EP2590646A1 - Method for inhibition of nf-kb gene expression - Google Patents

Method for inhibition of nf-kb gene expression

Info

Publication number
EP2590646A1
EP2590646A1 EP11746612.8A EP11746612A EP2590646A1 EP 2590646 A1 EP2590646 A1 EP 2590646A1 EP 11746612 A EP11746612 A EP 11746612A EP 2590646 A1 EP2590646 A1 EP 2590646A1
Authority
EP
European Patent Office
Prior art keywords
daidzein
daidzin
palmitate
cells
gene expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP11746612.8A
Other languages
German (de)
French (fr)
Inventor
Sushmita Bhattacharya
Suman Dasgupta
Pomy Barma
Anindita Biswas
Bikash Chandra Pal
Shelley Bhattacharya
Samir Bhattacharya
Manobjyoti Bordoloi
Nabin Chandra Barua
Paruchuri Gangadhar Rao
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Visva-Bharati School of Life Sciences
Council of Scientific and Industrial Research CSIR
Original Assignee
Visva-Bharati School of Life Sciences
Council of Scientific and Industrial Research CSIR
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Visva-Bharati School of Life Sciences, Council of Scientific and Industrial Research CSIR filed Critical Visva-Bharati School of Life Sciences
Publication of EP2590646A1 publication Critical patent/EP2590646A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/352Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7048Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/08Drugs for disorders of the urinary system of the prostate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

  • the present invention relates to a method of inhibition of synthesis of NF- ⁇ by inhibiting its gene expression using plant based isoflavones Daidzein and Daidzin derived from soybean (Glycine max) plant.
  • NF-KB is a well known transcription factor that plays a critical role in inflammatory diseases including diabetes and cancer.
  • NF- ⁇ remains as an inactive heterodimer having two polypeptide chains i.e. p50 and p65.
  • the nuclear localisation signal domains of these two dimers remain blocked by another protein known as inhibitor of kappa B ( ⁇ ).
  • inhibitor of kappa B
  • IKK inhibitor of kappa B kinase
  • IKK inhibitor of kappa B kinase
  • NF-KB regulates plethora of gene expression and many of them are related to diabetes, cancer, arthritis and Alzheimer's diseases.
  • NF- ⁇ inhibitors there are some NF- ⁇ inhibitors available in the market and almost all of them are highly toxic and therefore cannot be used for therapeutic purpose. However all of these are activation inhibitors i.e. either it inhibits ⁇ or IKK phosphorylation.
  • activation inhibitors i.e. either it inhibits ⁇ or IKK phosphorylation.
  • honokiol obtained from Magnolia officinalis inhibits NF- ⁇ activation and downregulates NF-DB induced expression of gene products (Tse, A.K., Wan, C.K., Zhu, G.Y., Shen, X.L., Cheung, H.Y, Yang, M. and Fong, W.F.
  • NF- ⁇ inhibitors There are many known NF- ⁇ inhibitors; they inhibit NF- ⁇ activation.
  • Daidzein a non toxic isoflavone having molecular weight of 254, usually present in number of dietary supplements such as soybeans, legumes and peas. Daidzein inhibits NF- ⁇ gene expression that results in inhibition of protein expression and therefore, can be utilized for treating the various critical diseases, such as diabetes, cancer etc.
  • NF- ⁇ is a transcription factor which was discovered by David Baltimore (Sen, R. and Baltimore, D (1986) Inducibility of k immunoglobulin enhancer- binding protein NF-kB by a post translational mechanism. Cell 47, 921-928.
  • lipid induced overexpression of NF- ⁇ in skeletal muscle cells is related to insulin resistance (Barma, P., Bhattacharya, S., Bhattacharya, A., Kundu, R., Dasgupta, S., Biswas, A., Bhattacharya, S., Roy, S.S. and Bhattacharya, S. (2009) Lipid induced overexpression of NF- ⁇ in skeletal muscle cells is linked to insulin resistance. Biochim. Biophys. Acta. 1792, 190-200). Daidzein ameliorates palmitate induced overexpression of NF- ⁇ in skeletal muscle cells.
  • isoflavone as drug candidate are glucuronidated in intestine and liver, and excreted out of the body through the urine and faecal matter.
  • Absorption of daidzein poses a real problem to act as a drug because it has great limitation for bioavailability.
  • Oral administration of daidzein does not lead to its availability in the serum suggesting its elimination from the gut through glucuronidation process due to the presence of UGT1 enzyme released from the gut cells (Hosoda, K., Furuta, T., Yokokawa, A., Ogura, K., Hiratsuka, A. and Ishii, K (2008).
  • daidzein could effectively blocked NF- ⁇ transcription, since its absorption through the gut is a problem, its action on target tissue for inhibiting NF- ⁇ synthesis will not be effective to treat diseases where NF- ⁇ is involved.
  • daidzin which is glucosylated and that could protect it from UGT1 mediated degradation.
  • Fetuin-A K2-Heremans Schmid glycoprotein [Ahsg]
  • an endogenous inhibitor of insulin receptor tyrosine kinase phosphorylation abrogates insulin stimulated downstream signals
  • Auberger, P., Falquerho, L Confreres, J.O., Pages, G., Le Cam, G., Rossi, B. and Le Cam, A. (1989) Characterization of a natural inhibitor of the insulin receptor tyrosine kinase: cDNA cloning, purification, and anti-mitogenic activity.
  • NF-KB S ' IRNA inhibits the palmitate induced fetuin-A overexpression whereas in forced expression of NF- ⁇ in hepatocytes induces fetuin-A expression in absence of palmitate.
  • Daidzein also inhibits fetuin-A protein and gene expression as it down regulation of NF- ⁇ synthesis.
  • NF- ⁇ and fetuin-A is related to insulin resistance and type 2 diabetes, inhibition of NF- ⁇ transcription by daidzein helps in amelioration of insulin action.
  • Daidzein increases insulin stimulated glucose uptake, as it helps in insulin stimulated Glut-4 migration towards the plasma membrane, which is downregulated by palmitate.
  • NF-KB activity is increased in different types of cancers.
  • PC-3 prostate cancer cell line
  • MCF-7 breast cancer cell line
  • the main objective of the present investigation is to provide a method of inhibition of synthesis of NF- ⁇ by inhibiting its gene expression using plant based molecules Daidzein and Daidzin.
  • Another objective of the present investigation is to provide a therapeutic active compound that will inhibit NF- ⁇ transcription thus abrogate NF- ⁇ gene expression which will give another alternative to treat critical diseases like diabetes, cancer etc.
  • the present invention provides a method for inhibiting NF- kappaB gene expression which comprises administering to a vertebrate in need of treatment, a therapeutically effective amount of atleast one compound selected from the group consisting of isoflavone obtainable from a soyabean plant belonging to the genus Glycine, and pharmaceutically acceptable salts thereof.
  • a method for inhibiting NF- kappaB gene expression which comprises administering to a vertebrate in need of treatment, a therapeutically effective amount of atleast one compound selected from the group consisting of isoflavone obtainable from a soyabean plant belonging to the genus Glycine, and pharmaceutically acceptable salts thereof.
  • isoflavone selected are daidzein and daidzin extracted from soybean.
  • the cell lines used were selected from the group consisting of PC-3 Prostrate Cancer cell line, and MCF-7 Breast Cancer cell line.
  • the NF-KappaB inhibition is used to treat diseases selected from the group comprising of Breast Cancer, Prostate Cancer and Diabetes.
  • the effective amount of Daidzein used is about 3-5 g /ml.
  • a method of treating human Prostrate cancer, Breast cancer, and Diabetes comprising administering orally to a subject in need thereof isoflavone selected from the group consisting of Diadzein and Diadzinin the range of 3-5 g /ml.
  • Figure 1 represents standard HPLC peak of daidzein.
  • Figure 2 represents standard HPLC peak of daidzin
  • Figure 3 represents that the oral administration of daidzin increases bioavailability of daidzein (Dn).
  • Dn bioavailability of daidzein
  • Figure 4 represents Palmitate overexpresses NF-kB. Skeletal muscle cells were incubated with 0.75 rtiM palmitate for 4h in the presence insulin (100 nmole) and insulin stimulated [ 3 H] 2- deoxy-glucose uptake was determined (Fig.4A). L6 myotubes were transfected with GFP-Glut4 plasmid followed by incubation with palmitate or palmitate plus daidzein; insulin was added prior to 30 minutes of termination of incubation.
  • Glut-4 translocation was observed under confocal microscope.
  • FIG. 4 B Western blot was performed with palmitate incubated myotubes using anti-pNF-kBp65, NF-kBp65, pNF-kBp50 and NF-kBp50 antibodies.b-actin was used as loading control
  • FIG. 4C Western blot was performed to determine NF-kB protein levels in a time and dose dependent manner (Fig.4D,E).Means ⁇ SEM was calculated from five independent experiments; * (p ⁇ 0.001 , #p ⁇ .01) as compared with the control and palmitate.
  • Figure 5 represents that both Daidzein(Dn) and daidzin(Din) inhibits NF-kB protein and gene expression.
  • Skeletal muscle cells were incubated with palmitate in the presence or absence of daidzein.
  • Changes in the NF-kB p65 and NF-kBp50 protein level was determined through immunoblot using NF- kB p65 or NF-kB p50 antibodies, ⁇ actin was used as a loading control (Fig.5A).
  • Skeletal muscle cells were incubated for 4h with insulin or palmitate or palmitate plus daidzein or without any of them (C- control).
  • Figure 6 represents purification of NF-kb p65 protein.
  • Control and palmitate incubated (6h) L6 skeletal muscle cell lysates were resolved on a 10% SDS-PAGE. A clear solid band at the 65 kDa region indicates overexpression of NF- kB p65 protein.
  • L6 skeletal muscle cells were incubated with palmitate and cell lysates after centrifugation was loaded on a Sephadex G-75 column. A control was run parallely to see any expression of NF- kB protein due to palmitate incubation. Separately collected fractions (such as A1, A2 and A3) from control and palmitate treated cell lysates were immunoblotted with anti-NF- kB p65 antibody.
  • the lanes A1 and A2 shows the immunoreactive bands of NF- kB "
  • the pooled fractions from gel filtration chromatography was lyophilized and loaded on a CNBr activated Sepharose 4Bimmunoaffinity column P1 (unbound protein) and P2 (bound fraction after elution with 2M Kl) peaks were collected and Western blot analysis shows P2 as immunoreactive band of NF- kB
  • FIG.7A NF-kBp65 protein was delivered in L6 skeletal muscle cells and its incorporation was detected by immunofluorescence. NPT transducted cells were incubated with daidzein [ 3 H] 2-deoxyglucose uptake was determined (Fig.7A). Control and NF-kBp65 transducted cells (NPT) were subjected to Western blot analysis with anti-NF- kB p65 antibody (Fig.7B).
  • C) GFP-Glut 4 construct was transfected into the skeletal muscle cells and incubated with insulin (I) or l+NF-kBp65 protein or l+NF- kBp65 protein+daidzein or with none (C-control). On termination of incubation, GFP- Glut 4 localization was detected by using laser scanning confocal microscope. (Fig.7C) Values represent means ⁇ SEM of three independent experiments, *p ⁇ 0.01 (I vs I + NPT).
  • Figure 8 Increase of NF- kB nuclear localization is inhibited by daidzein.
  • L6myotubes were incubated with palmitate or palmitate+daidzein. Immunofluorescence study was performed under fluorescence microscope.
  • Figure 9 represents the relationship between NF- kB overexpression and activation.
  • Nuclear extracts (NE) were prepared from L6 skeletal muscle cells incubated for 4h with palmitate, palmitate plus daidzein or SN50 or without any of them (control) followed by EMSA. Both wild type and mutant DNA sequences were used to determine the specificity of NF- kB binding (Fig.9A).
  • FIG. 10 Palmitate stimulation of NF- kB expression is inhibited by daidzein (Dn).
  • Dn daidzein
  • NF- kB cis-reporter gene plasmid transfected L6 myotubes were incubated with palmitate (P) and palmitate+Dn. Luciferase activity was determined after 5h of incubation. Prior to palmitate incubation cells were pre-incubated for 1 h with Dn.
  • FIG. 10A Means ⁇ SEM was calculated from three independent experiments Myotubes incubated with(P) or without(C) palmitate and palmitate+Dn were subjected to FACS analysis using anti-NF- ⁇ specific antibodies (Fig. 10B).
  • FIG11 NF-kB mediated fetuin-A expression is inhibited by daidzein (Dn).
  • Dn daidzein
  • Hepatocytes were incubated without (Ctl) or with 0.75 mM palmitate (P) for 4h.
  • Prior to palmitate incubation cells were pre-incubated for 1 h with Dn.
  • siRNA transfected cells were incubated with daidzein.
  • Cells were lysed and immunoblotted with anti-Fetuin-A antibody. ⁇ actin served as internal control.
  • RNA extracted from the above incubations was subjected to RT-PCR and Real time PCR using Fetuin-A specific primers where gapdh served as internal control. Means ⁇ SEM was calculated from three independent experiments.
  • Figure 12 Daidzein has protective effect against prostate cancer and breast cancer.
  • PC-3 and MCF-7 cells were incubated with daidzein at a concentration of 5 ⁇ g/ml. Cell mortality was determined under microscope.
  • RNA extracted from the above incubations was subjected to RT-PCR using NF-kB specific primers where gapdh served as internal control. Means ⁇ SEM was calculated from three independent experiments (Fig. 12A&B).
  • Figure 13 Relationship between expression and activation of NF- kB p65 in MCF-7 and PC-3 cells MCF-7 and PC-3 cells were treated without (Con) or with Dn ( ⁇ / ⁇ ) or transfected with NF- kB p65 siRNA (p65KO) or scramble siRNA (Mock).
  • Control cells contained DMSO as vehicle. Total RNA extracted from these cells was subjected to qPCR analysis using NF- kB p65 gene specific primers, gapdh was used as kB internal control. MCF-7 and PC-3 cells were incubated without or with Dn or transfected with NF- kB p65 (p65KO) or scramble (Mock) siRNA followed by the incubation of [ 3 H]-leucine or [ ⁇ 32 ⁇ ]- ⁇ .
  • NF- kB p65 or pNF- kB p65 was pull-down from the cell lysates and % incorporation of radiolabelled leucine or phosphate into NF- kB p65 or pNF- kB p65 was determined by radioactive counting in liquid scintillation counter.
  • Figures are one of the representatives of five individual experiments. Data represented are means ⁇ SEM, *p ⁇ 0.01 vs Con, #p ⁇ 0.001 vs Con.
  • Figure 14 Daidzein and daidzin inhibits cell survivability MTT assay was performed in a dose dependent manner with daidzein and daidzin in a dose dependent manner.
  • Daidzein a non toxic dietary supplement isoflavone of the structure 1, is a novel inhibitor of NF- ⁇ which blocks the synthesis of NF- ⁇ by inhibiting its gene expression.
  • Daidzein of the structure ⁇ inhibits NF- ⁇ gene transcription but had no toxic effect.
  • Daidzin, glucopyranosyl daidzein of the sturucture 2 is also an inhibitor of NF-KB which blocks the synthesis of NF- kB by inhibiting its gene expression and has no toxic effect.
  • Both daidzein of the structure ⁇ and daidzin of the structure 2 ameliorate palmitate induced overexpression of NF- ⁇ in skeletal muscle cells.
  • Daidzein of the structure 1 and daidzin of the structure 2 increase insulin stimulated glucose uptake, as it helps in insulin stimulated Glut-4 migration towards the plasma membrane, which is downregulated by palmitate.
  • Both daidzein of the structure i and daidzin of the structure 2 are inhibitors of PC-3 (prostate cancer cell line) and MCF-7 (breast cancer cell line) cells and are novel NF- ⁇ transcription inhibitor.
  • Daidzin of the structure 2 has very good bioavailibility over daidzein. Daidzein is present in dietary supplements, it is found in soyabeans, legumes and peas but it poses a problem of bioavailability.
  • Daidzein of the structure 1 is not absorbed when orally fed to mice as it is eliminated from the gut through glucuronidation process due to the presence of UGT1 enzyme released from the gut cells.
  • Daidzin of the structure 2 is glucosylated daidzein and is protected from UGT1 mediated degradation and is hydrolysed to daidzein which is absorbed and remains for more than 4 hours in blood therefore expected to be distributed to different tissues and organs.
  • Daidzein of the structure 1 and daidzin of the structure 2 reduce palmitate stimulated increased synthesis of NFKB significantly.
  • Daidzein inhibits formation of NF- ⁇ -DNA complex stimulated by palmitate.
  • daidzein of the structure 1_and daidzin of the structure 2 have protective effect against prostate cancer and breast cancer by inhibiting the gene expression of NF-KB in PC-3, breast cancer. These two compounds are also therapeutically active by inhibiting NF- kB transcription which would be beneficial for treating critical diseases like diabetes, arthritis and Alzheimer's diseases etc.
  • Daidzein of the structure 1_ and daidzin of the structure 2 were obtained from soy leaves through chromatography and both natural and commercial/synthetic daidzein and daidzin have same biological activities.
  • the following examples are given by way of illustration and should not be construed to limit the scope of present invention.
  • Daidzin an isoflavone was isolated and purified from Glycine max leaves through solvent fractionations, Diaion HP-20 and m-Bonadapak C-18 reverse phase column chromatography. Its structure was determined by 1 H NMR, 13 C NMR and Q-TOF-MS.
  • the plant material of 100 g of fresh leaves was crushed in a mixer-cum-grinder and immersed in 200 ml of ethanol/water (70/30, v/v) overnight.
  • the extract was obtained after filtration and the plant material was immersed again in raw ethanolic 200 ml of ethanol/water (70/30, v/v) overnight. The process is repeated three times.
  • the combined extract was concentrated under reduced pressure at below 50°C.
  • the concentrated extract was then defatted by extracting with hexane (100 ml x 3).
  • the defatted aquous layer was then extracted with chloroform followed by ethyl acetate.
  • the ethyl acetate layer was dried over anhydrous sodium sulphate and then distilled under reduced pressure at below 50°C.
  • the gummy mass obtained was then chromatographed over a silica gel column using ethyl acetate, 50% methanolic ethyl acetate, methanol and 45% water in methanol. Fractions obtained by elution of 45% water in methanol were found to be daidzein and daidzin respectively.
  • Bioavailibility Bioavalability of daidzein and daidzin was tested by oral feeding of a solution of daidzein and daidzin to mice and collecting blood at 15 minutes, 30 minutes, 60 minutes, 120 minutes and 240 minutes followed by separation of serum. At first a standard curve was calibrated for HPLC estimation of daidzein and daidzin in blood by using standard and authenticated daidzein and daidzin. Later, we purified daidzein from soybean seeds by using authenticated daidzein as the standard. Analysis of daidzein was performed with Waters HPLC equipment using Zorbax C18 45 column.
  • the blood serum collected after 15 minutes of feeding showed a peak at retention time 5.227 minute indicating clearly that daidzin was not in the blood and daidzein, the hydrolyzed product of the isoflavone glycoside daidzin, was present in the blood serum.
  • the hydrolyzed product of daidzin was observed for the serum sample collected at 4 hours, this shows that daidzein is available from circulatory source by the respective tissues and organs of the body for at least 4 hours which is an appreciable retention time in blood serum.
  • Daidzein Since bioavalability of flavone compounds is a problem because of their rapid elimination through the intestine due to glucuronidation by UGT groups of enzymes (King R. (1998) Am. J. Clin. Nutr. 68, 1496S-1499S), we examined the same for Daidzein.
  • Daidzein has two naturally available forms, one is glycosylated (daidzin) and another aglycone (daidzein), we have used daidzein in our experiments as it is comparatively more active. However, its absorption through the intestine is less than daidzin.
  • NF- ⁇ is a transcription factor that not only regulates diabetes but it is related to most of the inflammatory diseases like cancer, arthritis and Alzheimer's disease. Therefore there is a need to find out a potent inhibitor of NF- ⁇ .
  • daidzin a isoflavone glycoside from soyabean leaves
  • intestinal cells it is hydrolysed to form daidzein.
  • daidzin and daidzein can efficiently inhibit NF- ⁇ gene transcription and protein synthesis.
  • Soy isoflavones daidzein and genistein are currently being investigated in clinical studies.
  • Daidzein does not share these side effects and is more effective. Daidzein is present in dietary supplements, it is found in soyabeans, legumes and peas but it poses a problem of bioavailability. This problem could be avoided by using daidzin.
  • L6 skeletal muscle cell line To monitor inhibition of NF- ⁇ expression we have used L6 skeletal muscle cell line and conducted the assays where insulin activity is inhibited by NF- ⁇ . It is well-known that NF-KB inhibits insulin activity. L6 myotubes or skeletal muscle cell were incubated with or without palmitate or palmitate plus daidzein.lOOnM insulin and [ 3 H2-DOG] were added to these incubations before termination of incubation of cells. Insulin stimulated glucose uptake was significantly reduced by palmitate while daidzein co-incubation strikingly reduced palmitate adverse effect (Fig. 4 A).
  • L6 myotubes were incubated without or with palmitate, lysed by ultrasonication and then centrifuged. The supernatant was collected and loaded on Sephadex G75 column. The elution profile from these cells showed an increase of NF- ⁇ p65 protein due to palmitate (A2) treatment in comparison to control (A1 ).
  • the eluted fractions from these incubations were subjected to immunoaffinity chromatography by anti-NF- ⁇ 65 antibody for further purification.
  • the eluted fraction (P2) from immunoaffinity chromatography shows the cross reactivity with anti-NF- ⁇ antibody in Western blot analysis (Fig.6).
  • palmitate induced increased synthesis of NF-KB was prevented by daidzein.
  • NF- ⁇ p65 protein was transducted to L6 skeletal muscle cells and then subjected to insulin incubation.
  • Palmitate activation leads to the increase in NF- ⁇ nuclear localization.
  • NF-KB in skeletal muscle cells by immunofluorescence study using FITC conjugated anti-NF- ⁇ p65 antibody. Palmitate enhanced NF- ⁇ level both in the cytoplasm and nuclear region was inhibited by daidzein (Fig.8).
  • Daidzein inhibits palmitate induced NF- ⁇ promoter activity.
  • Cells were incubated without (control) or without palmitate and palmitate plus daidzein.
  • NF- ⁇ promoter activity increased remarkably due to palmitate incubation and daidzein reduces the palmitate stimulatory effect (Fig.10 A).
  • Fig.10 B Flow cytometric analysis showed that increased level of NF- ⁇ in response to palmitate was significantly inhibited by daidzein (Fig.10 B).
  • NF-KB regulates transcription of many inflammatory genes. It regulates transcription of fetuin-A, an inhibitor of insulin receptor tyrosine kinase.
  • Primary hepatocytes were incubated without or with palmitate or palmitate plus daidzein. Palmitate significantly induced fetuin-A gene expression.
  • Addition of NF- ⁇ siRNA or Daidzein inhibits fetuin-A synthesis by inhibiting NF- ⁇ expression (Fig. 11 ). By preventing NF- ⁇ gene expression daidzein can modulate NF- ⁇ downstream signalling.
  • Daidzein has also protective effect against prostate cancer and breast cancer. Daidzein at concentration of 5 g/ml reduce the gene expression of NF- ⁇ in PC-3, androgen independent prostate cancer cell line (Fig.12 A) and MCF-7, breast cancer cell line (Fig.12 B).
  • tissue culture materials were obtained from Gibco-BRL, Life Technologies Inc., Gaithersburg, USA.
  • [ 3 H]-leucine (specific activity 1000 Ci/mmol), was obtained from GE Healthcare, Kowloon, Hong Kong.
  • [ ⁇ - 32 ⁇ ]- ⁇ (Specific activity: 6000 Ci/mmol) was procured from BRIT, India.
  • the primary antibodies for NF-kBp65, pNF-kBp65, ⁇ / ⁇ , ⁇ , and ⁇ -actin were purchased from Santa Cruz Biotechnology Inc., California, USA.
  • Control and NF-kBp65 (h) siRNA were also purchased from Santa Cruz Biotechnology Inc., California, USA.
  • Fluorescence iso-thiocyanate (FITC) conjugated goat anti-rabbit and alkaline phosphatase conjugated secondary antibodies were purchased from Sigma Chemical Co., St. Louis MO, USA. All other chemicals and reagents were purchased from Sigma Chemical Co., St. Louis MO, USA.
  • the breast cancer cell line MCF-7 the prostate cancer cell line PC-3 and L-6 skeletal muscle cell line were gifted by Dr. Partha P. Banerjee, Georgetown University Medical Center, USA (ATCC Deposit No.MCF-7, HTB-22, PC-3 CRL-1435, L6-CRL- 1458.). These cells were cultured in DMEM containing Earle's salts and non-essential amino acids supplemented with 10% fetal calf serum, penicillin (100 U/ml) and streptomycin (100 pg/ ml) in a humidified 95% 0 2 /5% C0 2 atmosphere at 37°C. 3. Cell culture treatments
  • Confluent cells were subcultured by trypsinization and subsequently seeded in six well culture plates containing DMEM with essential supplements.
  • Confluent MCF-7 cells were incubated with 3Dg/ml daidzein (Dn) and PC3 cells were incubated with 5 ⁇ g/ml daidzein. Daidzein was dissolved in DMSO.
  • Control cells were treated with equal amounts of DMSO in the media. At the end of incubation, cells were lysed, centrifuged for 10 min at 10,000g and the supernatant was collected. Protein concentration of supernatant was determined by following the method of Lowry et al [O.H. Lowry, N.J. Rosebrough, A.E. Farr, R.J.
  • the membranes were first incubated with different primary antibodies at 1 :1000 dilutions followed by respective alkaline phosphatase conjugated secondary antibodies at same dilutions using SNAP i.d. apparatus (Millipore, Bedford, MA).
  • the protein bands were detected by developing with 5-bromro 4-chloro 3-indolyl phosphate/nitroblue tetrazolium (BCIP/NBT).
  • RT-PCR was performed with First strand cDNA synthesis kit, Fermentas Life Sciences, Revert AidTM, Hanover, MD, USA. Relative gene expression was further confirmed by Real-time PCR (Applied Biosystems Inc. CA, USA). PCR was performed using gene specific primers in the following reaction conditions: initial activation step at 95°C for 15mins, denaturation at 95°C for 30s, annealing at 50-55°C for 30s and final extension at 72°C for 30s x 40 cycles, gapdh was simultaneously amplified in separate reactions. C T value was corrected using corresponding gapdh controls.
  • NF-kBp65 forward: 5'-ccatcagggcagatctcaaacc-3' reverse: 5'-gctgctgaaactctgagttgtc-3'; Gene bank accession no. NM_021975.3
  • Bcl-2 forward: 5'-TGGGATGCCTTTGTGGAACT- 3', reverse: 5'-GAGACAGCCAGGAGAAATCAAAC-3'; Gene bank accession no. NM_000657.1
  • Cyclin D1 forward: 5 -GGATGCTGGAGGTCTGCGAGGAAC-3', reverse: 5 -GAGA-GGAAGCGTGTGAGGCGGTAG-3'; Gene bank accession no.
  • gapdh forward: 5'-gccatcaacgaccccttc-3', reverse: 5'- agccccagccttctcca-3'; Gene bank accession no. J04038.1 ).
  • NF-kB rich fraction gel filtration chromatography was performed on a Sephadex G-75 (Amersham Pharmacia Biotech AB, Uppsala, Sweden) column (2x50 cm) equilibrated with Tris-CI buffer (10 mM Tris-CI, pH-7.4) by following an earlier description from this laboratory [D. Basu, S. Bhattacharya, Purification of two types of gonadotropin receptors from carp ovarian follicles: overlapping recognition by two different ligands, Gen. Comp. Endo. 129 (2002) 152-162]. The flow rate was maintained at 1 ml/min and 1.0 ml fractions were collected just after loading the skeletal muscle cell lysate.
  • Unbound antibody was removed by washing with coupling buffer (pH-8.5) followed by acetate buffer (0.1 M, pH-4.0). The remaining active groups on the beads were blocked with glycine buffer (0.2 M, pH-8.0). The sample was loaded on the column and kept overnight at 4°C. The unbound proteins were eluted with 10 mM Tris- HCI buffer, pH-7.4 while NF-kBp65 bound to the ligand was eluted with elution buffer (10 mM Tris-HCI, pH -7.4) containing 2.0 M Kl as a chaotropic agent. The volume of each eluted fraction was 1.0 ml. The fractions were collected until the O.D.
  • NF-kB p65 was examined in a 10% SDS-PAGE where it gave a single protein band which also crossreacted with anti-NF-kB p65 antibody.
  • EMSA was performed by using nuclear extracts prepared from different incubations in cancer cells using oligonucleotide probes specific for NF-kB binding site (Wild: 5 - AGTTGAGGGGACTTTCCCAGGC -3', mutants: 5'- AGTTGAGGGAACTTTCCCAGGC -3', AGTTGAGGAAACTTTCCCAGGC -3').
  • the probes were end-labelled with [ ⁇ 32 ⁇ ]- ⁇ using T4 polynucleotide kinase and then incubated with 10 Dg of nuclear extracts of control and Dn treated MCF-7 and PC3 cells in a 20 Dl of binding reaction for 45 min. Reaction mixtures were resolved on 5% polyacrylamide gel and visualized by Phosphorlmager (GE Healthcare, USA).
  • MCF-7 and PC3 cells were incubated in Kreb's Ringer Phosphate (KRP) buffer supplemented with 0.2% bovine serum albumin.
  • KRP Kreb's Ringer Phosphate
  • cells were incubated with 10 ⁇ / ⁇ of [ 3 H]-leucine in the presence or absence of Dn.
  • Cells were also transfected with NF-kBp65 siRNA or scramble siRNA.
  • NF-kBp65 was pulled down by anti-NF-kBp65 antibody. Radioactive count incorporation to NF-kBp65 was measured in Liquid Scintillation counter (Perkin Elmer, Tri-Carb 2800TR).
  • MCF-7 and PC3 cells were incubated without or with daidzein (Dn) or transfected with NF-kBp65 siRNA or scramble siRNA in the presence of 80 ⁇ [ ⁇ 3 ⁇ ]- ⁇ and on termination of incubation, cell lysates were subjected to immunoprecipitation with anti- pNF-kBp65 antibody. Radioactive count incorporation to pNF-kBp65 was measured in Liquid Scintillation counter (Perkin Elmer, Tri-Carb 2800TR).
  • MCF-7 and PC3 cells were treated without (Con) or with Dn (3 and 5 dg/ml repectively) or transfected with NF- kB p65 siRNA (p65KO) or scramble siRNA (Mock).
  • Control cells contained DMSO as vehicle. Total RNA extracted from these cells was subjected to qPCR analysis using NF-i Bp65 gene specific primers, gapdh was used as internal control.
  • MCF-7 and PC3 cells were incubated without or with Dn or transfected with NF- kB p65 (p65KO) or scramble (Mock) siRNA followed by the incubation of [ 3 H]-leucine or [ ⁇ 32 ⁇ ]- ⁇ .
  • NF- kB p65 or pNF- kB p65 was pull-down from the cell lysates and % incorporation of radiolabelled leucine or phosphate into NF- kB p65 or pNF- kB p65 was determined by radioactive counting in liquid scintillation counter.
  • Figures are one of the representatives of five individual experiments. Data represented are means ⁇ SEM, *p ⁇ 0.01 vs Con, #p ⁇ 0.001 vs Con.
  • Our results demonstrate that suppression of NF- kB p65 gene expression by p65siRNA and a flavone compound; daidzein (Dn) reduced both inactive and phosphorylated form of NF- kB in cancer cells.
  • NF- kB p65 siRNA specifically inhibits its mRNA whereas Dn occupies promoter kB segment where NF- kB binds to express its gene.
  • Dn occupies promoter kB segment where NF- kB binds to express its gene.
  • NF- kB protein synthesis was markedly reduced because of suppressed NF- kB gene expression by NF-KBp65 siRNA or Dn. This corresponded with the significant decline of phosphorylated NF- kB indicating that active NF- kB pool in these cells is dependent on its de novo synthesis.
  • Daidzein inhibits NF-kB synthesis by reducing its gene expression.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Diabetes (AREA)
  • Epidemiology (AREA)
  • Endocrinology (AREA)
  • Hematology (AREA)
  • Emergency Medicine (AREA)
  • Reproductive Health (AREA)
  • Molecular Biology (AREA)
  • Obesity (AREA)
  • Urology & Nephrology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Plant Substances (AREA)

Abstract

The present invention discloses a method of inhibition of synthesis of NF- kB by inhibiting its gene expression using isoflavones Daidzein and Daidzin. Daidzein, a non toxic dietary supplement isoflavone of the structure (1) and 7-O-ϵ-glucopyranosyl daidzein of the structure (2) are novel inhibitors of NF- kB which blocks the synthesis of NF- kB by inhibiting its gene expression and have no toxic effect. Both daidzein of the structure (1) and daidzin of the structure (2) ameliorate palmitate induced overexpression of NF- kB in skeletal muscle cells by eliminating the inhibition of NF- kB on insulin stimulated glucose uptake. Daidzein inhibits NF- kB expression in prostate and breast cancer cells that increased mortality of these cancer cells. Daidzin of the structure (2) has very good bioavailibility over daidzein of structure (1). Daidzein of the structure (1) is not absorbed when orally fed to mice as it is eliminated from the gut through glucuronidation process catalyzed by UGT1. Daidzin of the structure (2) is glucosylated daidzein and is protected from UGT1 mediated degradation and is hydrolysed to daidzein which is absorbed and remains for more than 4 hours in blood and is expected to be distributed to different tissues and organs. Daidzein of the structure (1) and daidzin of the structure (2) reduce palmitate stimulated increased synthesis of NF- kB significantly. Daidzein inhibits formation of NF- kB -DNA complex stimulated by palmitate and both daidzein and daidzin inhibited NF- kB expression which leads to reduction of its DNA binding. Daidzein of the structure(1) was obtained from soy leaves through chromatography and both natural and synthetic daidzein and daidzin have same biological activities.

Description

METHOD FOR INHIBITION OF NF-KB GENE EXPRESSION
Field of Invention
The present invention relates to a method of inhibition of synthesis of NF-κΒ by inhibiting its gene expression using plant based isoflavones Daidzein and Daidzin derived from soybean (Glycine max) plant.
Background Art:
NF-KB is a well known transcription factor that plays a critical role in inflammatory diseases including diabetes and cancer. In cells, NF-κΒ remains as an inactive heterodimer having two polypeptide chains i.e. p50 and p65. The nuclear localisation signal domains of these two dimers remain blocked by another protein known as inhibitor of kappa B (ΙκΒ). Phosphorylation of ΙκΒ by inhibitor of kappa B kinase (IKK) leads to its proteosomal degradation and that allows translocation of active form of NF- κΒ to the nucleus where it binds to DNA and activates the promoter of a specific gene. NF-KB regulates plethora of gene expression and many of them are related to diabetes, cancer, arthritis and Alzheimer's diseases.
Hence, a potent inhibitor of NF-κΒ is of high demand. There are some NF-κΒ inhibitors available in the market and almost all of them are highly toxic and therefore cannot be used for therapeutic purpose. However all of these are activation inhibitors i.e. either it inhibits ΙκΒκ or IKK phosphorylation. agnolol, honokiol obtained from Magnolia officinalis inhibits NF-κΒ activation and downregulates NF-DB induced expression of gene products (Tse, A.K., Wan, C.K., Zhu, G.Y., Shen, X.L., Cheung, H.Y, Yang, M. and Fong, W.F. (2007) Magnolol suppresses NF-kappaB activation and NF-kappaB regulated gene expression through inhibition of IkappaB kinase activation. Mol. Immunol.AA, 2647-2658). Curcumin, a known potent NF-κΒ activation inhibitor is widely known. Acetyl salicylate also inhibits NF-κΒ by inhibiting ΙΚΚκ. There are also some proteasomal inhibitors like MG132 which inhibit ΙκΒκ degradation and restrict NF-KB to cytosol. Dithiocarbamates are known inhibitors of IKK (Shreck, R., Meier, B., Mannel, D.N., Droge, W. and Baeuerle, P.A. (1992) Dithiocarbamate as potent inhibitors of nuclear factor kappa B activation in intact cells. JEM 175, 1181-1194). SN- 50, parthenolide and PDTC are also commonly used as potent NF-κΒ activation inhibitor. The research is still going on to find out an inhibitor that has no toxic effects. Here, we have come across a novel molecule isolated from natural source which efficiently blocks NF-κΒ pathway but in a new target, it inhibits NF-κΒ gene transcription but had no toxic effect.
There are many known NF-κΒ inhibitors; they inhibit NF-κΒ activation. We have invented inhibitors of NF-κΒ which blocks the synthesis of NF-κΒ by inhibiting its gene expression. Daidzein, a non toxic isoflavone having molecular weight of 254, usually present in number of dietary supplements such as soybeans, legumes and peas. Daidzein inhibits NF-κΒ gene expression that results in inhibition of protein expression and therefore, can be utilized for treating the various critical diseases, such as diabetes, cancer etc. NF-κΒ is a transcription factor which was discovered by David Baltimore (Sen, R. and Baltimore, D (1986) Inducibility of k immunoglobulin enhancer- binding protein NF-kB by a post translational mechanism. Cell 47, 921-928. & Singh, H., Sen, R., Baltimore, D. and Sharp, P.A. (1986) A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes. Nature 319, 154-158). Presently intensive research is going with NF-κΒ as it regulates number of gene expressions which are associated with cancer, diabetes etc. This transcription factor also regulates transcription of most of the inflammatory genes. Therefore to search for a molecule which inhibits NF-κΒ is very important where cancer and diabetes are posing a great threat to human health. We have reported earlier that lipid induced overexpression of NF-κΒ in skeletal muscle cells is related to insulin resistance (Barma, P., Bhattacharya, S., Bhattacharya, A., Kundu, R., Dasgupta, S., Biswas, A., Bhattacharya, S., Roy, S.S. and Bhattacharya, S. (2009) Lipid induced overexpression of NF-κΒ in skeletal muscle cells is linked to insulin resistance. Biochim. Biophys. Acta. 1792, 190-200). Daidzein ameliorates palmitate induced overexpression of NF-κΒ in skeletal muscle cells. The problem with isoflavone as drug candidate is that they are glucuronidated in intestine and liver, and excreted out of the body through the urine and faecal matter. Absorption of daidzein poses a real problem to act as a drug because it has great limitation for bioavailability. Oral administration of daidzein does not lead to its availability in the serum suggesting its elimination from the gut through glucuronidation process due to the presence of UGT1 enzyme released from the gut cells (Hosoda, K., Furuta, T., Yokokawa, A., Ogura, K., Hiratsuka, A. and Ishii, K (2008). Plasma profiling of intact isoflavone metabolites by high-performance liquid chromatography and mass spectrometric identification of flavone glycosides daidzin and genistin in human plasma after administration of kinako. Drug Metabolism and Disposition 36, 1485-1495). We also faced the same problem. In in vitro cell line daidzein could effectively blocked NF-κΒ transcription, since its absorption through the gut is a problem, its action on target tissue for inhibiting NF-κΒ synthesis will not be effective to treat diseases where NF-κΒ is involved. To solve this problem we thought to use daidzin which is glucosylated and that could protect it from UGT1 mediated degradation. To examine this hypothesis, we purified daidzin from soybean leaves which has appreciable content of this isoflavone glycoside. We orally administered daidzin solution in mice, serum was collected at different times, subjected to protein precipitation and supernatant was lyophilized to observe absorption of daidzin. Interestingly, it is the nonglycosidic compound, daidzein which could be detected in the serum. This suggests that daidzin is hydrolysed to daidzein and remained for more than 4 hours in blood. We also found the daidzein in liver and skeletal muscle. Daidzein decreases NF-κΒ protein and gene expression and it simultaneously inhibits NF- Β regulated genes also. Fetuin-A (K2-Heremans Schmid glycoprotein [Ahsg]), an endogenous inhibitor of insulin receptor tyrosine kinase phosphorylation abrogates insulin stimulated downstream signals (Auberger, P., Falquerho, L, Confreres, J.O., Pages, G., Le Cam, G., Rossi, B. and Le Cam, A. (1989) Characterization of a natural inhibitor of the insulin receptor tyrosine kinase: cDNA cloning, purification, and anti-mitogenic activity. Cell 58, 631-640.& Rauth, G., Poschke, O., Fink, E., Eulitz, M., Tippmer, S., Kellerer, ., Haring, H.U., Nawratil, P., Haasemann, M. and Jahnen-Dechent, W. (1992) The nucleotide and partial amino acid sequences of rat fetuin: Identity with the natural tyrosine kinase inhibitor of the rat insulin receptor. Eur. J. Biochem. 204, 523-529.). Fetuin-A is primarily synthesized in liver and secreted into serum. Fetuin-A gene is overexpressed in palmitate treated rat primary hepatocytes. We found that this overexpression of fetuin-A is mediated by NF-KB. NF-KB S'IRNA inhibits the palmitate induced fetuin-A overexpression whereas in forced expression of NF-κΒ in hepatocytes induces fetuin-A expression in absence of palmitate. Daidzein also inhibits fetuin-A protein and gene expression as it down regulation of NF-κΒ synthesis. As both NF-κΒ and fetuin-A is related to insulin resistance and type 2 diabetes, inhibition of NF-κΒ transcription by daidzein helps in amelioration of insulin action. Daidzein increases insulin stimulated glucose uptake, as it helps in insulin stimulated Glut-4 migration towards the plasma membrane, which is downregulated by palmitate. Based on the several reports which indicate that NF-KB activity is increased in different types of cancers, we checked whether in cancer cells daidzein can inhibits NF-κΒ gene expression or not. We have found that in PC-3 (prostate cancer cell line) and MCF-7 (breast cancer cell line) cells daidzein significantly inhibits NF-κΒ gene expression. Therefore we can consider NF-κΒ as a universal NF-κΒ transcription inhibitor. Objectives of the invention
The main objective of the present investigation is to provide a method of inhibition of synthesis of NF-κΒ by inhibiting its gene expression using plant based molecules Daidzein and Daidzin.
Another objective of the present investigation is to provide a therapeutic active compound that will inhibit NF-κΒ transcription thus abrogate NF-κΒ gene expression which will give another alternative to treat critical diseases like diabetes, cancer etc.
Summary of the invention
Accordingly, the present invention provides a method for inhibiting NF- kappaB gene expression which comprises administering to a vertebrate in need of treatment, a therapeutically effective amount of atleast one compound selected from the group consisting of isoflavone obtainable from a soyabean plant belonging to the genus Glycine, and pharmaceutically acceptable salts thereof.
In an embodiment of the present invention, a method for inhibiting NF- kappaB gene expression which comprises administering to a vertebrate in need of treatment, a therapeutically effective amount of atleast one compound selected from the group consisting of isoflavone obtainable from a soyabean plant belonging to the genus Glycine, and pharmaceutically acceptable salts thereof.
In another embodiment of the present invention, isoflavone selected are daidzein and daidzin extracted from soybean.
In another embodiment of the present invention, the cell lines used were selected from the group consisting of PC-3 Prostrate Cancer cell line, and MCF-7 Breast Cancer cell line.
In another embodiment of the present invention, the NF-KappaB inhibition is used to treat diseases selected from the group comprising of Breast Cancer, Prostate Cancer and Diabetes.
In another embodiment of the present invention, the effective amount of Daidzein used is about 3-5 g /ml.
In another embodiment of the present invention, a method of treating human Prostrate cancer, Breast cancer, and Diabetes comprising administering orally to a subject in need thereof isoflavone selected from the group consisting of Diadzein and Diadzinin the range of 3-5 g /ml.
In another embodiment of the present invention, Use of Diadzein and Diadzin as an inhibitor of NF-kB gene expression.
In another embodiment of the present invention, Use of Diadzein and Diadzin for the treatment of human Prostrate cancer, Breast cancer, and Diabetes.
In another embodiment of the present invention, a method for inhibiting NF- kappaB gene expression substantially as herein described with reference to the examples. Brief description of the drawings
Figure 1: represents standard HPLC peak of daidzein.
Figure 2: represents standard HPLC peak of daidzin
Figure 3: represents that the oral administration of daidzin increases bioavailability of daidzein (Dn). (A) Time dependent increased bioavailability of Dn was observed in serum and (B) significant amount was detected in liver at 120 min. Figure 4:represents Palmitate overexpresses NF-kB. Skeletal muscle cells were incubated with 0.75 rtiM palmitate for 4h in the presence insulin (100 nmole) and insulin stimulated [3H] 2- deoxy-glucose uptake was determined (Fig.4A). L6 myotubes were transfected with GFP-Glut4 plasmid followed by incubation with palmitate or palmitate plus daidzein; insulin was added prior to 30 minutes of termination of incubation. Glut-4 translocation was observed under confocal microscope. (Fig. 4 B). Western blot was performed with palmitate incubated myotubes using anti-pNF-kBp65, NF-kBp65, pNF-kBp50 and NF-kBp50 antibodies.b-actin was used as loading control (Fig. 4C) Western blot was performed to determine NF-kB protein levels in a time and dose dependent manner (Fig.4D,E).Means ± SEM was calculated from five independent experiments; * (p< 0.001 , #p<.01) as compared with the control and palmitate.
Figure 5: represents that both Daidzein(Dn) and daidzin(Din) inhibits NF-kB protein and gene expression. Skeletal muscle cells were incubated with palmitate in the presence or absence of daidzein. Changes in the NF-kB p65 and NF-kBp50 protein level was determined through immunoblot using NF- kB p65 or NF-kB p50 antibodies, β actin was used as a loading control (Fig.5A).Skeletal muscle cells were incubated for 4h with insulin or palmitate or palmitate plus daidzein or without any of them (C- control). On termination of incubation RNA was extracted, followed by RT-PCR and real time PCR (Fig.5B).L6 myotubes were incubated with palmitate and palmitate+daidzin for 4h. Western blot and RT-PCR was performed using anti-NF-kB specific antibody or NF-kB specific primers (Fig. 5C).
Figure 6: represents purification of NF-kb p65 protein. Control and palmitate incubated (6h) L6 skeletal muscle cell lysates were resolved on a 10% SDS-PAGE. A clear solid band at the 65 kDa region indicates overexpression of NF- kB p65 protein. L6 skeletal muscle cells were incubated with palmitate and cell lysates after centrifugation was loaded on a Sephadex G-75 column. A control was run parallely to see any expression of NF- kB protein due to palmitate incubation. Separately collected fractions (such as A1, A2 and A3) from control and palmitate treated cell lysates were immunoblotted with anti-NF- kB p65 antibody. The lanes A1 and A2 shows the immunoreactive bands of NF- kB"The pooled fractions from gel filtration chromatography was lyophilized and loaded on a CNBr activated Sepharose 4Bimmunoaffinity column P1 (unbound protein) and P2 (bound fraction after elution with 2M Kl) peaks were collected and Western blot analysis shows P2 as immunoreactive band of NF- kB
Figure 7: NF-kBp65 protein was delivered in L6 skeletal muscle cells and its incorporation was detected by immunofluorescence. NPT transducted cells were incubated with daidzein [3H] 2-deoxyglucose uptake was determined (Fig.7A). Control and NF-kBp65 transducted cells (NPT) were subjected to Western blot analysis with anti-NF- kB p65 antibody (Fig.7B). C) GFP-Glut 4 construct was transfected into the skeletal muscle cells and incubated with insulin (I) or l+NF-kBp65 protein or l+NF- kBp65 protein+daidzein or with none (C-control). On termination of incubation, GFP- Glut 4 localization was detected by using laser scanning confocal microscope. (Fig.7C) Values represent means ± SEM of three independent experiments, *p<0.01 (I vs I + NPT).
Figure 8: Increase of NF- kB nuclear localization is inhibited by daidzein. L6myotubes were incubated with palmitate or palmitate+daidzein. Immunofluorescence study was performed under fluorescence microscope. Figure 9: represents the relationship between NF- kB overexpression and activation. Nuclear extracts (NE) were prepared from L6 skeletal muscle cells incubated for 4h with palmitate, palmitate plus daidzein or SN50 or without any of them (control) followed by EMSA. Both wild type and mutant DNA sequences were used to determine the specificity of NF- kB binding (Fig.9A). Levels of palmitate induced phosphorylation of IKK and I kB were determined in skeletal muscle cells incubated in the presence of palmitate (P) or palmitate plus daidzein or without any of them (C) using anti-plKK and anti-pl kB a antibodies as probes. Immunoblots for IKK and I kB a protein served as loading controls.
Figure 10: Palmitate stimulation of NF- kB expression is inhibited by daidzein (Dn). NF- kB cis-reporter gene plasmid transfected L6 myotubes were incubated with palmitate (P) and palmitate+Dn. Luciferase activity was determined after 5h of incubation. Prior to palmitate incubation cells were pre-incubated for 1 h with Dn. (Fig. 10A) Means±SEM was calculated from three independent experiments Myotubes incubated with(P) or without(C) palmitate and palmitate+Dn were subjected to FACS analysis using anti-NF-κΒ specific antibodies (Fig. 10B).
Figure11 : NF-kB mediated fetuin-A expression is inhibited by daidzein (Dn). Hepatocytes were incubated without (Ctl) or with 0.75 mM palmitate (P) for 4h. Prior to palmitate incubation cells were pre-incubated for 1 h with Dn. siRNA transfected cells were incubated with daidzein. Cells were lysed and immunoblotted with anti-Fetuin-A antibody.□ actin served as internal control. RNA extracted from the above incubations was subjected to RT-PCR and Real time PCR using Fetuin-A specific primers where gapdh served as internal control. Means±SEM was calculated from three independent experiments.
Figure 12: Daidzein has protective effect against prostate cancer and breast cancer. PC-3 and MCF-7 cells were incubated with daidzein at a concentration of 5μg/ml. Cell mortality was determined under microscope. RNA extracted from the above incubations was subjected to RT-PCR using NF-kB specific primers where gapdh served as internal control. Means±SEM was calculated from three independent experiments (Fig. 12A&B). Figure 13: Relationship between expression and activation of NF- kB p65 in MCF-7 and PC-3 cells MCF-7 and PC-3 cells were treated without (Con) or with Dn (δμρ/ηηΙ) or transfected with NF- kB p65 siRNA (p65KO) or scramble siRNA (Mock). Control cells contained DMSO as vehicle. Total RNA extracted from these cells was subjected to qPCR analysis using NF- kB p65 gene specific primers, gapdh was used as kB internal control. MCF-7 and PC-3 cells were incubated without or with Dn or transfected with NF- kB p65 (p65KO) or scramble (Mock) siRNA followed by the incubation of [3H]-leucine or [γ32ρ]-ΑΤΡ. NF- kB p65 or pNF- kB p65 was pull-down from the cell lysates and % incorporation of radiolabelled leucine or phosphate into NF- kB p65 or pNF- kB p65 was determined by radioactive counting in liquid scintillation counter. Figures are one of the representatives of five individual experiments. Data represented are means ± SEM, *p<0.01 vs Con, #p<0.001 vs Con.
Figure 14: Daidzein and daidzin inhibits cell survivability MTT assay was performed in a dose dependent manner with daidzein and daidzin in a dose dependent manner.
Detailed description of the invention
Daidzein, a non toxic dietary supplement isoflavone of the structure 1, is a novel inhibitor of NF-κΒ which blocks the synthesis of NF-κΒ by inhibiting its gene expression. Daidzein of the structure Λ inhibits NF-κΒ gene transcription but had no toxic effect. Daidzin, glucopyranosyl daidzein of the sturucture 2 is also an inhibitor of NF-KB which blocks the synthesis of NF- kB by inhibiting its gene expression and has no toxic effect. Both daidzein of the structure Λ and daidzin of the structure 2 ameliorate palmitate induced overexpression of NF-κΒ in skeletal muscle cells. Daidzein of the structure 1 and daidzin of the structure 2 increase insulin stimulated glucose uptake, as it helps in insulin stimulated Glut-4 migration towards the plasma membrane, which is downregulated by palmitate. Both daidzein of the structure i and daidzin of the structure 2 are inhibitors of PC-3 (prostate cancer cell line) and MCF-7 (breast cancer cell line) cells and are novel NF-κΒ transcription inhibitor. Daidzin of the structure 2 has very good bioavailibility over daidzein. Daidzein is present in dietary supplements, it is found in soyabeans, legumes and peas but it poses a problem of bioavailability. Daidzein of the structure 1 is not absorbed when orally fed to mice as it is eliminated from the gut through glucuronidation process due to the presence of UGT1 enzyme released from the gut cells. Daidzin of the structure 2 is glucosylated daidzein and is protected from UGT1 mediated degradation and is hydrolysed to daidzein which is absorbed and remains for more than 4 hours in blood therefore expected to be distributed to different tissues and organs. Daidzein of the structure 1 and daidzin of the structure 2 reduce palmitate stimulated increased synthesis of NFKB significantly. Daidzein inhibits formation of NF-κΒ -DNA complex stimulated by palmitate.
Thus daidzein of the structure 1_and daidzin of the structure 2 have protective effect against prostate cancer and breast cancer by inhibiting the gene expression of NF-KB in PC-3, breast cancer. These two compounds are also therapeutically active by inhibiting NF- kB transcription which would be beneficial for treating critical diseases like diabetes, arthritis and Alzheimer's diseases etc. Daidzein of the structure 1_ and daidzin of the structure 2 were obtained from soy leaves through chromatography and both natural and commercial/synthetic daidzein and daidzin have same biological activities. The following examples are given by way of illustration and should not be construed to limit the scope of present invention.
Example 1
We have extracted and purified daidzin from soyabean leaf. Daidzin, an isoflavone was isolated and purified from Glycine max leaves through solvent fractionations, Diaion HP-20 and m-Bonadapak C-18 reverse phase column chromatography. Its structure was determined by 1H NMR, 13C NMR and Q-TOF-MS.The plant material of 100 g of fresh leaves was crushed in a mixer-cum-grinder and immersed in 200 ml of ethanol/water (70/30, v/v) overnight. The extract was obtained after filtration and the plant material was immersed again in raw ethanolic 200 ml of ethanol/water (70/30, v/v) overnight. The process is repeated three times. The combined extract was concentrated under reduced pressure at below 50°C. The concentrated extract was then defatted by extracting with hexane (100 ml x 3). The defatted aquous layer was then extracted with chloroform followed by ethyl acetate. The ethyl acetate layer was dried over anhydrous sodium sulphate and then distilled under reduced pressure at below 50°C. The gummy mass obtained was then chromatographed over a silica gel column using ethyl acetate, 50% methanolic ethyl acetate, methanol and 45% water in methanol. Fractions obtained by elution of 45% water in methanol were found to be daidzein and daidzin respectively. These two fractions were further purified by flash chromatography with C18 RP column eluted with 45% water in methanol to get pure daidzein and daidzin. The isolated compounds were further confirmed by HPLC (Waters HPLC equipment) using Luna-C18 (2) column. Solvent system used was 45% methanol in water(v/v) in 35 min with flow rate 1 ml/min. 10 microliter sample was injected and I chromatograms was recorded at 232 nm UV wherein daizein appeared at retention time 5.6 minute in the chromatogram and daidzin appeared at retention time 8.76 minutes. And the structures were confirmed by IR, 1H-NMR, 13C NMR and Massspectra. Example 2:
Bioavailibility: Bioavalability of daidzein and daidzin was tested by oral feeding of a solution of daidzein and daidzin to mice and collecting blood at 15 minutes, 30 minutes, 60 minutes, 120 minutes and 240 minutes followed by separation of serum. At first a standard curve was calibrated for HPLC estimation of daidzein and daidzin in blood by using standard and authenticated daidzein and daidzin. Later, we purified daidzein from soybean seeds by using authenticated daidzein as the standard. Analysis of daidzein was performed with Waters HPLC equipment using Zorbax C18 45 column. Solvent system used was 0.1% H2P04 in water =A and 0.1% H2P04 in acetonitrile=B (gradient, 20 % B to 80% B in 25 min; 80% B to 20% B in 5 min) with flow rate 1 ml/min. All chromatograms were recorded at 232 nm UV. HPLC of chromatogram of daidzein, daidzin and a representative blood serum sample were shown at figure 1 , figure 2 and figure 3 respectively. The peak of daizein appears at retention time 5.6 minute in the chromatogram. The peak of daidzin appears at retention time 8.76 minutes. The blood serum sample does not show any peak at retention time around 8 minutes. However, the blood serum collected after 15 minutes of feeding showed a peak at retention time 5.227 minute indicating clearly that daidzin was not in the blood and daidzein, the hydrolyzed product of the isoflavone glycoside daidzin, was present in the blood serum. The hydrolyzed product of daidzin was observed for the serum sample collected at 4 hours, this shows that daidzein is available from circulatory source by the respective tissues and organs of the body for at least 4 hours which is an appreciable retention time in blood serum.
Bioavailability of daidzein:-
Since bioavalability of flavone compounds is a problem because of their rapid elimination through the intestine due to glucuronidation by UGT groups of enzymes (King R. (1998) Am. J. Clin. Nutr. 68, 1496S-1499S), we examined the same for Daidzein. Daidzein has two naturally available forms, one is glycosylated (daidzin) and another aglycone (daidzein), we have used daidzein in our experiments as it is comparatively more active. However, its absorption through the intestine is less than daidzin. We have found that oral administration of glycosylated form could be detected in the serum and liver as daidzein (Dn) indicating cleavage of carbohydrate moiety in the intestine and that possibly provided protection from intestinal glucuronidation. This was also demonstrated in a previous report (King, R. and Bursill, D.B. (1998) Am. J. Clin. Nutr. 67, 862-872). Hence, bioavalibility of Dn would not pose a problem for in vivo research and future therapeutic use.
Example 3
There are many reports about the role of NF-κΒ in insulin resistance but the detailed mechanism is not well known. Recent evidences indicate that lipid induced elevation of NF-KB activity may play an important role in insulin resistance and type 2 diabetes. Activation of inhibitor of kappa Β kinase (IKK) phosphorylates ΙκΒ, an inhibitor of NF- KB. Phosphorylation of ΙκΒ leads to its proteosomal degradation resulting the release of IMF-KB for its translocation to nucleus. Excessive activity of Ι Β and NF- Β has been shown to be linked with insulin resistance while inhibition of NF-DB activation ameliorates it (Cai, D., Yuan, M., Frantz, D.F., Melendez, P.A., Hansen, L, Lee, J. and Shoelson, S.E. (2005) Local and systemic insulin resistance resulting from hepatic activation of ΙΚΚ-β and NF-κΒ. Nat. Med. 11, 183-190.) Earlier we have reported that overexpression of NF-κΒ due to palmitate is associated with insulin resistance (Barma et al, 2009). NF-κΒ is a transcription factor that not only regulates diabetes but it is related to most of the inflammatory diseases like cancer, arthritis and Alzheimer's disease. Therefore there is a need to find out a potent inhibitor of NF-κΒ. We have isolated a isoflavone glycoside from soyabean leaves, known as daidzin. In intestinal cells it is hydrolysed to form daidzein. We found that both daidzin and daidzein can efficiently inhibit NF-κΒ gene transcription and protein synthesis. Soy isoflavones daidzein and genistein are currently being investigated in clinical studies. It has been reported that genistein has raised concerns over its potential negative effects on immune function, brain function and DNA repair (Kim, D.J., Seok, S.H., Baek, M.W., Lee, H.Y., Na, Y.R., Park, S.H., Lee, H.K., Dutta, N.K., Kawakami, K. and Park, J.H. (2009) Developmental toxicity and brain aromatase induction by high genistein concentrations in zebrafish embryos. Toxicology Mechanisms and Methods 19,251- 256). Daidzein does not share these side effects and is more effective. Daidzein is present in dietary supplements, it is found in soyabeans, legumes and peas but it poses a problem of bioavailability. This problem could be avoided by using daidzin.
Example 4
To monitor inhibition of NF-κΒ expression we have used L6 skeletal muscle cell line and conducted the assays where insulin activity is inhibited by NF-κΒ. It is well-known that NF-KB inhibits insulin activity. L6 myotubes or skeletal muscle cell were incubated with or without palmitate or palmitate plus daidzein.lOOnM insulin and [3H2-DOG] were added to these incubations before termination of incubation of cells. Insulin stimulated glucose uptake was significantly reduced by palmitate while daidzein co-incubation strikingly reduced palmitate adverse effect (Fig. 4 A). We transfected L6 myotubes with GFP-Glut4 plasmid followed by incubation with palmitate or palmitate plus daidzein; insulin was added prior to 30 minutes of termination of incubation (Fig. 4 B). Palmitate significantly increased both NF-κΒ p65 and NF-κΒ p50 protein levels (Fig. 4C). Palmitate induced increased NF-DB gene and protein expression was concentration and time dependent (Fig 4 D,E). Example 5
Determination of NF-κΒ content in cells through Western blot showed that there was a significant decrease of palmitate stimulated NF-κΒ due to daidzein (Fig.5 A). Both semiquantitative RT-PCR and quantitative Real Time PCR analysis showed that in palmitate incubated L6 myotubes NF-κΒ gene expression was significantly increased which was prevented by daidzein (Fig.5 B). These results suggest that daidzein inhibits NF-κΒ gene expression. Hence, daidzein inhibition of NF-κΒ protein overexpression due to palmitate is effected via the inhibition of NF-κΒ gene transcription. Daidzin, the flavone glycoside of daidzein also reduced palmitate induced NF-κΒ gene expression and protein synthesis (Fig 2C).
Example 6
L6 myotubes were incubated without or with palmitate, lysed by ultrasonication and then centrifuged. The supernatant was collected and loaded on Sephadex G75 column. The elution profile from these cells showed an increase of NF-κΒ p65 protein due to palmitate (A2) treatment in comparison to control (A1 ). The eluted fractions from these incubations were subjected to immunoaffinity chromatography by anti-NF- κΒρ65 antibody for further purification. The eluted fraction (P2) from immunoaffinity chromatography shows the cross reactivity with anti-NF-κΒ antibody in Western blot analysis (Fig.6). We have found that palmitate induced increased synthesis of NF-KB was prevented by daidzein.
Example 7
We transducted purified NF-κΒ p65 protein to L6 skeletal muscle cells then incubated them with insulin and [3H]-2DOG to observe whether excess of NF-κΒ p65 protein entry into the cell could affect insulin activity. Glucose uptake decreased in NF-κΒ p65 protein transducted cells which were prevented by daidzein (Fig. 7A). Western blot analysis confirmed the increased level of NF- Β p65 within the cell due to NF-κΒ p65 protein transduction (Fig. 7B). NF-κΒ p65 protein was transducted to a batch of GFP- Glut 4 transfected skeletal muscle cells and then subjected to insulin incubation. On termination of incubation, cells on the cover slips were fixed in paraformaldehyde (3.5%). The cover slips were examined for translocation of GFP-Glut 4 under laser scanning confocal microscope. GFP-Glut 4 translocation to plasma membrane in response to insulin was abrogated in NF-κΒ p65 transducted cells which were prevented by daidzein (Fig. 7 C).
Example 8
Palmitate activation leads to the increase in NF-κΒ nuclear localization. We tracked NF-KB in skeletal muscle cells by immunofluorescence study using FITC conjugated anti-NF-κΒ p65 antibody. Palmitate enhanced NF-κΒ level both in the cytoplasm and nuclear region was inhibited by daidzein (Fig.8).
Example 9
Palmitate induced increase of NF-κΒ translocation to the nucleus coincides with the enhanced binding of NF-κΒ with DNA. This was examined by performing EMSA. NF- KB -DNA complex formation was stimulated by palmitate whereas daidzein and SN-50 reduced the formation of this protein-DNA complex (Fig.9 A). Palmitate induces NF-KB binding to its κΒ enhancer element and regulates its own gene expression (Barma et al, 2009) whereas daidzein inhibits this binding and thus inactivates its gene expression. This suggests NF-κΒ has an autoregualtory loop, which controls its own gene expression. Palmitate induced phosphorylation of IKK and ΙκΒκ was not affected by daidzein suggesting that daidzein has no effect on the NF-κΒ activation pathway (Fig.9 B).
Example 10
Daidzein inhibits palmitate induced NF-κΒ promoter activity. Cells were incubated without (control) or without palmitate and palmitate plus daidzein. NF-κΒ promoter activity increased remarkably due to palmitate incubation and daidzein reduces the palmitate stimulatory effect (Fig.10 A). We also observed that NF-κΒ protein level in both control and palmitate treated cells by performing FACS analysis. Flow cytometric analysis showed that increased level of NF-κΒ in response to palmitate was significantly inhibited by daidzein (Fig.10 B).
Example 11
NF-KB regulates transcription of many inflammatory genes. It regulates transcription of fetuin-A, an inhibitor of insulin receptor tyrosine kinase. Primary hepatocytes were incubated without or with palmitate or palmitate plus daidzein. Palmitate significantly induced fetuin-A gene expression. Addition of NF-κΒ siRNA or Daidzein, inhibits fetuin-A synthesis by inhibiting NF-κΒ expression (Fig. 11 ). By preventing NF-κΒ gene expression daidzein can modulate NF-κΒ downstream signalling.
Example 12
Daidzein has also protective effect against prostate cancer and breast cancer. Daidzein at concentration of 5 g/ml reduce the gene expression of NF-κΒ in PC-3, androgen independent prostate cancer cell line (Fig.12 A) and MCF-7, breast cancer cell line (Fig.12 B).
Methods
The detailed methodologies utilized to obtained results in connection with the role of daidzein (Dn) in inhibiting NF-kB gene transcription are provided to understand our claim. Kindly note that although there are several reports on the inhibition of active NF- kB, which is a phosphorylated form of NF-kB by this isoflavone, inhibition of NF-kB gene and protein synthesis has no earlier report. Our novelty lies here. 1. Reagents
All tissue culture materials were obtained from Gibco-BRL, Life Technologies Inc., Gaithersburg, USA. [3H]-leucine (specific activity 1000 Ci/mmol), was obtained from GE Healthcare, Kowloon, Hong Kong. [γ-32ρ]-ΑΤΡ (Specific activity: 6000 Ci/mmol) was procured from BRIT, India. The primary antibodies for NF-kBp65, pNF-kBp65, ρΙΚΚα/β, ρΙκΒα, and β-actin were purchased from Santa Cruz Biotechnology Inc., California, USA. Control and NF-kBp65 (h) siRNA were also purchased from Santa Cruz Biotechnology Inc., California, USA. Fluorescence iso-thiocyanate (FITC) conjugated goat anti-rabbit and alkaline phosphatase conjugated secondary antibodies were purchased from Sigma Chemical Co., St. Louis MO, USA. All other chemicals and reagents were purchased from Sigma Chemical Co., St. Louis MO, USA.
2. Cell lines and cell culture
The breast cancer cell line MCF-7 ,the prostate cancer cell line PC-3 and L-6 skeletal muscle cell line were gifted by Dr. Partha P. Banerjee, Georgetown University Medical Center, USA (ATCC Deposit No.MCF-7, HTB-22, PC-3 CRL-1435, L6-CRL- 1458.). These cells were cultured in DMEM containing Earle's salts and non-essential amino acids supplemented with 10% fetal calf serum, penicillin (100 U/ml) and streptomycin (100 pg/ ml) in a humidified 95% 02/5% C02 atmosphere at 37°C. 3. Cell culture treatments
Confluent cells were subcultured by trypsinization and subsequently seeded in six well culture plates containing DMEM with essential supplements. Confluent MCF-7 cells were incubated with 3Dg/ml daidzein (Dn) and PC3 cells were incubated with 5μg/ml daidzein. Daidzein was dissolved in DMSO. Control cells were treated with equal amounts of DMSO in the media. At the end of incubation, cells were lysed, centrifuged for 10 min at 10,000g and the supernatant was collected. Protein concentration of supernatant was determined by following the method of Lowry et al [O.H. Lowry, N.J. Rosebrough, A.E. Farr, R.J. Randall, Protein measurement with Folin phenol reagent, J. Biol. Chem. 193 (1951 ) 265-275]. Scramble and NF-kBp65 siRNA were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) following manufacturer's instruction.
4. Western blots
Western blot was performed according to our previous description [S. Dasgupta,
5. Bhattacharya, A. Biswas, S. S. Majumdar, S. Mukhopadhyay, S. Ray and S. Bhattacharya (2010) NF-κΒ mediates lipid-induced fetuin-A expression in hepatocytes that impairs adipocyte function effecting insulin resistance. Biochem. J. 429: 451-462]. Briefly, 40-50 Dg of protein from control or treated cell lysates were resolved on 10% or 12.5% SDS-PAGE and transferred to PVDF membranes (Millipore, Bedford, MA) with the help of Semi-Dry trans blot Apparatus (Bio-Rad Trans-Blot® SD Cell, USA). The membranes were first incubated with different primary antibodies at 1 :1000 dilutions followed by respective alkaline phosphatase conjugated secondary antibodies at same dilutions using SNAP i.d. apparatus (Millipore, Bedford, MA). The protein bands were detected by developing with 5-bromro 4-chloro 3-indolyl phosphate/nitroblue tetrazolium (BCIP/NBT).
5. RT-PCR and Real Time PCR
Total RNA was extracted from different incubations using TRI-reagent according to the manufacturer's protocol. RT-PCR was performed with First strand cDNA synthesis kit, Fermentas Life Sciences, Revert Aid™, Hanover, MD, USA. Relative gene expression was further confirmed by Real-time PCR (Applied Biosystems Inc. CA, USA). PCR was performed using gene specific primers in the following reaction conditions: initial activation step at 95°C for 15mins, denaturation at 95°C for 30s, annealing at 50-55°C for 30s and final extension at 72°C for 30s x 40 cycles, gapdh was simultaneously amplified in separate reactions. CT value was corrected using corresponding gapdh controls. Primer sequences used were as follows; NF-kBp65 (forward: 5'-ccatcagggcagatctcaaacc-3' reverse: 5'-gctgctgaaactctgagttgtc-3'; Gene bank accession no. NM_021975.3), Bcl-2 (forward: 5'-TGGGATGCCTTTGTGGAACT- 3', reverse: 5'-GAGACAGCCAGGAGAAATCAAAC-3'; Gene bank accession no. NM_000657.1 ), Cyclin D1 (forward: 5 -GGATGCTGGAGGTCTGCGAGGAAC-3', reverse: 5 -GAGA-GGAAGCGTGTGAGGCGGTAG-3'; Gene bank accession no. NM_053056.2). gapdh (forward: 5'-gccatcaacgaccccttc-3', reverse: 5'- agccccagccttctcca-3'; Gene bank accession no. J04038.1 ).
6. Gel Filtration and Immunoaffinity Chromatography to purify NF-kB
To prepare NF-kB rich fraction, gel filtration chromatography was performed on a Sephadex G-75 (Amersham Pharmacia Biotech AB, Uppsala, Sweden) column (2x50 cm) equilibrated with Tris-CI buffer (10 mM Tris-CI, pH-7.4) by following an earlier description from this laboratory [D. Basu, S. Bhattacharya, Purification of two types of gonadotropin receptors from carp ovarian follicles: overlapping recognition by two different ligands, Gen. Comp. Endo. 129 (2002) 152-162]. The flow rate was maintained at 1 ml/min and 1.0 ml fractions were collected just after loading the skeletal muscle cell lysate. A standard gel filtration molecular weight marker from Sigma Chemical Co., St. Louis, USA, was run to determine the approximate molecular weight of the eluted proteins. Fractions around 66 kDa were pooled, lyophilized to reduce the volume and subjected to 10% SDS-PAGE. To identify NF-kB p65 there, the gel was transferred to PVDF membrane for Western blot analysis. It was further purified by immunoaffinity chromatography where CNBr activated Sepharose 4B beads were conjugated with the anti-NF-kBp65 antibody. Coupling of the antibody was carried out by following the procedure previously described from this laboratory. Briefly, NF-kB p65 antibody coupled Sepharose 4B beads were loaded on a 5 ml column. Unbound antibody was removed by washing with coupling buffer (pH-8.5) followed by acetate buffer (0.1 M, pH-4.0). The remaining active groups on the beads were blocked with glycine buffer (0.2 M, pH-8.0). The sample was loaded on the column and kept overnight at 4°C. The unbound proteins were eluted with 10 mM Tris- HCI buffer, pH-7.4 while NF-kBp65 bound to the ligand was eluted with elution buffer (10 mM Tris-HCI, pH -7.4) containing 2.0 M Kl as a chaotropic agent. The volume of each eluted fraction was 1.0 ml. The fractions were collected until the O.D. at 280 nm reached the baseline, pooled and dialyzed against the buffer (10 mM Tris-HCI, pH - 7.4) and lyophilized. The purity of NF-kB p65 was examined in a 10% SDS-PAGE where it gave a single protein band which also crossreacted with anti-NF-kB p65 antibody.
7. Electrophoretic Mobility Shift Assay (EMSA)
EMSA was performed by using nuclear extracts prepared from different incubations in cancer cells using oligonucleotide probes specific for NF-kB binding site (Wild: 5 - AGTTGAGGGGACTTTCCCAGGC -3', mutants: 5'- AGTTGAGGGAACTTTCCCAGGC -3', AGTTGAGGAAACTTTCCCAGGC -3'). The probes were end-labelled with [γ32ρ]-ΑΤΡ using T4 polynucleotide kinase and then incubated with 10 Dg of nuclear extracts of control and Dn treated MCF-7 and PC3 cells in a 20 Dl of binding reaction for 45 min. Reaction mixtures were resolved on 5% polyacrylamide gel and visualized by Phosphorlmager (GE Healthcare, USA).
8. [3H]-leucine incorporation study
MCF-7 and PC3 cells were incubated in Kreb's Ringer Phosphate (KRP) buffer supplemented with 0.2% bovine serum albumin. To determine the effect of Dn on NF- kBp65 protein synthesis, cells were incubated with 10μΟί/ιτιΙ of [3H]-leucine in the presence or absence of Dn. Cells were also transfected with NF-kBp65 siRNA or scramble siRNA. On termination of incubation cells were lysed and NF-kBp65 was pulled down by anti-NF-kBp65 antibody. Radioactive count incorporation to NF-kBp65 was measured in Liquid Scintillation counter (Perkin Elmer, Tri-Carb 2800TR).
9. [γ3 ρ]-ΑΤΡ incorporation study
MCF-7 and PC3 cells were incubated without or with daidzein (Dn) or transfected with NF-kBp65 siRNA or scramble siRNA in the presence of 80 μΜ [γ3 ρ]-ΑΤΡ and on termination of incubation, cell lysates were subjected to immunoprecipitation with anti- pNF-kBp65 antibody. Radioactive count incorporation to pNF-kBp65 was measured in Liquid Scintillation counter (Perkin Elmer, Tri-Carb 2800TR).
Example 13
MCF-7 and PC3 cells were treated without (Con) or with Dn (3 and 5 dg/ml repectively) or transfected with NF- kB p65 siRNA (p65KO) or scramble siRNA (Mock). Control cells contained DMSO as vehicle. Total RNA extracted from these cells was subjected to qPCR analysis using NF-i Bp65 gene specific primers, gapdh was used as internal control. MCF-7 and PC3 cells were incubated without or with Dn or transfected with NF- kB p65 (p65KO) or scramble (Mock) siRNA followed by the incubation of [3H]-leucine or [γ32ρ]-ΑΤΡ. NF- kB p65 or pNF- kB p65 was pull-down from the cell lysates and % incorporation of radiolabelled leucine or phosphate into NF- kB p65 or pNF- kB p65 was determined by radioactive counting in liquid scintillation counter. Figures are one of the representatives of five individual experiments. Data represented are means ± SEM, *p<0.01 vs Con, #p<0.001 vs Con. Our results demonstrate that suppression of NF- kB p65 gene expression by p65siRNA and a flavone compound; daidzein (Dn) reduced both inactive and phosphorylated form of NF- kB in cancer cells. The reason for selecting both p65siRNA and Dn to suppress NF- kB is that NF- kB p65 siRNA specifically inhibits its mRNA whereas Dn occupies promoter kB segment where NF- kB binds to express its gene. We therefore had two modes of NF- kB gene suppression to study the importance of equilibrium between inactive and active NF- kB in NF- kB dependent cancer cells. Inhibition of NF- kB gene expression in MCF-7 and PC3 cells consequently reduced its protein expression and this coincided with the significant decrease of its phospho-form. To examine whether such reduction is due to inhibition of NF- kB protein synthesis and that effected subdued phosphorylation, we incubated MCF-7 and PC3 cells with [3H]-leucine or [γ32ρ]-ΑΤΡ followed by immunoprecipitation of active and inactive NF- kB with their respective antibodies. NF- kB protein synthesis was markedly reduced because of suppressed NF- kB gene expression by NF-KBp65 siRNA or Dn. This corresponded with the significant decline of phosphorylated NF- kB indicating that active NF- kB pool in these cells is dependent on its de novo synthesis.
Advantages of present invention-
1. Till date an inhibitor of NF-kB synthesis has not been reported, hence, novelty of our research investigation lies on this achievement as daidzein has been found to be an effective inhibitor of NF-kB gene expression. Since it blocks transcription of NF-kB p65.
2. Daidzein inhibits NF-kB synthesis by reducing its gene expression.
3. For last few years there are several reports that in some cancers such as lung cancer, breast cancer, pancreatic cancer, colon cancer and in brain cancer NF- kB remains overexpressed. The reason behind this robust expression of NF-kB in these cancers has been reported to be their dependence on NF-kB. Such an excess expression of NF-kB is required for their survivability of these cancer cells Saitoh et al. (2010) Cancer 70: 263-270, Yu et al. (2003) Oncology 65: 37-45, Yu et al. (2004) Int J Colorectal Dis 19: 18-22).
Therefore in these NF-kB dependent cancer cells, an inhibitor of NF-kb expression would be a suitable intervention for their growth and survivability. Daidzein will serve this purpose as this is the only inhibitor of NF-kb expression known till date through our investigation. This is indeed a great advantage for daidzein.

Claims

Claims:
A method for inhibiting NF- kappaB gene expression which comprises administering to a vertebrate in need of treatment, a therapeutically effective amount of atleast one compound selected from the group consisting of isoflavone obtainable from a soyabean plant belonging to the genus Glycine, and pharmaceutically acceptable salts thereof.
A method as claimed in claim 1, wherein isoflavone selected are daidzein and daidzin extracted from soybean.
A method as claimed in claim 1 , wherein the cell lines used were selected from the group consisting of PC-3 Prostrate Cancer cell line, and MCF-7 Breast Cancer cell line.
A method as claimed in claim land 2, wherein the NF-KappaB inhibition is used to treat diseases selected from the group comprising of Breast Cancer, Prostate Cancer and Diabetes.
A method as claimed in claim 1-4, wherein the effective amount of Daidzein used
is about 3-5pg /ml.
A method of treating human Prostrate cancer, Breast cancer, and Diabetes comprising administering orally to a subject in need thereof isoflavone selected from the group consisting of Diadzein and Diadzinin the range of 3-5pg /ml. Use of Diadzein and Diadzin as an inhibitor of NF-kb gene expression.
Use of Diadzein and Diadzin for the treatment of human Prostrate cancer, Breast cancer, and Diabetes.
EP11746612.8A 2010-07-07 2011-07-07 Method for inhibition of nf-kb gene expression Withdrawn EP2590646A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IN1590DE2010 2010-07-07
PCT/IB2011/001580 WO2012004653A1 (en) 2010-07-07 2011-07-07 Method for inhibition of nf-kb gene expression

Publications (1)

Publication Number Publication Date
EP2590646A1 true EP2590646A1 (en) 2013-05-15

Family

ID=44503999

Family Applications (1)

Application Number Title Priority Date Filing Date
EP11746612.8A Withdrawn EP2590646A1 (en) 2010-07-07 2011-07-07 Method for inhibition of nf-kb gene expression

Country Status (4)

Country Link
EP (1) EP2590646A1 (en)
JP (1) JP2013530207A (en)
AU (1) AU2011275442A1 (en)
WO (1) WO2012004653A1 (en)

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0656786B2 (en) * 1992-05-19 2014-04-23 Novogen Research Pty Ltd Use of isoflavone phyto-oestrogen extracts of soy or clover
EP1127572A3 (en) * 2000-02-25 2003-05-02 Basf Aktiengesellschaft Use of flavones for treating cycloxygenase-2 mediated diseases
JP2003286166A (en) * 2002-03-26 2003-10-07 Nichimo Co Ltd Preventive and therapeutic preparations for insulin resistant diabetes
JP2004196720A (en) * 2002-12-19 2004-07-15 Nichimo Co Ltd Prophylactic and therapeutic preparations for prostate disease

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2012004653A1 *

Also Published As

Publication number Publication date
AU2011275442A1 (en) 2013-01-24
JP2013530207A (en) 2013-07-25
WO2012004653A8 (en) 2012-12-20
WO2012004653A1 (en) 2012-01-12

Similar Documents

Publication Publication Date Title
Zhong et al. NFATc1-mediated expression of SLC7A11 drives sensitivity to TXNRD1 inhibitors in osteoclast precursors
Yuan et al. CTRP3 protected against doxorubicin-induced cardiac dysfunction, inflammation and cell death via activation of Sirt1
Su et al. Licochalcone A activates Keap1-Nrf2 signaling to suppress arthritis via phosphorylation of p62 at serine 349
Qu et al. Chicoric acid attenuates tumor necrosis factor-α-induced inflammation and apoptosis via the Nrf2/HO-1, PI3K/AKT and NF-κB signaling pathways in C28/I2 cells and ameliorates the progression of osteoarthritis in a rat model
Hao et al. Trim47 is a critical regulator of cerebral ischemia-reperfusion injury through regulating apoptosis and inflammation
Xu et al. Enhanced cellular cholesterol efflux by naringenin is mediated through inhibiting endoplasmic reticulum stress-ATF6 activity in macrophages
CN107921015B (en) Azelaic acid composition with effect of hydrolyzing triglyceride in adipose tissue
Hu et al. Senkyunolide I attenuates oxygen-glucose deprivation/reoxygenation-induced inflammation in microglial cells
Bai et al. Biliverdin modulates the Nrf2/A20/eEF1A2 axis to alleviate cerebral ischemia-reperfusion injury by inhibiting pyroptosis
Zhou et al. Fenugreek attenuates obesity-induced inflammation and improves insulin resistance through downregulation of iRhom2/TACE
Majeed et al. Garcinia indica extract standardized for 20% Garcinol reduces adipogenesis and high fat diet-induced obesity in mice by alleviating endoplasmic reticulum stress
Li et al. Naringin promotes skeletal muscle fiber remodeling by the AdipoR1-APPL1-AMPK signaling pathway
KR101653451B1 (en) HER-2 targeted aptamer complex and use thereof
Bi et al. Cedrol attenuates acute ischemic injury through inhibition of microglia-associated neuroinflammation via ERβ-NF-κB signaling pathways
Xue et al. A novel protoapigenone analog RY10-4 induces apoptosis of breast cancer cells by exacerbating mitochondrial Ca2+ influx through mitochondrial calcium uniporter
Nagai et al. Anti-obesity effects of Asian dayflower, Commelina communis, in mice with high-fat diet-induced obesity and in 3T3-L1 cells
Wu et al. Ginsenoside Rh2 inhibits CBP/p300-mediated FOXO3a acetylation and epilepsy-induced oxidative damage via the FOXO3a–KEAP1–NRF2 pathway
CN113573725B (en) Anticancer drug composition containing IF1 as active ingredient
Yoon et al. Cyclophilin B, a molecule chaperone, promotes adipogenesis in 3T3-L1 preadipocytes via AKT/mTOR pathway
Liu et al. Edible O. fragrans flower ameliorates LPS-induced inflammatory responses through suppressing NF-κB and AP-1 pathways
Li et al. The bioflavonoid troxerutin prevents gestational hypertension in mice by inhibiting STAT3 signaling
WO2015093901A1 (en) Pharmaceutical composition containing taz protein activation inducing component for muscle differentiation and muscle regeneration
EP2590646A1 (en) Method for inhibition of nf-kb gene expression
US20160113852A1 (en) Sex hormone-binding globulin for use as a medicament
EP2937096B1 (en) Peptides derived from RS1 which down-regulate glucose absorption after a glucose rich meal and increase insulin sensitivity

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20121220

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20140111