EP2606132A1 - C6orf167 as a target gene for cancer therapy and diagnosis - Google Patents

C6orf167 as a target gene for cancer therapy and diagnosis

Info

Publication number
EP2606132A1
EP2606132A1 EP11817909.2A EP11817909A EP2606132A1 EP 2606132 A1 EP2606132 A1 EP 2606132A1 EP 11817909 A EP11817909 A EP 11817909A EP 2606132 A1 EP2606132 A1 EP 2606132A1
Authority
EP
European Patent Office
Prior art keywords
c6orf167
polypeptide
cancer
gene
double
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP11817909.2A
Other languages
German (de)
French (fr)
Inventor
Yataro Daigo
Yusuke Nakamura
Takuya Tsunoda
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oncotherapy Science Inc
Original Assignee
Oncotherapy Science Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oncotherapy Science Inc filed Critical Oncotherapy Science Inc
Publication of EP2606132A1 publication Critical patent/EP2606132A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5758Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4748Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5752Immunoassay; Biospecific binding assay; Materials therefor for cancer of the lungs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/04Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)

Definitions

  • the present invention relates to methods of detecting and diagnosing cancer as well as methods of treating and preventing cancer.
  • Priority The present application claims the benefit of U.S. Provisional Applications No. 61/401,927, filed on August 19, 2010, and 61/375,184, filed on August 19, 2010, the entire contents of which are incorporated by reference herein.
  • Lung cancer is the most common form of cancer, accounting for 1.35 million of the 10.9 million new cases of cancer per year. It is also the leading cause of death from cancer-associated disease, accounting for 1.18 million of the 6.7 million cancer-related deaths worldwide (NPL1).
  • NPL1 cancer-related deaths worldwide
  • cytotoxic agents including paclitaxel, docetaxel, gemcitabine, and vinorelbine have emerged to offer multiple therapeutic choices for patients with advanced NSCLC (non-small cell lung cancer); however, each of the new regimens can provide only modest survival benefits as compared with cisplatin-based therapies (NPL 2).
  • molecular-targeted agents including anti-EGFR or anti-VEGF monoclonal antibody, cetuximab (Erbitux) or Bevacizumab (Avastin), and small molecule inhibitors of EGFR tyrosine kinase, such as gefitinib (Iressa) and erlotinib (Tarceva), have been examined and/or approved for clinical use (NPL 3, 4).
  • These agents display activity against recurrent NSCLC to a certain extent, but the number of patients who could receive a survival benefit is still limited. Meanwhile patients with SCLC (small cell lung cancer) respond favorably to the 1 st line multi-agent chemotherapy, though they often relapse in a short time.
  • NPL 1 Jemal A, Siegel R, Ward E, et al. CA Cancer J Clin. 2008;58:71-96.
  • NPL 2 Schiller JH, Harrington D, Belani CP, et al. Eastern Cooperative Oncology Group. N Engl J Med 2002;346:92-8.
  • NPL 3 Dowell J, Minna JD, Kirkpatrick P. Nat Rev Drug Discov 2005;4:13-4.
  • NPL 4 Pal SK, Pegram M. Anticancer Drugs 2005;16:483-94.
  • NPL 5 Chute JP, Chen T, Feigal E, Simon R, Johnson BE: J Clin Oncol 1999;17:1794-801.
  • NPL6 Daigo Y, Nakamura Y.
  • the present invention relates to the discovery, through microarray analysis and RT-PCR, that C6orf167 gene is overexpressed in clinical lung cancer tissues.
  • functional knockdown of endogenous C6orf167 gene by siRNA in cancer cell lines results in drastic suppression of cancer cell growth, suggesting its essential role in maintaining viability of cancer cells. Since it is only scarcely expressed in adult normal organs, C6orf167 gene is a particularly useful molecular target for a therapeutic approach with minimal adverse effect.
  • nuclear localization of C6orf167 polypeptide is important for cancer cell growth and NFKBIL2 polypeptide is responsible for subcellular localization of C6orf167 polypeptide.
  • An increase in the level of expression of C6orf167 gene as compared to a normal control level indicates that the subject suffers from or is at risk of developing cancer, particularly lung cancer.
  • the mRNA of C6orf167 gene can be detected by appropriate probes or primer sets or, alternatively, the C6orf167 protein can be detected by anti- C6orf167 antibody.
  • kits that includes a reagent for detecting an mRNA of a C6orf167 gene or a protein encoded by a C6orf167 gene.
  • the reagent may be comprises an oligonucleotide that hybridizes to the mRNA of the C6orf167 gene, or an antibody against the protein encoded by the C6orf167 gene.
  • the methods of the present invention can be carried out in vitro or in vivo and use as an index the binding activity to a C6orf167 polypeptide, an expression level of a C6orf167 gene, a biological activity of a C6orf167 polypeptide, an expression level of a reporter gene or an activity of a reporter gene controlled under a transcriptional regulatory region of the C6orf167 gene, or a binding between a C6orf167 polypeptide and an NFKBIL2 polypeptide.
  • Substances that bind to a C6orf167 polypeptide, or suppress a C6orf167 expression or activity, a reporter gene expression or activity, or binding between a C6orf167 polypeptide and an NFKBIL2 polypeptide can be identified as candidate substances for either or both of treating and preventing cancer, or inhibiting cancer cell growth.
  • the biological activity of the C6orf167 polypeptide to be detected is preferably cell proliferation promoting activity or binding activity to an NFKBIL2 polypeptide.
  • a decrease in the biological activity of the C6orf167 polypeptide as compared to a control level in the absence of the test substance indicates that the test substance may be used to reduce symptoms of cancer, or either or both of treating and preventing cancer.
  • the sense strand of the double-stranded molecule includes a nucleotide sequence corresponding to a target sequence selected from the group consisting of SEQ ID NOs: 15 and 16 and the antisense strand includes a sequence which is complementary to the target sequence.
  • the double-stranded molecule inhibits an expression of the C6orf167 gene as well as cell proliferation.
  • polypeptide comprising a C6orf167-binding domain of an NFKBIL2 polypeptide, such polypeptide lacking a biological function of the NFKBIL2 polypeptide.
  • the biological function of the NFKBIL2 polypeptide that is lost can be a function to control a subcellular localization of a C6orf167 polypeptide.
  • the polypeptide of the present invention comprises an amino acid sequence of SEQ ID NO: 24 or a functional equivalent thereof.
  • the agent is a double-stranded molecule against C6orf167 gene or vector encoding the double-stranded molecule. Expression of the gene may be inhibited by introduction of a double-stranded molecule into the target cell in an amount sufficient to inhibit an expression of a C6orf167 gene.
  • the method includes the step of administering to a subject a pharmaceutically effective amount of double-stranded molecule against a C6orf167 gene or a vector encoding such a molecule, such molecule inhibiting an expression of a C6orf167 gene as well as cell proliferation when introduced into a cell expression a C6orf167 gene.
  • the agent that inhibits a function of a C6orf167 polypeptide may be a polypeptide comprising a C6orf167-binding domain of an NFKBIL2 polypeptide, lacking a function to control a subcellular localization of a C6orf167 polypeptide.
  • the method includes the step of administering to a subject a pharmaceutically effective amount of a polypeptide comprising a C6orf167-binding domain of an NFKBIL2 polypeptide and lacking a function to control a subcellular localization of a C6orf167 polypeptide.
  • a double-stranded molecule against C6orf167 is capable of inhibiting the expression of a C6orf167 gene as well as inhibiting the cell proliferation when introduced into a cell expressing a C6orf167 gene.
  • the methods and materials of the present invention are capable of identifying cancer prior to detection of overt clinical symptoms thereof and may be used in the context of cancer therapy without adverse effect.
  • the present invention provides the following [1] to [40]: [1] A method of detecting or diagnosing cancer or a predisposition for developing cancer in a subject, wherein the method comprises a step of determining an expression level of a C6orf167 gene in a subject-derived biological sample, wherein an increase of the level compared to a normal control level of the gene indicates the presence of cancer in the subject, or that the subject suffers from or is at risk of developing cancer, wherein the expression level is determined by any one of method selected from the group consisting of: (a) detecting an mRNA of a C6orf167 gene; (b) detecting a protein encoded by a C6orf167 gene; and (c) detecting a biological activity of a protein encoded by a C6orf167 gene; [2] The method of [1], wherein the increase is at least 10% greater than the normal control level; [3] The method of [1] or [2], wherein the subject-derived biological sample is a biopsy sample; [
  • a method of screening for a candidate substance for either or both of treating and preventing cancer, or inhibiting cancer cell growth comprises the steps of: a) contacting a test substance with a cell into which a vector comprising the transcriptional regulatory region of a C6orf167 gene and a reporter gene that is expressed under the control of the transcriptional regulatory region has been introduced, b) measuring the expression and/or activity levels of the reporter gene in the step (a); and c) selecting the test substance that reduces the expression and/or activity levels of said reporter gene detected in the step (b) in comparison with the expression and/or activity levels in the absence of the test substance; [14] A method of screening for a candidate substance for either or both of treating and preventing cancer, inhibiting cancer cell growth or the binding between a C6orf167 polypeptide and an NFKBIL2 polypeptide, wherein the method comprises the steps of: a) contacting a C6orf167 polypeptide or a functional equivalent thereof with an NFKBIL2 polypeptide
  • Figure 1 demonstrates the expression of C6orf167 gene in lung and esophageal tumors and normal tissues.
  • Part A depicts the results of semi quantitative RT-PCR validating the over-expression of C6orf167 gene in lung cancer tissues as compared to normal lung tissues.
  • Part B depicts the results of semiquantitative RT-PCR validating the expression of C6orf167 gene in lung cancer cell lines.
  • Part C depicts the results of Western blot analysis validating the expression of C6orf167 protein in lung cancer cell lines and esophageal cancer cell line.
  • Part D depicts the results of Northern blot analysis of the C6orf167 transcript in various normal human tissues.
  • Figure 2 demonstrates growth promoting effect of C6orf167
  • Part A depicts the results of semiquantitative RT-PCR analysis and Western blot analysis confirming the knockdown effect on C6orf167 expression in A549 and LC319 lung cancer cells in response to specific oligonucleotide siRNAs for C6orf167 (si-#1 and si-#2) or control siRNAs (si-LUC and si-CNT).
  • Part B depicts the results of MTT assays of A549 and LC319 cells transfected with the siRNAs. All assays were performed three independent times, and in triplicate wells.
  • Part C depicts the results of colony formation assays of A549 and LC319 cells transfected with the siRNAs.
  • Part D depicts the results of Western blot analysis and MTT assays confirming the expression of C6orf167 protein and the enhanced growth promoting activity in COS-7 and HEK293 cells transfected with C6orf167
  • Figure 3 demonstrates that NFKBIL2 controls the nucleus localization of C6orf167 protein in cultured cell.
  • Part A depicts the results of IP-MS analysis for identification of C6orf167-interacting protein. Exogenous C6orf167 protein was immunoprecipitated using Flag Agarose and detected by WB and Colloidal CBB staining.
  • Part B depicts the results of IP-WB analysis using Flag and/or HA-Agarose confirming that C6orf167 protein interacts with NFKBIL2 protein.
  • Part C depicts subcellular localization of endogenous C6orf167 and NFKBIL2 proteins in HeLa cells.
  • the cells were stained with a rabbit polyclonal anti-C6orf167 antibody; mouse polyclonal anti-NFKBIL2 and nucleus with DAPI.
  • Part D depicts subcellular localization of exogenous C6orf167 and NFKBIL2 proteins in COS-7 cells.
  • the cells were transfected with C6orf167 expressing vector (upper panels) or co-transfected with C6orf167 and NFKBIL2 expressing vectors (lower panels) and fixed with 4%Paraholmaldehide after 48h.
  • C6orf167 protein was stained with a monoclonal anti-Flag M2 antibody; NFKBIL2 was stained with mouse monoclonal anti-HA and nucleus with DAPI.
  • Part E depicts the localization of C6orf167 protein in cytoplasm and nucleus fractions of COS-7 cells co-transfected with C6orf167 and NFKBIL2 expressing vectors.
  • C6orf167 and NFKBIL2 proteins was detected using anti-mouse Flag-M2 monoclonal antibody and/or monoclonal anti-rat HA (3F10) antibody.
  • Part F depicts knockdown of C6orf167 or NFKBIL2 protein expression with si-C6orf167 or si-NFKBIL2 oligonucleotides. The expression of endogenous C6orf167 and NFKBIL2 proteins were detected by western blotting using anti-C6orf167 antibody and anti-NFKBIL2 antibody.
  • Figure 4 demonstrates dominant negative effect of partial protein NFKBIL2 in lung cancer cell lines.
  • Part A depicts the design of partial proteins of C6orf167 and NFKBIL2 proteins.
  • Part B depicts the result of IP-WB analysis in cells co-transfected with full length C6orf167 and/or NFKBIL2 proteins with each partial proteins. Binding region between C6orf167 and NFKBIL2 proteins were identified using Flag/HA-Agarose.
  • Part C depicts the subcellular localization of full length exogenous C6orf167 and each partial NFKBIL2 proteins in COS-7 cells. The cells were co-transfected with full length C6orf167 and partial NFKBIL2 expressing vectors and fixed with 4% Paraformaldehide after 48h.
  • C6orf167 protein was stained with a monoclonal anti-Flag M2 antibody; NFKBIL2 was stained with mouse monoclonal anti-HA and nucleus with DAPI.
  • Part D depicts localization of endogenous C6orf167 protein in HeLa cells transfected with partial NFKBIL2 expressing vectors. Endogenous C6orf167 protein was detected using rabbit polyclonal anti-C6orf167 antibody. Partial NFKBIL2 proteins were detected with monoclonal anti-rat HA (3F10) antibody.
  • Part E depicts dominant negative effect of partial NFKBIL2 proteins on high C6orf167 expression HeLa and LC319 cells. Dominant negative effect was detected in high C6orf167 expression HeLa and LC319 cells transfected with partial NFKBIL2 proteins quantifying by MTT and colony formation assays at 7 days after transfection.
  • Figure 5 demonstrates dominant negative growth suppressive effect of partial NFKBIL2 protein on cancer cells.
  • Part A depicts HEK293 cells which were co-transfected with C6orf167- and full-length/three partial NFKBIL2-expression vectors (N1, N2, and N3). Immunoprecipitation assays were performed using Flag-M2 agarose.
  • Part B depicts the expression of C6orf167 protein in HeLa, LC319, and CCDlu-19 cell lines.
  • Part C depicts MTT assay using C6orf167-positive HeLa and LC319 cells, and C6orf167-negative CCDlu-19 cells, which were transfected with mock plasmids or either of three partial NFKBIL2-expression vectors (N1, N2, and N3), as quantified by MTT assay at 7 days after transfection.
  • Figure 6 demonstrates the involvement of C6orf167 as an upstream molecule of NFKB pathway.
  • Part A depicts the results of Western blotting using antibodies to endogenous C6orf167 and RelA/p65, and HeLa and LC319 cells transfected with siRNA oligonucleotides for C6orf167 (si-C6orf167) or control siRNA (si-LUC). These cell lines were stimulated with 50 ng/ml TNF-alpha for 15 min. The nuclear and cytoplasmic fraction was isolated using NE-PER(registered trademark) Nuclear and Cytoplasmic Extraction Reagents kit (Thermo).
  • Part B depicts the results of Western blotting using antibodies to endogenous C6orf167, RelA/p65, Bcl-XL and TRAF1 and HeLa cells transfected with si-C6orf167 or si-LUC. These cell lines were treated with 50 ng/ml TNF-alpha for 15, 30, 60, or 120 min. N.T. indicates no treatment with TNF-alpha.
  • Part C depicts the results of Western blotting using antibodies to endogenous C6orf167, RelA/p65, Bcl-XL, ATM, CSB, p53 and HeLa cells which were transfected with si-C6orf167 or si-LUC oligonucleotides, and were subsequently treated with cisplatin (CDDP; 50 or 100 micro g/mL).
  • Part D depicts schematic summary of C6orf167 pathway.
  • Figure 7 demonstrates the expression of C6orf167 and its interacting protein NFKBIL2 and downstream proteins in cancer samples.
  • Part A depicts the expression of C6orf167 gene in lung and esophageal cancer tissues (T) and adjacent normal (N) lung and esophagus tissues, detected by semiquantitative RT-PCR.
  • Part B depicts the expression pattern of C6orf167 protein and its interacting/downstream proteins detected by western blotting using antibodies to C6orf167, NFKBIL2, RelA/p65, Bcl-XL, and TRAF1.
  • Figure 8 demonstrates that NFKBIL2 stabilizes C6orf167 protein in cultured cells. Immunocytochemical analysis using LC319 cells which were transfected with si-LUC (control) or si-NFKBIL2 oligonucleotides. The cells were stained with anti-C6orf167 antibody, anti-NFKBIL2, and DAPI.
  • Figure 9 demonstrates the suppression of cancer cell growth and/or survival using siRNAs against NFKBIL2.
  • Part A depicts knockdown of NFKBIL2 expression in lung cancer cell lines, LC319 and A549 by specific siRNA oligonucleotides for NFKBIL2 (si-#1 and si-#2) or control siRNAs (si-EGFP and si-LUC), confirmed by western blotting.
  • Part B depicts viability of LC319 and A549 cells evaluated by MTT assay in response to the siRNAs. All assays were performed in triplicate wells at three independent times.
  • Part C depicts colony formation assays using LC319 and A549 cells transfected with the siRNAs.
  • FIG. 10 demonstrates that C-terminal portion of NFKIL2 protein is crucial for binding to C6orf167 protein.
  • Part A depicts the design of vectors expressing partial proteins of C6orf167 and NFKBIL2.
  • Part B depicts binding between C6orf167 and NFKBIL2 proteins detected using Flag- or HA-agarose and COS-7 cells co-transfected with full-length/partial C6orf167-Flag and full-length/partial NFKBIL2-HA proteins.
  • Part C depicts subcellular localization of full-length C6orf167 and three partial NFKBIL2 proteins.
  • COS-7 cells were co-transfected with full-length C6orf167 and partial NFKBIL2-expression vectors (N1-N3).
  • C6orf167 protein was stained with anti-Flag M2 antibody; NFKBIL2 with anti-HA antibody, and nucleus with DAPI.
  • Figure 11 demonstrates elevated expression of endogenous RelA/p65 protein in cancer cells expressing exogenous C6orf167 and/or NFKBIL2.
  • Western blotting was performed using HeLa cells transfected with Flag-tagged C6orf167 and/or HA-tagged NFKIBL2-expression vector.
  • Exogenous C6orf167 and NFKBIL2 proteins were detected using anti-Fag-M2 antibody and/or anti-HA (3F10) antibody.
  • Endogenous NFKB subunit of RelA/p65 was detected using anti-RelA/p65 antibody (F-6, Santa Cruz sc-8008).
  • Figure 12 demonstrates increased levels of RelA/p65 protein in the nucleus of the cells under TNF-alpha stimulation.
  • HeLa cells were treated with 50 ng/ml TNF-alpha for 15 min.
  • the cells were divided into cytoplasmic and nuclear fractions using NE-PER(registered trademark) Nuclear and Cytoplasmic Extraction Reagents kit (Thermo).
  • Western blotting was performed using antibodies to C6orf167 and RelA/p65.
  • Figure 13 demonstrates increased sub G1 population of the cancer cells which were transfected with si-C6orf167 under DNA damage condition.
  • Part A depicts cell-cycle distribution in HeLa cells transfected with si-Corf167 and treated with DNA-damaging agent. After knockdown of C6orf167 expression with si-C6orf167 in HeLa cells, the cells were treated with cisplatin (CDDP; 50 micro-g/mL) or 5-FU (50 micro-g/mL) for 48 hours and harvested for flow cytometric analysis. N.T. indicates no treatment with CDDP or 5-FU.
  • Part B depicts cell-cycle distribution in HeLa cells transfected with si-Corf167 and treated with DNA-damaging agent.
  • an isolated or purified polypeptide refers to a polypeptide that is substantially free of cellular material such as carbohydrate, lipid, or other contaminating proteins from the cell or tissue source from which the polypeptide is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized.
  • substantially free of cellular material includes preparations of a polypeptide in which the polypeptide is separated from cellular components of the cells from which it is isolated or recombinantly produced.
  • a polypeptide that is substantially free of cellular material includes preparations of polypeptide having less than about 30%, 20%, 10%, or 5% (by dry weight) of heterologous protein (also referred to herein as a "contaminating protein").
  • heterologous protein also referred to herein as a "contaminating protein”
  • the polypeptide is recombinantly produced, it is also preferably substantially free of culture medium, which includes preparations of polypeptide with culture medium less than about 20%, 10%, or 5% of the volume of the protein preparation.
  • polypeptide When the polypeptide is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, which includes preparations of polypeptide with chemical precursors or other chemicals involved in the synthesis of the protein less than about 30%, 20%, 10%, 5% (by dry weight) of the volume of the protein preparation. That a particular protein preparation contains an isolated or purified polypeptide can be shown, for example, by the appearance of a single band following sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis of the protein preparation and Coomassie Brilliant Blue staining or the like of the gel.
  • SDS sodium dodecyl sulfate
  • polypeptides to be used in the present invention and the polypeptide of the present invention are isolated or purified.
  • nucleic acid molecule such as a cDNA molecule and double-stranded molecule (e.g., siRNA)
  • a cDNA molecule and double-stranded molecule e.g., siRNA
  • polypeptide e.g., a cDNA molecule and double-stranded molecule
  • protein e.g., a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is a modified residue, or a non-naturally occurring residue, such as an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.
  • amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that similarly functions to the naturally occurring amino acids.
  • Naturally occurring amino acids are those encoded by the genetic code, as well as those modified after translation in cells (e.g., hydroxyproline, gamma-carboxyglutamate, and O-phosphoserine).
  • amino acid analog refers to compounds that have the same basic chemical structure (an alpha carbon bound to a hydrogen, a carboxy group, an amino group, and an R group) as a naturally occurring amino acid but have a modified R group or modified backbones (e.g., homoserine, norleucine, methionine, sulfoxide, methionine methyl sulfonium).
  • modified R group or modified backbones e.g., homoserine, norleucine, methionine, sulfoxide, methionine methyl sulfonium.
  • amino acid mimetic refers to chemical compounds that have different structures but similar functions to general amino acids. Amino acids may be referred to herein by their commonly known three letter symbols or the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
  • biological sample refers to a whole organism or a subset of its tissues, cells or component parts (e.g., body fluids, including but not limited to blood, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, amniotic fluid, amniotic cord blood, urine, vaginal fluid and semen).
  • body fluids including but not limited to blood, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, amniotic fluid, amniotic cord blood, urine, vaginal fluid and semen.
  • biological sample further refers to a homogenate, lysate, extract, cell culture or tissue culture prepared from a whole organism or a subset of its cells, tissues or component parts, or a fraction or portion thereof.
  • biological sample refers to a medium, such as a nutrient broth or gel in which an organism has been propagated, which contains cellular components, such as proteins or polynucleotides.
  • nucleic acid refers to any combination thereof.
  • cancer refers to cancer over-expressing the C6orf167 gene.
  • cancers over-expressing C6orf167 gene include, but are not limited to, lung cancers including SCLC and NSCLC.
  • NSCLC includes, but are not limited to, adenocarcinoma (ADC) and squamous-cell carcinoma (SCC).
  • ADC adenocarcinoma
  • SCC squamous-cell carcinoma
  • double-stranded molecule refers to a nucleic acid molecule that inhibits expression of a target gene, including, for example, short interfering RNA (siRNA; e.g., double-stranded ribonucleic acid (dsRNA) or small hairpin RNA (shRNA)) and short interfering DNA/RNA (siD/R-NA; e.g., double-stranded chimera of DNA and RNA (dsD/R-NA) or small hairpin chimera of DNA and RNA (shD/R-NA)).
  • siRNA short interfering RNA
  • dsRNA double-stranded ribonucleic acid
  • shRNA small hairpin RNA
  • siD/R-NA short interfering DNA/RNA
  • double-stranded molecule is also referred to as “double-stranded nucleic acid”, “double-stranded nucleic acid molecule”, “double-stranded polynucleotide” and “double-stranded polynucleotide molecule”.
  • composition is used to refer to a product including that include the specified ingredients in the specified amounts, as well as any product that results, directly or indirectly, from combination of the specified ingredients in the specified amounts.
  • pharmaceutical when used in relation to the modifier "pharmaceutical” (as in “pharmaceutical composition"), are intended to encompass products including a product that includes the active ingredient(s), and any inert ingredient(s) that make up the carrier, as well as any product that results, directly or indirectly, from combination, complexation or aggregation of any two or more of the ingredients, or from dissociation of one or more of the ingredients, or from other types of reactions or interactions of one or more of the ingredients.
  • pharmaceutical composition refers to any product made by admixing a molecule or compound of the present invention and a pharmaceutically or physiologically acceptable carrier.
  • pharmaceutically acceptable carrier or “physiologically acceptable carrier”, as used herein, means a pharmaceutically or physiologically acceptable material, composition, substance or vehicle, including but not limited to, a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the active ingredient from one organ, or portion of the body, to another organ, or portion of the body.
  • active ingredient refers to a substance in composition that is biologically or physiologically active.
  • active ingredient refers to a substance that shows an objective pharmacological effect.
  • active ingredients in the compositions may lead to at least one biological or physiologically action on cancer cells and/or tissues directly or indirectly.
  • such action may include reducing or inhibiting cancer cell growth, damaging or killing cancer cells and/or tissues, and so on.
  • the "active ingredient” may also be referred to as "bulk", “drug substance” or "technical product”.
  • the present invention is based in part on the discovery that the gene encoding C6orf167 is over-expressed in cancer as compared to non-cancerous tissue.
  • Nucleotide sequences of C6orf167 and NFKBIL2 polynucleotides and amino acid sequences of C6orf167 and NFKBIL2 polypeptides are known to those skilled in the art, and obtained, for example, from gene databases on the web site such as GenBank TM .
  • Exemplified nucleotide sequences of C6orf167 polynucleotide are shown in SEQ ID NO: 17 and 19, and exemplified amino acid sequences of C6orf167 polypeptide is shown in SEQ ID NO: 18 and 20.
  • sequence data are also available, for example, via GenBank accession No. NM_198468 or No. NP_940870. Also, an exemplified nucleotide sequence of NFKBIL2 polynucleotide are shown in SEQ ID NO: 21, and an exemplified amino acid sequence of NFKBIL2 polypeptide is shown in SEQ ID NO: 22.
  • sequence data are also available, for example, via GenBank accession No. NM_013432 or No. NP_038460.
  • C6orf167 sequences or NFKBIL2 sequences need not be limited to these sequences and that variants (e.g., functional equivalents and allelic variants) can be used in the present invention as described below.
  • a “functional equivalent” of a protein is a polypeptide that has a biological activity equivalent to the protein. Namely, any polypeptide that retains the biological ability of the C6orf167 protein or NFKBIL2 protein may be used as such a functional equivalent in the present invention.
  • Such functional equivalents include those wherein one or more amino acids are substituted, deleted, added, or inserted to the natural occurring amino acid sequence of the C6orf167 protein or NFKBIL2 protein.
  • polypeptide may be composed an amino acid sequence having at least about 80% homology (also referred to as sequence identity) to the sequence of the respective protein, more preferably at least about 90% to 95% homology, often about 96%, 97%, 98% or 99% homology.
  • a polypeptide to be used in the present invention may have variations in amino acid sequence, molecular weight, isoelectric point, the presence or absence of sugar chains, or form, depending on the cell or host used to produce it or the purification method utilized. Nevertheless, so long as it has a function equivalent to that of the human C6orf167 protein or NFKBIL2 protein, it is within the scope of the present invention.
  • the polypeptide can be encoded by a polynucleotide that hybridizes under stringent conditions to the natural occurring nucleotide sequence of the C6orf167 gene or NFKBIL2 gene.
  • stringent (hybridization) conditions refers to conditions under which a nucleic acid molecule will hybridize to its target sequence, typically in a complex mixture of nucleic acids, but not detectably to other sequences. Stringent conditions are sequence-dependent and will vary in different circumstances. Longer sequences hybridize specifically at higher temperatures.
  • stringent conditions are selected to be about 5-10 degrees C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH.
  • Tm is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • a positive signal is at least two times of background, preferably 10 times of background hybridization.
  • Exemplary stringent hybridization conditions include the following: 50% formamide, 5x SSC, and 1% SDS, incubating at 42 degrees C, or, 5x SSC, 1% SDS, incubating at 65 degrees C, with wash in 0.2x SSC, and 0.1% SDS at 50 degrees C.
  • a condition of hybridization for isolating a DNA encoding a polypeptide functionally equivalent to the human C6orf167 protein or NFKBIL2 protein can be routinely selected by a person skilled in the art.
  • hybridization may be performed by conducting pre-hybridization at 68 degrees C for 30 min or longer using "Rapid-hyb buffer" (Amersham LIFE SCIENCE), adding a labeled probe, and warming at 68 degrees C for 1 hour or longer.
  • the following washing step can be conducted, for example, in a low stringent condition.
  • An exemplary low stringent condition may include 42 degrees C, 2x SSC, 0.1% SDS, preferably 50 degrees C, 2x SSC, 0.1% SDS.
  • High stringency conditions are often preferably used.
  • An exemplary high stringency condition may include washing 3 times in 2x SSC, 0.01% SDS at room temperature for 20 min, then washing 3 times in 1x SSC, 0.1% SDS at 37 degrees C for 20 min, and washing twice in 1x SSC, 0.1% SDS at 50 degrees C for 20 min.
  • factors such as temperature and salt concentration, can influence the stringency of hybridization and one skilled in the art can suitably select the factors to achieve the requisite stringency.
  • modifications of one, two or more amino acids in a protein will not influence the function of the protein.
  • mutated or modified proteins i.e., peptides composed of an amino acid sequence in which one, two, or several amino acid residues have been modified through substitution, deletion, insertion and/or addition
  • mutated or modified proteins have been known to retain the original biological activity (Mark et al., Proc Natl Acad Sci USA 81: 5662-6 (1984); Zoller and Smith, Nucleic Acids Res 10:6487-500 (1982); Dalbadie-McFarland et al., Proc Natl Acad Sci USA 79: 6409-13 (1982)).
  • the peptides of the present invention may have an amino acid sequence wherein one, two or even more amino acids are added, inserted, deleted, and/or substituted in the C6orf167 or NFKBIL2 sequence.
  • the number of amino acid mutations is not particularly limited. However, it is generally preferred to alter 5% or less of the amino acid sequence. Accordingly, in a typical embodiment, the number of amino acids to be mutated in such a mutant is generally 30 amino acids or fewer, preferably 20 amino acids or fewer, more preferably 10 amino acids or fewer, more preferably 5 or 6 amino acids or fewer, and even more preferably 3 or 4 amino acids or fewer.
  • An amino acid residue to be mutated is preferably mutated into a different amino acid in which the properties of the amino acid side-chain are conserved (a process known as conservative amino acid substitution).
  • properties of amino acid side chains are hydrophobic amino acids (A, I, L, M, F, P, W, Y, V), hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, T), and side chains having the following functional groups or characteristics in common: an aliphatic side-chain (G, A, V, L, I, P); a hydroxyl group containing side-chain (S, T, Y); a sulfur atom containing side-chain (C, M); a carboxylic acid and amide containing side-chain (D, N, E, Q); a base containing side-chain (R, K, H); and an aromatic containing side-chain (H, F, Y, W).
  • A, I, L, M, F, P, W, Y, V hydrophilic
  • Conservative substitution tables providing functionally similar amino acids are well known in the art. For example, the following eight groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins 1984).
  • Such conservatively modified polypeptides are included in the C6orf167 protein or NFKBIL2 protein.
  • the present invention is not restricted thereto and the C6orf167 protein or NFKBIL2 protein includes non-conservative modifications, so long as at least one biological activity of the C6orf167 protein or NFKBIL2 protein is retained.
  • the modified proteins do not exclude polymorphic variants, interspecies homologues, and those encoded by alleles of these proteins.
  • the C6orf167gene or NFKBIL2 gene encompasses polynucleotides that encode such functional equivalents of the C6orf167 protein or NFKBIL2 protein.
  • a gene amplification method for example, the polymerase chain reaction (PCR) method, can be utilized to isolate a polynucleotide encoding a polypeptide functionally equivalent to the C6orf167 protein or NFKBIL2 protein, using a primer synthesized based on the sequence information of the DNAs encoding those proteins.
  • PCR polymerase chain reaction
  • "High homology” typically refers to a homology of 40% or higher, preferably 60% or higher, more preferably 80% or higher, even more preferably 90% to 95% or higher, even more preferably 96%, 97%, 98%, 99% or higher.
  • the homology of a particular polynucleotide or polypeptide can be determined by following the algorithm in "Wilbur and Lipman, Proc Natl Acad Sci USA 80: 726-30 (1983)".
  • a method for Diagnosing Cancer The expression of C6orf167 gene was found to be specifically elevated in lung cancer (Figs. 1A-C, Fig. 7). Northern-blot analysis showed that C6orf167 was not expressed in normal tissues, except testis (Fig. 1D). Accordingly, the C6orf167 gene identified herein as well as its transcription and translation products find diagnostic utility as a marker for cancers such as lung cancer, and by measuring the expression of C6orf167 in a subject-derived biological sample. Cancer can be diagnosed or detected by comparing the expression level of C6orf167 gene between a subject-derived sample with a normal sample.
  • the present invention provides a method for detecting, diagnosing and/or determining the presence of or a predisposition for developing cancer, more particularly C6orf167-associated cancer such as lung cancer, by determining the expression level of C6orf167 gene in the subject.
  • the present invention provides a method for detecting or diagnosing cancer in a subject, such method including the step of determining an expression level of a C6orf167 gene in a subject-derived biological sample, wherein an increase of the level as compared to a normal control level of the gene indicates the presence or suspicion of cancer cells in the sample, which, in turn, suggests that the subject suffers from or is at risk of developing cancer.
  • the expression level of the C6orf167 gene may be determined by any known method, examples of which include: (a) detecting an mRNA of a C6orf167 gene; (b) detecting a protein encoded by a C6orf167 gene; and (c) detecting a biological activity of a protein encoded by a C6orf167 gene.
  • cancers to be diagnosed by the present method are lung cancers, including NSCLCs and SCLCs.
  • NSCLCs include, but are not limited to, lung adenocarcinoma (ADC) and lung squamous cell carcinoma (SCC).
  • ADC lung adenocarcinoma
  • SCC lung squamous cell carcinoma
  • an intermediate result for examining the condition of a subject may be provided. Such intermediate result may be combined with additional information to assist a doctor, nurse, or other practitioner to diagnose that a subject suffers from the disease.
  • the present invention contemplates the use of C6orf167 as a diagnostic marker for cancer.
  • the present invention may be used to detect or identify cancerous cells in a subject-derived tissue, such cells being characterized by an increase in said expression level as compared to a normal control level of said gene indicates the presence or suspicion of cancer cells in the tissue.
  • C6orf167 expression results may be combined with additional information to assist a doctor, nurse, or other healthcare practitioner in diagnosing a subject as afflicted with the disease.
  • the present invention may provide a doctor with useful information to diagnose a subject as afflicted with the disease.
  • the outcome of the gene expression analysis serves as an intermediate result for further diagnosis of a subject's disease state.
  • [1] A method of detecting or diagnosing cancer or a predisposition for developing cancer in a subject, including determining an expression level of C6orf167 gene in a subject-derived biological sample, wherein an increase of the level compared to a normal control level of the gene indicates that the presence of cancer in the subject, or the subject suffers from or is at risk of developing cancer; [2] The method of [1], wherein the increase is at least 10% greater than the normal control level; [3] The method of [1] or [2], wherein the expression level is detected by a method selected from among: (a) detecting an mRNA of a C6orf167 gene, (b) detecting a protein encoded by a C6orf167 gene, and (c) detecting a biological activity of a protein encoded by a C6orf167 gene; [4] The method of [3], wherein the expression level is determined by detecting hybridization of a probe to the
  • a subject to be diagnosed by the present method is preferably a mammal.
  • exemplary mammals include, but are not limited to, e.g., human, non-human primate, mouse, rat, dog, cat, horse, and cow. It is preferred to collect a biological sample from the subject to be diagnosed to perform the diagnosis. Any biological material can be used as a biological sample for the determination so long as it includes a transcription or translation product of C6orf167 gene.
  • the biological samples include, but are not limited to, bodily tissues which are desired for diagnosing or are suspicion of suffering from cancer, and fluids, such as biopsy sample, blood, sputum and urine.
  • the biological sample contains a cell population including an epithelial cell, more preferably a cancerous epithelial cell or an epithelial cell derived from tissue suspected to be cancerous.
  • the cell may be purified from the obtained bodily tissues or fluids, and then used as the biological sample.
  • a biological sample may include lung cells or a lung tissue obtained from a subject to be diagnosed.
  • the expression level of C6orf167 gene in a subject-derived biological sample is determined.
  • the expression level can be determined at the transcription product (mRNA) level, using methods known in the art.
  • the mRNA of C6orf167 gene may be quantified using probes by hybridization methods (e.g., Northern hybridization).
  • the detection may be carried out on a chip or an array.
  • the use of an array is preferable for detecting the expression level of a plurality of genes (e.g., various cancer specific genes) including C6orf167 gene.
  • Those skilled in the art can prepare such probes utilizing the sequence information of C6orf167 gene.
  • the cDNA of C6orf167 may be used as the probes.
  • the probe may be labeled with a suitable label, such as dyes, fluorescent and isotopes, and the expression level of the gene may be detected as the intensity of the hybridized labels.
  • the transcription product of C6orf167 gene may be quantified using primers by amplification-based detection methods (e.g., RT-PCR).
  • primers can also be prepared based on the available sequence information of the gene.
  • the primers used in the Example (SEQ ID NO: 3 to 6) may be employed for the detection by RT-PCR or Northern blot, but the present invention is not restricted thereto.
  • a probe or primer used for the present method hybridizes under stringent, moderately stringent, or low stringent conditions to the mRNA of C6orf167 gene.
  • stringent (hybridization) conditions refers to conditions under which a probe or primer will hybridize to its target sequence, but to no other sequences. Stringent conditions are sequence-dependent and will be different under different circumstances. Specific hybridization of longer sequences is observed at higher temperatures than shorter sequences. Generally, the temperature of a stringent condition is selected to be about 5 degreed C lower than the thermal melting point (Tm) for a specific sequence at a defined ionic strength and pH.
  • the Tm is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target sequence hybridize to the target sequence at equilibrium. Since the target sequences are generally present at excess, at Tm, 50% of the probes are occupied at equilibrium.
  • stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 degrees C for short probes or primers (e.g., 10 to 50 nucleotides) and at least about 60 degrees C for longer probes or primers. Stringent conditions may also be achieved with the addition of destabilizing agents, such as formamide.
  • the translation product may be detected for the diagnosis of the present invention.
  • the quantity of a protein encoded by a C6orf167 gene C6orf167 protein
  • a method for determining the quantity of the protein as the translation product includes immunoassay methods that use an antibody specifically recognizing the protein.
  • the antibody may be monoclonal or polyclonal.
  • any fragment or modification e.g., chimeric antibody, scFv, Fab, F(ab')2, Fv, etc.
  • Methods to prepare these kinds of antibodies for the detection of proteins are well known in the art, and any method may be employed in the present invention to prepare such antibodies and equivalents thereof.
  • the intensity of staining may be observed via immunohistochemical analysis using an antibody against C6orf167 protein. Namely, the observation of strong staining indicates increased presence of the C6orf167 protein and at the same time high expression level of C6orf167 gene.
  • the expression level of C6orf167 gene may also be determined to improve the accuracy of the diagnosis.
  • the expression level of cancer marker gene including C6orf167 gene in a biological sample can be considered to be increased if it increases from the control level of the corresponding cancer marker gene by, for example, 10%, 25%, or 50%; or increases to more than 1.1 fold, more than 1.5 fold, more than 2.0 fold, more than 5.0 fold, more than 10.0 fold, or more.
  • the control level may be determined at the same time with the test biological sample by using a sample(s) previously collected and stored from a subject/subjects whose disease state (cancerous or non-cancerous) is/are known.
  • the control level may be determined by a statistical method based on the results obtained by analyzing previously determined expression level(s) of C6orf167 gene in samples from subjects whose disease state are known.
  • the control level can be a database of expression patterns from previously tested cells.
  • the expression level of C6orf167 gene in a biological sample may be compared to multiple control levels, which control levels are determined from multiple reference samples.
  • control level determined from a reference sample derived from a tissue type similar to that of the subject-derived biological sample.
  • standard value may be obtained by any method known in the art. For example, a range of mean +/- 2 S.D. or mean +/- 3 S.D. may be used as standard value.
  • control level refers to the expression level of a test gene detected in a control sample and encompasses both a normal control level and a cancer control level.
  • normal control level refers to a level of gene expression detected in a normal healthy individual or in a population of individuals known not to be suffering from cancer. A normal individual is one with no clinical symptom of lung cancer. A normal control level can be determined using a normal cell obtained from a non-cancerous tissue. A "normal control level” may also be the expression level of a test gene detected in a normal healthy tissue or cell of an individual or population known not to be suffering from lung cancer.
  • cancer control level refers to an expression level of a test gene detected in the cancerous tissue or cell of an individual or population suffering from lung cancer.
  • the subject-derived sample may be any tissues obtained from test subjects, e.g., patients suspected of having cancer.
  • tissues may include epithelial cells. More particularly, tissues may be epithelial cells collected from a suspected cancerous area.
  • the expression level of C6orf167 gene in a subject-derived biological sample can be compared to (a) cancer control levels of C6orf167 gene.
  • a similarity between the expression level of a subject-derived biological sample and the cancer control level indicates that the subject (from which the sample has been obtained) suffers from or is at risk of developing cancer.
  • the expression levels of other cancer-related genes are also measured and compared, a similarity in the gene expression pattern between the sample and the reference that is cancerous indicates that the subject is suffering from or at a risk of developing cancer.
  • gene expression levels are deemed to be "altered” or “increased” when the gene expression changes or increases by, for example, 10%, 25%, or 50% from, or at least 0.1 fold, at least 0.2 fold, at least 0.5 fold, at least 2 fold, at least 5 fold, or at least 10 fold or more compared to a control level.
  • the expression level of cancer marker gene including C6orf167 in a biological sample can be considered to be increased if it increases from the normal control level of the corresponding cancer marker gene by, for example, 10% or more, 25% or more, or 50% or more; or increases to more than 1.1 fold, more than 1.5 fold, more than 2.0 fold, more than 5.0 fold, more than 10.0 fold, or more.
  • the expression level of the target gene can be determined by detecting, e.g., determined by the hybridization intensity of nucleic acid probes to gene transcripts in a sample. Difference between the expression levels of a test biological sample and the control level can be normalized to the expression level of control nucleic acids, e.g., housekeeping genes, whose expression levels are known not to differ depending on the cancerous or non-cancerous state of the cell.
  • control genes include, but are not limited to, beta-actin, glyceraldehyde 3 phosphate dehydrogenase, and ribosomal protein P1.
  • C6orf167 is not only a useful diagnostic marker, but is also suitable target for cancer therapy. Therefore, cancer treatment targeting C6orf167 can be achieved by the present invention.
  • the cancer treatment targeting C6orf167 refers to suppression or inhibition of C6orf167 activity and/or expression in the cancer cells. Any anti-C6orf167 agents may be used for the cancer treatment targeting C6orf167.
  • the anti-C6orf167 agents include following substance or active ingredient: (a) a double-stranded molecule of the present invention, (b) DNA encoding thereof, and (c) a vector encoding thereof.
  • the present invention provides a method of (i) diagnosing whether a subject has the cancer to be treated with anti- C6orf167 agent, and/or (ii) selecting a subject for cancer treatment targeting C6orf167, which method includes the steps of: a) determining the expression level of C6orf167 in cancer cells or tissue(s) obtained from a subject who is suspected to have the cancer to be treated; b) comparing the expression level of C6orf167 with a normal control level; c) diagnosing the subject as having the cancer to be treated, if the expression level of C6orf167 is increased as compared to the normal control level; and d) selecting the subject for cancer treatment, if the subject is diagnosed as having the cancer to be treated, in step c).
  • such a method includes the steps of: a) determining the expression level of C6orf167 in cancer cells or tissue(s) obtained from a subject who is suspected to have the cancer to be treated; b) comparing the expression level of C6orf167 with a cancerous control level; c) diagnosing the subject as having the cancer to be treated, if the expression level of C6orf167 is similar or equivalent to the cancerous control level; and d) selecting the subject for cancer treatment, if the subject is diagnosed as having the cancer to be treated, in step c).
  • kits for Diagnosing Cancer The present invention also provides a kit for diagnosing cancer, which may also be useful in assessing and/or monitoring the efficacy of a cancer therapy.
  • the present invention also provides a kit for determining a subject suffering from cancer that can be treated with the double-stranded molecule of the present invention or vector encoding thereof, which may also be useful in assessing and/or monitoring the efficacy of such cancer treatment.
  • the cancer to be diagnosed by the present kit is lung cancer, including NSCLC and SCLC.
  • the kit includes at least one reagent for detecting the expression level of the C6orf167 gene in a subject-derived biological sample, which reagent may be selected from the group consisting of: (a) a reagent for detecting an mRNA of a C6orf167 gene; (b) a reagent for detecting a protein encoded by a C6orf167 gene; and (c) a reagent for detecting a biological activity of a protein encoded by a C6orf167 gene.
  • Suitable reagents for detecting an mRNA of a C6orf167 gene include nucleic acids that specifically bind to or identify the C6orf167 mRNA, such as oligonucleotides which have a complementary sequence to a part of the C6orf167 mRNA. Such oligonucleotides specifically hybridize to the C6orf167 mRNA and the hybridization level correlate with the quantity of C6orf167 mRNA. These kinds of oligonucleotides are exemplified by primers and probes that are specific to the C6orf167 mRNA. These kinds of oligonucleotides may be prepared based on methods well known in the art. If needed, the reagent for detecting the C6orf167 mRNA may be immobilized on a solid matrix. Moreover, more than one reagent for detecting the C6orf167 mRNA may be included in the kit.
  • a probe or primer of the present invention typically comprises a substantially purified oligonucleotide.
  • the oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 2000, 1000, 500, 400, 350, 300, 250, 200, 150, 100, 50, or 25bp of consecutive sense strand nucleotide sequence of a nucleic acid comprising a C6orf167 sequence, or an anti sense strand nucleotide sequence of a nucleic acid comprising a C6orf167 sequence, or of a naturally occurring mutant of these sequences.
  • an oligonucleotide having 5-50bp in length can be used as a primer for amplifying the gene, to be detected. More preferably, mRNA or cDNA of a C6orf167 gene can be detected with oligonucleotide probe or primer having 15- 30bp in length. In preferred embodiments, length of the oligonucleotide probe or primer can be selected from 15-25bp.
  • Assay procedures, devices, or reagents for the detection of gene by using such oligonucleotide probe or primer are well known (e.g. oligonucleotide microarray or PCR). In these assays, probes or primers can also comprise tag or linker sequences.
  • probes or primers can be modified with detectable label or affinity ligand to be captured.
  • a polynucleotide having a few hundreds (e.g., about 100-200) bases to a few kilo (e.g., about 1000-2000) bases in length can also be used for a probe (e.g., northern blotting assay or cDNA microarray analysis).
  • suitable reagents for detecting a C6orf167 protein include antibodies against the C6orf167 protein.
  • the antibody may be monoclonal or polyclonal.
  • any fragment or modification (e.g., chimeric antibody, scFv, Fab, F(ab')2, Fv, etc.) of the antibody may be used as the reagent, so long as the fragment retains the binding ability to the C6orf167 protein.
  • Methods to prepare these kinds of antibodies for the detection of proteins are well known in the art, and any method may be employed in the present invention to prepare such antibodies and equivalents thereof.
  • the antibody may be labeled with signal generating molecules via direct linkage or an indirect labeling technique. Labels and methods for labeling antibodies and detecting the binding of antibodies to their targets are well known in the art and any labels and methods may be employed for the present invention.
  • more than one reagent for detecting the C6orf167 protein may be included in the kit.
  • the biological activity can be determined by, for example, measuring the cell proliferating activity due to the expressed C6orf167 protein in the biological sample.
  • the cell is cultured in the presence of a subject-derived biological sample, and then by detecting the speed of proliferation, or by measuring the cell cycle or the colony forming ability or the cell proliferating activity of the biological sample can be determined.
  • the reagent for detecting the C6orf167 mRNA may be immobilized on a solid matrix.
  • more than one reagent for detecting the biological activity of the C6orf167 protein may be included in the kit.
  • the kit may contain more than one of the aforementioned reagents.
  • the kit may include a solid matrix and reagent for binding a probe against the C6orf167 gene or antibody against the C6orf167 protein, a medium and container for culturing cells, positive and negative control reagents, and a secondary antibody for detecting an antibody against the C6orf167 protein.
  • tissue samples obtained from subject suffering from cancer or not may serve as useful control reagents.
  • a kit of the present invention may further include other materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts (e.g., written, tape, CD-ROM etc.) with instructions for use.
  • These reagents and such may be provided in a container with a label.
  • Suitable containers include bottles, vials, and test tubes.
  • the containers may be formed from a variety of materials, such as glass or plastic.
  • the reagent when the reagent is a probe against the C6orf167 mRNA, the reagent may be immobilized on a solid matrix, such as a porous strip, to form at least one detection site.
  • the measurement or detection region of the porous strip may include a plurality of sites, each containing a nucleic acid (probe).
  • a test strip may also contain sites for negative and/or positive controls. Alternatively, control sites may be located on a strip separated from the test strip.
  • the different detection sites may contain different amounts of immobilized nucleic acids, i.e., a higher amount in the first detection site and lesser amounts in subsequent sites.
  • the number of sites displaying a detectable signal provides a quantitative indication of the amount of C6orf167 mRNA present in the sample.
  • the detection sites may be configured in any suitably detectable shape and are typically in the shape of a bar or dot spanning the width of a test strip.
  • the kit of the present invention may further include positive and/or negative controls sample, and/or a C6orf167 standard sample.
  • the positive control sample of the present invention may be prepared by collecting C6orf167 positive cancer tissue samples.
  • C6orf167 positive samples may be obtained, for example, from established lung cancer cell lines, including lung adenocarcinoma cell (ADC) lines such as A427, NCI-H1781, A549, LC319 and the like; lung squamous cell carcinoma (SCC) cell lines such as NCI-H26, EBC-1, NCI-H520, NCI-H2170 and the like; and SCLC cell lines such as DMS114, DMS273, SBC-3, SBC-5, H196, H446 and the like.
  • ADC lung adenocarcinoma cell
  • SCC lung squamous cell carcinoma
  • the C6orf167 positive samples may be obtained from clinical lung cancer tissues, including lung adenocarcinoma tissues, lung squamous cell carcinoma tissues and SCLC tissues.
  • positive control samples may be prepared by determined a cut-off value and preparing a sample containing an amount of a C6orf167 mRNA or protein more than the cut-off value.
  • the phrase "cut-off value" refers to the value dividing between a normal range and a cancerous range.
  • ROC receiver operating characteristic
  • the present kit may include a C6orf167 standard sample containing a cut-off value amount of a C6orf167 mRNA or polypeptide.
  • negative control samples may be prepared from non-cancerous cell lines or non-cancerous tissues such as normal lung tissues, or may be prepared by preparing a sample containing a C6orf167 mRNA or protein less than cut-off value.
  • the present invention provides use of a reagent for preparing a diagnostic reagent for diagnosing cancer.
  • the reagent can be selected from the group consisting of: (a) a reagent for detecting mRNA of the C6orf167 gene; (b) a reagent for detecting the C6orf167 protein; and (c) a reagent for detecting the biological activity of the C6orf167 protein.
  • such reagent includes an oligonucleotide that hybridizes to the C6orf167 mRNA, or an antibody that binds to the C6orf167 protein.
  • the present invention also provides a reagent for detecting or diagnosing cancer.
  • such reagent includes an oligonucleotide that hybridize to the mRNA of the C6orf167 gene, or an antibody against the protein encoded by the C6orf167 gene.
  • C6orf167 is involved in cancer cell growth. Accordingly, substances that suppress an expression level of C6orf167 gene and/or a biological activity of C6orf167 polypeptide are useful for either or both of treating and preventing cancer. Such substances can be screened using a C6orf167 gene, polypeptides encoded by the gene, or transcriptional regulatory region of the gene. Thus, the present invention also provides a method of screening for a candidate substance for either or both of treating and preventing cancer using C6orf167 gene, C6orf167 polypeptide, or transcriptional regulatory region of the gene.
  • NFKBIL2 polypeptide interacts with C6orf167 polypeptide.
  • nuclear localization of C6orf167 polypeptide is crucial in cancer cell growth and NFKBIL2 polypeptide is involved in such nuclear localization.
  • substances that inhibit the interaction between C6orf167 polypeptide and NFKBIL2 polypeptide are also useful for either or both of treating and preventing cancer.
  • Such substances can be screened by identifying substances that inhibits the binding between C6orf167 polypeptide and NFKBIL2 polypeptide.
  • the present invention also provides a method of screening for a candidate substance for either or both of treating and preventing cancer by identifying a substance that inhibits the binding between C6orf167 polypeptide and NFKBIL2 polypeptide.
  • substances to be identified through the present screening methods may be any compound or composition including several compounds.
  • the test substance exposed to a cell or protein according to the screening methods of the present invention may be a single substance or a combination of substances.
  • the substances may be contacted sequentially or simultaneously.
  • the substances screened by the present screening method may be suitable candidate substances for treating and/or preventing cancer, and/or inhibiting cancer cell growth.
  • the cancer is preferably characterized by an association with C6orf167 overexpression. Accordingly, the screened substances may be preferably applied to the cancers correlated or associated with C6orf167 overexpression.
  • the cancers correlated or associated with C6orf167 overexpression are lung cancer, including NSCLCs and SCLCs.
  • NSCLCs include, but are not limited to, lung adenocarcinoma (ADC) and lung squamous cell carcinoma (SCC).
  • ADC lung adenocarcinoma
  • SCC lung squamous cell carcinoma
  • test substance for example, cell extracts, cell culture supernatants, products of fermenting microorganisms, extracts from marine organisms, plant extracts, purified or crude proteins, peptides, non-peptide compounds, synthetic micromolecular compounds (including nucleic acid constructs, such as antisense RNA, siRNA, Ribozymes, and aptamers etc.) and natural compounds can be used in the screening methods of the present invention.
  • test substance for example, cell extracts, cell culture supernatants, products of fermenting microorganisms, extracts from marine organisms, plant extracts, purified or crude proteins, peptides, non-peptide compounds, synthetic micromolecular compounds (including nucleic acid constructs, such as antisense RNA, siRNA, Ribozymes, and aptamers etc.) and natural compounds can be used in the screening methods of the present invention.
  • test substance of the present invention can be also obtained using any of the numerous approaches in combinatorial library methods known in the art, including (1) biological libraries, (2) spatially addressable parallel solid phase or solution phase libraries, (3) synthetic library methods requiring deconvolution, (4) the "one-bead one-compound” library method and (5) synthetic library methods using affinity chromatography selection.
  • biological libraries using affinity chromatography selection are limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, Anticancer Drug Des 1997, 12: 145-67).
  • a candidate substance obtained by the present screening method is a protein
  • for obtaining a DNA encoding the protein either the whole amino acid sequence of the protein may be determined to deduce the nucleic acid sequence coding for the protein, or partial amino acid sequence of the obtained protein may be analyzed to prepare an oligo DNA probe, which is used to screen cDNA libraries. The obtained DNA may then be tested to confirm that it encodes the candidate substance.
  • Test substances used in the screenings described herein may also be antibodies that specifically bind to a C6orf167 protein or partial peptides thereof that lack the biological activity of the original proteins in vivo.
  • test substance libraries are well known in the art, herein below, additional guidance in identifying test substances and preparing libraries of such substances for the present screening methods is provided.
  • One approach to preliminary screening of test substances suitable for further evaluation utilizes computer modeling of the interaction between the test substance and its target.
  • Computer modeling technology allows for the visualization of the three-dimensional atomic structure of a selected molecule and the rational design of new substances that will interact with the molecule.
  • the three-dimensional construct typically depends on data from x-ray crystallographic analysis or NMR imaging of the selected molecule.
  • the molecular dynamics require force field data.
  • the computer graphics systems enable prediction of how a new substance will link to the target molecule and allow experimental manipulation of the structures of the substance and target molecule to perfect binding specificity. Prediction of what the molecule-substance interaction will be when small changes are made in one or both requires molecular mechanics software and computationally intensive computers, usually coupled with user-friendly, menu-driven interfaces between the molecular design program and the user
  • CHARMm performs the energy minimization and molecular dynamics functions.
  • QUANTA performs the construction, graphic modeling and analysis of molecular structure. QUANTA allows interactive construction, modification, visualization, and analysis of the behavior of molecules with each other.
  • test substances may be screened using the methods of the present invention to identify test substances suited to the treatment and/or prophylaxis of cancer and/or the prevention of post-operative recurrence of cancer, particularly wherein the cancer is lung cancer.
  • Combinatorial chemical synthesis Combinatorial libraries of test substances may be produced as part of a rational drug design program involving knowledge of core structures existing in known inhibitors. This approach allows the library to be maintained at a reasonable size, facilitating high throughput screening.
  • simple, particularly short, polymeric molecular libraries may be constructed by simply synthesizing all permutations of the molecular family making up the library.
  • An example of this latter approach would be a library of all peptides six amino acids in length. Such a peptide library could include every 6 amino acid sequence permutation. This type of library is termed a linear combinatorial chemical library.
  • Combinatorial chemical libraries include, but are not limited to, peptide libraries (see, e.g., US Patent 5,010,175; Furka, Int J Pept Prot Res 1991, 37: 487-93; Houghten et al., Nature 1991, 354: 84-6).
  • peptide libraries see, e.g., US Patent 5,010,175; Furka, Int J Pept Prot Res 1991, 37: 487-93; Houghten et al., Nature 1991, 354: 84-6.
  • Other chemistries for generating chemical diversity libraries can also be used. Such chemistries include, but are not limited to: peptides (e.g., PCT Publication No.
  • WO 91/19735 encoded peptides (e.g., WO 93/20242), random bio-oligomers (e.g., WO 92/00091), benzodiazepines (e.g., US Patent 5,288,514), diversomers such as hydantoins, benzodiazepines and dipeptides (DeWitt et al., Proc Natl Acad Sci USA 1993, 90:6909-13), vinylogous polypeptides (Hagihara et al., J Amer Chem Soc 1992, 114: 6568), nonpeptidal peptidomimetics with glucose scaffolding (Hirschmann et al., J Amer Chem Soc 1992, 114: 9217-8), analogous organic syntheses of small compound libraries (Chen et al., J.
  • a second approach uses primarily chemical methods, of which the Geysen method (Geysen et al., Molecular Immunology 1986, 23: 709-15; Geysen et al., J Immunologic Method 1987, 102: 259-74); and the method of Fodor et al. (Science 1991, 251: 767-73) are examples.
  • Furka et al. 14th International Congress of Biochemistry 1988, Volume #5, Abstract FR:013; Furka, Int J Peptide Protein Res 1991, 37: 487-93
  • Houghten US Patent 4,631,211
  • Rutter et al. US Patent 5,010,175) describe methods to produce a mixture of peptides that can be tested as agonists or antagonists.
  • Aptamers are macromolecules composed of nucleic acid that bind tightly to a specific molecular target.
  • Tuerk and Gold discloses SELEX (Systematic Evolution of Ligands by Exponential Enrichment) method for selection of aptamers.
  • SELEX Systematic Evolution of Ligands by Exponential Enrichment
  • a large library of nucleic acid molecules ⁇ e.g., 10 15 different molecules) can be used for screening.
  • the present invention provides methods of screening for a candidate substance applicable to either or both of the treatment and prevention of cancer using a C6orf167 polypeptide.
  • the C6orf167 polypeptide to be used may be, for example, a purified polypeptide, a soluble protein, a form bound to a carrier or a fusion protein fused with other polypeptides.
  • the C6orf167 polypeptide may be a recombinant polypeptide, a protein derived from the nature or a partial peptide thereof.
  • C6orf167 polypeptides may be included in C6orf167 polypeptides used for the present screening so long as the modified peptide retains at least one biological activity of the original polypeptide.
  • Examles of the biological activity of the C6orf167 polypeptide include, but are not limited to, cell proliferative activity, binding activity to NFKBIL2 polypeptide. Typical examples of such functional equivalents are described above in the section entitled "The Genes and Polypeptides".
  • a preferred example of such a functional equivalent includes a polypeptide containing an NFKBIL2-binding domain of C6orf167 polypeptide.
  • Such polypeptides containing an NFKBIL2-binding domain include, but are not limited to, a polypeptide having an amino acid sequence of 1 to 414 of SEQ ID NO: 18 or 20.
  • the C6orf167 protein may be produced in vitro by means of an in vitro translation system.
  • the C6orf167 polypeptide to be used in the screening method of the present invention can be, for example, a purified polypeptide, a soluble protein, or a fusion protein fused with other polypeptides.
  • the polypeptides or fragments used for the present method may be obtained from nature as naturally occurring proteins via conventional purification methods or through chemical synthesis based on the selected amino acid sequence.
  • conventional peptide synthesis methods that can be adopted for the synthesis include: 1) Peptide Synthesis, Interscience, New York, 1966; 2) The Proteins, Vol.
  • polypeptides may be obtained by adapting any known genetic engineering methods to the production of the instant polypeptides (e.g., Morrison J., J Bacteriology 1977, 132: 349-51; Clark-Curtiss & Curtiss, Methods in Enzymology (eds. Wu et al.) 1983, 101: 347-62).
  • a suitable vector including a polynucleotide encoding the desired protein in an expressible form e.g., downstream of a regulatory sequence including a promoter
  • the host cell is cultured to produce the protein.
  • a gene encoding a C6orf167 polypeptide is expressed in host (e.g., animal) cells by inserting the gene into a vector for expressing foreign genes, such as pSV2neo, pcDNA I, pcDNA3.1, pCAGGS, or pCD8.
  • a promoter may be used for the expression. Any commonly used promoter may be employed, including, for example, the SV40 early promoter (Rigby in Williamson (ed.), Genetic Engineering, vol. 3.
  • the EF-alpha promoter (Kim et al., Gene 1990, 91:217-23), the CAG promoter (Niwa et al., Gene 1991, 108:193), the RSV LTR promoter (Cullen, Methods in Enzymology 1987, 152:684-704), the SR-alpha promoter (Takebe et al., Mol Cell Biol 1988, 8:466), the CMV immediate early promoter (Seed et al., Proc Natl Acad Sci USA 1987, 84:3365-9), the SV40 late promoter (Gheysen et al., J Mol Appl Genet 1982, 1:385-94), the Adenovirus late promoter (Kaufman et al., Mol Cell Biol 1989, 9:946), the HSV TK promoter, and such.
  • the introduction of the vector into host cells to express a C6orf167 polypeptide may be performed according to any conventional method, for example, the electroporation method (Chu et al., Nucleic Acids Res 1987, 15:1311-26), the calcium phosphate method (Chen et al., Mol Cell Biol 1987, 7:2745-52), the DEAE dextran method (Lopata et al., Nucleic Acids Res 1984, 12:5707-17; Sussman et al., Mol Cell Biol 1985, 4:1641-3), the Lipofectin method (Derijard B, Cell 1994, 7:1025-37; Lamb et al., Nature Genetics 1993, 5:22-30; Rabindran et al., Science 1993, 259:230-4), and such.
  • electroporation method Chou et al., Nucleic Acids Res 1987, 15:1311-26
  • the calcium phosphate method Choen et al., Mol Cell Biol 1987, 7:27
  • a C6orf167 polypeptide may be further linked to other substances, so long as the polypeptides and fragments retain at least one biological activity.
  • Usable substances include: peptides, lipids, sugar and sugar chains, acetyl groups, natural and synthetic polymers, etc. Such modifications may be used to confer additional functions or to stabilize the polypeptide and fragments.
  • the polypeptides may be expressed as a fusion protein including a recognition site (epitope) of a monoclonal antibody by introducing the epitope of the monoclonal antibody, whose specificity has been revealed, to the N- or C- terminus of the polypeptide.
  • a commercially available epitope-antibody system may be used (Experimental Medicine 13: 85-90 (1995)).
  • Vectors that are capable of expressing a fusion protein with, for example, beta-galactosidase, maltose binding protein, glutathione S-transferase, green florescence protein (GFP), and so on, by the use of its multiple cloning sites are commercially available.
  • a fusion protein prepared by introducing only small epitopes composed of several to a dozen amino acids so as not to change the property of the original polypeptide by the fusion, is also provided herein.
  • Epitopes such as polyhistidine (His-tag), influenza aggregate HA, human c-myc, FLAG, Vesicular stomatitis virus glycoprotein (VSV-GP), T7 gene 10 protein (T7-tag), human simple herpes virus glycoprotein (HSV-tag), E-tag (an epitope on monoclonal phage) and such, and antibodies recognizing them may be used as the epitope-antibody system for detecting the binding activity between the polypeptides (Experimental Medicine 13: 85-90 (1995)).
  • His-tag polyhistidine
  • influenza aggregate HA human c-myc
  • FLAG Vesicular stomatitis virus glycoprotein
  • VSV-GP Vesicular stomatitis virus glycoprotein
  • T7-tag T7 gene 10 protein
  • HSV-tag human simple herpes virus glycoprotein
  • E-tag an epitope on monoclonal phage
  • the present invention also provides a method of screening for a candidate substance that suppresses the proliferation of cancer cells, and a method for screening a candidate substance for treating or preventing cancer using the C6orf167 polypeptide.
  • an embodiment of this screening method includes the steps of: (a) contacting a test substance with a C6orf167 polypeptide or functional equivalent thereof; (b) detecting the binding activity between the polypeptide or the functional equivalent and the test substance; and (c) selecting the test substance that binds to the polypeptide or the functional equivalent.
  • the potential therapeutic effect of a test substance for either or both of treating and preventing cancer can also be evaluated or estimated.
  • the present invention provides a method for evaluating or estimating a therapeutic effect of a test substance for either or both of treating and preventing cancer and/or inhibiting cancer associated with over-expression of C6orf167 gene, the method including steps of: (a) contacting a test substance with a C6orf167 polypeptide or functional equivalent thereof; (b) detecting the binding activity between the polypeptide or the functional equivalent and the test substance; and (c) correlating the potential therapeutic effect and the test substance, wherein the potential therapeutic effect is shown, when a substance binds to the polypeptide or the functional equivalent.
  • the therapeutic effect may be correlated with the binding level of the test substance and C6orf167 polypeptide (or functional equivalent thereof).
  • the test substance when the test substance binds to a C6orf167 polypeptide, the test substance may identified or selected as a candidate substance having the requisite therapeutic effect.
  • the test substance when the test substance does not bind to a C6orf167 polypeptide, the test substance may characterized as having no significant therapeutic effect.
  • the C6orf167 polypeptide to be used for screening may be a recombinant polypeptide or a protein derived from the nature or a partial peptide thereof.
  • the polypeptide to be contacted with a test substance may be, for example, a purified polypeptide, a soluble protein, a form bound to a carrier or a fusion protein fused with other polypeptides.
  • test substances used by the present invention may be proteins such as antibodies or synthetic chemical compounds.
  • a method of screening substances that bind to a C6orf167 polypeptide many methods well known by a person skilled in the art may be used.
  • Such a screening may be conducted by, for example, immunoprecipitation method.
  • immunoprecipitation method it is preferred that a C6orf167 polypeptide contains an antibody recognition site.
  • C6orf167 polypeptides to be used for the screening method of the present invention may be prepared as described above.
  • a C6orf167 polypeptide can be expressed as a fusion protein as described above.
  • an immune complex is formed by adding these antibodies to cell lysate prepared using an appropriate detergent.
  • the immune complex consists of the C6orf167 polypeptide, a polypeptide including the binding ability with the polypeptide, and an antibody. Immunoprecipitation can be also conducted using antibodies against the C6orf167 polypeptide, besides using antibodies against the above epitopes, which antibodies can be prepared as described above.
  • An immune complex can be precipitated, for example by Protein A sepharose or Protein G sepharose when the antibody is a mouse IgG antibody.
  • a C6orf167 polypeptide is prepared as a fusion protein with an epitope, such as GST
  • an immune complex can be formed in the same manner as in the use of the antibody against the C6orf167 polypeptide, using a substance specifically binding to these epitopes, such as glutathione-Sepharose 4B. Immunoprecipitation can be performed by following or according to, for example, the methods in the literature (Harlow and Lane, Antibodies, 511-52, Cold Spring Harbor Laboratory publications, New York (1988)).
  • SDS-PAGE is commonly used for analysis of immunoprecipitated proteins and the bound protein can be analyzed by the molecular weight of the protein using gels with an appropriate concentration. Since the protein bound to the C6orf167 polypeptide is difficult to detect by a common staining method, such as Coomassie staining or silver staining, the detection sensitivity for the protein can be improved by culturing cells in culture medium containing radioactive isotope, 35 S-methionine or 35 S-cystein, labeling proteins in the cells, and detecting the proteins. The target protein can be purified directly from the SDS-polyacrylamide gel and its sequence can be determined, when the molecular weight of a protein has been revealed.
  • a protein binding to the C6orf167 polypeptide can be obtained by preparing a cDNA library from cultured cells expected to express a protein binding to the C6orf167 polypeptide using a phage vector (e.g., ZAP), expressing the protein on LB-agarose, fixing the protein expressed on a filter, reacting the purified and labeled C6orf167 polypeptide with the above filter, and detecting the plaques expressing proteins bound to the C6orf167 polypeptide according to the label.
  • a phage vector e.g., ZAP
  • the polypeptide of the invention may be labeled by utilizing the binding between biotin and avidin, or by utilizing an antibody that specifically binds to the C6orf167, or a peptide or polypeptide (for example, GST) that is fused to the C6orf167 polypeptide. Methods using radioisotope or fluorescence and such may be also used.
  • a two-hybrid system utilizing cells may be used ("MATCHMAKER Two-Hybrid system", “Mammalian MATCHMAKER Two-Hybrid Assay Kit”, “MATCHMAKER one-Hybrid system” (Clontech); “HybriZAP Two-Hybrid Vector System” (Stratagene); the references “Dalton and Treisman, Cell 68: 597-612 (1992)", “Fields and Sternglanz, Trends Genet 10: 286-92 (1994)”).
  • the polypeptide of the invention is fused to the SRF-binding region or GAL4-binding region and expressed in yeast cells.
  • a cDNA library is prepared from cells expected to express a protein binding to the polypeptide of the invention, such that the library, when expressed, is fused to the VP16 or GAL4 transcriptional activation region.
  • the cDNA library is then introduced into the above yeast cells and the cDNA derived from the library is isolated from the positive clones detected (when a protein binding to the polypeptide of the invention is expressed in yeast cells, the binding of the two activates a reporter gene, making positive clones detectable).
  • a protein encoded by the cDNA can be prepared by introducing the cDNA isolated above to E. coli and expressing the protein.
  • a reporter gene for example, Ade2 gene, lacZ gene, CAT gene, luciferase gene and such can be used in addition to the HIS3 gene.
  • a substance that binds to a C6orf167 polypeptide may also be screened using affinity chromatography.
  • a C6orf167 polypeptide may be immobilized on a carrier of an affinity column, and a composition containing test substances is applied to the column.
  • a composition herein may be, for example, cell extracts, cell lysates, antibody libraries etc. After loading test substances, the column is washed, and substances bound to the C6orf167 polypeptide can be collected.
  • the test substance is a protein
  • the amino acid sequence of the obtained protein is analyzed, an oligo DNA is synthesized based on the sequence, and cDNA libraries are screened using the oligo DNA as a probe to obtain a DNA encoding the protein.
  • a biosensor using the surface plasmon resonance phenomenon may be used as a mean for detecting or quantifying the bound substance in the present invention.
  • a biosensor When such a biosensor is used, the interaction between a C6orf167 polypeptide and a test substance can be observed real-time as a surface plasmon resonance signal, using only a minute amount of polypeptide and without labeling (for example, BIAcore, Pharmacia). Therefore, it is possible to evaluate the binding between a C6orf167 polypeptide and a test substance using a biosensor such as BIAcore.
  • the C6orf167 polypeptide is characterized as having the activity of promoting cell proliferation of cancer cells (Fig. 2).
  • the C6orf167 polypeptide is also characterized as having the activity of binding to a NFKBIL2 polypeptide (Fig. 3).
  • the present invention provides a method for screening a substance that suppresses the proliferation of cancer cells expressing C6orf167 gene, and a method of screening for a substance for either or both of treating and preventing the cancer, particular C6orf167 associated cancers such as lung cancer.
  • the present invention provides a method of screening for a candidate substance for either or both of treating and preventing cancer using a C6orf167 polypeptide including the steps as follows: (a) contacting a test substance with a C6orf167 polypeptide or functional equivalent thereof; (b) detecting the biological activity of the polypeptide or the functional equivalent of step (a); and (c) selecting the test substance that suppresses the biological activity of the polypeptide or the functional equivalent as compared to the biological activity detected in the absence of the test substance.
  • the therapeutic effect of the test substance in suppressing the biological activity (e.g., the cell-proliferating activity) of C6orf167 polypeptide (or functional equivalent thereof), or a candidate substance for either or both of treating and preventing cancer may be evaluated.
  • the present invention also provides a method of screening for a candidate substance that suppresses the biological activity of C6orf167 polypeptide, or a candidate substance for either or both of treating and preventing cancer, using the C6orf167 polypeptide or functional equivalent thereof, including the following steps: (a) contacting a test substance with the C6orf167 polypeptide or a functional equivalent thereof; and (b) detecting the biological activity of the polypeptide or the functional equivalent of step (a), and (c) correlating the biological activity of (b) with the therapeutic effect of the test substance.
  • the present invention provides a method for evaluating or estimating a therapeutic effect of a test substance in the treatment and/or prevention of cancer and/or in the inhibition of the growth of a cancer associated with over-expression of C6orf167 gene, the method including steps of: (a) contacting a test substance with the C6orf167 polypeptide or a functional equivalent thereof; (b) detecting the biological activity of the polypeptide or functional equivalent of step (a); and (c) correlating the potential therapeutic effect and the test substance, wherein the potential therapeutic effect is shown, when a substance suppresses the biological activity of the C6orf167 polypeptide or functional equivalent as compared to the biological activity of said polypeptide detected in the absence of the test substance.
  • the candidate substances identified in the screening methods of the present invention can be used in the treatment or prevention of cancers.
  • Such cancers include lung cancer.
  • the therapeutic effect may be correlated with the biological activity of the C6orf167 polypeptide or a functional equivalent thereof.
  • the test substance when the test substance suppresses or inhibits the biological activity of the C6orf167 polypeptide or a functional equivalent thereof as compared to a level detected in the absence of the test substance, the test substance may identified or selected as the candidate substance having the therapeutic effect.
  • the test substance when the test substance does not suppress or inhibit the biological activity of the C6orf167 polypeptide or a functional equivalent thereof as compared to a level detected in the absence of the test substance, the test substance may identified as the substance having no significant therapeutic effect.
  • Any polypeptides can be used for screening so long as they retain a biological activity of the C6orf167 polypeptide.
  • biological activity includes, but are not limited to, cell proliferation promoting activity, binding activity to NFKBIL2 polypeptide and nuclear localization activity.
  • naturally occurring human C6orf167 polypeptides e.g., polypeptide having an amino acid sequence of SEQ ID NO: 18 or 20
  • polypeptides functionally equivalent to these polypeptide can also be used (see " Genes and Polypeptides ").
  • Such polypeptides may be expressed endogenously or exogenously by cells. Methods for preparing such polypeptides are described above.
  • the present invention also provides a screening method following the method described in the above "Screening" section, such method including the steps of: (a) contacting a test substance with the C6orf167 polypeptide or functional equivalent thereof; (b) detecting the binding between the polypeptide or the functional equivalent and the test substance; (c) selecting the test substance that binds to the polypeptide or the functional equivalent; (d) contacting the test substance selected in step (c) with the C6orf167 polypeptide or the functional equivalent; (e) comparing the biological activity of the polypeptide or the functional equivalent detected in the step (d) with the biological activity detected in the absence of the test substance; and (f) selecting the test substance that suppresses the biological activity of the polypeptide or the functional equivalent as a candidate substance for treating or preventing lung cancer.
  • the substance isolated by this screening is a candidate for antagonists of the polypeptide encoded by C6orf167 gene.
  • antagonist refers to molecules that inhibit the function of the polypeptide by binding thereto. This term also refers to molecules that reduce or inhibit expression of the gene encoding C6orf167.
  • a substance isolated by this screening is a candidate for substances which inhibit the in vivo interaction of the C6orf167 polypeptide with molecules (including DNAs and proteins).
  • the biological activity to be detected in the present method is cell proliferation
  • it can be detected, for example, by preparing cells which express the C6orf167 polypeptide, culturing the cells in the presence of a test substance, and determining the speed of cell proliferation, measuring the cell cycle and such, as well as by measuring survival cells or the colony forming activity, for example, shown in Fig. 2.
  • the substances that reduce the speed of proliferation of the cells expressed C6orf167 gene are selected as candidate substance for treating or preventing cancer.
  • the method includes the step of: (a) contacting a test substance with cells overexpressing C6orf167 gene; (b) measuring cell-proliferating activity; and (c) selecting the test substance that reduces the cell-proliferating activity in the comparison with the cell-proliferating activity in the absence of the test substance.
  • the method of the present invention may further include the steps of: (d) selecting the test substance that have no effect to the cells no or little expressing C6orf167 gene.
  • suppress the biological activity are preferably at least 10% suppression of the biological activity of C6orf167 polypeptide in comparison with in absence of the substance, more preferably at least 25%, 50% or 75% suppression and most preferably at 90% suppression.
  • control cells that do not express C6orf167 gene are used.
  • the present invention also provides a method of screening for a candidate substance that inhibits cell growth or a candidate substance for either or both of treating and preventing a C6orf167- associated disease, using the C6orf167 polypeptide or functional equivalent thereof including the steps as follows: (a) culturing cells which express a C6orf167 polypeptide or a functional equivalent thereof, and control cells that do not express a C6orf167 polypeptide or a functional equivalent thereof in the presence of the test substance; (b) detecting the biological activity of the cells which express the C6orf167 polypeptide and control cells; and (c) selecting the test substance that inhibits the biological activity in the cells which express the protein as compared to the proliferation detected in the control cells and in the absence of said test substance.
  • the biological activity to be detected in the screening method of the present invention is binding activity to NFKBIL2 polypeptide
  • it can be detected, for example, by detecting the binding between C6orf167 polypeptide and NFKBIL2 polypeptide in the presence of a test substance. Details will be described under the following item "(iii) Screening for a Substance that Inhibits the Binding between C6orf167 and NFKBIL2".
  • the biological activity to be detected in the screening method of the present invention is nuclear localization activity
  • it can be detected, for example, by preparing cells which express a C6orf167 polypeptide or functional equivalent thereof, culturing the cells in the presence of a test substance, and determining the level of the C6orf167 polypeptide or the functional equivalent thereof that localize in the nuclear.
  • the nuclear localization level of C6orf167 polypeptide or the functional equivalent thereof can be determined by methods well-known in the art. For example, nuclear localization may be detected by immunocytochemical analysis or, cell fractionation and following Western blotting analysis, using an antibody against C6orf167 polypeptide as described in the Examples.
  • suppressing the biological activity of C6orf167 polypeptide reduces cell growth.
  • candidate substances that can be used to treat and/or prevent cancers can be identified.
  • the potential of these candidate substances to treat or prevent cancers may be evaluated by second and/or further screening to identify therapeutic substance for cancers. For example, when a substance that inhibits the biological activity of a C6orf167 polypeptide also inhibits the activity of a cancer, it may be concluded that such a substance has a C6orf167 specific therapeutic effect.
  • NFKBIL3 polypeptide is involved in nuclear localization of C6orf167 polypeptide, which is important for cancer cell growth. Accordingly, substances that inhibit the binding between C6orf167 polypeptide and NFKBIL2 polypeptide are useful for cancer therapeutic agents.
  • the present invention also provides a method of screening for a candidate substance that inhibits or reduces the growth of cancer cells, and a candidate substance for treating or preventing cancers, e.g. lung cancer.
  • the present invention provides the following methods of [1] to [7]:
  • [1] A method of screening for a substance that inhibits or reduces the binding between a C6orf167 polypeptide and an NFKBIL2 polypeptide, such method including the steps of: (a) contacting a C6orf167 polypeptide or functional equivalent thereof with an NFKBIL2 polypeptide or functional equivalent thereof in the presence of a test substance; (b) detecting a binding level between the polypeptides in the step (a); (c) comparing the binding level detected in the step (b) with those detected in the absence of the test substance; and (d) selecting the test substance that reduces or inhibits the binding level between the polypeptides; [2] A method of screening for a candidate substance suitable for the treatment and/or prevention of cancer or that inhibits cancer cell growth, such method including the steps of: (a) contacting a C6orf167 polypeptide or functional equivalent thereof with an NFKBIL2 polypeptide or functional equivalent thereof, in the presence of
  • the therapeutic effect of a candidate substance on the inhibition of the cell growth or a candidate substance in connection with the treatment and/or prevention of cancer may be evaluated. Therefore, the present invention also provides a method of screening for a candidate substance that suppresses the proliferation of cancer cells, and a method of screening for a candidate substance suited to the treatment and/or prevention cancer.
  • An illustrative example of such a method includes the steps of: (a) contacting a C6orf167 polypeptide or functional equivalent thereof with an NFKBIL2 polypeptide or functional equivalent thereof in the presence of a test substance; (b) detecting the level of binding between the polypeptides in the step (a); (c) comparing the binding level detected in the step (b) with those detected in the absence of the test substance; and (d) correlating the binding level of (c) with the therapeutic effect of the test substance.
  • the present invention may provide a method for evaluating or estimating the therapeutic effect of a test substance in connection with either or both of the treatment and prevention of cancer or the inhibition of cancer, the method including steps of: (a) contacting a C6orf167 polypeptide or functional equivalent thereof with an NFKBIL2 polypeptide or functional equivalent thereof in the presence of a test substance; (b) detecting a binding level between the polypeptides in the step (a); (c) comparing the binding level detected in the step (b) with those detected in the absence of the test substance; and (d) correlating the potential therapeutic effect and the test substance, wherein the potential therapeutic effect is shown, when a test substance reduces the binding level.
  • therapeutic effect may be correlated with the binding level of a C6orf167 polypeptide and an NFKBIL2 polypeptide.
  • a test substance when a test substance reduces the binding level of C6orf167 polypeptide and NFKBIL2 polypeptide as compared to a level detected in the absence of the test substance, the test substance may identified or selected as a candidate substance having the desired therapeutic effect.
  • the test substance when the test substance does not reduce the binding level of C6orf167 polypeptide and NFKBIL2 polypeptide as compared to a level detected in the absence of the test substance, the test substance may identified as the substance having no significant therapeutic effect.
  • a functional equivalent of a C6orf167 polypeptide or NFKBIL2 polypeptide will have a biological activity equivalent to a C6orf167 polypeptide or NFKBIL2 polypeptide (see, "Genes and Polypeptides").
  • functional equivalents of a C6orf167 polypeptide includes an NFKBIL2-binding domain of the C6orf167 polypeptide. Examples of such functional equivalent include, but are not limited to, polypeptides having an amino acid sequence of 1 to 414 of SEQ ID NO: 18 or 20.
  • NFKBIL2 polypeptide include a C6orf167-binding domain of the NFKBIL2 polypeptide.
  • functional equivalents of an NFKBIL2 polypeptide include, but are not limited to, polypeptides having an amino acid sequence of 932 to 1378 of SEQ ID NO: 22.
  • a screening can be conducted via, for example, an immunoprecipitation, West-Western blotting analysis (Skolnik et al., Cell 65: 83-90 (1991)), a two-hybrid system utilizing cells ("MATCHMAKER Two-Hybrid system", “Mammalian MATCHMAKER Two-Hybrid Assay Kit”, “MATCHMAKER one-Hybrid system” (Clontech); “HybriZAP Two-Hybrid Vector System” (Stratagene); the references “Dalton and Treisman, Cell 68: 597-612 (1992)", “Fields and Sternglanz, Trends Genet 10: 286-92 (1994)”), affinity chromatography and a biosensor using the surface plasmon resonance phenomenon.
  • Those methods can be conducted in
  • the screening method of the present invention may be carried out in a cell-based assay using cells expressing both of a C6orf167 polypeptide and an NFKBIL2 polypeptide.
  • Cells expressing C6orf167 polypeptide and NFKBIL2 polypeptide include, for example, cell lines established from cancer, e.g. lung cancer.
  • the cells may be prepared through transformation with polynucleotides encoding a C6orf167 polypeptide and an NFKBIL2 polypeptide. Such transformation may be carried out using an expression vector encoding both C6orf167 polypeptide and NFKBIL2 polypeptide, or expression vectors encoding either C6orf167 polypeptide or NFKBIL2 polypeptide.
  • the screening method of the present invention can be conducted by incubating such cells in the presence of a test substance.
  • the binding between C6orf167 polypeptide to NFKBIL2 polypeptide can be detected by immunoprecipitation assay using an anti-C6orf167 antibody or anti-NFKBIL2 antibody.
  • a C6orf167 polypeptide and a NFKBIL2 polypeptide contains antibody recognition sites.
  • a C6orf167 and/or NFKBIL2 polypeptide may be prepared as fusion proteins that includes the polypeptide and a commercially available epitope. Methods for preparing such fusion proteins are described above.
  • an immune complex may be formed by adding antibodies against epitopes fused to C6orf167 polypeptide and/or NFKBIL2 polypeptide to cell lysate prepared using an appropriate detergent.
  • the immune complex consists of the C6orf167 polypeptide, the NFKBIL2 polypeptide, and the antibody.
  • Immunoprecipitation can be also conducted using antibodies against the C6orf167 polypeptide and/or NFKBIL2 polypeptide, besides using antibodies against the above epitopes, which antibodies can be prepared as described above.
  • An immune complex can be precipitated, for example by Protein A sepharose or Protein G sepharose when the antibody is a mouse IgG antibody.
  • a potential therapeutic effect refers to a clinical benefit with a reasonable expectation.
  • such clinical benefit may include; (a) a reduction of the binding between C6orf167 polypeptide and NFKBIL2 polypeptide, (b) a decrease in size, prevalence, or metastatic potential of the cancer in the subject, (c) the prevention of further cancer formation, or (d) the prevention or alleviation of a clinical symptom of cancer.
  • the present invention provides a method of screening for a substance that inhibits the expression of C6orf167.
  • a substance that inhibits the expression of C6orf167 suppresses the proliferation of cancer cells, and thus is useful for treating or preventing cancer, particularly C6orf167-associated cancers such as lung cancer. Therefore, the present invention also provides a method for screening a substance that suppresses the proliferation of cancer cells, and a method for screening a candidate substance for treating or preventing cancer.
  • such screening may include, for example, the following steps: (a) contacting a test substance with a cell expressing C6orf167 gene; (b) detecting an expression level of the C6orf167 gene in the cell of the step (a); and (c) selecting the test substance that reduces the expression level of the C6orf167gene in the absence of the test substance.
  • such screening may include, for example, the following steps: (a) contacting a test substance with a cell expressing the C6orf167 gene; (b) detecting the expression level of the C6orf167 gene; and (c) correlating the expression level of (b) with the therapeutic effect of the test substance.
  • the therapeutic effect may be correlated with the expression level of the C6orf167 gene.
  • the test substance when the test substance reduces the expression level of the C6orf167 gene as compared to a level detected in the absence of the test substance, the test substance may identified or selected as the candidate substance having the therapeutic effect.
  • the test substance may identified as the substance having no significant therapeutic effect.
  • Cells expressing a C6orf167 gene include, for example, cell lines established from lung cancer or cell lines transfected with a C6orf167 expression vector; any of such cells can be used for the screening method of the present invention.
  • the expression level of a C6orf167 gene can be estimated by methods well known to one skilled in the art, for example, RT-PCR, Northern blot assay, Western blot assay, immunostaining and flow cytometry analysis.
  • the phrase "reduce the expression level" as defined herein are preferably at least 10% reduction of expression level of C6orf167 gene in comparison to the expression level in absence of the substance, more preferably at least 25%, 50% or 75% reduced level and most preferably at least 95% reduced level.
  • the substance herein includes chemical compounds, double-strand nucleotides, and so on. The preparation of the double-strand nucleotides will be described bellow. In the method of screening, a substance that reduces the expression level of C6orf167 gene can be selected as candidate substances to be used for the treatment or prevention of cancer.
  • the screening method of the present invention may include the following steps: (a) contacting a test substance with a cell into which a vector, including the transcriptional regulatory region of a C6orf167 gene and a reporter gene that is expressed under the control of the transcriptional regulatory region, has been introduced; (b) measuring the expression level or activity of the reporter gene; and (c) selecting the test substance that reduces the expression level or activity of the reporter gene.
  • reporter genes and host cells are well known in the art.
  • Illustrative reporter genes include, but are not limited to, luciferase, green fluorescence protein (GFP), Discosoma sp. Red Fluorescent Protein (DsRed), Chrolamphenicol Acetyltransferase (CAT), lacZ and beta-glucuronidase (GUS), and host cell is COS7, HEK293, HeLa and so on.
  • the reporter construct required for the screening can be prepared by connecting reporter gene sequence to the transcriptional regulatory region of C6orf167 gene.
  • the transcriptional regulatory region of C6orf167 gene herein is the region from transcription stat site to at least 500bp upstream, preferably 1000bp, more preferably 5000 or 10000bp upstream.
  • a nucleotide segment containing the transcriptional regulatory region can be isolated from a genome library or can be propagated by PCR.
  • the reporter construct required for the screening can be prepared by connecting reporter gene sequence to the transcriptional regulatory region of the gene. Methods for identifying a transcriptional regulatory region, and also assay protocol are well known (Molecular Cloning third edition chapter 17, 2001, Cold Springs Harbor Laboratory Press).
  • the vector containing such reporter construct is introduced into host cells and the expression or activity of the reporter gene is detected by methods well known in the art (e.g., using luminometer, absorption spectrometer, flow cytometer and so on).
  • "Reduces the expression level or activity” as defined herein are preferably at least 10% reduction of the expression level or activity of the reporter gene in comparison with in absence of the test substance, more preferably at least 25%, 50% or 75% reduction and most preferably at least 95% reduction.
  • the present invention also provides a method for evaluating or estimating a therapeutic effect of a test substance on treating or preventing cancer or inhibiting cancer associated with over-expression of C6orf167 gene, the method including steps of: (a) contacting a test substance with a cell into which a vector, including the transcriptional regulatory region of C6orf167 gene and a reporter gene that is expressed under the control of the transcriptional regulatory region, has been introduced; (b) measuring the expression level or activity of the reporter gene; and (c) correlating the potential therapeutic effect and the test substance, wherein the potential therapeutic effect is shown, when the test substance reduces the expression level or activity of said reporter gene.
  • the therapeutic effect of the test substance on inhibiting the cell growth or a candidate substance for treating or preventing C6orf16-associating disease such as cancer may be evaluated. Therefore, the present invention also provides a method for screening a candidate substance that suppresses the proliferation of cancer cells, and a method for screening a candidate substance for treating or preventing C6orf167-associating disease.
  • the present invention provides a method which includes the following steps of: (a) contacting a test substance with a cell into which a vector, composed of the transcriptional regulatory region of the C6orf167 gene and a reporter gene that is expressed under the control of the transcriptional regulatory region, has been introduced; (b) detecting the expression level or activity of the reporter gene; and (c) correlating the expression level or activity of (b) with the therapeutic effect of the test substance.
  • the therapeutic effect may be correlated with the expression level or activity of said reporter gene.
  • the test substance when the test substance reduces the expression level or activity of said reporter gene as compared to the expression level or activity detected in the absence of the test substance, the test substance may be identified or selected as the candidate substance having the therapeutic effect.
  • the test substance when the test substance does not reduce the expression level or activity of said reporter gene as compared to a level detected in the absence of the test substance, the test substance may be identified as the substance having no significant therapeutic effect.
  • the therapeutic potential of these candidate substances may be evaluated by second and/or further screening to identify therapeutic substance for cancers. For example, when a substance that binds to the C6orf167 polypeptide inhibits the above-described activities of cancer, it may be concluded that such a substance has the C6orf167-specific therapeutic effect.
  • the term "isolated double-stranded molecule” refers to a nucleic acid molecule that inhibits expression of a target gene and includes, for example, short interfering RNA (siRNA; e.g., double-stranded ribonucleic acid (dsRNA) or small hairpin RNA (shRNA)) and short interfering DNA/RNA (siD/R-NA; e.g. double-stranded chimera of DNA and RNA (dsD/R-NA) or small hairpin chimera of DNA and RNA (shD/R-NA)).
  • siRNA short interfering RNA
  • dsRNA double-stranded ribonucleic acid
  • shRNA small hairpin RNA
  • siD/R-NA short interfering DNA/RNA
  • a target sequence is a nucleotide sequence within mRNA or cDNA sequence of a target gene, which will result in suppress of translation of the whole mRNA of the target gene if a double-stranded nucleic acid molecule of the invention was introduced within a cell expressing the target gene.
  • a nucleotide sequence within mRNA or cDNA sequence of a gene can be determined to be a target sequence when a double-stranded polynucleotide including a sequence corresponding to the target sequence inhibits expression of the gene in a cell expressing the gene.
  • the double stranded polynucleotide by which suppresses the gene expression may consists of the target sequence and 3'overhang having 2 to 5 nucleotides in length (e.g., uu).
  • a sense strand sequence of a double-stranded cDNA i.e., a sequence that mRNA sequence is converted into DNA sequence
  • a double-stranded molecule is composed of a sense strand that has a sequence corresponding to a target sequence and an antisense strand that has a complementary sequence to the target sequence, and the antisense strand hybridizes with the sense strand at the complementary sequence to form a double-stranded molecule.
  • the phrase "corresponding to” means converting a target sequence according to the kind of nucleic acid that constitutes a sense strand of a double-stranded molecule.
  • a target sequence is shown in DNA sequence and a sense strand of a double-stranded molecule has an RNA region
  • base “t”s within the RNA region is replaced with base "u”s.
  • base "u"s within the DNA region is replaced with "t”s.
  • the target sequences are mainly shown in DNA.
  • a complementary sequence to a target sequence for an antisense strand of a double-stranded molecule can be defined according to the kind of nucleic acid that constitutes the antisense strand.
  • a double-stranded molecule may have one or two 3'overhangs having 2 to 5 nucleotides in length (e.g., uu) and/or a loop sequence that links a sense strand and an antisense strand to form hairpin structure, in addition to a sequence corresponding to a target sequence and complementary sequence thereto.
  • siRNA refers to a double-stranded RNA molecule that prevents translation of a target mRNA. Standard techniques of introducing siRNA into the cell are used, including those in which DNA is a template from which RNA is transcribed.
  • the siRNA includes a C6orf167 sense nucleic acid sequence (also referred to as “sense strand"), a C6orf167 antisense nucleic acid sequence (also referred to as "antisense strand”) or both.
  • the siRNA may be constructed such that a single transcript has both the sense and complementary antisense nucleic acid sequences of the target gene, e.g., a hairpin.
  • the siRNA may be either a dsRNA or shRNA.
  • dsRNA refers to a construct of two RNA molecules composed of complementary sequences to one another and that have annealed together via the complementary sequences to form a double-stranded RNA molecule.
  • the nucleotide sequence of two strands may include not only the "sense” or "antisense” RNAs selected from a protein coding sequence of target gene sequence, but also RNA molecule having a nucleotide sequence selected from non-coding region of the target gene.
  • shRNA refers to an siRNA having a stem-loop structure, composed of first and second regions complementary to one another, i.e., sense and antisense strands. The degree of complementarity and orientation of the regions are sufficient such that base pairing occurs between the regions, the first and second regions are joined by a loop region, the loop results from a lack of base pairing between nucleotides (or nucleotide analogs) within the loop region.
  • the loop region of an shRNA is a single-stranded region intervening between the sense and antisense strands and may also be referred to as "intervening single-strand".
  • siD/R-NA refers to a double-stranded polynucleotide molecule which is composed of both RNA and DNA, and includes hybrids and chimeras of RNA and DNA and prevents translation of a target mRNA.
  • a hybrid indicates a molecule wherein a polynucleotide composed of DNA and a polynucleotide composed of RNA hybridize to each other to form the double-stranded molecule; whereas a chimera indicates that one or both of the strands composing the double stranded molecule may contain RNA and DNA. Standard techniques of introducing siD/R-NA into the cell are used.
  • the siD/R-NA includes a C6orf167 sense nucleic acid sequence (also referred to as “sense strand”), a C6orf167 antisense nucleic acid sequence (also referred to as “antisense strand”) or both.
  • the siD/R-NA may be constructed such that a single transcript has both the sense and complementary antisense nucleic acid sequences from the target gene, e.g., a hairpin.
  • the siD/R-NA may be either a dsD/R-NA or shD/R-NA.
  • the term "dsD/R-NA” refers to a construct of two molecules composed of complementary sequences to one another and that have annealed together via the complementary sequences to form a double-stranded polynucleotide molecule.
  • the nucleotide sequence of two strands may include not only the "sense” or "antisense” polynucleotides sequence selected from a protein coding sequence of target gene sequence, but also polynucleotide having a nucleotide sequence selected from non-coding region of the target gene.
  • One or both of the two molecules constructing the dsD/R-NA are composed of both RNA and DNA (chimeric molecule), or alternatively, one of the molecules is composed of RNA and the other is composed of DNA (hybrid double-strand).
  • shD/R-NA refers to an siD/R-NA having a stem-loop structure, composed of a first and second regions complementary to one another, i.e., sense and antisense strands. The degree of complementarity and orientation of the regions are sufficient such that base pairing occurs between the regions, the first and second regions are joined by a loop region, the loop results from a lack of base pairing between nucleotides (or nucleotide analogs) within the loop region.
  • the loop region of an shD/R-NA is a single-stranded region intervening between the sense and antisense strands and may also be referred to as "intervening single-strand".
  • an "isolated nucleic acid” is a nucleic acid removed from its original environment (e.g., the natural environment if naturally occurring) and thus, synthetically altered from its natural state.
  • examples of isolated nucleic acid includes DNA, RNA, and derivatives thereof.
  • the double-stranded molecules of the present invention are isolated.
  • the expression of C6orf167 gene in several cancer cell lines was inhibited by dsRNA (Fig. 2).
  • the present invention provides isolated double-stranded molecules that are capable of inhibiting the expression of a C6orf167 gene when introduced into a cell expressing the gene.
  • the target sequence of double-stranded molecule may be designed by an siRNA design algorithm such as that mentioned below.
  • target sequences for C6orf167 gene include nucleotide sequences such as: SEQ ID NO: 15 or 16.
  • examples of target sequences for C6orf167 gene include nucleotide sequences such as: 3444 to 3462 of SEQ ID NO: 17 or 19; or 3671 to 3689 of SEQ ID NO: 17 or 19.
  • [1] to [20] are the following double-stranded molecules [1] to [20]: [1] An isolated double-stranded molecule that, when introduced into a cell, inhibits an expression of C6orf167 gene as well as cell proliferation, such molecules composed of a sense strand and an antisense strand complementary thereto, hybridized to each other to form the double-stranded molecule; [2] The double-stranded molecule of [1], wherein the double-stranded molecule acts on mRNA, matching a target sequence of SEQ ID NO: 15 or 16; [3] A double-stranded molecule composed of a sense strand containing a nucleotide sequence corresponding to a target sequence and an antisense strand containing a nucleotide sequence complementary to the target sequence, wherein the strands hybridize to each other at the target sequence to form the double-stranded molecule, and wherein the double-stranded molecule, when introduced into a cell expressing a C6orf
  • the double-stranded molecule of the present invention will be described in more detail below.
  • Methods for designing double-stranded molecules having the ability to inhibit target gene expression in cells are known. (See, for example, US Patent No. 6,506,559, herein incorporated by reference in its entirety).
  • a computer program for designing siRNAs is available from the Ambion website (http://www.ambion.com/techlib/misc/siRNA_finder.html). The computer program selects target nucleotide sequences for double-stranded molecules based on the following protocol.
  • Target Sites 1. Beginning with the AUG start codon of the transcript, scan downstream for AA di-nucleotide sequences. Record the occurrence of each AA and the 3' adjacent 19 nucleotides as potential siRNA target sites. Tuschl et al. don't recommend designing siRNA to the 5' and 3' untranslated regions (UTRs) and regions near the start codon (within 75 bases) as these may be richer in regulatory protein binding sites, and UTR-binding proteins and/or translation initiation complexes may interfere with binding of the siRNA endonuclease complex. 2. Compare the potential target sites to the appropriate genome database (human, mouse, rat, etc.) and eliminate from consideration any target sequences with significant homology to other coding sequences.
  • BLAST which can be found on the NCBI server at: ncbi.nlm.nih.gov/BLAST/, is used (Altschul SF et al., Nucleic Acids Res 1997 Sep 1, 25(17): 3389-402). 3. Select qualifying target sequences for synthesis. Selecting several target sequences along the length of the gene to evaluate is typical.
  • the target sequence for C6orf167 gene were designed as the nucleotide sequences of: 3444 to 3462 of SEQ ID NO: 17 or 19; and 3671 to 3689 of SEQ ID NO: 17 or 19.
  • the above target sequence is preferably nucleotide sequence of SEQ ID NO: 15 and 16.
  • Double-stranded molecules targeting the above-mentioned target sequences were respectively examined for their ability to suppress the growth of cells expressing the target genes. Therefore, the present invention provides double-stranded molecules targeting the sequence of 3444 to 3462 of SEQ ID NO: 17 or 19, or 3671 to 3689 of SEQ ID NO: 17 or 19. Alternatively, the present invention provides double-stranded molecules targeting the sequence of SEQ ID NO: 15 or 16 for C6orf167 gene.
  • the double-stranded molecule of the present invention targeting the above-mentioned target sequence for C6orf167 gene include isolated polynucleotide that contain the nucleic acid sequences of target sequences and/or complementary sequences to the target sequence.
  • Example of polynucleotide targeting C6orf167 gene includes that containing the sequence of SEQ ID NO: 15 or 16 and/or complementary sequences to these nucleotides;
  • the present invention is not limited to this example, and minor modifications in the aforementioned nucleic acid sequences are acceptable so long as the modified molecule retains the ability to suppress the expression of C6orf167 gene.
  • the phrase "minor modification" as used in connection with a nucleic acid sequence indicates one, two or several substitution, deletion, addition or insertion of nucleic acids to the sequence.
  • a double-stranded molecule is composed of two polynucleotides, one polynucleotide has a sequence corresponding to a target sequence, i.e., sense strand, and another polypeptide has a complementary sequence to the target sequence, i.e., antisense strand.
  • the sense strand polynucleotide and the antisense strand polynucleotide hybridize to each other to form double-stranded molecule.
  • double-stranded molecules include dsRNA and dsD/R-NA.
  • a double-stranded molecule is composed of a polynucleotide that has both a sequence corresponding to a target sequence, i.e., sense strand, and a complementary sequence to the target sequence, i.e., antisense strand.
  • the sense strand and the antisense strand are linked by a intervening strand, and hybridize to each other to form a hairpin loop structure.
  • Examples of such double-stranded molecule include shRNA and shD/R-NA.
  • a double-stranded molecule of the present invention is composed a sense strand polynucleotide having a nucleotide sequence of the target sequence and anti-sense strand polynucleotide having a nucleotide sequence complementary to the target sequence, and both of polynucleotides hybridize to each other to form the double-stranded molecule.
  • a part of the polynucleotide of either or both of the strands may be RNA, and when the target sequence is defined with a DNA sequence, the nucleotide "t" within the target sequence and complementary sequence thereto is replaced with "u".
  • such a double-stranded molecule of the present invention includes a stem-loop structure, composed of the sense and antisense strands.
  • the sense and antisense strands may be joined by a loop.
  • the present invention also provides the double-stranded molecule composed of a single polynucleotide containing both the sense strand and the antisense strand linked or flanked by an intervening single-strand.
  • double-stranded molecules targeting the C6orf167 gene may have a sequence selected from among SEQ ID NOs: 15 and 16 as a target sequence.
  • preferable examples of the double-stranded molecule of the present invention include polynucleotide and a complementary sequence thereto, and a polynucleotide that has a sequence corresponding to SEQ ID NO: 15 and 16 and a complementary sequence thereto.
  • the term "several" as applies to nucleic acid substitutions, deletions, additions and/or insertions may mean 3-7, preferably 3-5, more preferably 3-4, even more preferably 3 nucleic acid residues.
  • a double-stranded molecule of the present invention can be tested for its ability using the methods utilized in the Examples.
  • double-stranded molecules composed of sense strands of various portions of mRNA of C6orf167 genes or antisense strands complementary thereto were tested in vitro for their ability to decrease production of C6orf167 gene product in cancer cell lines according to standard methods.
  • reduction in C6orf167 gene product in cells contacted with the candidate double-stranded molecule compared to cells cultured in the absence of the candidate molecule can be detected by, e.g. RT-PCR using primers for the C6orf167 mRNA mentioned under Example 1 item "Semiquantitative RT-PCR".
  • Sequences that decrease the production of a C6orf167 gene product in in vitro cell-based assays can then be tested for their inhibitory effects on cell growth. Sequences that inhibit cell growth in in vitro cell-based assay can then be tested for their in vivo ability using animals with cancer, e.g. nude mouse xenograft models, to confirm decreased production of a C6orf167 gene product and decreased cancer cell growth.
  • the term “complementary” refers to Watson-Crick or Hoogsteen base pairing between nucleotides units of a polynucleotide
  • binding means the physical or chemical interaction between two polynucleotides.
  • the polynucleotide includes modified nucleotides and/or non-phosphodiester linkages, these polynucleotides may also bind each other as same manner.
  • complementary polynucleotide sequences hybridize under appropriate conditions to form stable duplexes containing few or no mismatches.
  • the sense strand and antisense strand of the isolated polynucleotide of the present invention can form double-stranded molecule or hairpin loop structure by the hybridization.
  • such duplexes contain no more than 1 mismatch for every 10 matches.
  • such duplexes contain no mismatches.
  • the polynucleotide is usually less than 8643 nucleotides in length for C6orf167 gene.
  • the polynucleotide is less than 500, 200, 100, 75, 50, or 25 nucleotides in length for C6orf167 gene.
  • the isolated polynucleotides of the present invention are useful for forming double-stranded molecules against C6orf167 gene or preparing template DNAs encoding the double-stranded molecules.
  • the polynucleotides may be longer than 19 nucleotides, preferably longer than 21 nucleotides, and more preferably has a length of between about 19 and 25 nucleotides.
  • the present invention provides a double-stranded molecule composed of a sense strand and an antisense strand, wherein the sense strand is a nucleotide sequence corresponding to a target sequence.
  • the sense strand hybridizes with antisense strand at the target sequence to form the double-stranded molecule having between 19 and 25 nucleotide pairs in length.
  • the double-stranded molecule serves as a guide for identifying homologous sequences in mRNA for the RISC complex, when the double-stranded molecule is introduced into cells.
  • the identified target RNA is cleaved and degraded by the nuclease activity of Dicer, through which the double-stranded molecule eventually decreases or inhibits production (expression) of the polypeptide encoded by the RNA.
  • a double-stranded molecule of the invention can be defined by its ability to generate a single-strand that specifically hybridizes to the mRNA of the C6orf167 gene under stringent conditions.
  • target sequence or “target nucleic acid” or “target nucleotide”.
  • target nucleic acid or “target nucleotide”.
  • nucleotide sequence of the "target sequence” can be shown using not only the RNA sequence of the mRNA, but also the DNA sequence of cDNA synthesized from the mRNA.
  • the double-stranded molecules of the invention may contain one or more modified nucleotides and/or non-phosphodiester linkages.
  • Chemical modifications well known in the art are capable of increasing stability, availability, and/or cell uptake of the double-stranded molecule.
  • the skilled person will be aware of other types of chemical modification which may be incorporated into the present molecules (WO03/070744; WO2005/045037).
  • modifications can be used to provide improved resistance to degradation or improved uptake.
  • modifications include, but are not limited to, phosphorothioate linkages, 2'-O-methyl ribonucleotides (especially on the sense strand of a double-stranded molecule), 2'-deoxy-fluoro ribonucleotides, 2'-deoxy ribonucleotides, "universal base” nucleotides, 5'-C- methyl nucleotides, and inverted deoxybasic residue incorporation (US20060122137).
  • modifications can be used to enhance the stability or to increase targeting efficiency of the double-stranded molecule.
  • modifications include, but are not limited to, chemical cross linking between the two complementary strands of a double-stranded molecule, chemical modification of a 3' or 5' terminus of a strand of a double-stranded molecule, sugar modifications, nucleobase modifications and/or backbone modifications, 2 -fluoro modified ribonucleotides and 2'-deoxy ribonucleotides (WO2004/029212).
  • modifications can be used to increased or decreased affinity for the complementary nucleotides in the target mRNA and/or in the complementary double-stranded molecule strand (WO2005/044976).
  • an unmodified pyrimidine nucleotide can be substituted for a 2-thio, 5-alkynyl, 5-methyl, or 5-propynyl pyrimidine.
  • an unmodified purine can be substituted with a 7-deaza, 7-alkyl, or 7-alkenyl purine.
  • the double-stranded molecule is a double-stranded molecule with a 3' overhang
  • the 3'- terminal nucleotide overhanging nucleotides may be replaced by deoxyribonucleotides (Elbashir SM et al., Genes Dev 2001 Jan 15, 15(2): 188-200).
  • published documents such as US20060234970 are available.
  • the present invention is not limited to these examples and any known chemical modifications may be employed for the double-stranded molecules of the present invention so long as the resulting molecule retains the ability to inhibit the expression of the target gene.
  • the double-stranded molecules of the present invention may include both DNA and RNA, e.g., dsD/R-NA or shD/R-NA.
  • RNA e.g., dsD/R-NA or shD/R-NA.
  • a hybrid polynucleotide of a DNA strand and an RNA strand or a DNA-RNA chimera polynucleotide shows increased stability.
  • DNA and RNA i.e., a hybrid type double-stranded molecule composed of a DNA strand (polynucleotide) and an RNA strand (polynucleotide), a chimera type double-stranded molecule containing both DNA and RNA on any or both of the single strands (polynucleotides), or the like may be formed for enhancing stability of the double-stranded molecule.
  • the hybrid of a DNA strand and an RNA strand may be either where the sense strand is DNA and the antisense strand is RNA, or vice versa so long as it can inhibit expression of the target gene when introduced into a cell expressing the gene.
  • the sense strand polynucleotide is DNA and the antisense strand polynucleotide is RNA.
  • the chimera type double-stranded molecule may be either where both of the sense and antisense strands are composed of DNA and RNA, or where any one of the sense and antisense strands is composed of DNA and RNA so long as it has an activity to inhibit expression of the target gene when introduced into a cell expressing the gene.
  • the molecule preferably contains as much DNA as possible, whereas to induce inhibition of the target gene expression, the molecule is required to be RNA within a range to induce sufficient inhibition of the expression.
  • an upstream partial region i.e., a region flanking to the target sequence or complementary sequence thereof within the sense or antisense strands
  • the upstream partial region indicates the 5' side (5'-end) of the sense strand and the 3' side (3'-end) of the antisense strand.
  • regions flanking to 5'-end of sense strand and/or 3'-end of antisense strand are referred to upstream partial region.
  • a region flanking to the 3'-end of the antisense strand, or both of a region flanking to the 5'-end of sense strand and a region flanking to the 3'-end of antisense strand are composed of RNA.
  • the chimera or hybrid type double-stranded molecule of the present invention include following combinations.
  • sense strand 5'-[---DNA---]-3' 3'-(RNA)-[DNA]-5' : antisense strand
  • sense strand 5'-(RNA)-[DNA]-3' 3'-(RNA)-[DNA]-5' : antisense strand
  • sense strand 5'-(RNA)-[DNA]-3' 3'-(---RNA---)-5' : antisense strand
  • the upstream partial region typically is a domain composed of 9 to 13 nucleotides counted from the terminus of the target sequence or complementary sequence thereto within the sense or antisense strands of the double-stranded molecules.
  • some examples of such chimera type double-stranded molecules include those having a strand length of 19 to 21 nucleotides in which at least the upstream half region (5' side region for the sense strand and 3' side region for the antisense strand) of the polynucleotide is RNA and the other half is DNA. In such a chimera type double-stranded molecule, the effect to inhibit expression of the target gene is much higher when the entire antisense strand is RNA (US20050004064).
  • the double-stranded molecule may form a hairpin, such as a short hairpin RNA (shRNA) and short hairpin consisting of DNA and RNA (shD/R-NA).
  • shRNA or shD/R-NA is a sequence of RNA or mixture of RNA and DNA making a tight hairpin turn that can be used to silence gene expression via RNA interference.
  • the shRNA or shD/R-NA includes the sense target sequence and the antisense target sequence on a single strand wherein the sequences are separated by a loop sequence.
  • the hairpin structure is cleaved by the cellular machinery into dsRNA or dsD/R-NA, which is then bound to the RNA-induced silencing complex (RISC).
  • RISC RNA-induced silencing complex
  • a loop sequence composed of an arbitrary nucleotide sequence can be located between the sense and antisense sequence in order to form the hairpin loop structure.
  • the present invention also provides a double-stranded molecule having the general formula 5'-[A]-[B]-[A']-3' or 5'-[A']-[B]-[A]-3', wherein [A] is the sense strand containing a nucleotide sequence corresponding to a target sequence, [B] is an intervening single-strand and [A'] is the antisense strand containing a complementary sequence to the target sequence.
  • the target sequence may be selected from among, for example, nucleotide sequences of SEQ ID NO: 15 and 16 for C6orf167.
  • the target sequence may be selected from among, for example, nucleotide sequences of 3444 to 3462 of SEQ ID NO: 17 or 19 and 3671 to 3689 of SEQ ID NO: 17 or 19.
  • the present invention is not limited to these examples, and the target sequence in [A] may be modified sequences from these examples so long as the double-stranded molecule retains the ability to suppress the expression of the targeted C6orf167 gene.
  • the region [A] hybridizes to [A'] to form a loop composed of the region [B].
  • the intervening single-stranded portion [B], i.e., loop sequence may be preferably 3 to 23 nucleotides in length.
  • the loop sequence for example, can be selected from among the following sequences (http://www.ambion.com/techlib/tb/tb_506.html).
  • loop sequence consisting of 23 nucleotides also provides active siRNA (Jacque JM et al., Nature 2002 Jul 25, 418(6896): 435-8, Epub 2002 Jun 26): CCC, CCACC, or CCACACC: Jacque JM et al., Nature 2002 Jul 25, 418(6896): 435-8, Epub 2002 Jun 26; UUCG: Lee NS et al., Nat Biotechnol 2002 May, 20(5): 500-5; Fruscoloni P et al., Proc Natl Acad Sci USA 2003 Feb 18, 100(4): 1639-44, Epub 2003 Feb 10; and UUCAAGAGA: Dykxhoorn DM et al., Nat Rev Mol Cell Biol 2003 Jun, 4(6): 457-67.
  • the loop sequence can be selected from among AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU, CCACACC, and UUCAAGAGA; however, the present invention is not limited thereto: CCGCCAAUAUCAUCUCUAA-[B]- UUAGAGAUGAUAUUGGCGG (for target sequence SEQ ID NO: 15). GAACCUGCAAUACAUGGUA-[B]- UACCAUGUAUUGCAGGUUC (for target sequence SEQ ID NO: 16).
  • nucleotides can be added to 3'end of the sense strand and/or antisense strand of the target sequence, as 3' overhangs.
  • the typical examples of nucleotides constituting a 3' overhang include “t" and "u", but are not limited to.
  • the number of nucleotides to be added is at least 2, generally 2 to 10, preferably 2 to 5.
  • the added nucleotides form single strand at the 3'end of the antisense strand of the double-stranded molecule.
  • a 3' overhang sequence may be added to the 3' end of the single polynucleotide.
  • the method for preparing the double-stranded molecule is not particularly limited though it is preferable to use a chemical synthetic method known in the art.
  • sense and antisense single-stranded polynucleotides are separately synthesized and then annealed together via an appropriate method to obtain a double-stranded molecule.
  • Specific example for the annealing includes wherein the synthesized single-stranded polynucleotides are mixed in a molar ratio of preferably at least about 3:7, more preferably about 4:6, and most preferably substantially equimolar amount (i.e., a molar ratio of about 5:5).
  • the mixture is heated to a temperature at which double-stranded molecules dissociate and then is gradually cooled down.
  • the annealed double-stranded polynucleotide can be purified by usually employed methods known in the art.
  • Example of purification methods include methods utilizing agarose gel electrophoresis or wherein remaining single-stranded polynucleotides are optionally removed by, e.g., degradation with appropriate enzyme.
  • the double-stranded molecules may be transcribed intracellularly by cloning its coding sequence into a vector containing a regulatory sequence (e.g., a RNA poly III transcription unit from the small nuclear RNA (snRNA) U6 or the human H1 RNA promoter) that directs the expression of the double-stranded molecule in an adequate cell, adjacent to the coding sequence.
  • a regulatory sequence e.g., a RNA poly III transcription unit from the small nuclear RNA (snRNA) U6 or the human H1 RNA promoter
  • the regulatory sequences flanking the coding sequences of double-stranded molecule may be identical or different, such that their expression can be modulated independently, or in a temporal or spatial manner. Details of vectors which are capable of producing the double-stranded molecules are described below.
  • Vector Encoding a Double-Stranded Molecule As noted above, the present invention contemplates vectors containing one or more of the double-stranded molecules described herein, and a cell containing such a vector. Of particular interest to the present invention are the following vector of [1] to [13].
  • a vector of the present invention preferably encodes the double-stranded molecule of the present invention in an expressible form.
  • the phrase "in an expressible form” indicates that the vector, when introduced into a cell, will express the molecule.
  • the vector includes regulatory elements necessary for expression of the double-stranded molecule.
  • the expression vector encodes the nucleic acid sequences of the double-stranded molecules of the present invention and is adapted for expression of such double-stranded molecules.
  • Such vectors of the present invention may be used for producing the present double-stranded molecules, or directly as an active ingredient for treating cancer.
  • Vectors of the present invention can be produced, for example, by cloning sequences of a sense strand and an antisense strand of the double-stranded molecule of the present invention into an expression vector so that regulatory sequences are operatively-linked to such sequences in a manner to allow expression (by transcription of the DNA molecule) of both strands (Lee NS et al., Nat Biotechnol 2002 May, 20(5): 500-5).
  • RNA molecule that is the antisense to mRNA of C6orf167 gene is transcribed by a first promoter (e.g., a promoter sequence flanking to the 3' end of the cloned DNA) and RNA molecule that is the sense strand to the mRNA of C6orf167 gene is transcribed by a second promoter (e.g., a promoter sequence flanking to the 5' end of the cloned DNA).
  • the sense and antisense strands hybridize in vivo to generate a double-stranded molecule constructs for silencing of the gene.
  • two vectors constructs respectively encoding the sense and antisense strands of the double-stranded molecule are utilized to respectively express the sense and anti-sense strands and then forming a double-stranded molecule construct.
  • the cloned sequence may encode a construct having a secondary structure (e.g., hairpin); namely, a single transcript of a vector contains both the sense and complementary antisense sequences of the target gene.
  • the vectors of the present invention may also be equipped so to achieve stable insertion into the genome of the target cell (see, e.g., Thomas KR & Capecchi MR, Cell 1987, 51: 503-12 for a description of homologous recombination cassette vectors). See, e.g., Wolff et al., Science 1990, 247: 1465-8; US Patent Nos. 5,580,859; 5,589,466; 5,804,566; 5,739,118; 5,736,524; 5,679,647; and WO 98/04720.
  • DNA-based delivery technologies include "naked DNA”, facilitated (bupivacaine, polymers, peptide-mediated) delivery, cationic lipid complexes, and particle-mediated (“gene gun”) or pressure-mediated delivery (see, e.g., US Patent No. 5,922,687).
  • the vectors of the present invention include, for example, viral or bacterial vectors.
  • expression vectors include attenuated viral hosts, such as vaccinia or fowlpox (see, e.g., US Patent No. 4,722,848). This approach involves the use of vaccinia virus, e.g., as a vector to express nucleotide sequences that encode the double-stranded molecule. Upon introduction into a cell expressing the target gene, the recombinant vaccinia virus expresses the molecule and thereby suppresses the proliferation of the cell.
  • Another example of useable vector includes Bacille Calmette Guerin (BCG). BCG vectors are described in Stover et al., Nature 1991, 351: 456-60.
  • a wide variety of other vectors are useful for therapeutic administration and production of the double-stranded molecules; examples include adeno and adeno-associated virus vectors, retroviral vectors, Salmonella typhi vectors, detoxified anthrax toxin vectors, and the like. See, e.g., Shata et al., Mol Med Today 2000, 6: 66-71; Shedlock et al., J Leukoc Biol 2000, 68: 793-806; and Hipp et al., In Vivo 2000, 14: 571-85.
  • the present invention also relates to inhibitory polypeptides that lack the ability to control subcellular localization of a C6orf167 polypeptide. As demonstrated in Examples, expression of partial C-terminal NFKBIL2 polypeptides reduce nuclear localization of C6orf167 polypeptide and suppress cancer cell growth, possibly through dominant negative effect. Thus, the protein-protein interacting inhibition between C6orf167 polypeptide and NFKBIL2 polypeptide may be used as a useful strategy for the development of anti-cancer drugs. Accordingly, the present invention also provides inhibitory polypeptides that inhibit the binding between C6orf167 polypeptide and NFKBIL2 polypeptide. Furthermore, the present invention also provides polynucleotides and vectors that encodes such polypeptides.
  • polypeptide Of particular interest to the present invention are the following polypeptide, polynucleotide and vector of [1] to [5].
  • the polypeptides of the present invention will be described in more detail below.
  • the inhibitory polypeptides of the present invention contain a C6orf167-binding domain of an NFKBIL2 polypeptide that lacks the ability to control a subcellular localization of a C6orf167 polypeptide.
  • the function that NFKBIL2 polypeptide lacks is the ability to localize C6orf167 polypeptide in nuclear.
  • the polypeptide of the present invention include an amino acid sequence of SEQ ID NO: 24.
  • polypeptides of the present invention may include polypeptides homologous (i.e., share sequence identity) to a polypeptide having the amino acid sequence of SEQ ID NO: 24.
  • polypeptides homologous to the polypeptide having the amino acid sequence of SEQ ID NO: 24 are those which contain any mutations selected from addition, deletion, substitution and insertion of one or several amino acid residues and are functionally equivalent.
  • the phrase "functionally equivalent” refers to having the function to bind to C6orf167 polypeptide and not having the function to localize C6orf167 polypeptide into nuclear, consequently inhibit cancer cell proliferation.
  • the inhibitory polypeptide of the present invention preferably have one or several amino acid mutations in the amino acid sequence of SEQ ID NO: 24.
  • "several" is generally 30 or fewer, preferably 20 or fewer, more preferably 10 or fewer, more preferably 5 or 6 or fewer, and even more preferably 3 or 4 or fewer.
  • the inhibitory polypeptide of the present invention may be composed an amino acid sequence having at least 80% or higher, preferably 90% or higher, or more preferably 95% or higher, and further more preferably 98% or 99% or higher homology to the amino acid sequence of SEQ ID NO: 24. Amino acid sequence homology can be determined using algorithms well known in the art, for example, BLAST or ALIGN set to their default settings.
  • the inhibitory polypeptide of the present invention can be encoded by a polynucleotide that hybridizes under stringent conditions to the polynucleotide having the nucleotide sequence of SEQ ID NO: 23.
  • polypeptides can be isolated in the same manner as methods described in "Genes and Polypeptide".
  • the polypeptides of the present invention can be chemically synthesized as described above (See, " Screening for an Anti-cancer Substance I. Protein based screening methods").
  • the polypeptides of the present invention can be also synthesized by known genetic engineering techniques. For example, a polynucleotide encoding the polypeptide of the present invention is introduced into an appropriate host cell to prepare a transformed cell.
  • polypeptides of the present invention can be obtained by recovering polypeptides produced by this transformed cell.
  • the polypeptide encoding the polypeptide may be a vector encoding the polypeptide.
  • Such polynucleotides and vectors can be prepared by conventional methods (See, " Screening for an Anti-cancer Substance I. Protein based screening methods").
  • the polypeptide of the present invention can be synthesized with an in vitro translation system, in which necessary elements for protein synthesis are reconstituted in vitro.
  • the polypeptide of the present invention can be expressed as a fused protein with a peptide having a different amino acid sequence.
  • a vector expressing a desired fusion protein can be obtained by linking a polynucleotide encoding the polypeptide of the present invention to a polynucleotide encoding a different peptide so that they are in the same reading frame, and then introducing the resulting nucleotide into an expression vector.
  • the fusion protein is expressed by transforming an appropriate host with the resulting vector.
  • peptides to be used in forming fusion proteins include the following peptides: FLAG (Hopp et al., (1988) BioTechnology 6, 1204-10), 6xHis consisting of six His (histidine) residues, 10xHis, Influenza hemagglutinin (HA) , Human c-myc fragment, VSV-GP fragment, p18 HIV fragment, T7-tag, HSV-tag, E-tag, SV40T antigen fragment, lck tag, alpha-tubulin fragment, B-tag, Protein C fragment, GST (glutathione-S-transferase), HA (Influenza hemagglutinin), Immunoglobulin constant region, beta-galactosidase, and MBP (maltose-binding protein).
  • FLAG Hopp et al., (1988) BioTechnology 6, 1204-10
  • 6xHis consisting of six His (histidine) residues
  • 10xHis Influenza
  • the polypeptide of the present invention can be obtained by treating the fusion protein thus produced with an appropriate protease, and then recovering the desired polypeptide.
  • the fusion protein is captured in advance with affinity chromatography that binds with the fusion protein, and then the captured fusion protein can be treated with a protease.
  • the desired polypeptide is separated from affinity chromatography, and the desired polypeptide with high purity is recovered.
  • the polypeptides of the present invention may include modified polypeptides.
  • the term "modified" refers, for example, to binding with other substances.
  • the polypeptides of the present invention may further comprise other substances such as cell-membrane permeable substance.
  • the other substances include organic compounds such as peptides, lipids, saccharides, and various naturally-occurring or synthetic polymers.
  • the polypeptides of the present invention may have any modifications so long as the polypeptides retain the inhibitory function.
  • the inhibitory polypeptides of the present invention can directly compete with NFKBIL2 polypeptide binding to C6orf167 polypeptide. Modifications can also confer additive functions on the polypeptides of the invention. Examples of the additive functions include targetability, deliverability, and stabilization.
  • Typical examples of modifications in the present invention include, for example, the introduction of a cell-membrane permeable substance.
  • the intracellular structure is cut off from the outside by the cell membrane. Therefore, it is difficult to efficiently introduce an extracellular substance into cells.
  • Cell membrane permeability can be conferred on the polypeptides of the present invention by modifying the polypeptides with a cell-membrane permeable substance. As a result, by contacting the polypeptide of the present invention with a cell, the polypeptide can be delivered into the cell to act thereon.
  • the "cell-membrane permeable substance” refers to a substance capable of penetrating the mammalian cell membrane to enter the cytoplasm. For example, a certain liposome fuses with the cell membrane to release the content into the cell. Meanwhile, a certain type of polypeptide penetrates the cytoplasmic membrane of mammalian cell to enter the inside of the cell. For conferring a cell-entering activity on the polypeptides of the present invention, such type of polypeptides are preferable as cell-membrane permeable substances. Specifically, the present invention includes polypeptides having the following general formula.
  • [R]-[D] wherein, [R] represents a cell-membrane permeable substance; [D] represents an amino acid sequence of the inhibitory polypeptide of the present invention.
  • [R] and [D] can be linked directly or indirectly through a linker. Peptides, compounds having multiple functional groups, or such can be used as a linker. Specifically, amino acid sequences containing -GGG- can be used as a linker. Alternatively, a cell-membrane permeable substance and a polypeptide containing a selected sequence can be bound to the surface of a minute particle. [R] can be linked to any position(s) of [D].
  • [R] can be linked to the N-terminal or C-terminal of [D], or to a side chain of amino acids constituting [D]. Furthermore, more than one [R] molecule can be linked to one molecule of [D]. The [R] molecules can be introduced to different positions on the [D] molecule. Alternatively, [D] can be modified with a number of [R]s linked together.
  • any substance selected from the following group can be used as the above-described cell-membrane permeable substance: poly-arginine; Matsushita et al., (2003) J. Neurosci.; 21, 6000-7. Tat / RKKRRQRRR Frankel et al., (1988) Cell 55,1189-93.
  • the poly-arginine which is listed above as an example of cell-membrane permeable substances, is constituted by any number of arginine residues. Specifically, for example, it is constituted by consecutive 5-20 arginine residues. The preferable number of arginine residues is 11.
  • dsRNAs for C6orf167 were tested for their ability to inhibit cell growth.
  • the dsRNA for C6orf167 (Fig. 2) effectively knocked down the expression of the gene in several cancer cell lines, which coincided with suppression of cell proliferation.
  • expression of partial C-terminal NFKBIL2 polypeptide could reduce nuclear localization of C6orf167 and suppress cancer cell growth, possibly through dominant negative effect.
  • the present invention provides methods for inhibiting cancer cell growth by inducing dysfunction of the C6orf167 gene or polypeptide via inhibiting the expression of C6orf167 gene or nuclear localization of C6orf167 polypeptide.
  • the C6orf167 gene expression can be inhibited by any of the aforementioned double-stranded molecules of the present invention that specifically target the C6orf167 gene.
  • nuclear localization of C6orf167 polypeptide can be inhibited by any of the aforementioned inhibitory polypeptides of the present invention.
  • the present invention provides methods to treat subjects with cancer or preventing cancer in a subject by administering a double-stranded molecule against C6orf167 gene or a vector expressing the double-stranded molecule, or an inhibitory polypeptide or a vector expressing the inhibitory polypeptide.
  • the methods of the present invention may be carried out without adverse effect because C6orf167 gene was minimally detected in normal organs (Fig. 1D).
  • [1] A method for inhibiting cancer cell growth, or either or both of treating and preventing cancer in a subject, wherein the cancer cell or the cancer expresses C6orf167 gene, such method including the step of administering to the subject a pharmaceutically effective amount of a double-stranded molecule against a C6orf167 gene or a vector encoding thereof, wherein the double-stranded molecule, when introduced into a cell expressing the C6orf167 gene, inhibits an expression of the C6orf167 gene as well as cell proliferation.; [2] The method of [1], wherein the double-stranded molecule acts on mRNA, matching a target sequence of SEQ ID NO: 15 or 16; [3] The method of [1], wherein the sense strand of the double-stranded molecule contains a nucleotide sequence corresponding to a target sequence of SEQ ID NO: 15 or 16; [4] The method of [1], where
  • the growth of cells expressing a C6orf167 gene may be inhibited by contacting the cells with a double-stranded molecule against a C6orf167 gene, an inhibitory polypeptide of the present invention, or a vector expressing such molecule or polypeptide, or a composition containing the same.
  • the cell may be further contacted with a transfection agent. Suitable transfection agents are known in the art.
  • the phrase "inhibition of cell growth" indicates that the cell proliferates at a lower rate or has decreased viability as compared to a cell not exposed to the molecule.
  • Cell growth may be measured by methods known in the art, e.g., using the MTT cell proliferation assay.
  • any kind of cell may be suppressed according to the present method so long as the cell expresses or over-expresses a C6orf167 gene.
  • Exemplary cells include lung cancer.
  • any kind of cancer may be treated and/or prevented by the method of the present invention, so long as cancer expresses or over-expressed a C6orf167 gene.
  • Exemplary cancer include lung cancer.
  • Subjects suffering from or at risk of developing disease related to C6orf167 may be treated with the administration of at least one double-stranded molecule or inhibitory polypeptide of the present invention, at least one vector expressing such molecule or polypeptide, or a composition containing such molecule or polypeptide.
  • subjects suffering from cancer may be treated according to the present methods.
  • the type of cancer may be identified by standard methods according to the particular type of tumor to be diagnosed.
  • subjects treated by the methods of the present invention are selected by detecting the expression of C6orf167 gene in a biopsy from the subject by RT-PCR or immunoassay.
  • the biopsy specimen from the subject is confirmed for C6orf167 gene over-expression by methods known in the art, for example, immunohistochemical analysis or RT-PCR.
  • each of the molecules may have different structures but act on mRNA that matches the same target sequence of C6orf167 gene.
  • plural kinds of the double-stranded molecules may act on mRNA that matches a different target sequence of same gene.
  • the method may utilize double-stranded molecules directed to one, two or more target sequence of C6orf167 gene.
  • a double-stranded molecule of the present invention may be directly introduced into the cells in a form to achieve binding of the molecule with corresponding mRNA transcripts.
  • an inhibitory polypeptide of the present invention may be directly introduced into the cells in a form to achieve binding of the polypeptide with a C6orf167 polypeptide.
  • a DNA encoding the double-stranded molecule or the inhibitory polypeptide may be introduced into cells as a vector.
  • transfection-enhancing agent such as FuGENE (Roche diagnostics), Lipofectamine 2000 (Invitrogen), Oligofectamine (Invitrogen), and Nucleofector (Wako pure Chemical), may be employed.
  • a treatment is deemed “efficacious” if it leads to clinical benefit such as, reduction in expression of C6orf167 gene, or a decrease in size, prevalence, or metastatic potential of the cancer in the subject.
  • “efficacious” means that it retards or prevents cancers from forming or prevents or alleviates a clinical symptom of cancer. Efficaciousness is determined in association with any known method for diagnosing or treating the particular tumor type.
  • prevention and prophylaxis can occur “at primary, secondary and tertiary prevention levels.” While primary prevention and prophylaxis avoid the development of a disease, secondary and tertiary levels of prevention and prophylaxis encompass activities aimed at the prevention and prophylaxis of the progression of a disease and the emergence of symptoms as well as reducing the negative impact of an already established disease by restoring function and reducing disease-related complications. Alternatively, prevention and prophylaxis can include a wide range of prophylactic therapies aimed at alleviating the severity of the particular disorder, e.g. reducing the proliferation and metastasis of tumors.
  • the treatment and/or prophylaxis of cancer and/or the prevention of postoperative recurrence thereof include any of the following steps, such as the surgical removal of cancer cells, the inhibition of the growth of cancerous cells, the involution or regression of a tumor, the induction of remission and suppression of occurrence of cancer, the tumor regression, and the reduction or inhibition of metastasis.
  • Effectively treating and/or the prophylaxis of cancer decreases mortality and improves the prognosis of individuals having cancer, decreases the levels of tumor markers in the blood, and alleviates detectable symptoms accompanying cancer.
  • reduction or improvement of symptoms constitutes effectively treating and/or the prophylaxis include 10%, 20%, 30% or more reduction, or stable disease.
  • a double-stranded molecule of the present invention degrades C6orf167 mRNA in substoichiometric amounts. Without wishing to be bound by any theory, it is believed that the double-stranded molecule of the invention causes degradation of the target mRNA in a catalytic manner. Thus, as compared to standard cancer therapies, the present invention requires the delivery of significantly less double-stranded molecule at or near the site of cancer in order to exert therapeutic effect.
  • an effective amount of the double-stranded molecule or the inhibitory polypeptide of the present invention can readily determine an effective amount of the double-stranded molecule or the inhibitory polypeptide of the present invention to be administered to a given subject, by taking into account factors such as body weight, age, sex, type of disease, symptoms and other conditions of the subject; the route of administration; and whether the administration is regional or systemic.
  • an effective amount of the double-stranded molecule or the inhibitory polypeptide of the present invention is an intercellular concentration at or near the cancer site of from about 1 nanomolar (nM) to about 100 nM, preferably from about 2 nM to about 50 nM, more preferably from about 2.5 nM to about 10 nM. It is contemplated that greater or smaller amounts of the double-stranded molecule or the inhibitory polypeptide can be administered. The precise dosage required for a particular circumstance may be readily and routinely determined by one of skill in the art.
  • the present methods can be used to inhibit the growth or metastasis of cancer expressing C6orf167 gene; for example lung cancer.
  • a double-stranded molecule containing a target sequence of C6orf167 gene e.g., SEQ ID NO: 15 and 16
  • an inhibitory polypeptide having an amino acid sequence of SEQ ID NO: 24 can be used for the treatment of cancer.
  • the double-stranded molecule or the inhibitory polypeptide of the present invention can also be administered to a subject in combination with a pharmaceutical composition different from them.
  • the double-stranded molecule or the inhibitory polypeptide of the present invention can be administered to a subject in combination with another therapeutic method designed to treat cancer.
  • the double-stranded molecule or the inhibitory polypeptide of the present invention can be administered in combination with therapeutic methods currently employed for treating cancer or preventing cancer metastasis (e.g., radiation therapy, surgery and treatment using chemotherapeutic agents, such as cisplatin, carboplatin, cyclophosphamide, 5-fluorouracil, adriamycin, daunorubicin or tamoxifen).
  • chemotherapeutic agents such as cisplatin, carboplatin, cyclophosphamide, 5-fluorouracil, adriamycin, daunorubicin or tamoxifen.
  • the double-stranded molecule or the inhibitory polypeptide can be administered to the subject either as an naked double-stranded molecule or the inhibitory polypeptide, in conjunction with a delivery reagent, or as a recombinant plasmid or viral vector which expresses the double-stranded molecule or the inhibitory polypeptide.
  • Suitable delivery reagents for administration in conjunction with the present a double-stranded molecule include the Mirus Transit TKO lipophilic reagent; lipofectin; lipofectamine; cellfectin; or polycations (e.g., polylysine), or liposomes.
  • a typical delivery reagent is a liposome.
  • Liposomes can aid in the delivery of the double-stranded molecule or the inhibitory polypeptide to a particular tissue, such as lung tumor tissue, and can also increase the blood half-life of the double-stranded molecule.
  • Liposomes suitable for use in the context of the present invention may be formed from standard vesicle-forming lipids, which generally include neutral or negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally guided by consideration of factors such as the desired liposome size and half-life of the liposomes in the blood stream. A variety of methods are known for preparing liposomes, for example as described in Szoka et al., Ann Rev Biophys Bioeng 1980, 9: 467; and US Pat. Nos. 4,235,871; 4,501,728; 4,837,028; and 5,019,369, the entire disclosures of which are herein incorporated by reference.
  • the liposomes encapsulating the double-stranded molecule or the inhibitory polypeptide of the present invention include a ligand molecule that can deliver the liposome to the cancer site.
  • Ligands which bind to receptors prevalent in tumor or vascular endothelial cells such as monoclonal antibodies that bind to tumor antigens or endothelial cell surface antigens, are preferred.
  • the liposomes encapsulating the double-stranded molecule or the inhibitory polypeptide of the present invention are modified so as to avoid clearance by the mononuclear macrophage and reticuloendothelial systems, for example, by having opsonization-inhibition moieties bound to the surface of the structure.
  • a liposome to be used in the present invention can include both opsonization-inhibition moieties and a ligand.
  • Opsonization-inhibiting moieties for use in preparing the liposomes are typically large hydrophilic polymers that are bound to the liposome membrane.
  • an opsonization-inhibiting moiety is "bound" to a liposome membrane when it is chemically or physically attached to the membrane, e.g., by the intercalation of a lipid-soluble anchor into the membrane itself, or by binding directly to active groups of membrane lipids.
  • These opsonization-inhibiting hydrophilic polymers form a protective surface layer which significantly decreases the uptake of the liposomes by the macrophage-monocyte system ("MMS") and reticuloendothelial system ("RES"); e.g., as described in US Pat. No.
  • Liposomes modified with opsonization-inhibition moieties thus remain in the circulation much longer than unmodified liposomes. For this reason, such liposomes are sometimes called "stealth" liposomes.
  • Stealth liposomes are known to accumulate in tissues fed by porous or "leaky" microvasculature.
  • target tissue characterized by such microvasculature defects for example, solid tumors, will efficiently accumulate these liposomes; see Gabizon et al., Proc Natl Acad Sci USA 1988, 18: 6949-53.
  • the reduced uptake by the RES lowers the toxicity of stealth liposomes by preventing significant accumulation in liver and spleen.
  • liposomes that are modified with opsonization-inhibition moieties can deliver the present double-stranded molecule or the inhibitory polypeptide to tumor cells.
  • Opsonization-inhibiting moieties suitable for modifying liposomes are preferably water-soluble polymers with a molecular weight from about 500 to about 40,000 daltons, and more preferably from about 2,000 to about 20,000 daltons.
  • Such polymers include polyethylene glycol (PEG) or polypropylene glycol (PPG) derivatives; e.g., methoxy PEG or PPG, and PEG or PPG stearate; synthetic polymers such as polyacrylamide or poly N-vinyl pyrrolidone; linear, branched, or dendrimeric polyamidoamines; polyacrylic acids; polyalcohols, e.g., polyvinylalcohol and polyxylitol to which carboxylic or amino groups are chemically linked, as well as gangliosides, such as ganglioside GM.sub.1.
  • Copolymers of PEG, methoxy PEG, or methoxy PPG, or derivatives thereof, are also suitable.
  • the opsonization-inhibiting polymer can be a block copolymer of PEG and either a polyamino acid, polysaccharide, polyamidoamine, polyethyleneamine, or polynucleotide.
  • the opsonization-inhibiting polymers can also be natural polysaccharides containing amino acids or carboxylic acids, e.g., galacturonic acid, glucuronic acid, mannuronic acid, hyaluronic acid, pectic acid, neuraminic acid, alginic acid, carrageenan; aminated polysaccharides or oligosaccharides (linear or branched); or carboxylated polysaccharides or oligosaccharides, e.g., reacted with derivatives of carbonic acids with resultant linking of carboxylic groups.
  • the opsonization-inhibiting moiety is a PEG, PPG, or derivatives thereof. Liposomes modified with PEG or PEG-derivatives are sometimes called "PEGylated liposomes".
  • the opsonization-inhibiting moiety can be bound to the liposome membrane by any one of numerous well-known techniques.
  • an N-hydroxysuccinimide ester of PEG can be bound to a phosphatidyl-ethanolamine lipid-soluble anchor, and then bound to a membrane.
  • a dextran polymer can be derivatized with a stearylamine lipid-soluble anchor via reductive amination using Na(CN)BH. sub. 3 and a solvent mixture such as tetrahydrofuran and water in a 30:12 ratio at 60 degrees C.
  • Vectors expressing a double-stranded molecule or the inhibitory polypeptide of the present invention are discussed above. Such vectors expressing at least one double-stranded molecule or the inhibitory polypeptide of the present invention can also be administered directly or in conjunction with a suitable delivery reagent, including the Mirus Transit LT1 lipophilic reagent; lipofectin; lipofectamine; cellfectin; polycations (e.g., polylysine) or liposomes.
  • a suitable delivery reagent including the Mirus Transit LT1 lipophilic reagent; lipofectin; lipofectamine; cellfectin; polycations (e.g., polylysine) or liposomes.
  • the double-stranded molecule or the inhibitory polypeptide of the present invention can be administered to the subject by any means suitable for delivering the double-stranded molecule or the inhibitory polypeptide into cancer sites.
  • the double-stranded molecule can be administered by gene gun, electroporation, or by other suitable parenteral or enteral administration routes.
  • the inhibitory polypeptide of the present invention can administered by suitable parenteral or enteral administration routes. Suitable enteral administration routes include oral, rectal, or intranasal delivery.
  • Suitable parenteral administration routes include intravesical and intravascular administration (e.g., intravenous bolus injection, intravenous infusion, intra-arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature); peri- and intra-tissue injection (e.g., peri-tumoral and intra-tumoral injection); subcutaneous injection or deposition including subcutaneous infusion (such as by osmotic pumps); direct application to the area at or near the site of cancer, for example by a catheter or other placement device (e.g., a suppository or an implant including a porous, non-porous, or gelatinous material); and inhalation. It is preferred that injections or infusions of the double-stranded molecule, the inhibitory polypeptide or vector be given at or near the site of the cancer.
  • intravesical and intravascular administration e.g., intravenous bolus injection, intravenous infusion, intra-arterial bolus injection
  • the double-stranded molecule or the inhibitory polypeptide of the present invention can be administered in a single dose or in multiple doses.
  • the infusion can be a single sustained dose or can be delivered by multiple infusions.
  • Injection of the double-stranded molecule or the inhibitory polypeptide directly into the tissue is at or near the site of cancer preferred. Multiple injections of the double-stranded molecule into the tissue at or near the site of cancer are particularly preferred.
  • the double-stranded molecule or the inhibitory polypeptide of the present invention can be administered to the subject once, for example, as a single injection or deposition at or near the cancer site.
  • the double-stranded molecule or the inhibitory polypeptide can be administered once or twice daily to a subject for a period of from about three to about twenty-eight days, more preferably from about seven to about ten days.
  • the double-stranded molecule or the inhibitory polypeptide is injected at or near the site of cancer once a day for seven days.
  • the effective amount of a double-stranded molecule or the inhibitory polypeptide administered to the subject can include the total amount of a double-stranded molecule or the inhibitory polypeptide administered over the entire dosage regimen.
  • a cancer overexpressing C6orf167 gene can be treated with at least one active ingredient selected from the group consisting of: (a) a double-stranded molecule of the present invention, (b) DNA encoding thereof, (c) a vector encoding thereof, (d) an inhibitory polypeptide of the present invention, (e) DNA encoding thereof, and (f) a vector encoding thereof.
  • the cancer includes, but is not limited to, lung cancer. Accordingly, prior to the administration of the double-stranded molecule or the inhibitory polypeptide of the present invention as active ingredient, it is preferable to confirm whether the expression level of C6orf167 in the cancer cells or tissues to be treated is enhanced as compared with normal cells of the same organ.
  • the present invention provides a method for treating a cancer (over)expressing C6orf167 gene, such method including the steps of: i) determining the expression level of C6orf167 gene in cancer cells or tissue(s) obtained from a subject with the cancer to be treated; ii) comparing the expression level of C6orf167 gene with normal control; and iii) administrating at least one component selected from the group consisting of (a) a double-stranded molecule of the present invention, (b) DNA encoding thereof, (c) a vector encoding thereof, (d) an inhibitory polypeptide of the present invention, (e) DNA encoding thereof, and (f) a vector encoding thereof, to a subject with a cancer overexpressing C6orf167 gene compared with normal control.
  • the present invention also provides a pharmaceutical composition containing at least one component selected from the group consisting of: (a) a double-stranded molecule of the present invention, (b) DNA encoding thereof, (c) a vector encoding thereof, (d) an inhibitory polypeptide of the present invention, (e) DNA encoding thereof, and (f) a vector encoding thereof, for use in administrating to a subject having a cancer overexpressing C6orf167 gene.
  • a pharmaceutical composition containing at least one component selected from the group consisting of: (a) a double-stranded molecule of the present invention, (b) DNA encoding thereof, (c) a vector encoding thereof, (d) an inhibitory polypeptide of the present invention, (e) DNA encoding thereof, and (f) a vector encoding thereof, for use in administrating to a subject having a cancer overexpressing C6orf167 gene.
  • the present invention further provides a method for identifying a subject to be treated with: (a) a double-stranded molecule of the present invention, (b) DNA encoding thereof, (c) a vector encoding thereof, (d) an inhibitory polypeptide of the present invention, (e) DNA encoding thereof, or (f) a vector encoding thereof, which method may include the step of determining an expression level of C6orf167 gene in subject-derived cancer cells or tissue(s), wherein an increase of the level compared to a normal control level of the gene indicates that the subject has cancer which may be treated with.
  • a subject to be treated by the present method is preferably a mammal.
  • exemplary mammals include, but are not limited to, e.g., human, non-human primate, mouse, rat, dog, cat, horse, and cow.
  • the expression level of C6orf167 gene in cancer cells or tissues obtained from a subject is determined.
  • the expression level can be determined at the transcription (nucleic acid) product level, using methods known in the art.
  • the mRNA of C6orf167 gene may be quantified using probes by hybridization methods (e.g., Northern hybridization).
  • the detection may be carried out on a chip or an array. The use of an array is preferable for detecting the expression level of C6orf167 gene.
  • the cDNA of C6orf167 gene may be used as the probes.
  • the probes may be labeled with a suitable label, such as dyes, fluorescent substances and isotopes, and the expression level of the gene may be detected as the intensity of the hybridized labels.
  • the transcription product of C6orf167 gene e.g., SEQ ID NO: 17 or 19
  • primers may be prepared based on the available sequence information of the gene.
  • a probe or primer used for the present method hybridizes under stringent, moderately stringent, or low stringent conditions to the mRNA of C6orf167 gene.
  • stringent (hybridization) conditions refers to conditions under which a probe or primer will hybridize to its target sequence, but not to other sequences. Stringent conditions are sequence-dependent and will be different under different circumstances. Specific hybridization of longer sequences is observed at higher temperatures than shorter sequences. Generally, the temperature of a stringent condition is selected to be about 5 degrees C lower than the thermal melting point (Tm) for a specific sequence at a defined ionic strength and pH.
  • the Tm is the temperature (under a defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to their target sequence hybridize to the target sequence at equilibrium. Since the target sequences are generally present at excess, at Tm, 50% of the probes are occupied at equilibrium.
  • stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 degrees C for short probes or primers (e.g., 10 to 50 nucleotides) and at least about 60 degrees C for longer probes or primers. Stringent conditions may also be achieved with the addition of destabilizing agents, such as formamide.
  • the translation product may be detected for the diagnosis of the present invention.
  • the quantity of observed protein e.g., SEQ ID NO: 18 or 20
  • Methods for determining the quantity of the protein as the translation product include immunoassay methods that use an antibody specifically recognizing the protein.
  • the antibody may be monoclonal or polyclonal.
  • any fragment or modification e.g., chimeric antibody, scFv, Fab, F(ab')2, Fv, etc.
  • Methods to prepare these kinds of antibodies for the detection of proteins are well known in the art, and any method may be employed in the present invention to prepare such antibodies and equivalents thereof.
  • the intensity of staining may be measured via immunohistochemical analysis using an antibody against the C6orf167 protein. Namely, in this measurement, strong staining indicates increased presence/level of the protein and, at the same time, high expression level of C6orf167 gene.
  • the expression level of a target gene, e.g., the C6orf167 gene, in cancer cells can be determined to be increased if the level increases from the control level (e.g., the level in normal cells) of the target gene by, for example, 10%, 25%, or 50%; or increases to more than 1.1 fold, more than 1.5 fold, more than 2.0 fold, more than 5.0 fold, more than 10.0 fold, or more.
  • the control level e.g., the level in normal cells
  • the control level may be determined at the same time with the cancer cells by using a sample(s) previously collected and stored from a subject/subjects whose disease state(s) (cancerous or non-cancerous) is/are known.
  • normal cells obtained from non-cancerous regions of an organ that has the cancer to be treated may be used as normal control.
  • the control level may be determined by a statistical method based on the results obtained by analyzing previously determined expression level(s) of C6orf167 gene in samples from subjects whose disease states are known.
  • the control level can be derived from a database of expression patterns from previously tested cells.
  • the expression level of C6orf167 gene in a biological sample may be compared to multiple control levels, which are determined from multiple reference samples. It is preferred to use a control level determined from a reference sample derived from a tissue type similar to that of the subject-derived biological sample. Moreover, it is preferred to use the standard value of the expression levels of C6orf167 gene in a population with a known disease state. The standard value may be obtained by any method known in the art. For example, a range of mean +/- 2 S.D. or mean +/- 3 S.D. may be used as the standard value.
  • a control level determined from a biological sample that is known to be non-cancerous is referred to as a "normal control level”.
  • the control level is determined from a cancerous biological sample, it is referred to as a "cancerous control level”.
  • the expression level of C6orf167 gene is increased as compared to the normal control level, or is similar/equivalent to the cancerous control level, the subject may be diagnosed with cancer to be treated.
  • compositions for Inhibiting or Reducing Cancer Cell Growth or Treating Cancer include the double-stranded molecule, the inhibitory polypeptide of the present invention, or the vector encoding such molecule or polypeptide.
  • compositions [1] to [23] [1] A composition for either or both of treating and preventing cancer, wherein the composition comprises a pharmaceutically effective amount of a double-stranded molecule against a C6orf167 gene or a vector encoding thereof, and a pharmaceutically acceptable carrier, wherein the double-stranded molecule, when introduced into a cell expressing the C6orf167 gene, inhibits an expression of the C6orf167 gene as well as cell proliferation; [2] The composition of [1], wherein the double-stranded molecule acts on mRNA, matching a target sequence of SEQ ID NO: 15 or 16; [3] The composition of [1], wherein the sense strand of the double-stranded molecule contains a nucleotide sequence corresponding to a target sequence of SEQ ID NO: 15 or 16; [4] The composition of [1], wherein the sense strand of the double-stranded molecule contains a nucleotide sequence corresponding to
  • compositions of the present invention are described in additional detail below.
  • the double-stranded molecule or the inhibitory polypeptide of the present invention is preferably formulated as pharmaceutical compositions prior to administering to a subject, according to techniques known in the art.
  • Pharmaceutical composition of the present invention is characterized as being at least sterile and pyrogen-free.
  • pharmaceutical composition include formulation for human and veterinary use.
  • the compositions may be used as pharmaceuticals for humans and other mammals, such as mice, rats, guinea-pigs, rabbits, cats, dogs, sheep, pigs, cattle, monkeys, baboons, and chimpanzees.
  • suitable pharmaceutical formulations of the present invention include those suitable for oral, rectal, nasal, topical (including buccal, sub-lingual, and transdermal), vaginal or parenteral (including intramuscular, subcutaneous and intravenous) administration, or for administration by inhalation or insufflation.
  • Other formulations include implantable devices and adhesive patches that release a therapeutic agent.
  • the above-described formulations may be adapted to give sustained release of the active ingredient.
  • Methods for preparing pharmaceutical compositions of the present invention are within the skill in the art, for example as described in Remington's Pharmaceutical Science, 17th ed., Mack Publishing Company, Easton, Pa. (1985), the entire disclosure of which is herein incorporated by reference.
  • the present pharmaceutical composition contains the double-stranded molecule or the inhibitory polypeptide of the present invention, or vector encoding such molecule or polypeptide (e.g., 0.1 to 90% by weight), or a pharmaceutically acceptable salt of the molecule, mixed with a pharmaceutically acceptable carrier medium.
  • Preferred physiologically acceptable carrier media are water, buffered water, normal saline, 0.4% saline, 0.3% glycine, hyaluronic acid and the like.
  • the composition may contain plural kinds of the double-stranded molecules, each of the molecules may be directed to the same target sequence, or different target sequences of C6orf167 gene.
  • the composition may contain double-stranded molecules directed to C6orf167 gene.
  • the composition may contain double-stranded molecules directed to one, two or more target sequences of C6orf167 gene.
  • the present composition may contain a vector encoding one or plural double-stranded molecules.
  • the vector may encode one, two or several kinds of the double-stranded molecules of the present invention.
  • the present composition may contain plural kinds of vectors, each of the vectors encoding a different double-stranded molecule.
  • compositions of the present invention can also include conventional pharmaceutical excipients and/or additives. Suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH adjusting agents.
  • Suitable additives include physiologically biocompatible buffers (e.g., tromethamine hydrochloride), additions of chelants (such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (for example calcium DTPA, CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate).
  • physiologically biocompatible buffers e.g., tromethamine hydrochloride
  • additions of chelants such as, for example, DTPA or DTPA-bisamide
  • calcium chelate complexes for example calcium DTPA, CaNaDTPA-bisamide
  • calcium or sodium salts for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate.
  • Pharmaceutical compositions of the present invention can be packaged for use in liquid form, or can be lyophilized.
  • a solid pharmaceutical composition for oral administration can include any of the carriers and excipients listed above and 10-95%, preferably 25-75%, of one or more double-stranded molecule of the invention.
  • a pharmaceutical composition for aerosol (inhalational) administration can include 0.01-20% by weight, preferably 1-10% by weight, of one or more double-stranded molecule of the present invention encapsulated in a liposome as described above, and propellant.
  • a carrier can also be included as desired; e.g., lecithin for intranasal delivery.
  • the present composition may contain other pharmaceutically active ingredients so long as they do not inhibit the in vivo function of the double-stranded molecule or the inhibitory polypeptide of the present invention.
  • the composition may contain chemotherapeutic agents conventionally used for treating cancers.
  • the pharmaceutical compositions may also contain other active ingredients such as antimicrobial agents, immunosuppressants or preservatives.
  • the formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question; for example, those suitable for oral administration may include flavoring agents.
  • the present invention provides for the use of the double-stranded nucleic acid molecule of the present invention in manufacturing a pharmaceutical composition for treating a cancer characterized by the expression of C6orf167 gene.
  • the present invention relates to a use of double-stranded molecule inhibiting the expression of an C6orf167 gene in a cell, which molecule includes a sense strand and an antisense strand complementary thereto, hybridized to each other to form the double-stranded nucleic acid molecule and target to a sequence of SEQ ID NO: 15 or 16, for manufacturing a pharmaceutical composition for treating cancer expressing C6orf167 gene.
  • the present invention relates to a use of inhibitory polypeptide inhibiting the binding between C6orf167 polypeptide and NFKBIL2 polypeptide, which polypeptide includes a C6orf167-binding domain of an NFKBIL2 polypeptide, wherein the polypeptide lacks a biological function of the NFKBIL2 polypeptide, and wherein the biological function is the ability to control a subcellular localization of a C6orf167 polypeptide.
  • the present invention further provides the double-stranded molecules or the inhibitory polypeptide of the present invention for use in treating a cancer expressing the C6orf167 gene.
  • the present invention further provides a method or process for manufacturing a pharmaceutical composition for treating a cancer characterized by the expression of C6orf167 gene, wherein the method or process includes a step for formulating a pharmaceutically or physiologically acceptable carrier with a double-stranded molecule inhibiting the expression of C6orf167 gene in a cell, which over-expresses the gene, which molecule includes a sense strand and an antisense strand complementary thereto, hybridized to each other to form the double-stranded nucleic acid molecule and target to a sequence of SEQ ID NO: 15 or 16 as active ingredients.
  • the present invention further provides a method or process for manufacturing a pharmaceutical composition for treating a cancer characterized by the expression of C6orf167 gene, wherein the method or process includes a step for formulating a pharmaceutically or physiologically acceptable carrier with a inhibitory polypeptide inhibiting the binding between C6orf167 polypeptide and NFKBIL2 polypeptide, which polypeptide includes a C6orf167-binding domain of an NFKBIL2 polypeptide, wherein the polypeptide lacks a biological function of the NFKBIL2 polypeptide, and wherein the biological function is the ability to control a subcellular localization of a C6orf167 polypeptide.
  • the present invention provides a method or process for manufacturing a pharmaceutical composition for treating a cancer characterized by the expression of C6orf167 gene, wherein the method or process includes a step for admixing an active ingredient with a pharmaceutically or physiologically acceptable carrier, wherein the active ingredient is a double-stranded nucleic acid molecule inhibiting the expression of C6orf167 gene in a cell, which over-expresses the gene, which molecule includes a sense strand and an antisense strand complementary thereto, hybridized to each other to form the double-stranded nucleic acid molecule and targets to a sequence of SEQ ID NO: 15 or 16.
  • the present invention provides a method or process for manufacturing a pharmaceutical composition for treating a cancer characterized by the expression of C6orf167 gene, wherein the method or process includes a step for admixing an active ingredient with a pharmaceutically or physiologically acceptable carrier, wherein the active ingredient is a inhibitory polypeptide inhibiting the binding between C6orf167 polypeptide and NFKBIL2 polypeptide, which polypeptide includes a C6orf167-binding domain of an NFKBIL2 polypeptide, wherein the polypeptide lacks a biological function of the NFKBIL2 polypeptide, and wherein the biological function is the ability to control a subcellular localization of a C6orf167 polypeptide.
  • the active ingredient is a inhibitory polypeptide inhibiting the binding between C6orf167 polypeptide and NFKBIL2 polypeptide, which polypeptide includes a C6orf167-binding domain of an NFKBIL2 polypeptide, wherein the polypeptide lacks a biological function of the
  • Example 1 General Methods Cell lines and clinical samples
  • the 24 human lung-cancer cell lines used for this study included nineteen NSCLCs (A427, A549, NCI-H1373, LC319, PC-14, NCI-H358, PC-3, PC-9, NCI-H1666, NCI-H1781, NCI-H647, NCI-H226, NCI-H1703, NCI-H520, LU61, RERF-LC-AI, SK-MES-1, EBC-1, LX1, and NCI-H2170) and four small-cell lung cancers (SCLC: DMS114, DMS273, SBC-3, and SBC-5).
  • the human esophageal carcinoma cell lines used in this study were as follows: twelve ESCC cell lines (TE1, TE2, TE3, TE4, TE5, TE6, TE8, TE9, TE10, TE12, TE13, and TE15) and one adenocarcinoma (ADC) cell line (TE7). All cells were grown in monolayers in appropriate media supplemented with 10% fetal calf serum (FCS) and were maintained at 37 degrees C in an atmosphere of humidified air with 5% CO 2 . Human airway epithelial cells, SAEC (Cambrex Bio Science Inc.) was also included in the panel of the cells used in this study.
  • FCS fetal calf serum
  • the primer sets for amplification were as follows: ACTB-F (5'-GAGGTGATAGCATTGCTTTCG-3') (SEQ ID NO: 1) and ACTB-R (5'-CAAGTCAGTGTACAGGTAAGC-3') (SEQ ID NO: 2) for ACTB, C6orf167-F (5'-GTCTCACCTTGGACAGATGG-3') (SEQ ID NO: 3) and C6orf167-R (5'-CCAAGGATCCTATTACACAGTTGC-3') (SEQ ID NO: 4) for C6orf167.
  • Anti-C6orf167 antibody Synthesized peptide with the amino acids sequence as CLGQMGQDEMQRLENDNT (SEQ ID NO: 7) (1227-1243) (Cistine was added at N terminal) was inoculated into rabbits; the immune sera were purified on affinity columns according to standard methodology. Affinity-purified anti- C6orf167 antibodies were used for western blotting as well as immunocytochemical studies. It was confirmed that the antibody was specific to C6orf167 on western blots using lysates from cell lines that had been transfected with C6orf167 expression vector as well as those from lung cancer cell lines that endogenously expressed C6orf167 or not.
  • RNA interference assay Two independent C6orf167 siRNA oligonucleotides were designed using the C6orf167 sequences (GenBank accession no: NM_198468). Two independent NFKBIL2 siRNA oligonucleotides were purchased (Sigma/Aldrich Catalog No. SASI_Hs02_0012682, SASI_00112683). siRNAs (600 pM) were transfected into two NSCLC cell lines, A549 and LC319 or a cervical cancer cell line HeLa, using 30 micro l of Lipofectamine 2000 (Invitrogen) following the manufacturer's protocol. The transfected cells were cultured for seven days.
  • siRNA sequences used were as follows: control-1 (si-LUC: luciferase gene from Photinus pyralis), 5'-CGUACGCGGAAUACUUCGA-3' (SEQ ID NO: 8); control-2 (CNT: ON-TARGETplus siCONTROL Non-targeting siRNAs a pool of four oligos: 5'-UGGUUUACAUGUCGACUAA-3' (SEQ ID NO: 9); 5'-UGGUUUACAUGUUUUCUGA-3' (SEQ ID NO: 10); 5'-UGGUUUACAUGUUUUCCUA-3' (SEQ ID NO: 11); and 5'-UGGUUUACAUGUUGUGUGA-3') (SEQ ID NO: 12); siRNA- C6orf167-#1 (si- C6orf167-#1: 5'- CCGCCAAUAUCAUCUCUAAUU-3') (SEQ ID NO: 13); siRNA-C6orf167-#2 (si-
  • HeLa and LC319 cells were transfected with Mock and pCAGGSn-HA-N1, N2, N3 expressing vectors, COS-7 or HEK293 cells that express endogenous C6orf167 at a very low level were transfected with mock or C6orf167-expressing vectors (pCAGGSn-3xFlag-C6orf167) using Lipofectamin 2000 transfection reagent (Roche). Transfected cells were incubated in culture medium containing 0.8 mg/mL neomycin (Geneticin, Invitrogen) for 7 days. Expression of C6orf167 as well as viability and colony numbers of cells were evaluated by western-blotting, and MTT and colony-formation assays at day 7.
  • Flow cytometric analysis Cells transfected with siRNA oligonucleotides against C6orf167 or control siRNAs were plated at densities of 5 X 10 5 per 60-mm dish. Cells were collected in PBS, and fixed in 70% cold ethanol for 30 min. After treatment with 100 micro-g/mL RNase (Sigma/Aldrich), the cells were stained with 50 micro-g/mL propidium iodide (Sigma/Aldrich) in PBS. Flow cytometric analysis was done on a Cell Lab Quanta SC (BECKMAN COULTER) and analyzed by CXP Analysis software (BECKMAN COULTER). The cells selected from at least 10,000 ungated cells were analyzed for DNA content.
  • Example 2 Up-regulation of C6orf167 in lung cancers Genome-wide expression profile analysis of 101 lung cancer cases was previously conducted using cDNA microarray (Daigo Y, Nakamura Y. Gen Thorac Cardiovasc Surg 2008;56:43-53.; Kikuchi T, et al. Oncogene 2003;22:2192-205.; Taniwaki M, et al. Int J Oncol 2006;29:567-75.).
  • C6orf167 transcript was identified to be over-expressed and it was confirmed by semiquantitative RT-PCR experiments that its expression was increased in all of 15 clinical lung cancer tissues, however hardly detectable in their adjacent normal lung tissues (Fig. 1A).
  • Example 3 Growth promoting effect of C6orf167
  • the expression of endogenous C6orf167 in two lung cancer cells, A549 and LC319 was knocked down, by means of the RNAi technique using siRNA oligonucleotide for C6orf167 (Figs. 2A-2C).
  • Semiquantitative RT-PCR experiments detected significant knockdown effect in both transcription and protein level of C6orf167 in the cells transfected with C6orf167 si-#1 and si-#2, but not with or control siRNA (si-LUC and si-CNT).
  • colony formation and MTT assays clearly revealed growth suppression of lung cancer cells by the two siRNAs, C6orf167 si-#1 and si-#2, compared with two controls siRNAs that showed no knockdown effect.
  • These findings implied a critical role of C6orf167 in the growth of lung cancer cells. Since the present inventor's original gene expression profile database also revealed its high level of expression in clinical cervical cancers, the expression of C6orf167 was also knocked down by siRNAs in a cervical cancer cell line, HeLa, and observed the growth suppressive effect by siRNAs for C6orf167.
  • C6orf167 To further examine the effect of C6orf167 on growth of mammalian cells, plasmids designed to transiently express full-length C6orf167 (pCAGGSn-3xFlag- C6orf167) or mock plasmids were transfected into COS-7 or HEK293 cells. The growth promoting effect was significantly observed in cells transfected with C6orf167 expressing vector compared with mock vector (Fig. 2D).
  • NFKBIL2 controls the nucleus localization of C6orf167 protein in cultured cell
  • immunoprecipitation assay coupled with MS analysis was performed.
  • NFKBIL2 nuclear factor of kappa (NFKB) light polypeptide gene enhancer in B-cells inhibitor-like 2
  • Fig. 3A C6orf167-interacting protein
  • exogenous C6orf167 and NFKBIL2 proteins stabilized their protein level in cells. Furthermore, knockdown of endogenous C6orf167 with siRNA for C6orf167 8si-C6orf167) reduced NFKBIL2 protein level in lung cancer LC319 cells, and reduction of NFKBIL2 with si-NFKBIL2 reduced C6orf167 levels and significantly suppressed cancer cell growth (Fig. 3F, Fig. 8 and Fig.9). These data suggest that the expression of NFKBIL2 is likely to promote nuclear localization and stability of C6orf167 protein, and a complex including these two proteins could coordinately play pivotal roles in cell growth and/or survival.
  • Example 5 Dominant negative effect of partial protein NFKBIL2 in lung cancer cell lines
  • NFKBIL2 protein play important roles in lung carcinogenesis
  • partial proteins of C6orf167 and NFKBIL2 were cloned to identify binding region (Fig. 4A).
  • Immunoprecipitation and western blotting assays revealed that N-terminal of C6orf167 protein strongly bound to NFKBIL2 protein at C-terminal (Fig. 4B). Because nuclear localization of C6orf167 protein was controlled in the presence of NFKIL2 protein, subsequently it was investigated which part of NFKBIL2 protein could control the subcellular localization of C6orf167 protein in cultured cells.
  • Plasmids expressing partial proteins of NFKBIL2 were co-transfected with full-length C6orf167 expressing vectors.
  • N1 N terminal partial protein of NFKBIL2
  • N2 central partial protein of NFKBIL2
  • these two partial proteins could not bind with C6orf167 protein, although these two proteins were detected in the nucleus but protein aggregation and cytoplasm localization of C6orf167 protein were observed.
  • the partial protein N3 which could bind to C6orf167 protein could not be located in the nucleus (Fig. 4C).
  • Example 6 C-terminal portion of NFKIL2 protein is crucial for binding to C6orf167 protein
  • the present inventors subsequently constructed various plasmids expressing partial C6orf167 proteins with Flag tag or partial NFKBIL2 proteins with HA tag, and transfected them into COS-7 cells (Fig. 10A). Immunoprecipitation and western blotting assays using antibodies to Flag- or HA-tags revealed that an N-terminal portion of C6orf167 protein (C1; codon 1-414) could bind to a C-terminal region of NFKBIL2 (N3; codon 823-1244) (Fig. 10B).
  • NFKBIL2 protein is essential for subcellular localization of C6orf167 protein in cultured cells. Plasmids expressing partial proteins of NFKBIL2 were co-transfected with full-length C6orf167 expression vector into COS-7 cells. Interestingly, N-terminal (N1; codon 1-450) and central part (N2; codon 403-836) of NFKBIL2 proteins could be localized in the nucleus, while aggregated C6orf167 protein was mainly located in the cytoplasm of the same cells (Fig. 10C).
  • N1 and N2 could not bind to C6orf167 protein as indicated by immunoprecipitation analyses.
  • C6orf167 protein and C-terminal part of NFKBIL2 protein (N3; codon 823-1244) that could bind to C6orf167 protein were mainly localized in the cytoplasm of the cells (Fig. 10C).
  • the data indicate that N-terminal (N1; codon 1-450) and central (N2; codon 403-836) parts of NFKBIL2 are more important for nuclear localization of NFKBIL2, while its C-terminal part (N3; codon 823-1244) is essential for binding to C6orf167.
  • Example 7 Dominant negative growth suppressive effect of partial NFKBIL2 protein including C6orf167-binding site. According to the data above, the present inventors hypothesized that if nuclear localization of C6orf167 protein is important for cancer cells growth, reduction of C6orf167 protein in the nucleus by inhibiting the interaction between C6orf167 and NFKBIL2 could suppress the cancer cell growth.
  • the present inventors co-transfected full-length C6orf167 and either of full-/partial-length NFKBIL2 expressing vectors (N1, N2, or N3) into HEK293 cells, and found that the amount of exogenous full-length NFKBIL2 protein that binds to exogenous C6orf167 was significantly decreased after introduction of the partial N3 protein, as demonstrated by immunoprecipitation assays, while it was not changed in the cells transfected with N1 or N2 vectors (Fig. 5A).
  • Example 8 C6orf167 protein acts as an upstream molecule of NFKB pathway Since NFKIL2 protein was indicated to be involved in the NFKB pathway that plays an essential role in the promotion of cell proliferation and anti-apoptosis (Rayet B.et al, Oncogene. 1999; 18, 6938-47, Tergaonkar V. Int J. Biochem. Cell Biol. 2006; 38, 1647-53, Yamamoto Y.et al, J Clin Invest.
  • the present inventors examined the expression of NFKB p65/RelA protein in HeLa cells in which both exogenous C6orf167 and NFKIL2 were introduced, and found that the level of endogenous p65/RelA protein was elevated compared with those of cells introduced NFKIL2 alone (Fig. 11). The result suggests that the expression of C6orf167-NFKBIL2 complex may positively regulate the NFKB pathway. Subsequently, the present inventors attempted to examine the effect of endogenous C6orf167 expression on the NFKB pathway molecules using cytoplasmic and nuclear fraction of HeLa and LC319 cells that were treated with TNF-alpha.
  • cancer cells that were transfected with si-C6orf167 were cultured under DNA damage condition using DNA-damaging agents (cisplatin/CDDP or 5-fluorouracil/5-FU). After knockdown of C6orf167 expression with si-C6orf167 in HeLa cells, the cells were treated with CDDP (50 micro-g/mL) or 5-FU (50 micro-g/mL) for 48 hours and harvested the cells for flow cytometric analysis. The sub G1 population of the cells which were transfected with si-C6orf167 was significantly increased compared with those with control siRNA (si-LUC) under DNA damage condition (Figs. 13A and 13B).
  • DNA-damaging agents cisplatin/CDDP or 5-fluorouracil/5-FU.
  • C6orf167 is a putative oncogene and that its nuclear localization and stabilization was enhanced by binding to NFKBIL2.
  • the present inventors revealed that introduction of the C-terminal portion of NFKBIL2 protein into cancer cells could dominant-negatively inhibit the nuclear localization of C6orf167 possibly by blocking the C6orf167-NFKBIL2 interaction, and resulted in the suppression of cancer cell growth/survival.
  • transfection of siRNAs against C6orf167 or NFKBIL2 into cancer cells suppressed their expression and the cell growth. Therefore, inhibition of the C6orf167-NFKBIL2 interaction or suppressing C6orf167 protein function can be an effective approach for development of novel cancer therapy.
  • NFKB transcription factors are known to be the key regulators of immune, inflammatory and acute phase responses, and to be involved in the control of cell proliferation and apoptosis (Rayet B.et al, Oncogene. 1999; 18, 6938-47, Tergaonkar V. Int J. Biochem. Cell Biol. 2006; 38, 1647-53, Yamamoto Y.et al, J Clin Invest. 2001; 107:135-42, Kim, H. J.et al, Cell Death Differ. 2006; 13, 738-47). Activation of NFKB activity and consequent induction of its downstream genes lead to the oncogenesis in mammalian cells.
  • C6orf167 protein appeared to act as an upstream molecule of RelA/p65 and be indispensable for induction of anti-apoptosis factors, Bcl-XL or TRAF1. Further studies on the regulation and function of C6orf167 protein will contribute to the understanding of molecular mechanism of carcinogenesis through the activation of C6orf167 and NFKB pathway.
  • C6orf167 in cellular response to DNA damaging agents.
  • knockdown of C6orf167 expression also enhanced the apoptosis of cancer cells that were exposed to DNA-damaging agents including 5-FU and CDDP probably due to inhibition of induction of DNA repair molecules such as ATM, CSB and p53 as well as RelA/p65 and its downstream anti-apoptosis factor Bcl-XL.
  • C6orf167 might function as an upstream molecule of these anti-apoptosis factors and DNA-repair molecules and that targeting C6orf167 could have a significant advantage in avoiding the resistance of cancer cells to anti-cancer treatments, although the detailed function of C6orf167 in drug response of the cells and in carcinogenesis remains to be elucidated.
  • these data indicate that C6orf167 is involved in NFKB pathway in cancer cells through its interaction with NFKBIL2 and that it might be a promising candidate target for developing highly specific anti-cancer drugs with minimal risk of adverse effects.
  • C6orf167 was found as a promising therapeutic target molecule.
  • C6orf167 protein was frequently up-regulated in clinical lung cancer samples, and showed that this gene product plays an indispensable role in the growth of lung cancer cells.
  • C6orf167 could be involved in carcinogenesis.
  • C6orf167 is a putative oncogene that is highly and frequently expressed in lung cancers. Inhibition of the interaction between C6orf167 and its interacting protein NFKBIL2 is a useful therapeutic strategy for the development of new type of anti-cancer drugs.
  • C6orf167 can be conveniently used as a molecular diagnostic marker for identifying and detecting cancer, in particular, lung cancer. Accordingly, the C6orf167 gene and the proteins encoded thereby find utility in diagnostic kits and assays of cancer.
  • the present invention further demonstrates that the cell growth may be suppressed by a double-stranded molecule that specifically targets the C6orf167 gene or an C-terminal partial protein of NFKBIL2.
  • the double-stranded molecule and C-terminal partial protein of NFKBIL2 are useful as anti-cancer pharmaceuticals.
  • C6orf167 polypeptide is a useful target for the development of anti-cancer pharmaceuticals. For example, substances that block the expression of C6orf167 protein or prevent its activity find therapeutic utility as anti-cancer agents, particularly anti-cancer agents for the treatment of lung cancer.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Public Health (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Plant Pathology (AREA)
  • Veterinary Medicine (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)

Abstract

Objective methods for diagnosing cancer or a predisposition to developing cancer, particularly lung cancer are described herein. The present invention provides a diagnostic method that utilizes the expression level of C6orf167 as an index of cancer. The present invention further provides methods of screening for therapeutic substances useful in the treatment of cancer, e.g. lung cancer. The invention further provides methods of inhibiting the cancer cell growth and either or both of treating and preventing cancer. The invention also features double stranded molecules against C6orf167 gene and an inhibitory polypeptide for NFKBIL2, as well as vector encoding them and compositions containing them.

Description

    C6ORF167 AS A TARGET GENE FOR CANCER THERAPY AND DIAGNOSIS
  • The present invention relates to methods of detecting and diagnosing cancer as well as methods of treating and preventing cancer.
    Priority
    The present application claims the benefit of U.S. Provisional Applications No. 61/401,927, filed on August 19, 2010, and 61/375,184, filed on August 19, 2010, the entire contents of which are incorporated by reference herein.
  • Lung cancer is the most common form of cancer, accounting for 1.35 million of the 10.9 million new cases of cancer per year. It is also the leading cause of death from cancer-associated disease, accounting for 1.18 million of the 6.7 million cancer-related deaths worldwide (NPL1). Over the last decade, newly developed cytotoxic agents including paclitaxel, docetaxel, gemcitabine, and vinorelbine have emerged to offer multiple therapeutic choices for patients with advanced NSCLC (non-small cell lung cancer); however, each of the new regimens can provide only modest survival benefits as compared with cisplatin-based therapies (NPL 2).
  • Recently, molecular-targeted agents, including anti-EGFR or anti-VEGF monoclonal antibody, cetuximab (Erbitux) or Bevacizumab (Avastin), and small molecule inhibitors of EGFR tyrosine kinase, such as gefitinib (Iressa) and erlotinib (Tarceva), have been examined and/or approved for clinical use (NPL 3, 4). These agents display activity against recurrent NSCLC to a certain extent, but the number of patients who could receive a survival benefit is still limited. Meanwhile patients with SCLC (small cell lung cancer) respond favorably to the 1st line multi-agent chemotherapy, though they often relapse in a short time. Only 20% of patients with limited-stage disease (LD) can be cured with combined modality therapy and less than 5% of those with extensive-disease (ED) can achieve 5-year survival after the initial diagnosis (NPL 5). Hence, new therapeutic strategies, such as development of more selective and effective molecular-targeted agents against lung cancer, are eagerly awaited.
    In the course of screening for novel molecular targets for diagnosis, treatment and prevention of human cancers, the present inventors performed genome-wide expression profiles of 101 cases of lung cancers using cDNA microarray containing 27,648 genes or expressed sequence tags (ESTs), coupled with laser microdissection, and found several candidate molecular targets and biomarkers for lung cancer treatment (PTLs 1-2, NPLs 6-9).
  • [PTL1] WO2004/031413
    [PTL2] WO2007/013665
  • Non-Patent Literature
  • [NPL 1] Jemal A, Siegel R, Ward E, et al. CA Cancer J Clin. 2008;58:71-96.
    [NPL 2] Schiller JH, Harrington D, Belani CP, et al. Eastern Cooperative Oncology Group. N Engl J Med 2002;346:92-8.
    [NPL 3] Dowell J, Minna JD, Kirkpatrick P. Nat Rev Drug Discov 2005;4:13-4.
    [NPL 4] Pal SK, Pegram M. Anticancer Drugs 2005;16:483-94.
    [NPL 5] Chute JP, Chen T, Feigal E, Simon R, Johnson BE: J Clin Oncol 1999;17:1794-801.
    [NPL6] Daigo Y, Nakamura Y. Gen Thorac Cardiovasc Surg 2008;56:43-53.
    [NPL7] Kikuchi T, Daigo Y, Katagiri T, et al. Oncogene 2003;22:2192-205.
    [NPL8] Kakiuchi S, Daigo Y, Tsunoda T, Yano S, Sone S, Nakamura Y. Mol Cancer Res 2003;1:485-99.
    [NPL9] Taniwaki M, Daigo Y, Ishikawa N, et al. Int J Oncol 2006;29:567-75.
  • The present invention relates to the discovery, through microarray analysis and RT-PCR, that C6orf167 gene is overexpressed in clinical lung cancer tissues. As demonstrated herein, functional knockdown of endogenous C6orf167 gene by siRNA in cancer cell lines results in drastic suppression of cancer cell growth, suggesting its essential role in maintaining viability of cancer cells. Since it is only scarcely expressed in adult normal organs, C6orf167 gene is a particularly useful molecular target for a therapeutic approach with minimal adverse effect. Furthermore, the results disclosed herein demonstrates that nuclear localization of C6orf167 polypeptide is important for cancer cell growth and NFKBIL2 polypeptide is responsible for subcellular localization of C6orf167 polypeptide.
  • Accordingly, it is an object of the present invention to provide a method of detecting or diagnosing cancer or a predisposition for developing cancer, particularly lung cancer in a subject by determining an expression level of C6orf167 gene in a subject-derived biological sample. An increase in the level of expression of C6orf167 gene as compared to a normal control level indicates that the subject suffers from or is at risk of developing cancer, particularly lung cancer. In the methods of the present invention, the mRNA of C6orf167 gene can be detected by appropriate probes or primer sets or, alternatively, the C6orf167 protein can be detected by anti- C6orf167 antibody.
    It is a further object of the present invention to provide a kit that includes a reagent for detecting an mRNA of a C6orf167 gene or a protein encoded by a C6orf167 gene. Preferably, the reagent may be comprises an oligonucleotide that hybridizes to the mRNA of the C6orf167 gene, or an antibody against the protein encoded by the C6orf167 gene.
  • It is yet a further object of the present invention to provide a reagent for diagnosis or detection of cancer, which comprises an oligonucleotide that hybridizes to the mRNA of the C6orf167 gene, or an antibody against the protein encoded by the C6orf167 gene.
    It is yet a further object of the present invention to provide use of a probe or primer to the mRNA of the C6orf167 gene, or an antibody against the protein encoded by the C6orf167 gene. for the manufacture of a reagent for diagnosis or detection of cancer.
  • It is yet a further object of the present invention to provide methods for screening for a candidate substance that inhibits cancer cell growth, such substances finding utility in the treatment and/or prevention of cancer, such as lung cancer. The methods of the present invention can be carried out in vitro or in vivo and use as an index the binding activity to a C6orf167 polypeptide, an expression level of a C6orf167 gene, a biological activity of a C6orf167 polypeptide, an expression level of a reporter gene or an activity of a reporter gene controlled under a transcriptional regulatory region of the C6orf167 gene, or a binding between a C6orf167 polypeptide and an NFKBIL2 polypeptide. Substances that bind to a C6orf167 polypeptide, or suppress a C6orf167 expression or activity, a reporter gene expression or activity, or binding between a C6orf167 polypeptide and an NFKBIL2 polypeptide can be identified as candidate substances for either or both of treating and preventing cancer, or inhibiting cancer cell growth. The biological activity of the C6orf167 polypeptide to be detected is preferably cell proliferation promoting activity or binding activity to an NFKBIL2 polypeptide. A decrease in the biological activity of the C6orf167 polypeptide as compared to a control level in the absence of the test substance indicates that the test substance may be used to reduce symptoms of cancer, or either or both of treating and preventing cancer.
  • It is yet a further object of the present invention to provide double-stranded molecules composed of a sense strand and an antisense strand, in which the sense strand and the antisense strand hybridize to each other to form a double-stranded molecule. Preferably, the sense strand of the double-stranded molecule includes a nucleotide sequence corresponding to a target sequence selected from the group consisting of SEQ ID NOs: 15 and 16 and the antisense strand includes a sequence which is complementary to the target sequence. When introduced into a cell expressing a C6orf167 gene, the double-stranded molecule inhibits an expression of the C6orf167 gene as well as cell proliferation.
  • It is yet a further object of the present invention to provide a polypeptide comprising a C6orf167-binding domain of an NFKBIL2 polypeptide, such polypeptide lacking a biological function of the NFKBIL2 polypeptide. The biological function of the NFKBIL2 polypeptide that is lost can be a function to control a subcellular localization of a C6orf167 polypeptide. Preferably, the polypeptide of the present invention comprises an amino acid sequence of SEQ ID NO: 24 or a functional equivalent thereof.
  • It is yet a further object of the present invention to provide a method for either or both of treating and preventing cancer, or inhibiting the growth of a cancerous cell over-expressing C6orf167, by administering an agent that inhibits an expression of a C6orf167 gene and/or a function of a C6orf167 polypeptide. Preferably, the agent is a double-stranded molecule against C6orf167 gene or vector encoding the double-stranded molecule. Expression of the gene may be inhibited by introduction of a double-stranded molecule into the target cell in an amount sufficient to inhibit an expression of a C6orf167 gene. Thus, in a particularly preferred embodiment of the present invention, the method includes the step of administering to a subject a pharmaceutically effective amount of double-stranded molecule against a C6orf167 gene or a vector encoding such a molecule, such molecule inhibiting an expression of a C6orf167 gene as well as cell proliferation when introduced into a cell expression a C6orf167 gene. The agent that inhibits a function of a C6orf167 polypeptide may be a polypeptide comprising a C6orf167-binding domain of an NFKBIL2 polypeptide, lacking a function to control a subcellular localization of a C6orf167 polypeptide. Thus, in a preferred embodiment of the present invention, the method includes the step of administering to a subject a pharmaceutically effective amount of a polypeptide comprising a C6orf167-binding domain of an NFKBIL2 polypeptide and lacking a function to control a subcellular localization of a C6orf167 polypeptide.
  • It is yet a further object of the present invention to provide a pharmaceutical composition suitable for either or both of the treatment and prevention of a C6orf167-associated cancer that includes a pharmaceutically acceptable carrier and an active agent including one or more double-stranded molecules against a C6orf167 gene or a vector encoding such a molecule, or a polypeptide comprising a C6orf167-binding domain of an NFKBIL2 polypeptide and lacking a function to control a subcellular localization of a C6orf167 polypeptide. In the context of the present invention, a double-stranded molecule against C6orf167 is capable of inhibiting the expression of a C6orf167 gene as well as inhibiting the cell proliferation when introduced into a cell expressing a C6orf167 gene.
    The methods and materials of the present invention are capable of identifying cancer prior to detection of overt clinical symptoms thereof and may be used in the context of cancer therapy without adverse effect.
  • More specifically, the present invention provides the following [1] to [40]:
    [1] A method of detecting or diagnosing cancer or a predisposition for developing cancer in a subject, wherein the method comprises a step of determining an expression level of a C6orf167 gene in a subject-derived biological sample, wherein an increase of the level compared to a normal control level of the gene indicates the presence of cancer in the subject, or that the subject suffers from or is at risk of developing cancer, wherein the expression level is determined by any one of method selected from the group consisting of:
    (a) detecting an mRNA of a C6orf167 gene;
    (b) detecting a protein encoded by a C6orf167 gene; and
    (c) detecting a biological activity of a protein encoded by a C6orf167 gene;
    [2] The method of [1], wherein the increase is at least 10% greater than the normal control level;
    [3] The method of [1] or [2], wherein the subject-derived biological sample is a biopsy sample;
    [4] The method of any one of [1] to [3], wherein the cancer is lung cancer;
    [5] A kit for detecting or diagnosing cancer, wherein the kit comprises at least one reagent selected from the group consisting of:
    (a) a reagent for detecting an mRNA of a C6orf167 gene;
    (b) a reagent for detecting a protein encoded by a C6orf167 gene; and
    (c) a reagent for detecting a biological activity of a protein encoded by a C6orf167 gene;
    [6] The kit of [5], wherein the reagent comprises an oligonucleotide that hybridizes to the mRNA of the C6orf167 gene, or an antibody against the protein encoded by the C6orf167 gene;
    [7] A reagent for detecting or diagnosing cancer, wherein the reagent comprises an oligonucleotide that hybridizes to the mRNA of the C6orf167 gene, or an antibody against the protein encoded by the C6orf167 gene;
    [8] The kit of [5] or [6], or the reagent of [7], wherein the cancer is lung cancer;
    [9] A method of screening for a candidate substance for either or both of treating and preventing cancer, or inhibiting cancer cell growth, wherein the method comprises the steps of:
    (a) contacting a test substance with a C6orf167 polypeptide or a functional equivalent thereof;
    (b) detecting the binding activity between the polypeptide or the functional equivalent and the test substance; and
    (c) selecting the test substance that binds to the polypeptide or the functional equivalent as a candidate substance for either or both of treating and preventing cancer;
    [10] A method of screening for a candidate substance for either or both of treating and preventing cancer, or inhibiting cancer cell growth, wherein the method comprises the steps of:
    (a) contacting a test substance with a cell expressing a C6orf167 gene;
    (b) detecting an expression level of the C6orf167 gene in the cell of the step (a); and
    (c) selecting the test substance that reduces the expression level detected in the step (b) in comparison with the expression level of the C6orf167 gene detected in the absence of the test substance;
    [11] A method of screening for a candidate substance for either or both of treating and preventing cancer, or inhibiting cancer cell growth, wherein the method comprises the steps of:
    (a) contacting a test substance with a C6orf167 polypeptide or a functional equivalent thereof;
    (b) detecting a biological activity of the polypeptide or the functional equivalent of the step (a); and
    (c) selecting the test substance that suppresses the biological activity of the polypeptide or the functional equivalent detected in the step (b) in comparison with the biological activity detected in the absence of the test substance;
    [12] The method of [11], wherein the biological activity is a cell proliferation promoting activity, a binding activity to an NFKBIL2 polypeptide or nuclear localization activity.
    [13] A method of screening for a candidate substance for either or both of treating and preventing cancer, or inhibiting cancer cell growth, wherein the method comprises the steps of:
    a) contacting a test substance with a cell into which a vector comprising the transcriptional regulatory region of a C6orf167 gene and a reporter gene that is expressed under the control of the transcriptional regulatory region has been introduced,
    b) measuring the expression and/or activity levels of the reporter gene in the step (a); and
    c) selecting the test substance that reduces the expression and/or activity levels of said reporter gene detected in the step (b) in comparison with the expression and/or activity levels in the absence of the test substance;
    [14] A method of screening for a candidate substance for either or both of treating and preventing cancer, inhibiting cancer cell growth or the binding between a C6orf167 polypeptide and an NFKBIL2 polypeptide, wherein the method comprises the steps of:
    a) contacting a C6orf167 polypeptide or a functional equivalent thereof with an NFKBIL2 polypeptide or a functional equivalent thereof, in the presence of a test substance;
    b) detecting the binding between the polypeptides; and
    c) selecting the test substance that inhibits the binding between the polypeptides;
    [15] The method of [14], wherein the functional equivalent of the C6orf167 polypeptide comprises an NFKBIL2-binding domain of the C6orf167 polypeptide;
    [16] The method of [15], wherein the functional equivalent of the C6orf167 polypeptide comprises an amino acid sequence of 1 to 414 of SEQ ID NO: 18 or 20;
    [17] The method of any one of [14] to [16], wherein the functional equivalent of the NFKBIL2 polypeptide comprises a C6orf167-binding domain of the NFKBIL2 polypeptide;
    [18] The method of [17], wherein the functional equivalent of the NFKBIL2 polypeptide comprises an amino acid sequence of 932 to 1378 of SEQ ID NO: 22;
    [19] The method of any one of [9] to [18], wherein the cancer is lung cancer;
    [20] A double-stranded molecule comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence corresponding to a target sequence selected from the group consisting of a nucleotide sequences of 3444 to 3462 of SEQ ID NO: 17 or 19, and 3671 to 3689 of SEQ ID NO: 17 or 19, and the antisense strand comprises a nucleotide sequence complementary to the target sequence, wherein the strands hybridize to each other at the target sequence to form the double-stranded molecule, and wherein the double-stranded molecule, when introduced into a cell expressing a C6orf167 gene, inhibits an expression of the C6orf167 gene as well as cell proliferation;
    [21] The double-stranded molecule of [20], wherein the sense strand hybridizes with antisense strand at the target sequence to form the double-stranded molecule having between 19 and 25 nucleotide pairs in length;
    [22] The double-stranded molecule of [20] or [21], wherein the double-stranded molecule has one or two 3' overhangs at the 3' ends of the sense strand and/or the antisense strand;
    [23] The double-stranded molecule of any one of [20] to [22], wherein the double-stranded molecule is a single polynucleotide comprising the sense strand and the antisense strand linked via a single-stranded nucleotide sequence;
    [24] The double-stranded molecule of [23], wherein said polynucleotide has the general formula 5'-[A]-[B]-[A']-3' or 5'-[A']-[B]-[A]-3', wherein [A] is a sense strand comprising a nucleotide sequence corresponding to a target sequence selected from the group consisting of nucleotide sequences of 3444 to 3462 of SEQ ID NO: 17 or 19, and 3671 to 3689 of SEQ ID NO: 17 or 19; [B] is a nucleotide sequence consisting of about 3 to about 23 nucleotides; and [A'] is an antisense strand comprising a nucleotide sequence complementary to the target sequence;
    [25] A vector encoding the double-stranded molecule of any one of [20] to [24] ;
    [26] A method of either or both of treating and preventing cancer in a subject, wherein the method comprises the step of administering to the subject a pharmaceutically effective amount of a double-stranded molecule against a C6orf167 gene or a vector encoding thereof, wherein the double-stranded molecule, when introduced into a cell expressing the C6orf167 gene, inhibits an expression of the C6orf167 gene as well as cell proliferation;
    [27] The method of [26], wherein the double-stranded molecule is that of any one of [20] to [24];
    [28] The method of [26], wherein the vector is that of [25];
    [29] A composition for either or both of treating and preventing cancer, wherein the composition comprises a pharmaceutically effective amount of a double-stranded molecule against a C6orf167 gene or a vector encoding thereof, and a pharmaceutically acceptable carrier, wherein the double-stranded molecule, when introduced into a cell expressing the C6orf167 gene, inhibits an expression of the C6orf167 gene as well as cell proliferation;
    [30] The composition of [29], wherein the double-stranded molecule is that of any one of [20] to [24];
    [31] The composition of [29], wherein the vector is that of [25];
    [32] A polypeptide comprising a C6orf167-binding domain of an NFKBIL2 polypeptide, wherein the polypeptide lacks a biological function of the NFKBIL2 polypeptide, and wherein the biological function is a function to control a subcellular localization of a C6orf167 polypeptide;
    [33] The polypeptide of [32], wherein the polypeptide is selected from the group consisting of:
    a) a polypeptide comprising an amino acid sequence of SEQ ID NO: 24;
    b) a polypeptide that comprises an amino acid sequence of SEQ ID NO: 24 in which one or more amino acids are substituted, deleted, inserted, and/or added; and
    c) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 23;
    [34] The polypeptide of [32] or [33], which is modified with a cell-membrane permeable substance;
    [35] A polynucleotide encoding the polypeptide of [32] or [33];
    [36] A vector encoding the polypeptide of [32] or [33];
    [37] A method of either or both of treating and preventing cancer in a subject, wherein the method comprises the step of administering to the subject a pharmaceutically effective amount of the polypeptide of any one of [32] to [34] or the vector of [36];
    [38] A composition for either or both of treating and preventing cancer, wherein the composition comprises a pharmaceutically effective amount of the polypeptide of any one of [32] to [34] or the vector of [36];
    [39] The method of [26], [27], [28], or [37], wherein the cancer to be treated is lung cancer; and
    [40] The composition of [29], [30], [31], or [38], wherein the cancer to be treated is lung cancer.
  • It will be understood by those skilled in the art that one or more aspects of this invention can meet certain objectives, while one or more other aspects can meet certain other objectives. Each objective may not apply equally, in all its respects, to every aspect of this invention. As such, the preceding objects can be viewed in the alternative with respect to any one aspect of this invention.
    It will also be understood that both the foregoing summary of the present invention and the following detailed description are of exemplified embodiments, and not restrictive of the present invention or other alternate embodiments of the present invention. Other objects and features of the invention will become more fully apparent when the following detailed description is read in conjunction with the accompanying figures and examples. In particular, while the invention is described herein with reference to a number of specific embodiments, it will be appreciated that the description is illustrative of the invention and is not constructed as limiting of the invention. Various modifications and applications may occur to those who are skilled in the art, without departing from the spirit and the scope of the invention, as described by the appended claims. Likewise, other objects, features, benefits and advantages of the present invention will be apparent from this summary and certain embodiments described below, and will be readily apparent to those skilled in the art. Such objects, features, benefits and advantages will be apparent from the above in conjunction with the accompanying examples, data, figures and all reasonable inferences to be drawn therefrom, alone or with consideration of the references incorporated herein.
  • Various aspects and applications of the present invention will become apparent to the skilled artisan upon consideration of the brief description of the figures and the detailed description of the present invention and its preferred embodiments that follows:
    Figure 1 demonstrates the expression of C6orf167 gene in lung and esophageal tumors and normal tissues. Part A depicts the results of semi quantitative RT-PCR validating the over-expression of C6orf167 gene in lung cancer tissues as compared to normal lung tissues. Part B depicts the results of semiquantitative RT-PCR validating the expression of C6orf167 gene in lung cancer cell lines. Part C depicts the results of Western blot analysis validating the expression of C6orf167 protein in lung cancer cell lines and esophageal cancer cell line. Part D depicts the results of Northern blot analysis of the C6orf167 transcript in various normal human tissues.
  • Figure 2 demonstrates growth promoting effect of C6orf167 Part A depicts the results of semiquantitative RT-PCR analysis and Western blot analysis confirming the knockdown effect on C6orf167 expression in A549 and LC319 lung cancer cells in response to specific oligonucleotide siRNAs for C6orf167 (si-#1 and si-#2) or control siRNAs (si-LUC and si-CNT). Part B depicts the results of MTT assays of A549 and LC319 cells transfected with the siRNAs. All assays were performed three independent times, and in triplicate wells. Part C depicts the results of colony formation assays of A549 and LC319 cells transfected with the siRNAs. Part D depicts the results of Western blot analysis and MTT assays confirming the expression of C6orf167 protein and the enhanced growth promoting activity in COS-7 and HEK293 cells transfected with C6orf167 expressing vectors.
  • Figure 3 demonstrates that NFKBIL2 controls the nucleus localization of C6orf167 protein in cultured cell. Part A depicts the results of IP-MS analysis for identification of C6orf167-interacting protein. Exogenous C6orf167 protein was immunoprecipitated using Flag Agarose and detected by WB and Colloidal CBB staining. Part B depicts the results of IP-WB analysis using Flag and/or HA-Agarose confirming that C6orf167 protein interacts with NFKBIL2 protein. Part C depicts subcellular localization of endogenous C6orf167 and NFKBIL2 proteins in HeLa cells. The cells were stained with a rabbit polyclonal anti-C6orf167 antibody; mouse polyclonal anti-NFKBIL2 and nucleus with DAPI. Part D depicts subcellular localization of exogenous C6orf167 and NFKBIL2 proteins in COS-7 cells. The cells were transfected with C6orf167 expressing vector (upper panels) or co-transfected with C6orf167 and NFKBIL2 expressing vectors (lower panels) and fixed with 4%Paraholmaldehide after 48h. C6orf167 protein was stained with a monoclonal anti-Flag M2 antibody; NFKBIL2 was stained with mouse monoclonal anti-HA and nucleus with DAPI. Part E depicts the localization of C6orf167 protein in cytoplasm and nucleus fractions of COS-7 cells co-transfected with C6orf167 and NFKBIL2 expressing vectors. C6orf167 and NFKBIL2 proteins was detected using anti-mouse Flag-M2 monoclonal antibody and/or monoclonal anti-rat HA (3F10) antibody. Part F depicts knockdown of C6orf167 or NFKBIL2 protein expression with si-C6orf167 or si-NFKBIL2 oligonucleotides. The expression of endogenous C6orf167 and NFKBIL2 proteins were detected by western blotting using anti-C6orf167 antibody and anti-NFKBIL2 antibody.
  • Figure 4 demonstrates dominant negative effect of partial protein NFKBIL2 in lung cancer cell lines. Part A depicts the design of partial proteins of C6orf167 and NFKBIL2 proteins. Part B depicts the result of IP-WB analysis in cells co-transfected with full length C6orf167 and/or NFKBIL2 proteins with each partial proteins. Binding region between C6orf167 and NFKBIL2 proteins were identified using Flag/HA-Agarose. Part C depicts the subcellular localization of full length exogenous C6orf167 and each partial NFKBIL2 proteins in COS-7 cells. The cells were co-transfected with full length C6orf167 and partial NFKBIL2 expressing vectors and fixed with 4% Paraformaldehide after 48h. C6orf167 protein was stained with a monoclonal anti-Flag M2 antibody; NFKBIL2 was stained with mouse monoclonal anti-HA and nucleus with DAPI. Part D depicts localization of endogenous C6orf167 protein in HeLa cells transfected with partial NFKBIL2 expressing vectors. Endogenous C6orf167 protein was detected using rabbit polyclonal anti-C6orf167 antibody. Partial NFKBIL2 proteins were detected with monoclonal anti-rat HA (3F10) antibody. Part E depicts dominant negative effect of partial NFKBIL2 proteins on high C6orf167 expression HeLa and LC319 cells. Dominant negative effect was detected in high C6orf167 expression HeLa and LC319 cells transfected with partial NFKBIL2 proteins quantifying by MTT and colony formation assays at 7 days after transfection.
  • Figure 5 demonstrates dominant negative growth suppressive effect of partial NFKBIL2 protein on cancer cells. Part A depicts HEK293 cells which were co-transfected with C6orf167- and full-length/three partial NFKBIL2-expression vectors (N1, N2, and N3). Immunoprecipitation assays were performed using Flag-M2 agarose. Part B depicts the expression of C6orf167 protein in HeLa, LC319, and CCDlu-19 cell lines. Part C depicts MTT assay using C6orf167-positive HeLa and LC319 cells, and C6orf167-negative CCDlu-19 cells, which were transfected with mock plasmids or either of three partial NFKBIL2-expression vectors (N1, N2, and N3), as quantified by MTT assay at 7 days after transfection.
  • Figure 6 demonstrates the involvement of C6orf167 as an upstream molecule of NFKB pathway. Part A depicts the results of Western blotting using antibodies to endogenous C6orf167 and RelA/p65, and HeLa and LC319 cells transfected with siRNA oligonucleotides for C6orf167 (si-C6orf167) or control siRNA (si-LUC). These cell lines were stimulated with 50 ng/ml TNF-alpha for 15 min. The nuclear and cytoplasmic fraction was isolated using NE-PER(registered trademark) Nuclear and Cytoplasmic Extraction Reagents kit (Thermo). Part B depicts the results of Western blotting using antibodies to endogenous C6orf167, RelA/p65, Bcl-XL and TRAF1 and HeLa cells transfected with si-C6orf167 or si-LUC. These cell lines were treated with 50 ng/ml TNF-alpha for 15, 30, 60, or 120 min. N.T. indicates no treatment with TNF-alpha. Part C depicts the results of Western blotting using antibodies to endogenous C6orf167, RelA/p65, Bcl-XL, ATM, CSB, p53 and HeLa cells which were transfected with si-C6orf167 or si-LUC oligonucleotides, and were subsequently treated with cisplatin (CDDP; 50 or 100 micro g/mL). Part D depicts schematic summary of C6orf167 pathway.
  • Figure 7 demonstrates the expression of C6orf167 and its interacting protein NFKBIL2 and downstream proteins in cancer samples. Part A depicts the expression of C6orf167 gene in lung and esophageal cancer tissues (T) and adjacent normal (N) lung and esophagus tissues, detected by semiquantitative RT-PCR. Part B depicts the expression pattern of C6orf167 protein and its interacting/downstream proteins detected by western blotting using antibodies to C6orf167, NFKBIL2, RelA/p65, Bcl-XL, and TRAF1.
  • Figure 8 demonstrates that NFKBIL2 stabilizes C6orf167 protein in cultured cells. Immunocytochemical analysis using LC319 cells which were transfected with si-LUC (control) or si-NFKBIL2 oligonucleotides. The cells were stained with anti-C6orf167 antibody, anti-NFKBIL2, and DAPI.
  • Figure 9 demonstrates the suppression of cancer cell growth and/or survival using siRNAs against NFKBIL2. Part A depicts knockdown of NFKBIL2 expression in lung cancer cell lines, LC319 and A549 by specific siRNA oligonucleotides for NFKBIL2 (si-#1 and si-#2) or control siRNAs (si-EGFP and si-LUC), confirmed by western blotting. Part B depicts viability of LC319 and A549 cells evaluated by MTT assay in response to the siRNAs. All assays were performed in triplicate wells at three independent times. Part C depicts colony formation assays using LC319 and A549 cells transfected with the siRNAs.
  • Figure 10 demonstrates that C-terminal portion of NFKIL2 protein is crucial for binding to C6orf167 protein. Part A depicts the design of vectors expressing partial proteins of C6orf167 and NFKBIL2. Part B depicts binding between C6orf167 and NFKBIL2 proteins detected using Flag- or HA-agarose and COS-7 cells co-transfected with full-length/partial C6orf167-Flag and full-length/partial NFKBIL2-HA proteins. Part C depicts subcellular localization of full-length C6orf167 and three partial NFKBIL2 proteins. COS-7 cells were co-transfected with full-length C6orf167 and partial NFKBIL2-expression vectors (N1-N3). C6orf167 protein was stained with anti-Flag M2 antibody; NFKBIL2 with anti-HA antibody, and nucleus with DAPI.
  • Figure 11 demonstrates elevated expression of endogenous RelA/p65 protein in cancer cells expressing exogenous C6orf167 and/or NFKBIL2. Western blotting was performed using HeLa cells transfected with Flag-tagged C6orf167 and/or HA-tagged NFKIBL2-expression vector. Exogenous C6orf167 and NFKBIL2 proteins were detected using anti-Fag-M2 antibody and/or anti-HA (3F10) antibody. Endogenous NFKB subunit of RelA/p65 was detected using anti-RelA/p65 antibody (F-6, Santa Cruz sc-8008).
  • Figure 12 demonstrates increased levels of RelA/p65 protein in the nucleus of the cells under TNF-alpha stimulation. HeLa cells were treated with 50 ng/ml TNF-alpha for 15 min. The cells were divided into cytoplasmic and nuclear fractions using NE-PER(registered trademark) Nuclear and Cytoplasmic Extraction Reagents kit (Thermo). Western blotting was performed using antibodies to C6orf167 and RelA/p65.
  • Figure 13 demonstrates increased sub G1 population of the cancer cells which were transfected with si-C6orf167 under DNA damage condition. Part A depicts cell-cycle distribution in HeLa cells transfected with si-Corf167 and treated with DNA-damaging agent. After knockdown of C6orf167 expression with si-C6orf167 in HeLa cells, the cells were treated with cisplatin (CDDP; 50 micro-g/mL) or 5-FU (50 micro-g/mL) for 48 hours and harvested for flow cytometric analysis. N.T. indicates no treatment with CDDP or 5-FU. Part B depicts cell-cycle distribution in HeLa cells transfected with si-Corf167 and treated with DNA-damaging agent. After knockdown of C6orf167 expression with si-C6orf167 in HeLa cells, the cells were treated with cisplatin (CDDP; 50 micro-g/mL) or 5-FU (50 micro-g/mL) for 48 hours and harvested for flow cytometric analysis. N.T. indicates no treatment with CDDP or 5-FU.
  • Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present invention, the typical methods, devices, and materials are now described. However, before the present materials and methods are described, it is to be understood that the present invention is not limited to the particular sizes, shapes, dimensions, materials, methodologies, protocols, etc. described herein, as these may vary in accordance with routine experimentation and optimization. It is also to be understood that the terminology used in the description is for the purpose of describing the particular versions or embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims.
  • The disclosure of each publication, patent or patent application mentioned in this specification is specifically incorporated by reference herein in its entirety. However, nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.
    In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
  • Definition:
    The words "a", "an", and "the" as used herein mean "at least one" unless otherwise specifically indicated.
    The terms "isolated" and "purified" when used herein in relation to a substance (e.g., polypeptide, antibody, polynucleotide, etc.) indicate that the substance is substantially free from at least one substance that may else be included in the natural source. Thus, an isolated or purified polypeptide refers to a polypeptide that is substantially free of cellular material such as carbohydrate, lipid, or other contaminating proteins from the cell or tissue source from which the polypeptide is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized. The term "substantially free of cellular material" includes preparations of a polypeptide in which the polypeptide is separated from cellular components of the cells from which it is isolated or recombinantly produced. Thus, a polypeptide that is substantially free of cellular material includes preparations of polypeptide having less than about 30%, 20%, 10%, or 5% (by dry weight) of heterologous protein (also referred to herein as a "contaminating protein"). When the polypeptide is recombinantly produced, it is also preferably substantially free of culture medium, which includes preparations of polypeptide with culture medium less than about 20%, 10%, or 5% of the volume of the protein preparation. When the polypeptide is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, which includes preparations of polypeptide with chemical precursors or other chemicals involved in the synthesis of the protein less than about 30%, 20%, 10%, 5% (by dry weight) of the volume of the protein preparation. That a particular protein preparation contains an isolated or purified polypeptide can be shown, for example, by the appearance of a single band following sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis of the protein preparation and Coomassie Brilliant Blue staining or the like of the gel. In a preferred embodiment, polypeptides to be used in the present invention and the polypeptide of the present invention are isolated or purified.
  • An "isolated" or "purified" nucleic acid molecule, such as a cDNA molecule and double-stranded molecule (e.g., siRNA), can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
    The terms "polypeptide", "peptide", and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is a modified residue, or a non-naturally occurring residue, such as an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.
  • The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that similarly functions to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those modified after translation in cells (e.g., hydroxyproline, gamma-carboxyglutamate, and O-phosphoserine). The phrase "amino acid analog" refers to compounds that have the same basic chemical structure (an alpha carbon bound to a hydrogen, a carboxy group, an amino group, and an R group) as a naturally occurring amino acid but have a modified R group or modified backbones (e.g., homoserine, norleucine, methionine, sulfoxide, methionine methyl sulfonium). The phrase "amino acid mimetic" refers to chemical compounds that have different structures but similar functions to general amino acids.
    Amino acids may be referred to herein by their commonly known three letter symbols or the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
  • As used herein, the phrase "biological sample" refers to a whole organism or a subset of its tissues, cells or component parts (e.g., body fluids, including but not limited to blood, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, amniotic fluid, amniotic cord blood, urine, vaginal fluid and semen). The phrase "biological sample" further refers to a homogenate, lysate, extract, cell culture or tissue culture prepared from a whole organism or a subset of its cells, tissues or component parts, or a fraction or portion thereof. Lastly, the phrase "biological sample" refers to a medium, such as a nutrient broth or gel in which an organism has been propagated, which contains cellular components, such as proteins or polynucleotides.
  • The terms "gene", "polynucleotide", "oligonucleotide", "nucleic acid", and "nucleic acid molecule" are used interchangeably unless otherwise specifically indicated and, similarly to the amino acids, are referred to by their commonly accepted single-letter codes. Similar to the amino acids, they encompass both naturally-occurring and non-naturally occurring nucleic acid polymers. The polynucleotide, oligonucleotide, nucleic acids, or nucleic acid molecule may be composed of DNA, RNA or a combination thereof.
    Unless otherwise defined, the term "cancer" refers to cancer over-expressing the C6orf167 gene. Examples of cancers over-expressing C6orf167 gene include, but are not limited to, lung cancers including SCLC and NSCLC. NSCLC includes, but are not limited to, adenocarcinoma (ADC) and squamous-cell carcinoma (SCC).
  • As used herein, the term "double-stranded molecule" refers to a nucleic acid molecule that inhibits expression of a target gene, including, for example, short interfering RNA (siRNA; e.g., double-stranded ribonucleic acid (dsRNA) or small hairpin RNA (shRNA)) and short interfering DNA/RNA (siD/R-NA; e.g., double-stranded chimera of DNA and RNA (dsD/R-NA) or small hairpin chimera of DNA and RNA (shD/R-NA)). Herein, "double-stranded molecule" is also referred to as "double-stranded nucleic acid", "double-stranded nucleic acid molecule", "double-stranded polynucleotide" and "double-stranded polynucleotide molecule".
  • In the context of the present invention, the term "composition" is used to refer to a product including that include the specified ingredients in the specified amounts, as well as any product that results, directly or indirectly, from combination of the specified ingredients in the specified amounts. Such terms, when used in relation to the modifier "pharmaceutical" (as in "pharmaceutical composition"), are intended to encompass products including a product that includes the active ingredient(s), and any inert ingredient(s) that make up the carrier, as well as any product that results, directly or indirectly, from combination, complexation or aggregation of any two or more of the ingredients, or from dissociation of one or more of the ingredients, or from other types of reactions or interactions of one or more of the ingredients. Accordingly, in the context of the present invention, the term "pharmaceutical composition" refers to any product made by admixing a molecule or compound of the present invention and a pharmaceutically or physiologically acceptable carrier.
  • The phrase "pharmaceutically acceptable carrier" or "physiologically acceptable carrier", as used herein, means a pharmaceutically or physiologically acceptable material, composition, substance or vehicle, including but not limited to, a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the active ingredient from one organ, or portion of the body, to another organ, or portion of the body.
  • The term "active ingredient" herein refers to a substance in composition that is biologically or physiologically active. Particularly, in the context of pharmaceutical composition, the term "active ingredient" refers to a substance that shows an objective pharmacological effect. For example, in case of pharmaceutical compositions for use in the treatment or prevention of cancer, active ingredients in the compositions may lead to at least one biological or physiologically action on cancer cells and/or tissues directly or indirectly. Preferably, such action may include reducing or inhibiting cancer cell growth, damaging or killing cancer cells and/or tissues, and so on. Before being formulated, the "active ingredient" may also be referred to as "bulk", "drug substance" or "technical product".
  • Genes and Polypeptides:
    The present invention is based in part on the discovery that the gene encoding C6orf167 is over-expressed in cancer as compared to non-cancerous tissue.
    Nucleotide sequences of C6orf167 and NFKBIL2 polynucleotides and amino acid sequences of C6orf167 and NFKBIL2 polypeptides are known to those skilled in the art, and obtained, for example, from gene databases on the web site such as GenBankTM. Exemplified nucleotide sequences of C6orf167 polynucleotide are shown in SEQ ID NO: 17 and 19, and exemplified amino acid sequences of C6orf167 polypeptide is shown in SEQ ID NO: 18 and 20. The sequence data are also available, for example, via GenBank accession No. NM_198468 or No. NP_940870. Also, an exemplified nucleotide sequence of NFKBIL2 polynucleotide are shown in SEQ ID NO: 21, and an exemplified amino acid sequence of NFKBIL2 polypeptide is shown in SEQ ID NO: 22. The sequence data are also available, for example, via GenBank accession No. NM_013432 or No. NP_038460. One of skill will recognize that C6orf167 sequences or NFKBIL2 sequences need not be limited to these sequences and that variants (e.g., functional equivalents and allelic variants) can be used in the present invention as described below.
  • According to an aspect of the present invention, functional equivalents are also considered to be "C6orf167 polypeptides" or "NFKBIL2 polypeptides". Herein, a "functional equivalent" of a protein (e.g., a C6orf167 polypeptide or an NFKBIL2 polypeptide) is a polypeptide that has a biological activity equivalent to the protein. Namely, any polypeptide that retains the biological ability of the C6orf167 protein or NFKBIL2 protein may be used as such a functional equivalent in the present invention. Such functional equivalents include those wherein one or more amino acids are substituted, deleted, added, or inserted to the natural occurring amino acid sequence of the C6orf167 protein or NFKBIL2 protein. Alternatively, the polypeptide may be composed an amino acid sequence having at least about 80% homology (also referred to as sequence identity) to the sequence of the respective protein, more preferably at least about 90% to 95% homology, often about 96%, 97%, 98% or 99% homology.
  • A polypeptide to be used in the present invention may have variations in amino acid sequence, molecular weight, isoelectric point, the presence or absence of sugar chains, or form, depending on the cell or host used to produce it or the purification method utilized. Nevertheless, so long as it has a function equivalent to that of the human C6orf167 protein or NFKBIL2 protein, it is within the scope of the present invention.
  • In other embodiments, the polypeptide can be encoded by a polynucleotide that hybridizes under stringent conditions to the natural occurring nucleotide sequence of the C6orf167 gene or NFKBIL2 gene.
    The phrase "stringent (hybridization) conditions" refers to conditions under which a nucleic acid molecule will hybridize to its target sequence, typically in a complex mixture of nucleic acids, but not detectably to other sequences. Stringent conditions are sequence-dependent and will vary in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays" (1993). Generally, stringent conditions are selected to be about 5-10 degrees C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least two times of background, preferably 10 times of background hybridization. Exemplary stringent hybridization conditions include the following: 50% formamide, 5x SSC, and 1% SDS, incubating at 42 degrees C, or, 5x SSC, 1% SDS, incubating at 65 degrees C, with wash in 0.2x SSC, and 0.1% SDS at 50 degrees C.
  • In the context of the present invention, a condition of hybridization for isolating a DNA encoding a polypeptide functionally equivalent to the human C6orf167 protein or NFKBIL2 protein can be routinely selected by a person skilled in the art. For example, hybridization may be performed by conducting pre-hybridization at 68 degrees C for 30 min or longer using "Rapid-hyb buffer" (Amersham LIFE SCIENCE), adding a labeled probe, and warming at 68 degrees C for 1 hour or longer. The following washing step can be conducted, for example, in a low stringent condition. An exemplary low stringent condition may include 42 degrees C, 2x SSC, 0.1% SDS, preferably 50 degrees C, 2x SSC, 0.1% SDS. High stringency conditions are often preferably used. An exemplary high stringency condition may include washing 3 times in 2x SSC, 0.01% SDS at room temperature for 20 min, then washing 3 times in 1x SSC, 0.1% SDS at 37 degrees C for 20 min, and washing twice in 1x SSC, 0.1% SDS at 50 degrees C for 20 min. However, several factors, such as temperature and salt concentration, can influence the stringency of hybridization and one skilled in the art can suitably select the factors to achieve the requisite stringency.
  • In general, modifications of one, two or more amino acids in a protein will not influence the function of the protein. In fact, mutated or modified proteins (i.e., peptides composed of an amino acid sequence in which one, two, or several amino acid residues have been modified through substitution, deletion, insertion and/or addition)have been known to retain the original biological activity (Mark et al., Proc Natl Acad Sci USA 81: 5662-6 (1984); Zoller and Smith, Nucleic Acids Res 10:6487-500 (1982); Dalbadie-McFarland et al., Proc Natl Acad Sci USA 79: 6409-13 (1982)). Accordingly, one of skill in the art will recognize that individual additions, deletions, insertions, or substitutions to an amino acid sequence which alter a single amino acid or a small percentage of amino acids or those considered to be a "conservative modifications", wherein the alteration of a protein results in a protein with similar functions, are acceptable in the context of the instant invention. Thus, in one embodiment, the peptides of the present invention may have an amino acid sequence wherein one, two or even more amino acids are added, inserted, deleted, and/or substituted in the C6orf167 or NFKBIL2 sequence.
  • So long as the activity of the protein is maintained, the number of amino acid mutations is not particularly limited. However, it is generally preferred to alter 5% or less of the amino acid sequence. Accordingly, in a typical embodiment, the number of amino acids to be mutated in such a mutant is generally 30 amino acids or fewer, preferably 20 amino acids or fewer, more preferably 10 amino acids or fewer, more preferably 5 or 6 amino acids or fewer, and even more preferably 3 or 4 amino acids or fewer.
  • An amino acid residue to be mutated is preferably mutated into a different amino acid in which the properties of the amino acid side-chain are conserved (a process known as conservative amino acid substitution). Examples of properties of amino acid side chains are hydrophobic amino acids (A, I, L, M, F, P, W, Y, V), hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, T), and side chains having the following functional groups or characteristics in common: an aliphatic side-chain (G, A, V, L, I, P); a hydroxyl group containing side-chain (S, T, Y); a sulfur atom containing side-chain (C, M); a carboxylic acid and amide containing side-chain (D, N, E, Q); a base containing side-chain (R, K, H); and an aromatic containing side-chain (H, F, Y, W). Conservative substitution tables providing functionally similar amino acids are well known in the art. For example, the following eight groups each contain amino acids that are conservative substitutions for one another:
    1) Alanine (A), Glycine (G);
    2) Aspartic acid (D), Glutamic acid (E);
    3) Asparagine (N), Glutamine (Q);
    4) Arginine (R), Lysine (K);
    5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V);
    6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W);
    7) Serine (S), Threonine (T); and
    8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins 1984).
  • Such conservatively modified polypeptides are included in the C6orf167 protein or NFKBIL2 protein. However, the present invention is not restricted thereto and the C6orf167 protein or NFKBIL2 protein includes non-conservative modifications, so long as at least one biological activity of the C6orf167 protein or NFKBIL2 protein is retained. Furthermore, the modified proteins do not exclude polymorphic variants, interspecies homologues, and those encoded by alleles of these proteins.
  • Moreover, the C6orf167gene or NFKBIL2 gene encompasses polynucleotides that encode such functional equivalents of the C6orf167 protein or NFKBIL2 protein. In addition to hybridization, a gene amplification method, for example, the polymerase chain reaction (PCR) method, can be utilized to isolate a polynucleotide encoding a polypeptide functionally equivalent to the C6orf167 protein or NFKBIL2 protein, using a primer synthesized based on the sequence information of the DNAs encoding those proteins. Polynucleotides and polypeptides that are functionally equivalent to the human C6orf167gene or NFKBIL2 gene and protein, respectively, normally have a high homology to the originating nucleotide or amino acid sequence thereof . "High homology" typically refers to a homology of 40% or higher, preferably 60% or higher, more preferably 80% or higher, even more preferably 90% to 95% or higher, even more preferably 96%, 97%, 98%, 99% or higher. The homology of a particular polynucleotide or polypeptide can be determined by following the algorithm in "Wilbur and Lipman, Proc Natl Acad Sci USA 80: 726-30 (1983)".
  • A method for Diagnosing Cancer:
    The expression of C6orf167 gene was found to be specifically elevated in lung cancer (Figs. 1A-C, Fig. 7). Northern-blot analysis showed that C6orf167 was not expressed in normal tissues, except testis (Fig. 1D). Accordingly, the C6orf167 gene identified herein as well as its transcription and translation products find diagnostic utility as a marker for cancers such as lung cancer, and by measuring the expression of C6orf167 in a subject-derived biological sample. Cancer can be diagnosed or detected by comparing the expression level of C6orf167 gene between a subject-derived sample with a normal sample. More particularly, the present invention provides a method for detecting, diagnosing and/or determining the presence of or a predisposition for developing cancer, more particularly C6orf167-associated cancer such as lung cancer, by determining the expression level of C6orf167 gene in the subject.
  • Accordingly, the present invention provides a method for detecting or diagnosing cancer in a subject, such method including the step of determining an expression level of a C6orf167 gene in a subject-derived biological sample, wherein an increase of the level as compared to a normal control level of the gene indicates the presence or suspicion of cancer cells in the sample, which, in turn, suggests that the subject suffers from or is at risk of developing cancer.
    The expression level of the C6orf167 gene may be determined by any known method, examples of which include:
    (a) detecting an mRNA of a C6orf167 gene;
    (b) detecting a protein encoded by a C6orf167 gene; and
    (c) detecting a biological activity of a protein encoded by a C6orf167 gene.
    In the typical embodiment, cancers to be diagnosed by the present method are lung cancers, including NSCLCs and SCLCs. NSCLCs include, but are not limited to, lung adenocarcinoma (ADC) and lung squamous cell carcinoma (SCC).
    According to the present invention, an intermediate result for examining the condition of a subject may be provided. Such intermediate result may be combined with additional information to assist a doctor, nurse, or other practitioner to diagnose that a subject suffers from the disease. Thus, the present invention contemplates the use of C6orf167 as a diagnostic marker for cancer.
  • Alternatively, the present invention may be used to detect or identify cancerous cells in a subject-derived tissue, such cells being characterized by an increase in said expression level as compared to a normal control level of said gene indicates the presence or suspicion of cancer cells in the tissue. C6orf167 expression results may be combined with additional information to assist a doctor, nurse, or other healthcare practitioner in diagnosing a subject as afflicted with the disease. In other words, the present invention may provide a doctor with useful information to diagnose a subject as afflicted with the disease. For example, according to the present invention, when there is doubt regarding the presence of cancer cells in the tissue obtained from a subject, clinical decisions can be reached by considering the expression level of the C6orf167 gene, plus a different aspect of the disease including tissue pathology, levels of known tumor marker(s) in blood, and clinical course of the subject, etc. For example, some well-known diagnostic lung tumor markers in blood are IAP, ACT, BFP, CA19-9, CA50, CA72-4, CA130, CEA, KMO-1, NSE, SCC, SP1, Span-1, TPA, CSLEX, SLX, STN and CYFRA. Namely, in this particular embodiment of the present invention, the outcome of the gene expression analysis serves as an intermediate result for further diagnosis of a subject's disease state.
  • Of particular interest to the present invention are the following methods [1] to [11]:
    [1] A method of detecting or diagnosing cancer or a predisposition for developing cancer in a subject, including determining an expression level of C6orf167 gene in a subject-derived biological sample, wherein an increase of the level compared to a normal control level of the gene indicates that the presence of cancer in the subject, or the subject suffers from or is at risk of developing cancer;
    [2] The method of [1], wherein the increase is at least 10% greater than the normal control level;
    [3] The method of [1] or [2], wherein the expression level is detected by a method selected from among:
    (a) detecting an mRNA of a C6orf167 gene,
    (b) detecting a protein encoded by a C6orf167 gene, and
    (c) detecting a biological activity of a protein encoded by a C6orf167 gene;
    [4] The method of [3], wherein the expression level is determined by detecting hybridization of a probe to the mRNA of the C6orf167 gene;
    [5] The method of [3], wherein the expression level is determined by detecting the binding of an antibody against the protein encoded by the C6orf167 gene;
    [6] The method of any one of [1] to [5], wherein the cancer is lung cancer;
    [7] The method of any one of [1] to [6], wherein the biological sample includes a biopsy sample, sputum or blood;
    [8] The method of any one of [1] to [7], wherein the subject-derived biological sample includes an epithelial cell;
    [9] The method of any one of [1] to [8], wherein the subject-derived biological sample includes a cancer cell;
    [10] The method of any one of [1] to [9], wherein the subject-derived biological sample includes a cancerous epithelial cell; and
    [11] The method of any one of [1] to [10], wherein the subject-derived biological sample includes a lung tissue or lung cells.
  • The method of diagnosing cancer of the present invention is described in more detail below.
    A subject to be diagnosed by the present method is preferably a mammal. Exemplary mammals include, but are not limited to, e.g., human, non-human primate, mouse, rat, dog, cat, horse, and cow.
    It is preferred to collect a biological sample from the subject to be diagnosed to perform the diagnosis. Any biological material can be used as a biological sample for the determination so long as it includes a transcription or translation product of C6orf167 gene. The biological samples include, but are not limited to, bodily tissues which are desired for diagnosing or are suspicion of suffering from cancer, and fluids, such as biopsy sample, blood, sputum and urine. Preferably, the biological sample contains a cell population including an epithelial cell, more preferably a cancerous epithelial cell or an epithelial cell derived from tissue suspected to be cancerous. Further, if necessary, the cell may be purified from the obtained bodily tissues or fluids, and then used as the biological sample. In a typical embodiment, a biological sample may include lung cells or a lung tissue obtained from a subject to be diagnosed.
  • According to the present invention, the expression level of C6orf167 gene in a subject-derived biological sample is determined. The expression level can be determined at the transcription product (mRNA) level, using methods known in the art. For example, the mRNA of C6orf167 gene may be quantified using probes by hybridization methods (e.g., Northern hybridization). The detection may be carried out on a chip or an array. The use of an array is preferable for detecting the expression level of a plurality of genes (e.g., various cancer specific genes) including C6orf167 gene. Those skilled in the art can prepare such probes utilizing the sequence information of C6orf167 gene. For example, the cDNA of C6orf167 may be used as the probes. If necessary, the probe may be labeled with a suitable label, such as dyes, fluorescent and isotopes, and the expression level of the gene may be detected as the intensity of the hybridized labels.
  • Furthermore, the transcription product of C6orf167 gene may be quantified using primers by amplification-based detection methods (e.g., RT-PCR). Such primers can also be prepared based on the available sequence information of the gene. For example, the primers used in the Example (SEQ ID NO: 3 to 6) may be employed for the detection by RT-PCR or Northern blot, but the present invention is not restricted thereto.
  • Specifically, a probe or primer used for the present method hybridizes under stringent, moderately stringent, or low stringent conditions to the mRNA of C6orf167 gene. As used herein, the phrase "stringent (hybridization) conditions" refers to conditions under which a probe or primer will hybridize to its target sequence, but to no other sequences. Stringent conditions are sequence-dependent and will be different under different circumstances. Specific hybridization of longer sequences is observed at higher temperatures than shorter sequences. Generally, the temperature of a stringent condition is selected to be about 5 degreed C lower than the thermal melting point (Tm) for a specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target sequence hybridize to the target sequence at equilibrium. Since the target sequences are generally present at excess, at Tm, 50% of the probes are occupied at equilibrium. Typically, stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 degrees C for short probes or primers (e.g., 10 to 50 nucleotides) and at least about 60 degrees C for longer probes or primers. Stringent conditions may also be achieved with the addition of destabilizing agents, such as formamide.
  • Alternatively, the translation product (protein) may be detected for the diagnosis of the present invention. For example, the quantity of a protein encoded by a C6orf167 gene (C6orf167 protein) may be determined. A method for determining the quantity of the protein as the translation product includes immunoassay methods that use an antibody specifically recognizing the protein. The antibody may be monoclonal or polyclonal. Furthermore, any fragment or modification (e.g., chimeric antibody, scFv, Fab, F(ab')2, Fv, etc.) of the antibody may be used for the detection, so long as the fragment retains the binding ability to C6orf167 protein. Methods to prepare these kinds of antibodies for the detection of proteins are well known in the art, and any method may be employed in the present invention to prepare such antibodies and equivalents thereof.
  • As another method to detect the expression level of C6orf167 gene based on its translation product, the intensity of staining may be observed via immunohistochemical analysis using an antibody against C6orf167 protein. Namely, the observation of strong staining indicates increased presence of the C6orf167 protein and at the same time high expression level of C6orf167 gene.
  • Moreover, in addition to the expression level of C6orf167 gene, the expression level of other cancer-associated genes, for example, genes known to be differentially expressed in cancer may also be determined to improve the accuracy of the diagnosis.
    The expression level of cancer marker gene including C6orf167 gene in a biological sample can be considered to be increased if it increases from the control level of the corresponding cancer marker gene by, for example, 10%, 25%, or 50%; or increases to more than 1.1 fold, more than 1.5 fold, more than 2.0 fold, more than 5.0 fold, more than 10.0 fold, or more.
  • The control level may be determined at the same time with the test biological sample by using a sample(s) previously collected and stored from a subject/subjects whose disease state (cancerous or non-cancerous) is/are known. Alternatively, the control level may be determined by a statistical method based on the results obtained by analyzing previously determined expression level(s) of C6orf167 gene in samples from subjects whose disease state are known. Furthermore, the control level can be a database of expression patterns from previously tested cells. Moreover, according to an aspect of the present invention, the expression level of C6orf167 gene in a biological sample may be compared to multiple control levels, which control levels are determined from multiple reference samples. It is preferred to use a control level determined from a reference sample derived from a tissue type similar to that of the subject-derived biological sample. Moreover, it is preferred, to use the standard value of the expression levels of C6orf167 gene in a population with a known disease state. The standard value may be obtained by any method known in the art. For example, a range of mean +/- 2 S.D. or mean +/- 3 S.D. may be used as standard value.
  • In the context of the present invention, the phrase "control level" refers to the expression level of a test gene detected in a control sample and encompasses both a normal control level and a cancer control level. The phrase "normal control level" refers to a level of gene expression detected in a normal healthy individual or in a population of individuals known not to be suffering from cancer. A normal individual is one with no clinical symptom of lung cancer. A normal control level can be determined using a normal cell obtained from a non-cancerous tissue. A "normal control level" may also be the expression level of a test gene detected in a normal healthy tissue or cell of an individual or population known not to be suffering from lung cancer. On the other hand, the phrase "cancer control level" refers to an expression level of a test gene detected in the cancerous tissue or cell of an individual or population suffering from lung cancer.
  • An increase in the expression level of C6orf167 gene detected in a subject-derived sample as compared to a normal control level indicates that the subject (from which the sample has been obtained) suffers from or is at risk of developing lung cancer. In the context of the present invention, the subject-derived sample may be any tissues obtained from test subjects, e.g., patients suspected of having cancer. For example, tissues may include epithelial cells. More particularly, tissues may be epithelial cells collected from a suspected cancerous area.
  • Alternatively, the expression level of C6orf167 gene in a subject-derived biological sample can be compared to (a) cancer control levels of C6orf167 gene. A similarity between the expression level of a subject-derived biological sample and the cancer control level indicates that the subject (from which the sample has been obtained) suffers from or is at risk of developing cancer. When the expression levels of other cancer-related genes are also measured and compared, a similarity in the gene expression pattern between the sample and the reference that is cancerous indicates that the subject is suffering from or at a risk of developing cancer.
  • Herein, gene expression levels are deemed to be "altered" or "increased" when the gene expression changes or increases by, for example, 10%, 25%, or 50% from, or at least 0.1 fold, at least 0.2 fold, at least 0.5 fold, at least 2 fold, at least 5 fold, or at least 10 fold or more compared to a control level. Accordingly, the expression level of cancer marker gene including C6orf167 in a biological sample can be considered to be increased if it increases from the normal control level of the corresponding cancer marker gene by, for example, 10% or more, 25% or more, or 50% or more; or increases to more than 1.1 fold, more than 1.5 fold, more than 2.0 fold, more than 5.0 fold, more than 10.0 fold, or more. The expression level of the target gene can be determined by detecting, e.g., determined by the hybridization intensity of nucleic acid probes to gene transcripts in a sample.
    Difference between the expression levels of a test biological sample and the control level can be normalized to the expression level of control nucleic acids, e.g., housekeeping genes, whose expression levels are known not to differ depending on the cancerous or non-cancerous state of the cell. Exemplary control genes include, but are not limited to, beta-actin, glyceraldehyde 3 phosphate dehydrogenase, and ribosomal protein P1.
  • In the present invention, it is revealed that C6orf167 is not only a useful diagnostic marker, but is also suitable target for cancer therapy. Therefore, cancer treatment targeting C6orf167 can be achieved by the present invention. In the present invention, the cancer treatment targeting C6orf167 refers to suppression or inhibition of C6orf167 activity and/or expression in the cancer cells. Any anti-C6orf167 agents may be used for the cancer treatment targeting C6orf167. In the present invention, the anti-C6orf167 agents include following substance or active ingredient:
    (a) a double-stranded molecule of the present invention,
    (b) DNA encoding thereof, and
    (c) a vector encoding thereof.
  • Accordingly, in a typical embodiment, the present invention provides a method of (i) diagnosing whether a subject has the cancer to be treated with anti- C6orf167 agent, and/or (ii) selecting a subject for cancer treatment targeting C6orf167, which method includes the steps of:
    a) determining the expression level of C6orf167 in cancer cells or tissue(s) obtained from a subject who is suspected to have the cancer to be treated;
    b) comparing the expression level of C6orf167 with a normal control level;
    c) diagnosing the subject as having the cancer to be treated, if the expression level of C6orf167 is increased as compared to the normal control level; and
    d) selecting the subject for cancer treatment, if the subject is diagnosed as having the cancer to be treated, in step c).
  • Alternatively, such a method includes the steps of:
    a) determining the expression level of C6orf167 in cancer cells or tissue(s) obtained from a subject who is suspected to have the cancer to be treated;
    b) comparing the expression level of C6orf167 with a cancerous control level;
    c) diagnosing the subject as having the cancer to be treated, if the expression level of C6orf167 is similar or equivalent to the cancerous control level; and
    d) selecting the subject for cancer treatment, if the subject is diagnosed as having the cancer to be treated, in step c).
  • A kit for Diagnosing Cancer:
    The present invention also provides a kit for diagnosing cancer, which may also be useful in assessing and/or monitoring the efficacy of a cancer therapy. The present invention also provides a kit for determining a subject suffering from cancer that can be treated with the double-stranded molecule of the present invention or vector encoding thereof, which may also be useful in assessing and/or monitoring the efficacy of such cancer treatment. Preferably, the cancer to be diagnosed by the present kit is lung cancer, including NSCLC and SCLC. More preferably, the kit includes at least one reagent for detecting the expression level of the C6orf167 gene in a subject-derived biological sample, which reagent may be selected from the group consisting of:
    (a) a reagent for detecting an mRNA of a C6orf167 gene;
    (b) a reagent for detecting a protein encoded by a C6orf167 gene; and
    (c) a reagent for detecting a biological activity of a protein encoded by a C6orf167 gene.
  • Suitable reagents for detecting an mRNA of a C6orf167 gene (C6orf167 mRNA) include nucleic acids that specifically bind to or identify the C6orf167 mRNA, such as oligonucleotides which have a complementary sequence to a part of the C6orf167 mRNA. Such oligonucleotides specifically hybridize to the C6orf167 mRNA and the hybridization level correlate with the quantity of C6orf167 mRNA. These kinds of oligonucleotides are exemplified by primers and probes that are specific to the C6orf167 mRNA. These kinds of oligonucleotides may be prepared based on methods well known in the art. If needed, the reagent for detecting the C6orf167 mRNA may be immobilized on a solid matrix. Moreover, more than one reagent for detecting the C6orf167 mRNA may be included in the kit.
  • A probe or primer of the present invention typically comprises a substantially purified oligonucleotide. The oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 2000, 1000, 500, 400, 350, 300, 250, 200, 150, 100, 50, or 25bp of consecutive sense strand nucleotide sequence of a nucleic acid comprising a C6orf167 sequence, or an anti sense strand nucleotide sequence of a nucleic acid comprising a C6orf167 sequence, or of a naturally occurring mutant of these sequences. In particular, for example, in a preferred embodiment, an oligonucleotide having 5-50bp in length can be used as a primer for amplifying the gene, to be detected. More preferably, mRNA or cDNA of a C6orf167 gene can be detected with oligonucleotide probe or primer having 15- 30bp in length. In preferred embodiments, length of the oligonucleotide probe or primer can be selected from 15-25bp. Assay procedures, devices, or reagents for the detection of gene by using such oligonucleotide probe or primer are well known (e.g. oligonucleotide microarray or PCR). In these assays, probes or primers can also comprise tag or linker sequences. Further, probes or primers can be modified with detectable label or affinity ligand to be captured. Alternatively, in hybridization based detection procedures, a polynucleotide having a few hundreds (e.g., about 100-200) bases to a few kilo (e.g., about 1000-2000) bases in length can also be used for a probe (e.g., northern blotting assay or cDNA microarray analysis).
  • On the other hand, suitable reagents for detecting a C6orf167 protein include antibodies against the C6orf167 protein. The antibody may be monoclonal or polyclonal. Furthermore, any fragment or modification (e.g., chimeric antibody, scFv, Fab, F(ab')2, Fv, etc.) of the antibody may be used as the reagent, so long as the fragment retains the binding ability to the C6orf167 protein. Methods to prepare these kinds of antibodies for the detection of proteins are well known in the art, and any method may be employed in the present invention to prepare such antibodies and equivalents thereof. Furthermore, the antibody may be labeled with signal generating molecules via direct linkage or an indirect labeling technique. Labels and methods for labeling antibodies and detecting the binding of antibodies to their targets are well known in the art and any labels and methods may be employed for the present invention. Moreover, more than one reagent for detecting the C6orf167 protein may be included in the kit.
  • Furthermore, the biological activity can be determined by, for example, measuring the cell proliferating activity due to the expressed C6orf167 protein in the biological sample. For example, the cell is cultured in the presence of a subject-derived biological sample, and then by detecting the speed of proliferation, or by measuring the cell cycle or the colony forming ability or the cell proliferating activity of the biological sample can be determined. If needed, the reagent for detecting the C6orf167 mRNA may be immobilized on a solid matrix. Moreover, more than one reagent for detecting the biological activity of the C6orf167 protein may be included in the kit.
  • The kit may contain more than one of the aforementioned reagents. Furthermore, the kit may include a solid matrix and reagent for binding a probe against the C6orf167 gene or antibody against the C6orf167 protein, a medium and container for culturing cells, positive and negative control reagents, and a secondary antibody for detecting an antibody against the C6orf167 protein. For example, tissue samples obtained from subject suffering from cancer or not may serve as useful control reagents. A kit of the present invention may further include other materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts (e.g., written, tape, CD-ROM etc.) with instructions for use. These reagents and such may be provided in a container with a label. Suitable containers include bottles, vials, and test tubes. The containers may be formed from a variety of materials, such as glass or plastic.
  • As an embodiment of the present invention, when the reagent is a probe against the C6orf167 mRNA, the reagent may be immobilized on a solid matrix, such as a porous strip, to form at least one detection site. The measurement or detection region of the porous strip may include a plurality of sites, each containing a nucleic acid (probe). A test strip may also contain sites for negative and/or positive controls. Alternatively, control sites may be located on a strip separated from the test strip. Optionally, the different detection sites may contain different amounts of immobilized nucleic acids, i.e., a higher amount in the first detection site and lesser amounts in subsequent sites. Upon the addition of test sample, the number of sites displaying a detectable signal provides a quantitative indication of the amount of C6orf167 mRNA present in the sample. The detection sites may be configured in any suitably detectable shape and are typically in the shape of a bar or dot spanning the width of a test strip.
  • The kit of the present invention may further include positive and/or negative controls sample, and/or a C6orf167 standard sample. The positive control sample of the present invention may be prepared by collecting C6orf167 positive cancer tissue samples. Such C6orf167 positive samples may be obtained, for example, from established lung cancer cell lines, including lung adenocarcinoma cell (ADC) lines such as A427, NCI-H1781, A549, LC319 and the like; lung squamous cell carcinoma (SCC) cell lines such as NCI-H26, EBC-1, NCI-H520, NCI-H2170 and the like; and SCLC cell lines such as DMS114, DMS273, SBC-3, SBC-5, H196, H446 and the like. Alternatively, the C6orf167 positive samples may be obtained from clinical lung cancer tissues, including lung adenocarcinoma tissues, lung squamous cell carcinoma tissues and SCLC tissues. Alternatively, positive control samples may be prepared by determined a cut-off value and preparing a sample containing an amount of a C6orf167 mRNA or protein more than the cut-off value. Herein, the phrase "cut-off value" refers to the value dividing between a normal range and a cancerous range. For example, one skilled in the art may be determine a cut-off value using a receiver operating characteristic (ROC) curve. The present kit may include a C6orf167 standard sample containing a cut-off value amount of a C6orf167 mRNA or polypeptide. On the contrary, negative control samples may be prepared from non-cancerous cell lines or non-cancerous tissues such as normal lung tissues, or may be prepared by preparing a sample containing a C6orf167 mRNA or protein less than cut-off value.
  • Alternatively, the present invention provides use of a reagent for preparing a diagnostic reagent for diagnosing cancer. In some embodiments, the reagent can be selected from the group consisting of:
    (a) a reagent for detecting mRNA of the C6orf167 gene;
    (b) a reagent for detecting the C6orf167 protein; and
    (c) a reagent for detecting the biological activity of the C6orf167 protein.
    Specifically, such reagent includes an oligonucleotide that hybridizes to the C6orf167 mRNA, or an antibody that binds to the C6orf167 protein. Furthermore, the present invention also provides a reagent for detecting or diagnosing cancer. In a typical embodiment, such reagent includes an oligonucleotide that hybridize to the mRNA of the C6orf167 gene, or an antibody against the protein encoded by the C6orf167 gene.
  • Screening for an Anti-cancer Substance:
    Through the present invention, it has been demonstrated that C6orf167 is involved in cancer cell growth. Accordingly, substances that suppress an expression level of C6orf167 gene and/or a biological activity of C6orf167 polypeptide are useful for either or both of treating and preventing cancer. Such substances can be screened using a C6orf167 gene, polypeptides encoded by the gene, or transcriptional regulatory region of the gene. Thus, the present invention also provides a method of screening for a candidate substance for either or both of treating and preventing cancer using C6orf167 gene, C6orf167 polypeptide, or transcriptional regulatory region of the gene.
  • In the present invention, it has been further demonstrated that NFKBIL2 polypeptide interacts with C6orf167 polypeptide. As demonstrated herein, nuclear localization of C6orf167 polypeptide is crucial in cancer cell growth and NFKBIL2 polypeptide is involved in such nuclear localization. Accordingly, substances that inhibit the interaction between C6orf167 polypeptide and NFKBIL2 polypeptide are also useful for either or both of treating and preventing cancer. Such substances can be screened by identifying substances that inhibits the binding between C6orf167 polypeptide and NFKBIL2 polypeptide. Thus, the present invention also provides a method of screening for a candidate substance for either or both of treating and preventing cancer by identifying a substance that inhibits the binding between C6orf167 polypeptide and NFKBIL2 polypeptide.
  • In the context of the present invention, substances to be identified through the present screening methods may be any compound or composition including several compounds. Furthermore, the test substance exposed to a cell or protein according to the screening methods of the present invention may be a single substance or a combination of substances. When a combination of substances is used in the methods, the substances may be contacted sequentially or simultaneously.
    The substances screened by the present screening method may be suitable candidate substances for treating and/or preventing cancer, and/or inhibiting cancer cell growth. In the present invention, the cancer is preferably characterized by an association with C6orf167 overexpression. Accordingly, the screened substances may be preferably applied to the cancers correlated or associated with C6orf167 overexpression. In the typical embodiments, the cancers correlated or associated with C6orf167 overexpression are lung cancer, including NSCLCs and SCLCs. NSCLCs include, but are not limited to, lung adenocarcinoma (ADC) and lung squamous cell carcinoma (SCC).
  • Any test substance, for example, cell extracts, cell culture supernatants, products of fermenting microorganisms, extracts from marine organisms, plant extracts, purified or crude proteins, peptides, non-peptide compounds, synthetic micromolecular compounds (including nucleic acid constructs, such as antisense RNA, siRNA, Ribozymes, and aptamers etc.) and natural compounds can be used in the screening methods of the present invention. The test substance of the present invention can be also obtained using any of the numerous approaches in combinatorial library methods known in the art, including (1) biological libraries, (2) spatially addressable parallel solid phase or solution phase libraries, (3) synthetic library methods requiring deconvolution, (4) the "one-bead one-compound" library method and (5) synthetic library methods using affinity chromatography selection. The biological library methods using affinity chromatography selection are limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, Anticancer Drug Des 1997, 12: 145-67). Examples of methods for the synthesis of molecular libraries can be found in the art (DeWitt et al., Proc Natl Acad Sci USA 1993, 90: 6909-13; Erb et al., Proc Natl Acad Sci USA 1994, 91: 11422-6; Zuckermann et al., J Med Chem 37: 2678-85, 1994; Cho et al., Science 1993, 261: 1303-5; Carell et al., Angew Chem Int Ed Engl 1994, 33: 2059; Carell et al., Angew Chem Int Ed Engl 1994, 33: 2061; Gallop et al., J Med Chem 1994, 37: 1233-51). Libraries of compounds may be presented in solution (see Houghten, Bio/Techniques 1992, 13: 412-21) or on beads (Lam, Nature 1991, 354: 82-4), chips (Fodor, Nature 1993, 364: 555-6), bacteria (US Pat. No. 5,223,409), spores (US Pat. No. 5,571,698; 5,403,484, and 5,223,409), plasmids (Cull et al., Proc Natl Acad Sci USA 1992, 89: 1865-9) or phage (Scott and Smith, Science 1990, 249: 386-90; Devlin, Science 1990, 249: 404-6; Cwirla et al., Proc Natl Acad Sci USA 1990, 87: 6378-82; Felici, J Mol Biol 1991, 222: 301-10; US Pat. Application 2002103360).
  • A compound in which a part of the structure of the substance screened by any one of the present screening methods is converted by addition, deletion and/or replacement, is included in the substances obtained by the screening methods of the present invention.
    Furthermore, when a candidate substance obtained by the present screening method is a protein, for obtaining a DNA encoding the protein, either the whole amino acid sequence of the protein may be determined to deduce the nucleic acid sequence coding for the protein, or partial amino acid sequence of the obtained protein may be analyzed to prepare an oligo DNA probe, which is used to screen cDNA libraries. The obtained DNA may then be tested to confirm that it encodes the candidate substance.
    Test substances used in the screenings described herein may also be antibodies that specifically bind to a C6orf167 protein or partial peptides thereof that lack the biological activity of the original proteins in vivo.
    Although the construction of test substance libraries is well known in the art, herein below, additional guidance in identifying test substances and preparing libraries of such substances for the present screening methods is provided.
  • (i) Molecular modeling:
    Construction of test substance libraries is facilitated by knowledge of the molecular structure of substances known to have the properties sought, and/or the molecular structure of C6orf167 protein. One approach to preliminary screening of test substances suitable for further evaluation utilizes computer modeling of the interaction between the test substance and its target.
    Computer modeling technology allows for the visualization of the three-dimensional atomic structure of a selected molecule and the rational design of new substances that will interact with the molecule. The three-dimensional construct typically depends on data from x-ray crystallographic analysis or NMR imaging of the selected molecule. The molecular dynamics require force field data. The computer graphics systems enable prediction of how a new substance will link to the target molecule and allow experimental manipulation of the structures of the substance and target molecule to perfect binding specificity. Prediction of what the molecule-substance interaction will be when small changes are made in one or both requires molecular mechanics software and computationally intensive computers, usually coupled with user-friendly, menu-driven interfaces between the molecular design program and the user.
  • An example of the molecular modeling system described generally above includes the CHARMm and QUANTA programs, Polygen Corporation, Waltham, Mass. CHARMm performs the energy minimization and molecular dynamics functions. QUANTA performs the construction, graphic modeling and analysis of molecular structure. QUANTA allows interactive construction, modification, visualization, and analysis of the behavior of molecules with each other.
  • A number of articles have been published on the subject of computer modeling of drugs interactive with specific proteins, examples of which include Rotivinen et al. Acta Pharmaceutica Fennica 1988, 97: 159-66; Ripka, New Scientist 1988, 54-8; McKinlay & Rossmann, Annu Rev Pharmacol Toxiciol 1989, 29: 111-22; Perry & Davies, Prog Clin Biol Res 1989, 291: 189-93; Lewis & Dean, Proc R Soc Lond 1989, 236: 125-40, 141-62; and, with respect to a model receptor for nucleic acid components, Askew et al., J Am Chem Soc 1989, 111: 1082-90.
    Other computer programs that screen and graphically depict chemicals are available from companies such as BioDesign, Inc., Pasadena, Calif., Allelix, Inc, Mississauga, Ontario, Canada, and Hypercube, Inc., Cambridge, Ontario. See, e.g., DesJarlais et al., J Med Chem 1988, 31: 722-9; Meng et al., J Computer Chem 1992, 13: 505-24; Meng et al., Proteins 1993, 17: 266-78; Shoichet et al., Science 1993, 259: 1445-50.
    Once a putative inhibitor has been identified, combinatorial chemistry techniques can be employed to construct any number of variants based on the chemical structure of the identified putative inhibitor, as detailed below. The resulting library of putative inhibitors, or "test substances" may be screened using the methods of the present invention to identify test substances suited to the treatment and/or prophylaxis of cancer and/or the prevention of post-operative recurrence of cancer, particularly wherein the cancer is lung cancer.
  • (ii) Combinatorial chemical synthesis:
    Combinatorial libraries of test substances may be produced as part of a rational drug design program involving knowledge of core structures existing in known inhibitors. This approach allows the library to be maintained at a reasonable size, facilitating high throughput screening. Alternatively, simple, particularly short, polymeric molecular libraries may be constructed by simply synthesizing all permutations of the molecular family making up the library. An example of this latter approach would be a library of all peptides six amino acids in length. Such a peptide library could include every 6 amino acid sequence permutation. This type of library is termed a linear combinatorial chemical library.
  • Preparation of combinatorial chemical libraries is well known to those of skill in the art, and may be generated by either chemical or biological synthesis. Combinatorial chemical libraries include, but are not limited to, peptide libraries (see, e.g., US Patent 5,010,175; Furka, Int J Pept Prot Res 1991, 37: 487-93; Houghten et al., Nature 1991, 354: 84-6). Other chemistries for generating chemical diversity libraries can also be used. Such chemistries include, but are not limited to: peptides (e.g., PCT Publication No. WO 91/19735), encoded peptides (e.g., WO 93/20242), random bio-oligomers (e.g., WO 92/00091), benzodiazepines (e.g., US Patent 5,288,514), diversomers such as hydantoins, benzodiazepines and dipeptides (DeWitt et al., Proc Natl Acad Sci USA 1993, 90:6909-13), vinylogous polypeptides (Hagihara et al., J Amer Chem Soc 1992, 114: 6568), nonpeptidal peptidomimetics with glucose scaffolding (Hirschmann et al., J Amer Chem Soc 1992, 114: 9217-8), analogous organic syntheses of small compound libraries (Chen et al., J. Amer Chem Soc 1994, 116: 2661), oligocarbamates (Cho et al., Science 1993, 261: 1303), and/or peptidylphosphonates (Campbell et al., J Org Chem 1994, 59: 658), nucleic acid libraries (see Ausubel, Current Protocols in Molecular Biology 1995 supplement; Sambrook et al., Molecular Cloning: A Laboratory Manual, 1989, Cold Spring Harbor Laboratory, New York, USA), peptide nucleic acid libraries (see, e.g., US Patent 5,539,083), antibody libraries (see, e.g., Vaughan et al., Nature Biotechnology 1996, 14(3):309-14 and PCT/US96/10287), carbohydrate libraries (see, e.g., Liang et al., Science 1996, 274: 1520-22; US Patent 5,593,853), and small organic molecule libraries (see, e.g., benzodiazepines, Gordon EM. Curr Opin Biotechnol. 1995 Dec 1;6(6):624-31.; isoprenoids, US Patent 5,569,588; thiazolidinones and metathiazanones, US Patent 5,549,974; pyrrolidines, US Patents 5,525,735 and 5,519,134; morpholino compounds, US Patent 5,506,337; benzodiazepines, 5,288,514, and the like).
    Devices for the preparation of combinatorial libraries are commercially available (see, e.g., 357 MPS, 390 MPS, Advanced Chem Tech, Louisville KY, Symphony, Rainin, Woburn, MA, 433A Applied Biosystems, Foster City, CA, 9050 Plus, Millipore, Bedford, MA). In addition, numerous combinatorial libraries are themselves commercially available (see, e.g., ComGenex, Princeton, N.J., Tripos, Inc., St. Louis, MO, 3D Pharmaceuticals, Exton, PA, Martek Biosciences, Columbia, MD, etc.).
  • (iii) Other candidates:
    Another approach uses recombinant bacteriophage to produce libraries. Using the "phage method" (Scott & Smith, Science 1990, 249: 386-90; Cwirla et al., Proc Natl Acad Sci USA 1990, 87: 6378-82; Devlin et al., Science 1990, 249: 404-6), very large libraries can be constructed (e.g., 106 -108 chemical entities). A second approach uses primarily chemical methods, of which the Geysen method (Geysen et al., Molecular Immunology 1986, 23: 709-15; Geysen et al., J Immunologic Method 1987, 102: 259-74); and the method of Fodor et al. (Science 1991, 251: 767-73) are examples. Furka et al. (14th International Congress of Biochemistry 1988, Volume #5, Abstract FR:013; Furka, Int J Peptide Protein Res 1991, 37: 487-93), Houghten (US Patent 4,631,211) and Rutter et al. (US Patent 5,010,175) describe methods to produce a mixture of peptides that can be tested as agonists or antagonists.
    Aptamers are macromolecules composed of nucleic acid that bind tightly to a specific molecular target. Tuerk and Gold (Science. 249:505-510 (1990)) discloses SELEX (Systematic Evolution of Ligands by Exponential Enrichment) method for selection of aptamers. In the SELEX method, a large library of nucleic acid molecules {e.g., 1015 different molecules) can be used for screening.
  • I. Protein based screening methods
    The present invention provides methods of screening for a candidate substance applicable to either or both of the treatment and prevention of cancer using a C6orf167 polypeptide.
    In the context of the present screening method, the C6orf167 polypeptide to be used may be, for example, a purified polypeptide, a soluble protein, a form bound to a carrier or a fusion protein fused with other polypeptides. Further, the C6orf167 polypeptide may be a recombinant polypeptide, a protein derived from the nature or a partial peptide thereof.
  • In addition to naturally-occurring C6orf167 polypeptides, functional equivalents of the polypeptides may be included in C6orf167 polypeptides used for the present screening so long as the modified peptide retains at least one biological activity of the original polypeptide. Examles of the biological activity of the C6orf167 polypeptide include, but are not limited to, cell proliferative activity, binding activity to NFKBIL2 polypeptide. Typical examples of such functional equivalents are described above in the section entitled "The Genes and Polypeptides". For example, a preferred example of such a functional equivalent includes a polypeptide containing an NFKBIL2-binding domain of C6orf167 polypeptide. Such polypeptides containing an NFKBIL2-binding domain include, but are not limited to, a polypeptide having an amino acid sequence of 1 to 414 of SEQ ID NO: 18 or 20.
  • The C6orf167 protein may be produced in vitro by means of an in vitro translation system.
    The C6orf167 polypeptide to be used in the screening method of the present invention can be, for example, a purified polypeptide, a soluble protein, or a fusion protein fused with other polypeptides.
    The polypeptides or fragments used for the present method may be obtained from nature as naturally occurring proteins via conventional purification methods or through chemical synthesis based on the selected amino acid sequence. For example, conventional peptide synthesis methods that can be adopted for the synthesis include:
    1) Peptide Synthesis, Interscience, New York, 1966;
    2) The Proteins, Vol. 2, Academic Press, New York, 1976;
    3) Peptide Synthesis (in Japanese), Maruzen Co., 1975;
    4) Basics and Experiment of Peptide Synthesis (in Japanese), Maruzen Co., 1985;
    5) Development of Pharmaceuticals (second volume) (in Japanese), Vol. 14 (peptide synthesis), Hirokawa, 1991;
    6) WO99/67288; and
    7) Barany G. & Merrifield R.B., Peptides Vol. 2, "Solid Phase Peptide Synthesis", Academic Press, New York, 1980, 100-118.
  • Alternatively, the polypeptides may be obtained by adapting any known genetic engineering methods to the production of the instant polypeptides (e.g., Morrison J., J Bacteriology 1977, 132: 349-51; Clark-Curtiss & Curtiss, Methods in Enzymology (eds. Wu et al.) 1983, 101: 347-62). For example, first, a suitable vector including a polynucleotide encoding the desired protein in an expressible form (e.g., downstream of a regulatory sequence including a promoter) is prepared, transformed into a suitable host cell, and then the host cell is cultured to produce the protein. More specifically, a gene encoding a C6orf167 polypeptide is expressed in host (e.g., animal) cells by inserting the gene into a vector for expressing foreign genes, such as pSV2neo, pcDNA I, pcDNA3.1, pCAGGS, or pCD8. A promoter may be used for the expression. Any commonly used promoter may be employed, including, for example, the SV40 early promoter (Rigby in Williamson (ed.), Genetic Engineering, vol. 3. Academic Press, London, 1982, 83-141), the EF-alpha promoter (Kim et al., Gene 1990, 91:217-23), the CAG promoter (Niwa et al., Gene 1991, 108:193), the RSV LTR promoter (Cullen, Methods in Enzymology 1987, 152:684-704), the SR-alpha promoter (Takebe et al., Mol Cell Biol 1988, 8:466), the CMV immediate early promoter (Seed et al., Proc Natl Acad Sci USA 1987, 84:3365-9), the SV40 late promoter (Gheysen et al., J Mol Appl Genet 1982, 1:385-94), the Adenovirus late promoter (Kaufman et al., Mol Cell Biol 1989, 9:946), the HSV TK promoter, and such. The introduction of the vector into host cells to express a C6orf167 polypeptide may be performed according to any conventional method, for example, the electroporation method (Chu et al., Nucleic Acids Res 1987, 15:1311-26), the calcium phosphate method (Chen et al., Mol Cell Biol 1987, 7:2745-52), the DEAE dextran method (Lopata et al., Nucleic Acids Res 1984, 12:5707-17; Sussman et al., Mol Cell Biol 1985, 4:1641-3), the Lipofectin method (Derijard B, Cell 1994, 7:1025-37; Lamb et al., Nature Genetics 1993, 5:22-30; Rabindran et al., Science 1993, 259:230-4), and such.
  • A C6orf167 polypeptide may be further linked to other substances, so long as the polypeptides and fragments retain at least one biological activity. Usable substances include: peptides, lipids, sugar and sugar chains, acetyl groups, natural and synthetic polymers, etc. Such modifications may be used to confer additional functions or to stabilize the polypeptide and fragments.
    For example, the polypeptides may be expressed as a fusion protein including a recognition site (epitope) of a monoclonal antibody by introducing the epitope of the monoclonal antibody, whose specificity has been revealed, to the N- or C- terminus of the polypeptide. For example, a commercially available epitope-antibody system may be used (Experimental Medicine 13: 85-90 (1995)). Vectors that are capable of expressing a fusion protein with, for example, beta-galactosidase, maltose binding protein, glutathione S-transferase, green florescence protein (GFP), and so on, by the use of its multiple cloning sites are commercially available.
    A fusion protein, prepared by introducing only small epitopes composed of several to a dozen amino acids so as not to change the property of the original polypeptide by the fusion, is also provided herein. Epitopes, such as polyhistidine (His-tag), influenza aggregate HA, human c-myc, FLAG, Vesicular stomatitis virus glycoprotein (VSV-GP), T7 gene 10 protein (T7-tag), human simple herpes virus glycoprotein (HSV-tag), E-tag (an epitope on monoclonal phage) and such, and antibodies recognizing them may be used as the epitope-antibody system for detecting the binding activity between the polypeptides (Experimental Medicine 13: 85-90 (1995)).
  • (i) Screening for a C6orf167 Binding Substance:
    In the context of the present invention, an over-expression of C6orf167 gene was detected in lung cancer, in spite of no expression in normal organs (Fig. 1). Accordingly, using the C6orf167 gene and proteins encoded thereby, the present invention provides a method of screening for a substance that binds to C6orf167 polypeptide. Due to the expression of C6orf167 in cancer, a substance that binds to C6orf167 polypeptide can be used to suppress the proliferation of cancer cells, and thus be useful for either or both of treating and preventing cancer. Therefore, the present invention also provides a method of screening for a candidate substance that suppresses the proliferation of cancer cells, and a method for screening a candidate substance for treating or preventing cancer using the C6orf167 polypeptide. On particular, an embodiment of this screening method includes the steps of:
    (a) contacting a test substance with a C6orf167 polypeptide or functional equivalent thereof;
    (b) detecting the binding activity between the polypeptide or the functional equivalent and the test substance; and
    (c) selecting the test substance that binds to the polypeptide or the functional equivalent.
  • Alternatively, according to the present invention, the potential therapeutic effect of a test substance for either or both of treating and preventing cancer can also be evaluated or estimated. In some embodiments, the present invention provides a method for evaluating or estimating a therapeutic effect of a test substance for either or both of treating and preventing cancer and/or inhibiting cancer associated with over-expression of C6orf167 gene, the method including steps of:
    (a) contacting a test substance with a C6orf167 polypeptide or functional equivalent thereof;
    (b) detecting the binding activity between the polypeptide or the functional equivalent and the test substance; and
    (c) correlating the potential therapeutic effect and the test substance, wherein the potential therapeutic effect is shown, when a substance binds to the polypeptide or the functional equivalent.
  • In the context of the present invention, the therapeutic effect may be correlated with the binding level of the test substance and C6orf167 polypeptide (or functional equivalent thereof). For example, when the test substance binds to a C6orf167 polypeptide, the test substance may identified or selected as a candidate substance having the requisite therapeutic effect. Alternatively, when the test substance does not bind to a C6orf167 polypeptide, the test substance may characterized as having no significant therapeutic effect.
  • The method of the present invention will be described in more detail below.
    The C6orf167 polypeptide to be used for screening may be a recombinant polypeptide or a protein derived from the nature or a partial peptide thereof. The polypeptide to be contacted with a test substance may be, for example, a purified polypeptide, a soluble protein, a form bound to a carrier or a fusion protein fused with other polypeptides.
    In typical embodiment, test substances used by the present invention may be proteins such as antibodies or synthetic chemical compounds. As a method of screening substances that bind to a C6orf167 polypeptide, many methods well known by a person skilled in the art may be used. Such a screening may be conducted by, for example, immunoprecipitation method.
    When immunoprecipitation method is used, it is preferred that a C6orf167 polypeptide contains an antibody recognition site. C6orf167 polypeptides to be used for the screening method of the present invention may be prepared as described above. Alternatively, a C6orf167 polypeptide can be expressed as a fusion protein as described above.
  • In immunoprecipitation, an immune complex is formed by adding these antibodies to cell lysate prepared using an appropriate detergent. The immune complex consists of the C6orf167 polypeptide, a polypeptide including the binding ability with the polypeptide, and an antibody. Immunoprecipitation can be also conducted using antibodies against the C6orf167 polypeptide, besides using antibodies against the above epitopes, which antibodies can be prepared as described above. An immune complex can be precipitated, for example by Protein A sepharose or Protein G sepharose when the antibody is a mouse IgG antibody. If a C6orf167 polypeptide is prepared as a fusion protein with an epitope, such as GST, an immune complex can be formed in the same manner as in the use of the antibody against the C6orf167 polypeptide, using a substance specifically binding to these epitopes, such as glutathione-Sepharose 4B.
    Immunoprecipitation can be performed by following or according to, for example, the methods in the literature (Harlow and Lane, Antibodies, 511-52, Cold Spring Harbor Laboratory publications, New York (1988)).
  • SDS-PAGE is commonly used for analysis of immunoprecipitated proteins and the bound protein can be analyzed by the molecular weight of the protein using gels with an appropriate concentration. Since the protein bound to the C6orf167 polypeptide is difficult to detect by a common staining method, such as Coomassie staining or silver staining, the detection sensitivity for the protein can be improved by culturing cells in culture medium containing radioactive isotope, 35S-methionine or 35S-cystein, labeling proteins in the cells, and detecting the proteins. The target protein can be purified directly from the SDS-polyacrylamide gel and its sequence can be determined, when the molecular weight of a protein has been revealed.
  • West-Western blotting analysis (Skolnik et al., Cell 65: 83-90 (1991)) can be used as a method of screening for proteins binding to the C6orf167 polypeptide using the polypeptide. In particular, a protein binding to the C6orf167 polypeptide can be obtained by preparing a cDNA library from cultured cells expected to express a protein binding to the C6orf167 polypeptide using a phage vector (e.g., ZAP), expressing the protein on LB-agarose, fixing the protein expressed on a filter, reacting the purified and labeled C6orf167 polypeptide with the above filter, and detecting the plaques expressing proteins bound to the C6orf167 polypeptide according to the label. The polypeptide of the invention may be labeled by utilizing the binding between biotin and avidin, or by utilizing an antibody that specifically binds to the C6orf167, or a peptide or polypeptide (for example, GST) that is fused to the C6orf167 polypeptide. Methods using radioisotope or fluorescence and such may be also used.
  • Alternatively, in another embodiment of the screening method of the present invention, a two-hybrid system utilizing cells may be used ("MATCHMAKER Two-Hybrid system", "Mammalian MATCHMAKER Two-Hybrid Assay Kit", "MATCHMAKER one-Hybrid system" (Clontech); "HybriZAP Two-Hybrid Vector System" (Stratagene); the references "Dalton and Treisman, Cell 68: 597-612 (1992)", "Fields and Sternglanz, Trends Genet 10: 286-92 (1994)").
  • In the two-hybrid system, the polypeptide of the invention is fused to the SRF-binding region or GAL4-binding region and expressed in yeast cells. A cDNA library is prepared from cells expected to express a protein binding to the polypeptide of the invention, such that the library, when expressed, is fused to the VP16 or GAL4 transcriptional activation region. The cDNA library is then introduced into the above yeast cells and the cDNA derived from the library is isolated from the positive clones detected (when a protein binding to the polypeptide of the invention is expressed in yeast cells, the binding of the two activates a reporter gene, making positive clones detectable). A protein encoded by the cDNA can be prepared by introducing the cDNA isolated above to E. coli and expressing the protein. As a reporter gene, for example, Ade2 gene, lacZ gene, CAT gene, luciferase gene and such can be used in addition to the HIS3 gene.
  • A substance that binds to a C6orf167 polypeptide may also be screened using affinity chromatography. For example, a C6orf167 polypeptide may be immobilized on a carrier of an affinity column, and a composition containing test substances is applied to the column. A composition herein may be, for example, cell extracts, cell lysates, antibody libraries etc. After loading test substances, the column is washed, and substances bound to the C6orf167 polypeptide can be collected. When the test substance is a protein, the amino acid sequence of the obtained protein is analyzed, an oligo DNA is synthesized based on the sequence, and cDNA libraries are screened using the oligo DNA as a probe to obtain a DNA encoding the protein.
  • A biosensor using the surface plasmon resonance phenomenon may be used as a mean for detecting or quantifying the bound substance in the present invention. When such a biosensor is used, the interaction between a C6orf167 polypeptide and a test substance can be observed real-time as a surface plasmon resonance signal, using only a minute amount of polypeptide and without labeling (for example, BIAcore, Pharmacia). Therefore, it is possible to evaluate the binding between a C6orf167 polypeptide and a test substance using a biosensor such as BIAcore.
  • The methods of screening for molecules that bind when the immobilized C6orf167 polypeptide is exposed to synthetic chemical substances, or natural substance banks or a random phage peptide display library, and the methods of screening using high-throughput based on combinatorial chemistry techniques (Wrighton et al., Science 273: 458-64 (1996); Verdine, Nature 384: 11-13 (1996); Hogan, Nature 384: 17-9 (1996)) to isolate not only proteins but chemical substances that bind to the C6orf167 protein (including agonist and antagonist) are well known to one skilled in the art.
  • (ii) Screening for a Substance that Suppresses the Biological Activity of C6orf167:
    In the context of present invention, the C6orf167 polypeptide is characterized as having the activity of promoting cell proliferation of cancer cells (Fig. 2). In the context of the present invention, the C6orf167 polypeptide is also characterized as having the activity of binding to a NFKBIL2 polypeptide (Fig. 3). Using these biological activities as indices, the present invention provides a method for screening a substance that suppresses the proliferation of cancer cells expressing C6orf167 gene, and a method of screening for a substance for either or both of treating and preventing the cancer, particular C6orf167 associated cancers such as lung cancer. Thus, the present invention provides a method of screening for a candidate substance for either or both of treating and preventing cancer using a C6orf167 polypeptide including the steps as follows:
    (a) contacting a test substance with a C6orf167 polypeptide or functional equivalent thereof;
    (b) detecting the biological activity of the polypeptide or the functional equivalent of step (a); and
    (c) selecting the test substance that suppresses the biological activity of the polypeptide or the functional equivalent as compared to the biological activity detected in the absence of the test substance.
  • According to the present invention, the therapeutic effect of the test substance in suppressing the biological activity (e.g., the cell-proliferating activity) of C6orf167 polypeptide (or functional equivalent thereof), or a candidate substance for either or both of treating and preventing cancer may be evaluated. Therefore, the present invention also provides a method of screening for a candidate substance that suppresses the biological activity of C6orf167 polypeptide, or a candidate substance for either or both of treating and preventing cancer, using the C6orf167 polypeptide or functional equivalent thereof, including the following steps:
    (a) contacting a test substance with the C6orf167 polypeptide or a functional equivalent thereof; and
    (b) detecting the biological activity of the polypeptide or the functional equivalent of step (a), and
    (c) correlating the biological activity of (b) with the therapeutic effect of the test substance.
  • Alternatively, in some embodiments, the present invention provides a method for evaluating or estimating a therapeutic effect of a test substance in the treatment and/or prevention of cancer and/or in the inhibition of the growth of a cancer associated with over-expression of C6orf167 gene, the method including steps of:
    (a) contacting a test substance with the C6orf167 polypeptide or a functional equivalent thereof;
    (b) detecting the biological activity of the polypeptide or functional equivalent of step (a); and
    (c) correlating the potential therapeutic effect and the test substance, wherein the potential therapeutic effect is shown, when a substance suppresses the biological activity of the C6orf167 polypeptide or functional equivalent as compared to the biological activity of said polypeptide detected in the absence of the test substance.
    Thus, the candidate substances identified in the screening methods of the present invention can be used in the treatment or prevention of cancers. Such cancers include lung cancer.
  • In the context of the present invention, the therapeutic effect may be correlated with the biological activity of the C6orf167 polypeptide or a functional equivalent thereof. For example, when the test substance suppresses or inhibits the biological activity of the C6orf167 polypeptide or a functional equivalent thereof as compared to a level detected in the absence of the test substance, the test substance may identified or selected as the candidate substance having the therapeutic effect. Alternatively, when the test substance does not suppress or inhibit the biological activity of the C6orf167 polypeptide or a functional equivalent thereof as compared to a level detected in the absence of the test substance, the test substance may identified as the substance having no significant therapeutic effect.
  • The method of the present invention will be described in more detail below.
    Any polypeptides can be used for screening so long as they retain a biological activity of the C6orf167 polypeptide. Examples of such biological activity includes, but are not limited to, cell proliferation promoting activity, binding activity to NFKBIL2 polypeptide and nuclear localization activity. For example, naturally occurring human C6orf167 polypeptides (e.g., polypeptide having an amino acid sequence of SEQ ID NO: 18 or 20) can be used and polypeptides functionally equivalent to these polypeptide can also be used (see " Genes and Polypeptides "). Such polypeptides may be expressed endogenously or exogenously by cells. Methods for preparing such polypeptides are described above.
  • In another aspect, the present invention also provides a screening method following the method described in the above "Screening" section, such method including the steps of:
    (a) contacting a test substance with the C6orf167 polypeptide or functional equivalent thereof;
    (b) detecting the binding between the polypeptide or the functional equivalent and the test substance;
    (c) selecting the test substance that binds to the polypeptide or the functional equivalent;
    (d) contacting the test substance selected in step (c) with the C6orf167 polypeptide or the functional equivalent;
    (e) comparing the biological activity of the polypeptide or the functional equivalent detected in the step (d) with the biological activity detected in the absence of the test substance; and
    (f) selecting the test substance that suppresses the biological activity of the polypeptide or the functional equivalent as a candidate substance for treating or preventing lung cancer.
  • The substance isolated by this screening is a candidate for antagonists of the polypeptide encoded by C6orf167 gene. The term "antagonist" refers to molecules that inhibit the function of the polypeptide by binding thereto. This term also refers to molecules that reduce or inhibit expression of the gene encoding C6orf167. Moreover, a substance isolated by this screening is a candidate for substances which inhibit the in vivo interaction of the C6orf167 polypeptide with molecules (including DNAs and proteins).
  • When the biological activity to be detected in the present method is cell proliferation, it can be detected, for example, by preparing cells which express the C6orf167 polypeptide, culturing the cells in the presence of a test substance, and determining the speed of cell proliferation, measuring the cell cycle and such, as well as by measuring survival cells or the colony forming activity, for example, shown in Fig. 2. The substances that reduce the speed of proliferation of the cells expressed C6orf167 gene are selected as candidate substance for treating or preventing cancer.
  • More specifically, the method includes the step of:
    (a) contacting a test substance with cells overexpressing C6orf167 gene;
    (b) measuring cell-proliferating activity; and
    (c) selecting the test substance that reduces the cell-proliferating activity in the comparison with the cell-proliferating activity in the absence of the test substance.
  • In preferable embodiments, the method of the present invention may further include the steps of:
    (d) selecting the test substance that have no effect to the cells no or little expressing C6orf167 gene.
  • The phrase "suppress the biological activity" as defined herein are preferably at least 10% suppression of the biological activity of C6orf167 polypeptide in comparison with in absence of the substance, more preferably at least 25%, 50% or 75% suppression and most preferably at 90% suppression.
  • In the typical embodiments, control cells that do not express C6orf167 gene are used. Accordingly, the present invention also provides a method of screening for a candidate substance that inhibits cell growth or a candidate substance for either or both of treating and preventing a C6orf167- associated disease, using the C6orf167 polypeptide or functional equivalent thereof including the steps as follows:
    (a) culturing cells which express a C6orf167 polypeptide or a functional equivalent thereof, and control cells that do not express a C6orf167 polypeptide or a functional equivalent thereof in the presence of the test substance;
    (b) detecting the biological activity of the cells which express the C6orf167 polypeptide and control cells; and
    (c) selecting the test substance that inhibits the biological activity in the cells which express the protein as compared to the proliferation detected in the control cells and in the absence of said test substance.
  • When the biological activity to be detected in the screening method of the present invention is binding activity to NFKBIL2 polypeptide, it can be detected, for example, by detecting the binding between C6orf167 polypeptide and NFKBIL2 polypeptide in the presence of a test substance. Details will be described under the following item "(iii) Screening for a Substance that Inhibits the Binding between C6orf167 and NFKBIL2".
  • When the biological activity to be detected in the screening method of the present invention is nuclear localization activity, it can be detected, for example, by preparing cells which express a C6orf167 polypeptide or functional equivalent thereof, culturing the cells in the presence of a test substance, and determining the level of the C6orf167 polypeptide or the functional equivalent thereof that localize in the nuclear. The nuclear localization level of C6orf167 polypeptide or the functional equivalent thereof can be determined by methods well-known in the art. For example, nuclear localization may be detected by immunocytochemical analysis or, cell fractionation and following Western blotting analysis, using an antibody against C6orf167 polypeptide as described in the Examples.
  • As revealed herein, suppressing the biological activity of C6orf167 polypeptide reduces cell growth. Thus, by screening for a candidate substance that inhibits the biological activity of C6orf167 polypeptide, candidate substances that can be used to treat and/or prevent cancers can be identified. The potential of these candidate substances to treat or prevent cancers may be evaluated by second and/or further screening to identify therapeutic substance for cancers. For example, when a substance that inhibits the biological activity of a C6orf167 polypeptide also inhibits the activity of a cancer, it may be concluded that such a substance has a C6orf167 specific therapeutic effect.
  • (iii) Screening for a Substance that Inhibits the Binding between C6orf167 and NFKBIL2:
    In the present invention, C6orf167 polypeptide was confirmed to interact with NFKBIL2 polypeptide (Fig. 3). Accordingly, a substance that inhibits the binding between C6orf167 polypeptide and NFKBIL2 polypeptide can be identified using the binding of C6orf167 polypeptide and NFKBIL2 polypeptide as an index. In view thereof, it is an object of the present invention to provide a method of screening for a substance that inhibits the binding between C6orf167 polypeptide and NFKBIL2 polypeptide. Furthermore, as demonstrated in Examples, NFKBIL3 polypeptide is involved in nuclear localization of C6orf167 polypeptide, which is important for cancer cell growth. Accordingly, substances that inhibit the binding between C6orf167 polypeptide and NFKBIL2 polypeptide are useful for cancer therapeutic agents. Thus, the present invention also provides a method of screening for a candidate substance that inhibits or reduces the growth of cancer cells, and a candidate substance for treating or preventing cancers, e.g. lung cancer.
  • Accordingly, the present invention provides the following methods of [1] to [7]:
    [1] A method of screening for a substance that inhibits or reduces the binding between a C6orf167 polypeptide and an NFKBIL2 polypeptide, such method including the steps of:
    (a) contacting a C6orf167 polypeptide or functional equivalent thereof with an NFKBIL2 polypeptide or functional equivalent thereof in the presence of a test substance;
    (b) detecting a binding level between the polypeptides in the step (a);
    (c) comparing the binding level detected in the step (b) with those detected in the absence of the test substance; and
    (d) selecting the test substance that reduces or inhibits the binding level between the polypeptides;
    [2] A method of screening for a candidate substance suitable for the treatment and/or prevention of cancer or that inhibits cancer cell growth, such method including the steps of:
    (a) contacting a C6orf167 polypeptide or functional equivalent thereof with an NFKBIL2 polypeptide or functional equivalent thereof, in the presence of a test substance;
    (b) detecting the binding level between the polypeptides in the step (a);
    (c) comparing the binding level detected in the step (b) with those detected in the absence of the test substance; and
    (d) selecting the test substance that inhibits or reduces the binding level between the polypeptides;
    [3] The method of [1] or [2], wherein the functional equivalent of the C6orf167 polypeptide includes an amino acid sequence of an NFKBIL2-binding domain of the C6orf167 polypeptide;
    [4] The method of [1] or [2], wherein the functional equivalent of the C6orf167 polypeptide includes the amino acid sequence of 1 to 414 of SEQ ID NO: 18 or 20;
    [5] The method of [1] or [2], wherein the functional equivalent of the NFKBIL2 polypeptide includes an amino acid sequence of a C6orf167 binding domain of the NFKBIL2 polypeptide;
    [6] The method of [1] or [2], wherein the functional equivalent of the NFKBIL2 polypeptide includes the amino acid sequence of 932 to 1378 of SEQ ID NO: 22; and
    [7] The method of any one of [2] to [6], wherein the cancer is lung cancer.
  • According to the present invention, the therapeutic effect of a candidate substance on the inhibition of the cell growth or a candidate substance in connection with the treatment and/or prevention of cancer may be evaluated. Therefore, the present invention also provides a method of screening for a candidate substance that suppresses the proliferation of cancer cells, and a method of screening for a candidate substance suited to the treatment and/or prevention cancer.
  • An illustrative example of such a method includes the steps of:
    (a) contacting a C6orf167 polypeptide or functional equivalent thereof with an NFKBIL2 polypeptide or functional equivalent thereof in the presence of a test substance;
    (b) detecting the level of binding between the polypeptides in the step (a);
    (c) comparing the binding level detected in the step (b) with those detected in the absence of the test substance; and
    (d) correlating the binding level of (c) with the therapeutic effect of the test substance.
  • Alternatively, in other embodiments, the present invention may provide a method for evaluating or estimating the therapeutic effect of a test substance in connection with either or both of the treatment and prevention of cancer or the inhibition of cancer, the method including steps of:
    (a) contacting a C6orf167 polypeptide or functional equivalent thereof with an NFKBIL2 polypeptide or functional equivalent thereof in the presence of a test substance;
    (b) detecting a binding level between the polypeptides in the step (a);
    (c) comparing the binding level detected in the step (b) with those detected in the absence of the test substance; and
    (d) correlating the potential therapeutic effect and the test substance, wherein the potential therapeutic effect is shown, when a test substance reduces the binding level.
  • In the context of the present invention, therapeutic effect may be correlated with the binding level of a C6orf167 polypeptide and an NFKBIL2 polypeptide. For example, when a test substance reduces the binding level of C6orf167 polypeptide and NFKBIL2 polypeptide as compared to a level detected in the absence of the test substance, the test substance may identified or selected as a candidate substance having the desired therapeutic effect. Alternatively, when the test substance does not reduce the binding level of C6orf167 polypeptide and NFKBIL2 polypeptide as compared to a level detected in the absence of the test substance, the test substance may identified as the substance having no significant therapeutic effect.
  • In the context of the present invention, a functional equivalent of a C6orf167 polypeptide or NFKBIL2 polypeptide will have a biological activity equivalent to a C6orf167 polypeptide or NFKBIL2 polypeptide (see, "Genes and Polypeptides"). In typical embodiments, functional equivalents of a C6orf167 polypeptide includes an NFKBIL2-binding domain of the C6orf167 polypeptide. Examples of such functional equivalent include, but are not limited to, polypeptides having an amino acid sequence of 1 to 414 of SEQ ID NO: 18 or 20. Similarly, in typical embodiments, functional equivalents of an NFKBIL2 polypeptide include a C6orf167-binding domain of the NFKBIL2 polypeptide. Examples of such functional equivalent include, but are not limited to, polypeptides having an amino acid sequence of 932 to 1378 of SEQ ID NO: 22.
  • In the context of screening for substances that inhibit or reduce the binding between C6orf167 polypeptide and NFKBIL2 polypeptide, many methods well known by one skilled in the art can be used. Such a screening can be conducted via, for example, an immunoprecipitation, West-Western blotting analysis (Skolnik et al., Cell 65: 83-90 (1991)), a two-hybrid system utilizing cells ("MATCHMAKER Two-Hybrid system", "Mammalian MATCHMAKER Two-Hybrid Assay Kit", "MATCHMAKER one-Hybrid system" (Clontech); "HybriZAP Two-Hybrid Vector System" (Stratagene); the references "Dalton and Treisman, Cell 68: 597-612 (1992)", "Fields and Sternglanz, Trends Genet 10: 286-92 (1994)"), affinity chromatography and a biosensor using the surface plasmon resonance phenomenon. Those methods can be conducted in a manner similar to the methods described above under the item "(i) Screening for a C6orf167 Binding Substance ".
  • In some embodiments, the screening method of the present invention may be carried out in a cell-based assay using cells expressing both of a C6orf167 polypeptide and an NFKBIL2 polypeptide. Cells expressing C6orf167 polypeptide and NFKBIL2 polypeptide include, for example, cell lines established from cancer, e.g. lung cancer. Alternatively, the cells may be prepared through transformation with polynucleotides encoding a C6orf167 polypeptide and an NFKBIL2 polypeptide. Such transformation may be carried out using an expression vector encoding both C6orf167 polypeptide and NFKBIL2 polypeptide, or expression vectors encoding either C6orf167 polypeptide or NFKBIL2 polypeptide. The screening method of the present invention can be conducted by incubating such cells in the presence of a test substance. The binding between C6orf167 polypeptide to NFKBIL2 polypeptide can be detected by immunoprecipitation assay using an anti-C6orf167 antibody or anti-NFKBIL2 antibody.
  • When immunoprecipitation method is used, it is preferred that a C6orf167 polypeptide and a NFKBIL2 polypeptide contains antibody recognition sites. For example, a C6orf167 and/or NFKBIL2 polypeptide may be prepared as fusion proteins that includes the polypeptide and a commercially available epitope. Methods for preparing such fusion proteins are described above.
  • In immunoprecipitation, an immune complex may be formed by adding antibodies against epitopes fused to C6orf167 polypeptide and/or NFKBIL2 polypeptide to cell lysate prepared using an appropriate detergent. The immune complex consists of the C6orf167 polypeptide, the NFKBIL2 polypeptide, and the antibody. Immunoprecipitation can be also conducted using antibodies against the C6orf167 polypeptide and/or NFKBIL2 polypeptide, besides using antibodies against the above epitopes, which antibodies can be prepared as described above. An immune complex can be precipitated, for example by Protein A sepharose or Protein G sepharose when the antibody is a mouse IgG antibody.
  • In the present invention, it is revealed that suppression of the binding between C6orf167 polypeptide and NFKBIL2 polypeptide lead to suppression of the growth of cancer cells. Therefore, when a substance inhibits the binding between C6orf167 polypeptide and NFKBIL2 polypeptide, the inhibition is indicative of a potential therapeutic effect in a subject. In the present invention, a potential therapeutic effect refers to a clinical benefit with a reasonable expectation. In the present invention, such clinical benefit may include;
    (a) a reduction of the binding between C6orf167 polypeptide and NFKBIL2 polypeptide,
    (b) a decrease in size, prevalence, or metastatic potential of the cancer in the subject,
    (c) the prevention of further cancer formation, or
    (d) the prevention or alleviation of a clinical symptom of cancer.
  • II. Screening for a Substance that Alters the Expression of C6orf167:
    As shown herein, a decrease in the expression of C6orf167 gene by siRNA results in the inhibition of cancer cell proliferation (Fig.2A-C). Accordingly, the present invention provides a method of screening for a substance that inhibits the expression of C6orf167. A substance that inhibits the expression of C6orf167 suppresses the proliferation of cancer cells, and thus is useful for treating or preventing cancer, particularly C6orf167-associated cancers such as lung cancer. Therefore, the present invention also provides a method for screening a substance that suppresses the proliferation of cancer cells, and a method for screening a candidate substance for treating or preventing cancer. In the context of the present invention, such screening may include, for example, the following steps:
    (a) contacting a test substance with a cell expressing C6orf167 gene;
    (b) detecting an expression level of the C6orf167 gene in the cell of the step (a); and
    (c) selecting the test substance that reduces the expression level of the C6orf167gene in the absence of the test substance.
  • In the context of the present invention, such screening may include, for example, the following steps:
    (a) contacting a test substance with a cell expressing the C6orf167 gene;
    (b) detecting the expression level of the C6orf167 gene; and
    (c) correlating the expression level of (b) with the therapeutic effect of the test substance.
    In the context of present invention, the therapeutic effect may be correlated with the expression level of the C6orf167 gene. For example, when the test substance reduces the expression level of the C6orf167 gene as compared to a level detected in the absence of the test substance, the test substance may identified or selected as the candidate substance having the therapeutic effect. Alternatively, when the test substance does not reduce the expression level of the C6orf167 gene as compared to a level detected in the absence of the test substance, the test substance may identified as the substance having no significant therapeutic effect.
  • The method of the present invention will be described in more detail below.
    Cells expressing a C6orf167 gene include, for example, cell lines established from lung cancer or cell lines transfected with a C6orf167 expression vector; any of such cells can be used for the screening method of the present invention. The expression level of a C6orf167 gene can be estimated by methods well known to one skilled in the art, for example, RT-PCR, Northern blot assay, Western blot assay, immunostaining and flow cytometry analysis. The phrase "reduce the expression level" as defined herein are preferably at least 10% reduction of expression level of C6orf167 gene in comparison to the expression level in absence of the substance, more preferably at least 25%, 50% or 75% reduced level and most preferably at least 95% reduced level. The substance herein includes chemical compounds, double-strand nucleotides, and so on. The preparation of the double-strand nucleotides will be described bellow. In the method of screening, a substance that reduces the expression level of C6orf167 gene can be selected as candidate substances to be used for the treatment or prevention of cancer.
  • Alternatively, the screening method of the present invention may include the following steps:
    (a) contacting a test substance with a cell into which a vector, including the transcriptional regulatory region of a C6orf167 gene and a reporter gene that is expressed under the control of the transcriptional regulatory region, has been introduced;
    (b) measuring the expression level or activity of the reporter gene; and
    (c) selecting the test substance that reduces the expression level or activity of the reporter gene.
  • Suitable reporter genes and host cells are well known in the art. Illustrative reporter genes include, but are not limited to, luciferase, green fluorescence protein (GFP), Discosoma sp. Red Fluorescent Protein (DsRed), Chrolamphenicol Acetyltransferase (CAT), lacZ and beta-glucuronidase (GUS), and host cell is COS7, HEK293, HeLa and so on. The reporter construct required for the screening can be prepared by connecting reporter gene sequence to the transcriptional regulatory region of C6orf167 gene. The transcriptional regulatory region of C6orf167 gene herein is the region from transcription stat site to at least 500bp upstream, preferably 1000bp, more preferably 5000 or 10000bp upstream. A nucleotide segment containing the transcriptional regulatory region can be isolated from a genome library or can be propagated by PCR. The reporter construct required for the screening can be prepared by connecting reporter gene sequence to the transcriptional regulatory region of the gene. Methods for identifying a transcriptional regulatory region, and also assay protocol are well known (Molecular Cloning third edition chapter 17, 2001, Cold Springs Harbor Laboratory Press).
  • The vector containing such reporter construct is introduced into host cells and the expression or activity of the reporter gene is detected by methods well known in the art (e.g., using luminometer, absorption spectrometer, flow cytometer and so on). "Reduces the expression level or activity" as defined herein are preferably at least 10% reduction of the expression level or activity of the reporter gene in comparison with in absence of the test substance, more preferably at least 25%, 50% or 75% reduction and most preferably at least 95% reduction.
  • Alternatively, in some embodiments, the present invention also provides a method for evaluating or estimating a therapeutic effect of a test substance on treating or preventing cancer or inhibiting cancer associated with over-expression of C6orf167 gene, the method including steps of:
    (a) contacting a test substance with a cell into which a vector, including the transcriptional regulatory region of C6orf167 gene and a reporter gene that is expressed under the control of the transcriptional regulatory region, has been introduced;
    (b) measuring the expression level or activity of the reporter gene; and
    (c) correlating the potential therapeutic effect and the test substance, wherein the potential therapeutic effect is shown, when the test substance reduces the expression level or activity of said reporter gene.
  • According to the present invention, the therapeutic effect of the test substance on inhibiting the cell growth or a candidate substance for treating or preventing C6orf16-associating disease such as cancer may be evaluated. Therefore, the present invention also provides a method for screening a candidate substance that suppresses the proliferation of cancer cells, and a method for screening a candidate substance for treating or preventing C6orf167-associating disease.
  • According to another aspect, the present invention provides a method which includes the following steps of:
    (a) contacting a test substance with a cell into which a vector, composed of the transcriptional regulatory region of the C6orf167 gene and a reporter gene that is expressed under the control of the transcriptional regulatory region, has been introduced;
    (b) detecting the expression level or activity of the reporter gene; and
    (c) correlating the expression level or activity of (b) with the therapeutic effect of the test substance.
  • In the present invention, the therapeutic effect may be correlated with the expression level or activity of said reporter gene. For example, when the test substance reduces the expression level or activity of said reporter gene as compared to the expression level or activity detected in the absence of the test substance, the test substance may be identified or selected as the candidate substance having the therapeutic effect. Alternatively, when the test substance does not reduce the expression level or activity of said reporter gene as compared to a level detected in the absence of the test substance, the test substance may be identified as the substance having no significant therapeutic effect.
  • By screening for candidate substances that (i) bind to the C6orf167 polypeptide; (ii) suppress/reduce the biological activity (e.g., the cell-proliferating activity, binding activity to a NFKBIL2 polypeptide, nuclear localization activity) of the C6orf167 polypeptide; (iii) reduce the expression level of C6orf167 gene, or (iv) inhibit or reduce the binding between C6orf167 polypeptide and NFKBIL2 polypeptide, candidate substances that have the potential to treat or prevent cancers (e.g., lung cancer, ) can be identified. The therapeutic potential of these candidate substances may be evaluated by second and/or further screening to identify therapeutic substance for cancers. For example, when a substance that binds to the C6orf167 polypeptide inhibits the above-described activities of cancer, it may be concluded that such a substance has the C6orf167-specific therapeutic effect.
  • Double Stranded Molecules:
    As used herein, the term "isolated double-stranded molecule" refers to a nucleic acid molecule that inhibits expression of a target gene and includes, for example, short interfering RNA (siRNA; e.g., double-stranded ribonucleic acid (dsRNA) or small hairpin RNA (shRNA)) and short interfering DNA/RNA (siD/R-NA; e.g. double-stranded chimera of DNA and RNA (dsD/R-NA) or small hairpin chimera of DNA and RNA (shD/R-NA)).
  • As used herein, a target sequence is a nucleotide sequence within mRNA or cDNA sequence of a target gene, which will result in suppress of translation of the whole mRNA of the target gene if a double-stranded nucleic acid molecule of the invention was introduced within a cell expressing the target gene. A nucleotide sequence within mRNA or cDNA sequence of a gene can be determined to be a target sequence when a double-stranded polynucleotide including a sequence corresponding to the target sequence inhibits expression of the gene in a cell expressing the gene. The double stranded polynucleotide by which suppresses the gene expression may consists of the target sequence and 3'overhang having 2 to 5 nucleotides in length (e.g., uu).
  • When a target sequence is shown by cDNA sequence, a sense strand sequence of a double-stranded cDNA, i.e., a sequence that mRNA sequence is converted into DNA sequence, is used for defining a target sequence. A double-stranded molecule is composed of a sense strand that has a sequence corresponding to a target sequence and an antisense strand that has a complementary sequence to the target sequence, and the antisense strand hybridizes with the sense strand at the complementary sequence to form a double-stranded molecule.
  • Herein, the phrase "corresponding to" means converting a target sequence according to the kind of nucleic acid that constitutes a sense strand of a double-stranded molecule. For example, when a target sequence is shown in DNA sequence and a sense strand of a double-stranded molecule has an RNA region, base "t"s within the RNA region is replaced with base "u"s. On the other hand, when a target sequence is shown in RNA sequence and a sense strand of a double-stranded molecule has a DNA region, base "u"s within the DNA region is replaced with "t"s. In the context of the present invention, the target sequences are mainly shown in DNA.
    Also, a complementary sequence to a target sequence for an antisense strand of a double-stranded molecule can be defined according to the kind of nucleic acid that constitutes the antisense strand.
    A double-stranded molecule may have one or two 3'overhangs having 2 to 5 nucleotides in length (e.g., uu) and/or a loop sequence that links a sense strand and an antisense strand to form hairpin structure, in addition to a sequence corresponding to a target sequence and complementary sequence thereto.
  • As use herein, the term "siRNA" refers to a double-stranded RNA molecule that prevents translation of a target mRNA. Standard techniques of introducing siRNA into the cell are used, including those in which DNA is a template from which RNA is transcribed. The siRNA includes a C6orf167 sense nucleic acid sequence (also referred to as "sense strand"), a C6orf167 antisense nucleic acid sequence (also referred to as "antisense strand") or both. The siRNA may be constructed such that a single transcript has both the sense and complementary antisense nucleic acid sequences of the target gene, e.g., a hairpin. The siRNA may be either a dsRNA or shRNA.
  • As used herein, the term "dsRNA" refers to a construct of two RNA molecules composed of complementary sequences to one another and that have annealed together via the complementary sequences to form a double-stranded RNA molecule. The nucleotide sequence of two strands may include not only the "sense" or "antisense" RNAs selected from a protein coding sequence of target gene sequence, but also RNA molecule having a nucleotide sequence selected from non-coding region of the target gene.
  • The term "shRNA", as used herein, refers to an siRNA having a stem-loop structure, composed of first and second regions complementary to one another, i.e., sense and antisense strands. The degree of complementarity and orientation of the regions are sufficient such that base pairing occurs between the regions, the first and second regions are joined by a loop region, the loop results from a lack of base pairing between nucleotides (or nucleotide analogs) within the loop region. The loop region of an shRNA is a single-stranded region intervening between the sense and antisense strands and may also be referred to as "intervening single-strand".
  • As use herein, the term "siD/R-NA" refers to a double-stranded polynucleotide molecule which is composed of both RNA and DNA, and includes hybrids and chimeras of RNA and DNA and prevents translation of a target mRNA. Herein, a hybrid indicates a molecule wherein a polynucleotide composed of DNA and a polynucleotide composed of RNA hybridize to each other to form the double-stranded molecule; whereas a chimera indicates that one or both of the strands composing the double stranded molecule may contain RNA and DNA. Standard techniques of introducing siD/R-NA into the cell are used. The siD/R-NA includes a C6orf167 sense nucleic acid sequence (also referred to as "sense strand"), a C6orf167 antisense nucleic acid sequence (also referred to as "antisense strand") or both. The siD/R-NA may be constructed such that a single transcript has both the sense and complementary antisense nucleic acid sequences from the target gene, e.g., a hairpin. The siD/R-NA may be either a dsD/R-NA or shD/R-NA.
  • As used herein, the term "dsD/R-NA" refers to a construct of two molecules composed of complementary sequences to one another and that have annealed together via the complementary sequences to form a double-stranded polynucleotide molecule. The nucleotide sequence of two strands may include not only the "sense" or "antisense" polynucleotides sequence selected from a protein coding sequence of target gene sequence, but also polynucleotide having a nucleotide sequence selected from non-coding region of the target gene. One or both of the two molecules constructing the dsD/R-NA are composed of both RNA and DNA (chimeric molecule), or alternatively, one of the molecules is composed of RNA and the other is composed of DNA (hybrid double-strand).
  • The term "shD/R-NA", as used herein, refers to an siD/R-NA having a stem-loop structure, composed of a first and second regions complementary to one another, i.e., sense and antisense strands. The degree of complementarity and orientation of the regions are sufficient such that base pairing occurs between the regions, the first and second regions are joined by a loop region, the loop results from a lack of base pairing between nucleotides (or nucleotide analogs) within the loop region. The loop region of an shD/R-NA is a single-stranded region intervening between the sense and antisense strands and may also be referred to as "intervening single-strand".
  • As used herein, an "isolated nucleic acid" is a nucleic acid removed from its original environment (e.g., the natural environment if naturally occurring) and thus, synthetically altered from its natural state. In the context of the present invention, examples of isolated nucleic acid includes DNA, RNA, and derivatives thereof. In typical embodiments, the double-stranded molecules of the present invention are isolated.
  • A double-stranded molecule against C6orf167 gene that molecule hybridizes to target mRNA, decreases or inhibits production of C6orf167 protein encoded by C6orf167 gene by associating with the normally single-stranded mRNA transcript of the gene, thereby interfering with translation and thus, inhibiting expression of the protein. As demonstrated herein, the expression of C6orf167 gene in several cancer cell lines was inhibited by dsRNA (Fig. 2). Accordingly, the present invention provides isolated double-stranded molecules that are capable of inhibiting the expression of a C6orf167 gene when introduced into a cell expressing the gene. The target sequence of double-stranded molecule may be designed by an siRNA design algorithm such as that mentioned below.
  • Examples of target sequences for C6orf167 gene include nucleotide sequences such as:
    SEQ ID NO: 15 or 16.
    In other words, examples of target sequences for C6orf167 gene include nucleotide sequences such as:
    3444 to 3462 of SEQ ID NO: 17 or 19; or
    3671 to 3689 of SEQ ID NO: 17 or 19.
  • Of particular interest in the present invention are the following double-stranded molecules [1] to [20]:
    [1] An isolated double-stranded molecule that, when introduced into a cell, inhibits an expression of C6orf167 gene as well as cell proliferation, such molecules composed of a sense strand and an antisense strand complementary thereto, hybridized to each other to form the double-stranded molecule;
    [2] The double-stranded molecule of [1], wherein the double-stranded molecule acts on mRNA, matching a target sequence of SEQ ID NO: 15 or 16;
    [3] A double-stranded molecule composed of a sense strand containing a nucleotide sequence corresponding to a target sequence and an antisense strand containing a nucleotide sequence complementary to the target sequence, wherein the strands hybridize to each other at the target sequence to form the double-stranded molecule, and wherein the double-stranded molecule, when introduced into a cell expressing a C6orf167 gene, inhibits an expression of the C6orf167 gene as well as cell proliferation.
    [4] The double-stranded molecule of [3], wherein the sense strand contains a nucleotide sequence corresponding to a target sequence of SEQ ID NO: 15 or 16;
    [5] The double-stranded molecule of [3], wherein the sense strand contains a nucleotide sequence corresponding to a target sequence of 3444 to 3462 of SEQ ID NO: 17 or 19, or 3671 to 3689 of SEQ ID NO: 17 or 19;
    [6] The double-stranded molecule of any one of [1] to [5], wherein the sense strand hybridize with antisense strand at the target sequence to form the double-stranded molecule having a less than about 100 nucleotide pairs in length;
    [7] The double-stranded molecule of [6], wherein the sense strand hybridize with antisense strand at the target sequence to form the double-stranded molecule having less than about 75 nucleotide pairs in length;
    [8] The double-stranded molecule of [7], wherein the sense strand hybridize with antisense strand at the target sequence to form the double-stranded molecule having less than about 50 nucleotide pairs in length;
    [9] The double-stranded molecule of [8], wherein the sense strand hybridize with antisense strand at the target sequence to form the double-stranded molecule having less than about 25 nucleotide pairs in length;
    [10] The double-stranded molecule of [9], wherein the sense strand hybridize with antisense strand at the target sequence to form the double-stranded molecule having a between about 19 and about 25 nucleotide pairs in length;
    [11] The double-stranded molecule of any one of [1] to [10], composed of a single polynucleotide having both the sense and antisense strands linked by an intervening single-strand;
    [12] The double-stranded molecule of [11], having the general formula 5'-[A]-[B]-[A']-3' or 5'-[A']-[B]-[A]-3', wherein [A] is the sense strand containing a nucleotide sequence corresponding to a target sequence of SEQ ID NO: 15 or 16, [B] is the intervening single-strand composed of 3 to 23 nucleotides, and [A'] is the antisense strand containing a sequence complementary to the target sequence;
    [13] The double-stranded molecule of any one of [1] to [12], composed of RNA;
    [14] The double-stranded molecule of any one of [1] to [12], composed of both DNA and RNA;
    [15] The double-stranded molecule of [14], wherein the molecule is a hybrid of a DNA polynucleotide and an RNA polynucleotide;
    [16] The double-stranded molecule of [15], wherein the sense and the antisense strands are composed of DNA and RNA, respectively;
    [17] The double-stranded molecule of [14], wherein the molecule is a chimera of DNA and RNA;
    [18] The double-stranded molecule of [17], wherein a region flanking to the 3'-end of the antisense strand, or both of a region flanking to the 5'-end of sense strand and a region flanking to the 3'-end of antisense strand are RNA;
    [19] The double-stranded molecule of [18], wherein the flanking region is composed of 9 to 13 nucleotides; and
    [20] The double-stranded molecule of any one of [1] to [19], wherein the molecule contains one or two 3' overhang(s).
  • The double-stranded molecule of the present invention will be described in more detail below.
    Methods for designing double-stranded molecules having the ability to inhibit target gene expression in cells are known. (See, for example, US Patent No. 6,506,559, herein incorporated by reference in its entirety). For example, a computer program for designing siRNAs is available from the Ambion website (http://www.ambion.com/techlib/misc/siRNA_finder.html).
    The computer program selects target nucleotide sequences for double-stranded molecules based on the following protocol.
  • Selection of Target Sites:
    1. Beginning with the AUG start codon of the transcript, scan downstream for AA di-nucleotide sequences. Record the occurrence of each AA and the 3' adjacent 19 nucleotides as potential siRNA target sites. Tuschl et al. don't recommend designing siRNA to the 5' and 3' untranslated regions (UTRs) and regions near the start codon (within 75 bases) as these may be richer in regulatory protein binding sites, and UTR-binding proteins and/or translation initiation complexes may interfere with binding of the siRNA endonuclease complex.
    2. Compare the potential target sites to the appropriate genome database (human, mouse, rat, etc.) and eliminate from consideration any target sequences with significant homology to other coding sequences. Basically, BLAST, which can be found on the NCBI server at: ncbi.nlm.nih.gov/BLAST/, is used (Altschul SF et al., Nucleic Acids Res 1997 Sep 1, 25(17): 3389-402).
    3. Select qualifying target sequences for synthesis. Selecting several target sequences along the length of the gene to evaluate is typical.
  • Using the above protocol, the target sequence for C6orf167 gene were designed as the nucleotide sequences of:
    3444 to 3462 of SEQ ID NO: 17 or 19; and
    3671 to 3689 of SEQ ID NO: 17 or 19.
    The above target sequence is preferably nucleotide sequence of SEQ ID NO: 15 and 16.
  • Double-stranded molecules targeting the above-mentioned target sequences were respectively examined for their ability to suppress the growth of cells expressing the target genes. Therefore, the present invention provides double-stranded molecules targeting the sequence of 3444 to 3462 of SEQ ID NO: 17 or 19, or 3671 to 3689 of SEQ ID NO: 17 or 19. Alternatively, the present invention provides double-stranded molecules targeting the sequence of SEQ ID NO: 15 or 16 for C6orf167 gene.
  • The double-stranded molecule of the present invention targeting the above-mentioned target sequence for C6orf167 gene include isolated polynucleotide that contain the nucleic acid sequences of target sequences and/or complementary sequences to the target sequence. Example of polynucleotide targeting C6orf167 gene includes that containing the sequence of SEQ ID NO: 15 or 16 and/or complementary sequences to these nucleotides; However, the present invention is not limited to this example, and minor modifications in the aforementioned nucleic acid sequences are acceptable so long as the modified molecule retains the ability to suppress the expression of C6orf167 gene. Herein, the phrase "minor modification" as used in connection with a nucleic acid sequence indicates one, two or several substitution, deletion, addition or insertion of nucleic acids to the sequence.
  • In an embodiment, a double-stranded molecule is composed of two polynucleotides, one polynucleotide has a sequence corresponding to a target sequence, i.e., sense strand, and another polypeptide has a complementary sequence to the target sequence, i.e., antisense strand. The sense strand polynucleotide and the antisense strand polynucleotide hybridize to each other to form double-stranded molecule. Examples of such double-stranded molecules include dsRNA and dsD/R-NA.
  • In an another embodiment, a double-stranded molecule is composed of a polynucleotide that has both a sequence corresponding to a target sequence, i.e., sense strand, and a complementary sequence to the target sequence, i.e., antisense strand. Generally, the sense strand and the antisense strand are linked by a intervening strand, and hybridize to each other to form a hairpin loop structure. Examples of such double-stranded molecule include shRNA and shD/R-NA.
    In other words, a double-stranded molecule of the present invention is composed a sense strand polynucleotide having a nucleotide sequence of the target sequence and anti-sense strand polynucleotide having a nucleotide sequence complementary to the target sequence, and both of polynucleotides hybridize to each other to form the double-stranded molecule. In the double-stranded molecule including the polynucleotides, a part of the polynucleotide of either or both of the strands may be RNA, and when the target sequence is defined with a DNA sequence, the nucleotide "t" within the target sequence and complementary sequence thereto is replaced with "u".
  • In one embodiment of the present invention, such a double-stranded molecule of the present invention includes a stem-loop structure, composed of the sense and antisense strands. The sense and antisense strands may be joined by a loop. Accordingly, the present invention also provides the double-stranded molecule composed of a single polynucleotide containing both the sense strand and the antisense strand linked or flanked by an intervening single-strand.
  • In the present invention, double-stranded molecules targeting the C6orf167 gene may have a sequence selected from among SEQ ID NOs: 15 and 16 as a target sequence. Accordingly, preferable examples of the double-stranded molecule of the present invention include polynucleotide and a complementary sequence thereto, and a polynucleotide that has a sequence corresponding to SEQ ID NO: 15 and 16 and a complementary sequence thereto.
    In the context of the present invention, the term "several" as applies to nucleic acid substitutions, deletions, additions and/or insertions may mean 3-7, preferably 3-5, more preferably 3-4, even more preferably 3 nucleic acid residues.
  • According to the present invention, a double-stranded molecule of the present invention can be tested for its ability using the methods utilized in the Examples. In the Examples herein below, double-stranded molecules composed of sense strands of various portions of mRNA of C6orf167 genes or antisense strands complementary thereto were tested in vitro for their ability to decrease production of C6orf167 gene product in cancer cell lines according to standard methods. Furthermore, for example, reduction in C6orf167 gene product in cells contacted with the candidate double-stranded molecule compared to cells cultured in the absence of the candidate molecule can be detected by, e.g. RT-PCR using primers for the C6orf167 mRNA mentioned under Example 1 item "Semiquantitative RT-PCR". Sequences that decrease the production of a C6orf167 gene product in in vitro cell-based assays can then be tested for their inhibitory effects on cell growth. Sequences that inhibit cell growth in in vitro cell-based assay can then be tested for their in vivo ability using animals with cancer, e.g. nude mouse xenograft models, to confirm decreased production of a C6orf167 gene product and decreased cancer cell growth.
  • When the isolated polynucleotide is RNA or derivatives thereof, base "t" should be replaced with "u" in the nucleotide sequences. As used herein, the term "complementary" refers to Watson-Crick or Hoogsteen base pairing between nucleotides units of a polynucleotide, and the term "binding" means the physical or chemical interaction between two polynucleotides. When the polynucleotide includes modified nucleotides and/or non-phosphodiester linkages, these polynucleotides may also bind each other as same manner. Generally, complementary polynucleotide sequences hybridize under appropriate conditions to form stable duplexes containing few or no mismatches. Furthermore, the sense strand and antisense strand of the isolated polynucleotide of the present invention can form double-stranded molecule or hairpin loop structure by the hybridization. In a typical embodiment, such duplexes contain no more than 1 mismatch for every 10 matches. In some embodiments, where the strands of the duplex are fully complementary, such duplexes contain no mismatches.
  • The polynucleotide is usually less than 8643 nucleotides in length for C6orf167 gene. For example, the polynucleotide is less than 500, 200, 100, 75, 50, or 25 nucleotides in length for C6orf167 gene. The isolated polynucleotides of the present invention are useful for forming double-stranded molecules against C6orf167 gene or preparing template DNAs encoding the double-stranded molecules. When the polynucleotides are used for forming double-stranded molecules, the polynucleotide may be longer than 19 nucleotides, preferably longer than 21 nucleotides, and more preferably has a length of between about 19 and 25 nucleotides.
    Accordingly, the present invention provides a double-stranded molecule composed of a sense strand and an antisense strand, wherein the sense strand is a nucleotide sequence corresponding to a target sequence. In preferable embodiments, the sense strand hybridizes with antisense strand at the target sequence to form the double-stranded molecule having between 19 and 25 nucleotide pairs in length.
  • The double-stranded molecule serves as a guide for identifying homologous sequences in mRNA for the RISC complex, when the double-stranded molecule is introduced into cells. The identified target RNA is cleaved and degraded by the nuclease activity of Dicer, through which the double-stranded molecule eventually decreases or inhibits production (expression) of the polypeptide encoded by the RNA. Thus, a double-stranded molecule of the invention can be defined by its ability to generate a single-strand that specifically hybridizes to the mRNA of the C6orf167 gene under stringent conditions. Herein, the portion of the mRNA that hybridizes with the single-strand generated from the double-stranded molecule is referred to as "target sequence" or "target nucleic acid" or "target nucleotide". In the context of the present invention, the nucleotide sequence of the "target sequence" can be shown using not only the RNA sequence of the mRNA, but also the DNA sequence of cDNA synthesized from the mRNA.
  • The double-stranded molecules of the invention may contain one or more modified nucleotides and/or non-phosphodiester linkages. Chemical modifications well known in the art are capable of increasing stability, availability, and/or cell uptake of the double-stranded molecule. The skilled person will be aware of other types of chemical modification which may be incorporated into the present molecules (WO03/070744; WO2005/045037). In one embodiment, modifications can be used to provide improved resistance to degradation or improved uptake. Examples of such modifications include, but are not limited to, phosphorothioate linkages, 2'-O-methyl ribonucleotides (especially on the sense strand of a double-stranded molecule), 2'-deoxy-fluoro ribonucleotides, 2'-deoxy ribonucleotides, "universal base" nucleotides, 5'-C- methyl nucleotides, and inverted deoxybasic residue incorporation (US20060122137).
  • In another embodiment, modifications can be used to enhance the stability or to increase targeting efficiency of the double-stranded molecule. Examples of such modifications include, but are not limited to, chemical cross linking between the two complementary strands of a double-stranded molecule, chemical modification of a 3' or 5' terminus of a strand of a double-stranded molecule, sugar modifications, nucleobase modifications and/or backbone modifications, 2 -fluoro modified ribonucleotides and 2'-deoxy ribonucleotides (WO2004/029212). In another embodiment, modifications can be used to increased or decreased affinity for the complementary nucleotides in the target mRNA and/or in the complementary double-stranded molecule strand (WO2005/044976). For example, an unmodified pyrimidine nucleotide can be substituted for a 2-thio, 5-alkynyl, 5-methyl, or 5-propynyl pyrimidine. Additionally, an unmodified purine can be substituted with a 7-deaza, 7-alkyl, or 7-alkenyl purine. In another embodiment, when the double-stranded molecule is a double-stranded molecule with a 3' overhang, the 3'- terminal nucleotide overhanging nucleotides may be replaced by deoxyribonucleotides (Elbashir SM et al., Genes Dev 2001 Jan 15, 15(2): 188-200). For further details, published documents such as US20060234970 are available. The present invention is not limited to these examples and any known chemical modifications may be employed for the double-stranded molecules of the present invention so long as the resulting molecule retains the ability to inhibit the expression of the target gene.
  • Furthermore, the double-stranded molecules of the present invention may include both DNA and RNA, e.g., dsD/R-NA or shD/R-NA. Specifically, a hybrid polynucleotide of a DNA strand and an RNA strand or a DNA-RNA chimera polynucleotide shows increased stability. Mixing of DNA and RNA, i.e., a hybrid type double-stranded molecule composed of a DNA strand (polynucleotide) and an RNA strand (polynucleotide), a chimera type double-stranded molecule containing both DNA and RNA on any or both of the single strands (polynucleotides), or the like may be formed for enhancing stability of the double-stranded molecule.
  • The hybrid of a DNA strand and an RNA strand may be either where the sense strand is DNA and the antisense strand is RNA, or vice versa so long as it can inhibit expression of the target gene when introduced into a cell expressing the gene. Preferably, the sense strand polynucleotide is DNA and the antisense strand polynucleotide is RNA. Also, the chimera type double-stranded molecule may be either where both of the sense and antisense strands are composed of DNA and RNA, or where any one of the sense and antisense strands is composed of DNA and RNA so long as it has an activity to inhibit expression of the target gene when introduced into a cell expressing the gene. In order to enhance stability of the double-stranded molecule, the molecule preferably contains as much DNA as possible, whereas to induce inhibition of the target gene expression, the molecule is required to be RNA within a range to induce sufficient inhibition of the expression.
  • As a typical example of the chimera type double-stranded molecule, an upstream partial region (i.e., a region flanking to the target sequence or complementary sequence thereof within the sense or antisense strands) of the double-stranded molecule is RNA. Preferably, the upstream partial region indicates the 5' side (5'-end) of the sense strand and the 3' side (3'-end) of the antisense strand. Alternatively, regions flanking to 5'-end of sense strand and/or 3'-end of antisense strand are referred to upstream partial region. That is, in preferable embodiments, a region flanking to the 3'-end of the antisense strand, or both of a region flanking to the 5'-end of sense strand and a region flanking to the 3'-end of antisense strand are composed of RNA. For instance, the chimera or hybrid type double-stranded molecule of the present invention include following combinations.
    sense strand:
    5'-[---DNA---]-3'
    3'-(RNA)-[DNA]-5'
    : antisense strand,
    sense strand:
    5'-(RNA)-[DNA]-3'
    3'-(RNA)-[DNA]-5'
    : antisense strand, and
    sense strand:
    5'-(RNA)-[DNA]-3'
    3'-(---RNA---)-5'
    : antisense strand.
  • The upstream partial region typically is a domain composed of 9 to 13 nucleotides counted from the terminus of the target sequence or complementary sequence thereto within the sense or antisense strands of the double-stranded molecules. Moreover, some examples of such chimera type double-stranded molecules include those having a strand length of 19 to 21 nucleotides in which at least the upstream half region (5' side region for the sense strand and 3' side region for the antisense strand) of the polynucleotide is RNA and the other half is DNA. In such a chimera type double-stranded molecule, the effect to inhibit expression of the target gene is much higher when the entire antisense strand is RNA (US20050004064).
  • In the context of the present invention, the double-stranded molecule may form a hairpin, such as a short hairpin RNA (shRNA) and short hairpin consisting of DNA and RNA (shD/R-NA). The shRNA or shD/R-NA is a sequence of RNA or mixture of RNA and DNA making a tight hairpin turn that can be used to silence gene expression via RNA interference. The shRNA or shD/R-NA includes the sense target sequence and the antisense target sequence on a single strand wherein the sequences are separated by a loop sequence. Generally, the hairpin structure is cleaved by the cellular machinery into dsRNA or dsD/R-NA, which is then bound to the RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs which match the target sequence of the dsRNA or dsD/R-NA.
  • A loop sequence composed of an arbitrary nucleotide sequence can be located between the sense and antisense sequence in order to form the hairpin loop structure. Thus, the present invention also provides a double-stranded molecule having the general formula 5'-[A]-[B]-[A']-3' or 5'-[A']-[B]-[A]-3', wherein [A] is the sense strand containing a nucleotide sequence corresponding to a target sequence, [B] is an intervening single-strand and [A'] is the antisense strand containing a complementary sequence to the target sequence. The target sequence may be selected from among, for example, nucleotide sequences of SEQ ID NO: 15 and 16 for C6orf167. Alternatively, the target sequence may be selected from among, for example, nucleotide sequences of 3444 to 3462 of SEQ ID NO: 17 or 19 and 3671 to 3689 of SEQ ID NO: 17 or 19.
  • The present invention is not limited to these examples, and the target sequence in [A] may be modified sequences from these examples so long as the double-stranded molecule retains the ability to suppress the expression of the targeted C6orf167 gene. The region [A] hybridizes to [A'] to form a loop composed of the region [B]. The intervening single-stranded portion [B], i.e., loop sequence may be preferably 3 to 23 nucleotides in length. The loop sequence, for example, can be selected from among the following sequences (http://www.ambion.com/techlib/tb/tb_506.html). Furthermore, loop sequence consisting of 23 nucleotides also provides active siRNA (Jacque JM et al., Nature 2002 Jul 25, 418(6896): 435-8, Epub 2002 Jun 26):
    CCC, CCACC, or CCACACC: Jacque JM et al., Nature 2002 Jul 25, 418(6896): 435-8, Epub 2002 Jun 26;
    UUCG: Lee NS et al., Nat Biotechnol 2002 May, 20(5): 500-5; Fruscoloni P et al., Proc Natl Acad Sci USA 2003 Feb 18, 100(4): 1639-44, Epub 2003 Feb 10; and
    UUCAAGAGA: Dykxhoorn DM et al., Nat Rev Mol Cell Biol 2003 Jun, 4(6): 457-67.
  • Examples of typical double-stranded molecules of the present invention having hairpin loop structure are shown below. In the following structure, the loop sequence can be selected from among AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU, CCACACC, and UUCAAGAGA; however, the present invention is not limited thereto:
    CCGCCAAUAUCAUCUCUAA-[B]- UUAGAGAUGAUAUUGGCGG
    (for target sequence SEQ ID NO: 15).
    GAACCUGCAAUACAUGGUA-[B]- UACCAUGUAUUGCAGGUUC
    (for target sequence SEQ ID NO: 16).
  • Furthermore, in order to enhance the inhibition activity of the double-stranded molecules, several nucleotides can be added to 3'end of the sense strand and/or antisense strand of the target sequence, as 3' overhangs. The typical examples of nucleotides constituting a 3' overhang include "t" and "u", but are not limited to. The number of nucleotides to be added is at least 2, generally 2 to 10, preferably 2 to 5. The added nucleotides form single strand at the 3'end of the antisense strand of the double-stranded molecule. In cases where double-stranded molecules consists of a single polynucleotide to form a hairpin loop structure, a 3' overhang sequence may be added to the 3' end of the single polynucleotide.
  • The method for preparing the double-stranded molecule is not particularly limited though it is preferable to use a chemical synthetic method known in the art. According to the chemical synthesis method, sense and antisense single-stranded polynucleotides are separately synthesized and then annealed together via an appropriate method to obtain a double-stranded molecule. Specific example for the annealing includes wherein the synthesized single-stranded polynucleotides are mixed in a molar ratio of preferably at least about 3:7, more preferably about 4:6, and most preferably substantially equimolar amount (i.e., a molar ratio of about 5:5). Next, the mixture is heated to a temperature at which double-stranded molecules dissociate and then is gradually cooled down. The annealed double-stranded polynucleotide can be purified by usually employed methods known in the art. Example of purification methods include methods utilizing agarose gel electrophoresis or wherein remaining single-stranded polynucleotides are optionally removed by, e.g., degradation with appropriate enzyme.
  • Alternatively, the double-stranded molecules may be transcribed intracellularly by cloning its coding sequence into a vector containing a regulatory sequence (e.g., a RNA poly III transcription unit from the small nuclear RNA (snRNA) U6 or the human H1 RNA promoter) that directs the expression of the double-stranded molecule in an adequate cell, adjacent to the coding sequence. The regulatory sequences flanking the coding sequences of double-stranded molecule may be identical or different, such that their expression can be modulated independently, or in a temporal or spatial manner. Details of vectors which are capable of producing the double-stranded molecules are described below.
  • Vector Encoding a Double-Stranded Molecule:
    As noted above, the present invention contemplates vectors containing one or more of the double-stranded molecules described herein, and a cell containing such a vector.
    Of particular interest to the present invention are the following vector of [1] to [13].
    [1] A vector, encoding a double-stranded molecule that, when introduced into a cell, inhibits an expression of C6orf167 gene as well as cell proliferation, such molecules composed of a sense strand and an antisense strand complementary thereto, hybridized to each other to form the double-stranded molecule;
    [2] The vector of [1], wherein the double-stranded molecule acts on mRNA, matching a target sequence of SEQ ID NO: 15 or 16;
    [3] A vector, encoding a double-stranded molecule, composed of a sense strand containing a nucleotide sequence corresponding to a target sequence and an antisense strand containing a nucleotide sequence complementary to the target sequence, wherein the strands hybridize to each other at the target sequence to form the double-stranded molecule, and wherein the double-stranded molecule, when introduced into a cell expressing a C6orf167 gene, inhibits an expression of the C6orf167 gene as well as cell proliferation.
    [4] The vector of [3], wherein the sense strand contains a nucleotide sequence corresponding to a target sequence of SEQ ID NO: 15 or 16;
    [5] The vector of [3], wherein the sense strand contains a nucleotide sequence corresponding to a target sequence of 3444 to 3462 of SEQ ID NO: 17 or 19, or 3671 to 3689 of SEQ ID NO: 17 or 19;
    [6] The vector of any one of [1] to [5], wherein the sense strand hybridize with antisense strand at the target sequence to form the double-stranded molecule having a less than about 100 nucleotide pairs in length;
    [7] The vector of [6], wherein the sense strand hybridize with antisense strand at the target sequence to form the double-stranded molecule having less than about 75 nucleotide pairs in length;
    [8] The vector of [7], wherein the sense strand hybridize with antisense strand at the target sequence to form the double-stranded molecule having less than about 50 nucleotide pairs in length;
    [9] The vector of [8], wherein the sense strand hybridize with antisense strand at the target sequence to form the double-stranded molecule having less than about 25 nucleotide pairs in length;
    [10] The vector of [9], wherein the sense strand hybridize with antisense strand at the target sequence to form the double-stranded molecule having a between about 19 and about 25 nucleotide pairs in length;
    [11] The vector of any one of [1] to [10], wherein the double-stranded molecule is composed of a single polynucleotide having both the sense and antisense strands linked by an intervening single-strand;
    [12] The vector of [11], encoding the double-stranded molecule, having the general formula 5'-[A]-[B]-[A']-3' or 5'-[A']-[B]-[A]-3', wherein [A] is the sense strand containing a nucleotide sequence corresponding to a target sequence of SEQ ID NO: 15 or 16, [B] is the intervening single-strand composed of 3 to 23 nucleotides, and [A'] is the antisense strand containing a sequence complementary to the target sequence; and
    [13] The double-stranded molecule of any one of [1] to [12], wherein the double-stranded molecule contains one or two 3' overhangs.
  • The vector of the present invention will be described in more detail below.
    A vector of the present invention preferably encodes the double-stranded molecule of the present invention in an expressible form. Herein, the phrase "in an expressible form" indicates that the vector, when introduced into a cell, will express the molecule. In a typical embodiment, the vector includes regulatory elements necessary for expression of the double-stranded molecule. Accordingly, in one embodiment, the expression vector encodes the nucleic acid sequences of the double-stranded molecules of the present invention and is adapted for expression of such double-stranded molecules. Such vectors of the present invention may be used for producing the present double-stranded molecules, or directly as an active ingredient for treating cancer.
  • Vectors of the present invention can be produced, for example, by cloning sequences of a sense strand and an antisense strand of the double-stranded molecule of the present invention into an expression vector so that regulatory sequences are operatively-linked to such sequences in a manner to allow expression (by transcription of the DNA molecule) of both strands (Lee NS et al., Nat Biotechnol 2002 May, 20(5): 500-5). For example, RNA molecule that is the antisense to mRNA of C6orf167 gene is transcribed by a first promoter (e.g., a promoter sequence flanking to the 3' end of the cloned DNA) and RNA molecule that is the sense strand to the mRNA of C6orf167 gene is transcribed by a second promoter (e.g., a promoter sequence flanking to the 5' end of the cloned DNA). The sense and antisense strands hybridize in vivo to generate a double-stranded molecule constructs for silencing of the gene. Alternatively, two vectors constructs respectively encoding the sense and antisense strands of the double-stranded molecule are utilized to respectively express the sense and anti-sense strands and then forming a double-stranded molecule construct. Furthermore, the cloned sequence may encode a construct having a secondary structure (e.g., hairpin); namely, a single transcript of a vector contains both the sense and complementary antisense sequences of the target gene.
  • The vectors of the present invention may also be equipped so to achieve stable insertion into the genome of the target cell (see, e.g., Thomas KR & Capecchi MR, Cell 1987, 51: 503-12 for a description of homologous recombination cassette vectors). See, e.g., Wolff et al., Science 1990, 247: 1465-8; US Patent Nos. 5,580,859; 5,589,466; 5,804,566; 5,739,118; 5,736,524; 5,679,647; and WO 98/04720. Examples of DNA-based delivery technologies include "naked DNA", facilitated (bupivacaine, polymers, peptide-mediated) delivery, cationic lipid complexes, and particle-mediated ("gene gun") or pressure-mediated delivery (see, e.g., US Patent No. 5,922,687).
  • The vectors of the present invention include, for example, viral or bacterial vectors. Examples of expression vectors include attenuated viral hosts, such as vaccinia or fowlpox (see, e.g., US Patent No. 4,722,848). This approach involves the use of vaccinia virus, e.g., as a vector to express nucleotide sequences that encode the double-stranded molecule. Upon introduction into a cell expressing the target gene, the recombinant vaccinia virus expresses the molecule and thereby suppresses the proliferation of the cell. Another example of useable vector includes Bacille Calmette Guerin (BCG). BCG vectors are described in Stover et al., Nature 1991, 351: 456-60. A wide variety of other vectors are useful for therapeutic administration and production of the double-stranded molecules; examples include adeno and adeno-associated virus vectors, retroviral vectors, Salmonella typhi vectors, detoxified anthrax toxin vectors, and the like. See, e.g., Shata et al., Mol Med Today 2000, 6: 66-71; Shedlock et al., J Leukoc Biol 2000, 68: 793-806; and Hipp et al., In Vivo 2000, 14: 571-85.
  • Inhibitory Polypeptides of NFKBIL2:
    The present invention also relates to inhibitory polypeptides that lack the ability to control subcellular localization of a C6orf167 polypeptide. As demonstrated in Examples, expression of partial C-terminal NFKBIL2 polypeptides reduce nuclear localization of C6orf167 polypeptide and suppress cancer cell growth, possibly through dominant negative effect. Thus, the protein-protein interacting inhibition between C6orf167 polypeptide and NFKBIL2 polypeptide may be used as a useful strategy for the development of anti-cancer drugs. Accordingly, the present invention also provides inhibitory polypeptides that inhibit the binding between C6orf167 polypeptide and NFKBIL2 polypeptide. Furthermore, the present invention also provides polynucleotides and vectors that encodes such polypeptides.
  • Of particular interest to the present invention are the following polypeptide, polynucleotide and vector of [1] to [5].
  • [1] A polypeptide comprising a C6orf167-binding domain of an NFKBIL2 polypeptide, wherein the polypeptide lacks a biological function of the NFKBIL2 polypeptide, and wherein the biological function is a function to control a subcellular localization of a C6orf167 polypeptide.;
    [2] The polypeptide of [1], wherein the polypeptide is selected from the group consisting of:
    a) a polypeptide comprising an amino acid sequence of SEQ ID NO: 24;
    b) a polypeptide that comprises an amino acid sequence of SEQ ID NO: 24 in which one or more amino acids are substituted, deleted, inserted, and/or added; and
    c) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 23.;
    [3] The polypeptide of [1] or [2], which is modified with a cell-membrane permeable substance.
    [4] A polynucleotide encoding the polypeptide of [1] or [2].
    [5] A vector encoding the polypeptide of [1] or [2].
  • The polypeptides of the present invention will be described in more detail below.
    The inhibitory polypeptides of the present invention contain a C6orf167-binding domain of an NFKBIL2 polypeptide that lacks the ability to control a subcellular localization of a C6orf167 polypeptide. In the context of the present invention, the function that NFKBIL2 polypeptide lacks is the ability to localize C6orf167 polypeptide in nuclear. In a typical embodiment, the polypeptide of the present invention include an amino acid sequence of SEQ ID NO: 24.
  • Furthermore, in some embodiments, the polypeptides of the present invention may include polypeptides homologous (i.e., share sequence identity) to a polypeptide having the amino acid sequence of SEQ ID NO: 24. In the present invention, polypeptides homologous to the polypeptide having the amino acid sequence of SEQ ID NO: 24 are those which contain any mutations selected from addition, deletion, substitution and insertion of one or several amino acid residues and are functionally equivalent. Herein, the phrase "functionally equivalent" refers to having the function to bind to C6orf167 polypeptide and not having the function to localize C6orf167 polypeptide into nuclear, consequently inhibit cancer cell proliferation. Therefore, the inhibitory polypeptide of the present invention preferably have one or several amino acid mutations in the amino acid sequence of SEQ ID NO: 24. In some embodiments, "several" is generally 30 or fewer, preferably 20 or fewer, more preferably 10 or fewer, more preferably 5 or 6 or fewer, and even more preferably 3 or 4 or fewer. Alternatively, the inhibitory polypeptide of the present invention may be composed an amino acid sequence having at least 80% or higher, preferably 90% or higher, or more preferably 95% or higher, and further more preferably 98% or 99% or higher homology to the amino acid sequence of SEQ ID NO: 24. Amino acid sequence homology can be determined using algorithms well known in the art, for example, BLAST or ALIGN set to their default settings.
  • In other embodiments, the inhibitory polypeptide of the present invention can be encoded by a polynucleotide that hybridizes under stringent conditions to the polynucleotide having the nucleotide sequence of SEQ ID NO: 23. Such polypeptides can be isolated in the same manner as methods described in "Genes and Polypeptide".
    The polypeptides of the present invention can be chemically synthesized as described above (See, " Screening for an Anti-cancer Substance I. Protein based screening methods").
    The polypeptides of the present invention can be also synthesized by known genetic engineering techniques. For example, a polynucleotide encoding the polypeptide of the present invention is introduced into an appropriate host cell to prepare a transformed cell. The polypeptides of the present invention can be obtained by recovering polypeptides produced by this transformed cell. In a typical embodiment, the polypeptide encoding the polypeptide may be a vector encoding the polypeptide. Such polynucleotides and vectors can be prepared by conventional methods (See, " Screening for an Anti-cancer Substance I. Protein based screening methods"). Alternatively, the polypeptide of the present invention can be synthesized with an in vitro translation system, in which necessary elements for protein synthesis are reconstituted in vitro.
  • When genetic engineering techniques are used, the polypeptide of the present invention can be expressed as a fused protein with a peptide having a different amino acid sequence. A vector expressing a desired fusion protein can be obtained by linking a polynucleotide encoding the polypeptide of the present invention to a polynucleotide encoding a different peptide so that they are in the same reading frame, and then introducing the resulting nucleotide into an expression vector. The fusion protein is expressed by transforming an appropriate host with the resulting vector. Different peptides to be used in forming fusion proteins include the following peptides: FLAG (Hopp et al., (1988) BioTechnology 6, 1204-10), 6xHis consisting of six His (histidine) residues, 10xHis, Influenza hemagglutinin (HA) , Human c-myc fragment, VSV-GP fragment, p18 HIV fragment, T7-tag, HSV-tag, E-tag, SV40T antigen fragment, lck tag, alpha-tubulin fragment, B-tag, Protein C fragment, GST (glutathione-S-transferase), HA (Influenza hemagglutinin), Immunoglobulin constant region, beta-galactosidase, and MBP (maltose-binding protein).
  • The polypeptide of the present invention can be obtained by treating the fusion protein thus produced with an appropriate protease, and then recovering the desired polypeptide. To purify the polypeptide, the fusion protein is captured in advance with affinity chromatography that binds with the fusion protein, and then the captured fusion protein can be treated with a protease. With the protease treatment, the desired polypeptide is separated from affinity chromatography, and the desired polypeptide with high purity is recovered.
  • In some embodiment, the polypeptides of the present invention may include modified polypeptides. In the present invention, the term "modified" refers, for example, to binding with other substances. Accordingly, in the present invention, the polypeptides of the present invention may further comprise other substances such as cell-membrane permeable substance. The other substances include organic compounds such as peptides, lipids, saccharides, and various naturally-occurring or synthetic polymers. The polypeptides of the present invention may have any modifications so long as the polypeptides retain the inhibitory function. In some embodiments, the inhibitory polypeptides of the present invention can directly compete with NFKBIL2 polypeptide binding to C6orf167 polypeptide. Modifications can also confer additive functions on the polypeptides of the invention. Examples of the additive functions include targetability, deliverability, and stabilization.
  • Typical examples of modifications in the present invention include, for example, the introduction of a cell-membrane permeable substance. Usually, the intracellular structure is cut off from the outside by the cell membrane. Therefore, it is difficult to efficiently introduce an extracellular substance into cells. Cell membrane permeability can be conferred on the polypeptides of the present invention by modifying the polypeptides with a cell-membrane permeable substance. As a result, by contacting the polypeptide of the present invention with a cell, the polypeptide can be delivered into the cell to act thereon.
  • The "cell-membrane permeable substance" refers to a substance capable of penetrating the mammalian cell membrane to enter the cytoplasm. For example, a certain liposome fuses with the cell membrane to release the content into the cell. Meanwhile, a certain type of polypeptide penetrates the cytoplasmic membrane of mammalian cell to enter the inside of the cell. For conferring a cell-entering activity on the polypeptides of the present invention, such type of polypeptides are preferable as cell-membrane permeable substances. Specifically, the present invention includes polypeptides having the following general formula.
    [R]-[D];
    wherein,
    [R] represents a cell-membrane permeable substance; [D] represents an amino acid sequence of the inhibitory polypeptide of the present invention. In the above-described general formula, [R] and [D] can be linked directly or indirectly through a linker. Peptides, compounds having multiple functional groups, or such can be used as a linker. Specifically, amino acid sequences containing -GGG- can be used as a linker. Alternatively, a cell-membrane permeable substance and a polypeptide containing a selected sequence can be bound to the surface of a minute particle. [R] can be linked to any position(s) of [D]. Specifically, [R] can be linked to the N-terminal or C-terminal of [D], or to a side chain of amino acids constituting [D]. Furthermore, more than one [R] molecule can be linked to one molecule of [D]. The [R] molecules can be introduced to different positions on the [D] molecule. Alternatively, [D] can be modified with a number of [R]s linked together.
  • For example, there have been reported a variety of naturally-occurring or artificially synthesized polypeptides having cell-membrane permeability (Joliot A. & Prochiantz A., Nat Cell Biol. 2004; 6: 189-96). All of these known cell-membrane permeable substances can be used for modifying polypeptides in the present invention. In the present invention, for example, any substance selected from the following group can be used as the above-described cell-membrane permeable substance:
    poly-arginine; Matsushita et al., (2003) J. Neurosci.; 21, 6000-7.
    Tat / RKKRRQRRR Frankel et al., (1988) Cell 55,1189-93.
    Green & Loewenstein (1988) Cell 55, 1179-88.
    Penetratin / RQIKIWFQNRRMKWKK
    Derossi et al., (1994) J. Biol. Chem. 269, 10444-50.
    Buforin II / TRSSRAGLQFPVGRVHRLLRK
    Park et al., (2000) Proc. Natl Acad. Sci. USA 97, 8245-50.
    Transportan / GWTLNSAGYLLGKINLKALAALAKKIL
    Pooga et al., (1998) FASEB J. 12, 67-77.
    MAP (model amphipathic peptide) / KLALKLALKALKAALKLA
    Oehlke et al., (1998) Biochim. Biophys. Acta. 1414, 127-39.
    K-FGF / AAVALLPAVLLALLAP
    Lin et al., (1995) J. Biol. Chem. 270, 14255-8.
    Ku70 / VPMLK
    Sawada et al., (2003) Nature Cell Biol. 5, 352-7.
    Ku70 / PMLKE
    Sawada et al., (2003) Nature Cell Biol. 5, 352-7.
    Prion / MANLGYWLLALFVTMWTDVGLCKKRPKP
    Lundberg et al., (2002) Biochem. Biophys. Res. Commun. 299, 85-90.
    pVEC / LLIILRRRIRKQAHAHSK
    Elmquist et al., (2001) Exp. Cell Res. 269, 237-44.
    Pep-1 / KETWWETWWTEWSQPKKKRKV
    Morris et al., (2001) Nature Biotechnol. 19, 1173-6.
    SynB1 / RGGRLSYSRRRFSTSTGR
    Rousselle et al., (2000) Mol. Pharmacol. 57, 679-86.
    Pep-7 / SDLWEMMMVSLACQY
    Gao et al., (2002) Bioorg. Med. Chem. 10, 4057-65.
    HN-1 / TSPLNIHNGQKL
    Hong & Clayman (2000) Cancer Res. 60, 6551-6.
    In the present invention, the poly-arginine, which is listed above as an example of cell-membrane permeable substances, is constituted by any number of arginine residues. Specifically, for example, it is constituted by consecutive 5-20 arginine residues. The preferable number of arginine residues is 11.
  • Method of Inhibiting or Reducing Cancer Cell Growth or Treating Cancer:
    In present invention, dsRNAs for C6orf167 were tested for their ability to inhibit cell growth. The dsRNA for C6orf167 (Fig. 2) effectively knocked down the expression of the gene in several cancer cell lines, which coincided with suppression of cell proliferation. Further, in the present invention, expression of partial C-terminal NFKBIL2 polypeptide could reduce nuclear localization of C6orf167 and suppress cancer cell growth, possibly through dominant negative effect.
  • Accordingly, the present invention provides methods for inhibiting cancer cell growth by inducing dysfunction of the C6orf167 gene or polypeptide via inhibiting the expression of C6orf167 gene or nuclear localization of C6orf167 polypeptide. The C6orf167 gene expression can be inhibited by any of the aforementioned double-stranded molecules of the present invention that specifically target the C6orf167 gene. Also, nuclear localization of C6orf167 polypeptide can be inhibited by any of the aforementioned inhibitory polypeptides of the present invention.
  • Such ability of the double-stranded molecules and the inhibitory polypeptides of the present invention to inhibit cell growth of cancerous cell indicates that they can be used for methods for either or both of treating and preventing cancer such as lung cancer. Thus, the present invention provides methods to treat subjects with cancer or preventing cancer in a subject by administering a double-stranded molecule against C6orf167 gene or a vector expressing the double-stranded molecule, or an inhibitory polypeptide or a vector expressing the inhibitory polypeptide. The methods of the present invention may be carried out without adverse effect because C6orf167 gene was minimally detected in normal organs (Fig. 1D).
  • Of particular interest to the present invention are the following methods [1] to [23]:
    [1] A method for inhibiting cancer cell growth, or either or both of treating and preventing cancer in a subject, wherein the cancer cell or the cancer expresses C6orf167 gene, such method including the step of administering to the subject a pharmaceutically effective amount of a double-stranded molecule against a C6orf167 gene or a vector encoding thereof, wherein the double-stranded molecule, when introduced into a cell expressing the C6orf167 gene, inhibits an expression of the C6orf167 gene as well as cell proliferation.;
    [2] The method of [1], wherein the double-stranded molecule acts on mRNA, matching a target sequence of SEQ ID NO: 15 or 16;
    [3] The method of [1], wherein the sense strand of the double-stranded molecule contains a nucleotide sequence corresponding to a target sequence of SEQ ID NO: 15 or 16;
    [4] The method of [1], wherein the sense strand of the double-stranded molecule contains a nucleotide sequence corresponding to a target sequence of 3444 to 3462 of SEQ ID NO: 17 or 19, or 3671 to 3689 of SEQ ID NO: 17 or 19;
    [5] The method of any one of [1] to [4], wherein the sense strand hybridize with antisense strand at the target sequence to form the double-stranded molecule having a less than about 100 nucleotide pairs in length;
    [6] The method of [5], wherein the sense strand hybridize with antisense strand at the target sequence to form the double-stranded molecule having less than about 75 nucleotide pairs in length;
    [7] The method of [6], wherein the sense strand hybridize with antisense strand at the target sequence to form the double-stranded molecule having less than about 50 nucleotide pairs in length;
    [8] The method of [7], wherein the sense strand hybridize with antisense strand at the target sequence to form the double-stranded molecule having less than about 25 nucleotide pairs in length;
    [9] The method of [8], wherein the sense strand hybridize with antisense strand at the target sequence to form the double-stranded molecule having a between about 19 and about 25 nucleotide pairs in length;
    [10] The method of any one of [1] to [9], wherein the double-stranded is composed of a single polynucleotide having both the sense and antisense strands linked by an intervening single-strand;
    [11] The method of [10], wherein the double-stranded molecule have the general formula 5'-[A]-[B]-[A']-3' or 5'-[A']-[B]-[A]-3', wherein [A] is the sense strand containing a nucleotide sequence corresponding to a target sequence of SEQ ID NO: 15 or 16, [B] is the intervening single-strand composed of 3 to 23 nucleotides, and [A'] is the antisense strand containing a sequence complementary to the target sequence;
    [12] The method of any one of [1] to [11], wherein the double-stranded molecule is composed of RNA;
    [13] The method of any one of [1] to [11], wherein the double-stranded molecule is composed of both DNA and RNA;
    [14] The method of [13], wherein the double-stranded molecule is a hybrid of a DNA polynucleotide and an RNA polynucleotide;
    [15] The method of [14], wherein the sense and the antisense strands of the double-stranded molecule are composed of DNA and RNA, respectively;
    [16] The method of [14], wherein the double-stranded molecule is a chimera of DNA and RNA;
    [17] The method of [16], wherein a region flanking to the 3'-end of the antisense strand, or both of a region flanking to the 5'-end of sense strand and a region flanking to the 3'-end of antisense strand are RNA in the double-stranded molecule;
    [18] The method of [17], wherein the flanking region is composed of 9 to 13 nucleotides;
    [19] The method of any one of [1] to [18], wherein the double-strande molecule contains one or two 3' overhang(s);
    [20] A method for inhibiting cancer cell growth, or either or both of treating and preventing cancer in a subject, wherein the method comprises the step of administering to the subject a pharmaceutically effective amount of a polypeptide containing a C6orf167-binding domain of an NFKBIL2 polypeptide or a vector encoding the polypeptide, wherein the polypeptide lacks a biological function of the NFKBIL2 polypeptide, and wherein the biological function is the ability to control a subcellular localization of a C6orf167 polypeptide;
    [21] The method of [20], wherein the polypeptide is selected from the group consisting of:
    a) a polypeptide comprising an amino acid sequence of SEQ ID NO: 24;
    b) a polypeptide that comprises an amino acid sequence of SEQ ID NO: 24 in which one or more amino acids are substituted, deleted, inserted, and/or added;
    c) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 23; and
    [22] The method of [21], wherein the polypeptide is modified with a cell-membrane permeable substance; and
    [23] The method of any one of [1] to [22], wherein the double-stranded molecule or the polypeptide is contained in a composition which includes a transfection-enhancing agent and pharmaceutically acceptable carrier.
  • The method of the present invention will be described in more detail below.
    The growth of cells expressing a C6orf167 gene may be inhibited by contacting the cells with a double-stranded molecule against a C6orf167 gene, an inhibitory polypeptide of the present invention, or a vector expressing such molecule or polypeptide, or a composition containing the same. The cell may be further contacted with a transfection agent. Suitable transfection agents are known in the art. The phrase "inhibition of cell growth" indicates that the cell proliferates at a lower rate or has decreased viability as compared to a cell not exposed to the molecule. Cell growth may be measured by methods known in the art, e.g., using the MTT cell proliferation assay.
  • The term "specifically inhibit" in the context of inhibitory polynucleotides and polypeptides refers to the ability of an agent or ligand to inhibit the expression or the biological function of C6orf167. Specific inhibition typically results in at least about a 2-fold inhibition over background, preferably greater than about 10 fold and most preferably greater than 100-fold inhibition of C6orf167 expression (e.g., transcription or translation) or measured biological function (e.g., cell growth or proliferation, inhibition of apoptosis, intracellular signaling from C6orf167). Expression levels and/or biological function can be measured in the context of comparing treated and untreated cells, or a cell population before and after treatment. In some embodiments, the expression or biological function of C6orf167 is completely inhibited. Typically, specific inhibition is a statistically meaningful reduction in C6orf167 expression or biological function (e.g., p <= 0.05) using an appropriate statistical test.
  • The growth of any kind of cell may be suppressed according to the present method so long as the cell expresses or over-expresses a C6orf167 gene. Exemplary cells include lung cancer. Similarly, any kind of cancer may be treated and/or prevented by the method of the present invention, so long as cancer expresses or over-expressed a C6orf167 gene. Exemplary cancer include lung cancer.
  • Subjects suffering from or at risk of developing disease related to C6orf167 may be treated with the administration of at least one double-stranded molecule or inhibitory polypeptide of the present invention, at least one vector expressing such molecule or polypeptide, or a composition containing such molecule or polypeptide. For example, subjects suffering from cancer may be treated according to the present methods. The type of cancer may be identified by standard methods according to the particular type of tumor to be diagnosed. More preferably, subjects treated by the methods of the present invention are selected by detecting the expression of C6orf167 gene in a biopsy from the subject by RT-PCR or immunoassay. Preferably, before the treatment of the present invention, the biopsy specimen from the subject is confirmed for C6orf167 gene over-expression by methods known in the art, for example, immunohistochemical analysis or RT-PCR.
  • According to the present method to inhibit cell growth and thereby treat cancer, through the administration of plural kinds of the double-stranded molecules (or vectors expressing or compositions containing the same), each of the molecules may have different structures but act on mRNA that matches the same target sequence of C6orf167 gene. Alternatively, plural kinds of the double-stranded molecules may act on mRNA that matches a different target sequence of same gene. Alternatively, for example, the method may utilize double-stranded molecules directed to one, two or more target sequence of C6orf167 gene.
  • For inhibiting cell growth, a double-stranded molecule of the present invention may be directly introduced into the cells in a form to achieve binding of the molecule with corresponding mRNA transcripts. Similarly, an inhibitory polypeptide of the present invention may be directly introduced into the cells in a form to achieve binding of the polypeptide with a C6orf167 polypeptide. Alternatively, a DNA encoding the double-stranded molecule or the inhibitory polypeptide may be introduced into cells as a vector. For introducing the double-stranded molecules and vectors into the cells, transfection-enhancing agent, such as FuGENE (Roche diagnostics), Lipofectamine 2000 (Invitrogen), Oligofectamine (Invitrogen), and Nucleofector (Wako pure Chemical), may be employed.
  • A treatment is deemed "efficacious" if it leads to clinical benefit such as, reduction in expression of C6orf167 gene, or a decrease in size, prevalence, or metastatic potential of the cancer in the subject. When the treatment is applied prophylactically, "efficacious" means that it retards or prevents cancers from forming or prevents or alleviates a clinical symptom of cancer. Efficaciousness is determined in association with any known method for diagnosing or treating the particular tumor type.
  • To the extent that the methods and compositions of the present invention find utility in the context of "prevention" and "prophylaxis", such terms are interchangeably used herein to refer to any activity that reduces the burden of mortality or morbidity from disease. Prevention and prophylaxis can occur "at primary, secondary and tertiary prevention levels." While primary prevention and prophylaxis avoid the development of a disease, secondary and tertiary levels of prevention and prophylaxis encompass activities aimed at the prevention and prophylaxis of the progression of a disease and the emergence of symptoms as well as reducing the negative impact of an already established disease by restoring function and reducing disease-related complications. Alternatively, prevention and prophylaxis can include a wide range of prophylactic therapies aimed at alleviating the severity of the particular disorder, e.g. reducing the proliferation and metastasis of tumors.
  • The treatment and/or prophylaxis of cancer and/or the prevention of postoperative recurrence thereof include any of the following steps, such as the surgical removal of cancer cells, the inhibition of the growth of cancerous cells, the involution or regression of a tumor, the induction of remission and suppression of occurrence of cancer, the tumor regression, and the reduction or inhibition of metastasis. Effectively treating and/or the prophylaxis of cancer decreases mortality and improves the prognosis of individuals having cancer, decreases the levels of tumor markers in the blood, and alleviates detectable symptoms accompanying cancer. For example, reduction or improvement of symptoms constitutes effectively treating and/or the prophylaxis include 10%, 20%, 30% or more reduction, or stable disease.
  • It is understood that a double-stranded molecule of the present invention degrades C6orf167 mRNA in substoichiometric amounts. Without wishing to be bound by any theory, it is believed that the double-stranded molecule of the invention causes degradation of the target mRNA in a catalytic manner. Thus, as compared to standard cancer therapies, the present invention requires the delivery of significantly less double-stranded molecule at or near the site of cancer in order to exert therapeutic effect.
  • One skilled in the art can readily determine an effective amount of the double-stranded molecule or the inhibitory polypeptide of the present invention to be administered to a given subject, by taking into account factors such as body weight, age, sex, type of disease, symptoms and other conditions of the subject; the route of administration; and whether the administration is regional or systemic. Generally, an effective amount of the double-stranded molecule or the inhibitory polypeptide of the present invention is an intercellular concentration at or near the cancer site of from about 1 nanomolar (nM) to about 100 nM, preferably from about 2 nM to about 50 nM, more preferably from about 2.5 nM to about 10 nM. It is contemplated that greater or smaller amounts of the double-stranded molecule or the inhibitory polypeptide can be administered. The precise dosage required for a particular circumstance may be readily and routinely determined by one of skill in the art.
  • The present methods can be used to inhibit the growth or metastasis of cancer expressing C6orf167 gene; for example lung cancer. In particular, a double-stranded molecule containing a target sequence of C6orf167 gene (e.g., SEQ ID NO: 15 and 16) is particularly useful for the treatment of cancer. Alternatively, an inhibitory polypeptide having an amino acid sequence of SEQ ID NO: 24 can be used for the treatment of cancer.
  • For treating cancer, the double-stranded molecule or the inhibitory polypeptide of the present invention can also be administered to a subject in combination with a pharmaceutical composition different from them. Alternatively, the double-stranded molecule or the inhibitory polypeptide of the present invention can be administered to a subject in combination with another therapeutic method designed to treat cancer. For example, the double-stranded molecule or the inhibitory polypeptide of the present invention can be administered in combination with therapeutic methods currently employed for treating cancer or preventing cancer metastasis (e.g., radiation therapy, surgery and treatment using chemotherapeutic agents, such as cisplatin, carboplatin, cyclophosphamide, 5-fluorouracil, adriamycin, daunorubicin or tamoxifen).
  • In the present methods, the double-stranded molecule or the inhibitory polypeptide can be administered to the subject either as an naked double-stranded molecule or the inhibitory polypeptide, in conjunction with a delivery reagent, or as a recombinant plasmid or viral vector which expresses the double-stranded molecule or the inhibitory polypeptide.
    Suitable delivery reagents for administration in conjunction with the present a double-stranded molecule include the Mirus Transit TKO lipophilic reagent; lipofectin; lipofectamine; cellfectin; or polycations (e.g., polylysine), or liposomes. A typical delivery reagent is a liposome.
    Liposomes can aid in the delivery of the double-stranded molecule or the inhibitory polypeptide to a particular tissue, such as lung tumor tissue, and can also increase the blood half-life of the double-stranded molecule. Liposomes suitable for use in the context of the present invention may be formed from standard vesicle-forming lipids, which generally include neutral or negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally guided by consideration of factors such as the desired liposome size and half-life of the liposomes in the blood stream. A variety of methods are known for preparing liposomes, for example as described in Szoka et al., Ann Rev Biophys Bioeng 1980, 9: 467; and US Pat. Nos. 4,235,871; 4,501,728; 4,837,028; and 5,019,369, the entire disclosures of which are herein incorporated by reference.
  • Preferably, the liposomes encapsulating the double-stranded molecule or the inhibitory polypeptide of the present invention include a ligand molecule that can deliver the liposome to the cancer site. Ligands which bind to receptors prevalent in tumor or vascular endothelial cells, such as monoclonal antibodies that bind to tumor antigens or endothelial cell surface antigens, are preferred.
  • Particularly preferably, the liposomes encapsulating the double-stranded molecule or the inhibitory polypeptide of the present invention are modified so as to avoid clearance by the mononuclear macrophage and reticuloendothelial systems, for example, by having opsonization-inhibition moieties bound to the surface of the structure. In one embodiment, a liposome to be used in the present invention can include both opsonization-inhibition moieties and a ligand.
  • Opsonization-inhibiting moieties for use in preparing the liposomes are typically large hydrophilic polymers that are bound to the liposome membrane. As used herein, an opsonization-inhibiting moiety is "bound" to a liposome membrane when it is chemically or physically attached to the membrane, e.g., by the intercalation of a lipid-soluble anchor into the membrane itself, or by binding directly to active groups of membrane lipids. These opsonization-inhibiting hydrophilic polymers form a protective surface layer which significantly decreases the uptake of the liposomes by the macrophage-monocyte system ("MMS") and reticuloendothelial system ("RES"); e.g., as described in US Pat. No. 4,920,016, the entire disclosure of which is herein incorporated by reference. Liposomes modified with opsonization-inhibition moieties thus remain in the circulation much longer than unmodified liposomes. For this reason, such liposomes are sometimes called "stealth" liposomes.
  • Stealth liposomes are known to accumulate in tissues fed by porous or "leaky" microvasculature. Thus, target tissue characterized by such microvasculature defects, for example, solid tumors, will efficiently accumulate these liposomes; see Gabizon et al., Proc Natl Acad Sci USA 1988, 18: 6949-53. In addition, the reduced uptake by the RES lowers the toxicity of stealth liposomes by preventing significant accumulation in liver and spleen. Thus, liposomes that are modified with opsonization-inhibition moieties can deliver the present double-stranded molecule or the inhibitory polypeptide to tumor cells.
  • Opsonization-inhibiting moieties suitable for modifying liposomes are preferably water-soluble polymers with a molecular weight from about 500 to about 40,000 daltons, and more preferably from about 2,000 to about 20,000 daltons. Such polymers include polyethylene glycol (PEG) or polypropylene glycol (PPG) derivatives; e.g., methoxy PEG or PPG, and PEG or PPG stearate; synthetic polymers such as polyacrylamide or poly N-vinyl pyrrolidone; linear, branched, or dendrimeric polyamidoamines; polyacrylic acids; polyalcohols, e.g., polyvinylalcohol and polyxylitol to which carboxylic or amino groups are chemically linked, as well as gangliosides, such as ganglioside GM.sub.1. Copolymers of PEG, methoxy PEG, or methoxy PPG, or derivatives thereof, are also suitable. In addition, the opsonization-inhibiting polymer can be a block copolymer of PEG and either a polyamino acid, polysaccharide, polyamidoamine, polyethyleneamine, or polynucleotide. The opsonization-inhibiting polymers can also be natural polysaccharides containing amino acids or carboxylic acids, e.g., galacturonic acid, glucuronic acid, mannuronic acid, hyaluronic acid, pectic acid, neuraminic acid, alginic acid, carrageenan; aminated polysaccharides or oligosaccharides (linear or branched); or carboxylated polysaccharides or oligosaccharides, e.g., reacted with derivatives of carbonic acids with resultant linking of carboxylic groups.
    Preferably, the opsonization-inhibiting moiety is a PEG, PPG, or derivatives thereof. Liposomes modified with PEG or PEG-derivatives are sometimes called "PEGylated liposomes".
  • The opsonization-inhibiting moiety can be bound to the liposome membrane by any one of numerous well-known techniques. For example, an N-hydroxysuccinimide ester of PEG can be bound to a phosphatidyl-ethanolamine lipid-soluble anchor, and then bound to a membrane. Similarly, a dextran polymer can be derivatized with a stearylamine lipid-soluble anchor via reductive amination using Na(CN)BH. sub. 3 and a solvent mixture such as tetrahydrofuran and water in a 30:12 ratio at 60 degrees C.
  • Vectors expressing a double-stranded molecule or the inhibitory polypeptide of the present invention are discussed above. Such vectors expressing at least one double-stranded molecule or the inhibitory polypeptide of the present invention can also be administered directly or in conjunction with a suitable delivery reagent, including the Mirus Transit LT1 lipophilic reagent; lipofectin; lipofectamine; cellfectin; polycations (e.g., polylysine) or liposomes. Methods for delivering recombinant viral vectors, which express a double-stranded molecule or the inhibitory polypeptide of the present invention, to an area of cancer in a patient are within the skill of the art.
  • The double-stranded molecule or the inhibitory polypeptide of the present invention can be administered to the subject by any means suitable for delivering the double-stranded molecule or the inhibitory polypeptide into cancer sites. For example, the double-stranded molecule can be administered by gene gun, electroporation, or by other suitable parenteral or enteral administration routes. Similarly, the inhibitory polypeptide of the present invention can administered by suitable parenteral or enteral administration routes.
    Suitable enteral administration routes include oral, rectal, or intranasal delivery.
    Suitable parenteral administration routes include intravesical and intravascular administration (e.g., intravenous bolus injection, intravenous infusion, intra-arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature); peri- and intra-tissue injection (e.g., peri-tumoral and intra-tumoral injection); subcutaneous injection or deposition including subcutaneous infusion (such as by osmotic pumps); direct application to the area at or near the site of cancer, for example by a catheter or other placement device (e.g., a suppository or an implant including a porous, non-porous, or gelatinous material); and inhalation. It is preferred that injections or infusions of the double-stranded molecule, the inhibitory polypeptide or vector be given at or near the site of the cancer.
  • The double-stranded molecule or the inhibitory polypeptide of the present invention can be administered in a single dose or in multiple doses. Where the administration of the double-stranded molecule or the inhibitory polypeptide of the present invention is by infusion, the infusion can be a single sustained dose or can be delivered by multiple infusions. Injection of the double-stranded molecule or the inhibitory polypeptide directly into the tissue is at or near the site of cancer preferred. Multiple injections of the double-stranded molecule into the tissue at or near the site of cancer are particularly preferred.
  • One skilled in the art can also readily determine an appropriate dosage regimen for administering the double-stranded molecule or the inhibitory polypeptide of the present invention to a given subject. For example, the double-stranded molecule or the inhibitory polypeptide can be administered to the subject once, for example, as a single injection or deposition at or near the cancer site. Alternatively, the double-stranded molecule or the inhibitory polypeptide can be administered once or twice daily to a subject for a period of from about three to about twenty-eight days, more preferably from about seven to about ten days. In a preferred dosage regimen, the double-stranded molecule or the inhibitory polypeptide is injected at or near the site of cancer once a day for seven days. Where a dosage regimen requires multiple administrations, it is understood that the effective amount of a double-stranded molecule or the inhibitory polypeptide administered to the subject can include the total amount of a double-stranded molecule or the inhibitory polypeptide administered over the entire dosage regimen.
  • In the present invention, a cancer overexpressing C6orf167 gene can be treated with at least one active ingredient selected from the group consisting of:
    (a) a double-stranded molecule of the present invention,
    (b) DNA encoding thereof,
    (c) a vector encoding thereof,
    (d) an inhibitory polypeptide of the present invention,
    (e) DNA encoding thereof, and
    (f) a vector encoding thereof.
  • The cancer includes, but is not limited to, lung cancer. Accordingly, prior to the administration of the double-stranded molecule or the inhibitory polypeptide of the present invention as active ingredient, it is preferable to confirm whether the expression level of C6orf167 in the cancer cells or tissues to be treated is enhanced as compared with normal cells of the same organ. Thus, in one embodiment, the present invention provides a method for treating a cancer (over)expressing C6orf167 gene, such method including the steps of:
    i) determining the expression level of C6orf167 gene in cancer cells or tissue(s) obtained from a subject with the cancer to be treated;
    ii) comparing the expression level of C6orf167 gene with normal control; and
    iii) administrating at least one component selected from the group consisting of
    (a) a double-stranded molecule of the present invention,
    (b) DNA encoding thereof,
    (c) a vector encoding thereof,
    (d) an inhibitory polypeptide of the present invention,
    (e) DNA encoding thereof, and
    (f) a vector encoding thereof,
    to a subject with a cancer overexpressing C6orf167 gene compared with normal control. Alternatively, the present invention also provides a pharmaceutical composition containing at least one component selected from the group consisting of:
    (a) a double-stranded molecule of the present invention,
    (b) DNA encoding thereof,
    (c) a vector encoding thereof,
    (d) an inhibitory polypeptide of the present invention,
    (e) DNA encoding thereof, and
    (f) a vector encoding thereof,
    for use in administrating to a subject having a cancer overexpressing C6orf167 gene. In other words, the present invention further provides a method for identifying a subject to be treated with:
    (a) a double-stranded molecule of the present invention,
    (b) DNA encoding thereof,
    (c) a vector encoding thereof,
    (d) an inhibitory polypeptide of the present invention,
    (e) DNA encoding thereof, or
    (f) a vector encoding thereof,
    which method may include the step of determining an expression level of C6orf167 gene in subject-derived cancer cells or tissue(s), wherein an increase of the level compared to a normal control level of the gene indicates that the subject has cancer which may be treated with.
  • The method of treating a cancer of the present invention will be described in more detail below.
  • A subject to be treated by the present method is preferably a mammal. Exemplary mammals include, but are not limited to, e.g., human, non-human primate, mouse, rat, dog, cat, horse, and cow.
    According to the present invention, the expression level of C6orf167 gene in cancer cells or tissues obtained from a subject is determined. The expression level can be determined at the transcription (nucleic acid) product level, using methods known in the art. For example, the mRNA of C6orf167 gene may be quantified using probes by hybridization methods (e.g., Northern hybridization). The detection may be carried out on a chip or an array. The use of an array is preferable for detecting the expression level of C6orf167 gene. Those skilled in the art can prepare such probes utilizing the sequence information of C6orf167 gene. For example, the cDNA of C6orf167 gene may be used as the probes. If necessary, the probes may be labeled with a suitable label, such as dyes, fluorescent substances and isotopes, and the expression level of the gene may be detected as the intensity of the hybridized labels.
    Furthermore, the transcription product of C6orf167 gene (e.g., SEQ ID NO: 17 or 19) may be quantified using primers by amplification-based detection methods (e.g., RT-PCR). Such primers may be prepared based on the available sequence information of the gene.
  • Specifically, a probe or primer used for the present method hybridizes under stringent, moderately stringent, or low stringent conditions to the mRNA of C6orf167 gene. As used herein, the phrase "stringent (hybridization) conditions" refers to conditions under which a probe or primer will hybridize to its target sequence, but not to other sequences. Stringent conditions are sequence-dependent and will be different under different circumstances. Specific hybridization of longer sequences is observed at higher temperatures than shorter sequences. Generally, the temperature of a stringent condition is selected to be about 5 degrees C lower than the thermal melting point (Tm) for a specific sequence at a defined ionic strength and pH. The Tm is the temperature (under a defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to their target sequence hybridize to the target sequence at equilibrium. Since the target sequences are generally present at excess, at Tm, 50% of the probes are occupied at equilibrium. Typically, stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 degrees C for short probes or primers (e.g., 10 to 50 nucleotides) and at least about 60 degrees C for longer probes or primers. Stringent conditions may also be achieved with the addition of destabilizing agents, such as formamide.
  • Alternatively, the translation product may be detected for the diagnosis of the present invention. For example, the quantity of observed protein (e.g., SEQ ID NO: 18 or 20) may be determined. Methods for determining the quantity of the protein as the translation product include immunoassay methods that use an antibody specifically recognizing the protein. The antibody may be monoclonal or polyclonal. Furthermore, any fragment or modification (e.g., chimeric antibody, scFv, Fab, F(ab')2, Fv, etc.) of the antibody may be used for the detection, so long as the fragment or modified antibody retains the binding ability to the C6orf167 protein. Methods to prepare these kinds of antibodies for the detection of proteins are well known in the art, and any method may be employed in the present invention to prepare such antibodies and equivalents thereof.
  • As another method to detect the expression level of C6orf167 gene based on its translation product, the intensity of staining may be measured via immunohistochemical analysis using an antibody against the C6orf167 protein. Namely, in this measurement, strong staining indicates increased presence/level of the protein and, at the same time, high expression level of C6orf167 gene.
  • The expression level of a target gene, e.g., the C6orf167 gene, in cancer cells can be determined to be increased if the level increases from the control level (e.g., the level in normal cells) of the target gene by, for example, 10%, 25%, or 50%; or increases to more than 1.1 fold, more than 1.5 fold, more than 2.0 fold, more than 5.0 fold, more than 10.0 fold, or more.
  • The control level may be determined at the same time with the cancer cells by using a sample(s) previously collected and stored from a subject/subjects whose disease state(s) (cancerous or non-cancerous) is/are known. In addition, normal cells obtained from non-cancerous regions of an organ that has the cancer to be treated may be used as normal control. Alternatively, the control level may be determined by a statistical method based on the results obtained by analyzing previously determined expression level(s) of C6orf167 gene in samples from subjects whose disease states are known. Furthermore, the control level can be derived from a database of expression patterns from previously tested cells. Moreover, according to an aspect of the present invention, the expression level of C6orf167 gene in a biological sample may be compared to multiple control levels, which are determined from multiple reference samples. It is preferred to use a control level determined from a reference sample derived from a tissue type similar to that of the subject-derived biological sample. Moreover, it is preferred to use the standard value of the expression levels of C6orf167 gene in a population with a known disease state. The standard value may be obtained by any method known in the art. For example, a range of mean +/- 2 S.D. or mean +/- 3 S.D. may be used as the standard value.
  • In the context of the present invention, a control level determined from a biological sample that is known to be non-cancerous is referred to as a "normal control level". On the other hand, if the control level is determined from a cancerous biological sample, it is referred to as a "cancerous control level".
    When the expression level of C6orf167 gene is increased as compared to the normal control level, or is similar/equivalent to the cancerous control level, the subject may be diagnosed with cancer to be treated.
  • Compositions for Inhibiting or Reducing Cancer Cell Growth or Treating Cancer:
    In addition to the above, the present invention also provides pharmaceutical compositions for inhibiting or reducing cancer cell growth of either or both of treating and preventing cancer, such compositions including the double-stranded molecule, the inhibitory polypeptide of the present invention, or the vector encoding such molecule or polypeptide.
    Of particular interest to the present invention are the following compositions [1] to [23]:
    [1] A composition for either or both of treating and preventing cancer, wherein the composition comprises a pharmaceutically effective amount of a double-stranded molecule against a C6orf167 gene or a vector encoding thereof, and a pharmaceutically acceptable carrier, wherein the double-stranded molecule, when introduced into a cell expressing the C6orf167 gene, inhibits an expression of the C6orf167 gene as well as cell proliferation;
    [2] The composition of [1], wherein the double-stranded molecule acts on mRNA, matching a target sequence of SEQ ID NO: 15 or 16;
    [3] The composition of [1], wherein the sense strand of the double-stranded molecule contains a nucleotide sequence corresponding to a target sequence of SEQ ID NO: 15 or 16;
    [4] The composition of [1], wherein the sense strand of the double-stranded molecule contains a nucleotide sequence corresponding to a target sequence of 3444 to 3462 of SEQ ID NO: 17 or 19, or 3671 to 3689 of SEQ ID NO: 17 or 19;
    [5] The composition of any one of [1] to [4], wherein the sense strand hybridize with antisense strand at the target sequence to form the double-stranded molecule having a less than about 100 nucleotide pairs in length;
    [6] The composition of [5], wherein the sense strand hybridize with antisense strand at the target sequence to form the double-stranded molecule having less than about 75 nucleotide pairs in length;
    [7] The composition of [6], wherein the sense strand hybridize with antisense strand at the target sequence to form the double-stranded molecule having less than about 50 nucleotide pairs in length;
    [8] The composition of [7], wherein the sense strand hybridize with antisense strand at the target sequence to form the double-stranded molecule having less than about 25 nucleotide pairs in length;
    [9] The composition of [8], wherein the sense strand hybridize with antisense strand at the target sequence to form the double-stranded molecule having a between about 19 and about 25 nucleotide pairs in length;
    [10] The composition of any one of [1] to [9], wherein the double-stranded is composed of a single polynucleotide having both the sense and antisense strands linked by an intervening single-strand;
    [11] The composition of [10], wherein the double-stranded molecule have the general formula 5'-[A]-[B]-[A']-3' or 5'-[A']-[B]-[A]-3', wherein [A] is the sense strand containing a nucleotide sequence corresponding to a target sequence of SEQ ID NO: 15 or 16, [B] is the intervening single-strand composed of 3 to 23 nucleotides, and [A'] is the antisense strand containing a sequence complementary to the target sequence;
    [12] The composition of any one of [1] to [11], wherein the double-stranded molecule is composed of RNA;
    [13] The composition of any one of [1] to [11], wherein the double-stranded molecule is composed of both DNA and RNA;
    [14] The composition of [13], wherein the double-stranded molecule is a hybrid of a DNA polynucleotide and an RNA polynucleotide;
    [15] The composition of [14], wherein the sense and the antisense strands of the double-stranded molecule are composed of DNA and RNA, respectively;
    [16] The composition of [14], wherein the double-stranded molecule is a chimera of DNA and RNA;
    [17] The composition of [16], wherein a region flanking to the 3'-end of the antisense strand, or both of a region flanking to the 5'-end of sense strand and a region flanking to the 3'-end of antisense strand are RNA in the double-stranded molecule;
    [18] The composition e of [17], wherein the flanking region is composed of 9 to 13 nucleotides;
    [19] The composition of any one of [1] to [18], wherein the double-stranded molecule contains one or two 3' overhang(s);
    [20] A composition for inhibiting cancer cell growth, or either or both of treating and preventing cancer in a subject, wherein the composition includes a pharmaceutically effective amount of a polypeptide containing a C6orf167-binding domain of an NFKBIL2 polypeptide or a vector encoding the polypeptide, and a pharmaceutically acceptable carrier, wherein the polypeptide lacks a biological function of the NFKBIL2 polypeptide, wherein the biological function is the ability to control a subcellular localization of a C6orf167 polypeptide;
    [21] The composition of [20], wherein the polypeptide is selected from the group consisting of:
    a) a polypeptide comprising an amino acid sequence of SEQ ID NO: 24;
    b) a polypeptide that comprises an amino acid sequence of SEQ ID NO: 24 in which one or more amino acids are substituted, deleted, inserted, and/or added; and
    c) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 23;
    [22] The composition of [21], wherein the polypeptide is modified with a cell-membrane permeable substance; and
    [23] The composition of any one of [1] to [22], containing a transfection-enhancing agent.
  • Suitable compositions of the present invention are described in additional detail below.
    The double-stranded molecule or the inhibitory polypeptide of the present invention is preferably formulated as pharmaceutical compositions prior to administering to a subject, according to techniques known in the art. Pharmaceutical composition of the present invention is characterized as being at least sterile and pyrogen-free. As used herein, "pharmaceutical composition" include formulation for human and veterinary use. Thus, the compositions may be used as pharmaceuticals for humans and other mammals, such as mice, rats, guinea-pigs, rabbits, cats, dogs, sheep, pigs, cattle, monkeys, baboons, and chimpanzees.
  • In the context of the present invention, suitable pharmaceutical formulations of the present invention include those suitable for oral, rectal, nasal, topical (including buccal, sub-lingual, and transdermal), vaginal or parenteral (including intramuscular, subcutaneous and intravenous) administration, or for administration by inhalation or insufflation. Other formulations include implantable devices and adhesive patches that release a therapeutic agent. When desired, the above-described formulations may be adapted to give sustained release of the active ingredient. Methods for preparing pharmaceutical compositions of the present invention are within the skill in the art, for example as described in Remington's Pharmaceutical Science, 17th ed., Mack Publishing Company, Easton, Pa. (1985), the entire disclosure of which is herein incorporated by reference.
  • The present pharmaceutical composition contains the double-stranded molecule or the inhibitory polypeptide of the present invention, or vector encoding such molecule or polypeptide (e.g., 0.1 to 90% by weight), or a pharmaceutically acceptable salt of the molecule, mixed with a pharmaceutically acceptable carrier medium. Preferred physiologically acceptable carrier media are water, buffered water, normal saline, 0.4% saline, 0.3% glycine, hyaluronic acid and the like.
    According to the present invention, the composition may contain plural kinds of the double-stranded molecules, each of the molecules may be directed to the same target sequence, or different target sequences of C6orf167 gene. For example, the composition may contain double-stranded molecules directed to C6orf167 gene. Alternatively, for example, the composition may contain double-stranded molecules directed to one, two or more target sequences of C6orf167 gene.
  • Furthermore, the present composition may contain a vector encoding one or plural double-stranded molecules. For example, the vector may encode one, two or several kinds of the double-stranded molecules of the present invention. Alternatively, the present composition may contain plural kinds of vectors, each of the vectors encoding a different double-stranded molecule.
  • Moreover, the double-stranded molecule or the inhibitory polypeptide of the present invention may be contained as liposomes in the composition. See the section entitled "Method of Inhibiting or Reducing Cancer Cell Growth or Treating Cancer" for details of liposomes.
    Pharmaceutical compositions of the present invention can also include conventional pharmaceutical excipients and/or additives. Suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH adjusting agents. Suitable additives include physiologically biocompatible buffers (e.g., tromethamine hydrochloride), additions of chelants (such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (for example calcium DTPA, CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate). Pharmaceutical compositions of the present invention can be packaged for use in liquid form, or can be lyophilized.
  • For solid compositions, conventional nontoxic solid carriers can be used; for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.
    For example, a solid pharmaceutical composition for oral administration can include any of the carriers and excipients listed above and 10-95%, preferably 25-75%, of one or more double-stranded molecule of the invention. A pharmaceutical composition for aerosol (inhalational) administration can include 0.01-20% by weight, preferably 1-10% by weight, of one or more double-stranded molecule of the present invention encapsulated in a liposome as described above, and propellant. A carrier can also be included as desired; e.g., lecithin for intranasal delivery.
  • In addition to the above, the present composition may contain other pharmaceutically active ingredients so long as they do not inhibit the in vivo function of the double-stranded molecule or the inhibitory polypeptide of the present invention. For example, the composition may contain chemotherapeutic agents conventionally used for treating cancers. The pharmaceutical compositions may also contain other active ingredients such as antimicrobial agents, immunosuppressants or preservatives. Furthermore, it should be understood that, in addition to the ingredients particularly mentioned above, the formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question; for example, those suitable for oral administration may include flavoring agents.
  • In another embodiment, the present invention provides for the use of the double-stranded nucleic acid molecule of the present invention in manufacturing a pharmaceutical composition for treating a cancer characterized by the expression of C6orf167 gene. For example, the present invention relates to a use of double-stranded molecule inhibiting the expression of an C6orf167 gene in a cell, which molecule includes a sense strand and an antisense strand complementary thereto, hybridized to each other to form the double-stranded nucleic acid molecule and target to a sequence of SEQ ID NO: 15 or 16, for manufacturing a pharmaceutical composition for treating cancer expressing C6orf167 gene. Similarly, the present invention relates to a use of inhibitory polypeptide inhibiting the binding between C6orf167 polypeptide and NFKBIL2 polypeptide, which polypeptide includes a C6orf167-binding domain of an NFKBIL2 polypeptide, wherein the polypeptide lacks a biological function of the NFKBIL2 polypeptide, and wherein the biological function is the ability to control a subcellular localization of a C6orf167 polypeptide.
    The present invention further provides the double-stranded molecules or the inhibitory polypeptide of the present invention for use in treating a cancer expressing the C6orf167 gene.
  • Alternatively, the present invention further provides a method or process for manufacturing a pharmaceutical composition for treating a cancer characterized by the expression of C6orf167 gene, wherein the method or process includes a step for formulating a pharmaceutically or physiologically acceptable carrier with a double-stranded molecule inhibiting the expression of C6orf167 gene in a cell, which over-expresses the gene, which molecule includes a sense strand and an antisense strand complementary thereto, hybridized to each other to form the double-stranded nucleic acid molecule and target to a sequence of SEQ ID NO: 15 or 16 as active ingredients. Similarly, the present invention further provides a method or process for manufacturing a pharmaceutical composition for treating a cancer characterized by the expression of C6orf167 gene, wherein the method or process includes a step for formulating a pharmaceutically or physiologically acceptable carrier with a inhibitory polypeptide inhibiting the binding between C6orf167 polypeptide and NFKBIL2 polypeptide, which polypeptide includes a C6orf167-binding domain of an NFKBIL2 polypeptide, wherein the polypeptide lacks a biological function of the NFKBIL2 polypeptide, and wherein the biological function is the ability to control a subcellular localization of a C6orf167 polypeptide.
  • In another embodiment, the present invention provides a method or process for manufacturing a pharmaceutical composition for treating a cancer characterized by the expression of C6orf167 gene, wherein the method or process includes a step for admixing an active ingredient with a pharmaceutically or physiologically acceptable carrier, wherein the active ingredient is a double-stranded nucleic acid molecule inhibiting the expression of C6orf167 gene in a cell, which over-expresses the gene, which molecule includes a sense strand and an antisense strand complementary thereto, hybridized to each other to form the double-stranded nucleic acid molecule and targets to a sequence of SEQ ID NO: 15 or 16. Similarly, the present invention provides a method or process for manufacturing a pharmaceutical composition for treating a cancer characterized by the expression of C6orf167 gene, wherein the method or process includes a step for admixing an active ingredient with a pharmaceutically or physiologically acceptable carrier, wherein the active ingredient is a inhibitory polypeptide inhibiting the binding between C6orf167 polypeptide and NFKBIL2 polypeptide, which polypeptide includes a C6orf167-binding domain of an NFKBIL2 polypeptide, wherein the polypeptide lacks a biological function of the NFKBIL2 polypeptide, and wherein the biological function is the ability to control a subcellular localization of a C6orf167 polypeptide.
    Hereinafter, the present invention is described in more detail with reference to the Examples. However, the following materials, methods and examples only illustrate aspects of the invention and in no way are intended to limit the scope of the present invention. As such, methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention.
    Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
  • The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
    Example 1: General Methods
    Cell lines and clinical samples
    The 24 human lung-cancer cell lines used for this study included nineteen NSCLCs (A427, A549, NCI-H1373, LC319, PC-14, NCI-H358, PC-3, PC-9, NCI-H1666, NCI-H1781, NCI-H647, NCI-H226, NCI-H1703, NCI-H520, LU61, RERF-LC-AI, SK-MES-1, EBC-1, LX1, and NCI-H2170) and four small-cell lung cancers (SCLC: DMS114, DMS273, SBC-3, and SBC-5). The human esophageal carcinoma cell lines used in this study were as follows: twelve ESCC cell lines (TE1, TE2, TE3, TE4, TE5, TE6, TE8, TE9, TE10, TE12, TE13, and TE15) and one adenocarcinoma (ADC) cell line (TE7). All cells were grown in monolayers in appropriate media supplemented with 10% fetal calf serum (FCS) and were maintained at 37 degrees C in an atmosphere of humidified air with 5% CO2. Human airway epithelial cells, SAEC (Cambrex Bio Science Inc.) was also included in the panel of the cells used in this study. Primary lung and esophageal cancer samples had been obtained earlier with informed consent (Kikuchi T, et al. Oncogene 2003; 22:2192-205.;Kakiuchi S, et al. Mol Cancer Res 2003; 1:485-99.; Kakiuchi S, et al. Hum Mol Genet 2004; 13:3029-43.; Kikuchi T, et al. Int J Oncol 2006; 28:799-805.; Taniwaki M, et al. Int J Oncol 2006; 29:567-75.; Yamabuki T, et al. Int J Oncol 2006; 28: 1375-84.). This study and the use of all clinical materials mentioned were approved individual institutional ethics committees.
  • Semiquantitative RT-PCR
    Appropriate dilutions of each single-stranded cDNA prepared from mRNAs of clinical lung and esophagus-cancer samples were prepared, taking the level of beta-actin (ACTB) expression as a quantitative control. The primer sets for amplification were as follows: ACTB-F (5'-GAGGTGATAGCATTGCTTTCG-3') (SEQ ID NO: 1) and ACTB-R (5'-CAAGTCAGTGTACAGGTAAGC-3') (SEQ ID NO: 2) for ACTB, C6orf167-F (5'-GTCTCACCTTGGACAGATGG-3') (SEQ ID NO: 3) and C6orf167-R (5'-CCAAGGATCCTATTACACAGTTGC-3') (SEQ ID NO: 4) for C6orf167. All reactions involved initial denaturation at 95 degrees C for 5 min followed by 22 (for ACTB) or 30 (for C6orf167) cycles of 95 degrees C for 30 s, 56 degrees C for 30 s, and 72 degrees C for 60 s on a GeneAmp PCR system 9700 (Applied Biosystems).
  • Northern-blot analysis
    Human multiple-tissue blots (16 normal tissues including heart, brain, placenta, lung, liver, skeletal muscle, kidney, pancreas, spleen, thymus, prostate, testis, ovary, small intestine, colon, leukocyte; BD Biosciences Clontech) were hybridized with a 32P-labeled PCR product of C6orf167. The partial-length cDNA of C6orf167 was prepared by RT-PCR using primers C6orf167-F1 (CTGGAAGAGGCAGTTGAAAA) (SEQ ID NO: 5) and C6orf167-R1 (ATCGCCCAATATACTGCTCA) (SEQ ID NO: 6). Prehybridization, hybridization, and washing were performed according to the supplier's recommendations. The blots were autoradiographed with intensifying screens at -80 degrees C for 7 days.
  • Anti-C6orf167 antibody
    Synthesized peptide with the amino acids sequence as CLGQMGQDEMQRLENDNT (SEQ ID NO: 7) (1227-1243) (Cistine was added at N terminal) was inoculated into rabbits; the immune sera were purified on affinity columns according to standard methodology. Affinity-purified anti- C6orf167 antibodies were used for western blotting as well as immunocytochemical studies. It was confirmed that the antibody was specific to C6orf167 on western blots using lysates from cell lines that had been transfected with C6orf167 expression vector as well as those from lung cancer cell lines that endogenously expressed C6orf167 or not.
  • Western-blotting
    Cells were lysed in lysis buffer; 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 0.5% NP-40, 0.5% deoxycholate-Na, 0.1% SDS, plus protease inhibitor (Protease Inhibitor Cocktail Set III). The present inventors used an ECL western-blotting analysis system (GE Healthcare Bio-sciences), as described previously (Bencardino, K et al. (March 2007). Internal and Emergency Medicine 2 (1): 3-12.).
  • Immunocytochemical analysis
    Cultured cells were washed twice with PBS(-), fixed and rendered permeable in 1:1 Acetone: methanol solution for 10 minutes at -20 degrees C. Prior to the primary antibody reaction, cells were covered with blocking solution [5% bovine serum albumin in PBS(-)] for 10 minutes to block non-specific antibody binding. After the cells were incubated with a rabbit polyclonal antibody to human C6orf167 (generated to synthesized peptide C6orf167; please see above) or a mouse monoclonal antibody to human NFKBIL2 (Abnova), Alexa Fluor 488-labelled a donkey anti-rabbit secondary antibody (Molecular Probes) or Alexa Fluor 594-labelled a donkey anti-mouse secondary antibody (Molecular Probes) was added to detect endogenous C6orf167 or NFKBIL2, individually. Nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI). The antibody-stained cells were viewed with a laser-confocal microscope (TSC SP2 AOBS: Leica Microsystems).
  • RNA interference assay
    Two independent C6orf167 siRNA oligonucleotides were designed using the C6orf167 sequences (GenBank accession no: NM_198468). Two independent NFKBIL2 siRNA oligonucleotides were purchased (Sigma/Aldrich Catalog No. SASI_Hs02_0012682, SASI_00112683). siRNAs (600 pM) were transfected into two NSCLC cell lines, A549 and LC319 or a cervical cancer cell line HeLa, using 30 micro l of Lipofectamine 2000 (Invitrogen) following the manufacturer's protocol. The transfected cells were cultured for seven days. Cell numbers and viability were measured by Giemsa staining and triplicate 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (cell counting kit-8 solution; Dojindo Laboratories). The siRNA sequences used were as follows: control-1 (si-LUC: luciferase gene from Photinus pyralis), 5'-CGUACGCGGAAUACUUCGA-3' (SEQ ID NO: 8); control-2 (CNT: ON-TARGETplus siCONTROL Non-targeting siRNAs a pool of four oligos: 5'-UGGUUUACAUGUCGACUAA-3' (SEQ ID NO: 9); 5'-UGGUUUACAUGUUUUCUGA-3' (SEQ ID NO: 10); 5'-UGGUUUACAUGUUUUCCUA-3' (SEQ ID NO: 11); and 5'-UGGUUUACAUGUUGUGUGA-3') (SEQ ID NO: 12); siRNA- C6orf167-#1 (si- C6orf167-#1: 5'- CCGCCAAUAUCAUCUCUAAUU-3') (SEQ ID NO: 13); siRNA-C6orf167-#2 (si-C6orf167-#2: 5'-GAACCUGCAAUACAUGGUAUU-3') (SEQ ID NO: 14); siRNA- NFKBIL2-#1(si- NFKBIL2-#1: 5'-GTGATTCGGACCTCATGGAG-3') (SEQ ID NO: 25); siRNA- NFKBIL2-#2(si- NFKBIL2-#2: 5'-AGAAGGCCTACAGGCTGGGC) (SEQ ID NO: 26). Down-regulation of endogenous C6orf167 expression in the cell lines by siRNAs for C6orf167, but not by controls, was confirmed by semiquantitative RT-PCR and western blot analyses.
  • Cell growth assay
    HeLa and LC319 cells were transfected with Mock and pCAGGSn-HA-N1, N2, N3 expressing vectors, COS-7 or HEK293 cells that express endogenous C6orf167 at a very low level were transfected with mock or C6orf167-expressing vectors (pCAGGSn-3xFlag-C6orf167) using Lipofectamin 2000 transfection reagent (Roche). Transfected cells were incubated in culture medium containing 0.8 mg/mL neomycin (Geneticin, Invitrogen) for 7 days. Expression of C6orf167 as well as viability and colony numbers of cells were evaluated by western-blotting, and MTT and colony-formation assays at day 7.
  • Flow cytometric analysis
    Cells transfected with siRNA oligonucleotides against C6orf167 or control siRNAs were plated at densities of 5 X 105 per 60-mm dish. Cells were collected in PBS, and fixed in 70% cold ethanol for 30 min. After treatment with 100 micro-g/mL RNase (Sigma/Aldrich), the cells were stained with 50 micro-g/mL propidium iodide (Sigma/Aldrich) in PBS. Flow cytometric analysis was done on a Cell Lab Quanta SC (BECKMAN COULTER) and analyzed by CXP Analysis software (BECKMAN COULTER). The cells selected from at least 10,000 ungated cells were analyzed for DNA content.
  • Example 2: Up-regulation of C6orf167 in lung cancers
    Genome-wide expression profile analysis of 101 lung cancer cases was previously conducted using cDNA microarray (Daigo Y, Nakamura Y. Gen Thorac Cardiovasc Surg 2008;56:43-53.; Kikuchi T, et al. Oncogene 2003;22:2192-205.; Taniwaki M, et al. Int J Oncol 2006;29:567-75.). Among genes up-regulated in lung cancers, C6orf167 transcript was identified to be over-expressed and it was confirmed by semiquantitative RT-PCR experiments that its expression was increased in all of 15 clinical lung cancer tissues, however hardly detectable in their adjacent normal lung tissues (Fig. 1A). High levels of C6orf167 expression were specifically observed in all of 16 lung-cancer cell lines examined, but its expression was hardly detectable in SAEC cells derived from normal airway epithelial cells (Fig. 1B). High levels of endogenous C6orf167 protein were further confirmed by western-blot analysis in lung and esophageal cancer cell lines using anti-C6orf167 antibody (Fig. 1C).
    Northern blot analysis of 16 normal tissues further confirmed that C6orf167 was hardly detectable in 15 tissues, but exclusively expressed in the testis (Fig.1D).
  • Example 3: Growth promoting effect of C6orf167
    To investigate its growth-promoting role in lung cancer cells, the expression of endogenous C6orf167 in two lung cancer cells, A549 and LC319 was knocked down, by means of the RNAi technique using siRNA oligonucleotide for C6orf167 (Figs. 2A-2C). Semiquantitative RT-PCR experiments detected significant knockdown effect in both transcription and protein level of C6orf167 in the cells transfected with C6orf167 si-#1 and si-#2, but not with or control siRNA (si-LUC and si-CNT). In concordance with the knockdown effect, colony formation and MTT assays clearly revealed growth suppression of lung cancer cells by the two siRNAs, C6orf167 si-#1 and si-#2, compared with two controls siRNAs that showed no knockdown effect. These findings implied a critical role of C6orf167 in the growth of lung cancer cells. Since the present inventor's original gene expression profile database also revealed its high level of expression in clinical cervical cancers, the expression of C6orf167 was also knocked down by siRNAs in a cervical cancer cell line, HeLa, and observed the growth suppressive effect by siRNAs for C6orf167.
  • To further examine the effect of C6orf167 on growth of mammalian cells, plasmids designed to transiently express full-length C6orf167 (pCAGGSn-3xFlag- C6orf167) or mock plasmids were transfected into COS-7 or HEK293 cells. The growth promoting effect was significantly observed in cells transfected with C6orf167 expressing vector compared with mock vector (Fig. 2D).
  • Example 4: NFKBIL2 controls the nucleus localization of C6orf167 protein in cultured cell
    To analyze the function of C6orf167 protein in cancer cells, immunoprecipitation assay coupled with MS analysis was performed. NFKBIL2 (nuclear factor of kappa (NFKB) light polypeptide gene enhancer in B-cells inhibitor-like 2) was identified as a C6orf167-interacting protein (Fig. 3A). Previous reports independently suggested the roles of C6orf167-NFKBIL2 interaction in genomic stability and DNA replication in immortalized cell lines (O'Donnell L, et al. Molecular Cell . 2010; 40, 619-31; Duro E, et al. Molecular Cell . 2010; 40, 632-44; Brenda C, et al. Molecular Cell. 2010; 40, 645-57; Piwko W, et al. The EMBO Journal. 2010; 29 ( 24 ) 4210-4222), however no study has indicated critical roles of activation of C6orf167 and NFKBIL2 in clinical cancers and investigated their functional importance in carcinogenesis. Western blotting using cell lines derived from lung cancers and antibodies to C6orf167 and NFKBIL2 revealed the co-expresstion of these two proteins (Fig. 7B). The interactions between these proteins were confirmed using IP-WB analysis (Fig. 3B). Subsequently, immunofluorescence analysis was performed to identify the subcellular localization of endogenous C6orf167 protein using HeLa cells. The data showed that this protein was mainly located in the nucleus and weakly in the cytoplasm (Fig. 3C). However, subcellular localization of exogenous C6orf167 protein using mammalian cells COS-7 or NIH3T3 showed that this protein was mainly locate in the cytoplasm and the protein aggregation was also observed (data not shown). Therefore, it was speculated that in cancer cells, C6orf167 may interact with NFKBIL2 protein and control its subcellular localization. Next, C6orf167 and its interacting protein NFKBIL2 expressing vectors were co-transfected and it was found that cells transfected with both these two vectors showed that without the expression of NFKBIL2 protein, C6orf167 was mainly located in the cytoplasm. Nuclear localization of exogenous C6orf167 was firstly observed in only cells that expressed NFKBIL2 protein (Fig. 3D). These data impulsively elucidated that the nuclear localization of C6orf167 protein in cells was controlled by the expression of NFKBIL2 protein. Furthermore, these data was confirmed by using fractionation cytoplasm and nucleus detecting western blotting method (Fig. 3E).
  • In addition, it was also confirmed that exogenous C6orf167 and NFKBIL2 proteins stabilized their protein level in cells. Furthermore, knockdown of endogenous C6orf167 with siRNA for C6orf167 8si-C6orf167) reduced NFKBIL2 protein level in lung cancer LC319 cells, and reduction of NFKBIL2 with si-NFKBIL2 reduced C6orf167 levels and significantly suppressed cancer cell growth (Fig. 3F, Fig. 8 and Fig.9). These data suggest that the expression of NFKBIL2 is likely to promote nuclear localization and stability of C6orf167 protein, and a complex including these two proteins could coordinately play pivotal roles in cell growth and/or survival.
  • Example 5: Dominant negative effect of partial protein NFKBIL2 in lung cancer cell lines
    To examine whether NFKBIL2 protein play important roles in lung carcinogenesis, partial proteins of C6orf167 and NFKBIL2 were cloned to identify binding region (Fig. 4A). Immunoprecipitation and western blotting assays revealed that N-terminal of C6orf167 protein strongly bound to NFKBIL2 protein at C-terminal (Fig. 4B). Because nuclear localization of C6orf167 protein was controlled in the presence of NFKIL2 protein, subsequently it was investigated which part of NFKBIL2 protein could control the subcellular localization of C6orf167 protein in cultured cells. Plasmids expressing partial proteins of NFKBIL2 were co-transfected with full-length C6orf167 expressing vectors. Interestingly, N1 (N terminal partial protein of NFKBIL2) and N2 (central partial protein of NFKBIL2) could locate in the nucleus. However, according to IP-WB analysis results, these two partial proteins could not bind with C6orf167 protein, although these two proteins were detected in the nucleus but protein aggregation and cytoplasm localization of C6orf167 protein were observed. In contrast, the partial protein N3 which could bind to C6orf167 protein could not be located in the nucleus (Fig. 4C). Taken together, it is hypothesized that if nucleus localization of C6orf167 protein is important for cancer cells growth, inhibition of nucleus location of C6orf167 protein might reduced the cells growth. To examine whether exogenous partial protein N3 can inhibit the nucleus localization of C6orf167 protein in cancer cells, Mock, N1, N2, N3 expressing vectors transfected to cells which is highly expressed C6orf167 protein. Predictably, cells which were transfected with N3 vector showed the reduction of nuclear localization of C6orf167 protein (Fig. 4D).
  • Furthermore, to investigate the functional significance of interaction between C6orf167 and NFKBIL2 for growth or survival of lung cancer cells, growth assay was performed using high C6orf167 protein expression cells transfected with each partial NFKBIL2 proteins and Mock vector. The data showed that cells expressed N3, the partial protein binding with C6orf167 protein at cytoplasm, inhibited the cells growth as measured in MTT assay. Our finding indicated that inhibition of the interaction between C6orf167 and NFKBIL2 protein reduced the nucleus localization of C6orf167 protein, and resulted in cancer cells growth suppression (Fig. 4E).
  • Example 6: C-terminal portion of NFKIL2 protein is crucial for binding to C6orf167 protein
    To examine whether the C6orf167-NFKBIL2 protein complex may play important roles in carcinogenesis, the present inventors subsequently constructed various plasmids expressing partial C6orf167 proteins with Flag tag or partial NFKBIL2 proteins with HA tag, and transfected them into COS-7 cells (Fig. 10A). Immunoprecipitation and western blotting assays using antibodies to Flag- or HA-tags revealed that an N-terminal portion of C6orf167 protein (C1; codon 1-414) could bind to a C-terminal region of NFKBIL2 (N3; codon 823-1244) (Fig. 10B). Because immunocytochemical analysis revealed that nuclear localization of C6orf167 protein appeared to require the presence of NFKIL2 protein in the nucleus (Fig. 3D), the present inventors subsequently investigated which part of NFKBIL2 protein is essential for subcellular localization of C6orf167 protein in cultured cells. Plasmids expressing partial proteins of NFKBIL2 were co-transfected with full-length C6orf167 expression vector into COS-7 cells. Interestingly, N-terminal (N1; codon 1-450) and central part (N2; codon 403-836) of NFKBIL2 proteins could be localized in the nucleus, while aggregated C6orf167 protein was mainly located in the cytoplasm of the same cells (Fig. 10C). It is concordant with the data that these two partial proteins (N1 and N2) could not bind to C6orf167 protein as indicated by immunoprecipitation analyses. In contrast, C6orf167 protein and C-terminal part of NFKBIL2 protein (N3; codon 823-1244) that could bind to C6orf167 protein were mainly localized in the cytoplasm of the cells (Fig. 10C). The data indicate that N-terminal (N1; codon 1-450) and central (N2; codon 403-836) parts of NFKBIL2 are more important for nuclear localization of NFKBIL2, while its C-terminal part (N3; codon 823-1244) is essential for binding to C6orf167.
  • Example 7: Dominant negative growth suppressive effect of partial NFKBIL2 protein including C6orf167-binding site.
    According to the data above, the present inventors hypothesized that if nuclear localization of C6orf167 protein is important for cancer cells growth, reduction of C6orf167 protein in the nucleus by inhibiting the interaction between C6orf167 and NFKBIL2 could suppress the cancer cell growth. To examine whether exogenous expression of partial N3 protein can inhibit the C6orf167-NFKBIL2 interaction and cell growth, the present inventors co-transfected full-length C6orf167 and either of full-/partial-length NFKBIL2 expressing vectors (N1, N2, or N3) into HEK293 cells, and found that the amount of exogenous full-length NFKBIL2 protein that binds to exogenous C6orf167 was significantly decreased after introduction of the partial N3 protein, as demonstrated by immunoprecipitation assays, while it was not changed in the cells transfected with N1 or N2 vectors (Fig. 5A). To investigate the functional significance of the interaction between C6orf167 and NFKBIL2 for growth of cancer cells, either of vectors expressing partial NFKBIL2 proteins or mock vectors were transfected into two cancer cell lines, HeLa and LC319, which highly expressed both endogenous C6orf167 and NFKBIL2 proteins and lung fibroblast CCDlu-19 cells in which C6orf167 expression was hardly detectable. Expectedly, exogenous expression of the C-terminal portion of NFKIL2 protein (N3) reduced the levels of C6orf167 protein in the nucleus and inhibited the growth of HeLa and LC319 cells as measured by MTT assay, while it did not affect the growth of C6orf167-negative CCDLu-19 cells (Figs. 4D, 5B-5C). These findings imply that inhibition of the interaction between the C6orf167 and NFKBIL2 protein can suppress the nuclear localization of C6orf167 protein, and resulted in the reduction of cancer growth, and that inhibition of the interaction in cancer cells by small molecules might be a potential therapeutic strategy for new cancer treatment.
  • Example 8: C6orf167 protein acts as an upstream molecule of NFKB pathway
    Since NFKIL2 protein was indicated to be involved in the NFKB pathway that plays an essential role in the promotion of cell proliferation and anti-apoptosis (Rayet B.et al, Oncogene. 1999; 18, 6938-47, Tergaonkar V. Int J. Biochem. Cell Biol. 2006; 38, 1647-53, Yamamoto Y.et al, J Clin Invest. 2001; 107:135-42), the present inventors examined the expression of NFKB p65/RelA protein in HeLa cells in which both exogenous C6orf167 and NFKIL2 were introduced, and found that the level of endogenous p65/RelA protein was elevated compared with those of cells introduced NFKIL2 alone (Fig. 11). The result suggests that the expression of C6orf167-NFKBIL2 complex may positively regulate the NFKB pathway. Subsequently, the present inventors attempted to examine the effect of endogenous C6orf167 expression on the NFKB pathway molecules using cytoplasmic and nuclear fraction of HeLa and LC319 cells that were treated with TNF-alpha. Firstly it was confirmed that the level of RelA/p65 was increased in the nucleus of the cells by TNF-alpha stimulation (Representative data of HeLa cells was shown in Fig. 12), but that of endogenous RelA/p65 protein was decreased in these cells transfected with siRNA for C6orf167 (si-C6orf167) after TNF-alpha treatment, compared to cells with control siRNA (si-LUC) (Fig. 6A). The present inventors then examined the relationship between C6orf167 protein and downstream molecules of RelA/p65 such as Bcl-XL and TRAF1/2 that were the anti-apoptosis factors. When the si-LUC-transfected HeLa cells were treated with TNF-alpha, Bcl-XL and TRAF1 were increased in accordance with the elevation of RelA/p65 (Fig. 6B). However, the elevation of p65, Bcl-XL and TRAF1 were not detected in the TNF-alpha-stimulated cells transfected with si-C6orf167. The expression level of C6orf167 protein showed good correlation with those of p65, Bcl-XL and TRAF1 proteins in lung cancer cell lines (Fig. 7B).
  • To further examine the effect of C6orf167 expression on apoptosis pathway in cancer cells, cancer cells that were transfected with si-C6orf167 were cultured under DNA damage condition using DNA-damaging agents (cisplatin/CDDP or 5-fluorouracil/5-FU). After knockdown of C6orf167 expression with si-C6orf167 in HeLa cells, the cells were treated with CDDP (50 micro-g/mL) or 5-FU (50 micro-g/mL) for 48 hours and harvested the cells for flow cytometric analysis. The sub G1 population of the cells which were transfected with si-C6orf167 was significantly increased compared with those with control siRNA (si-LUC) under DNA damage condition (Figs. 13A and 13B). When the present inventors exposed the cells that were transfected with si-C6orf167 or si-LUC with 20J of ultraviolet for 48 hours, the similar results were observed (data not shown). Western blotting using the HeLa cells which were transfected with si-C6orf167 or si-LUC, and subsequently treated with CDDP as mentioned above revealed that induction of DNA repair molecules such as ATM, CSB and p53 as well as RelA/p65 and its downstream anti-apoptosis factor Bcl-XL were significantly suppressed in the cells transfected with si-C6orf167 compared with those transfected with si-LUC (Fig. 6C). The data suggest that C6orf167 can function as an upstream molecule of these anti-apoptosis factors and also affect the induction of some DNA repair pathway molecules (Fig. 6D).
  • Discussion
    Despite the recent development of surgical techniques combined with various treatment modalities such as radiotherapy and chemotherapy, clinical outcome of lung and esophageal cancer patients still remains poor. Therefore, development of new types of anti-cancer drugs is eagerly awaited. To identify novel target molecules for drug development, the present inventors combined genome-wide expression profile analysis of genes that were overexpressed in lung and esophageal cancer cells with high-throughput screening of loss-of-function effects by means of the RNAi technique and tumor tissue microarray analysis (Kikuchi T,et al. Oncogene 2003; 22:2192-205, Kakiuchi S, et al. Mol Cancer Res 2003; 1:485-99, Kakiuchi S, et al. Hum Mol Genet 2004; 13:3029-43, Furukawa C, et al. Cancer Res 2005; 65:7102-10, Hayama S, et al. Cancer Res 2007; 67:4113-22, Hirata D, et al. Clin Cancer Res 2009; 15:256-66, Ishikawa N, et al. Clin Cancer Res 2004; 10:8363-70, Takano A, et al. Cancer Res 2009; 69: 6694-703, Sato N, et al. Cancer Res 2010; 70: 5326-36, Kono K, et al. Cancer Sci. 2009; 100: 1502-9, Tomita Y, et al. Cancer Sci 2011 ; 102 (49) 697-705). Through this systematic approach, the present inventors found C6orf167 to be up-regulated frequently in clinical lung and esophageal cancer samples, and showed that this gene product plays an indispensable role in the growth and/or survival of cancer cells.
  • It was demonstrated that C6orf167 is a putative oncogene and that its nuclear localization and stabilization was enhanced by binding to NFKBIL2. In addition, the present inventors revealed that introduction of the C-terminal portion of NFKBIL2 protein into cancer cells could dominant-negatively inhibit the nuclear localization of C6orf167 possibly by blocking the C6orf167-NFKBIL2 interaction, and resulted in the suppression of cancer cell growth/survival. Furthermore, transfection of siRNAs against C6orf167 or NFKBIL2 into cancer cells suppressed their expression and the cell growth. Therefore, inhibition of the C6orf167-NFKBIL2 interaction or suppressing C6orf167 protein function can be an effective approach for development of novel cancer therapy.
  • To date, NFKB transcription factors are known to be the key regulators of immune, inflammatory and acute phase responses, and to be involved in the control of cell proliferation and apoptosis (Rayet B.et al, Oncogene. 1999; 18, 6938-47, Tergaonkar V. Int J. Biochem. Cell Biol. 2006; 38, 1647-53, Yamamoto Y.et al, J Clin Invest. 2001; 107:135-42, Kim, H. J.et al, Cell Death Differ. 2006; 13, 738-47). Activation of NFKB activity and consequent induction of its downstream genes lead to the oncogenesis in mammalian cells. C6orf167 protein appeared to act as an upstream molecule of RelA/p65 and be indispensable for induction of anti-apoptosis factors, Bcl-XL or TRAF1. Further studies on the regulation and function of C6orf167 protein will contribute to the understanding of molecular mechanism of carcinogenesis through the activation of C6orf167 and NFKB pathway.
  • In cancer chemotherapy, many kinds of DNA damaging agents are being used. The most common approach for targeting the cell cycle is to exploit the effect of DNA-damaging chemotherapeutic agents like 5-FU or CDDP, whose effects are mediated through diverse intracellular targets inducing apoptosis in various cancer cells (BJ Lee, et al. Chemotherapy. 2005; 51: 103-10). However, the toxicity of DNA-damaging drugs can be diminished by the activities of several DNA repair pathways as well as anti-apoptotic factors. Therefore, inhibitors of specific DNA repair and/or anti-apoptotic pathways might be promising therapeutic strategy for novel cancer treatments which can improve the efficacy of DNA damage-based cancer therapy (BJ Lee, et al. Chemotherapy. 2005; 51: 103-10). These data suggested the involvement of C6orf167 in cellular response to DNA damaging agents. In fact, knockdown of C6orf167 expression also enhanced the apoptosis of cancer cells that were exposed to DNA-damaging agents including 5-FU and CDDP probably due to inhibition of induction of DNA repair molecules such as ATM, CSB and p53 as well as RelA/p65 and its downstream anti-apoptosis factor Bcl-XL. The combined data of our experiments suggest that C6orf167 might function as an upstream molecule of these anti-apoptosis factors and DNA-repair molecules and that targeting C6orf167 could have a significant advantage in avoiding the resistance of cancer cells to anti-cancer treatments, although the detailed function of C6orf167 in drug response of the cells and in carcinogenesis remains to be elucidated.
    In summary, these data indicate that C6orf167 is involved in NFKB pathway in cancer cells through its interaction with NFKBIL2 and that it might be a promising candidate target for developing highly specific anti-cancer drugs with minimal risk of adverse effects.
  • The data provided herein add to a comprehensive understanding of cancers, facilitate development of novel diagnostic strategies, and provide molecular targets for therapeutic drugs and preventative agents. Such information contributes to a more profound understanding of tumorigenesis, and provides indicators for developing useful strategies for diagnosis, treatment, and ultimately prevention of cancers.
    According to the microarray data, C6orf167 was found as a promising therapeutic target molecule. C6orf167 protein was frequently up-regulated in clinical lung cancer samples, and showed that this gene product plays an indispensable role in the growth of lung cancer cells. To date, no study has shown that C6orf167 could be involved in carcinogenesis. In the present invention, it has been shown that C6orf167 is a putative oncogene that is highly and frequently expressed in lung cancers. Inhibition of the interaction between C6orf167 and its interacting protein NFKBIL2 is a useful therapeutic strategy for the development of new type of anti-cancer drugs.
  • For example, given its differential expression, C6orf167 can be conveniently used as a molecular diagnostic marker for identifying and detecting cancer, in particular, lung cancer. Accordingly, the C6orf167 gene and the proteins encoded thereby find utility in diagnostic kits and assays of cancer.
    The present invention further demonstrates that the cell growth may be suppressed by a double-stranded molecule that specifically targets the C6orf167 gene or an C-terminal partial protein of NFKBIL2. Thus, the double-stranded molecule and C-terminal partial protein of NFKBIL2 are useful as anti-cancer pharmaceuticals. Furthermore, C6orf167 polypeptide is a useful target for the development of anti-cancer pharmaceuticals. For example, substances that block the expression of C6orf167 protein or prevent its activity find therapeutic utility as anti-cancer agents, particularly anti-cancer agents for the treatment of lung cancer.
  • All publications, databases, sequences, patents, and patent applications cited herein are herby incorporated by reference.
    While the invention has been described in detail and with reference to specific embodiments thereof, it is to be understood that the foregoing description is exemplary and explanatory in nature and is intended to illustrate the invention and its preferred embodiments. Through routine experimentation, one skilled in the art will readily recognize that various changes and modifications can be made therein without departing from the spirit and scope of the invention. Thus, the invention is intended to be defined not by the above description, but by the following claims and their equivalents.

Claims (40)

  1. A method of detecting or diagnosing cancer or a predisposition for developing cancer in a subject, wherein the method comprises a step of determining an expression level of a C6orf167 gene in a subject-derived biological sample, wherein an increase of the level compared to a normal control level of the gene indicates the presence of cancer in the subject, or that the subject suffers from or is at risk of developing cancer, wherein the expression level is determined by any one of method selected from the group consisting of:
    (a) detecting an mRNA of a C6orf167 gene;
    (b) detecting a protein encoded by a C6orf167 gene; and
    (c) detecting a biological activity of a protein encoded by a C6orf167 gene.
  2. The method of claim 1, wherein the increase is at least 10% greater than the normal control level.
  3. The method of claim 1 or 2, wherein the subject-derived biological sample is a biopsy sample.
  4. The method of any one of claims 1 to 3, wherein the cancer is lung cancer.
  5. A kit for detecting or diagnosing cancer, wherein the kit comprises at least one reagent selected from the group consisting of:
    (a) a reagent for detecting an mRNA of a C6orf167 gene;
    (b) a reagent for detecting a protein encoded by a C6orf167 gene; and
    (c) a reagent for detecting a biological activity of a protein encoded by a C6orf167 gene.
  6. The kit of claim 5, wherein the reagent comprises an oligonucleotide that hybridizes to the mRNA of the C6orf167 gene, or an antibody against the protein encoded by the C6orf167 gene.
  7. A reagent for detecting or diagnosing cancer, wherein the reagent comprises an oligonucleotide that hybridizes to the mRNA of the C6orf167 gene, or an antibody against the protein encoded by the C6orf167 gene.
  8. The kit of claim 5 or 6, or the reagent of claim 7, wherein the cancer is lung cancer.
  9. A method of screening for a candidate substance for either or both of treating and preventing cancer, or inhibiting cancer cell growth, wherein the method comprises the steps of:
    (a) contacting a test substance with a C6orf167 polypeptide or a functional equivalent thereof;
    (b) detecting the binding activity between the polypeptide or the functional equivalent and the test substance; and
    (c) selecting the test substance that binds to the polypeptide or the functional equivalent as a candidate substance for either or both of treating and preventing cancer.
  10. A method of screening for a candidate substance for either or both of treating and preventing cancer, or inhibiting cancer cell growth, wherein the method comprises the steps of:
    (a) contacting a test substance with a cell expressing a C6orf167 gene;
    (b) detecting an expression level of the C6orf167 gene in the cell of the step (a); and
    (c) selecting the test substance that reduces the expression level detected in the step (b) in comparison with the expression level of the C6orf167 gene detected in the absence of the test substance.
  11. A method of screening for a candidate substance for either or both of treating and preventing cancer, or inhibiting cancer cell growth, wherein the method comprises the steps of:
    (a) contacting a test substance with a C6orf167 polypeptide or a functional equivalent thereof;
    (b) detecting a biological activity of the polypeptide or the functional equivalent of the step (a); and
    (c) selecting the test substance that suppresses the biological activity of the polypeptide or the functional equivalent detected in the step (b) in comparison with the biological activity detected in the absence of the test substance.
  12. The method of claim 11, wherein the biological activity is a cell proliferation promoting activity, a binding activity to an NFKBIL2 polypeptide or nuclear localization activity.
  13. A method of screening for a candidate substance for either or both of treating and preventing cancer, or inhibiting cancer cell growth, wherein the method comprises the steps of:
    a) contacting a test substance with a cell into which a vector comprising the transcriptional regulatory region of a C6orf167 gene and a reporter gene that is expressed under the control of the transcriptional regulatory region has been introduced,
    b) measuring the expression and/or activity levels of the reporter gene in the step (a); and
    c) selecting the test substance that reduces the expression and/or activity levels of said reporter gene detected in the step (b) in comparison with the expression and/or activity levels in the absence of the test substance.
  14. A method of screening for a candidate substance for either or both of treating and preventing cancer, inhibiting cancer cell growth or the binding between a C6orf167 polypeptide and an NFKBIL2 polypeptide, wherein the method comprises the steps of:
    a) contacting a C6orf167 polypeptide or a functional equivalent thereof with an NFKBIL2 polypeptide or a functional equivalent thereof, in the presence of a test substance;
    b) detecting the binding between the polypeptides; and
    c) selecting the test substance that inhibits the binding between the polypeptides.
  15. The method of claim 14, wherein the functional equivalent of the C6orf167 polypeptide comprises an NFKBIL2-binding domain of the C6orf167 polypeptide.
  16. The method of claim 15, wherein the functional equivalent of the C6orf167 polypeptide comprises an amino acid sequence of 1 to 414 of SEQ ID NO: 18 or 20.
  17. The method of any one of claims 14 to 16, wherein the functional equivalent of the NFKBIL2 polypeptide comprises a C6orf167-binding domain of the NFKBIL2 polypeptide.
  18. The method of claim 17, wherein the functional equivalent of the NFKBIL2 polypeptide comprises an amino acid sequence of 932 to 1378 of SEQ ID NO: 22.
  19. The method of any one of claims 9 to 18, wherein the cancer is lung cancer.
  20. A double-stranded molecule comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence corresponding to a target sequence selected from the group consisting of a nucleotide sequences of 3444 to 3462 of SEQ ID NO: 17 or 19, and 3671 to 3689 of SEQ ID NO: 17 or 19, and the antisense strand comprises a nucleotide sequence complementary to the target sequence, wherein the strands hybridize to each other at the target sequence to form the double-stranded molecule, and wherein the double-stranded molecule, when introduced into a cell expressing a C6orf167 gene, inhibits an expression of the C6orf167 gene as well as cell proliferation.
  21. The double-stranded molecule of claim 20, wherein the sense strand hybridizes with antisense strand at the target sequence to form the double-stranded molecule having between 19 and 25 nucleotide pairs in length.
  22. The double-stranded molecule of claim 20 or 21, wherein the double-stranded molecule has one or two 3' overhangs at the 3' ends of the sense strand and/or the antisense strand.
  23. The double-stranded molecule of any one of claims 20 to 22, wherein the double-stranded molecule is a single polynucleotide comprising the sense strand and the antisense strand linked via a single-stranded nucleotide sequence.
  24. The double-stranded molecule of claim 23, wherein said polynucleotide has the general formula 5'-[A]-[B]-[A']-3' or 5'-[A']-[B]-[A]-3', wherein [A] is a sense strand comprising a nucleotide sequence corresponding to a target sequence selected from the group consisting of nucleotide sequences of 3444 to 3462 of SEQ ID NO: 17 or 19, and 3671 to 3689 of SEQ ID NO: 17 or 19; [B] is a nucleotide sequence consisting of about 3 to about 23 nucleotides; and [A'] is an antisense strand comprising a nucleotide sequence complementary to the target sequence.
  25. A vector encoding the double-stranded molecule of any one of claims 20 to 24.
  26. A method of either or both of treating and preventing cancer in a subject, wherein the method comprises the step of administering to the subject a pharmaceutically effective amount of a double-stranded molecule against a C6orf167 gene or a vector encoding thereof, wherein the double-stranded molecule, when introduced into a cell expressing the C6orf167 gene, inhibits an expression of the C6orf167 gene as well as cell proliferation.
  27. The method of claim 26, wherein the double-stranded molecule is that of any one of claims 20 to 24.
  28. The method of claim 26, wherein the vector is that of claim 25.
  29. A composition for either or both of treating and preventing cancer, wherein the composition comprises a pharmaceutically effective amount of a double-stranded molecule against a C6orf167 gene or a vector encoding thereof, and a pharmaceutically acceptable carrier, wherein the double-stranded molecule, when introduced into a cell expressing the C6orf167 gene, inhibits an expression of the C6orf167 gene as well as cell proliferation.
  30. The composition of claim 29, wherein the double-stranded molecule is that of any one of claims 20 to 24.
  31. The composition of claim 29, wherein the vector is that of claim 25.
  32. A polypeptide comprising a C6orf167-binding domain of an NFKBIL2 polypeptide, wherein the polypeptide lacks a biological function of the NFKBIL2 polypeptide, and wherein the biological function is a function to control a subcellular localization of a C6orf167 polypeptide.
  33. The polypeptide of claim 32, wherein the polypeptide is selected from the group consisting of:
    a) a polypeptide comprising an amino acid sequence of SEQ ID NO: 24;
    b) a polypeptide that comprises an amino acid sequence of SEQ ID NO: 24 in which one or more amino acids are substituted, deleted, inserted, and/or added; and
    c) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 23.
  34. The polypeptide of claim 32 or 33, which is modified with a cell-membrane permeable substance.
  35. A polynucleotide encoding the polypeptide of claim 32 or 33.
  36. A vector encoding the polypeptide of claim 32 or 33.
  37. A method of either or both of treating and preventing cancer in a subject, wherein the method comprises the step of administering to the subject a pharmaceutically effective amount of the polypeptide of any one of claims 32 to 34 or the vector of claim 36.
  38. A composition for either or both of treating and preventing cancer, wherein the composition comprises a pharmaceutically effective amount of the polypeptide of any one of claims 32 to 34 or the vector of claim 36.
  39. The method of claims 26, 27, 28, or 37, wherein the cancer to be treated is lung cancer.
  40. The composition of claims 29, 30, 31, or 38, wherein the cancer to be treated is lung cancer.
EP11817909.2A 2010-08-19 2011-08-09 C6orf167 as a target gene for cancer therapy and diagnosis Withdrawn EP2606132A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US37518410P 2010-08-19 2010-08-19
US40192710P 2010-08-19 2010-08-19
PCT/JP2011/004507 WO2012023259A1 (en) 2010-08-19 2011-08-09 C6orf167 as a target gene for cancer therapy and diagnosis

Publications (1)

Publication Number Publication Date
EP2606132A1 true EP2606132A1 (en) 2013-06-26

Family

ID=45604929

Family Applications (1)

Application Number Title Priority Date Filing Date
EP11817909.2A Withdrawn EP2606132A1 (en) 2010-08-19 2011-08-09 C6orf167 as a target gene for cancer therapy and diagnosis

Country Status (3)

Country Link
EP (1) EP2606132A1 (en)
JP (1) JP2013542711A (en)
WO (1) WO2012023259A1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2026077451A1 (en) * 2024-10-11 2026-04-16 中国药科大学 Use of novel micropeptide in cancer treatment
CN120189429B (en) * 2025-05-09 2026-02-27 中国科学院生物物理研究所 Application of inhibitor targeting C6orf223 protein in preparation of tumor treatment drugs

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2295570A1 (en) * 2005-07-27 2011-03-16 Oncotherapy Science, Inc. Method of diagnosing small cell lung cancer
EP2311985A1 (en) * 2005-07-27 2011-04-20 Oncotherapy Science, Inc. Sirna for treating esophageal cancer
TW201100090A (en) * 2009-04-01 2011-01-01 Oncotherapy Science Inc C6orf167 peptides and vaccines containing the same

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2012023259A1 *

Also Published As

Publication number Publication date
WO2012023259A1 (en) 2012-02-23
JP2013542711A (en) 2013-11-28

Similar Documents

Publication Publication Date Title
US8420329B2 (en) Methods for diagnosing or treating prostate cancer
US8512944B2 (en) PRMT1 for target genes of cancer therapy and diagnosis
WO2011096211A1 (en) Whsc1 and whsc1l1 for target genes of cancer therapy and diagnosis
US8975086B2 (en) Method for treating or preventing bladder cancer using the DEPDC1 polypeptide
WO2010023856A1 (en) Pancreatic cancer related gene ttll4
WO2010023855A1 (en) C12orf48 as a target gene for cancer therapy and diagnosis
WO2012023285A1 (en) Ehmt2 as a target gene for cancer therapy and diagnosis
WO2012023259A1 (en) C6orf167 as a target gene for cancer therapy and diagnosis
WO2012023290A1 (en) Rasef as tumor marker and therapeutic target for cancer
WO2010023864A1 (en) Oip5 as a target gene for cancer therapy and diagnosis
WO2011024441A1 (en) Ercc6l as target genes for cancer therapy and diagnosis
WO2012023284A1 (en) Lhx4 as a target gene for cancer therapy and diagnosis
WO2012023288A1 (en) Fam161a as a target gene for cancer therapy and diagnosis
WO2012023286A1 (en) Lrrc42 as a target gene for cancer therapy and diagnosis
WO2012023287A1 (en) Suv420h1 and suv420h2 as target genes for cancer therapy and diagnosis
WO2011018898A1 (en) Cdc45l as tumor marker and therapeutic target for cancer

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20130312

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20130531