EP2788477A2 - Identification of a swine parecho-like virus and applications - Google Patents
Identification of a swine parecho-like virus and applicationsInfo
- Publication number
- EP2788477A2 EP2788477A2 EP12797926.8A EP12797926A EP2788477A2 EP 2788477 A2 EP2788477 A2 EP 2788477A2 EP 12797926 A EP12797926 A EP 12797926A EP 2788477 A2 EP2788477 A2 EP 2788477A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- spelv
- polynucleotide
- sequence
- virus
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/32011—Picornaviridae
- C12N2770/32022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/32011—Picornaviridae
- C12N2770/32511—Parechovirus, e.g. human parechovirus
- C12N2770/32521—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/32011—Picornaviridae
- C12N2770/32511—Parechovirus, e.g. human parechovirus
- C12N2770/32522—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/32011—Picornaviridae
- C12N2770/32511—Parechovirus, e.g. human parechovirus
- C12N2770/32534—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Definitions
- Picornaviruses are non-enveloped, positive-stranded RNA viruses with an icosahedral capsid. They are usually grouped in the Picornaviridae family, which encompasses a great number of different genera and includes many important pathogens of humans and animals.
- the picornavirus genome RNA comprises a large open reading frame encoding a large polypeptide precursor and is bordered by two non-coding sequences. The polyprotein precursor then gives different mature viral capsid proteins by proteolytic cleavage.
- the 5' non-coding sequence is important for viral replication, while the role of the 3' non-coding region is not well characterized.
- Parechovirus is a viral gen us in the fami ly Picornaviridae.
- the gen us is composed of two species: Human parechovirus and Ljungan virus.
- h u man parech ovi ru s h ave been id entified : h u man parechovirus 1 (formerly echovirus 22), human parechovirus 2 (formerly echovirus 23), and human parechoviruses 3 to 14 (Benshop KS et al, J. Gen Virol 2010).
- They display the characteristic structure of the viruses of the family Picornaviridae. In particular, they have a single-stranded RNA genome of positive polarity encoding a polyprotein precursor, which is then matured into the capsid proteins VP1 to VP3 (Stanway and Hyypia, J. Virol., 1999; Williams et al., J. Gen. Virol., 2009).
- LV has been implicated with diabetes and intrauterine fetal death in human (Niklasson B, birth Defects Res. A. Clin. Mol. Teratol 2007; Niklasson B, Int. J. Exp. Diabesity. Res. 2003).
- LV infection has been linked with intrauterine fetal death (IUFD), malformations, placental inflammation, myocarditis, encephalitis, and Guillain-Barre syndrome (Niklasson B. et al, Forensic. Sci. Med. Pathol. 2009; Niklasson B. et al, Birth Defects Res. A. Clin. Mol. teratol. 2009; Samsioe A.
- Figure 1 A to I depicts the mapping of the 9 contigs of SEQ ID NO:29 to 37 with the amino acid reference sequence of LV (NCBI accession:21309880 AF327922 - Protein id: AAM46081 )(NCBI BlastX). As can be seen, large regions of each coding gene have been sequenced.
- Figures 2 and 3 depict SPeLVI VP1 nucleotide alignment with the closest known VP1 from HPeVs and LV.
- VP1 s have been extracted from the best BLASTP hit between SPeLVI polyprotein and other parechoviruses and Ljungan Virus fully annotated polyproteins (except for H PeVI O and H PeV1 1 were only VP 1 was available).
- Fig u re 4 represents the phylogenetic tree of the SPeLVI with in the Picornaviridae family.
- SPeLVI Single Parechovirus-l i ke vi ru s 1
- HPEV1 human parechovirus type 1
- the present invention thus provides an isolated polynucleotide wherein said polynucleotide is a virus genome sharing at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identity with the sequence represented by SEQ ID NO: 1 .
- the said polynucleotide is the SPeLVI virus genome, represented by SEQ ID NO: 1 .
- the present invention also relates to the SPeLV virus genome, in a recombinant form (meaning that the virus displays at least one modification from naturally occurring virus), to the SPeLV virus genome in the form of complementary sequence of SEQ I D NO: 1 , or even to the SPeLV virus genome in the form of complete cDNA of SEQ ID NO: 1 .
- the invention also encompasses parts of said SPeLV virus genome as defined above comprising at least 100, 200 or 500 consecutive nucleotides of the sequence as defined above (SEQ ID NO: 1 , complementary sequence thereof or cDNA thereof).
- the invention also relates to an SPeLV viral particle containing the said SPeLV virus genome.
- the genome of the parechoviruses contains a large open reading frame encoding a polyprotein precursor.
- the present invention thus relates to a polynucleotide comprising an open reading frame encoding the large polyprotein of the SPeLVI genome.
- said open reading frame comprises a sequence sharing at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identity with the sequence represented by SEQ ID NO: 2.
- the said polynucleotide encodes a polyprotein precursor displaying at least 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% identity with the polyprotein precursor of SPeLVI , whose sequence is represented by SEQ I D NO: 3.
- the said polynucleotide encodes the SPeL1 polyprotein precursor of SEQ ID NO: 3.
- the present invention provides the large polyprotein precursor of SPeLVI , said polyprotein precursor being encoded by a polynucleotide sequence sharing at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identity with the sequence represented by SEQ ID NO: 2.
- the present invention provides the large polyprotein precursor of SPeLVI , said polyprotein precursor comprising an amino acid sequence displaying at least 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 96%, 97%, 98%, 99% , 99.5%, 99.9% identity with the polyprotein of SPeLVI , whose sequence is represented by SEQ ID NO: 3.
- the said polyprotein precursor comprises an amino acid sequence of SEQ ID NO: 3.
- the polyprotein precursor of parechoviruses is matured by proteolytic cleavage into 3 viral capsid proteins, designated VP1 , VP2 and VP3.
- the present invention also relates to the capsid protein VP1 of SPeLVI and to a polynucleotide sequence encoding said VP1 protein.
- VP1 is specifically important for tropism as, within the Picornaviridae family, it mediates interactions with the cell receptor(s).
- VP1 is also a major target of antibodies, including neutralizing and opsonizing antibodies and thus is fundamental for medical application as it is the main candidate for the development of vaccines and serological tests.
- the said VP1 capsid protein is encoded by a polynucleotide sequence displaying at least 50% , 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90% , 92.5% , 95% , 96% , 97% , 98% , 99% , 99.5% , 99.9% i d entity with th e polynucleotide sequence represented by SEQ I D NO: 4.
- the polynucleotide has the sequence of SEQ ID NO: 4.
- the invention also relates to a polynucleotide sequence encoding a VP 1 protein, said polynucleotide sequence displaying at least 50% , 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% identity with the polynucleotide sequence represented by SEQ ID NO: 4.
- the polynucleotide has the sequence of SEQ ID NO: 4.
- the said a VP1 capsid protein comprises a sequence displaying at least 50 %, 55 %, 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% identity with the amino acid sequence represented by the sequence SEQ ID NO: 5.
- the invention also relates to a polynucleotide sequence encoding a VP 1 protein, said polynucleotide sequence displaying at least 50% , 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% identity with the polynucleotide sequence represented by SEQ ID NO: 4.
- the polynucleotide has the sequence of SEQ ID NO: 4.
- the present invention also relates to the VP1 protein in association with at least one protein obtained by proteolytic cleavage from the polyprotein.
- the said protein is VP2.
- the said protein is VP3.
- the VP1 protein is associated with both the VP2 and the VP3 protein.
- sequence identity refers to the identity between two peptides or between two nucleic acids. I dentity between sequences can be determined by comparing a position in each of the sequences which may be aligned for the purposes of comparison. When a position in the compared sequences is occupied by the same base or amino acid, then the sequences are identical at that position. A degree of sequence identity between nucleic acid sequences is a function of the number of identical nucleotides at positions shared by these sequences. A degree of identity between amino acid sequences is a function of the number of identical amino acid sequences that are shared between these sequences. Since two polypeptides may each (i) comprise a sequence (i.e.
- a portion of a complete polynucleotide sequence) that is similar between two polynucleotides, and (ii) may further comprise a sequence that is divergent between two polynucleotides, sequence identity comparisons between two or more polynucleotides over a "comparison window" refers to the conceptual segment of at least 20 contiguous nucleotide positions wherein a polynucleotide sequence may be compared to a reference nucleotide sequence of at least 20 contiguous nucleotides and wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e. gaps) of 20 percent or less compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
- the sequences are aligned for optimal comparison. For example, gaps can be introduced in the sequence of a first amino acid sequence or a first nucleic acid sequence for optimal alignment with the second amino acid sequence or second nucleic acid sequence.
- the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, the molecules are identical at that position.
- sequences can be the same length or can be different in length.
- Optimal alignment of sequences for determining a comparison window may be conducted by the local homology algorithm of Smith and Waterman (J. Theor. Biol., 1981 ), by the homology alignment algorithm of Needleman and Wunsch (J. Mol. Biol, 1972), by the search for similarity via the method of Pearson and Lipman (Proc. Natl. Acad. Sci. U.S.A., 1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetic Computer Group, 575, Science Drive, Mad ison , Wisconsin) or by inspection. The best alignment (i.e. resulting in the highest percentage of identity over the comparison window) generated by the various methods is selected.
- sequence identity means that two polynucleotide or polypeptide sequences are identical (i.e. on a nucleotide by nucleotide or an amino acid by amino acid basis) over the window of comparison.
- percentage of sequence identity is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g. A, T, C, G, U , or 1 ) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e. the window size) and multiplying the result by 100 to yield the percentage of sequence identity.
- the same process can be applied to polypeptide sequences.
- the percentage of sequence identity of a nucleic acid sequence or an amino acid sequence can also be calculated using BLAST software (Version 2.06 of September 1998) with the default or user defined parameter.
- sequence similarity means that amino acids can be modified while retaining the same function. It is known that amino acids are classified according to the nature of their side groups and some amino acids such as the basic amino acids can be interchanged for one another while their basic function is maintained.
- the SPeLV virus of the invention is likely to infect human beings, especially young children. This is all the more relevant since the virus of the invention appears to be present in the general pig population. It is therefore important to be capable of detecting the presence or not of the SPeLV virus of the invention in pig as well as in human beings, in particular in young children. Detection of the SPeLV virus in pregnant women would be also crucial in order to monitor the risk of vertical transmission from the mother to the child.
- the invention thus relates to an in vitro method of detection of a SPeLV virus in a subject, comprising the step a) of determining the presence of the SPeLV virus in a biological sample of the said subject.
- a “biological sample” may be any sample that may be taken from a subject, and thus includes, but is not limited to, for example, blood, serum, plasma, sputum, urine, stool, skin, cerebrospinal fluid, saliva, gastric secretions, semen, seminal fluid, breast milk, and tears.
- a sample can be obtained by an oropharyngeal swab, nasopharyngeal swab, throat swab, nasal aspirate, nasal wash, fluid collected from the ear, eye, mouth, or respiratory airway, spinal tissue or fluid, cerebral fluid, trigeminal ganglion sample, a sacral ganglion sample, adipose tissue, lymphoid tissue, placental tissue, upper reproductive tract tissue, gastrointestinal tract tissue, male genital tissue and fetal central nervous system tissue.
- a sample can also be a pool of individual samples, especially those made during the process of manufacturing of biological samples obtained from h umans (blood or urine derived products, for exam ple), or any intermediate product sampled during the manufacturing of such products. Such sample must allow the determination of the presence of SPeLV through the methods of the invention.
- the presence of the SPeLV virus may be determined by any technology known to a person skilled in the art.
- the SPeLV virus may be detected at the genomic and/or nucleic and/or protein level.
- the method according to the invention may thus comprise another preliminary step, between the taking of the sample from the patient and step a) as defined above, corresponding to the transformation of the biological sample into a genomic DNA sample, or into an mRNA (or corresponding cDNA) sample, or into a protein sample, which is then ready to use for in vitro detection of SPeLV in step a).
- the detection of the SPeLV virus may be performed, depending on the type of transformation and the available ready-to-use sample, either at the genomic DNA (i .e. based on the presence of at least one sequence consisting of at least a part of the SPeLV genome as defined above), mRNA (i.e. based on the mRNA content of the sample) or at the protein level (i.e. based on the protein content of the sample).
- Methods for detecting a genomic nucleic acid in a biological sample include inter alia hybridization with a labeled probe, genomic PCR, nucleic microarrays, high- throughput sequencing, and all other methods known to the person of skills in the art.
- the amount of nucleic acid transcripts can be measured by any technology known by the skilled person . I n particular, the measure may be carried out directly on an extracted messenger RNA (mRNA) sample, or on retrotranscribed complementary DNA (cDNA) prepared from extracted mRNA by technologies well-known in the art. From the mRNA or cDNA sample, the amount of nucleic acid transcripts may be measured using any technology known by a person skilled in the art, including nucleic microarrays, quantitative PCR, and hybridization with a labeled probe.
- mRNA messenger RNA
- cDNA retrotranscribed complementary DNA
- the presence of the said virus is determined by hybridization of probes specific for the said virus or parts thereof with the biological sample.
- amplification and/or sequencing of the SPeLV sequences is performed in order to assess the presence of the said virus.
- the presence of the SPeLV virus is determined by detecting the polyprotein produced by the single open reading frame, or the VP1 capsid protein.
- Another object of the invention therefore relates to a probe capable of hybridizing to the genomic DNA of SPeLV. By "probe capable of hybridizing", one should understand that the said probe is substantially complementary to at least part of the SPeLV virus genome.
- the said probe comprises a nucleotide sequence displaying at least 50 %, 55 %, 65 %, 70 %, 75 %, 80 %, 85 %, 87.5 %, 90 %, 92.5 %, 95 %, 96 %, 97 %, 98 %, 99 %, 99.5 %, 99.9 % identity with at least a part of a sequence of the genomic DNA of SPeLV (SEQ ID NO:1 ).
- the probe of the invention comprises at least 12 nucleotides, more preferably at least 15 nucleotides, even more preferably at least 20 nucleotides.
- the method of the invention is performed by hybridization with the probes of the invention. Detection of a hybridization signal is thus indicative of the presence of a SPeLV virus in the biological sample. It is advantageous to use labeled probes in this embodiment.
- the present invention also includes primers specific for the SPeLV virus.
- the said primers have the sequences as laid out in SEQ ID NOs: 6-29.
- the said primers can be used for amplification of specific regions of the SPeLV virus of the invention .
- the amplification may be carried out directly on genomic DNA, on an extracted messenger RNA (mRNA) sample, or on retrotranscribed complementary DNA (cDNA) prepared from extracted mRNA by technologies well-known in the art.
- the said primers of the invention can also be used for sequencing the SPeLV virus. Alternatively, the said SPeLV virus is detected by high-throughput sequencing.
- An embodiment of the present invention thus provides a method of detection of an SPeLV virus comprising a step of amplification and/or sequencing of the said virus using the primers of the invention.
- amplification or sequencing of nucleic acid using the primers of the invention is indicative of the presence of the SPeLV virus in the said sample.
- sequencing it is within the scope of the invention to detect SPeLV in samples, or to screen for SPeLV in biological materials, with deep sequencing technics, such as pyro-sequencing.
- the said method of detection can be used for detecting a virus homologous to SpeLV in a species other than pig, in particular in man.
- the SPeLV virus When the SPeLV virus is detected at the protein level , it may be notably performed using specific antibodies.
- the invention thus also encompasses antibodies directed against the SpeLV virus and their use in detecting the said virus.
- the antibodies of the invention are capable of recognizing specifically the SPeLV VP1 protein.
- the SPeLV protein has the sequence represented by SEQ ID NO: 5.
- the antibodies of the invention can be used for detecting of the SpeLV virus by using in particular well known technologies such as cell membrane staining using biotinylation or other equivalent techniques followed by immunoprecipitation with specific antibodies, western blot, ELISA or ELISPOT, antibodies microarrays, or tissue microarrays coupled to immunohistochemistry.
- suitable techniques include FRET or BRET, single cell microscopic or histochemistery methods using single or multiple excitation wavelength and applying any of the adapted optical methods, such as electrochemical methods (voltametry and amperometry techniques), atomic force microscopy, and radio frequency methods, e.g.
- the invention also provides recombinant vectors comprising at least the polynucleotide of the invention as defined above.
- the polynucleotide of the invention may be inserted into a replicable vector for cloning (amplification of the DNA) or for expression.
- a replicable vector for cloning (amplification of the DNA) or for expression.
- Various vectors are publicly available.
- the vector may, for example, be in the form of a plasmid, cosmid, viral particle, or phage.
- the appropriate nucleic acid sequence may be inserted into the vector by a variety of procedures.
- Vector components generally include, but are not limited to, one or more of a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence. Construction of suitable vectors containing one or more of these components employs standard ligation techniques which are known to the skilled artisan. Thus, it is within the scope of the invention to provide a vector for expressing any of the above defined polypeptides.
- the polynucleotides encoding said proteins are inserted into expression vectors such that the genes are operatively linked to transcriptional and translational sequences.
- Expression vectors include plasmids, YACs, cosmids, retrovirus, adenovirus, EBV-derived episomes, and all the other vectors that the skilled man will know to be convenient for ensuring the expression of the protein of interest.
- Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Such sequences are well known for a variety of bacteria, yeast, and viruses.
- the origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2 ⁇ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning vectors in mammalian cells.
- Expression and cloning vectors will typically contain a selection gene, also termed a selectable marker.
- Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, methotrexate, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g., the gene encoding D-alanine racemase for Bacilli.
- Polynucleotides of the invention and vectors comprising these molecules can be used for the transformation of a suitable host cell. Transformation can be performed by any known method for introducing polynucleotides into a cell host. Such methods are well known of the man skilled in the art and include dextran-mediated transformation, calcium phosphate precipitation, polybrene-mediated transfection, protoplast fusion, electroporation, encapsulation of the polynucleotide into liposomes, biolistic injection and direct microinjection of DNA into nuclei. Therefore, the invention also encompasses a host cell comprising a vector of the invention.
- the said host cell is a bacterial cell; more preferably, it is a eukaryotic cell; even more preferably it is a mammalian cell.
- the nature of the host cell will be dictated by the intended use of the vector of the invention .
- a cloning vector will usually be maintained and propagated in bacterial cells.
- stable expression is preferred.
- cell lines which stably express the protein of the invention may be engineered.
- host cells can be transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker.
- appropriate expression control elements e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.
- engineered cells may be allowed to grow for 1 -2 days in an enriched media, and then are switched to a selective media.
- the selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method may advantageously be used to engineer cell lines which express the SPeLV protein of the invention.
- Such engineered cell lines may be particularly useful in screening and evaluation of compounds that interact directly or indirectly with the said SPeLV protein.
- the proteins of the invention may be prepared by growing a culture transformed host cells under culture conditions necessary to express the desired protein . The resulting expressed protein may then be purified from the culture medium or cell extracts. Soluble forms of the protein of the invention can be purified from conditioned media. Membrane-bound forms of protein of the invention can be purified by preparing a total membrane fraction from the expressing cell and extracting the membranes with a non-ionic detergent such as Triton X-100.
- the proteins can be purified using methods known to those skilled in the art.
- the proteins of the invention can be concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit.
- the concentrate can be applied to a purification matrix such as a gel filtration medium.
- a purification matrix such as a gel filtration medium.
- an anion exchange resi n can be em ployed , for exam ple, a matrix or su bstrate havi n g pen da nt diethylaminoethyl (DEAE) or polyetheyleneimine (PEI) groups.
- the matrices can be acrylamide, agarose, dextran, cellulose or other types commonly employed in protein purification.
- a cation exchange step can be employed .
- Suitable cation exchangers include various insoluble matrices comprising sulfopropyl or carboxymethyl groups. Sulfopropyl groups are preferred (e.g. , S-Sepharose B columns).
- the purification of the MU-1 protein from culture supernatant may also include one or more column steps over such affinity resins as concanavalin A-agarose, heparin-Toyopearl or Cibacrom blue 3GA Sepharose B; or by hydrophobic interaction chromatography using such resins as phenyl ether, butyl ether, or propyl ether; or by immunoaffinity ch romatography.
- RP-HPLC reverse-phase h igh performance liqu id chromatography
- Affinity columns including antibodies to the protein of the invention can also be used in purification in accordance with known methods. Some or all of the foregoing purification steps, in various combinations or with other known methods, can also be employed to provide a substantially purified isolated recombinant protein.
- the isolated protein of the invention is purified so that it is substantially free of other mammalian proteins. It is thus also an aspect of the invention to provide a method for producing a recombinant SPeLV protein of the invention.
- the method of the invention comprises the steps of: (a) introducing a nucleic acid encoding the recombinant SPeLV protein into one of the host cell described above;
- SPeLV protein it is herein referred to a protein directly encoded by the open reading frame of the swine virus of the invention, or a cleavage product thereof.
- the SpeLV protein of the invention can be the polyprotein precursor, or any of the capsid proteins VP1 , VP2, or VP3.
- the SPeLV protein of the invention is a protein having the amino acid sequence represented by SEQ ID NO: 3, or a cleavage product thereof, such as for example the protein having the sequence of SEQ ID NO:5.
- Proteins of the invention may be used to screen for agents which are capable of binding to the said protein. Binding assays using a desired binding protein, immobilized or not, are well known in the art and may be used for this purpose using the protein of the invention. Purified cell based or protein based (cell free) screening assays may be used to identify such agents.
- the SpeLV virus is the etiological agent of a number of human pathological conditions, including intrauterine fetal death (I U F D), malformations, placental inflammation, myocarditis, encephalitis, Guillain-Barre syndrome, and diabetes mellitus type 1 .
- the present invention also provides a method of i nd ucing neutral izing antibodies against the SPeLV virus in a mammal, comprising the administration of a vaccinal SPeLV composition.
- the present invention is drawn to a vaccinal SPeLV composition, for its use inducing neutralizing antibodies against the SPeLV virus in a mammal.
- the vaccinal SpeLV composition of the invention is for preventing intrauterine fetal death (I UFD), malformations, placental inflammation, myocarditis, encephalitis, Guillain-Barre syndrome, and diabetes mellitus type 1 .
- the vaccinal SpeLV composition of the invention is for preventing diabetes mellitus type 1 .
- the present invention also relates to a vaccinal S PeLV composition .
- vaccinal SpeLV composition it is herein referred to a composition comprising vaccinal SPeLV virus and/or at least one SpeLV protein of the invention and/or at least one polynucleotide encoding an SPeLV protein of the invention.
- a "vaccinal SPeLV virus” is an SPeLV virus which is capable of inducing one or more immune responses against SpeLVI , as well as any other existing, but not yet identified, SpeLV serotype.
- Immune responses according to the present invention include the humoral immune response and the cellular immune response.
- a vaccinal SPeLV virus according to the invention is capable of inducing neutralizing . opsonizing antibodies or antibodies mediating Antibody Dependant Cell Cytotoxicity against SpeLVI , as well as any other existing, but not yet identified, SpeLV serotype.
- vaccinal SPeLV virus viruses such as inactivated SPeLV virus, attenuated SpeLV virus, and chimeric SPeLV virus.
- An SPeLV virus is "inactivated” if it is unable to replicate to any significant degree in cells permissive for replication of wild-type SPeLV virus.
- An SPeLV virus which can replicate in a permissive cell but only to a degree significantly lower than a wild-type SPeLV virus is an "attenuated SPeLV virus”.
- a "chimeric SPeLV virus” is a non- SPeLV virus which has been genetically engineered to express one or more SPeLV envelope proteins.
- the vaccinal SPeLV composition of the invention may also comprise an SPeLV protein of the invention.
- the vaccinal SPeLV composition of the invention may comprise the polyprotein precursor or the capsid proteins, VP1 , VP2 or VP3, or any combination of these 4 polypeptides.
- the vaccinal SPeLV composition of the invention may also comprise at least one polynucleotide encoding an SPeLV polypeptide. It is possible to administer the polynucleotide of the invention to the said subject using gene therapy techniques.
- the vaccinal composition of the invention may contain the SPeLV virus.
- th e vacci n al com position of th e i nvention may com prise th e polynucleotide of the invention carried by a vector suitable for administration to a patient.
- Such vectors may be either derived from a virus or from a non-viral origin.
- Non-viral vectors include plasmids.
- a plasmid may be a conditionally replicating plasmid that is incapable of replicating in the patients for safety reasons.
- These plasm ids may be based on the plasmids described i n the patent PCT applications WO 97/10343 and WO 2009/027351.
- Naked plasmid DNA can be directly injected into muscle cells (Wolff et al, Science, 1990) or attached to gold particles that are bombarded into the tissue (Cheng et al, Proc. Natl. Acad. Sci. U.S.A, 1993). Though not very efficient, this can result in prolonged low level expression in vivo.
- the plasmid DNA can also be transfected into the cell with the use of non-viral gene delivery vectors, termed "self-assembled" systems, based on cationic molecules, which form spontaneous complexes with negatively charged nucleic acids (Eliyahu et al., Molecules, 2005).
- the vector is a viral vector.
- the recombinant viral vectors can transduce the cell type it would normally infect.
- the nonessential genes are provided in trans, either integrated into the genome of the packaging cell line or on a plasmid.
- viruses such as poxvirus, adenovirus, adeno-associated virus (AAV), lentivirus, or herpes si mplex virus 1 (HSV1 ), are available for gene therapy. All of them are encompassed within this invention.
- Adenoviral vectors are currently the most frequently used viral vectors in gene therapy in humans.
- third-generation (or "gutless") adenoviral vectors (Lindermann and Thomasler, Thromb. Haemost., 2009) is preferred for the use in the present invention. Said vectors need not be detailed here, since the skilled person is fully aware of the characteristics and uses of said adenoviral vectors.
- the AAV used for treating a neuromuscular disease according to the invention is preferentially an AAV1 , i.e. its capside is of the serotype 1 .
- AAV1 has been shown to be the most efficient for muscle cells transduction.
- the sequences of a viral origin, and in particular the ITRs, associated to the transgene are preferably of AAV2 origin .
- the resulting AAV-based vector of the invention has, preferentially, a 2/1 pseudotype.
- AAV6, AAV8 or AAV9 also effectively transduce striated muscle cells, while AAV5 is highly efficient in transducing neural cells in the brain (Markakis et al., Molecular Therapy, 2010); all of them can therefore be used successfully in the context of the invention.
- AAV-based vectors Like adenoviral vectors, the AAV-based vectors have already been used extensively by the skilled person for gene therapy purposes (see e.g. Michelfelder and Trepel, Adv Genet., 2009); there is thus no need for detailing methods for constructing and using the said AAV vectors.
- the skilled person may use a lentiviral vector to deliver the proteins of the invention.
- the said lentiviral is a self-inactivating (SI N) lentivirus.
- the lentiviral vector genome comprises, as an inserted c/s-acting fragment, at least one polynucleotide consisting in the DNA flap (Zennou et al ., Cell, 101 : 1 73-185, 2000; WO 99/55892; WO 01 /27304; WO 2009/019612) or containing such DNA flap.
- the DNA flap is inserted upstream of the polynucleotide of interest, advantageously but not necessarily to be located in an approximate central position in the vector genome.
- any lentiviral vector can be used in the context of the present invention .
- the construction and the manipulation of lentiviral vectors are well known to the skilled person.
- poxvirus refers to a virus belonging to the Poxviridae family.
- poxvirus according to the invention may be obtained from canarypox (e.g. ALVAC as described in WO 95/27780), fowlpox (e.g. TROVAC as described in Paoletti et al., Dev. Biol. Stand. 1995) or vaccinia virus, the latter being preferred.
- Suitable vaccinia viruses include without limitation the Copenhagen strain (Goebel et al., Virol. 1990a and 1990b; Johnson et al., Virol. 1993), the Wyeth strain, NYVAC (see WO 92/15672 and Tartaglia et al., Virol. 1992) and the highly attenuated modified Ankara (MVA) strain (Mayr et al., Infection 1975).
- the basic techniques for inserting the nucleic acid molecule and associated regulatory elements required for expression in a poxviral genome are already available to the person of skills in the art (Paul et al., Cancer Gene Ther. 2002; Piccini et al., Methods Enzymol 1987; US 4,769,330; US 4,772,848; US 4,603,1 12; US 5,100,587; and US 5,179,993).
- a "vaccinal composition” is a composition comprising an immunoeffective quantity of an antigen sufficient to induce a specific immune response against a pathogen in an immunocompetent mammal.
- the immune response according to the invention comprises the synthesis of neutralizing antibodies
- mammal comprises individuals of the mammalian family, including cow, dogs, horse, primates, pigs, rabbits, cats, and humans.
- the mammals of the invention are humans.
- the protein or polynucleotide or SPeLV virus is preferably formulated in the vaccinal composition in an effective amount.
- An "effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired result, i.e., to immunize effectively the patient.
- An effective amount as meant herein should also not have any toxic or detrimental severe effects.
- the vaccinal SPeLV compositions of the invention comprise, in addition to the SPeLV protein or SPeLV polynucleotide or SPeLV virus, one or more pharmaceutically acceptable excipients.
- Suitable excipients are well known in the art. Suitable excipients are typically large, slowly metabolized macromolecules such as proteins, saccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, sucrose (Paoletti et a/., Vaccine, 19: 21 18, 2001 ), trehalose (WO 00/56365), lactose and lipid aggregates (such as oil droplets or liposomes). Such carriers are well known to those of ordinary skill in the art.
- the vaccines may also contain diluents, such as water, saline, glycerol, etc. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present. Sterile pyrogen-free, phosphate buffered physiologic saline is a typical carrier. A thorough discussion of pharmaceutically acceptable excipients is available in reference Gennaro, 2000, Remington: The Science and Practice of Pharmacy, 20.sup.th edition.
- the vaccinal SPeLV composition of the invention may contain, in addition to the carrier and SPeLV protein or SPeLV polynucleotide or SPeLV virus, various diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art.
- the vaccinal SPeLV composition of the invention may optionally comprise one or more adjuvants to enhance the immunogenicity of the said composition in a mammal.
- Suitable adjuvants include an aluminum salt such as aluminum hydroxide gel or aluminum phosphate or alum, but may also be a salt of calcium, magnesium, iron or zinc, or may be an insoluble suspension of acylated tyrosine, or acylated sugars, cationically or anionically derivatized saccharides, or polyphosphazenes.
- the adjuvant may be an oil-in-water emulsion adjuvants (EP 0 399 843B), as well as combinations of oil in water emulsions and other active agents (WO 95/1721 0; WO 98/56414; WO 99/12565; WO 99/1 1241 ).
- oil emulsion adjuvants have been described, such as water-in-oil emulsions (U.S. Pat. No. 5,422, 109; EP 0 480 982 B2) and water-in-oil-in- water emulsions (U .S. Pat. No. 5,424,067; EP 0 480 981 B1 ).
- the adjuvant examples include MF59, AF03, AF04, AF05, AF06 and derivatives thereof.
- the adjuvant may be a saponin, lipid A or a derivative thereof, an immunostimulatory oligonucleotide, an alkyl glucosamide phosphate, an oil in water emulsion or combinations thereof.
- saponins include Quil A and purified fragments thereof such as QS7 and QS21 .
- the protein or polynucleotide or SPeLV virus of the invention is administered to a mammal, preferably a human, in a pharmaceutically acceptable dosage form such as those discussed above.
- administrations may include injection via the intramuscular, intraperitoneal, intradermal, transcutaneous or subcutaneous routes; or via mucosal administration to the oral/alimentary, respiratory, genitourinary tracts.
- Th us one aspect of the present disclosure is a method of immunizing a human host against a disease caused by infection of SpeLV virus, which method comprises administering to the host an immunoprotective dose of the vaccinal SPeLV composition of the present disclosure.
- the present invention also includes kits for achieving immunization against SpeLV-related conditions, e.g. intrauterine fetal death (IUFD), malformations, placental inflammation, myocarditis, encephalitis, Guillain-Barre syndrome, or diabetes mellitus type 1 .
- the kit according to the invention comprises at least one vaccinal SPeLV composition as described above.
- the kit of the invention therefore comprises at least one container holding the at least one vaccinal SPeLV composition.
- the kit of the invention may also advantageously contain an explanatory brochure including useful information for administration of the said compositions.
- the vaccinal compositions wh ich may be used in the kit accordi ng to the invention i nclude the vacci nal compositions described herein in relation to the method of immunization according to the invention. If the vaccinal compositions are provided in lyophilized form, the kit will advantageously comprise at least one additional container holding a solution which can be used to reconstitute a lyophilized vaccinal composition suitable for administration by intradermal , transcutaneous, subcutaneous , or i ntram uscu lar ad m i n istration . Pharmaceutically acceptable diluents and carriers may be used for reconstitution.
- the examples that follow are merely exemplary of the scope of this invention and content of this disclosure. One skilled in the art can devise and construct numerous modifications to the examples listed below without departing from the scope of this invention.
- Nucleic acid samples extracted from feces taken from two healthy pigs have been screened. These nucleic acids have been amplified by the bacteriophage phi29 polymerase based multiple displacement amplification (MDA) assay using random primers. The ligation and amplification were performed with the QuantiTect® Whole Transcriptome kit (Qiagen) according essentially to the manufacturer's instructions. This provides concateners of high molecular weight DNA. Resulting DNAs from the two pigs were pooled.
- MDA multiple displacement amplification
- Sequencing was conducted by an lllumina HiSeq 2000 sequencer. 5 ⁇ g of high molecular weight DNA resulting from isothermal amplification was fragmented into 200 to 350 nt fragments, to which were ligated adapters. 27146966 reads of 96 nt were derived from the sample.
- Sorting out the flow of l llumina sequences was first done by a subtractive database comparison procedure. To this end, the whole host genome sequence (Sus scrofa, ref: susScr2) was scanned with the reads using SOAPaligner (remaining 24834733 reads). A number of assembly programs dedicated to short or medium- sized reads (Velvet, SOAPdenovo, CLC) have been tested for their efficiency in our pipeline. Optimal parameters have been set. The comparison of the single reads and contigs with already known genomic and taxonomic data was done on generalist databases maintained locally (nt, nrprot). The aforementioned databases were scanned using BLASTN and BLASTX. Binning (or taxonomic assignment) was based on the best hits among reads with a significant e-value. 2. Results
- SPeLVI SPeLV type 1
- a set of 12 primer pairs encompassing the whole target genome was defined (table 1 ).
- the primers allowed to amplify 6057 nt of the genome by PCR, corresponding to around 80 % of the genome, which was sequenced by a conventional Sanger method.
- the figure 3 shows the SPeLVI sequenced genome. The quasi-full length sequence of the large polyprotein was obtained.
- the polyprotein is encoded by a single open reading frame that encompasses all the RNA genome, except the 5' and 3' untranslated regions (UTRs).
- the figure 4 shows the nucleotide sequence of the major part of the polyprotein of SPeLVI .
- the figure 5 corresponds to the deduced amino acid sequences of the polyprotein of SPeLV 1 .
- the figure 6 shows the seq uence of VP 1 of SPeLVI translated from its nucleotide sequence: the probable NH2 and COOH ends have been deduced by homology with the other viruses of the Parechovirus genus. Nucleotide and amino acid alignments with the closest known VP1 from the HPeVs and LV are shown in figure 7 and 8 respectively.
- the sequence identity with LV is 45.6% (nt) or 29.1 % (aa.).
- the sequence identity of SPeLVI with the closest HPeV type is 44.7% (nt -HpeV2-) or 26.7% (aa.-HPeV1 -) (table 2). Alignment of this protein with other representatives of the H PeVs and LV by MUSCLE using curation by G-Blocks allowed to generate a phylogenetic tree using PhymL (Phylogeny package)(figure 9).
- the SPeLVI VP1 is devoid of RGD motif at the C terminus of the protein.
- a RGD motif is present in HPeV1 , 2,4,5 and 6 but is lacking in HPeV3, 7 and 8. This motif is important for virus entry in cells through interaction with alpha v beta 5 and alpha v beta 3 integrins.
- the receptor of HPeV 3, 7 and 8 is yet unknown (Seitsonen J, J. of Virology, 2010).
- VP1 of SPELV1 could reflect similar tropism than HPeV 3, which is the main HPeV found in Central Nervous Disease-related disease (Verboon-Maciolek MA, Ann. Neurol.2008, Abed Y., Emerg. Infect. Dis.2006).
- VP1s have been extracted from the best blastp hit between SPeLVI polyprotein and other parechoviruses and Ljungan Virus fully annotated polyproteins (except for HPeVIOand HPeV11 were only VP1 was available).
- herd # 03 another herd for which stools samples were available.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention relates to SPe LV, a swine parechovirus-likerelated to the Ljungan virus (LV) and human parechovirus (HPeV). The present invention also relates to new proteinsencoded by SPeLV, which displays some homology with LV and HPeV capsid proteins. Also provided are methods for raising immune responses against SPeLV in a subject.
Description
IDENTIFICATION OF A SWINE PARECHO-like VIRUS AND APPLICATIONS
INTRODUCTION
Picornaviruses are non-enveloped, positive-stranded RNA viruses with an icosahedral capsid. They are usually grouped in the Picornaviridae family, which encompasses a great number of different genera and includes many important pathogens of humans and animals. The picornavirus genome RNA comprises a large open reading frame encoding a large polypeptide precursor and is bordered by two non-coding sequences. The polyprotein precursor then gives different mature viral capsid proteins by proteolytic cleavage. The 5' non-coding sequence is important for viral replication, while the role of the 3' non-coding region is not well characterized.
Parechovirus is a viral gen us in the fami ly Picornaviridae. The gen us is composed of two species: Human parechovirus and Ljungan virus.
Fou rteen types of h u man parech ovi ru s h ave been id entified : h u man parechovirus 1 (formerly echovirus 22), human parechovirus 2 (formerly echovirus 23), and human parechoviruses 3 to 14 (Benshop KS et al, J. Gen Virol 2010). They display the characteristic structure of the viruses of the family Picornaviridae. In particular, they have a single-stranded RNA genome of positive polarity encoding a polyprotein precursor, which is then matured into the capsid proteins VP1 to VP3 (Stanway and Hyypia, J. Virol., 1999; Williams et al., J. Gen. Virol., 2009).
Human parechovirus infections are prevalent and generally occur below two years of age (Stanway G., Rev. Med. Virol. 2000). Viral infection is generally asymptomatic but can occur as "neonatal viral sepsis", a disease characterized by pyrexia with a high fever without identifiable cause, which occurs at the age of a few months. HePV3 seems more particularly implicated in this disease. Also, HePV3 infections cause encephalitis, similarly with enterovirus infections (Harvala H, Curr. Opin. Infect.Dis, 2010). Finally, association of several HePV with gastroenteritis has been described but the responsibility of the virus remains unclear. It is also the case for many other clinical manifestations as myositis, aseptic meningitis, hemolytic uremic syndrome, enterocolitis and myocarditis.
The Ljungan virus (LV) was first isolated from bank voles {Myodes glareolus, formerly Clethrionomys glareolus) (Niklasson B, Virology 1999). The virus was later discovered in several animal species causing diseases such as diabetes, perinatal death and malformations in several animal species. A number of scientific reports have recently suggested that LV may be a human pathogen causing significant morbidity and mortality (Niklasson B. et al, Emerg. Infect.Dis 1998). In particular, LV has been implicated with diabetes and intrauterine fetal death in human (Niklasson B, Birth Defects Res. A. Clin. Mol. Teratol 2007; Niklasson B, Int. J. Exp. Diabesity. Res. 2003). In addition, LV infection has been linked with intrauterine fetal death (IUFD), malformations, placental inflammation, myocarditis, encephalitis, and Guillain-Barre syndrome (Niklasson B. et al, Forensic. Sci. Med. Pathol. 2009; Niklasson B. et al, Birth Defects Res. A. Clin. Mol. teratol. 2009; Samsioe A. et al, Birth Defects Res. A. Clin. Mol. teratol. 2009). Finally, it has been observed that antibodies against LV are more frequently detected in newly diagnosed type-1 diabetes children than in matched controls, suggesting that children with newly diagnosed type-1 diabetes may have been exposed to LV (Tolf C. et al, J. Virol Methods 2008; Niklasson B, J. Med. Virol. 201 1 ).
However, the data regarding these features are still debated (Krous HF, Birth Defects Res. A. Clin. Mol. Teratol 2010; Tapia G, Diabetes Care 2010). In particular, whereas antibodies directed against LV are frequently detected , LV RNA is not (Niklasson B., J. Med Virol. 201 1 ; Tapia G, Diabetes Care 2010). This is particularly the case for human type 1 diabetes.
Th is observation suggests that another virus capable of triggering the production of antibodies cross-reacting with LV is responsible for these medical conditions. It is known that infection with a porcine virus through human alimentation is more probable than by contact with a rodent virus, as demonstrated by the high frequency of infection of humans with Hepatitis E virus, a very prevalent porcine virus which remains clinically silent in pigs (Pavio N et al, Curr. Opin. Infect. Dis 2010). However, no swine parechovirus has yet been identified . An unidentified swine parechovirus or close to parachoviruses could thus be a good candidate as an etiologic agent of a lot of human diseases or symptoms.
FIGURES
Figure 1 A to I depicts the mapping of the 9 contigs of SEQ ID NO:29 to 37 with the amino acid reference sequence of LV (NCBI accession:21309880 AF327922 - Protein id: AAM46081 )(NCBI BlastX). As can be seen, large regions of each coding gene have been sequenced.
Figures 2 and 3 depict SPeLVI VP1 nucleotide alignment with the closest known VP1 from HPeVs and LV. VP1 s have been extracted from the best BLASTP hit between SPeLVI polyprotein and other parechoviruses and Ljungan Virus fully annotated polyproteins (except for H PeVI O and H PeV1 1 were only VP 1 was available).
Fig u re 4 represents the phylogenetic tree of the SPeLVI with in the Picornaviridae family.
DETAILED DESCRIPTION OF THE INVENTION The present invention provides a new swine virus strain belonging to the
Picornaviridae family, designated SPeLVI (Swine Parechovirus-l i ke vi ru s 1 ) . Surprisingly, the inventors have found that this new strain is related to the rodent parechovirus (Ljungan virus) and to the human parechovirus type 1 (HPEV1 ). This new strain defines a new virus species which is called SPeLV, and which appears to be the prototype of a new genus within the Picornaviridae family.
According to current taxonomic rules in the Picornaviridae family, this new virus species is the prototype of a new genus within the family. As it is very likely that several species exist for SPeLVs, the virus species described here was named SPeLV type 1 (SPeLVI ). In a first aspect, the present invention thus provides an isolated polynucleotide wherein said polynucleotide is a virus genome sharing at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identity with the sequence represented by SEQ ID NO: 1 .
I n a p referred embodiment, the said polynucleotide is the SPeLVI virus genome, represented by SEQ ID NO: 1 .
The present invention also relates to the SPeLV virus genome, in a recombinant form (meaning that the virus displays at least one modification from naturally occurring virus), to the SPeLV virus genome in the form of complementary sequence of SEQ I D NO: 1 , or even to the SPeLV virus genome in the form of complete cDNA of SEQ ID NO: 1 . The invention also encompasses parts of said SPeLV virus genome as defined above comprising at least 100, 200 or 500 consecutive nucleotides of the sequence as defined above (SEQ ID NO: 1 , complementary sequence thereof or cDNA thereof). In another aspect, the invention also relates to an SPeLV viral particle containing the said SPeLV virus genome. The genome of the parechoviruses contains a large open reading frame encoding a polyprotein precursor. In another aspect, the present invention thus relates to a polynucleotide comprising an open reading frame encoding the large polyprotein of the SPeLVI genome. In a preferred embodiment, said open reading frame comprises a sequence sharing at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identity with the sequence represented by SEQ ID NO: 2.
I n a preferred embodiment, the said polynucleotide encodes a polyprotein precursor displaying at least 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% identity with the polyprotein precursor of SPeLVI , whose sequence is represented by SEQ I D NO: 3. I n a most preferred embodiment, the said polynucleotide encodes the SPeL1 polyprotein precursor of SEQ ID NO: 3.
I n another aspect, the present invention provides the large polyprotein precursor of SPeLVI , said polyprotein precursor being encoded by a polynucleotide sequence sharing at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identity with the sequence represented by SEQ ID NO: 2.
In yet another aspect, the present invention provides the large polyprotein precursor of SPeLVI , said polyprotein precursor comprising an amino acid sequence displaying at least 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 96%, 97%, 98%, 99% , 99.5%, 99.9% identity with the polyprotein of SPeLVI , whose sequence is represented by SEQ ID NO: 3. In a most preferred embodiment, the said polyprotein precursor comprises an amino acid sequence of SEQ ID NO: 3.
The polyprotein precursor of parechoviruses is matured by proteolytic cleavage into 3 viral capsid proteins, designated VP1 , VP2 and VP3.
The present invention also relates to the capsid protein VP1 of SPeLVI and to a polynucleotide sequence encoding said VP1 protein. Among the capsid proteins, VP1 is specifically important for tropism as, within the Picornaviridae family, it mediates interactions with the cell receptor(s). For non-enveloped viruses as Picornaviridae, it is also a major target of antibodies, including neutralizing and opsonizing antibodies and thus is fundamental for medical application as it is the main candidate for the development of vaccines and serological tests. In one embodiment, the said VP1 capsid protein is encoded by a polynucleotide sequence displaying at least 50% , 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90% , 92.5% , 95% , 96% , 97% , 98% , 99% , 99.5% , 99.9% i d entity with th e polynucleotide sequence represented by SEQ I D NO: 4. In a preferred embodiment, the polynucleotide has the sequence of SEQ ID NO: 4. The invention also relates to a polynucleotide sequence encoding a VP 1 protein, said polynucleotide sequence displaying at least 50% , 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% identity with the polynucleotide sequence represented by SEQ ID NO: 4. In a preferred embodiment, the polynucleotide has the sequence of SEQ ID NO: 4. In another embodiment, the said a VP1 capsid protein comprises a sequence displaying at least 50 %, 55 %, 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% identity with the amino acid sequence represented by the sequence SEQ ID NO: 5.
The invention also relates to a polynucleotide sequence encoding a VP 1 protein, said polynucleotide sequence displaying at least 50% , 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% identity with the polynucleotide sequence represented by SEQ ID NO: 4. In a preferred embodiment, the polynucleotide has the sequence of SEQ ID NO: 4.
The present invention also relates to the VP1 protein in association with at least one protein obtained by proteolytic cleavage from the polyprotein. In one embodiment,
the said protein is VP2. In another embodiment, the said protein is VP3. In a preferred embodiment, the VP1 protein is associated with both the VP2 and the VP3 protein.
The term "sequence identity" refers to the identity between two peptides or between two nucleic acids. I dentity between sequences can be determined by comparing a position in each of the sequences which may be aligned for the purposes of comparison. When a position in the compared sequences is occupied by the same base or amino acid, then the sequences are identical at that position. A degree of sequence identity between nucleic acid sequences is a function of the number of identical nucleotides at positions shared by these sequences. A degree of identity between amino acid sequences is a function of the number of identical amino acid sequences that are shared between these sequences. Since two polypeptides may each (i) comprise a sequence (i.e. a portion of a complete polynucleotide sequence) that is similar between two polynucleotides, and (ii) may further comprise a sequence that is divergent between two polynucleotides, sequence identity comparisons between two or more polynucleotides over a "comparison window" refers to the conceptual segment of at least 20 contiguous nucleotide positions wherein a polynucleotide sequence may be compared to a reference nucleotide sequence of at least 20 contiguous nucleotides and wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e. gaps) of 20 percent or less compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
To determine the percent identity of two amino acids sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison. For example, gaps can be introduced in the sequence of a first amino acid sequence or a first nucleic acid sequence for optimal alignment with the second amino acid sequence or second nucleic acid sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences. Hence % identity = number of identical positions/total number of overlapping positions X 100.
In this comparison the sequences can be the same length or can be different in length. Optimal alignment of sequences for determining a comparison window may be conducted by the local homology algorithm of Smith and Waterman (J. Theor. Biol., 1981 ), by the homology alignment algorithm of Needleman and Wunsch (J. Mol. Biol, 1972), by the search for similarity via the method of Pearson and Lipman (Proc. Natl. Acad. Sci. U.S.A., 1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetic Computer Group, 575, Science Drive, Mad ison , Wisconsin) or by inspection. The best alignment (i.e. resulting in the highest percentage of identity over the comparison window) generated by the various methods is selected.
The term "sequence identity" means that two polynucleotide or polypeptide sequences are identical (i.e. on a nucleotide by nucleotide or an amino acid by amino acid basis) over the window of comparison. The term "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g. A, T, C, G, U , or 1 ) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e. the window size) and multiplying the result by 100 to yield the percentage of sequence identity. The same process can be applied to polypeptide sequences. The percentage of sequence identity of a nucleic acid sequence or an amino acid sequence can also be calculated using BLAST software (Version 2.06 of September 1998) with the default or user defined parameter.
The term "sequence similarity" means that amino acids can be modified while retaining the same function. It is known that amino acids are classified according to the nature of their side groups and some amino acids such as the basic amino acids can be interchanged for one another while their basic function is maintained.
Like the LV and HPeV viruses, the SPeLV virus of the invention is likely to infect human beings, especially young children. This is all the more relevant since the virus of the invention appears to be present in the general pig population. It is therefore important to be capable of detecting the presence or not of the SPeLV virus of the invention in pig as well as in human beings, in particular in young children. Detection of the SPeLV virus in pregnant women would be also crucial in order to monitor the risk of vertical transmission from the mother to the child.
In another aspect, the invention thus relates to an in vitro method of detection of a SPeLV virus in a subject, comprising the step a) of determining the presence of the SPeLV virus in a biological sample of the said subject.
A "biological sample" may be any sample that may be taken from a subject, and thus includes, but is not limited to, for example, blood, serum, plasma, sputum, urine, stool, skin, cerebrospinal fluid, saliva, gastric secretions, semen, seminal fluid, breast milk, and tears. A sample can be obtained by an oropharyngeal swab, nasopharyngeal swab, throat swab, nasal aspirate, nasal wash, fluid collected from the ear, eye, mouth, or respiratory airway, spinal tissue or fluid, cerebral fluid, trigeminal ganglion sample, a sacral ganglion sample, adipose tissue, lymphoid tissue, placental tissue, upper reproductive tract tissue, gastrointestinal tract tissue, male genital tissue and fetal central nervous system tissue. A sample can also be a pool of individual samples, especially those made during the process of manufacturing of biological samples obtained from h umans (blood or urine derived products, for exam ple), or any intermediate product sampled during the manufacturing of such products. Such sample must allow the determination of the presence of SPeLV through the methods of the invention.
The presence of the SPeLV virus may be determined by any technology known to a person skilled in the art. In particular, the SPeLV virus may be detected at the genomic and/or nucleic and/or protein level. The method according to the invention may thus comprise another preliminary step, between the taking of the sample from the patient and step a) as defined above, corresponding to the transformation of the biological sample into a genomic DNA sample, or into an mRNA (or corresponding cDNA) sample, or into a protein sample, which is then ready to use for in vitro detection of SPeLV in step a). Once a ready-to-use genomic DNA, mRNA (or corresponding cDNA) or protein sample is available, the detection of the SPeLV virus may be performed, depending on the type of transformation and the available ready-to-use sample, either at the genomic DNA (i .e. based on the presence of at least one sequence consisting of at least a part of the SPeLV genome as defined above), mRNA (i.e. based on the mRNA content of the sample) or at the protein level (i.e. based on the protein content of the sample).
Methods for detecting a genomic nucleic acid in a biological sample include inter alia hybridization with a labeled probe, genomic PCR, nucleic microarrays, high-
throughput sequencing, and all other methods known to the person of skills in the art. The amount of nucleic acid transcripts can be measured by any technology known by the skilled person . I n particular, the measure may be carried out directly on an extracted messenger RNA (mRNA) sample, or on retrotranscribed complementary DNA (cDNA) prepared from extracted mRNA by technologies well-known in the art. From the mRNA or cDNA sample, the amount of nucleic acid transcripts may be measured using any technology known by a person skilled in the art, including nucleic microarrays, quantitative PCR, and hybridization with a labeled probe.
In a preferred embodiment, the presence of the said virus is determined by hybridization of probes specific for the said virus or parts thereof with the biological sample. I n another embodiment, amplification and/or sequencing of the SPeLV sequences is performed in order to assess the presence of the said virus. I n yet another embodiment, the presence of the SPeLV virus is determined by detecting the polyprotein produced by the single open reading frame, or the VP1 capsid protein. Another object of the invention therefore relates to a probe capable of hybridizing to the genomic DNA of SPeLV. By "probe capable of hybridizing", one should understand that the said probe is substantially complementary to at least part of the SPeLV virus genome. For example, the said probe comprises a nucleotide sequence displaying at least 50 %, 55 %, 65 %, 70 %, 75 %, 80 %, 85 %, 87.5 %, 90 %, 92.5 %, 95 %, 96 %, 97 %, 98 %, 99 %, 99.5 %, 99.9 % identity with at least a part of a sequence of the genomic DNA of SPeLV (SEQ ID NO:1 ). The probe of the invention comprises at least 12 nucleotides, more preferably at least 15 nucleotides, even more preferably at least 20 nucleotides. According to a specific embodiment, the method of the invention is performed by hybridization with the probes of the invention. Detection of a hybridization signal is thus indicative of the presence of a SPeLV virus in the biological sample. It is advantageous to use labeled probes in this embodiment.
The present invention also includes primers specific for the SPeLV virus. Preferably, the said primers have the sequences as laid out in SEQ ID NOs: 6-29. The said primers can be used for amplification of specific regions of the SPeLV virus of the invention . The amplification may be carried out directly on genomic DNA, on an extracted messenger RNA (mRNA) sample, or on retrotranscribed complementary DNA (cDNA) prepared from extracted mRNA by technologies well-known in the art. The said primers of the invention can also be used for sequencing the SPeLV virus.
Alternatively, the said SPeLV virus is detected by high-throughput sequencing. Many such methods are already known to the man of skills in the art; according to some of the methods, amplification of the template prior to sequencing may be required (see, for a few examples, Mardis, Genome Med., 2009; Valouev et al., Genome Res., 2008, Walter et al., Proc Natl Acad Sci U S A., 2009).
An embodiment of the present invention thus provides a method of detection of an SPeLV virus comprising a step of amplification and/or sequencing of the said virus using the primers of the invention. I n this particular embodiment, amplification or sequencing of nucleic acid using the primers of the invention is indicative of the presence of the SPeLV virus in the said sample. When referring to sequencing, it is within the scope of the invention to detect SPeLV in samples, or to screen for SPeLV in biological materials, with deep sequencing technics, such as pyro-sequencing. The skilled person will easily realize that the said method of detection can be used for detecting a virus homologous to SpeLV in a species other than pig, in particular in man. When the SPeLV virus is detected at the protein level , it may be notably performed using specific antibodies. The invention thus also encompasses antibodies directed against the SpeLV virus and their use in detecting the said virus. In a preferred embodiment, the antibodies of the invention are capable of recognizing specifically the SPeLV VP1 protein. In a further preferred embodiment, the SPeLV protein has the sequence represented by SEQ ID NO: 5.
The antibodies of the invention can be used for detecting of the SpeLV virus by using in particular well known technologies such as cell membrane staining using biotinylation or other equivalent techniques followed by immunoprecipitation with specific antibodies, western blot, ELISA or ELISPOT, antibodies microarrays, or tissue microarrays coupled to immunohistochemistry. Other suitable techniques include FRET or BRET, single cell microscopic or histochemistery methods using single or multiple excitation wavelength and applying any of the adapted optical methods, such as electrochemical methods (voltametry and amperometry techniques), atomic force microscopy, and radio frequency methods, e.g. multipolar resonance spectroscopy, c o n f o c a l a n d n o n-co nfoca l , d etecti on of fl u oresce n ce , l u m i n esce n ce , chemiluminescence, absorbance, reflectance, transmittance, and birefringence or refractive index (e.g., surface plasmon resonance, ellipsometry, a resonant mirror method, a grating coupler waveguide method or interferometry), cell ELISA, flow
cytometry, radioisotopic, magnetic resonance imaging, analysis by polyacrylamide gel electrophoresis (SDS-PAGE); HPLC-M a s s S p e c t r o s c o p y ; L i q u i d Chromatography/Mass Spectrometry/Mass Spectrometry (LC-MS/MS)). All these techniques are well known in the art and need not be further detailed here. The invention also provides recombinant vectors comprising at least the polynucleotide of the invention as defined above. The polynucleotide of the invention may be inserted into a replicable vector for cloning (amplification of the DNA) or for expression. Various vectors are publicly available. The vector may, for example, be in the form of a plasmid, cosmid, viral particle, or phage. The appropriate nucleic acid sequence may be inserted into the vector by a variety of procedures. In general, DNA is inserted into an appropriate restriction endonuclease site(s) using techniques known in the art (see, for example, the techniques described in Sambrook et al, 1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). Vector components generally include, but are not limited to, one or more of a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence. Construction of suitable vectors containing one or more of these components employs standard ligation techniques which are known to the skilled artisan. Thus, it is within the scope of the invention to provide a vector for expressing any of the above defined polypeptides. I n order to express the SPeLV proteins of the invention, the polynucleotides encoding said proteins are inserted into expression vectors such that the genes are operatively linked to transcriptional and translational sequences. Expression vectors include plasmids, YACs, cosmids, retrovirus, adenovirus, EBV-derived episomes, and all the other vectors that the skilled man will know to be convenient for ensuring the expression of the protein of interest. Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Such sequences are well known for a variety of bacteria, yeast, and viruses. The origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2μ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning vectors in mammalian cells. Expression and cloning vectors will typically contain a selection gene, also termed a selectable marker. Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, methotrexate, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available
from complex media, e.g., the gene encoding D-alanine racemase for Bacilli.
Polynucleotides of the invention and vectors comprising these molecules can be used for the transformation of a suitable host cell. Transformation can be performed by any known method for introducing polynucleotides into a cell host. Such methods are well known of the man skilled in the art and include dextran-mediated transformation, calcium phosphate precipitation, polybrene-mediated transfection, protoplast fusion, electroporation, encapsulation of the polynucleotide into liposomes, biolistic injection and direct microinjection of DNA into nuclei. Therefore, the invention also encompasses a host cell comprising a vector of the invention. Preferably, the said host cell is a bacterial cell; more preferably, it is a eukaryotic cell; even more preferably it is a mammalian cell. The nature of the host cell will be dictated by the intended use of the vector of the invention . For example, a cloning vector will usually be maintained and propagated in bacterial cells. On the other hand, it will be advantageous to transform an expression vector in a mammalian cell in order to express the SPeLV proteins of the invention . For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines which stably express the protein of the invention may be engineered. Rather than using expression vectors which contain viral origins of replication, host cells can be transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction of the foreign DNA, engineered cells may be allowed to grow for 1 -2 days in an enriched media, and then are switched to a selective media. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method may advantageously be used to engineer cell lines which express the SPeLV protein of the invention. Such engineered cell lines may be particularly useful in screening and evaluation of compounds that interact directly or indirectly with the said SPeLV protein. The proteins of the invention may be prepared by growing a culture transformed host cells under culture conditions necessary to express the desired protein . The resulting expressed protein may then be purified from the culture medium or cell extracts. Soluble forms of the protein of the invention can be purified from conditioned
media. Membrane-bound forms of protein of the invention can be purified by preparing a total membrane fraction from the expressing cell and extracting the membranes with a non-ionic detergent such as Triton X-100.
The proteins can be purified using methods known to those skilled in the art. For example, the proteins of the invention can be concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit. Following the concentration step, the concentrate can be applied to a purification matrix such as a gel filtration medium. Alternatively, an anion exchange resi n can be em ployed , for exam ple, a matrix or su bstrate havi n g pen da nt diethylaminoethyl (DEAE) or polyetheyleneimine (PEI) groups. The matrices can be acrylamide, agarose, dextran, cellulose or other types commonly employed in protein purification.
Alternatively, a cation exchange step can be employed . Suitable cation exchangers include various insoluble matrices comprising sulfopropyl or carboxymethyl groups. Sulfopropyl groups are preferred (e.g. , S-Sepharose B columns). The purification of the MU-1 protein from culture supernatant may also include one or more column steps over such affinity resins as concanavalin A-agarose, heparin-Toyopearl or Cibacrom blue 3GA Sepharose B; or by hydrophobic interaction chromatography using such resins as phenyl ether, butyl ether, or propyl ether; or by immunoaffinity ch romatography. Finally, one or more reverse-phase h igh performance liqu id chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC media, e.g., silica gel having pendant methyl or other aliphatic groups, can be employed to further purify the protein of the invention.
Affinity columns including antibodies to the protein of the invention can also be used in purification in accordance with known methods. Some or all of the foregoing purification steps, in various combinations or with other known methods, can also be employed to provide a substantially purified isolated recombinant protein. Preferably, the isolated protein of the invention is purified so that it is substantially free of other mammalian proteins. It is thus also an aspect of the invention to provide a method for producing a recombinant SPeLV protein of the invention. According to a particular embodiment, the method of the invention comprises the steps of:
(a) introducing a nucleic acid encoding the recombinant SPeLV protein into one of the host cell described above;
(b) growing the transfected host cell to produce the SPeLV protein; and
(c) isolating the recombinant SPeLV protein from the host cell. By "SPeLV protein", it is herein referred to a protein directly encoded by the open reading frame of the swine virus of the invention, or a cleavage product thereof. In other words, the SpeLV protein of the invention can be the polyprotein precursor, or any of the capsid proteins VP1 , VP2, or VP3. Preferably, the SPeLV protein of the invention is a protein having the amino acid sequence represented by SEQ ID NO: 3, or a cleavage product thereof, such as for example the protein having the sequence of SEQ ID NO:5.
Proteins of the invention may be used to screen for agents which are capable of binding to the said protein. Binding assays using a desired binding protein, immobilized or not, are well known in the art and may be used for this purpose using the protein of the invention. Purified cell based or protein based (cell free) screening assays may be used to identify such agents.
The SpeLV virus is the etiological agent of a number of human pathological conditions, including intrauterine fetal death (I U F D), malformations, placental inflammation, myocarditis, encephalitis, Guillain-Barre syndrome, and diabetes mellitus type 1 .
The present invention also provides a method of i nd ucing neutral izing antibodies against the SPeLV virus in a mammal, comprising the administration of a vaccinal SPeLV composition. In another aspect, the present invention is drawn to a vaccinal SPeLV composition, for its use inducing neutralizing antibodies against the SPeLV virus in a mammal.
In a preferred embodiment, the vaccinal SpeLV composition of the invention is for preventing intrauterine fetal death (I UFD), malformations, placental inflammation, myocarditis, encephalitis, Guillain-Barre syndrome, and diabetes mellitus type 1 . In a further preferred embodiment, the vaccinal SpeLV composition of the invention is for preventing diabetes mellitus type 1 .
The present invention also relates to a vaccinal S PeLV composition . By "vaccinal SpeLV composition", it is herein referred to a composition comprising vaccinal SPeLV virus and/or at least one SpeLV protein of the invention and/or at least one polynucleotide encoding an SPeLV protein of the invention. In the context of the present invention, a "vaccinal SPeLV virus" is an SPeLV virus which is capable of inducing one or more immune responses against SpeLVI , as well as any other existing, but not yet identified, SpeLV serotype. Immune responses according to the present invention include the humoral immune response and the cellular immune response. In particular, a vaccinal SPeLV virus according to the invention is capable of inducing neutralizing . opsonizing antibodies or antibodies mediating Antibody Dependant Cell Cytotoxicity against SpeLVI , as well as any other existing, but not yet identified, SpeLV serotype. Encompassed by the term "vaccinal SPeLV virus" are viruses such as inactivated SPeLV virus, attenuated SpeLV virus, and chimeric SPeLV virus. An SPeLV virus is "inactivated" if it is unable to replicate to any significant degree in cells permissive for replication of wild-type SPeLV virus. An SPeLV virus which can replicate in a permissive cell but only to a degree significantly lower than a wild-type SPeLV virus is an "attenuated SPeLV virus". A "chimeric SPeLV virus" is a non- SPeLV virus which has been genetically engineered to express one or more SPeLV envelope proteins. The vaccinal SPeLV composition of the invention may also comprise an SPeLV protein of the invention. Thus the vaccinal SPeLV composition of the invention may comprise the polyprotein precursor or the capsid proteins, VP1 , VP2 or VP3, or any combination of these 4 polypeptides.
The vaccinal SPeLV composition of the invention may also comprise at least one polynucleotide encoding an SPeLV polypeptide. It is possible to administer the polynucleotide of the invention to the said subject using gene therapy techniques. In this case, the vaccinal composition of the invention may contain the SPeLV virus. Alternatively, th e vacci n al com position of th e i nvention may com prise th e polynucleotide of the invention carried by a vector suitable for administration to a patient. Such vectors may be either derived from a virus or from a non-viral origin.
Non-viral vectors include plasmids. Such a plasmid may be a conditionally replicating plasmid that is incapable of replicating in the patients for safety reasons. These plasm ids may be based on the plasmids described i n the patent PCT
applications WO 97/10343 and WO 2009/027351. Naked plasmid DNA can be directly injected into muscle cells (Wolff et al, Science, 1990) or attached to gold particles that are bombarded into the tissue (Cheng et al, Proc. Natl. Acad. Sci. U.S.A, 1993). Though not very efficient, this can result in prolonged low level expression in vivo. The plasmid DNA can also be transfected into the cell with the use of non-viral gene delivery vectors, termed "self-assembled" systems, based on cationic molecules, which form spontaneous complexes with negatively charged nucleic acids (Eliyahu et al., Molecules, 2005).
In another aspect of the invention, the vector is a viral vector. By replacing genes that are needed for the replication phase of the virus life cycle (the non-essential genes) with foreign genes of interest, the recombinant viral vectors can transduce the cell type it would normally infect. To produce such recombinant viral vectors the nonessential genes are provided in trans, either integrated into the genome of the packaging cell line or on a plasmid. Several vectors based on viruses such as poxvirus, adenovirus, adeno-associated virus (AAV), lentivirus, or herpes si mplex virus 1 (HSV1 ), are available for gene therapy. All of them are encompassed within this invention.
Adenoviral vectors are currently the most frequently used viral vectors in gene therapy in humans. The use of so-called third-generation (or "gutless") adenoviral vectors (Lindermann and Schnittler, Thromb. Haemost., 2009) is preferred for the use in the present invention. Said vectors need not be detailed here, since the skilled person is fully aware of the characteristics and uses of said adenoviral vectors.
It is also possible to use viral vectors based on adenoviral-associated virus or AAV. Amongst the 8 serotypes, the AAV used for treating a neuromuscular disease according to the invention is preferentially an AAV1 , i.e. its capside is of the serotype 1 . AAV1 has been shown to be the most efficient for muscle cells transduction. On the other hand, the sequences of a viral origin, and in particular the ITRs, associated to the transgene are preferably of AAV2 origin . The resulting AAV-based vector of the invention has, preferentially, a 2/1 pseudotype. The skilled person will easily realize, however, that the invention is not restricted to this particular vector; in fact, all AAV serotypes are equally suited for use in this invention. For example, AAV6, AAV8 or AAV9 also effectively transduce striated muscle cells, while AAV5 is highly efficient in transducing neural cells in the brain (Markakis et al., Molecular Therapy, 2010); all of
them can therefore be used successfully in the context of the invention. Like adenoviral vectors, the AAV-based vectors have already been used extensively by the skilled person for gene therapy purposes (see e.g. Michelfelder and Trepel, Adv Genet., 2009); there is thus no need for detailing methods for constructing and using the said AAV vectors.
Alternatively, the skilled person may use a lentiviral vector to deliver the proteins of the invention. Preferentially, the said lentiviral is a self-inactivating (SI N) lentivirus. In a further preferred embodiment, the lentiviral vector genome comprises, as an inserted c/s-acting fragment, at least one polynucleotide consisting in the DNA flap (Zennou et al ., Cell, 101 : 1 73-185, 2000; WO 99/55892; WO 01 /27304; WO 2009/019612) or containing such DNA flap. In a particular embodiment, the DNA flap is inserted upstream of the polynucleotide of interest, advantageously but not necessarily to be located in an approximate central position in the vector genome. Nevertheless, any lentiviral vector can be used in the context of the present invention . The construction and the manipulation of lentiviral vectors are well known to the skilled person.
The preferred viral vectors according to the invention are based on poxvirus (see for example Cox et al. in "Viruses in Human Gene Therapy" Ed J . M . Hos, Carolina Academic Press). As used herein the term "poxvirus" refers to a virus belonging to the Poxviridae family. According to a preferred embodiment, the poxvirus according to the invention may be obtained from canarypox (e.g. ALVAC as described in WO 95/27780), fowlpox (e.g. TROVAC as described in Paoletti et al., Dev. Biol. Stand. 1995) or vaccinia virus, the latter being preferred. Suitable vaccinia viruses include without limitation the Copenhagen strain (Goebel et al., Virol. 1990a and 1990b; Johnson et al., Virol. 1993), the Wyeth strain, NYVAC (see WO 92/15672 and Tartaglia et al., Virol. 1992) and the highly attenuated modified Ankara (MVA) strain (Mayr et al., Infection 1975). The basic techniques for inserting the nucleic acid molecule and associated regulatory elements required for expression in a poxviral genome are already available to the person of skills in the art (Paul et al., Cancer Gene Ther. 2002; Piccini et al., Methods Enzymol 1987; US 4,769,330; US 4,772,848; US 4,603,1 12; US 5,100,587; and US 5,179,993).
As used herein , a "vaccinal composition" is a composition comprising an immunoeffective quantity of an antigen sufficient to induce a specific immune response
against a pathogen in an immunocompetent mammal. Preferably, the immune response according to the invention comprises the synthesis of neutralizing antibodies The term "mammal" comprises individuals of the mammalian family, including cow, dogs, horse, primates, pigs, rabbits, cats, and humans. Preferably, the mammals of the invention are humans.
The protein or polynucleotide or SPeLV virus is preferably formulated in the vaccinal composition in an effective amount. An "effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired result, i.e., to immunize effectively the patient. An effective amount as meant herein should also not have any toxic or detrimental severe effects.
The vaccinal SPeLV compositions of the invention comprise, in addition to the SPeLV protein or SPeLV polynucleotide or SPeLV virus, one or more pharmaceutically acceptable excipients. Suitable excipients are well known in the art. Suitable excipients are typically large, slowly metabolized macromolecules such as proteins, saccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, sucrose (Paoletti et a/., Vaccine, 19: 21 18, 2001 ), trehalose (WO 00/56365), lactose and lipid aggregates (such as oil droplets or liposomes). Such carriers are well known to those of ordinary skill in the art. The vaccines may also contain diluents, such as water, saline, glycerol, etc. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present. Sterile pyrogen-free, phosphate buffered physiologic saline is a typical carrier. A thorough discussion of pharmaceutically acceptable excipients is available in reference Gennaro, 2000, Remington: The Science and Practice of Pharmacy, 20.sup.th edition.
The vaccinal SPeLV composition of the invention may contain, in addition to the carrier and SPeLV protein or SPeLV polynucleotide or SPeLV virus, various diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art.
The vaccinal SPeLV composition of the invention may optionally comprise one or more adjuvants to enhance the immunogenicity of the said composition in a mammal. Suitable adjuvants include an aluminum salt such as aluminum hydroxide gel or aluminum phosphate or alum, but may also be a salt of calcium, magnesium, iron or zinc, or may be an insoluble suspension of acylated tyrosine, or acylated sugars, cationically or anionically derivatized saccharides, or polyphosphazenes. Alternatively, the adjuvant may be an oil-in-water emulsion adjuvants (EP 0 399 843B), as well as
combinations of oil in water emulsions and other active agents (WO 95/1721 0; WO 98/56414; WO 99/12565; WO 99/1 1241 ). Other oil emulsion adjuvants have been described, such as water-in-oil emulsions (U.S. Pat. No. 5,422, 109; EP 0 480 982 B2) and water-in-oil-in- water emulsions (U .S. Pat. No. 5,424,067; EP 0 480 981 B1 ). Examples of such adjuvants include MF59, AF03, AF04, AF05, AF06 and derivatives thereof. Alternatively, the adjuvant may be a saponin, lipid A or a derivative thereof, an immunostimulatory oligonucleotide, an alkyl glucosamide phosphate, an oil in water emulsion or combinations thereof. Examples of saponins include Quil A and purified fragments thereof such as QS7 and QS21 . For vaccinal applications, the protein or polynucleotide or SPeLV virus of the invention is administered to a mammal, preferably a human, in a pharmaceutically acceptable dosage form such as those discussed above. These administrations may include injection via the intramuscular, intraperitoneal, intradermal, transcutaneous or subcutaneous routes; or via mucosal administration to the oral/alimentary, respiratory, genitourinary tracts. Th us one aspect of the present disclosure is a method of immunizing a human host against a disease caused by infection of SpeLV virus, which method comprises administering to the host an immunoprotective dose of the vaccinal SPeLV composition of the present disclosure.
The present invention also includes kits for achieving immunization against SpeLV-related conditions, e.g. intrauterine fetal death (IUFD), malformations, placental inflammation, myocarditis, encephalitis, Guillain-Barre syndrome, or diabetes mellitus type 1 . The kit according to the invention comprises at least one vaccinal SPeLV composition as described above. The kit of the invention therefore comprises at least one container holding the at least one vaccinal SPeLV composition. The kit of the invention may also advantageously contain an explanatory brochure including useful information for administration of the said compositions. The vaccinal compositions wh ich may be used in the kit accordi ng to the invention i nclude the vacci nal compositions described herein in relation to the method of immunization according to the invention. If the vaccinal compositions are provided in lyophilized form, the kit will advantageously comprise at least one additional container holding a solution which can be used to reconstitute a lyophilized vaccinal composition suitable for administration by intradermal , transcutaneous, subcutaneous , or i ntram uscu lar ad m i n istration . Pharmaceutically acceptable diluents and carriers may be used for reconstitution.
The examples that follow are merely exemplary of the scope of this invention and content of this disclosure. One skilled in the art can devise and construct numerous modifications to the examples listed below without departing from the scope of this invention.
EXAMPLES
1 . Material and methods
Nucleic acid samples extracted from feces taken from two healthy pigs (sample 1000193 and 100194) have been screened. These nucleic acids have been amplified by the bacteriophage phi29 polymerase based multiple displacement amplification (MDA) assay using random primers. The ligation and amplification were performed with the QuantiTect® Whole Transcriptome kit (Qiagen) according essentially to the manufacturer's instructions. This provides concateners of high molecular weight DNA. Resulting DNAs from the two pigs were pooled.
Sequencing was conducted by an lllumina HiSeq 2000 sequencer. 5 μg of high molecular weight DNA resulting from isothermal amplification was fragmented into 200 to 350 nt fragments, to which were ligated adapters. 27146966 reads of 96 nt were derived from the sample.
Sorting out the flow of l llumina sequences was first done by a subtractive database comparison procedure. To this end, the whole host genome sequence (Sus scrofa, ref: susScr2) was scanned with the reads using SOAPaligner (remaining 24834733 reads). A number of assembly programs dedicated to short or medium- sized reads (Velvet, SOAPdenovo, CLC) have been tested for their efficiency in our pipeline. Optimal parameters have been set. The comparison of the single reads and contigs with already known genomic and taxonomic data was done on generalist databases maintained locally (nt, nrprot). The aforementioned databases were scanned using BLASTN and BLASTX. Binning (or taxonomic assignment) was based on the best hits among reads with a significant e-value.
2. Results
2.1 . Identification of SPeLVI (Swine Parechovirus-like type 1 )
Some reads could be assembled into contigs that appeared to be homolog of different human viruses or bacteria. Nine of them have been more deeply analyzed (figure 1 ) because they showed a low but significant homology with the rodent parechovirus (Ljungan virus) (AF327922 S E Q I D N O : 39 ) a n d wi th h u m a n parechoviruses type 1 (GQ183025, SEQ I D NO: 40) and type 5 (HQ696576, SEQ I D NO: 41 ). These results seemed particularly interesting as no swine virus close to parechoviruses was known so far. A new virus species was thus discovered. And, according to current taxonomic rules in the Picornaviridae family, this new virus species is the prototype of a new genus within the family.
As described above, several strains of HPEV and LV exist; it is thus very likely that it is also the case for SPeLVs. So the virus species described here was named SPeLV type 1 (SPeLVI ). The figure 2 depicts the mapping of the amino acid sequences derived from the
9 contigs on the reference sequence of Ljungan virus (AF327922, SEQ ID NO: 39). As can be seen, large regions of each coding gene have been sequenced.
Based on the sequence of the contigs distributed along the genome, a set of 12 primer pairs encompassing the whole target genome was defined (table 1 ).The primers allowed to amplify 6057 nt of the genome by PCR, corresponding to around 80 % of the genome, which was sequenced by a conventional Sanger method. The figure 3 shows the SPeLVI sequenced genome. The quasi-full length sequence of the large polyprotein was obtained.
Table 1 : Primers used to amplify parts of the SpeLVI genome
Primer sequence (5'→ 3')
Expected size (bp)
Forward Reverse
SPeV.532.F SPeV.532.R
531
GC 1 1 1 1 GACCAGTGGCTCTGG AG CCG TAG GAG C AG C ACT ATG
SPeV.567.F SPeV.567.R
566
TG ATACTG CTG AATCTG G CGG ACCCGCAGTCAGAAGAATCAG
SPeV.610.F SPeV.610.R
598
TCAGGTCAATGCTGCTGCAGG AGCTGTGAACGGTAGCAAAGG
SPeV.593.F SPeV.593.R
572
CTAGTGTTG C AG G C ACG AG AG CTTGACAGTGTCACCGCATGG
SPeV.747.F SPeV.747.R
746
GTTGAAACCCGATTGGCTCAC GGAGCCTCAGGCACTAACTTC
SPeV.483.F SPeV.578.R
1408
TATTCCTGGTCGCCATTGCGG CCCCATACGTGGTAAAACCCT
SPeV.808.F SPeV.808.R
807
CCCCCATTATGGGGATATTCCT ATTTCAGGAGGGTACGATCCC
SPeV.578.F SPeV.578.R
634
CTTCTGCTATGGAGTTGCTGG CCCCATACGTGGTAAAACCCT
SPeV.529.F SPeV.529.R
900
TTGAAGGATTGTGCCACCACC G CTAG CG CAATAGTCG AACAC
SPeV.620.F SPeV.620.R
619
CCTTCTTGGCCCTGCTGTTC GACACCATCTCCAAGGTCTCC
SPeV.550.F SPeV.550.R
597
GGGTGCTTGACTATAATGGGTC TGCCAATCACAGAGTCAACCTC
SPeV.703.F SPeV.703.R
702
CAAGGACTAGTCACCGACACC GGCACTTGGAGAAGGTTGCTC
Importantly, the primers used in Donoso et al, J. Virol. Methods 2007 for detecting H PeV and / or LV virus do no detect the SPeLVI genome from the WTA amplified sample 1000193 and 100194.
2.2. Polyprotein sequence
Within the parechoviruses, the polyprotein is encoded by a single open reading frame that encompasses all the RNA genome, except the 5' and 3' untranslated regions (UTRs). The figure 4 shows the nucleotide sequence of the major part of the polyprotein of SPeLVI . The figure 5 corresponds to the deduced amino acid sequences of the polyprotein of SPeLV 1 .
The figure 6 shows the seq uence of VP 1 of SPeLVI translated from its nucleotide sequence: the probable NH2 and COOH ends have been deduced by homology with the other viruses of the Parechovirus genus. Nucleotide and amino acid alignments with the closest known VP1 from the HPeVs and LV are shown in figure 7 and 8 respectively. The sequence identity with LV is 45.6% (nt) or 29.1 % (aa.). The sequence identity of SPeLVI with the closest HPeV type is 44.7% (nt -HpeV2-) or 26.7% (aa.-HPeV1 -) (table 2). Alignment of this protein with other representatives of the H PeVs and LV by MUSCLE using curation by G-Blocks allowed to generate a phylogenetic tree using PhymL (Phylogeny package)(figure 9).
Table 2: SPeLVI VP1 amino acid and nucleotide percentage of identity with other closest known HPeVs and LV VP1
% identity aa VP1 % identity nuc VP1
VP1 length ref
SPeLVI SPeLVI
HPeV1 26,7 231 226527808:542-772 40,5
HPeV2 25,8 233 6093762:543-775 44,7
HPeV3 25,3 226 24898927:546-771 40,8
HPeV4 25,8 232 194578172:545-776 40,1
HPeV5 27 232 ABX79453.1 |: 1-232 41 ,9
HPeV6 26,1 234 ABS82455.1 |:542-775 44
HPeV7 25,8 226 ACD80088.1 |:544-769 43,2
HPeV8 26,2 228 ACF60607.1|:540-767 41,4
HPeV-10 25,8 234 ACV32378.1 (ext) 41,3
HPeV11 23,6 224 ADV16096.1 39,5
LV 29,1 297 NP_705876.1 45,6
SPeLVI 290
This shows that SPeLVIs is close to LV and HPeVs, but, according to t a x o n o m i c ru l e s w i t h i n t h e P i c o rn a v i ri d a e f a m i l y (http://www.picornostudygroup.com/definitions/genus_definition.htm), should define an new Picornaviridae genus.
Interestingly, the SPeLVI VP1 is devoid of RGD motif at the C terminus of the protein. A RGD motif is present in HPeV1 , 2,4,5 and 6 but is lacking in HPeV3, 7 and 8. This motif is important for virus entry in cells through interaction with alpha v beta 5 and alpha v beta 3 integrins. The receptor of HPeV 3, 7 and 8 is yet unknown (Seitsonen J, J. of Virology, 2010).
As receptor usage is a major determinant of virus tropism and pathogenicity, the lack of RGD in VP1 of SPELV1 could reflect similar tropism than HPeV 3, which is the main HPeV found in Central Nervous Disease-related disease (Verboon-Maciolek MA, Ann. Neurol.2008, Abed Y., Emerg. Infect. Dis.2006). VP1s have been extracted from the best blastp hit between SPeLVI polyprotein and other parechoviruses and Ljungan Virus fully annotated polyproteins (except for HPeVIOand HPeV11 were only VP1 was available).
2.3. Prevalence of the virus in relation with human consumption of pig meat
Using the sequence of SpeLVI , we have defined primers allowing for detection of the viral RNA by RT-PCR and have explored the feces of a set of pigs within the same herd in which SPeLVI . We have found that the virus was excreted by more than 50% of the pigs between 6 and 28 weeks of age. Interestingly, the peak of infection was between 9-20 weeks but it was also present in pigs of 23-24 weeks, which corresponds to the age of slaughtering for human consumption. This profile is similar to
Hepatitis E virus, a pig virus shown to be transmitted to humans by contaminated pig products (Pavio et al, Vet Res., 2010).
2.4. Prevalence of the virus in the pig population
To confirm that the virus was present in other herds than the one in which the virus was identified, we have random selected another herd (herd # 03) for which stools samples were available. We tested 24 stool samples from 22 week-old piglets by PCR using the primers (SPaV1 .3D.151 F, 5'-AAACCATGGCCTGGTGTGCGT-3', and SPaV1.3D.151 R, 5'-TGCCAATCGCAGAGTCAACCT-3 ' ) . Two piglets were fou n d positive and the amplicons were confirmed by sequencing. As the virus was present in two herds randomly selected, this demonstrated that its prevalence should be high within the pig population
BIBLIOGRAPHIC REFERENCES
Abed Y., Emerg. Infect. Dis. 12(6):969-75, 2006 Benshop KS et al, J. Gen Virol 91 (Pt 1 ): 145-54, 2010
Cheng et al, Proc. Natl. Acad. Sci. U.S.A., 90: 4455-4459, 1993
Donoso et al, J. Virol. Methods , 141 (1 )71 -7, 2007
Eliyahu et al., Molecules, 10: 34-64, 2005
Goebel et al., Virol. 179: 247-266, 1990a Goebel et al., Virol. 179: 517-563, 1990b
Harvala H, Curr. Opin. Infect.Dis, 23(3):224-30, 2010
Johnson et al., Virol. 196: 381 -401 , 1993
Krous HF, Birth Defects Res. A. Clin. Mol. Teratol , 88(1 1 ):947-52, 2010 Lindermann and Schnittler, Thromb. Haemost, 102: 1 135-1 143, 2009
Mardis, Genome Med., 1 (4): 40, 2009
Markakis et al., Molecular Therapy, 18: 588-593, 2010
Mayr et a/., Infection 3: 6-16, 1975
Michelfelder and Trepel, Adv Genet, 67: 29-60, 2009
Needleman and Wunsch, J. Mol. Biol, 48(3): 443-453, 1972
Niklasson B. et al, Emerg. Infect.Dis , 4(2):187-93, 1998
Niklasson B, Virology 255 (1 ): 86-93 1999
Niklasson B, Int. J. Exp. Diabesity. Res. 4 (1 ): 35-44' 2003
Niklasson B, Birth Defects Res. A. Clin. Mol. Teratol , 79 (6): 488-93, 2007
Niklasson B, Birth Defects Res. A. Clin. Mol. Teratol , 85(6):542-5, 2009
Niklasson B. et al, Forensic. Sci. Med. Pathol. 5(4):274-9, 2009
Niklasson B., J. Med Virol. 83(9):1673, 201 1
Paoletti et al., Dev. Biol. Stand. 84 : 159-163, 1995
Paul et al., Cancer Gene Ther. 9, 470-477, 2002
Pavio N et al, Curr. Opin. Infect. Dis, 23(5):521-7, 2010
Pavio N. et al., Vet Res, 41 (6): 46, 2010
Pearson and Lipman , Proc. Natl. Acad. Sci. U.S.A., 85(5): 2444-2448, 1988 Piccini et al., Methods Enzymol 153: 545-563, 1987
Samsioe A. et al, Birth Defects Res. A. Clin. Mol. teratol. , 85(3):227-9, 2009
Seitsonen J, J. of Virology, 84(17):8509-19, 2010
Smith and Waterman , J. Theor. Biol., 91 (2): 370-380, 1981
Stanway G., Rev. Med. Virol. 10 (1 ): 57-69, 2000
Tapia G, Diabetes Care, 33(5):1069-71, 2010
Tartaglia etal., Virol.188: 217-232, 1992
Tolf C. etal, J. Virol Methods ,150(1-2):34-40, 2008
Valouev etal., Genome Res., 18(7):1051-63, 2008
Verboon-Macioiek MA, Ann. Neurol.64(3):266- 73.2008
Walter et al., Proc Natl Acad Sci USA., 106(31):12950-5, 2009 Wolff et al, Science, 247: 1465-1468, 1990
Claims
1 . An isolated polynucleotide, wherein said polynucleotide is a virus genome sharing at least 55 % identity with the sequence of SEQ ID NO : 1 .
2. The polynucleotide of claim 1 , wherein said polynucleotide comprises an open reading frame (ORF), said ORF comprising a sequence sharing at least 55 % identity with the sequence of SEQ ID NO: 2.
3. The polynucleotide of any of claims 1 or 2, wherein the said polynucleotide encodes a polyprotein precursor, said polyprotein precursor having a sequence sharing at least 60 % identity with the sequence of SEQ ID NO: 3.
4. A polynucleotide sequence encoding a VP1 capsid protein, said polynucleotide sharing at least 50 % identity with SEQ ID NO: 4.
5. The polynucleotide of claim 4, wherein the said polynucleotide encodes a VP1 capsid protein, said protein having a sequence sharing at least 50 % identity with the sequence of SEQ ID NO: 5.
6. A viral particle containing the polynucleotide of any one of claims l to 3.
7. A probe capable of hybridizing to the polynucleotide of any one of claims 1 to 5.
8. A primer specific for the polynucleotide of any one of claims 1 to 5, said primer having a sequence selected from the group of the sequences represented by SEQ ID NOS: 6-29.
9. A vector comprising the polynucleotide of any one of claims 1 to 5.
10. A host cell containing the vector of claim 9.
1 1 . A method for the producing a recombinant SPeLV protein, comprising the steps of: a. growing the host cell of claim 10, and b. isolating the recombinant SPeLV protein from the host cell.
12. A polypeptide obtained by the method of claim 1 1.
13. A polyprotein precursor, said precursor comprising an amino acid sharing at least 60 % identity with the sequence of SEQ ID NO: 3.
14. The polyprotein precursor of claim 12, wherein the said polyprotein precursor is encoded by the polynucleotide of any one of claims 2 or 3.
15. A VP1 capsid protein, wherein said VP1 protein comprises a sequence sharing at least 50 % identity with the sequence of SEQ ID NO: 5
16. The VP1 capsid protein of claim 15, wherein the said polyprotein precursor is encoded by the polynucleotide of any one of claims 4 or 5.
17. A vaccinal SPeLV composition comprising a vaccinal SpeLV virus of claim 6 and/or an SpeLV protein of any one of claims 12 to 16 and/or a polynucleotide of any one of claims 1 to 5.
18. The vaccinal SPeLV composition of claim 17, for use in induction of of one or more immune responses against the SPeLV virus in a mammal.
19. The vaccinal SpeLV composition of claim 18 for use in preventing intrauterine fetal death (I U F D), malformations, placental inflammation , myocarditis, encephalitis, Guillain-Barre syndrome, and diabetes mellitus type 1 .
20. The vaccinal SpeLV composition of claim 19 for use in preventing diabetes mellitus type 1 .
21 . An immunization kit against intrauterine fetal death (I U FD), malformations, placental inflammation, myocarditis, encephalitis, Guillain-Barre syndrome, and diabetes mellitus type 1 , said kit comprising at least the vaccinal composition of claim 17.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161567904P | 2011-12-07 | 2011-12-07 | |
| PCT/EP2012/074741 WO2013083753A2 (en) | 2011-12-07 | 2012-12-07 | Identification of a swine parecho-like virus and applications |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP2788477A2 true EP2788477A2 (en) | 2014-10-15 |
Family
ID=47297291
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP12797926.8A Withdrawn EP2788477A2 (en) | 2011-12-07 | 2012-12-07 | Identification of a swine parecho-like virus and applications |
Country Status (2)
| Country | Link |
|---|---|
| EP (1) | EP2788477A2 (en) |
| WO (1) | WO2013083753A2 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20200036873A (en) * | 2017-07-14 | 2020-04-07 | 온코루스, 인크. | Encapsulated polynucleotides and methods of use |
Family Cites Families (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US109A (en) | 1836-12-15 | Erawijtg | ||
| US5422A (en) | 1848-02-01 | Spark-arrester | ||
| US4769330A (en) | 1981-12-24 | 1988-09-06 | Health Research, Incorporated | Modified vaccinia virus and methods for making and using the same |
| US4603112A (en) | 1981-12-24 | 1986-07-29 | Health Research, Incorporated | Modified vaccinia virus |
| DE3642912A1 (en) | 1986-12-16 | 1988-06-30 | Leybold Ag | MEASURING DEVICE FOR PARAMAGNETIC MEASURING DEVICES WITH A MEASURING CHAMBER |
| WO1990014837A1 (en) | 1989-05-25 | 1990-12-13 | Chiron Corporation | Adjuvant formulation comprising a submicron oil droplet emulsion |
| FR2649012B1 (en) | 1989-07-03 | 1991-10-25 | Seppic Sa | INJECTABLE MULTIPHASIC EMULSIONS |
| FR2649013B1 (en) | 1989-07-03 | 1991-10-25 | Seppic Sa | VACCINES AND VECTORS OF FLUID ACTIVE INGREDIENTS CONTAINING METABOLIZABLE OIL |
| US5100587A (en) | 1989-11-13 | 1992-03-31 | The United States Of America As Represented By The Department Of Energy | Solid-state radioluminescent zeolite-containing composition and light sources |
| US5756102A (en) | 1990-11-20 | 1998-05-26 | Virogenetics Corporation | Poxvirus-canine distemper virus (CDV) recombinants and compositions and methods employing the recombinants |
| WO1992015672A1 (en) | 1991-03-07 | 1992-09-17 | Virogenetics Corporation | Genetically engineered vaccine strain |
| US5179993A (en) | 1991-03-26 | 1993-01-19 | Hughes Aircraft Company | Method of fabricating anisometric metal needles and birefringent suspension thereof in dielectric fluid |
| GB9326253D0 (en) | 1993-12-23 | 1994-02-23 | Smithkline Beecham Biolog | Vaccines |
| FR2738842B1 (en) | 1995-09-15 | 1997-10-31 | Rhone Poulenc Rorer Sa | CIRCULAR DNA MOLECULE WITH ORIGIN OF CONDITIONAL REPLICATION, THEIR PREPARATION METHOD AND THEIR USE IN GENE THERAPY |
| GB9711990D0 (en) | 1997-06-11 | 1997-08-06 | Smithkline Beecham Biolog | Vaccine |
| GB9718901D0 (en) | 1997-09-05 | 1997-11-12 | Smithkline Beecham Biolog | Vaccine |
| AU1145699A (en) | 1997-09-05 | 1999-03-22 | Smithkline Beecham Biologicals (Sa) | Oil in water emulsions containing saponins |
| FR2777909B1 (en) | 1998-04-24 | 2002-08-02 | Pasteur Institut | USE OF TRIPLEX-STRUCTURED DNA SEQUENCES FOR THE TRANSFER OF NUCLEOTID SEQUENCES IN CELLS, RECOMBINANT VECTORS CONTAINING THESE TRIPLEX SEQUENCES |
| FR2791895B1 (en) | 1999-03-23 | 2001-06-15 | Pasteur Merieux Serums Vacc | USE OF TREHALOSE TO STABILIZE A LIQUID VACCINE |
| WO2001027304A2 (en) | 1999-10-12 | 2001-04-19 | Institut Pasteur | Lentiviral triplex dna, and vectors and recombinant cells containing lentiviral triplex dna |
| GB0120437D0 (en) * | 2001-08-22 | 2001-10-17 | Nya Apodemus Ab | Diabetic model |
| CA2695433C (en) | 2007-08-03 | 2025-05-06 | Institut Pasteur | Lentiviral gene transfer vectors and their medicinal applications |
| FR2920158B1 (en) | 2007-08-24 | 2010-03-12 | Centre Nat Rech Scient | PLASMID PRODUCTION AND EXPRESSION OF RECOMBINANT PROTEINS IN CULTIVATED CELLS WITHOUT ANTIBIOTICS |
| GB0901056D0 (en) * | 2009-01-22 | 2009-03-11 | Apodemus Ab | Virus |
-
2012
- 2012-12-07 EP EP12797926.8A patent/EP2788477A2/en not_active Withdrawn
- 2012-12-07 WO PCT/EP2012/074741 patent/WO2013083753A2/en not_active Ceased
Non-Patent Citations (1)
| Title |
|---|
| See references of WO2013083753A2 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2013083753A2 (en) | 2013-06-13 |
| WO2013083753A3 (en) | 2013-08-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230022109A1 (en) | Recombinant novel coronavirus vaccine using replication-deficient human adenovirus as vector | |
| CN111560354B (en) | Recombinant novel coronavirus, preparation method and application thereof | |
| KR101721090B1 (en) | Porcine torque teno virus vaccines and diagnosis | |
| CN113666990B (en) | A T cell vaccine immunogen inducing broad-spectrum anti-coronavirus and its application | |
| JP6895944B2 (en) | Recombinant modified vaccinia virus Ankara (MVA) RS virus (RSV) vaccine | |
| CA2746340A1 (en) | Pcv 2-based methods and compositions for the treatment of pigs | |
| KR100204438B1 (en) | Chicken anemia virus vaccine and diagnostic reagent | |
| JPH03504963A (en) | Preparation of recombinant subunit vaccine against pseudorabies infection | |
| CN102459578A (en) | Immunogenic compositions, vaccines and diagnostic methods based on canine distemper virus circulating in North American dogs | |
| TW202328166A (en) | Composition and methods of mrna vaccines against novel coronavirus infection | |
| CN115160413B (en) | A novel coronavirus vaccine | |
| JP2024542478A (en) | Ribonucleic acid respiratory syncytial virus (RSV) vaccine compositions and methods | |
| DK3063298T3 (en) | HCBI SEQUENCES AS AN EARLY MARKER FOR FUTURE DEVELOPMENT OF CANCER AND DISEASES IN CNS AND AS A TARGET FOR TREATMENT AND PREVENTION OF CANCER | |
| TW201938578A (en) | Enterovirus vaccine | |
| KR20230022206A (en) | Recombinant Modified Vaccinia Virus Ankara (MVA) Vaccine Against Coronavirus Disease | |
| TW202118771A (en) | Vaccine | |
| CN103079593A (en) | Parapoxvirus vectors | |
| CN101768575B (en) | Construction of recombinant rabies virus of double-expression G gene and biological property analysis thereof | |
| WO2013083753A2 (en) | Identification of a swine parecho-like virus and applications | |
| KR20130058706A (en) | Parapoxvirus expressing the vp60 major capsid protein of the rabbit haemorrhagic disease virus | |
| CN115836124A (en) | SARS-CoV-2 inactivated vaccine and its preparation | |
| WO2006002594A1 (en) | A recombinant canine adenovirus type-2 and the preparation method and usage thereof | |
| CN111926021A (en) | Recombinant human norrin cystine knot growth factor expression vector and application thereof | |
| BR112012004847B1 (en) | mutant bohv-4 virus, vaccine, and method for producing a mutant bohv-4 virus | |
| Liu et al. | Rescue and characterization of a recombinant HY12 bovine enterovirus carrying a foreign HA epitope in the 3A nonstructural protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20140704 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAX | Request for extension of the european patent (deleted) | ||
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20150701 |