EP2588602A1 - Variants of glucoamylase - Google Patents

Variants of glucoamylase

Info

Publication number
EP2588602A1
EP2588602A1 EP11736309.3A EP11736309A EP2588602A1 EP 2588602 A1 EP2588602 A1 EP 2588602A1 EP 11736309 A EP11736309 A EP 11736309A EP 2588602 A1 EP2588602 A1 EP 2588602A1
Authority
EP
European Patent Office
Prior art keywords
glucoamylase
seq
amino acid
parent
glucoamylase variant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP11736309.3A
Other languages
German (de)
French (fr)
Inventor
Peter Edvard Degn
Richard R. Bott
Casper Willem Vroemen
Martijn Silvan Scheffers
Wolfgang Aehle
Elin Petersen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
International N and H Denmark ApS
Danisco US Inc
Original Assignee
DuPont Nutrition Biosciences ApS
Danisco US Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/EP2010/062035 external-priority patent/WO2011020852A1/en
Application filed by DuPont Nutrition Biosciences ApS, Danisco US Inc filed Critical DuPont Nutrition Biosciences ApS
Priority to EP11736309.3A priority Critical patent/EP2588602A1/en
Publication of EP2588602A1 publication Critical patent/EP2588602A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C13SUGAR INDUSTRY
    • C13KSACCHARIDES OBTAINED FROM NATURAL SOURCES OR BY HYDROLYSIS OF NATURALLY OCCURRING DISACCHARIDES, OLIGOSACCHARIDES OR POLYSACCHARIDES
    • C13K1/00Glucose; Glucose-containing syrups
    • C13K1/06Glucose; Glucose-containing syrups obtained by saccharification of starch or raw materials containing starch
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L29/00Foods or foodstuffs containing additives; Preparation or treatment thereof
    • A23L29/30Foods or foodstuffs containing additives; Preparation or treatment thereof containing carbohydrate syrups; containing sugars; containing sugar alcohols, e.g. xylitol; containing starch hydrolysates, e.g. dextrin
    • A23L29/35Degradation products of starch, e.g. hydrolysates, dextrins; Enzymatically modified starches
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12CBEER; PREPARATION OF BEER BY FERMENTATION; PREPARATION OF MALT FOR MAKING BEER; PREPARATION OF HOPS FOR MAKING BEER
    • C12C5/00Other raw materials for the preparation of beer
    • C12C5/004Enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12CBEER; PREPARATION OF BEER BY FERMENTATION; PREPARATION OF MALT FOR MAKING BEER; PREPARATION OF HOPS FOR MAKING BEER
    • C12C7/00Preparation of wort
    • C12C7/04Preparation or treatment of the mash
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405Glucanases
    • C12N9/2408Glucanases acting on alpha -1,4-glucosidic bonds
    • C12N9/2411Amylases
    • C12N9/2428Glucan 1,4-alpha-glucosidase (3.2.1.3), i.e. glucoamylase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/02Monosaccharides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01003Glucan 1,4-alpha-glucosidase (3.2.1.3), i.e. glucoamylase

Definitions

  • Glucoamylase enzymes are starch hydrolyzing exo-acting carbohydrases, which catalyze the removal of successive glucose units from the non-reducing ends of starch or related oligo and polysaccharide molecules. Glucoamylases can hydrolyze both the linear and branched glucosidic linkages of starch ⁇ e.g. , amylose and amylopectin).
  • Glucoamylases are produced by numerous strains of bacteria, fungi, yeast and plants.
  • glucoamylases are fungal enzymes that are extracellularly produced, for example from strains of Aspergillus (Svensson et al.,
  • glucoamylases are very important enzymes and have been used in a wide variety of applications that require the hydrolysis of starch (e.g., for producing glucose and other monosaccharides from starch). Glucoamylases are used to produce high fructose corn sweeteners, which comprise over 50% of the sweetener market in the United States.
  • glucoamylases may be, and commonly are, used with alpha-amylases in starch hydrolyzing processes to hydrolyze starch to dextrins and then glucose.
  • the glucose may then be converted to fructose by other enzymes (e.g., glucose isomerases); crystallized; or used in fermentations to produce numerous end products (e.g., ethanol, citric acid, lactic acid, succinate, ascorbic acid intermediates, glutamic acid, glycerol and 1, 3-propanediol).
  • Ethanol produced by using glucoamylases in the fermentation of starch and/or cellulose containing material may be used as a source of fuel or for alcoholic consumption.
  • glucoamylase synthesizes di-, tri- , and tetra- saccharides from glucose by condensation reactions. This occurs because of the slow hydrolysis of alpha-(l-6)-D-glucosidlc bonds in starch and the formation of various accumulating condensation products, mainly isomaltose, from D-glucose. Accordingly, the glucose yield in many conventional processes does not exceed 95% of theoretical yield. The amount of syrups produced worldwide by this process is very large and even very small increases in the glucose yield pr ton of starch are commercially important.
  • Glucoamylase is used in brewing mainly for production of low carb beer. In combination with other amylases (such as from the malt), glucoamylase gives a very extensive hydrolysis of starch, all the way down to glucose units. Glucose is readily converted to alcohol by yeast making it possible for the breweries to obtain a very high alcohol yield from fermentation and at the same time obtain a beer, which is very low in residual carbohydrate. The ferment is diluted down to the desired alcohol % with water, and the final beer is sold as "low carb”.
  • glucoamylases have been used successfully in commercial applications for many years, a need still exists for new glucoamylases with altered properties, such as an improved specific activity, a reduced formation of condensation products such as isomaltose and increased thermostability.
  • glucoamylase variants and the use of glucoamylase variants for reducing the synthesis of condensation products during hydrolysis of starch are contemplated herein.
  • These glucoamylase variants contain amino acid substitutions within the catalytic domains and/or the starch binding domain.
  • the variants display altered properties, such as an altered specific activity, a reduced formation of condensation products such as isomaltose and/or altered thermostability.
  • a glucoamylase variant comprising the following amino acid substitutions: a) 44R and 539R; or b) 44R, 611 and 539R, the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase, wherein the glucoamylase variant has at least 80% sequence identity with SEQ ID NO: 1 or 2, or the parent glucoamylase.
  • the use is described of a glucoamylase variant for the preparation of an enzymatic composition.
  • the enzymatic composition comprises at least one additional enzyme selected among amylase, protease, pullulanase, isoamylase, ceilulase, glucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, phytase and a further glucoamylase such as for example an pullulanase and a alpha-amylase.
  • additional enzyme selected among amylase, protease, pullulanase, isoamylase, ceilulase, glucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, phytase and a further glucoamylase such as for example an pullulanase and a alpha-amylase.
  • a glucoamylase variant with a starch binding domain and a catalytic domain comprising two or more amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 2 or equivalent parent glucoamylase in interconnecting loop 2',and/or in loop 1, and/or in helix 2, and/or In loop 11, and/or in helix 12 for reducing the synthesis of condensation products during hydrolysis of starch.
  • a glucoamylase variant comprising two or more amino acid substitutions relative to interconnecting loop 2' with the amino acid sequence from position 518 to position 543 of SEQ ID NO:2 or equivalent sequence of residues
  • a parent glucoamylase and/or loop 1 with the amino acid sequence from position 21 to position 51 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or helix 2 with the amino acid sequence from position 52 to position 68 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or loop 11 with the amino acid sequence from position 396 to position 420 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase, and/or helix 12 with the amino acid sequence from position 421 to position 434 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase for reducing the synthesis of condensation products during hydrolysis of
  • a glucoamylase variant comprising two or more amino acid substitutions relative to the amino acid sequence from position 518 to position 543 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 21 to position 51 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 52 to position 68 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 396 to position 420 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 421 to position 434 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase for reducing the synthesis of condensation products during hydrolysis of starch.
  • glucoamylase variant wherein said two or more amino acid substitutions are relative to the interconnecting loop 2' with the amino acid sequence from position 518 to position 543 of SEQ ID NO:2, and/or loop 1 with the amino acid sequence from position 21 to position 51 of SEQ ID NO: 2, and/or helix 2 with the amino acid sequence from position 52 to position 68 of SEQ ID NO:2, and/or loop 11 with the amino acid sequence from position 396 to position 420 of SEQ ID NO: 2, and/or helix 12 with the amino acid sequence from position 421 to position 434 of SEQ ID NO: 2.
  • a glucoamylase variant which when in its crystal form has a crystal structure for which the atomic coordinates of the main chain atoms have a root-mean- square deviation from the atomic coordinates of the equivalent main chain atoms of TrGA (as defined in Table 20 in WO2009/067218) of less than 0.13 nm following alignment of equivalent main chain atoms, and which have a linker region, a starch binding domain and a catalytic domain, said variant comprising two or more amino acid substitutions relative to the amino acid sequence of the parent glucoamylase in interconnecting loop 2' of the starch binding domain, and/or in loop 1, and/or in helix 2, and/or in loop 11, and/or in helix 12 of the catalytic domain for reducing the synthesis of condensation products during hydrolysis of starch.
  • the glucoamylase variant comprises two or more amino acid substitutions, wherein an amino acid substitution is in position 539 and an amino acid substitution is in position 44, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase, and which sequence has at least 80% sequence identity to the parent glucoamylase, and wherein the amino acid substitution in position 44 is not 44C.
  • the present disclosure further relates to a polynucleotide encoding a glucoamylase variant as described herein.
  • a plasmid comprising a nucleic acid.
  • a vector comprising a polynucleotide as described, or capable of expressing a glucoamylase variant as described.
  • Another aspect Is a host cell comprising, e.g. transformed with, a plasmid or a vector as described.
  • Another aspect is a host cell, which has stably integrated into the chromosome a nucleic acid sequence encoding the variant glucoamylase.
  • Another aspect is a cell capable of expressing a glucoamylase variant as described.
  • Another aspect is a method of expressing a glucoamylase variant, the method comprising obtaining a host cell or a cell and expressing the glucoamylase variant from the cell or host cell, and optionally purifying the glucoamylase variant.
  • a further aspect of the disclosure is an enzymatic composition comprising at least one glucoamylase variant as described herein, and the use thereof.
  • a further aspect of the disclosure is a method for converting starch or partially hydrolyzed starch into a syrup containing glucose, which process includes saccharifying a liquid starch solution in the presence of at least one glucoamylase variant or an enzymatic composition as described herein.
  • a further aspect of the disclosure is the use of a glucoamylase variant as described herein in a starch conversion process, such as in a continuous starch conversion process, in a process for producing oligosaccharides, maltodextrins or glucose syrups and in a process for producing high fructose corn syrup.
  • glucoamylase variant as described herein in a alchohol fermentation process is provided.
  • a further aspect of the disclosure is a method for producing a wort for brewing comprising forming a mash from a grist, and contacting the mash with a glucoamylase variant as described or an enzymatic composition as described.
  • Yet a further aspect of the disclosure is a method for production of a beer which comprises: a) preparing a mash, b) filtering the mash to obtain a wort, and fermenting the wort to obtain a beer, wherein a glucoamylase variant as described is added to: step (a) and/or step (b) and/or step (c).
  • Yet a further aspect of the disclosure is the use of a glucoamylase variant as described to enhance the production of fermentable sugars in either the mashing step or the fermentation step of a brewing process.
  • Yet a further aspect of the disclosure is a beer, wherein the beer is produced by the steps of: a) preparing a mash, b) filtering the mash to obtain a wort, c) fermenting the wort to obtain a beer, and d) pasteurizing the beer, wherein a glucoamylase variant as described is added to: step (a) and/or step (b) and/or step (c). Accordingly, it is an object of the invention to not encompass within the invention any previously known product, process of making the product, or method of using the product such that Applicants reserve the right and hereby disclose a disclaimer of any previously known product, process, or method.
  • the invention does not intend to encompass within the scope of the invention any product, process, or making of the product or method of using the product, which does not meet the written description and enablement requirements of the USPTO (35 U.S.C. ⁇ 112, first paragraph) or the EPO (Article 83 of the EPC), such that Applicants reserve the right and hereby disclose a disclaimer of any previously described product, process of making the product, or method of using the product,
  • FIG. 1A depicts a Trichoderma reesei glucoamylase (TrGA) having 632 amino acids (SEQ ID NO : 1) .
  • the signal peptide is underlined, the catalytic region (SEQ ID NO: 3) starting with amino acid residues SVDDFI (SEQ ID NO: 12) and having 453 amino acid residues is In bold; the linker region is in italics and the starch binding domain (SBD) is both italics and underlined.
  • the mature protein of TrGA (SEQ ID NO: 2) includes the catalytic domain (SEQ ID NO : 3), linker region (SEQ ID NO: 10), and starch binding domain (SEQ ID NO : 11).
  • FIG. IB depicts the cDNA (SEQ ID NO:4) that codes for the TrGA.
  • FIG. 1C depicts the precursor and mature protein TrGA domains.
  • FIG. 2 depicts the destination plasmid pDONR-TrGA which includes the cDNA (SEQ ID NO: 4) of the TrGA.
  • FIG. 3 depicts the plasmid pTTT-Dest.
  • FIG. 4 depicts the final expression vector pTTT-TrGA.
  • FIGs. 5A and 5B depict an alignment comparison of the catalytic domains of parent glucoamyiases from Aspergillus awamori (AaGA) (SEQ ID NO: 5); Aspergillus niger (AnGA) (SEQ ID NO: 6); Aspergillus oryzae (AoGA) (SEQ ID NO: 7); Trichoderma reesei (TrGA) (SEQ ID NO: 3); Humico/a grisea (HgGA) (SEQ ID NO: 8); and Hypocrea vinosa (HvGA) (SEQ ID NO: 9). Identical amino acids are indicated by an asterisk (*).
  • FIG. 5C depicts a
  • FIGs 5D and 5E depict an alignment comparing the Starch Binding Domain (SBD) of parent glucoamyiases from Trichoderma reesei (SEQ ID NO : 11); Humicola grisea (HgGA) (SEQ ID NO: 385); Thermomyces lanuginosus (ThGA) (SEQ ID NO: 386); Talaromyces emersonii (TeGA) (SEQ ID NO: 387); Aspergillus niger (AnGA) (SEQ ID NO: 388); Aspergillus awamori (AaGA) (SEQ ID NO: 389); and Thielavia terrestris (TtGA) (SEQ ID NO: 390).
  • SBD Starch Binding Domain
  • FIG. 6 depicts a comparison of the three dimensional structure of Trichoderma reesei glucoamylase (black) (SEQ ID NO: 2) and Aspergillus awamori glucoamylase (grey) (SEQ ID NO: 5) viewed from the side. The side is measured in reference to the active site and the active site entrance is at the "top" of the molecule.
  • FIG. 7 depicts a comparison of the three dimensional structures of Trichoderma reesei glucoamylase (black) (SEQ ID NO: 2) and Aspergillus awamori glucoamylase (grey) (SEQ ID NO: 5) viewed from the top.
  • FIG. 8 depicts an alignment of the three dimensional structures of TrGA (SEQ ID NO: 2) and AnGA (SEQ ID NO: 6) viewed from the side showing binding sites 1 and 2.
  • FIG. 9 depicts a model of the binding of acarbose to the TrGA crystal structure.
  • Fig. 10 depicts a TLC plate with standards containing different concentrations of glucose, maltose and isomaltose and samples containing reaction products from glucose incubated with TrGA and AnGA.
  • Glucoamylases are commercially important enzymes in a wide variety of applications that require the hydrolysis of starch.
  • the applicants have found that by introducing certain alterations In positions within specific regions of the amino acid sequence of a parent glucoamylase the rate of forming alpha-(l-6) bonds is reduced, and/or the formation of condensation products such as isomaltose is reduced.
  • a reduction of the rate that glucoamylase forms alpha-(l-6) bonds relative to the rate it cleaves alpha-( l-4) bonds has practical implications.
  • the present inventors have provided a number of variants of a parent glucoamylase, which variants in some embodiments show a reduced condensation and/or a reduced ratio between isomaltose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase.
  • using a glucoamylase variant as described herein in a saccharification process produces a syrup with high glucose percentage.
  • glucoamylase variant as described herein results in an enhanced production of fermentable sugars in a mashing and/or fermentation step of a brewing step.
  • using a glucoamylase variant as described herein results in an enhanced real degree of fermentation.
  • glucoamylase variant comprising two or more amino acid substitutions relative to interconnecting loop 2' with the amino acid sequence from position 518 to position 543 of SEQ ID NO : 2 or equivalent sequence of residues in a parent glucoamylase, and/or loop 1 with the amino acid sequence from position 21 to position 51 of SEQ ID NO:2 or equivalent sequence of residues in a parent
  • glucoamylase and/or helix 2 with the amino acid sequence from position 52 to position 68 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or loop 11 with the amino acid sequence from position 396 to position 420 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase, and/or helix 12 with the amino acid sequence from position 421 to position 434 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase for reducing the synthesis of condensation products during hydrolysis of starch.
  • a glucoamylase variant comprising two or more amino acid substitutions relative to the amino acid sequence from position 518 to position 543 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 21 to position 51 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 52 to position 68 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 396 to position 420 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 421 to position 434 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase for reducing the synthesis of condensation products during hydrolysis of starch.
  • glucoamylase variant when in its crystal form has a crystal structure for which the atomic coordinates of the main chain atoms have a root-mean-square deviation from the atomic coordinates of the equivalent main chain atoms of TrGA (as defined in Table 20 in
  • WO2009/067218 of less than 0.13 nm following alignment of equivalent main chain atoms, and which have a linker region, a starch binding domain and a catalytic domain, said variant comprising two or more amino acid substitutions relative to the amino acid sequence of the parent glucoamylase in interconnecting loop 2' of the starch binding domain, and/or in loop 1, and/or in helix 2, and/or in loop 11, and/or in helix 12 of the catalytic domain for reducing the synthesis of condensation products during hydrolysis of starch.
  • the root-mean-square deviation from the atomic coordinates of the equivalent main chain atoms of TrGA is less than 0.12 nm, such as less than 0.11 or such as less than 0.10.
  • a glucoamylase variant with a starch binding domain and a catalytic domain comprising two or more amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 2 or equivalent parent glucoamylase in interconnecting loop 2', and/or in loop 1, and/or in helix 2, and/or in loop 11, and/or in helix 12 for reducing the synthesis of condensation products during hydrolysis of starch.
  • a glucoamylase variant wherein said two or more amino acid substitutions are relative to the interconnecting loop 2' with the amino acid sequence from position 518 to position 543 of SEQ ID NO:2 or equivalent sequence of residues in parent glucoamylase, and/or loop 1 with the amino acid sequence from position 21 to position 51 of SEQ ID NO:2 or equivalent sequence of residues in parent glucoamylase, and/or helix 2 with the amino acid sequence from position 52 to position 68 of SEQ ID NO: 2 or equivalent sequence of residues in parent glucoamylase, and/or loop 11 with the amino acid sequence from position 396 to position 420 of SEQ ID NO: 2 or equivalent sequence of residues in parent glucoamylase, and/or helix 12 with the amino acid sequence from position 421 to position 434 of SEQ ID NO: 2 or equivalent sequence of residues in parent
  • glucoamylase In a further aspect, the use is described of a glucoamylase variant wherein said two or more amino acid substitutions are relative to the interconnecting loop 2' with the amino acid sequence from position 518 to position 543 of SEQ ID NO:2, and/or loop 1 with the amino acid sequence from position 21 to position 51 of SEQ ID NO:2, and/or helix 2 with the amino acid sequence from position 52 to position 68 of SEQ ID NO:2, and/or loop 11 with the amino acid sequence from position 396 to position 420 of SEQ ID NO: 2, and/or helix 12 with the amino acid sequence from position 421 to position 434 of SEQ ID NO:2.
  • the two or more amino acid substitutions are at least one such as one, two or three amino acid substitution in the interconnecting loop 2' and at least one such as one, two, three, four, five or six amino acid substitution in loop 1 and/or helix 2 and/or loop 11 and/or helix 12.
  • the two or more amino acid substitutions are one, two, three or four amino acid substitutions in the interconnecting loop 2' and one, two, three or four amino acid substitutions in loop 1 and/or helix 2 and/or loop 11 and/or helix 12. In a further aspect, there are one, two, three or four amino acid substitutions in the interconnecting loop 2'. In a further aspect, there are one, two, three or four amino acid substitutions in loop 1. In a further aspect, there are one, two, three or four amino acid substitutions in helix 2. In a further aspect, there are one, two, three or four amino acid substitutions in loop 11. In a further aspect, there are one, two, three or four amino acid substitutions in helix 12.
  • the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in loop 1.
  • the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in helix 2.
  • the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in loop 11,
  • the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in helix 12.
  • the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in loop 1 and at least one amino acid substitution in helix 2.
  • the glucoamylase variant has at least one amino acid substitution within position 520-543, 530-543, or 534-543 of interconnecting loop 2', the positions
  • the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 30-50, 35-48, or 40-46 of loop 1, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase.
  • the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 50-66, 55-64, or 58-63 of helix 2, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase.
  • the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 405-420, 410-420, or 415-420 of loop 11, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase.
  • the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 421-434, 425-434, or 428-434 of helix 12, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase.
  • the glucoamylase variant has at least 80%, 85%, 90%, 95%, 98%, or 99.5% sequence identity to the parent glucoamylase, such as at least 80%, 85%, 90%, 95%, 98%, or 99.5% sequence identity to SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9. In one aspect, the glucoamylase variant has at least 80%, 85%, 90%, 95%, 98%, or 99.5% sequence identity to SEQ ID NO:2.
  • the parent glucoamylase or the glucoamylase variant has a starch binding domain that has at least 96%, 97%, 98%, 99%, or 99.5% sequence identity with the starch binding domain of SEQ ID NO: 1, 2, 11, 385, 386, 387, 388, 389, or 390.
  • the parent glucoamylase or the glucoamylase variant has a catalytic domain that has at least 80%, 85%, 90%, 95%, or 99.5% sequence identity with the catalytic domain of SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9.
  • the glucoamylase variant has an amino acid substitution in position 539 and one or more amino acid substitutions in a position selected from position 44, 61, 417 and 431, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase. In one aspect, the glucoamylase variant has an amino acid substitution in position 539 and a) an amino acid substitution in position 44 and/or b) amino acid substitutions in both positions 417 and 431, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase.
  • the glucoamylase variant has an amino acid substitution in position 539 and an amino acid substitution in position 44, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase. In one aspect, the glucoamylase variant has an amino acid substitution in position 539 and amino acid substitutions in positions 417 and 431, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase. In one aspect, the glucoamylase variant has an amino acid substitution in position 539 and amino acid substitutions in positions 44 and 61, the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
  • the glucoamylase variant has an amino acid substitution in position 43, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase, In one aspect, the glucoamylase variant has an amino acid substitution in position 61, the position
  • the amino acid substitution in position 539 Is 539R, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
  • the amino acid substitution in position 44 is 44R, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
  • the amino acid substitution in position 417 is 417R/V, the position corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase.
  • the amino acid substitution in position 417 is 417R, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase. In one aspect, the amino acid substitution in position 417 is 417V, the position corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase.. In one aspect, the amino acid substitution in position 431 is 431L, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase. In one aspect, the amino acid substitution in position 43 is 43R, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase. In one aspect, the amino acid substitution in position 61 is 611, the position corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase. T EP2011/061082
  • the condensation product is isomaltose
  • the hydrolysis of starch is in a brewing process. In for example brewing, the formation of isomaltose is undeslred because it can not be converted into alcohol during fermentation .
  • Beer is traditionally referred to as an alcoholic beverage derived from malt, such as malt derived from barley, and optionally adjuncts, such as cereal grains, and flavoured with hops.
  • Beer can be made from a variety of grains by essentially the same process. All grain starches are glucose homopolymers in which the glucose residues are linked by either alpha-1, 4- or alpha- l,6-bonds, with the former predominating.
  • the process of making fermented malt beverages is commonly referred to as brewing.
  • the principal raw materials used in making these beverages are water, hops and malt.
  • adjuncts such as common corn grits, refined corn grits, brewer's milled yeast, rice, sorghum, refined corn starch, barley, barley starch, dehusked barley, wheat, wheat starch, torrified cereal, cereal flakes, rye, oats, potato, tapioca, and syrups, such as corn syrup, sugar cane syrup, inverted sugar syrup, barley and/or wheat syrups, and the like may be used as a source of starch.
  • the starch will eventually be converted into dextrins and fermentable sugars.
  • the malt which is produced principally from selected varieties of barley, is believed to have the greatest effect on the overall character and quality of the beer.
  • the malt is the primary flavouring agent in beer.
  • the malt provides the major portion of the fermentable sugar.
  • the malt provides the proteins, which will contribute to the body and foam character of the beer.
  • the malt provides the necessary enzymatic activity during mashing.
  • Hops also contribute significantly to beer quality, including flavouring.
  • hops or hops constituents
  • the hops act as protein precipitants, establish preservative agents and aid in foam formation and
  • the process for making beer is well known in the art, but briefly, it involves five steps: (a) mashing and/or adjunct cooking (b) wort separation and extraction (c) boiling and hopping of wort (d) cooling, fermentation and storage, and (e) maturation, processing and packaging.
  • the mash is transferred to a "Iauter tun” or mash filter where the liquid is separated from the grain residue. This sweet liquid is called “wort” and the left over grain residue is called “spent grain”.
  • the mash is typically subjected to an extraction, which involves adding water to the mash in order to recover the residual soluble extract from the spent grain.
  • the wort is boiled vigorously. This sterilizes the wort and helps to develop the colour, flavour and odour and inactivates enzyme activities. Hops are added at some point during the boiling.
  • the wort is cooled and transferred to a fermentor, which either contains the yeast or to which yeast is added.
  • the yeast converts the sugars by fermentation into alcohol and carbon dioxide gas; at the end of fermentation the fermentor is chilled or the fermentor may be chilled to stop fermentation.
  • the yeast flocculates and is removed,
  • the beer is cooled and stored for a period of time, during which the beer clarifies and its flavour develops, and any material that might impair the appearance, flavour and shelf life of the beer settles out.
  • the beer Prior to packaging, the beer is carbonated and, optionally, filtered and pasteurized.
  • a beverage which usually contains from about 2% to about 10% alcohol by weight.
  • the non-fermentable carbohydrates are not converted during fermentation and form the majority of the dissolved solids in the final beer.
  • a giucoamyiase variant as described herein wherein the production of fermentable sugar(s) is enhanced as compared to the parent giucoamyiase, such as TrGA.
  • a giucoamyiase variant as described herein wherein the production of fermentable sugars is enhanced in a mashing step of the brewing process as compared to the parent giucoamyiase, such as TrGA.
  • a giucoamyiase variant as described herein wherein the production of fermentable sugars is enhanced in a fermentation step of a brewing process as compared to the parent giucoamyiase, such as TrGA.
  • a giucoamyiase variant as described herein wherein the fermentable sugar is glucose.
  • a giucoamyiase that can produce glucose with a significantly reduced amount of by-products would be of great commercial interest, e.g. in production of glucose syrup or in brewing. Further disclosed herein is the use of a giucoamyiase variant as described herein, wherein the hydrolysis of starch is in a process for producing glucose syrup.
  • the giucoamyiase exhibit a reduced ratio between isomaltose synthesis (IS) and starch hydrolysis activity (SH) as compared to the parent giucoamyiase, such as TrGA.
  • the giucoamyiase exhibit a reduced starch hydrolysis activity, which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent giucoamyiase, such as TrGA. In one aspect, the giucoamyiase exhibit an enhanced real degree of fermentation as compared to the parent giucoamyiase such as TrGA. In one aspect, the giucoamyiase forms a lower amount of condensation products than the amount of condensation products formed by the giucoamyiase Aspergillus niger (AnGA) (SEQ ID NO: 6) under comparable conditions.
  • the giucoamyiase forms an amount of condensation products which amount is essentially the same as, not more than 5% higher, not more than 8% higher or not more than 10% higher than the amount of condensation products formed by Aspergillus niger (AnGA) (SEQ ID NO: 6) under comparable conditions.
  • dosing of the glucoamyiases are the same based on protein concentration. In one aspect, dosing of the glucoamyiases are the same based on measurement of activity in activity assays. 2
  • G!ucoamylase variants described herein contain amino acid substitutions within the catalytic domain and/or the starch binding domain.
  • the variants may display altered properties such as improved thermostability, altered formation of condensation products such as Isomaitose and/or an enhanced real degree of fermentation and/or a reduced ratio between isomaitose synthesis (IS) and starch hydrolysis activity (SH) and/or specific activity.
  • the variants with reduced formation of condensation products such as isomaitose may significantly improve the ability to make desired products in the brewing industri, for example.
  • glucose glycoamyiase (EC 3.2.1.3) refers to an enzyme that catalyzes the release of D-glucose from the non-reducing ends of starch and related oligo- and
  • parent glucoamylases include, but are not limited to, the
  • glucoamyiase sequences set forth in SEQ ID NOs: 1, 2, 3, 5, 6, 7, 8, and 9, and
  • glucoamylases with at least 80% amino acid sequence identity to SEQ ID NO: 2.
  • an "equivalent position” means a position that is common to two parent sequences that is based on an alignment of the amino add sequence of the parent glucoamyiase In question as well as alignment of the three-dimensional structure of the parent glucoamyiase In question with the TrGA reference glucoamyiase amino acid sequence (SEQ ID NO: 2) and three-dimensional structure. Thus either sequence alignment or structural alignment may be used to determine equivalence.
  • TrGA refers to a parent Trichoderma reesei glucoamyiase sequence having the mature protein sequence illustrated In SEQ ID NO: 2 that includes the catalytic domain having the sequence illustrated in SEQ ID NO: 3.
  • the Isolation, cloning and expression of the TrGA are described in WO 2006/060062 and U. S. Patent No. 7,413,887, both of which are incorporated herein by reference.
  • the parent sequence refers to a glucoamylase sequence that is the starting point for protein engineering.
  • the numbering of the glucoamylase amino acids herein is based on the sequence alignment of a glucoamylase with TrGA (SEQ ID NO : 2 and/or 3) .
  • mature form of a protein or polypeptide refers to the final functional form of the protein or polypeptide.
  • a mature form of a glucoamylase may lack a signal peptide, for example.
  • a mature form of the TrGA includes the catalytic domain, linker region and starch binding domain having the amino acid sequence of SEQ ID NO: 2.
  • glucoamylase variant and “variant” are used in reference to glucoamylases that have some degree of am ino acid sequence identity to a parent glucoamylase sequence.
  • a variant is similar to a parent sequence, but has at least one substitution, deletion or insertion in their amino acid sequence that makes them different in sequence from a parent glucoamylase.
  • variants have been manipulated and/or engineered to include at least one substitution, deletion, or insertion in their amino acid sequence that makes them different in sequence from a parent.
  • a glucoamylase variant may retain the functional characteristics of the parent glucoamylase, e.g. , maintaining a glucoamylase activity that is at least about 50%, about 60%, about 70%, about 80%, or about 90% of that of the parent glucoamylase. Can also have higher activity than 100% if that is what one has selected for.
  • “Variants” may have at least about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 88%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 99.5% sequence identity to a parent polypeptide sequence when optimally aligned for comparison.
  • the glucoamylase variant may have at least about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 88%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 99.5% sequence identity to the catalytic domain of a parent glucoamylase.
  • the glucoamylase variant may have at least at least about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 88%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 99.5% sequence Identity to the starch binding domain of a parent
  • sequence identity can be measured over the entire length of the parent or the variant sequence. Sequence identity is determined using standard techniques known in the art (see e.g. , Smith and Waterman, Adv. Appl. Math. 2: 482 (1981); Needleman and Wunsch, J. Mol. Biol. 48 ; 443 (1970); Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85: 2444 (1988); programs such as GAP, BESTHT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, WI); and Devereux el al., Nucleic Acid Res. , 12: 387- 395 (1984)).
  • the "percent (%) nucleic acid sequence identity” or “percent (%) amino acid sequence identity” is defined as the percentage of nucleotide residues or amino acid residues In a candidate sequence that are identical with the nucleotide residues or amino acid residues of the starting sequence (e.g. , SEQ ID NO 2). The sequence identity can be measured over the entire length of the starting sequence.
  • Sequence identity is determined herein by the method of sequence alignment.
  • the alignment method is BLAST described by Altschul et al., (Altschul et al., J. Mol. Biol. 215: 403-410 (1990); and Karlin et al, Proc. Natl. Acad. Sci. USA 90: 5873-5787 (1993)).
  • a particularly useful BLAST program is the WU-BLAST-2 program (see Altschul et al, Meth. Enzymol. 266: 460-480 (1996)). WU-BLAST-2 uses several search parameters, most of which are set to the default values.
  • the HSP S and HSP S2 parameters are dynamic values and are established by the program itself depending upon the composition of the particular sequence and composition of the particular database against which the sequence of interest is being searched. However, the values may be adjusted to increase sensitivity.
  • a % amino acid sequence identity value is determined by the number of matching identical residues divided by the total number of residues of the "longer" sequence in the aligned region.
  • the "longer" sequence is the one having the most actual residues in the aligned region (gaps introduced by WU-Blast-2 to maximize the alignment score are ignored).
  • optical alignment refers to the alignment giving the highest percent identity score.
  • catalytic domain refers to a structural region of a polypeptide, which contains the active site for substrate hydrolysis.
  • linker refers to a short amino acid sequence generally having between 3 and 40 amino acids residues that covalently bind an amino acid sequence comprising a starch binding domain with an amino acid sequence comprising a catalytic domain.
  • starch binding domain refers to an amino acid sequence that binds preferentially to a starch substrate.
  • mutant sequence and “mutant gene” are used interchangeably and refer to a polynucleotide sequence that has an alteration in at least one codon occurring in a host cell's parent sequence.
  • the expression product of the mutant sequence is a variant protein with an altered amino acid sequence relative to the parent.
  • the expression product may have an altered functional capacity (e.g. , enhanced enzymatic activity) .
  • polypeptide refers to any characteristic or attribute of a polypeptide that can be selected or detected. These properties include, but are not limited to oxidative stability, substrate specificity, catalytic activity, thermal stability, pH activity profile, resistance to proteolytic degradation, K M , K C AT, K C AT/K m ratio, protein folding, ability to bind a substrate and ability to be secreted.
  • nucleic acid refers to any characteristic or attribute of a nucleic acid that can be selected or detected. These properties include, but are not limited to, a property affecting gene transcription (e.g. , promoter strength or promoter recognition), a property affecting RNA processing (e.g. , RNA splicing and RNA stability), a property affecting translation (e.g., regulation, binding of mRNA to ribosomal proteins).
  • a property affecting gene transcription e.g. , promoter strength or promoter recognition
  • RNA processing e.g. , RNA splicing and RNA stability
  • translation e.g., regulation, binding of mRNA to ribosomal proteins.
  • thermoally stable and “thermostable” refer to glucoamylase variants of the present disclosure that retain a specified amount of enzymatic activity after exposure to a temperature over a given period of time under conditions prevailing during the hydrolysis of starch substrates, for example, while exposed to altered temperatures.
  • thermostability in the context of a property such as thermostability refers to a higher retained starch hydrolytic activity over time as compared to another reference (i.e. , parent) glucoamylase.
  • thermostability in the context of a property such as thermostability refers to a lower retained starch hydrolytic activity over time as compared to another reference glucoamylase.
  • specific activity is defined as the activity per mg of glucoamylase protein.
  • the activity for glucoamylase is determined by the ethanol assay described herein and expressed as the amount of glucose that is produced from the starch P T/EP2011/061082
  • the protein concentration can be determined using the Caliper assay described herein.
  • active and biologically active refer to a biological activity associated with a particular protein. It follows that the biological activity of a given protein refers to any biological activity typically attributed to that protein by those skilled in the art. For example, an enzymatic activity associated with a glucoamylase is hydrolytic and, thus an active glucoamylase has hydrolytic activity.
  • polynucleotide and “nucleic acid”, used interchangeably herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. These terms include, but are not limited to, a single-, double- or triple-stranded DNA, genomic DNA, cDNA, RNA, DNA-RNA hybrid, or a polymer comprising purine and pyrimidine bases, or other natural, chemically, biochemically modified, non-natural or derivatized nucleotide bases.
  • DNA construct As used herein, the terms "DNA construct,” “transforming DNA” and “expression vector” are used interchangeably to refer to DNA used to introduce sequences into a host cell or organism.
  • the DNA may be generated in vitro by PCR or any other suitable technique(s) known to those in the art.
  • the DNA construct, transforming DNA or recombinant expression cassette can be incorporated into a plasmid, chromosome, mitochondrial DNA, plastid DNA, virus, or nucleic acid fragment.
  • the recombinant expression cassette portion of an expression vector, DNA construct or transforming DNA includes, among other sequences, a nucleic acid sequence to be transcribed and a promoter.
  • expression vectors have the ability to incorporate and express heterologous DNA fragments in a host cell.
  • vector refers to a polynucleotide construct designed to introduce nucleic acids into one or more cell types.
  • Vectors include cloning vectors, expression vectors, shuttle vectors, plasmids, cassettes, and the like.
  • the term "introduced” refers to any method suitable for transferring the nucleic acid sequence into the cell. Such methods for introduction include but are not limited to protoplast fusion, transfection, transformation, conjugation, and transduction.
  • transformed refers to a cell that has a non-native (heterologous) polynucleotide sequence integrated into its genome or as an episomal plasmid that is maintained for at least two generations.
  • selectable marker refers to a nucleic acid (e.g. , a gene) capable of expression in host cells that allows for ease of selection of those hosts containing the vector.
  • selectable markers are genes that confer antimicrobial resistance or a metabolic advantage on the host cell to allow cells containing the exogenous DNA to be distinguished from cells that have not received any exogenous sequence during the transformation.
  • promoter refers to a nucleic acid sequence that functions to direct transcription of a downstream gene.
  • the promoter together with other transcriptional and translational regulatory nucleic acid sequences (also termed “control sequences") is necessary to express a given gene.
  • control sequences also termed “control sequences”
  • transcriptional and translational regulatory sequences include, but are not limited to, promoter sequences, ribosomal binding sites, transcriptional start and stop sequences, translational start and stop sequences, and enhancer or activator sequences.
  • a nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence, For example, DNA encoding a secretory leader ⁇ I.e., a signal peptide), is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide.
  • "operably linked” means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase.
  • gene refers to a polynucleotide (e.g. , a DNA segment), that encodes a polypeptide and includes regions preceding and following the coding regions, as well as intervening sequences (introns) between individual coding segments (exons).
  • ortholog and “orthologous genes” refer to genes in different species that have evolved from a common ancestral gene (i.e., a homologous gene) by speclation.
  • orthologs retain the same function during the course of evolution. Identification of orthologs finds use in the reliable prediction of gene function in newly sequenced genomes.
  • paralogous genes refer to genes that are related by duplication within a genome. While orthologs retain the same function through the course of evolution, paralogs evolve new functions, even though some functions are often related to the original one. Examples of paralogous genes include, but are not limited to genes encoding trypsin, chymotrypsin, elastase, and thrombin, which are all serine proteinases and occur together within the same species. 2
  • hybridization refers to the process by which a strand of nucleic acid joins with a complementary strand through base pairing, as known in the art.
  • a nucleic acid sequence is considered to be "selectively hybridizable" to a reference nucleic acid sequence if the two sequences specifically hybridize to one another under moderate to high stringency hybridization and wash conditions.
  • Hybridization conditions are based on the melting temperature (T m ) of the nucleic acid binding complex or probe.
  • T m melting temperature
  • maximum stringency typically occurs at about T m - 5°C (5°C below the T m of the probe); “high stringency” at about 5-10°C below the T m ; “intermediate stringency” at about 10-20°C below the T m of the probe; and “low stringency” at about 20-25°C below the T m .
  • maximum stringency conditions may be used to Identify sequences having strict Identity or near-strict identity with the hybridization probe; while an intermediate or low stringency hybridization can be used to identify or detect polynucleotide sequence homologs.
  • Moderate and high stringency hybridization conditions are well known in the art.
  • An example of high stringency conditions includes hybridization at about 42°C in 50% formamide, 5 x SSC, 5 x Denhardt's solution, 0.5% SDS and 100 pg/rnl denatured carrier DIMA followed by washing two times in 2 ⁇ SSC and 0.5% SDS at room temperature and two additional times in 0.1 x SSC and 0.5% SDS at 42°C.
  • moderate stringent conditions include an overnight incubation at 37°C in a solution comprising 20% formamide, 5 ⁇ SSC (150 mM NaCI, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 ⁇ Denhardt's solution, 10% dextran sulfate and 20 mg/ml denaturated sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 37-50°C.
  • SSC 150 mM NaCI, 15 mM trisodium citrate
  • 50 mM sodium phosphate pH 7.6
  • Denhardt's solution 10% dextran sulfate
  • 20 mg/ml denaturated sheared salmon sperm DNA followed by washing the filters in 1 x SSC at about 37-50°C.
  • recombinant includes reference to a cell or vector, that has been modified by the introduction of a heterologous or homologous nucleic acid sequence or that the cell is derived from a cell so modified.
  • recombinant cells express genes that are not found in identical form within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all as a result of deliberate human intervention.
  • mutant DNA sequences are generated with site saturation mutagenesis in at least one codon. In another embodiment, site saturation mutagenesis is performed for two or more codons. In a further embodiment, mutant DNA sequences have more than about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 98% identity with the parent sequence. In alternative embodiments, mutant DNA is generated in vivo using any known mutagenic procedure such as, for example, radiation, nitrosoguanidine, and the like. The desired DNA sequence is then isolated and used in the methods provided herein.
  • heterologous protein refers to a protein or polypeptide that does not naturally occur in the host cell.
  • An enzyme is "over-expressed" in a host cell if the enzyme is expressed in the cell at a higher level than the level at which it is expressed in a corresponding wild-type cell.
  • polypeptide proteins and polypeptide are used interchangeability herein.
  • the conventional one-letter and three-letter codes for amino acid residues are used.
  • the 3-letter code for amino acids as defined in conformity with the IUPAC-IUB Joint Commission on Biochemical Nomenclature (JCBN). It is also understood that a polypeptide may be coded for by more than one nucleotide sequence due to the degeneracy of the genetic code.
  • Variants of the disclosure are described by the following nomenclature: [original amino acid residue/position/substituted amino acid residue].
  • the substitution of leucine for arginine at position 76 is represented as R76L.
  • the substitution is represented as 1) Q172C, Q172D or Q172R; 2) Q172C, D, or R, or 3) Q172C/D/R.
  • a position suitable for substitution is identified herein without a specific amino acid suggested, it is to be understood that any amino acid residue may be substituted for the amino acid residue present in the position.
  • a variant glucoamylase contains a deletion in comparison with other glucoamylases the deletion is indicated with "*".
  • a deletion at position R76 is represented as R76*.
  • a deletion of two or more consecutive amino acids is indicated for example as (76 - 78)*.
  • a “prosequence” is an amino acid sequence between the signal sequence and mature protein that is necessary for the secretion of the protein. Cleavage of the pro sequence will result in a mature active protein.
  • signal sequence refers to any sequence of nucleotides and/or amino acids that may participate In the secretion of the mature or precursor forms of the protein.
  • This definition of signal sequence is a functional one, meant to include all those amino acid sequences encoded by the N-terminal portion of the protein gene, which participate in the effectuation of the secretion of protein. They are often, but not universally, bound to the N-terminal portion of a protein or to the N-terminal portion of a precursor protein.
  • the signal sequence may be endogenous or exogenous.
  • the signal sequence may 1 061082
  • glucoamylase 24 be that normally associated with the protein (e.g. , glucoamylase), or may be from a gene encoding another secreted protein.
  • precursor form of a protein or peptide refers to a mature form of the protein having a prosequence operabiy linked to the amino or carbonyl terminus of the protein.
  • the precursor may also have a "signal" sequence operabiy linked, to the amino terminus of the prosequence.
  • T e precursor may also have additional polynucleotides that are involved in post-translational activity (e.g., polynucleotides cleaved therefrom to leave the mature form of a protein or peptide).
  • “Host strain” or “host cell” refers to a suitable host for an expression vector comprising DNA according to the present disclosure.
  • derived from and “obtained from” refer to not only a glucoamylase produced or producible by a strain of the organism in question, but also a glucoamylase encoded by a DNA sequence isolated from such strain and produced in a host organism containing such DNA sequence. Additionally, the term refers to a glucoamylase that is encoded by a DNA sequence of synthetic and/or cDNA origin and that has the identifying characteristics of the glucoamylase in question.
  • a “derivative" within the scope of this definition generally retains the characteristic hydrolyzing activity observed in the wild-type, native or parent form to the extent that the derivative is useful for similar purposes as the wild-type, native or parent form.
  • Functional derivatives of glucoamylases encompass naturally occurring, synthetically or recombinantly produced peptides or peptide fragments that have the general characteristics of the glucoamylases of the present disclosure.
  • isolated refers to a material that is removed from the natural environment if it is naturally occurring.
  • a “purified” protein refers to a protein that is at least partially purified to homogeneity. In some embodiments, a purified protein is more than about 10% pure, about 20% pure, or about 30% pure, as determined by SDS-PAGE. Further aspects of the disclosure encompass the protein in a highly purified form [I.e., more than about 40% pure, about 60% pure, about 80% pure, about 90% pure, about 95% pure, about 97% pure, or about 99% pure), as determined by SDS-PAGE.
  • combinatorial mutagenesis refers to methods In which libraries of variants of a starting sequence are generated. In these libraries, the variants contain one or several mutations chosen from a predefined set of mutations. In addition, the methods provide means to introduce random mutations that were not members of the predefined set EP2011/061082
  • combinatorial mutagenesis methods encompass commercially available kits (e.g., QuikChange® Multisite, Stratagene, San Diego, CA).
  • library of mutants refers to a population of cells that are identical in most of their genome but include different homologues of one or more genes. Such libraries can be used, for example, to identify genes or operons with improved traits.
  • dry solids content refers to the total solids of a slurry in % on a dry weight basis.
  • initial hit refers to a variant that was identified by screening a combinatoriai consensus mutagenesis library. In some embodiments, initial hits have improved performance characteristics, as compared to the starting gene.
  • improved hit refers to a variant that was identified by screening an enhanced combinatorial consensus mutagenesis library.
  • target property refers to the property of the starting gene that is to be altered. It is not intended that the present disclosure be limited to any particular target property. However, in some embodiments, the target property is the stability of a gene product (e.g., resistance to denaturation, proteolysis or other degradative factors), while in other embodiments, the level of production in a production host is altered. Indeed, it is contemplated that any property of a starting gene will find use in the present disclosure. Other definitions of terms may appear throughout the specification.
  • process for making beer may further be applied in the mashing of any grist.
  • the term "grist” refers to any starch and/or sugar containing plant material derivable from any plant and plant part, including tubers (e.g. potatoes), roots (e.g. cassava [Manihot esculenta] roots), stems, leaves and seeds.
  • the grist may comprise grain, such as grain from barley, wheat, rye, oat, corn/maize, rice, milo, millet and sorghum, and e.g. at least 10%, or at least 15%, or at least 25%, or at least 35%, such as at least 50%, at least 75%, at least 90% or even 100% (w/w) of the grist of the wort is derived from grain.
  • the grist may comprise the starch and/or sugar containing plant material obtained from cassava [Manihot esculenta] roots.
  • the grist may comprise malted grain, such as barley malt. Often, at least 10%, or at least 15%, or at least 25%, or at least 35%, such as at least 50%, at least 75%, at least 90% or even 100% (w/w) of the grist of the wort is derived from malted grain.
  • the grist may comprise adjunct, such as up to 10%, or at least 10%, or at least 15%, or at least 25%, or at least 35%, or at least 50%, at least 75%, at least 90%, or even 100% (w/w) of the grist of the wort is adjunct.
  • adjunct is understood as the part of the grist which is not barley malt.
  • the adjunct may be any carbohydrate rich material.
  • adjunct includes starch and/or sugar containing plant material as e.g. defined above under “grist”.
  • fermentation means, in the context of brewing, the transformation of sugars in the wort, by enzymes in the brewing yeast, into ethanol and carbon dioxide with the formation of other fermentation by-products.
  • malt Is understood as any malted cereal grain, such as barley.
  • malt beverage includes such foam forming fermented malt beverages as full malted beer, ale, dry beer, near beer, light beer, low alcohol beer, low calorie beer, porter, bock beer, stout, malt liquor, non-alcoholic malt liquor and the like.
  • malt beverages also includes non-foaming beer and alternative malt beverages such as fruit flavoured malt beverages, e. g. , citrus flavoured, such as lemon-, orange-, lime-, or berry-flavoured malt beverages, liquor flavoured malt beverages, e. g. , vodka-, rum-, or tequila-flavoured malt liquor, or coffee flavoured malt beverages, such as caffeine-flavoured malt liquor, and the like.
  • fruit flavoured malt beverages e. g. , citrus flavoured, such as lemon-, orange-, lime-, or berry-flavoured malt beverages
  • liquor flavoured malt beverages e.
  • ash is understood as aqueous starch slurry, e. g. comprising crushed barley malt, crushed barley, and/or other adjunct or a combination hereof, mixed with water later to be separated into wort + spent grains.
  • wort refers to the unfermented liquor run-off following extracting the grist during mashing.
  • the term "spent grains” refers to the drained solids remaining when the grist has been extracted and the wort separated from the mash.
  • beer any fermented wort, produced by the brewing and fermentation of a starch-containing material, mainly derived from cereal grains, such as malted barley. Wheat, maize, and rice may also be used. 1082
  • extract recovery in the wort is defined as the sum of soluble substances extracted from the grist (malt and adjuncts) expressed in percentage based on dry matter.
  • pasteurization means heating (e.g. beer) at certain temperatures for certain time intervals.
  • the purpose is normally killing of micro-organisms but
  • pasteurisation fn the brewing process is typically through the use of a flash pasteuriser or tunnel pasteuriser.
  • pasteurisation units or PU refers to a quantitative measure of pasteurisation.
  • One pasteurisation unit (1 PU) for beer is defined as a heat retention of one minute at 60 degrees Celsius.
  • T temperature, in degrees Celsius, in the pasteuriser
  • pasteurisation 14 - 15 PU are required.
  • pasteurisation temperatures are typically in the range of 64 - 72 degrees Celsius with a pasteurisation time calculated accordingly. Further information may be found in "Technology Brewing and Malting” by Wolfgang Kunze of the Research and Teaching Institute of Brewing, Berlin (VLB), 3rd completely updated edition, 2004, ISBN 3-921690-49-8..
  • non-alcoholic beer or “low-alcohol beer” refers to a beer containing a maximum of 0.1% to 3.5% or 0.1% to 2.5% such as 0.1% to 0.5% alcohol by volume.
  • Non-alcoholic beer is brewed by traditional methods, but during the finishing stages of the brewing process the alcohol is removed by vacuum evaporation, by taking advantage of the different boiling points of water and alcohol.
  • the term "low-calorie beer” or "beer with a low carbohydrate content” is defined as a beer with a carbohydrate content of 1.5 g/100 g or less and with a real degree of fermentation of at least 80%.
  • a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range Is also specifically disclosed.
  • Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the disclosure.
  • the present disclosure provides a giucoamylase variant.
  • the giucoamylase variant is a variant of a parent giucoamylase, which may comprise both a catalytic domain and a starch binding domain.
  • the parent giucoamylase may comprise both a catalytic domain and a starch binding domain.
  • the parent giucoamylase may comprise both a catalytic domain and a starch binding domain.
  • giucoamylase comprises a catalytic domain having an amino acid sequence as illustrated In SEQ ID NO: 1, 2, 3, 5, 6, 7, 8 or 9 or having an amino acid sequence displaying at least about 80%, about 85%, about 90%, about 95%, about 97%, about 99%, or about 99.5% sequence identity with one or more of the amino acid sequences illustrated in SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9.
  • the parent giucoamylase comprises a catalytic domain encoded by a DNA sequence that hybridizes under medium, high, or stringent conditions with a DNA encoding the catalytic domain of a giucoamylase having one of the amino acid sequences of SEQ ID NO: 1, 2 or 3.
  • the parent giucoamylase comprises a starch binding domain having an amino acid sequence as illustrated in SEQ ID NO 1, 2, 11 , 385, 386, 387, 388, 389, or 390, or having an amino acid sequence displaying at least about 80%, about 85%, about 90%, about 95%, about 97%, about 99%, or about 99.5% sequence identity with one or more of the amino acid sequence illustrated in SEQ ID NO 1, 2, 11, 385, 386, 387, 388, 389, or 390.
  • the parent glucoamylase comprises a starch binding domain encoded by a DNA sequence that hybridizes under medium, high, or stringent conditions with a DNA encoding the starch binding domain of a glucoamylase having one of the amino acid sequences of SEQ ID NO: 1, 2, or 11.
  • the parent glucoamylase is a filamentous fungal glucoamylase. In some embodiments, the parent glucoamylase is obtained from a
  • Trichoderma strain e.g., T. reesei, T. longibrachiatum, T. strictipilis, T. asperellum, T.
  • a Aspergillus strain e.g. A. niger, A. nidulans, A. kawachi, A. awamori and A. orzyae
  • a Talaromyces strain e.g. T. emersonii, T. thermophilus, and T. duponti
  • a Hypocrea strain e.g. H. gelatinosa , H. orientalis, H. vinosa, and H. citrina
  • a Fusarium strain e.g., F. oxysporum, F. roseum, and F. venenatum
  • a Neurospora strain e.g., N.
  • a Humicola strain e.g., H. grisea, H. insolens and H. lanuginose
  • a Penicillium strain e.g. , P. notatum or P. chrysogenum
  • Saccharomycopsis strain e.g. , S. fibuligera
  • the parent glucoamylase may be a bacterial glucoamylase.
  • the polypeptide may be obtained from a gram-positive bacterial strain such as Bacillus (e.g. , B. alkalophilus, B. amyloliquefaciens, B. lentus, B. lichenlformis, B.
  • Streptomyces strain e.g., S.
  • the parent glucoamylase will comprise a catalytic domain having at least about 80%, about 85%, about 90%, about 93%, about 95%, about 97%, about 98%, or about 99% sequence identity with the catalytic domain of the TrGA amino acid sequence of SEQ ID NO: 3.
  • the parent glucoamylase will comprise a catalytic domain having at least about 90%, about 93%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity with the catalytic domain of the Aspergillus parent glucoamylase of SEQ ID NO: 5 or SEQ ID NO: 6.
  • the parent glucoamylase will comprise a catalytic domain having at least about 90%, about 95%, about 97%, or about 99% sequence identity with the catalytic domain of the Humicola grisea (HgGA) parent glucoamylase of SEQ ID NO: 8.
  • HgGA Humicola grisea
  • the parent glucoamylase will comprise a starch binding domain having at least about 80%, about 85%, about 90%, about 95%, about 97%, or about 98% sequence identity with the starch binding domain of the TrGA amino acid sequence of SEQ ID NO: 1, 2, or 11.
  • the parent glucoamylase will comprise a starch binding domain having at least about 90%, about 95%, about 97%, or about 99% sequence identity with the catalytic domain of the Humicola grisea (HgGA) glucoamylase of SEQ ID NO: 385.
  • HgGA Humicola grisea
  • the parent glucoamylase will comprise a starch binding domain having at least about 90%, about 95%, about 97%, or about 99% sequence identity with the catalytic domain of the Thielavia terrestris (TtGA) glucoamylase of SEQ ID NO: 390.
  • TtGA Thielavia terrestris
  • the parent glucoamylase will comprise a starch binding domain having at least about 90%, about 95%, about 97%, or about 99% sequence identity with the catalytic domain of the Thermomyces lanuginosus (ThGA) glucoamylase of SEQ ID NO: 386.
  • the parent glucoamylase will comprise a starch binding domain having at least about 90%, about 95%, about 97%, or about 99% sequence identity with the catalytic domain of the Talaromyces emersoniit (TeGA) glucoamylase of SEQ ID NO: 387.
  • the parent glucoamylase will comprise a starch binding domain having at least about 90%, about 93%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity with the starch binding domain of the Aspergillus parent glucoamylase of SEQ ID NO: 388 or 389.
  • the parent glucoamylase will have at least about 80%, about 85%, about 88%, about 90%, about 93%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity with the TrGA amino acid sequence of SEQ ID NO: 1 or 2.
  • a Trichoderma glucoamylase homologue will be obtained from a Trichoderma or Hypocrea strain.
  • Trichoderma glucoamylase homologues are described in U.S. Patent No. 7,413,887 and reference is made specifically to amino acid sequences set forth In SEQ ID NOs: 17-22 and 43-47 of the reference. T EP2011/061082
  • the parent glucoamyiase is TrGA comprising the amino acid sequence of SEQ ID NO: 2, or a Trichoderma glucoamyiase homologue having at least about 80%, about 85%, about 88%, about 90%, about 93%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the TrGA sequence (SEQ ID NO: 2).
  • a parent glucoamyiase can be Isolated and/or identified using standard recombinant DNA techniques. Any standard techniques can be used that are known to the skilled artisan. For example, probes and/or primers specific for conserved regions of the glucoamyiase can be used to identify homologs in bacterial or fungal cells (the catalytic domain, the active site, etc.). Alternatively, degenerate PCR can be used to identify homologues in bacterial or fungal cells. In some cases, known sequences, such as in a database, can be analyzed for sequence and/or structural identity to one of the known glucoamylases, including SEQ ID NO:
  • Functional assays can also be used to identify glucoamyiase activity in a bacterial or fungal cell. Proteins having glucoamyiase activity can be isolated and reverse sequenced to isolate the corresponding DNA sequence. Such methods are known to the skilled artisan.
  • the central dogma of molecular biology is that the sequence of DNA encoding a gene for a particular enzyme, determines the amino acid sequence of the protein, this sequence in turn determines the three-dimensional folding of the enzyme. This folding brings together disparate residues that create a catalytic center and substrate binding surface and this results in the high specificity and activity of the enzymes in question.
  • Glucoamylases consist of as many as three distinct structural domains, a catalytic domain of approximately 450 residues that Is structurally conserved in all glucoamylases, generally followed by a linker region consisting of between 30 and 80 residues that are connected to a starch binding domain of approximately 100 residues.
  • the structure of the Trichoderma reesei glucoamyiase with all three regions intact was determined to 1.8 Angstrom resolution herein (see Table 20 in WO2009/067218 (Danisco US Inc., Genencor Division) page 94-216 incorporated herein by reference and Example 11 in WO2009/067218 (Danisco US Inc., Genencor Division) page 89-93 incorporated herein by reference ).
  • the Aspergillus awamori crystal structure only included the catalytic domain. As seen in FIGs. 6-7, the structure of the catalytic domains overlap very closely, and it is possible to identify equivalent residues based on this structural superposition. It is believed that all glucoamylases share the basic structure depicted in FIGs. 6-7.
  • the catalytic domain of TrGA thus has approximately 450 residues such as residues 1-453 of TrGA SEQ ID NO:2 and is a twelve helix double barrel domain.
  • the helices and loops of the catalytic domain can be defined in terms of the residues of TrGA with SEQ ID NO:2 forming them: helix 1 residues 2-20,
  • the linker domain has between 30 and 80 residues such as residues 454-490 of TrGA with SEQ ID NO: 2.
  • the starch binding domain of TrGA has approximately 100 residues such as residues 496-596 of TrGA with SEQ ID NO: 2 consisting of the beta sandwich composed of two twisted three stranded sheets.
  • the sheets, helices and loops of the starch binding domain can be defined in terms of the residues of TrGA with SEQ ID NO: 2 forming them: sheet 1' residues 496-504,
  • FIG. 6 is a comparison of the three dimensional structures of the Trichoderma reesei glucoamylase (black) of SEQ ID NO: 2 and of Aspergillus awamorii glucoamylase (grey) viewed from the side. In this view, the relationship between the catalytic domain and the linker region and the starch binding domain can be seen.
  • FIG. 7 Is a comparison of the three dimensional structures of the Trichoderma reesei glucoamylase (black) of SEQ ID NO: 2 and of Aspergillus awamorii glucoamylase (grey) viewed from the top.
  • the conservation of structure correlates with the conservation of activity and a conserved mechanism of action for all glucoamylases. Given this high homology, changes resulting from site specific variants of the Trichoderma glucoamylase resulting in altered functions would also have similar structural and therefore functional consequences in other glucoamylases. Therefore, the teachings of which variants result in desirable benefits can be applied to other glucoamylases.
  • SBD Starch Binding Domain
  • the SBD for TrGA was aligned with the SBD for A. niger. As shown in FIG. 8, the structure of the A. niger and TrGA SBDs overlaps very closely. It is believed that while all starch binding domains share at least some of the basic structure depicted in FIG. 8, some SBDs are more structurally similar than others.
  • the TrGA SBD can be classified as within the carbohydrate binding module 20 family within the CAZY database (cazy.org).
  • the CAZY database describes the families of structurally-related catalytic and carbohydrate-binding modules (or functional domains) of enzymes that degrade, modify, or create glycosidic bonds. Given a high structural homology, site specific variants of the TrGA SBD resulting In altered function would also have similar structural and therefore functional consequences in other glucoamylases having SBDs with similar structure to that of the TrGA SBD, particularly those classified within the carbohydrate binding module 20 family. Thus, the teachings of which variants result in desirable benefits can be applied to other SBDs having structural similarity.
  • the amino acid position numbers discussed herein refer to those assigned to the mature Trichoderma reesei glucoamylase sequence presented in FIG. 1 (SEQ ID NO: 2).
  • the present disclosure is not limited to the variants of Trichoderma glucoamylase, but extends to glucoamylases containing amino acid residues at positions that are "equivalent" to the particular identified residues in Trichoderma reesei glucoamylase (SEQ ID NO: 2).
  • the parent glucoamylase is a Talaromyces GA and the substitutions are made at the equivalent amino acid residue positions in Talaromyces glucoamylase (see e.g.
  • the parent glucoamylase comprises SEQ ID NOs: 5-9 (see FIGs. 5A and 5B).
  • the parent glucoamylase is a Penicillium glucoamylase, such as Penicillium chrysogenum (see e.g., SEQ ID NO: 13).
  • Structural identity determines whether the amino acid residues are equivalent. Structural identity is a one-to-one topological equivalent when the two structures (three dimensional and amino acid structures) are aligned.
  • a residue (amino acid) position of a glucoamylase is "equivalent" to a residue of T. reesei glucoamylase if it is either homologous ⁇ i.e. , corresponding in position in either primary or tertiary structure) or analogous to a specific residue or portion of that residue in T. reesei glucoamylase (having the same or similar functional capacity to combine, react, or interact chemically).
  • the amino acid sequence of a glucoamylase can be directly compared to Trichoderma reesei glucoamylase primary sequence and particularly to a set of residues known to be invariant in glucoamylases for which sequence is known.
  • FIGs. 5A and 5B herein show the conserved residues between glucoamylases.
  • FIGs. 5D and 5E show an alignment of starch binding domains from various glucoamylases. After aligning the conserved residues, allowing for necessary insertions and deletions in order to maintain alignment (I.e.
  • the residues equivalent to particular amino acids in the primary sequence of Trichoderma reesei glucoamylase are defined. Alignment of conserved residues typically should conserve 100% of such residues. However, alignment of greater than about 75% or as little as about 50% of conserved residues is also adequate to define equivalent residues. Further, the structural identity can be used In combination with the sequence identity to identify equivalent residues.
  • FIGs. 5A and 5B the catalytic domains of glucoamylases from six organisms are aligned to provide the maximum amount of homology between amino acid sequences. A comparison of these sequences shows that there are a number of conserved residues contained in each sequence as designated by an asterisk. These conserved residues, thus, may be used to define the corresponding equivalent amino acid residues of Trichoderma reesei glucoamylase in other glucoamylases such as glucoamylase from Aspergillus niger.
  • FIGs. 5D and 5E show the starch binding domains of glucoamylases from seven organisms aligned to identify equivalent residues.
  • Structural identity involves the identification of equivalent residues between the two structures.
  • "Equivalent residues” can be defined by determining homology at the level of tertiary structure (structural identity) for an enzyme whose tertiary structure has been determined by X-ray crystallography.
  • Equivalent residues are defined as those for which the atomic coordinates of two or more of the main chain atoms of a particular amino acid residue of the Trichoderma reesei glucoamylase (N on IM, CA on CA, C on C and O on O) are within 0.13 nm and optionally 0.1 nm after alignment. In one aspect, at least 2 or 3 of the four possible main chain atoms are within 0.1 nm after alignment. Alignment is achieved after the best model has been oriented and positioned to give the maximum overlap of atomic coordinates of non-hydrogen protein atoms of the glucoamylase in question to the
  • Trichoderma reesei glucoamylase The best model is the crystallographic model giving the lowest R factor for experimental diffraction data at the highest resolution available.
  • Equivalent residues that are functionally analogous to a specific residue of Trichoderma reesei glucoamylase are defined as those amino acids of the enzyme that may adopt a conformation such that they either alter, modify or contribute to protein structure, substrate binding or catalysis in a manner defined and attributed to a specific residue of the Trichoderma reesei glucoamylase.
  • residues of the enzyme for which a tertiary structure has been obtained by X-ray crystallography
  • residues of the enzyme for which a tertiary structure has been obtained by X-ray crystallography
  • the atomic coordinates of at least two of the side chain atoms of the residue lie with 0.13 nm of the corresponding side chain atoms of Trichoderma reesei glucoamylase.
  • Trichoderma reesei glucoamylase The coordinates of the three dimensional structure of Trichoderma reesei glucoamylase are set forth in Table 20 in WO2009/067218 (Danisco US Inc., Genencor Division) page 94-216 incorporated herein by reference and can be used as outlined above to determine equivalent residues on the level of tertiary structure.
  • residues identified for substitution are conserved residues whereas others are not.
  • substitution of one or more amino acids is limited to substitutions that produce a variant that has an amino acid sequence that does not correspond to one found in nature. In the case of conserved residues, such substitutions should not result in a naturally-occurring sequence.
  • the variants according to the disclosure include at least one substitution, deletion or insertion in the amino acid sequence of a parent glucoamylase that makes the variant different in sequence from a parent glucoamylase.
  • the variants of the disclosure will have at least about 20%, about 40%, about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 97%, or about 100% of the glucoamylase activity as that of the TrGA (SEQ ID NO: 2), a parent glucoamylase that has at least 80% sequence identity to TrGA (SEQ ID NO: 2).
  • the variants according to the disclosure will comprise a substitution, deletion or insertion in at least one amino acid position of the parent TrGA (SEQ ID NO: 2), or in an equivalent position in the sequence of another parent glucoamylase having at least about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, or about 99% sequence identity to the TrGA sequence (SEQ ID NO: 2).
  • the variant according to the disclosure will comprise a substitution, deletion or insertion in at least one amino acid position of a fragment of the parent TrGA, wherein the fragment comprises the catalytic domain of the TrGA sequence (SEQ ID NO: 3) or in an equivalent position in a fragment comprising the catalytic domain of a parent glucoamylase having at least about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, or about 99% sequence identity to the catalytic-domain-containing fragment of the SEQ ID NO: 3, 5, 6, 7, 8, or 9.
  • the fragment will comprise at least about 400, about 425, about 450, or about 500 amino acid residues of TrGA catalytic domain (SEQ ID NO: 3).
  • the variant according to the disclosure will comprise a substitution, deletion or insertion in at least one amino acid position of a fragment of the parent TrGA, wherein the fragment comprises the starch binding domain of the TrGA sequence (SEQ ID NO: 11) or in an equivalent position in a fragment comprising the starch binding domain of a parent glucoamyiase having at least about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, or about 99% sequence identity to the starch-binding-domain-containing fragment of SEQ ID NO: 11, 385, 386, 387, 388, 389, and 390.
  • the fragment will comprise at least about 40, about 50, about 60, about 70, about 80, about 90, about 100, or about 109 amino acid residues of TrGA starch binding domain (SEQ ID NO: 11).
  • the variant when the parent giucoamylase includes a catalytic domain, a linker region, and a starch binding domain, the variant will comprise a substitution, deletion or insertion in at least one amino acid position of a fragment comprising part of the linker region. In some embodiments, the variant will comprise a substitution deletion, or insertion in the amino acid sequence of a fragment of the TrGA sequence (SEQ ID NO: 2).
  • Structural identity with reference to an amino acid substitution means that the substitution occurs at the equivalent amino acid position in the homologous glucoamyiase or parent glucoamyiase.
  • the term equivalent position means a position that is common to two parent sequences that is based on an alignment of the amino acid sequence of the parent giucoamylase in question as well as alignment of the three-dimensional structure of the parent glucoamyiase in question with the TrGA reference glucoamyiase amino acid sequence and three-dimensional sequence.
  • position 24 in TrGA (SEQ ID NO: 2 or 3) is D24 and the equivalent position for Aspergillus nlger (SEQ ID NO: 6) is position D25, and the equivalent position for Aspergillus oryzea (SEQ ID NO: 7) is position D26. See FIGs. 6 and 7 for an exemplary alignment of the three-dimensional sequence.
  • a giucoamylase variant which giucoamylase variant when in its crystal form has a crystal structure for which the atomic coordinates of the main chain atoms have a root-mean-square deviation from the atomic coordinates of the equivalent main chain atoms of TrGA (as defined in Table 20 in WO2009/067218) of less than 0.13 nm following alignment of equivalent main chain atoms, and which have a linker region, a starch binding domain and a catalytic domain, said variant comprising two or more amino acid substitutions relative to the amino acid sequence of the parent giucoamylase in interconnecting loop 2' of the starch binding domain, and/or in loop 1, and/or in helix 2, and/or in loop 11, and/or in helix 12 of the catalytic domain.
  • the root- mean-square deviation from the atomic coordinates of the equivalent main chain atoms of TrGA (as defined in Table 20 in WO2009/067218) is (ess than 0.12 nm, such as less than 0.11 or such as less than 0.10.
  • a glucoamylase variant comprises a starch binding domain and a catalytic domain, said variant comprising two or more amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 2 or equivalent parent glucoamylase in interconnecting loop 2', and/or in loop 1, and/or in helix 2, and/or in loop 11, and/or in helix 12 for reducing the synthesis of condensation products during hydrolysis of starch.
  • a glucoamylase variant comprises two or more amino acid substitutions relative to interconnecting loop 2' with the amino acid sequence from position 518 to position 543 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase, and/or loop 1 with the amino acid sequence from position 21 to position 51 of SEQ ID NO; 2 or equivalent sequence of residues in a parent glucoamylase, and/or helix 2 with the amino acid sequence from position 52 to position 68 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or loop 11 with the amino acid sequence from position 396 to position 420 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or helix 12 with the amino acid sequence from position 421 to position 434 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase.
  • a glucoamylase variant comprises two or more amino acid substitutions relative to the amino acid sequence from position 518 to position 543 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 21 to position 51 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 52 to position 68 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 396 to position 420 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 421 to position 434 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase.
  • the two or more amino acid substitutions are relative to the interconnecting loop 2' with the amino acid sequence from position 518 to position 543 e.g. in one or more of positions 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542 and/or 543 of SEQ ID NO: 2, and/or loop 1 with the amino acid sequence from position 21 to position 51 e.g.
  • the two or more amino acid substitutions are at least one amino acid substitution in the interconnecting loop 2' and at least one amino acid substitution in loop 1 and/or helix 2 and/or loop 11 and/or helix 12. In a further aspect, the two or more amino acid substitutions are 1, 2, 3 or 4 amino acid substitutions in the interconnecting loop 2' and 1, 2, 3 or 4 amino acid substitutions in loop 1 and/or helix 2 and/or loop 11 and/or helix 12.
  • the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in loop 1. In a further aspect, the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution In helix 2. In a further aspect, the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in loop 11. In a further aspect, the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in helix 12.
  • the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in loop 1 and at least one amino acid substitution in helix 2.
  • the glucoamylase variant has at least one amino acid substitution within position 520-543, 530-543, or 534-543 of interconnecting loop 2', the positions corresponding to the respective position in SEQ ID NO:2 or equivalent positions in a parent glucoamylase.
  • the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 30-50, 35-48, or 40-46 of loop 1, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase. In a further aspect, the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 50-66, 55-64, or 58-63 of helix 2, the positions corresponding to the respective position in SEQ ID NO:2 or equivalent positions in a parent glucoamylase.
  • the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 405-420, 410-420, or 415-420 of loop 11, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase.
  • the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 421-434, 425-434, or 428-434 of helix 12, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase.
  • the glucoamylase variant comprises two or more amino acid substitutions, wherein an amino acid substitution is in position 539 and an amino acid substitution is in position 44, the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase, and which sequence has at least 80% sequence identity to the parent glucoamylase, and wherein the amino acid substitution in position 44 is not 44C.
  • the glucoamylase variant comprises two or more amino acid
  • the glucoamylase variant comprises an amino acid substitution in position 61, the position corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase,
  • the amino acid substitution in position 539 is 539R, the position corresponding to the respective position In SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
  • the amino acid substitution in position 44 is 44R, the position
  • amino acid substitution in position 61 is 611, the position corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase.
  • the glucoamylase variant comprises the following amino acid
  • the glucoamylase variant consist of SEQ ID NO: 2 and has the following amino acid substitutions: a) D44R and A539R; or b) D44R, N61I and A539R, the positions corresponding to the respective position in SEQ ID NO: 2.
  • the glucoamylase variant has a starch binding domain that has at least 96%, 97%, 98%, 99%, or 99.5% sequence identity with the starch binding domain of SEQ ID NO: 1, 2, 11, 385, 386, 387, 388, 389, or 390.
  • the glucoamylase variant has a catalytic domain that has at least 80%, 85%, 90%, 95%, or 99.5% sequence identity with the catalytic domain of SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9.
  • the parent glucoamylase is a fungal glucoamylase.
  • the parent glucoamylase is selected from a glucoamylase obtained from a Trichoderma spp., an Aspergillus spp. , a Humicola spp. , a Penicillium spp. , a Ta/aromycese spp. , or a Schizosaccharmyces spp.
  • the parent glucoamylase is obtained from a Trichoderma spp. or an Aspergillus spp.
  • the glucoamylase has been purified.
  • the glucoamylases of the present disclosure may be recovered or purified from culture media by a variety of procedures known in the art including centrifugation, filtration, extraction, precipitation and the like.
  • the glucoamylase variant will include at least two substitutions in the amino acid sequence of a parent. In further embodiments, the variant may have more than two substitutions. For example, the variant may have 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 amino acid substitutions, deletions, or insertions as compared to a corresponding parent glucoamylase.
  • a glucoamylase variant comprises a substitution, deletion or insertion, and typically a substitution in at least one amino acid position in a position corresponding to the regions of non-conserved amino acids as illustrated in FIGs. 5A, 5B, 5D, and 5E (e.g., amino acid positions corresponding to those positions that are not designated by "*" in FIGs. 5A, 5B, 5D, and 5E).
  • a glucoamylase variant comprises two or more substitutions in the following positions in the amino acid sequence set forth in SEQ ID NO: 2 : 23, 42, 43, 44, 59, 60, 61, 65, 67, 68, 410, 417, 418, 430, 431, 433, 518, 519, 520, 527, 531, 535, 536, 537 or 539, or in an equivalent position in a parent glucoamylase.
  • the glucoamylase variant comprises one or more further substitutions in the following positions in the amino acid sequence set forth in SEQ ID NO: 2: 10, 14, 15, 72, 73, 97, 98, 99, 102, 110, 113, 114, 133, 140, 144, 145, 147, 152, 153, 164, 182, 204, 205, 214, 216, 219, 228, 229, 230, 231, 236, 239, 241, 242, 263, 264, 265, 268, 269, 276, 284, 291, 294, 300, 301, 303, 311, 338, 342, 344, 346, 349, 359, 361, 364, 375, 379, 382, 390, 391, 393, 394, 436, 442, 444, 448, 451, 493, 494, 495, 502, 503, 508, 511, 563, or 577, or in an equivalent position in a parent glucoamylase.
  • glucoamylase will have at least about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity with SEQ ID NO: 2.
  • the parent glucoamylase will be a Trichoderma
  • the variant will have altered properties.
  • the parent glucoamylase will have structural identity with the glucoamylase of SEQ ID NO: 2.
  • the glucoamylase variant comprises two or more substitutions in the following positions in the amino acid sequence set forth in SEQ ID NO: 2 : P23, T42, 143, D44, P45, D46, F59, K60, N61, T67, E68, R408, S410, S415, L417, H418, T430, A431, R433, N518, A519, A520, T527, V531, A535, V536, N537, and A539 or an equivalent position in parent glucoamylase (e.g., a Trichoderma glucoamylase homologue).
  • parent glucoamylase e.g., a Trichoderma glucoamylase homologue
  • the glucoamylase variant comprises one or more substitutions in the following positions in the amino acid sequence set forth in SEQ ID NO: 2: T10, L14, N15, A72, G73, S97, L98, A99, S1Q2, K108, E110, L113, K114, R122, Q124, R125, 1133, 140, N144, N145, Y147, S152, N 153, N164, F175, N182, A204, T205, S214, V216, Q219, W228, V229, S230, S231, D236, 1239, N240, T241, N242, G244, N263, L264, G265, A268, G269, D276, V284, S291, G294, P300, A301, A303, Y310, A311, D313, Y316, V338, T342, S344, T346, A349, V359, G361, A364, T375, N379, S382, S3
  • the glucoamylase variant may differ from the parent glucoamylase only at the specified positions.
  • the variant of a glucoamylase parent comprises at least two of the following substitutions in the following positions in an amino acid sequence set forth in SEQ ID NO: 2: T42V, I430JR, D44R/C, N61I, T67M, E68C/M, L417 /R/V, T430A/K, A431I/L/Q, R433C/E/G/L/N/S/V/Y, A519I/K/R/Y, A520C/L/P, V531L, A535K/N/P/R, V536M, or
  • the glucoamylase variant comprises one or more substitutions in the following positions in the amino acid sequence set forth In SEQ ID NO: 2: T10S, A72Y, G73F/W, S97N, S102A/M/R, K114M/Q, I133T/V, N145I, N153A/D/E/M/S/V, T205Q, Q219S, W228A/F/H/ /V, V229I/L, S230C/F/G/L/N/Q/R, S231L/V, D236R, I239V/Y, N263P, L264D/K, A268C/D/G/K, S291A/F/H/M/T, g294c, A301P/R, V338I/N/Q, T342V, S344M/P/
  • the glucoamylase variant comprises one of the following sets of substitutions, at the relevant positions of SEQ ID NO: 2, or at equivalent positions in a parent glucoamylase:
  • the glucoamylase variant comprises one of the following sets of substitutions, at positions of SEQ ID NO: 2 or equivalent positions in a parent glucoamylase: L417V/A431L/A539R;
  • L417R/A431L/A539R or L417G/A431L/A539R;
  • the glucoamylase variant does not have any further substitutions relative to the parent glucoamylase, and wherein the parent glucoamylase has a catalytic domain that has at least 80% sequence Identity with SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9.
  • the parent glucoamylase may be any of those described elsewhere.
  • the parent glucoamylase may comprise a starch binding domain that has at least 95% sequence identity with SEQ ID NO: 1, 2, 11, 385, 386, 387, 388, 389, or 390.
  • the parent glucoamylase may have at least 80% sequence identity with SEQ ID NO: 1 or 2; for example it may comprise SEQ ID NO: 1 or 2.
  • the parent glucoamylase may consist of SEQ ID NO: 1 or 2.
  • Glucoamylase variants of the disclosure may also include chimeric or hybrid glucoamylases with, for example a starch binding domain (SBD) from one glucoamylase and a catalytic domain and linker from another.
  • SBD starch binding domain
  • a hybrid glucoamylase can be made by swapping the SBD from AnGA (SEQ ID NO: 6) with the SBD from TrGA (SEQ ID NO: 2), making a hybrid with the AnGA SBD and the TrGA catalytic domain and linker.
  • the SBD and linker from AnGA can be swapped for the SBD and linker of TrGA.
  • the variant glucoamylase exhibits altered thermostability as compared to the parent glucoamylase.
  • the altered thermostability may be increased thermostability as compared to the parent glucoamylase.
  • the altered property is altered specific activity compared to the parent glucoamylase.
  • the altered specific activity may be increased specific activity compared to the parent glucoamylase.
  • the altered property is increased
  • thermostability at lower temperatures as compared to the parent glucoamylase is both increased specific activity and increased thermostability as compared to the parent glucoamylase.
  • some variants may include the substitutions at positions:
  • some variants may include the substitutions at positions: D44R/N61I/A539R;
  • SEQ ID NO: 2 or equivalent positions in parent glucoamylases and particularly Trichoderma glucoamylase homoiogues.
  • some variants may include the substitutions at positions:
  • SEQ ID NO: 2 or equivalent positions in parent glucoamylases and particularly Trichoderma glucoamylase homoiogues.
  • some variants may include the substitutions at positions:
  • Trichoderma glucoamylase homologues Trichoderma glucoamylase homologues.
  • some variants may include the substitutions at positions:
  • Trichoderma glucoamylase homologues Trichoderma glucoamylase homologues.
  • some variants has the following substitutions: D44R/N61I/A539R or D44R/A539R of SEQ ID NO: 2.
  • the variant comprises SEQ ID NO: 1098, In yet a further embodiment, the variant consists of SEQ ID NO: 1098. In a further embodiment, the variant comprises SEQ ID NO: 1099. In yet a further embodiment, the variant consists of SEQ ID NO: 1099.
  • Figure 5 includes the catalytic domain of the following parent glucoamylases Aspergillus awamori (AaGA) (SEQ ID NO: 5); Aspergillus niger (AnGA) (SEQ ID NO: 6); Aspergillus orzyae (AoGA) (SEQ IDNO: 7); Humicola grisea (HgGA) (SEQ ID NO: 8); and Hypocrea vinosa (HvGA) (SEQ ID NO: 9).
  • the % identity of the catalytic domains is represented in Table 1 below.
  • the variant glucoamyiase will be derived from a parent glucoamyiase that is an Aspergillus glucoamyiase, a Humicola glucoamyiase, or a Hypocrea glucoamyiase.
  • the present disclosure also provides glucoamyiase variants having at least one altered property (e.g., improved property) as compared to a parent glucoamyiase and particularly to the TrGA.
  • at least one altered property e.g., improved property
  • the altered property is reduced IS/SH-ratio, enhanced real degree of fermentation, reduced formation of condensation products, increased thermal stability and/or increased specific activity.
  • the increased thermal stability typically is at higher temperatures.
  • the increased pH stability is at high pH. In a further embodiment, the increased pH stability is at low pH.
  • the glucoamyiase variants of the disclosure may also provide higher rates of starch hydrolysis at low substrate concentrations as compared to the parent glucoamyiase.
  • the variant may have a higher V max or lower K m than a parent glucoamyiase when tested under the same conditions.
  • the variant glucoamyiase may have a higher V max at a temperature range of about 25°C to about 70oc (e.g., about 25°C to about 35°C; about 30°C to about 35°C; about 40°C to about 50°C; at about 50°C to about 55°C, or about 55°C to about 62°C).
  • the glucoamyiase may also exhibit a reduced starch hydrolysis activity which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent glucoamyiase such as TrGA.
  • the disclosure relates to a variant glucoamyiase having altered thermal stability as compared to a parent (wild-type).
  • Altered thermostability can be at increased temperatures or at decreased temperatures. Thermostability is measured as the % residual activity after incubation for 1 hour at 64°C in NaAc buffer pH 4.5. Under these conditions, TrGA has a residual activity of between about 15% and 44% due to day-to-day variation as compared to the initial activity before incubation.
  • variants with increased thermostability have a residual activity that is between at least about 1% and at least about 50% more than that of the parent (after incubation for 1 hour at 64°C in NaAc buffer pH 4.5), including about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, and about 50% as compared to the parent (after incubation
  • a variant with increased thermal stability may have a residual activity of between about 16% and about 75%.
  • the glucoamylase variant will have improved thermostability such as retaining at least about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 92%, about 95%, about 96%, about 97%, about 98%, or about 99% enzymatic activity after exposure to altered temperatures over a given time period, for example, at least about 60 minutes, about 120 minutes, about 180 minutes, about 240 minutes, or about 300 minutes.
  • the variant has increased thermal stability compared to the parent glucoamylase at selected temperatures in the range of about 40°C to about 80°C, also in the range of about 50°C to about 75°C, and in the range of about 60°C to about 70°C, and at a pH range of about 4.0 to about 6.0.
  • the thermostability is determined as described in the Assays and Methods. That method may be adapted as appropriate to measure thermostability at other
  • the variant has increased thermal stability at lower temperature compared to the parent glucoamylase at selected temperature in the range of about 20°C to about 50°C, including about 35°C to about 45°C and about 30°C to about 40°C.
  • variants having an Improvement in thermostability include one or more deletions, substitutions or insertions and particularly substitutions in the following positions in the amino acid sequence set forth in SEQ ID NO: 2: 10, 42, 43, 44, 59, 61, 68, 72, 73, 97, 98, 99, 102, 114, 133, 140, 144, 152, 153, 182, 204, 205, 214, 216, 228, 229, 230, 231, 236, 241, 242, 263, 264, 265, 268, 269, 276, 284, 291, 294 300, 301, 303, 311, 338, 342, 344, 346, 349, 359, 361, 364, 375, 379, 382, 390, 391, 393, 394, 410, 417, 430, 431, 433, 436, 442, 444, 448, 451, 493, 495, 503, 508, 511, 518, 519, 520, 527, 531, 535
  • the parent glucoamylase will be a Trichoderma glucoamylase homologue and in further embodiments, the parent glucoamylase will have at least about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 98% sequence identity to SEQ ID NO: 2. In some embodiments, the parent glucoamylase will also have structural identity to SEQ ID NO: 2.
  • the variant having increased thermostability has a substitution in at least one of the positions: T10S, T42V, I43Q, I43R, D44C, D44R, E68C, E68M, G73F, G73W, K114M, K114Q, U33V, N153A, N153E, N153M, N153S, N153V, W228V, V229I, V229L, S230Q, S231V, D236R, L264D, L264K, A268D, S291A, S291F, S291H, S291M, S291T, G294C, A301P, A301R, V338I, V338N, V338Q, S344M, S344P, S344Q, S344R, S344V, G361D, G361E, G361F, G361I, G361L, G361M, G361P, G361P, G36
  • specific activity is the activity of the glucoamylase per mg of protein. Activity was determined using the ethanol assay. The screening identified variants having a
  • Performance Index >1.0 compared to the parent TrGA PI.
  • the PI is calculated from the specific activities (activity/mg enzyme) of the wild-type (WT) and the variant enzymes. It is the quotient "Variant-specific act!vity/WT-speciflc activity" and can be a measure of the increase in specific activity of the variant. A PI of about 2 should be about 2 fold better than WT.
  • the disclosure relates to a variant glucoamylase having altered specific activity as compared to a parent or wild-type glucoamylase. In some embodiments, the altered specific activity is increased specific activity.
  • Increased specific activity can be defined as an increased performance Index of greater than or equal to about 1, including greater than or equal to about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, and about 2.
  • the increased specific activity is from about 1.0 to about 5.0, including about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2., about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, about 4.0, about 4.1, about 4.2, about 4.3, about 4.4, about 4.5, about 4.6, about 4.7, about 4.8, and about 4.9.
  • the variant has an at least about 1.0 fold higher specific activity than the parent glucoamylase, including at least about 1.1 fold, about 1.2 fold, about 1.3 fold, about 1,4 fold, about 1.5 fold, about 1.6 fold, about 1.7 fold, about 1.8 fold, about 1.9 fold, about 2,0 fold, about 2.2 fold, about 2.5 fold, about 2.7 fold, about 2.9 fold, about 3.0 fold, about 4.0 fold, and about 5.0 fold.
  • variants having an improvement in specific activity include one or more deletions, substitutions or insertions in the following positions in the amino acid sequence set forth in SEQ ID NO: 2: 10, 14, 15, 23, 59, 60, 61, 65, 67, 68, 72, 73, 97, 98, 99, 102, 110, 113, 133, 140, 144, 145, 147, 152, 153, 164, 182, 204, 205, 214, 216, 219, 228, 229, 230, 231, 236, 239, 241, 242, 263, 264, 265, 268, 269, 276, 284, 291, 300, 301, 303, 311, 338, 342, 344, 346, 349, 359, 361, 364, 375, 379, 382, 390, 391, 393, 394, 410, 417, 418, 430, 431, 433, 442, 444, 448, 451, 493, 494, 495, 502, 503, 508, 511
  • the parent glucoamylase will comprise a sequence having at least about 50%, about 60%, about 70%, about 80%, about 90%, or about 95% sequence identity to the sequence of SEQ ID NO: 2. In some embodiments, the parent glucoamylase will also have structural identity to SEQ ID NO: 2.
  • variants of the disclosure having improved specific activity include a substitution in the following positions In the amino acid sequence set forth in SEQ ID NO: 2: I43Q, I43R, D44C, D44R, N061I, T067M, A072Y, S097N, S102A, S102M, S102R, I133T, N145I, N153D, T205Q, Q219S, W228A, W228F, W228H, W228M, S230C, S230F, S230G, S230L, S230N, S230Q, S230R, S231L, I239V, I239Y, N263P, A268C, A268G, A268K, S291A, G294C, T342V, K394S, L417R, L417V, T430K, A431I, A431L, A431Q, R433Y, T451 , T495M, A5
  • the disclosure relates to a variant glucoamylase having both altered thermostability and altered specific activity as compared to a parent ⁇ e.g. , wild-type).
  • the altered specific activity is an increased specific activity.
  • the altered thermostability is an increased thermostability at high
  • temperatures ⁇ e.g. , at temperatures above 80°C as compared to the parent glucoamylase.
  • variants with an increased thermostability and increased specific activity include one or more deletions, substitutions or insertions and substitutions in the following positions in the amino acid sequence set forth in SEQ ID NO: 2 : 10, 15, 43, 44, 59, 61, 68, 72, 73, 97, 99, 102, 140, 153, 182, 204, 205, 214, 228, 229, 230, 231, 236, 241, 242, 264, 265, 268, 276, 284, 291, 294, 300, 301, 303, 311, 338, 344, 346, 349, 359, 361, 364, 375, 379, 382, 391, 393, 394, 410, 430, 433, 444, 448, 451, 495, 503, 511, 520, 531, 535, 536, 539, or 563, or an equivalent position in a parent glucoamylase.
  • the parent glucoamylase will be a Tric oderma glucoamylase homologue and in further embodiments, the parent glucoamylase will have at least about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 98% sequence identity to SEQ ID NO: 2. In some embodiments, the parent glucoamylase will also have structural identity to SEQ ID NO: 2. In some embodiments, the variant having increased thermostability and specific activity has a substitution in at least one of the positions: I43Q R, D44C/R,
  • W228F/H/M S230C/F/G/N/Q/R, S231L, A268C/D/G/K, S291A, G294C, R433Y, S451K, E503C, Q511H, A520C/L/P, or A535N/P/R of SEQ ID NO: 2.
  • the glucoamylase exhibit an enhanced production of fermentable sugar(s) as compared to the parent glucoamylase such as TrGA. In a further aspect, the glucoamylase exhibit an enhanced production of fermentable sugars in the mashing step of the brewing process as compared to the parent glucoamylase such as TrGA. In a further aspect, the glucoamylase exhibit an enhanced production of fermentable sugars in the fermentation step of the brewing process as compared to the parent glucoamylase such as TrGA. In a further aspect, the fermentable sugar is glucose. A skilled person within the field can determine the production of fermentable sugar(s) by e.g. HPLC techniques.
  • the glucoamylase exhibit a reduced ratio between isomaltose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase such as TrGA.
  • the glucoamylase exhibit a starch hydrolysis activity which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent glucoamylase such as TrGA.
  • a screening method for identification of a glucoamylase variant having a reduced synthesis of condensation products during hydrolysis of starch and the glucoamylse variants obtained by the method comprising the steps of measuring the isomaltose synthesis and starch hydrolysis activity of glucoamylase variants and selecting the variants having a reduced starch hydrolysis activity which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent glucoamylase and having a reduced ratio between isomaltose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase.
  • IS/SH ratio isomaltose synthesis and starch hydrolysis activity
  • the glucoamylase variants are selecting for having a reduced ratio between isomaltose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase.
  • the glucoamylase variants are selecting for having the same or increased starch hydrolysis activity and reduced isomaltose synthesis, which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent glucoamylase and thereby having a reduced ratio between isomaltose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase.
  • the g/ucoamylase exhibit an enhanced real degree of fermentation as compared to the parent glucoamylase such as TrGA.
  • the glucoamylase forms a lower amount of condensation products than the amount of condensation products formed by Aspergillus niger (AnGA) (SEQ ID NO: 6) under the same conditions. In a further aspect, the glucoamylase forms an amount of condensation products which amount is essentially the same as, not more than 5%, not more than 8% or not more than 10% higher than the amount of condensation products formed by Aspergillus niger (AnGA) (SEQ ID NO: 6) under the same conditions. In a further aspect, the dosing of the glucoamylases are the same based on protein concentration.
  • the dosing of the glucoamylases are the same based on measurement of activity in activity assays such as a GAU activity assay as described herein or a starch hydrolysation-activity assay also as described herein.
  • the present disclosure also relates to isolated polynucleotides encoding the variant glucoamylase.
  • the polynucleotides may be prepared by established techniques known in the art.
  • the polynucleotides may be prepared synthetically, such as by an automatic DNA synthesizer.
  • the DNA sequence may be of mixed genomic (or cDNA) and synthetic origin prepared by ligating fragments together.
  • the polynucleotides may also be prepared by polymerase chain reaction (PC ) using specific primers.
  • PC polymerase chain reaction
  • DNA may also be synthesized by a number of commercial companies such as Geneart AG, Regensburg, Germany.
  • the present disclosure also provides isolated polynucleotides comprising a nucleotide sequence (i) having at least about 50% identity to SEQ ID NO: 4, including at least about 60%, about 70%, about 80%, about 90%, about 95%, and about 99%, or (ii) being capable of hybridizing to a probe derived from the nucleotide sequence set forth in SEQ ID NO: 4, under conditions of intermediate to high stringency, or (iii) being complementary to a nucleotide sequence having at least 90% sequence identity to the sequence set forth in SEQ ID NO: 4.
  • Probes useful according to the disclosure may include at least about 50, about 100, about 150, about 200, about 250, about 300 or more contiguous nucleotides of SEQ ID NO: 4.
  • the encoded polypeptide also has structural identity to SEQ ID NO: 2.
  • the present disclosure further provides Isolated polynucleotides that encode variant glucoamylases that comprise an amino acid sequence comprising at least about 50%, about 60%, about 70%, about 80%, about 90%, about 93%, about 95%, about 97%, about 98%, or about 99% amino acid sequence identity to SEQ ID NO: 2. Additionally, the present disclosure provides expression vectors comprising any of the polynucleotides provided above. The present disclosure also provides fragments ⁇ i.e., portions) of the DNA encoding the variant glucoamylases provided herein.
  • fragments of the DNA find use in obtaining partial length DNA fragments capable of being used to isolate or identify polynucleotides encoding mature giucoamylase enzymes described herein from filamentous fungal cells (e.g. , Trichoderma , Aspergillus, Fusarium, Penidllium, and Humicola), or a segment thereof having giucoamylase activity.
  • fragments of the DNA may comprise at least about 50, about 100, about 150, about 200, about 250, about 300 or more contiguous nucleotides.
  • portions of the DNA provided in SEQ ID NO: 4 may be used to obtain parent glucoamylases and particularly Trichoderma giucoamylase homologues from other species, such as filamentous fungi that encode a giucoamylase.
  • a DNA construct comprising a polynucleotide as described above encoding a variant giucoamylase encompassed by the disclosure and operably linked to a promoter sequence is assembled to transfer into a host cell.
  • a polynucleotide encoding a giucoamylase variant as disclosed herein is provided.
  • the DNA construct may be introduced into a host cell using a vector.
  • a vector comprising the polynucleotide, or capable of expressing a giucoamylase variant as disclosed herein is provided.
  • the vector may be any vector that when introduced into a host cell is stably introduced.
  • the vector is integrated into the host cell genome and is replicated.
  • Vectors include cloning vectors, expression vectors, shuttle vectors, piasmids, phage particles, cassettes and the like.
  • the vector is an expression vector that comprises regulatory sequences operably linked to the giucoamylase coding sequence. Examples of suitable expression and/or integration vectors are provided in Sambrook et al.
  • Suitable plasmids for use in bacterial cells include pB 322 and pUC19 permitting replication in E . coli and pE194 for example permitting replication in Bacillus.
  • Other specific vectors suitable for use in E. coli host cells include vectors such as pFB6, pBR322, pUC18, pUClOO, pDONRTM201, 10 pDONRTM221, pENTRTM, pGEM ® 3Z and pGEM ® 4Z.
  • Specific vectors suitable for use in fungal cells include pRAX, a general purpose expression vector useful in Aspergillus, pRAX with a g/aA promoter, and in Hypocrea/Trichoderma includes pTrex3g with a cbhl promoter.
  • the promoter that shows transcriptional activity in a bacterial or a fungal host cell may be derived from genes encoding proteins either homologous or heterologous to the host cell.
  • the promoter may be a mutant, a truncated and/or a hybrid promoter.
  • suitable promoters useful in fungal cells and particularly filamentous fungal cells such as Trichoderma or Aspergillus cells include such exemplary promoters as the T. reesei promoters cbhl, cbhl, eg/1, eg/2, eg5, x/nl and xlnl.
  • Other examples of useful promoters include promoters from A.
  • awamori and A. niger glucoamylase genes (glaA) (see Nunberg et al., Mol. Cell Biol. 4: 2306-2315 (1984) and Boel et al., EMBO J. 3: 1581-1585 (1984)), A. oryzae TA A amylase promoter, the TPI (triose phosphate isomerase) promoter from S. cerevlslae, the promoter from Aspergillus nidulans acetamidase genes and Rhizomucor miehei lipase genes.
  • TPI triose phosphate isomerase
  • suitable promoters useful In bacterial cells include those obtained from the E coli lac operon; Bacillus llcheniformis afpha-amylase gene amyL), B. stearothermophilus amylase gene [amyS); Bacillus subtilis xylA and xylB genes, the beta-lactamase gene, and the tac promoter.
  • the promoter is one that is native to the host cell.
  • the promoter is a native T. reesei promoter.
  • the promoter is one that is heterologous to the fungal host ceil.
  • the promoter will be the promoter of a parent glucoamylase (e.g., the TrGA promoter).
  • the DNA construct includes nucleic acids coding for a signal sequence, that is, an amino acid sequence linked to the amino terminus of the polypeptide that directs the encoded polypeptide into the cell's secretory pathway.
  • the 5' end of the coding sequence of the nucleic acid sequence may naturally include a signal peptide coding region that is naturally linked in translation reading frame with the segment of the glucoamylase coding sequence that encodes the secreted glucoamylase or the 5' end of the coding sequence of the nucleic acid sequence may include a signal peptide that is foreign to the coding sequence.
  • the DNA construct includes a signal sequence that is naturally associated with a parent glucoamylase gene from which a variant glucoamylase has been obtained.
  • the signal sequence will be the sequence depicted in SEQ ID NO: 1 or a sequence having at least about 90%, about 94, or about 98% sequence identity thereto.
  • Effective signal sequences may include the signal sequences obtained from other filamentous fungal enzymes, such as from Trichoderma (T.
  • reesel glucoamylase cellobiohydrolase I, cellobiohydrolase II, endoglucanase I, endoglucanase II, endoglucanase II, or a secreted proteinase, such as an aspartic proteinase), Humicola [H, !nsolens cellobiohydrolase or endoglucanase, or H. grisea glucoamylase), or Aspergillus (A niger glucoamylase and A. oryzae TAKA amylase).
  • a DNA construct or vector comprising a signal sequence and a promoter sequence to be introduced into a host cell are derived from the same source.
  • the native glucoamylase signal sequence of a Trichoderma glucoamylase homologue such as a signal sequence from a Hypocrea strain may be used.
  • the expression vector also includes a termination sequence. Any termination sequence functional in the host cell may be used in the present disclosure. In some embodiments, the termination sequence and the promoter sequence are derived from the same source. In another embodiment, the termination sequence is homologous to the host cell. Useful termination sequences include termination sequences obtained from the genes of Trichoderma reesei cbll; A. niger or A. awamori glucoamylase (Nunberg et al.
  • an expression vector includes a selectable marker.
  • selectable markers include ones that confer antimicrobial resistance ⁇ e.g. , hygromycln and phleomycin).
  • Nutritional selective markers also find use in the present disclosure Including those markers known in the art as amdS (acetamidase), argB (ornithine
  • the selective marker is the amdS gene, which encodes the enzyme acetamldase, allowing transformed cells to grow on acetamide as a nitrogen source.
  • A. nidulans amdS gene as a selective marker is described in Kelley et al., EMBO J, 4:475-479 (1985) and Penttila et al., Gene 61: 155-164 (1987).
  • Methods used to ligate the DIMA construct comprising a nucleic acid sequence encoding a variant glucoamylase, a promoter, a termination and other sequences and to insert them into a suitable vector are well known in the art. Linking is generally accomplished by ligation at convenient restriction sites. If such sites do not exist, synthetic oligonucleotide linkers are used in accordance with conventional practice (see Sambrook et al. (1989) supra, and Bennett and Lasure, More Gene Manipulations In Fungi, Academic Press, San Diego (1991) pp 70-76.). Additionally, vectors can be constructed using known recombination techniques (e.g., Invitrogen Life Technologies, Gateway Technology).
  • the present disclosure also relates to host cells comprising a polynucleotide encoding a variant glucoamylase of the disclosure.
  • the host cells are chosen from bacterial, fungal, plant and yeast cells.
  • the term host cell includes both the cells, progeny of the cells and protoplasts created from the cells that are used to produce a variant glucoamylase according to the disclosure.
  • a host cell comprising, preferably transformed with a vector is disclosed.
  • a cell capable of expressing a glucoamylase variant is provided.
  • the host cell is a protease deficient and/or xylanase deficient and/or glucanase deficient host cell.
  • a protease deficient and/or xylanase deficient and/or native glucanase deficient host cell may be obtained by deleting or silencing the genes coding for the mentioned enzymes. As a consequence the host cell containing the GA-variant is not expressing the mentioned enzymes
  • the host cells are fungal cells and optionally filamentous fungal host cells.
  • filamentous fungi refers to all filamentous forms of the subdivision
  • Eumycotlna (see, Alexopoulos, C. J. (1962), Introductory Mycology, Wiley, New York). These fungi are characterized by a vegetative mycelium with a cell wall composed of chitin, cellulose, and other complex polysaccharides.
  • the filamentous fungi of the present disclosure are morphologically, physiologically, and genetically distinct from yeasts. Vegetative growth by filamentous fungi is by hyphal elongation and carbon catabolism is obligatory aerobic.
  • the filamentous fungal parent cell may be a cell of a species of, but not limited to, Trlchoderma (e.g., Trichoderma reesei, the asexual morph of Hypocrea jecorina, previously classified as T. longibrachiatum, Trichoderma viride, Trichoderma koningii, Trichoderma harzianum) (Sheir-Neirs et al., Appl. Microbiol. Biotechnol. 20:46-53 (1984); ATCC No. 56765 and ATCC No. 26921), Penicilliurn sp., Humicola sp, (e.g. , H, insolens, H. lanuginosa and H. grisea), Chrysosporium sp. (e.g. , C. lucknowense),
  • Trlchoderma e.g., Trichoderma reesei, the asexual morph of Hypocrea jecorina, previously classified
  • Gliocladium sp. Aspergillus sp. ⁇ e.g., A. oryzae, A. nlger, A sojae, A. japonicus, A. nidulans, and A. awamorl) (Ward et al., Appl. Microbiol. Biotechnol. 39: 738-743 (1993) and
  • Trichoderma or “Trichoderma sp.” or “Trichoderma spp.” refer to any fungal genus previously or currently classified as Trichoderma.
  • the host cells will be gram-positive bacterial cells.
  • Non-limiting examples include strains of Streptomyces (e.g. , S. Ilvidans, S. coelicolor, and S. griseus) and Bacillus.
  • Streptomyces e.g. , S. Ilvidans, S. coelicolor, and S. griseus
  • Bacillus As used herein, "the genus Bacillus” Includes all species within the genus '"Bacillus,” as known to those of skill in the art, including but not limited to B. subtilis, B. licheniformis, B. lentus, B. brevis, B. stearothermophilus, B. alkalophllus, B. amyloliquefadens, B. clausii, B. halodurans, B. megaterium, B.
  • the host cell is a gram-negative bacterial strain, such as E. coli or Pseudomonas sp.
  • the host cells may be yeast cells such as
  • the host cell will be a genetically engineered host cell wherein native genes have been inactivated, for example by deletion in bacterial or fungal cells. Where it Is desired to obtain a fungal host cell having one or more inactivated genes known methods may be used (e.g. , methods disclosed in U.S. Patent No. 5,246,853, U.S. Patent No. 5,475,101, and WO 92/06209).
  • Gene inactivation may be accomplished by complete or partial deletion, by insertional inactivation or by any other means that renders a gene nonfunctional for its intended purpose (such that the gene is prevented from expression of a functional protein).
  • the host cell when the host cell is a Trichoderma cell and particularly a T. reesei host cell, the cbhl, cbh2, eg/1 and eg/2 genes will be inactivated and/or deleted.
  • Exemplary Trichoderma reesei host cells having quad-deleted proteins are set forth and described in U.S. Patent No. 5,847,276 and WO 05/001036.
  • the host cell is a protease deficient or protease minus strain.
  • Introduction of a DNA construct or vector into a host cell includes techniques such as transformation; electroporation; nuclear microinjection; transduction; transfection, (e.g., lipofection-mediated and DEAE-Dextrin mediated transfection); incubation with calcium phosphate DNA precipitate; high velocity bombardment with DNA-coated microprojectiles; and protoplast fusion.
  • General transformation techniques are known in the art (see, e.g. , Ausubel et al. (1987) supra, chapter 9; and Sambrook et al. (1989) supra, and Campbell et al., Curr. Genet 16:53-56 (1989)).
  • the preparation of Trichoderma sp. for transformation involves the preparation of protoplasts from fungal mycelia (see, Campbell et al., Curr. Genet. 16:53- 56 (1989); Pentllla et al., Gene 61 : 155-164 (1987)).
  • Agrobacterium tumefaciens- mediated transformation of filamentous fungi is known (see de Groot et al., Nat. Biotechnol. 16 : 839- 842 (1998)).
  • U.S. Patent No. 6,022,725 and U.S. Patent No. 6,268,328 for transformation procedures used with filamentous fungal hosts.
  • genetically stable transformants are constructed with vector systems whereby the nucleic acid encoding the variant glucoamylase is stably integrated into a host strain chromosome. Transformants are then purified by known techniques.
  • the host cells are plant cells, such as cells from a monocot plant (e.g. , corn, wheat, and sorghum) or cells from a dicot plant (e.g., soybean).
  • a monocot plant e.g. , corn, wheat, and sorghum
  • a dicot plant e.g., soybean.
  • Methods for making DNA constructs useful in transformation of plants and methods for plant transformation are known. Some of these methods include Agrobacterium tumefaciens mediated gene transfer; microprojectile bombardment, PEG mediated transformation of protoplasts, electroporation and the like.
  • the present disclosure further relates to methods of producing the variant glucoamylases, which comprises transforming a host cell with an expression vector comprising a
  • a method of expressing a variant glucoamylase according to the disclosure comprising obtaining a host celt or a cell as disclosed herein and expressing the glucoamylase variant from the cell or host cell, and optionally purifying the glucoamylase variant, is provided.
  • the glucoamylase variant is purified.
  • the host cells are cultured under suitable conditions in shake flask cultivation, small scale or large scale fermentations (including continuous, batch and fed batch fermentations ) in laboratory or industrial fermentors, with suitable medium containing physiological salts and nutrients (see, e.g., Pourquie, J. et al., Biochemistry And Genetics Of Cellulose Degradation, eds. Aubert, J. P. et al., Academic Press, pp. 71-86, 1988 and Ilmen, M. et al., Appl. Environ. Microbiol. 63 : 1298-1306 (1997)).
  • suitable medium containing physiological salts and nutrients see, e.g., Pourquie, J. et al., Biochemistry And Genetics Of Cellulose Degradation, eds. Aubert, J. P. et al., Academic Press, pp. 71-86, 1988 and Ilmen, M. et al., Appl. Environ. Microbiol. 63 : 1298
  • Yeast Malt Extract (YM) broth, Luria Bertani (LB) broth and Sabouraud Dextrose (SD) broth) find use in the present disclosure.
  • Culture conditions for bacterial and filamentous fungal cells are known in the art and may be found in the scientific literature and/or from the source of the fungi such as the American Type Culture Collection and Fungal Genetics Stock Center.
  • the inducing agent e.g. , a sugar, metal salt or antimicrobial
  • the inducing agent is added to the medium at a concentration effective to induce glucoamylase expression.
  • the present disclosure relates to methods of producing the variant glucoamylase in a plant host comprising transforming a plant cell with a vector comprising a polynucleotide encoding a glucoamylase variant according to the disclosure and growing the plant cell under conditions suitable for the expression and production of the variant.
  • assays are carried out to evaluate the expression of a variant glucoamylase by a cell line that has been transformed with a polynucleotide encoding a variant glucoamylase encompassed by the disclosure.
  • the assays can be carried out at the protein level, the RNA level and/or by use of functional bioassays particular to glucoamylase activity and/or production.
  • Some of these assays include Northern blotting, dot blotting (DNA or RNA analysis), RT-PCR (reverse transcriptase polymerase chain reaction), in situ hybridization using an appropriately labeled probe (based on the nucleic acid coding sequence) and conventional Southern blotting and autoradiography.
  • glucoamylase activity may be assayed by the 3,5-dinitrosalicylic acid (DNS) method (see Goto et al., Biosci. Biotechnol. Biochem. 58 : 49-54 ( 1994)).
  • DAS 3,5-dinitrosalicylic acid
  • protein expression is evaluated by immunological methods, such as immunohistochemical staining of cells, tissue sections or immunoassay of tissue culture medium, (e.g., by Western blot or ELISA) .
  • immunoassays can be used to qualitatively and quantitatively evaluate expression of a glucoamylase. The details of such methods are known to those of skill in the art and many reagents for practicing such methods are commercially available.
  • glucoamylases of the present disclosure may be recovered or purified from culture media by a variety of procedures known in the art including centrifugation, filtration, extraction, precipitation and the like.
  • glucoamylase variant as described herein for the preparation of an enzymatic composition, is provided.
  • the variant glucoamylases of the disclosure may be used in enzyme compositions including but not limited to starch hydrolyzing and saccharifying compositions, cleaning and detergent compositions (e.g. , laundry detergents, dish washing detergents, and hard surface cleaning compositions), alcohol fermentation compositions, and in animal feed compositions. Further, the variant glucoamylases may be used in, for example, brewing, healthcare, textile, environmental waste conversion processes, biopulp processing, and biomass conversion applications. The variant glucoamylases of the disclosure may be used in enzyme
  • compositions including a starch hydrolyzing composition, a saccharifying composition, a detergent, an alcohol fermentation enzymatic composition, and an animal feed.
  • the composition is a starch hydrolyzing composition.
  • an enzyme composition comprising a variant glucoamylase encompassed by the disclosure will be optionally used in combination with any one or combination of the following enzymes - alpha-amylases, proteases, pullulanases, isoamylases, cellulases, hemiceflulases, xylanases, cyclodextrin glycotransferases, lipases, phytases, !accases, oxidases, esterases, cutinases, xylanases, granular starch hydro!yzing enzymes and other glucoamylases.
  • an enzyme composition comprising a variant glucoamylase encompassed by the disclosure will be optionally used in combination with any one or combination of the following enzymes - amylase, protease, pullulanase, cellulase, glucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase and a further glucoamylase.
  • an enzyme composition comprising a variant glucoamylase encompassed by the disclosure will be optionally used in combination with any one or combination of the following enzymes - amylase, pullulanase and a further glucoamylase.
  • an enzyme composition comprising a variant glucoamylase encompassed by the disclosure will be optionally used In combination with any one or combination of the following enzymes - amylase and pullulanase.
  • the amylase is alpha-amylase and/or isoamylase.
  • the glucanase is exoglucanase and/or endoglucanase.
  • the enzyme composition will include an alpha-amylase such as fungal alpha-amylases (e.g. , Aspergillus sp. ) or bacterial alpha-amylases (e.g., Bacillus sp. such as B. stearothermophilus, B. amyloliquefaciens and B. licheniformis) and variants and hybrids thereof.
  • an alpha-amylase (EC. 3.2.1.1) catalyses the endohydrolysis of ( l->4)-alpha-D-glucosidic linkages in oligosaccharides and polysaccharides.
  • an alpha- amylase acts on starch, glycogen and related polysaccharides and oligosaccharides in a random manner; reducing groups are liberated in the alpha-configuration.
  • the alpha-amylase is an acid stable alpha-amylase.
  • the alpha-amylase is Aspergillus kawachi alpha-amylase (AkAA), see U.S. Patent No.
  • alpha-amylases contemplated for use in the compositions of the disclosure include, but are not limited to, bacterial alpha-amylases such as those from Bacillus subtilis (AmyE), and Bacillus licheniformis (AmyL) and Geobacillus stearothermophilus (AmyS) as described by Gray et al.
  • AmyE Bacillus subtilis
  • AmyL Bacillus licheniformis
  • AmyS Geobacillus stearothermophilus
  • AmyE, AmyL and AmyS are well known and examples are described in US Patent Application 20100015686 Al ("Variant Alpha-Amylases from Bacillus subtilis and Methods of Uses, Thereof"), US Patent Application 20090314286 Al ("Geobacillus stearothermophilus Alpha-Amylase (AmyS) Variants with Improved Properties”),
  • alpha-amylase Variants (Alpha-Amylase Variants)
  • US 20090238923 Al Vehicle-Amylase Variants
  • Commercially available alpha-amylases contemplated for use in the compositions of the disclosure are known and include GZYME G997, SPEZY E® FRED, SPEZYME® XTRA AMYLEX® 4T, AMYLEX® 3T and AMYLEX® XT (Danisco US, Inc, Genencor Division), TERMAMYL® 120-L and SUPRA® (Novozymes, A/S).
  • the enzyme composition will include a pullulanase (EC 3.2.1.41).
  • the pullulanases used herein is pullulanase from e.g. Pyrococcus or Bacillus sp, such as Bacillus acidopullulyticus (e.g., the one described in FEMS Microbiol. Letters 115: 97- 106) or Bacillus deramificans, or Bacillus naganoencis.
  • the pullulanase is the Bacillus acidopullulyticus PulB enzyme, described in the paper by Kelly et al. FEMS
  • the pullulanase may also be an engineered pullulanases from, e.g., a Bacillus strain.
  • Other pullulanases which are preferably used in the processes according to the invention include: Bacillus deramificans (U.S. Patent No.
  • pullulanase may be derived from Pyrococcus woesei described in
  • the pullulanase may be derived from Fervidobacterium sp. Ven 5 described in PCT/DK92/00079, or the pullulanase may be derived from Thermococcus celer described In PCT/DK95/00097, or the pullulanase may be derived from Pyrodictium abyssei described in PCT/DK95/Q0211 , or the pullulanase may be derived from Fervidobacterium pennavorans described in PCT/DK95/00095, or the pullulanase may be derived from
  • the pullulanase (EC 3.2.1.41) may also be derived from, but not limited to, Klebsiella (Aerobacter) spp. (PulA); for example Klebsiella planticola, Klebsiella ⁇ Aerobacter) aerogenes and Klebsiella pneumoniae (see: Katsuragi et al. Journal of Bacteriology (1987) 169(5) p2301-2306; Fouts et al. PLoS Genetics (2008) 4(7), E1000141).
  • Klebsiella (Aerobacter) spp. PulA
  • Klebsiella planticola for example Klebsiella planticola, Klebsiella ⁇ Aerobacter aerogenes and Klebsiella pneumoniae
  • These pullulanases, along with those from, for example, Bacillus acidopullulyticus are members of Glycoside Hydrolase Family 13.
  • the enzyme composition will include an acid fungal protease.
  • the acid fungal protease is derived from a Trichoderma sp. and may be any one of the proteases disclosed in US Patent No. 7,563,607 (published as US 2006/0154353 July 13, 2006), incorporated herein by reference.
  • the enzyme composition will include a phytase from Buttiauxiella spp. (e.g., BP-17, see also variants disclosed in PCT patent publication WO 2006/043178).
  • the variant glucoamylases of the disclosure may be combined with other glucoamylases.
  • the glucoamylases of the disclosure will be combined with one or more glucoamylases derived from strains of Aspergillus or variants thereof, such as A. oryzae, A. niger, A. kawachi, and A. awamori; glucoamylases derived from strains of Humicola or variants thereof, particularly H.
  • grisea such as the glucoamylase having at least about 90%, about 93%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to SEQ ID NO: 3 disclosed in WO 05/052148; glucoamylases derived from strains of Talaromyces or variants thereof, particularly T. emersonii;
  • glucoamylases derived from strains of Atheiia and particularly A. rolfsii; glucoamylases derived from strains of Penicillium, particularly P. chrysagenum.
  • the variant glucoamylases may be used for starch conversion processes, and particularly In the production of dextrose for fructose syrups, specialty sugars and in alcohol and other end-product (e.g., organic acid, ascorbic acid, and amino acids) production from fermentation of starch containing substrates (G.M.A. van Beynum et al. , Eds. (1985) Starch Conversion Technology, Marcel Dekker Inc. NY). Dextrins produced using variant glucoamylase compositions of the disclosure may result in glucose yields of at least 80%, at (east 85%, at least 90% and at least 95%.
  • end-product e.g., organic acid, ascorbic acid, and amino acids
  • Production of alcohol from the fermentation of starch substrates using glucoamylases encompassed by the disclosure may include the production of fuel alcohol or potable alcohol.
  • the production of alcohol will be greater when the variant glucoamylase is used under the same conditions as the parent glucoamylase.
  • the production of alcohol will be between about 0.5% and 2.5% better, including but not limited to about 0.6%, about 0.7%, about 0.8%, about 0.9%, about 1.0%, about 1.1%, about 1.2%, about 1.3%, about 1.4%, about 1.5%, about 1.6%. about 1.7%, about 1.8%, about 1.9%, about 2.0%, about 2.1%, about 2.2%, about 2.3%, and about 2.4% more alcohol than the parent glucoamylase.
  • the variant glucoamylases of the disclosure will find use In the hydrolysis of starch from various plant-based substrates, which are used for alcohol production.
  • the plant-based substrates will include corn, wheat, barley, rye, milo, rice, sugar cane, potatoes and combinations thereof.
  • the plant-based substrate will be fractionated plant material, for example a cereal grain such as com, which is fractionated into components such as fiber, germ, protein and starch (endosperm) (U.S. Patent No. 6,254,914 and U.S. Patent No. 6,899,910).
  • a cereal grain such as com
  • components such as fiber, germ, protein and starch (endosperm)
  • the alcohol will be ethanol.
  • alcohol fermentation production processes are characterized as wet milling or dry milling processes.
  • the variant glucoamylase will be used in a wet milling fermentation process and In other embodiments the variant glucoamylase will find use in a dry milling process.
  • Dry grain milling involves a number of basic steps, which generally include: grinding, cooking, liquefaction, saccharification, fermentation and separation of liquid and solids to produce alcohol and other co-products.
  • Plant material and particularly whole cereal grains, such as corn, wheat or rye are ground. In some cases, the grain may be first fractionated into component parts.
  • the ground plant material may be milled to obtain a coarse or fine particle.
  • the ground plant material is mixed with liquid (e.g., water and/or thin stillage) in a slurry tank. The slurry is subjected to high temperatures (e.g.
  • a jet cooker along with liquefying enzymes (e.g., alpha-amylases) to solublize and hydrolyze the starch in the grain to dextrins.
  • liquefying enzymes e.g., alpha-amylases
  • the mixture is cooled down and further treated with saccharifying enzymes, such as glucoamylases encompassed by the instant disclosure, to produce glucose.
  • saccharifying enzymes such as glucoamylases encompassed by the instant disclosure, to produce glucose.
  • the mash containing glucose may then be fermented for approximately 24 to 120 hours in the presence of fermentation microorganisms, such as ethanol producing microorganism and particularly yeast (Saccharomyces spp).
  • the solids in the mash are separated from the liquid phase and alcohol such as ethanol and useful co- products such as distillers' grains are obtained.
  • the saccharification step and fermentation step are combined and the process is referred to as simultaneous saccharification and fermentation or simultaneous saccharification, yeast propagation and fermentation.
  • the variant glucoamylase is used in a process for starch hydrolysis wherein the temperature of the process is between about 30°C and about 75°C, in some embodiments, between about 40°C and about 65°C. In some embodiments, the variant glucoamylase is used in a process for starch hydrolysis at a pH between about 3.0 and about 6.5.
  • the fermentation processes in some embodiments include milling of a cereal grain or fractionated grain and combining the ground cereal grain with liquid to form a slurry that is then mixed in a single vessel with a variant glucoamylase according to the disclosure and optionally other enzymes such as, but not limited to, alpha-amylases, other glucoamylases, phytases, proteases, pullulanases, isoamylases or other enzymes having granular starch hydrolyzing activity and yeast to produce ethanol and other co-products (see e.g. , U.S. Patent No. 4,514,496, WO 04/081193, and WO 04/080923).
  • the disclosure pertains to a method of saccharifying a liquid starch solution, which comprises an enzymatic saccharification step using a variant glucoamylase of the disclosure.
  • the liquid starch solution may be produced by solubilising starch in water or an aqueous buffer and optionally heating to gelatinize the starch. Further partial degradation of the starch by amylases may be applied.
  • the present invention provides a method of using glucoamylase variants of the invention for producing glucose and the like from starch.
  • the method includes the steps of partially hydrolyzing precursor starch in the presence of alpha-amylase and then further hydrolyzing the release of D-glucose from the non-reducing ends of the starch or related oligo- and polysaccharide molecules in the presence of glucoamylase by cleaving alpha-(l-4) and alpha-(l-6) glucosidic bonds.
  • the partial hydrolysis of the precursor starch utilizing alpha-amylase provides an initial breakdown of the starch molecules by hydrolyzing internal alpha-(l-4)-iinkages.
  • the initial hydrolysis using alpha-amylase is run at a temperature of approximately 105°C.
  • a very high starch concentration is processed, usually 30% to 40% solids.
  • the initial hydrolysis is usually carried out for five minutes at this elevated temperature.
  • the partially hydrolyzed starch can then be transferred to a second tank and incubated for approximately one hour at a temperature of 85° to 90°C to derive a dextrose equivalent (D.E.) of 10 to 15,
  • D.E. dextrose equivalent
  • the step of further hydrolyzing the release of D- glucose from the non-reducing ends of the starch or related oligo- and polysaccharides molecules in the presence of glucoamylase is normally carried out in a separate tank at a reduced temperature between 30° and 60°C.
  • the temperature of the substrate liquid is dropped to between 55°C and 60°C.
  • the pH of the solution is dropped from 6 to 6.5 to a range between 3 and 5.5.
  • the pH of the solution Is 4 to 4.5.
  • the glucoamylase Is added to the solution and the reaction is carried out for 24-72 hours, such as 36-48 hours.
  • Examples of saccharification processes wherein the glucoamylase variants of the invention may be used include the processes described in JP 3-224493; JP 1-191693; JP 62-272987; and EP 452,238.
  • the glucoamylase variant(s) described herein may be used in combination with an enzyme that hydrolyzes only alpha-(l-6)-glucosidic bonds in molecules with at least four glucosyl residues.
  • the glucoamylase variant can be used in combination with pullulanase or alpha-amylase.
  • glucoamylase variant as described herein in a starch conversion process, such as in a continuous saccharification step, is provided.
  • the glucoamylase variants described herein may also be used in immobilised form. This is suitable and often used for producing maltodextrins or glucose syrups or speciality syrups, such as maltose syrups and further for the raffinate stream of oligosaccharides in connection with the production of fructose syrups.
  • the dextrose syrup may be converted into fructose.
  • the pH is increased to a value in the range of 6-8, such as pH 7,5, and the calcium is removed by ion exchange.
  • the dextrose syrup Is then converted Into high fructose syrup using, e.g., an immobilized glucose isomerase (such as SweetzymeTM IT).
  • an immobilized glucose isomerase such as SweetzymeTM IT.
  • the variant glucoamyiase is used in a process for beer brewing.
  • Mashing is the process of converting starch from the milled barley malt and solid adjuncts into fermentable and un-fermentable sugars to produce wort.
  • Traditional mashing involves mixing milled barley malt and adjuncts with water at a set temperature and volume to continue the biochemical changes initiated during the malting process.
  • the mashing process is conducted over a period of time at various temperatures in order to activate the endogenous enzymes responsible for the degradation of proteins and carbohydrates.
  • the wort is separated from the solids (spent grains).
  • the wort may be fermented with brewers' yeast to produce a beer.
  • the short-branched glucose oligomers formed during mashing may be further hydrolyzed by addition of exogenous enzymes like glucoamylases and/or alpha-amyiases, beta-amylases and pullulanase, among others.
  • the wort may be used as it is or It may be concentrated and/or dried.
  • the concentrated and/or dried wort may be used as brewing extract, as malt extract flavoring, for non-alcoholic malt beverages, malt vinegar, breakfast cereals, for confectionary etc.
  • the wort is fermented to produce an alcoholic beverage, typically a beer, e.g.
  • the wort is fermented to produce potable ethanol.
  • the disclosure pertains to a method of hydrolyzing and saccharifying gelatinised and liquefied (typically) grist starch to be used in brewing, whereby an enzymatic composition comprising one or more glucoamylases as contemplated herein, Is used to enhance the amount of brewers' yeast fermentable sugars obtained from the starch.
  • a brewing process is used to produce the potable product, beer, where fermentable sugars are converted to ethanol and C0 2 by fermentation with brewers' yeast.
  • the fermentable sugars are traditionally derived from starch in cereal grains, optionally supplemented with fermentable sugar sources such as glucose and maltose syrups and cane sugar.
  • beer production well-known in the art, typically includes the steps of malting, mashing, and fermentation.
  • the malted cereal is milled to give a grist which may be mixed with a milled adjunct (e.g. non-germinated cereal grain) to give a mixed grist.
  • a milled adjunct e.g. non-germinated cereal grain
  • the grist is mixed with water and subjected to mashing; a previously cooked (gelatinised and liquefied) adjunct may be added 2011/061082
  • the mashing process is conducted over a period of time at various temperatures in order to hydrolyse cereal proteins, degrade beta-glucans and so!ubilise and hydrolyse the starch,
  • the hydrolysis of the grist starch in the malt and adjunct in traditional mashing is catalysed by two main enzymes endogenous to malted barley.
  • Alpha-amylase randomly cleaves alpha-1,4 bonds in the interior of the starch molecule fragmenting them into smaller dextrins.
  • Beta-amylase sequentially cleaves alpha-1,4 bonds from the non-reducing end of the these dextrins producing mainly maltose.
  • Both alpha- and beta-amyiase are unable to hydrolyse the alpha-1,6 bonds which forms the branching points of the starch chains in the starch molecule, which results in the accumulation of limit dextrins in the mash.
  • Malt does contain an enzyme, limit dextrinase, which catalyses the hydrolysis of alpha-1,6 bonds but it only shows weak activity at mashing temperatures due to its thermolability.
  • the liquid extract (wort) is separated from the spent grain solids (i.e. the insoluble grain and husk material forming part of grist).
  • the objectives of wort separation include: ⁇ to obtain good extract recovery, ⁇ to obtain good filterability, and ⁇ to produce clear wort. Extract recovery and filterability of the wort are important in the economics of the brewing process.
  • the composition of the wort depends on the raw materials, mashing process and profiles and other variables.
  • a typical wort comprises 65-80% fermentable sugars (glucose, maltose and maltotriose, and 20-35% non-fermentable limit dextrins (sugars with a higher degree of polymerization than maltotriose).
  • An insufficiency of starch hydrolytic enzymes during mashing can arise when brewing with high levels of adjunct unmalted cereal grists.
  • a source of exogenous enzymes, capable of producing fermentable sugars during the mashing process is thus needed.
  • exogenous enzymes are also needed to reduce the level of non-fermentable sugars in the wort, with a corresponding increase in fermentable sugars, in order to brew highly attenuated beers with a low carbohydrate content.
  • a enzyme composition for hydrolysis of starch comprising at least one glucoamylase as contemplated herein, which can be added to the mash or used in the mashing step of a brewing process, in order to cleave alpha-1,4 bonds and/or alpha-1,6 bonds in starch grist and thereby increase the fermentable sugar content of the wort and reduce the residue of non-fermentable sugars In the finished beer.
  • the wort, so produced may be dried (by for example spray drying) or concentrated (e.g. boiling and evaporation) to provide a syrup or powder.
  • the grist may comprise any starch and/or sugar containing plant material derivable from any plant and plant part, including tubers, roots, stems, leaves and seeds.
  • the grist comprises grain, such as grain from barley, wheat, rye, oat, corn, rice, milo, millet and sorghum, and more preferably, at least 10%, or more preferably at least 15%, even more preferably at least 25%, or most preferably at least 35%, such as at least 50%, at least 75%, at least 90% or even 100% (w/w) of the grist of the wort is derived from T EP2011/061082
  • the grist comprises malted grain, such as barley malt.
  • malted grain such as barley malt.
  • at least 10%, or more preferably at least 15%, even more preferably at least 25%, or most preferably at least 35%, such as at least 50%, at least 75%, at least 90% or even 100% (w/w) of the grist of the wort is derived from malted grain.
  • the grist comprises adjunct, such as non-malted grain from barley, wheat, rye, oat, corn, rice, milo, millet and sorghum, and more preferably, at least 10%, or more preferably at least 15%, even more preferably at least 25%, or most preferably at least 35%, such as at least 50%, at least 75%, at least 90% or even 100% (w/w) of the grist of the wort is derived from non-malted grain or other adjunct.
  • Adjunct comprising readily fermentable carbohydrates such as sugars or syrups may be added to the malt mash before, during or after the mashing process of the invention but is preferably added after the mashing process.
  • a part of the adjunct may be treated with an alpha-amylase, and/or endopeptidase (protease) and/or a endoglucanase, and/or heat treated before being added to the mash,
  • the enzyme composition as
  • additional enzyme(s) may include additional enzyme(s), preferably an enzyme selected from among an alpha-amylase, protease, pullulanase, isoamylase, cellulase, glucanase such as exoglucanase or endoglucanase, xylanase, arabinofuranosidase, feruloyl esterase, xylan acetyl esterase, phytase and glucoamylase.
  • starch extracted from the grist is gradually hydroly
  • the mash is starch negative to iodine testing, before wort separation.
  • a pullulanase (E. C. 3.2.1 .41 ) enzyme activity is exogenously supplied and present in the mash.
  • the pullulanase may be added to the mash Ingredients, e.g., the water and/or the grist before, during or after forming the mash.
  • an alpha-amylase enzyme activity is exogenously supplied and present in the mash.
  • the alpha-amylase may be added to the mash ingredients, e.g., the water and/or the grist before, during or after forming the mash.
  • both pullulanase and alpha-amylase enzyme activities are exogenously supplied and present in the mash.
  • the alpha-amylase and pullulanase may be added to the mash ingredients, e.g., the water and/or the grist before, during or after forming the mash.
  • a further enzyme may be added to the mash, said enzyme being selected from the group consisting of among amylase, protease, pullulanase, isoamylase, cellulase, glucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, phytase and a further glucoamylase.
  • wort boiling occurs during wort boiling (further information may be found in "Technology Brewing and Malting” by Wolfgang Kunze of the Research and Teaching Institute of Brewing, Berlin (VLB), 3rd completely updated edition, 2004, ISBN 3-921690-49-8) including inactivation of the endogenous malt enzymes and any exogenous enzyme added to the mash or adjunct.
  • the boiled wort is then cooled, pitched with brewers' yeast and fermented at temperatures typically ranging from 8-16 °C to convert the fermentable sugars to ethanol.
  • a low-alcohol beer can be produced from the final beer, by a process of vacuum evaporation that serves to selectively remove alcohol.
  • the disclosure pertains to a method of enhancing the amount of fermentable sugars in the wort, using an enzymatic composition comprising one or more glucoamylases as contemplated herein (e.g. thermolabile glucoamylase), whereby the enzymatic composition is added to the wort after it has been boiled, such that the one or more glucoamylases are active during the fermentation step.
  • the enzymatic composition can be added to the boiled wort either before, simultaneously, or after the wort is pitched with the brewers' yeast.
  • the beer which may optionally be subjected to vacuum evaporation to produce a low-alcohol beer, is then pasteurized.
  • An Inherent advantage of this method lies in the duration of the fermentation process, which is about 6-15 days (depending on pitching rate, fermentation, temperature, etc), which allows more time for the enzymatic cleavage of non-fermentable sugars, as compared to the short mashing step (2-4 h duration).
  • a further advantage of this method lies in the amount of the enzymatic composition needed to achieve the desired decrease in non- fermentable sugars (and increase in fermentable sugars), which corresponds to a significantly lower number of units of enzymatic activity (e.g. units of glucoamylase activity) than would need to be added to the mash to achieve a similar decrease in non-fermentable sugars.
  • it removes the difficulties often seen during wort separation, especially by lautering, when high dose rates of glucoamylase are added in the mash.
  • the disclosure pertains to an enzymatic composition
  • an enzymatic composition comprising at least one additional enzyme selected among amylase, protease, pullulanase, isoamylase, cellulase, glucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, phytase and a further glucoamylase.
  • the disclosure pertains to an enzymatic composition, wherein the composition comprises at least one additional enzyme selected among a!pha-amylase and/or pullulanase.
  • the disclosure pertains to an enzymatic composition, wherein the composition further comprises alpha-amylase and pullulanase.
  • the disclosure pertains to an enzymatic composition, which enzymatic composition comprises less than 1, less than 0.8, less than 0.6, less than 0.5, less than 0.4, less than 0.2, less than 0.125, less than 0.1, less than 0.05, less than 0.01, or less than 0.005 XL) of xylanase activity per GAU of a glucoamylase variant as described herein.
  • xylanase activity may be reduced by different methods known to the skilled person such as e.g. heat treatment, passing through wheat bran, or other materials, which may selectively adsorb xylanase activity.
  • the disclosure pertains to an enzymatic composition, which enzymatic composition comprises less than 400, less than 200, less than 50, less than 20, or less than 2 XU of xylanase activity per gram of the composition.
  • the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.1-20, 0,1-10, 0.1-5 or 0.2-3 SSU of alpha-amylase activity per GAU of a glucoamylase variant as described herein.
  • the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.30-10, 1-8, 3-10 or 5-9 PU of pullulanase activity per GAU of a glucoamylase variant as described herein.
  • the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.95-20 SSU of alpha-amylase activity per GAU of a glucoamylase variant as described herein and between 0.30-10 PU of pullulanase activity per GAU of a glucoamylase variant as described herein.
  • the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.95 - 20 SSU of alpha-amylase activity per GAU of a glucoamylase variant as described herein and between 0.30 - 10 PU of pullulanase activity per GAU of a glucoamylase variant as described herein and less than 1, less than 0.8, less than 0.6, less than 0.5, less than 0.4, less than 0.2, less than 0.125, less than 0.1, ( ess than 0.05, less than 0.01, or less than 0.005 XU of xylanase activity per GAU of a glucoamylase variant as described herein.
  • the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.05-10, 0.1-10, 0.1-8, 0.1-5, 0.1 -3, 0.2-3, 0.2-2 PU of pullulanase activity per GAU of a glucoamylase variant as described herein.
  • the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.1-20, 1-15, 2-10, 3-10 SSU of alpha-amylase activity per GAU of a glucoamylase variant as described herein.
  • the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.05-10 PU of pullulanase activity per GAU of a
  • glucoamylase variant as described herein and between 0.1-20 SSU of alpha-amylase activity per GAU of a glucoamylase variant as described herein.
  • the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.1-5 PU of pullulanase activity per GAU of a glucoamylase variant as described herein and between 1-15 SSU of alpha-amylase activity per GAU of a glucoamylase variant as described herein.
  • the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.2-2 PU of pullulanase activity per GAU of a glucoamylase variant as described herein and between 2-10 SSU of alpha-amylase activity per GAU of a glucoamylase variant as described herein.
  • the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.05-10 PU of pullulanase activity per GAU of a
  • glucoamylase variant as described herein and between 0.1-20 SSU of alpha-amylase activity per GAU of a glucoamylase variant as described herein and less than 1, less than 0.8, less than 0.6, less than 0.5, less than 0.4, less than 0.2, less than 0.125, less than 0.1, less than 0.05, less than 0.01, or less than 0.005 XU of xylanase activity per GAU of a glucoamylase variant as described herein.
  • the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.1-5 PU of pullulanase activity per GAU of a glucoamylase variant as described herein and between 1-15 SSU of alpha-amylase activity per GAU of a glucoamylase variant as described herein and less than 1, less than 0.8, less than 0.6, less than 0.5, less than 0.4, less than 0.2, less than 0.125, less than 0.1, less than 0.05, less than 0.01, or less than 0.005 XU of xylanase activity per GAU of a glucoamylase variant as described herein.
  • the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.2-2 PU of pullulanase activity per GAU of a glucoamylase variant as described herein and between 2-10 SSU of alpha-amylase activity per GAU of a glucoamylase variant as described herein and less than 1, less than 0.8, less than 0.6, less than 0.5, less than 0.4, less than 0.2, less than 0.125, less than 0.1, less than 0.05, less than 0.01, or less than 0.005 XU of xylanase activity per GAU of a glucoamylase variant as described herein.
  • the glucoamylase variant as described herein is added in an amount of 500 - 20000 GAU/kg grist. In another aspect, the glucoamylase variant as described herein is added in an amount of 750 - 10000 GAU/kg grist. In a further aspect, the glucoamylase variant as described herein is added in an amount of 1000 - 7500 GAU/kg grist.
  • the present disclosure also provides an animal feed composition or formulation comprising at least one variant glucoamylase encompassed by the disclosure.
  • Methods of using a glucoamylase enzyme in the production of feeds comprising starch are provided in WO 03/049550 (herein incorporated by reference in its entirety). Briefly, the glucoamylase variant is admixed with a feed comprising starch.
  • the glucoamylase is capable of degrading resistant starch for use by the animal.
  • a glucoamylase variant as described herein is used in processes in the generation of fuels based on starch feed stocks. Other objects and advantages of the present disclosure are apparent from the present specification.
  • Embodiment 1 Use of a glucoamylase variant comprising two or more amino acid substitutions relative to interconnecting loop 2' with the amino acid sequence from position 518 to position 543 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase, and/or loop 1 with the amino acid sequence from position 21 to position 51 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or helix 2 with the amino acid sequence from position 52 to position 68 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase, and/or loop 11 with the amino acid sequence from position 396 to position 420 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase, and/or helix 12 with the amino acid sequence from position 421 to position 434 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase for reducing the synthesis of condensation products during hydrolysis of starch.
  • Embodiment 2 Use of a glucoamylase variant, which when in its crystal, form has a crystal structure for which the atomic coordinates of the main chain atoms have a root- mean-square deviation from the atomic coordinates of the equivalent main chain atoms of TrGA (as defined in Table 20 in WO2009/067218) of less than 0.13 nm following alignment of equivalent main chain atoms, and which have a linker region, a starch binding domain and a catalytic domain, said variant comprising two or more amino acid substitutions relative to the amino acid sequence of the parent glucoamylase in interconnecting loop 2' of the starch binding domain, and/or in loop 1, and/or in helix 2, and/or in loop 11, and/or in helix 12 of the catalytic domain for reducing the synthesis of condensation products during hydrolysis of starch.
  • TrGA as defined in Table 20 in WO2009/067218
  • Embodiment 3 The use of a glucoamylase variant according to any one of the embodiments 1-2, wherein said two or more amino acid substitutions are relative to the interconnecting loop 2' with the amino acid sequence from position 518 to position 543 of SEQ ID NO:2, and/or loop 1 with the amino acid sequence from position 21 to position 51 of SEQ ID NO:2, and/or helix 2 with the amino acid sequence from position 52 to position 68 of SEQ ID NO:2, and/or loop 11 with the amino acid sequence from position 396 to position 420 of SEQ ID NO:2, and/or helix 12 with the amino acid sequence from position 421 to position 434 of SEQ ID NO:2.
  • Embodiment 4 The use of a glucoamylase variant according to any one of the embodiments 1-3, wherein the two or more amino acid substitutions are at least one amino acid substitution in the Interconnecting loop 2' and at least one amino acid substitution in loop 1 and/or helix 2 and/or loop 11 and/or helix 12.
  • Embodiment 5 The use of a glucoamylase variant according to any one of the embodiments 1-4, wherein the two or more amino acid substitutions are 1, 2, 3 or 4 amino acid substitutions in the interconnecting loop 2' and 1, 2, 3 or 4 amino acid substitutions in loop 1 and/or helix 2 and/or loop 11 and/or helix 12.
  • Embodiment 6 The use of a glucoamylase variant according to any one of the embodiments 1-5, wherein the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in loop 1.
  • Embodiment 7 The use of a glucoamylase variant according to any one of the embodiments 1-6, wherein the two or more amino acid substitutions are at least one amino acid substitution In interconnecting loop 2' and at least one amino acid substitution in helix 2.
  • Embodiment 8 The use of a glucoamylase variant according to any one of the embodiments 1-7, wherein the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in loop 11.
  • Embodiment 9 The use of a glucoamylase variant according to any one of the embodiments 1-8, wherein the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in helix 12.
  • Embodiment 10 The use of a glucoamy!ase variant according to any one of the embodiments 1-9, wherein the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in loop 1 and at least one amino acid substitution in helix 2.
  • Embodiment 11 The use of a glucoamylase variant according to any one of embodiments 1- 10, wherein the glucoamylase variant has at least one amino acid substitution within position 520-543, 530-543, or 534-543 of interconnecting loop 2', the positions corresponding to the respective position in SEQ ID NO:2 or equivalent positions in a parent glucoamylase.
  • Embodiment 12 The use of a glucoamylase variant according to any one of embodiments 1-11, wherein the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 30-50, 35-48, or 40-46 of loop 1, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase.
  • Embodiment 13 The use of a glucoamylase variant according to any one of embodiments 1- 12, wherein the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 50-66, 55-64, or 58-63 of helix 2, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase.
  • Embodiment 14 The use of a glucoamylase variant according to any one of embodiments 1-13, wherein the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 405-420, 410-420, or 415-420 of loop 11, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase.
  • Embodiment 15 The use of a glucoamylase variant according to any one of embodiments 1- 14, wherein the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 421-434, 425-434, or 428-434 of helix 12, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase.
  • Embodiment 16 The use of a glucoamylase variant according to any one of embodiments 1-15, wherein the glucoamylase variant has at least 80%, 85%, 90%, 95%, 98%, or 99.5% sequence identity to the parent glucoamylase.
  • Embodiment 17 The use of a glucoamylase variant according to any one of embodiments 1-16, wherein the glucoamylase variant has at least 80%, 85%, 90%, 95%, 98%, or 99.5% sequence identity to SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9.
  • Embodiment 18 The use of a glucoamylase variant to any one of the embodiments
  • glucoamylase variant has a starch binding domain that has at least 96%, 97%, 98%, 99%, or 99.5% sequence identity with the starch binding domain of SEQ ID NO: 1, 2, 11, 385, 386, 387, 388, 389, or 390.
  • Embodiment 19 The use of a glucoamylase variant according to any one of the embodiments 1-18, wherein the glucoamylase variant has a catalytic domain that has at least 80%, 85%, 90%, 95%, or 99.5% sequence identity with the catalytic domain of SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9.
  • Embodiment 20 The use of a glucoamylase variant according to any one of embodiments 1-19, wherein the glucoamylase variant has at least 80%, 85%, 90%, 95%, 98%, or 99.5% sequence identity to SEQ ID NO: 2.
  • Embodiment 21 The use of a glucoamylase variant according to any one of embodiments 1-20, wherein the condensation product is isomaltose.
  • Embodiment 22 The use of a glucoamylase variant according to any one of embodiments 1-21, wherein the hydrolysis of starch is in a brewing process.
  • Embodiment 23 The use of a glucoamylase variant according to any one of embodiments 1-22, wherein the glucoamylase exhibit an enhanced production of fermentable sugar(s) as compared to the parent glucoamylase, such as TrGA.
  • Embodiment 24 The use of a glucoamylase variant according to any one of embodiments 1-23, wherein the glucoamylase exhibit an enhanced production of fermentable sugars in a mashing step of the brewing process as compared to the parent glucoamylase, such as TrGA.
  • Embodiment 25 The use of a glucoamylase variant according to any one of embodiments 1-24, wherein the glucoamylase exhibit an enhanced production of fermentable sugars in a fermentation step of the brewing process as compared to the parent
  • TrGA glucoamylase
  • Embodiment 26 The use of a glucoamylase variant according to any one of embodiments 1-25, wherein the fermentable sugar is glucose.
  • Embodiment 27 The use of a glucoamylase variant according to any one of embodiments 1-26, wherein the hydrolysis of starch is in a process for producing glucose syrup.
  • Embodiment 28 The use of a glucoamylase variant according to any one of embodiments 1-27, wherein the glucoamylase exhibit a reduced ratio between isomaltose synthesis (IS) and starch hydrolysis activity (SH) as compared to the parent glucoamylase, such as TrGA.
  • IS isomaltose synthesis
  • SH starch hydrolysis activity
  • Embodiment 29 The use of a glucoamylase variant according to any one of embodiments 1-28, wherein the glucoamylase exhibit a reduced starch hydrolysis activity, which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent glucoamylase, such as TrGA.
  • Embodiment 30 The use of a glucoamylase variant according to any one of embodiments 1-29, wherein the glucoamylase exhibit an enhanced real degree of fermentation as compared to the parent glucoamylase such as TrGA.
  • Embodiment 31 The use of a glucoamylase variant according to any one of embodiments 1-30, wherein the glucoamylase forms a lower amount of condensation products than the amount of condensation products formed by the glucoamylase Aspergillus niger (AnGA) (SEQ ID NO: 6) under comparable conditions.
  • AnGA glucoamylase Aspergillus niger
  • Embodiment 32 The use of a glucoamylase variant according to any one of embodiments 1-31, wherein the glucoamylase forms an amount of condensation products which amount is essentially the same as, not more than 5% higher, not more than 8% higher or not more than 10% higher than the amount of condensation products formed by
  • Aspergillus niger (AnGA) (SEQ ID NO: 6) under comparable conditions.
  • Embodiment 33 The use of a glucoamylase variant according to any one of embodiments 31-32, wherein dosing of the glucoamylases are the same based on protein concentration.
  • Embodiment 34 The use of a glucoamylase variant according to any one of embodiments 31-33, wherein dosing of the glucoamylases are the same based on measurement of activity in activity assays.
  • Embodiment 35 The use of a glucoamylase variant according to any one of embodiments 1-34, which glucoamylase variant has an amino acid substitution in position 539 and one or more amino acid substitutions in a position selected from position 44, 61, 417 and 431, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase.
  • Embodiment 36 The use of a glucoamylase variant according to any one of embodiments 1-35, which glucoamylase variant has an amino acid substitution in position 539 and a) an amino acid substitution In position 44 and/or b) amino acid substitutions in both positions 417 and 431, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase.
  • Embodiment 37 The use of a glucoamylase variant according to any one of embodiments 1-36, which glucoamylase variant has an amino acid substitution in position 539 and an amino acid substitution in position 44, the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
  • Embodiment 38 The use of a glucoamylase variant according to any one of embodiments 1-37, which glucoamylase variant has an amino acid substitution in position 539 and amino acid substitutions in positions 417 and 431, the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
  • Embodiment 39 The use of a glucoamylase variant according to any one of embodiments 1-38, which glucoamylase variant has an amino acid substitution in position 539 and amino a id substitutions In positions 44 and 61, the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
  • Embodiment 40 The use of a glucoamylase variant according to any one of embodiments 1-39, which glucoamylase variant has an amino acid substitution in position 43, the position corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase.
  • Embodiment 41 The use of a glucoamylase variant according to any one of embodiments 1-40, which glucoamylase variant has an amino acid substitution in position 61, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
  • Embodiment 42 The use of a glucoamylase variant according to any one of embodiments 1-41, wherein the amino acid substitution in position 539 is 539R, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
  • Embodiment 43 The use of a glucoamylase variant according to any one of embodiments 1-42, wherein the amino acid substitution in position 44 is 44R, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
  • Embodiment 44 The use of a glucoamylase variant according to any one of embodiments 1-43, wherein the amino acid substitution in position 417 is 417R/V, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
  • Embodiment 45 The use of a glucoamylase variant according to any one of embodiments 1-44, wherein the amino acid substitution in position 417 is 417R, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
  • Embodiment 46 The use of a glucoamylase variant according to any one of embodiments 1-45, wherein the amino acid substitution in position 417 is 417V, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
  • Embodiment 47 The use of a glucoamylase variant according to any one of embodiments 1-46, wherein the amino acid substitution in position 431 is 431L, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
  • Embodiment 48 The use of a glucoamylase variant according to any one of embodiments 1-47, wherein the amino acid substitution in position 43 is 43R, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
  • Embodiment 49 The use of a glucoamylase variant according to any one of embodiments 1-48, wherein the amino acid substitution in position 61 is 611, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
  • Embodiment 50 A glucoamylase variant as defined in any one of embodiments 1-
  • Embodiment 51 A glucoamylase variant comprising two or more amino acid substitutions, wherein an amino acid substitution Is in position 539 and an amino acid substitution is in position 44, the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase, and which sequence has at least 80% sequence identity to the parent glucoamylase, and wherein the amino acid substitution in position 44 is not 44C.
  • Embodiment 52 The glucoamylase variant according to embodiment 51 comprising two or more amino acid substitutions, wherein an amino acid substitution is in position 539 and an amino acid substitution is 44 , the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
  • Embodiment 53 The glucoamylase variant according to any one of embodiments
  • Embodiment 54 The glucoamylase variant according to any one of embodiments
  • glucoamylase variant has at least 85%, 90%, 95%, 98%, or 99.5% sequence identity to the parent glucoamylase.
  • Embodiment 55 The glucoamylase variant according to any one of embodiments
  • glucoamylase variant has at least 85%, 90%, 95%, 98%, or 99.5% sequence identity to SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9.
  • Embodiment 56 The glucoamylase variant according to any one of embodiments
  • glucoamylase variant has at least 85%, 90%, 95%, 98%, or 99.5% sequence identity to SEQ ID NO:2.
  • Embodiment 57 The glucoamylase variant according to any one of embodiments
  • amino acid substitution in position 539 is 539R, the position corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase.
  • Embodiment 58 The glucoamylase variant according to any one of embodiments
  • amino acid substitution in position 44 is 44R, the position corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase.
  • Embodiment 59 The glucoamylase variant according to any one of embodiments
  • amino acid substitution in position 61 is 611, the position corresponding to the respective position in SEQ ID NO:2 or an equivalent position In a parent glucoamylase.
  • Embodiment 60 The glucoamylase variant according to any one of embodiments
  • 51-59 comprising the following amino acid substitutions: a. D44R and A539R; or b. D44R, N61I and A539R, the positions corresponding to the respective position in SEQ ID IMO:2 or an equivalent position in a parent glucoamylase.
  • Embodiment 61 The glucoamylase variant according to any one of embodiments
  • 51-60 consisting of SEQ ID l ⁇ IO:2 and having the following amino acid substitutions: a. D44R and A539R; or b. D44R, N61I and A539R, the positions corresponding to the respective position in SEQ ID NO: 2.
  • Embodiment 62 The glucoamylase variant according to any one of embodiments
  • glucoamylase variant has a starch binding domain that has at least 96%, 97%, 98%, 99%, or 99.5% sequence identity with the starch binding domain of SEQ ID NO: 1, 2, 11, 385, 386, 387, 388, 389, or 390.
  • Embodiment 63 The glucoamylase variant according to any one of embodiments
  • glucoamylase variant has a catalytic domain that has at least 80%, 85%, 90%, 95%, or 99.5% sequence Identity with the catalytic domain of SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9.
  • Embodiment 64 The glucoamylase variant according to any one of embodiments
  • parent glucoamylase is selected from a glucoamylase obtained from a Trichoderma spp., an Aspergillus spp., a Humicola spp., a Penicillium spp., a Talaromyces spp., or a Schizosaccharmyces spp.
  • Embodiment 65 The glucoamylase variant according to any one of embodiments
  • parent glucoamylase is obtained from a Trichoderma spp. or an
  • Embodiment 66 The glucoamylase variant according to any one of embodiments
  • glucoamylase exhibit an enhanced production of fermentable sugar(s) as compared to the parent glucoamylase such as TrGA.
  • Embodiment 67 The glucoamylase variant according to any one of embodiments
  • glucoamylase 50-66 which glucoamylase exhibit an enhanced production of fermentable sugars in the mashing step of the brewing process as compared to the parent glucoamylase such as TrGA.
  • Embodiment 68 The glucoamylase variant according to any one of embodiments
  • glucoamylase exhibit an enhanced production of fermentable sugars in the fermentation step of the brewing process as compared to the parent glucoamylase such as TrGA.
  • Embodiment 69 The glucoamylase variant according to embodiment 68, wherein the fermentable sugar is glucose.
  • Embodiment 70 The glucoamylase variant according to any one of embodiments
  • glucoamylase exhibit a reduced ratio between isomaltose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase such as TrGA.
  • Embodiment 71 The glucoamylase variant according to any one of embodiments
  • glucoamylase exhibit a reduced starch hydrolysis activity which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent glucoamylase such as TrGA.
  • Embodiment 72 The glucoamylase variant according to any one of embodiments
  • glucoamylase 50-71 which glucoamylase exhibit an enhanced real degree of fermentation as compared to the parent glucoamylase such as TrGA.
  • Embodiment 73 The glucoamylase variant according to any one of embodiments
  • Embodiment 74 The glucoamylase variant according to any one of embodiments
  • glucoamylase forms an amount of condensation products which amount is essentially the same as, not more than 5%, not more than 8%, or not more than 10% higher than the amount of condensation products formed by Aspergillus niger (AnGA) (SEQ ID NO: 6) under the same conditions.
  • Embodiment 75 The glucoamylase variant according to any one of embodiments
  • Embodiment 76 The glucoamylase variant according to any one of embodiments
  • Embodiment 77 The glucoamylase variant according to any one of embodiments
  • Embodiment 78 A polynucleotide encoding a glucoamylase variant according to any of embodiments 50-77.
  • Embodiment 79 A vector comprising the polynucleotide according to embodiment
  • Embodiment 80 A host cell comprising a vector according to embodiment 79.
  • Embodiment 81 A host cell which has stably integrated into the chromosome a nucleic acid encoding the variant glucoamylase according to any of embodiments 50-80.
  • Embodiment 82 A cell capable of expressing a glucoamylase variant according to any one of embodiments 50-76.
  • Embodiment 83 The host cell according to any one of embodiments 78-81, or the cell according to embodiment 81, which is a bacterial, fungal or yeast cell.
  • Embodiment 84 The host cell according to embodiment 83, which Is Trichoderma spp. such as Trichoderma reesei.
  • Embodiment 85 The host eel! according to any one of embodiments 83-84, which is a protease deficient and/or xylanase deficient and/or native glucanase deficient host cell.
  • Embodiment 86 A method of expressing a giucoamylase variant, the method comprising obtaining a host cell or a cell according to any one of embodiments 80-85 and expressing the giucoamylase variant from the cell or host cell, and optionally purifying the giucoamylase variant.
  • Embodiment 87 The method according to embodiment 86 comprising purifying the giucoamylase variant.
  • Embodiment 88 Use of a giucoamylase variant according to any one of embodiments 50-76 for the preparation of an enzymatic composition.
  • Embodiment 89 An enzymatic composition comprising at least one giucoamylase variant according to any one of embodiments 50-77.
  • Embodiment 90 The enzymatic composition according to embodiment 89 comprising at least one giucoamylase variant according to any one of embodiments 50-77, wherein the composition is selected from among a starch hydrolyzing composition, a saccharifying composition, a detergent, an alcohol fermentation enzymatic composition, and an animal feed.
  • Embodiment 91 The enzymatic composition according to embodiment 90, which is a starch hydrolyzing composition.
  • Embodiment 92 The enzymatic composition according to any one of embodiments
  • 89-91 comprising at least one additional enzyme selected among amylase, protease, pullulanase, celiulase, glucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, and a further giucoamylase.
  • additional enzyme selected among amylase, protease, pullulanase, celiulase, glucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, and a further giucoamylase.
  • Embodiment 93 The enzymatic composition according to embodiment 89-92, wherein the at least one additional enzyme is selected among amylase, pullulanase, and a further giucoamylase.
  • Embodiment 94 The enzymatic composition according to embodiment 89-93, wherein the at least one additional is selected among amylase and pullulanase.
  • Embodiment 95 The enzymatic composition according to any one of embodiments
  • amylase Is selected among alpha-amylase, and isoamylase.
  • Embodiment 96 A method for converting starch or partially hydrolyzed starch into a syrup containing glucose, said process including saccharifying a liquid starch solution in the presence of at least one glucoamylase variant according to any one of embodiments 50-77 or an enzymatic composition according to any one of embodiments 89-95.
  • Embodiment 97 The method according to embodiment 96 of saccharifying a liquid starch solution, which comprises an enzymatic saccharification step using a glucoamylase variant according to embodiment 50-77 or an enzymatic composition according to any one of embodiments 89-95.
  • Embodiment 98 The method according to any one of embodiments 96-97, further comprising contacting the liquid starch solution with at least one additional enzyme.
  • Embodiment 99 The method according to embodiment 98, wherein the additional enzyme is selected among amylase, protease, pullulanase, cellulase, glucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, and glucoamylase.
  • the additional enzyme is selected among amylase, protease, pullulanase, cellulase, glucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, and glucoamylase.
  • Embodiment 100 The method according to embodiment 96-99, wherein the additional enzyme is amylase and pullulanase.
  • Embodiment 101 The method according to embodiment any one of embodiments
  • amylase is selected among alpha-amylase, and isoamylase.
  • Embodiment 102 Use of a glucoamylase variant according to any one of embodiments 50-77 in a starch conversion process, such as a in a continuous starch conversion process.
  • Embodiment 103 Use of a glucoamylase variant according to any one of embodiments 50-77 in a process for producing oligosaccharides, maltodextrins, or glucose syrups.
  • Embodiment 104 Use of a glucoamylase variant according to any one of
  • Embodiment 105 A method for producing a wort for brewing comprising forming a mash from a grist, and contacting the mash with a glucoamylase variant according to any one of embodiments 50-77 or an enzymatic composition according to any one of
  • Embodiment 106 The method of embodiment 105, further comprising contacting the mash with one or more additional enzyme(s)
  • Embodiment 107 The method according to embodiment 106, wherein the one or more enzyme(s) is selected among amylase, protease, puliulanase, cellulase, endoglucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, and glucoamylase.
  • the one or more enzyme(s) is selected among amylase, protease, puliulanase, cellulase, endoglucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, and glucoamylase.
  • Embodiment 108 The method according to embodiment 107, wherein the one or more enzyme(s) is amylase and/or puliulanase.
  • Embodiment 109 The method according to embodiment any one of embodiments
  • amylase is alpha-amylase and/or isoamylase.
  • Embodiment 110 The method according to any one of embodiments 105-109, wherein the grist comprises one ore more of malted grain, unmalted grain, adjunct, and any combination thereof.
  • Embodiment 111 The method of any one of embodiments 105-110, further comprising fermenting the wort to obtain a fermented beverage.
  • Embodiment 112. The method of any one of embodiments 105-111, further comprising fermenting the wort to obtain a beer.
  • Embodiment 113 A method for production of a beer which comprises: a. preparing a mash, b. filtering the mash to obtain a wort, and c. fermenting the wort to obtain a beer, wherein a glucoamylase variant according to any one of embodiments 50-77 is added to: step (a) and/or step (b) and/or step (c).
  • Embodiment 114 The method of embodiment 113, wherein the beer is subjected to a pasteurization step.
  • Embodiment 115 Use of a glucoamylase variant according to any one of embodiments 50-77 to enhance the production of fermentable sugars in either the mashing step or the fermentation step of a brewing process.
  • Embodiment 116 A beer, wherein the beer is produced by the steps of: a. preparing a mash, b. filtering the mash to obtain a wort, c. fermenting the wort to obtain a beer, and d. pasteurizing the beer, wherein a glucoamylase variant according to any one of embodiments 50-77 is added to: step (a) and/or step (b) and/or step (c).
  • Embodiment 117 The beer of embodiment 116, wherein the pasteurized beer is further characterized as being: a. essentially without glucoamylase activity; and/or b. a low-calorie beer and/or a low-alcohoi beer.
  • Embodiment 118 Use of a glucoamylase variant according to any one of embodiments 50-77 in an alcohol fermentation process.
  • Embodiment 119 A screening method for identification of a glucoamylase variant having a reduced ratio between isomaitose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase.
  • Embodiment 120 A screening method for identification of a glucoamylase variant having the same or increased starch hydrolysis activity and reduced isomaitose synthesis, which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent glucoamylase and having a reduced ratio between isomaitose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase.
  • IS/SH ratio isomaitose synthesis and starch hydrolysis activity
  • a screening method for identification of a glucoamylase variant having a reduced synthesis of condensation products during hydrolysis of starch comprising the steps of measuring the isomaltose synthesis and starch hydrolysis activity of glucoamylase variants and selecting the variants having a reduced starch hydrolysis activity which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent glucoamylase and having a reduced ratio between isomaltose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase.
  • IS/SH ratio isomaltose synthesis and starch hydrolysis activity
  • Embodiment 122 The glucoamylase variant obtained by the method according to any one of embodiments 119-121.
  • a glucoamylase variant comprising the following amino acid substitutions: a. 44R and 539R; or b. 44R, 611 and 539R, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase, wherein the glucoamylase variant has at least 80% sequence identity with SEQ ID NO: 1 or 2, or the parent glucoamylase.
  • glucoamylase variant according to further embodiment 1 comprising the following amino acid substitutions: a. D44R and A539R; or b. D44R, N61I and A539R, the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase, wherein the glucoamylase variant has at least 80% sequence identity with SEQ ID NO: 1 or 2, or the parent glucoamylase.
  • glucoamylase variant according to any one of further embodiments 1-2 comprising the following amino acid substitutions: a. D44R, N61I and A539R, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase, wherein the glucoamylase variant has at least 80% sequence identity with SEQ ID NO: 1 or 2, or the parent glucoamylase.
  • glucoamylase variant according to any one of further embodiments 1-2 comprising the following amino acid substitutions: a. D44 and A539R, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase, wherein the glucoamylase variant has at least 80% sequence identity with SEQ ID NO: 1 or 2, or the parent glucoamylase.
  • glucoamylase variant of further embodiment 5 wherein the glucoamylase variant has at least 95% sequence identity with SEQ ID NO: 1 or 2.
  • glucoamylase variant of further embodiment 6, wherein the glucoamylase variant has at least 99.5% sequence identity with SEQ ID NO: 1 or 2.
  • glucoamylase variant according to any one of further embodiments 1-9, wherein the glucoamylase variant has a starch binding domain that has at least 96%, 97%, 98%, 99%, or 99.5% sequence identity with the starch binding domain of SEQ ID NO: 1, 2, 11, 385, 386, 387, 388, 389, or 390.
  • glucoamylase variant according to any one of further embodiments 1-10, wherein the glucoamylase variant has a catalytic domain that has at least 80%, 85%, 90%, 95%, or 99.5% sequence identity with the catalytic domain of SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9. Further embodiment 12.
  • glucoamylase variant according to any one of further embodiments 1-11, wherein the parent glucoamylase is selected from a glucoamylase obtained from a Trichoderma spp., an Aspergillus spp., a Humicola spp., a Penicillium spp., a Talaromyces spp., or a Schizosaccharmyces spp.
  • glucoamylase variant according to any one of further embodiments 1-12, wherein the parent glucoamylase is obtained from a Trichoderma spp. or an Aspergillus spp.
  • glucoamylase variant according to any one of further embodiments 1-13, which glucoamylase exhibit an enhanced production of fermentable sugar(s) as compared to the parent glucoamylase.
  • glucoamylase variant according to any one of further embodiments 1-15, which glucoamylase exhibit an enhanced production of fermentable sugars in the fermentation step of the brewing process as compared to the parent glucoamylase.
  • glucoamylase variant according to further embodiment 16 wherein the fermentable sugar is glucose.
  • glucoamylase variant according to any one of further embodiments 1-17, which glucoamylase exhibit a reduced ratio between isomaltose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase.
  • glucoamylase variant according to any one of further embodiments 1-18 which glucoamylase exhibit a reduced starch hydrolysis activity which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent glucoamylase.
  • glucoamylase variant according to any one of further embodiments 1-19, which glucoamylase exhibit an enhanced real degree of fermentation as compared to the parent glucoamylase.
  • Further embodiment 21 The glucoamylase variant according to any one of further embodiments 1-20, which glucoamylase forms a lower amount of condensation products than the amount of condensation products formed by Aspergillus niger (AnGA) (SEQ ID NO: 6) under the same conditions.
  • glucoamylase variant according to any one of further embodiments 1-21, which glucoamylase forms an amount of condensation products which amount is essentially the same as, not more than 5%, not more than 8%, or not more than 10% higher than the amount of condensation products formed by Aspergillus niger (AnGA) (SEQ ID NO: 6) under the same conditions.
  • glucoamylase variant according to any one of further embodiments 18-21, wherein the dosing of the glucoamylases are the same based on protein concentration.
  • glucoamylase variant according to any one of further embodiments 18-23, wherein the dosing of the glucoamylases are the same based on measurement of activity in activity assays.
  • a vector comprising the polynucleotide according to further embodiment 26, or capable of expressing a glucoamylase variant according to any of further embodiments 1-25.
  • a host cell comprising a vector according to further embodiment 27.
  • a host cell which has stably Integrated into the chromosome a nucleic acid encoding the variant glucoamylase according to any of further embodiments 1- 25.
  • FIG. 30 A cell capable of expressing a glucoamylase variant according to any one of further embodiments 1-25.
  • Further embodiment 31 The host cell according to any one of further embodiments 28-29, or the cell according to further embodiment 30, which is a bacterial, fungal or yeast cell.
  • the host cell according to any one of further embodiments 28-29 and 31-32 which is a protease deficient and/or xylanase deficient and/or glucanase deficient host cell.
  • a method of expressing a glucoamylase variant comprising obtaining a host cell or a cell according to any one of further embodiments 28-33 and expressing the glucoamylase variant from the cell or host cell, and optionally purifying the glucoamylase variant.
  • An enzymatic composition comprising at least one glucoamylase variant according to any one of embodiments 1-25, said enzyme composition comprising one or more further enzymes.
  • compositions comprising at least one glucoamylase variant according to any one of further embodiments 1-25, wherein the composition is selected from among a starch hydrolyzing composition, a saccharifying composition, a detergent composition, an alcohol fermentation enzymatic composition, and an animal feed composition.
  • An enzymatic composition according to any one of further embodiments 36-39 comprising at least one additional enzyme selected among amylase, protease, pullulanase, isoamylase, cellulase, glucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, phytase and a further glucoamylase.
  • composition according to any one of further embodiments 36-41, wherein the composition comprises alpha-amylase and pullulanase.
  • the enzymatic composition according to any one of further embodiments 36-42 which enzymatic composition comprises less than 1, less than 0.8, less than 0.6, less than 0.5, less than 0.4, less than 0.2, less than 0.125, less than 0.1, less than 0.05, less than 0.01, or less than 0.005 XU of xylanase activity per GAL ) of a glucoamylase variant according to any one of further embodiments 1-25.
  • enzymatic composition according to any one of further embodiments 36-43, which enzymatic composition comprises less than 400, less than 200, less than 50, less than 20, or less than 2 XU of xylanase activity per gram of the composition,
  • enzymatic composition according to any one of further embodiments 36-44, which enzymatic composition comprises between 0.1 - 20, 1-15, 2-10, or 3-10 SSU of alpha-amylase activity per GAU of a glucoamylase variant according to any one of further embodiments 1-25.
  • enzymatic composition according to any one of further embodiments 36-45, which enzymatic composition comprises between 0.05 - 10, 0.1 - 10, 0.1-8, 0.1-5, 0.1 -3, 0.2-3, or 0.2-2 PU of pullulanase activity per GAU of a glucoamylase variant according to any one of further embodiments 1-25.
  • the enzymatic composition according to any one of further embodiments 36-46 which enzymatic composition comprises between 0.05 - 10 PU of pullulanase activity per GAU of a glucoamylase variant according to any one of further embodiments l ⁇ 25and between 0.1 - 20 SSU of alpha-amylase activity per GAU of a glucoamylase variant according to any one of further embodiments 1-25.
  • the enzymatic composition according to any one of further embodiments 36-47 which enzymatic composition comprises between 0.05 - 10 PU of pullulanase activity per GAU of a glucoamylase variant according to any one of further embodiments l-25and between 0.1 - 20 SSU of alpha-amylase activity per GAU of a glucoamylase variant according to any one of further embodiments 1-25 and less than 1, less than 0.8, less than 0.6, less than 0.5, less than 0.4, less than 0,2, less than 0.125, less than 0.1, less than 0.05, less than 0.01, or less than 0.005 XU of xylanase activity per GAU of a glucoamy!ase according to any one of further embodiments 1-25.
  • a method for producing a wort for brewing comprising forming a mash from a grist, and contacting the mash with a glucoamylase variant according to any one of further embodiments 1-25 or an enzymatic composition according to any one of further embodiments 36-48.
  • Further embodiment 51 The method according to further embodiment 50, wherein the one or more enzyme(s) is selected among amylase, protease, pullulanase, isoamylase, cellulase, endoglucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, phytase and glucoamylase.
  • the one or more enzyme(s) is selected among amylase, protease, pullulanase, isoamylase, cellulase, endoglucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, phytase and glucoamylase.
  • Further embodiment 54 The method of any one of further embodiments 49-53, further comprising fermenting the wort to obtain a fermented beverage.
  • Further embodiment 55 The method of any one of further embodiments 49-54, further comprising fermenting the wort to obtain a beer.
  • a method for production of a beer which comprises: a. preparing a mash, b. filtering the mash to obtain a wort, and c. fermenting the wort to obtain a beer, wherein a glucoamylase variant according to any one of further embodiments 1-25 or an enzymatic composition according to any one of further embodiments 36-48 is added to: step (a) and/or step (b) and/or step (c).
  • embodiments 36-48 to enhance the production of fermentable sugars in either the mashing step or the fermentation step of a brewing process.
  • a beer wherein the beer is produced by the steps of: a. preparing a mash, b. filtering the mash to obtain a wort, c. fermenting the wort to obtain a beer, and d. pasteurizing the beer, e. wherein a glucoamylase variant according to any one of further embodiments 1- 25 or an enzymatic composition according to any one of further embodiments 36- 48 is added to: step (a) and/or step (b) and/or step (c).
  • the beer of further embodiment 59, wherein the pasteurized beer is further characterized as being: a. essentially without glucoamylase activity; and/or b. a low-calorie beer and/or a low-alcohol beer.
  • AII2-13 TGCGGTGATTGCATCTCCCAGCACACTTGACCCGGACTAC 725
  • AII2-88 CCCAATCCACAGGGGGTGGTTATCTCTATAGTTGACGGCG 733
  • AII3-70 CAAGAACGAGGCGTACGACCACGTCAGGTGAACCGCAGAC 739
  • AII3-88 j CCCAATCCACAGGGGGTGGTTATCTCTATAGTTGACGGCG 744
  • AII4-13 j TGCGGTGATTGCATCTCCCAGCACACTTGACCCGGACTAC 745

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Food Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Polymers & Plastics (AREA)
  • Nutrition Science (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Emergency Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention relates to combinatorial variants of a parent glucoamylase that have altered properties for reducing the synthesis of condensation products during hydrolysis of starch. Accordingly the variants of a parent glucoamylase are suitable such as for use within brewing and glucose syrup production. Also disclosed are DMA constructs encoding the variants and methods of producing the glucoamylase variants in host cells.

Description

VARIANTS OF GLUCOAMYLASE
FIELD OF THE INVENTION
Disclosed are combinatorial variants of a parent g!ucoamylase that have altered properties and are suitable such as for use within brewing and glucose syrup production. Also disclosed are DNA constructs encoding the variants and methods of producing the glucoamylase variants in host cells.
BACKGROUND OF THE INVENTION
Glucoamylase enzymes (glucan 1, 4-a-glucohydrolases, EC 3.2.1.3) are starch hydrolyzing exo-acting carbohydrases, which catalyze the removal of successive glucose units from the non-reducing ends of starch or related oligo and polysaccharide molecules. Glucoamylases can hydrolyze both the linear and branched glucosidic linkages of starch {e.g. , amylose and amylopectin).
Glucoamylases are produced by numerous strains of bacteria, fungi, yeast and plants.
Particularly interesting, and commercially important, glucoamylases are fungal enzymes that are extracellularly produced, for example from strains of Aspergillus (Svensson et al.,
Carlsberg Res. Commun. 48: 529-544 (1983); Boel et al., EMBO J. 3: 1097-1102 (1984);
Hayashida et al., Agric. Biol. Chem. 53 : 923-929 (1989); U.S. Patent No. 5,024,941; U.S.
Patent No. 4,794,175 and WO 88/09795); Talaromyces (U.S. Patent No. 4,247,637; U.S.
Patent No. 6,255,084; and U.S. Patent No. 6,620,924); Rhizopus (Ashikari et al., Agric. Biol. Chem. 50: 957-964 (1986); Ashikari et al., App. Microbio. Biotech. 32: 129-133 (1989) and
U.S. Patent No. 4,863,864); Humicola (WO 05/052148 and U.S. Patent No. 4,618,579); and
Mucor (Houghton-Larsen et al., Appl. Microbiol. Biotechnol. 62 : 210-217 (2003)). Many of the genes that code for these enzymes have been cloned and expressed in yeast, fungal and/or bacterial cells. Commercially, glucoamylases are very important enzymes and have been used in a wide variety of applications that require the hydrolysis of starch (e.g., for producing glucose and other monosaccharides from starch). Glucoamylases are used to produce high fructose corn sweeteners, which comprise over 50% of the sweetener market in the United States. In general, glucoamylases may be, and commonly are, used with alpha-amylases in starch hydrolyzing processes to hydrolyze starch to dextrins and then glucose. The glucose may then be converted to fructose by other enzymes (e.g., glucose isomerases); crystallized; or used in fermentations to produce numerous end products (e.g., ethanol, citric acid, lactic acid, succinate, ascorbic acid intermediates, glutamic acid, glycerol and 1, 3-propanediol). Ethanol produced by using glucoamylases in the fermentation of starch and/or cellulose containing material may be used as a source of fuel or for alcoholic consumption.
At the high solids concentrations used commercially for high glucose corn syrup (HGCS) and high fructose corn syrup (HFCS) production, glucoamylase synthesizes di-, tri- , and tetra- saccharides from glucose by condensation reactions. This occurs because of the slow hydrolysis of alpha-(l-6)-D-glucosidlc bonds in starch and the formation of various accumulating condensation products, mainly isomaltose, from D-glucose. Accordingly, the glucose yield in many conventional processes does not exceed 95% of theoretical yield. The amount of syrups produced worldwide by this process is very large and even very small increases in the glucose yield pr ton of starch are commercially important.
Glucoamylase is used in brewing mainly for production of low carb beer. In combination with other amylases (such as from the malt), glucoamylase gives a very extensive hydrolysis of starch, all the way down to glucose units. Glucose is readily converted to alcohol by yeast making it possible for the breweries to obtain a very high alcohol yield from fermentation and at the same time obtain a beer, which is very low in residual carbohydrate. The ferment is diluted down to the desired alcohol % with water, and the final beer is sold as "low carb".
Although glucoamylases have been used successfully in commercial applications for many years, a need still exists for new glucoamylases with altered properties, such as an improved specific activity, a reduced formation of condensation products such as isomaltose and increased thermostability.
Citation or identification of any document in this application is not an admission that such document Is available as prior art to the present invention.
SUMMARY OF THE INVENTION
The glucoamylase variants and the use of glucoamylase variants for reducing the synthesis of condensation products during hydrolysis of starch are contemplated herein. These glucoamylase variants contain amino acid substitutions within the catalytic domains and/or the starch binding domain. The variants display altered properties, such as an altered specific activity, a reduced formation of condensation products such as isomaltose and/or altered thermostability.
In one aspect, a glucoamylase variant is described herein comprising the following amino acid substitutions: a) 44R and 539R; or b) 44R, 611 and 539R, the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase, wherein the glucoamylase variant has at least 80% sequence identity with SEQ ID NO: 1 or 2, or the parent glucoamylase. In a further aspect, the use is described of a glucoamylase variant for the preparation of an enzymatic composition. In a further aspect, the enzymatic composition comprises at least one additional enzyme selected among amylase, protease, pullulanase, isoamylase, ceilulase, glucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, phytase and a further glucoamylase such as for example an pullulanase and a alpha-amylase.
In a further aspect, the use is described herein of a glucoamylase variant with a starch binding domain and a catalytic domain, said variant comprising two or more amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 2 or equivalent parent glucoamylase in interconnecting loop 2',and/or in loop 1, and/or in helix 2, and/or In loop 11, and/or in helix 12 for reducing the synthesis of condensation products during hydrolysis of starch.
In a further aspect, the use is described of a glucoamylase variant comprising two or more amino acid substitutions relative to interconnecting loop 2' with the amino acid sequence from position 518 to position 543 of SEQ ID NO:2 or equivalent sequence of residues In a parent glucoamylase, and/or loop 1 with the amino acid sequence from position 21 to position 51 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or helix 2 with the amino acid sequence from position 52 to position 68 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or loop 11 with the amino acid sequence from position 396 to position 420 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase, and/or helix 12 with the amino acid sequence from position 421 to position 434 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase for reducing the synthesis of condensation products during hydrolysis of starch.
In a further aspect, the use is described of a glucoamylase variant comprising two or more amino acid substitutions relative to the amino acid sequence from position 518 to position 543 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 21 to position 51 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 52 to position 68 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 396 to position 420 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 421 to position 434 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase for reducing the synthesis of condensation products during hydrolysis of starch.
In a further aspect, the use is described of a glucoamylase variant wherein said two or more amino acid substitutions are relative to the interconnecting loop 2' with the amino acid sequence from position 518 to position 543 of SEQ ID NO:2, and/or loop 1 with the amino acid sequence from position 21 to position 51 of SEQ ID NO: 2, and/or helix 2 with the amino acid sequence from position 52 to position 68 of SEQ ID NO:2, and/or loop 11 with the amino acid sequence from position 396 to position 420 of SEQ ID NO: 2, and/or helix 12 with the amino acid sequence from position 421 to position 434 of SEQ ID NO: 2.
In a further aspect, the use of a glucoamylase variant which when in its crystal form has a crystal structure for which the atomic coordinates of the main chain atoms have a root-mean- square deviation from the atomic coordinates of the equivalent main chain atoms of TrGA (as defined in Table 20 in WO2009/067218) of less than 0.13 nm following alignment of equivalent main chain atoms, and which have a linker region, a starch binding domain and a catalytic domain, said variant comprising two or more amino acid substitutions relative to the amino acid sequence of the parent glucoamylase in interconnecting loop 2' of the starch binding domain, and/or in loop 1, and/or in helix 2, and/or in loop 11, and/or in helix 12 of the catalytic domain for reducing the synthesis of condensation products during hydrolysis of starch.
In one aspect, the glucoamylase variant comprises two or more amino acid substitutions, wherein an amino acid substitution is in position 539 and an amino acid substitution is in position 44, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase, and which sequence has at least 80% sequence identity to the parent glucoamylase, and wherein the amino acid substitution in position 44 is not 44C.
The present disclosure further relates to a polynucleotide encoding a glucoamylase variant as described herein. One aspect, is a plasmid comprising a nucleic acid. Another aspect, is a vector comprising a polynucleotide as described, or capable of expressing a glucoamylase variant as described. Another aspect. Is a host cell comprising, e.g. transformed with, a plasmid or a vector as described. Another aspect, is a host cell, which has stably integrated into the chromosome a nucleic acid sequence encoding the variant glucoamylase. Another aspect is a cell capable of expressing a glucoamylase variant as described. Another aspect is a method of expressing a glucoamylase variant, the method comprising obtaining a host cell or a cell and expressing the glucoamylase variant from the cell or host cell, and optionally purifying the glucoamylase variant.
A further aspect of the disclosure is an enzymatic composition comprising at least one glucoamylase variant as described herein, and the use thereof.
A further aspect of the disclosure is a method for converting starch or partially hydrolyzed starch into a syrup containing glucose, which process includes saccharifying a liquid starch solution in the presence of at least one glucoamylase variant or an enzymatic composition as described herein.
A further aspect of the disclosure is the use of a glucoamylase variant as described herein in a starch conversion process, such as in a continuous starch conversion process, in a process for producing oligosaccharides, maltodextrins or glucose syrups and in a process for producing high fructose corn syrup.
In a further aspect, the use of a glucoamylase variant as described herein in a alchohol fermentation process is provided.
A further aspect of the disclosure is a method for producing a wort for brewing comprising forming a mash from a grist, and contacting the mash with a glucoamylase variant as described or an enzymatic composition as described.
Yet a further aspect of the disclosure is a method for production of a beer which comprises: a) preparing a mash, b) filtering the mash to obtain a wort, and fermenting the wort to obtain a beer, wherein a glucoamylase variant as described is added to: step (a) and/or step (b) and/or step (c).
Yet a further aspect of the disclosure is the use of a glucoamylase variant as described to enhance the production of fermentable sugars in either the mashing step or the fermentation step of a brewing process.
Yet a further aspect of the disclosure is a beer, wherein the beer is produced by the steps of: a) preparing a mash, b) filtering the mash to obtain a wort, c) fermenting the wort to obtain a beer, and d) pasteurizing the beer, wherein a glucoamylase variant as described is added to: step (a) and/or step (b) and/or step (c). Accordingly, it is an object of the invention to not encompass within the invention any previously known product, process of making the product, or method of using the product such that Applicants reserve the right and hereby disclose a disclaimer of any previously known product, process, or method. It is further noted that the invention does not intend to encompass within the scope of the invention any product, process, or making of the product or method of using the product, which does not meet the written description and enablement requirements of the USPTO (35 U.S.C. § 112, first paragraph) or the EPO (Article 83 of the EPC), such that Applicants reserve the right and hereby disclose a disclaimer of any previously described product, process of making the product, or method of using the product,
It is noted that in this disclosure and particularly in the claims and/or embodiments, terms such as "comprises", "comprised", "comprising" and the like can have the meaning attributed to it in U .S. Patent law; e.g ., they can mean "includes", "included", "including", and the like; and that terms such as "consisting essentially of" and "consists essentially of" have the meaning ascribed to them in U .S. Patent law, e.g ., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention.
These and other embodiments are disclosed or are obvious from and encompassed by, the following Detailed Description.
BRIEF DESCRIPTION OF THE DRAWINGS
The following detailed description, given by way of example, but not intended to limit the invention solely to the specific embodiments described, may best be understood in conjunction with the accompanying drawings, in which :
FIG. 1A depicts a Trichoderma reesei glucoamylase (TrGA) having 632 amino acids (SEQ ID NO : 1) . The signal peptide is underlined, the catalytic region (SEQ ID NO: 3) starting with amino acid residues SVDDFI (SEQ ID NO: 12) and having 453 amino acid residues is In bold; the linker region is in italics and the starch binding domain (SBD) is both italics and underlined. The mature protein of TrGA (SEQ ID NO: 2) includes the catalytic domain (SEQ ID NO : 3), linker region (SEQ ID NO: 10), and starch binding domain (SEQ ID NO : 11). With respect to the SBD numbering of the TrGA glucoamylase molecule, reference is made in the present disclosure to either a) positions 491 to 599 in SEQ ID NO: 2 of the mature TrGA, and/or b) positions 1 to 109 in SEQ ID NO: 11, which represents the isolated SBD sequence of the mature TrGA. With respect to the catalytic domain numbering of the TrGA molecule, reference is made to SEQ ID NO: 2 and/or SEQ ID NO: 3. FIG. IB depicts the cDNA (SEQ ID NO:4) that codes for the TrGA. FIG. 1C depicts the precursor and mature protein TrGA domains.
FIG. 2 depicts the destination plasmid pDONR-TrGA which includes the cDNA (SEQ ID NO: 4) of the TrGA.
FIG. 3 depicts the plasmid pTTT-Dest.
FIG. 4 depicts the final expression vector pTTT-TrGA.
FIGs. 5A and 5B depict an alignment comparison of the catalytic domains of parent glucoamyiases from Aspergillus awamori (AaGA) (SEQ ID NO: 5); Aspergillus niger (AnGA) (SEQ ID NO: 6); Aspergillus oryzae (AoGA) (SEQ ID NO: 7); Trichoderma reesei (TrGA) (SEQ ID NO: 3); Humico/a grisea (HgGA) (SEQ ID NO: 8); and Hypocrea vinosa (HvGA) (SEQ ID NO: 9). Identical amino acids are indicated by an asterisk (*). FIG. 5C depicts a
Talaromyces glucoamylase (TeGA) mature protein sequence (SEQ ID NO: 384). FIGs 5D and 5E depict an alignment comparing the Starch Binding Domain (SBD) of parent glucoamyiases from Trichoderma reesei (SEQ ID NO : 11); Humicola grisea (HgGA) (SEQ ID NO: 385); Thermomyces lanuginosus (ThGA) (SEQ ID NO: 386); Talaromyces emersonii (TeGA) (SEQ ID NO: 387); Aspergillus niger (AnGA) (SEQ ID NO: 388); Aspergillus awamori (AaGA) (SEQ ID NO: 389); and Thielavia terrestris (TtGA) (SEQ ID NO: 390).
FIG. 6 depicts a comparison of the three dimensional structure of Trichoderma reesei glucoamylase (black) (SEQ ID NO: 2) and Aspergillus awamori glucoamylase (grey) (SEQ ID NO: 5) viewed from the side. The side is measured in reference to the active site and the active site entrance is at the "top" of the molecule.
FIG. 7 depicts a comparison of the three dimensional structures of Trichoderma reesei glucoamylase (black) (SEQ ID NO: 2) and Aspergillus awamori glucoamylase (grey) (SEQ ID NO: 5) viewed from the top.
FIG. 8 depicts an alignment of the three dimensional structures of TrGA (SEQ ID NO: 2) and AnGA (SEQ ID NO: 6) viewed from the side showing binding sites 1 and 2.
FIG. 9 depicts a model of the binding of acarbose to the TrGA crystal structure.
Fig. 10 depicts a TLC plate with standards containing different concentrations of glucose, maltose and isomaltose and samples containing reaction products from glucose incubated with TrGA and AnGA. DETAILED DISCLOSURE OF THE INVENTION
Glucoamylases are commercially important enzymes in a wide variety of applications that require the hydrolysis of starch. The applicants have found that by introducing certain alterations In positions within specific regions of the amino acid sequence of a parent glucoamylase the rate of forming alpha-(l-6) bonds is reduced, and/or the formation of condensation products such as isomaltose is reduced. A reduction of the rate that glucoamylase forms alpha-(l-6) bonds relative to the rate it cleaves alpha-( l-4) bonds has practical implications.
The present inventors have provided a number of variants of a parent glucoamylase, which variants in some embodiments show a reduced condensation and/or a reduced ratio between isomaltose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase. In some embodiments using a glucoamylase variant as described herein in a saccharification process produces a syrup with high glucose percentage. In some
embodiments using a glucoamylase variant as described herein results in an enhanced production of fermentable sugars in a mashing and/or fermentation step of a brewing step. In some embodiments using a glucoamylase variant as described herein results in an enhanced real degree of fermentation. These altered properties are obtained by mutating e.g.
substituting selected positions in a parent glucoamylase. This will be described in more detail below.
Accordingly, in a further aspect, the use is described of a glucoamylase variant comprising two or more amino acid substitutions relative to interconnecting loop 2' with the amino acid sequence from position 518 to position 543 of SEQ ID NO : 2 or equivalent sequence of residues in a parent glucoamylase, and/or loop 1 with the amino acid sequence from position 21 to position 51 of SEQ ID NO:2 or equivalent sequence of residues in a parent
glucoamylase, and/or helix 2 with the amino acid sequence from position 52 to position 68 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or loop 11 with the amino acid sequence from position 396 to position 420 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase, and/or helix 12 with the amino acid sequence from position 421 to position 434 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase for reducing the synthesis of condensation products during hydrolysis of starch.
In a further aspect, the use is described of a glucoamylase variant comprising two or more amino acid substitutions relative to the amino acid sequence from position 518 to position 543 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 21 to position 51 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 52 to position 68 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 396 to position 420 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 421 to position 434 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase for reducing the synthesis of condensation products during hydrolysis of starch.
Accordingly, in a further aspect, the use of a glucoamylase variant is described, which glucoamylase variant when in its crystal form has a crystal structure for which the atomic coordinates of the main chain atoms have a root-mean-square deviation from the atomic coordinates of the equivalent main chain atoms of TrGA (as defined in Table 20 in
WO2009/067218) of less than 0.13 nm following alignment of equivalent main chain atoms, and which have a linker region, a starch binding domain and a catalytic domain, said variant comprising two or more amino acid substitutions relative to the amino acid sequence of the parent glucoamylase in interconnecting loop 2' of the starch binding domain, and/or in loop 1, and/or in helix 2, and/or in loop 11, and/or in helix 12 of the catalytic domain for reducing the synthesis of condensation products during hydrolysis of starch. In a further aspect, the root-mean-square deviation from the atomic coordinates of the equivalent main chain atoms of TrGA (as defined in Table 20 in WO2009/067218) is less than 0.12 nm, such as less than 0.11 or such as less than 0.10.
In one aspect, the use is described herein of a glucoamylase variant with a starch binding domain and a catalytic domain, said variant comprising two or more amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 2 or equivalent parent glucoamylase in interconnecting loop 2', and/or in loop 1, and/or in helix 2, and/or in loop 11, and/or in helix 12 for reducing the synthesis of condensation products during hydrolysis of starch.
In a further aspect, the use is described of a glucoamylase variant wherein said two or more amino acid substitutions are relative to the interconnecting loop 2' with the amino acid sequence from position 518 to position 543 of SEQ ID NO:2 or equivalent sequence of residues in parent glucoamylase, and/or loop 1 with the amino acid sequence from position 21 to position 51 of SEQ ID NO:2 or equivalent sequence of residues in parent glucoamylase, and/or helix 2 with the amino acid sequence from position 52 to position 68 of SEQ ID NO: 2 or equivalent sequence of residues in parent glucoamylase, and/or loop 11 with the amino acid sequence from position 396 to position 420 of SEQ ID NO: 2 or equivalent sequence of residues in parent glucoamylase, and/or helix 12 with the amino acid sequence from position 421 to position 434 of SEQ ID NO: 2 or equivalent sequence of residues in parent
glucoamylase. In a further aspect, the use is described of a glucoamylase variant wherein said two or more amino acid substitutions are relative to the interconnecting loop 2' with the amino acid sequence from position 518 to position 543 of SEQ ID NO:2, and/or loop 1 with the amino acid sequence from position 21 to position 51 of SEQ ID NO:2, and/or helix 2 with the amino acid sequence from position 52 to position 68 of SEQ ID NO:2, and/or loop 11 with the amino acid sequence from position 396 to position 420 of SEQ ID NO: 2, and/or helix 12 with the amino acid sequence from position 421 to position 434 of SEQ ID NO:2.
In a further aspect, the two or more amino acid substitutions are at least one such as one, two or three amino acid substitution in the interconnecting loop 2' and at least one such as one, two, three, four, five or six amino acid substitution in loop 1 and/or helix 2 and/or loop 11 and/or helix 12.
In a further aspect, the two or more amino acid substitutions are one, two, three or four amino acid substitutions in the interconnecting loop 2' and one, two, three or four amino acid substitutions in loop 1 and/or helix 2 and/or loop 11 and/or helix 12. In a further aspect, there are one, two, three or four amino acid substitutions in the interconnecting loop 2'. In a further aspect, there are one, two, three or four amino acid substitutions in loop 1. In a further aspect, there are one, two, three or four amino acid substitutions in helix 2. In a further aspect, there are one, two, three or four amino acid substitutions in loop 11. In a further aspect, there are one, two, three or four amino acid substitutions in helix 12.
In a further aspect, the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in loop 1.
In a further aspect, the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in helix 2.
In a further aspect, the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in loop 11,
In a further aspect, the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in helix 12.
In a further aspect, the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in loop 1 and at least one amino acid substitution in helix 2. 61082
11
In a further aspect, the glucoamylase variant has at least one amino acid substitution within position 520-543, 530-543, or 534-543 of interconnecting loop 2', the positions
corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase.
In a further aspect, the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 30-50, 35-48, or 40-46 of loop 1, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase.
In a further aspect, the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 50-66, 55-64, or 58-63 of helix 2, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase.
In a further aspect, the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 405-420, 410-420, or 415-420 of loop 11, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase.
In a further aspect, the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 421-434, 425-434, or 428-434 of helix 12, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase.
In a further aspect, the glucoamylase variant has at least 80%, 85%, 90%, 95%, 98%, or 99.5% sequence identity to the parent glucoamylase, such as at least 80%, 85%, 90%, 95%, 98%, or 99.5% sequence identity to SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9. In one aspect, the glucoamylase variant has at least 80%, 85%, 90%, 95%, 98%, or 99.5% sequence identity to SEQ ID NO:2.
In a further aspect, the parent glucoamylase or the glucoamylase variant has a starch binding domain that has at least 96%, 97%, 98%, 99%, or 99.5% sequence identity with the starch binding domain of SEQ ID NO: 1, 2, 11, 385, 386, 387, 388, 389, or 390. In a further aspect, the parent glucoamylase or the glucoamylase variant has a catalytic domain that has at least 80%, 85%, 90%, 95%, or 99.5% sequence identity with the catalytic domain of SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9. In one aspect, the glucoamylase variant has an amino acid substitution in position 539 and one or more amino acid substitutions in a position selected from position 44, 61, 417 and 431, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase. In one aspect, the glucoamylase variant has an amino acid substitution in position 539 and a) an amino acid substitution in position 44 and/or b) amino acid substitutions in both positions 417 and 431, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase. In one aspect, the glucoamylase variant has an amino acid substitution in position 539 and an amino acid substitution in position 44, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase. In one aspect, the glucoamylase variant has an amino acid substitution in position 539 and amino acid substitutions in positions 417 and 431, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase. In one aspect, the glucoamylase variant has an amino acid substitution in position 539 and amino acid substitutions in positions 44 and 61, the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase. In one aspect, the glucoamylase variant has an amino acid substitution in position 43, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase, In one aspect, the glucoamylase variant has an amino acid substitution in position 61, the position
corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase. In one aspect, the amino acid substitution in position 539 Is 539R, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase. In one aspect, the amino acid substitution in position 44 is 44R, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase. In one aspect, the amino acid substitution in position 417 is 417R/V, the position corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase. In one aspect, the amino acid substitution in position 417 is 417R, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase. In one aspect, the amino acid substitution in position 417 is 417V, the position corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase.. In one aspect, the amino acid substitution in position 431 is 431L, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase. In one aspect, the amino acid substitution in position 43 is 43R, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase. In one aspect, the amino acid substitution in position 61 is 611, the position corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase. T EP2011/061082
13
In one aspect, the condensation product is isomaltose, In one aspect, the hydrolysis of starch is in a brewing process. In for example brewing, the formation of isomaltose is undeslred because it can not be converted into alcohol during fermentation .
Beer is traditionally referred to as an alcoholic beverage derived from malt, such as malt derived from barley, and optionally adjuncts, such as cereal grains, and flavoured with hops.
Beer can be made from a variety of grains by essentially the same process. All grain starches are glucose homopolymers in which the glucose residues are linked by either alpha-1, 4- or alpha- l,6-bonds, with the former predominating.
The process of making fermented malt beverages is commonly referred to as brewing. The principal raw materials used in making these beverages are water, hops and malt. In addition, adjuncts such as common corn grits, refined corn grits, brewer's milled yeast, rice, sorghum, refined corn starch, barley, barley starch, dehusked barley, wheat, wheat starch, torrified cereal, cereal flakes, rye, oats, potato, tapioca, and syrups, such as corn syrup, sugar cane syrup, inverted sugar syrup, barley and/or wheat syrups, and the like may be used as a source of starch. The starch will eventually be converted into dextrins and fermentable sugars.
For a number of reasons, the malt, which is produced principally from selected varieties of barley, is believed to have the greatest effect on the overall character and quality of the beer. First, the malt is the primary flavouring agent in beer. Second, the malt provides the major portion of the fermentable sugar. Third, the malt provides the proteins, which will contribute to the body and foam character of the beer. Fourth, the malt provides the necessary enzymatic activity during mashing.
Hops also contribute significantly to beer quality, including flavouring. In particular, hops (or hops constituents) add desirable bittering substances to the beer. In addition, the hops act as protein precipitants, establish preservative agents and aid in foam formation and
stabilization.
The process for making beer is well known in the art, but briefly, it involves five steps: (a) mashing and/or adjunct cooking (b) wort separation and extraction (c) boiling and hopping of wort (d) cooling, fermentation and storage, and (e) maturation, processing and packaging.
Typically, in the first step, milled or crushed malt is mixed with water and held for a period of time under controlled temperatures to permit the enzymes present in the malt to convert the starch present in the malt into fermentable sugars. In the second step, the mash is transferred to a "Iauter tun" or mash filter where the liquid is separated from the grain residue. This sweet liquid is called "wort" and the left over grain residue is called "spent grain". The mash is typically subjected to an extraction, which involves adding water to the mash in order to recover the residual soluble extract from the spent grain.
In the third step, the wort is boiled vigorously. This sterilizes the wort and helps to develop the colour, flavour and odour and inactivates enzyme activities. Hops are added at some point during the boiling.
In the fourth step, the wort is cooled and transferred to a fermentor, which either contains the yeast or to which yeast is added. The yeast converts the sugars by fermentation into alcohol and carbon dioxide gas; at the end of fermentation the fermentor is chilled or the fermentor may be chilled to stop fermentation. The yeast flocculates and is removed,
In the last step, the beer is cooled and stored for a period of time, during which the beer clarifies and its flavour develops, and any material that might impair the appearance, flavour and shelf life of the beer settles out. Prior to packaging, the beer is carbonated and, optionally, filtered and pasteurized.
After fermentation, a beverage is obtained which usually contains from about 2% to about 10% alcohol by weight. The non-fermentable carbohydrates are not converted during fermentation and form the majority of the dissolved solids in the final beer.
This residue remains because of the inability of malt amylases to hydrolyze the alpha-1,6- linkages of the starch. The non-fermentable carbohydrates contribute about 50 calories per 12 ounces of beer.
Further information on conventional brewing processes, as well as definitions for terms used in the field of brewing technology to be applied for the present invention, may be found in "Technology Brewing and Malting" by Wolfgang Kunze of the Research and Teaching Institute of Brewing, Berlin (VLB), 2nd revised Edition 1999, ISBN 3-921690-39-0 or 3rd edition (2004): ISBN 3-921690-49-8.
Recently, there has been a widespread popularization of brewed beverages called light beers, reduced calorie beers or low calorie beers, particularly in the U. S. market. As defined in the U. S., these beers have approximately 30% fewer calories than a manufacturer's "normal" beer. As used herein, the term "light beers, reduced calorie beers or low calorie beers", refers to the recent, widespread popularization of brewed beverages, particularly in the U. S. market. As defined in the U. 5., these highly attenuated beers have approximately 30% fewer calories than a manufacturer's "normal beer". Further information on conventional brewing processes may be found in "Technology Brewing and Malting" by Wolfgang Kunze of the Research and Teaching Institute of Brewing, Berlin (VLB), 3rd completely updated edition, 2004, ISBN 3- 921690-49-8. "
Disclosed herein is the use of a giucoamyiase variant as described herein, wherein the production of fermentable sugar(s) is enhanced as compared to the parent giucoamyiase, such as TrGA. Further disclosed herein is the use of a giucoamyiase variant as described herein, wherein the production of fermentable sugars is enhanced in a mashing step of the brewing process as compared to the parent giucoamyiase, such as TrGA. Disclosed herein is the use of a giucoamyiase variant as described herein, wherein the production of fermentable sugars is enhanced in a fermentation step of a brewing process as compared to the parent giucoamyiase, such as TrGA. Disclosed herein is the use of a giucoamyiase variant as described herein, wherein the fermentable sugar is glucose.
A giucoamyiase that can produce glucose with a significantly reduced amount of by-products would be of great commercial interest, e.g. in production of glucose syrup or in brewing. Further disclosed herein is the use of a giucoamyiase variant as described herein, wherein the hydrolysis of starch is in a process for producing glucose syrup. In one aspect, the giucoamyiase exhibit a reduced ratio between isomaltose synthesis (IS) and starch hydrolysis activity (SH) as compared to the parent giucoamyiase, such as TrGA. In one aspect, the giucoamyiase exhibit a reduced starch hydrolysis activity, which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent giucoamyiase, such as TrGA. In one aspect, the giucoamyiase exhibit an enhanced real degree of fermentation as compared to the parent giucoamyiase such as TrGA. In one aspect, the giucoamyiase forms a lower amount of condensation products than the amount of condensation products formed by the giucoamyiase Aspergillus niger (AnGA) (SEQ ID NO: 6) under comparable conditions. In one aspect, the giucoamyiase forms an amount of condensation products which amount is essentially the same as, not more than 5% higher, not more than 8% higher or not more than 10% higher than the amount of condensation products formed by Aspergillus niger (AnGA) (SEQ ID NO: 6) under comparable conditions. In one aspect, dosing of the glucoamyiases are the same based on protein concentration. In one aspect, dosing of the glucoamyiases are the same based on measurement of activity in activity assays. 2
16
G!ucoamylase variants described herein contain amino acid substitutions within the catalytic domain and/or the starch binding domain. The variants may display altered properties such as improved thermostability, altered formation of condensation products such as Isomaitose and/or an enhanced real degree of fermentation and/or a reduced ratio between isomaitose synthesis (IS) and starch hydrolysis activity (SH) and/or specific activity. The variants with reduced formation of condensation products such as isomaitose may significantly improve the ability to make desired products in the brewing industri, for example.
1. Definitions and Abbreviations
1.1. Definitions
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Singleton et al., Dictionary Of Microbiology And Molecular Biology, 2nd ed., John Wiley and Sons, New York (1994), and Hale & Markham, The Harper Collins Dictionary Of Biology, Harper Perennial, N.Y. (1991) provide one of skill with the general meaning of many of the terms used herein. Certain terms are defined below for the sake of clarity and ease of reference.
As used herein, the term "glucoamyiase (EC 3.2.1.3)" refers to an enzyme that catalyzes the release of D-glucose from the non-reducing ends of starch and related oligo- and
polysaccharides.
The term "parent" or "parent sequence" refers to a sequence that is native or naturally occurring in a host cell. Parent glucoamylases include, but are not limited to, the
glucoamyiase sequences set forth in SEQ ID NOs: 1, 2, 3, 5, 6, 7, 8, and 9, and
glucoamylases with at least 80% amino acid sequence identity to SEQ ID NO: 2.
As used herein, an "equivalent position" means a position that is common to two parent sequences that is based on an alignment of the amino add sequence of the parent glucoamyiase In question as well as alignment of the three-dimensional structure of the parent glucoamyiase In question with the TrGA reference glucoamyiase amino acid sequence (SEQ ID NO: 2) and three-dimensional structure. Thus either sequence alignment or structural alignment may be used to determine equivalence.
The term "TrGA" refers to a parent Trichoderma reesei glucoamyiase sequence having the mature protein sequence illustrated In SEQ ID NO: 2 that includes the catalytic domain having the sequence illustrated in SEQ ID NO: 3. The Isolation, cloning and expression of the TrGA are described in WO 2006/060062 and U. S. Patent No. 7,413,887, both of which are incorporated herein by reference. In some embodiments, the parent sequence refers to a glucoamylase sequence that is the starting point for protein engineering. The numbering of the glucoamylase amino acids herein is based on the sequence alignment of a glucoamylase with TrGA (SEQ ID NO : 2 and/or 3) .
The phrase "mature form of a protein or polypeptide" refers to the final functional form of the protein or polypeptide. A mature form of a glucoamylase may lack a signal peptide, for example. To exemplify, a mature form of the TrGA includes the catalytic domain, linker region and starch binding domain having the amino acid sequence of SEQ ID NO: 2.
As used herein, the terms "glucoamylase variant" and "variant" are used in reference to glucoamylases that have some degree of am ino acid sequence identity to a parent glucoamylase sequence. A variant is similar to a parent sequence, but has at least one substitution, deletion or insertion in their amino acid sequence that makes them different in sequence from a parent glucoamylase. In some cases, variants have been manipulated and/or engineered to include at least one substitution, deletion, or insertion in their amino acid sequence that makes them different in sequence from a parent. Additionally, a glucoamylase variant may retain the functional characteristics of the parent glucoamylase, e.g. , maintaining a glucoamylase activity that is at least about 50%, about 60%, about 70%, about 80%, or about 90% of that of the parent glucoamylase. Can also have higher activity than 100% if that is what one has selected for.
"Variants" may have at least about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 88%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 99.5% sequence identity to a parent polypeptide sequence when optimally aligned for comparison. In some embodiments, the glucoamylase variant may have at least about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 88%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 99.5% sequence identity to the catalytic domain of a parent glucoamylase. In some embodiments, the glucoamylase variant may have at least at least about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 88%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 99.5% sequence Identity to the starch binding domain of a parent
glucoamylase. The sequence identity can be measured over the entire length of the parent or the variant sequence. Sequence identity is determined using standard techniques known in the art (see e.g. , Smith and Waterman, Adv. Appl. Math. 2: 482 (1981); Needleman and Wunsch, J. Mol. Biol. 48 ; 443 (1970); Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85: 2444 (1988); programs such as GAP, BESTHT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, WI); and Devereux el al., Nucleic Acid Res. , 12: 387- 395 (1984)).
The "percent (%) nucleic acid sequence identity" or "percent (%) amino acid sequence identity" is defined as the percentage of nucleotide residues or amino acid residues In a candidate sequence that are identical with the nucleotide residues or amino acid residues of the starting sequence (e.g. , SEQ ID NO 2). The sequence identity can be measured over the entire length of the starting sequence.
"Sequence identity" is determined herein by the method of sequence alignment. For the purpose of the present disclosure, the alignment method is BLAST described by Altschul et al., (Altschul et al., J. Mol. Biol. 215: 403-410 (1990); and Karlin et al, Proc. Natl. Acad. Sci. USA 90: 5873-5787 (1993)). A particularly useful BLAST program is the WU-BLAST-2 program (see Altschul et al, Meth. Enzymol. 266: 460-480 (1996)). WU-BLAST-2 uses several search parameters, most of which are set to the default values. The adjustable parameters are set with the following values: overlap span = 1, overlap fraction = 0.125, word threshold (T) = 11. The HSP S and HSP S2 parameters are dynamic values and are established by the program itself depending upon the composition of the particular sequence and composition of the particular database against which the sequence of interest is being searched. However, the values may be adjusted to increase sensitivity. A % amino acid sequence identity value is determined by the number of matching identical residues divided by the total number of residues of the "longer" sequence in the aligned region. The "longer" sequence is the one having the most actual residues in the aligned region (gaps introduced by WU-Blast-2 to maximize the alignment score are ignored).
The term "optimal alignment" refers to the alignment giving the highest percent identity score.
As used herein the term "catalytic domain" refers to a structural region of a polypeptide, which contains the active site for substrate hydrolysis.
The term "linker" refers to a short amino acid sequence generally having between 3 and 40 amino acids residues that covalently bind an amino acid sequence comprising a starch binding domain with an amino acid sequence comprising a catalytic domain. 2011/061082
19
The term "starch binding domain" refers to an amino acid sequence that binds preferentially to a starch substrate.
As used herein, the terms "mutant sequence" and "mutant gene" are used interchangeably and refer to a polynucleotide sequence that has an alteration in at least one codon occurring in a host cell's parent sequence. The expression product of the mutant sequence is a variant protein with an altered amino acid sequence relative to the parent. The expression product may have an altered functional capacity (e.g. , enhanced enzymatic activity) .
The term "property" or grammatical equivalents thereof in the context of a polypeptide, as used herein, refers to any characteristic or attribute of a polypeptide that can be selected or detected. These properties include, but are not limited to oxidative stability, substrate specificity, catalytic activity, thermal stability, pH activity profile, resistance to proteolytic degradation, KM, KCAT, KCAT/Km ratio, protein folding, ability to bind a substrate and ability to be secreted.
The term "property" or grammatical equivalent thereof in the context of a nucleic acid, as used herein, refers to any characteristic or attribute of a nucleic acid that can be selected or detected. These properties include, but are not limited to, a property affecting gene transcription (e.g. , promoter strength or promoter recognition), a property affecting RNA processing (e.g. , RNA splicing and RNA stability), a property affecting translation (e.g., regulation, binding of mRNA to ribosomal proteins).
The terms "thermally stable" and "thermostable" refer to glucoamylase variants of the present disclosure that retain a specified amount of enzymatic activity after exposure to a temperature over a given period of time under conditions prevailing during the hydrolysis of starch substrates, for example, while exposed to altered temperatures.
The term "enhanced stability" in the context of a property such as thermostability refers to a higher retained starch hydrolytic activity over time as compared to another reference (i.e. , parent) glucoamylase.
The term "diminished stability" in the context of a property such as thermostability refers to a lower retained starch hydrolytic activity over time as compared to another reference glucoamylase.
The term "specific activity" is defined as the activity per mg of glucoamylase protein. In some embodiments, the activity for glucoamylase is determined by the ethanol assay described herein and expressed as the amount of glucose that is produced from the starch P T/EP2011/061082
20 substrate. In some embodiments, the protein concentration can be determined using the Caliper assay described herein.
The terms "active" and "biologically active" refer to a biological activity associated with a particular protein. It follows that the biological activity of a given protein refers to any biological activity typically attributed to that protein by those skilled in the art. For example, an enzymatic activity associated with a glucoamylase is hydrolytic and, thus an active glucoamylase has hydrolytic activity.
The terms "polynucleotide" and "nucleic acid", used interchangeably herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. These terms include, but are not limited to, a single-, double- or triple-stranded DNA, genomic DNA, cDNA, RNA, DNA-RNA hybrid, or a polymer comprising purine and pyrimidine bases, or other natural, chemically, biochemically modified, non-natural or derivatized nucleotide bases.
As used herein, the terms "DNA construct," "transforming DNA" and "expression vector" are used interchangeably to refer to DNA used to introduce sequences into a host cell or organism. The DNA may be generated in vitro by PCR or any other suitable technique(s) known to those in the art. The DNA construct, transforming DNA or recombinant expression cassette can be incorporated into a plasmid, chromosome, mitochondrial DNA, plastid DNA, virus, or nucleic acid fragment. Typically, the recombinant expression cassette portion of an expression vector, DNA construct or transforming DNA includes, among other sequences, a nucleic acid sequence to be transcribed and a promoter. In some embodiments, expression vectors have the ability to incorporate and express heterologous DNA fragments in a host cell.
As used herein, the term "vector" refers to a polynucleotide construct designed to introduce nucleic acids into one or more cell types. Vectors include cloning vectors, expression vectors, shuttle vectors, plasmids, cassettes, and the like.
As used herein in the context of introducing a nucleic acid sequence into a cell, the term "introduced" refers to any method suitable for transferring the nucleic acid sequence into the cell. Such methods for introduction include but are not limited to protoplast fusion, transfection, transformation, conjugation, and transduction.
As used herein, the terms "transformed" and "stably transformed" refers to a cell that has a non-native (heterologous) polynucleotide sequence integrated into its genome or as an episomal plasmid that is maintained for at least two generations. 11 061082
21
As used herein, the terms "selectable marker" and "selective marker" refer to a nucleic acid (e.g. , a gene) capable of expression in host cells that allows for ease of selection of those hosts containing the vector. Typically, selectable markers are genes that confer antimicrobial resistance or a metabolic advantage on the host cell to allow cells containing the exogenous DNA to be distinguished from cells that have not received any exogenous sequence during the transformation.
As used herein, the term "promoter" refers to a nucleic acid sequence that functions to direct transcription of a downstream gene. The promoter, together with other transcriptional and translational regulatory nucleic acid sequences (also termed "control sequences") is necessary to express a given gene. In general, the transcriptional and translational regulatory sequences include, but are not limited to, promoter sequences, ribosomal binding sites, transcriptional start and stop sequences, translational start and stop sequences, and enhancer or activator sequences.
A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence, For example, DNA encoding a secretory leader {I.e., a signal peptide), is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide. Generally, "operably linked" means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase.
As used herein the term "gene" refers to a polynucleotide (e.g. , a DNA segment), that encodes a polypeptide and includes regions preceding and following the coding regions, as well as intervening sequences (introns) between individual coding segments (exons).
As used herein, "ortholog" and "orthologous genes" refer to genes in different species that have evolved from a common ancestral gene (i.e., a homologous gene) by speclation.
Typically, orthologs retain the same function during the course of evolution. Identification of orthologs finds use in the reliable prediction of gene function in newly sequenced genomes.
As used herein, "paralog" and "paralogous genes" refer to genes that are related by duplication within a genome. While orthologs retain the same function through the course of evolution, paralogs evolve new functions, even though some functions are often related to the original one. Examples of paralogous genes include, but are not limited to genes encoding trypsin, chymotrypsin, elastase, and thrombin, which are all serine proteinases and occur together within the same species. 2
22
As used herein, the term "hybridization" refers to the process by which a strand of nucleic acid joins with a complementary strand through base pairing, as known in the art.
A nucleic acid sequence is considered to be "selectively hybridizable" to a reference nucleic acid sequence if the two sequences specifically hybridize to one another under moderate to high stringency hybridization and wash conditions. Hybridization conditions are based on the melting temperature (Tm) of the nucleic acid binding complex or probe. For example, "maximum stringency" typically occurs at about Tm - 5°C (5°C below the Tm of the probe); "high stringency" at about 5-10°C below the Tm; "intermediate stringency" at about 10-20°C below the Tm of the probe; and "low stringency" at about 20-25°C below the Tm. Functionally, maximum stringency conditions may be used to Identify sequences having strict Identity or near-strict identity with the hybridization probe; while an intermediate or low stringency hybridization can be used to identify or detect polynucleotide sequence homologs.
Moderate and high stringency hybridization conditions are well known in the art. An example of high stringency conditions includes hybridization at about 42°C in 50% formamide, 5 x SSC, 5 x Denhardt's solution, 0.5% SDS and 100 pg/rnl denatured carrier DIMA followed by washing two times in 2 χ SSC and 0.5% SDS at room temperature and two additional times in 0.1 x SSC and 0.5% SDS at 42°C. An example of moderate stringent conditions include an overnight incubation at 37°C in a solution comprising 20% formamide, 5 χ SSC (150 mM NaCI, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 χ Denhardt's solution, 10% dextran sulfate and 20 mg/ml denaturated sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 37-50°C. Those of skill in the art know how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the like.
As used herein, "recombinant" includes reference to a cell or vector, that has been modified by the introduction of a heterologous or homologous nucleic acid sequence or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found in identical form within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all as a result of deliberate human intervention.
In an embodiment of the disclosure, mutated DNA sequences are generated with site saturation mutagenesis in at least one codon. In another embodiment, site saturation mutagenesis is performed for two or more codons. In a further embodiment, mutant DNA sequences have more than about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 98% identity with the parent sequence. In alternative embodiments, mutant DNA is generated in vivo using any known mutagenic procedure such as, for example, radiation, nitrosoguanidine, and the like. The desired DNA sequence is then isolated and used in the methods provided herein.
As used herein, "heterologous protein" refers to a protein or polypeptide that does not naturally occur in the host cell.
An enzyme is "over-expressed" in a host cell if the enzyme is expressed in the cell at a higher level than the level at which it is expressed in a corresponding wild-type cell.
The terms "protein" and "polypeptide" are used interchangeability herein. In the present disclosure and claims, the conventional one-letter and three-letter codes for amino acid residues are used. The 3-letter code for amino acids as defined in conformity with the IUPAC-IUB Joint Commission on Biochemical Nomenclature (JCBN). It is also understood that a polypeptide may be coded for by more than one nucleotide sequence due to the degeneracy of the genetic code.
Variants of the disclosure are described by the following nomenclature: [original amino acid residue/position/substituted amino acid residue]. For example, the substitution of leucine for arginine at position 76 is represented as R76L. When more than one amino acid is substituted at a given position, the substitution is represented as 1) Q172C, Q172D or Q172R; 2) Q172C, D, or R, or 3) Q172C/D/R. When a position suitable for substitution is identified herein without a specific amino acid suggested, it is to be understood that any amino acid residue may be substituted for the amino acid residue present in the position. Where a variant glucoamylase contains a deletion in comparison with other glucoamylases the deletion is indicated with "*". For example, a deletion at position R76 is represented as R76*. A deletion of two or more consecutive amino acids is indicated for example as (76 - 78)*.
A "prosequence" is an amino acid sequence between the signal sequence and mature protein that is necessary for the secretion of the protein. Cleavage of the pro sequence will result in a mature active protein.
The term "signal sequence" or "signal peptide" refers to any sequence of nucleotides and/or amino acids that may participate In the secretion of the mature or precursor forms of the protein. This definition of signal sequence is a functional one, meant to include all those amino acid sequences encoded by the N-terminal portion of the protein gene, which participate in the effectuation of the secretion of protein. They are often, but not universally, bound to the N-terminal portion of a protein or to the N-terminal portion of a precursor protein. The signal sequence may be endogenous or exogenous. The signal sequence may 1 061082
24 be that normally associated with the protein (e.g. , glucoamylase), or may be from a gene encoding another secreted protein.
The term "precursor" form of a protein or peptide refers to a mature form of the protein having a prosequence operabiy linked to the amino or carbonyl terminus of the protein. The precursor may also have a "signal" sequence operabiy linked, to the amino terminus of the prosequence. T e precursor may also have additional polynucleotides that are involved in post-translational activity (e.g., polynucleotides cleaved therefrom to leave the mature form of a protein or peptide).
"Host strain" or "host cell" refers to a suitable host for an expression vector comprising DNA according to the present disclosure.
The terms "derived from" and "obtained from" refer to not only a glucoamylase produced or producible by a strain of the organism in question, but also a glucoamylase encoded by a DNA sequence isolated from such strain and produced in a host organism containing such DNA sequence. Additionally, the term refers to a glucoamylase that is encoded by a DNA sequence of synthetic and/or cDNA origin and that has the identifying characteristics of the glucoamylase in question.
A "derivative" within the scope of this definition generally retains the characteristic hydrolyzing activity observed in the wild-type, native or parent form to the extent that the derivative is useful for similar purposes as the wild-type, native or parent form. Functional derivatives of glucoamylases encompass naturally occurring, synthetically or recombinantly produced peptides or peptide fragments that have the general characteristics of the glucoamylases of the present disclosure.
The term "isolated" refers to a material that is removed from the natural environment if it is naturally occurring. A "purified" protein refers to a protein that is at least partially purified to homogeneity. In some embodiments, a purified protein is more than about 10% pure, about 20% pure, or about 30% pure, as determined by SDS-PAGE. Further aspects of the disclosure encompass the protein in a highly purified form [I.e., more than about 40% pure, about 60% pure, about 80% pure, about 90% pure, about 95% pure, about 97% pure, or about 99% pure), as determined by SDS-PAGE.
As used herein, the term, "combinatorial mutagenesis" refers to methods In which libraries of variants of a starting sequence are generated. In these libraries, the variants contain one or several mutations chosen from a predefined set of mutations. In addition, the methods provide means to introduce random mutations that were not members of the predefined set EP2011/061082
25 of mutations. In some embodiments, the methods include those set forth in U.S. Patent No. 6,582,914, hereby incorporated by reference. In alternative embodiments, combinatorial mutagenesis methods encompass commercially available kits (e.g., QuikChange® Multisite, Stratagene, San Diego, CA).
As used herein, the term "library of mutants" refers to a population of cells that are identical in most of their genome but include different homologues of one or more genes. Such libraries can be used, for example, to identify genes or operons with improved traits.
As used herein the term "dry solids content (DS or ds)" refers to the total solids of a slurry in % on a dry weight basis.
As used herein, the term "initial hit" refers to a variant that was identified by screening a combinatoriai consensus mutagenesis library. In some embodiments, initial hits have improved performance characteristics, as compared to the starting gene.
As used herein, the term "improved hit" refers to a variant that was identified by screening an enhanced combinatorial consensus mutagenesis library.
As used herein, the term "target property" refers to the property of the starting gene that is to be altered. It is not intended that the present disclosure be limited to any particular target property. However, in some embodiments, the target property is the stability of a gene product (e.g., resistance to denaturation, proteolysis or other degradative factors), while in other embodiments, the level of production in a production host is altered. Indeed, it is contemplated that any property of a starting gene will find use in the present disclosure. Other definitions of terms may appear throughout the specification.
As used herein, the "process for making beer" may further be applied in the mashing of any grist.
As used herein, the term "grist" refers to any starch and/or sugar containing plant material derivable from any plant and plant part, including tubers (e.g. potatoes), roots (e.g. cassava [Manihot esculenta] roots), stems, leaves and seeds. The grist may comprise grain, such as grain from barley, wheat, rye, oat, corn/maize, rice, milo, millet and sorghum, and e.g. at least 10%, or at least 15%, or at least 25%, or at least 35%, such as at least 50%, at least 75%, at least 90% or even 100% (w/w) of the grist of the wort is derived from grain. In some embodiments the grist may comprise the starch and/or sugar containing plant material obtained from cassava [Manihot esculenta] roots. The grist may comprise malted grain, such as barley malt. Often, at least 10%, or at least 15%, or at least 25%, or at least 35%, such as at least 50%, at least 75%, at least 90% or even 100% (w/w) of the grist of the wort is derived from malted grain. The grist may comprise adjunct, such as up to 10%, or at least 10%, or at least 15%, or at least 25%, or at least 35%, or at least 50%, at least 75%, at least 90%, or even 100% (w/w) of the grist of the wort is adjunct.
The term "adjunct" is understood as the part of the grist which is not barley malt. The adjunct may be any carbohydrate rich material. In term "adjunct" includes starch and/or sugar containing plant material as e.g. defined above under "grist".
The term "fermentation" means, in the context of brewing, the transformation of sugars in the wort, by enzymes in the brewing yeast, into ethanol and carbon dioxide with the formation of other fermentation by-products.
As used herein the term "malt" Is understood as any malted cereal grain, such as barley.
As used herein, the term "malt beverage" includes such foam forming fermented malt beverages as full malted beer, ale, dry beer, near beer, light beer, low alcohol beer, low calorie beer, porter, bock beer, stout, malt liquor, non-alcoholic malt liquor and the like. The term "malt beverages" also includes non-foaming beer and alternative malt beverages such as fruit flavoured malt beverages, e. g. , citrus flavoured, such as lemon-, orange-, lime-, or berry-flavoured malt beverages, liquor flavoured malt beverages, e. g. , vodka-, rum-, or tequila-flavoured malt liquor, or coffee flavoured malt beverages, such as caffeine-flavoured malt liquor, and the like.
The term "mash" is understood as aqueous starch slurry, e. g. comprising crushed barley malt, crushed barley, and/or other adjunct or a combination hereof, mixed with water later to be separated into wort + spent grains.
As used herein, the term "wort" refers to the unfermented liquor run-off following extracting the grist during mashing.
As used herein, the term "spent grains" refers to the drained solids remaining when the grist has been extracted and the wort separated from the mash.
Included within the term "beer" is any fermented wort, produced by the brewing and fermentation of a starch-containing material, mainly derived from cereal grains, such as malted barley. Wheat, maize, and rice may also be used. 1082
27
As used herein, the term "extract recovery" in the wort is defined as the sum of soluble substances extracted from the grist (malt and adjuncts) expressed in percentage based on dry matter.
As used herein, the term "pasteurization" means heating (e.g. beer) at certain temperatures for certain time intervals. The purpose is normally killing of micro-organisms but
pasteurization can also cause Inactivation of enzyme activity. Implementation of
pasteurisation fn the brewing process is typically through the use of a flash pasteuriser or tunnel pasteuriser. As used herein, the term "pasteurisation units or PU" refers to a quantitative measure of pasteurisation. One pasteurisation unit (1 PU) for beer is defined as a heat retention of one minute at 60 degrees Celsius. One calculates that:
PU = t x 1.393A(T - 60), where: t = time, in minutes, at the pasteurisation temperature in the pasteuriser
T = temperature, in degrees Celsius, in the pasteuriser
[Λ(Τ -60) represents the exponent of (T-60)]
Different minimum PU may be used depending on beer type, raw materials and microbial contamination, brewer and perceived effect on beer flavour. Typically, for beer
pasteurisation, 14 - 15 PU are required. Depending on the pasteurising equipment, pasteurisation temperatures are typically in the range of 64 - 72 degrees Celsius with a pasteurisation time calculated accordingly. Further information may be found in "Technology Brewing and Malting" by Wolfgang Kunze of the Research and Teaching Institute of Brewing, Berlin (VLB), 3rd completely updated edition, 2004, ISBN 3-921690-49-8..
As used herein, the term "non-alcoholic beer" or "low-alcohol beer" refers to a beer containing a maximum of 0.1% to 3.5% or 0.1% to 2.5% such as 0.1% to 0.5% alcohol by volume. Non-alcoholic beer is brewed by traditional methods, but during the finishing stages of the brewing process the alcohol is removed by vacuum evaporation, by taking advantage of the different boiling points of water and alcohol.
As used herein, the term "low-calorie beer" or "beer with a low carbohydrate content" is defined as a beer with a carbohydrate content of 1.5 g/100 g or less and with a real degree of fermentation of at least 80%. Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range Is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be inciuded or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included In the disclosure.
Before the exemplary embodiments are described in more detail, it Is to be understood that this disclosure is not limited to particular embodiments described, as such may, of course, vary. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, exemplary methods and materials are now described.
As used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a gene" includes a plurality of such candidate agents and reference to "the cell" includes reference to one or more cells and equivalents thereof known to those skilled in the art, and so forth.
The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein Is to be construed as an admission that the present disclosure is not entitled to antedate such publication by virtue of prior invention.
1.2. Abbreviations
GA glucoamylase
GAU glucoamylase unit
wt % weight percent
°C degrees Centigrade
rpm revolutions per minute
H20 water
dHzO deionized water
dIH20 deionized water, Milli-Q filtration
aa or AA amino acid
bp base pair
kb kilobase pair
kD kilodaltons
g or grn grams
μ9 micrograms
mg milligrams 2011/061082
29 μΙ and μΐ microliters
ml and mL milliliters
mm millimeters
μΐτι micrometer
M molar
mM millimolar
μΜ micromolar
U units
V volts
W molecular weight
MWCO molecular weight cutoff
sec(s) or s(s) second/seconds
min(s) or m(s) minute/minutes
hr(s) or h(s) hour/hours
DO dissolved oxygen
ABS Absorbance
EtOH ethanol
PSS physiological salt solution
m/v mass/volume
MTP microtiter plate
N Normal
DPI monosaccharides
DP2 disaccharides
DP>3 oligosaccharides, sugars having a degree of polymerization greater than 3
ppm parts per million
SBD starch binding domain
CD catalytic domain
PC polymerase chain reaction
WT wild-type
2. Parent Glucoamylases
In some embodiments, the present disclosure provides a giucoamylase variant. The giucoamylase variant is a variant of a parent giucoamylase, which may comprise both a catalytic domain and a starch binding domain. In some embodiments, the parent
giucoamylase comprises a catalytic domain having an amino acid sequence as illustrated In SEQ ID NO: 1, 2, 3, 5, 6, 7, 8 or 9 or having an amino acid sequence displaying at least about 80%, about 85%, about 90%, about 95%, about 97%, about 99%, or about 99.5% sequence identity with one or more of the amino acid sequences illustrated in SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9. In yet other embodiments, the parent giucoamylase comprises a catalytic domain encoded by a DNA sequence that hybridizes under medium, high, or stringent conditions with a DNA encoding the catalytic domain of a giucoamylase having one of the amino acid sequences of SEQ ID NO: 1, 2 or 3.
In some embodiments, the parent giucoamylase comprises a starch binding domain having an amino acid sequence as illustrated in SEQ ID NO 1, 2, 11 , 385, 386, 387, 388, 389, or 390, or having an amino acid sequence displaying at least about 80%, about 85%, about 90%, about 95%, about 97%, about 99%, or about 99.5% sequence identity with one or more of the amino acid sequence illustrated in SEQ ID NO 1, 2, 11, 385, 386, 387, 388, 389, or 390. In yet other embodiments, the parent glucoamylase comprises a starch binding domain encoded by a DNA sequence that hybridizes under medium, high, or stringent conditions with a DNA encoding the starch binding domain of a glucoamylase having one of the amino acid sequences of SEQ ID NO: 1, 2, or 11.
Predicted structure and known sequences of glucoamylases are conserved among fungal species (Coutinho et al., 1994, Protein Eng. , 7:393-400 and Coutinho et al., 1994, Protein Eng., 7 : 749-760) . In some embodiments, the parent glucoamylase is a filamentous fungal glucoamylase. In some embodiments, the parent glucoamylase is obtained from a
Trichoderma strain (e.g., T. reesei, T. longibrachiatum, T. strictipilis, T. asperellum, T.
koniiangbra and T. hazianum), an Aspergillus strain e.g. A. niger, A. nidulans, A. kawachi, A. awamori and A. orzyae ), a Talaromyces strain (e.g. T. emersonii, T. thermophilus, and T. duponti ), a Hypocrea strain (e.g. H. gelatinosa , H. orientalis, H. vinosa, and H. citrina), a Fusarium strain (e.g., F. oxysporum, F. roseum, and F. venenatum), a Neurospora strain (e.g., N. crassa) and a Humicola strain (e.g., H. grisea, H. insolens and H. lanuginose), a Penicillium strain (e.g. , P. notatum or P. chrysogenum), or a Saccharomycopsis strain (e.g. , S. fibuligera).
In some embodiments, the parent glucoamylase may be a bacterial glucoamylase. For example, the polypeptide may be obtained from a gram-positive bacterial strain such as Bacillus (e.g. , B. alkalophilus, B. amyloliquefaciens, B. lentus, B. lichenlformis, B.
stearothermophilus, B. subtilis and 5. thuringiensis) or a Streptomyces strain (e.g., S.
lividans).
In some embodiments, the parent glucoamylase will comprise a catalytic domain having at least about 80%, about 85%, about 90%, about 93%, about 95%, about 97%, about 98%, or about 99% sequence identity with the catalytic domain of the TrGA amino acid sequence of SEQ ID NO: 3.
In other embodiments, the parent glucoamylase will comprise a catalytic domain having at least about 90%, about 93%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity with the catalytic domain of the Aspergillus parent glucoamylase of SEQ ID NO: 5 or SEQ ID NO: 6. EP2011/061082
31
In yet other embodiments, the parent glucoamylase will comprise a catalytic domain having at least about 90%, about 95%, about 97%, or about 99% sequence identity with the catalytic domain of the Humicola grisea (HgGA) parent glucoamylase of SEQ ID NO: 8.
In some embodiments, the parent glucoamylase will comprise a starch binding domain having at least about 80%, about 85%, about 90%, about 95%, about 97%, or about 98% sequence identity with the starch binding domain of the TrGA amino acid sequence of SEQ ID NO: 1, 2, or 11.
In other embodiments, the parent glucoamylase will comprise a starch binding domain having at least about 90%, about 95%, about 97%, or about 99% sequence identity with the catalytic domain of the Humicola grisea (HgGA) glucoamylase of SEQ ID NO: 385.
In other embodiments, the parent glucoamylase will comprise a starch binding domain having at least about 90%, about 95%, about 97%, or about 99% sequence identity with the catalytic domain of the Thielavia terrestris (TtGA) glucoamylase of SEQ ID NO: 390.
In other embodiments, the parent glucoamylase will comprise a starch binding domain having at least about 90%, about 95%, about 97%, or about 99% sequence identity with the catalytic domain of the Thermomyces lanuginosus (ThGA) glucoamylase of SEQ ID NO: 386.
In other embodiments, the parent glucoamylase will comprise a starch binding domain having at least about 90%, about 95%, about 97%, or about 99% sequence identity with the catalytic domain of the Talaromyces emersoniit (TeGA) glucoamylase of SEQ ID NO: 387.
In yet other embodiments, the parent glucoamylase will comprise a starch binding domain having at least about 90%, about 93%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity with the starch binding domain of the Aspergillus parent glucoamylase of SEQ ID NO: 388 or 389.
In some embodiments, the parent glucoamylase will have at least about 80%, about 85%, about 88%, about 90%, about 93%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity with the TrGA amino acid sequence of SEQ ID NO: 1 or 2.
In further embodiments, a Trichoderma glucoamylase homologue will be obtained from a Trichoderma or Hypocrea strain. Some typical Trichoderma glucoamylase homologues are described in U.S. Patent No. 7,413,887 and reference is made specifically to amino acid sequences set forth In SEQ ID NOs: 17-22 and 43-47 of the reference. T EP2011/061082
32
In some embodiments, the parent glucoamyiase is TrGA comprising the amino acid sequence of SEQ ID NO: 2, or a Trichoderma glucoamyiase homologue having at least about 80%, about 85%, about 88%, about 90%, about 93%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the TrGA sequence (SEQ ID NO: 2).
A parent glucoamyiase can be Isolated and/or identified using standard recombinant DNA techniques. Any standard techniques can be used that are known to the skilled artisan. For example, probes and/or primers specific for conserved regions of the glucoamyiase can be used to identify homologs in bacterial or fungal cells (the catalytic domain, the active site, etc.). Alternatively, degenerate PCR can be used to identify homologues in bacterial or fungal cells. In some cases, known sequences, such as in a database, can be analyzed for sequence and/or structural identity to one of the known glucoamylases, including SEQ ID NO:
2, or a known starch binding domains, including SEQ ID NO: 11. Functional assays can also be used to identify glucoamyiase activity in a bacterial or fungal cell. Proteins having glucoamyiase activity can be isolated and reverse sequenced to isolate the corresponding DNA sequence. Such methods are known to the skilled artisan.
3. Glucoamyiase Structural Homology
The central dogma of molecular biology is that the sequence of DNA encoding a gene for a particular enzyme, determines the amino acid sequence of the protein, this sequence in turn determines the three-dimensional folding of the enzyme. This folding brings together disparate residues that create a catalytic center and substrate binding surface and this results in the high specificity and activity of the enzymes in question.
Glucoamylases consist of as many as three distinct structural domains, a catalytic domain of approximately 450 residues that Is structurally conserved in all glucoamylases, generally followed by a linker region consisting of between 30 and 80 residues that are connected to a starch binding domain of approximately 100 residues. The structure of the Trichoderma reesei glucoamyiase with all three regions intact was determined to 1.8 Angstrom resolution herein (see Table 20 in WO2009/067218 (Danisco US Inc., Genencor Division) page 94-216 incorporated herein by reference and Example 11 in WO2009/067218 (Danisco US Inc., Genencor Division) page 89-93 incorporated herein by reference ). Using the coordinates (see Table 20 in WO2009/067218 (Danisco US Inc., Genencor Division) page 94-216 incorporated herein by reference), the structure was aligned with the coordinates of the catalytic domain of the glucoamyiase from Aspergillus awamori strain X100 that was determined previously (Aleshin, A.E., Hoffman, C, Firsov, L.M., and Honzatko, R.B. Refined crystal structures of glucoamyiase from Aspergillus awamori var. X100. J. Mol. Biol. 238: 575-591 (1994)). The Aspergillus awamori crystal structure only included the catalytic domain. As seen in FIGs. 6-7, the structure of the catalytic domains overlap very closely, and it is possible to identify equivalent residues based on this structural superposition. It is believed that all glucoamylases share the basic structure depicted in FIGs. 6-7.
The catalytic domain of TrGA thus has approximately 450 residues such as residues 1-453 of TrGA SEQ ID NO:2 and is a twelve helix double barrel domain. The helices and loops of the catalytic domain can be defined in terms of the residues of TrGA with SEQ ID NO:2 forming them: helix 1 residues 2-20,
loop 1 residues 21-51,
helix 2 residues 52-68,
loop 2 residues 69-71,
helix 3 residues 72-90,
loop 3 residues 91-125,
helix 4 residues 126-145,
loop 4 residues 146,
helix 5 residues 147-169,
helix 6 residues 186-206,
loop 6 residues 207-210,
helix 7 residues 211-227,
loop 7 residues 211-227,
helix 8 residues 250-275,
loop 8 residues 260-275,
helix 9 residues 276-292,
loop 9 residues 293-321,
helix 10 residues 322-342,
loop 10 residues 343-3 1,
helix 11 residues 372-395,
loop 11 residues 396-420,
helix 12 residues 421-434,
loop 12 residues 435-443,
helix 13 residues 444-447,
loop 13 residues 448-453
The linker domain has between 30 and 80 residues such as residues 454-490 of TrGA with SEQ ID NO: 2. The starch binding domain of TrGA has approximately 100 residues such as residues 496-596 of TrGA with SEQ ID NO: 2 consisting of the beta sandwich composed of two twisted three stranded sheets. The sheets, helices and loops of the starch binding domain can be defined in terms of the residues of TrGA with SEQ ID NO: 2 forming them: sheet 1' residues 496-504,
loop 1' residues 505-511,
sheet 2' residues 512-517,
interconnecting loop 2' residues 518-543,
sheet 3' residues 544-552,
loop 3' residues 553,
sheet 4' residues 554-565,
loop 4' residues 566-567,
sheet 5' residues 568-572,
inter-sheet segment residues 573-577,
sheet 5a' residues 578-582,
loop 5' residues 583-589,
sheet 61 residues 590-596,
It is possible to Identify equivalent residues based on structural superposition in other glucoamylases as described in further detail below.
FIG. 6 is a comparison of the three dimensional structures of the Trichoderma reesei glucoamylase (black) of SEQ ID NO: 2 and of Aspergillus awamorii glucoamylase (grey) viewed from the side. In this view, the relationship between the catalytic domain and the linker region and the starch binding domain can be seen.
FIG. 7 Is a comparison of the three dimensional structures of the Trichoderma reesei glucoamylase (black) of SEQ ID NO: 2 and of Aspergillus awamorii glucoamylase (grey) viewed from the top. The glucoamylases shown here and Indeed all known glucoamylases to date share this structural homology. The conservation of structure correlates with the conservation of activity and a conserved mechanism of action for all glucoamylases. Given this high homology, changes resulting from site specific variants of the Trichoderma glucoamylase resulting in altered functions would also have similar structural and therefore functional consequences in other glucoamylases. Therefore, the teachings of which variants result in desirable benefits can be applied to other glucoamylases.
A further crystal structure was produced using the coordinates in Table 20 in
O2009/067218 (Danisco US Inc., Genencor Division) page 94-216 incorporated herein by reference for the Starch Binding Domain (SBD). The SBD for TrGA was aligned with the SBD for A. niger. As shown in FIG. 8, the structure of the A. niger and TrGA SBDs overlaps very closely. It is believed that while all starch binding domains share at least some of the basic structure depicted in FIG. 8, some SBDs are more structurally similar than others. For example, the TrGA SBD can be classified as within the carbohydrate binding module 20 family within the CAZY database (cazy.org). The CAZY database describes the families of structurally-related catalytic and carbohydrate-binding modules (or functional domains) of enzymes that degrade, modify, or create glycosidic bonds. Given a high structural homology, site specific variants of the TrGA SBD resulting In altered function would also have similar structural and therefore functional consequences in other glucoamylases having SBDs with similar structure to that of the TrGA SBD, particularly those classified within the carbohydrate binding module 20 family. Thus, the teachings of which variants result in desirable benefits can be applied to other SBDs having structural similarity.
Thus, the amino acid position numbers discussed herein refer to those assigned to the mature Trichoderma reesei glucoamylase sequence presented in FIG. 1 (SEQ ID NO: 2). The present disclosure, however, is not limited to the variants of Trichoderma glucoamylase, but extends to glucoamylases containing amino acid residues at positions that are "equivalent" to the particular identified residues in Trichoderma reesei glucoamylase (SEQ ID NO: 2). In some embodiments of the present disclosure, the parent glucoamylase is a Talaromyces GA and the substitutions are made at the equivalent amino acid residue positions in Talaromyces glucoamylase (see e.g. , SEQ ID NO: 12) as those described herein. In other embodiments, the parent glucoamylase comprises SEQ ID NOs: 5-9 (see FIGs. 5A and 5B). In further embodiments, the parent glucoamylase is a Penicillium glucoamylase, such as Penicillium chrysogenum (see e.g., SEQ ID NO: 13).
"Structural identity" determines whether the amino acid residues are equivalent. Structural identity is a one-to-one topological equivalent when the two structures (three dimensional and amino acid structures) are aligned. A residue (amino acid) position of a glucoamylase is "equivalent" to a residue of T. reesei glucoamylase if it is either homologous {i.e. , corresponding in position in either primary or tertiary structure) or analogous to a specific residue or portion of that residue in T. reesei glucoamylase (having the same or similar functional capacity to combine, react, or interact chemically).
In order to establish identity to the primary structure, the amino acid sequence of a glucoamylase can be directly compared to Trichoderma reesei glucoamylase primary sequence and particularly to a set of residues known to be invariant in glucoamylases for which sequence is known. For example, FIGs. 5A and 5B herein show the conserved residues between glucoamylases. FIGs. 5D and 5E show an alignment of starch binding domains from various glucoamylases. After aligning the conserved residues, allowing for necessary insertions and deletions in order to maintain alignment (I.e. avoiding the elimination of conserved residues through arbitrary deletion and insertion), the residues equivalent to particular amino acids in the primary sequence of Trichoderma reesei glucoamylase are defined. Alignment of conserved residues typically should conserve 100% of such residues. However, alignment of greater than about 75% or as little as about 50% of conserved residues is also adequate to define equivalent residues. Further, the structural identity can be used In combination with the sequence identity to identify equivalent residues.
For example, in FIGs. 5A and 5B, the catalytic domains of glucoamylases from six organisms are aligned to provide the maximum amount of homology between amino acid sequences. A comparison of these sequences shows that there are a number of conserved residues contained in each sequence as designated by an asterisk. These conserved residues, thus, may be used to define the corresponding equivalent amino acid residues of Trichoderma reesei glucoamylase in other glucoamylases such as glucoamylase from Aspergillus niger. Similarly, FIGs. 5D and 5E show the starch binding domains of glucoamylases from seven organisms aligned to identify equivalent residues.
Structural identity involves the identification of equivalent residues between the two structures. "Equivalent residues" can be defined by determining homology at the level of tertiary structure (structural identity) for an enzyme whose tertiary structure has been determined by X-ray crystallography. Equivalent residues are defined as those for which the atomic coordinates of two or more of the main chain atoms of a particular amino acid residue of the Trichoderma reesei glucoamylase (N on IM, CA on CA, C on C and O on O) are within 0.13 nm and optionally 0.1 nm after alignment. In one aspect, at least 2 or 3 of the four possible main chain atoms are within 0.1 nm after alignment. Alignment is achieved after the best model has been oriented and positioned to give the maximum overlap of atomic coordinates of non-hydrogen protein atoms of the glucoamylase in question to the
Trichoderma reesei glucoamylase. The best model is the crystallographic model giving the lowest R factor for experimental diffraction data at the highest resolution available.
R factor
Equivalent residues that are functionally analogous to a specific residue of Trichoderma reesei glucoamylase are defined as those amino acids of the enzyme that may adopt a conformation such that they either alter, modify or contribute to protein structure, substrate binding or catalysis in a manner defined and attributed to a specific residue of the Trichoderma reesei glucoamylase. Further, they are those residues of the enzyme (for which a tertiary structure has been obtained by X-ray crystallography) that occupy an analogous position to the extent that, although the main chain atoms of the given residue may not satisfy the criteria of equivalence on the basis of occupying a homologous position, the atomic coordinates of at least two of the side chain atoms of the residue lie with 0.13 nm of the corresponding side chain atoms of Trichoderma reesei glucoamylase. The coordinates of the three dimensional structure of Trichoderma reesei glucoamylase are set forth in Table 20 in WO2009/067218 (Danisco US Inc., Genencor Division) page 94-216 incorporated herein by reference and can be used as outlined above to determine equivalent residues on the level of tertiary structure.
Some of the residues identified for substitution are conserved residues whereas others are not. In the case of residues that are not conserved, the substitution of one or more amino acids is limited to substitutions that produce a variant that has an amino acid sequence that does not correspond to one found in nature. In the case of conserved residues, such substitutions should not result in a naturally-occurring sequence.
4. Glucoamylase Variants
The variants according to the disclosure include at least one substitution, deletion or insertion in the amino acid sequence of a parent glucoamylase that makes the variant different in sequence from a parent glucoamylase. In some embodiments, the variants of the disclosure will have at least about 20%, about 40%, about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 97%, or about 100% of the glucoamylase activity as that of the TrGA (SEQ ID NO: 2), a parent glucoamylase that has at least 80% sequence identity to TrGA (SEQ ID NO: 2). In some embodiments, the variants according to the disclosure will comprise a substitution, deletion or insertion in at least one amino acid position of the parent TrGA (SEQ ID NO: 2), or in an equivalent position in the sequence of another parent glucoamylase having at least about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, or about 99% sequence identity to the TrGA sequence (SEQ ID NO: 2).
In other embodiments, the variant according to the disclosure will comprise a substitution, deletion or insertion in at least one amino acid position of a fragment of the parent TrGA, wherein the fragment comprises the catalytic domain of the TrGA sequence (SEQ ID NO: 3) or in an equivalent position in a fragment comprising the catalytic domain of a parent glucoamylase having at least about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, or about 99% sequence identity to the catalytic-domain-containing fragment of the SEQ ID NO: 3, 5, 6, 7, 8, or 9. In some embodiments, the fragment will comprise at least about 400, about 425, about 450, or about 500 amino acid residues of TrGA catalytic domain (SEQ ID NO: 3).
In other embodiments, the variant according to the disclosure will comprise a substitution, deletion or insertion in at least one amino acid position of a fragment of the parent TrGA, wherein the fragment comprises the starch binding domain of the TrGA sequence (SEQ ID NO: 11) or in an equivalent position in a fragment comprising the starch binding domain of a parent glucoamyiase having at least about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, or about 99% sequence identity to the starch-binding-domain-containing fragment of SEQ ID NO: 11, 385, 386, 387, 388, 389, and 390. In some embodiments, the fragment will comprise at least about 40, about 50, about 60, about 70, about 80, about 90, about 100, or about 109 amino acid residues of TrGA starch binding domain (SEQ ID NO: 11).
In some embodiments, when the parent giucoamylase includes a catalytic domain, a linker region, and a starch binding domain, the variant will comprise a substitution, deletion or insertion in at least one amino acid position of a fragment comprising part of the linker region. In some embodiments, the variant will comprise a substitution deletion, or insertion in the amino acid sequence of a fragment of the TrGA sequence (SEQ ID NO: 2).
Structural identity with reference to an amino acid substitution means that the substitution occurs at the equivalent amino acid position in the homologous glucoamyiase or parent glucoamyiase. The term equivalent position means a position that is common to two parent sequences that is based on an alignment of the amino acid sequence of the parent giucoamylase in question as well as alignment of the three-dimensional structure of the parent glucoamyiase in question with the TrGA reference glucoamyiase amino acid sequence and three-dimensional sequence. For example, with reference to FIG. 5A, position 24 in TrGA (SEQ ID NO: 2 or 3) is D24 and the equivalent position for Aspergillus nlger (SEQ ID NO: 6) is position D25, and the equivalent position for Aspergillus oryzea (SEQ ID NO: 7) is position D26. See FIGs. 6 and 7 for an exemplary alignment of the three-dimensional sequence.
Accordingly, in one aspect, a giucoamylase variant is described, which giucoamylase variant when in its crystal form has a crystal structure for which the atomic coordinates of the main chain atoms have a root-mean-square deviation from the atomic coordinates of the equivalent main chain atoms of TrGA (as defined in Table 20 in WO2009/067218) of less than 0.13 nm following alignment of equivalent main chain atoms, and which have a linker region, a starch binding domain and a catalytic domain, said variant comprising two or more amino acid substitutions relative to the amino acid sequence of the parent giucoamylase in interconnecting loop 2' of the starch binding domain, and/or in loop 1, and/or in helix 2, and/or in loop 11, and/or in helix 12 of the catalytic domain. In a further aspect, the root- mean-square deviation from the atomic coordinates of the equivalent main chain atoms of TrGA (as defined in Table 20 in WO2009/067218) is (ess than 0.12 nm, such as less than 0.11 or such as less than 0.10.
In one aspect, a glucoamylase variant is described, which glucoamylase variant comprises a starch binding domain and a catalytic domain, said variant comprising two or more amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 2 or equivalent parent glucoamylase in interconnecting loop 2', and/or in loop 1, and/or in helix 2, and/or in loop 11, and/or in helix 12 for reducing the synthesis of condensation products during hydrolysis of starch.
In a further aspect, a glucoamylase variant is described, which glucoamylase variant comprises two or more amino acid substitutions relative to interconnecting loop 2' with the amino acid sequence from position 518 to position 543 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase, and/or loop 1 with the amino acid sequence from position 21 to position 51 of SEQ ID NO; 2 or equivalent sequence of residues in a parent glucoamylase, and/or helix 2 with the amino acid sequence from position 52 to position 68 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or loop 11 with the amino acid sequence from position 396 to position 420 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or helix 12 with the amino acid sequence from position 421 to position 434 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase.
In a further aspect, a glucoamylase variant is described, which glucoamylase variant comprises two or more amino acid substitutions relative to the amino acid sequence from position 518 to position 543 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 21 to position 51 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 52 to position 68 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 396 to position 420 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or the amino acid sequence from position 421 to position 434 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase.
In one aspect, the two or more amino acid substitutions are relative to the interconnecting loop 2' with the amino acid sequence from position 518 to position 543 e.g. in one or more of positions 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542 and/or 543 of SEQ ID NO: 2, and/or loop 1 with the amino acid sequence from position 21 to position 51 e.g. in one or more of positions 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 and/or 51 of SEQ ID NO: 2, and/or helix 2 with the amino acid sequence from position 52 to position 68 e.g. in one or more of positions 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67 and/or 68 of SEQ ID NO: 2, and/or loop 11 with the amino acid sequence from position 396 to position 420 e.g. in one or more of positions 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419 and/or 420 of SEQ ID NO:2, and/or helix 12 with the amino acid sequence from position 421 to position 434 e.g. in one or more of positions 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433 and/or 534 of SEQ ID NO:2.
In a further aspect, the two or more amino acid substitutions are at least one amino acid substitution in the interconnecting loop 2' and at least one amino acid substitution in loop 1 and/or helix 2 and/or loop 11 and/or helix 12. In a further aspect, the two or more amino acid substitutions are 1, 2, 3 or 4 amino acid substitutions in the interconnecting loop 2' and 1, 2, 3 or 4 amino acid substitutions in loop 1 and/or helix 2 and/or loop 11 and/or helix 12.
In a further aspect, the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in loop 1. In a further aspect, the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution In helix 2. In a further aspect, the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in loop 11. In a further aspect, the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in helix 12. In a further aspect, the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in loop 1 and at least one amino acid substitution in helix 2. In a further aspect, the glucoamylase variant has at least one amino acid substitution within position 520-543, 530-543, or 534-543 of interconnecting loop 2', the positions corresponding to the respective position in SEQ ID NO:2 or equivalent positions in a parent glucoamylase. In a further aspect, the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 30-50, 35-48, or 40-46 of loop 1, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase. In a further aspect, the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 50-66, 55-64, or 58-63 of helix 2, the positions corresponding to the respective position in SEQ ID NO:2 or equivalent positions in a parent glucoamylase. In a further aspect, the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 405-420, 410-420, or 415-420 of loop 11, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase. In a further aspect, the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 421-434, 425-434, or 428-434 of helix 12, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase.
In one aspect, the glucoamylase variant comprises two or more amino acid substitutions, wherein an amino acid substitution is in position 539 and an amino acid substitution is in position 44, the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase, and which sequence has at least 80% sequence identity to the parent glucoamylase, and wherein the amino acid substitution in position 44 is not 44C.
In a further aspect, the glucoamylase variant comprises two or more amino acid
substitutions, wherein an amino acid substitution is in position 539 and an amino acid substitution is 44R, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase. In a further aspect, the glucoamylase variant comprises an amino acid substitution in position 61, the position corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase, In a further aspect, the amino acid substitution in position 539 is 539R, the position corresponding to the respective position In SEQ ID NO: 2 or an equivalent position in a parent glucoamylase. In a further aspect, the amino acid substitution in position 44 is 44R, the position
corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase. In a further aspect, the amino acid substitution in position 61 is 611, the position corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase.
In a further aspect, the glucoamylase variant comprises the following amino acid
substitutions: a) D44R and A539R; or b) D44R, N61I and A539R, the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position In a parent glucoamylase. In a further aspect, the glucoamylase variant consist of SEQ ID NO: 2 and has the following amino acid substitutions: a) D44R and A539R; or b) D44R, N61I and A539R, the positions corresponding to the respective position in SEQ ID NO: 2.
In a further aspect, the glucoamylase variant has a starch binding domain that has at least 96%, 97%, 98%, 99%, or 99.5% sequence identity with the starch binding domain of SEQ ID NO: 1, 2, 11, 385, 386, 387, 388, 389, or 390. In a further aspect, the glucoamylase variant has a catalytic domain that has at least 80%, 85%, 90%, 95%, or 99.5% sequence identity with the catalytic domain of SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9.
In a further aspect, the parent glucoamylase is a fungal glucoamylase.
In a further aspect, the parent glucoamylase is selected from a glucoamylase obtained from a Trichoderma spp., an Aspergillus spp. , a Humicola spp. , a Penicillium spp. , a Ta/aromycese spp. , or a Schizosaccharmyces spp.
In a further aspect, the parent glucoamylase is obtained from a Trichoderma spp. or an Aspergillus spp.
In a further aspect, the glucoamylase has been purified. The glucoamylases of the present disclosure may be recovered or purified from culture media by a variety of procedures known in the art including centrifugation, filtration, extraction, precipitation and the like.
In some embodiments, the glucoamylase variant will include at least two substitutions in the amino acid sequence of a parent. In further embodiments, the variant may have more than two substitutions. For example, the variant may have 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 amino acid substitutions, deletions, or insertions as compared to a corresponding parent glucoamylase.
In some embodiments, a glucoamylase variant comprises a substitution, deletion or insertion, and typically a substitution in at least one amino acid position in a position corresponding to the regions of non-conserved amino acids as illustrated in FIGs. 5A, 5B, 5D, and 5E (e.g., amino acid positions corresponding to those positions that are not designated by "*" in FIGs. 5A, 5B, 5D, and 5E). While the variants may have substitutions in any position of the mature protein sequence (SEQ ID NO: 2), in some embodiments, a glucoamylase variant comprises two or more substitutions in the following positions in the amino acid sequence set forth in SEQ ID NO: 2 : 23, 42, 43, 44, 59, 60, 61, 65, 67, 68, 410, 417, 418, 430, 431, 433, 518, 519, 520, 527, 531, 535, 536, 537 or 539, or in an equivalent position in a parent glucoamylase. In a further aspect, the glucoamylase variant comprises one or more further substitutions in the following positions in the amino acid sequence set forth in SEQ ID NO: 2: 10, 14, 15, 72, 73, 97, 98, 99, 102, 110, 113, 114, 133, 140, 144, 145, 147, 152, 153, 164, 182, 204, 205, 214, 216, 219, 228, 229, 230, 231, 236, 239, 241, 242, 263, 264, 265, 268, 269, 276, 284, 291, 294, 300, 301, 303, 311, 338, 342, 344, 346, 349, 359, 361, 364, 375, 379, 382, 390, 391, 393, 394, 436, 442, 444, 448, 451, 493, 494, 495, 502, 503, 508, 511, 563, or 577, or in an equivalent position in a parent glucoamylase. In some embodiments, the parent
glucoamylase will have at least about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity with SEQ ID NO: 2. In other embodiments, the parent glucoamylase will be a Trichoderma
glucoamylase homologue. In some embodiments, the variant will have altered properties. In some embodiments, the parent glucoamylase will have structural identity with the glucoamylase of SEQ ID NO: 2.
In some embodiments, the glucoamylase variant comprises two or more substitutions in the following positions in the amino acid sequence set forth in SEQ ID NO: 2 : P23, T42, 143, D44, P45, D46, F59, K60, N61, T67, E68, R408, S410, S415, L417, H418, T430, A431, R433, N518, A519, A520, T527, V531, A535, V536, N537, and A539 or an equivalent position in parent glucoamylase (e.g., a Trichoderma glucoamylase homologue). In a further aspect, the glucoamylase variant comprises one or more substitutions in the following positions in the amino acid sequence set forth in SEQ ID NO: 2: T10, L14, N15, A72, G73, S97, L98, A99, S1Q2, K108, E110, L113, K114, R122, Q124, R125, 1133, 140, N144, N145, Y147, S152, N 153, N164, F175, N182, A204, T205, S214, V216, Q219, W228, V229, S230, S231, D236, 1239, N240, T241, N242, G244, N263, L264, G265, A268, G269, D276, V284, S291, G294, P300, A301, A303, Y310, A311, D313, Y316, V338, T342, S344, T346, A349, V359, G361, A364, T375, N379, S382, S390, E391, A393, K394, 1436, A442, N443, S444, T448, S451, T493, P494, T495, H502, E503, Q508, Q511, N563, and N577 or in an equivalent position in a parent glucoamylase. In some embodiments, the variant will have altered properties as compared to the parent glucoamylase.
In some embodiments, the glucoamylase variant may differ from the parent glucoamylase only at the specified positions. In further embodiments, the variant of a glucoamylase parent comprises at least two of the following substitutions in the following positions in an amino acid sequence set forth in SEQ ID NO: 2: T42V, I430JR, D44R/C, N61I, T67M, E68C/M, L417 /R/V, T430A/K, A431I/L/Q, R433C/E/G/L/N/S/V/Y, A519I/K/R/Y, A520C/L/P, V531L, A535K/N/P/R, V536M, or
A539E/R/S, or a substitution in an equivalent position in a parent glucoamylase. In a further aspect, the glucoamylase variant comprises one or more substitutions in the following positions in the amino acid sequence set forth In SEQ ID NO: 2: T10S, A72Y, G73F/W, S97N, S102A/M/R, K114M/Q, I133T/V, N145I, N153A/D/E/M/S/V, T205Q, Q219S, W228A/F/H/ /V, V229I/L, S230C/F/G/L/N/Q/R, S231L/V, D236R, I239V/Y, N263P, L264D/K, A268C/D/G/K, S291A/F/H/M/T, g294c, A301P/R, V338I/N/Q, T342V, S344M/P/Q R V,
G361D/E/F/I/L/M/P/S/W/Y, A364D/E/F/G/K/1./M/R/S/T/V/W, T375N, 394S, I436H, T451K, T495K/M/S, E503A/C/V, Q508R, Q511H, N563C/E/I/K/ /Q/T/V, or N577K/P/R, or in an equivalent position in a parent glucoamylase.
In further embodiments, the glucoamylase variant comprises one of the following sets of substitutions, at the relevant positions of SEQ ID NO: 2, or at equivalent positions in a parent glucoamylase:
N61I/L417V/A431L/A539R;
I43Q/N61I/L417V/A431L/A539R;
N61I/L417V/A431L/A535R/A539R
I43Q/L417V/A431L/A535R/A539R;
I43Q/N61I/L417V/A431L/A535R/A539R;
I43Q/N61I/L417V/T430A/A431L7A535R/A539R;
I43Q/L417V/T430A/A431UQ511H/A535R/A539R N563I;
N61I/L417V/T430A/A431L/Q511H/A535R/A539R/N563I;
I43Q N61I/L417V/T430A/A431L/Q511H/A535R/A539R N563I;
r43R/N61I/L417V/A431L/A539R;
I43R/N61I/L417V/T430A/A431L7A535R/A539R;
G73F/L417R/E503V/A539R/N563K;
I43R G73F/L417R/E503V/A539R/N563K; and
I43R/G73F/E503V/Q511H/N563K.
In further embodiments, the glucoamylase variant comprises one of the following sets of substitutions, at positions of SEQ ID NO: 2 or equivalent positions in a parent glucoamylase: L417V/A431L/A539R;
I43Q/L417V/A431L/A539R;
L417V/A431L/A535R/A539R
I43R/L417V/A431L/A539R;
L417R/A431L/A539R; or L417G/A431L/A539R;
wherein the glucoamylase variant does not have any further substitutions relative to the parent glucoamylase, and wherein the parent glucoamylase has a catalytic domain that has at least 80% sequence Identity with SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9. Thus the parent glucoamylase may be any of those described elsewhere.
The parent glucoamylase may comprise a starch binding domain that has at least 95% sequence identity with SEQ ID NO: 1, 2, 11, 385, 386, 387, 388, 389, or 390. The parent glucoamylase may have at least 80% sequence identity with SEQ ID NO: 1 or 2; for example it may comprise SEQ ID NO: 1 or 2. Optionally the parent glucoamylase may consist of SEQ ID NO: 1 or 2.
Glucoamylase variants of the disclosure may also include chimeric or hybrid glucoamylases with, for example a starch binding domain (SBD) from one glucoamylase and a catalytic domain and linker from another. For example, a hybrid glucoamylase can be made by swapping the SBD from AnGA (SEQ ID NO: 6) with the SBD from TrGA (SEQ ID NO: 2), making a hybrid with the AnGA SBD and the TrGA catalytic domain and linker. Alternatively, the SBD and linker from AnGA can be swapped for the SBD and linker of TrGA.
In some aspects, the variant glucoamylase exhibits altered thermostability as compared to the parent glucoamylase. In some aspects, the altered thermostability may be increased thermostability as compared to the parent glucoamylase. In some embodiments, the altered property is altered specific activity compared to the parent glucoamylase. In some embodiments, the altered specific activity may be increased specific activity compared to the parent glucoamylase. In some embodiments, the altered property is increased
thermostability at lower temperatures as compared to the parent glucoamylase. In some embodiments, the altered property is both increased specific activity and increased thermostability as compared to the parent glucoamylase.
In one embodiment, some variants may include the substitutions at positions:
D44R/N61I/A539R;
D44R/A539R;
I43QJD44C/L417V/E503A/Q511H/A539R;
I43Q/L417V/E503A/Q511H/A539R;
I43Q/D44C/N61I/L417V/E503A/Q511H/A539R;
I43Q/N61I/L417V/E503A/Q511H/A539R;
I43R/L417V/E503A/Q511H/A539R;
I43R/N61I/L417V/E503A/Q511H/A539R;
I43R/L417R/E503A/A539R;
I43R/N61I/L417R E503A/Q511H/A539R;
G73F/T430A/Q511H;
I43R/G73F/T430A; G73F/T430A/E503V/Q511H;
D44C/G73F/N563K;
D44C/G73F/E503V/Q511 H ;
D44C/G73F/N563K;
D44C/G73F/L417R/N563K;
D44C/G73F/N563K;
I43R/T430A;
I43Q/T430A;
I43Q/T430A/Q511H ;
D44C/L417R/N563K;
L417V/T430A/A431L/Q511H/A535R/A539R N563I;
L417V/T430A/A431Q/Q511H/A535R/A539R/N563I;
L417V/T430A/Q511H/A535R/N563I;
L417V/T430A/Q511H/A539R/N563I;
G294C/L417R/A431L;
G294C/L417V/A431Q;
G294C/L417V/A431L/Q511H;
G294C/L417R/A431Q/Q511H;
L417R/A431L/Q511H;
L417V/A431Q/Q511H;
I43Q/T430A/Q511H/N61I;
I43Q/T430A/Q511H/L417V;
I43Q/T430A/Q511H/A431L;
I43Q/T430A/Q511 H/E503A;
I43Q/T430A/Q511H/A539R;
I43Q/T430A/Q511H/N61I/A539R;
I43Q/T430A/Q511H/L417V/A539R;
I43Q/T430A/Q511 H/A431L/A539R;
I43Q/T430A/Q511H/A431L E503A;
I43Q/T430A/Q511H/N61I/A539R/A431L;
I43Q/T430A/Q511H/L417V/A539R/A431L;
I43Q/Q511H/N61I;
I43Q/Q511H/L417V;
I43Q/Q511H/A431L;
I43Q/Q511H/A539R;
I43Q/Q511H/A539R/N61I;
I43Q/Q511H/A539R/E503A;
I43Q/Q511H/A539R/T430M;
I43Q Q511H/A539R/T430M/N61I;
I43Q Q511H/A539R/T430M/N61I/L417V;
I43R/T430A/E503V/A535R/N563K;
D44R/E503A/Q511H/N563I;
E503A/N563I;
I43R/T430A/E503A/Q511H/N563 ;
D44R/T430A/Q511H/A535R;
L417V/A431L/A539R;
L417V/A4311./A539R/I43Q;
L417V/A431L/A539R/N61I;
L417V/A431L/A539R/A535R;
L417V/A431L/A539R/I43Q/N61I;
L417V/A431L/A539R/N61I/A535R;
L417V/A431L/A539R/A535R I43Q;
L417V/A431L/A539R/I43Q/N61I/A535R;
L417V/A431L/A539R/I43Q/N61I/A535R/T430A;
L417V/T430A/A431L/Q511H/A535R/A539R/N563I/I43Q;
L417V/T430A/A431L/Q511H/A535R/A539R/N563I/N61I;
L417V/T430A/A431L/Q511H/A535R/A539R/N563I/I43Q/N61I
L417V/A431 L/A539R/I43 R;
L417V/A431L A539R I43R/N61I; L417V/A431L/A539R/I43R/N61I/A535R/T430A;
L417R/A431L/A539R;
L417G/A431L/A539R;
G73F/E503V/N563K/L417R/A539R;
G73F/E503V/N563K/I43R/L417R/A539R; and
G73F/E503V/N563K/I43R/Q511H of SEQ ID NO: 2, or equivalent positions in parent glucoamylases and particulady Trichoderma glucoamylase homologues.
In a further embodiment, some variants may include the substitutions at positions: D44R/N61I/A539R;
D44R/A539R;
I43Q/D44C/L417V/E503A/Q511H/A539R;
I43Q L417V/E503A/Q511H/A539R;
I43Q/D44C/N61I/L417V/E503A/Q511H/A539R;
I43Q/N61I/L417V/E503A/Q511H/A539R;
I43R/L417V/E503A/Q511H/A539R;
I43R/N61I/L417V/E503A/Q511H/A539R;
I43R/L417R/E503A/A539R;
I43R/N61I/L417R/E503A/Q511H/A539R;
L417V/T430A/A431L/Q511H/A535R A539R/N563I;
L417V/T430A/A431Q Q511H/A535R/A539R/N563I;
L417V/T430A/Q511H/A539R/N563I;
I43OJT430A/Q511 H/A539R;
I43OJT430A/Q511H/N61I/A539R;
I43OJT430A/Q511H/L417V/A539R;
I43OJT430A/Q511H/A431L7A539R;
I43Q/T430A/Q511H/N61I/A539R/A431L;
I43Q/T430A/Q511H/L417V/A539R/A431L;
I43Q/Q511H/A539R;
I43Q/Q511H/A539R/N61I;
I43Q/Q511H/A539R/E503A;
I43Q/Q511H/A539R/T430M ;
I43Q/Q511H/A539R/T430M/N61I;
I43OJQ511H/A539R/T430M/N61I/L417V;
L417V/A431L/A539R;
L417V/A431L/A539R I43Q;
L417V/A431iyA539R N61I;
L417V/A431L A539R A535R;
L417V/A4311. A539R/I43Q/N61I;
L417V/A431L/A539R/N61I/A535R;
L417V/A431L/A539R/A535R/I43Q;
L417V/A431L7A539R/I43Q/N61I/A535R;
L417V/A431L/A539R/I43Q IM61I/A535R T430A;
L417V/T430A/A4311- Q511H/A535R A539R/N563I/I43Q;
L417V/T430A/A431L/Q511H/A535R A539R/N563I/N61I;
L417V/T430A/A431L Q511H/A535R/A539R/N563I/I43Q/N61I;
L417V/A431L/A539R/I43R;
L417V/A431L/A539R/I43R/N61I;
L417V/A431L/A539R/I43R/N61I/A535R/T430A;
L417R/A431L/A539R;
L417G/A431I7A539R;
G73F/E503V/N563K/L417R/A539R; and G73F/E503V/N563K/I43R/L417R/A539R
of SEQ ID NO: 2, or equivalent positions in parent glucoamylases and particularly Trichoderma glucoamylase homoiogues. In a further embodiment, some variants may include the substitutions at positions:
D44R/N61I/A539R;
D44R/A539R;
I43OJD44C/L417V/E503A/Q511H/A539R;
I43Q/L417V/E503A/Q511H/A539R;
I43Q/D44C/N61I/L417V/E503A/Q511H/A539R;
I43Q/N61I/L417V/E503A/Q511H/A539R;
I43R/L417V/E503A/Q511H/A539R;
I43R/N61I/L417V/E503A/Q511H/A539R;
I43R/L417R E503A/A539R;
I43R/N61I/L417R/E503A/Q511H/A539R;
L417V/T430A/A431L/Q511H/A535R/A539R/N563I;
L417V/T430A/A431Q Q511H/A535R/A539R/N563I;
L417V/T430A/Q511 H/A539R/N563I ;
I43Q T430A/Q511H/A539R;
I43Q T430A/Q511H/N61I/A539R;
I43Q/T430A/Q511H/L417V/A539R;
I43OJT430A/Q511H/A431LyA539R;
I43Q/T430A/Q511H/N61I/A539R/A431L;
I43Q/T430A/Q511 H/L417V/A539R/A431 L;
I430JQ511H/A539R;
I43Q/Q511H/A539R/N61I;
I43OJQ511H/A539R/E503A;
I43Q/Q511H/A539R/T430M;
I43Q/Q511H/A539R/T430M/N61I;
I43OJQ511H/A539R T430M/N61I/L417V;
L417V/A431L/A539R;
L417V/A431 L/A539R/I43Q;
L417V/A431L/A539R/N61I;
L417V/A431L/A539R/A535R;
L417V/A431L/A539R/I430JN61I;
L417V/A431L/A539R/N61I/A535R;
L417V/A431L/A539R/A535R/I43Q;
L417V/A431L/A539R I430JN61I/A535R;
L417V/A431L- A539R/I43OJN61I/A535R/T430A;
L417V/T430A/A431L/Q511H/A535R/A539R/N563I/I43Q;
L417V/T430A/A431L Q511H/A535R/A539R/N563I/N61I;
L417V/T430A/A431L/Q511H/A535R/A539R/N563I/I43OJN6H;
L417V/A431L/A539R I43R;
L417V/A431 L/A539R/I43 R/N6 II;
L417V/A431L/A539R/I43R/N61I/A535R/T430A;
L417R/A431L/A539R;
L417G/A431L A539R;
G73F/E503V/N563K/L417R/A539R; and
G73F/E503V/N563 /I43R/L417R/A539R
of SEQ ID NO: 2, or equivalent positions in parent glucoamylases and particularly Trichoderma glucoamylase homoiogues. In a further embodiment, some variants may include the substitutions at positions:
D44R/N61I/A539R;
D44R A539R;
L417V/A431L/A539R;
L417V/A431L/A539R/I43Q;
L417V/A431L/A539R/N61I;
of SEQ ID NO: 2, or equivalent positions in parent glucoamylases and particularly
Trichoderma glucoamylase homologues.
In a further embodiment, some variants may include the substitutions at positions:
D44R/N61I/A539R;
D44R/A539R
of SEQ ID NO: 2, or equivalent positions in parent glucoamylases and particularly
Trichoderma glucoamylase homologues.
In a further embodiment, some variants has the following substitutions: D44R/N61I/A539R or D44R/A539R of SEQ ID NO: 2.
In a further embodiment, the variant comprises SEQ ID NO: 1098, In yet a further embodiment, the variant consists of SEQ ID NO: 1098. In a further embodiment, the variant comprises SEQ ID NO: 1099. In yet a further embodiment, the variant consists of SEQ ID NO: 1099.
A number of parent glucoamylases have been aligned with the amino acid sequence of TrGA. Figure 5 includes the catalytic domain of the following parent glucoamylases Aspergillus awamori (AaGA) (SEQ ID NO: 5); Aspergillus niger (AnGA) (SEQ ID NO: 6); Aspergillus orzyae (AoGA) (SEQ IDNO: 7); Humicola grisea (HgGA) (SEQ ID NO: 8); and Hypocrea vinosa (HvGA) (SEQ ID NO: 9). The % identity of the catalytic domains is represented in Table 1 below.
Table 1: Sequence homology between various fungal glucoamylases In some embodiments, for example, the variant glucoamyiase will be derived from a parent glucoamyiase that is an Aspergillus glucoamyiase, a Humicola glucoamyiase, or a Hypocrea glucoamyiase.
5. Characterization of Variant Glucoamylases
The present disclosure also provides glucoamyiase variants having at least one altered property (e.g., improved property) as compared to a parent glucoamyiase and particularly to the TrGA. In some embodiments, at least one altered property (e.g., improved property) Is selected from the group consisting of IS/SH-ratio, starch hydrolysis activity, real degree of fermentation, reduced formation of condensation products, acid stability, thermal stability and specific activity. Typically, the altered property is reduced IS/SH-ratio, enhanced real degree of fermentation, reduced formation of condensation products, increased thermal stability and/or increased specific activity. The increased thermal stability typically is at higher temperatures. In one embodiment, the increased pH stability is at high pH. In a further embodiment, the increased pH stability is at low pH.
The glucoamyiase variants of the disclosure may also provide higher rates of starch hydrolysis at low substrate concentrations as compared to the parent glucoamyiase. The variant may have a higher Vmax or lower Km than a parent glucoamyiase when tested under the same conditions. For example the variant glucoamyiase may have a higher Vmax at a temperature range of about 25°C to about 70oc (e.g., about 25°C to about 35°C; about 30°C to about 35°C; about 40°C to about 50°C; at about 50°C to about 55°C, or about 55°C to about 62°C). The ichaelis-Menten constant, Km and VmaK values can be easily determined using standard known procedures. In another aspect, the glucoamyiase may also exhibit a reduced starch hydrolysis activity which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent glucoamyiase such as TrGA.
5.1. Variant Glucoamylases with Altered Thermostability
In some aspects, the disclosure relates to a variant glucoamyiase having altered thermal stability as compared to a parent (wild-type). Altered thermostability can be at increased temperatures or at decreased temperatures. Thermostability is measured as the % residual activity after incubation for 1 hour at 64°C in NaAc buffer pH 4.5. Under these conditions, TrGA has a residual activity of between about 15% and 44% due to day-to-day variation as compared to the initial activity before incubation. Thus, in some embodiments, variants with increased thermostability have a residual activity that is between at least about 1% and at least about 50% more than that of the parent (after incubation for 1 hour at 64°C in NaAc buffer pH 4.5), including about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, and about 50% as compared to the initial activity before incubation. For example, when the parent residual activity is 15%, a variant with increased thermal stability may have a residual activity of between about 16% and about 75%. In some embodiments, the glucoamylase variant will have improved thermostability such as retaining at least about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 92%, about 95%, about 96%, about 97%, about 98%, or about 99% enzymatic activity after exposure to altered temperatures over a given time period, for example, at least about 60 minutes, about 120 minutes, about 180 minutes, about 240 minutes, or about 300 minutes. In some embodiments, the variant has increased thermal stability compared to the parent glucoamylase at selected temperatures in the range of about 40°C to about 80°C, also in the range of about 50°C to about 75°C, and in the range of about 60°C to about 70°C, and at a pH range of about 4.0 to about 6.0. In some embodiments, the thermostability is determined as described in the Assays and Methods. That method may be adapted as appropriate to measure thermostability at other
temperatures. Alternatively the thermostability may be determined at 64°C as described there. In some embodiments, the variant has increased thermal stability at lower temperature compared to the parent glucoamylase at selected temperature in the range of about 20°C to about 50°C, including about 35°C to about 45°C and about 30°C to about 40°C.
In some embodiments, variants having an Improvement in thermostability include one or more deletions, substitutions or insertions and particularly substitutions in the following positions in the amino acid sequence set forth in SEQ ID NO: 2: 10, 42, 43, 44, 59, 61, 68, 72, 73, 97, 98, 99, 102, 114, 133, 140, 144, 152, 153, 182, 204, 205, 214, 216, 228, 229, 230, 231, 236, 241, 242, 263, 264, 265, 268, 269, 276, 284, 291, 294 300, 301, 303, 311, 338, 342, 344, 346, 349, 359, 361, 364, 375, 379, 382, 390, 391, 393, 394, 410, 417, 430, 431, 433, 436, 442, 444, 448, 451, 493, 495, 503, 508, 511, 518, 519, 520, 527, 531, 535, 536, 537, 539, 563, or 577, or an equivalent position In a parent glucoamylase. In some embodiments, the parent glucoamylase will be a Trichoderma glucoamylase homologue and in further embodiments, the parent glucoamylase will have at least about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 98% sequence identity to SEQ ID NO: 2. In some embodiments, the parent glucoamylase will also have structural identity to SEQ ID NO: 2. In some embodiments, the variant having increased thermostability has a substitution in at least one of the positions: T10S, T42V, I43Q, I43R, D44C, D44R, E68C, E68M, G73F, G73W, K114M, K114Q, U33V, N153A, N153E, N153M, N153S, N153V, W228V, V229I, V229L, S230Q, S231V, D236R, L264D, L264K, A268D, S291A, S291F, S291H, S291M, S291T, G294C, A301P, A301R, V338I, V338N, V338Q, S344M, S344P, S344Q, S344R, S344V, G361D, G361E, G361F, G361I, G361L, G361M, G361P, G361S, G361W, G361Y, A364D, A364E, A364F, A364G, A364K, A364L, A364M, A364R, A364S, A364T, A364V, A364W, T375N, L417K, L417R, R433C, R433E, R433G, R433L, R433N, R433S, R433V, I436H, T495K, T495S, E503A, E503C, E503V, Q508R, Q511H, A519K, A519R, A519Y, V531L, A535K, A535N, A535P, A535R, A539E, A539R, A539S, N563C, N563E, N563I, N563K, N563L, N563Q, N563T, N563V, N577K, N577P, or N577R of SEQ ID NO: 2.
5.2. Variant Glucoamylases with Altered Specific Activity
As used herein, specific activity is the activity of the glucoamylase per mg of protein. Activity was determined using the ethanol assay. The screening identified variants having a
Performance Index (PI) >1.0 compared to the parent TrGA PI. The PI is calculated from the specific activities (activity/mg enzyme) of the wild-type (WT) and the variant enzymes. It is the quotient "Variant-specific act!vity/WT-speciflc activity" and can be a measure of the increase in specific activity of the variant. A PI of about 2 should be about 2 fold better than WT. In some aspects, the disclosure relates to a variant glucoamylase having altered specific activity as compared to a parent or wild-type glucoamylase. In some embodiments, the altered specific activity is increased specific activity. Increased specific activity can be defined as an increased performance Index of greater than or equal to about 1, including greater than or equal to about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, and about 2. In some embodiments, the increased specific activity is from about 1.0 to about 5.0, including about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2., about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, about 4.0, about 4.1, about 4.2, about 4.3, about 4.4, about 4.5, about 4.6, about 4.7, about 4.8, and about 4.9. In some embodiments, the variant has an at least about 1.0 fold higher specific activity than the parent glucoamylase, including at least about 1.1 fold, about 1.2 fold, about 1.3 fold, about 1,4 fold, about 1.5 fold, about 1.6 fold, about 1.7 fold, about 1.8 fold, about 1.9 fold, about 2,0 fold, about 2.2 fold, about 2.5 fold, about 2.7 fold, about 2.9 fold, about 3.0 fold, about 4.0 fold, and about 5.0 fold.
In some embodiments, variants having an improvement in specific activity include one or more deletions, substitutions or insertions in the following positions in the amino acid sequence set forth in SEQ ID NO: 2: 10, 14, 15, 23, 59, 60, 61, 65, 67, 68, 72, 73, 97, 98, 99, 102, 110, 113, 133, 140, 144, 145, 147, 152, 153, 164, 182, 204, 205, 214, 216, 219, 228, 229, 230, 231, 236, 239, 241, 242, 263, 264, 265, 268, 269, 276, 284, 291, 300, 301, 303, 311, 338, 342, 344, 346, 349, 359, 361, 364, 375, 379, 382, 390, 391, 393, 394, 410, 417, 418, 430, 431, 433, 442, 444, 448, 451, 493, 494, 495, 502, 503, 508, 511, 518, 519, 520, 531, 535, 536, 539, or 563, or an equivalent position in a parent glucoamylase. In some embodiments, the parent glucoamylase will comprise a sequence having at least about 50%, about 60%, about 70%, about 80%, about 90%, or about 95% sequence identity to the sequence of SEQ ID NO: 2. In some embodiments, the parent glucoamylase will also have structural identity to SEQ ID NO: 2. In some embodiments, variants of the disclosure having improved specific activity include a substitution in the following positions In the amino acid sequence set forth in SEQ ID NO: 2: I43Q, I43R, D44C, D44R, N061I, T067M, A072Y, S097N, S102A, S102M, S102R, I133T, N145I, N153D, T205Q, Q219S, W228A, W228F, W228H, W228M, S230C, S230F, S230G, S230L, S230N, S230Q, S230R, S231L, I239V, I239Y, N263P, A268C, A268G, A268K, S291A, G294C, T342V, K394S, L417R, L417V, T430K, A431I, A431L, A431Q, R433Y, T451 , T495M, A519I, A520C, A520L, A520P, A535R, V536 , A539R, N563K, or N563I, or an equivalent position in a parent glucoamylase. In some embodiments, the specific activity of the parent as compared to the variant is determined as described in the Assays and Methods.
5.3. Variant Glucoamylases with Both Altered Thermostability and Altered
Specific Activity
In some aspects, the disclosure relates to a variant glucoamylase having both altered thermostability and altered specific activity as compared to a parent {e.g. , wild-type). In some embodiments, the altered specific activity is an increased specific activity. In some embodiments, the altered thermostability is an increased thermostability at high
temperatures {e.g. , at temperatures above 80°C) as compared to the parent glucoamylase.
In some embodiments, variants with an increased thermostability and increased specific activity include one or more deletions, substitutions or insertions and substitutions in the following positions in the amino acid sequence set forth in SEQ ID NO: 2 : 10, 15, 43, 44, 59, 61, 68, 72, 73, 97, 99, 102, 140, 153, 182, 204, 205, 214, 228, 229, 230, 231, 236, 241, 242, 264, 265, 268, 276, 284, 291, 294, 300, 301, 303, 311, 338, 344, 346, 349, 359, 361, 364, 375, 379, 382, 391, 393, 394, 410, 430, 433, 444, 448, 451, 495, 503, 511, 520, 531, 535, 536, 539, or 563, or an equivalent position in a parent glucoamylase. In some embodiments, the parent glucoamylase will be a Tric oderma glucoamylase homologue and in further embodiments, the parent glucoamylase will have at least about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 98% sequence identity to SEQ ID NO: 2. In some embodiments, the parent glucoamylase will also have structural identity to SEQ ID NO: 2. In some embodiments, the variant having increased thermostability and specific activity has a substitution in at least one of the positions: I43Q R, D44C/R,
W228F/H/M, S230C/F/G/N/Q/R, S231L, A268C/D/G/K, S291A, G294C, R433Y, S451K, E503C, Q511H, A520C/L/P, or A535N/P/R of SEQ ID NO: 2.
5.4. Variant Glucoamylases with production of fermentable sugar(s)
In a further aspect, the glucoamylase exhibit an enhanced production of fermentable sugar(s) as compared to the parent glucoamylase such as TrGA. In a further aspect, the glucoamylase exhibit an enhanced production of fermentable sugars in the mashing step of the brewing process as compared to the parent glucoamylase such as TrGA. In a further aspect, the glucoamylase exhibit an enhanced production of fermentable sugars in the fermentation step of the brewing process as compared to the parent glucoamylase such as TrGA. In a further aspect, the the fermentable sugar is glucose. A skilled person within the field can determine the production of fermentable sugar(s) by e.g. HPLC techniques.
5.5 Variant Glucoamylases with a altered ratio between isomaltose synthesis and starch hydrolysis activity (IS/SH ratio)
In a further aspect, the glucoamylase exhibit a reduced ratio between isomaltose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase such as TrGA. In a further aspect, the glucoamylase exhibit a starch hydrolysis activity which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent glucoamylase such as TrGA.
In one aspect, a screening method for identification of a glucoamylase variant having a reduced synthesis of condensation products during hydrolysis of starch and the glucoamylse variants obtained by the method is provided, the method comprising the steps of measuring the isomaltose synthesis and starch hydrolysis activity of glucoamylase variants and selecting the variants having a reduced starch hydrolysis activity which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent glucoamylase and having a reduced ratio between isomaltose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase.
In some embodiments the glucoamylase variants are selecting for having a reduced ratio between isomaltose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase.
In some embodiments the glucoamylase variants are selecting for having the same or increased starch hydrolysis activity and reduced isomaltose synthesis, which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent glucoamylase and thereby having a reduced ratio between isomaltose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase.
In a further aspect, the g/ucoamylase exhibit an enhanced real degree of fermentation as compared to the parent glucoamylase such as TrGA.
5.6 Variant Glucoa myiases with an altered formation of condensation products
In one aspect, the glucoamylase forms a lower amount of condensation products than the amount of condensation products formed by Aspergillus niger (AnGA) (SEQ ID NO: 6) under the same conditions. In a further aspect, the glucoamylase forms an amount of condensation products which amount is essentially the same as, not more than 5%, not more than 8% or not more than 10% higher than the amount of condensation products formed by Aspergillus niger (AnGA) (SEQ ID NO: 6) under the same conditions. In a further aspect, the dosing of the glucoamylases are the same based on protein concentration. In a further aspect, the dosing of the glucoamylases are the same based on measurement of activity in activity assays such as a GAU activity assay as described herein or a starch hydrolysation-activity assay also as described herein.
6. Polynucleotides Encoding Glucoamylases
The present disclosure also relates to isolated polynucleotides encoding the variant glucoamylase. The polynucleotides may be prepared by established techniques known in the art. The polynucleotides may be prepared synthetically, such as by an automatic DNA synthesizer. The DNA sequence may be of mixed genomic (or cDNA) and synthetic origin prepared by ligating fragments together. The polynucleotides may also be prepared by polymerase chain reaction (PC ) using specific primers. In general, reference is made to Minshu!l J. et al., Methods 32(4):416-427 (2004). DNA may also be synthesized by a number of commercial companies such as Geneart AG, Regensburg, Germany.
The present disclosure also provides isolated polynucleotides comprising a nucleotide sequence (i) having at least about 50% identity to SEQ ID NO: 4, including at least about 60%, about 70%, about 80%, about 90%, about 95%, and about 99%, or (ii) being capable of hybridizing to a probe derived from the nucleotide sequence set forth in SEQ ID NO: 4, under conditions of intermediate to high stringency, or (iii) being complementary to a nucleotide sequence having at least 90% sequence identity to the sequence set forth in SEQ ID NO: 4. Probes useful according to the disclosure may include at least about 50, about 100, about 150, about 200, about 250, about 300 or more contiguous nucleotides of SEQ ID NO: 4. In some embodiments, the encoded polypeptide also has structural identity to SEQ ID NO: 2.
The present disclosure further provides Isolated polynucleotides that encode variant glucoamylases that comprise an amino acid sequence comprising at least about 50%, about 60%, about 70%, about 80%, about 90%, about 93%, about 95%, about 97%, about 98%, or about 99% amino acid sequence identity to SEQ ID NO: 2. Additionally, the present disclosure provides expression vectors comprising any of the polynucleotides provided above. The present disclosure also provides fragments {i.e., portions) of the DNA encoding the variant glucoamylases provided herein. These fragments find use in obtaining partial length DNA fragments capable of being used to isolate or identify polynucleotides encoding mature giucoamylase enzymes described herein from filamentous fungal cells (e.g. , Trichoderma , Aspergillus, Fusarium, Penidllium, and Humicola), or a segment thereof having giucoamylase activity. In some embodiments, fragments of the DNA may comprise at least about 50, about 100, about 150, about 200, about 250, about 300 or more contiguous nucleotides. In some embodiments, portions of the DNA provided in SEQ ID NO: 4 may be used to obtain parent glucoamylases and particularly Trichoderma giucoamylase homologues from other species, such as filamentous fungi that encode a giucoamylase.
7. Production of Glucoamylases
7.1. DNA Constructs and Vectors
According to one embodiment of the disclosure, a DNA construct comprising a polynucleotide as described above encoding a variant giucoamylase encompassed by the disclosure and operably linked to a promoter sequence is assembled to transfer into a host cell. In one aspect, a polynucleotide encoding a giucoamylase variant as disclosed herein is provided.
The DNA construct may be introduced into a host cell using a vector. In one aspect, a vector comprising the polynucleotide, or capable of expressing a giucoamylase variant as disclosed herein is provided. The vector may be any vector that when introduced into a host cell is stably introduced. In some embodiments, the vector is integrated into the host cell genome and is replicated. Vectors include cloning vectors, expression vectors, shuttle vectors, piasmids, phage particles, cassettes and the like. In some embodiments, the vector is an expression vector that comprises regulatory sequences operably linked to the giucoamylase coding sequence. Examples of suitable expression and/or integration vectors are provided in Sambrook et al. (1989) supra, and Ausubel (1987) supra, and van den Hondel et al. (1991) in Bennett and Lasure (Eds.) More Gene Manipulations In Fungi, Academic Press pp. 396-428 and U.S. Patent No. 5,874,276. Reference is also made to the Fungal Genetics Stock Center Catalogue of Strains (FGSC, http://www.fgsc.net) for a list of vectors. Particularly useful vectors include vectors obtained from for example Invitrogen and Promega.
Suitable plasmids for use in bacterial cells include pB 322 and pUC19 permitting replication in E . coli and pE194 for example permitting replication in Bacillus. Other specific vectors suitable for use in E. coli host cells include vectors such as pFB6, pBR322, pUC18, pUClOO, pDONR™201, 10 pDONR™221, pENTR™, pGEM®3Z and pGEM®4Z.
Specific vectors suitable for use in fungal cells include pRAX, a general purpose expression vector useful in Aspergillus, pRAX with a g/aA promoter, and in Hypocrea/Trichoderma includes pTrex3g with a cbhl promoter.
In some embodiments, the promoter that shows transcriptional activity in a bacterial or a fungal host cell may be derived from genes encoding proteins either homologous or heterologous to the host cell. The promoter may be a mutant, a truncated and/or a hybrid promoter. The above-mentioned promoters are known in the art. Examples of suitable promoters useful in fungal cells and particularly filamentous fungal cells such as Trichoderma or Aspergillus cells include such exemplary promoters as the T. reesei promoters cbhl, cbhl, eg/1, eg/2, eg5, x/nl and xlnl. Other examples of useful promoters include promoters from A. awamori and A. niger glucoamylase genes (glaA) (see Nunberg et al., Mol. Cell Biol. 4: 2306-2315 (1984) and Boel et al., EMBO J. 3: 1581-1585 (1984)), A. oryzae TA A amylase promoter, the TPI (triose phosphate isomerase) promoter from S. cerevlslae, the promoter from Aspergillus nidulans acetamidase genes and Rhizomucor miehei lipase genes. Examples of suitable promoters useful In bacterial cells include those obtained from the E coli lac operon; Bacillus llcheniformis afpha-amylase gene amyL), B. stearothermophilus amylase gene [amyS); Bacillus subtilis xylA and xylB genes, the beta-lactamase gene, and the tac promoter. In some embodiments, the promoter is one that is native to the host cell. For example, when T. reesei is the host, the promoter is a native T. reesei promoter. In other embodiments, the promoter is one that is heterologous to the fungal host ceil. In some embodiments, the promoter will be the promoter of a parent glucoamylase (e.g., the TrGA promoter).
In some embodiments, the DNA construct includes nucleic acids coding for a signal sequence, that is, an amino acid sequence linked to the amino terminus of the polypeptide that directs the encoded polypeptide into the cell's secretory pathway. The 5' end of the coding sequence of the nucleic acid sequence may naturally include a signal peptide coding region that is naturally linked in translation reading frame with the segment of the glucoamylase coding sequence that encodes the secreted glucoamylase or the 5' end of the coding sequence of the nucleic acid sequence may include a signal peptide that is foreign to the coding sequence. In some embodiments, the DNA construct includes a signal sequence that is naturally associated with a parent glucoamylase gene from which a variant glucoamylase has been obtained. In some embodiments, the signal sequence will be the sequence depicted in SEQ ID NO: 1 or a sequence having at least about 90%, about 94, or about 98% sequence identity thereto. Effective signal sequences may include the signal sequences obtained from other filamentous fungal enzymes, such as from Trichoderma (T. reesel glucoamylase, cellobiohydrolase I, cellobiohydrolase II, endoglucanase I, endoglucanase II, endoglucanase II, or a secreted proteinase, such as an aspartic proteinase), Humicola [H, !nsolens cellobiohydrolase or endoglucanase, or H. grisea glucoamylase), or Aspergillus (A niger glucoamylase and A. oryzae TAKA amylase).
In additional embodiments, a DNA construct or vector comprising a signal sequence and a promoter sequence to be introduced into a host cell are derived from the same source. In some embodiments, the native glucoamylase signal sequence of a Trichoderma glucoamylase homologue, such as a signal sequence from a Hypocrea strain may be used.
In some embodiments, the expression vector also includes a termination sequence. Any termination sequence functional in the host cell may be used in the present disclosure. In some embodiments, the termination sequence and the promoter sequence are derived from the same source. In another embodiment, the termination sequence is homologous to the host cell. Useful termination sequences include termination sequences obtained from the genes of Trichoderma reesei cbll; A. niger or A. awamori glucoamylase (Nunberg et al.
(1984) supra, and Boel et al., (1984) supra), Aspergillus nidulans anthranilate synthase, Aspergillus oryzae TAKA amylase, or A. nidulans trpC (Punt et al., Gene 56: 117-124 (1987)).
In some embodiments, an expression vector includes a selectable marker. Examples of selectable markers include ones that confer antimicrobial resistance {e.g. , hygromycln and phleomycin). Nutritional selective markers also find use in the present disclosure Including those markers known in the art as amdS (acetamidase), argB (ornithine
carbamoyltransferase) and pyrG (orotidine-5'phosphate decarboxylase). Markers useful in vector systems for transformation of Trichoderma are known in the art (see, e.g., Finkelstein, Chapter 6 in Biotechnology Of Filamentous Fungi, Finkelstein et al. (1992) Eds. Butterworth- Heinemann, Boston, MA; Kinghorn et al. ( 1992) Applied Molecular Genetics Of Filamentous Fungi, Blackie Academic and Professional, Chapman and Hall, London; Berges and Barreau, Curr. Genet. 19:359-365 (1991); and van Hartingsveldt et al., Mol. Gen. Genet 206: 71-75 (1987)). In some embodiments, the selective marker is the amdS gene, which encodes the enzyme acetamldase, allowing transformed cells to grow on acetamide as a nitrogen source. The use of A. nidulans amdS gene as a selective marker is described in Kelley et al., EMBO J, 4:475-479 (1985) and Penttila et al., Gene 61: 155-164 (1987).
Methods used to ligate the DIMA construct comprising a nucleic acid sequence encoding a variant glucoamylase, a promoter, a termination and other sequences and to insert them into a suitable vector are well known in the art. Linking is generally accomplished by ligation at convenient restriction sites. If such sites do not exist, synthetic oligonucleotide linkers are used in accordance with conventional practice (see Sambrook et al. (1989) supra, and Bennett and Lasure, More Gene Manipulations In Fungi, Academic Press, San Diego (1991) pp 70-76.). Additionally, vectors can be constructed using known recombination techniques (e.g., Invitrogen Life Technologies, Gateway Technology).
7.2. Host Cells and Transformation of Host Cells
1. The present disclosure also relates to host cells comprising a polynucleotide encoding a variant glucoamylase of the disclosure. In some embodiments, the host cells are chosen from bacterial, fungal, plant and yeast cells. The term host cell includes both the cells, progeny of the cells and protoplasts created from the cells that are used to produce a variant glucoamylase according to the disclosure. In one aspect, a host cell comprising, preferably transformed with a vector is disclosed. In a further aspect, a cell capable of expressing a glucoamylase variant is provided. In a further aspect, the host cell is a protease deficient and/or xylanase deficient and/or glucanase deficient host cell. A protease deficient and/or xylanase deficient and/or native glucanase deficient host cell may be obtained by deleting or silencing the genes coding for the mentioned enzymes. As a consequence the host cell containing the GA-variant is not expressing the mentioned enzymes
In some embodiments, the host cells are fungal cells and optionally filamentous fungal host cells. The term "filamentous fungi" refers to all filamentous forms of the subdivision
Eumycotlna (see, Alexopoulos, C. J. (1962), Introductory Mycology, Wiley, New York). These fungi are characterized by a vegetative mycelium with a cell wall composed of chitin, cellulose, and other complex polysaccharides. The filamentous fungi of the present disclosure are morphologically, physiologically, and genetically distinct from yeasts. Vegetative growth by filamentous fungi is by hyphal elongation and carbon catabolism is obligatory aerobic. In the present disclosure, the filamentous fungal parent cell may be a cell of a species of, but not limited to, Trlchoderma (e.g., Trichoderma reesei, the asexual morph of Hypocrea jecorina, previously classified as T. longibrachiatum, Trichoderma viride, Trichoderma koningii, Trichoderma harzianum) (Sheir-Neirs et al., Appl. Microbiol. Biotechnol. 20:46-53 (1984); ATCC No. 56765 and ATCC No. 26921), Penicilliurn sp., Humicola sp, (e.g. , H, insolens, H. lanuginosa and H. grisea), Chrysosporium sp. (e.g. , C. lucknowense),
Gliocladium sp. , Aspergillus sp. {e.g., A. oryzae, A. nlger, A sojae, A. japonicus, A. nidulans, and A. awamorl) (Ward et al., Appl. Microbiol. Biotechnol. 39: 738-743 (1993) and
Goedegebuur et al., Curr. Genet. 41 :89 -98 (2002)), Fusarium sp. ,(e.g., F. roseum, F.
graminum, F. cerealis, F. oxysporum , and F. venenatum), Neurospora sp., (N. crassa), Hypocrea sp. , Mucor sp. (M. miehei), Rhizopus sp. , and Emericella sp. (see also, Innls et al., Science 228: 21 -26 (1985)). The term "Trichoderma" or "Trichoderma sp. " or "Trichoderma spp. " refer to any fungal genus previously or currently classified as Trichoderma.
In some embodiments, the host cells will be gram-positive bacterial cells. Non-limiting examples include strains of Streptomyces (e.g. , S. Ilvidans, S. coelicolor, and S. griseus) and Bacillus. As used herein, "the genus Bacillus" Includes all species within the genus '"Bacillus," as known to those of skill in the art, including but not limited to B. subtilis, B. licheniformis, B. lentus, B. brevis, B. stearothermophilus, B. alkalophllus, B. amyloliquefadens, B. clausii, B. halodurans, B. megaterium, B. coagulans, B. circulans, B. lautus, and B. thuringiensis. It Is recognized that the genus Bacillus continues to undergo taxonomical reorganization. Thus, it is intended that the genus include species that have been reclassified, including but not limited to such organisms as B. stearothermophilus, which is now named "Geobacillus tearothermophilus."
In some embodiments, the host cell is a gram-negative bacterial strain, such as E. coli or Pseudomonas sp. In other embodiments, the host cells may be yeast cells such as
Saccharomyces sp. , Schizosaccharomyces sp., Pichia sp. , or Candida sp. In other embodiments, the host cell will be a genetically engineered host cell wherein native genes have been inactivated, for example by deletion in bacterial or fungal cells. Where it Is desired to obtain a fungal host cell having one or more inactivated genes known methods may be used (e.g. , methods disclosed in U.S. Patent No. 5,246,853, U.S. Patent No. 5,475,101, and WO 92/06209). Gene inactivation may be accomplished by complete or partial deletion, by insertional inactivation or by any other means that renders a gene nonfunctional for its intended purpose (such that the gene is prevented from expression of a functional protein). In some embodiments, when the host cell is a Trichoderma cell and particularly a T. reesei host cell, the cbhl, cbh2, eg/1 and eg/2 genes will be inactivated and/or deleted. Exemplary Trichoderma reesei host cells having quad-deleted proteins are set forth and described in U.S. Patent No. 5,847,276 and WO 05/001036. In other embodiments, the host cell is a protease deficient or protease minus strain.
Introduction of a DNA construct or vector into a host cell includes techniques such as transformation; electroporation; nuclear microinjection; transduction; transfection, (e.g., lipofection-mediated and DEAE-Dextrin mediated transfection); incubation with calcium phosphate DNA precipitate; high velocity bombardment with DNA-coated microprojectiles; and protoplast fusion. General transformation techniques are known in the art (see, e.g. , Ausubel et al. (1987) supra, chapter 9; and Sambrook et al. (1989) supra, and Campbell et al., Curr. Genet 16:53-56 (1989)).
Transformation methods for Bacillus are disclosed in numerous references including
Anagnostopoulos C. and J. Spizizen, J. Bacteriol. 81 :741-746 (1961) and WO 02/14490.
Transformation methods for Aspergillus are described in Yelton et al., Proc. Natl. Acad. Sci. USA 81: 1470-1474 (1984); Berka et al., (1991) in Applications of Enzyme Biotechnology, Eds. Kelly and Baldwin, Plenum Press (NY); Cao et al., Protein Sci. 9:991-1001 (2000); Campbell et al., Curr. Genet. 16: 53-56 (1989), and EP 238 023. The expression of heterologous protein in Trlchoderma is described in U.S. Patent No. 6,022,725; U.S. Patent No. 6,268,328; Harkki et al. Enzyme Microb. Technol. 13: 227-233 ( 1991); Harkki et al., BioTec nol. 7: 596-603 (1989); EP 244,234; EP 215,594; and Nevalalnen et al., "The Molecular Biology of Trichoderma and its Application to the Expression of Both Homologous and Heterologous Genes", in Molecular Industrial Mycology, Eds. Leong and Berka, Marcel Dekker Inc., NY (1992) pp. 129-148). Reference is also made to W096/00787 and Bajar et al., Proc. Natl. Acad. Sci. USA 88:8202-8212 (1991) for transformation of Fusarium strains.
In one specific embodiment, the preparation of Trichoderma sp. for transformation involves the preparation of protoplasts from fungal mycelia (see, Campbell et al., Curr. Genet. 16:53- 56 (1989); Pentllla et al., Gene 61 : 155-164 (1987)). Agrobacterium tumefaciens- mediated transformation of filamentous fungi is known (see de Groot et al., Nat. Biotechnol. 16 : 839- 842 (1998)). Reference is also made to U.S. Patent No. 6,022,725 and U.S. Patent No. 6,268,328 for transformation procedures used with filamentous fungal hosts.
In some embodiments, genetically stable transformants are constructed with vector systems whereby the nucleic acid encoding the variant glucoamylase is stably integrated into a host strain chromosome. Transformants are then purified by known techniques.
In some further embodiments, the host cells are plant cells, such as cells from a monocot plant (e.g. , corn, wheat, and sorghum) or cells from a dicot plant (e.g., soybean). Methods for making DNA constructs useful in transformation of plants and methods for plant transformation are known. Some of these methods include Agrobacterium tumefaciens mediated gene transfer; microprojectile bombardment, PEG mediated transformation of protoplasts, electroporation and the like. Reference is made to U.S. Patent No. 6,803,499, U.S. Patent No. 6,777,589; Fromm et al., BioTec nol. 8: 833-839 (1990); Potrykus et a!., Mol. Gen. Genet 199: 169-177 (1985).
7.3. Production of Glucoamylases
The present disclosure further relates to methods of producing the variant glucoamylases, which comprises transforming a host cell with an expression vector comprising a
polynucleotide encoding a variant glucoamylase according to the disclosure, culturing the host cell under conditions suitable for expression and production of the variant glucoamylase and optionally recovering the variant glucoamylase. In one aspect, a method of expressing a variant glucoamylase according to the disclosure, the method comprising obtaining a host celt or a cell as disclosed herein and expressing the glucoamylase variant from the cell or host cell, and optionally purifying the glucoamylase variant, is provided. In one aspect, the glucoamylase variant is purified.
In the expression and production methods of the present disclosure the host cells are cultured under suitable conditions in shake flask cultivation, small scale or large scale fermentations (including continuous, batch and fed batch fermentations ) in laboratory or industrial fermentors, with suitable medium containing physiological salts and nutrients (see, e.g., Pourquie, J. et al., Biochemistry And Genetics Of Cellulose Degradation, eds. Aubert, J. P. et al., Academic Press, pp. 71-86, 1988 and Ilmen, M. et al., Appl. Environ. Microbiol. 63 : 1298-1306 (1997)). Common commercially prepared media (e.g. , Yeast Malt Extract (YM) broth, Luria Bertani (LB) broth and Sabouraud Dextrose (SD) broth) find use in the present disclosure. Culture conditions for bacterial and filamentous fungal cells are known in the art and may be found in the scientific literature and/or from the source of the fungi such as the American Type Culture Collection and Fungal Genetics Stock Center. In cases where a glucoamylase coding sequence is under the control of an inducible promoter, the inducing agent {e.g. , a sugar, metal salt or antimicrobial), is added to the medium at a concentration effective to induce glucoamylase expression.
In some embodiments, the present disclosure relates to methods of producing the variant glucoamylase in a plant host comprising transforming a plant cell with a vector comprising a polynucleotide encoding a glucoamylase variant according to the disclosure and growing the plant cell under conditions suitable for the expression and production of the variant.
In some embodiments, assays are carried out to evaluate the expression of a variant glucoamylase by a cell line that has been transformed with a polynucleotide encoding a variant glucoamylase encompassed by the disclosure. The assays can be carried out at the protein level, the RNA level and/or by use of functional bioassays particular to glucoamylase activity and/or production. Some of these assays include Northern blotting, dot blotting (DNA or RNA analysis), RT-PCR (reverse transcriptase polymerase chain reaction), in situ hybridization using an appropriately labeled probe (based on the nucleic acid coding sequence) and conventional Southern blotting and autoradiography.
In addition, the production and/or expression of a variant glucoamylase may be measured in a sample directly, for example, by assays directly measuring reducing sugars such as glucose in the culture medium and by assays for measuring glucoamylase activity, expression and/or production. In particular, glucoamylase activity may be assayed by the 3,5-dinitrosalicylic acid (DNS) method (see Goto et al., Biosci. Biotechnol. Biochem. 58 : 49-54 ( 1994)). In additional embodiments, protein expression, is evaluated by immunological methods, such as immunohistochemical staining of cells, tissue sections or immunoassay of tissue culture medium, (e.g., by Western blot or ELISA) . Such immunoassays can be used to qualitatively and quantitatively evaluate expression of a glucoamylase. The details of such methods are known to those of skill in the art and many reagents for practicing such methods are commercially available.
The glucoamylases of the present disclosure may be recovered or purified from culture media by a variety of procedures known in the art including centrifugation, filtration, extraction, precipitation and the like.
S. Compositions and Uses
In one aspect, the use of a glucoamylase variant as described herein for the preparation of an enzymatic composition, is provided.
The variant glucoamylases of the disclosure may be used in enzyme compositions including but not limited to starch hydrolyzing and saccharifying compositions, cleaning and detergent compositions (e.g. , laundry detergents, dish washing detergents, and hard surface cleaning compositions), alcohol fermentation compositions, and in animal feed compositions. Further, the variant glucoamylases may be used in, for example, brewing, healthcare, textile, environmental waste conversion processes, biopulp processing, and biomass conversion applications. The variant glucoamylases of the disclosure may be used in enzyme
compositions including a starch hydrolyzing composition, a saccharifying composition, a detergent, an alcohol fermentation enzymatic composition, and an animal feed. In one aspect, the composition is a starch hydrolyzing composition.
In some embodiments, an enzyme composition comprising a variant glucoamylase encompassed by the disclosure will be optionally used in combination with any one or combination of the following enzymes - alpha-amylases, proteases, pullulanases, isoamylases, cellulases, hemiceflulases, xylanases, cyclodextrin glycotransferases, lipases, phytases, !accases, oxidases, esterases, cutinases, xylanases, granular starch hydro!yzing enzymes and other glucoamylases.
In some embodiments, an enzyme composition comprising a variant glucoamylase encompassed by the disclosure will be optionally used in combination with any one or combination of the following enzymes - amylase, protease, pullulanase, cellulase, glucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase and a further glucoamylase. In some embodiments, an enzyme composition comprising a variant glucoamylase encompassed by the disclosure will be optionally used in combination with any one or combination of the following enzymes - amylase, pullulanase and a further glucoamylase. In some embodiments, an enzyme composition comprising a variant glucoamylase encompassed by the disclosure will be optionally used In combination with any one or combination of the following enzymes - amylase and pullulanase. In a further aspect, the amylase is alpha-amylase and/or isoamylase. In a further aspect, the glucanase is exoglucanase and/or endoglucanase.
In some embodiments, the enzyme composition will include an alpha-amylase such as fungal alpha-amylases (e.g. , Aspergillus sp. ) or bacterial alpha-amylases (e.g., Bacillus sp. such as B. stearothermophilus, B. amyloliquefaciens and B. licheniformis) and variants and hybrids thereof. In the present context, an alpha-amylase (EC. 3.2.1.1) catalyses the endohydrolysis of ( l->4)-alpha-D-glucosidic linkages in oligosaccharides and polysaccharides. An alpha- amylase acts on starch, glycogen and related polysaccharides and oligosaccharides in a random manner; reducing groups are liberated in the alpha-configuration. In some embodiments, the alpha-amylase is an acid stable alpha-amylase. In some embodiments, the alpha-amylase is Aspergillus kawachi alpha-amylase (AkAA), see U.S. Patent No.
7,037,704. Other alpha-amylases contemplated for use in the compositions of the disclosure include, but are not limited to, bacterial alpha-amylases such as those from Bacillus subtilis (AmyE), and Bacillus licheniformis (AmyL) and Geobacillus stearothermophilus (AmyS) as described by Gray et al. (1986) (Gray GL, Mainzer SE, Rey MW, Lamsa H, Kindle KL, Carmona C and Requadt C "Structural genes encoding the thermophilic alpha-amylases of Bacillus stearothermophilus and Bacillus licheniformis" Journal of Bacteriology (1986) 166(2) p635-643) along with variants and combinations, including combinations of variants of the above. Variants of AmyE, AmyL and AmyS are well known and examples are described in US Patent Application 20100015686 Al ("Variant Alpha-Amylases from Bacillus subtilis and Methods of Uses, Thereof"), US Patent Application 20090314286 Al ("Geobacillus stearothermophilus Alpha-Amylase (AmyS) Variants with Improved Properties"),
WO/2006/066594) ("Alpha-Amylase Variants"), US 20090238923 Al ("Variants Of Bacillus Licheniformis Alpha-Amylase With Increased Thermostability And/Or Decreased Calcium Dependence"). Commercially available alpha-amylases contemplated for use in the compositions of the disclosure are known and include GZYME G997, SPEZY E® FRED, SPEZYME® XTRA AMYLEX® 4T, AMYLEX® 3T and AMYLEX® XT (Danisco US, Inc, Genencor Division), TERMAMYL® 120-L and SUPRA® (Novozymes, A/S).
In some embodiments, the enzyme composition will include a pullulanase (EC 3.2.1.41). In one aspect, the pullulanases used herein is pullulanase from e.g. Pyrococcus or Bacillus sp, such as Bacillus acidopullulyticus (e.g., the one described in FEMS Microbiol. Letters 115: 97- 106) or Bacillus deramificans, or Bacillus naganoencis. In one aspect, the pullulanase is the Bacillus acidopullulyticus PulB enzyme, described in the paper by Kelly et al. FEMS
Microbiology Letters 115 (1994) 97-106. The pullulanase may also be an engineered pullulanases from, e.g., a Bacillus strain. Other pullulanases which are preferably used in the processes according to the invention include: Bacillus deramificans (U.S. Patent No.
5,736,375), or the pullulanase may be derived from Pyrococcus woesei described in
PCT/DK91/00219, or the pullulanase may be derived from Fervidobacterium sp. Ven 5 described in PCT/DK92/00079, or the pullulanase may be derived from Thermococcus celer described In PCT/DK95/00097, or the pullulanase may be derived from Pyrodictium abyssei described in PCT/DK95/Q0211 , or the pullulanase may be derived from Fervidobacterium pennavorans described in PCT/DK95/00095, or the pullulanase may be derived from
Desulforococcus mucosus described in PCT/DK95/00098. The pullulanase (EC 3.2.1.41) may also be derived from, but not limited to, Klebsiella (Aerobacter) spp. (PulA); for example Klebsiella planticola, Klebsiella {Aerobacter) aerogenes and Klebsiella pneumoniae (see: Katsuragi et al. Journal of Bacteriology (1987) 169(5) p2301-2306; Fouts et al. PLoS Genetics (2008) 4(7), E1000141). These pullulanases, along with those from, for example, Bacillus acidopullulyticus are members of Glycoside Hydrolase Family 13. In some
embodiments, the enzyme composition will include an acid fungal protease. In a further embodiment, the acid fungal protease is derived from a Trichoderma sp. and may be any one of the proteases disclosed in US Patent No. 7,563,607 (published as US 2006/0154353 July 13, 2006), incorporated herein by reference. In a further embodiment, the enzyme composition will include a phytase from Buttiauxiella spp. (e.g., BP-17, see also variants disclosed in PCT patent publication WO 2006/043178).
In other embodiments, the variant glucoamylases of the disclosure may be combined with other glucoamylases. In some embodiments, the glucoamylases of the disclosure will be combined with one or more glucoamylases derived from strains of Aspergillus or variants thereof, such as A. oryzae, A. niger, A. kawachi, and A. awamori; glucoamylases derived from strains of Humicola or variants thereof, particularly H. grisea, such as the glucoamylase having at least about 90%, about 93%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to SEQ ID NO: 3 disclosed in WO 05/052148; glucoamylases derived from strains of Talaromyces or variants thereof, particularly T. emersonii;
glucoamylases derived from strains of Atheiia and particularly A. rolfsii; glucoamylases derived from strains of Penicillium, particularly P. chrysagenum.
In particular, the variant glucoamylases may be used for starch conversion processes, and particularly In the production of dextrose for fructose syrups, specialty sugars and in alcohol and other end-product (e.g., organic acid, ascorbic acid, and amino acids) production from fermentation of starch containing substrates (G.M.A. van Beynum et al. , Eds. (1985) Starch Conversion Technology, Marcel Dekker Inc. NY). Dextrins produced using variant glucoamylase compositions of the disclosure may result in glucose yields of at least 80%, at (east 85%, at least 90% and at least 95%. Production of alcohol from the fermentation of starch substrates using glucoamylases encompassed by the disclosure may include the production of fuel alcohol or potable alcohol. In some embodiments, the production of alcohol will be greater when the variant glucoamylase is used under the same conditions as the parent glucoamylase. In some embodiments, the production of alcohol will be between about 0.5% and 2.5% better, including but not limited to about 0.6%, about 0.7%, about 0.8%, about 0.9%, about 1.0%, about 1.1%, about 1.2%, about 1.3%, about 1.4%, about 1.5%, about 1.6%. about 1.7%, about 1.8%, about 1.9%, about 2.0%, about 2.1%, about 2.2%, about 2.3%, and about 2.4% more alcohol than the parent glucoamylase.
In some embodiments, the variant glucoamylases of the disclosure will find use In the hydrolysis of starch from various plant-based substrates, which are used for alcohol production. In some embodiments, the plant-based substrates will include corn, wheat, barley, rye, milo, rice, sugar cane, potatoes and combinations thereof. In some
embodiments, the plant-based substrate will be fractionated plant material, for example a cereal grain such as com, which is fractionated into components such as fiber, germ, protein and starch (endosperm) (U.S. Patent No. 6,254,914 and U.S. Patent No. 6,899,910).
Methods of alcohol fermentations are described in The Alcohol Textbook, K,A. Jacques et al., Eds. 2003, Nottingham University Press, UK.
In certain embodiments, the alcohol will be ethanol. In particular, alcohol fermentation production processes are characterized as wet milling or dry milling processes. In some embodiments, the variant glucoamylase will be used in a wet milling fermentation process and In other embodiments the variant glucoamylase will find use in a dry milling process.
Dry grain milling involves a number of basic steps, which generally include: grinding, cooking, liquefaction, saccharification, fermentation and separation of liquid and solids to produce alcohol and other co-products. Plant material and particularly whole cereal grains, such as corn, wheat or rye are ground. In some cases, the grain may be first fractionated into component parts. The ground plant material may be milled to obtain a coarse or fine particle. The ground plant material is mixed with liquid (e.g., water and/or thin stillage) in a slurry tank. The slurry is subjected to high temperatures (e.g. , about 90°C to about 105°C or higher) in a jet cooker along with liquefying enzymes (e.g., alpha-amylases) to solublize and hydrolyze the starch in the grain to dextrins. The mixture is cooled down and further treated with saccharifying enzymes, such as glucoamylases encompassed by the instant disclosure, to produce glucose. The mash containing glucose may then be fermented for approximately 24 to 120 hours in the presence of fermentation microorganisms, such as ethanol producing microorganism and particularly yeast (Saccharomyces spp). The solids in the mash are separated from the liquid phase and alcohol such as ethanol and useful co- products such as distillers' grains are obtained.
In some embodiments, the saccharification step and fermentation step are combined and the process is referred to as simultaneous saccharification and fermentation or simultaneous saccharification, yeast propagation and fermentation.
In other embodiments, the variant glucoamylase is used in a process for starch hydrolysis wherein the temperature of the process is between about 30°C and about 75°C, in some embodiments, between about 40°C and about 65°C. In some embodiments, the variant glucoamylase is used in a process for starch hydrolysis at a pH between about 3.0 and about 6.5. The fermentation processes in some embodiments include milling of a cereal grain or fractionated grain and combining the ground cereal grain with liquid to form a slurry that is then mixed in a single vessel with a variant glucoamylase according to the disclosure and optionally other enzymes such as, but not limited to, alpha-amylases, other glucoamylases, phytases, proteases, pullulanases, isoamylases or other enzymes having granular starch hydrolyzing activity and yeast to produce ethanol and other co-products (see e.g. , U.S. Patent No. 4,514,496, WO 04/081193, and WO 04/080923).
In some embodiments, the disclosure pertains to a method of saccharifying a liquid starch solution, which comprises an enzymatic saccharification step using a variant glucoamylase of the disclosure. The liquid starch solution may be produced by solubilising starch in water or an aqueous buffer and optionally heating to gelatinize the starch. Further partial degradation of the starch by amylases may be applied.
The present invention provides a method of using glucoamylase variants of the invention for producing glucose and the like from starch. Generally, the method includes the steps of partially hydrolyzing precursor starch in the presence of alpha-amylase and then further hydrolyzing the release of D-glucose from the non-reducing ends of the starch or related oligo- and polysaccharide molecules in the presence of glucoamylase by cleaving alpha-(l-4) and alpha-(l-6) glucosidic bonds. The partial hydrolysis of the precursor starch utilizing alpha-amylase provides an initial breakdown of the starch molecules by hydrolyzing internal alpha-(l-4)-iinkages. In commercial applications, the initial hydrolysis using alpha-amylase is run at a temperature of approximately 105°C. A very high starch concentration is processed, usually 30% to 40% solids. The initial hydrolysis is usually carried out for five minutes at this elevated temperature. The partially hydrolyzed starch can then be transferred to a second tank and incubated for approximately one hour at a temperature of 85° to 90°C to derive a dextrose equivalent (D.E.) of 10 to 15, The step of further hydrolyzing the release of D- glucose from the non-reducing ends of the starch or related oligo- and polysaccharides molecules in the presence of glucoamylase is normally carried out in a separate tank at a reduced temperature between 30° and 60°C. Often the temperature of the substrate liquid is dropped to between 55°C and 60°C. The pH of the solution is dropped from 6 to 6.5 to a range between 3 and 5.5. Often, the pH of the solution Is 4 to 4.5. The glucoamylase Is added to the solution and the reaction is carried out for 24-72 hours, such as 36-48 hours.
Examples of saccharification processes wherein the glucoamylase variants of the invention may be used include the processes described in JP 3-224493; JP 1-191693; JP 62-272987; and EP 452,238. The glucoamylase variant(s) described herein may be used in combination with an enzyme that hydrolyzes only alpha-(l-6)-glucosidic bonds in molecules with at least four glucosyl residues. Preferentially, the glucoamylase variant can be used in combination with pullulanase or alpha-amylase. The use of alpha-amylase and pullulanase for
debranching, the molecular properties of the enzymes, and the potential use of the enzymes with glucoamylase is set forth in G.M.A. van Beynum et al., Starch Conversion Technology, Marcel Dekker, New York, 1985, 101-142.
In one embodiment, the use of a glucoamylase variant as described herein in a starch conversion process, such as in a continuous saccharification step, is provided. The glucoamylase variants described herein may also be used in immobilised form. This is suitable and often used for producing maltodextrins or glucose syrups or speciality syrups, such as maltose syrups and further for the raffinate stream of oligosaccharides in connection with the production of fructose syrups.
When the desired final sugar product is, e.g., high fructose syrup the dextrose syrup may be converted into fructose. After the saccharification process the pH is increased to a value in the range of 6-8, such as pH 7,5, and the calcium is removed by ion exchange. The dextrose syrup Is then converted Into high fructose syrup using, e.g., an immobilized glucose isomerase (such as Sweetzyme™ IT). In other embodiments, the variant glucoamyiase is used in a process for beer brewing.
Brewing processes are well-known in the art, and generally involve the steps of malting, mashing, and fermentation, Mashing is the process of converting starch from the milled barley malt and solid adjuncts into fermentable and un-fermentable sugars to produce wort. Traditional mashing involves mixing milled barley malt and adjuncts with water at a set temperature and volume to continue the biochemical changes initiated during the malting process. The mashing process is conducted over a period of time at various temperatures in order to activate the endogenous enzymes responsible for the degradation of proteins and carbohydrates. After mashing, the wort is separated from the solids (spent grains).
Following wort separation, the wort may be fermented with brewers' yeast to produce a beer. The short-branched glucose oligomers formed during mashing may be further hydrolyzed by addition of exogenous enzymes like glucoamylases and/or alpha-amyiases, beta-amylases and pullulanase, among others. The wort may be used as it is or It may be concentrated and/or dried. The concentrated and/or dried wort may be used as brewing extract, as malt extract flavoring, for non-alcoholic malt beverages, malt vinegar, breakfast cereals, for confectionary etc. The wort is fermented to produce an alcoholic beverage, typically a beer, e.g. , ale, strong ale, bitter, stout, porter, lager, export beer, malt liquor, barley wine, happoushu, high-alcohol beer, low-alcohol beer, low-calorie beer, or light beer. In another typical embodiment, the wort is fermented to produce potable ethanol.
In some embodiments, the disclosure pertains to a method of hydrolyzing and saccharifying gelatinised and liquefied (typically) grist starch to be used in brewing, whereby an enzymatic composition comprising one or more glucoamylases as contemplated herein, Is used to enhance the amount of brewers' yeast fermentable sugars obtained from the starch. A brewing process is used to produce the potable product, beer, where fermentable sugars are converted to ethanol and C02 by fermentation with brewers' yeast. The fermentable sugars are traditionally derived from starch in cereal grains, optionally supplemented with fermentable sugar sources such as glucose and maltose syrups and cane sugar. Briefly, beer production, well-known in the art, typically includes the steps of malting, mashing, and fermentation.
Historically the first step in beer production is malting - steeping, germination and drying of cereal grain (e.g. barley). During malting enzymes are produced in the germinating cereal (e.g. barley) kernel and there are certain changes in its chemical constituents (known as modification) including some degradation of starch, proteins and beta-glucans.
The malted cereal is milled to give a grist which may be mixed with a milled adjunct (e.g. non-germinated cereal grain) to give a mixed grist. The grist is mixed with water and subjected to mashing; a previously cooked (gelatinised and liquefied) adjunct may be added 2011/061082
70 to the mash. The mashing process is conducted over a period of time at various temperatures in order to hydrolyse cereal proteins, degrade beta-glucans and so!ubilise and hydrolyse the starch, The hydrolysis of the grist starch in the malt and adjunct in traditional mashing is catalysed by two main enzymes endogenous to malted barley. Alpha-amylase, randomly cleaves alpha-1,4 bonds in the interior of the starch molecule fragmenting them into smaller dextrins. Beta-amylase sequentially cleaves alpha-1,4 bonds from the non-reducing end of the these dextrins producing mainly maltose. Both alpha- and beta-amyiase are unable to hydrolyse the alpha-1,6 bonds which forms the branching points of the starch chains in the starch molecule, which results in the accumulation of limit dextrins in the mash. Malt does contain an enzyme, limit dextrinase, which catalyses the hydrolysis of alpha-1,6 bonds but it only shows weak activity at mashing temperatures due to its thermolability. After mashing, the liquid extract (wort) is separated from the spent grain solids (i.e. the insoluble grain and husk material forming part of grist). The objectives of wort separation include: · to obtain good extract recovery, · to obtain good filterability, and · to produce clear wort. Extract recovery and filterability of the wort are important in the economics of the brewing process.
The composition of the wort depends on the raw materials, mashing process and profiles and other variables. A typical wort comprises 65-80% fermentable sugars (glucose, maltose and maltotriose, and 20-35% non-fermentable limit dextrins (sugars with a higher degree of polymerization than maltotriose). An insufficiency of starch hydrolytic enzymes during mashing can arise when brewing with high levels of adjunct unmalted cereal grists. A source of exogenous enzymes, capable of producing fermentable sugars during the mashing process is thus needed. Furthermore, such exogenous enzymes are also needed to reduce the level of non-fermentable sugars in the wort, with a corresponding increase in fermentable sugars, in order to brew highly attenuated beers with a low carbohydrate content. Herein disclosed is a enzyme composition for hydrolysis of starch comprising at least one glucoamylase as contemplated herein, which can be added to the mash or used in the mashing step of a brewing process, in order to cleave alpha-1,4 bonds and/or alpha-1,6 bonds in starch grist and thereby increase the fermentable sugar content of the wort and reduce the residue of non-fermentable sugars In the finished beer. In addition, the wort, so produced may be dried (by for example spray drying) or concentrated (e.g. boiling and evaporation) to provide a syrup or powder.
The grist, as contemplated herein, may comprise any starch and/or sugar containing plant material derivable from any plant and plant part, including tubers, roots, stems, leaves and seeds. Often the grist comprises grain, such as grain from barley, wheat, rye, oat, corn, rice, milo, millet and sorghum, and more preferably, at least 10%, or more preferably at least 15%, even more preferably at least 25%, or most preferably at least 35%, such as at least 50%, at least 75%, at least 90% or even 100% (w/w) of the grist of the wort is derived from T EP2011/061082
71 grain. Most preferably the grist comprises malted grain, such as barley malt. Preferably, at least 10%, or more preferably at least 15%, even more preferably at least 25%, or most preferably at least 35%, such as at least 50%, at least 75%, at least 90% or even 100% (w/w) of the grist of the wort is derived from malted grain. Preferably the grist comprises adjunct, such as non-malted grain from barley, wheat, rye, oat, corn, rice, milo, millet and sorghum, and more preferably, at least 10%, or more preferably at least 15%, even more preferably at least 25%, or most preferably at least 35%, such as at least 50%, at least 75%, at least 90% or even 100% (w/w) of the grist of the wort is derived from non-malted grain or other adjunct. Adjunct comprising readily fermentable carbohydrates such as sugars or syrups may be added to the malt mash before, during or after the mashing process of the invention but is preferably added after the mashing process. A part of the adjunct may be treated with an alpha-amylase, and/or endopeptidase (protease) and/or a endoglucanase, and/or heat treated before being added to the mash, The enzyme composition, as
contemplated herein, may include additional enzyme(s), preferably an enzyme selected from among an alpha-amylase, protease, pullulanase, isoamylase, cellulase, glucanase such as exoglucanase or endoglucanase, xylanase, arabinofuranosidase, feruloyl esterase, xylan acetyl esterase, phytase and glucoamylase. During the mashing process, starch extracted from the grist is gradually hydrolyzed into fermentable sugars and smaller dextrins.
Preferably the mash is starch negative to iodine testing, before wort separation.
In one aspect, a pullulanase (E. C. 3.2.1 .41 ) enzyme activity is exogenously supplied and present in the mash. The pullulanase may be added to the mash Ingredients, e.g., the water and/or the grist before, during or after forming the mash.
In another aspect, an alpha-amylase enzyme activity is exogenously supplied and present in the mash. The alpha-amylase may be added to the mash ingredients, e.g., the water and/or the grist before, during or after forming the mash.
In a further aspect, both pullulanase and alpha-amylase enzyme activities are exogenously supplied and present in the mash. The alpha-amylase and pullulanase may be added to the mash ingredients, e.g., the water and/or the grist before, during or after forming the mash.
A further enzyme may be added to the mash, said enzyme being selected from the group consisting of among amylase, protease, pullulanase, isoamylase, cellulase, glucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, phytase and a further glucoamylase.
Prior to the third step of the brewing process, fermentation, the wort is typically transferred to a brew kettle and boiled vigorously for 50 - 60 minutes. A number of Important processes EP2011/061082
72 occur during wort boiling (further information may be found in "Technology Brewing and Malting" by Wolfgang Kunze of the Research and Teaching Institute of Brewing, Berlin (VLB), 3rd completely updated edition, 2004, ISBN 3-921690-49-8) including inactivation of the endogenous malt enzymes and any exogenous enzyme added to the mash or adjunct. The boiled wort is then cooled, pitched with brewers' yeast and fermented at temperatures typically ranging from 8-16 °C to convert the fermentable sugars to ethanol. A low-alcohol beer can be produced from the final beer, by a process of vacuum evaporation that serves to selectively remove alcohol.
In an alternative embodiment, the disclosure pertains to a method of enhancing the amount of fermentable sugars in the wort, using an enzymatic composition comprising one or more glucoamylases as contemplated herein (e.g. thermolabile glucoamylase), whereby the enzymatic composition is added to the wort after it has been boiled, such that the one or more glucoamylases are active during the fermentation step. The enzymatic composition can be added to the boiled wort either before, simultaneously, or after the wort is pitched with the brewers' yeast. At the end of the fermentation and maturation step the beer, which may optionally be subjected to vacuum evaporation to produce a low-alcohol beer, is then pasteurized. An Inherent advantage of this method lies in the duration of the fermentation process, which is about 6-15 days (depending on pitching rate, fermentation, temperature, etc), which allows more time for the enzymatic cleavage of non-fermentable sugars, as compared to the short mashing step (2-4 h duration). A further advantage of this method lies in the amount of the enzymatic composition needed to achieve the desired decrease in non- fermentable sugars (and increase in fermentable sugars), which corresponds to a significantly lower number of units of enzymatic activity (e.g. units of glucoamylase activity) than would need to be added to the mash to achieve a similar decrease in non-fermentable sugars. In addition, it removes the difficulties often seen during wort separation, especially by lautering, when high dose rates of glucoamylase are added in the mash.
In one aspect, the disclosure pertains to an enzymatic composition comprising at least one additional enzyme selected among amylase, protease, pullulanase, isoamylase, cellulase, glucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, phytase and a further glucoamylase.
In a further aspect, the disclosure pertains to an enzymatic composition, wherein the composition comprises at least one additional enzyme selected among a!pha-amylase and/or pullulanase.
In a further aspect, the disclosure pertains to an enzymatic composition, wherein the composition further comprises alpha-amylase and pullulanase. In a further aspect, the disclosure pertains to an enzymatic composition, which enzymatic composition comprises less than 1, less than 0.8, less than 0.6, less than 0.5, less than 0.4, less than 0.2, less than 0.125, less than 0.1, less than 0.05, less than 0.01, or less than 0.005 XL) of xylanase activity per GAU of a glucoamylase variant as described herein. If desired, xylanase activity may be reduced by different methods known to the skilled person such as e.g. heat treatment, passing through wheat bran, or other materials, which may selectively adsorb xylanase activity.
In a further aspect, the disclosure pertains to an enzymatic composition, which enzymatic composition comprises less than 400, less than 200, less than 50, less than 20, or less than 2 XU of xylanase activity per gram of the composition.
In a further aspect, the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.1-20, 0,1-10, 0.1-5 or 0.2-3 SSU of alpha-amylase activity per GAU of a glucoamylase variant as described herein.
In a further aspect, the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.30-10, 1-8, 3-10 or 5-9 PU of pullulanase activity per GAU of a glucoamylase variant as described herein.
In a further aspect, the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.95-20 SSU of alpha-amylase activity per GAU of a glucoamylase variant as described herein and between 0.30-10 PU of pullulanase activity per GAU of a glucoamylase variant as described herein.
In a further aspect, the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.95 - 20 SSU of alpha-amylase activity per GAU of a glucoamylase variant as described herein and between 0.30 - 10 PU of pullulanase activity per GAU of a glucoamylase variant as described herein and less than 1, less than 0.8, less than 0.6, less than 0.5, less than 0.4, less than 0.2, less than 0.125, less than 0.1, (ess than 0.05, less than 0.01, or less than 0.005 XU of xylanase activity per GAU of a glucoamylase variant as described herein.
In a further aspect, the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.05-10, 0.1-10, 0.1-8, 0.1-5, 0.1 -3, 0.2-3, 0.2-2 PU of pullulanase activity per GAU of a glucoamylase variant as described herein. In a further aspect, the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.1-20, 1-15, 2-10, 3-10 SSU of alpha-amylase activity per GAU of a glucoamylase variant as described herein.
In a further aspect, the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.05-10 PU of pullulanase activity per GAU of a
glucoamylase variant as described herein and between 0.1-20 SSU of alpha-amylase activity per GAU of a glucoamylase variant as described herein.
In a further aspect, the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.1-5 PU of pullulanase activity per GAU of a glucoamylase variant as described herein and between 1-15 SSU of alpha-amylase activity per GAU of a glucoamylase variant as described herein.
In a further aspect, the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.2-2 PU of pullulanase activity per GAU of a glucoamylase variant as described herein and between 2-10 SSU of alpha-amylase activity per GAU of a glucoamylase variant as described herein.
In a further aspect, the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.05-10 PU of pullulanase activity per GAU of a
glucoamylase variant as described herein and between 0.1-20 SSU of alpha-amylase activity per GAU of a glucoamylase variant as described herein and less than 1, less than 0.8, less than 0.6, less than 0.5, less than 0.4, less than 0.2, less than 0.125, less than 0.1, less than 0.05, less than 0.01, or less than 0.005 XU of xylanase activity per GAU of a glucoamylase variant as described herein.
In a further aspect, the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.1-5 PU of pullulanase activity per GAU of a glucoamylase variant as described herein and between 1-15 SSU of alpha-amylase activity per GAU of a glucoamylase variant as described herein and less than 1, less than 0.8, less than 0.6, less than 0.5, less than 0.4, less than 0.2, less than 0.125, less than 0.1, less than 0.05, less than 0.01, or less than 0.005 XU of xylanase activity per GAU of a glucoamylase variant as described herein.
In a further aspect, the disclosure pertains to an enzymatic composition, which enzymatic composition comprises between 0.2-2 PU of pullulanase activity per GAU of a glucoamylase variant as described herein and between 2-10 SSU of alpha-amylase activity per GAU of a glucoamylase variant as described herein and less than 1, less than 0.8, less than 0.6, less than 0.5, less than 0.4, less than 0.2, less than 0.125, less than 0.1, less than 0.05, less than 0.01, or less than 0.005 XU of xylanase activity per GAU of a glucoamylase variant as described herein.
In one aspect, the glucoamylase variant as described herein is added in an amount of 500 - 20000 GAU/kg grist. In another aspect, the glucoamylase variant as described herein is added in an amount of 750 - 10000 GAU/kg grist. In a further aspect, the glucoamylase variant as described herein is added in an amount of 1000 - 7500 GAU/kg grist.
The present disclosure also provides an animal feed composition or formulation comprising at least one variant glucoamylase encompassed by the disclosure. Methods of using a glucoamylase enzyme in the production of feeds comprising starch are provided in WO 03/049550 (herein incorporated by reference in its entirety). Briefly, the glucoamylase variant is admixed with a feed comprising starch. The glucoamylase is capable of degrading resistant starch for use by the animal. In some embodiments a glucoamylase variant as described herein is used in processes in the generation of fuels based on starch feed stocks. Other objects and advantages of the present disclosure are apparent from the present specification.
Further embodiments according to the invention:
Embodiment 1. Use of a glucoamylase variant comprising two or more amino acid substitutions relative to interconnecting loop 2' with the amino acid sequence from position 518 to position 543 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase, and/or loop 1 with the amino acid sequence from position 21 to position 51 of SEQ ID NO:2 or equivalent sequence of residues in a parent glucoamylase, and/or helix 2 with the amino acid sequence from position 52 to position 68 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase, and/or loop 11 with the amino acid sequence from position 396 to position 420 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase, and/or helix 12 with the amino acid sequence from position 421 to position 434 of SEQ ID NO: 2 or equivalent sequence of residues in a parent glucoamylase for reducing the synthesis of condensation products during hydrolysis of starch.
Embodiment 2. Use of a glucoamylase variant, which when in its crystal, form has a crystal structure for which the atomic coordinates of the main chain atoms have a root- mean-square deviation from the atomic coordinates of the equivalent main chain atoms of TrGA (as defined in Table 20 in WO2009/067218) of less than 0.13 nm following alignment of equivalent main chain atoms, and which have a linker region, a starch binding domain and a catalytic domain, said variant comprising two or more amino acid substitutions relative to the amino acid sequence of the parent glucoamylase in interconnecting loop 2' of the starch binding domain, and/or in loop 1, and/or in helix 2, and/or in loop 11, and/or in helix 12 of the catalytic domain for reducing the synthesis of condensation products during hydrolysis of starch.
Embodiment 3. The use of a glucoamylase variant according to any one of the embodiments 1-2, wherein said two or more amino acid substitutions are relative to the interconnecting loop 2' with the amino acid sequence from position 518 to position 543 of SEQ ID NO:2, and/or loop 1 with the amino acid sequence from position 21 to position 51 of SEQ ID NO:2, and/or helix 2 with the amino acid sequence from position 52 to position 68 of SEQ ID NO:2, and/or loop 11 with the amino acid sequence from position 396 to position 420 of SEQ ID NO:2, and/or helix 12 with the amino acid sequence from position 421 to position 434 of SEQ ID NO:2.
Embodiment 4. The use of a glucoamylase variant according to any one of the embodiments 1-3, wherein the two or more amino acid substitutions are at least one amino acid substitution in the Interconnecting loop 2' and at least one amino acid substitution in loop 1 and/or helix 2 and/or loop 11 and/or helix 12.
Embodiment 5. The use of a glucoamylase variant according to any one of the embodiments 1-4, wherein the two or more amino acid substitutions are 1, 2, 3 or 4 amino acid substitutions in the interconnecting loop 2' and 1, 2, 3 or 4 amino acid substitutions in loop 1 and/or helix 2 and/or loop 11 and/or helix 12.
Embodiment 6. The use of a glucoamylase variant according to any one of the embodiments 1-5, wherein the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in loop 1.
Embodiment 7. The use of a glucoamylase variant according to any one of the embodiments 1-6, wherein the two or more amino acid substitutions are at least one amino acid substitution In interconnecting loop 2' and at least one amino acid substitution in helix 2.
Embodiment 8. The use of a glucoamylase variant according to any one of the embodiments 1-7, wherein the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in loop 11.
Embodiment 9. The use of a glucoamylase variant according to any one of the embodiments 1-8, wherein the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in helix 12.
Embodiment 10. The use of a glucoamy!ase variant according to any one of the embodiments 1-9, wherein the two or more amino acid substitutions are at least one amino acid substitution in interconnecting loop 2' and at least one amino acid substitution in loop 1 and at least one amino acid substitution in helix 2.
Embodiment 11. The use of a glucoamylase variant according to any one of embodiments 1- 10, wherein the glucoamylase variant has at least one amino acid substitution within position 520-543, 530-543, or 534-543 of interconnecting loop 2', the positions corresponding to the respective position in SEQ ID NO:2 or equivalent positions in a parent glucoamylase.
Embodiment 12. The use of a glucoamylase variant according to any one of embodiments 1-11, wherein the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 30-50, 35-48, or 40-46 of loop 1, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase.
Embodiment 13. The use of a glucoamylase variant according to any one of embodiments 1- 12, wherein the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 50-66, 55-64, or 58-63 of helix 2, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase.
Embodiment 14. The use of a glucoamylase variant according to any one of embodiments 1-13, wherein the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 405-420, 410-420, or 415-420 of loop 11, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase.
Embodiment 15. The use of a glucoamylase variant according to any one of embodiments 1- 14, wherein the glucoamylase variant has at least one amino acid substitution within the amino acid sequence of position 421-434, 425-434, or 428-434 of helix 12, the positions corresponding to the respective position in SEQ ID NO: 2 or equivalent positions in a parent glucoamylase. Embodiment 16. The use of a glucoamylase variant according to any one of embodiments 1-15, wherein the glucoamylase variant has at least 80%, 85%, 90%, 95%, 98%, or 99.5% sequence identity to the parent glucoamylase.
Embodiment 17. The use of a glucoamylase variant according to any one of embodiments 1-16, wherein the glucoamylase variant has at least 80%, 85%, 90%, 95%, 98%, or 99.5% sequence identity to SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9.
Embodiment 18. The use of a glucoamylase variant to any one of the embodiments
1-17, wherein the glucoamylase variant has a starch binding domain that has at least 96%, 97%, 98%, 99%, or 99.5% sequence identity with the starch binding domain of SEQ ID NO: 1, 2, 11, 385, 386, 387, 388, 389, or 390.
Embodiment 19. The use of a glucoamylase variant according to any one of the embodiments 1-18, wherein the glucoamylase variant has a catalytic domain that has at least 80%, 85%, 90%, 95%, or 99.5% sequence identity with the catalytic domain of SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9.
Embodiment 20. The use of a glucoamylase variant according to any one of embodiments 1-19, wherein the glucoamylase variant has at least 80%, 85%, 90%, 95%, 98%, or 99.5% sequence identity to SEQ ID NO: 2.
Embodiment 21. The use of a glucoamylase variant according to any one of embodiments 1-20, wherein the condensation product is isomaltose.
Embodiment 22. The use of a glucoamylase variant according to any one of embodiments 1-21, wherein the hydrolysis of starch is in a brewing process.
Embodiment 23. The use of a glucoamylase variant according to any one of embodiments 1-22, wherein the glucoamylase exhibit an enhanced production of fermentable sugar(s) as compared to the parent glucoamylase, such as TrGA.
Embodiment 24. The use of a glucoamylase variant according to any one of embodiments 1-23, wherein the glucoamylase exhibit an enhanced production of fermentable sugars in a mashing step of the brewing process as compared to the parent glucoamylase, such as TrGA.
Embodiment 25. The use of a glucoamylase variant according to any one of embodiments 1-24, wherein the glucoamylase exhibit an enhanced production of fermentable sugars in a fermentation step of the brewing process as compared to the parent
glucoamylase, such as TrGA.
Embodiment 26. The use of a glucoamylase variant according to any one of embodiments 1-25, wherein the fermentable sugar is glucose.
Embodiment 27. The use of a glucoamylase variant according to any one of embodiments 1-26, wherein the hydrolysis of starch is in a process for producing glucose syrup.
Embodiment 28. The use of a glucoamylase variant according to any one of embodiments 1-27, wherein the glucoamylase exhibit a reduced ratio between isomaltose synthesis (IS) and starch hydrolysis activity (SH) as compared to the parent glucoamylase, such as TrGA.
Embodiment 29. The use of a glucoamylase variant according to any one of embodiments 1-28, wherein the glucoamylase exhibit a reduced starch hydrolysis activity, which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent glucoamylase, such as TrGA.
Embodiment 30. The use of a glucoamylase variant according to any one of embodiments 1-29, wherein the glucoamylase exhibit an enhanced real degree of fermentation as compared to the parent glucoamylase such as TrGA.
Embodiment 31. The use of a glucoamylase variant according to any one of embodiments 1-30, wherein the glucoamylase forms a lower amount of condensation products than the amount of condensation products formed by the glucoamylase Aspergillus niger (AnGA) (SEQ ID NO: 6) under comparable conditions.
Embodiment 32. The use of a glucoamylase variant according to any one of embodiments 1-31, wherein the glucoamylase forms an amount of condensation products which amount is essentially the same as, not more than 5% higher, not more than 8% higher or not more than 10% higher than the amount of condensation products formed by
Aspergillus niger (AnGA) (SEQ ID NO: 6) under comparable conditions.
Embodiment 33. The use of a glucoamylase variant according to any one of embodiments 31-32, wherein dosing of the glucoamylases are the same based on protein concentration. Embodiment 34. The use of a glucoamylase variant according to any one of embodiments 31-33, wherein dosing of the glucoamylases are the same based on measurement of activity in activity assays.
Embodiment 35. The use of a glucoamylase variant according to any one of embodiments 1-34, which glucoamylase variant has an amino acid substitution in position 539 and one or more amino acid substitutions in a position selected from position 44, 61, 417 and 431, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase.
Embodiment 36. The use of a glucoamylase variant according to any one of embodiments 1-35, which glucoamylase variant has an amino acid substitution in position 539 and a) an amino acid substitution In position 44 and/or b) amino acid substitutions in both positions 417 and 431, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase.
Embodiment 37, The use of a glucoamylase variant according to any one of embodiments 1-36, which glucoamylase variant has an amino acid substitution in position 539 and an amino acid substitution in position 44, the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
Embodiment 38. The use of a glucoamylase variant according to any one of embodiments 1-37, which glucoamylase variant has an amino acid substitution in position 539 and amino acid substitutions in positions 417 and 431, the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
Embodiment 39. The use of a glucoamylase variant according to any one of embodiments 1-38, which glucoamylase variant has an amino acid substitution in position 539 and amino a id substitutions In positions 44 and 61, the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
Embodiment 40. The use of a glucoamylase variant according to any one of embodiments 1-39, which glucoamylase variant has an amino acid substitution in position 43, the position corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase.
Embodiment 41. The use of a glucoamylase variant according to any one of embodiments 1-40, which glucoamylase variant has an amino acid substitution in position 61, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
Embodiment 42. The use of a glucoamylase variant according to any one of embodiments 1-41, wherein the amino acid substitution in position 539 is 539R, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
Embodiment 43. The use of a glucoamylase variant according to any one of embodiments 1-42, wherein the amino acid substitution in position 44 is 44R, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
Embodiment 44. The use of a glucoamylase variant according to any one of embodiments 1-43, wherein the amino acid substitution in position 417 is 417R/V, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
Embodiment 45. The use of a glucoamylase variant according to any one of embodiments 1-44, wherein the amino acid substitution in position 417 is 417R, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
Embodiment 46. The use of a glucoamylase variant according to any one of embodiments 1-45, wherein the amino acid substitution in position 417 is 417V, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
Embodiment 47. The use of a glucoamylase variant according to any one of embodiments 1-46, wherein the amino acid substitution in position 431 is 431L, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
Embodiment 48. The use of a glucoamylase variant according to any one of embodiments 1-47, wherein the amino acid substitution in position 43 is 43R, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase. Embodiment 49. The use of a glucoamylase variant according to any one of embodiments 1-48, wherein the amino acid substitution in position 61 is 611, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
Embodiment 50. A glucoamylase variant as defined in any one of embodiments 1-
49.
Embodiment 51. A glucoamylase variant comprising two or more amino acid substitutions, wherein an amino acid substitution Is in position 539 and an amino acid substitution is in position 44, the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase, and which sequence has at least 80% sequence identity to the parent glucoamylase, and wherein the amino acid substitution in position 44 is not 44C.
Embodiment 52. The glucoamylase variant according to embodiment 51 comprising two or more amino acid substitutions, wherein an amino acid substitution is in position 539 and an amino acid substitution is 44 , the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
Embodiment 53. The glucoamylase variant according to any one of embodiments
51-52 comprising an amino acid substitution in position 61, the position corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase.
Embodiment 54. The glucoamylase variant according to any one of embodiments
51-53, wherein the glucoamylase variant has at least 85%, 90%, 95%, 98%, or 99.5% sequence identity to the parent glucoamylase.
Embodiment 55. The glucoamylase variant according to any one of embodiments
51-54, wherein the glucoamylase variant has at least 85%, 90%, 95%, 98%, or 99.5% sequence identity to SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9.
Embodiment 56. The glucoamylase variant according to any one of embodiments
51-55, wherein the glucoamylase variant has at least 85%, 90%, 95%, 98%, or 99.5% sequence identity to SEQ ID NO:2.
Embodiment 57. The glucoamylase variant according to any one of embodiments
51-56, wherein the amino acid substitution in position 539 is 539R, the position corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase.
Embodiment 58. The glucoamylase variant according to any one of embodiments
51-57, wherein the amino acid substitution in position 44 is 44R, the position corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase.
Embodiment 59. The glucoamylase variant according to any one of embodiments
51-58, wherein the amino acid substitution in position 61 is 611, the position corresponding to the respective position in SEQ ID NO:2 or an equivalent position In a parent glucoamylase.
Embodiment 60. The glucoamylase variant according to any one of embodiments
51-59 comprising the following amino acid substitutions: a. D44R and A539R; or b. D44R, N61I and A539R, the positions corresponding to the respective position in SEQ ID IMO:2 or an equivalent position in a parent glucoamylase.
Embodiment 61. The glucoamylase variant according to any one of embodiments
51-60 consisting of SEQ ID l\IO:2 and having the following amino acid substitutions: a. D44R and A539R; or b. D44R, N61I and A539R, the positions corresponding to the respective position in SEQ ID NO: 2.
Embodiment 62. The glucoamylase variant according to any one of embodiments
51-61, wherein the glucoamylase variant has a starch binding domain that has at least 96%, 97%, 98%, 99%, or 99.5% sequence identity with the starch binding domain of SEQ ID NO: 1, 2, 11, 385, 386, 387, 388, 389, or 390.
Embodiment 63. The glucoamylase variant according to any one of embodiments
51-62, wherein the glucoamylase variant has a catalytic domain that has at least 80%, 85%, 90%, 95%, or 99.5% sequence Identity with the catalytic domain of SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9. Embodiment 64. The glucoamylase variant according to any one of embodiments
50-63, wherein the parent glucoamylase is selected from a glucoamylase obtained from a Trichoderma spp., an Aspergillus spp., a Humicola spp., a Penicillium spp., a Talaromyces spp., or a Schizosaccharmyces spp.
Embodiment 65. The glucoamylase variant according to any one of embodiments
50-64, wherein the parent glucoamylase is obtained from a Trichoderma spp. or an
Aspergillus spp.
Embodiment 66. The glucoamylase variant according to any one of embodiments
50-65, which glucoamylase exhibit an enhanced production of fermentable sugar(s) as compared to the parent glucoamylase such as TrGA.
Embodiment 67. The glucoamylase variant according to any one of embodiments
50-66, which glucoamylase exhibit an enhanced production of fermentable sugars in the mashing step of the brewing process as compared to the parent glucoamylase such as TrGA.
Embodiment 68. The glucoamylase variant according to any one of embodiments
50-67, which glucoamylase exhibit an enhanced production of fermentable sugars in the fermentation step of the brewing process as compared to the parent glucoamylase such as TrGA.
Embodiment 69. The glucoamylase variant according to embodiment 68, wherein the fermentable sugar is glucose.
Embodiment 70. The glucoamylase variant according to any one of embodiments
50-69, which glucoamylase exhibit a reduced ratio between isomaltose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase such as TrGA.
Embodiment 71. The glucoamylase variant according to any one of embodiments
50-70, which glucoamylase exhibit a reduced starch hydrolysis activity which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent glucoamylase such as TrGA.
Embodiment 72. The glucoamylase variant according to any one of embodiments
50-71, which glucoamylase exhibit an enhanced real degree of fermentation as compared to the parent glucoamylase such as TrGA. Embodiment 73. The glucoamylase variant according to any one of embodiments
50-72, which glucoamylase forms a lower amount of condensation products than the amount of condensation products formed by Aspergillus niger (AnGA) (SEQ ID NO: 6) under the same conditions.
Embodiment 74. The glucoamylase variant according to any one of embodiments
50-73, which glucoamylase forms an amount of condensation products which amount is essentially the same as, not more than 5%, not more than 8%, or not more than 10% higher than the amount of condensation products formed by Aspergillus niger (AnGA) (SEQ ID NO: 6) under the same conditions.
Embodiment 75. The glucoamylase variant according to any one of embodiments
73-74, wherein the dosing of the glucoamylases are the same based on protein
concentration.
Embodiment 76. The glucoamylase variant according to any one of embodiments
73-74, wherein the dosing of the glucoamylases are the same based on measurement of activity In activity assays.
Embodiment 77. The glucoamylase variant according to any one of embodiments
50-76, which glucoamylase has been purified.
Embodiment 78. A polynucleotide encoding a glucoamylase variant according to any of embodiments 50-77.
Embodiment 79. A vector comprising the polynucleotide according to embodiment
78, or capable of expressing a glucoamylase variant according to any of embodiments 50-77.
Embodiment 80. A host cell comprising a vector according to embodiment 79.
Embodiment 81. A host cell which has stably integrated into the chromosome a nucleic acid encoding the variant glucoamylase according to any of embodiments 50-80.
Embodiment 82. A cell capable of expressing a glucoamylase variant according to any one of embodiments 50-76.
Embodiment 83. The host cell according to any one of embodiments 78-81, or the cell according to embodiment 81, which is a bacterial, fungal or yeast cell. Embodiment 84. The host cell according to embodiment 83, which Is Trichoderma spp. such as Trichoderma reesei.
Embodiment 85. The host eel! according to any one of embodiments 83-84, which is a protease deficient and/or xylanase deficient and/or native glucanase deficient host cell.
Embodiment 86. A method of expressing a giucoamylase variant, the method comprising obtaining a host cell or a cell according to any one of embodiments 80-85 and expressing the giucoamylase variant from the cell or host cell, and optionally purifying the giucoamylase variant.
Embodiment 87. The method according to embodiment 86 comprising purifying the giucoamylase variant.
Embodiment 88. Use of a giucoamylase variant according to any one of embodiments 50-76 for the preparation of an enzymatic composition.
Embodiment 89. An enzymatic composition comprising at least one giucoamylase variant according to any one of embodiments 50-77.
Embodiment 90. The enzymatic composition according to embodiment 89 comprising at least one giucoamylase variant according to any one of embodiments 50-77, wherein the composition is selected from among a starch hydrolyzing composition, a saccharifying composition, a detergent, an alcohol fermentation enzymatic composition, and an animal feed.
Embodiment 91. The enzymatic composition according to embodiment 90, which is a starch hydrolyzing composition.
Embodiment 92. The enzymatic composition according to any one of embodiments
89-91 comprising at least one additional enzyme selected among amylase, protease, pullulanase, celiulase, glucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, and a further giucoamylase.
Embodiment 93. The enzymatic composition according to embodiment 89-92, wherein the at least one additional enzyme is selected among amylase, pullulanase, and a further giucoamylase. Embodiment 94. The enzymatic composition according to embodiment 89-93, wherein the at least one additional is selected among amylase and pullulanase.
Embodiment 95. The enzymatic composition according to any one of embodiments
89-94, wherein the amylase Is selected among alpha-amylase, and isoamylase.
Embodiment 96. A method for converting starch or partially hydrolyzed starch into a syrup containing glucose, said process including saccharifying a liquid starch solution in the presence of at least one glucoamylase variant according to any one of embodiments 50-77 or an enzymatic composition according to any one of embodiments 89-95.
Embodiment 97. The method according to embodiment 96 of saccharifying a liquid starch solution, which comprises an enzymatic saccharification step using a glucoamylase variant according to embodiment 50-77 or an enzymatic composition according to any one of embodiments 89-95.
Embodiment 98. The method according to any one of embodiments 96-97, further comprising contacting the liquid starch solution with at least one additional enzyme.
Embodiment 99. The method according to embodiment 98, wherein the additional enzyme is selected among amylase, protease, pullulanase, cellulase, glucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, and glucoamylase.
Embodiment 100. The method according to embodiment 96-99, wherein the additional enzyme is amylase and pullulanase.
Embodiment 101, The method according to embodiment any one of embodiments
96-100, wherein the amylase is selected among alpha-amylase, and isoamylase.
Embodiment 102. Use of a glucoamylase variant according to any one of embodiments 50-77 in a starch conversion process, such as a in a continuous starch conversion process.
Embodiment 103. Use of a glucoamylase variant according to any one of embodiments 50-77 in a process for producing oligosaccharides, maltodextrins, or glucose syrups.
Embodiment 104. Use of a glucoamylase variant according to any one of
embodiments 50-77 in a process for producing high fructose corn syrup. Embodiment 105. A method for producing a wort for brewing comprising forming a mash from a grist, and contacting the mash with a glucoamylase variant according to any one of embodiments 50-77 or an enzymatic composition according to any one of
embodiments 89-95.
Embodiment 106. The method of embodiment 105, further comprising contacting the mash with one or more additional enzyme(s)
Embodiment 107. The method according to embodiment 106, wherein the one or more enzyme(s) is selected among amylase, protease, puliulanase, cellulase, endoglucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, and glucoamylase.
Embodiment 108. The method according to embodiment 107, wherein the one or more enzyme(s) is amylase and/or puliulanase.
Embodiment 109. The method according to embodiment any one of embodiments
107-108, wherein the amylase is alpha-amylase and/or isoamylase.
Embodiment 110. The method according to any one of embodiments 105-109, wherein the grist comprises one ore more of malted grain, unmalted grain, adjunct, and any combination thereof.
Embodiment 111. The method of any one of embodiments 105-110, further comprising fermenting the wort to obtain a fermented beverage.
Embodiment 112. The method of any one of embodiments 105-111, further comprising fermenting the wort to obtain a beer.
Embodiment 113. A method for production of a beer which comprises: a. preparing a mash, b. filtering the mash to obtain a wort, and c. fermenting the wort to obtain a beer, wherein a glucoamylase variant according to any one of embodiments 50-77 is added to: step (a) and/or step (b) and/or step (c). Embodiment 114. The method of embodiment 113, wherein the beer is subjected to a pasteurization step.
Embodiment 115. Use of a glucoamylase variant according to any one of embodiments 50-77 to enhance the production of fermentable sugars in either the mashing step or the fermentation step of a brewing process.
Embodiment 116. A beer, wherein the beer is produced by the steps of: a. preparing a mash, b. filtering the mash to obtain a wort, c. fermenting the wort to obtain a beer, and d. pasteurizing the beer, wherein a glucoamylase variant according to any one of embodiments 50-77 is added to: step (a) and/or step (b) and/or step (c).
Embodiment 117. The beer of embodiment 116, wherein the pasteurized beer is further characterized as being: a. essentially without glucoamylase activity; and/or b. a low-calorie beer and/or a low-alcohoi beer.
Embodiment 118. Use of a glucoamylase variant according to any one of embodiments 50-77 in an alcohol fermentation process.
Embodiment 119. A screening method for identification of a glucoamylase variant having a reduced ratio between isomaitose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase.
Embodiment 120. A screening method for identification of a glucoamylase variant having the same or increased starch hydrolysis activity and reduced isomaitose synthesis, which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent glucoamylase and having a reduced ratio between isomaitose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase. Embodiment 121. A screening method for identification of a glucoamylase variant having a reduced synthesis of condensation products during hydrolysis of starch, the method comprising the steps of measuring the isomaltose synthesis and starch hydrolysis activity of glucoamylase variants and selecting the variants having a reduced starch hydrolysis activity which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent glucoamylase and having a reduced ratio between isomaltose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase.
Embodiment 122. The glucoamylase variant obtained by the method according to any one of embodiments 119-121.
Further embodiments also part of the invention:
Further embodiment 1. A glucoamylase variant comprising the following amino acid substitutions: a. 44R and 539R; or b. 44R, 611 and 539R, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase, wherein the glucoamylase variant has at least 80% sequence identity with SEQ ID NO: 1 or 2, or the parent glucoamylase.
Further embodiment 2. The glucoamylase variant according to further embodiment 1 comprising the following amino acid substitutions: a. D44R and A539R; or b. D44R, N61I and A539R, the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase, wherein the glucoamylase variant has at least 80% sequence identity with SEQ ID NO: 1 or 2, or the parent glucoamylase.
Further embodiment 3. The glucoamylase variant according to any one of further embodiments 1-2 comprising the following amino acid substitutions: a. D44R, N61I and A539R, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase, wherein the glucoamylase variant has at least 80% sequence identity with SEQ ID NO: 1 or 2, or the parent glucoamylase.
Further embodiment 4, The glucoamylase variant according to any one of further embodiments 1-2 comprising the following amino acid substitutions: a. D44 and A539R, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase, wherein the glucoamylase variant has at least 80% sequence identity with SEQ ID NO: 1 or 2, or the parent glucoamylase.
Further embodiment 5. The glucoamylase variant of any one of further embodiments 1-4, wherein the glucoamylase variant has at least 85% or 90% sequence identity with SEQ ID NO; 1 or 2.
Further embodiment 6. The glucoamylase variant of further embodiment 5, wherein the glucoamylase variant has at least 95% sequence identity with SEQ ID NO: 1 or 2.
Further embodiment 7. The glucoamylase variant of further embodiment 6, wherein the glucoamylase variant has at least 99.5% sequence identity with SEQ ID NO: 1 or 2.
Further embodiment 8. The glucoamylase variant of any one of further embodiments 1-7, wherein the parent glucoamylase comprises SEQ ID NO: 1 or 2.
Further embodiment 9. The glucoamylase variant of further embodiment 8, wherein the parent glucoamylase consists of SEQ ID NO: 1 or 2.
Further embodiment 10. The glucoamylase variant according to any one of further embodiments 1-9, wherein the glucoamylase variant has a starch binding domain that has at least 96%, 97%, 98%, 99%, or 99.5% sequence identity with the starch binding domain of SEQ ID NO: 1, 2, 11, 385, 386, 387, 388, 389, or 390.
Further embodiment 11. The glucoamylase variant according to any one of further embodiments 1-10, wherein the glucoamylase variant has a catalytic domain that has at least 80%, 85%, 90%, 95%, or 99.5% sequence identity with the catalytic domain of SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9. Further embodiment 12. The glucoamylase variant according to any one of further embodiments 1-11, wherein the parent glucoamylase is selected from a glucoamylase obtained from a Trichoderma spp., an Aspergillus spp., a Humicola spp., a Penicillium spp., a Talaromyces spp., or a Schizosaccharmyces spp.
Further embodiment 13. The glucoamylase variant according to any one of further embodiments 1-12, wherein the parent glucoamylase is obtained from a Trichoderma spp. or an Aspergillus spp.
Further embodiment 14. The glucoamylase variant according to any one of further embodiments 1-13, which glucoamylase exhibit an enhanced production of fermentable sugar(s) as compared to the parent glucoamylase.
Further embodiment 15. The glucoamylase variant according to any one of further embodiments 1-14, which glucoamylase exhibit an enhanced production of fermentable sugars in the mashing step of the brewing process as compared to the parent glucoamylase.
Further embodiment 16. The glucoamylase variant according to any one of further embodiments 1-15, which glucoamylase exhibit an enhanced production of fermentable sugars in the fermentation step of the brewing process as compared to the parent glucoamylase.
Further embodiment 17. The glucoamylase variant according to further embodiment 16, wherein the fermentable sugar is glucose.
Further embodiment 18. The glucoamylase variant according to any one of further embodiments 1-17, which glucoamylase exhibit a reduced ratio between isomaltose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase.
Further embodiment 19. The glucoamylase variant according to any one of further embodiments 1-18, which glucoamylase exhibit a reduced starch hydrolysis activity which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent glucoamylase.
Further embodiment 20. The glucoamylase variant according to any one of further embodiments 1-19, which glucoamylase exhibit an enhanced real degree of fermentation as compared to the parent glucoamylase. Further embodiment 21. The glucoamylase variant according to any one of further embodiments 1-20, which glucoamylase forms a lower amount of condensation products than the amount of condensation products formed by Aspergillus niger (AnGA) (SEQ ID NO: 6) under the same conditions.
Further embodiment 22. The glucoamylase variant according to any one of further embodiments 1-21, which glucoamylase forms an amount of condensation products which amount is essentially the same as, not more than 5%, not more than 8%, or not more than 10% higher than the amount of condensation products formed by Aspergillus niger (AnGA) (SEQ ID NO: 6) under the same conditions.
Further embodiment 23. The glucoamylase variant according to any one of further embodiments 18-21, wherein the dosing of the glucoamylases are the same based on protein concentration.
Further embodiment 24. The glucoamylase variant according to any one of further embodiments 18-23, wherein the dosing of the glucoamylases are the same based on measurement of activity in activity assays.
Further embodiment 25. The glucoamylase variant according to any one of further embodiments 1-24, which glucoamylase has been purified.
Further embodiment 26. A polynucleotide encoding a glucoamylase variant according to any of further embodiments 1-25.
Further embodiment 27. A vector comprising the polynucleotide according to further embodiment 26, or capable of expressing a glucoamylase variant according to any of further embodiments 1-25.
Further embodiment 28. A host cell comprising a vector according to further embodiment 27.
Further embodiment 29. A host cell which has stably Integrated into the chromosome a nucleic acid encoding the variant glucoamylase according to any of further embodiments 1- 25.
Further embodiment 30. A cell capable of expressing a glucoamylase variant according to any one of further embodiments 1-25. Further embodiment 31. The host cell according to any one of further embodiments 28-29, or the cell according to further embodiment 30, which is a bacterial, fungal or yeast cell.
Further embodiment 32. The host cell according to further embodiment 31, which is Tr!choderma spp. such as Trichoderma reeset.
Further embodiment 33. The host cell according to any one of further embodiments 28-29 and 31-32, which is a protease deficient and/or xylanase deficient and/or glucanase deficient host cell.
Further embodiment 34. A method of expressing a glucoamylase variant, the method comprising obtaining a host cell or a cell according to any one of further embodiments 28-33 and expressing the glucoamylase variant from the cell or host cell, and optionally purifying the glucoamylase variant.
Further embodiment 35. The method according to further embodiment 34 comprising purifying the glucoamylase variant,
Further embodiment 36. Use of a glucoamylase variant according to any one of further embodiments 1-25 for the preparation of an enzymatic composition.
Further embodiment 37. An enzymatic composition comprising at least one glucoamylase variant according to any one of further embodiments 1-25.
Further embodiment 38. An enzymatic composition comprising at least one glucoamylase variant according to any one of embodiments 1-25, said enzyme composition comprising one or more further enzymes.
Further embodiment 39. The enzymatic composition according to any one of further embodiments 37-38 comprising at least one glucoamylase variant according to any one of further embodiments 1-25, wherein the composition is selected from among a starch hydrolyzing composition, a saccharifying composition, a detergent composition, an alcohol fermentation enzymatic composition, and an animal feed composition.
Further embodiment 40. An enzymatic composition according to any one of further embodiments 36-39 comprising at least one additional enzyme selected among amylase, protease, pullulanase, isoamylase, cellulase, glucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, phytase and a further glucoamylase. Further embodiment 41. The enzymatic composition according to any one of further embodiments 36-40, wherein the composition comprises at least one additional enzyme selected among alpha-amylase and/or pullu!anase.
Further embodiment 42. The enzymatic composition according to any one of further embodiments 36-41, wherein the composition comprises alpha-amylase and pullulanase.
Further embodiment 43. The enzymatic composition according to any one of further embodiments 36-42, which enzymatic composition comprises less than 1, less than 0.8, less than 0.6, less than 0.5, less than 0.4, less than 0.2, less than 0.125, less than 0.1, less than 0.05, less than 0.01, or less than 0.005 XU of xylanase activity per GAL) of a glucoamylase variant according to any one of further embodiments 1-25.
Further embodiment 44. The enzymatic composition according to any one of further embodiments 36-43, which enzymatic composition comprises less than 400, less than 200, less than 50, less than 20, or less than 2 XU of xylanase activity per gram of the composition,
Further embodiment 45. The enzymatic composition according to any one of further embodiments 36-44, which enzymatic composition comprises between 0.1 - 20, 1-15, 2-10, or 3-10 SSU of alpha-amylase activity per GAU of a glucoamylase variant according to any one of further embodiments 1-25.
Further embodiment 46. The enzymatic composition according to any one of further embodiments 36-45, which enzymatic composition comprises between 0.05 - 10, 0.1 - 10, 0.1-8, 0.1-5, 0.1 -3, 0.2-3, or 0.2-2 PU of pullulanase activity per GAU of a glucoamylase variant according to any one of further embodiments 1-25.
Further embodiment 47, The enzymatic composition according to any one of further embodiments 36-46, which enzymatic composition comprises between 0.05 - 10 PU of pullulanase activity per GAU of a glucoamylase variant according to any one of further embodiments l~25and between 0.1 - 20 SSU of alpha-amylase activity per GAU of a glucoamylase variant according to any one of further embodiments 1-25.
Further embodiment 48. The enzymatic composition according to any one of further embodiments 36-47, which enzymatic composition comprises between 0.05 - 10 PU of pullulanase activity per GAU of a glucoamylase variant according to any one of further embodiments l-25and between 0.1 - 20 SSU of alpha-amylase activity per GAU of a glucoamylase variant according to any one of further embodiments 1-25 and less than 1, less than 0.8, less than 0.6, less than 0.5, less than 0.4, less than 0,2, less than 0.125, less than 0.1, less than 0.05, less than 0.01, or less than 0.005 XU of xylanase activity per GAU of a glucoamy!ase according to any one of further embodiments 1-25.
Further embodiment 49. A method for producing a wort for brewing comprising forming a mash from a grist, and contacting the mash with a glucoamylase variant according to any one of further embodiments 1-25 or an enzymatic composition according to any one of further embodiments 36-48.
Further embodiment 50. The method of further embodiment 49, further comprising contacting the mash with one or more additional enzyme(s)
Further embodiment 51. The method according to further embodiment 50, wherein the one or more enzyme(s) is selected among amylase, protease, pullulanase, isoamylase, cellulase, endoglucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, phytase and glucoamylase.
Further embodiment 52. The method according to further embodiment 51, wherein the one or more enzyme(s) is/are alpha-amylase and/or pullulanase.
Further embodiment 53. The method according to any one of further embodiments 49-52, wherein the grist comprises one ore more of malted grain, unmaited grain, adjunct, and any combination thereof.
Further embodiment 54. The method of any one of further embodiments 49-53, further comprising fermenting the wort to obtain a fermented beverage.
Further embodiment 55. The method of any one of further embodiments 49-54, further comprising fermenting the wort to obtain a beer.
Further embodiment 56. A method for production of a beer which comprises: a. preparing a mash, b. filtering the mash to obtain a wort, and c. fermenting the wort to obtain a beer, wherein a glucoamylase variant according to any one of further embodiments 1-25 or an enzymatic composition according to any one of further embodiments 36-48 is added to: step (a) and/or step (b) and/or step (c).
Further embodiment 57. The method of further embodiment 55, wherein the beer is subjected to a pasteurization step.
Further embodiment 58. Use of a glucoamylase variant according to any one of further embodiments 1-25 or an enzymatic composition according to any one of further
embodiments 36-48 to enhance the production of fermentable sugars in either the mashing step or the fermentation step of a brewing process.
Further embodiment 59. A beer, wherein the beer is produced by the steps of: a. preparing a mash, b. filtering the mash to obtain a wort, c. fermenting the wort to obtain a beer, and d. pasteurizing the beer, e. wherein a glucoamylase variant according to any one of further embodiments 1- 25 or an enzymatic composition according to any one of further embodiments 36- 48 is added to: step (a) and/or step (b) and/or step (c).
Further embodiment 60. The beer of further embodiment 59, wherein the pasteurized beer is further characterized as being: a. essentially without glucoamylase activity; and/or b. a low-calorie beer and/or a low-alcohol beer.
The invention will now be further described by way of the following non-limiting examples. P T/EP2011/061082
132
133
2011/061082
134
61082
135
11061082
1061082
137
138
139
140
SEQ ID
Primer ONA sequence
NO:
Alll-70 CAAGAACGAGGCGTACGACCACGTCAGGTGAACCGCAGAC 719
All 1-82 j TGTCGACACGAGCGCGTGGAAGGTGACGGCCACGGAGGTT 720
All 1-83 [ TCCACGCGCTCGTGTCGACACAGTTTGGCCACACGGTCAA 721
Alll-84 j CCGCGGCGTTGCCCGCCACCTTGACCGTGTGGCCAAACTG 722
Alll-87 AGCGCCGCCGTGGCTCTGGACGCCGTCAACTATAGAGATA 723
Alll-88 i CCCAATCCACAGGGGGTGGTTATCTCTATAGTTGACGGCG 724
AII2-13 j TGCGGTGATTGCATCTCCCAGCACACTTGACCCGGACTAC 725
AII2-14 j TCTCGCGTCCACATGTAATAGTAGTCCGGGTCAAGTGTGC 726
AII2-69 CGCAACAGCGGCACTCCGCTGTCTGCGGTTCACCTGACGT 727
AII2-70 CAAGAACGAGGCGTACGACCACGTCAGGTGAACCGCAGAC 728
AII2-82 TGTCGACACGAGCGCGTGGAAGGTGACGGCCACGGAGGTT 729
AII2-83 TCCACGCGCTCGTGTCGACACAGTTTGGCCACACGGTCAA 730
AII2-84 CCGCGGCGTTGCCCGCCACCTTGACCGTGTGGCCAAACTG 731
AII2-87 AGCGCCGCCGTGGCTCTGGACGCCGTCAACTATAGAGATA 732
AII2-88 CCCAATCCACAGGGGGTGGTTATCTCTATAGTTGACGGCG 733
AII3-13 TGCGGTGATTGCATCTCCCAGCACACTTTGCCCGGACTAC 734
AII3-14 TCTCGCGTCCACATGTAATAGTAGTCCGGGCAAAGTGTGC 735
AII3-16 GGTGAAGCGGTCGATGAGGATCTTGAAGACAAGAGCGCTA 736
AII3-17 TCCTCATCGACCGCTTCACCGAAACGTACGATGCGGGCCT 737
AII3-69 CGCAACAGCGGCACTCCGCTGTCTGCGGTTCACCTGACGT 738
AII3-70 CAAGAACGAGGCGTACGACCACGTCAGGTGAACCGCAGAC 739
AII3-82 TGTCGACACGAGCGCGTGGAAGGTGACGGCCACGGAGGTT 740
AII3-83 TCCACGCGCTCGTGTCGACACA 1 1 1 GGCCACACGGTCAA 741
AII3-84 CCGCGGCGTTGCCCGCCACCTTGACCGTGTGGCCAAACTG 742
AII3-87 AGCGCCGCCGTGGCTCTGGACGCCGTCAACTATAGAGATA 743
AII3-88 j CCCAATCCACAGGGGGTGGTTATCTCTATAGTTGACGGCG 744
AII4-13 j TGCGGTGATTGCATCTCCCAGCACACTTGACCCGGACTAC 745 AII4-14 j TCTCGCGTCCACATGTAATAGTAGTCCGGGTCAAGTGTGC 746
AII4-16 1 GGTGAAGCGGTCGATGAGGATCTTGAAGACAAGAGCGCTA 747
A/14-17 j TCCTCATCGACCGCTTCACCGAAACGTACGATGCGGGCCT j 748 141
SEQ ID
Primer ONA sequence
NO:
ΑΠ4-69 CGCAACAGCGGCACTCCGCTGTCTGCGGTTCACCTGACGT 749
AII4-70 CAAGAACGAGGCGTACGACCACGTCAGGTGAACCGCAGAC 750
AII4-82 TGTCGACACGAGCGCGTGGAAGGTGACGGCCACGGAGGTT 751
AII4-83 TCCACGCGCTCGTGTCGACACAGTTTGGCCACACGGTCAA 752
AM4-84 CCGCGGCGTTGCCCGCCACCTTGACCGTGTGGCCAAACTG 753
AII4-87 AGCGCCGCCGTGGCTCTGGACGCCGTCAACTATAGAGATA 754
AII4-88 CCCAATCCACAGGGGGTGGTTATCTCTATAGTTGACGGCG 755
AII5-13 TGCGGTGATTGCATCTCCCAGCACAAGAGACCCGGACTAC 756
AII5-14 TCTCGCGTCCACATGTAATAGTAGTCCGGGTCTCTTGTGC 757
AII5-69 CGCAACAGCGGCACTCCGCTGTCTGCGGTTCACCTGACGT 758
AII5-70 CAAGAACGAGGCGTACGACCACGTCAGGTGAACCGCAGAC 759
AII5-82 TGTCGACACGAGCGCGTGGAAGGTGACGGCCACGGAGGTT 760
AII5-83 TCCACGCGCTCGTGTCGACACAGTTTGGCCACACGGTCAA 761
AII5-84 CCGCGGCGTTGCCCGCCACCTTGACCGTGTGGCCAAACTG 762
AII5-87 AGCGCCGCCGTGGCTCTGGACGCCGTCAACTATAGAGATA 763
AII5-88 CCCAATCCACAGGGGGTGGTTATCTCTATAGTTGACGGCG 764
AII6-13 TGCGGTGATTGCATCTCCCAGCACAAGAGACCCGGACTAC 765
AK6-14 TCTCGCGTCCACATGTAATAGTAGTCCGGGTCTCTTGTGC 766
AII6-16 GGTGAAGCGGTCGATGAGGATCTTGAAGACAAGAGCGCTA 767
AII6-17 TCCTCATCGACCGCTTCACCGAAACGTACGATGCGGGCCT 768
AII6-69 CGCAACAGCGGCACTCCGCTGTCTGCGGTTCACCTGACGT 769
AI16-70 CAAGAACGAGGCGTACGACCACGTCAGGTGAACCGCAGAC 770
AII6-82 TGTCGACACGAGCGCGTGGAAGGTGACGGCCACGGAGGTT 771
AII6-83 TCCACGCGCTCGTGTCGACACAGTTTGGCCACACGGTCAA j 772
AII6-84 CCGCGGCGTTGCCCGCCACCTTGACCGTGTGGCCAAACTG j 773
A1I6-87 AGCGCCGCCGTGGCTCTGGACGCCGTCAACTATAGAGATA 774
AII6-88 CCCAATCCACAGGGGGTGGTTATCTCTATAGTTGACGGCG 775
AII7-13 TGCGGTGATTGCATCTCCCAGCACAAGAGACCCGGACTAC 776
A1I7-14 TCTCGCGTCCACATGTAATAGTAGTCCGGGTCTCTTGTGC 777
AII7-69 CGCAACAGCGGCACTCCGCTGTCTGCGAGACACCTGACGT 778 142
2
143
144
145
146
147
148
149
SEQ ID
Primer 1 DNA sequence
NO:
GAV st-76 ; GGCGGTGGGACGCGAGTAGGATCCGACCACGGACGCGCCG 989
GAV st-77 CCTACTCGCGTCCCACCGCCACGTCATTCCCTCCGTCGCA 990
GAV st- 78 GCACGCCAGGCTTGGGCGTCTGCGACGGAGGGAATGACGT 991
GAV st- 79 GACGCCCAAGCCTGGCGTGCCTTCCGGTACTCCCTACACG 992 GAV st-80 GGGGTCGCGCAGGGCAGGGGCGTGTAGGGAGTACCGGAAG 993
GAV st-81 CCCCTGCCCTGCGCGACCCCAACCTCCGTGGCCGTCACCT 994
GAV st-82 TGTCGACACGAGCTCGTGGAAGGTGACGGCCACGGAGGTT 995
GAV st-83 TCCACGAGCTCGTGTCGACACAGTTTGGCCACACGGTCAA 996 GAV st-84 CCGCGGCGTTGCCCGCCACCTTGACCGTGTGGCCAAACTG 997 GAV st-85 GGTGGCGGGCAACGCCGCGGCCCTGGGCAACTGGAGCACG 998
GAV st-86 TCCAGAGCCACGGCGGCGCTCGTGCTCCAGTTGCCCAGGG 999 GAV st-87 AGCGCCGCCGTGGCTCTGGACGCCGTCAACTATGCCGATA 1000
GAV st-88 CCCAATCCACAGGGGGTGGTTATCGGCATAGTTGACGGCG 1001
GAV st-89 ACCACCCCCTGTGGATTGGGACGGTCAACCTCGAGGCTGG 1002
GAV st-90 ACTTGTACTCCACGACGTCTCCAGCCTCGAGGTTGACCGT 1003
GAV st-91 AGACGTCGTGGAGTACAAGTACATCAATGTGGGCCAAGAT 1004 GAV st-92 CTCTCCCAGGTCACGGAGCCATCTTGGCCCACATTGATGT 1005
GAV st-93 GGCTCCGTGACCTGGGAGAGTGATCCCAACCACACTTACA 1006
GAV st-94 ACAAGCCACCGCAGGAACCGTGTAAGTGTGGTTGGGATCA 1007 GAV st-95 CGGTTCCTGCGGTGGCTTGTGTGACGCAGGTTGTCAAGGA 1008
GAV St-96 TTTACGACTGCCAGGTGTCCTCCTTGACAACCTGCGTCAC 1009
GAV st-97 GGACACCTGGCAGTCGTAAACCCAGC 1 I TC1TGTACAAAG 1010
GAV st-98 CTCTGGGGACCACTTTGTACAAGAAAGCTGGG 1011 B1-16 GGTGAAGCGGTCGATGAGGATCTTGAAGACAAGAGCGCTA 1012 RB1-17 TCCTCATCGACCGCTTCACCGAAACGTACGATGCGGGCCT 1013 RB1-71 GGTCGTACGCCTCGTTCT GACAGCCGCGGCCCGTCGGGC 1014
RB1-72 ACGAGGGGGGCACGATGCCAGCCCGACGGGCCGCGGCTGT 1015 RB2-69 CGCAACAGCGGCACTCCGCTGTCTGCGGTTCACCTGACGT 1016 RB2-70 CAAGAACGAGGCGTACGACCACGTCAGGTGAACCGCAGAC 1017
RB2-71 GGTCGTACGCCTCGTTCTTGACAGCCGCGGCCCGTCGGGC 1018 150
SEQ ID
Primer DNA sequence
NO:
RB2-72 ACGAGGGGGGCACGATGCCAGCCCGACGGGCCGCGGCTGT 1019
RB3-71 GGTCGTACGCCTCGTTCTTGACAGCCGCGCTCCGTCGGGC 1020
RB3-72 ACGAGGGGGGCACGATGCCAGCCCGACGGAGCGCGGCTGT 1021
RB1-71 ! GGTCGTACGCCTCGTTCTTGACAGCCGCGGCCCGTCGGGC 1022
RB1-72 1 ACGAGGGGGGCACGATGCCAGCCCGACGGGCCGCGGCTGT 1023
RB4-82 TGTCGACACGAGCGCGTGGAAGGTGACGGCCACGGAGGTT 1024
RB4-83 TCCACGCGCTCGTGTCGACACAGTTTGGCCACACGGTCAA 1025
RB4-71 GGTCGTACGCCTCGTTCTTGACAGCCGCGGCCCGTCGGGC 1026
RB4-72 ACGAGGGGGGCACGATGCCAGCCCGACGGGCCGCGGCTGT 1027
RB5-71 1 GGTCGTACGCCTCGTTCTTGACAGCCGCGGCCCGTCGGGC 1028
RB5-72 1 ACGAGGGGGGCACGATGCCAGCCCGACGGGCCGCGGCTGT 1029
RB5-87 AGCGCCGCCGTGGCTCTGGACGCCGTCAACTATCGCGATA 1030
RB5-88 CCCAATCCACAGGGGGTGGTTATCGCGATAGTTGACGGCG 1031
RB6-16 GGTGAAGCGGTCGATGAGGATCTTGAAGACAAGAGCGCTA 1032
RB6- 17 TCCTCATCGACCGCTTCACCGAAACGTACGATGCGGGCCT 1033
RB6-71 GGTCGTACGCCTCGTTCTTGACAGCCGCGGCCCGTCGGGC 1034
RB6-72 ACGAGGGGGGCACGATGCCAGCCCGACGGGCCGCGGCTGT 1035
RB6-87 AGCGCCGCCGTGGCTCTGGACGCCGTCAACTATCGCGATA 1036
RB6-88 CCCAATCCACAGGGGGTGGTTATCGCGATAGTTGACGGCG 1037
RB7-69 CGCAACAGCGGCACTCCGCTGTCTGCGGTTCACCTGACGT 1038
RB7-70 CAAGAACGAGGCGTACGACCACGTCAGGTGAACCGCAGAC 1039
RB7-71 GGTCGTACGCCTCGTTCTTGACAGCCGCGGCCCGTCGGGC 1040
RB7-72 ACGAGGGGGGCACGATGCCAGCCCGACGGGCCGCGGCTGT 1041
RB7-87 AGCGCCGCCGTGGCTCTGGACGCCGTCAACTATCGCGATA 1042
RB7-88 CCCAATCCACAGGGGGTGGTTATCGCGATAGTTGACGGCG 1043
RB8-71 GGTCGTACGCCTCGTTCTTGACAGCCGCGCTCCGTCGGGC 1044
RB8-72 ACGAGGGGGGCACGATGCCAGCCCGACGGAGCGCGGCTGT 1045
RB8-87 AGCGCCGCCGTGGCTCTGGACGCCGTCAACTATCGCGATA 1046
RB8-88 CCCAATCCACAGGGGGTGGTTATCGCGATAGTTGACGGCG 1047
RB9-71 GGTCGTACGCCTCGTTCTTGACAGCCGCGCTCCGTCGGGC 1048 151
! SEQ ID
Primer i DNA sequence
i NO:
RB9-72 ACGAGGGGGGCACGATGCCAGCCCGACGGAGCGCGGCTGT 1 1049
RB9-82 TGTCGACACGAGCGCGTGGAAGGTGACGGCCACGGAGGTT ; 1050
RB9-83 TCCACGCGCTCGTGTCGACACAGTTTGGCCACACGGTCAA ! 1051
RB10-16 GGTGAAGCGGTCGATGAGGATCTTGAAGACAAGAGCGCTA j 1052
RB10-17 j TCCTCATCGACCGCTTCACCGAAACGTACGATGCGGGCCT I 1053
RB10-71 GGTCGTACGCCTCGTTCTTGACAGCCGCGCTCCGTCGGGC j 1054
RB10-72 ACGAGGGGGGCACGATGCCAGCCCGACGGAGCGCGGCTGT j 1055
RB10-87 AGCGCCGCCGTGGCTCTGGACGCCGTCAACTATCGCGATA [ 1056
RB10-88 CCCAATCCACAGGGGGTGGTTATCGCGATAGTTGACGGCG 1057
RB11-69 1 CGCAACAGCGGCACTCCGCTGTCTGCGGTTCACCTGACGT 1058
RB11-70 CAAGAACGAGGCGTACGACCACGTCAGGTGAACCGCAGAC 1059
RB11-71 GGTCGTACGCCTCGTTCTTGACAGCCGCGCTCCGTCGGGC 1060
RB11-72 ACGAGGGGGGCACGATGCCAGCCCGACGGAGCGCGGCTGT 1061
RBI 1-87 AGCGCCGCCGTGGCTCTGGACGCCGTCAACTATCGCGATA 1062
RBI 1-88 CCCAATCCACAGGGGGTGGTTATCGCGATAGTTGACGGCG 1063
RB12-16 GGTGAAGCGGTCGATGAGGATCTTGAAGACAAGAGCGCTA 1064
RB12-17 TCCTCATCGACCGCTTCACCGAAACGTACGATGCGGGCCT 1065
RB13-69 CGCAACAGCGGCACTCCGCTGTCTGCGGTTCACCTGACGT 1066
RB13-70 CAAGAACGAGGCGTACGACCACGTCAGGTGAACCGCAGAC 1067
RB14-71 GGTCGTACGCCTCGTTCTTGACAGCCACGCTCCGTCGGGC 1068
RB14-72 ACGAGGGGGGCACGATGCCAGCCCGACGGAGCGTGGCTGT 1069
RB15-87 AGCGCCGCCGTGGCTCTGGACGCCGTCAACTATCGCGATA 1070
RBI 5-88 _ CCCAATCCACAGGGGGTGGTTATCGCGATAGTTGACGGCG 1071
RB16-16 GGTGAAGCGGTCGATGAGGATCTTGAAGACAAGAGCGCTA 1072
RB16-17 TCCTCATCGACCGCTTCACCGAAACGTACGATGCGGGCCT 1073
RB16-87 AGCGCCGCCGTGGCTCTGGACGCCGTCAACTATCGCGATA 1074
RB16-88 CCCAATCCACAGGGGGTGGTTATCGCGATAGTTGACGGCG 1075
RB17-82 TGTCGACACGAGCGCGTGGAAGGTGACGGCCACGGAGGTT 1076
RB17-83 TCCACGCGCTCGTGTCGACACAGTTTGGCCACACGGTCAA 1077
RB17-87 AGCGCCGCCGTGGCTCTGGACGCCGTCAACTATCGCGATA 1078
S 152
Variants were purified from large-scale fermentation, i.e. , 100 ml or 500 ml fermentation, and Pis of thermal stability (Ts) and specific activities were determined. Specifically, specific activities were determined using different substrates, including DP2, DP3, DP4, DPS, DP6, DP7, cornstarch (CS), and liquefact (Liq). Pis are presented in Table 8. "N/D" in Table 8 stands for "not done." Table 8: Pis of representative combinatorial variants
157
Example 9: Homology between TrGA and AaGA
The crystal structure of the TrGA identified in Example 11 in WO2009/067218 (Danisco US Inc., Genencor Division) page 89-93 incorporated herein by reference was superposed on the previously identified crystal structure of the Aspergillus awamori GA (AaGA), The AaGA crystal structure was obtained from the protein database (PDB) and the form of AaGA that was crystallized was the form containing only a catalytic domain (PDB entry number: 1GL ). The structure of the TrGA with all three regions intact was determined to 1.8 Angstrom resolution herein (see Table 20 in WO2009/067218 (Danisco US Inc., Genencor Division) page 94-216 incorporated herein by reference and Example 11 In in WO2009/067218 (Danisco US Inc., Genencor Division) page 89-93 incorporated herein by reference). Using the coordinates (see Table 20 in WO2009/067218 (Danisco US Inc., Genencor Division) page 94-216 incorporated herein by reference), the structure was aligned with the coordinates of the catalytic domain from Aspergillus awamori strain X100 that was determined previously (Aleshin et a!., J. Mol. Biol. 238: 575-591 (1994)). As seen in Figures 6-7, the structure of the catalytic domain overlapped very closely and allowed the identification of equivalent residues based on the structural superposition.
Based on this analysis, sites were identified that could be mutated in TrGA and result in increased thermostability and/or specific activity. There sites include 108, 124, 175, and 316 at the active site. Also identified were specific pairwise variants Y47W/Y315F and
Y47F/Y315W. Other sites identified were 143, D44, P45, D46, R122, R125, V181, E242, Y310, D313, V314, N317, R408, and N409. Because of the high structural homology, it is expected that beneficial variants found at sites in the TrGA would have similar consequence in Aspergillus awamori and other homologous glucoamylases.
The TrGA linker, residues 454-490 is defined as the segment spanning the region between two disulfide bridges, one between residues 222 and 453 and one between residues 491 and 587. Nine of the residues in the linker are prolines. From the crystal structure, the linker extends from the back of the molecule in a wide arc followed by an abrupt turn after the lysine 477 residue on the surface near the substrate binding surface. The linker extends as a random coil that is anchored by interactions of the side chains of Tyr 452, Pro 465, Phe 470, Gin 474, Pro 475, Lys 477, Val 480 and Tyr 486 to regions on the surface of the catalytic domain.
The starch binding domain is composed of a beta-sandwich of two twisted beta sheets, tethered at one end by a disulfide bridge between Cys 491 and Cys 587 and at the other end, having a series of loops that comprise a binding site for starch connected by long loops. The structure of the TrGA SBD is quite similar to the averaged structure of the AnGA SBD 158 determined by NMR (Sorimachi et al., Structure 5: 647-661(1997)) and the SBD of beta amylase from Bacillus cereus (Mikaml, B. et al., Biochemistry 38: 7050-61(1999)). Figure 9 shows an alignment of the AnGA and TrGA crystal structures including the SBD. When aligned with one or both of these SBD's, one loop stands out as being highly variable, corresponding to residues 537-543 (in A. niger the loop is 554-560 and in B. cereus the loop is 462-465). In the NMR structure of beta-cyclodextrin, a starch analog complexed to the SBD of AnGA (Sorimachi et al. (1997) supra), the loop shifts substantially upon binding to cyclodextrin. Thus, this loop is designated the "flexible loop." This flexible loop forms part of the "binding site 2" (see Figure 9 for this binding site in TrGA). A second binding site was also identified in AnGA (binding site 1), a primary site that shares similarities with other carbohydrate binding proteins. Overall, conservation of residues and even side
conformations in the binding site 1 of these SBDs is very high. The figures demonstrate the interactions In these binding sites between the SBD and the catalytic domain that serve to bind to the starch.
Taken together, there appears to be a common pattern for the interactions between the linker and SBD with the catalytic domain. The interaction is in the form of an anchoring side chain that interacts with the surface area of the neighboring domain. In general, the anchor residue is found on the linker segment. In the case of interactions between the CD and SBD, the anchor residues can be contributed from either domain as in the case of residues He 43 and Phe 29 that come from the CD or residue 592, which comes from the SBD.
Example 10: Model of acarbose binding to TrGA
The crystal structure of the TrGA complexed with the inhibitor acarbose has been
determined. Crystals of the complex were obtained by soaking pre-grown native TrGA crystals in acarbose. After soaking for 3 days the crystals were mounted in a seal glass capillary tube and x-ray diffraction was collected with a Rigaku Raxis IV++ image plate detector to a resolution of 2.0 A\ The coordinates were fitted to a difference electron density map. The model was refined to an R-factor of 0.154 with an R-free of 0.201 for a total of 41276 reflection representing all data collected between 27 and 2.0 A resolution. The model of the resulting refined structure Is shown in Figure 9.
Based on the knowledge that the presence of the SBD has an impact on hydrolysis of insoluble starch, it followed that there should be an interaction of the SBD with larger starch molecules. Thus, the structure of the TrGA was compared with known structures of (1) an acarbose bound CD of AaGA and (2) an SBD from A. niger complexed with beta-cyclodextrin. This showed that the beta-cyclodextrin bound at binding site 2 was close to the substrate location as indicated by the location of acarbose bound to the A. awamori CD. Thus, the 159 coordinates of acarbose from the structure model of the AaGA (pdb entylGAI, Aleshin, et al. 1994 supra) were aligned into the TrGA active site. Further, the AnGA SBD structure bound to cyclodextrin (pdb entry 1AC0: Sorimachi, et ai 1997 supra) was aligned. From this, a model was made for acarbose binding to TrGA (see Figure 9). The model showed that the SBD would localize the TrGA CD near disrupted starch, and also prevent the enzyme from diffusing away from the substrate while releasing the product from the active site after hydrolysis. The SBD of TrGA would bind to starch along site 1, and favor localization where a disrupted fragment could bind to site 2 within a loose end that points Into the catalytic site (the active side for the catalytic domain). This model shows how the proposed function of the enzyme is contributed by the structure of the SBD and linker. The amino acid side chains involved in the specific interaction between the CD, the linker and the SBD are specific for Trichoderma reesei GA, however, in other glucoamylases, complementary sequence changes would enable similar overall interactions and domain juxtaposition.
Based on this model, sites were identified for which substitutions could be made in the TrGA SBD to result in increased stability and/or specific activity. Thus, two loops that are part of binding site 1 are likely candidates for alterations to increase or decrease binding to the larger starch molecule. These are loop 1 (aa 560-570) and loop 2 (aa 523-527). Because the two Trp (tryptophan) residues at amino acids 525 and 572 are likely involved directly in starch binding, they would not be as conducive to change. However, the underlying residues, including 516-518 would be conducive, as would the underlying residues 558-562. The loop from residues 570-578 is also a good candidate for alterations. Residues 534-541 are part of the binding site 2 that interacts with the catalytic site on the CD. Thus, these might be a good candidate for alterations that may increase or decrease specific activity.
Because of the high structural homology of the TrGA SBD, it is expected that beneficial variants found at sites in Trichoderma reesei GA would have similar consequences in
Aspergillus awamorl and other homologous glucoamylases. Thus, the structure of the TrGA SBD provides a basis for engineering this and related enzymes for altered properties as compared to a parent glucoamylase. These altered properties may be advantageous for processes in the generation of fuels based on starch feed stocks.
Example 11
Enzymes used:
Purified variant of the Trichoderma reesei glucoamulase (TrGA) with mutations D44R and A539R. The variant is expressed in Trichoderma reesei and is hereafter called BR 1.
Glucoamylase product from fermentation of Aspergillus niger, sold under the name 160
DIAZYME® X4. Pullulanase product from Bacillus deramnificans expressed in Bacillus licheniformis, sold under the name DIAZYME® PIO. Acid a-amylase product from Aspergillus kawachi expressed in Trichoderma reesei, sold under the name GC626.
Results:
Table 9 below shows the RDF values obtained with different combinations of glucoamylase, pullu/anase and alpha-amylase using the above described "Malt-adjunct brew analysis"- method. The glucoamylase, pullulanase and alpha-amylase activity were measured as described above. Three replicates were made for each dose. The average RDF and standard deviation are listed. For giucoamyiases the amount of glucoamylase protein added/kg of grist is listed. Additionally the corresponding activity in GAU/kg of grist is listed. For alpha-amylase and pullulanase the number of enzyme units added/kg of grist is listed together with the corresponding amount of enzyme product (GC626 and DIAZYME® P10 respectively) added/kg of grist. *DIAZYME® X4 also contains some alpha-amylase activity. The number of units of alpha-amylase added when dosing this product is also listed in the table.
It is seen from Table 9, dose 2 and 3 that BRWl performs better in terms of RDF obtained than TrGA. This correlates well with the fact that the BRWl variant has a lower level of reversion activity. When dosed at 1022 mg glucoamylase protein/kg of grist BRWl performs on level with DIAZYME® X4 (compare dose 1 and 3). Note that the glucoamylase in
DIAZYME® X4 (Aspergillus niger glucoamylase) and the BRWl glucoamylase have similar levels of reversion activity. The alpha-amylase activity present in DIAZYME® X4 probably means that the RDF value obtained is slightly higher than what pure Aspergillus niger 1 061082
161 glucoamylase would give, This only emphasizes that the BRWl molecule performs as well if not better than Aspergillus niger glucoamy/ase.
When the dose of BRWl is doubled from 1022 to 2044 mg/kg of grist, the RDF value increases from 83.2 to 84.8 (compare doses 3 and 4). RDF values can also be increased by adding auxiliary enzymes. When BRWl is combined with alpha-amylase at 28172 SSU/kg of grist and pullulanase at 1961 PU/kg of grist the RDF value increases from 83.2 to 84.1 (compare doses 3 and 5). At high dose of BRWl (2044 mg/kg of grist) there is also a benefit of adding auxiliary enzymes, but not as pronounced as with the low dose of BRWl (compare differences in RDF between dose 3 and 5 and dose 4 and 6).
SEQUENCES
Following are sequences, which are herein incorporated by reference in their entirety.
SEQ ID NO: 1: Tric ode.ima reesei glucoamylase, full lenqth; with si-anal peptide
<21.0> 1
<2U> 632
<212> PUT
<213> Triohocierma reesei
<40Q> 1
Met His Va I Le u Ser Thr As a Va Leu Leu Gly Se Val Ala Val Gin
1 5 1.5
Lys Val Leu Gly Acq Pro Gly Ser Ser Gly Leu S r As Val Thr Lys
20 25 30
Arg Ser V¾i -As Asp Phe lie Ser Thr Glu Thr Pro lie Ala Le LJ Asn
35 40 45
Asn Leu Leu Gys A 3 n Val Gly Pro Asp Gly Cys Arc; Ala Phe Gly Thr
50 55 60
Ser A3, a Gly A! -i Va 1 lie Ala Ser Pro Ser Thr lie Asp Pro sp Tyr
65 70 75 80
Tyr Tyr Me T rp Thr A g ASP Ser Ala Leu Va 1 Phe L s Asn Leu 1 Le
85 90 05
As Arc Phe Thr Giu Thr Tyr As la Gly Leu Gin Arg Arg lie Glu
100 105 1.10
Gin Tyr Tie Thr Ala Gin val Thr Leu G .1 n Gl Leu Ser Asn P o Ser
115 120 125
Gi Ser Leu Ala Asp G Ly Ser Gl Leu Giy Glu Pro Lys Phe Glu Leu
130 135 li 0
Thr Leu Lys Pro Phe Thr Gly Asn Trp Gly Arg .Pro Gin Arg As Giy
145 150 155 160
Pro Ala Leu Ar Ala lie Ala Leu 11 e Gly Tyr Se r Lys Trp Leu lie
165 170 175
A Asn Asn T r G ! ri Ser Thr Val Ser Asn Val lie T p P o lie Val
180 155 100
Arg Λ3Ι1 Asp Leu Asn Tyr val Ala Gin Tyr Trp Asn in Thr Gly Phe
] 95 200 205
As Le Trn G I. u Glu VOai Asn Gly he r Ser Phe Phe Thr va 1 Ala Asn
210 215 220
Gin H i s Are AJ a L u Va 1 Giu Gly A.La Th r L u Ala Ala Thr Leu Gly 162
255 230 235 240
'"•'In Ser Gly Se Phe
Leu Gin Arg Phe T Val Ser Ser Gly Gly Tyr Val Asp Se Asn lie
260 265 270
A n Thr Asn Giu Gl Arg Thr. Gly Lys Asp V¾l Asn Ser Gal Leu Thr
275 280 285
Ser lie Has Thr Phe Asp P o sn Leu Gly Gys Asp A3! a Gly Th Phe
290 255 300
n Pro Cys Se Asp Lys Ala Leu Ser Asn Leu Lys val Val Vai Asp
310 313 725
Se r Phe Arg Ser He Tyr Gly Vai Asn L s Gly lie Pro Ala Gl Ala
325 330 333
A Va 2 Ala lie 1y Arg Tyr Ala Giu sp Va 1 Tyr T r Asn Gly Asa
340 345 350
Pro Trp Tyr Leu Ala Th Phe Ala Ala Ala Giu Gin Leu Tyr Asp Al
355 360 365
lie y r Val Trp Lys Lys Th r Gly Ser lie Thr Val Thr Ala Thr Ser
370 575 350
Leu Ala Phe Phe Gin Giu Leu Vai Pro Gly Va 1 Thr Ala Gly Thr Tyr
385 330 395 400
Ser Se r Se Ser Ger Thr Phe Th Asn He ΐ le Asn Ala Va 1 Ser Thr
105 410 415
Tyr AU2 Asp Gly Phe Lea Ser Giu Ala Ala Lys Tyr Va J. Pro Ala Asp
420 425 " 430
Giy Ser Leu Ala Giu Gin Phe Asa Arg Asn Ser (Ώ y Thr Pro Leu Ser
435 440 ' 445
Ala Lea His Leu Thr Trp Ser Tyr Ala Ser Phe Leu Thr Ala Thr Ala
450 455 460
Arg Arg Ala Giy He Va 1 Pro P o Ser Trp Ala Asn Ser Se Ala Ser
465 470 475 4P0
Thr lie P o Se r Thr Gys Ser Gly Ala Ser Va i. va .1 Gly Se Se
485 490 495
Arg Pro Thr Ala Thr Ser Phe Pro Pro Ser G.1n Thr Pro Lys Pro Gly
300 505 510
Val P o Ser Gly Thr Pro Tyr Thr Pro Leu Pro Cys Ala Thr Pro Thr
515 320 525
Ser Vai Ala Val. Thr Phe His Giu Leu Val Ser Th Gin Phe Giy Gin
530 535 540
Thr Va 1 L s Val Ala Gly Asn Ala Ala Ala. Leu Giy Asn Per Thr
545 530 555 550
Ser Al a la Val Ala Leu As Ala Val Asn Tyr Ala Asp Asn His P o
565 570 3/5
.Leu rp 1 le Gly Thr Vai Asn .Leu Giu Ala Gly sp Val Val. Giu Tyr
580 395 590
i-ys T r He Asn Val Giy Gin As Gly Ge Vai Thr Trp Giu Ser Asp
595 600 605
Pro Asa His Thr Tyr Thr Val Pro Ala Vai la. C s Val Thr Gin Val
610 615 620
Val Lys Giu Asp Th r Trp Gin Se r
525 630
3135) TO GO: 2: Tvi cd rma reesei giucoaniyrase , a:atu.re proLern; without sisitral pep ide
<210-> 2
•Hll> 599
-GH2> PPT
<213> richoderma reese
400> 2
Ser Val Asp Asp Phe He Ser Thr Giu Thr Pro He Ala Leu Asn Asn 163
10 15
Leu Leu G s Asr. Lai Giy Pro- Asp Giy Gys Arg Ala Phe Giy Thr Ser
20 25 3θ'
A L a Gi-y Ala Val He Ala Se r Pro Ser Thr He As ro As Tyr Tyr
10 45
Tyr Trp Thr A q Asp Per Aia Leu Va 1. She Lys Asn Leu lie Asp
50 55 60
Arq ??« Thr Glu Th Tyr Asp la Giy Leu Gin Arg Per cj He Glu Gin
65 70 73 80
Ayr lie Thr Aia Gin Val Thr Leu Gin Gly Leu Ser Asn Pro Ser Gi y
85 90 55
!_-eu Aia Asp Gly Ser oiy Leu Gly Glu Pro l s Phe Glu Leu Thr
100 105 .110
Leu Lys Pro Phe Th Gly Asn Hp Gly Arg Pi: o Gl n rg' As Giy Pro
11 Π0 125
id. Leu ALP Ala He Ala Leu ί le Gly Tyr Ser L s T p Le u He As a
130 135 140
Asn Asn Ϊy r Gin Ser Thi r Val Ser Asn Va 1 He Trp Pro He Val Arg
145 130 155 160
Asn As p Leu. Asn T r Va 1. Ala Gin T r T p Asn Gl n Thr Giy Phe .La
165 170 175
Lsu Hp ILLj Gl u Vol Aar Gly .0er Ser Phe Phe Th Pal Al a Asn G 1 n
1.30 1.85 190
His Arg Ala Leu Val Glu Gly Ala Thr Leu Ai a Ala Thr ou G1.y Gin.
155 500 205
ier Gly Se Aia Tyr Ser Ser Va L Ala P ro 1 a Val Leu Cys Phe Leu
210 215 220
Gin Arg Phe Trp Val Ser Ser Gly Gly Tyr Val As . Ser Asn He Asn
255 230 235 240
T.h r Asn Glu Gl A g Thr Gly Lys Asp Val Asn Ser Val Leu Thr Ser
245 250 255 lie His Thr Phe Asp Pro Asn Leu G y Cys Asp Aia Gi Thr Phe Gin
260 265 270
Pro Gys Ser Asp Lys Aia. Leu Ser Asn Lou Lys Val. Val. Val As Ser
275 280 285
Phe Arq Ser Tie Tyr Giy Val Asn Lys Gly i lo Pro Ala Giy Ala A .1 a.
290 295 300
Val Ala He Gly Arg Tyr Ala. Glu. Asp Val Tyr Tyr Asn Gl Asn Pro
305 3 0 315 320
Trp Tyr L A a Th Phe Ala Ala Ala lu Gin Leu Tyr As ia 1 le
325 330 335
Tyr Val Trp Lys Lys Thr Gly Ser He Thr Va 1. Thr Ala Thr Ser Leu
.340 345 350
Aia Phe Phe Gin Glu Leu Val Pro Gly Val Thr Ala. Gly Thr T Sec
355 360 365
Ser Ser 3e r Se Thr Phe Thr Aan. He He Asn Ala Val Ser Th T r
370 375 380
Al Asp Giy Phe Leu Ser Glu Ala Ala L s Tyr Val Pro Ala Asp Giy
385 390 335 400
Set- Leu Ala Glu G In Phe Asp Arg Asn Se Gly Thr Pro Leu Se .5la
405 410 415
L v. His Leu Thr Trp Ser Tyr Ala Ser Phe Leu Thr Ala Thr Ala Arg
420 425 430 ft t q Aia Gly lie Val. Pro Pro Ser Trp A la. Asn Ser Ser Ala Ser Thr
435 440 445
XH- P o Ser Thr G s Ser Gly Aia Ser Val Va J, Gly Se T r Se rg
450 455 460
Pro T"n r Ala Thr Ser Phe Pro Pro Ser Gin Thr Pro Lys Pro Gl Ha .1
465 470 475 480
P r o Se r: Th Pro Tyr Thr ro Leu Pro Gys Ala ha Pro Thr Se r
HS 450 495
Val Ala Val Thi: Phe His Glu Leu Val. Se Th r Gin Phe Gly Gin Thr 164
500 005 500
Sal Lys Val Ala Gly Asn Ala Ala Ala Leu Gly Asn Trp Ser Thr Ser
Oil " 520 515
Ala Ala Val Ala Leu Asp Ala Val Asn Tyr Ala Asp Asn His Fro Leu o o o ' 035 o-; o
Trp lie Gly Thr Val Asn Lea Glu Ala Gly Asp Val Val Glu Tyr Lys 545 550 055 560
Tyr lie Asa Val Ai.y Gin Asp Gly Sar Vai Thr Trp Glu Ser Asp Pro
505 570 " 575
Asn Lis Thr Tyr Thr Val Pro Ala Val Ala Cys Val Th.r Gin Val Val
080 580 5
Lys Glu Asp Thr Trp 00! n Set:
090
SEQ 50 NO: 3: r ickociar a reesei glucoomylase catalytic domain, T GA, CD
210 5
<211> 453
<012> POT
<213> Tnchoderma rensei
< 4 ϋ0> 3
Sar Val Asp Asp the lie Ser Thr Glu Thr Pro lie Ala Leu Asn Asn
1 5 10 15
Leu Leu Cys nSn Val Gly Pro Asp Gly Cys Arg A La Phe Gly Thr Ser
20 2b" 30
Ala Gly Ala Val lie Ala Ser Pro Ser Thr lie Asp Pro Asp Tyr Tyr
05 40 45
Tyr Met Trp Thr Arg Asp Ser Ala Leu Val Phe Lys Asn Leu lie Asp
50 ' 55 60
Arg Phe Thr Glu Thr Tyr Asp Ala Gly Leu Gin Arg Arg lie Glu Gin 65 70 75 00
Tyr lie Thr Ala Gin Vai Thr Leu Gin Gly Leu Ser Asn Pro Ser Gly
05 00 05
Ser Leu Ala Asp Gly Ser Gly Leu Gly Glu Pro Lys Phe Glu Leu Thr
100 105 110
Leu Lys Pro he Thr Gly Asn Trp Glv Arg Ore Gin Arg Asp Gly Pre
115 120 " 125
Ala Leu Arg Ala lie Ala Leu He Gly Tyr Ser Lys Trp Leu lie Asn
100 135 100
Asn Asn Tyr Gin Ser Thr Val Ser Asn Val He Trp Pro He Val Arg 145 150 155 160
Aan Asp Leu Asn Tyr Val Ala Gin Tyr Trp Asn Gin Thr Gly Phs Asp
165 170 175
Leu Trp Glu Glu Val Aan Gly Se Ser Phe Phe Thr Val Ala Asn Gin
180 185 190
His Arg Ala Leu Val Glu Gly Ala Thr Leu Ala Ala Tht Leu Gly Gin
193 200 205
Ser Gly Ser Ala Tyr Ser Ser Val Ala Pro Gin Val Lea Cys Phe Leu
210 ' 215 220
Gin Arg Phe Trp Vai Ser Ser Gly Gly Tyr Val Asp Ser Asn He Asn 225 200 " 235 ' 240
Thr Asn Glu Gly Arg Thr Gly Lys Asp Val Asn Ser Val Leu Thr Ser
245 ' ' 250 255
He Lis Th:: Phe Asp Pro Asn Leu Gly Cys Asp Ala Gly Thr Phe Gin
200 205 270
Pro Cys Ser Asp Lys Ala Leu Ser Aan Leu Lys Val Val Val Asp Ser
275 200 205
Phe Arg Ser Ale Tyr Gly Val Asn Lys Gly He Pro Ala Gly Ala Ala
200 205 300
Vai Ala He Gly Arg Tyr Ala Glu Asp Vat Tyr Tyr Asp Gly Asn Pre 165
503 210 315 320
Trp Tyr Lsu Ala Thr Phe Ala Ala Ala Glu Gin ilea. Tyr Asp Ala He
325 330 835
tvr Val Tap L s ays Thr Gl S r He Thr V l Thr Ala Tar Ser Lea
340 345 830
Ala Phe r-hc Gin ilia Aaa Va t Pro Gly Val Thr Ala Gly Thr Tyr Ser
85D 360 865
Ser Ser Ser Set: Thr Phe Thr Asn I la Γ i e Aan AJ a Val her Thr T r
110 375 380
Ala Asp Gly Phe Lea Set Gtu. Ala Ala lya Tyr Val Pro Ala Asp Gly
185 "' 390 305 400 her Lou Ala Gia Ala Phe Asp Arg Asn Ser Gl Thr Pro Sen Ser Ala
405 1.0 15
Leu his Leu Thr Trp Ser Tyr Ala Ser Phe Lea; Thr Ala Thr Ala Arg
410 423 430
Arq Ala Gly lie Va i Pro Pro Sen Trp Ala Aari Ser Ser Ala Ser Tar
415 44υ 445
11a Pro Sor T '- Gys
450
SEQ ID NO: 4: Tr.Lchode.rmd reeaei giucaamyl
210> 4
<2il 1809
<212> DMA
<213> Trichotierroa reosel
< 400> 4
atgeacgteo tgOoqaol.gc qqtgctgcoe ggaaccgttg ccattcaaaa ggtcctggga 60 agaceaggat caagcggLcL gt.ccgacq ; accaagaggt ctgttgacga cttaatcagc 120 accgagacgc etattgeact gaacaalcti: c 1.. t r.gcaahq ttqgtcctga tgqahgcagt 180 gcatlcggca aatcagctgg tajeggtgat t gcarctccca gcacaatcga cccggactac 240 tattacatgt qgacgegaga tagcgctctc gtcttcaaga acctcaccqa ccgcttcacc 300 gaaacgtacg atgeaqgeet gcagcgccga atoqagcagt acattachgc ccaggtcact 360 ateoagggee tct.cOaaccc cacgggcLca chcgcggacg gctctggtct eggcgaqccc 420 aagtttgagt tgaccctgaa gcctttcacc ggcaaccggg gl.cgacc.gca gcgqgatggc 480 ccagctctgc gagccattgc cttgattgga taetcaaagt ggctcatcaa caacaactat 540 aaqtogact:g' Ogtacaacqt. cacctggcct at. Lqtgcgca acgacctcaa ccatgttqac 600 cagtactgga accaaaccgg ctOLgaccLc tgggaagaaq tcaatgggag ctcattcttt 660 actgttgcca acnagcaccg agcacttgta gagggegeca ctcttgctgc cactcttggc 720 aagaagggaa gegettaetc acotgetget ccccaggttt tgtqctttct ecaacgattc 780 l.gggLgLcgt ctggtqgata cgtcqactcc aacatcaaca ccaacgaggg caggactggc 840 aaggatgtca ad:ccgtcat gaci.Occatc cacaccttcg atcccaacct tgqetghgae 900 gcaggeacct tccagccatg cagtgacaaa gcgctctcca accccaaggt tgttgtcgac 360 tccttccgct ccatctacgg cgtgaacaag qqcattcctg ccggtgctqc cgtegecatt 1020 gqcogqtal.g cagaggatgt gtactacaac ggcaaccctt gqtatcttgc tacattOgct 1080 gctgccgagc agctgtacga tqccatctac gtalggaaga aqacgggcic catcaeggtg 1140 accqccacct ccctggcctt cttccaggaq cttgttcctg gcgtqacggc cgggacctac 1200 tccaqeagct cttcgacctt taccaacatc atcaacgccg tctcgacata cgcagahgqc 1260 ttcclcagcg aggctgecaa gtacgtcccc gecgaeggtt cgctgqccga gcagtttgac 1320 cqcaacagcg qeactccgct gtctgegett cacctgacgt ggtegtaege ctegctcttg 1380 acagccacgg cccgtcgggc tqgcar.cgag cccccctcgt gggccaacag cagegctagc Ϊ440 acgatcccct cgac tgctc cggcqegtcc qtggtcggat cctactagcg tcccaccgcc 1.500 acgtcattcc otccqtc ea gaegeceaaq cctqgcgtgc cttccqgtac tccctacacg 1.560 cccctgccct gcgcgacccc aacctoegtrj gcagtcacct tccacgagct cqtgrqqaca 1020 cagtOOggcc agaegqtcaa. qqtggcgggc aarrqecgegg ccctgggcaa clggagcacg 1680 agcgccgccg tgqerctgga cgcagtcaaa tatgecgata accaccccct gcqgattggg 1740 acggtcaacc tegaqgecqg agaegtegtg gag': scaaq t: acatcaqirgt gqgecaagat: 1100 gqetccqtga cctqggagaq tgatcccaac cacacttaca cqqttcctgc ggtgqcttgt I860 gtgacqcagq ttqtcaagga ggaaacctgq caalcgtaa 1.809
SEQ ID MO: 5: Aspergillus awamori OA iftaGA} CD 166 s210> '3
ΠΗ> 448
Hi2s PRT
Π13> Aspergillus awamori
H00> 3
A La T r Leu ASD 3er Trp Leu Ser Asn G 1 u Ala Thr Val Ala Arg Thr i 5 10 15 ft!. a lit: Leu Asn Asn lie Gly Ala .Asp Gly Ala Pro Val Ser Gly Ala
20 25' 20
Asp Se Gly 1 Le Val val Ain Ser Pro Ser Thr Asp Asn Pro Asp Tyr
35 40 45
The Tyr Thr T p Th Arg sp Per Gly Len va i He L s Thr Leu Va.l
50 5e 60
As Leu Pile Are Asn Gly A Thr As Le u Leu Ser Thr He Glu Asn
6b 30 75 80
Tyr lie re r 3e r Gl.n Ala 11 e Va 1 Gi . Gly He Ser Asn Pro Se r Gly
85 90 95
Asp Leu Ser Ser Giy Gly Leu Gly Glu Pro Lys The Asn Val Asp- Glu i o o 105 110
Thr Ala Tyr Thr Gly Ser Trp Gly Arg Pro Gin Arg As Gly Pro Ala
115 120 125
3ου A e Ala Thr Ala Met He Gly Phe Are Gin Trp Lou Leu A p Asn
130 135 140
Gly Tyr ITrr Ser Ala Ala Thr Glu He Val Trp P ro Leu Vai Arg Asn
145 150 155 .160
Asp Le u 3er Tyr Val Ala Gl n Tyr Trp Asn Gin Thr Gly Tyr Αερ Leu
] 65 170 175
Trp Gl u Glu Va 1. AST) Gi Ser Ser Phe Phe Thr ile Ala Val Gin Ills
130 185 150
Arg Ala Leu Val Glu Gly Ser Ala P e Ala Thr Ala Val Gl Ser Ser
195 200 203
Cys Ser Trp Cys As Ser Gin Ala Pro Gin I le Leu Cys Tyr Pes Gin
210 2 5 220
Ser Phe Trp Thr Gly Glu Tyr He Leu Ala Asn Phe Asp Ser Ser Arg
333 230 235 240
SK Gly Lys Asp Thr Asn Th r Leu Leu Giy Ser He His Thr Phe Asp
245 250 255 ro Glu Ala Gly Cys Asp sp Ser Thr Phe Gin Pro Cys Ser Pro rg
230 205 270
Ala Le u Ala Asn His Lys Glu Val Val As Ser Phe Arg Ser Ile Tyr
275 280 285
Th Leu Aan Asp Giy Leu Ser Asp Ser Gin Ala Vai Ala Val Gly A q
29!) 295 300
Tyr Pro Lys Asp Ser Tyr T r Asn Giy Asn Pro Trp Plie Leu Cys Thr
303 310 315 320
Leu Ala Ala A: a Glu Gin Leu Tyr Asp Ala Leu Tyr Gin T rp Asp Lys
325 330 335
'3In Gly Ser Leu Glu He T r sp Val Se Leu As Phe Phe Gin Ala
340 345 550
Leu Tyr Ser Asp Ala Ala Th r Gly Thr Tyr Ser S t Ser Ser Ser Th r
355 360 365
Tyr Ser Per I Le Va 1 Asp Ale Val Lys Th Phe A 1 a Asn Gly Phe Va 1
370 375 580
Ser tie Val Glu Th His Ala Ala Ser Asn Gly Ser Leu Ser Glu Gin
333 300 395 400
Ty- As Lys Ser Asp iiy Asp Glu Leu Ser Ala Arg Asp Peu Thr Trp
405 410 Π5
'V- r Tyr A] a Ala Leu Leu Thr Ala Asn Asn Arg Acq Asn 3e r Vai Met
420 425 430
Pro Pi_G Ser Trp Gly Glu Thr Ser Ala Ser Ser Val Pro Gly The Cys 167
440
32Q ID ISO; 6: Aspergillus niger (AnGAi ,
21Q.> 5
<211e 449
<212> PRT
<213> Aspergillus niger
<400> 6
Ala Thr Leu Asp Ser Trp Leu Scr Asn Glu Ala Thr Val Ala rg Thr
1 s 1.0 15 '
Ala Tie Leu Asn s n. 1 Le Gly Ala Asp Giy Ala Trp va 1. Ser Giy Ala
20 25 30
As Ser Giy He Val Va i Ala Ser Fro Se r Th r Asp Asn Pro Asp Tyr
35 40 45
she Tyr Th.tr Trp Thr Arg A3p Ser Gly Leu Va 1. Leu Lys Ohr Leu Va 1
50 55 60
Asp Leu Phe A c sn Giy ..As Thr Ser Leu Leu Scr Th.tr H e Giu Asn
65 70 35 SO
Tyr lie So r Ala G.i Λ i a lie Va 1 Gin Giy 1 le Sec Asn Pro Se Giy
35 90 95
Asp Leu St; r Ser Gl Ala Giy Leu Gly Glu Pro Lys Phe Asn Vai Asp
100 105 i i 0
Glu Thr Ala Tyr Thr Giy Ser Trp Giy Arg Pro G.I n. Arq Asp Gly Pro
2] 5 120 125
Ala .Leu Arg Ala Thr Ala Met. He Gly Phe Gly Gin Trp Leu i.e a .As
130 135 .140
Asn Gly Tyr Th r S r Thr Al Th r Asp T le Va 1 Trp Pro Leu Vai Arg
145 150 .1.55 1.60 sn As .L u. Ser Tyr Val Ala Gin Tyr Trp Asn Gin Thr Gly Tyr sp
165 17 1.75
Leu Trp Glu Glu Val Asn Gly Sei- Ser Phe Phe Th r He la. Val Gin
180 185 150
H i s A rg Ala Le u Va 1 G ! u Gly Se r Ala Phe Ala Thr Ala Vai Gly Ser
195 200 205
Sex- Cys S r Trp Cys Asp Se r Gin Ala P ro Glu He Leu Cys Tyr Leu
210 213 220
Gin Ser Phe Trp Th r Gly Ser Phe Tie Leu Ala Asn Phe sp Ser Ser
225 230 235 240
Arg Ser Gly Lys Asp Ala Asn Th Leu Leu Giy Se He His Thr Phe
245 250 255
Asp Pro Clu Ala Ala Cys Asp Asp Ser Thr Phe Gin Pro Cys Ser Pro
260 265 270
Arq Ala Leu Ala Asn His Lys Glu Val Val As Ser Phe Arg Se .1 le
275 200 235
Tyr i:hr L u Asn Asp Gly Leu Ser Asp Ser Glu Ala Va 1 Ala Vai Gl
290 295 300
Arg Tyr Pro Gi u Asp Th Tyr Tyr .Asn Gi Asp. P t o Trp Phe Leu Cys
305 10 315 320 thr L eu Ala Ala Ala Glu GI n Leu Tyr A s la. Liea yr: Gin Tro Asp
325 330 335
Lys Gin Giy Ser Leu Glu Val Thr Asp Va 1 Ser Leu As Phe Phe Lys
340 345 320
Ala Leu Tyr Se tr Asp Ala Ala Thr: Giy Thr Tyr Se r Ser Se Se Ser
355 300 305
The Tyr Sur Ser T Le Val Asp Ala Va 1 Lys Th Pha Ala Asp Gly Phe
.1/0 335 380
Val Se r He Val Glu. Thr His Ala Ala Ser Asn Gly Ser eL Ser¬ Glu
525 3ah 305 400
Girl Tyr As L s Se Asp GLy Glu Gin Le u. Se r Ala Arg Asp pen Tlrr
405 410 415 168
Trp Ser Tyr Aia Ala Leu Leu Thr Aia Asn. Asn Arq Arg Asn Ser val •120 425 430
VJL Fro Ala Ser Trp Giy Gi u Tar Ser Aia Ser Ser Var Pro Gly Ihr i 35 440 415
SAG: ID NO; 7 : Aspergillus oeyzae (AoGA , CD
AiI0> 7
<21I> 450
<S12> 3RT
sG13> Aspergillus oryzao
< 400> ■■'
Gin Ser Asp Leu Asn Aia Phe lie Glu Ala Gin Thr Pro Ale Ala Gys 1. 5 10 15
Gin Giy Tyr- Gen Asn Asn. lie Gly Aid Asp Giy iys Leu Val Glu Giy
20 25 30
A'.a Ala AAa Gly lie Val Tyr Ala Ser Pro Gar Lys Ser Asn Pro Asp
35 40 45
Tyr Phe Tyr Thr Trp Thr Arq Asp Ala Gly Geu Thr Met Glu Glu Tyr
.50 S3 C
lie Glu Gin Phe lie Gly Gly Asp Ala Thr Leu Glu Ser Thr lie Gin 65 "AO " 75 30
Asn Tyr- Val Asp Ser Gin Ala Asn Glu Gin Aia Vai Ser Asn Pro Ser
85 90 95
Giy Gly Leu Se Asp Gly Ser Gly Leu Aia Glu Pre leys Phe Tyr Tyr
100 ' ' 105 110
Asn lie Ser Gin Phe Thr Asp Ser Trp Gly Arg Pro Gin Arg Asp Gly
115 20 125
Pro Aia Geu Arg Ala Ser Ala Geu lie Aia Tyr Gly Asn Ser Leu ile
AGO 135 110
Ser Ser Asp Lys Gin Ser Val Vai l.ys Ala Asn lie Trp Pro lie Tyr 145 ' 150 IPS 160
Gin Asn Asp Leu Ser Tyr Val Gly Gin Tyr Trp Asn Gin Thr Gly Phe
165 1.70 " 175
Asp Leu Trp Glu Glu Val Gin Gly Ser Ser Phe Phe Thr al Aia Val
180 " 185 190
Gin His Lys Ala Leu. Val Gla Gly Asp Aia Phe ftla Lys Ala Leu Gly
195 200 " 205
Glu Glu Cys Gin Aia Gys Ser vai Ala Pro Gin lie Leu Cys His Leu
210 215 220
Gin Asp Phe ?rp ftsn Giy Ser Ala Val Leu Ser Asn Leu Pro Thr Asn 225 230 235 240
Gly Ara Ser Gly Leu Asp Thr Asn Ser Leu Leu Giy Ser lie his Tar
" 215 250 255
Phe Asp Pro Ala Ala Ala Cys Asp Asp Thr Thr Phe Gin Pro Cys Ser
260 265 270
Ser Arq Ala "Geu Ser Asn His Lys Leu Val Val Asp Ser Phe Arg Ser
275 220 285
Val Tyr Gly lie Asn Asn Gly Arg Gly Ala Giy Lys Aia Ala Aia Vai
200 295 ' ' 300
Gly Pro Tyr Ala Giu Asp Thr Tyr Gl.n Giy illy Asn Pre Trp Tyr Leu 305 310 315 120
Thr Phr Leu Val A.3a Ala Gin Leu Lou Tyr Asp Ala Leu Tyr Gin Trp
325 330 335
Asp Lys Gin Gly <Un Val Asn Gal Thr Glu Thr Ser Leu. Pro Phe Phe
340 345 .350
Lys Asp Leu Ser Ser Asn Val Thr thr Gly Ser Tyr Ala Lys Ser Ser
155 360 365
Ser Ala Tyr 01 Lu Ser Leu. Thr Ser Ala Val Lys Thr Tyr Ala Asp Gly 169
370 3H 380
Phe lie Ser Val Val Gin Glu Tyr Thr Pro Asp Gly Gly Ala Leu Aia 185 7" 90 '7-95 100
Gin Gin Tyr Ser Are Asp Gin Gly Trrr Pro Val Sec Ala Ser Asp leu
405 410 415
7hr Tim Ser lyr Ala A.la The Leu Per Ala Val Gly Arg Arq Asn Gly
420 420 410
Thr va!. Fro Ala Ser Trp GJ y Ser Ser Thr Ala Asn Ala VaJ Pro Ser
435 " 440 445
Gin Gys
450
3 HQ ID O : 8: Ha ico gi.i ea gl ucoamy I ase (HQGA! ; CD
<210> 8
o211> 441
H12r PRT
e2!3> Humicola grisea
400> 0
Aia Aia Val As Th Phe He Asn Thr Glu L s Pro He Aia Trp Asn
1 5 10 15
Lys Leu Leu Aia Asn He Gly Pro Asn Gly Lys Ala A.i.a Pro Giy Ala
S '~ s 0
Aia Aia Gly Val Va 1 He Aia Ser Pro Ser rg Thr Asp Pro P o Tyr
35' 40 45
Phe Phe Thr Trp Thr Pro Asp Ala Ala Leu val Leu Thr Gl lie He
50 55 60
GJ u Ser Leu Gly His Asn Tyr Asn Thr Thr Leu Gin Gin Val. Ser Asn
65 70 75 80
Ore So r Giy Thr P7;e Aia Asp Gl S r Giy Leu Gly Glu A.1 a Lys P e
85 90 95
Asn Va 1 Asp Leu Thr Ala. Phe Thr Gly Glu Trp Gly Arg Pro Gin Arg
100 705 110 i3 Gi y Pro Pro Leu Arg Aia I le Aia Leu He Gin T r la L s Trp
115 120 125
i7eu 11 e Ala Aart Gi Tyr Lys Ser T r Ala Lys Per Val Val Trp P o
130 i 35 1.40
Val Val Lys Asn As Leu Ala T r Th Ala Gin. T Trp Asn G u Thr
; 45 150 155 160
Gly Phe Asp Leu Trp Glu Glu Val Pro Gly Ser Ser Phe Phe Thr He
165 100 175
Al Ser Ser His Arg Ala Leu Thr Glu Giy Ala Tyr Leu Rla Ala Gin
ISO 185 190 leu Asp Thr Glu Cys Pro P o Cys Thr Th r Val Ala Pro Gin val Leu
195 200 205
Cys Phe Gin Gin Ala Phe Trp Asn Ser Lys Gl Asn Tyr Val. Val Ser
210 215 220
Thr Sec Thr Ala Gl Glu Tyr A g Ser Gi Lys . s Ala .Asn Se r I ie
225 230 235 240
Leu Ala Ser I ie His Asn Phe 71 Sp Pro Gl. a A l.a Gly Gys Asp Asn Leu
245 250 205
Th i: Phe Gin Pro C s Ser Glu. Arq Ala Leu Ala. Aso, His L s Ala. Tyr
200 155 200
Va 1 3\ spLo Phe q Asn Leu Ty Ala 1 ie Asn L s Gly 1 Le Ala G 1n
2075 280 285
Gly ays Aia Val Ala Val Gly Arg ^ Sec G Lu As Val Tyr T r Asn
200 205 300
Gly Asn Pro Trp T r Leu Aia Asn Phe 1a Al Ala Glu Gin Leu Tyr
105 310 315 320
A p Ai He Tyr val Trp Arm .Lys Gin Gly Ser 11 e Thr Va 1 Tht: Ser
325 530 315 170
Val Ser Leu Fro Phe Phe Arg Asp Lau val Ser Ser Val Sor Thr Gly
340 345 350
Thr Tyr Ser Lys Ser Ser Ser Thr Phe Thr Asn lie Val Asa ALa Val
315 ISO 365
Lys Ala Tyr Ala Asp Gly She lie Glu Val Ara Ala Lys Tyr The Pre
370 375 380
Ser Asn Gly Ala Leu Ala Glu Gin Tyr Asp Arg Asn Thr Gly Lys Pro 335 390 395 400
Asp Ser Ala Ala Asp Lea Thr Trp Ser Tyr Sar Ala She Leu 3er Ala
105 410 315 lie Asp Arq Arg Ala Gly Leu val Pro Pro Ser Trp Arg Ala Ser Val
420 425 430
Ala Lys Ser Gin Leu Pro Ser Thr Cys
435 440
LTQ ID NO: 3: Hypocrea vinosa glucoamy laso (HvGA); CD
<210> 9
Alil> 452
<212> PRT
<213> Hypocrea vinosa
<400> 9
Ser Val Asp Asp Phe lie Asn Thr Gin Thr Pro lie Ala Leu Asn Asn
1 5 10 15
Leu Leu Cys Asn Va L Gl Pro Asp Gly Gys Arg Ala Phe Gly Thr Ser
20 " 25 30
Ala. Gly Ala Val lie Ala Ser Pro Ser Thr Thr Asp Pro Asp Tyr Tyr
35 40 45
Tyr Met Trp Thr Arg Asp Ser Ala Lea Val Phe Lys Asn lie Val Asp
50 ' " 55 60 "
Arg Phe Thr G n Gin Tyr Asp Ala Gly Leu Gin Arg Arg He Glu Gin 55 70 75 SO
Tyr lie Sor Ala Gin Val Thr Leu Gin Gly lie Ser Asn Pro Ser Gly
85 90 95
Ser Leu Ser Asp Gly Ser Gly Leu Gly Glu Pro Lys Phe Glu Leu Thr
100 ' ' 105 " 110
Seu Ser Gin Phe Thr Gly Asn. Trp Gly Arg Pre Gin Arg Asp Gly Pro
115 " 120 125
Ala Leu Arg Ala. lie Ala Leu lie Gly Tyr Ser Lys Trp Leu lie Asn
1.10 135 ' ' 140
Aan Asn. Tyr Gin Ser Thr Val Ser Asn He He Trp Pro He Val Arg 145 150 155 160
Asn Asp Leu Asn Tyr Val Ala Gin Tyr Trp Asn Gin Thr Gly Phe Asp
105 ' 170 175
Leu Trp Glu Glu Val Asn Gly Ser Ser Phe Phe Thr Val Ala Asn Gin
180 ' 185 190
His Arg Ala Leu Til Glu Gly Ala Thr Leu AU Ale Thr Leu Gly Gin
195 " 200 205
Ser Gly Ser Thr Tyr Ser Ser Val Ala :Tr0 Gin He Leu Cys Phe Leu
210 ' 215 220
Gin Arg Phe Trp 'Val Ser Gly G Tyr He Asp Ser Asn Lie Asn Thr 225 " 230 235 240
Asn. Gin Gly Arg Th Gly Lys Aso Ala Asn Ser Leu Leu Ala Ser He
245 ' ' 250 255
His Thr Phe Asp Pro Ser Leu Gly Gys Asp Ala Ser Thr Phe Gin. Pro
250 265 270
Gys Ser Asp Lys Ala Leu Ser Asn Leu Lys Val Val Val Asp Ser Phe
215 280 285
Arg Ser IH Tyr Gly yal Asn Lys Gly He Pre Ala Gly Sor Ala Val 171
290 235 300
Ala 'lie Giy Arq Tyr Pre GLu Asp Val yr Phe Asn Giy Asn 2ro Trp rhr ' ' 3 !G 31 320 i'yr Leu Ala Thr hhs Ala Ala Aia Giu Git; Leu Tyr Asp Ser Val. Tyr
125 330 335
V,ai ¾:p Lya hys Thr Giy ¾r lie 'Hit val Thr 5¾r i' r her Ser Aid
40 343 350
L"hG Lhs; Gin Glu L; Vai Pro Giy Vai A:.3 Ala Giy Thr Tyr Ser Sex:
235 230 36¾
Sen: Ser T r Tyr Aia
Λί-ip Giy File Leu G t Glu Aia Ala hys Tyr Vai P o Aia Asp Giy Ser¬ ies ' 390 ' 393 400 rot; Λ · Giu Gin i'h<s Arip Ary Asn T r Giy i'hr Lro tan He Aia Vai
•105 " 410 413
Ts Leu Thr Trp 3«r Tyr Ala Ser The Lew Thr Aid Ala A Arq Arg
120 423 430
Aia Giy vai val Pro Pro Ser Trp Ala Sor Gar Giy Aia Asn Thr Val
433 140 445
Fr Se Ser Cys
450
Thy I'D NO: IT: TrGA, linker region
"2 !.0> 10
<211 3?
<2 i Z> f'R'T
<2i 'i> Triohoderma ceea i
<400> 10
Srr Giy Ala Sec Vul Vai Giy S r Tyr Sor Arq Pro Thr Aia Th 3er
1 5 10 1.5 'he Pro Pro Ser Gi n Thr Pr.n hys hro Giy V l pro Ser tiiy Thr Pro
20 23 .Ml
Tyr Thr Pro Leu Pro
33
SEQ 10 GO: 11; TrGA, SB!)
<210> 11
</ i l> 109
<Gl ;;> PUT
213> Trichoderma reesei
<iOO 11
Gys Aia Thr hro Thr Ser Val Aia VAI Thr Phe His Giu Leu Val Ger ί 3 10 15
Thr Gin Phs u Ala Leu
G!y Asn Trp S*r Thr S<-;r Ala Ala Vai A Lea Asp la V/ii Asn Tyr
33 40 i:>
AGs Asp Asn his Pro Leu Trp l ie Giy Thr Vat Asn Leu Giu Aia Giy
30 33* 60
Asp Val Val Glu Tyr hys Tyr l ie Aan Vai Giy Gin Asp Giy Ser Vai 63 70 75 30
Thr Trp Glu IG-r Asp Pru Asn His Thr Tyr Thr Val Pro A Λ Val Ala
85 90 95
Cys Val Thr G'n 7ul Vu l hys; Giu A.sp Thr Trp Gin Se
G)0 105
ShO IV GO: 12 GVLTG'T : rjiTi t of. ! he TrGA mau.ire ro win 172 21C> 12
V27 Π (::
212 PR'i'
<212> Triohoderraa reesei
aiOOr 12
Ser Val Asp Asp Phe I Le
SEC; I'D 00: 384 Talaramyces GA mature protein
2J0> 384
211> 538
2 > P T
13> Taia omyces
H00> 304
Gly 3er Leu Asp 5er Phe Leu Ala Thr Glu Thr Pro He Ala Leu Gia
1 5 1.0 15
Giy Va ! Leu Asn Asn 1 l.o Gly Pro Asn Gly Ala Asp Va L Ala Gly A.la
20 25 30
Ser Ala Gi He Val Val Ala Ser o Ser Arg Ser Asp Pro Asp Tyr
33 10 45
Phe A r Se r Trp Thr g Asp Ala Ala Leu Thr Ala Lys Tyr Leu Va 1
50 55 60
Asp Ala Phe lie la GLy Aan Lys sp Leu Glu Gin Th r Lie Gin Glu
65 70 75 SO
Tyr lie Ser Ala Gin Ala Gin Val Gin Thr He Ser Aan Pro Ser Gly
85 90 05
As Leu Ser Thr Gly Gly Leu Gly Glu Pro Lys Phe Asn 'Va .1 Asn Glu
100 105 110
Vh r Ala Phe Thr Gly Pro T p Gly Arg P o Gin A g Asp Gl Pro Ala
115 120 125
Leu Arg Ai a Th Ala Leu He Ala Tyr Ala Asn Tyr Leu He Asp Asn
130 135 140
Gly Gin A] a Ser Thr Ai a Asp Glu I i.e He Trp Pro 1.1.3 Val Gin Asn
145 150 155 160 sp 2aa Or Tyr Val Th Gin Tyr p Asn Ser Ser Thr Phe sp Leu
105 170 175
Trp Glu Gl u V l Glu Gly Ser Ser Phe Phe Thr Thr Ala Val Gin His
180 185 190
Arg Ala Leu Val Glu Gly Asn Ala Leu Ala Thr Arg Leu Asn His Thr
195 200 205
Cys Pro Asn Cys Val Ser Gin Ala. Pro Gin Val Leu. Cys Phe Leu G in
210 215 220
Ser Tyr Trp T r Gly Ser Tyr Val Leu Ala Asn Phe Gl Gl Ser Giy
225 2.30 235 210
Arg Ser Giy L s Asp Va I. sn Ser 1 le Leu ly Ser He His "Ha: Phe
245 250 255
Asp P o Ala Giy Gly Gya Asp Asp Ser Thr Phe Gin Pro Cys Se r Ai a
260 265 270 r:g Ala Leu Ala Asn His Lys Val. Val Thr Asp Ser Phe Arg Ser Val
235 280 205
'f'yr Ala Va 1 Asn. Per Gly T .Le a l a Gl y Ser AI a Va i Ala Va 1 G ;.y
290 295 .300
Arg Tyr P o Glu Aap va 1. Tyr Gin G.1v Gly sn Pro Tip T r Leu i a
305 310 513 ί20
Thr Ala AI a. Ala Ala Glu in Leu Tyr Asp Ala Lie Tyr Gi n. Trp Asn
325 330 335 ays r. ] e Gly Ser 1" Le Se r He Th r Asp Val S'e r Leu Ala Phe Phe Gin
340 345 350
Asp Tie Ty Pro Ser Ala la Val Gl Tnr T r /Aan Se r Gly Ser Ser 173
555 300 305
Thr Phe Asn ASP lie I to Ser Ala Val Gin Thr Tyr Ala Asp Gly Tyr 370 3^5 580
Sea Tar iis iia Tie A s Tyr Thr Ore Ser Asp Gly Ser Leu Thr Glu 385 390 395 400
Tin The Ser Arg Ser Asp Gly Thr Pre Aeu Ser Ala Ser Gly lieu Thr
405 3 :..0 415
Trp Ser Tyr Ala Ser Ten Leu Thr Ala Ala Ala Arg Arg Gin Ser lie
420 425 430
Val .re Ala Ser Trp Gly Glu Ser Ser Ala Sec Ser Vai Pro Ala Val
435 440 445
C:ys Oer Ala Thr Ser Ala Thr Gly ?co i'yr Ser Thr Ala Thi: Asn Thr 130 455 460
Ala Trp Pro Ser Ser Gly Ser Gly Pro Ser Thr Thr Thr Ser Vai Pro 365 170 -i 16 480
Gys Thr Thr Pro Thr Ser Vai Ala Val Thr Phe Asp Glu lie Vai Ser
485 190 495 rhr Thr Tyr Gly Glu T r I G¾ Tyr Pen A.La Gly Ser lie Fro Glu Lea
500 505 510
Gly Asn Trp Ser Pre Se Se.r Ala lie Pro Leu Arg Ala. Asp Ala Tyr a 15 530 525
Thr Oer Ser Asn Pro Leu Trp Tyr Val Thr Leu Asn Leu Pro Ala Gly 030 535 540
Th Oer Pho Glu Tyr Ays Phe ilhe Lys Lys Glu Tnr Asp Gly Th lie 545 550 555 560 val Trp Glu Asp Asp Pro Asn Arg Ser Tyr Thr Vai Pro Ala Tyr Cys
565 570 575
Gly Gin Thr Thr Ala lie Leu Asp Asp Ser Trp Gin
300 585
SEQ IS NO: 005 Humicola gr.isea GA SBD
<210> 385
<21.1> IIP
<212e PRT
<213> Humicola gr.isea
<400> 385
Gys i.a Asp Ala Ser Glu Val Tyr Val Thr Phe Asn Glu Arg Val Ser
1 5 1.0 15
Thr Ala Trp Gly Glu Thr lie Lys Vai Val Gly Asn Val P o Ala Leu
20 25 ' 30
Gly Asn Trp Asp Thr Ser Lys Ala Val Thr Leu Ser Ala Ser Gly Tyr
35' " " 10 45
Lys Ser Asn Asp Pro Leu Trp Ser He Thr Val Pro lie Lys Ala Thr
50 55' 60
Gly Ser Ala Val Gin Tyr Lys Tyr lie Lys Vai Gly Thr Asn. Gly Lys 65 10 ' ' 75 80 lie Thr Trp Glu Ser Asp Pro Asn Arg Ser lie Thr Leu Gin Thr Ala
05 00 05
Oer Ser Ala Gly Lys Gys Ala Ala Gin Thr Vai Asn Asp Ser Trp Arg
1.00 ' 105 110
3F,Q LD SO; 386 The 1aomycas tanuu Lr.osus GA SBD
<210> 366
vATI '- 100
<212> PRT
<213> Thermomyc.es ianuginosus 174
<150> 356
Cy's Thr Pro Pro 3er Glu Vai Thr Lets Thr Phe Asn Ala Leu Vai. Asp
) ' r, 10 i 5 i' r Ala l.'he Giy Gin Asr: Tie Tyr Leu Vai Gi.y S r La Prn Giy Leu
20 25 30
Gi y Ser Trp Asp Pro Alo Asn Ala Leu Leu M<~v. $o Ala Lys Ser Th p is 4¾
Thr Ser Gly Asn Pro vai Trp Thr Lau Ser lie Ser Leu Pro Ala Gly
50 55* 60
". r Ser rhe G > lyr Lys Phi r io Arq Lys Arp Asp Gly Ser Se As 55 70 5 50 v¾l Vai TED Glu Ser Asp Pro Asn Arg Ser T'/r Asn Vat Pro Lys Asp
55 50 55
Cys Giy Ai;i Asn 'i'hr Ala Thr V-ii Asn 5 r Trp Trp Aro
i00 105
SiG ID O: 385 Talar mycea rnersoni 1 GA 555
<2\Q> 157
■G! l 155
<"252> PAT
2' 13 > Talatomyees ems r; so nil
.iOij 55 ;
Gys Thr 'i'hr Pro Thr Ser Vai Ala Vai Thr She Asp Glu He Vai Sec
1* 5 10 15 i'hr Sfir Tyc Giy Glu Thr lie Tyr Leu la Giy Ser j le Pro Glu Lou
20 25 30
Giy Asn Trp Ser Thr Ala Ser Ala l ie Pro Leu. Arq Ala Asp Ala Tyr
55" 50 15
Thr Asn So;: Asn Pro LCU Trp Tyr V¾i Thr V i Asr; tu Pro Pro Giy
50 55 60
Thr Se She Gin Tyr Lys Phe Phe Lys Asn Girt T Asp Gly Thr f ie h ?() n 5;.!
Vrtl Trp GUi Asp Asn Pro sn Arg Ser Tyr Thr Vat Pro Ala Tyr Cys
55 90 95
Gly Gin Thr Th >: Ala. T io Leu Asp As Ser Trp Gin
100 105
SLQ ID : 555 Aspesiqi llus n ί ::prr GA SBO
<2I0> 388
Til i 15)5
H12> PRT
<2I3> Aspergillus rigor
<40t» 358
Cys Thr Thr Pro Thr A S .¾ Vai Ala Vai Thr Phe Asp Leu Thr Ala i'hr
1 5 10 15
Thr Thr Tyr Gi y Glu Α.-ϊη He Tyr Leu Vai. Gi y Ser lie Ser Gin. Leu
20 25 30
Gly Asp Trp Glu i'hr Ser Asp Gly He Ala LAU Ser Ala Asp Lys Tyr
35 ' o 45
Thr Sor Sor Asp Pro Lsu Trp Tyr V-ii Thr V i Thr' Lou Pro M a Gly
50 55 50
Gil! Ser Phe Glu Tyr Lys Phe Tie Arq Fie Gsu Ser As Asp Ser Vai 5!) 75 55 80
Glu Trp Glu Ser Aop Pro Asn Arg Glu Tyr The Vai Pro Gin Ala Cys
55* ' 90 95 175 oar T.nr Ala Thr val Thr Asp Thr Trp Arg
■_00 '05
SSQ T D NO: 389 Aspergillus awamori GA S.BD
<2GG- 389
211> 109
<212> PRT
213> Aspergillus awamori
<4CCe 389
Cys :fhr Thi Pro Th>: Ala Val Ala Val Thr Pho Asp Leu Thr Ala. Thr
l' 5 10 15
Thr Thr Tyr Gly Glu Asn .lie Tyr I.e.i Val Gly Ser lie her Gin Leu
20' J 25 30
G.l Asp Trp Asp Thr Se? Asp Gly tie Ala Leu Ser: Ala Asp Lys Tyr
.35 40" 45
Thr Ser Ser Asn Pro Leu Trp Tyr Val Thr Val Thr Leu Pro Ala Gly
50 55 60
Glu her Phe Gl.u Tyr Lys Phe lie Arg Tie Glu her Asp Asp Ser Vai
65 70 " ;!5 30
Glu T.cp Glu Ser Asp Pro Asn Arg Glu Tyr Thr Val Pro Gin Ala Cys
85' 90 95
Gly Glu Ser Thr Ala Thr Val Thr Asp Thr Trp Arg
150 105
SEQ ID NO; 390 Thtelavia terrestris GA SBD
210> 390
<211> 108
<212 PRT
<213> Thielavi eerrc.sOris
<.400> 390
Cys Ser Thr Pro Thr Ala Val Ala Val Thr Phe A.311 Glu Arg Val. Thr
1 •J .1.0 15
Th c Gin Trp Gly Gin Thr 1.1. e Lys Va L Val Gly Asp Ala Ala Ala lieu
20 25 30
Gly Gly Trp Asp Thr SarLys Ala Val Pro Leu Ser Ala Ala Gly Tyr
35 40 45
Thr A 1 a Ser Asp ro ileu Trp Ser Gly Thr Va 1 Asp Leu Pro Ala Gly
50 55~ 60
Leu Ala Val Gin Tyr Lys Tyr lie Asn Val. Ala Ala Asp Gly Gly Val
65 70 75 80
Thr T p Glu Al a Asp Pro Asn Iris Ser Phe Th c Val Pro Ala Ala Cys
05 90 95
Gly T r Th Al Val Th r A g Asp Asp Thr rp Gin
100 105
3LQ l Ρ MO: 1096 Tcichodec a reesei glucoainy i.ase variant
SVDDi'l STilTPT [<NriIAjCNVGPD(.;GRAFGT;JAGAVIASPST iiUT)y>'YHWTR9SALVFKiU.lt DR1 ETYDAGLQSRI S
VRMLLNYVAQYWNQTGFU'LWIiEVNGSS F^^ SSGGYVDS NT tiTNTGRTGKDVNSVrirSlHTFDPPLGCDAG'rPQPCSDKALSNLKVVVDSPRS 1 YGVNKG1 PAGAAVAIGRYAEDVYY NGNPWY LATFAAAEQLYDAlYVWKKTGS ITVTATSLAPi'QELVPGVTAtjTYSSSSSTFTNi IHR S Y DGPLSSAAKY PADGS 5 FQFDRNSGT PLSALUI.lf'WSYASFhTA'lARRAGTVPPShVANSS GT I PSTCSGA3VVGSYSRPT TSFPPSQ 176
TPKPGVPSGTPYTPLPCATPTSVAVTc'H^
P VPP yT " QP SyTSESDPKKTYTy PAVAC TQ KSOiwOS
SGO ::n NO; A)99 Trlahoder a reesei gliiCoaiPYiase variant
S CPFISTGTPI LN iAiCNVGPDGGPAFGYSAGA
QYITAQVTLQGLSriPSGSLADGSGLGE ? FEI i, PFTG GRPQRDGPALR¾IALIGY3 ViLI¾NNYQSTViiHV IW ί
N P NT P G RT G D 7 N S VT T S Ί HTFD NT.GCDAG FQ CSDKAPG LKVyy D3FRS '[YGVH iP G A AIGRYAEDVYY MGNP¾JVPATFAPAEQLYDAI YVWKKTGSI VTATSIAIG^OEL VPGV AG YSSSSJj F Nr TNAV3TY DG FPSEAAKY VPADGSPAFQEPPriSGT LSALHLTHS YASFLT RR GI YPPS¾ANSSASTI STGSGASV VGG YSRFT ATS FPPSQ TPKPGVPSGTPYTPIGAGATFTSVAVTF^EIJVSTO^GOPT EA GDyVEY YIiG"GQPGSV ¾ESDPNHTY VPAVAGVTQVy KEDTWQS
The foregoing applications, and all documents cited therein or during their prosecution ("appln cited documents") and all documents cited or referenced in the appfn cited documents, and all documents cited or referenced herein ("herein cited documents"), and all documents cited or referenced In herein cited documents, together with any manufacturer's instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention.
Various modifications and variations of the described methods and system of the disclosure will be apparent to those skilled in the art without departing from the scope and spirit of the disclosure. Although the disclosure has been described in connection with specific representative embodiments, it should be understood that the subject matters as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the disclosure that are obvious to those skilled In the art are intended to be within the scope of the following claims.

Claims

177 CLAIMS
1. A glucoamylase variant comprising the following amino acid substitutions: a. 44 and 539R; or b. 44R, 611 and 539R, the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase, wherein the glucoamylase variant has at least 80% sequence identity with SEQ ID NO: 1 or 2, or the parent glucoamylase.
2. The glucoamylase variant according to claim 1 comprising the following amino acid substitutions: a. D44R and A539R; or b. D44R, N61I and A539R, the positions corresponding to the respective position in SEQ ID NO:2 or an equivalent position in a parent glucoamylase, wherein the glucoamylase variant has at least 80% sequence identity with SEQ ID NO: 1 or 2, or the parent glucoamylase.
3. The glucoamylase variant according to any one of claims 1-2 comprising the following amino acid substitutions: a. D44R, N61I and A539R, the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase, wherein the glucoamylase variant has at least 80% sequence identity with SEQ ID NO: 1 or 2, or the parent glucoamylase.
4. The glucoamylase variant according to any one of claims 1-2 comprising the following amino acid substitutions: a. D44R and A539R, 178 the positions corresponding to the respective position in SEQ ID NO: 2 or an equivalent position in a parent glucoamylase, wherein the glucoamylase variant has at least 80% sequence identity with SEQ ID NO: 1 or 2, or the parent glucoamylase.
5. The glucoamylase variant according to any one of claims 1-3, wherein the glucoamylase variant has at least 85%, 90%, 95%, 98%, or 99.5% sequence identity with SEQ ID NO: 1 or 2.
6. The glucoamylase variant of claim 5, wherein the glucoamylase variant has at least 95% sequence identity with SEQ ID NO: 1 or 2.
7. The glucoamylase variant of claim 6, wherein the glucoamylase variant has at least 99.5% sequence identity with SEQ ID NO: 1 or 2.
8. The glucoamylase variant of any one of claims 1-7, wherein the parent glucoamylase comprises SEQ ID NO: 1 or 2.
9. The glucoamylase variant of claim 8, wherein the parent glucoamylase consists of SEQ ID NO: 1 or 2.
10. The glucoamylase variant according to any one of claims 1-9, wherein the glucoamylase variant has a starch binding domain that has at least 96%, 97%, 98%, 99%, or 99.5% sequence identity with the starch binding domain of SEQ ID NO: 1, 2, 11, 385, 386, 387, 388, 389, or 390.
11. The glucoamylase variant according to any one of claims 1-10, wherein the glucoamylase variant has a catalytic domain that has at least 80%, 85%, 90%, 95%, or 99.5% sequence identity with the catalytic domain of SEQ ID NO: 1, 2, 3, 5, 6, 7, 8, or 9.
12. The glucoamylase variant according to any one of claims 1-11, wherein the parent glucoamylase is selected from a glucoamylase obtained from a Trichoderma spp., an Aspergillus spp., a Humicola spp., a Penicillium spp., a Talaromyces spp., or a
Schizosaccharmyces spp.
13. The glucoamylase variant according to any one of claims 1-12, wherein the parent glucoamylase is obtained from a Trichoderma spp. or an Aspergillus spp. 179
14. The glucoamylase variant according to any one of claims 1-13, which glucoamylase exhibit an enhanced production of fermentable sugar(s) as compared to the parent glucoamylase.
15. The glucoamylase variant according to any one of claims 1-14, which glucoamylase exhibit an enhanced production of fermentable sugars in the mashing step of the brewing process as compared to the parent glucoamylase.
16. The glucoamylase variant according to any one of claims 1-15, which glucoamylase exhibit an enhanced production of fermentable sugars in the fermentation step of the brewing process as compared to the parent glucoamylase.
17. The glucoamylase variant according to claim 16, wherein the fermentable sugar is glucose.
18. The glucoamylase variant according to any one of claims 1-17, which glucoamylase exhibit a reduced ratio between isomaitose synthesis and starch hydrolysis activity (IS/SH ratio) as compared to the parent glucoamylase.
19. The glucoamylase variant according to any one of claims 1-18, which glucoamylase exhibit a reduced starch hydrolysis activity which is not more than 5%, not more than 10% or not more than 15% reduced as compared to the parent glucoamylase.
20. The glucoamylase variant according to any one of claims 1-19, which glucoamylase exhibit an enhanced real degree of fermentation as compared to the parent glucoamylase.
21. The glucoamylase variant according to any one of claims 1-20, which glucoamylase forms a lower amount of condensation products than the amount of condensation products formed by Aspergillus niger (AnGA) (SEQ ID NO: 6) under the same conditions.
22. The glucoamylase variant according to any one of claims 1-21, which glucoamylase forms an amount of condensation products which amount is essentially the same as, not more than 5%, not more than 8%, or not more than 10% higher than the amount of condensation products formed by Aspergillus niger (AnGA) (SEQ ID NO: 6) under the same conditions.
23. The glucoamylase variant according to any one of claims 18-21, wherein the dosing of the glucoamylases are the same based on protein concentration. 180
24. The glucoamylase variant according to any one of claims 18-23, wherein the dosing of the glucoamylases are the same based on measurement of activity in activity assays.
25. The glucoamylase variant according to any one of claims 1-24, which glucoamylase has been purified.
26. A polynucleotide encoding a glucoamylase variant according to any of claims 1-25.
27. A vector comprising the polynucleotide according to claim 26, or capable of expressing a glucoamylase variant according to any of claims 1-25.
28. A host cell comprising a vector according to claim 27.
29. A host cell which has stably integrated into the chromosome a nucleic acid encoding the variant glucoamylase according to any of claims 1-25.
30. A cell capable of expressing a glucoamylase variant according to any one of claims claims 1-25.
31. The host cell according to any one of claims 28-29, or the cell according to claim 30, which is a bacterial, fungal or yeast cell.
32. The host cell according to claim 31, which is Trichoderma spp. such as Trichoderma reesei.
33. The host cell according to any one of claims 28-29 and 31-32, which is a protease deficient and/or xylanase deficient and/or glucanase deficient host cell.
34. A method of expressing a glucoamylase variant, the method comprising obtaining a host cell or a cell according to any one of claims 28-33 and expressing the glucoamylase variant from the cell or host cell, and optionally purifying the glucoamylase variant.
35. The method according to claim 34 comprising purifying the glucoamylase variant.
36. Use of a glucoamylase variant according to any one of claims 1-25 for the preparation of an enzymatic composition. 181
37. An enzymatic composition comprising at least one glucoamylase variant according to any one of claims 1-25.
38. The enzymatic composition according to claim 37 comprising at least one
glucoamylase variant according to any one of claims 1-25, wherein the composition is selected from among a starch hydrolyzing composition, a saccharifying composition, a detergent composition, an alcohol fermentation enzymatic composition, and an animal feed composition.
39. An enzymatic composition according to any one of claims 36-38 comprising at least one additional enzyme selected among amylase, protease, pullulanase, isoamylase, cellulase, glucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, phytase and a further glucoamylase.
40. The enzymatic composition according to any one of claims 36-39, wherein the composition comprises at least one additional enzyme selected among alpha-amylase and/or pullulanase.
41. The enzymatic composition according to any one of claims 36-40, wherein the composition comprises alpha-amylase and pullulanase.
42. The enzymatic composition according to any one of claims 36-41, which enzymatic composition comprises less than 1, less than 0.8, less than 0.6, less than 0.5, less than 0.4, less than 0.2, less than 0.125, less than 0.1, less than 0.05, less than 0.01, or less than 0.005 XU of xylanase activity per GAU of a glucoamylase variant according to any one of claims 1-25.
43. The enzymatic composition according to any one of claims 36-42, which enzymatic composition comprises less than 400, less than 200, less than 50, less than 20, or less than 2 XU of xylanase activity per gram of the composition.
44. The enzymatic composition according to any one of claims 36-43, which enzymatic composition comprises between 0.1 - 20, 1-15, 2-10, or 3-10 SSU of alpha-amylase activity per GAU of a glucoamylase variant according to any one of claims 1-25.
45. The enzymatic composition according to any one of claims 36-44, which enzymatic composition comprises between 0.05-10, 0.1-10, 0.1-8, 0.1-5, 0.1 -3, 0.2-3, or 0.2-2 PU of pullulanase activity per GAU of a glucoamylase variant according to any one of claims 1-25. 182
46. The enzymatic composition according to any one of claims 36-45, which enzymatic composition comprises between 0.05 - 10 PU of pullulanase activity per GAU of a glucoamylase variant according to any one of claims l-25and between 0.1 - 20 SSU of alpha-amylase activity per GAU of a glucoamylase variant according to any one of claims 1- 25.
47. The enzymatic composition according to any one of claims 36-46, which enzymatic composition comprises between 0.05 - 10 PU of pullulanase activity per GAU of a glucoamylase variant according to any one of claims l-25and between 0.1 - 20 SSU of alpha-amylase activity per GAU of a glucoamylase variant according to any one of claims 1- 25 and less than 1, less than 0.8, less than 0.6, less than 0.5, less than 0.4, less than 0.2, less than 0.125, less than 0.1, less than 0.05, less than 0.01, or less than 0.005 XU of xylanase activity per GAU of a glucoamylase according to any one of claims 1-25.
48. A method for producing a wort for brewing comprising forming a mash from a grist, and contacting the mash with a glucoamylase variant according to any one of claims 1-25 or an enzymatic composition according to any one of claims 36-47.
49. The method of claim 48, further comprising contacting the mash with one or more additional enzyme(s)
50. The method according to claim 49, wherein the one or more enzyme(s) is selected among amylase, protease, pullulanase, isoamylase, cellulase, endoglucanase, xylanase, arabinofuranosidase, ferulic acid esterase, xylan acetyl esterase, phytase and glucoamylase.
51. The method according to claim 50, wherein the one or more enzyme(s) is/are alpha- amylase and/or pullulanase.
52. The method according to any one of claims 48-51, wherein the grist comprises one ore more of malted grain, unmalted grain, adjunct, and any combination thereof.
53. The method of any one of claims 48-52, further comprising fermenting the wort to obtain a fermented beverage.
54. The method of any one of claims 48-53, further comprising fermenting the wort to obtain a beer.
55. A method for production of a beer which comprises: 183 a. preparing a mash, b. filtering the mash to obtain a wort, and c. fermenting the wort to obtain a beer, wherein a glucoamylase variant according to any one of claims 1-25 or an enzymatic composition according to any one of claims 36-47 is added to: step (a) and/or step (b) and/or step (c) .
56. The method of claim 55, wherein the beer is subjected to a pasteurization step.
57. Use of a glucoamylase variant according to any one of claims 1-25 or an enzymatic composition according to any one of claims 36-47 to enhance the production of fermentable sugars in either the mashing step or the fermentation step of a brewing process.
58. A beer, wherein the beer is produced by the steps of: a. preparing a mash, b. filtering the mash to obtain a wort, c. fermenting the wort to obtain a beer, and d. pasteurizing the beer, e. wherein a glucoamylase variant according to any one of claims 1-25 or an
enzymatic composition according to any one of claims 36-47 is added to: step (a) and/or step (b) and/or step (c).
59. The beer of claim 58, wherein the pasteurized beer is further characterized as being : a. essentially without glucoamylase activity; and/or b. a low-calorie beer and/or a low-alcohol beer.
EP11736309.3A 2010-07-01 2011-06-30 Variants of glucoamylase Withdrawn EP2588602A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP11736309.3A EP2588602A1 (en) 2010-07-01 2011-06-30 Variants of glucoamylase

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US36089110P 2010-07-01 2010-07-01
DKPA201070337 2010-07-15
PCT/EP2010/062035 WO2011020852A1 (en) 2009-08-19 2010-08-18 Variants of glucoamylase
US201161444481P 2011-02-18 2011-02-18
PCT/EP2011/061082 WO2012001139A1 (en) 2010-07-01 2011-06-30 Variants of glucoamylase
EP11736309.3A EP2588602A1 (en) 2010-07-01 2011-06-30 Variants of glucoamylase

Publications (1)

Publication Number Publication Date
EP2588602A1 true EP2588602A1 (en) 2013-05-08

Family

ID=47998014

Family Applications (1)

Application Number Title Priority Date Filing Date
EP11736309.3A Withdrawn EP2588602A1 (en) 2010-07-01 2011-06-30 Variants of glucoamylase

Country Status (1)

Country Link
EP (1) EP2588602A1 (en)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2012001139A1 *

Similar Documents

Publication Publication Date Title
AU2010284963C1 (en) Variants of glucoamylase
James et al. Glucoamylases: microbial sources, industrial applications and molecular biology—a review
US20170306309A1 (en) Variants having glucoamylase activity
US9677058B2 (en) Polypeptides having glucoamylase activity and method of producing the same
US20120164695A1 (en) Combinatorial variants of glucoamylase with improved specific activity and/or thermostability
CN106397601A (en) Enzymes for starch processing
EP2766490B1 (en) Liquefaction process for producing fermentation products
EP2561083A1 (en) Neutral ph saccharification and fermentation
CN104602540B (en) Trichoderma reesei glucoamylase variants resistant to oxidation-related activity loss and uses thereof
JP2016019522A (en) Variants of glucoamylase

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20130201

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20140908

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: DANISCO US INC.

Owner name: DUPONT NUTRITION BIOSCIENCES APS

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

RIC1 Information provided on ipc code assigned before grant

Ipc: C12C 7/04 20060101ALI20160531BHEP

Ipc: C12P 19/02 20060101ALI20160531BHEP

Ipc: C12N 9/34 20060101AFI20160531BHEP

Ipc: C07K 14/38 20060101ALI20160531BHEP

Ipc: C12C 7/00 20060101ALI20160531BHEP

Ipc: C12C 5/00 20060101ALI20160531BHEP

Ipc: C12P 19/14 20060101ALI20160531BHEP

Ipc: C13K 1/06 20060101ALI20160531BHEP

INTG Intention to grant announced

Effective date: 20160705

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: GRANT OF PATENT IS INTENDED

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20161116