the percentage of cells positive for DDR foci. c. Addition of gel-purified RNA in the size range of 20-35nt allows DDR foci reformation in RNase A-treated cells. RNAs were separated according to their size by acrylamide gel electrophoresis and gel extracted. 100, 50 or 20ng of gel extracted total RNA and 50ng of RNA extracted from each gel fraction (>100nt, 35-100nt and 20-35nt) were used for RNA reconstitution post RNase treatment in HeLa cells. Error bars indicate s.e.m. (n=2). Differences are statistically significant (*p-value<0.01). d. Irradiation-induced 53BP1, pS/TQ and pATM foci are restored in RNase A-treated cells when incubated with RNA of wild-type (WT RNA) RKO cells but not with RNA of DICERexon5 -hypomorphic (DICERexon5 RNA) RKO cells. tRNA was used as control. γH2AX foci were not affected. e. Histograms report the percentage of cells positive for DDR foci. Error bars indicate s.e.m. (n≥4). Differences are statistically significant (*p-value<0.001).
    • Figure 5 | Site-specific DDR focus formation is RNase A-sensitive and can be restored by locus-specific RNA in a MRE11-RAD50-NBS1 complex-dependent manner. a. NIH2/4 mouse cells experiencing I-Sce I-induced DSB next to a Lac-operator array (LacO array) display a 53BP1 (green) and yH2AX (magenta) focus colocalizing with the Cherry-Lac focus (red). 53BP1, but not yH2AX focus, is sensitive to RNase A and it is restored by incubation with total RNA. b. Histograms show the percentage of cells in which 53BP1 and Cherry-Lac foci co-localize. Addition of 50, 200, 800 ng of RNA purified from NIH2/4 rescues 53BP1 foci formation in a dose-dependent manner. c. Incubation of RNase A-treated cells with RNA purified from NIH2/4 expressing I-Sce I restores 53BP1 focus at the I-Sce I induced cut site, while RNA from NIH3T3 parental cells expressing I-Sce I does not. d, e. RNA from NIH2/4 cells, or parental one, was used in RNase A-treated NIH2/4 cells to test 53BP1 or pATM focus reformation in the presence of the MRN inhibitor mirin. Cells were pretreated with 100 µM mirin for 15 minutes at room temperature before RNA addition and mirin was kept at the same concentration during incubation with RNA. Both 53BP1 and pATM foci reformation is inhibited by the presence of mirin. Histograms report the percentage of cells positive for DDR foci. Error bars indicate s.e.m. (n≥3). Differences are statistically significant (*p-value<0.05).
    • Figure 6 | Chemically synthesized locus-specific RNAs and in vitro generated DICER RNA products promote DDR focus formation at the DNA damage site in RNase A-treated cells.
      1. a. A pool of chemically synthesized oligonucleotides was tested to restore DDR focus formation in RNase A-treated NIH2/4 cells. Mixed with a constant amount of RNA from parental cells (800ng), a wide range of concentrations (1ng/µl - 1fg/µl, ten-fold dilution steps) of locus-specific or control (GFP) RNAs was used. Locus-specific synthetic RNAs (down to a concentration of 100fg/µl), but not control ones, allow site-specific DDR activation. b. Short RNAs generated by recombinant DICER processing of RNA generated in vitro by transcription of a DNA fragment carrying the central portion of the integrated locus, or a control one of similar length, were tested to restore DDR focus formation at the DNA damage site in RNase A-treated NIH2/4 cells. RNAs were tested at the concentration of 1ng/µl mixed with 800ng of RNA from parental cells. Locus-specific DICER RNA products, but not control ones, allow site-specific DDR activation. c. The fraction of 22-23 nt vs total short RNAs at the locus decreases in DICER and DROSHA knockdown samples both in uncut and cut conditions. In DICER knockdown samples the decrease is statistically significant (in the uncut samples p = 4.8e-7, in the cut samples p = 0.029). The fraction of 22-23 nt vs total short RNAs at the locus increases in the wildtype upon cutting (p = 0.02). The statistical significance was calculated by fitting a negative binomial model to the short RNA count data and performing a likelihood ratio test, keeping the fraction of 22-23 nt vs total RNAs at the locus fixed across conditions under the null hypothesis and allowing it to vary between conditions under the alternative hypothesis.
    • Figure 7 | DICER or DROSHA inactivation in OIS cells allows escape from senescence and cell-cycle progression. a. DICER, DROSHA knockdown by siRNA pools in OIS cells were evaluated by QRT-PCR. ATM knockdown by siRNA pool was evaluated by immunofluorescence. b. DICER or DROSHA knockdown in OIS cells by siRNA increases BrdU incorporation rates. Histograms show the percentage of BrdU-positive cells. siGFP was used as control. Error bars indicate s.e.m. (n ≥ 3). Differences are statistically significant (p-value < 0.001). c and f. DICER-, DROSHA- and DDR-inactivated OIS cells by transfection with siRNA pools, re-express MCM2, a marker of chromosomal DNA replication, and pH3, a marker of entry into mitosis. Error bars indicate s.e.m. (n ≥ 3). Differences are statistically significant (p-value < 0.001). d and g. DICER and DROSHA knockdown was evaluated by QRT-PCR e. 53BP1 knockdown is evaluated by immunofluorescence.
    • Figure 8 | Different concentrations and individual siRNA against DICER or DROSHA in OIS cells reproducibly allow escape from senescence. a-c. Different concentrations (10 fold difference) of siRNA pools against DICER or DROSHA in OIS cells allow escape from senescence. Error bars indicate s.e.m. (n ≥ 3). Differences are statistically significant (p-value <0.05). Knockdown was evaluated by QRT-PCR. d,e. siRNA pools against DICER or DROSHA used in OIS cells were deconvolved and siRNAs were tested individually and they reproducibly allow escape from senescence. Error bars indicate s.e.m. (n ≥ 3). Differences are statistically significant (p-value <0.05). Knockdown was evaluated by QRT-PCR.
    • Figure 9 | DICER or DROSHA inactivation in OIS cells does not alter SAHF maintenance and does not decrease DDR protein levels but impairs their activation over a range of siRNA concentrations. a. DICER or DROSHA were inactivated by transfection with siRNA pool in OIS cells. Cells were stained for H3K9me3 SAHF marker and for 53BP1. siGFP transfected cells are used as control. DICER or DROSHA inactivation affects 53BP1 foci without altering SAHF stability. b. Immunoblot analysis of H3K9me3 in DICER or DROSHA inactivated OIS cells. Total H3 is used as loading control. c. Immunoblot analysis of 53BP1, ATM and H2AX in DICER or DROSHA inactivated OIS cells. siGFP transfected cells are used as control. Vinculin is used as loading control. d-f. Different concentrations (10 fold difference) of siRNA pools against DICER or DROSHA in OIS cells impair DDR foci detection. Error bars indicate s.e.m. (n ≥ 3). Differences are statistically significant (p-value < 0.05). Knockdown was evaluated by QRT-PCR.
    • Figure 10 | DICER or DROSHA, but not GW182, inactivation in OIS cells impairs DDR foci formation. a. DICER, DROSHA or GW182/TNRC6A were inactivated by siRNA pool in OIS cells. DICER-, DROSHA- or GW182/TNRC6A-inactivated cells were stained for 53BP1, pATM and pS/TQ markers of activated DDR. GW182/TNRC6A inactivation has no detectable effect on DDR. Differences for DICER and DROSHA, but not GW182, are statistically significant (p-value <0.005). Error bars indicate s.e.m. (n ≥ 3). b. Knockdown was evaluated by QRT-PCR.
    • Figure 11 | Simultaneous inactivation of TNRC6A/GW182, TNRC6B and TNC6C in OIS cells does not affect DDR foci formation while DROSHA inactivation does. a. OIS cells inactivated by individual siRNA for DROSHA or TNRC6A, B and C simultaneously (with two different sets of siRNAs: pool #1 and #2) were stained for 53BP1, pATM and pS/TQ markers of activated DDR. TNRC6A, B and C simultaneous inactivation with either siRNA pools #1 or #2 has no detectable effect on DDR. Differences for DROSHA, but not TNRC6A, B and C, are statistically significant (p-value <0.05). Error bars indicate s.e.m. (n ≥ 3). b. Knockdown was evaluated by QRT-PCR.
    • Figure 12 | DICER or DROSHA inactivation in HNF impairs IR-induced DDR foci formation. a, b. Efficiency of DICER or DROSHA knockdown in WI38 human fibroblasts was evaluated by immunostaining (a) and QRT-PCR (b), respectively. c. Immunoblot analysis of ATM, 53BP1 and H2AX proteins expression levels in DICER- or DROSHA-inactivated WI38. siGFP transfected cells are used as control. Vinculin is used as loading control. d-g. siRNA pools against DICER or DROSHA were deconvolved and siRNAs were used individually. They all reduce DDR (53BP1, pATM and pS/TQ, but not yH2AX) foci formation. Differences are statistically significant (p-value <0.005). Error bars indicate s.e.m. (n ≥ 3). Knockdown was evaluated by QRT-PCR.
    • Figure 13 | 53BP1 foci formation is delayed upon DICER or DROSHA knockdown and impaired DDR foci formation is rescued by wild type but not mutant DICER. a. 53BP1-foci formation is impaired 10 minutes post IR (10 Gy) in WI38 cells knocked-down for DICER or DROSHA by siRNA pools. Histograms show the percentage of WI38 cells positive for 53BP1 foci. Differences (*) are statistically significant (p-value< 0.05). b-d. Expression of siRNA-resistant wt DICER, but not a mutant allele lacking endonuclease activity, rescues DDR foci formation defect in DICER knocked-down cells. 53BP1 foci formation was studied 10' after IR (10 Gy), pATM and MDC1 1 hour afterward. Differences (*) are statistically significant (p-value<0.001). Error bars indicate s.e.m. (n=3). Knockdown of endogenous DICER by 3'UTR siRNA was evaluated by QRT-PCR.
    • Figure 14 | DICER or DROSHA, but not GW182, inactivation in HNF impairs DDR foci formation. a-b. DICER, DROSHA or GW182/TNRC6A was inactivated in Wi38 cells by siRNA pools, cells were irradiated (2Gy) and stained for 53BP1 10' later, for yH2AX, pATM and pS/TQ markers of activated DDR, 1 hour post IR. GW182/TNRC6A inactivation has no detectable effect on DDR. Differences for DICER and DROSHA, but not GW182, are statistically significant (p-value <0.001). Error bars indicate s.e.m. (n ≥ 3). c. Knockdown was evaluated by QRT-PCR.
    • Figure 15 | DICER inactivation and TNRC6 A, B and C, simultaneous inactivation in HeLa cells is associated with similar levels of the co-transfected RFP-miR126 sensor mRNA but DDR foci are impaired only in DICER-inactivated cells a. HeLa cells were cotransfected with RFP-miR126 sensor mRNA and siRNA against DICER or TNRC6A, B and C in a pool. Cells were irradiated (2Gy) and stained for 53BP1 10' later. b. Both DICER and GW182-like proteins inactivation results in the upregulation of the miR126 sensitive RFP reporter but only DICER inactivation has detectable effect on DDR. Differences for DICER but not TNRC6 A, B and C, are statistically significant (p-value <0.05). Error bars indicate s.e.m. (n ≥ 3). c. Knockdown was evaluated by QRT-PCR.
    • Figure 16 | DDR factors are expressed but 53BP1 foci formation is delayed in DICERexon5 -hypomorphic RKO cells. Immunoblot analysis of ATM, MDC1, 53BP1 and H2AX in wild-type (WT) and DICERexon5 -hypomorphic RKO cells. Vinculin and tubulin are used as loading control. b. Irradiated DICERexon5 -hypomorphic RKO cells have delayed 53BP1-foci formation. Images show 53BP1-foci at 10, 30 and 90 minutes post IR (2 Gy) in wild-type (WT) and DICERexon5 -hypomorphic RKO cells. c. Histograms show the percentage of RKO cells positive for 53BP1 foci. Error bars indicate s.e.m. (n=3). Differences (*) are statistically significant (p-value<0.05).
    • Figure 17 | Impaired DDR foci formation in DICERexon5 -hypomorphic cells is rescued by wild type but not mutant DICER. a. Expression of wt DICER but not a mutant allele lacking endonuclease activity, restores DDR foci formation defect in DICERexon5 -hypomorphic RKO cells. 53BP1 foci formation was studied 10' after IR (2 Gy), pATM and pS/TQ 1 hour afterward. b. Histograms show the percentage of cells positive for the indicated DDR foci. Differences (*) are statistically significant (p-value<0.001). Error bars indicate s.e.m. (n ≥ 3).
    • Figure 18 | ATM activation by autophosphorylation is impaired in DICER and DROSHA-inactivated cells. a. ATM activation following IR (10 Gy) is impaired in DICER and DROSHA knocked-down WI38 human fibroblasts as detected by immunoblot analysis for pATM. siGFP transfected cells are used as a positive control for ATM activation. Total ATM is unaffected as shown by vinculin. DICER knockdown was evaluated by immunoblot analysis. b. DROSHA knockdown in WI38 cells was evaluated by QRT-PCR. c. ATM activation is impaired in irradiated (2 Gy) DICERexon5 -hypomorphic RKO cells. Total ATM and vinculin are used as loading control.
    • Figure 19 | DICER or DROSHA knockdown impairs G1/S checkpoint. DICER, DROSHA and 53BP1 knockdowns by siRNA pools in WI38 cells were monitored by QRT-PCR (a), immunoblot (b) and immunofluorescence (c), respectively. d, e. siRNA pools against DICER or DROSHA used in WI38 cells were deconvolved and siRNAs were used individually and they reproducibly impair G1/S checkpoint activation. Histogram shows the percentage of BrdU positive cells before (black bar) and after IR (gray bar) upon normalization on the percentage of BrdU-positive cells before IR for each cell line. Error bars indicate s.e.m. (n=3). Knockdown was evaluated by QRT-PCR. f. DICER-inactivated MRC-5 cells have impaired G1/S checkpoint post IR (10 Gy). siGFP is used as control. g. DICER and 53BP1 knockdowns efficiency in MRC-5 was monitored by immunofluorescence. Error bars indicate s.e.m. (n=3). Differences (*) are statistically significant (p-value<0.05).
    • Figure 20 | Loss of G1/S and G2/M checkpoint activation in DICER knocked-down cells. a. DICER-flag cDNA transfection into HCT116 DICERexon5 -hypomorphic cells restores a proficient G1/S checkpoint post IR (2 Gy). Histograms show the percentage of BrdU-positive cells. Error bars indicate s.e.m. (n=3). Differences (*) are statistically significant (p-value<0.01). b. Immunoblot analysis against flag-epitope shows the expression of DICER mutants (DICER-flag, DICER110ab-flag and DICER44ab-flag) in RKO cells. c. DICER knockdown by shRNA in HEK293 cells was monitored by QRT-PCR. d. DICER-inactivated HEK293 cells have impaired G2/M checkpoint as detected by pH3 immunostaining of mitotic cells in not irradiated cells and 24h post IR (5 Gy). Histograms show the percentage of pH3 positive cells in control and DICER-inactivated cells. Error bars indicate s.d. (n=3). Differences are statistically significant by student's t-test (p-value<0.05). e. DICER knocked-down cells have an impaired G2/M checkpoint that can be restored upon transfection of siRNA-resistant DICER. The table shows the percentage of cells in G1, S and G2 phase of the cell cycle at different time points post IR. f. FACS profiles of HEK293 cells transfected with the indicated combinations of siRNA and vectors (EV stands for empty vector), 36 hours post IR (5Gy). g. Endogenous DICER (En DICER) knockdown and exogenous DICER (Exo DICER) overexpression were evaluated by QRT-PCR.
    • Figure 21 | Dicer1 morpholino-injected zebrafish embryos downregulate the expression of miRNAs. a. 72 hours post fertilization (hpf) larvae injected with Red Fluorescent Protein (RFP) miR126 sensor mRNA (1 larva on the left) or RFP miR126 sensor mRNA together with Dicer1 morpholino (3 larvae on the right). Note the jaw defects, small eye and delayed yolk re-absorption indicative of developmental delays in the Dicer1 morpholino-injected embryos. The same embryos visualized by epifluorescence show an increase in RFP expression in Dicer1 morpholino injected embryos. b. Specificity of miR126 sensor. Upper panels show the expression levels of RFP miR126 sensor mRNA and GFP mRNA in the control, uninjected embryos. Lower panel shows the effects of Dicer1 morpholino injection on the expression of RFP miR126 sensor (increased in the absence of mature miR 126) and GFP (unchanged). c. miRNA expression of 48 and 72 hours post fertilization embryos injected or not with Dicer1 morpholino were analyzed by real-time PCR. Data are expressed as relative expression level of Dicer1 morpholino-injected embryos compared to the control embryos not injected and are the mean of two independent pools of embryo performed in duplicate. d. Table of raw CT values.
    • Figure 22 | RNase A treatment degrades both mRNAs and microRNAs, leaves DDR protein levels unaltered but compromises their activation. a. QRT PCR analysis of β-actin mRNA and miR-21 in mock and RNase A-treated cells. Error bars indicate s.d. (n=3). Differences are statistically significant by Student's t-test (p-value<0.05). b. QRT PCR analysis of 53BP1 and ATM mRNA in RNase A-treated cells. Error bars indicate s.d. (n=3). Differences are statistically significant by Student's t-test (p-value<0.05). c. RNase A treatment does not affect DDR (ATM, 53BP1, MDC1) protein stability. Lamin A/C is used as loading control. d. RNase A affects 53BP1 and MDC1 but not □H2AX in the same focus. Irradiated HeLa cells were treated with PBS or RNase A. 53BP1 foci (green) and MDC1 foci (red) are affected by RNase A treatment while yH2AX (magenta) foci in the same cell are not.
    • Figure 23 | α-amanitin inhibits spontaneous DDR foci reformation following RNase A treatment. a. Irradiation-induced (2 Gy) 53BP1 foci are α-amanitin sensitive. HeLa cells were irradiated and incubated with PBS (-) or RNase A (+). Afterwards cells were incubated with the RNase A inhibitor RNaseOUT, with or without α-amanitin for 10 or 45 minutes. Incubation with α-amanitin prevents 53BP1-foci reformation. b. Histogram shows the percentage of cells positive for 53BP1 foci. Error bars indicate s.e.m. (n=3). Differences (*) are statistically significant (p-value<0.01).
    • Figure 24 | Ppo I-induced DDR foci are RNase A sensitive and reform upon RNA addition. HeLa cells were transfected with the active form of Ppo I, a restriction enzyme, treated with RNase A and incubated with tRNA, as a control, or their own RNA. Histograms show the percentage of cells positive for the indicated DDR markers. Error bars indicate s.e.m. (n=3). Differences (*) are statistically significant (p-value<0.005)
    • Figure 25 | Short RNAs promote DDR foci reformation at the DNA damage site a. Relative enrichment of miR-21 RNA compared to β-actin mRNA quantity evaluated by QRT-PCR in total RNA and short RNA-enriched fractions. b. Histograms show the percentage of cells positive for 53BP1, pATM and pS/TQ foci in irradiated HeLa cells, RNase A-treated, and cells incubated with 200ng of total RNA or a proportional volume of short RNA-enriched (<200nt) fraction. tRNA (200ng) was used as control. c. Irradiation-induced 53BP1 (green) and pATM (red) foci are restored in RNase A-treated cells by incubation with total and short RNAs-enriched fraction. tRNA was used as control.
    • Figure 26 | Irradiation-induced DDR foci are restored in RNase A-treated cells by incubation with RNAs extracted from gel in the 20-35nt range. a. Irradiated cells were RNase A treated and incubated with equal amounts (50ng) of RNA extracted from polyacrilamide gel as shown in Figure 4 c. Images show 53BP1 staining in cells incubated with the indicated RNAs. b. QRT PCR analysis of RNU19 (200 nt), RNU44 (61 nt) and mir-21 (22 nt) in the indicated RNA fractions extracted from gel. Error bars indicate s.d. (n=3). Differences are statistically significant by student's t-test (p-value<0.005).
    • Figure 27 | RNA extracted from DICERexon5 -hypomorphic cells transfected with wild type but not mutant DICER allows DDR foci reformation in RNase A-treated cells. a. Irradiated cells were RNase A-treated and incubated with RNA extracted from the indicated cells. RNA from wild type cells or DICERexon5 -hypomorphic cells transfected with wild type DICER allows 53BP1 foci reformation, while RNA from untransfected DICERexon5 -hypomorphic cells or the same cells transfected with mutant DICER do not. b. Histograms show the percentage of cells positive for the indicated DDR markers. Error bars indicate s.e.m. (n=3). Differences (*) are statistically significant (p-value<0.005)
    • Figure 28 | DICER and DROSHA RNA products are required for DDR foci reformation a. RNA extracted from wild-type HCT116 and DLD-1 cell lines, but not that extracted from DICERexon5 -hypomorphic HCT116 and DLD-1 cell lines, rescues 53BP1 foci. Histograms show the percentage of cells positive for 53BP1 foci. Error bars indicate s.e.m. (n=3). Differences are statistically significant (p-value<0.01). b. RNA extracted from shDICER-transfected (or GFP as control) HEK293 cells does not restore irradiation-induced 53BP1 foci in RNase A-treated HeLa cells. tRNA is used as negative control. c. Histograms report the percentage of cells positive for 53BP1 foci. d. Immunoblotting shows DICER knockdown efficiency. e. Histograms show the percentage of cells positive for 53BP1, pATM and pS/TQ foci in irradiated HeLa cells after RNase A treatment and incubation with RNA purified from siGFP and siDROSHA transfected cells. tRNA was used as control.
    • Figure 29 | MRN complex involvement in DDR foci reformation after RNase treatment. a. MRN complex recruitment to the I-Sce I-induced DSB is sensitive to RNase A treatment. 53BP1, pATM and MRE11 foci, but not yH2AX, are lost in RNase A treated NIH2/4 cells. Histograms show the percentage of cells in which 53BP1, pATM, MRE11 or yH2AX foci colocalizing with the Cherry-Lac focus. b. Mirin impairs pATM activation on the I-Sce I-induced DSB. Histogram shows the percentage of cells in which pATM focus colocalize with the Cherry-Lac focus. Error bars indicate s.e.m. (n≥3). Differences are statistically significant (*p-value<0.05).
    • Figure 30 | Identification of biologically active locus-specific molecules. Chemically synthesized locus-specific RNAs and in vitro generated DICER RNA products promote DDR focus formation at the DNA damage site in RNase A-treated cells. a. Nuclear RNA shorter than 200 nt was purified and analyzed on the small RNA Bioanalyser kit (Agilent). b. Short RNA library was prepared and extracted from 6% polyacrylamide gel (indicated by an arrow at 100 bp). c. The integrity of the prepared library was checked using the Agilent DNA high sensitivity kit. d. Length distribution of tags in the library. e. Length distribution of tags in the library mapping to the exogenous integrated locus combining tags from cut and uncut samples. f. A pool of chemically synthesized oligonucleotides mapping to the exogenous locus was tested to restore DDR focus formation in RNase A-treated NIH2/4 cells. Mixed with a constant amount of tRNA, a wide range of concentrations (0.1ng/µl, 0.1pg/µl and 1fg/µl) of locus-specific or control (GFP) RNAs, was used. g. DICER processing was evaluated by running DICER RNA-products on a 3% agarose gel. h. Short RNAs cleaved by recombinant DICER processing of RNA generated in vitro upon transcription of a DNA fragment carrying the central portion of the integrated locus, or a control one of similar length, were tested to restore DDR focus formation in RNase A-treated NIH2/4 cells. RNAs were tested at the concentration of 1ng/µl mixed with 800ng of tRNA. Locus-specific DICER RNA products, but not control ones, allow site-specific DDR activation at the DNA damage site. Histograms report the percentage of cells positive for DDR foci.
    • Figure 31 | Library profile and length distribution of selected sequenced samples. a. Bioanalyser profile of <200 nt RNA from wildtype cut sample. b. Short RNA libraries were prepared from 40 ng RNA from each sample and run on a 6% PAGE gel. Arrow shows the 100 bp library band of interest. c. Wildtype cut library profile. Gel extracted libraries were run on Bioanalyser high sensitivity kit. Sequencing was performed on Hi seq Version 3. d-i. Tag length distribution of each library.
    • Figure 32 | Dicer and Drosha knockdown downregulates miRNAs. a. Dicer and Drosha knockdown by shRNA in uncut and cut samples was evaluated by QRT-PCR. b. Reads mapping to the miRNA database miRBase release 18 were normalized with the number of reads of spike in each library. Normalized miRNAs in Dicer and Drosha knockdown samples were compared with wildtype samples before and after cut (as labeled). Statistical significance was calculated using the Wilcoxon signed-rank test. The authors find that miRNAs are significantly lower expressed in the Dicer and Drosha knockdown sample compared to the wildtype sample in both cut and uncut conditions (Dicer knockdown uncut vs wildtype uncut p =1.544e-263; Drosha knockdown uncut vs wildtype uncut p =3.843e-279; Dicer knockdown cut vs wildtype cut p = 8.911e-84; Drosha knockdown cut vs wildtype cut p = 1.172e-275).
    • Figure 33 | Features of short RNAs arising from the locus. a. Length of tags arising from the locus before and after cut. Y-axis shows number of tags from the locus and X-axis depicts tag lengths in nucleotides. The bulk of short RNAs in wildtype samples before and after cut are in the 22-23 nt size range. Among knockdown samples, Dicer knockdown shows a broader tag length distribution. b. 22-23 nt percentage of the locus is significantly different from the same ratio of non miRNA genomic loci. Fractions of 22-23 nt vs total short RNAs at non miRNA genomic loci with at least 50 reads are shown in histograms with the vertical axis depicting their frequency. In each sample, the vertical line depicts the ratio of 22-23 nt RNAs to the total at the locus. The p-value was calculated by summing the area (indicated in red) to the right of this line. The authors find that the fraction of 22-23 nt vs total short RNAs at the locus studied is significantly higher than the fraction of 22-23 nt tags at non miRNA genomic loci in both uncut (p = 0.049) and cut (p = 0.022) conditions.
    • Figure 34 | Sequence-specific inhibitory oligonucleotides (i.e. LNAs) transfection impairs DDR at the locus in cut cells. The scheme (a) shows the TET-I-SceI-LAC locus, the DDRNAs generated upon cut (grey line), and the LNAs used (black dotted line). Cells were co-transfected with Cherry-Lac and I-Sce I-restriction endonuclease expressing vectors together with different sets (as in the legend in the figure) of LNA (200pM) with the potential to anneal to DDRNAs arising from the locus upon I-SceI-induced cleavage or a control LNA matching telomere sequence. 24h post transfection cells were scored for DDR markers at the Lac array. Histograms show the percentage of cells positive for the DDR markers analysed: yH2AX (b) is not affected, whereas 53BP1 (c) accumulation at the locus is significantly reduced upon all sets of transfected LNAs. Around 100 cells from three independent experiments were scored. Error bars indicate s.e.m. Statistical significance was calculated by Chi-squared test compared to control LNA (sample 2). * p-value<0.05, ** p-value<0.01, *** p-value<0.005.
    • Figure 35 | DDR activation (53BP1 focus maintenance) at uncapped telomeres is RNA-dependent. TRF2flox/flox MEFs (Lazzerini Denchi and de Lange, Nature 2007) were treated with 4-hydroxytamoxifen to induce cre-mediated TRF2 knockout and generate uncapped telomeres. 48 hours later, cells were permeabilized and treated with RNase A or BSA, as a control. (a) Representative images show that yH2AX foci are stable, while 53BP1 foci disassemble upon RNase A treatment. (b) Quantification of yH2AX and 53BP1 foci in RNase A and BSA treated cells. For the quantifications shown around 150 cells from two independent experiments were scored. Error bars indicate s.e.m. *** p-value <0.001.
    • Figure 36 | Sequence-specific inhibitory oligonucleotides (i.e. LNAs) transfection suppresses DDR and prevents BrdU reduction following telomere-uncapping. T19 fibrosarcoma cell line (van Steensel, Cell 1998) was cultured in absence of doxycycline to induce expression of a dominant negative allele of TRF2 fused to flag. Induced cells are visualized by Flag immunostaining. Induced (Flag +) and uninduced (Flag -) cells were transfected with LNA molecules (200 nM) matching the sense (LNA 6), the antisense (LNA 5) telomeric sequence, and an unrelated (LNA 3, Cntrl) sequence at day 13 from induction. (a) 53BP1 foci-positive cells were scored at the indicated time points post transfection. LNA 5 and 6 cause a decrease in DDR-positive cells, to different extent, compared to control LNA in induced cells, while no difference was observed in uninduced cells. For the quantifications shown, around 30-100 cells were scored for each time point (b, c). Induced cells were incubated with BrdU for 16 hours and scored for BrdU incorporation 3 days following LNA transfection. LNA 5 and 6 transfected Flag + cells show a significant increase in the percentage of BrdU-positive cells, compared to the Cntrl LNA (b), while no difference is observed in Flag - cells (c). For the quantifications shown around 150 cells from three (b) or two (c) independent experiments were scored. Error bars indicate s.e.m. * p-value <0.05, *** p-value <0.001.
    DETAILED DESCRIPTION OF THE INVENTION METHODS
  • Cultured cells. Early passage BJ cells, WI38 and MRC-5 (The American Type Culture Collection, ATCC) were grown under standard tissue culture conditions (37°C, 5% CO2) in MEM supplemented with 10% fetal bovine serum, 1% L-glutamine, 1% non-essential aminoacids, 1% Na Pyruvate. HeLa, Phoenix ecotrophic and HEK293T cell lines were grown under standard tissue culture conditions (37°C, 5% CO2) in DMEM, supplemented with 10% fetal bovine serum, 1% glutamine, 1% penicillin/streptomycin. RKO, HCT116 and DLD1 colon cancer cell lines25 were cultured in Mc'Coy 5A medium +10% fetal calf serum, 1% penicillin/streptomycin. NIH2/4 35 where grown in DMEM, supplemented with 10% fetal bovine serum, 1% glutamine, gentamicine (40 µg/ml), and hygromycin (400 µg/ml).
  • H-RasV12 overexpressing senescent BJ cells were generated as in20. BrdU incorporation assays were carried at least a week after cultures had fully entered the senescent state, as determined by ceased proliferation, DDR activation, SAHF formation, and senescence-associated β-galactosidase expression. Ionizing radiation (IR) was induced by a high-voltage X-rays generator tube (Faxitron X-Ray Corporation). In general, cultured cells were exposed to 2 Grays for the foci formation assay. The authors used 5 Grays for the G2/M checkpoint assays and 10 Grays for the G1/S checkpoint assays.
  • Cherry-Lac and I-Sce I-restriction endonuclease expressing vector were transfected by lipofectamine 2000 (Invitrogen) in a ratio of 3:1. 16h post transfection around 70% of the cells were scored positive for DDR markers at the Lac array. For generation of Dicer and Drosha knocked-down NIH2/4 cells were infected with Lentiviral particles carrying pLKO.1, shDicer or shDrosha vectors. After 48 hours cells were superinfected with Adeno Empty Vector or Adeno I-Sce I [Anglana et al. Nucl Ac Res 1999]. Nuclei were isolated the day after the adenoviral infection.
  • Transient expression of ER-I-PpoI endonucleases in HeLa cells was carried out by Lipofectamine 2000 transfection and 16 hours later tamoxifen (0.1µM) was added to culture medium to induce the activation of the endonuclease. 4 hours later cells were fixed for immunostaining or used for RNA extraction. Cherry-Lac transfected (mock) cells were used as control in these experiments.
  • Cultured cells and LNA transfection (for the experiments in Fig. 34). NIH2/4 cells where grown in DMEM, supplemented with 10% fetal bovine serum, 1% glutamine, gentamicine (40mg/ml), and hygromycin (400mg/ml). Cherry-Lac and I-Sce I-restriction endonuclease expressing vectors were transfected with Lipofectamine 2000 (Invitrogen) with a 3:1 ratio. LNA were first boiled at 90°C for 5 minutes and quickly chilled at 4°C for 5 minutes and then added in different combinations to the Cherry-Lac and I-Sce I transfection mix, at the final concentration of 200pM. 24h post transfection cells were scored for DDR markers at the Lac array.
  • Cultured cells (for the experiments in Figs. 35-36). T19 fibrosarcoma cells (van Steensel, Cell 1998) were grown in DMEM supplemented with 10% fetal bovine serum, 1% glutamine and doxycycline (100 ng/ml). For induction, cells were grown without doxycycline for at least 7-8 days. CRE-ER TRF2flox/flox MEFs (Lazzerini Denchi and de Lange, Nature 2007) were grown in DMEM supplemented with 10% fetal bovine serum and 1% glutamine. For induction, cells were grown in presence of 4-hydroxytamoxifen (600 nM) for 48 hours. For BrdU incorporation, cells were labeled with 10µg/ml bromodeoxyuridine (BrdU, Sigma) for 16 hours and incorporation was evaluated by immunofluorescence after DNA denaturation.
  • Antibodies. Mouse anti-yH2AX, anti-H3K9me3, rabbit polyclonal anti-PH3 (Upstate Biotechnology); anti-pS/TQ (Cell Signaling Technology); anti-H2AX, anti-H3 and anti DICER (13D6) (Abcam); rabbit polyclonal anti-53BP1 (Novus Biological) and mouse monoclonal anti-53BP1 (a gift from Thanos Halazonetis); anti-MRE11 (a gift from S. Jackson); anti pH3, anti-BrdU (Becton Dickinson); rabbit polyclonal anti-MCM2 (a gift of Marine Melixetian); anti MRE11 rabbit polyclonal raised against recombinant MRE11; anti-pATM (Rockland); mouse monoclonal anti-ATM and anti-MDCl (SIGMA); anti-vinculin (clone hVIN-1), anti-β-tubulin (clone AA2) and anti-Flag M2 monoclonal antibodies (SIGMA).
  • Indirect immunofluorescence. Cells were grown on poly-D-lysinated coverslips (poly-D-lysine was used at 50µg/ml final concentration) and plated (15-20x103 cells/cover) one day before staining. DDR and BrdU staining was performed as in 20. Cells were fixed in 4% paraformaldehyde or methanol:acetone 1:1. NIH2/4 mouse cells were fixed by 4% paraformaldehyde as in 35. Images were acquired using a wide field Olympus Biosystems Microscope BX71 and the analySIS or the MetaMorph software (Soft Imaging System GmbH). Comparative immunofluorescence analyses were performed in parallel with identical acquisition parameters; at least 100 cells were screened for each antigen. Cells with more than 2 DDR foci were scored positive. Foci intensity quantifications were performed using Cell Profiler software 2.0. Confocal sections were obtained with a Leica TCS SP2 AOBS confocal laser microscope by sequential scanning.
  • Immunofluorescence (for the experiments in Figs. 35-36). Cells were fixed with 1:1 methanol/acetone solution for 2 minutes at room temperature, or 4% paraformaldehyde for 10 minutes at room temperature. After blocking, cells were stained with primary antibodies for 1h at room temperature, washed and incubated with conjugated secondary antibodies for 40 minutes at RT. Nuclei were stained with DAPI (1 µg/ml).
  • Plasmids. Flag-DICER, Flag-DICER44ab and Flag-DICERl 10ab were a kind gift of R. Shiekhattar. pLKO.1 shDICER expressing vector was a kind gift of WC. Hahn. Short hairpin sequence for DICER is: CCG GCC ACA CAT CTT CAA GAC TTA ACT CGA GTT AAG TCT TGA AGA TGT GTG GTT TTT G (SEQ ID NO:1). pRETROSUPER shp53 as in20. Short hairpin sequence for p53 was: AGT AGA TTA CCA CTG GAG TCT T (SEQ ID NO:2). Cherry-Lac-repressor and I-Sce I-restriction endonuclease expressing vectors were kind gifts of E. Soutoglou35. ER-I-Ppo I-restriction endonuclease expressing vector was a kind gift of Michael Kastan 33. shRNA against mouse Dicer and Drosha expressing vectors were a kind gift of W.C. Hahn. shRNA for mouse Dicer: CCG GGC CTC ACT TGA CCT GAA GTA TCT CGA GAT ACT TCA GGTCAA GTG AGG CTT TTT (SEQ ID NO:3). shRNA for mouse Drosha: CCG GCC TGG AAT ATG TCC ACA CTT TCT CGA GAA AGT GTG GAC ATA TTC CAG GTT TTT G (SEQ ID NO:4).
  • siRNA. The DHARMACON siGENOME SMARTpool siRNA oligonucleotide sequences for human 53BP1, ATM, DICER, DROSHA were:
    • 53BP1:
      • GAG AGC AGA UGA UCC UUU A (SEQ ID NO:5);
      • GGA CAA GUC UCU CAG CUA U (SEQ ID NO:6);
      • GAU AUC AGC UUA GAC AAU U (SEQ ID NO:7);
      • GGA CAG AAC CCG CAG AUU U (SEQ ID NO:8).
    • ATM:
      • GAA UGU UGC UUU CUG AAU U (SEQ ID NO:9);
      • AGA CAG AAU UCC CAA AUA A (SEQ ID NO:10);
      • UAU AUC ACC UGU UUG UUA G (SEQ ID NO:11);
      • AGG AGG AGC UUG GGC CUU U (SEQ ID NO:12).
    • DICER:
      • UAA AGU AGC UGG AAU GAU G (SEQ ID NO:13);
      • GGA AGA GGC UGA CUA UGA A (SEQ ID NO:14);
      • GAA UAU CGA UCC UAU GUU C (SEQ ID NO:15);
      • GAU CCU AUG UUC AAU CUA A (SEQ ID NO:16).
    • DROSHA:
      • CAA CAU AGA CUA CAC GAU U (SEQ ID NO:17);
      • CCA ACU CCC UCG AGG AUU A (SEQ ID NO:18);
      • GGC CAA CUG UUA UAG AAU A (SEQ ID NO:19);
      • GAG UAG GCU UCG UGA CUU A (SEQ ID NO:20).
  • The DHARMACON siGENOME si RNA sequences for Human TNRC6A, B and C were:
    • GW182/TNRC6A:
      • GAA AUG CUC UGG UCC GCU A (SEQ ID NO:21);
      • GCC UAA AUA UUG GUG AUU A (SEQ ID NO:22).
    • TNRC6B:
      • GCA CUG CCC UGA UCC GAU A (SEQ ID NO:23);
      • GGA AUU AAG UCG UCG UCA U (SEQ ID NO:24).
    • TNRC6C:
      • CUA UUA ACC UCG CCA AUU A (SEQ ID NO:25);
      • GGU AAG UCC UCC AUU GAU G (SEQ ID NO:26).
    • siRNA against human DICER 3' UTR:
      CCG UGA AAG UUU AAC GUU U (SEQ ID NO:27).
    • siRNA against GFP:
      AAC ACU UGU CAC UAC UUU CUC (SEQ ID NO:28).
    • siRNA against Luciferase:
      • CAU UCU AUC CUC UAG AGG AUG dTdT (SEQ ID NO:29);
      • dTdT GUA AGA UAG GAG AUC UCC UAC (SEQ ID NO:30).
  • siRNAs were transfected by Oligofectamine (Invitrogen) at a final concentration of 200 nM in OIS cells and 100nM in HNF. In the siRNA titration experiment we transfected OIS cells in parallel with 20nM and 200nM siRNA oligos. For siRNA transfection with deconvolved siRNA oligos the authors used 50 nM for smart pools and 12.5 nM for deconvolved siRNAs.
  • Real-time quantitative PCR (RT-QPCR). Total RNA was isolated from cells using TRIzol (Invitrogen) or RNAeasy kit (Qiagen) according to the manufacturer's instructions, and treated with DNAse before reverse transcription. For microRNA isolation the authors used mirVana™ miRNA Isolation Kit (Ambion). cDNA was generated using the Superscript II Reverse Transcriptase (Invitrogen). cDNA was used as template in TaqMan® Gene Expression Assays (Applied Biosystems) for the evaluation of DICER (Assay ID: Hs00998580_m1) and DROSHA (Assay ID: Hs01095030_m1) mRNA levels. TaqMan® MicroRNA Assays (Applied Biosystems) were used for the evaluation of mature miR-21 and rnu44 and rnu19 expression levels (Assay ID: 000397, 001094 and 001003). 18S or β-actin was used as a control gene for normalization. miR21 and rnu44 enrichment in the small RNA-enriched fraction was evaluated as the ratio between PCR cycles (ct) for miR-21 or rnu44 and for β-actin mRNA after normalization to the same ratio in total RNA fraction. Real-time quantitative PCR reactions were performed on an Applied Biosystems ABI Prism 7900HT Sequence Detection System or on a Roche LightCycler 480 Sequence Detection System. The reactions were prepared using SyBR Green reaction mix from Roche. Ribosomal protein P0 (RPP0) was used as a human and mouse control gene for normalization.
  • Primer sequences for real-time quantitative PCR were:
    • RPP0:
      • TTCATTGTGGGAGCAGAC (SEQ ID NO:31) (Forward),
      • CAGCAGTTTCTCCAGAGC (SEQ ID NO:32) (Reverse);
    • human endogenous DICER:
      • AGCAACACAGAGATCTCAAACATT (SEQ ID NO:33) (Forward),
      • GCAAAGCAGGGCTTTTCAT (SEQ ID NO:34) (Reverse);
    • human endogenous and overexpressed DICER:
      • TGTTCCAGGAAGACCAGGTT (SEQ ID NO:35) (Forward),
      • ACTATCCCTCAAACACTCTGGAA (SEQ ID NO:36) (Reverse);
    • human DROSHA:
      • GGCCCGAGAGCCTTTTATAG (SEQ ID NO:37) (Forward),
      • TGCACACGTCTAACTCTTCCAC (SEQ ID NO:38) (Reverse);
    • human GW182:
      • CAGCCAGTCAGAAAGCAGTG (SEQ ID NO:39) (Forward),
      • TGTGAGTCCAGGATCTGCTACTT (SEQ ID NO:40) (Reverse);
    • mouse Dicer:
      • GCAAGGAATGGACTCTGAGC (SEQ ID NO:41) (Forward),
      • GGGGACTTCGATATCCTCTTC (SEQ ID NO:42) (Reverse);
    • mouse Drosha:
      • CGTCTCTAGAAAGGTCCTACAAGAA (SEQ ID NO:43) (Forward),
      • GGCTCAGGAGCAACTGGTAA (SEQ ID NO:44) (Reverse).
  • RNase A treatment and RNA complementation experiments. Cells were plated on poly-D-lysinated coverslips and irradiated with 2 Gy of IR. 1h after HeLa cells were permeabilized with 2% Tween 20 in PBS for 10 minutes at RT while I-Sce I-transfected NIH2/4 cells were permeabilized in 0,5% Tween 20 in PBS for 10 minutes at RT. RNase A treatment was carried out in 1ml of 1mg/ml Ribonuclease A from bovine pancreas (Sigma-Aldrich cat n: R5503) in PBS for 25 minutes at room temperature. After RNase A digestion, the samples were washed with PBS, treated with 80 units of RNase inhibitor (RNaseOUT Invitrogen 40units/µl) and 2µg/ml of α-amanitin (SIGMA) for 15 minutes in a total volume of 70 µl. For experiments with mirin, NIH2/4 cells were incubated at this point also with 100 µM mirin (SIGMA) or DMSO for 15 minutes. Then, RNase A-treated cells were incubated with total, small or gel extracted RNA, or the same amount of tRNA, for additional 15 minutes at room temperature. If using mirin, NIH2/4 cells were incubated with total RNA in the presence of 100 µM mirin or DMSO for 25 minutes at room temperature. Cell were then fixed with 4% paraformaldehyde or methanol:acetone 1:1.
  • In complementation experiments with synthetic RNA oligonucleotides, eight RNA oligonucleotides with the potential to form four pairs were chosen among the sequences obtained by deep sequencing that map at the integrated locus in NIH2/4 cells. Synthetic RNA oligonucleotides were generated by SIGMA with a monophosphate modification at the 5' end. Sequences map to different regions of the integrated locus: two pairs map to a unique sequence flanking the I-Sce I restriction site (Oligo 1+Oligo 2 and Oligos 3+ Oligo 4), one to the Lac-operator (Oligo 5 + Oligo 6) and one to the Tet-repressor repetitive sequences (Oligo 7 +Oligo 8). Two paired RNA oligonucleotides with the sequences of GFP were used as negative control (Oligo GFP 1+ Oligo GFP 2). Sequences are reported below.
  • DDRNA sequences
    • Oligo 1: 5'-AUA ACA AUU UGU GGA AUU CGG CGC-3'(SEQ ID NO:45),
    • oligo 2: 5'-CGA AUU CCA CAA AUU GUU AUC C-3'(SEQ ID NO:46),
    • oligo 3: 5'-AUU UGU GGA AUU CGG CGC CUC UAG AGU CGA GG-3'(SEQ ID NO:47),
    • oligo 4: 5'- CCU CGA CUC UAG AGG CG-3'(SEQ ID NO:48),
    • oligo 5: 5'-AGC GGA UAA CAA UUU GUG GCC ACA UGU GGA-3'(SEQ ID NO:49),
    • oligo 6: 5'- UGU GGC CAC AAA UUG UU-3'(SEQ ID NO:50),
    • oligo 7: 5'-ACU CCC UAU CAG UGA UAG AGA AAA GUG AAA GU-3'(SEQ ID NO:51),
    • oligo 8: 5'-CUU UCA CUU UUC UCU AUC ACU GAU AGG GAG UG-3'(SEQ ID NO:52)
    • GFP 1: 5'-GUU CAG CGU GUC CGG CGA GUU-3'(SEQ ID NO:53),
    • GFP 2: 5'-CUC GCC GGA CAC GCU GAA CUU-3'(SEQ ID NO:54)
  • RNAs were resuspended in 60mM KCl, 6mM HEPES-pH 7.5, 0.2mM MgCl2, at the stock concentration of 12.5µM, denatured at 95°C for 5 minutes and annealed for 10minutes at room temperature.
  • DICER RNA products were generated as follows. A 550 bp DNA fragment carrying the central portion of the genomic locus studied (three Lac repeats, the I-Sce I site and two Tet repeats) was flanked by T7 promoters at both ends and was used as a template for in vitro transcription with the TurboScript T7 transcription kit (AMSBIO). The 500nt long RNA obtained was purified and incubated with human recombinant DICER enzyme (AMSBIO) to generate 22-23nt RNAs. RNA products were purified, quantified and checked on a polyacrylamide or an agarose gel. As a control, the same procedure was followed with a 700bp construct containing the RFP DNA sequence. Equal amounts of DICER products generated in this way were used in complementation experiment in NIH2/4 cells following RNase treatment.
  • RNaseA treatment (for the experiments in Figs. 35). CRE-ER TRF2flox/flox MEFs (Lazzerini Denchi and de Lange, Nature 2007) were induced to generate TRF2 knockout and telomere uncapping. 48 hours later cells were permeabilized with 0.6% Tween 20 in PBS for 15 min at room temperature. RNase A treatment was carried out in 1ml of 1 mg/ml ribonuclease A from bovine pancreas (Sigma-Aldrich catalogue no. R5503) in PBS for 30 minutes at room temperature.
  • LNA Transfection (for the experiments in Fig. 36). LNA were first boiled at 90°C for 5 minutes, chilled at 4°C for 5 minutes and transfected with Lipofectamine RNAiMAX (Invitrogen) at the final concentration of 200 nM.
  • Small RNA preparation. Total RNA was isolated from cells using TRIzol (Invitrogen) according to the manufacturer's instructions. To generate small RNA-enriched fraction and small RNA-devoid fraction the authors used mirVana™ microRNA Isolation Kit (Ambion) according to the manufacturer's instructions. The mirVana microRNA isolation kit employs an organic extraction followed by immobilization of RNA on glass-fiber (silica-fibers) filters to purify either total RNA, or RNA enriched for small species. For total RNA extraction ethanol is added to samples, and they are passed through a Filter Cartridge containing a glass-fiber filter, which immobilizes the RNA. The filter is then washed a few times, and finally the RNA is eluted with a low ionic-strength solution. To isolate RNA that is highly enriched for small RNA species, ethanol is added to bring the samples to 25% ethanol. When this lysate/ethanol mixture is passed through a glass-fiber filter, large RNAs are immobilized, and the small RNA species are collected in the filtrate. The ethanol concentration of the filtrate is then increased to 55%, and it is passed through a second glass-fiber filter where the small RNAs become immobilized. This RNA is washed a few times, and eluted in a low ionic strength solution. Using this approach consisting of two sequential filtrations with different ethanol concentrations, an RNA fraction highly enriched in RNA species ≤200 nt can be obtained 25,66.
  • RNA extraction from gel. Total RNA samples were heat-denatured, loaded and resolved on a 15% denaturing acrylamide gel [1X TBE, 7 M urea, 15% acrylamide (29:1 acryl:bis-acryl)]. Gel was run for 1 hour at 180 V and stained in GelRed solution. Gel slices were excised according to the molecular weight marker, moved to a 2 ml clean tube, smashed and RNA was eluted in 2 ml of ammonium acetate 0.5 M, EDTA 0.1 M in RNase-free water, rocking overnight at 4°C. Tubes were then centrifuged 5 minutes at top speed, the acqueous phase was recovered and RNA was precipitated and resuspended in RNase free water.
  • G1/S checkpoint assay. WI38, BJ and MRC-5 cells were irradiated with 10Gy and 1 hour afterwards incubated with BrdU for 7h; HCT116 and RKO cells were irradiated 2Gy and incubated with BrdU for 2h. Cells were fixed with 4% paraformaldehyde and probed for BrdU immunostaining. At least 100 cells per condition were analyzed.
  • G2/M checkpoint assay. HEK 293 calcium phosphate transfected cells were irradiated with 5 Gy and allowed to respond to IR-induced DNA damage in a cell culture incubator for 12, 24 or 36 hours. Then, at these three time points post irradiation, together with not irradiated cells, 1X106 cells were collected for Fluorescence Activated Cell Sorting (FACS) analysis, fixed in 75% ethanol in PBS, 30 minutes on ice. Afterwards, cells were treated 12 hours with 40 µg/ml of RNase A and incubated at least 1h with propidium iodide (PI). FACS profiles were obtained by the analysis of at least 5X105 cells. In the complementation experiments HEK 293 were transfected using Lipofectamine RNAi Max (Invitrogen) and 48 hours later irradiated with 5 Gy. Cells were then treated as explained above.
  • Immunoblotting. Cells were lysed in sample buffer and 50-100 µg of whole cell lysate were resolved by SDS-PAGE, transferred to nitrocellulose and probed as in 20.
  • For zebrafish immunoblotting protein analysis, 72 hours post fertilization (hpf) larvae were deyolked in Krebs Ringer's solution containing ImM EDTA, 3mM PMSF and proteases inhibitor (Roche complete protease inhibitor cocktail). Embryos were then homogenized in SDS sample buffer containing ImM EDTA with a pestle, boiled 5 min and centrifuged 13000 rpm for 1 min. Protein concentration was measured with the BCA method (Pierce) and proteins (50µg-900µg) were loaded in an SDS-12% (for yH2AX and H3) and SDS-6% polyacrylamide gel (for pATM and ATM), transferred to a nitrocellulose membrane, and incubated with anti-yH2AX (1:2000, a gift from J. Amatruda67), H3 (1:10000, Abcam), pATM (1:1000, Rockland), ATM (1:1000, Sigma). Immunoreactive bands were detected with horseradish peroxidase-conjugated anti-rabbit or anti-mouse IgG and an ECL detection kit (Pierce, Springfield, IL, USA). Protein loading was normalized to equal amounts of total ATM and H3.
  • Zebrafish embryo injection, cell transplantation and staining. Zebrafish embryos at the stage of 1-2 cells were injected with a morpholino against Dicer1 29 diluted in Danieau buffer. The morpholino oligonucleotide was injected at a concentration of 5 ng/nl, and a volume of 2 nl/embryo. To assess the efficiency of the morpholino to block microRNA maturation, the authors co-injected the morpholino with in vitro synthesized mRNA, encoding for red fluorescent protein (RFP) and carrying 3 binding site for miR126 in the 3' UTR 28. The oligonucleotides carrying the binding sites for miR126 used for construction of pCS2:RFPmiR126 sensor are:
    Figure imgb0001
  • The construct was verified by sequencing and used to synthesize mRNA in vitro using the mMessage Kit (Ambion). Messenger RNA encoding for RFPmiR126 sensor was injected alone or in combination with Dicer1 morpholino at a concentration of 10 pg/nl. Dicer morpholino was injected at a concentration of 5 ng/nl, and a volume of 2 nl/embryo. For cell transplantation experiments, the authors injected donor embryos with a mixture of dicer1 morpholino and mRNA encoding for GFP (5 pg/nl). Approximately 20 cells were transplanted from donor embryos at dome (5 hpf) stage to uninjected host at the same stage. Succesfully transplanted larvae (displaying GFP+ cells) were irradiated as described below. Mature miRNA were reverse transcribed to produce 6 different cDNA for TaqMan® MicroRNA assay (30ng of total mRNA for each reaction; Applied Biosystems). Real-time PCR reactions based on TaqMan reagent chemistry were performed in duplicate on ABI PRISM® 7900HT Fast Real-Time PCR System (Applied Biosystems). The level of miRNA expression was measured using CT (threshold cycle). Fold change was generated using the equation 2-CT.
  • For immunofluorescence in zebrafish larvae: 72 hpf larvae were irradiated with 12Gy, fixed in 2% paraformaldehyde for 2 hours at room temperature. After equilibration in 10 and 15% sucrose in PBS, larvae were frozen in OCT compound on coverslips on dry ice. Sections were cut with a cryostat at a nominal thickness of 14 □m and collected on Superfrost slides (BDH). Antisera used were zebrafish yH2AX - a kind gift of J. Amatruda67 - and pATM (Rockland). GFP fluorescence in transplanted embryos was still easily visible in fixed embryos. Images were acquired with a confocal (Leica SP2) microscope and 63X oil immersion lens.
  • RNA sequencing. Nuclear RNA shorter than 200 nt was purified using mirVana™ microRNA Isolation Kit. RNA quality was checked on a small RNA chip (Agilent) before library preparation (Supplementary Figure 23 a). For Illumina hi Seq Version3 sequencing, spike RNA was added to each RNA sample in the RNA : spike ratio of 10,000 :1 before library preparation and libraries for Illumina GA IIX were prepared without spike. An improved short RNA library preparation protocol was used to prepare libraries 68. In brief, adenylated 3' adapters were ligated to 3' ends of 3'-OH short RNAs using a truncated RNA ligase enzyme followed by 5' adapter ligation to 5'-monophosphate ends using RNA ligase enzyme, ensuring specific ligation of undegraded short RNAs. cDNA was prepared using a primer specific to the 3'adapter in the presence of Dimer eliminator and amplified for 12-15 PCR cycles using a special forward primer targeting the 5' adapter containing additional sequence for sequencing and a reverse primer targeting the 3' adapter. The amplified cDNA library was run on a 6% polyacrylamide gel and the 100 bp band containing cDNAs up to 33 nt was extracted using standard extraction protocols. Libraries were sequenced after quality check on a DNA high sensitivity chip (Agilent). Multiplexed barcode sequencing was performed on Illumina GA-IIX (35 bp Single end reads) and Illumina Hi seq version3 (51 bp single end reads). Sequences of all the DDRNAs identified in this study will be available for free downloading by the time of publication at short read archive.
  • Statistical analyses. Results are shown as means plus/minus standard error (s.e.m.). p-value was calculated by Chi-squared test. QRT-PCR results are shown as means of a triplicate plus/minus standard deviation (s.d.) and p-value was calculated by Student's t-test as indicated. * indicates p-value<0.05.
  • Results in Fig. 34b and c are shown as means plus standard error (s.e.m.). p-value was calculated by Chi-squared test. * indicates p-value<0.05, ** indicates p-value<0.01, *** indicates p-value<0.005.
  • Results in Figs. 35-36 are shown as means plus standard error of the mean (s.e.m.). p-value was calculated by Chi-squared test. * indicates p-value <0.05, *** indicates p-value <0.001.
  • Short RNA sequencing data statistical analysis. Statistical significance of downregulation of normalized miRNAs in Dicer and Drosha knockdown samples were calculated using the Wilcoxon signed-rank test.
  • The differences in the fraction of 22-23 nt vs total short RNAs at the locus between the wildtype, Dicer knockdown, and Drosha knockdown before and after cut was calculated by fitting a negative binomial model to the sRNA count data and performing a likelihood ratio test, keeping the fraction of 22-23 nt vs total short RNAs at the locus fixed across conditions under the null hypothesis and allowing it to vary between conditions under the alternative hypothesis.
    • LNA sequences (for experiments in Fig. 34 and 36).
    • LNA 1: TTATCCGCTCACAATTCCACAT (SEQ ID NO:57)
    • LNA 2: ATGTGGAATTGTGAGCGGATAA (SEQ ID NO:58)
    • LNA 3 (Cntrl in Fig. 36): ACTGATAGGGAGTGGTAAACT (SEQ ID NO:59)
    • LNA 4: AGAGAAAAGTGAAAGTCGAGT (SEQ ID NO:60)
    • LNA 5 (control in Fig. 34): CCCTAACCCTAACCCTAACCC (SEQ ID NO:61)
    • LNA 6: GGGTTAGGGTTAGGGTTAGGG (SEQ ID NO:62)
    EXAMPLES Inactivation of DICER and DROSHA inhibits DDR and allows senescent cells to reenter into cell cycle.
  • Oncogene-induced senescence (OIS) is a non-proliferative state characterized by a sustained DDR20,21 (caused by high level of endogenous DNA damage) and senescence-associated heterochromatic foci (SAHF)22. Since the RNAi-machinery has been involved in heterochromatin formation23, the authors investigated whether the inactivation of components of the RNAi machinery could have an impact on escape from senescence induced in human fibroblasts by transduction of H-RasV12 (referred here as OIS cells). The authors therefore suppressed the expression of DICER or DROSHA in OIS cells using a pool of small interfering RNAs (siRNA) and monitored cell-cycle progression into S-phase with BrdU labeling. The authors observed that DICER or DROSHA knockdown, as well as ATM knockdown used as positive control for escape from senescence20 (Figure S1 a), result in an increased fraction of BrdU-positive cells (Figure 7b), re-expression of markers of chromosomal DNA replication (Figures 7c-e) and entry into mitosis (Figure 7f-g). These results could be reproduced over a range of siRNA concentrations (Figure 8a-c) and with four individual siRNA oligonucleotides (Figure 8d, e). Perhaps unexpectedly however, in DICER- or DROSHA-inactivated cells the authors failed to detect any overt impairment in heterochromatin formation and SAHF components accumulation as detected by DAPI staining and by immunostaining and immunoblotting for the trimethylated form of the histone H3 (H3K9me3) (Figure 9a, b).
  • Since DDR plays a crucial role in the maintenance of the proliferative arrest in OIS cells 20,21, the authors monitored whether DICER or DROSHA inactivation had an impact on DDR foci maintenance. The authors therefore stained cells for markers of active DDR such as the autophosphorylated form of ATM (pATM), phosphorylated substrates of ATM and ATR (pS/TQ), 53BP1 and yH2AX. The authors observed that DICER or DROSHA inactivation significantly reduces the number of 53BP1, pATM and pS/TQ foci positive cells (Figures 1a, b and 9a) even though 53BP1, ATM or H2AX protein levels are not reduced (Figure 9c). The authors also observed that the percentage of yH2AX-positive cells did not show a significant variation, although the intensity of yH2AX foci was generally reduced (Figure 1a and b). These effects could be observed over a range of siRNA concentrations (Figure 9d-f). Importantly, inactivation of GW182/TNRC6A, the main component of the RNAi machinery involved in mRNA translational control, did not impact on DDR foci detection (Figure 10), nor the simultaneous inactivation of all three GW182-like proteins TNRC6A, B and C with two independent pools of siRNAs (Figure 11). Therefore, DICER or DROSHA inactivation impairs DDR signaling and overcomes the DDR-induced proliferative arrest of OIS cells.
  • DICER or DROSHA inactivation impairs ionizing radiation-induced DDR foci formation.
  • The authors next asked whether the involvement of DICER and DROSHA in DDR activation is specific for the senescence condition or whether DICER or DROSHA inactivation has also an impact on ionizing radiation (IR)-induced DDR activation in proliferating non-senescent cells. Therefore, the authors transiently inactivated DICER or DROSHA by a pool of siRNA in human normal fibroblasts (HNF - WI38; Figure 12a and b), exposed them to IR and a few hours later the authors stained them for markers of activated DDR. The authors observed that, despite not reduced levels of protein expression (Figure 12c), formation of pATM, pS/TQ, MDC1, but not yH2AX, foci are impaired in DICER- or DROSHA-inactivated HNF (Figure 1c and d). These observations can be reproduced by using four individual siRNAs (Figure 12d-g) and in a different HNF cell line (BJ, data not shown). Under these conditions (DICER- or DROSHA-knocked down HNF analyzed 7 hours post IR), the authors did not observe the dramatic impairment of 53BP1 foci previously observed in OIS cells. However, an analysis performed at earlier time points (10' after IR) showed a significant reduction of 53BP1 foci formation in DICER- or DROSHA-inactivated HNF (Figure 13a), suggesting that DICER or DROSHA inactivation delays 53BP1 foci formation.
  • In order to exclude off target effects, the authors expressed an RNAi-resistant form of DICER in DICER-knocked down HeLa cells. The authors observed that re-expression of wild-type DICER, but of not a mutant allele (DICER44ab) previously shown to abolish its RNA endonuclease activity24, allows DDR foci formation to an extent similar to wild type cells, thus confirming DICER-dependency of the effects observed (Figure S 7b-d). Finally, the effects observed are independent of mRNA translational control, as GW182 knockdown has no significant impact on DDR foci formation (Figure 14a-c), consistent with the results in OIS cells (Figure 10). As an additional control, the simultaneous inactivation of TNRC6A, B and C or DICER in Hela cells expressing a reporter mRNA encoding for Red Fluorescent Protein (RFP) carrying three binding sites for miR-126, used as a sensor for microRNA-dependent translational repression, showed that both GW-like proteins and DICER inactivation result in comparable RFP up-regulation, due to the abolished miR-126-dependent RFP translational repression (Figure 15a, b and d); nevertheless, only DICER inactivation affects DDR foci stability (Figure 15c).
  • To further confirm the involvement of DICER in DDR activation, the authors used a colon cancer cell line (RKO) carrying a homozygotic genetic deletion of exon 5 in DICER gene and therefore expressing a hypomorphic allele of DICER (DICERexon5 ); this cell line is defective in microRNAs maturation25. In DICERexon5 -hypomorphic cells, the level of expression of ATM, MDC1, 53BP1 or H2AX proteins is not reduced (Figure 16a). However, while in wild-type (WT) cells IR induces pATM, pS/TQ, MDC1 and yH2AX foci, in DICERexon5 -hypomorphic cells DDR foci formation is impaired (Figure 1e and f). In a time-course experiment, the authors observed that 53BP1 foci formation is delayed in DICERexon5 -hypomorphic cells (Figure 16b and c). Also in this system, the authors observed that yH2AX foci are only mildly affected (Figure 1e and f). The defects observed in DICERexon5 -hypomorphic cells could be reversed by the re-introduction of wild-type but not of an endonuclease mutant allele of DICER (DICER44ab) (Figure 17). Similar conclusions were reached in an additional cell line (HCT116) carrying the same DICER deletion (data not shown).
  • Next, the authors tested if the absence of DDR foci observed in DICER- or DROSHA-inactivated cells was due to a defect in actual DDR activation or DDR foci assembly. Therefore, the authors performed a set of immunoblot analyses both in DICER- or DROSHA-interfered HNF and in DICERexon5 -hypomorphyc cell lines. The authors' analyses revealed that IR-induced ATM autophosphorylation is impaired in DICER- or DROSHA-inactivated fibroblasts (Figure 18a and b) and in irradiated RKO DICERexon5 -hypomorphic cells, compared to wild-type cells (Figure 18c). This indicates that DICER and DROSHA control ATM activation and not just its accumulation in foci. Combined, these results reveal that DICER or DROSHA inactivation impairs DDR activation induced by exogenous sources of DNA damage in manner independent from canonical RNAi translational repressors (GW-like proteins).
  • DICER or DROSHA inactivation impairs G1/S and G2/M DNA damage checkpoints.
  • DNA damage elicits DDR signal transduction leading to checkpoint-dependent cell-cycle arrest at two critical transition steps: the G1/S checkpoint and the G2/M checkpoint1. The authors tested whether impaired DDR activation in DICER- or DROSHA-inactivated cells has an impact on G1/S and G2/M checkpoints. To test the G1/S checkpoint-dependent arrest, cells were irradiated and pulse-labeled with BrdU. The authors observed that DICER- and DROSHA-inactivated HNF (WI38; Figure 19a and b) have an impaired irradiation-induced G1/S-phase arrest compared to control cells (Figure 2a) and that the extent of checkpoint deficiency is comparable to that of 53BP1-interfered cells, used as a positive control26 (Figure 2 a and 19c). G1/S checkpoint impairment was confirmed with four individual siRNA oligonucleotides (Figure 19d, e) and in two additional HNF cell lines (MRC-5 and BJ) in separate sets of experiments (Figure 19f, g and data not shown). Consistent with the results in HNF, DICERexon5 -hypomorphic cells, from two distinct cell lines (RKO and HCT116; Figure 2b and 20a, respectively), also show an impaired G1/S transition arrest. To confirm the dependency of the checkpoint on DICER in these cell lines, the authors re-expressed wild-type DICER-cDNA in DICERexon5 -hypomorphic cells. Indeed, DICER cDNA expression restored the G1/S checkpoint in both DICERexon5 -hypomorphic cell lines (Figure 2b and 20a). Next, the authors asked if the RNA-endonuclease activity of DICER is required for the DNA damage-induced checkpoint activation. With this aim, the authors complemented DICERexon5 -hypomorphic cells with two distinct DICER mutants carrying the amino acid substitution Asp44 to Ala44 (DICER44ab) or Glu110 to Ala110 (DICER110ab) known to abolish DICER RNA endonuclease activity 24. While wild-type DICER expression rescued the G1/S checkpoint defect of DICERexon5 -hypomorphic cells, both DICER mutants failed to do so (Figure 2b), despite similar levels of DICER expression (Figure 20b). The authors conclude that the RNA processing activity of DICER is necessary to enforce the G1/S checkpoint.
  • The authors also tested whether DICER is required to arrest cell-cycle progression at the G2/M boundary following DNA-damage. Thus, the authors suppressed DICER, or p53 as positive control, in HEK293 cells and the authors tested G2/M checkpoint activation by monitoring the cell-cycle progression profile over time through Fluorescence-Activated Cell Sorting (FACS). As expected, irradiated empty-vector (EV) transfected cells progressively accumulate in the G2 phase of the cell cycle, as a consequence of the checkpoint enforcement. Differently, DICER, as well as p53 knocked-down cells, did not arrest upon DNA damage and passed through the G2/M transition (Figure 2 c and d). This result was further confirmed by monitoring the percentage of mitotic cells in control and DICER-inactivated cells following IR, based on histone H3 phosphorylation (pH3) (Figure 20c and d) 21. Furthermore, the defect in G2/M checkpoint activation in DICER-knocked down cells could be rescued by the expression of a siRNA-resistant DICER expressing construct (Figure 20e-g).
  • These results indicate that DICER-inactivated cells are deficient in the activation of both G1/S and G2/M checkpoints and that DICER's RNA processing activity is necessary to enforce the checkpoint after DNA damage.
  • DICER inactivation in zebrafish impairs DDR activation in vivo.
  • To study if DICER is required for DDR activation upon irradiation in a living organism, the authors tested the impact of DICER inactivation in Danio rerio (zebrafish) larvae, as a model system. Zebrafish embryos were injected with morpholino oligonucleotides against Dicer1. Efficiency of Dicer1 inactivation was assessed by the ability of the morpholino oligonucleotide to block microRNA maturation and therefore impede the suppression of the co-injected reporter RFP-miR-12628. In addition, the authors investigated the levels of six different mature microRNAs using QPCR to confirm inactivation of Dicer1. Larvae originated from embryos injected with morpholino oligonucleotides against Dicer1 displayed upregulated RFP expression and the developmental defects previously reported for Dicer1-inactivated larvae29 (Figure 21 a, b) together with reduced levels of microRNAs (Figure 21c, d). Irradiated larvae were stained with antibodies against pATM and yH2AX. Not irradiated larvae showed no or weak staining (Figure 3). Irradiation induced a strong pATM and yH2AX activation in all the cells throughout the sections of wild-type larvae head. Differently, irradiated Dicer1 morpholino-injected larvae showed a dramatic impairment both in pATM and yH2AX signal (Figure 3a). The observed impact on yH2AX suggests a stronger dependency of yH2AX on Dicer1 in zebrafish in vivo, compared with cultured mammalian cells. An immunoblot analysis of protein extracts from wild-type and Dicer1 morpholino-injected larvae treated in parallel showed that the impairment in pATM and yH2AX accumulation is present in the whole animal (Figure 3b). The differential response to irradiation of cells with reduced Dicer1 activity due to morpholino injection versus Dicer1 proficient cells was further confirmed in reciprocal cell transplantation experiments. Briefly, cells from embryos injected with Dicer1 morpholino and mRNA encoding for GFP were transplanted at blastula stage into control uninjected embryos. Chimaeric larvae were irradiated at 3 days post fertilization (dpf) and stained with antibodies against yH2AX (Figure 3c). In the reciprocal experiment, control cells from embryos injected with mRNA encoding for GFP were transplanted into Dicer1 morpholino injected embryos. Chimaeric larvae were irradiated as above and stained with antibodies against yH2AX. In both cases, cells with reduced Dicer1 activity displayed reduced yH2AX signals compared to their neighboring, Dicer1-proficient cells. (Figure 3c). The authors conclude that Dicer1 is required for DDR activation in vivo in living zebrafish larvae.
  • In an in vitro cell system DDR foci are sensitive to RNase A and DICER and DROSHA RNA products allow DDR foci reformation.
  • The authors then sought an experimental system amenable for the study of the potential direct contribution of DICER and DROSHA RNA products in DDR activation. It has been previously shown that mammalian cells can withstand a transient membrane permeabilization and RNase treatment. This approach allowed the study of the contribution of RNA to heterochromatin structure and protein association with chromatin30,31. The authors therefore utilised this technique to address the contribution of RNA in DDR activation. IR-exposed human cells (HeLa) were permeabilized by a mild detergent and treated with the broad-specificity RNA nuclease RNase A. This treatment leads to the degradation of both messenger RNAs and miRNAs including the mRNAs of DDR genes (Figure 22a, b), without significantly affecting DDR protein levels (Fig. 22c). Untreated and RNase A-treated irradiated cells were stained for markers of DDR activation. The authors observed that RNA degradation strongly impairs 53BP1, pATM, pS/TQ and MDC1 foci formation (Figure 4a and b). This result is consistent with the reported sensitivity of 53BP1-GFP to ribonuclease treatment31. Similar to the authors' observations in DICER- and DROSHA-inactivated cells, yH2AX accumulation is only slightly affected by RNase A (Figure 4a and b). Noteworthy, unperturbed yH2AX signals indicate that RNase A treatment does not dramatically alter chromatin structure or nuclear integrity. Intriguingly, 53BP1, MDC1 and yH2AX triple staining shows that RNase A reduces 53BP1 and MDC1 accumulation at individual yH2AX-foci, which are instead maintained (Figure 22d), thus suggesting that RNA molecules act to favor MDC1 and 53BP1 focus formation once H2AX has been phosphorylated.
  • The authors also noticed that when RNase A is inactivated by an RNase A inhibitor (RNaseOUT, a small protein inhibitor), DDR foci progressively reappear within minutes. In addition, the authors also observed that foci reformation can be prevented by the RNA polymerase II-specific inhibitor α-amanitin (Figure 23a, b). This suggests that that DDR foci formation is dependent on RNA polymerase II RNA products.
  • Next, the authors tested if DDR foci that are lost after RNase A treatment can reform following the addition of purified RNA to RNase A-treated cells. Therefore, irradiated RNase A-treated cells were washed, incubated with RNaseOUT and α-amanitin and incubated with HeLa-purified total RNA. Strikingly, the authors observed that the addition of total RNA, but not tRNA used as control, robustly restores focal accumulation of all DDR factors tested (Figure 4d, e) within a relatively short time (15 minutes) at room temperature.
  • As IR may induce different kinds of DNA lesions, the authors expressed the site-specific endonuclease PpoI 32, 33 which generates several genomic DSBs. Also in this system, the authors could demonstrate that 53BP1, pATM and pS/TQ signals assemble in DDR foci that are sensitive to RNase A treatment and that their reformation can be induced by the addition of RNA extracted from the same cells (Figure 24). Similar conclusions were reached when using an inducible form of the restriction enzyme AsiSI 34 (data not shown). Next, the authors attempted to characterize the RNA species involved in DDR-foci reformation by incubating RNase A-treated cells with different RNA populations. To gauge the length of the RNA molecules involved in DDR focus reformation, the authors enriched total HeLa RNA for short RNAs by chromatography (<200nt; Figure 25a) and the authors used proportional volumes of total and short RNA to restore DDR foci in RNase A treated cells. The authors observed that the short RNAs-enriched fraction was sufficient to restore pATM, pS/TQ and 53BP1 foci indicating that this fraction contains the active RNA molecules (Figure 25b, c). To attain better RNA size separation, the authors resolved total RNA on a polyacrylamide gel and recovered RNAs of different lengths: longer than 100nt, between 100nt and 35nt and between 35nt and 20nt (Figure 4c and 26). Using equal amounts of RNA from each fraction, the authors observed that only RNAs in the 20-35nt size range are active in restoring DDR foci formation (Figure 4c). Thus, two different separation approaches indicate that RNA components required for DDR foci assembly are short and in the size range of the RNA products generated by DICER and DROSHA.
  • Since the authors observed that inactivation of DICER and DROSHA affects DDR foci formation in living cells and organisms, the authors reasoned that its small RNA products could indeed be responsible for DDR foci restoration in this in vitro cell system. Thus, the authors investigated if DICER RNA products directly contribute to DDR foci formation. To do so, the authors extracted total RNA from wild-type and DICERexon5 -hypomorphic cells and the authors used these two RNA preparations to restore DDR foci in RNase A-treated irradiated cells. Total RNA preparations from the two cell lines are expected to have the same composition apart from the population of DICER RNA products 25. Strikingly, while RNA extracted from wild-type cells does restore pATM, pS/TQ or 53BP1 foci, RNA extracted from DICERexon5 hypomorphic cells does not (Figure 4d, e). Importantly, RNA from DICERexon5 hypomorphic cells transfected with a vector expressing wild-type but not mutant DICER allows DDR foci reformation (Figure 27). These results can be quantitatively reproduced using RNA preparations from two additional cell lines (HCT116 and DLD1) carrying the same hypomorphic DICER mutation25 (Figure 28a) and by the use of RNA extracted from cells transiently knocked-down for DICER (Figure 28b-d). To test if also RNA purified from DROSHA-inactivated cells is unable to restore DDR foci, the authors knocked-down DROSHA, and GFP as control, by siRNA in HeLa cells, purified RNA and used these RNA preparations to attempt to restore DDR foci. The authors' experiments revealed that total RNA from siGFP control cells restores DDR foci, while RNA purified from DROSHA-inactivated cells does not (Figure 28e).
  • Overall, these observations are consistent with a model in which small RNA molecules generated by DICER and DROSHA are necessary to form IR-induced DDR foci. One conceivable mechanism is that small RNA products from DICER and DROSHA activity suppress the translation of a hypothetical DDR inhibitor. However, the observation that after RNase A treatment (which degrades both mRNAs and microRNAs) (Figure 22a, b) and α-amanitin treatment (which inhibits transcription), gel-purified 20-35nt short RNA promote DDR foci reformation, strongly indicates that DICER and DROSHA RNA products control DDR directly and independently from potential mRNA targets and translational modulation. Moreover, the translation inhibitor cyclohexamide has no impact on DDR foci formation in this system (data not shown). These conclusions are consistent with the observation that inactivation of DICER or DROSHA, but not GW-like proteins involved in translational inhibition, impacts on DDR activation in living cells.
  • DDR focus formation at a defined damaged genomic site requires damage site-specific RNAs.
  • Ionizing radiations induce the formation of DNA lesions that are heterogeneous in nature and random in their location. To reduce this diversity, the authors studied a single DSB at a unique, defined and traceable genomic locus. The authors therefore took advantage of NIH2/4 mouse cells carrying an integrated copy of the I-Sce I restriction site flanked by an array of Lac-repressor (Lac) binding sites and Tet repeats35. In this system, the expression of the I-Sce I restriction enzyme together with the fluorescent protein Cherry-Lac-repressor (Cherry-Lac) allows the visualization in the nucleus of the site-specific DSB generated by the nuclease. Indeed, co-expression of I-Sce I and Cherry-Lac-repressor in NIH2/4 cells induces a 53BP1 and yH2AX focus that overlaps with a focal Cherry-Lac signal (Figure 5a). The authors observed that, also in this system, RNase-A treatment causes the disappearance of the 53BP1 focus from I-Sce I-induced DSB (Figure 5a and b) and α-amanitin prevents 53BP1 focus reformation at the same site (data not shown). Next, the authors tested if total RNA re-addition, following RNase A treatment, restores DDR focus at the I-Sce I-induced DNA lesion. Therefore, RNase A-treated NIH2/4 cells were incubated with increasing amounts of total RNA extracted from cells treated in parallel. When RNA was added to the RNase A-treated samples, NIH2/4 cells re-acquired a bright 53BP1 focus co-localizing with the Cherry-Lac-repressor in a manner dependent on the RNA amount used (Figure 5a and b). Therefore, the very same DDR focus generated on a defined DSB can disassemble and reassemble in a manner dependent on RNA.
  • Collectively, the results described so far demonstrate that DICER and DROSHA short RNA products control DDR foci formation. However, as such, they do not allow to discriminate whether RNAs are generated in cis using the damaged genomic locus as a template or in trans from a distinct locus. To discriminate between these two possibilities, the authors took advantage of the fact that the I-Sce I-induced DSB is generated within an exogenous sequence, which is not present in the parental cell line. The authors therefore transfected I-Sce I and the Cherry-Lac-repressor in NIH2/4 cells and in the NIH3T3 parental cell line and the authors used RNA extracted from either cell lines to attempt to restore 53BP1 focus formation in RNase A-treated NIH2/4 cells that had experienced the I-Sce I-induced DSB: the two RNA preparations are expected to differ only in the potential presence of RNA transcripts generated from the exogenous integrated construct carrying the Lac and Tet repeats and the I-Sce I site. Excitingly, the 53BP1 focus assembly on the I-Sce I-induced DSB, as labeled by Cherry-Lac-repressor, was efficiently recovered only by the addition of RNA purified from NIH2/4 cells and not by RNA extracted from the NIH3T3 parental cell line (Figure 5c). This result indicates that DDR-focus formation requires an RNA component, which originates from the damaged genomic locus.
  • The MRE11/RAD50/NBS1 (MRN) complex is a key DNA damage sensor and a necessary cofactor of the apical DDR regulator ATM 1. Also MRE11 focus formation upon I-Sce I induction is sensitive to RNase A-treatment (Figure 29a). To probe the molecular mechanisms of action of RNAs at sites of DNA damage, the authors used mirin, a specific small molecule inhibitor of MRN 36 which, as expected, prevents ATM activation also following I-Sce I induction (Figure 29b). The authors therefore tested whether RNAs involved in DDR modulation engage MRN. The authors observed that in the presence of mirin, NIH2/4 RNA is unable to induce 53BP1 or pATM focus reformation (Figure 5d and e). This result demonstrates that RNAs at sites of DNA damage modulate DDR in a MRN-dependent manner.
  • To detect potential short RNAs originating from the integrated locus, the authors isolated nuclear RNA from parental NIH 3T3 cells transfected with the I-Sce I (mock), NIH 2/4 cells transfected with Cherry-Lac-repressor (uncut) and from NIH 2/4 cells transfected with the I-Sce I (cut) and further selected them for length (<200 nt) - this procedure enriches for RNAs active in DDR foci reformation 40 folds (data not shown). Libraries prepared from these samples were sequenced by Illumina GAII-X to obtain 15-32bp cDNA reads (Figure 30a-d). Their analyses revealed transcripts arising from the exogenous locus which were absent in the parental NIH 3T3 cells which had a length distribution of mapped tags peaking around 22nt, the length of canonical miRNAs (Figure 29e). Thus, even an exogenous integrated locus lacking mammalian transcriptional regulatory elements is transcribed and generates short RNA transcripts.
  • In order to test whether the short RNAs identified at the damaged locus are biologically active in DDR activation, the authors chemically synthesized four potential pairs of short RNAs as identified at the cut genomic locus by short RNA sequencing as described above and the authors used them to attempt DDR focus reformation in RNase A-treated cells carrying a DSB at the locus. By testing them over a large range of concentrations, the authors could demonstrate that the addition of these RNAs, but not equal amounts of control ones, promote site-specific DDR activation at the damaged site (Figure 6a). These chemically-synthesized short RNAs are biologically active both when added to the cells together with total RNA from parental cells (cells not carrying the integrated endogenous locus; Figure 6a) or with yeast tRNA (Figure 30f), thus in the absence of any additional mammalian RNA.
  • In addition, to prove the biological activity of locally generated DICER RNA products, the authors cloned the locus, and an unrelated control DNA, in a plasmid to allow its transcription in vitro by T7 polymerase and the authors processed the resulting RNAs with recombinant DICER protein in vitro. The resulting short RNAs (Figure 30g) were purified and tested in RNase A-treated cells. The authors observed that also these locus-specific DICER-generated RNAs, but not equal amounts of control RNAs, allow DDR focus reformation both when mixed with RNA from parental cells (Figure 6b) and when mixed with yeast tRNA (Figure 30h). Thus, in vitro generated DICER RNA products promote DDR focus reformation at the DNA damaged site in a sequence-specific manner.
  • Overall, these results indicate that short RNAs with the sequence of the damaged locus play a direct role in DDR activation at the damaged site.
  • In order to further investigate the nature of the RNAs generated at the locus, the authors performed deeper sequencing experiments of nuclear RNAs <200 nt from wildtype NIH 2/4 samples before and after cut using the Illumina Hi seq Version3 (Figure 31). To study the biogenesis of these RNAs, the authors also sequenced <200 nt nuclear RNAs from NIH 2/4 cells following Dicer or Drosha knockdown (WT uncut, Dicer KD uncut, Drosha KD uncut, WT cut, Dicer KD cut, Drosha KD cut) (Figure 32a). To ease normalization, each RNA preparation was spiked with a short RNA "spike" before library preparation. Reads were mapped to miRBase 18 and, after spike normalization, were demonstrated to be significantly reduced after Dicer or Drosha knockdown in uncut and cut samples when compared with wildtype uncut and cut samples respectively (Figure 32b). This validates the functional efficacy of the knockdowns performed.
  • By analyzing the locus, the authors found that in wildtype samples the bulk of RNAs from the locus were in the 22-23 nt size range (45.2% in WT uncut and 67.6% in the wildtype cut, Figure 6c and 33a). Fitting a negative binomial model to the sequence count data and application of the likelihood ratio test showed that this increase in the fraction of 22-23 nt vs total short RNAs in wildtype cut sample is statistically significant respect to the uncut sample (p = 0.020) (Figure 6c). Further, the authors found that the fraction of 22-23 nt vs total short RNAs at the locus decreases upon Dicer knockdown, both in the uncut (p = 4.8e-7) and cut (p = 0.029) conditions, suggesting that the 22-23 nt RNAs at the locus are indeed Dicer dependent (Figure 6c). The fraction of 22-23 nt vs total short RNAs at the locus also decreases upon Drosha knockdown.
  • To further exclude that the majority of tags arising from the locus were products of random degradation, the authors compared the fraction of 22-23 nt vs total RNAs at the locus to the same fraction at non-miRNA genomic loci - at such loci, any 22-23 nt RNAs are most likely products of random degradation or Dicer/Drosha independent enzymatic processing. The authors found that the fraction of 22-23 nt vs total short RNAs is significantly larger than the fraction found in non-miRNA genomic loci before cut (p = 0.049) and after cut (p = 0.022, Figure 33b).
  • Finally, the authors observed that the distribution of nucleotides at the 5' and the 3' end of RNA sequences from the locus is significantly different from both the genomic background nucleotide distribution (p=0.012 at the 5' end and 0.008 at the 3' end) as well as the background nucleotide distribution at the locus (p=0.014 at the 5' end and 1.2e-6 at the 3' end). Specifically, 82.9% sequences start with an A/U and 48.6% sequences end with a G (Figure 6d).
  • By these analyses the authors therefore conclude that 22-23 nt RNAs are the bulk of the RNA species detected at the locus, they depend on Dicer and, to an extent, on Drosha, and their proportion increases upon DNA damage. Their unlikelihood to be random degradation products is further indicated by their differential abundance compared to the rest of non-miRNA loci and the observed 5' and 3' base bias.
  • Sequence-specific inhibitory oligonuncleotides (LNAs) reduce DDR activation at a specific genetic locus.
  • The authors previously showed that DDRNAs identified by deep sequencing are biologically active and have a causative role in sequence-specific DDR focus reformation at the damaged site, following removal of all cellular RNAs by RNaseA treatment (Fig. 6a; Fig. 30f).
  • The authors next aimed to test whether DDRNA functions could be inactivated in living cells by sequence-specific Locked Nucleic Acids (LNA, modified DNA oligonucleotides avidly binding and inactivating complementary RNA species) (Jepsen et al., Oligonucleotides, 2004; Machlin et al., Curr Gene Ther., 2012).
  • The authors thus got 4 LNA molecules synthesized (Exiqon) with their sequence fully complementary to the individual DDRNAs they previously showed to be biologically active and able to restore DDR signaling and focus formation in RNaseA-treated cells (Fig. 6a; Fig. 30f). Given the repetitive DNA sequence structure of the locus, these are likely to anneal also to other DDRNAs generated at the locus (Fig. 34a).
  • Cells carrying the integrated locus were co-transfected with Cherry-Lac and I-Sce I-restriction endonuclease-expressing vectors and with either no LNA (sample 1), control LNA carrying an unrelated sequence which is not part of the locus (sample 2) or different sets of LNA (samples 3-7) (Fig. 34b). 24 hours post transfection, cells were fixed and stained for DDR markers. The authors analyzed the samples at the confocal microscope and scored as positive those cells that showed a DDR signal at the locus. As shown in Figure 34b, the portion of cells showing a specific yH2AX focus co-localizing with the Cherry-Lac signal was not significantly affected by the transfection of any LNA. This is consistent with the authors' data showing that any impairment of the biogenesis of DDRNAs or removal of RNAs by RNaseA treatment makes no significant impact on yH2AX (Fig. 1; Fig. 4 a,b,d,e; Fig. 5a). Differently, 53BP1 accumulation at the locus, a marker of activated DDR, is significantly reduced upon transfection of LNA with the sequence matching the DDRNAs (samples 3-6), compared to control LNA (sample 2) or to the same LNA inactivated (sample 7; Figure 34c). LNA were inactivated by annealing them to each other in vitro before transfection, thus becoming unable to bind and interfere with the action of other complementary nucleic acids. The decrease in 53BP1 accumulation was observed, to different extents, for all LNA sets tested (samples 3-6).
  • In summary, these results demonstrate that sequence-specific LNAs can specifically inactivate the known biological functions of DDRNAs.
  • Sequence-specific inhibitory oligonucleotides (i.e. LNAs) with a telomeric sequence reduce DDR activation at dysfunctional telomeres.
  • The authors previously showed that short RNAs with the sequence of a damaged locus (named DDRNAs) are necessary for DDR activation and maintenance specifically at that locus, upon ionizing radiations or endonuclease cleavage (Figs. 4,5). However, nothing is known about the role of DDRNAs at telomeres. Telomeres are the end of linear chromosomes, and they are protected by a protein complex named shelterin (de Lange, Genes Dev. 2005). Removal of this protection causes telomere uncapping, so telomeres are recognized as DNA DSBs. This may lead to DDR activation, cellular senescence, chromosomal fusions and genome instability (Sfeir and de Lange, Science 2012).
  • In order to investigate the role of DDRNA at dysfunctional telomeres, the authors used CRE-ER TRF2flox/flox mouse embryonic fibroblasts (MEFs) (Lazzerini Denchi and de Lange, Nature 2007). Cells were grown in presence of 4-hydroxytamoxifen to induce cre recombinase localization into the nucleus, thus generating a TRF2-knockout (TRF2-/-) cell line. TRF2 is one of the shelterin component and its removal induces a strong DDR activation at telomeres (Lazzerini Denchi and de Lange, Nature 2007). To test the role of DDRNA at the telomeres, we treated MEFs TRF2-/- with RNase A or BSA as a control. Consistent with the authors' previous results, they observed that yH2AX foci resist, while 53BP1 foci are sensitive to RNase A treatment (Fig. 35a-b). This suggests that, like all other DSB lesions, also at uncapped telomeres, DDRNAs with telomeric sequence are generated and they are necessary for DDR cascade activation.
  • Cells can accumulate damaged telomeres during ageing, due to telomeric shortening (Harley, Nature 1990; Herbig, Mol Cell 2004; d'Adda di Fagagna, Nature 2003) or to endogenous or exogenous DNA damage occurred at telomeres. DNA damage accumulate and DDR signaling persists at telomeres as they are not repairable (Fumagalli, Nat Cell Biol 2012). In both cases this persistent DDR activation at telomeres leads to cellular senescence. If DDRNAs are necessary for DDR at damaged telomeres, inhibiting their action could suppress DDR activation and potentially prevent or revert the senescence phenotype. To test this hypothesis, the authors used a human cell line, T19 fibrosarcoma cells, that express an inducible dominant negative (DN) allele of flag-tagged TRF2 (van Steensel, Cell 1998). The expression of this allele is induced culturing cells in the absence of doxycycline. After 7-8 days of DN TRF2 expression, telomeres are dysfunctional and cells show a strong DDR activation at telomeres (data not shown and van Steensel, Cell 1998). Induced cells, in which Flag-DN TRF2 was expressed, are positive for Flag immunostaining (Flag +). At day 13 from induction, the authors transfected T19 cells with LNA molecules with sequences complementary to either strands of telomeric DNA repeats (LNA 5 and 6) or an unrelated sequence as control (LNA 3, Cntrl). The authors observed that, with time, in Flag+ cells, both LNAs transfected individually with telomeric sequence decrease the percentage of 53BP1-positive cells, to a different extent, while control LNA had no effect (Fig. 36a). Importantly, in uninduced undamaged cells (Flag -), LNA molecules are not inducing any DNA damage, excluding that they can be genotoxic per se. Furthermore, the authors monitored the passage through S phase of cell cycle, looking at BrdU incorporation in induced T19 cells, three days after LNA transfection. The authors observed that Flag + cells, transfected with telomeric LNAs, proliferate significantly more than control cells (Fig. 36b), suggesting that LNA, by inactivating DDR at telomeres, can promote cell cycle reentry of cells otherwise activating a DNA-damage checkpoint and reducing BrdU incorporation. In contrast there is no significant difference in Flag - cells (Fig. 36c).
  • Here the authors show that different sources of DNA damage, including oncogenic stress, ionizing irradiation and PpoI or I-Sce I endonucleases engage the DDR in a manner dependent on DICER and DROSHA RNA products. These DDR-regulating RNAs (DDRNAs) control DDR-foci formation and maintenance, checkpoint enforcement and cellular senescence. This occurs both in cultured human and mouse cells and in different cell types in living zebrafish embryos.
  • Oncogene activation can trigger DDR and DDR-induced cellular senescence acts as tumor suppressive mechanism2,37. DICER inactivation enhances tumor development in a K-Ras-induced mouse model of lung cancer38,39 and inactivation of various components of DICER and DROSHA complexes stimulate cell transformation and tumorigenesis38. More recently, mutations of DICER and TARBP2, a DICER cofactor affecting its stability, have been described in human carcinomas40,41. However, individual microRNAs have been reported both to promote and to reduce cell proliferation by regulating stability and translation of mRNAs encoding proteins with different roles in cell proliferation18: it is therefore presently unclear how RNAi apparatus inactivation favors tumorigenesis. In the light of the authors' novel findings pointing to a role of DDRNAs in DDR control, a known tumor suppressive mechanism37, it is tempting to suggest that, in addition to their well-characterized functions in the modulation of gene expression, DICER and DROSHA RNA products may curb cancerous cell proliferation by sustaining DDR activation and this generates the selective pressure for the inactivation of factors involved in their biogenesis.
  • The authors also report that in an in vitro cellular system, DDR foci are lost in irradiated cells following RNase A treatment and that site-specific DDRNAs, even if generated by chemical synthesis or upon in vitro cleavage by recombinant DICER, are required to restore them. This suggests that DDRNAs are locally generated and favor the assembly of DDR factors in the shape of detectable DDR foci at the DNA damaged site. Indeed RNA sequencing confirmed the presence of short RNAs arising from the integrated exogenous locus which are induced upon cut. Comparison with short RNAs generated at other non miRNA genomic loci indicates that they are distinct from products of RNA degradation and their nucleotide bias at 5' end and 3' end indicates that these RNAs are processed at preferential RNA precursors sites.
  • Although at present how DDRNAs act to control DDR activation has not been elucidated in full, the observation that they act in a manner dependent on the MRN complex place them upstream of the canonical DDR signaling cascade.
  • Although novel and unanticipated, the authors' results are consistent with the emerging evidence supporting a role for RNA molecules in DDR. Indeed, an epistasis map generated in fission yeast has recently shown that DDR components display genetic interactions with the RNAi machinery56 and components of the large DROSHA complex have been identified in a ATM-dependent phosphoproteome screen57. In Drosophila, repeated DNA integrity is dependent on RNAi pathway58. In Saccharomyces cerevisiae and in Oxytricha Trifallax RNA orchestrates recombination and RNA can function as a template for DNA repair events in S. cerevisiae 59,60,61. It is also intriguing to observe that like several DDR factors, that are inactivated early in apoptosis in order to prevent DDR activation62, also DICER is specifically cleaved by caspases during apoptosis63. Recently, ATM has been shown to directly modulate the biogenesis of DICER and DROSHA RNA products by phosphorylating KSRP 64.
  • Finally, it is worth noticing that the here-described novel functions of components of the RNAi machinery in the modulation of the response to DNA damage are consistent with its well-established and evolutionary-conserved role of preserving genome integrity from viral invaders, transposons and retroelements 65.
  • REFERENCES
    • 1 Jackson, S. P. & Bartek, J. Nature 461, 1071-1078 (2009).
    • 2 d'Adda di Fagagna, F. ).
    • 3 Clark, M. B. et al. ).
    • 4 Wilusz, J. E., Sunwoo, H. & Spector, D. L. ).
    • 5 Guttman, M. et al. Nature 458, 223-227 (2009).
    • 6 Drinnenberg, I. A. et al. Science 326, 544-550 (2009).
    • 7 Clemson, C. M. et al. Mol ).
    • 8 Wutz, ).
    • 9 Orom, U. A. et al. ).
    • 10 Wang, X. et al. Nature 454, 126-130 (2008).
    • 11 Zhao, J., et al. Science 322, 750-756 (2008).
    • 12 Calabrese, J. M., et al. Proc Natl ).
    • 13 Sun, B. K., Deaton, A. M. & Lee, J. T. ).
    • 14 Berezikov, E. Nature reviews. ).
    • 15 Farazi, T. A., Juranek, S. A. & Tuschl, T. Development 135, 1201-1214 (2008).
    • 16 Lee, H. C. et al. Nature 459, 274-277 (2009).
    • 17 Kim, V. N., Han, J. & Siomi, M. C. Nat Rev ).
    • 18 Esquela-Kerscher, A. & Slack, F. J. ).
    • 19 He, L., He, X., Lowe, S. W. & Hannon, G. J. ).
    • 20 Di Micco, R. et al. Nature 444, 638-642 (2006).
    • 21 Bartkova, J. et al. Nature 444, 633-637 (2006).
    • 22 Narita, M. et al. Cell 113, 703-716 (2003).
    • 23 White, S. A. & Allshire, R. C. Curr Top Microbiol Immunol 320, 157-183 (2008).
    • 24 Zhang, H., et al. Cell 118, 57-68 (2004).
    • 25 Cummins, J. M. et al. Proc Natl Acad Sci USA 103, 3687-3692 (2006).
    • 26 Cescutti, R., et al. ).
    • 27 Wei, Y., Yu, L., Bowen, J., Gorovsky, M. A. & Allis, C. D. Cell 97, 99-109 (1999).
    • 28 Nicoli, S. et al. Nature 464, 1196-1200 (2010).
    • 29 Wienholds, E., et al., ).
    • 30 Maison, C. et al. ).
    • 31 Pryde, F. et al. J Cell Sci 118, 2043-2055 (2005).
    • 32 Flick, K. E., et al. Nature 394, 96-101 (1998).
    • 33 Berkovich, E., ).
    • 34 lacovoni, J. S. et al. ).
    • 35 Soutoglou, E. et al. ).
    • 36 Dupre, A. et al. ).
    • 37 Halazonetis, T. D., Gorgoulis, V. G. & Bartek, J. Science 319, 1352-1355 (2008).
    • 38 Kumar, M. S., et al. Nat Genet 39, 673-677 (2007).
    • 39 Kumar, M. S. et al. ).
    • 40 Hill, D. A. et al. Science 325, 965 (2009).
    • 41 Melo, S. A. et al. Nat Genet 41, 365-370 (2009).
    • 42 Mudhasani, R. et al. J Cell Biol 181, 1055-1063 (2008).
    • 43 Tang, K. F. et al. J Cell Biol 182, 233-239 (2008).
    • 44 Kumar, M. S. et al. ).
    • 50 Muchardt, C. et al. ).
    • 51 Eskeland, R., Eberharter, A. & Imhof, A. ).
    • 52 Ayoub, N., et al., Nature 453, 682-686 (2008).
    • 53 Murga, M. et al. J Cell Biol 178, 1101-1108 (2007).
    • 54 Bakkenist, C. J. & Kastan, M. B. Nature 421, 499-506 (2003).
    • 55 Goodarzi, A. A. et al. Mol ).
    • 56 Roguev, A. et al. Science 322, 405-410 (2008).
    • 57 Bensimon, A. et al. ).
    • 58 Peng, J. C. & Karpen, G. H. ).
    • 59 Derr, L. K. & Strathern, J. N. Nature 361, 170-173 (1993).
    • 60 Nowacki, M. et al. Nature 451, 153-158 (2008).
    • 61 Storici, F., et al. Nature 447, 338-341 (2007).
    • 62 Smith, G. C., et al., ).
    • 63 Ghodgaonkar, M. M. et al. Cell Death Differ 16, 858-868 (2009).
    • 64 Zhang, X., Wan, G., Berger, F. G., He, X. & Lu, X. Mol Cell 41, 371-383 (2011).
    • 65 Hannon, G. J. RNA interference. Nature 418, 244-251 (2002).
    • 66 Duchaine, T. F. et al. Cell 124, 343-354 (2006).
    • 67 Sidi, S. et al. Cell 133, 864-877 (2008).
    • 68 Kawano, M. et al. Biotechniques 49, 751-755 (2010).
    • 69 Jepsen JS, Sorensen MD, and Wengel J. (2004). Oligonucleotides, 14(2): 130-46.
    • 70 Machlin ES, Sarnow P, and Sagan SM. (2012). Curr Gene Ther,12(4):301-6.
    • 71 Lazzerini Denchi, E and de Lange T (2007). Nature, 448, 1068-1071
    • 72 van Steensel B, Smogorzewska A and de Lange T (1998). Cell, 92 (3), 401-413
    • 73 de Lange T (2005) Gen Dev 19 (18), 2100-2110
    • 74 Sfeir A et al, (2009) Cell 138 (1), 90-103
    • 75 Harley CB, Futcher AB and Greider CW (1990) Nature 345, 458-460
    • 76 Herbig U, et al. (2004)
    • 77 d'Adda di Fagagna F et al. (2003) Nature 426, 194-198
    • 78 Fumagalli, M. et al. (2012)
    • 79 Michalik, K.M. et al (2012). Nucleic Acid Res. 40: 9596-603
    • 80 Limmer K, Aschenbrenner D, Gaub HE (2013) Nucleic Acids Res. 41(6):e69
    • 81 Wei et al, (2012) Cell 149(1):101-12
    • 82 Blazkova H et al (2010). J Cell Mol Med. 2010 Jan;14(1-2):357-67.
    • 83 Anglana M et al (1999). Nucleic Acids Res. 1999
    • 84. Serrano M et al (2007). Nat Rev Mol Cell Biol. Sep;8(9):715-22.
    • 85. Calado RT et al (2009). N. Engl J Med. 361:2353-2365
    SEQUENCE LISTING
    • <110> Fondazione Istituto FIRC di Oncologia Molecolare-IFOM
      d'Adda di Fagagna, Fabrizio
      Michelini, Flavia
      Rossiello, Francesca
      Francia, Sofia
    • <120> RNA PRODUCTS AND USES THEREOF
    • <130> PCT 120246
    • <150> US61/645285
      <151> 2012-05-10
    • <160> 62
    • <170> PatentIn version 3.5
    • <210> 1
      <211> 58
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 1
      ccggccacac atcttcaaga cttaactcga gttaagtctt gaagatgtgt ggtttttg   58
    • <210> 2
      <211> 22
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 2
      agtagattac cactggagtc tt   22
    • <210> 3
      <211> 57
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 3
      ccgggcctca cttgacctga agtatctcga gatacttcag gtcaagtgag gcttttt   57
    • <210> 4
      <211> 58
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 4
      ccggcctgga atatgtccac actttctcga gaaagtgtgg acatattcca ggtttttg   58
    • <210> 5
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 5
      gagagcagau gauccuuua   19
    • <210> 6
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 6
      ggacaagucu cucagcuau   19
    • <210> 7
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 7
      gauaucagcu uagacaauu   19
    • <210> 8
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 8
      ggacagaacc cgcagauuu   19
    • <210> 9
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 9
      gaauguugcu uucugaauu   19
    • <210> 10
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 10
      agacagaauu cccaaauaa   19
    • <210> 11
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 11
      uauaucaccu guuuguuag   19
    • <210> 12
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 12
      aggaggagcu ugggccuuu   19
    • <210> 13
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 13
      uaaaguagcu ggaaugaug   19
    • <210> 14
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 14
      ggaagaggcu gacuaugaa   19
    • <210> 15
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 15
      gaauaucgau ccuauguuc   19
    • <210> 16
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 16
      gauccuaugu ucaaucuaa   19
    • <210> 17
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 17
      caacauagac uacacgauu   19
    • <210> 18
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 18
      ccaacucccu cgaggauua   19
    • <210> 19
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 19
      ggccaacugu uauagaaua   19
    • <210> 20
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 20
      gaguaggcuu cgugacuua   19
    • <210> 21
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 21
      gaaaugcucu gguccgcua   19
    • <210> 22
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 22
      gccuaaauau uggugauua   19
    • <210> 23
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 23
      gcacugcccu gauccgaua   19
    • <210> 24
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 24
      ggaauuaagu cgucgucau   19
    • <210> 25
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 25
      cuauuaaccu cgccaauua   19
    • <210> 26
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 26
      gguaaguccu ccauugaug   19
    • <210> 27
      <211> 19
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 27
      ccgugaaagu uuaacguuu   19
    • <210> 28
      <211> 21
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 28
      aacacuuguc acuacuuucu c   21
    • <210> 29
      <211> 23
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 29
      cauucuaucc ucuagaggau gtt   23
    • <210> 30
      <211> 23
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 30
      ttguaagaua ggagaucucc uac   23
    • <210> 31
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 31
      ttcattgtgg gagcagac   18
    • <210> 32
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 32
      cagcagtttc tccagagc   18
    • <210> 33
      <211> 24
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 33
      agcaacacag agatctcaaa catt   24
    • <210> 34
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 34
      gcaaagcagg gcttttcat   19
    • <210> 35
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 35
      tgttccagga agaccaggtt   20
    • <210> 36
      <211> 23
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 36
      actatccctc aaacactctg gaa   23
    • <210> 37
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 37
      ggcccgagag ccttttatag   20
    • <210> 38
      <211> 22
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 38
      tgcacacgtc taactcttcc ac   22
    • <210> 39
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 39
      cagccagtca gaaagcagtg   20
    • <210> 40
      <211> 23
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 40
      tgtgagtcca ggatctgcta ctt   23
    • <210> 41
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 41
      gcaaggaatg gactctgagc   20
    • <210> 42
      <211> 21
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 42
      ggggacttcg atatcctctt c   21
    • <210> 43
      <211> 25
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 43
      cgtctctaga aaggtcctac aagaa   25
    • <210> 44
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 44
      ggctcaggag caactggtaa   20
    • <210> 45
      <211> 24
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 45
      auaacaauuu guggaauucg gcgc   24
    • <210> 46
      <211> 22
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 46
      cgaauuccac aaauuguuau cc   22
    • <210> 47
      <211> 32
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 47
      auuuguggaa uucggcgccu cuagagucga gg   32
    • <210> 48
      <211> 17
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 48
      ccucgacucu agaggcg   17
    • <210> 49
      <211> 30
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 49
      agcggauaac aauuuguggc cacaugugga   30
    • <210> 50
      <211> 17
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 50
      uguggccaca aauuguu   17
    • <210> 51
      <211> 32
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 51
      acucccuauc agugauagag aaaagugaaa gu   32
    • <210> 52
      <211> 32
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 52
      cuuucacuuu ucucuaucac ugauagggag ug   32
    • <210> 53
      <211> 21
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 53
      guucagcgug uccggcgagu u   21
    • <210> 54
      <211> 21
      <212> RNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 54
      cucgccggac acgcugaacu u   21
    • <210> 55
      <211> 73
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 55
      Figure imgb0002
    • <210> 56
      <211> 73
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 56
      Figure imgb0003
    • <210> 57
      <211> 22
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 57
      ttatccgctc acaattccac at   22
    • <210> 58
      <211> 22
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 58
      atgtggaatt gtgagcggat aa   22
    • <210> 59
      <211> 21
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 59
      actgataggg agtggtaaac t   21
    • <210> 60
      <211> 21
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 60
      agagaaaagt gaaagtcgag t   21
    • <210> 61
      <211> 21
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 61
      ccctaaccct aaccctaacc c   21
    • <210> 62
      <211> 21
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> synthetic
    • <400> 62
      gggttagggt tagggttagg g   21

Claims (19)

  1. An in vitro method to inhibit the DNA damage response in a mammalian cell damaged in at least one sequence-specific genomic locus, wherein the DNA damage occurs at telomeres and/or is caused by a sequence-specific DNA endonuclease, wherein the method comprises inhibiting the function and/or impairing the production of small RNAs (DDRNAs), said small RNAs being generated in cis by processing by DICER and/or DROSHA of a RNA transcript synthesized using the specific damaged genomic locus as template for transcription, wherein inhibiting the function of DDRNAs and/or impairing the production thereof is performed by a sequence-specific inhibitory oligonucleotide that specifically binds to said small RNAs (DDRNAs).
  2. The method according to claim 1 further comprising the step of exposing said cell to a DNA damaging treatment.
  3. The method according to claim 2 wherein the DNA-damaging treatment belongs to the group of: radiotherapy, chemotherapy, for instance hydroxyurea treatment or bleomycin treatment, a treatment that impairs DNA repair, or any genotoxic treatment.
  4. An in vitro method for sensitizing a mammalian cell to DNA damage in at least one sequence-specific genomic locus, wherein the DNA damage occurs at telomeres and/or is caused by a sequence-specific DNA endonuclease, wherein the method comprises:
    a) inhibiting the function and/or impairing the production of small RNAs (DDRNAs), said small RNAs being generated in cis by processing by DICER and/or DROSHA of a RNA transcript synthesized using the specific damaged genomic locus as template for transcription, wherein inhibiting the function of DDRNAs and/or impairing the production thereof is performed by a sequence-specific inhibitory oligonucleotide that specifically binds to said small RNAs (DDRNAs);
    b) exposing said cell to an effective amount of the DNA-damaging treatment,
    wherein step a) and step b) are performed in any order.
  5. The method according to claim 4 wherein the DNA-damaging treatment is a radiotherapy.
  6. The method according to any one of the previous claims wherein the mammalian cell is damaged by a genotoxic event, preferably the genotoxic event belongs to the group of: cellular transformation, cellular senescence, oncogene activation, DNA replication stress, reactive oxygen species, ionizing radiation, chemotherapeutic agents, for instance bleomycin, or telomere shortening, damaged telomere, dysfunctional telomere, viral integration in the genome, viral infection or bacterial infection.
  7. The method according to any one of the previous claims wherein the sequence-specific inhibitor oligonucleotide is a LNA molecule, a 2'-O-Methyl-modified oligonucleotide or a phosphorothioate-modified oligonucleotide.
  8. The method of any one of the previous claims wherein the mammalian cell is a human cell, preferably the cell is a pre-cancerous cell, a cancer cell, a senescent cell or a virally-infected cell, preferably the senescent cell has critically short and/or damaged and/or dysfunctional telomeres.
  9. An inhibitor of small RNAs (DDRNAs), said small RNAs being generated in cis by processing by DICER and/or DROSHA of a RNA transcript synthesized following DNA damage in at least one sequence-specific genomic locus in a cell, wherein the DNA damage occurs at telomeres and/or is caused by a sequence-specific DNA endonuclease, wherein said RNA transcript is synthesized using the specific damaged genomic locus as template for transcription, wherein said inhibitor is a sequence-specific inhibitory oligonucleotide that specifically binds to said small RNAs (DDRNAs), for use as a medicament.
  10. The inhibitor for use according to claim 9 for the treatment of a condition induced by the sequence-specific damaged genomic locus, preferably the condition is cancer and/or aging and/or a viral infection, preferably aging is associated with critically short and/or damaged and/or dysfunctional telomeres.
  11. The inhibitor for use according to any of claims 9 to 10 being a LNA molecule, a 2'-O-Methyl-modified oligonucleotide or a phosphorothioate-modified oligonucleotide.
  12. The inhibitor for use according to claim 9, wherein the oligonucleotide inhibits the DNA damage response in the cell at the damaged sequence-specific genomic locus.
  13. The inhibitor for use according to claim 9 wherein the inhibitor sensitizes the cell to the effect of a DNA-damaging treatment, said use further comprising the step of exposing said cell to an effective amount of the DNA-damaging treatment.
  14. A pharmaceutical composition comprising the inhibitor as defined in any one of claims 9 to 13 for use as a medicament.
  15. A method to detect the presence of damage to DNA in a sequence-specific genomic locus in a cell comprising the steps of:
    a) detecting the presence of small RNAs (DDRNAs), said small RNAs being generated in cis by processing by DICER and/or DROSHA of a RNA transcript synthesized using the specific damaged genomic locus as template for transcription in said cell;
    b) comparing the result to a control cell with undamaged DNA genomic locus.
  16. A method to identify the genomic location of a damage to DNA in a sequence-specific genomic locus in a cell comprising the steps of:
    a) isolating and/or purifying small RNAs (DDRNAs) from a sample, said small RNAs being generated in cis by processing by DICER and/or DROSHA of a RNA transcript synthesized using the specific damaged genomic locus as template for transcription in said cell;
    b) sequencing said isolated and/or purified small RNAs (DDRNAs).
  17. An in vitro method to quantify the DNA damage in a specific genomic locus in a cell or an in vitro method for the diagnosis and/or prognosis of a condition associated with and/or induced by the generation of DNA damage in at least one sequence specific genomic locus or an in vitro method for monitoring the efficacy of therapy directed to a condition associated with and/or induced by the generation of DNA damage in at least one sequence specific genomic locus in a subject comprising the steps of:
    a) measuring the amount of small RNAs (DDRNAs), said small RNAs being generated in cis by processing by DICER and/or DROSHA of a RNA transcript synthesized using the specific damaged genomic locus as template for transcription in said cell;
    b) comparing the result to a proper control.
  18. The method according to claim 17 wherein the condition associated with and/or induced by the generation of DNA damage in at least one sequence specific genomic locus is selected from the group consisting of: cancer, aging, viral infection, preferably aging is associated with critically short and/or damaged and/or dysfunctional telomeres.
  19. A method of screening for an agent able to inhibit small RNAs (DDRNAs), said small RNAs being generated in cis by processing by DICER and/or DROSHA of a RNA transcript synthesized using the specific damaged genomic locus as template for transcription in a cell comprising the step of measuring the amount of said small RNAs upon exposure of the cell to said agent, and comparing to a proper control.
EP13721970.5A 2012-05-10 2013-05-10 Rna products and uses thereof Active EP2847332B1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261645285P 2012-05-10 2012-05-10
PCT/EP2013/059753 WO2013167744A1 (en) 2012-05-10 2013-05-10 Rna products and uses thereof

Publications (2)

Publication Number Publication Date
EP2847332A1 EP2847332A1 (en) 2015-03-18
EP2847332B1 true EP2847332B1 (en) 2019-08-28

Family

ID=48428478

Family Applications (1)

Application Number Title Priority Date Filing Date
EP13721970.5A Active EP2847332B1 (en) 2012-05-10 2013-05-10 Rna products and uses thereof

Country Status (4)

Country Link
US (3) US9708606B2 (en)
EP (1) EP2847332B1 (en)
ES (1) ES2754309T3 (en)
WO (1) WO2013167744A1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3124609A1 (en) * 2015-07-29 2017-02-01 IFOM Fondazione Istituto Firc di Oncologia Molecolare Therapeutics oligonucleotides
EP3650546A1 (en) 2015-07-29 2020-05-13 IFOM Fondazione Istituto Firc di Oncologia Molecolare Therapeutic oligonucleotides

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB201012845D0 (en) * 2010-07-30 2010-09-15 Vib Vzw Inhibition of dicer function for treatment of cancer

Non-Patent Citations (22)

* Cited by examiner, † Cited by third party
Title
"Telomere - A Complex End of a Chromosome", 23 November 2016, INTECH, article ALEJANDRO D. BOLZÁN: "Telomere Instability Induced by Anticancer Drugs in Mammalian Cells", XP055399010, DOI: 10.5772/64928 *
ANGELA RIZZO ET AL: "Identification of novel RHPS4-derivative ligands with improved toxicological profiles and telomere-targeting activities", JOURNAL OF EXPERIMENTAL & CLINICAL CANCER RESEARCH, BIOMED CENTRAL LTD, LONDON UK, vol. 33, no. 1, 6 October 2014 (2014-10-06), pages 81, XP021200484, ISSN: 1756-9966, DOI: 10.1186/S13046-014-0081-X *
B. L. PIKE ET AL: "Mdt1 Facilitates Efficient Repair of Blocked DNA Double-Strand Breaks and Recombinational Maintenance of Telomeres", MOLECULAR AND CELLULAR BIOLOGY., vol. 27, no. 18, 15 September 2007 (2007-09-15), US, pages 6532 - 6545, XP055382883, ISSN: 0270-7306, DOI: 10.1128/MCB.00471-07 *
BARTKOVA JIRINA ET AL: "DNA damage response as a candidate anti-cancer barrier in early human tumorigenesis", NATURE, NATURE PUBLISHING GROUP, UNITED KINGDOM, vol. 434, no. 7035, 1 April 2005 (2005-04-01), pages 864 - 870, XP002444321, ISSN: 0028-0836, DOI: 10.1038/NATURE03482 *
DARZYNKIEWICZ Z ET AL: "Impaired DNA damage response - An Achilles' heel sensitizing cancer to chemotherapy and radiotherapy", EUROPEAN JOURNAL OF PHARMACOLOGY, ELSEVIER SCIENCE, NL, vol. 625, no. 1-3, 25 December 2009 (2009-12-25), pages 143 - 150, XP026762256, ISSN: 0014-2999, [retrieved on 20091018], DOI: 10.1016/J.EJPHAR.2009.05.032 *
DOUGLAS M. MCCARTY ET AL: "Integration of Adeno-Associated Virus (AAV) and Recombinant AAV Vectors", ANNUAL REVIEW OF GENETICS., vol. 38, no. 1, 1 December 2004 (2004-12-01), US, pages 819 - 845, XP055279778, ISSN: 0066-4197, DOI: 10.1146/annurev.genet.37.110801.143717 *
GRAEME HEWITT ET AL: "Telomeres are favoured targets of a persistent DNA damage response in ageing and stress-induced senescence", NATURE COMMUNICATIONS, vol. 3, 28 February 2012 (2012-02-28), pages 708, XP055399004, DOI: 10.1038/ncomms1708 *
HANH T Q NGUYEN ET AL: "The DNA sequence specificity of bleomycin cleavage in telomeric sequences in human cells", JBIC JOURNAL OF BIOLOGICAL INORGANIC CHEMISTRY, SPRINGER, BERLIN, DE, vol. 17, no. 8, 9 September 2012 (2012-09-09), pages 1209 - 1215, XP035144900, ISSN: 1432-1327, DOI: 10.1007/S00775-012-0934-8 *
J. SEO ET AL: "Genome-wide profiles of H2AX and -H2AX differentiate endogenous and exogenous DNA damage hotspots in human cells", NUCLEIC ACIDS RESEARCH, vol. 40, no. 13, 29 March 2012 (2012-03-29), GB, pages 5965 - 5974, XP055300006, ISSN: 0305-1048, DOI: 10.1093/nar/gks287 *
M. PORRU ET AL: "Targeting G-Quadruplex DNA Structures by EMICORON Has a Strong Antitumor Efficacy against Advanced Models of Human Colon Cancer", MOLECULAR CANCER THERAPEUTICS, vol. 14, no. 11, 24 August 2015 (2015-08-24), pages 2541 - 2551, XP055399001, ISSN: 1535-7163, DOI: 10.1158/1535-7163.MCT-15-0253 *
MARY ARMANIOS: "Syndromes of Telomere Shortening", ANNUAL REVIEW OF GENOMICS AND HUMAN GENETICS, vol. 10, no. 1, 1 September 2009 (2009-09-01), US, pages 45 - 61, XP055300003, ISSN: 1527-8204, DOI: 10.1146/annurev-genom-082908-150046 *
MARZIA FUMAGALLI ET AL: "Telomeric DNA damage is irreparable and causes persistent DNA-damage-response activation", NATURE CELL BIOLOGY, 1 April 2012 (2012-04-01), England, pages 355, XP055399007, Retrieved from the Internet <URL:http://www.nature.com/ncb/journal/v14/n4/pdf/ncb2466.pdf> [retrieved on 20170816], DOI: 10.1038/ncb2466 *
MURRAY VINCENT ET AL: "The Sequence Specificity of the Anti-tumour Drug, Cisplatin, in Telomeric DNA Sequences Compared with Consecutive Guanine DNA Sequences", ANTI-CANCER AGENTS IN MEDICINAL CHEMISTRY, BENTHAM SCIENCE PUBLISHERS LTD, NL, vol. 12, no. 3, 1 March 2012 (2012-03-01), pages 177 - 181, XP008185674, ISSN: 1871-5206, DOI: 10.2174/187152012800228742 *
NELSON STEPHANIE M ET AL: "DNA and the chromosome - varied targets for chemotherapy", CELL & CHROMOSOME, BIOMED CENTRAL LTD, LONDON, GB, vol. 3, no. 1, 24 May 2004 (2004-05-24), pages 2, XP021010624, ISSN: 1475-9268, DOI: 10.1186/1475-9268-3-2 *
NICOLA CROSETTO ET AL: "Nucleotide-resolution DNA double-strand break mapping by next-generation sequencing", HHS PUBLIC ACCESS AUTHOR MANUSCRIPT, vol. 10, no. 4, 17 March 2013 (2013-03-17), GB, pages 361 - 365, XP055257938, ISSN: 1548-7091, DOI: 10.1038/nmeth.2408 *
RAFFAELLA DI MICCO ET AL: "Oncogene-induced senescence is a DNA damage response triggered by DNA hyper-replication", NATURE, vol. 444, no. 7119, 30 November 2006 (2006-11-30), United Kingdom, pages 638 - 642, XP055300005, ISSN: 0028-0836, DOI: 10.1038/nature05327 *
SCAGLIONI LEONARDO ET AL: "Nemorubicin and doxorubicin bind the G-quadruplex sequences of the human telomeres and of the c-MYC promoter element Pu22", BIOCHIMICA ET BIOPHYSICA ACTA (BBA) - GENERAL SUBJECTS, ELSEVIER, AMSTERDAM, NL, vol. 1860, no. 6, 23 February 2016 (2016-02-23), pages 1129 - 1138, XP029511138, ISSN: 0304-4165, DOI: 10.1016/J.BBAGEN.2016.02.011 *
SILAHTAROGLU A ET AL: "LNA-modified oligonucleotides are highly efficient as FISH probes", CYTOGENETIC AND GENOME RESE, ALLERTON PRESS, NEW YORK, NY, US, vol. 107, no. 1-2, 1 January 2004 (2004-01-01), pages 32 - 37, XP008144161, ISSN: 1424-8581, DOI: 10.1159/000079569 *
SUZANNE M CUTTS ET AL: "Sequence Specificity of Adriamycin-DNA Adducts in Human Tumor Cells", MOLECULAR CANCER THERAPEUTICS, vol. 2, 1 July 2003 (2003-07-01), pages 661 - 670, XP055399060, ISSN: 1535-7163 *
Y ZHANG ET AL: "Down-modulation of cancer targets using locked nucleic acid (LNA)-based antisense oligonucleotides without transfection", GENE THERAPY, vol. 18, no. 4, 23 December 2010 (2010-12-23), GB, pages 326 - 333, XP055412231, ISSN: 0969-7128, DOI: 10.1038/gt.2010.133 *
Y. CHEN ET AL: "VirusSeq: software to identify viruses and their integration sites using next-generation sequencing of human cancer tissue", BIOINFORMATICS, vol. 29, no. 2, 15 January 2013 (2013-01-15), pages 266 - 267, XP055197282, ISSN: 1367-4803, DOI: 10.1093/bioinformatics/bts665 *
YE BU ET AL: "Knockdown of Dicer in MCF-7 human breast carcinoma cells results in G1 arrest and increased sensitivity to cisplatin", ONCOLOGY REPORTS, 1 January 2009 (2009-01-01), Greece, pages 13, XP055383784, Retrieved from the Internet <URL:https://www.spandidos-publications.com/or/21/1/13/download> DOI: 10.3892/or_00000183 *

Also Published As

Publication number Publication date
US20180066251A1 (en) 2018-03-08
US9708606B2 (en) 2017-07-18
WO2013167744A1 (en) 2013-11-14
ES2754309T3 (en) 2020-04-16
EP2847332A1 (en) 2015-03-18
US20150119448A1 (en) 2015-04-30
US20190211331A1 (en) 2019-07-11
US10240154B2 (en) 2019-03-26

Similar Documents

Publication Publication Date Title
Michelini et al. Damage-induced lncRNAs control the DNA damage response through interaction with DDRNAs at individual double-strand breaks
Chu et al. The EZH2–PHACTR2–AS1–ribosome axis induces genomic instability and promotes growth and metastasis in breast cancer
Ugalde et al. Aging and chronic DNA damage response activate a regulatory pathway involving miR-29 and p53
Takakura et al. Oncogenic role of miR‐17‐92 cluster in anaplastic thyroid cancer cells
US10865252B2 (en) Lin28-mediated control of let-7 biogenesis
US9464289B2 (en) Methods of inhibiting Alu RNA and therapeutic uses thereof
US20090209621A1 (en) Compositions and methods for decreasing microrna expression for the treatment of neoplasia
US12152241B2 (en) Targeting human satellite II (HSATII)
Bilsland et al. MicroRNA and senescence: the senectome, integration and distributed control
Luo et al. Negative correlation of ITCH E3 ubiquitin ligase and miRNA-106b dictates metastatic progression in pancreatic cancer
WO2016149612A2 (en) Assay for telomere length regulators
Durso et al. Chemical modifications in the seed region of miRNAs 221/222 increase the silencing performances in gastrointestinal stromal tumor cells
US20190211331A1 (en) Rna products and uses thereof
EP3904518A1 (en) Pharmaceutical composition for preventing or treating cancer, comprising tut4/7 expression modulator
US20240425866A1 (en) Parn as a biomarker and therapeutic target
Rosso BETting on ALTeRNAtives: targeting telomeric dilncRNA and BET proteins in ALT cancer
Michelini A NEW CLASS OF NON-CODING RNA CONTROLS THE DNA DAMAGE RESPONSE AND DNA REPAIR
Min et al. Mechanisms of insertions at a DNA double-strand break [preprint]
Mao Interplay between regulation of promoter proximal pausing, BRCA1 and PARP inhibitor, and their effects on G-MiDS
Sfaxi et al. Uncoupling from transcription protects polyadenylation site cleavage from inhibition by DNA damage
Aguado Perez THE ROLE OF TELOMERIC RNA AT DYSFUNCTIONAL TELOMERES AND ITS IMPACT ON SENESCENCE AND AGING
Kim Estrogen Regulation of miR-9-5p and miR-9-3p Stability and Localization in the Aging Female Brain
Vallejo Rodríguez Understanding the role of E2F7 in the regulation of cellular proliferation and DNA damage responses.
Buemi Telomerase regulation by non-coding RNAs
Dinami Telomere regulation by microRNAs in human breast cancer

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20141203

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20160414

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: GRANT OF PATENT IS INTENDED

INTG Intention to grant announced

Effective date: 20190328

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE PATENT HAS BEEN GRANTED

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

REG Reference to a national code

Ref country code: DE

Ref legal event code: R096

Ref document number: 602013059714

Country of ref document: DE

REG Reference to a national code

Ref country code: AT

Ref legal event code: REF

Ref document number: 1172445

Country of ref document: AT

Kind code of ref document: T

Effective date: 20190915

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: NV

Representative=s name: DENNEMEYER AG, CH

REG Reference to a national code

Ref country code: NL

Ref legal event code: FP

REG Reference to a national code

Ref country code: LT

Ref legal event code: MG4D

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: NO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20191128

Ref country code: SE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

Ref country code: BG

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20191128

Ref country code: LT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

Ref country code: HR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

Ref country code: FI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

Ref country code: PT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20191230

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: AL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

Ref country code: LV

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

Ref country code: IS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20191228

Ref country code: RS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20191129

REG Reference to a national code

Ref country code: AT

Ref legal event code: MK05

Ref document number: 1172445

Country of ref document: AT

Kind code of ref document: T

Effective date: 20190828

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: TR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

REG Reference to a national code

Ref country code: ES

Ref legal event code: FG2A

Ref document number: 2754309

Country of ref document: ES

Kind code of ref document: T3

Effective date: 20200416

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: AT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

Ref country code: RO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

Ref country code: PL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

Ref country code: EE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

Ref country code: DK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20200224

Ref country code: SM

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

Ref country code: SK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

Ref country code: CZ

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

REG Reference to a national code

Ref country code: DE

Ref legal event code: R097

Ref document number: 602013059714

Country of ref document: DE

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

PG2D Information on lapse in contracting state deleted

Ref country code: IS

26N No opposition filed

Effective date: 20200603

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MC

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20200510

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20200510

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

Ref country code: CY

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

P01 Opt-out of the competence of the unified patent court (upc) registered

Effective date: 20230530

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190828

REG Reference to a national code

Ref country code: DE

Ref legal event code: R082

Ref document number: 602013059714

Country of ref document: DE

Representative=s name: KRAUS & LEDERER PARTGMBB, DE

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: NL

Payment date: 20250521

Year of fee payment: 13

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: DE

Payment date: 20250521

Year of fee payment: 13

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: GB

Payment date: 20250521

Year of fee payment: 13

Ref country code: ES

Payment date: 20250627

Year of fee payment: 13

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: IT

Payment date: 20250417

Year of fee payment: 13

Ref country code: BE

Payment date: 20250521

Year of fee payment: 13

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: FR

Payment date: 20250528

Year of fee payment: 13

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: CH

Payment date: 20250601

Year of fee payment: 13