EP2542686A1 - Compositions and methods for bacterial production of chondroitin - Google Patents
Compositions and methods for bacterial production of chondroitinInfo
- Publication number
- EP2542686A1 EP2542686A1 EP11751231A EP11751231A EP2542686A1 EP 2542686 A1 EP2542686 A1 EP 2542686A1 EP 11751231 A EP11751231 A EP 11751231A EP 11751231 A EP11751231 A EP 11751231A EP 2542686 A1 EP2542686 A1 EP 2542686A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- chondroitin
- construct
- gene
- seq
- host cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- C07K14/245—Escherichia (G)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/12—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from bacteria
- C07K16/1203—Gram-negative bacteria
- C07K16/1228—Enterobacterales (O), e.g. Citrobacter (G), Serratia (G), Proteus (G), Providencia (G), Morganella (G) or Yersinia (G)
- C07K16/1232—Escherichia (G)
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08B—POLYSACCHARIDES; DERIVATIVES THEREOF
- C08B37/00—Preparation of polysaccharides not provided for in groups C08B1/00 - C08B35/00; Derivatives thereof
- C08B37/006—Heteroglycans, i.e. polysaccharides having more than one sugar residue in the main chain in either alternating or less regular sequence; Gellans; Succinoglycans; Arabinogalactans; Tragacanth or gum tragacanth or traganth from Astragalus; Gum Karaya from Sterculia urens; Gum Ghatti from Anogeissus latifolia; Derivatives thereof
- C08B37/0063—Glycosaminoglycans or mucopolysaccharides, e.g. keratan sulfate; Derivatives thereof, e.g. fucoidan
- C08B37/0069—Chondroitin-4-sulfate, i.e. chondroitin sulfate A; Dermatan sulfate, i.e. chondroitin sulfate B or beta-heparin; Chondroitin-6-sulfate, i.e. chondroitin sulfate C; Derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08L—COMPOSITIONS OF MACROMOLECULAR COMPOUNDS
- C08L5/00—Compositions of polysaccharides or of their derivatives not provided for in groups C08L1/00 or C08L3/00
- C08L5/08—Chitin; Chondroitin sulfate; Hyaluronic acid; Derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
Definitions
- the invention relates to the field of recombinant DNA technology for the production of chondroitin, including the production of chondroitin sulfate via a combination of recombinant bacterial fermentation and post-fermentation sulfation.
- Chondroitin belongs to a family of heteropolysaccharides called glycosaminoglycans
- GAGs Glycosaminoglycans
- GAGs are unbranched, negatively charged polysaccharide chains composed of repeating disaccharide units, one of which is an acidic sugar and the other of which is an amino sugar (N-acetylglucosamine or N-acetylgalactosamine), that can be sulfated. Because of their inflexible nature and high negative charge, GAGs exhibit highly extended conformations occupying large amounts of space, attracting cations and water and forming porous gels in the extracellular matrix. As such, GAGs, which are found in most animals, help to hydrate and expand tissues and enable the matrix to withstand compressive forces.
- the cartilage matrix lining the knee joint for example, can support pressures of hundreds of atmospheres by this mechanism.
- Chondroitin sulfate is important for maintenance of cartilage strength and resilience and is marketed as a nutritional supplement to reduce joint pain and promote healthy cartilage and joint function.
- Clinical studies support the use of chondroitin sulfate for treatment of osteoarthritis (See, for example, Kahan et al., Arthritis and Rheumatism 2009;60:524-533; Michel et al., Arthritis and Rheumatism 2005;52:779-786 and Uebelhardt et al., Osteoarthritis and Cartilage 2004;12:269-276), interstitial cystitis (See, for example, Nickel et. al, BJU Int.
- Chondroitin sulfate is currently produced by extraction from cartilage of animals including cows, pigs, sharks and poultry, using chemical and enzymatic treatments to dissociate the polysaccharide from the protein and produce a polysaccharide product of varying quality (Barnhill et al., J. Am. Pharm. Assoc. 2006;46: 14-24, Volpi, J. Pharm. Pharmacol. 2009;61:1271- 1280).
- Chondroitin contains D-glucuronic acid (GlcUA) and N-acetyl-D-galactosamine
- GalNAc is composed of a disaccharide repeating unit p3GalNAc-p4GlcUA. Typically, the GalNAc residues are variably sulfated at the 4 and 6 positions.
- Chondroitin sulfate occurs naturally as a component of proteoglycans that are structural components of cartilaginous tissue, such as joints, in humans and other animals.
- Proteoglycans consist of a core protein and a polysaccharide component, such as chondroitin sulfate, which is covalently attached to the protein through an oligosaccharide linker as shown in Figure 1.
- the core protein is decorated with multiple polysaccharide chains.
- Proteoglycans can be anchored in the cell membrane with the polysaccharide-containing portion of the protein present in the extracellular space or can be secreted and localized in the extracellular matrix (Prydz and Dalen, J. Cell Sci. 2000; 113: 193- 205).
- chondroitin synthases do so by adding alternating monosaccharide units of GalNAc and GlcUA from UDP-GalNAc and UDP-GlcUA donors to an accepting substrate.
- Theses enzymes have been identified in humans (Kitagawa et al, J, Biol. Chem. 2001;276:43894-43900; Yada et al, J Biol. Chem. 2003;278:39711-39725), and homologs of human chondroitin synthase have been identified in a variety of other animals including horse, cow, rodents, dog, chicken, zebra fish, nematodes, and insects (www.ncbi.nlm.nih.gov/homologene/8950).
- Some bacteria also produce chondroitin or chondroitin-like polysaccharide polymers as a component of their capsule. Unlike the chondroitin sulfate found in vertebrates, microbial chondroitin is not present as a proteoglycan, but rather as a lipid-linked polysaccharide on the bacterial cell surface and as free (i.e., not cell-associated) polysaccharide in culture media (Whitfield, Annu. Rev. Biochem. 2006;75:39-68; DeAngelis, Glycobiol. 2002; 12:9R-16R).
- Pasteurella multocida serotype F (Rimler, Vet. Rec. 1994; 134: 191-192), were reported to produce non-sulfated, chondroitin-like, capsular polysaccharides that potentially could be chemically modified to produce chondroitin sulfate.
- E. coli K4 was shown by Rodriguez et al. to produce an unsulfated chondroitin backbone with fructose side branches (K4 antigen) as a capsular polymer component.
- Ninomiya et al. J, Biol. Chem. 2002;277:21567-21575) identified and sequenced key genes required for biosynthesis of the chondroitin-like capsular polysaccharide in E. coli K4.
- the sequences disclosed by Ninomiya et al. comprise the so-called "region 2" portion of the "group 2" capsule gene cluster of E. coli K4.
- the region 2 genes of E. coli group 2 capsule gene clusters encode the proteins that determine the structure of the capsular polysaccharide.
- the AB079602 sequence includes a gene, termed kfoC, that encodes the E. coli K4 chondroitin polymerase.
- coli K4 chondroitin polymerase is a bifunctional glycosyltransferase that transfers GlcUA and GalNAc alternately to the non-reducing end of a chondroitin saccharide chain and related oligosaccharides, producing the chondroitin backbone of the K4 antigen polysaccharide.
- the chondroitin-like capsule polysaccharide produced by E. coli K4 contains fructose, linked ( ⁇ ,3) to the GlcUA residues of chondroitin.
- Pasteurella multocida Type F also produces an unsulfated chondroitin capsule component and the glycosyltransferase responsible for chondroitin polymerization in this organism has also been cloned, as reported in DeAngelis & Padgett-McCue, J. Biol. Chem. 2000;275:24124-29.
- the Pasteurella chondroitin synthase (pmCS, Genbank Accession No. AAF97500) is a single polypeptide enzyme that can synthesize a chondroitin polymer from UDP -GlcUA and UDP-GalNAc when provided with an appropriate acceptor substrate.
- P. multocida is considered not suitable for commercial production of chondroitin because of its low yield, requirement of expensive media, and Biohazard Level 2 (BL2) status, which requires specialized and expensive facilities. High yields from a microorganism would be necessary for commercially profitable production of chondroitin.
- DeAngelis US Patent Application Publication No. 20030109693 mentions the possibility of expressing pmCS in host cells such as a food grade Lactococcus or Bacillus to synthesize recombinant chondroitin.
- Bacillus is a gram positive bacterium and, as such, has a very different membrane/cell wall structure than gram negative organisms like E. coli and Pasteurella multocida.
- Efficient secretion of the polymer would, therefore, be expected to be problematic in Bacillus.
- E. coli 4 is also unsuitable for production of chondroitin because it is known to be a human pathogen. Moreover, it does not produce chondroitin per se, but instead produces, as noted above, a fructosylated form of chondroitin. Extensive chemical or enzymatic modification of this polysaccharide is required to produce chondroitin. Such modification increases the total cost of the process. Additionally, it requires introduction of further processes and quality control measures to determine that such modification was complete and generated a consistent product.
- the present invention addresses this need by providing constructs and host cells and methods for recombinant microbial production of chondroitin which can subsequently be sulfated to produce chondroitin sulfate.
- the present invention is directed to a construct comprising a gene cluster comprising kpsE, kpsE, kpsO, kpsU, kpsC, kpsS, kfoA, kfoC, and kfoE, wherein the gene cluster does not contain a functional gene of one or more of kfoD, or (kfol), kfoE, or orfl(kfoH), and wherein the construct is suitable for producing a chondroitin in a non-pathogenic bacterial host cell.
- the chondroitin is non-fructosylated.
- the chondroitin is secreted from the host cell.
- the gene cluster further comprises kfoG, kfoB, or both kfoG and kfoB. In some embodiments, the gene cluster further comprises kfoM and kfoT. In some embodiments, the construct comprises pDD66, pDD67, pCX040, pCX041, pCX042, pCX043, pCX096, or pBR1052.
- the present invention is directed to a construct comprising a gene cluster comprising kfoA, kfoC, and kfoF, wherein the gene cluster does not contain a functional gene of one or more of kpsM, kpsT, kpsE, kpsO, kpsC, or kpsS, and wherein the construct is suitable for producing a chondroitin in a non-pathogenic bacterial host cell.
- the chondroitin is not secreted from the host cell.
- the construct also does not contain a functional gene of one or more of kfoD, orfl, kfoE, or orfl .
- the chondroitin is non- fructosylated.
- the gene cluster further comprises kfoG, kfoB, or both kfoG and kfoB.
- the construct comprises kfoA, kfoB, kfoC, kfo ⁇ , and kfoG.
- the construct comprises pCX039, pCX044, or pCX092.
- the construct comprises pCX045 or pCX048.
- the present invention is directed to a construct comprising a gene selected from the group consisitng of kfoA, kfoB, kfoC, kfoE, kfoG, and a combination thereof, wherein the construct does not contain a functional gene of one or more of kpsM, kpsT, kpsE, kpsO, kpsC, or kpsS, and wherein the construct is suitable for producing a chondroitin or increasing the amount of a chondroitin in a non-pathogenic bacterial host cell.
- the chondroitin is not secreted from the host cell, in some embodiments, the construct also does not contain a functional gene of one or more of kfoD, orfi, kfoE, or or/1. In some embodiments, the chondroitin is non-fructosylated. In some embodiments, the construct comprises kfoA, kfoB, kfoC, kfoF, and kfoG. In some embodiments, the construct comprises pCX075, pCX081, pCX082, pCX092, pCXIOl, pBR1102, pBRl lOO or pBRl lOl. In some embodiments, the construct comprises pCX045 or pCX048.
- one or more genes in any of the constructs of the invention are modified for optimal codon usage in the bacterial host cell.
- any of the constructs of the invention further comprise a promoter.
- the promoter is selected from the group consisting of Pm, Viae, Ytrp, Ftac, XpL, PT7, TphoA, YaraC, YxapA, Ycad, and YrecA. In some embodiments, the promoter is Pm.
- any of the constructs of the invention further comprise a second promoter.
- the second promoter is selected from the group consisting of Pm, Viae, Ytrp, Ytac, XpL, PT7, Pp/zoA, FaraC, YxapA, Fcad, and PrecA.
- the second promoter is Pm.
- the second promoter is operably linked to one or more genes in the construct.
- the second promoter is operably linked to kpsYEDVCS.
- the construct further comprises a xylS regulatory gene.
- any of the constructs of the invention further comprise an antibiotic resistance gene.
- the antibiotic resistance gene is selected from the group consisting of chloramphenicol (CamR), kanamycin (KanR), ampicillin (AmpR), tetracycline (TetR), bleomycin (BleR), spectinomycin (SpcR), sulfonamide (SuR), streptomycin (StrR), carbenicillin (CbR), and erythromycin (EryR).
- any of the constructs of the invention comprise a K4 gene cluster.
- any of the constructs of the invention are suitable for producing a chondroitin in a non-pathogenic bacterial host cell, wherein the bacterial host cell is or is derived from a non-pathogenic organism selected from the group consisting of Escherichia, Pseudomonas, Xanthomonas, Methylomonas, Acinetobacter, and Sphingomonas.
- the present invention is directed to a non-pathogenic bacterial host cell comprising any of the constructs of the invention.
- the bacterial host cell is or is derived from a non-pathogenic organism selected from the group consisting of Escherichia, Pseudomonas, Xanthomonas, Methylomonas, Acinetobacter, and Sphingomonas.
- the bacterial host cell is a bacterial strain selected from the group consisting of MSC279, MSC280, MSC315, MSC316, MSC317, MSC319, MSC322, MSC323, MSC324, MSC325, MSC326, MSC328, MSC346, MSC347, MSC348, MSC350, MSC356, MSC359, MSC392, MSC402, MSC403, MSC404, MSC405, MSC410, MSC41 1, MSC436, MSC437, MSC438, MSC439, MSC458, MSC459, MSC460, MSC461, MSC466, MSC467, MSC469, MSC480, MSC494, MSC498, MSC499, MSC500, MSC510, MSC511, MSC522, MSC526, MSC537, MSC551, MSC561, MSC562, MSC563, MSC564, MSC566, MSC567, MSC619, MSC
- the present invention is directed to a method for producing a chondroitin, comprising transferring any of the constructs of the invention to a non-pathogenic bacterial host cell, and culturing the bacterial host cell under fermentation conditions wherein the chondroitin is produced by the bacterial host cell.
- the present invention is directed to a method for producing a chondroitin, comprising culturing a non-pathogenic bacterial host cell comprising any of the constructs of the invention under fermentation conditions sufficient for production of the chondroitin.
- the present invention is directed to a method for producing a non-pathogenic bacterial host cell comprising transferring any of the constructs of the invention to a non-pathogenic bacterial host cell.
- a gene cluster or gene of any of the constructs of the invention is integrated into a chromosome of the bacterial host cell in any of the methods of the invention.
- two or more copies of a gene cluster or gene of any of the constructs of the invention are integrated into a chromosome of the bacterial host cell in any of the methods of the invention.
- the two or more copies of the gene cluster or gene include two or more copies of the same gene or gene cluster.
- the chondroitin produced by any of the methods of the invention is non-fructosylated.
- the methods of the present invention further comprise sulfating the chondroitin.
- the present invention is directed to a method for producing a chondroitin sulfate, comprising producing a chondroitin by any of the methods of the invention; and sulfating the chondroitin.
- the process of sulfating the chondroitin in any of the methods of the invention comprises mixing sulfurtrioxide-triethylamine complex or chlorosulfbnic acid with the chondroitin in formamide.
- the bacterial host cell in any of the methods of the invention is or is derived from a non-pathogenic organism selected from the group consisting of Escherichia, Pseudomonas, Xanthomonas, Methylomonas, Acinetobacier, and Sphingomonas.
- the bacterial host cell in any of the methods of the invention is or is derived from a gram-negative organism.
- the bacterial host cell in any of the methods of the invention is a
- the X. campestris is a bacterial strain selected from the group consisting of MSC255, MSC256, MSC257, MSC225, and MSC226.
- the bacterial host cell in any of the methods of the invention is a non-pathogenic E. coli.
- the non-pathogenic E. coli is selected from the group consisting of E. coli K-12 and E. coli B.
- the E. coli K-12 is a bacterial strain selected from the group consisting of MSC188 and MSC175.
- the E. coli B is bacterial strain MSC364.
- an endogenous gene of the bacterial host cell in any of the methods of the invention is deleted or inactivated by homologous recombination.
- the bacterial host cell in any of the methods of the invention does not express extracellular polysaccharides endogenous to the host cell.
- the bacterial host cell in any of the methods of the invention is suitable for conjugal transfer from a laboratory cloning strain.
- the methods of the invention further comprise recovering the chondroitin from the bacterial host cell.
- the methods of the invention further comprise recovering the chondroitin from extracellular culture medium.
- 1 g/L to 50 g L of the chondroitin is secreted from the bacterial host cell in any of the methods of the invention in 24 to 72 hours. In some embodiments, 5 g/L to 50 g/L of the chondroitin is secreted from the bacterial host cell in 24 to 72 hours. In some embodiments, 15 g/L to 50 g/L of the chondroitin is secreted from the bacterial host cell in 24 to 72 hours.
- any of the methods of the invention further comprise purifying the chondroitin.
- the bacterial host cell in any of the methods of the invention is cultured at 25°C to 37°C.
- the bacterial host cell in any of the methods of the invention is cultured in a medium comprising glycerine.
- the present invention is directed to the chondroitin produced by any of the methods of the invention.
- the present invention is directed to a composition comprising the chondroitin produced by any of the methods of the invention.
- the present invention is directed to an antibody or antibody fragment that binds to an amino acid sequence selected from the group of: SEQ ID NO:92 of KpsF, SEQ ID NO:93 of KpsE, SEQ ID NO:94 of KpsD, SEQ ID NO:95 of KpsU, SEQ ID NO:96 of KpsC, SEQ ID NO:97 of KpsS, SEQ ID NO:91 of KpsT, SEQ ID NO:83 of KfoA, SEQ ID NO:84 of KfoB, SEQ ID NO:85 of KfoC, SEQ ID NO:86 of Kfol (Orf3), SEQ ⁇ ) NO:87 of KfoE, SEQ ID NO:88 of KfoH (Orfl), SEQ ID NO:89 of KfoF, and SEQ ID NO:90 of KfoG.
- Figure 1A shows the structure of chondroitin and chondroitin sulfate.
- Figure IB shows the linkage between chondroitin sulfate and core protein of proteoglycans.
- Figure 2 shows the organization of the gene cluster involved in the synthesis of the E. coli
- region 2 shown in this figure is as described in Ninomiya et al. (J. Biol. Chem. 2002;277:21567-21575). Regions 1 and 3 of the E. coli K4 capsule gene cluster were not sequenced prior to this invention and therefore, their structure was not known prior to this invention.
- Figure 3 shows the analysis by the present inventors of the E. coli K4 capsule region 2 sequence (AB079602) as described in Ninomiya et al. (J. Biol. Chem. 2002;277:21567-21575).
- Figure 3A shows the presence of additional putative coding sequences orfl, orfl. and or/3, and further shows that based on sequence alignment of region 2 from E. coli K4 with P. multocida serotypes B and E; genes (alignment data shown in Figure 3B), kfoD, orfl, kfoE, orfl , from E. coli K4 have homologs among the P. multocida M1404 serotype B genes bcbDEFG and the P. multocida PI 234 serotype E genes ecoDEFG. Homologs are connected by two-headed arrows.
- Figure 4 relates to the sequences of the region 2 genes of E. coli K4 strain ATCC 23502 as determined by the present inventors.
- Figure 4A lists differences between the sequences determined by the present inventors as compared to the sequences previously reported by
- Figure 4B shows a comparison of the predicted amino acid sequences encoded by the sequences of the region 2 genes, as determined by the present inventors (shown in Figure
- Figure 5 shows the organization of the K4 capsule gene cluster from the E. coli K4 strain
- the gene cluster contains 17 open reading frames (exclusive of IS2) that are predicted to encode proteins.
- Figure 6 diagrammatically represents the structure of synthetic genes constructed as three segments, «FEDUCS (the "FS segment”), kpsMTkfoN CFG (the “MG segment”) and kfoOJEH (the "DH segment”).
- restriction sites were incorporated at strategic locations to allow assembly of the synthetic fragments into one or more operons and to facilitate manipulation of individual genes.
- Figure 7A shows the pop in, pop-out strategy for constructing derivative bacterial strains by deletion of a particular gene or gene cluster.
- Figure 7B shows the map of the suicide vector pCX027 (SEQ ID NO: 141) used to employ this strategy in Xanthomonas campestris in this strategy.
- Figures 8A-8U represent the DNA maps for plasmids and DNA fragments pBHRl, pDD39, pDD42, pDD47, pREZ6, pDD49, pJ201: 11352, pDD50, pDD54, pJ241 : 10662, pJ241 : 10664, pJ241 :10663, pDD37, pDD38, pDD51, pDD52, pDD57, pDD58, pDD61, pDD62, pDD63, pDD59, pDD67, pDD60, pDD66, pBR1052, pMAK-CL, pDD74, pDD76, pDD73, pDD77, pDD79, pDD80, pCX045, pCS048, pCX039, pCX044, pCX040, pCX042, pCX
- Figure 9 shows examples of results from western blots performed using antisera directed against proteins encoded by the E. coli K4 group 2 capsule gene cluster.
- Figures 10A-10D show the DNA maps of plasmid constructs used to introduce cloned E. coli K4 chondroitin biosynthesis genes into Xanthomonas campestris.
- Figure 11A shows a typical calibration curve for the K4 fructosylated chondroitin capsular polysaccharide ("K4P") measured in inhibitory ELISA.
- Figure 11B shows a typical standard curve of the disaccharide, 2-acetamido-2-deoxy-3-0-(P-D-gluco-4-enepyranosyluronic acid)-D-galactose ("Adi-0S”), measured in the chondroitinase/HPLC assay for chondroitin.
- Figure 12 shows chondroitinase digestibility of recombinant chondroitin.
- Figure 13 shows chondroitinase digestibility of both K4 fructosylated chondroitin capsular polysaccharide (K4P) and defructosylated K4P (DFK4P).
- Figures 14A-14X show the DNA maps for plasmid constructs pCX096, pCX097, pCXIOO, pCXIO l, pCS102, pCX075, pCX082, pCX081, pCX092, pBR1077, pBR1082, pCX050, pCX070, pCX093, pCX094, pCX095, pMAK705pl, pBR1103, pBR10931acZ, pBRlOO-lac, pBR1094mtl, pBRl 101-mtl, pBR1095fru, and pBRl 102-fru of the present invention.
- Figure 15 shows a family tree of chondroitin-producing E. coli strains and the steps used for strain derivation.
- the present invention is directed to constructs and recombinant cells for the production of chondroitin, methods of producing chondroitin, chondroitin produced from the methods, and uses of the chondroitin.
- the present invention is based on a novel technology that allows production of chondroitin and chondroitin sulfate.
- the present invention meets an important need in the art by providing a safe, consistent, and reliable supply of chondroitin and chondroitin sulfate at lower cost, while providing superior product quality. This process can also provide a vegetarian and kosher product.
- the recombinantly produced chondroitin can be sulfated using known methods to form chondroitin sulfate.
- the present invention includes methods of sulfation of the recombinantly produced chondroitin, the recombinantly produced chondroitin sulfate product, as well as uses of the recombinantly produced chondroitin sulfate product.
- the present inventors sequenced the E. coli K4 gene cluster encoding proteins involved in biosynthesis of the E. coli K4 fructosylated chondroitin capsular polysaccharide (K4P), synthesized and assembled DNA segments based on the native sequence, transferred these genes into alternative host cells that are suitable for large scale fermentation, and demonstrated production of recombinant fructosylated chondroitin capsular polysaccharide in these host cells. Since it is preferable that the alternative host cells should produce non- fructosylated chondroitin, genes responsible for fructosylation of chondroitin by E. coli K4 were identified and deleted from the E.
- coli K4 chondroitin biosynthesis gene set transferred to the alternative hosts.
- the alternative hosts containing this gene set produced non- fructosylated chondroitin.
- This recombinant chondroitin (rCH) produced by the alternative host can be sulfated to produce a chondroitin sulfate product.
- K4P refers to the native or naturally occurring fructosylated chondroitin capsular polysaccharide as synthesized by the wild type E. coli K4 strain.
- chondroitin refers to the chondroitin backbone. Chondroitin can be fructosylated or unfructosylated (or non-fructosylated).
- chondroitin includes both fructosylated and unfructosylated forms, unless specifically noted.
- chondroitin refers to unsulfated chondroitin.
- the present invention comprises DNA constructs comprising the E. coli K4 gene sets or gene clusters.
- K4 gene cluster refers to the set of genes from E. coli K4 that are involved in the biosynthesis of the chondroitin-like capsular polysaccharide (K4P).
- K4 gene cluster can refer to all the genes from E. coli K4 that are involved in the biosynthesis of the chondroitin-like capsular polysaccharide or to a subset of these genes.
- E. coli K4 contains a set of multiple genes that are involved in the synthesis of a chondroitin-like capsular polysaccharide referred to as K4P.
- this polysaccharide consists of a chondroitin backbone that is modified by the addition of a fructose residue.
- these genes are organized in three main regions (Region 1 ("Rl"), Region 2 ("R2”), and Region 3 ("R3"))- Based on the sequence of region 2 described by Ninomiya et al. (2002) (GenBank accession no.
- region 2 was predicted to comprise seven genes relating to capsule biosynthesis, kfoA, kfoB, kfoC, kfoD, kfoE, kfoF and kfoG.
- Ninomiya et al. did not disclose the sequences of the expected region 1 and region 3 portions of the E. coli K4 capsule gene cluster.
- region 1 would be predicted to comprise six genes, kps ⁇ , kpsE, kpsO, kps J, kpsC, kpsS and region 3 would be predicted to comprise two genes, kpsM and kpsT.
- the kpsM, kpsT, JcpsD, kpsE, kpsC and kpsS genes encode proteins required for translocation of the capsular polysaccharide from the cell cytoplasm to the cell surface where the mature capsular polysaccharide is believed to be anchored to the outer cell membrane through a covalent linkage to a lipid component of that membrane (Whitfield, 2006).
- the kpsE and kpsU genes encode proteins that are predicted to catalyze steps in the biosynthesis of CMP-Kdo.
- a role of CMP-Kdo in the biosynthesis of chondroitin capsules in E. coli has been proposed (Roberts, Annu. Rev. Microbiol. 1996;50:285-315) but has not been demonstrated experimentally (Whitfield, 2006)
- the entire K4 gene cluster was thought to comprise 15 genes.
- the present inventors sequenced region 2 of the K4 capsule gene cluster from the E. coli K4 strain ATCC 23502.
- sequence determined by the present inventors and the AB079602 sequence were compared, single base pair differences were discovered, including substitutions, deletions and insertions at 26 positions. As explained in detail in Example 1 , some of these differences result in substantial differences in the predicted amino acid sequences of the region 2 proteins encoded by the gene cluster.
- the present inventors examined the regions identified by Ninomiya et al. as intergenic sequences separating the genes and identified three additional open reading frames or/1 (also referred to herein as kfoH), orfl and orfl (also referred to herein as kfol) in region 2 that were previously unidentified.
- E. coli serotype K4 strain Ul-41 was obtained from the Statens Serum Institut (Copenhagen, Denmark). Ul-41 is the progenitor of the ATCC 23502 strain and has been reported to produce K4 capsular polysaccharide in culture. It is also the K4 reference strain for E. coli serotyping and was used to produce the polysaccharide preparation used for K4P structural determination by Rodriguez et al. (1988). A total of approximately 23 kb of DNA spanning the K4 capsule gene cluster in E. coli Ul-41 was sequenced.
- This sequence confirmed the presence of kpsF, kpsE, kpsD, kpsU, kpsC and kpsS genes in region 1 and the presence of kpsM and kpsT genes in region 3.
- the region 2 sequence of Ul-41 and the sequence determined by the present inventors for region 2 of ATCC 23502 were found to be identical.
- Region 1 comprising conserved genes kps ⁇ , kpsE, kpsD, kpsU, kpsC and kpsS, and region 3, comprising conserved genes kpsM and kpsT, flank the 9 open reading frames of region 2.
- Region 1 and region 3 genes include proteins that are required for synthesis and translocation of all group 2 capsules in E. coli.
- Region 1 also includes two genes (kps ⁇ and kpsXJ) that encode enzymes that are, as noted above, predicted to catalyze steps in the biosynthesis of CMP-Kdo.
- genes kps ⁇ and kpsXJ that encode enzymes that are, as noted above, predicted to catalyze steps in the biosynthesis of CMP-Kdo.
- three encode proteins with clearly defined activities relating to capsule biosynthesis: kfoA (UDP-GlcNAc epimerase, which converts UDP-GlcNAc to the UDP- GalNAc precursor), kfoF (UDP-Glc dehydrogenase, which converts UDP-Glc to the UDP-GlcUA precursor) and kfoC (chondroitin synthase, i.e. the polymerase, which can add either one of the precursors, UDP-GalNAc or UDP-GlcUA, to an acceptor chondroitin molecule).
- kfoB, kfoG, kfoD, kfoE, kfoH. (orfl) and kfol (orfl) were not known.
- the kfoB and kfoG genes encode proteins that are homologous to those encoded by genes present in capsule clusters of bacteria known to produce other glycosaminoglycan (GAG) capsules such as P. multocida serotypes A, F and D (Townsend et al., J. Clin. Microbiol. 2001;39:924-929) and E.
- GAG glycosaminoglycan
- coli serotype K5 (Petit et al., Mol. Microbiol. 1995;4:611-620).
- This circumstantial evidence suggested that kfoB and kfoG can play a role in biosynthesis of the GAG-containing K4 capsule.
- the present inventors have found that kfoB and kfoG genes are not essential for the production of chondroitin in E. coli, but that kfoG gene is required for the optimal production of chondroitin.
- kfoO, kfol (orfl), kfoE and kfoH (orfl) might not be involved in the synthesis of chondroitin.
- kfoO, kfol (orfl), kfoE and kfoH (orfl) might not be involved in the synthesis of chondroitin.
- none of these genes are required for biosynthesis of chondroitin, but one or more of these genes are essential for fhictosylation of the chondroitin produced by the K4 gene set.
- the present inventors Using the sequence of the Ul-41 4 capsule gene cluster as the basis, the present inventors further designed synthetic genes that are codon-optimized for expression in hosts such as E. coli, Xanthomonas campestris, Sphingomonas elodea and Bacillus subtilis. The design and synthesis of these codon-optimized genes is explained in detail in Example 2.
- Example 4 describes the construction of plasmid vectors for the expression of these genes in heterologous bacteria.
- the complete nucleotide sequences of the codon-optimized genes of the present invention, and the amino acid sequences encoded by them, are as follows.
- the complete nucleotide sequence for kpsF used in the present invention is represented herein as SEQ ID NO: l .
- kpsF is a 981 nucleotide sequence (not including the stop codon) which encodes a 327 amino acid sequence, represented herein as SEQ ID NO:2.
- the complete nucleotide sequence for kps is represented herein as SEQ ID NO:3.
- kpsE is a 1146 nucleotide sequence (not including the stop codon) which encodes a 382 amino acid sequence, represented herein as SEQ ID NO:4.
- the complete nucleotide sequence for kpsO is represented herein as SEQ ID NO:5.
- kpsD is a 1674 nucleotide sequence (not including the stop codon) which encodes a 558 amino acid sequence, represented herein as SEQ ID NO: 6.
- the complete nucleotide sequence for kpsU is represented herein as SEQ ID NO:7.
- kpsXJ is a 738 nucleotide sequence (not including the stop codon) which encodes a 246 amino acid sequence, represented herein as SEQ ID NO: 8.
- the complete nucleotide sequence for kpsC is represented herein as SEQ ID NO:9.
- kpsC is a 2025 nucleotide sequence (not including the stop codon) which encodes a 675 amino acid sequence, represented herein as SEQ ID NO: 10.
- the complete nucleotide sequence for kpsS is represented herein as SEQ ID NO: l 1.
- kpsS is a 1209 nucleotide sequence (not including the stop codon) which encodes a 403 amino acid sequence, represented herein as SEQ ID NO: 12.
- the complete nucleotide sequence for kpsM is represented herein as SEQ ID NO: 13.
- kpsM is a 774 nucleotide sequence (not including the sto codon) which encodes a 258 amino acid sequence, represented herein as SEQ ID NO: 14.
- the complete nucleotide sequence for kpsT is represented herein as SEQ ID NO: 15.
- kpsT is a 666 nucleotide sequence (not including the stop codon) which encodes a 222 amino acid sequence, represented herein as SEQ ID NO: 16.
- the complete nucleotide sequence for kfoA is represented herein as SEQ ID NO: 17.
- kfoA is a 1017 nucleotide sequence (not including the stop codon) which encodes a 339 amino acid sequence, represented herein as SEQ ID NO: 18.
- the complete nucleotide sequence for kfo is represented herein as SEQ ID NO: 19.
- kfoB is a 1638 nucleotide sequence (not including the stop codon) which encodes a 546 amino acid sequence, represented herein as SEQ ID NO:20.
- the complete nucleotide sequence for kfoC is represented herein as SEQ ID NO:21.
- kfoC is a 2058 nucleotide sequence (not including the stop codon) which encodes a 686 amino acid sequence, represented herein as SEQ ID NO:22.
- the complete nucleotide sequence for kfoO is represented herein as SEQ ID NO:23.
- kfoD is a 1431 nucleotide sequence (not including the stop codon) which encodes a 477 amino acid sequence, represented herein as SEQ ID NO:24.
- the complete nucleotide sequence for kfoE is represented herein as SEQ ID NO:25.
- kfoE is a 1566 nucleotide sequence (not including the stop codon) which encodes a 522 amino acid sequence, represented herein as SEQ ID NO:26.
- the complete nucleotide sequence for kfoF is represented herein as SEQ ID NO:27.
- kfo ⁇ is a 1167 nucleotide sequence (not including the stop codon) which encodes a 389 amino acid sequence, represented herein as SEQ ID NO:28.
- the complete nucleotide sequence for kfoG is represented herein as SEQ ID NO:29.
- kfoG is a 1464 nucleotide sequence (not including the stop codon) which encodes a 488 amino acid sequence, represented herein as SEQ ID NO:30.
- orfl is a 723 nucleotide sequence (not including the stop codon) which encodes a 241 amino acid sequence, represented herein as SEQ ID NO: 32.
- SEQ ID NO:33 The complete nucleotide sequence for orfl (also referred to herein as kfol) is represented herein as SEQ ID NO:33.
- orfl is a 378 nucleotide sequence (not including the stop codon) which encodes a 126 amino acid sequence, represented herein as SEQ ID NO: 34.
- the present invention comprises DNA constructs comprising the
- the constructs can include the entire 17 gene cluster described above or one or more genes of the 17 gene cluster described above, i.e.
- the construct comprises one or more regions of the K4 cluster (i.e., regions 1, 2, and/or 3 as described herein). In some embodiments, the construct comprises one or more subsets of genes from the K4 cluster (including subsets of genes from regions 1, 2, and/or 3 as described herein).
- the construct can comprise a gene cluster in which a gene in the cluster is present in any order relative to any other gene in the cluster.
- the ordering of genes in a gene cluster within the construct can be different from the naturally occurring order of genes within the K4 cluster.
- the construct can comprise a region, a subset of genes, or a gene from the K4 cluster that can be in any order within the construct relative to any other region, subset of genes, or individual genes from the K4 cluster.
- the genes are present in a specified order in the construct.
- the constructs can include one or more native genes (i.e., the genes having the sequence present in E. coli K4 Ul-41 or other serotype K4 strains) that were isolated from the E.
- kfoO, kfol, kfoE and kfoH genes are essential for fructosylation of chondroitin in E. coli, but none of these genes is required for synthesis of chondroitin. Simultaneous omission or inactivation of all four of these genes results in the production of unfructosylated chondroitin.
- a construct of the invention does not contain a functional gene of one or more of kfoD, kfol, kfoE and kfoH.
- a functional gene of one or more of kfoD, kfol, kfoE and kfoH is absent from the construct in these embodiments.
- a construct that does not contain a functional gene includes constructs in which the entire gene is absent as well as constructs in which the gene or portion thereof is present but is non-functional (i.e., inactive).
- a construct of the invention comprises a gene cluster that has been modified to inactivate one or more of kfoD, kfol, kfoE and kfoH.
- the present invention includes a construct that comprises a gene cluster comprising kpsF, kpsE, kpsO, kpsU, kpsC, kpsS, kfoA, kfoC, and kfoF, wherein the construct does not contain a functional gene of one or more of kfoO, kfol, kfoE and kfoH.
- the construct is suitable for producing a chondroitin in a non-pathogenic bacterial host cell as described herein.
- the chondroitin is non-fructosylated.
- the construct can further comprise kfoG and/or kfoB.
- kfoB and kfoG genes were not found to be essential for the production of chondroitin, but the kfoG gene was found to be required for the optimal production of chondroitin (See example 7).
- the construct of the present invention can further comprise kpsM and/or kpsT.
- the constructs are useful for the production of recombinant chondroitin that is secreted from the cell.
- these constructs include the expression vectors pDD66 (expression vector containing ApsMT-A oABCFG-ApsFEDUCS), pDD67 (expression vector containing kpsV mjC&-kpsWl-kfoAB>CYG), pCX040 (expression vector containing kpsMJ-kfoACFG- ⁇ FEDUCS), pCX041 (expression vector containing ⁇ MT-/ ⁇ oABCF-A/ «FEDUCS), pCX042 (expression vector containing kpsFEO CS-kpsMT-kfoACFG), pCX043 (expression vector containing kpsFEDUCS-kpsMT-kfoA CF), and pCX096 (expression vector containing kpsFEDXJCS-kfoABCFG).
- pDD66 expression vector containing ApsMT-A oABCFG-ApsFEDUCS
- pDD67 expression vector containing
- pBR1052 contains the same K4 gene set as pDD66 (kpsMT-kfoABCFG- kpsFEDUCS) and additionally has a second copy of the Pm promoter sequence inserted immediately upstream of the kpsF gene.
- the nucleotide sequence of pDD66 is denoted by SEQ ID NO:35; the nucleotide sequence of pDD67 is denoted by SEQ ID NO:36; the nucleotide sequence of pCX040 is denoted by SEQ ID NO:37; the nucleotide sequence of pCX041 is denoted by SEQ ID NO:38; the nucleotide sequence of pCX042 is denoted by SEQ ID NO:39; the nucleotide sequence of pCX043 is denoted by SEQ ID NO:40; the nucleotide sequence of pCX096 is denoted by SEQ ID NO: 149; and the nucleotide sequence of pBR1052 is denoted by SEQ ID NO:41.
- the design and construction of these DNA constructs is explained in detail in Example 4.
- the present invention includes constructs that are useful for the purpose of producing intracellular chondroitin, i.e., chondroitin that is not secreted from the host cell. Intracellular production of chondroitin can be desirable in order to eliminate viscosity of the fermentation resulting from high levels of polysaccharide in the culture medium. In addition, it is possible that intracellular production could achieve higher levels of chondroitin than secretion.
- the construct does not contain a functional gene of at least one of kpsM and kpsT of region 3.
- the construct comprises a gene cluster that does not contain or has been modified to inactivate at least one of kpsM and kpsT of region 3.
- the construct does not contain a functional gene of at least one of kpsE, kpsO, kpsC and kpsS of region 1.
- the construct comprises a gene cluster that does not contain or has been modified to inactivate at least one of kpsE, kpsD, kpsC and kpsS of region 1.
- the construct does not contain a functional gene of at least one of kpsM and kpsT of region 3 and at least one of kpsF, kpsD, kpsC and kpsS of region 1.
- the construct comprises a gene cluster that does not contain or has been modified to inactivate at least one of kpsM and kpsT of region 3 and at least one of kpsE, kpsO, kpsC and kpsS of region 1.
- the present invention includes a construct comprising a gene cluster comprising kfoA, kfoC, and kfoF, wherein the gene cluster does not contain a functional gene of one or more of kpsM, kpsT, kpsE, kpsD, kpsC and kpsS.
- the construct is suitable for producing a chondroitin in a non-pathogenic bacterial host cell as described herein.
- the chondroitin is not secreted from the host cell.
- the chondroitin is non-fructosylated.
- the construct also does not contain a functional gene of one or more of kfoD, orfl, kfoB, and orfl .
- the construct can further comprise kfoG and/or kfoB.
- the construct comprises kfoA, kfoB, kfoC, kfoF and kfoG.
- a construct of the present invention includes a gene selected from the group consisting of kfoA, kfoB, kfoC, kfoF, kfoG, and a combination thereof, wherein the construct does not contain a functional gene of one or more of kpsM, kpsT, kpsE, kpsD, kpsC and kpsS.
- the construct is suitable for producing a chondroitin in a nonpathogenic bacterial host cell as described herein.
- the construct is suitable for increasing the amount of a chondroitin in a non-pathogenic bacterial host cell as described herein.
- the construct is transferred to a bacterial host cell comprising one or more existing copies of the E. coli K4 gene cluster, regions of the cluster, subsets of genes of the cluster, or genes of the cluster that have been integrated into the host chromosome.
- the chondroitin is non-fructosylated.
- the construct also does not contain a functional gene of one or more of kfoO, orfl, kfoE, and orfl .
- the construct comprises kfoA, kfoB, kfoC, kfoF and kfoG.
- a construct of the present invention comprises the expression vectors pCX039 (expression vector containing kfoABCFG), pCX044 (expression vector containing kfoACFG), pCX092 (expression vector containing kfoABCE), pCX045 (expression vector containing kpsMY-kfoABCFG-kpsFEDOS), and pCX048 (expression vector containing kpsM-kfoABCFG-kpsFEOVCS).
- the nucleotide sequence of pCX039 is denoted by SEQ ID NO:42; the nucleotide sequence of pCX044 is denoted by SEQ ID NO:43; the nucleotide sequence of pCX092 is denoted by SEQ ID NO: 154; the nucleotide sequence of pCX045 is denoted by SEQ ID NO:44; and the nucleotide sequence of pCX048 is denoted by SEQ ID NO:45.
- SEQ ID NO:42 The design and construction of these DNA constructs is explained in detail in Example 4.
- a construct of the present invention comprises the expression vectors pCX075 (expression vector containing kfoABFG), pCX081 (expression vector containing kfoABCG), pCX082 (expression vector containing kfoBCFG), pCXIOl (expression vector containing kfoABCFG-kpsMT), pBR1102 (expression vector containing k oABCFG), pBRHOO (expression vector containing kfoABCFG), and pBRl lOl (expression vector containing kfoABCFG).
- the nucleotide sequence of pCX075 is denoted by SEQ ID NO: 153; the nucleotide sequence of pCX081 is denoted by SEQ ID NO: 151; the nucleotide sequence of pCX082 is denoted by SEQ ID NO: 152; the nucleotide sequence of pCXIOl is denoted by SEQ ID NO: 150; the nucleotide sequence of pBR1102 is denoted by SEQ ID NO: 170; the nucleotide sequence of pBRl 100 is denoted by SEQ ID NO: 171; and the nucleotide sequence of pBRl 101 is denoted by SEQ ID NO: 172.
- the design and construction of these DNA constructs is explained in detail in Examples 18 and 20.
- constructs of the present invention can comprise one or more genes that are modified for optimal codon usage in a bacterial host cell as described herein.
- the constructs of the present invention can further comprise a promoter.
- the promoter should be capable of driving expression of the gene cluster in a bacterial host cell as described herein. Numerous such promoters, which are useful to drive expression in the desired bacterial host cell are familiar to those skilled in the art and can be used in the present invention. Examples of promoters that have been commonly used to express heterologous proteins include, without limitation, Pm, lac, trp, tac, ⁇ pL, ⁇ , ⁇ , araC, xapA, cad and recA ⁇ See, e.g., Weikert et al, Curr. Opin. Biotechnol. 1996;7:494-499). Such promoters can be constitutive or inducible. Termination control regions can also be derived from various genes native to the preferred hosts. Optionally, a termination site may be unnecessary.
- the constructs of the present invention comprise the Pm promoter along with the xylS regulatory gene (Mermod et al., J. Bacteriol. 1986;167:447-54).
- the Pm promoter which is isolated from Pseudomonas putida TOL plasmid and its regulatory gene xylS provide a strong, well regulated promoter shown to function in a variety of gram negative bacteria (Blatny et al., Plasmid 1997;38:35-51).
- the XylS protein can exist as a monomer or dimer. In the dimeric form, the XylS protein can bind to the Pm promoter and stimulate transcription.
- effector molecules such as meta-toluic acid (3-methylbenzoate) which bind directly to XylS and promote dimerization of the protein.
- the promoter can be operably linked to one or more genes of the gene cluster.
- the constructs of the present invention can further comprise a second promoter.
- a second promoter can be added to the expression construct at a location that is selected so as to enhance the transcription of the gene or gene set that is not expressed at an optimal level.
- the added promoter would be inserted immediately upstream (i.e., 5' to) the gene or gene set of interest.
- the second promoter can be Pm, or any of the promoters listed above as examples of promoters useful expressing K4 gene sets. In some embodiments, the second promoter can be Pm.
- the second promoter can be operably linked to one or more genes of the gene cluster.
- the second promoter can be operably linked to ApsFEDUCS gene set. See, for instance, expression vector pBR1052 as described in Example 4.
- the genes, or combinations of genes, that it would be advantageous to express, or augment the expression of, by use of a second promoter can be determined empirically for any given plasmid, or chromosomal, gene set by western blot analysis.
- the constructs of the present invention can further comprise an antibiotic resistance gene that confers resistance to a particular antibiotic.
- antibiotic resistance genes include, without limitation, chloramphenicol resistance gene (CamR), kanamycin resistance gene (KanR), ampicillin resistance gene (AmpR), tetracycline resistance gene (TetR), spectinomycin resistance gene (SpcR), sulfonamide resistance gene (SuR), bleomycin resistance gene (BleR), streptomycin resistance gene (StrR), carbenicillin resistance gene (CbR) and erythromycin resistance gene (EryR).
- the constructs of the present invention are useful for producing chondroitin in a bacterial host cell.
- the host is a gram-negative bacterium.
- gram negative bacteria include, without limitation, Escherichia, Pseudomonas, Xanthomonas, Methylomonas, Acinetobacter and Sphingomonas.
- the host is a non-pathogenic gram-negative bacterium.
- non-pathogenic gram-negative bacteria include without limitation, non-pathogenic E. coli such as E. coli K-12 or E. coli B, Xanthomonas campestris, Sphingomonas elodea and Pseudomonas putida.
- an endogenous gene of a bacterial host cell as described herein is deleted or inactivated by homologous recombination.
- Derivatives of hosts that are unable to manufacture their native extracellular polysaccharides are desirable. Use of such derivative hosts would facilitate the visual and chemical identification of biosynthesis of recombinant chondroitin (rCH), as well as the purification of the rCH produced by the host when a K4 gene set is introduced. Furthermore, biosynthesis of rCH in appropriately designed derivative hosts would not be limited by competition with the native polysaccharide synthesis.
- inactivation or deletion of the first glycosyltransferase genes of a native polysaccharide biosynthetic pathway would prevent utilization of any potential lipid carrier by the native pathway and prevent competition between the enzymes of the native pathway and the K4 enzymes for the lipid carrier, or any other cellular component(s) that acts on nascent polysaccharide chains and might be limiting in availability.
- Inactivation (e.g. by deletion) of the entire native biosynthetic gene clusters would remove most of the competitive elements, but could potentially have undesirable effects on physiology and or membrane structure.
- E. coli K-12 (“K-12")
- E. coli B (“EcB”)
- Xanthomonas campestris pv. campestris (“Xcc”
- Generation of derivative hosts that comprise deletions in one or more genes of the gene cluster that encode enzymes for synthesis of native extracellular polysaccharides was carried out using a two-step, "pop-in / pop-out” homology-driven method as described in detail in Example 3.
- colanic acid (M antigen) is an extracellular polysaccharide produced by many enteric bacteria.
- Strains MSC188 and MSC175 are derivatives of E. coli K-12 strain that comprise a deletion of the entire colanic acid operon, and the weal gene encoding the glycosyltransferase enzyme responsible for loading of the first sugar onto a lipid carrier during colanic acid biosynthesis, respectively.
- Strain MSC364 is a derivative of E. coli B that comprises a deletion of the entire colanic acid operon.
- Xanthomonas campestris pv. campestris strains that are deficient or defective in the biosynthesis of the extracellular polysaccharide xanthan gum were created.
- Strains MSC225 and MSC226 are derivatives of Xcc strain that comprise a deletion of the gumD gene encoding the glycosyltransferase I enzyme and strains MSC255, MSC256. and MSC257 comprise a deletion of the entire xanthan gum operon.
- the present invention is directed to a method for producing a non-pathogenic bacterial host cell comprising any one or more of the constructs of the present invention, comprising transferring any one or more of the constructs of the present invention to a non-pathogenic bacterial host cell.
- the constructs of the present invention can be introduced into bacterial host cells by any known method for expression of the genes present within the constructs. Such methods can include, without limitation, transformation, electroporation, conjugation or transduction.
- the present invention is directed to a non-pathogenic bacterial host cell comprising any one or more of the constructs of the present invention.
- the present invention also includes various strains that were created by introducing the constructs comprising expression vectors of the present invention into the host strains, including the derivative strains comprising deletions. Certain examples are described in detail in Examples 6-9, 11, 13 and 14.
- the genes contained within the constructs of the invention are introduced into the chromosome of the recipient host strain such that the genes are integrated within the host chromosome.
- Placing the cloned genes in the chromosome provides the advantage of eliminating the requirement for maintaining selective pressure to maintain the plasmid(s) or vector(s) which carry the chondroitin biosynthesis genes and can thus potentially provide more stable expression strains or expression strains that are stable in the absence of any selective pressure. Accordingly, the present invention includes bacterial strains that comprise one or more copies of any one or more of the genes contained within the constructs of the present invention integrated into their chromosome.
- the present inventors have created E. coli K-12 and Xcc strains that include one or more of the synthetic genes for the biosynthesis of chondroitin integrated into their chromosomes.
- the present invention also includes strains that were created by introducing the constructs comprising expression vectors of the present invention into the strains of the present invention that comprise one or more copies of the constructs integrated into their chromosome.
- the K4 gene cluster, one or more regions of the cluster, one or more subsets of genes of the cluster, or one or more genes of the cluster are integrated into the chromosome of a non-pathogenic bacterial host cell as described herein using a construct of the invention and methods described herein.
- two or more copies of the gene cluster, region, subset, or gene are integrated into the chromosome of a non-pathogenic bacterial host cell.
- 2 to 20; 2 to 19; 2 to 18; 2 to 17; 2 to 16; 2 to 15; 2 to 14; 2 to 13; 2 to 12; 2 to 11; 2 to 10; 2 to 9; 2 to 8; 2 to 7; 2 to 6; 2 to 5; 2 to 4; or 2 to 3 copies of the gene cluster, region, subset, or gene are integrated into the chromosome of a non-pathogenic bacterial host cell.
- 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 copies of the gene cluster, region, subset, or gene are integrated into the chromosome of a nonpathogenic bacterial host cell.
- the two or more copies are integrated into the host chromosome using the same construct.
- the two or more copies are integrated into the host chromosome using different constructs.
- a promoter is also integrated into the host chromosome to control expression of the gene cluster, region, subset, or gene that is integrated into the host chromosome.
- the two or more copies that are integrated into the host chromosome are expressed from the same promoter or from different promoters.
- two or more copies of a region 2 gene selected from the group consisting of kfoA, kfo , kfoC, kfoF, kfoG, and a combination thereof are integrated into a host chromosome.
- two or more copies of kfoA, kfoB, kfoC, kfoF, and kfoG are integrated into a host chromosome.
- two or more copies of region 1, region 3, or one or more genes from region 1 or region 3 are integrated into a host chromosome.
- genes contained within a construct of the invention are integrated into the chromosome of a bacterial host cell that also contains one or more constructs of the invention comprising genes that are not integrated into the chromosome.
- strains of the present invention include, without limitation, E. coli K-12 strains MSC279, MSC280, MSC322, MSC323, MSC324, MSC325, MSC328, MSC346, MSC356, MSC359, MSC392, MSC402, MSC403, MSC404, MSC405, MSC410, MSC411, MSC436, MSC437, MSC438, MSC439, MSC458, MSC459, MSC460, MSC466, MSC467, MSC498, MSC499, MSC500, MSC510, MSC511, MSC522, MSC526, MSC537, MSC551, MSC561, MSC562, MSC563, MSC564, MSC566, MSC567, MSC619, MSC625, MSC627, MSC640, MSC641, MSC643, MSC646, MSC650, MSC656, MSC657, MSC658, MSC659, MSC660,
- the present invention is directed to a method for producing a chondroitin, comprising transferring any one or more of the constructs of the present invention to a non-pathogenic bacterial host cell, and culturing the bacterial host cell under fermentation conditions wherein the chondroitin is produced by the bacterial host cell.
- the present invention is directed to a method for producing a chondroitin, comprising culturing a non-pathogenic host cell comprising any one or more of the constructs of the present invention under fermentation conditions sufficient for production of chondroitin.
- the present invention includes a method for producing an unsulfated chondroitin.
- the method comprises culturing a non-pathogenic bacterial host cell of the invention under fermentation conditions sufficient for production of unsulfated chondroitin.
- the method comprises transferring the constructs of the present invention to a nonpathogenic bacterial host cell and culturing the bacterial host cell under fermentation conditions, which results in the production of unsulfated chondroitin by the bacterial host cell.
- Examples 6-9, 11, 13 and 14 present data demonstrating production of chondroitin when the constructs of the present invention are transformed into host cells and Examples 10-15 present data demonstrating production of chondroitin when the constructs of the present invention are integrated into the chromosome of the host cell.
- chondroitin that is fructosylated or non-fructosylated (see Examples 6 and 7). Furthermore, depending on the specific construct and the combination of genes therein, the recombinant chondroitin can be secreted into the culture medium or retained in an intracellular location (See Example 9).
- Methods of culturing bacterial cells and compositions of culture media are well known in the art and can be used in the present invention.
- various culture parameters such as temperature, pH, dissolved oxygen concentration, inducer concentration and duration of culture post-induction, as well as composition of the media including content of nutrients and salts therein should be optimized.
- Example 8 describes the recombinant production of chondroitin in a variety of growth media, temperatures and induction conditions. Based on this information, further optimization of such parameters will be readily apparent to one skilled in the art.
- the bacterial host cell is cultured at 20°C to 37°C, e.g., 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C or 37°C.
- the culture medium comprises yeast extract, a protein digest, a potassium phosphate, and water.
- the culture medium comprises glycerine (also known as glycerol).
- 1 g/L to 50 g/L, 5 g/L to 50 g/L or 15 g L to 50 g/L of the unsulfated chondroitin is secreted from the bacterial host cell in 24 to 72 hours.
- a method for producing a chondroitin of the invention further comprises recovering the chondroitin from the bacterial host cell.
- a method for producing a chondroitin of the invention further comprises recovering the chondroitin from extracellular culture medium.
- Chondroitin can be recovered from fermentation broth by alcohol precipitation or any technique known in the art, including without limitation, lyophilization to obtain dry powder.
- a method for producing a chondroitin can include the step of purifying the recovered chondroitin.
- Purification of chondroitin can be accomplished by any technique known in the art, including, for example, alkali treatment, acid treatment, proteinases treatment, chromatography, extraction, solvent extraction, membrane separation, electrodialysis, reverse osmosis, distillation, precipitation, chemical derivatization, crystallization, ultrafiltration, and/or precipitation of the polysaccharide using organic solvents. See, for example, Taniguchi, N., 1982. Isolation and analysis of glycosaminoglycans.
- the method for producing a chondroitin further comprises sulfating the chondroitin.
- the present invention is directed to a method for producing a chondroitin sulfate, comprising producing a chondroitin by a method of the present invention and sulfating the chondroitin.
- Sulfation can be done chemically or enzymatically.
- Several procedures are known in the art for chemical sulfation of polysaccharides, any one of which can be used here.
- sulfation can be accomplished by solubilization of the polysaccharide into an organic solvent followed by reacting with a sulfating agent under a controlled temperature.
- solubilization solvents can include, without limitation, formamide, N,N-dimethylformamide (DMF), pyridine, or dimethylsulfoxide.
- solubilization solvents can include, without limitation, formamide, N,N-dimethylformamide (DMF), pyridine, or dimethylsulfoxide.
- sulfating agents can include, without limitation, chlorosulfonic acid, sulfur trioxide, and various sulfur trioxide-amine complexes.
- amines suitable for the sulfur trioxide-amine complexes include, without limitation, pyridine, DMF, trimethylamine, triethylamine (TEA) and piperidine.
- the sulfated product upon sulfation of recombinant chondroitin, contains 5.0 to 7.5% of sulfur content which corresponds to that of natural chondroitin sulfate. In further embodiments, the sulfated product does not undergo significant depolymerization.
- Example 15 describes a method for chemical sulfation of recombinant chondroitin.
- sulfating a chondroitin produced by a method of the invention comprises mixing sulfurtrioxide-triethylamine complex or chlorosulfonic acid with the chondroitin in formamide.
- the present invention is directed to a recombinant chondroitin or a recombinant chondroitin sulfate produced by any of the methods described herein.
- the present invention is directed to a composition comprising a recombinant chondroitin or a recombinant chondroitin sulfate produced by any of the methods described herein.
- the composition can include a supplement such as glucosamine, glucosamine sulfate or glucosamine hydrochloride.
- Glucosamine (2-acetamido-2-deoxyglucose) is a naturally occurring compound that is found in cartilage.
- Glucosamine sulfate is a normal constituent of glycosaminoglycans in the cartilage matrix and synovial fluid.
- the present invention includes methods of maintaining healthy joint function in a subject.
- the present invention includes methods for treating or preventing osteoarthritis, interstitial cystitis and/or synovitis. These methods comprise administering to the subject the compositions comprising the recombinant chondroitin sulfate described above.
- the compositions of the present invention can be generally administered in therapeutically effective amounts.
- the present invention is directed to an antibody or antibody fragment that selectively binds to a protein encoded by a gene of the K4 chondroitin biosynfhetic gene cluster.
- These antibodies and antibody fragments can be used to confirm the expression of genes of the K4 chondroitin biosynfhetic gene cluster in the bacterial hosts.
- the antibody or antibody fragment binds to an amino acid sequence selected from the group consisting of SEQ ID NO:92 of KpsF, SEQ ID NO:93 of KpsE, SEQ ID NO:94 of KpsD, SEQ ID NO:95 of KpsU, SEQ ID NO:96 of KpsC, SEQ ID NO:97 of KpsS, SEQ ID NO:91 of KpsT, SEQ ID NO:83 of KfoA, SEQ ID NO:84 of KfoB, SEQ ID NO:85 of KfoC, SEQ ID NO:86 of Kfol (Orf3), SEQ ID NO:87 of KfoE, SEQ ID NO:88 of KfoH (Orfl), SEQ ID NO: 89 of KfoF, and SEQ ID NO:90 of KfoG.
- the generation of the antibodies is described in detail in Example 5.
- a microorganism having a genetic modification described herein is cultured in a fermentation medium to produce chondroitin.
- An appropriate, or effective, fermentation medium refers to any medium in which a genetically modified microorganism of the present invention, when cultured, is capable of producing chondroitin.
- a medium is typically an aqueous medium comprising assimilable carbon, nitrogen and phosphate sources.
- Such a medium can also include appropriate salts, minerals, metals and other nutrients. Exemplary media are described below and in the Examples section. It should be recognized, however, that a variety of fermentation conditions are suitable and can be selected by those skilled in the art.
- Sources of assimilable carbon which can be used in a suitable fermentation medium include, but are not limited to, sugars and their polymers, including dextrin, sucrose, maltose, lactose, glucose, fructose, mannose, sorbose, arabinose and xylose; fatty acids; organic acids such as acetate; primary alcohols such as ethanol and n-propanol; and polyalcohols such as glycerine.
- Carbon sources in the present invention include polyalcohols, monosaccharides, disaccharides, and trisaccharides. In some embodiments, the carbon source is glycerine.
- the concentration of a carbon source, such as glycerine, in the fermentation medium should promote cell growth, but not be so high as to repress growth of the microorganism used.
- a carbon source such as glycerine
- concentration of a carbon source, such as glycerine, in the fermentation medium is greater than 1 g/L, greater than 2 g/L, or greater than 5 g/L.
- the concentration of a carbon source, such as glycerine, in the fermentation medium is typically less than 100 g/L, less than 50 g/L, or less than 20 g/L. It should be noted that references to fermentation component concentrations can refer to both initial and/or ongoing component concentrations, hi some cases, it can be desirable to allow the fermentation medium to become depleted of a carbon source during fermentation.
- Sources of assimilable nitrogen which can be used in a suitable fermentation medium include, but are not limited to, simple nitrogen sources, organic nitrogen sources and complex nitrogen sources. Such nitrogen sources include anhydrous ammonia, ammonium salts and substances of animal, vegetable and/or microbial origin. Suitable nitrogen sources include, but are not limited to, protein hydrolysates, microbial biomass hydrolysates, peptone, yeast extract, ammonium sulfate, ammonium hydroxide, urea, and amino acids. Typically, the concentration of the nitrogen sources in the fermentation medium is greater than 0.1 g/L, greater than 0.25 g/L, or greater than 1.0 g/L.
- the addition of a nitrogen source to the fermentation medium is not advantageous for the growth of the microorganisms.
- the concentration of the nitrogen sources in the fermentation medium is less than 20 g/L, less than 10 g/L, or less than 5 g/L. Further, in some instances it can be desirable to allow the fermentation medium to become depleted of the nitrogen sources during fermentation.
- the effective fermentation medium can contain other compounds such as defoamers, inorganic salts, vitamins, trace metals and/or growth promoters. Such other compounds can also be present in carbon, nitrogen or mineral sources in the effective medium or can be added specifically to the medium.
- the fermentation medium can also contain a suitable phosphate source. Such phosphate sources include both inorganic and organic phosphate sources. Phosphate sources include, but are not limited to, phosphate salts such as mono or dibasic sodium and potassium phosphates, ammonium phosphate and mixtures thereof. Typically, the concentration of phosphate in the fermentation medium is greater than 1.0 g/L, greater than 2.0 g/L, or greater than 5.0 g/L.
- the concentration of phosphate in the fermentation medium is typically less than 20 g/L, less than 15 g/L, or less than 10 g/L.
- a suitable fermentation medium can also include a source of magnesium.
- the source of magnesium is in the form of a physiologically acceptable salt, such as magnesium sulfate heptahydrate, although other magnesium sources in concentrations which contribute similar amounts of magnesium can be used.
- the concentration of magnesium in the fermentation medium is greater than 0.5 g/L, greater than 1.0 g/L, or greater than 2.0 g/L. Beyond certain concentrations, however, the addition of magnesium to the fermentation medium is not advantageous for the growth of the microorganisms. Accordingly, the concentration of magnesium in the fermentation medium is typically less than 10 g/L, less than 5 g/L, or less than 3 g/L. Further, in some instances it can be desirable to allow the fermentation medium to become depleted of a magnesium source during fermentation.
- the fermentation medium can also include a biologically acceptable chelating agent, such as the dihydrate of trisodium citrate or citric acid.
- a biologically acceptable chelating agent such as the dihydrate of trisodium citrate or citric acid.
- concentration of a chelating agent in the fermentation medium is greater than 0.1 g/L, greater than 0.2 g/L, greater than 0.5 g/L, or greater than 1 g/L. Beyond certain concentrations, however, the addition of a chelating agent to the fermentation medium is not advantageous for the growth of the microorganisms. Accordingly, the concentration of a chelating agent in the fermentation medium is typically less than 10 g/L, less than 5 g/L, or less than 2 g/L.
- the fermentation medium can also initially include a biologically acceptable acid or base to maintain the desired pH of the fermentation medium.
- Biologically acceptable acids include, but are not limited to, hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid and mixtures thereof.
- Biologically acceptable bases include, but are not limited to, anhydrous ammonia, ammonium hydroxide, sodium hydroxide, potassium hydroxide and mixtures thereof. In some embodiments of the present invention, the base used is ammonium hydroxide.
- the fermentation medium can also include a biologically acceptable calcium source, including, but not limited to, calcium chloride.
- a biologically acceptable calcium source including, but not limited to, calcium chloride.
- the concentration of the calcium source, such as calcium chloride, dihydrate, in the fermentation medium is within the range of from 5 mg/L to 2000 mg/L, 20 mg/L to 1000 mg/L, or 50 mg/L to 500 mg/L.
- the fermentation medium can also include sodium chloride.
- the concentration of sodium chloride in the fermentation medium is within the range of from 0.1 g/L to 5 g L, 1 g/L to 4 g/L, or 2 g/L to 4 g/L.
- the fermentation medium can also include trace metals.
- trace metals can be added to the fermentation medium as a stock solution that, for convenience, can be prepared separately from the rest of the fermentation medium.
- a suitable trace metals stock solution for use in the fermentation medium is shown below in Tables 1A and IB.
- the amount of such a trace metals solution added to the fermentation medium is greater than 1 mL/L, greater than 5 mL/L, or greater than 10 rriL/L. Beyond certain concentrations, however, the addition of a trace metals to the fermentation medium is not advantageous for the growth of the microorganisms.
- the amount of such a trace metals solution added to the fermentation medium is typically less than 100 mL/L, less than 50 mL/L, or less than 30 mL/L. It should be noted that, in addition to adding trace metals in a stock solution, the individual components can be added separately, each within ranges corresponding independently to the amounts of the components dictated by the above ranges of the trace metals solution.
- a suitable trace metals solution for use in the present invention can include, but is not limited to ferrous sulfate, heptahydrate; cupric sulfate, pentahydrate; zinc sulfate, heptahydrate; sodium molybdate, dihydrate; cobaltous chloride, hexahydrate; and manganous sulfate, monohydrate.
- Hydrochloric acid is added to the stock solution to keep the trace metal salts in solution.
- IB can include, but is not limited to, ferric chloride, hexahydrate; zinc chloride; cobalt chloride, hexahydrate; sodium molybdate; manganese chloride; boric acid; and citric acid as a chelating agent.
- the fermentation medium can also include vitamins.
- vitamins can be added to the fermentation medium as a stock solution that, for convenience, can be prepared separately from the rest of the fermentation medium.
- a suitable vitamin stock solution for use in the fermentation medium is shown below in Table 2.
- the amount of such vitamin solution added to the fermentation medium is greater than 1 ml/L, greater than 5 ml/L, or greater than 10 ml/L. Beyond certain concentrations, however, the addition of vitamins to the fermentation medium is not advantageous for the growth of the microorganisms. Accordingly, the amount of such a vitamin solution added to the fermentation medium is typically less than 50 ml/L, less than 30 ml/L, or less than 20 ml/L. It should be noted that, in addition to adding vitamins in a stock solution, the individual components can be added separately, each within the ranges corresponding independently to the amounts of the components dictated by the above ranges of the vitamin stock solution.
- a suitable vitamin solution for use in the present invention can include, but is not limited to, biotirs, calcium pantothenate, inositol, pyridoxirse-HCI and thiamine-HCl.
- Microorganisms of the present invention can be cultured in conventional fermentation modes, which include, but are not limited to, batch, fed-batch, cell recycle, and continuous.
- the fermentation is carried out in fed-batch mode.
- some of the components of the medium are depleted. It is possible to initiate the fermentation with relatively high concentrations of such components so that growth is supported for a period of time before additions are required.
- the preferred ranges of these components are maintained throughout the fermentation by making additions as levels are depleted by fermentation.
- Levels of components in the. fermentation medium can be monitored by, for example, sampling the fermentation medium periodically and assaying for concentrations.
- additions can be made at timed intervals corresponding to known levels at particular times throughout the fermentation.
- rate of consumption of nutrient increases during fermentation, as the cell density of the medium increases.
- addition is performed using aseptic addition methods, as are known in the art.
- a small amount of anti-foaming agent can be added during the fermentation.
- the temperature of the fermentation medium can be any temperature suitable for growth and production of chondroitin.
- the fermentation medium prior to inoculation of the fermentation medium with an inoculum, can be brought to and maintained at a temperature in the range of from 20°C to 45°C, 25°C to 40°C, or 28°C to 32°C.
- the pH of the fermentation medium can be controlled by the addition of acid or base to the fermentation medium. In such cases when ammonia is used to control pH, it also conveniently serves as a nitrogen source in the fermentation medium. In some embodiments, the pH is maintained from 3.0 to 8.0, 5.5 to 7.5, or 6.0 to 7.
- the fermentation medium can also be maintained to have a constant dissolved oxygen content during the course of fermentation to maintain cell growth and to maintain cell metabolism for production of chondroitin.
- the oxygen concentration of the fermentation medium can be monitored using known methods, such as through the use of an oxygen electrode.
- Oxygen can be added to the fermentation medium using methods known in the art, for example, through agitation and aeration of the medium by stirring, shaking or sparging.
- the oxygen concentration in the fermentation medium is in the range of from 10% to 200% of the saturation value of oxygen in the medium based upon the solubility of oxygen in the fermentation medium at atmospheric pressure and at a temperature in the range of from 20°C to 40°C. Periodic drops in the oxygen concentration below this range can occur during fermentation, however, without adversely affecting the fermentation.
- aeration of the medium has been described herein in relation to the use of air, other sources of oxygen can be used. Particularly useful is the use of an aerating gas which contains a volume fraction of oxygen greater than the volume fraction of oxygen in ambient air. In addition, such aerating gases can include other gases which do not negatively affect the fermentation.
- a fermentation medium is prepared as described above.
- This fermentation medium is inoculated with an actively growing culture of genetically modified microorganisms of the present invention in an amount sufficient to produce, after a reasonable growth period, a high cell density.
- Typical inoculation cell densities are within the range of from 0.001 g/L to 10 g/L, 0.01 g/L to 5 g/L, or 0.05 g/L to 1.0 g/L, based on the dry weight of the cells. In production scale fermentors, however, greater inoculum cell densities are preferred.
- the cells are then grown to a cell density in the range of from 10 g/L to 150 g/L, 20 g/L to 80 g/L, or 50 g/L to 70 g/L.
- the residence times for the microorganisms to reach the desired cell densities during fermentation are typically less than 200 hours, less than 120 hours, or less than 96 hours.
- the carbon source concentration, such as the glycerine concentration, of the fermentation medium is monitored during fermentation.
- Glycerine concentration of the fermentation medium can be monitored using known techniques, such as, for example, use of the high pressure liquid chromatography, which can be used to monitor glycerine concentration in the supernatant, e.g., a cell-free component of the fermentation medium.
- the carbon source concentration should be kept below the level at which cell growth inhibition occurs. Although such concentration can vary from organism to organism, for glycerine as a carbon source, cell growth inhibition occurs at glycerine concentrations greater than at about 60 g/L, and can be determined readily by trial.
- the glycerine when used as a carbon source the glycerine is preferably fed to the fermentor and maintained below detection limits.
- the glycerine concentration in the fermentation medium is maintained in the range of from 1 g/L to 100 g/L, 2 g/L to 50 g/L, or 5 g/L to 20 g/L.
- the carbon source concentration can be maintained within desired levels by addition of, for example, a substantially pure glycerine solution, it is acceptable to maintain the carbon source concentration of the fermentation medium by addition of aliquots of the original fermentation medium.
- the use of aliquots of the original fermentation medium can be desirable because the concentrations of other nutrients in the medium (e.g. the nitrogen and phosphate sources) can be maintained simultaneously.
- the trace metals concentrations can be maintained in the fermentation medium by addition of aliquots of the trace metals solution.
- chondroitin can be present in a cell-free form in culture media ("secreted chondroitin") and/or associated with the cells. Chondroitin that is associated with the cells can be associated with the cell surface (“cell-surface chondroitin”) and/or retained within the cell (“intracellular chondroitin”).
- chondroitin With respect to "secreted chondroitin,” the recovery of chondroitin can be accomplished by cell removal followed by alcohol precipitation of the cell-free culture media, or any technique known in the art, including without limitation, lyophilization of the cell-free culture media to obtain dry powder.
- the recovery of chondroitin can additionally include a step of detaching the chondroitin from the cell surface followed by a cell removal step that removes the cells from the culture media that contains the free chondroitin.
- the recovery can additionally include a step of permeabilizing or lysing the cells, followed by a step that accomplishes removal of the lysed or permeabilized cells from the culture media that now contains the liberated chondroitin.
- Chondroitin can be recovered from the culture media by alcohol precipitation of the culture media, or any technique known in the art, including without limitation, lyophilization of the culture media to obtain dry powder.
- the recovered chondroitin polymer can be depolymerized to reduce the molecular weight of the polymer.
- Depolymerization of a chondroitin can be accomplished by any technique known in the art, including without limitation, acidic depolymerization. See, for example, Tommeraas and Melander, Biomacromolecules 2008;9:1535-1540.
- a recovered chondroitin can be depolymenzed, for example, to produce a chondroitin with a similar or identical molecular weight to an animal-derived chondroitin and/or to aid in sulfation of a recovered non-sulfated chondroitin.
- a recovered chondroitin can be depolymerized to obtain a polymer with a molecular weight of 5 kDa to 100 kDa, preferably, 10 kDa to 70 kDa, more preferably, 20 kDa to 40 kDa.
- gene refers to a nucleic acid fragment (or polynucleotide) that is capable of being expressed as a specific protein, optionally including regulatory sequences preceding (5' non-coding sequences) and following (3 1 noncoding sequences) the coding sequence.
- Native gene refers to a gene that is found in nature with its own regulatory sequences.
- Endogenous gene refers to a native gene in its natural location in the genome of an organism.
- coding sequence refers to a DNA sequence that codes for a specific amino acid sequence.
- Suitable regulatory sequences refer to nucleotide sequences located upstream (5' non- coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences can include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites and stem-loop structures.
- promoter refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA.
- a coding sequence is located 3' to a promoter sequence. Promoters can be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters can direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as "constitutive promoters". It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths can have identical promoter activity.
- expression refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid fragment of the invention. Expression can also refer to translation of mRNA into a polypeptide.
- transformation refers to the transfer of a nucleic acid fragment into a host organism, resulting in genetically stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as “transgenic” or “recombinant” or “transformed” organisms.
- construct refers to an extra chromosomal element often carrying genes which are not part of the central metabolism of the cell, and usually in the form of circular, or linear, double stranded DNA fragments.
- Such elements can be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3' untranslated sequence into a cell.
- cognate degeneracy refers to the nature in the genetic code permitting variation of the nucleotide sequence without variation in the amino acid sequence of an encoded polypeptide.
- the skilled artisan is well aware of the "codon-bias" exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid. Therefore, when synthesizing a gene for improved expression in a host cell, it is desirable to design the gene such that its frequency of codon usage approaches the frequency of preferred codon usage of the host cell.
- codon-optimized refers to genes or coding regions of nucleic acid molecules for transformation of various hosts, refers to the alteration of codons in the gene or coding regions of the nucleic acid molecules to reflect the typical codon usage of the host organism without altering the polypeptide encoded by the DNA.
- operably linked refers to the association of nucleic acid sequences on a single nucleic add fragment so that the function of one is affected by the other.
- a promoter is operably linked with a coding sequence when it is capable of effecting the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter).
- Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation.
- the E. coli K4 capsule is categorized as a "group 2" capsule. As reviewed by Whitfield
- E. coli group 2 capsules is directed by a set of proteins encoded by gene clusters having a common genetic organization consisting of three regions.
- the predicted structure ⁇ prior to the current invention) of the E. coli K4 capsule gene cluster is shown in the Figure 2.
- Region 1 was expected to contain six genes, ApsFEDUCS, and region 3 was expected to contain two genes, kpsM and kps .
- kpsF and kpsXJ genes were predicted to encode proteins that catalyze steps in the biosynthesis of the sugar nucleotide CMP-Kdo.
- coli has been proposed (Roberts, Annu. Rev. Microbiol. 1996; 50:285-315) but has not been demonstrated experimentally (Whitfield, Annu Rev Biochem. 2006; 75:39-68).
- the kpsM, kpsT, kps , kpsE, kpsC and kpsS genes were posited to encode proteins required for translocation of the capsular polysaccharide from the cell cytoplasm, where polymerization of sugar precursors occurs, to the cell surface where the mature capsular polysaccharide is believed to be anchored to the outer cell membrane through a covalent linkage to a lipid component of that membrane (Roberts, Annu. Rev. Microbiol. 1996;50:285-315; Whitfield, Annu Rev Biochem.
- the region 1 and region 3 genes, and the proteins that they encode, are highly conserved among
- E. coli strains that produce capsules having very diverse polysaccharide compositions and structures (Whitfield, Annu Rev Biochem. 2006;75:39-68).
- the genes contained in region 2 of group 2 capsule clusters in E. coli include genes that encode enzymes for sugar nucleotide precursor biosynthesis and for polymerization of these precursors, and region 2 thereby determines the structure of the capsular polysaccharide.
- Other genes in region 2 of group 2 capsule clusters in E. coli encode proteins for which functions are unknown and have not been demonstrated to have a role in capsule biosynthesis.
- the sequence of region 2 of the E. coli K4 capsule gene cluster as described by Ninomiya et al. J Biol. Chem. 2002;277:21567-21575, GenBank AB079602 contains 7 annotated open reading frames (kfoABCDEFG) predicted to encode proteins.
- An insertion element, IS2 is located between genes kfoC and kfoD.
- ORF3 390 bp ORF, termed "ORF3", which initiates 10 nucleotides after the stop codon of kfoD and terminates within the coding region of kfoE. That is, the putative orfl gene overlaps the kfoE gene by 10 nucleotides.
- This ORF is initiated by an ATG and a second possible ATG start is located, in frame, 9 bp downstream. Both of these possible starts lack a recognizable Shine-Dalgarno (SD) sequence (Shine and Dalgarno Proc. Natl. Acad. Sci. U S A 1974;71 : 1342-6).
- SD Shine-Dalgarno
- multocida sequences come from a serotype B strain (Ml 404) and a serotype E strain (PI 234), respectively. Composition of the serotype E capsule is unknown while the serotype B capsule is reported to be composed of mannose, galactose and arabinose but no structure has been reported (Towttsend et al., J, Clin. Microbiol. 2001;39:924- 929).
- ORF1 a 630 bp ORF termed "ORF1" is present as shown in Figure
- ORF2 a 384 bp ORF, termed "ORF2" is present.
- the ATG start codon of this ORF is preceded by a GG sequence 15 bp upstream, which could provide a weak SD sequence. No significant hits were found in BLAST searches with this protein sequence. This suggested that this ORF may not encode a polypeptide that is actually produced.
- K4 capsule cluster genes from region 2 ⁇ kfoD and kfoE have homology to P. multocida genes located in the P. multocida PI 234 and P. multocida M1404 capsule gene clusters.
- the protein encoded by kfoO shares homology with EcbD and BcbD and similarly the kfoE gene product shares homology with EcbG and BcbG.
- the four contiguous K4 genes (kfoD, orfh, kfoE, and orfl) have homologs among the contiguous P. multocida serotype B genes bcbDEFG and the P.
- multocida serotype E genes ecbOEFG multocida serotype E genes ecbOEFG.
- these two Pasteurella strains are not chondroitin producers and the role, if any, which the K4 genes kfoD, orfh, kfoE, and orfl play in chondroitin biosynthesis was unknown prior to this invention.
- IS2 raises numerous possibilities regarding their origin and role in chondroitin capsule synthesis.
- the present inventors contemplate that the K4 region 2 gene cluster has arisen via IS2-mediated recombination / insertion into a parental, chondroitin- producing, cluster comprised of kfoABCFG.
- the present inventors hypothesized that the kfoD, orfh, kfoE and orfl genes might be involved in the fructosylation of the chondroitin backbone.
- the fructosylation is the one obvious structural difference between the P. multocida serotype F capsule and the E coli K4 capsule. It is possible that the significant difference in genetic structure between the two, i.e.
- the presence or absence of the kfoD, orfh, kfoE, orfl gene set is a reflection of that structural difference.
- the capsule biosynthetic gene cluster of the P. multocida chondroitin-producing serotype F strain P4182 (Townsend et al, J Clin. Microbiol. 2001;39:924-929), it may be possible that the only relevant K4 region 2 genes for production of the chondroitin backbone might be kfoA, kfoB, kfoC, kfoE and kfoG.
- the present inventors confirmed that the kfoO, orfl, kfoE and orfl genes are not required for production of chondroitin and that one or more of these genes is essential for fructosylation of chondroitin.
- the present inventors sequenced region 2 of the K4 capsule gene cluster from the E. coli K4 strain ATCC 23502 obtained from ATCC.
- Genomic DNA was prepared from a fresh overnight culture of ATCC strain 23502 using the Qiagen Genomic DNA Kit (Qiagen Inc., Valencia, CA) according to the vendor protocol. Aliquots of genomic DNA, sheared by passage (five times) through a 20 gauge needle were used as template in PCR reactions to produce a series of 6 overlapping PCR products ranging in size from 2.2 kB to 2.7 kB.
- E. coli serotype K4 strain Ul-41 was obtained from the Statens Serum Institut (Copenhagen, Denmark). Ul-41 is the progenitor of the ATCC 23502 strain and was used to produce the polysaccharide preparation used for structural determination of the K4 polysaccharide (Rodriguez et al, 1988). The sequence of approximately 23 kb of DNA spanning regions 1, 2 and 3 of the K4 capsule gene cluster in E. coli Ul-41 was determined.
- This sequence (SEQ ID NO: 117) consists of 23,230 base pairs spanning a region from 125 bp upstream of the ATG translational start codon of the kps ⁇ F gene of region 1 to 110 bp upstream of the ATG translational start codon of the kpsM gene of region 3.
- genomic DNA was prepared from a fresh overnight culture of E. coli Ul-41 using the Qiagen Genomic DNA Kit (Qiagen Inc., Valencia, CA) according to the vendor protocol. Aliquots of genomic DNA, sheared by passage (five times) through a 20 gauge needle was used as template in PCR reactions to produce a series of 1 1 overlapping PCR products ranging in size from 2.1 kB to 2.8 kB.
- Reactions 1 through 11 employed the following oligonucleotide primers: Reaction 1; (DHD089 and DHD090), Reaction 2; (DHD091 and DHD092), Reaction 3; (DHD093 and DHD175), Reaction 4; (DHD120 and DHD096), Reaction 5; (DHD097 and DHD098), Reaction 6; (DHD099 and DHD100), Reaction 7; (DHD101 and DHD102), Reaction 8; (DHD103 and DHD104), Reaction 9; (DHD105 and DHD106), Reaction 10; (DHD162 and DHD108), Reaction 11; (DHD169 and DHD110). Sequences of these primers are shown below. DHD089 5> GCACCTCCATGAGACATTGC >3 (SEQ ID NO:118)
- PCR reactions were performed in a Perkin-Elmer GeneAmp 2400 thermocyler using the following cycling parameters: 1 cycle of 2 minutes at 95°C; 35 cycles of 20 seconds at 95°C, 20 seconds at 55°C, and 40 seconds at 72°C; 1 cycle of 3 minutes at 72°C; and a hold at 4°C.
- PCR Reactions 4, 5 and 6 were performed as above with the following exceptions.
- the primers were added to a final concentration of 0.5 ⁇ each and the annealing step was at 60°C instead of 55°C.
- primers were added to a final concentration of 0.5 ⁇ each and PCR reactions were performed in a RoboCycler® Gradient 96 thermocycler (STRATAGENE, LaJolla, CA) using the following cycling parameters: 1 cycle of 1 minute at 95°C; 35 cycles of 30 seconds at 95°C, 30 seconds at 52°C, and 1 minute at 72°C; 1 cycle of 5 minutes at 72°C; and a hold at 6°C.
- the purified PCR products of reactions 1 - 1 1 were sent to a commercial vendor (Cornell University Life Sciences Core Laboratories Center, Cornell University, Ithaca, New York) for DNA sequence determination.
- the sequences obtained from these 11 overlapping PCR products spanned the region 2 sequence as determined by Ninomiya et al. (2002) and included all of the region 1 and region 3 genes as well.
- the sequence of the K4 capsule gene cluster from Ul-41 demonstrates the presence of kps ⁇ , kpsE, kpsO, kpsXJ, kpsC and kpsS genes in region 1 as is typical for group 2 capsule gene clusters in E. coli.
- the predicted amino acid sequences of Ul-41 KpsF, KpsE, KpsD, KpsU, KpsC and KpsS proteins are homologous to the sequences of these proteins encoded by other E. coli group 2 capsule producers. They all show >95% identity to the consensus sequences for these proteins and to the E.
- the Ul-41 DNA sequence includes an approximately 13.5 kb region 2 segment that can be aligned to the Ninomiya et al. region 2 sequence and to the sequence determined by the present inventors for region 2 of ATCC 23502.
- the Ul-41 sequence and the sequence determined by the present inventors for region 2 of ATCC 23502 are identical over this span.
- Nine open reading frames (ORFs) predicted to be expressed as polypeptides are present in the identified region 2, exclusive of the IS2 sequence. These nine include the two ORFs, detailed above, that were not previously identified.
- the genes encoding these ORFs were initially termed here orfi and or/3 and are now proposed to be designated as kfoR and kfol, respectively.
- Figure 5 shows the arrangement of the K4 capsule gene cluster as determined by the present inventors from the DNA sequences of ATCC 23502 and Ul-41. Orfl mentioned above was not found to exist as a separate open reading frame in the sequence of region 2 as determined by the present inventors.
- the sequences comprising orfl are a portion of the coding sequence of kfoG. Frameshifts within the sequence published by Ninomiya et al. split the kfoG sequence into two smaller open reading frames; the kfoG gene as annotated by Ninomiya et al. and the orfl sequence as annotated by the present inventors.
- orfl was an artifact of the erroneous sequence published by Ninomiya et al.
- the gene cluster contains 17 open reading frames that are predicted to encode proteins.
- the arrangement of these genes is typical for an E. coli group 2 capsule gene cluster (Whitfield 2006).
- Region 1 comprising conserved genes AjwFEDUCS, and region 3, comprising conserved genes kpsMT, flank the 9 open reading frames (and IS2) of region 2.
- Region 1 and region 3 genes include proteins that are required for synthesis and translocation of all group 2 capsules in E. coli.
- Region 1 also includes two genes (kpsF and kpsO) that encode enzymes that are predicted to catalyze steps in the biosynthesis of CMP-Kdo. As noted above, a role of CMP-Kdo in biosynthesis of group 2 capsules in E.
- region 2 genes typically include those that encode serotype-specific proteins that determine the structure of the capsular polysaccharide.
- region 2 genes typically include those that encode serotype-specific proteins that determine the structure of the capsular polysaccharide.
- three encode proteins with clearly defined activities relating to capsule biosynthesis kfoC (chondroitin synthase, i.e., the polymerase), kfoA (UDPGlcNAc epimerase, converts UDPGlcNAc to the UDPGalNAc precursor) and kfo ⁇ (UDPGlc-dehydrogenase, converts UDPGlc to the UDPGlcUA precursor).
- kfoB encodes a protein that is homologous to proteins encoded by genes present in capsule clusters of bacteria known to produce other glycosaminoglycan (GAG) capsules, P. multocida serotypes A, F and D and E. coli serotype K5.
- GAG glycosaminoglycan
- the KfoG protein also has homology to proteins encoded by genes present in the capsule clusters of P. multocida serotypes A, F and D. This circumstantial evidence suggests that kfoB and kfoG can play a role in the biosynthesis of the GAG-containing K4 capsule.
- the insertion element IS2 is present between genes kfoC and kfoD in U 1-41 as well as in
- the sequence of the Ul-41 K4 capsule gene cluster as determined by the present inventors was used as the basis for the design of synthetic genes to be used for expression in alternative hosts.
- Synthetic constructs were designed to allow the expression of one or more synthetic operons containing the K4 capsule biosynthetic genes and were optimized for codon usage based on a consensus preferred codon table that employs codons that are acceptable for expression in E. coli, X. campestris, S. elodea and B. subtilis.
- Table 3A gives codon usage tables for E. coli, X. campestris and B. subtilis genomes as well as for E. coli K4 region 2 genes related to K4P capsule biosynthesis, and 53 S.
- elodea genes including those related to gellan biosynthesis.
- This table illustrates the striking use of unfavorable codons in the K4 region 2 biosynthetic genes. These codons are not only extremely unfavorable for X, campestris or S. elodea expression but are also unfavorable for expression in E. coli. For optimal expression in E. coli, it would be expected that significant codon optimization would be necessary. Based on comparison of these codon usage tables, a consensus preferred codon usage table was designed, shown in Table 3B for the synthetic chondroitin biosynthetic genes. This codon usage pattern is expected to provide efficient translation in a wide variety of potential alternative hosts.
- Codon usages were calculated from the genome of B. subtilis strain 168, X. campestris pv. campestris ATCC33913, E. coli K-12 W3110 and Sphingomonas elodea 53 CDSs containing 20,972 codons.
- the codon usage shown below in Table 3B is the consensus codon usage table used in the design of the synthetic genes and the final codon usage of the synthetic gene set as constructed below.
- the actual usage in the synthetic genes reflects design considerations such as DNA and mRNA secondary structure, inclusion and exclusion of restriction sites, and overall GC content.
- a synthetic gene set was constructed as three segments, ApsFEDUCS (the "FS segment"), kpsMTkfoABCFG (the "MG segment”) and kfoOJER (the "DH segment”).
- Figure 6 diagrammatically presents the structure of these three synthetic segments. Unique restriction sites, shown in Figure 6 were incorporated at strategic locations to allow assembly of the synthetic fragments into one or more operons which can be inserted into plasmid expression vectors. The initial strategy was to assemble the genes as a single operon for expression experiments. Other restriction sites also were strategically located throughout the synthetic sequences in positions that allow construction of non-polar deletions for any given gene(s).
- a consensus strong ribosome binding site (AGGAGGttaataaATG, SEQ ID NO:46) was employed for most of the synthetic genes; all except for kpsC, kpsT, kfoE, and kfoH.
- the translational start sites of these genes are coupled to the translational stops of the genes immediately upstream and as a result the ribosome binding sites overlap coding sequences of those upstream genes.
- the synthetic sequences comprising FS, MG and DH segments as defined above were synthesized as three separate fragments by a commercial vendor, DNA2.0 (Menlo Park, CA).
- the nucleotide sequences of the three synthetic segments are listed as: FS segment (SEQ ID NO:47), MG segment (SEQ ID NO:48) and DH segment (SEQ TD NO:49).
- the initial alternate hosts chosen for expression of the K4 biosynthetic genes included E. coli K-12 ("K-12”), E. coli. B (“EcB”), Sphingomonas elodea (“Sph”), and Xanthomonas campestris pv. campestris (“Xcc”).
- K-12 strains W3110 and MG1655 were obtained from the Coli Genetic Stock Center, Yale University.
- Sph strain ATCC 31461 was obtained from ATCC.
- Xcc strain NRRL B-1459 was obtained from the ARS Culture Collection (NCUAR), Peoria, IL.
- E. coli B (ATCC 11303) was obtained from ATCC.
- E. coli strain SI 7-1 (Simon et al, BioTechnology 1983; 1 :784- 791) can be used. This strain has a chromosomally integrated form of plasmid RP4 and will directly mobilize appropriate plasmids to new hosts. This strain is streptomycin resistant, however, so streptomycin cannot be used to select against this strain among the exconjugants.
- the second step recombination occurred in the opposite flanking region removing (popping-out; "resolving") the cloning vector (plus marker) and the targeted chromosomal region, but leaving the designed deletion.
- Such strains were obtained by multi-generational growth in the absence of marker selection, followed by screening for loss of the marker and the desired phenotype (determined by colony morphology and/or PCR).
- the desired deletion is typically built in a "suicide" vector that can be conjugally transferred to, but cannot replicate in, the target (non-ii. coli) host strain.
- plasmid pMA 705 (Hamilton et al, J Bacteriol. 1989; 171 (9) :4617-4622) was used.
- This plasmid contained a temperature-sensitive pSClOl replicon so that production of the first step integration and loss of plasmid sequences in the second ("resolution") step were facilitated at high temperature.
- the gene structure of " extracellular polysaccharide (EPS) minus" mutants was confirmed by PCR and Southern blot analysis.
- Upstream and downstream regions of homology were derived by PCR using the appropriate genomic DNA as templates. Restriction sites were designed into the PCR primers such that the resulting DNA fragments could be cloned into the desired plasmid, or, as for the Xcc gum gene described below, restriction sites occurring naturally in the genome were used.
- the deletions (and the restriction sites used for cloning) were designed such that in-frame fusions were created between short regions of the N-terminal and C-terminal coding regions of the target gene(s). In effect, the targeted coding regions were replaced with a restriction enzyme recognition sequence.
- the engineered restriction site sequences between the upstream and downstream fragments added 2-3 non-native codons to the fused coding regions. This procedure yielded well-defined mutations with the expectation of little/no polar effects on the expression of downstream genes.
- E. coli K-12 E. coli K-12
- Colanic acid is an extracellular polysaccharide produced by many enteric bacteria (Grant, W.D., et al, J Bacteriol.1969;100: 1187-1193), and greater production is typically found at lower growth temperatures (Stout, V., J. Bacteriol. 1996; 178:4273-4280).
- the creation of E. coli K-12 strains defective in the colanic acid biosynthesis is described in this Example. Such strains do not produce interfering or contaminating colanic acid when they are further engineered for the production of recombinant chondroitin which can be carried out at 30°C or lower.
- Plasmid pMAK705 Hamilton, CM., et al, J.
- Bacteriol. 1989; 171 :4617-4622) was used to create precise deletions in the chromosomal colanic acid biosynthetic gene cluster.
- This plasmid contains a temperature sensitive replicon and cannot exist in an extra-chromosomal state at higher temperatures.
- the steps for creating precise mutations at a target locus result from a "pop-in / pop-out" mechanism and are described by Hamilton et al. (supra).
- Plasmid clones containing the designed mutations are driven into the chromosome ("pop-in"), typically via homologous recombination at the target locus, by growth of transformants at the non-permissive temperature and selection for plasmid-encoded antibiotic (chloramphenicol; Cm) resistance. Subsequent multi-generational growth of these integrants in the absence of chloramphenicol results in a sub-population of cells in which the plasmid has recombined out of the chromosome and been lost from the cell during cell division leaving behind either the original wild type structure or the mutant structure. These "pop-outs" are identified by Cm sensitivity. A strain with the desired mutant structure is then identified by phenotype (if possible) and by PCR or Southern blotting.
- Cm plasmid-encoded antibiotic
- the colanic acid biosynthetic operon in E. coli K-12 consists of 19 or 20 contiguous genes covering about 24 kb (Stevenson, G., et al, J Bacteriol 1996; 178:4885-4893).
- the twentieth gene, wcaM appears to be part of the operon/transcription unit but is not required for colanic acid production. Contained therein is the wcaJ gene encoding the glycosyltransferase enzyme responsible for loading of the first sugar onto a lipid carrier during colanic acid biosynthesis.
- This Example describes the creation of E. coli K-12 strains containing deletions of either the entire 20-gene operon or just the wcaJ gene.
- the sequence of the genome of E. coli K- 12 strain W3110 is published as GenBank AP009048 (Blattner, F.R., et al, Science 1997;277: 1453-1462).
- PCR primers were designed to amplify approximately 950 bp upstream of the first gene (wza) and downstream of the last gene (wcaM) of the W3110 colanic acid operon. These fragments provided homology to the desired recombination sites in the chromosome.
- the PCR primers were designed to result in non-native restriction sites at the ends of the amplified PCR products to be used in subsequent cloning.
- the upstream region was amplified with primers CAX129 (HmdIII site underlined) and CAX128 (Ascl site underlined).
- the downstream region was amplified with primers CAX130 (Ascl site underlined) and CAX131 (Xbal site underlined).
- the template consisted of 100 ng of E. coli K-12 W3110 genomic DNA.
- the PCR fragments were cloned into pCR-Blunt II-TOPO (Invitrogen) and transformed into E. coli TOP 10 (Invitrogen), and the sequences of selected cloned inserts were confirmed to match published data.
- An upstream clone was digested with HmdIII plus Ascl, and a downstream clone was digested with Xbal plus Ascl.
- the desired fragments were gel-purified (Gene Clean Turbo, Q-BIOgene) and ligated with pMAK705 that had been digested with Htwdffl plus Xbal followed by treatment with Antarctic phosphatase (New England Biolabs).
- Cm-resistant (LB Cm 34 ⁇ g/mL, 30°C) transformants of E. coli DH5a (Invitrogen) were analyzed for plasmid structure, and one with the desired structure was named pMAK-CL.
- Plasmid pMAK-CL was transformed into E. coli W3110 by electroporation with selection for Cm resistance by plating on LB (Maniatis, 1989) agar plates containing Cm at 17 ⁇ g/mL at 30°C (permissive temperature). Several transform colonies were streaked to M9 (Maniatis, 1989) Cm 17 ⁇ ⁇ ⁇ agar plates and incubated at 43°C (non-permissive temperature). After two days, multiple colonies (presumptive integrants) were present, and these were re-streaked to M9 Cm at 43 °C for confirmation.
- a small amount of a colony was suspended in 10 ⁇ of sterile de-ionized water in a tube compatible with PCR. To this was added 20 ⁇ ⁇ of a 1.5-fold concentrated mix of "Taq Master” (Eppendorf) components such that the final concentrations/amounts in the reaction were: IX Taq polymerase buffer, IX "Taq Master” reagent, 0.33 mM each dNTP, 0.4 ⁇ each primer, and 0.5 units Taq polymerase.
- PCR was started with 8 minutes at 95°C, continued with 35 cycles of denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec, and extension at 68°C for 3 rain., and finished with extension at 68°C for 7 min.
- Initial characterization was carried out with a forward primer (CAX132) in the upstream homologous region and a reverse primer (CAX135) in the downstream homologous region.
- CAX132 CCGAATTGTTATCTTGCCTGC (SEQ ID NO:54)
- PCR of strains containing the desired operon deletion were expected to produce a 1000 bp fragment, and this was found in 9 of 23 "pop-out" strains analyzed. To ensure that undesired rearrangements had not occurred in these strains, "colony PCR” with primers outside of the regions of homology were used: CAX162 (forward) and C AX 163 (reverse).
- CAX126 AAGCTTGGAAGACGCCATCTATGGTGG (SEQ ED NO:60)
- coli W3110 by colony PCR was carried out with primers CAX126 and CAX127, and 11 of 23 prospective "pop-outs" gave the desired signal.
- Outside primers CAX160 (forward) and CAX161 (reverse) were used to identify presumptive wcaJ deletions, and 3 of 4 strains tested contained the expected product (1188 bp).
- One strain with the desired DNA structure was designated MSC175.
- CAXl 61 AAACAGCAGCGTTCTCACCG (SEQ ID NO:63)
- Xanthomonas campestris pv. campestris (Xcc) is used commercially to produce the extracellular carbohydrate polymer xanthan gum for a variety of industrial and food applications (Baird, J., et al, BioTechnology 1983;1 :778-783). In order to employ this strain and process for production of chondroitin, Xcc strains unable to biosynthesize xanthan gum are required. A strategy similar to that used (above) for E. coli was used to delete the entire xanthan gum biosynthetic operon or just the gene for the first glycosyltransferase, gumO, in Xanthomonas campestris pv.
- campestris strain ATCC13951 also known as NRRL B-1459 (Capage, M.R. et al., World Patent WO87/05938; Katzen, F., et al., J. Bacterid. 1998; 180(7): 1607-1617).
- MSC116 a spontaneously-arising derivative resistant to 100 ⁇ g/mL streptomycin sulfate in nutrient agar at 30°C was obtained and named MSC116.
- PCR primers were designed against the sequence of the xanthan gum biosynthetic cluster of strain NRRL B-1459 (GenBank accession #U22511) and, where necessary, to the genomic sequence for X, campestris pv.
- PCR was performed with Pfu Ultra II polymerase (Stratagene) for 30 cycles of denaturation at 95°C (20 sec), annealing at 62°C (20 sec.) and extension at 72°C (30 sec).
- Template consisted of 100 ng of X. campestris pv. campestris (strain ATCC13951; "Xcc”) genomic DNA.
- the PCR fragments were cloned into pCR-Blunt II-TOPO (Invitrogen) and transformed into E. coli TOP 10 (Invitrogen).
- the relevant sequence of an upstream homology clone matched the sequence of the PCR product, but this shared sequence differs by two base pairs from the published Xcc sequence for this region (primers excluded). It is likely that the published sequence contains a small number of incorrect assignments.
- the relevant sequence of a downstream homology clone matched the sequence of its PCR product and that of the published Xcc sequence for this region (primers excluded).
- Plasmid pCM184 consisted of a ColEl replicon, which permits replication of the plasmid in E. coli but not in Xanthomonas (or other non-enteric bacteria), an oril region for conjugal transfer among Gram negative bacteria, resistance genes for ampicillin and tetracycline, plus a resistance gene for kanamycin (Kan 1 ) flanked by loxP sequences. This plasmid was designed to create unmarked (no remaining antibiotic resistance gene) deletions in non-is.
- pCM184 was modified to remove the loxP sites and the intervening kanamycin resistance gene. This allowed for use of the resulting derivative plasmid for creation of desired unmarked deletions in Xanthomonas by a variation on the "pop-in / pop-out" mechanism described above.
- the plasmids (about 2 ⁇ g each) containing the cloned PCR products for the gumD upstream and downstream regions (above) were digested with 10 U Sbfi for 2 hr at 37°C, then 10 U iscoRI (with enzyme-specific buffer) under the same conditions. After heat treatment (70°C for 20 min.), the digests were subjected to agarose gel electrophoresis, and the desired fragments (upstream fragment about 1.6 kb; downstream fragment about 1.1 kb) were purified with the QIAGEN Mini-Elute kit.
- Plasmid pCX027 (about 3.5 ⁇ g) was digested with 20 U £coRI in a 50 ⁇ reaction for 2.5 hr at 37°C, treated with about 18 U Antarctic phosphatase (New England Biolabs) in a 60 ⁇ reaction for 15 min. at 37°C, and then heated at 70°C for 20 min.
- a three- way ligation was carried out with about 100 ng each of treated pCX027 and purified gumD upstream and downstream fragments in 10 pL reactions at 16°C for about 20 hr.
- Half of this reaction was transformed into E. coli DH5a (Stratagene) followed by plating to either LB Ap 100 or LB Tc 5 at 37°C.
- Colony PCR was performed (as described above) to identify clones with the desired structure using primers CAX122 and CAX119 homologous to regions in the upstream and downstream sequences, respectively.
- PCR products of the expected size (1169bp) were detected in several colonies, and the desired structures were confirmed by restriction analysis. Plasmids in which the orientation (given as the gum gene reading frames) of the paired homology regions were the same or opposite of that for the vector Tef gene were named pCX030 and pCX031, respectively.
- NCUAR Peoria, IL; also known as ATCC 13951
- NB nutrient broth
- str streptomycin
- Plasmid pCX030 or pCX031 was transferred to Xcc strain MSC116 by electroporation
- Tc R Tetracycline-resistant colonies
- pCX030 4.1 x 10 4 ⁇ g
- pCX031 3.1 x 10 4 ⁇
- Genomic DNA was prepared from isolated Tc R strains derived from pCX031 transformation and evaluated by PCR for the site of pCX031 integration. Primer pairs were chosen to determine linkage of genomic sequence outside of the upstream region used in pCX031 to the downstream region and sequence outside of the downstream region used in pCX031 to the upstream region.
- primer CAX116 (outside primer” for upstream region) plus CAX119 (in downstream homologous region; see above) were used to test the upstream linkage and CAX117 (“outside primer” for downstream region; see above) plus CAX122 (in upstream homologous region; see above) were used to test the downstream linkage.
- PCR was conducted with Go Taq DNA polymerase (Promega, Madison, WI) with 0.5 uM each primer, 250 ⁇ each dNTP, 1000 ng DNA template, and 0.5 U enzyme. Reaction conditions include initial denaturation at 94°C for 4 min., 30 cycles of 15 sec. denaturation at 94°C, 30 sec. annealing at 55°C, and 4 min.
- Tc s strains were found at a frequency of 2% from both strains. Colony PCR analysis against selected Tc s strains using the primer pairs (CAX116 plus CAX119 and CAX117 plus CAX122), as described above, demonstrated that all strains tested were consistent with gumD deletion. These isolated "pop-out" strains from MSC221 and MSC222 were designated MSC225 and MSC226, respectively. Colonies of MSC225 and MSC226 on agar plates were clearly non-mucoid relative to colonies of the MSC116 parent strain.
- Deletion of the xantlian gum biosynthetic scne cluster Deletion of the gumB thru gumM biosynthetic cluster largely follows the same steps detailed for deletion of the gurtiD gene. Regions of homology upstream of gumB and downstream of gumM were created by PCR with primers CAX136 x CAX137 (1434 bp) and CAX138 x CAX139 (1420 bp), respectively, incorporating a Bglll restriction site for cloning into pCX027 and Noil sites for fusion between the upstream and downstream fragments.
- Noil sites Fusion of the Noil sites will create an open reading frame for a 53 amino acid polypeptide consisting of the 5 ' end of the gumB and 3 ' end of the gumM coding sequences. Restriction sites are underlined: Bglll inCAX136 and CAX139; Noil in CAX137 and CAX138.
- CAX139 AGATCTCCTACCGACCAGGCATTGGC (SEQ ID NO:73)
- PCR was performed with Pfu Ultra II polymerase (Stratagene) for amplification of upstream and downstream fragments. Reaction conditions include initial denaturation at 94°C for 4 min., 30 cycles of 20 sec. denaturation at 95°C, 30 sec. annealing at 57°C, 30 min. extension at 72°C and final extension at 72°C for 5 min. Template consisted of 100 ng of X. campestris pv. campestris (strain ATCC13951; "Xcc”) genomic DNA. The PCR fragments were cloned into pCR-Blunt II-TOPO (Invitrogen) and transformed into E. coli TOP10 (Invitrogen).
- the relevant sequence of an upstream homology clone matches the sequence of the PCR product, but this shared sequence differs by 14 base pairs from the published sequence of Xcc strain ATCC33913 for this region (primers excluded). These sequence variances likely reflect subtle differences between the B-1459/ATCC13951 and ATCC33913 genomes.
- the relevant sequence of a downstream homology clone matches the sequence of the PCR product and this sequence does not differ from the published Xcc ATCC33913 sequence for this region (primers excluded).
- the plasmids (about 1 ⁇ ig each) containing the cloned PCR products for the upstream region of gumB (above) and the downstream region of gumM (above) were digested with 7.5 U Noil and 7.5 U Bglll for 2 hr at 37°C.
- the digests were subjected to agarose gel electrophoresis, and the desired fragments (each about 1.4 kb) were purified with the QIAGEN Mini-Elute Kit.
- Plasmid pCX027 (about 1.0 ⁇ g) was digested with 15 U BglR in a 15 uL reaction for 2 hr at 37°C, treated with about 5 U Antarctic phosphatase (New England Biolabs) in a 75 reaction for 15 min. at 37°, and then heated at 65°C for 10 min. After purification of Bglll digested pCX027, a three-way ligation was carried out with purified pCX027, the upstream fragment of gwnB, and the downstream fragment of gumM in 20 reactions at room temperature for 3 hr. Half of the reaction mixture was transformed into E.
- Plasmid was prepared from PCR positive clones with the QIAGEN Qiaprep Spin
- Plasmids in which the orientations of the paired homology regions were the same or opposite of that for the vector Te gene were designated pKMOOl and pKM002, respectively.
- Plasmid pKMOOl or pKM002 was transferred to Xcc strain MSC116 by electroporation
- Tc R colonies were obtained from transformants of pKMOOl (5.3 x 10 3 ⁇ g) and pKM002 (5.0 x 10 3 ⁇ g), respectively.
- Genomic DNA was prepared from isolated Tc R strain derived from pKMOOl transformant and evaluated by PCR for the site of pKMOOl integration. Primer pairs were chosen to determine linkage of genomic sequence outside of the upstream region used in pKMOOl to the downstream region and sequence outside of the downstream region used in pKMOOl to the upstream region.
- primer prKMOOl outside primer
- CAX145 in downstream homologous region; see above
- prKM002 outside primer
- CAX142 in upstream homologous region; see below
- MSC242, MSC247 and MSC248 were inoculated in LBLS medium for growth at 30°C, and then thrice sub-cultured into the same medium at 48 hr intervals using 1 :1000 dilutions. The resulting cultures were diluted, and aliquots were spread to NA Str plates. Resulting colonies were transferred to NA and NA Tc 5 plates. Tc s strains were observed at frequencies of 1 -2% from the three strains. Genomic structure in selected Tc s strains was evaluated by PCR to confirm deletion of xanthan gum synthesis genes from gum to gumM using prKMOOl plus CAX145 for upstream linkage and prKM003 plus CAX142 for downstream linkage (see above).
- PCR was conducted with Herculase II Fusion DNA polymerase (Stratagene) with 0.25 ⁇ each primer, 250 uM each dNTP, 500-700 ng DNA template, and 0.5 U enzyme. Reaction conditions included initial denaturation at 98°C for 4 min., 30 cycles of 20 sec denaturation at 98°C, 20sec. annealing at 60°C, and 2 min. extension at 72°C and final extension for 4 min. Three "pop-out” strains (one from each "pop-in” strain) showed the PCR products consistent with deletion of the xanthan gum biosynthetic gene cluster.
- MSC242, MSC247 and MSC248 were designated MSC255, MSC256 and MSC257, respectively. Colonies of MSC255, MSC256, and MSC257 on agar plates were clearly non- mucoid relative to colonies of the MSC116 parent strain.
- E. coli B can be engineered to synthesize chondroitin by providing just the K4 region 2 genes on a plasmid or integrated into the chromosome (see below). To improve the utility of E. coli B as a host for chondroitin production, the production of colanic acid was eliminated by genetic mutation as described for E. coli K-12 above.
- the upstream homologous region (944 bp) differs by only two bases (transitions) from the K-12 upstream region, and the downstream homologous regions (911 bp) differs by 30 bases (24 transitions, 6 transversions).
- the upstream and downstream fragments were cloned into pMAK705 to generate pMAK-BCL.
- Plasmid pMAK-BCL was introduced into E. coli B by electroporation.
- LB medium was inoculated with a fresh colony and incubated overnight at 37°C with vigorous shaking.
- a volume of fresh, pre-warmed LB was inoculated with the overnight culture to give an initial OD600 reading of 0.03 (BioPhotometer, Eppendorf).
- the culture was grown to OD600 ⁇ 0.8 and then chilled on ice for 30-40 minutes. Cells were collected by centrifugation (10 min., 4000g), and the cells ware washed twice by re-suspension in original volumes of ice-cold deionized water followed by re-centrifugation.
- the cells from the final centrifugation were suspended in 1/500* volume of ice-cold water.
- pMAK-BCL 200 ng was added to 50 ⁇ ⁇ of prepared E. coli B suspension and incubated on ice for about 20 min.
- Electroporation was carried out with Gene Pulser Xcell (BioRad) in 0.1 mm gap cuvettes at settings of 25 ⁇ , 200 ⁇ , and 1.8 kV yielding durations of 4.5-5.0 msec. Pulsed cells were diluted with 350 iL SOC medium (Maniatis, 1989) and incubated at 37°C for 1 hr; 5-10 ]iL was then spread to LB Cm 34 agar plates with incubation at 43°C.
- Colonies appearing after 2 days were streaked to LB Cm 34 agar plates at 43 °C, and resulting colonies were inoculated into LB medium (no Cm) for growth and serial passage at 30°C. Colonies derived from these cultures were tested for Cm- sensitivity, and "pop-out” candidates were identified. Colony PCR was used to characterize the candidate strains. One isolate was found to give the expected PCR products using primer pairs CAX129 x CAX132, CAX131 x CAX132, CAX132 x CAX135, CAX129 x CAX135, and CAX162 x CAX163. This E. coli B isolate deleted for the colanic acid gene cluster was named MSC364.
- E. coli have been described (Balbas and Bolivar, Methods Enzymol. 1990;185:14-37, Das, Methods Enzymol. 1990;182:93-112, Mardanov et al. Gene 2007; 15(395): 15-21).
- Such vectors employ a variety of well characterized promoter systems for regulated gene expression in E. coli.
- conjugally-transmissible plasmid vectors based on broad host range plasmids such as RK2 (low copy number IncP) and RSF1010 (high copy number IncQ) that function in E.
- coli, X campestris and a wide variety of other gram negative bacteria are also available (Franklin and Spooner, Promiscuous plasmids in Gram-negative bacteria Academic Press (London) 1989 pp247-267, Mather et al. Gene 1995;15:85-88, Haugen et al, Plasmid 1995;33:27-39. Mermod et al, J Bact. 1986; 167:447-454).
- the synthetic chondroitin biosynthetic gene set can be cloned into these versatile broad host range vectors so that the same plasmids can be used for gene transfer and expression in a wide array of gram-negative bacteria including X. campestris, S. elodea, P. putida, and non-pathogenic E. coli (Guiney and Lanka, Promiscuous plasmids in Gram-negative bacteria Academic Press (London) 1989 pp27-54).
- IncP -based vectors are derived from the RK2, a conjugally self-transmissible plasmid originally isolated from clinical Pseudomonas isolates and subsequently shown to be capable of transferring itself into, and functioning within, nearly every gram negative bacterium tested.
- Smaller derivatives of RK2 have been constructed that are stable replicons and can be conjugally transferred when "helper" functions are supplied in trans from a second plasmid.
- One such plasmid is pFFl (Durland et al, J, Bact. 1990;172:3859-3867).
- pJB653 Bosatny et al, Appl.
- RSF1010 carrying the Pm promoter and xylS regulatory protein have been constructed and described.
- the plasmid pNM185 (Mermod et al., J Bact. 1986; 167:447-454) is an RSF1010 derivative that carries the Pm promoter and xylS regulatory gene.
- pBHPU Broad-host-range plasmid pBHPU (Szpirer et al, J. Bacteriol. 2001;183:2101-10), which is reported to be compatible with IhcP and IncQ plasmids, was purchased from MoBiTec GmbH (Goettingen, Germany). This plasmid was modified to create a vector (pDD54) employing the Pm / xylS expression system referenced above. The first step in constructing the pBHRl -based expression vector was to delete the kanamycin resistance (KanR) gene present on that plasmid.
- KanR kanamycin resistance
- pRK2013 a plasmid that can be used to direct conjugal transfer of pBHRI and derivatives, also carried a KanR gene. Moreover, deletion of that gene, and flanking sequences, facilitated certain subsequent cloning steps detailed below.
- pBHRI also carries a gene that confers chlorampbenicol-resistance (CamR) and that antibiotic can be used instead of kanamycin to select for this plasmid.
- Plasmid DNA was prepared from pBHRI (diagrammed in Figure 8A) digested with Sbfi and the 1.2 kb Sbfl fragment containing the KanR gene was deleted by ligating the digestion products and screening for chloramphenicol-resistant, kanamycin- sensitive transformants.
- the plasmid from one such transformant was designated pDD39 (see Figure 8A) and used in further construction steps.
- the xylS gene which positively regulates expression from the Pm promoter, was amplified by PCR from pWWO (TOL plasmid) DNA prepared from Pseudomonas putida ATCC 33015. Using the QIAGEN Plasmid Mini Kit (QIAGEN Inc., Valencia, CA) according to the vendor protocol 4 ⁇ g of pWWO DNA was isolated from 20 mL of a fresh overnight culture of Pseudomonas putida ATCC 33015. This DNA preparation was used as template for PCR reactions which amplified the xylS gene and flanking DNA sequences as two fragments which were subsequently joined together by a subsequent PCR splicing reaction.
- pWWO TOL plasmid
- reaction A employed primers DHD197 (SEQ ID NO: 103) and DHD201 (SEQ ID NO: 104) and a second reaction (Reaction B) employed primers DHD200 (SEQ ID NO: 105) and DHD198 (SEQ ID NO: 106). Sequences of these primers are as follows:
- PCR reactions were performed in a Perkin- Elmer GeneAmp 2400 thermocyler using the following cycling parameters: 1 cycle of 2 min. at 95°C; 30 cycles of 20 sec. at 95°C, 20 sec. at 60°C, and 45 sec. at 72°C; 1 cycle of 3 min. at 72°C; and a hold at 4°C. Products of these reactions were analyzed by agarose gel electrophoresis. The sizes of PCR products observed were consistent with the expected sizes for the products of both Reaction A (1259 bp) and Reaction B (422 bp). [0222] The products of these reactions were purified using the Qiagen QIAquick PCR
- the products of this reaction were purified using the Qiagen QIAquick PCR Purification Kit (QIAGEN, Valencia, CA) according to the vendor protocol and analyzed by agarose gel electrophoresis. A strong band was observed at a position consistent with the expected size of the product of the PCR splicing reaction, 1610 bp. This band was excised from the gel using the QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia, CA) according to the vendor protocol.
- the resulting plasmid was designated pDD42 and is diagramed in Figure 8A.
- the PCR primers DHD197 and DHD198 added Pstl sites 3 base pairs from each end of the 1610 bp PCR fragment.
- the sequence of the Pstl fragment in pDD42 was determined (SEQ ID NO: 107). This sequence matched the expected sequence for the xylS gene based on the reported pWWO sequence (GenBank, AJ344068) and showed the addition of 5 base pairs derived from primers DHD200 and DHD201 which results in the creation of a Nsil site 9 base pairs downstream (3') of the translational stop codon of xylS.
- the Pstl fragment containing the xylS gene was excised from pDD42, gel-purified and cloned into the Sbfl site of pDD39. Pstl and Sbfl enzymes create digestion products having identical 4 bp overhangs, which can be ligated together, but the Sbfl recognition site is destroyed in the resulting recombinants.
- the pDD39 derivative containing the xylS gene contained on the Pstl fragment from pDD42 was termed pDD47 and is shown in Figure 8A.
- a 470 bp DNA fragment (SEQ ID NO:79) that comprises approximately 90 bp of TOL plasmid DNA sequence spanning the minimal Pm promoter sequences required for binding of RNA polymerase and the XylS protein (Dominguez-Cuevas et ah, 2008) plus synthetic upstream and downstream transcriptional terminators and multiple restriction sites for cloning genes immediately downstream of the Pm promoter was synthesized de novo by DNA 2.0 (Carlsbad, CA).
- Figure 8B shows pJ201 : 11352 which contains this 470 bp fragment cloned in the DNA 2.0 pJ201 vector.
- the promoter-containing fragment was designed with flanking Accl sites to allow cloning into the compatible, and supposedly, unique BstB I site located in pBHRl and the derivative pDD47 plasmid.
- digestion of pDD47, and subsequently pBHRl revealed the presence of two BstBl sites.
- sequence of pBHRl as reported in the literature is not entirely correct. Due to this discrepancy additional cloning steps were required to add the cloned Pm promoter to pDD47.
- pDD47 contains unique EcoRl and Agel sites that flank the annotated BstB I site targeted for insertion of the promoter. It also contains an NgoM TV site downstream of the Agel site.
- the 763 bp EcoRI - NgoMTV fragment of pDD47 was excised and cloned into EcoW - NgoMTV cut pREZ6 to generate pDD49 ( Figure 8B).
- pREZ6 also diagrammed in Figure 8B, is a derivative of pBluescript SK+ (Stratagene, LaJolla, CA) in which a short polylinker sequence (ttaattaagggtttaaactac (SEQ ID NO: 142)) was inserted at the unique Dralll site of pBluescript SK+.
- the BstBl of interest is unique, so the Accl fragment of pJ201: 11352 which contains the Pm promoter was excised and cloned into the BstBl site of pDD49 to create pDD50.
- pDD54 was used as the expression vector in the initial cloning of K4 capsule genes for transfer into, and expression in, alternative hosts as descnbed below and in Examples 6, 7, 8 and 9.
- the gel-purified approximately 9.1 kb Sbfi - BamHl MG segment was ligated into the Sbfi plus BglTl digested and phosphatased pJ241: 10664 vector which contains the FS gene segment.
- BamH I and BglTl enzymes recognize different sequences, GGATCC vs AGATCT respectively, they produce an identical 4 bp overhang (GATC) and therefore the digestion products can be ligated together but resulting ligation products cannot subsequently be recognized by either enzyme.
- the resulting recombinant plasmid, designated pDD37 is shown in Figure 8E.
- This construct retains the Sbfi site 5' to the synthetic genes and the BamHl site, present in pJ241 : 10664, 3' to the synthetic genes.
- the synthetic gene set ApsMT ⁇ oABCFGAjwFEDUCS (MGFS segment) can therefore be excised as an Sbfi - BamHl fragment of approximately 17.1 kb.
- the gel-purified Sbfi - BamRl approximately 8.0 kb FS segment was ligated into the Sbfi and Bgfll digested and phosphatase treated pJ241: 10662 vector which contains the MG gene segment.
- this construct retains the Sbfi site 5' to the synthetic genes and the BamHl present in pJ241: 10662 3' to the synthetic genes. Therefore, this synthetic gene set, kpsFEDUCSkpsMTkfoABCFG (the FSMG segment) can be excised as an Sbfi - BamHl fragment of approximately 17.1 kb.
- Synthetic genes kfoD, kfol (or or i), kfoE and kfoH (or orfY) (the DH segment), contained in pJ241 :10663 (see Figure 8D), were cloned into plasmids pDD37 and pDD38. Plasmids pDD37 and pDD38 were digested with EcoRI, treated with alkaline phosphatase and gel -purified using the QIAEX II Gel Extraction Kit (Qiagen Inc., Valencia, CA) according to the vendor protocol. The unique EcoRI site in each of these plasmids is located in the intergenic region separating kfoC and kfoF.
- the DH segment containing synthetic genes kfoD, kfol, kfoE and kfoH, was excised from pJ241 : 10663 as a approximately 4.2 kb EcoRI fragment and gel-purified. This fragment was ligated into both of the iscoRI-cut and phosphatased pDD37 and pDD38 plasmids. Resulting recombinants were tested for orientation of the approximately 4.2 kb EcoRI fragment by cutting with diagnostic restriction enzymes. Recombinants that contained the added DH segment in the correct orientation were readily obtained.
- the resulting plasmids, pDD51, derived from pDD37, and pDD52 derived from pDD38, are shown in Figure 8F.
- constructs each contain all of the K4 capsule cluster genes but, as shown, the gene order differs for the two plasmids: in pDD51 the gene order is ApsMT ⁇ ABCDIEHFG£/wFEDUCS, in pDD52 the order is kpsFEDlJCSkpsMTkfoABCDJEHFG. In both cases the entire K4 gene set can be excised as an Sbfi - BamHl fragment of approximately 21 kb.
- the K4 capsule genes from these plasmids were subcloned into the expression vector pDD54, described above, to generate expression plasmids pDD57 and pDD58, respectively. Both of these plasmids are illustrated in Figure 8G.
- the entire synthetic K4 capsule gene set was excised from pDD51 and pDD52 as an approximately 21 kb Sbfi - BamHl fragment, gel-purified using the QIAEX II Gel Extraction Kit (Qiagen Inc., Valencia, CA) according to the vendor protocol and cloned into Sbfi - BamHl digested pDD54. [0230] In pDD57 and pDD58 the entire K4 capsule gene set (17 genes) is under control of the
- the pDD54 and pDD58 plasmids were originally constructed in the E. coli "TOP 10" strain, a commercially available (Invitrogen, Carlsbad, CA) strain that contains a number of mutations that enhance its utility for gene cloning. The plasmids were also subsequently transferred into another E. coli host ("DH5a") that is commonly used in recombinant DNA experiments. These E. coli strains are not ideal candidates for development as production platforms. Therefore, in initial experiments, pDD54 and pDD58 were transformed into more suitable E. coli -12 strains and the resulting strains tested for chondroitin production as described below in Example 6.
- Tetracycline-resistance potentially has two advantages as a selection for plasmid introduction and maintenance.
- TcR tetracycline-resistance
- the resistance mechanism is based on transport of the antibiotic out of the cell, not on inactivation of the antibiotic, as is the case for chloramphenicol and many other antibiotics. Therefore, the effective concentration of selective agent in the culture medium is unaltered by cell growth and metabolism.
- Expression plasmids pDD57 and pDD58 were modified by addition of a gene that confers the property of tetracycline-resistance (TcR) while the chloramphenicol-resistance (CmR) property of these plasmids was retained.
- this gene was modified as follows. PCR primers added a BglR site at the 5' end of the tetR gene, upstream of the promoter, and a BamHI site 3' to the tetR stop codon. Primers further modified the gene to eliminate an internal BamHI site (without changing the amino acid sequence of the protein) and to eliminate the so-called "anti-fef" promoter normally present on the fragment that was amplified. This promoter is located near the tetR promoter but directs transcription in the opposite direction (Balbas et at, Gene 1986;50:3-40).
- This modified tetR gene was created by performing two PCR reactions that amplified two overlapping segments of the tetR gene and introduced the desired sequence changes. Subsequently a these two fragments were joined together by a subsequent PCR splicing reaction to generate the tetR gene and promoter region of the desired sequence having the BgHl site at the 5' end of the tetR gene, upstream of the promoter, and a BamHl site 3' to the tetR translational stop codon.
- the first PCR reaction (Reaction A) employed primers DHD218 (SEQ ID NO: 113) and
- DHD219 (SEQ ID NO: 114) to amplify approximately 400 bp of DNA including the ammo- terminal portion of the tetR coding sequence and upstream promoter sequence.
- the second reaction employed primers DHD220 (SEQ ID NO: 115) and DHD221 (SEQ ID NO: 1 16) to amplify approximately 900 bp of DNA including the remainder of tetR coding sequence and translational stop codon. Sequences of these primers are as follows shown below.
- the shaded sequence shown in DHD218 replaces the sequence ATCGATAAGCTT (nucleic acids 2843-2854 of SEQ ID NO: 141) that is present in pCX027 and, in so doing, eliminates the Clal and HmdIII sites located in the tetR promoter region and changes the sequence of the -10 region of the anti-/e/ promoter.
- the complementary shaded sequences of DHD219 and DHD220 create a silent mutation that eliminates the BamHl site of the tetR gene of pCX027. This mutation changes a CTC leucine codon to a TTG leucine codon and thus does not alter the amino acid sequence of the TetR protein.
- PCR Reactions A and B were performed using PfuUltra II polymerase (Stratagene,
- PCR Reactions A and B were performed in a RoboCycler® Gradient 96 thermocycler (Stratagene, LaJolla, CA) using the following cycling parameters: 1 cycle of 1 min. at 95°C; 30 cycles of 30 sec. at 95°C, 30 sec. at 55°C, and 30 sec.
- the gel-purified fragments served as templates in the subsequent PCR splicing reaction; Reaction SP.
- Reaction SP In a 50 reaction, Pfu reaction buffer was added to a final concentration of IX, primers were added to a final concentration of 0.4 uM each, dNTPs were added at a final concentration of 200 uM each, 3 uL of each of the gel-purified reaction products of Reactions A and B were added as template and 2.5 units of PfuUltra II polymerase were added.
- PCR Reaction SP was performed in a RoboCycler® Gradient 96 thermocycler (Stratagene, LaJolla, CA) using the following cycling parameters: 1 cycle of 1 min. at 95°C; 30 cycles of 30 sec.
- the product of this reaction was purified using the QIAGEN QIAquick PCR Purification Kit (QIAGEN, Valencia, CA) according to the vendor protocol, and was analyzed by agarose gel electrophoresis. A strong band was observed at a position consistent with the expected size of the product of the PCR splicing reaction, 1295 bp.
- This PCR product was digested with BgRl and BamHI and ligated with ZfamHI-digested pDD57 and pDD58. Ligation products were used to transform E. coli TOP 10 (Invitrogen, Carlsbad, CA) and transformants that had acquired tetracycline resistance were selected by plating at 30°C on LB plates containing 10 ⁇ g/mL tetracycline. Resulting tetracycline-resistant transformants were screened by diagnostic PCR reactions and restriction digests to confirm the presence, and determine the orientation, of the tetR gene.
- Plasmids having the desired structure were identified and designated pDD61 (pDD57:: /R) (SEQ ID NO:143) and pDD62 (pDD58::/e/R) (SEQ ID NO: 144). Diagrams of these plasmids are shown in Figure 8H. The analogous insertion of the tetR. gene was made into the BamHI site of vector pDD54 to generate pDD63; shown in Figure 81. This plasmid can serve as a TcR vector-only control for experiments with any of the TcR plasmids that express cloned K4 genes.
- the synthetic gene set contains restriction sites that allow non-polar deletions of any gene(s) of interest to be created.
- the set of four genes kfoDWR was deleted by deletion of a single 4.2 kb EcoRl fragment. This 4.2 kb EcoRl fragment was deleted from expression plasmids pDD 7 and pDD58 and from their respective TcR derivatives, pDD61 and pDD62 which are described above. These four plasmids, shown in Figures 8G and 8H, all contain 3 EcoRl sites. Two sites define the 4.2 kb fragment of interest and the third site cleaves within the coding sequence of the plasmid gene that confers chloramphenicol-resistance (CmR).
- CmR chloramphenicol-resistance
- Plasmids deleted for the 4.2 kb EcoRl fragment were readily obtained in all instances. Plasmids pDD59, pDD60, pDD67 and pDD66 are the 4.2 kb Eco l fragment deletion derivatives of pDD57, pDD58, pDD61 and pDD62, respectively, and all are deleted for the kfoDlER genes. These plasmids are depicted in Figure 8J.
- a 127 bp Pad ⁇ Clal DNA fragment having the sequence: TTAATTAATGTTTCTGTTGCATAAAGCCTAAGGGGTAGGCCTTTCTAGAGATA GCCATTTTTTGCACTCCTGTATCCGCTTCTTGCAAGGCTGGACTTATCCCTATC AAACCGGACACTGCATCGAT (SEQ D NO: 80),
- the added 127 bp Pad - Clal fragment includes a copy of the Pm promoter sequence. As shown in Figure 8K, in pBR.1052 the added copy of the Pm promoter is oriented so that transcription initiation at this promoter can result in RNA transcripts that include the ApsFEDUCS genes.
- the K4 gene expression cassettes were excised and gel-purified, using the QIAEX II Gel Extraction Kit (Qiagen Inc., Valencia, CA) according to the vendor protocol, from pDD66 and pBR1052 as approximately 19 kb Ascl fragments and these fragments were ligated with pMAK-CL DNA that was v4scl-digested, phosphatase-treated, and gel-purified. Transformants were selected for resistance to tetracycline. The gene conferring resistance to tetracycline is present on the Ascl fragments of pDD66 and pBR1052, along with the Pm promoter and the upstream and downstream transcription terminator sequences. Derivatives of pMAK-CL that contained the Ascl fragments of pBR1052 or pDD66 were identified and designated pDD74 and pDD76 respectively. These plasmids are diagramed in Figure 8L.
- DNA segments upstream and downstream of t efhuA gene were amplified by PCR from genomic DNA prepared from E. coli K-12 strain W3110 (See Example 3) and these two fragments were subsequently joined together by a subsequent PCR splicing reaction. This procedure facilitated the addition of a Pstl site at the junction of the upstream and downstream DNA segments.
- reaction A employed primers DHD236 (SEQ ID NO: 1
- DHD238-S SEQ ID NO: 110
- DHD239 SEQ ID NO:l l l
- PCR Reaction A was performed using PfuUltra II polymerase (Stratagene, LaJolla, CA).
- PCR Reaction A was performed in a RoboCycler ® Gradient 96 thermocycler (Stratagene, LaJolla, CA) using the following cycling parameters: 1 cycle of 1 min. at 95°C; 30 cycles of 1 min. at 95°C, 1 min. at 55°C, and 1 min. at 72°C; 1 cycle of 4 min. at 72°C; and a hold at 6°C.
- PCR Reaction B was performed using Herculase polymerase (Stratagene, LaJolla, CA).
- PCR Reaction B was performed in a RoboCycler ® Gradient 96 thermocycler (Stratagene, LaJolla, CA) using the following cycling parameters: 1 cycle of 2 min. at 92°C; 33 cycles of 30 sec.at 95°C, 30 sec. at 50°C, and 1 min. at 72°C; 1 cycle of 10 min. at 68°C; and a hold at 6°C.
- PCR Reaction SP was performed in a RoboCycler ® Gradient 96 thermocycler (Stratagene, LaJolla, CA) using the following cycling parameters: 1 cycle of 1 min. at 95°C; 33 cycles of 30 sec. at 95°C, 30 sec. at 60°C, and 40 sec. at 72°C; 1 cycle of 5 min.
- This sequence matched the expected sequence for the DNA segments upstream and downstream of the ⁇ 1 ⁇ 2A gene based on the reported genome sequence for W3110 (GenBank, AP009048) and showed the addition, at the junction of the upstream and downstream segments, of the 6 bp Pstl site derived from primers DHD237-S and DHD238-S. It also confirmed the addition of a HmdHI site at the 5' end of the upstream DNA segment and an Xbal site at the 3' end of the downstream DNA segment which derive from primers DHD236 and DHD239 respectively.
- sequence-verified PCR fragment was excised from the pCR-Blunt II-TOPO vector and gel- purified as a HmdIII - Xbal fragment of 1739 bp and ligated with the temperature-sensitive pMAK705 vector (See Example 3) which was digested with HmdIII and Xbal and treated with Antarctic Phosphatase (New England BioLabs, Ipswich, MA) according to the vendor protocol. Ligation products were used to transform E.
- coli ⁇ 5 New England BioLabs, Ipswich, MA
- chloramphenicol-resistant transformants obtained from plating at 30°C, the permissive temperature for pMAK705 replication were analyzed by digestion with Pstl, and Xbal plus Hzwdlll, to identify those recombinants carrying the 1739 Xbal - HmdIII bp fragment containing the cloned DNA regions upstream and downstream of the E. coli fliuA gene.
- One such recombinant plasmid was designated as pDD73 ( Figure 8M) and was used in subsequent experiments.
- the xylS regulatory gene was cloned into the pDD73 replacement vector as follows.
- the xylS gene was excised from pDD42 as a Pstl fragment and cloned into the Pstl site of pDD73 to generate pDD77, which is diagramed in Figure 8N.
- the Pstl fragment of pDD77 that contains the xylS gene is identical to the y/S-containing Pstl fragment present in expression plasmids pDD66 and pBR1052, the parent vector pDD54 and pDD63 the tetracycline resistant derivative of pDD54.
- a synthetic optimized version of the xylS gene promoter, ribosome binding site, and 5' untranslated region (UTR) was designed and synthesized, and those modified sequences were introduced into the xylS replacement vector pDD77 and subsequently into the chromosome.
- a 257 bp Blpl-Bg L fragment (SEQ ID NO: 140) was synthesized by a commercial vendor (DNA2.0) and the synthetic DNA containing the modified sequences was cloned into the xylS replacement vector, pDD77, as a Blp I - Bgl II fragment in place of the native Blp I - Bgl II fragment containing the native y/S regulatory sequences.
- the plasmid containing the modified xylS was termed pDD79 ( Figure 8N).
- a replacement vector was constructed in order to insert a copy of the & oABCFG gene segment into the E. coli K-12 chromosome at the fliuA locus.
- the kfo ABCFG gene segment (without the Pm promoter) was excised from pCX039 on a Pstl fragment and this fragment was cloned into the compatible Nsil site of pDD79 which is unique in this plasmid.
- pDD80 Figure 80
- the kfoABCFG genes are transcribed by the synthetic xylS promoter, which was designed to be a strong constitutive promoter.
- Deletion derivatives of the pDD66 and pDD67 expression plasmids were constructed in order to evaluate the roles of individual genes or groups of genes. Construction of these derivatives utilized the flanking restriction enzyme sites designed into the synthetic K4 gene fragments as described above.
- the kpsC gene (K4 region 1) was deleted from pDD66 by digestion of 0.6 ⁇ g DNA with 10 U Sad for 2 hours in a 10 ⁇ sL reaction followed by heat treatment of the reaction (to inactivate the enzyme) and ligation (with 1 mM ATP plus T4 DNA ligase) in a 12 iL reaction. Half of this reaction was transformed into E. coli DH5a (Invitrogen) with plating to LB Tc5 at 30°C.
- TcR transformants were expected to contain plasmids comprised of at least the vector/origin fragment plus the tetR fragment. Transformants were screened for plasmids containing these two Sad fragments but lacking the kpsC Sad fragment, and candidate pOO66AkpsC clones were further screened by Sail digestion for those with the desired orientation of the former two Sad fragments.
- pCX045 Figure 8P
- Plasmid pCX039 was created from pi>D67 (described above, see Figure 8 J) by deletion of the K4 regions 1 and 3 genes. Plasmid pDD67 (1.5 ⁇ g) was digested simultaneously with enzymes Pmll and Mlul (10U each), followed by treatment with T4 DNA polymerase (1.5 U) plus dNTPs (150 uM each) at 12°C for 15 min. to fill in the overhangs (leaving blunt ends) generated by Mlul. Pmll digestion leaves blunt ends. Treated pDD67 was subsequently incubated with T4 DNA ligase and transformed into E. coli TOP 10 (hivitrogen) followed by selection for Tet- resistance and screening for Cm-resistance. Colony PCR on 48 double antibiotic resistant colonies was performed with primers DHD229 and DHD231.
- DHD231 CAATGCGACGGATGCTTTCG (SEQ ID NO : 82)
- the kfoB gene in pCX039 (plus its ribosome binding site) is closely flanked by BstBI restriction sites, and there is a third BstBI site in the vector backbone. Therefore, digestion of pCX039 with BstBI results in three fragments: the kfoB gene fragment, a large fragment encompassing the plasmid replication origin, the Tet-resistance gene, and the kfoCFG genes, and a fragment containing the Cm-resistance gene plus PmJkfoA (see Figure 8Q).
- plasmid 600 ng was completely digested with BstBI (10 U) for 90 min. at 65°C. The enzyme was removed from the reaction with the MinElute kit (QIAGEN) with a final elution in 12uL Elution Buffer. Approximately 250 ng (5 ⁇ ) of this digest was incubated with T4 DNA ligase and transformed into E. coli DH5a (invitrogen) with selection for Cm-resistance.
- MinElute kit QIAGEN
- Plasmids in 8 selected transformants were analyzed by restriction digests, and 5 were found to be lacking the kfoB BstBI fragment and to have the other two fragments in the desired relative orientation.
- the plasmid in one such isolate was named pCX044 ( Figure 8Q; xylS plus kfoACFG).
- plasmids pDD66 and pDD67 contain 13 K4 genes in different arrangements: pDD66 - VmJkpsMT/kfoABCFG/kpsFEDlJCS; pDD67 - Pm/ ⁇ FEDUCS/ ⁇ MT/ ⁇ oABCFG. Most of the K4 genes (together with their respective ribosome binding sites) in these plasmids are closely flanked by pairs of restriction enzyme sites that cut only two or three times within the plasmids. These features (and other sequence elements described above) allow for selective, non-polar deletion of individual K4 genes.
- Antibodies directed against 15 of the proteins that are encoded by the K4 chondroitin biosynthetic gene cluster were produced as described below. These antibodies can be used to assess expression of the cloned K4 chondroitin biosynthetic genes in the alternative hosts and in the native E. coli K4 strains. They can also be used to assess region 1 and region 3 gene expression in other group 2 capsule producing E. coli and potentially used with other serogroup K4 E. coli to assess region 2 gene expression. Antibodies were generated as follows.
- PCR primers were designed to amplify a series of polypeptides, or complete proteins, on the order of about 20-30 kDa each in size, corresponding to the 17 genes identified in the K4 capsule gene cluster.
- the initial set of PCR primers were based on the sequence of the Ul-41 K4 capsule gene cluster as determined in Example 1.
- cloned PCR fragments were sequence-verified and then subcloned into pQE30 (Qiagen, Inc., Valencia, CA), an E. coli plasmid vector, for high level expression in E. coli.
- PCR fragments were cloned directly into the expression vector and then sequenced.
- the pQE30 vector employs a strong bacteriophage T5 promoter under control of the Lacl repressor protein to achieve high levels of IPTG inducible expression in E. coli.
- the vector is designed to fuse a poly-His tag at the amino- terminus of the cloned polypeptide in order to facilitate purification.
- antigens derived from KpsM, KpsF, KpsE, KpsS, KfoC, KfoH and KfoC were expressed in the pQE30 vector as His-tagged polypeptides and antigens derived from KpsD, KpsU, KpsC, KfoD, Kfol, KfoE and KfoF were expressed without the His-tag.
- the constructs lacking the His tag were created by cloning into a derivative of pQE30, termed pQE30-dH, in which the sequence encoding the His residues was deleted.
- cultures containing antigen sequences cloned into pQE30 or pQE30-dH typically were grown at 37°C in Luria Broth to mid-log phase, and then induced by the addition of 1 mM IPTG.
- IPTG 1 mM IPTG
- cells were harvested and fractionated into soluble and insoluble fractions using BugBuster® Protein Extraction Reagent (Novagen, Madison, WD, a detergent-based lysis system, according to the vendor protocols.
- BugBuster® Protein Extraction Reagent Novagen, Madison, WD, a detergent-based lysis system, according to the vendor protocols.
- over-expression in the T5 promoter system leads to accumulation of the expressed polypeptide in an insoluble form within the E. coli cytoplasm although some expressed polypeptides are accumulated in a soluble form.
- the KpsU-derived antigen was expressed in a soluble form; all other antigens were found to partition to the insoluble fraction. Often, the recombinant protein is the predominant polypeptide in the insoluble fraction generated by the BugBuster® lysis and extraction procedure. For immunization purposes, expression of these polypeptide antigens was performed in 100 ml shake-flask cultures. Following lysis of induced cultures, insoluble fractions of all cultures (except the KpsU antigen-expressing culture) were run on preparative gels. In the case of KpsU antigen, the polypeptide antigen partitioned to the soluble fraction of the cell lysate and therefore that soluble fraction was run on preparative gels.
- the gel regions containing the protein of interest were excised and sent to the commercial vendor, Open Biosystems (Huntsville, AL) for further processing and subsequent immunization of rabbits to produce antisera.
- 12 antigens were deemed to be sufficiently well expressed to warrant purification of the antigen. These 12 antigens were derived from KpsE, KpsD, KpsU, KpsC, KpsS, KpsT, KfoA, KfoB, Kfol (Orf3), KfoE, KfoH (Orfl) and KfoF.
- Antigens derived from the protein sequences of KpsF, KpsM, KfoC, KfoD, and KfoG were not expressed or were poorly expressed.
- the polypeptide sequences of poorly expressed antigens were analyzed with respect to codon usage, and physical properties such as hydrophobicity and calculated pi. Comparison to these same properties as determined for the well-expressed polypeptide antigens did not reveal any clear correlations. Codon usage was unfavorable in some poorly expressed antigens, such as KfoG, but it was also unfavorable in other well-expressed antigens.
- KpsM antigen was extremely hydrophobic and that could potentially affect stability of the expressed antigen, but because KpsM is an integral membrane protein, its entire sequence is very hydrophobic and any polypeptide of significant size derived from KpsM will be highly hydrophobic.
- Additional antigen coding sequences were derived from the synthetic, codon-optimized, genes for KpsM, KpsF, KfoC, and KfoG using the synthetic K4 gene set described above in Example 2.
- PCR products derived from the synthetic DNA template were cloned into pQE-30, the 6X-His tag vector, and tested for expression.
- Synthetic sequence KfoC, KfoG, and KpsF antigens were found to have high, or moderately high, accumulation when expressed in the pQE- 30 vector with a 6X-His tag.
- These antigens were gel-purified from induced cultures as described above and sent to Open Biosystems (Huntsville, AL) for antisera production in rabbits.
- Synthetic sequence KpsM antigen with a 6X-His tag was not expressed at detectable levels as determined by Coomassie staining of induced cultures.
- Antisera from immune rabbits were tested by western blot for titer and for specificity using cell extracts from induced antigen-expressing E coli strains. All antisera recognized their respective antigens in these western blots. Titers for use were typically 1 : 1500 with acceptable non-specific background. Examples of results from western blots performed using these antisera are shown in Figure 9.
- some antisera e.g. anti-KfoA, anti-KpsD and anti-KpsS
- anti-KfoA, anti-KpsD and anti-KpsS identified the target protein band in strains carrying the cloned K4 genes with little or no observable nonspecific reactivity to other E. coli proteins.
- antisera e.g. anti-KpsC and anti-KpsF
- Most antisera identified single protein bands as their specific targets in western blots, but in some instances (e.g. KfoC) multiple bands were specifically recognized.
- the KfoC polypeptide appeared to undergo some proteolyic breakdown or processing either intracellularly or during processing of extracts prior to the western blot, and a doublet band, as indicated in Figure 9, was consistently observed.
- antisera that could detect KpsF, KpsE, KpsD, KpsU, KpsC, KpsS, KpsT, KfoA,
- KfbB, KfoC, Kfbl (OrG), KfoE, Kf H (Orfl), KfbF and KfoG in E. coli K4 strains, and in recombinant strains expressing the cloned K4 capsule gene cluster, and in native E. coli strains that might contain some or all of these genes were successfully raised.
- the amino acid sequence of the recombinantly-expressed polypeptide that was used to immunize rabbits to generate antisera that recognized the indicated proteins is given below.
- the antigens that were expressed in the pQE30-dH vector contain an added MGS sequence at the amino-terminus of the expressed polypeptide which is derived from the plasmid expression vector and is not present in the sequence of the target protein.
- Antigens that were expressed in the pQE30 vector by cloning into the BamHl site contain an added MRGSHHHHHHGS (amino acids 1-12 of SEQ ID NO: 85) sequence at the amino-terminus which is derived from the plasmid expression vector and is not present in the target protein.
- Antigens that were expressed in the pQE30 vector by cloning into the Sacl site contain an added MRGSHHHHHHGSACEL (amino acids 1-16 of SEQ ID NO: 93) sequence at the amino-terminus which is derived from the plasmid expression vector and is not present in the target protein.
- the amino-terminal sequences of the polypeptide antigens that are derived from the expression vector DNA sequences are shaded below.
- KfoA-derived antigen SEQ ID:NO:83:
- KfoB-derived antigen SEQ ID NO:84:
- KpsT-derived antigen SEQ ID NO:91:
- KpsF-derived antigen SEQ ID NO:92:
- KpsD-derived antigen SEQ ID NO:94:
- KpsU-derived antigen SEQ ID NO:95:
- KpsS-derived antigen SEQ ID NO:97:
- the synthetic gene set [ ⁇ sFEDUCS+ ⁇ psMT+A oABCDIEHFG] produces fructosylated chondroitin when expressed in E. coli K-12.
- MSC188 E. coli K-12 strain W3110 deleted for the colanic acid biosynthetic gene cluster as described above in Example 3
- the resulting strains, MSC204 [MSC188 (pDD54)] and MSC206 [MSC188 (pDD58)] were grown in shake flask cultures and tested for chondroitin production. Strains were grown overnight from fresh colonies in CYG medium (20 g/L casamino acids, 5 g/L yeast extract, 2 g/L glucose, pH 7.2) plus chloramphenicol (20 g/mL) at 30° C and these cultures were diluted to OD A600 - 0.05 in the same medium.
- OD A600 OD A600 of approximately 0.1 (after approximately 1 hour), the inducer m-toluic acid was added to a final concentration of 2 mM.
- OD A600 values were determined and samples were taken for analysis. Culture ODs are given in Table 6-1 below.
- 10 mL samples for polysaccharide analysis were autoc laved (121° C, >15psi, 5 min.) then stored frozen. Two 5 ml aliquots of each strain at each time point were centrifuged and resulting cell pellets were stored frozen for subsequent western blot analyses.
- MSC206 produces fructosylated chondroitin.
- the detection of the polysaccharide by ELISA demonstrates that the recombinant polysaccharide produced in these strains is fructosylated chondroitin because the antiserum used in the ELISA assay is specific for the fructosylated form of chondroitin and does not recognize unfructosylated chondroitin.
- the highest level of fructosylated chondroitin production observed in this experiment was approximately 25 g/mL.
- Fructosylated chondroitin production was consistently undetectable in the control strain MSC204 that carried the vector-only plasmid, pDD54. There are quantitative differences in fructosylated chondroitin values measured between the ELISA and the HPLC assays for the MSC206 at 4 hr and 8 hr samples. These differences probably reflect the lower sensitivity of the ELISA assay. Typically, the higher the fructosylated chondroitin concentration in a given sample, the closer is the agreement between the ELISA and the HPLC assays.
- a subsequent experiment was performed to confirm the production of fructosylated chondroitin by MSC206 and to test the effect of inducer concentration on level of chondroitin produced.
- a fresh overnight culture of MSC206 was diluted to 0.05 OD A600 and grown at 30°C in CYG medium plus chloramphenicol (20 ⁇ .,) to an OD A600 of approximately 0.1. Aliquots of the culture were then induced by addition of m-toluic acid to a final concentration of 0, 0.5, 1.0, or 2.0 mM. Cultures were grown for 24 hours post-induction at which point ODs were measured and samples were taken as described above for polysaccharide assays.
- results of the ELISA assay confirm production of fructosylated chondroitin in MSC206 and are consistent with the results obtained using the HPLC assay when the de-fructosylation step is included.
- the samples with the highest chondroitin titers showed the best agreement between ELISA and HPLC assays.
- results also demonstrate the production of fructosylated chondroitin even in the absence of induction by m-TA addition.
- all induced cultures produced more fructosylated chondroitin than the uninduced culture, with the highest level of fmctosylated chondroitin being produced by the culture that was induced with 1.0 mM TO-TA.
- kpsFEOVCS+kpsMT+kfoABCFG produces unfructosylated chondroitin when expressed in E. coli K-12 or E. coli B.
- the kfoB and kfoG genes are not essential for production of unfructosylated chondroitin, but kfoG is required for optimal production.
- the genes present within region 2 of group 2 E. coli capsules are all typically involved in synthesis of the polysaccharide or the sugar nucleotide precursors of the polysaccharide (Whitfield 2006).
- the kfoB and kfoG genes encode proteins that are homologous to those encoded by genes present in capsule clusters of bacteria known to produce other glycosaminoglycan capsules. This circumstantial evidence suggests a potential role for kfoB and kfoG in biosynthesis of glycosaminoglycan capsules.
- kfoD, kfol, kfo and kfoH genes are implicated in biosynthesis of the chondroitin backbone of the K4 capsular polysaccharide.
- the present inventors hypothesized that the kfoO, kfol, kfoE and kfoH genes might encode proteins that are involved in fructosylation of chondroitin although others have hypothesized that the kfoD and kfoE genes were probably not involved in fructosylation (Ninomiya et al. , 2002 and Krahulec et al., Molec. Biotech., 2005;30:129-134.).
- pDD66 and pDD67 Two such plasmids, termed pDD66 and pDD67, were constructed as described in Example 4 above. These two plasmids also contain a gene conferring tetracycline resistance, so that tetracycline can be used in cell cultures to select for plasmid maintenance.
- a derivative of pDD58, termed pDD62 was also constructed as a control plasmid.
- the pDD62 plasmid described in detail in Example 4 above, contains ApsFEDUCS, kpsMT and kfoABCDIEHFG genes and also contains a gene that confers resistance to tetracycline.
- pDD62, pDD66 and pDD67 were transformed into MSC188 or MSC175 (W31 1 OAwcaJ described in Example 3 above) and the resulting strains were cultured and assayed for production of fructosylated chondroitin and unfructosylated chondroitin.
- MSC274 (MSC175 + pDD62), MSC279 (MSC188 + pDD66) and MSC280 (MSC188 + pDD67) were grown in CYG medium in shake flasks at 30°C with 2 ⁇ g/mL tetracycline (Tc) and induced with 1 mM w-TA as indicated. Cultures were sampled at 24 hours post-induction as described above, autoclaved, centrifuged and the resulting supernatants were assayed by the HPLC assay with, or without, a de-fructosylation step.
- Tc tetracycline
- chondroitin is only detected in the MSC274 sample that was subjected to the de-fructosylation step.
- fructosylated chondroitin is not digested by the chondroitinase that is used in the HPLC assay, and is therefore not detectable by this assay.
- Plasmids pDD66 and pDD67 were transformed into MSC139, E. coli B (ATCC11303), and the resulting strains were tested for chondroitin production.
- a control plasmid, pDD63 was also transformed into MSC139.
- This plasmid, described in Example 4 above, is a derivative of the pDD54 vector to which a tetracycline-resistance gene has been added. It contains none of the K4 chondroitin biosynthesis genes. Chondroitin production in E. coli B containing pDD63 (MSC314), pDD66 (MSC315) or pDD67 (MSC316) was evaluated in shake flasks.
- Tc 5 at 30°C.
- growth in TB medium was found to enhance recombinant production of chondroitin in E. coli as compared to CYG medium, and Tc 5 was found to be an effective concentration for plasmid maintenance without impairing cell growth.
- the cultures were inoculated at 0.05 OD A600 and induced at 0.10-0.13 by addition of 2 mM m- TA. Following induction, cultures were grown at 30°C for up to 3 days. Strain MSC315 initially grew slower than the others and was induced several hours later than MSC314 and MSC316 cultures. At 48 hours post-induction (42 hours post-induction in the case of MSC315) samples were taken for viable cell counts in the presence or absence of tetracycline and for chondroitin assays by the HPLC method.
- E. coli B does not produce a capsule but does contain a cryptic group 2 capsule gene cluster in which the region 2 genes are disrupted by an insertion element, and regions 1 and 3 genes appear functional (Andreishcheva and Vann, Gene 2004;484: 113-119).
- a plasmid containing only kfoABCFG genes was constructed. This plasmid, pCX039, is described in Example 4. Plasmid pCX039 was transformed into MSC139, E.
- coli B ATCC11303
- chondroitin production in the resulting strain designated MSC317
- the strain was grown in TB medium plus 5 ⁇ g/mL Tc at 30°C.
- the culture was inoculated at approximately 0.05 OD A600 and induced with 2 mM m-TA at an OD of approximately 0.10.
- samples were taken for viable cell counts in the presence or absence of tetracycline and for chondroitin assay by the HPLC method.
- KfoB and KfoG homologs are encoded in gene clusters of other glycosaminoglycan-producing bacteria, but the functions of these proteins remain unknown.
- the kfoB or kfoG genes were deleted from pDD66 and pDD67 to generate plasmids pCX040, pCX041, pCX042 and pCX043 which are summarized in Table 5C below. These plasmids were transformed into host strain MSC188 and cultures of the resulting strains were tested for chondroitin biosynthesis.
- This example demonstrates recombinant production of chondreitin in a variety of growth media, temperatures, asid indjseisoss cossditiom.
- a variety of different growth media can support production of chondroitin by recombinant E. coli strains carrying the E. coli K4 chondroitin biosynthesis genes.
- E. coli K4 chondroitin biosynthesis genes For optimal production of recombinant chondroitin cultures conditions such as medium composition, temperature, inducer concentration, and duration of culture post-induction need to be optimized.
- TB medium (Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)).
- This medium was tested and found to also support production of chondroitin by recombinant E. coli. Further, the effect of prolonged incubation time (up to 72 hours post-induction) on chondroitin production was also tested. Additionally, the effect on chondroitin production of induction with 1 mM vs. 2 mM ⁇ - ⁇ was also tested.
- Both CYG and TB are "complex" growth media containing hydrolyzed casein products and autolyzed yeast in which the components of the medium are not chemically defined. In some circumstances it might be desirable to employ a minimal or defined growth medium for cell culture.
- Some examples of possible defined or minimal media include "2XM9” plus glucose or glycerine and with, or without, supplementation with yeast extract (YE).
- the basal inorganic salt components of "2XM9" are: 22.6 g/L Na 2 HP0 4 -7H 2 0, 6 g/L .H2PO4, 1 g/L NaCl, 2mM MgS0 4 , 0.2 mM CaCl 2 , and 2.0 g/L NH 4 C1 (pH 7.4).
- a carbon source is added, and other supplements can be added as indicated.
- Strains MSC279 and MSC280 were cultured in shake flasks at 30°C in 2XM9 that contained 10 g/L glucose or glycerine as carbon sources. The effect of supplementation of the glucose containing medium with YE at 1 g/L also was tested.
- CYG medium plus 2 ⁇ g/mL Tc Flasks were incubated at 20°C, 25°C, 30°C, and 37°C. Cultures were inoculated at approximately 0.05 OD A600 and grown at the indicated temperatures to approximately 0.1 -0.2 OD A600 at which point cultures were induced by addition of 1 mM m-TA where indicated. One control culture at 30°C was not induced. Samples were collected at 24, 48, and 72 hours post induction for chondroitin assays and viable cell counts. Results from the terminal harvest timepoints are shown below in Table 6C. Under these conditions, chondroitin production was achieved at all temperatures tested but the best chondroitin titers achieved were at
- This example demonstrates that recombinant chondroitin can be secreted to the culture medium in E. coli K-12 and E. coli B. This example further demonstrates that chondroitin can also be produced intracellularly at high levels.
- coli serotype K5 the cell associated form is believed primarily to be associated with the outer leaflet of the outer membrane of the cell by means of a lipid anchor (Whitfield, 2006).
- the nature of the linkage between the polysaccharide and the lipid anchor has not been defined at a structural level, nor has the identity of the lipid anchor been determined.
- Recombinant chondroitin produced and detected as described in Examples 6-8 above is clearly present in the culture medium. Low speed centrifugation (10 minutes at 3500g) is sufficient to remove cells from the culture medium of samples to be assayed for chondroitin, and significant quantities of chondroitin have been detected in the cell-free supernatants.
- Strain MSC279 was grown in a shake flask in TB medium 5 ⁇ / ⁇ ⁇ Tc at 30°C.__The culture was inoculated at approximately 0.03 OD A600 and grown to approximately 0.1-0.2 A600 at which point it was induced by addition of 2 mM m-TK. At 48 hours post-induction samples were taken and assayed for chondroitin. One aliquot of this culture was autoclaved prior to being centrifuged, and the resulting supernatant and cell pellet fractions were assayed for chondroitin according to the HPLC method of Example 14.
- sample #2 whereas 45% of the total chondroitin was present in the cell pellet in the sample (sample #4) that was not autoclaved prior to centrifugation.
- the cell-associated chondroitin in the pellet of the non-autoclaved strain was found to be digested by direct CHase treatment of resuspended cells without lysis treatment.
- the quantity of surface-associated chondroitin calculated based on the amount of disaccharide released was determined to be 130-154 ⁇ g/mL (sample #5 and sample #8) in the original culture.
- this chondroitin could be present in the cell cytoplasm, in the periplasmic space, or still attached to the outer cell membrane.
- the results for these mutant strains are consistent with the notion that mutations in kpsC and kpsT block secretion of chondroitin and result in intracellular accumulation of chondroitin. Presence of this chondroitin on the cell surface can be tested by resuspending the non-autoclaved cell pellet, subjecting the resuspended cells to CHase digestion and measuring the production of the chondroitin specific disaccharide. Alternatively, electron microscopy can be employed to determine the cellular location of cell-associated chondroitin produced by MSC356 and MSC359.
- This example describes the construction of strains of E. coli K-12 that contain the chondroitin biosynthesis genes inserted in the chromosome and demonstrates chondroitin production in these strains.
- Examples 6-9 above describe chondroitin production in recombinant E. coli strains using plasmid vectors to introduce cloned genes that encode the chondroitin biosynthesis proteins into heterologous host strains. In some circumstances it could be desirable to introduce the cloned chondroitin biosynthesis genes into the chromosome of the recipient host strain. Placing the cloned genes in the chromosome eliminates the requirement for maintaining selective pressure to maintain the plasmid(s) which carry the chondroitin biosynthesis genes and could thus potentially provide more stable expression strains or expression strains that are stable in the absence of selective pressure. Therefore, E. coli K-12 strains were constructed in which the E.
- coli K4 genes for chondroitin biosynthesis are stably integrated into the host chromosome.
- These "chromosomal expression strains" employ the Pm promoter and K4 gene sets from pDD66 and pBR1052 integrated at the colanic acid biosynthesis locus.
- the xylS regulatory gene also has been integrated into the chromosome at a separate locus, the fliuA locus. Resulting constructs were shown to produce high levels of chondroitin in shake flasks and in fermentors (Examples 14 and 15).
- Expression plasmids pDD66 and pBR1052 are described in Example 4.
- the K4 chondroitin biosynthesis genes from pDD66 and pBR1052 were cloned into the pMAK-CL replacement vector which is also described in Example 3.
- This vector diagramed in Figure 8L, contains cloned DNA regions upstream and downstream of the colanic acid (CA) gene cluster and a unique Ascl cloning site at the junction of these regions.
- CA colanic acid
- the K4 gene expression cassettes were excised and gel-purified using the QIAEX II Gel Extraction Kit (QIAGEN Inc., Valencia, CA) according to the vendor protocol from pDD66 and pBR1052 as approximately 19 kb Ascl fragments and these fragments were ligated with pMAK-CL DNA that was ⁇ scl-digested, phosphatase-treated, and gel-purified. Transformants were selected for resistance to tetracycline which is carried on the Ascl fragments of pDD66 and pBR1052 along with the Pm promoters and the upstream and downstream transcription terminators. Derivatives of pMAK-CL that contained the Ascl fragments of pBR1052 or pDD66 were identified and designated pDD74 and pDD76, respectively. These plasmids are diagramed in Figure 8L.
- Plasmids pDD74 and pDD76 were transformed into MSC188 to generate strains MSC373 and MSC377, respectively, and derivatives of these strains in which the K4 gene set is integrated into the chromosome were obtained as follows. MSC373 and MSC377 were grown overnight at 30°C in LB + 5 g/mL tetracycline (Tc 5 ) and an aliquot of approximately 20 was spotted and streaked onto an LB + Tc 5 plate which was incubated overnight at 41 °C. Colonies that arose on this plate were picked and re-streaked on LB + Tc 5 plates at 43°C.
- Tc 5 tetracycline
- TcR, CmS derivatives termed MSC391 and MSC392, respectively, were putative replacement strains in which recombination has occurred in such a way the K4 DNA sequence remains in the chromosome at the CA locus while the remainder of the plasmid sequences have been excised by homologous recombination and the plasmid subsequently lost.
- PCR analyses of these isolates showed that the 5' and 3' ends of the approximately 19 kb K4 DNA fragment are present in the expected location with respect to the chromosomal DNA sequences that flank the colanic acid locus.
- DNA regions upstream and downstream of the E. coli fliuA gene were cloned by PCR, assembled and sequenced and this deletion fragment moved into the pMAK705 suicide plasmid to create a replacement vector for the fhuK locus termed pMAK705- AfliuA, or pDD73 ( Figure 8M).
- the xylS regulatory gene was cloned into this replacement vector as follows. The xylS gene was excised from pDD42 as a Pstl fragment and cloned into the Pstl site of pDD73 to generate pDD77, which is diagramed in Figure 8N.
- the Pstl fragment of pDD77 is identical to the y/S-containing Pstl fragment present in expression plasmids pDD66 and pBR1052, and the parent vector pDD54.
- the K4 gene cluster replacement strains, MSC391 and MSC392, described above were transformed with pDD77.
- Two isolates each from transformation of MSC391 and MSC392 by pDD77 were selected and designated as follows: MSC402 ⁇ MSC391 pDD77 "isolate A"
- MSC405 ⁇ MSC392 pDD77 "isolate B" [0307] These strains were all tested in shake flasks for chondroitin biosynthesis. Strains were grown in TB medium at 30°C + Cm 34 to select for maintenance the pDD77 plasmid. At OD A600 of approximately 0.2, cultures were induced by addition of 2 mM m-toluic acid (m-TA). Samples were taken at 24 and 48 hours post-induction and assayed for chondroitin. All four strains produced chondroitin. Results of these assays are shown in Table 8A below. The chondroitin levels for induced MSC404 and MSC405 were approximately 2.5-fold higher than MSC402 and MSC403.
- MSC404 and MSC405 produced about 65-70% the amount typically seen with MSC279 (MSC188 pDD66) in shake flasks under these culture conditions; approximately 0.5 g/L.
- the strains (MSC404 and MSC405) derived from pBR1052 appeared to be more productive than the strains derived from pDD66, but both chromosomal genes sets functioned sufficiently well to produce chondroitin.
- the chromosomal K4 gene set derived from pBR1052 contains a second copy of the Pm promoter inserted immediately upstream of the kpsF gene. This added promoter was shown to enhance expression of the downstream genes ( ⁇ cwFEDUCS) in the plasmid pBR1052 relative to expression in pDD66. It is possible that the additional Pm promoter also increases downstream gene expression in the chromosomal context and that the enhanced expression of these genes can significantly increase CH production.
- MSC403 and MSC405 were obtained in which the plasmid-borne xy/S gene of pDD77 was integrated into the chromosome at the fliuA locus using the two step "pop- in/pop-out" method as follows.
- MSC403 and MSC405 were grown overnight at 30°C in LB + Cm 34 . These cultures were diluted 10 4 -fold and 0.1 mL aliquots were plated on LB + Cm 34 at 43°C. After overnight incubation approximately 100 colonies of varying size were obtained. Isolated colonies were picked and streaked onto LB + Cm 34 plates and grown overnight at 43°C.
- Isolated colonies from these platings were picked and used to inoculate 5 mL cultures of LB without any antibiotic. These cultures were grown overnight at 30°C and subsequently twice passaged by 1000-fold dilution and overnight growth in LB at 30°C. This third passage was then diluted 10 6 -fold and 0.1 mL aliquots were plated on LB at 30°C and 37°C. Individual colonies from these platings were toothpicked onto LB and LB + Cm 34 to test for loss of the plasmid.
- Chloramphenicol-sensitive (CmS) isolates were readily obtained, and these were screened by PCR to identify the desired "pop-out" replacement strains in which recombination occurred in such a way that the xy/S-containing DNA sequence remained in the chromosome at the fliuA locus while the remainder of the plasmid sequences were excised and the plasmid subsequently lost. This event also results in deletion of the entire fliuA gene from the E. coli chromosome. PCR analyses of these isolates indicated that the 5' and 3' ends of the xy/S DNA fragment now are present in the expected location with respect to the chromosomal DNA sequences that flank the fliuA locus.
- the resulting strains, MSC410, derived from MSC403, and MSC411, derived from MSC405, contain the xy/S gene inserted at the fliu A locus and retain the K4 genes inserted at the colanic acid locus.
- MSC410 and MSC411 were tested for chondroitin biosynthesis. Strains were grown in
- Plasmid pDD77 was transformed into MSC410 and MSC41 1 to test for the functionality of the chromosomal K4 gene sets in these two strains.
- the resulting strains were designated MSC436 (MSC410 pDD77 "isolate A"), MSC437 (MSC410 pDD77 “isolate B"), MSC438 (MSC41 1 pDD77 "isolate A”) and MSC439 (MSC411 pDD77 "isolate B”).
- MSC436 MSC410 pDD77 "isolate A"
- MSC437 MSC410 pDD77 "isolate B”
- MSC438 MSC41 1 pDD77 "isolate A”
- MSC439 MSC411 pDD77 "isolate B”
- the xylS genes the in chromosomes of MSC410 and MSC411 were sequenced to test these hypotheses.
- the region of the E. coli chromosome containing the xy/S gene insertion was amplified by PCR using primers that flank the integration site and the amplified DNA segment was sequenced.
- the sequence of the xy/S promoter and coding regions exactly matches the expected sequence. This result suggested that the defect in xy/S function in MSC410 and MSC411 is due to insufficient expression of the XylS protein from the chromosomal gene. Therefore, experiments were performed to enhance expression of the xy/S gene.
- xy/S gene promoter Toward that end, a synthetic optimized version of the xy/S gene promoter, ribosome binding site, and 5' untranslated region (UTR) was designed and synthesized, and those modified sequences were introduced into the xy/S replacement vector pDD77 and subsequently into the chromosome.
- UTR 5' untranslated region
- the synthesized fragment contains 134 bp of sequence matching the Blpl - Pstl sequence of pDD77 followed by 86 bp of synthetic sequence up to the ATG start codon of xy/S and extends 37 bp further into xy/S coding sequence through the unique Bglll site.
- the sequence from the ATG through the Bglll site matches the sequence present in pDD77.
- the Blpl - Bglll fragment can be readily introduced into pDD77 because these restriction sites are unique in this plasmid.
- the 86 bp synthetic sequence (shown below) (SEQ ID NO:98) includes a consensus E.
- coli promoter (based on Hawley and McClure, Gene 1983;11:2237-2255.) and a consensus Shine- Dalgarno (S-D) sequence (Shine and Dalgarno Proc. Natl. Acad. Sci. U S A. 1974;71 :1342-6).
- S-D Shine- Dalgarno
- the sequence also incorporates a stem-loop structure (indicated by underlined text) at the 5' end of the predicted mRNA. All of these features are expected to promote efficient expression of the XylS protein.
- the Blpl-BgUl fragment (SEQ ID NO: 140) was synthesized by a commercial vendor (DNA2.0) and the synthetic DNA containing the modified sequences was cloned into the xy/S replacement vector, pDD77, as a Blpl - BgUl fragment in place of the native Blpl - BgUI fragment containing the native xylS regulatory sequences.
- the plasmid containing the modified xylS termed pDD79 ( Figure 8N) was transformed into MSC392 to test the ability of the modified xylS gene to activate the Pm promoter and drive chondroitin production.
- MSC392 transformants containing pDD79 were picked and designated MSC458, MSC459 and MSC460. These strains, along with the MSC392 parent, were tested for chondroitin production in the standard shake flask experiment. Strains were grown in TB medium (MSC392), or TB + Cm 34 (MSC458-460), at 30°C and, at OD A600 of approximately 0.2, cultures were induced by addition of 2 mM m-TA. Samples were taken at 24, 48 and 72 hours post-induction. The 48 hour samples were assayed for chondroitin. All of the pDD79-containing strains produced approximately 300 ⁇ g/mL in both induced, and uninduced, cultures. In contrast, MSC392, lacking a xylS gene, produced only 4 ⁇ / ⁇ chondroitin in both induced, and uninduced, cultures. These results are shown below in table 8D.
- Chloramphenicol- sensitive (CmS) isolates were readily obtained and 6 such isolates from each culture were screened by PCR to identify the desired "pop-out" replacement strains in which recombination occurred in such a way that the y/S-containing DNA sequence remained in the chromosome at the fliuA locus while the remainder of the plasmid sequences were excised and the plasmid subsequently lost. This event also results in deletion of the entire fliuA gene from the E. coli chromosome. PCR analyses of these isolates indicated that the 5' and 3' ends of the xylS DNA fragment now are present in the expected location with respect to the chromosomal DNA sequences that flank the fliuA locus.
- MSC466 and MSC467 derived from MSC459
- xylS gene with synthetic promoter
- MSC466 and MSC467 were tested for chondroitin biosynthesis in shake flasks. Strains were grown in TB medium at 30°C and, at OD A600 of approximately 0.2, cultures were induced by addition of 0, 1 , 2 or 4 mM m-TA. Samples were taken at 24, 48 and 72 hours post-induction. Chondroitin assay data from the 48 hour samples are shown below in Table 8E. Both strains produced substantial titers of chondroitin (>400 pg/mL) when induced with 1 or 2 mM m-TA. Cultures induced with 4 mM m-TA produced somewhat lower chondroitin titers.
- MSC467 contains the tetracycline-resistance gene derived from pDD74 (see Figure 8L) inserted in the chromosome immediately downstream (3') of the kpsS gene of the chromosomal K4 gene cluster. (See Figure 8T)
- this chromosomal tetracycline-resistance gene was deleted from the chromosome of MSC467, as detailed below, using the "pop in / pop out" procedure described in Example 3.
- the resulting tetracycline-sensitive derivative of MSC467 was designated MSC561. Construction of MSC561 was accomplished as follows.
- BLR476 5> CGTCAAGCTTGTGAACGCCTATAGCAGCTTG >3 (SEQ ID NO : 101 )
- BLR478 5> CAGTGGCGCGCCGAGCGATGATAAGCTGTC >3 (SEQ ID NO: 102)
- CL (described in Example 3 and Figure 8L) plasmid DNA that had been digested with Hmdlll and Ascl and treated with Antarctic Phosphatase (New England BioLabs, Ipswich, MA) according to the vendor protocol. Ligation products were transformed into E. coli NEB5a (New England BioLabs, Ipswich, MA), and plasmid DNAs from resulting transformants were screened for the presence of the cloned PCR fragment by diagnostic restriction endonuclease digestions. The recombinant plasmid from one such transformant was designated as pBR1087 and used in gene replacement experiments to delete the tetR gene from the MSC467 chromosome.
- pBR1087 The structure of pBR1087 is diagrammed in Figure 8U.
- This plasmid was transformed into MSC467 with selection for chloramphenicol-resistance at 30°C, the permissive temperature for replication of the pMAK705-based replicon. Cultures grown at 30°C were subsequently plated at 43°C in the presence of chloramphenicol at 34 ⁇ g/mL (Cm 34 ), and resulting colonies were picked and streaked onto LB + Cm 34 plates at 43°C.
- Resulting colonies were screened by PCR for the integration of pBR1087 at the targeted locus, and isolates that were identified as containing the plasmid sequences integrated at this locus were sub-cultured in LB liquid medium at 30°C in the absence of chloramphenicol. Subsequently, isolates thus sub-cultured were plated on LB at 30°C in the absence of chloramphenicol, and resulting colonies were tested for sensitivity to chloramphenicol and tetracycline.
- MSC561 One strain that was thus identified as having undergone deletion of the tetR gene was designated as MSC561 and the structure of the chromosomal K4 gene cluster of MSC561 is shown in Figure 8T.
- the deletion extends from 71 bp downstream of the kpsS coding sequence up to the Ascl site at the 5' end of the sequences downstream of the colanic acid locus.
- the deletion includes the entire tetR gene.
- E. coli K-12 strain MSC467 (Example 10) contains regions 1, 2, and 3 at the colanic acid locus under control of the Pm promoter and xylS at the fliuA locus under control of the synthetic consensus promoter.
- Plasmid pCX039 (Example 4) contains the region 2 kfoABCFG genes under control of the Pm promoter and also contains the native xylS gene.
- pCX039 was transformed into MSC467 to create strain MSC499.
- Control strain MSC498 was created by transforming pDD63 (Example 4) into MSC467. Chondroitin production in shake flask cultures (TB/Cm 34 medium, 30°C, 72 hr) with variable inducer concentrations was determined for these two strains. (Table 9A).
- plasmids pDD63 and pCX039 lacking xylS genes were constructed. These plasmids each contain two Nsi I restriction sites that flank the entire xylS gene coding sequence within 1049 bp fragments (see Example 4). Samples of these plasmids were digested with Nsil, heat-treated to inactivate the enzyme, and then treated with T4 DNA ligase to generate circular plasmids lacking the xylS gene fragment. The pDD63 (Nsi was first transformed into E. coli MSC188 (Example 3).
- the characterized pDD63zir ⁇ /S plasmid was named pCX069. This plasmid was subsequently transformed into E. coli MSC467 (Example 10) to create strain MSC510. The pCX039 Nsi sample was transformed directly into MSC467, and the characterized AxylS plasmid was named pCX074. Chondroitin production by these strains plus the MSC498 and MSC499 control strains was determined as described previously in this Example, and the results are shown in Table 9B.
- Example 4 above describes the derivation of plasmid pDD80, a pMAK705-based replacement plasmid designed for insertion of xylS and the region 2 kfoABCFG genes, all expressed from the synthetic consensus promoter, into the E. coli chromosome at the fliu A locus.
- Table 9C below describes chondroitin production in MSC467 (chromosomal xylS) and MSC392 (no xylS) strains (Example 10) containing pDD80 as an extra-chromosomal element.
- plasmid pDD80 enhanced chondroitin production in E. coli host strains containing chromosomal copies of the entire complement of K4 chondroitin biosynthesis genes (regions 1 , 2, and 3). Induction had little effect on chondroitin production in strains containing pDD80, regardless of the presence or absence of xy/S copies in the chromosome. This is likely a result of a relatively high level of XylS in these strains due to expression, from a multicopy plasmid, of the modified xy/S gene driven by the strong synthetic promoter, and containing the optimized ribosome binding site and hairpin structure added to the mRNA 5-prime end.
- Example 11 above demonstrates that chondroitin production by strain MSC467 in shake flasks was greatly enhanced when extra copies of the K4 region 2 genes kfoABCFG under control of the Pm promoter were introduced into MSC467 on plasmid pCX039. Similar results were obtained when plasmid pDD80 was introduced into MSC467. Plasmid pDD80, described in Example 4 carries the kfoABCFG genes under transcriptional control of the synthetic xy/S promoter described in Example 10 above. These results indicate that increasing the levels of one or more of the proteins encoded by the kfoABCFG genes significantly increases chondroitin production.
- Cloning of these genes on a multi-copy plasmid provides one method for increasing the production of these proteins.
- An alternative method for increasing the production of these proteins, without employing a plasmid expression platform, is to insert multiple copies of these genes into the chromosome of the host organism.
- a replacement vector was constructed for this purpose by cloning the kfoABCFG genes on a Pstl fragment excised from pCX039 into the compatible Nsil site of pDD79 as detailed in Example 4.
- the kfoABCFG genes are transcribed by the synthetic xylS promoter which was designed to be a strong constitutive promoter.
- pDD80 was transformed into MSC467 to produce strain MSC522 which was shown in Example 10 above to produce approximately 1 g/L chondroitin in shake flasks.
- a replacement strain (MSC537) was derived from MSC522 via procedures for pMAK705-based plasmid replacements as detailed in Example 3 and Example 10 above. This strain carries one additional copy of the kfo ABCFG genes inserted at the fliuA locus, immediately downstream of the xylS gene, in the MSC467 chromosome.
- MSC537 was tested in parallel with MSC467 for chondroitin production. Cultures were inoculated at approximately 0.01 OD A600 in TB medium at 30°C. At an OD of approximately 0.10, cultures were induced by addition of 1 mM m-TA and cultured for an additional 72 hours. Samples were taken for chondroitin assays at 48 and 72 hours post-induction. At 72 hours post- induction, MSC537 produced 0.57 g/L chondroitin while MSC467 gave 0.45 g/L; an increase of approximately 25% for MSC537 vs. MSC467.
- the MSC537 strain contains the tetracycline-resistance gene derived from pDD74 (see Figure 8L) inserted in the chromosome immediately downstream (3') of the kpsS gene of the chromosomal K4 gene cluster present in MSC537.
- the ietR gene was deleted from the chromosome of MSC537 using the same procedures, and replacement plasmid (pBR1087) as described above in Example 10 for deletion of the ietR gene from the chromosome of MSC467.
- MSC562 The resulting tetracycline-sensitive derivative of MSC537 was designated MSC562.
- MSC562 and MSC537 were grown in TB medium at 30°C and induced by addition of 1 mM m- ⁇ . Chondroitin titers of culture samples harvested at 72 hours post-induction were determined and found to be comparable to each other; 0.51 g/L for MSC562 vs. 0.57 g/L for MSC537.
- Plasmids pCX039 which contains the kfo ABCFG genes as shown in Figure 8Q, and pDD63, the vector-only control plasmid shown in Figure 81, were transformed into strain MSC562 to create strains MSC564 and MSC563, respectively.
- MSC563 and MSC564 were grown at 30°C in TB medium containing tetracycline (5 ⁇ g/mL) for plasmid selection and induced with 1 mM m- ⁇ .
- cultures of MSC564 and MSC563 produced chondroitin at titers of 0.81g/L and 0.29 g/L, respectively.
- additional methods for increasing the production of the proteins encoded by the ⁇ bABCFG genes include codon optimization of protein coding sequences, and optimization of the sequences of promoters, ribosome binding sites and 5 -prime untranslated regions of mRNAs of these genes. Such sequence optimizations could be applied to genes that were expressed from plasmid vectors and to genes that were inserted into the chromosome.
- This example describes the introduction of chondroitin biosynthesis genes into Xanthomonas campestris using plasmid vectors and chromosomal integration, and demonstrates recombinant DNA mediated chondroitin biosynthesis in Xanthomonas campestris in shake flasks.
- plasmids containing combinations of the K4 biosynthetic genes and their introduction into Xanthomonas campestris strain MSC255 Further described is the use of derivatives of plasmids pKMOOl and pKM002 (described in Example 3) to stably insert the chondroitin biosynthetic genes and subsets thereof into the X, campestris strain MSC255 chromosome at the site of the deletion of the xanthan gum operon. Introduction of chondroitin biosvnthet ' c genes into X. campestris as extra-chromosomal elements.
- the present inventors have discovered that introduction of large plasmids into X, campestris directly from E. coli donors ⁇ e.g., via tri-parental crosses) or as plasmid purified from E. coli strains ⁇ e.g., via electroporation - see below) can result in structural anomalies in the resulting plasmid in X. campestris. Relatively small plasmids appear less sensitive to this phenomenon, which may be due to restriction systems native to X. campestris (Feyter and Gabriel, J. Bact. 1991;173:6421-6427, da Silva et al, Nature 2002;417:459, Roberts et al, Nuc. Acid Res.
- Electroporation was used to introduce plasmids into X. campestris cells (Oshiro et al, J.
- Plasmid pDD67 (described in Example 4) was digested with restriction enzymes BamHl and Rsrll (which bound the region 2 genes) followed by reaction with T4 DNA polymerase (to create blunt ends) and ligation. The resulting mix was transformed into E. coli, and tetracycline-resistant isolates were characterized. The resulting plasmid, pKM005, shown in Figure 10A, containing Pm-driven regions 1 and 3 genes, was then transformed by electroporation into X, campestris to create strain MSC338. Likewise, pCX039 (Example 4) was transformed into X. campestris to create MSC326.
- One X, campestris transformant, MSC348, was shown to contain the plasmid pKM007 ( Figure 10A) which was indistinguishable from pDD67 by restriction digests of plasmid that had been transferred back to E. coli.
- X. campestris strain MSC255 was transformed with pDD63 vector to create strain MSC397.
- Plasmid pJAK15 (ATCC77290, obtained from ATCC) belongs to the IncQ incompatibility group and encodes kanamycin resistance.
- the HmdUIA4vrII fragment from pKM005 (containing the Pm-driven regions 1 and 3; see above) was ligated with the vector/kanamycin resistance H/ «dIII/A3 ⁇ 4aI fragment from pJAK15.
- Strain MSC326 (MSC255 pCX039) was transformed with pKM006 with simultaneous selection for kanamycin and tetracycline resistance to create strain MSC350.
- the knock-out vectors pKMOOl and pKM002 were first modified by introduction of a short DNA oligonucleotide linker that carries Ascl, Sbfi, Swal and Xhol cloning sites into the Noil restriction sites that define the junctions of the upstream and downstream regions of homology in pKMOOl and pKM002.
- the linker was made from annealed oligonucleotides prKM015 and prKM016 such that single-strand overhangs were present that are compatible with those generated by Noil digestion of pKMOOl and pKM002.
- the resulting plasmids designated pKM008 and pKM009 respectively, contain the linker oriented such that the Ascl restriction sites are proximal to the upstream regions.
- prKMO 15 (5 ' -3 ' ) GGCCGCGGCGCGCCTGCAGGATTTAAATCTCGAGGC (SEQ ID NO:99)
- prKMO 16 (3 ' -5 ' ) CGCCGCGCGGACGTCCTAAATTTAGAGCTCCGCCGG (SEQ ID NO: 100)
- Replacement vectors having only the K4 region 2 genes were constructed as follows: pKM008 was digested with Sbfi-Xhol or Ascl-Xho and pCX039 was digested with Sbfi-Sall or Ascl-Sall. Sbfl-Sall treatment produces a kfoABCFG- containing fragment from pCX039 and Ascl-Sall treatment produces a Pm promoter- ⁇ ABCFG- containing fragment.
- pKMOlO and pKMO 11 were digested with Sbfi-Avrll and these linearized vectors were ligated with the ApsFEDUCSMT-containing fragment produced by Sbfi-Avrll digestion of pDD67.
- the resulting plasmids were designated pKM012 (Pm-) and pKM013 (Pm+).
- Derivation of plasmids pKMOlO (SEQ ID NO: 145) and pKM012 (SEQ ID NO: 147) is diagrammed in Figure IOC.
- Derivation of plasmids pKMOl l (SEQ ID NO: 146) and pKM013 (SEQ ID NO: 148) is diagrammed in Figure 10D.
- Plasmid pDD63 (carrying the xylS inducer gene) was then transformed into the recombinants in which the Pm promoter is driving the K4 gene sets.
- the genetic structure of the four key Xanthomonas chromosomal insertion strains (containing no plasmid-encoded K4 genes), MSC480, MSC469, MSC461, and MAC494, is summarized in Table 10A.
- Xanthomonas campestris strain MSC255 (Ag mB-gumM) transformed with various plasmids was determined by culturing and assaying as described above. Results are shown in Table 10B.
- control strain MSC397 containing the empty vector, made no detectable chondroitin.
- Strains MSC348 and MSC350 containing the regions 1 , 2, and 3 genes, produced about 40 ⁇ g/mL chondroitin under these conditions.
- Recombinant chondroitin (rCH) was captured using an anion-exchanger DEAE-cellulose DE52 column. After washing with 5 volumes of 100 mM NaCl, the column was eluted with 5 volumes of 300 mM NaCl. The eluate was concentrated and dialyzed against 10 volumes of distilled water. The dialyzed solution was lyophilized. The lyophilized powder was used as rCH.
- Fructosylated chondroitin capsular polysaccharide (K4P) was purified from the culture of strain Ul-41 ⁇ Escherichia coli 05:K4:H4) according to the method of Manzoni, M. et al. (Biotechnology Letters 1996; 18:383-386). Preparation of defructosylated K4P (DFK4P) from K4P was performed according to the method of Lidholt, K., et al. (J Biol. Chem. 1997;272: 2682).
- Flask culture samples typically 5 mL were autoclaved at 121°C at >15 psi for 5 min. and allowed to cool. Samples were then re-adjusted to the original volume with water as needed to account for losses during autoclaving. Samples (1.5-5 mL) were centrifuged (typically 3500g for 10 min. for lower cell density flask cultures; 12000g for 5 min. for fermentation or higher density cultures) to yield supernate and pellet fractions. In some cases, as indicated, samples were centrifuged without prior autoclaving. Culture samples or separated supernates and pellets were usually stored at -20°C until assayed.
- cell pellets were resuspended in an original volume of 50mM sodium phosphate buffer pH 7.2 and hydrolyzed with 5-lOmg/mL lysozyme (Sigma L-7651) and 60 U/mL deoxyribonuclease I (Sigma D-4527) at 37°C for 2 hr followed by 200 ⁇ g/mL proteinase K (Promega V3021) at 37°C for 1 hr. After terminating the reaction (90°C, 5 min), the solutions were centrifuged to remove cell debris.
- samples for analysis of fructosylated chondroitin capsular polysaccharide (K4P), samples (flask/fermentation broth supernates or clarified hydrolyzed cell pellets) were first defructosylated using mild acid hydrolysis; i.e., adjusted with HC1 to pH 1.5, incubated at 80°C for 30 min. and then neutralized with 0.5 M sodium carbonate.
- mild acid hydrolysis i.e., adjusted with HC1 to pH 1.5
- the DFK4P samples and the non-fructosylated rCH samples were dialyzed overnight against deionized water (Pierce Biotechnology Slide-A-Lyzer®, molecular weight cut-off 7 kD) or partially purified by centrifugal ultra-filtration (Amicon Ultra-0.5 Centrifugal Filter Device, lOkD nominal molecular weight cut-off) with elution in deionized water.
- the resulting unsaturated disaccharide (2-acetamido-2-deoxy-3-0- (P-D-gluco-4-enepyranosyluronic acid)-D-galactose; Adi-0S) was separated by reverse-phase ion- pair HPLC (Senshu Pak Docosil, 4.6 x 150 mm; particle size, 5 ⁇ ), labeled post-column with 2- cyanoacetamide, detected with fluorescence (Toyoda, EL, et al. J, Biol. Chem., 2000; 275:2269), and quantified against external standards prepared from commercially available chondroitin (Seikagaku Biobusiness, Japan) or rCH.
- the typical calibration curve for the disaccharide is shown in Figure 1 IB.
- the calibration curve for the disaccharide was linear in the range of 2 to 200 ⁇ g/mL, and the detection limit of the disaccharide was 1 ⁇ g/mL.
- the concentration of the chondroitin polysaccharide can be calculated using the following formula,
- [A] represents the peak area of Adi-0S in the sample chromatogram
- [S] represents the slope of calibration curve for Adi-0S concentration
- [D] represents the dilution factor
- Biotinylation coupling through carboxyl groups of K4P was performed according to the method of Osmond, R. I.W. et al, Analytical Biochemistry 2002;310: 199-207). 100 ⁇ of biotinylated K4P (1 ⁇ g/ml) was conjugated to a streptoavidin coated 96-well micro-titer-plate (Thermo Scientific, Japan) at room temperature for 30 min. After washing the plate using 50 mM Tris-HCl buffered saline (NaCl lOOmM) supplemented with 0.05 % TWEEN® 20 and 0.05% Proclin (pH 7.5).
- Weight average molecular weight (“Mw”) and chondroitinase-digestibility of polysaccharides was determined by analyzing on a SEC-HPLC using an TOSOH HLC-8220GPC system equipped with a refractive index detector and tandem columns of TSK-gel PWXL-4000, PWXL-3000, and PWXL-2500 (TOSOH, Japan) at a constant flow rate of 0.6 mL/min with 0.2 M NaCl. Fifty ⁇ L of polysaccharide solution was injected at a concentration of 1 mg/mL on the column. The columns and detector compartment were maintained at 40°C. Mw-defined chondroitin sulfates (Mw: 52.2, 31.4, 20.0, 10.0, 6.6, and 1.0 kDa) were used as molecular weight standards.
- K4P and DFK4P were dissolved in 50 mM THB (Tris-HCl with 50 mM sodium acetate pH 8.0), to give a final concentration of 1 mg/mL and divided into equal parts. A part of the solution was directly analyzed on the SEC-HPLC as described above. Another part was analyzed on the same system followed by processing with chondroitinase ABC (final concentration; 2 units/mL) at 37°C for 3 hours. Results are shown in Figure 13. The molecular weight values of K4P and DFK4P prepared from the culture of E.
- THB Tris-HCl with 50 mM sodium acetate pH 8.0
- coli K4 Ul-41 were 33 kDa and 28 kDa, respectively.
- DFK4P was completely digested into the disaccharide, Adi-0S, by chondroitinase treatment whereas K4P was partially digested with the enzyme (Figure 13).
- K4P was converted to the defructosylated form without affecting the chondroitin backbone structure of K4P by the defructosylation process described above. Consequently, the amount of K4P in samples can also be determined by quantifying the disaccharide enzymatically produced from the polysaccharide using the chondroitinase/HPLC method when samples were processed in the defructosylation process before the enzyme digestion.
- This example illustrates sulfation of chondroitin.
- chondroitin prepared in Example 14 was subjected to partial depolymerization to obtain a chondroitin of molecular weight app. 30 kDa. 30 mg of this chondroitin was solubilized into 0.6 mL of dry formamide (FA) with stirring at 60°C. When the solution became completely homogeneous, solid sulfur trioxide-TEA complex (5 eq. of chondroitin disaccharide unit) was added and the stirring was continued for 120 min. The sulfation reaction was stopped by addition of 3x vol. of 1 M sodium acetate solution and was allowed to stand for another 30 min at room temperature.
- FA dry formamide
- the solution was dialyzed against distilled water for 3 days, neutralized by NaOH, and lyophilized to a white powder (32 mg, 107 %). Further analysis of the recombinant chondroitin sulfate demonstrated a molecular weight of 29 kDa, 5.2 % of sulfur.
- chondroitin biosynthetic region 2 gene set (kfoABCFG) is sufficient for maximal enhancement of chondroitin production in E. coli strain MSC562.
- a set of plasmids containing combinations of the regions 1, 2, and 3 (Rl, R2, and R3) gene sets was prepared from pBR1052 ( Figure 8K) and pDD67 ( Figure 8J).
- sets of genes were deleted by digestion of a starting plasmid with particular restriction enzymes; generation of blunt ends, for example, with T4 polymerase; and ligation of the resulting vector fragments.
- E. coli strain MSC188 (Example 3) was transformed with the ligation reactions, and selected antibiotic resistant transformants were evaluated for the desired features. Due to the fact that pBR1052 contains a second Pm promoter preceding the region 1 gene set, some of the plasmids described here also contain a second Pm promoter.
- Plasmids pCX097 and pCXIOl were used as starting plasmids for pCXIOO and pCX102, respectively.
- Each of the final plasmids was transformed into host strain MSC562 resulting in the strains given in Table 12 below. These strains and pre-existing control strains were grown in shake flasks with 2xM9/tet5 medium, induced with 1 mM weta-toluic acid at OD600 values of approximately 0.1-0.12, and evaluated for growth (OD600) and rCH production after 72 hours.
- Plasmid pCX039 ( Figure 8Q; containing the region 2 genes kfoABCFG) drove a large (8 to 10-fold) increase in rCH production when present in host E. coli strain MSC562 (as compared to MSC562 containing the empty vector pDD63).
- two sets of plasmids were derived from pCX039 to demonstrate the roles of individual region 2 genes on stimulation of rCH production by pCX039.
- a second set of pCX039 derivatives was designed to evaluate the effects of the presence of individual plasmid-borne region 2 genes on enhancement of rCH titers in host strain MSC562.
- the promoter- proximal kfoA gene was retained in all constructs. While this design strategy does not allow for evaluation of plasmid-encoded kfoB, C, F, or G genes in complete isolation, the retention of the kfoA gene and the resulting fixed relationship between the Pm promoter and the first reading frame in all of these plasmids are expected to make expression levels from the Pm promoter comparable.
- Table 15 were carried out. All plasmids contain xylS.
- Each of the final set of plasmids was transformed into host strain MSC562 resulting in the strains given in Table 16 below. These strains and MSC563 and MSC564 controls were grown in shake flasks with 2xM9/tet2 medium, induced with ImM meta-toluic acid at OD600 values of 0.08-0.18, and evaluated for growth (OD600) and rCH production after 68 hours.
- This example illustrates constructs for increased chromosomal copy number of chondroitin biosynthetic gene region 2 for greater chondroitin production.
- Example 12 demonstrates that the addition of a single chromosomal copy of the region 2 gene set (kfoABCFG) in an E. coli host already containing single chromosomal copies of regions 1, 2, and 3 leads to a significant 20-30% increase in rCH production.
- Example 11 demonstrates that a similar host containing a multi-copy plasmid carrying the region 2 gene set leads to a 2- 300% increase in rCH production.
- this example describes the construction and use of plasmids designed to increase the chromosomal complement of region 2 copies (driven by the Pm promoter) by inserting them into various non-essential chromosomal genes chosen specifically to facilitate identification of such insertions. It is noted that in using the homology-driven "pop-in/pop-out" methodology (see Examples 4 and 12) to successively insert copies of region 2 gene sets into different loci in the host E. coli chromosome, there is increasing competition for undesired targeting (homology- driven recombination) into pre-existing region 2 inserts instead of the desired locus. Therefore, having a means of initially identifying strains containing inserts at the desired locus by simple colony screening instead of by more laborious and time-consuming PCR becomes increasingly beneficial as the number of region 2 copies in the host strain rises.
- E. coli target loci are described. These are the genes lacZ, mtlA, and the /rwBKA operon (referred to as "fruA" for simplicity in some cases) that are necessary for growth on the sugars lactose, mannitol, and fructose, respectively, but not for growth on other carbon sources such as glucose or glycerin.
- Colonies of strains disrupted for these genes can be visually identified on indicator agars such as MacConkey's (Miller, JH, Experiments in Molecular Genetics, 1972) by colony color differences: pink/red for strains able to utilize the incorporated sugar and white/light pink for strains with gene disruptions (e.g., insertions).
- indicator agars such as MacConkey's (Miller, JH, Experiments in Molecular Genetics, 1972) by colony color differences: pink/red for strains able to utilize the incorporated sugar and white/light pink for strains with gene disruptions (e.g., insertions).
- LB/Xgal/IPTG agar medium ibid.
- Primers DHD266c and DHD267c contain one-strand halves of a multiple restriction (cloning) site (Noil, Xhol, Ascl, Sail, BgUl, HindUi) and are complementary except for 2-base single strand ends that (when annealed) are compatible with overhangs generated by digestion of pMAK705 with Asel and Clal. Neither Asel nor Clal restriction sites are regenerated upon ligation of these compatible ends.
- Plasmid pMAK705 was digested with Asel and Clal, and the vector fragment was gel- purified. Phosphorylated oligonucleotides DHD266c and DHD267c were annealed (200 nM each oligonucleotide, 90°C for 5 min, slow cooling to 50°C for 30 min), and then ligated to the pMAK705 vector fragment. Ligation reactions were transformed into E. coli ⁇ with selection for chloramphenicol resistance. Plasmids in isolated transformants were screened by PCR and then for the presence of MCS restriction enzyme sites. Sequencing of the MCS region identified a plasmid with the desired structure. This plasmid was named pMAK705pl (SEQ ID NO:157; Figure 14Q).
- step 2 Due to the end homologies designed into the upstream and downstream PCR products (now templates in step 2), the results of the step 2 reactions were DNA fragments comprising the appropriate orientations of the upstream and downstream regions flanking multi-cloning sites.
- the PCR products from step 2 were digested with enzymes whose recognition sequences were designed into the "outside" primers: NotI for upstream ends and HmdIII for the downstream ends. These fragments were then individually cloned into pMAK705pl (SEQ ID NO: 157) digested with NotI and Hz «dIII.
- the three resulting plasmids contained approximately 900-lOOObp of properly oriented upstream (UP) and downstream (DN) regions flanking multi-cloning sites (MCS) to be used to accept R2 copies.
- MCS multi-cloning sites
- UP upstream
- DN downstream
- MCS multi-cloning sites
- Pm:R2 could be isolated from pBR1096 as aXhoVAscl fragment for cloning into pBR1093 ( Figure 14S), pBR1094 ( Figure 14V), and pBR1095 ( Figure 14W).
- Table 17 provides the designation of the final replacement pMAK705-based Pm:R2 insertion plasmids pBRl lOO (for the lacA locus), pBRl lOl (for the mtlA locus), and pBR1102 (for the fruBKA locus).
- Transformants were then plated at 43 °C to MacConkey/fructose/Cm agar (for pBR1102 transformants), MacConkey/mannitol/Cm agar (for pBRl 101 transformants), or LB/Xgal/IPTG/Cm agar (for pBRl 100 transformants). Colonies that were conspicuously less colored were chosen for further analysis. Among these, strains with plasmids integrated into the target loci were identified by PCR. Strains with successfully- integrated plasmids were then grown for multiple (e.g., 20-30) generations in the absence of chloramphenicol selection.
- strain MSC702 contains the following key elements: Pm[£/wMT ⁇ oABCFG]Pm[£/ «FEDUCS] inserted at the colanic acid locus, Psyn[;ty/S] inserted at the fliuA locus, Pm[ ⁇ bABCFG] inserted at the fruBKA, lacZ and mtlK loci, and (presumed due to its derivation from MSC691; see Example 19) 8 base pair changes within the leuB gene.
- This example Illustrates the ideatifieatioii md correction of spontaneo sIy-oceisrriBg auxoirophy in E. coli strains
- LeuB enzymes in these spontaneous revertant strains have altered amino acid sequences in this region, but the changes from the native structure appear to allow sufficient function to support growth in leucine-free media.
- spontaneous revertant MSC692 no compensating nucleotide changes in leuB were detected. The nature of the genetic change in this strain is uncharacterized.
- PCR primers BLR513 SEQ ID NO: 173
- BLR516 SEQ ID NO: 174 were used to amplify a 646 base pair region of the native leuB gene using gDNA from wild type E. coli W3110 as template.
- the site of the base pair found deleted in MSC561 was 288 bp from the upstream end of this PCR fragment, and the PCR primers generate Hindlll and Xhol ends for cloning into pMAK705pl (Example 18; SEQ ID NO: 157; Figure 14Q) resulting in pBR1 103 (SEQ ID NO: 175; Figure 14R).
- Standard "pop-in/pop-out” methodology was then used to replace the defective leuB region with the native region in auxotrophic strains MSC650, MSC679, and MSC700 to give prototrophic strains MSC722, MSC723, and MSC724, respectively.
- initial transformants of MSC650, MSC679, and MSC700 with pBR1103 were selected on LB/Cm34 plates at 30°C.
- Selected tranformants were plated to LB/Cm34 at 43°C, and isolated survivors were confirmed by PCR to have pBR1103 integrated at the leuB locus.
- Leu+ prototrophs was compared to production in strains with identical K4 gene complements and arrangements but derived by spontaneous conversion to prototrophy: MSC677, MSC692, and MSC702, respectively (see Figure 15).
- the six strains were grown in duplicate 2xM9 flasks at 30°C and induced with ImM mTA at OD600 values of approximately 0.1. Samples of culture broths at 71 hours post-induction were assayed for rCH content as described above. The average OD600 and rCH concentrations are shown in Table 19.
- This example describes recombinant DNA-niediate production of chondroitin in E. ili m ferasesitors.
- the fermentor was inoculated with a typical seed culture and induced with 2 mM w-TA after 4.25 hours, then cultivated for 69 hours and fed a carbon feed (consisting of a 625 g/L glycerine solution) during cultivation. After 69 hours, the fermentor was autoclaved and harvested by centrifugation.
- the fermentation control conditions and product yield are shown in Tables 20C and 20D, respectively. ⁇ Table 20C
- the fermentor was inoculated with a typical seed culture, then cultivated for 66 hours and fed 170 mL of a carbon feed (consisting of a 625 g/L glycerine solution) during cultivation. After 5 hours of cultivation, it was induced with 2 mM m-TA.
- the fermentation was controlled for pH, dissolved oxygen, temperature, glycerine concentration, and acetate concentration (byproduct of carbon metabolism).
- the glycerine feed rate was adjusted based on the acetate concentration with a target of ⁇ 2 g/L acetate.
- the target glycerine concentration was ⁇ 5 g/L.
- the fermentation was run for 66 hours, at which point, glycerine consumption declined to ⁇ 1.5 g/L/hour.
- MSC619 was cultivated using glycerine, casein hydrolysate and ammonium hydroxide as the main carbon and nitrogen sources, respectively.
- the fermentor was batched with the following medium (Table 22A) to a volume of 6 liters using de-ionized water: Table 22A
- the fermentor was inoculated with a typical seed culture and induced with 2 mM m-TA after 4.2 hours, then cultivated for 80 hours and fed a carbon feed (consisting of a 625 g/L glycerine solution) and a nitrogen feed in the form of 4N ammonium hydroxide.
- the carbon and nitrogen feeds were adjusted manually based on sample readings taken offline on the NOVA 300A Bioanalyzer.
- the concentration of glycerine was targeted to maintain less than 1 g/L and the feedrate was reduced further in the presence of acetate accumulation.
- the ammonia concentration target was 100 mg/L or less of ammonia in the broth.
- Acid in the form of 2N sulfuric acid and base in the form of 4N sodium hydroxide were added automatically during cultivation to control pH.
- Antifoam was also fed automatically to the fermentor to control foaming of the broth.
- the fermentation control conditions and product yield are shown below in Tables 22C and 22D, respectively.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Polymers & Plastics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Dermatology (AREA)
- Materials Engineering (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Polysaccharides And Polysaccharide Derivatives (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US30940710P | 2010-03-01 | 2010-03-01 | |
| PCT/US2011/026748 WO2011109438A1 (en) | 2010-03-01 | 2011-03-01 | Compositions and methods for bacterial production of chondroitin |
Publications (3)
| Publication Number | Publication Date |
|---|---|
| EP2542686A1 true EP2542686A1 (en) | 2013-01-09 |
| EP2542686A4 EP2542686A4 (en) | 2014-03-26 |
| EP2542686B1 EP2542686B1 (en) | 2018-01-03 |
Family
ID=44542545
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP11751231.9A Active EP2542686B1 (en) | 2010-03-01 | 2011-03-01 | Compositions and methods for bacterial production of chondroitin |
Country Status (8)
| Country | Link |
|---|---|
| US (2) | US8697398B2 (en) |
| EP (1) | EP2542686B1 (en) |
| JP (1) | JP5875531B2 (en) |
| KR (1) | KR101848102B1 (en) |
| CN (1) | CN102869782B (en) |
| BR (1) | BR112012021995A8 (en) |
| ES (1) | ES2661593T3 (en) |
| WO (1) | WO2011109438A1 (en) |
Families Citing this family (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011109438A1 (en) | 2010-03-01 | 2011-09-09 | Martek Biosciences Corporation | Compositions and methods for bacterial production of chondroitin |
| KR101855062B1 (en) * | 2010-07-09 | 2018-05-09 | 그노시스 에스.피.에이. | Biotechnological production of chondroitin |
| WO2013172154A1 (en) * | 2012-05-17 | 2013-11-21 | 東洋紡株式会社 | Basidiomycetous yeast mutant |
| ITMI20120896A1 (en) | 2012-05-23 | 2013-11-24 | Bongulielmi Reto | CONDROITIN FOR USE IN MEDICINE |
| ITMI20121316A1 (en) * | 2012-07-27 | 2014-01-28 | Altergon Sa | CONDROTIC COMPLEXES FOR TRANSCUTANEOUS ABSORPTION |
| AU2013344571A1 (en) * | 2012-11-16 | 2015-06-04 | The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. | Gonorrheal MtrE peptides and vaccines |
| US20150247174A1 (en) * | 2012-12-28 | 2015-09-03 | Anhui Huaheng Bioengineering Co., Ltd, | Engineering bacteria for producing dl-alanine and method for producing dl-alanine by using engineering bacteria |
| JP6478115B2 (en) * | 2013-09-30 | 2019-03-06 | 生化学工業株式会社 | Method of enhancing retention of protein in blood |
| FR3016637B1 (en) * | 2014-01-23 | 2020-11-27 | Centre Nat Rech Scient | GLYCOSAMINOGLYCANE IN VIVO PRODUCTION PROCESS |
| US9616114B1 (en) | 2014-09-18 | 2017-04-11 | David Gordon Bermudes | Modified bacteria having improved pharmacokinetics and tumor colonization enhancing antitumor activity |
| EP3050973A1 (en) * | 2015-01-30 | 2016-08-03 | Jennewein Biotechnologie GmbH | Fermentation process for producing monosaccharides in free form from nucleotide-activated sugars |
| WO2016159296A1 (en) | 2015-03-31 | 2016-10-06 | 生化学工業株式会社 | Method for sulfating glycosaminoglycan |
| US10676723B2 (en) | 2015-05-11 | 2020-06-09 | David Gordon Bermudes | Chimeric protein toxins for expression by therapeutic bacteria |
| US11180535B1 (en) | 2016-12-07 | 2021-11-23 | David Gordon Bermudes | Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria |
| US11129906B1 (en) | 2016-12-07 | 2021-09-28 | David Gordon Bermudes | Chimeric protein toxins for expression by therapeutic bacteria |
| IT202000004564A1 (en) | 2020-03-04 | 2021-09-04 | Lesaffre & Cie | PROCESS FOR DIRECT SULPHATION OF POLYSACCHARIDES IN ECOLOGICALLY ACCEPTABLE SOLVENT |
| IT202000013633A1 (en) * | 2020-06-08 | 2021-12-08 | Vivatis Pharma Gmbh | PROCESS OF EXTRACTION OF A CHONDROITIN SULPHATE FROM A MUSHROOM, A CHONDROITIN SULPHATE OF VEGETABLE ORIGIN AND ITS USE |
| EP4067487A1 (en) * | 2021-04-01 | 2022-10-05 | Givaudan SA | Chondroitin-producing recombinant cell |
| WO2022241107A1 (en) * | 2021-05-12 | 2022-11-17 | The Trustees Of Columbia University In The City Of New York | Programmable nanoencapsulation for delivery of probiotics in vivo |
Family Cites Families (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030104601A1 (en) | 1999-04-01 | 2003-06-05 | Deangelis Paul L. | Chondroitin synthase gene and methods of making and using same |
| US20060105431A1 (en) | 1998-11-11 | 2006-05-18 | Deangelis Paul L | Polymer grafting by polysaccharide synthases using artificial sugar acceptors |
| EP1129209B1 (en) | 1998-11-11 | 2009-01-21 | The Board Of Regents Of The University Of Oklahoma | Polymer grafting by polysaccharide synthases |
| US6235510B1 (en) | 1999-08-18 | 2001-05-22 | Smithkline Beecham Corporation | ppGaNTase-T6 |
| WO2001038555A1 (en) | 1999-11-25 | 2001-05-31 | Yamasa Corporation | Novel use of uridine diphosphate glucose 4-epimerase |
| DE10019881A1 (en) * | 2000-04-20 | 2001-11-15 | Gerhard Miksch | Process for overexpression and extracellular production of bacterial phytases in Escherichia coli |
| AU2002361549A1 (en) | 2001-07-13 | 2003-04-14 | Paul L. Deangelis | Glycosaminoglycan polymers and methods of making and using same |
| JP4702819B2 (en) | 2001-08-01 | 2011-06-15 | 生化学工業株式会社 | Chondroitin synthase |
| JP4101548B2 (en) | 2001-08-10 | 2008-06-18 | 生化学工業株式会社 | Chondroitin synthase and DNA encoding the same |
| US7232676B2 (en) | 2002-05-31 | 2007-06-19 | Seikagaku Kogyo Kabushiki Kaisha | Chondroitin synthase and nucleic acid encoding the enzyme |
| JP4333880B2 (en) | 2002-05-31 | 2009-09-16 | 生化学工業株式会社 | Chondroitin synthase and DNA encoding the enzyme |
| EP1768678A4 (en) | 2004-06-30 | 2009-09-23 | Paul L Deangelis | Methods of selectively treating diseases with specific glycosaminoglycan polymers |
| ES2299284B1 (en) * | 2004-11-04 | 2009-04-16 | Universidad Pablo De Olavide | CONTROL OF GENE EXPRESSION THROUGH THE USE OF A TRANSCRIPTION ATTENATOR. |
| CA2591421A1 (en) | 2004-12-16 | 2006-06-22 | Stichting Top Institute Food And Nutrition | Novel efficient production process for capsular polysaccharides of pathogenic grampositive bacteria by heterologous expression and secretion of complex polysaccharides in non-pathogenic, non-invasive gram- positive bacteria |
| JP5176114B2 (en) * | 2005-06-06 | 2013-04-03 | フェネックス インコーポレイテッド | Mannitol-inducible promoter system in bacterial host cells |
| EP1964924B1 (en) | 2005-12-15 | 2015-09-30 | Seikagaku Corporation | Long-chain chondroitin sugar chain and method for producing the same and method for promoting synthesis of chondroitin |
| WO2008130373A2 (en) | 2006-10-03 | 2008-10-30 | The Board Of Regents Of The University Of Oklahoma | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same |
| KR101548139B1 (en) | 2007-04-24 | 2015-08-28 | 세이가가쿠 고교 가부시키가이샤 | How to Produce Chondroitin Producing Bacteria and Chondroitin |
| WO2011109438A1 (en) | 2010-03-01 | 2011-09-09 | Martek Biosciences Corporation | Compositions and methods for bacterial production of chondroitin |
| KR101855062B1 (en) | 2010-07-09 | 2018-05-09 | 그노시스 에스.피.에이. | Biotechnological production of chondroitin |
-
2011
- 2011-03-01 WO PCT/US2011/026748 patent/WO2011109438A1/en not_active Ceased
- 2011-03-01 JP JP2012556184A patent/JP5875531B2/en active Active
- 2011-03-01 ES ES11751231.9T patent/ES2661593T3/en active Active
- 2011-03-01 EP EP11751231.9A patent/EP2542686B1/en active Active
- 2011-03-01 CN CN201180022154.5A patent/CN102869782B/en active Active
- 2011-03-01 US US13/038,326 patent/US8697398B2/en active Active
- 2011-03-01 BR BR112012021995A patent/BR112012021995A8/en not_active Application Discontinuation
- 2011-03-01 KR KR1020127025916A patent/KR101848102B1/en active Active
-
2014
- 2014-02-20 US US14/185,639 patent/US9175293B2/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| BR112012021995A2 (en) | 2015-10-06 |
| US9175293B2 (en) | 2015-11-03 |
| US20110244520A1 (en) | 2011-10-06 |
| CN102869782A (en) | 2013-01-09 |
| KR20130055571A (en) | 2013-05-28 |
| ES2661593T3 (en) | 2018-04-02 |
| EP2542686B1 (en) | 2018-01-03 |
| EP2542686A4 (en) | 2014-03-26 |
| JP2013520995A (en) | 2013-06-10 |
| US20140296505A1 (en) | 2014-10-02 |
| JP5875531B2 (en) | 2016-03-02 |
| WO2011109438A1 (en) | 2011-09-09 |
| KR101848102B1 (en) | 2018-04-11 |
| BR112012021995A8 (en) | 2018-01-02 |
| CN102869782B (en) | 2015-11-25 |
| US8697398B2 (en) | 2014-04-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2542686B1 (en) | Compositions and methods for bacterial production of chondroitin | |
| Skurnik et al. | A novel locus of Yersinia enterocolitica serotype O: 3 involved in lipopolysaccharide outer core biosynthesis | |
| KR101548139B1 (en) | How to Produce Chondroitin Producing Bacteria and Chondroitin | |
| US9695453B2 (en) | Process for the production of hyaluronic acid in Escherichia coli or bacillus megaterium | |
| WO2019020707A1 (en) | Sialyltransferases and their use in producing sialylated oligosaccharides | |
| AU2021298060B2 (en) | Improved export of oligosaccharides from bacterial cells | |
| US20200215178A1 (en) | Glycosylation method | |
| CN103228781B (en) | Biotechnological production of chondroitin | |
| TW202204631A (en) | Method for producing heparosan and bacterium of genus escherichia having heparosan-producing ability | |
| US20240263132A1 (en) | Recombinant expression of klebsiella pneumoniae o-antigens in escherichia coli | |
| JP7222902B2 (en) | Oligosaccharyltransferase Polypeptide | |
| CN121294220A (en) | Streptococcus equi and its application in gene editing of Streptococcus equi. | |
| WO2021020995A1 (en) | Bacteria of the genus bacillus producing hyaluronic acid | |
| KR20090039027A (en) | Extracellular secretion production method of target protein by using Ar., O.S. or F.A. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20120927 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAX | Request for extension of the european patent (deleted) | ||
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20140226 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: C12P 19/04 20060101AFI20140220BHEP Ipc: C07K 14/245 20060101ALI20140220BHEP Ipc: C12N 15/52 20060101ALI20140220BHEP Ipc: C08L 5/08 20060101ALI20140220BHEP Ipc: C12N 15/70 20060101ALI20140220BHEP Ipc: C08B 37/00 20060101ALI20140220BHEP Ipc: C07K 16/12 20060101ALI20140220BHEP Ipc: C12N 15/74 20060101ALI20140220BHEP Ipc: C12P 19/26 20060101ALI20140220BHEP |
|
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: SEIKAGAKU CORPORATION |
|
| 17Q | First examination report despatched |
Effective date: 20160225 |
|
| GRAP | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOSNIGR1 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: GRANT OF PATENT IS INTENDED |
|
| INTG | Intention to grant announced |
Effective date: 20170721 |
|
| GRAS | Grant fee paid |
Free format text: ORIGINAL CODE: EPIDOSNIGR3 |
|
| GRAA | (expected) grant |
Free format text: ORIGINAL CODE: 0009210 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE PATENT HAS BEEN GRANTED |
|
| AK | Designated contracting states |
Kind code of ref document: B1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| REG | Reference to a national code |
Ref country code: GB Ref legal event code: FG4D |
|
| REG | Reference to a national code |
Ref country code: CH Ref legal event code: EP Ref country code: AT Ref legal event code: REF Ref document number: 960305 Country of ref document: AT Kind code of ref document: T Effective date: 20180115 |
|
| REG | Reference to a national code |
Ref country code: IE Ref legal event code: FG4D |
|
| REG | Reference to a national code |
Ref country code: FR Ref legal event code: PLFP Year of fee payment: 8 |
|
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R096 Ref document number: 602011044729 Country of ref document: DE |
|
| REG | Reference to a national code |
Ref country code: ES Ref legal event code: FG2A Ref document number: 2661593 Country of ref document: ES Kind code of ref document: T3 Effective date: 20180402 |
|
| REG | Reference to a national code |
Ref country code: NL Ref legal event code: MP Effective date: 20180103 |
|
| REG | Reference to a national code |
Ref country code: LT Ref legal event code: MG4D |
|
| REG | Reference to a national code |
Ref country code: AT Ref legal event code: MK05 Ref document number: 960305 Country of ref document: AT Kind code of ref document: T Effective date: 20180103 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: NL Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: HR Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 Ref country code: NO Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180403 Ref country code: LT Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 Ref country code: FI Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 Ref country code: CY Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: LV Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 Ref country code: IS Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180503 Ref country code: SE Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 Ref country code: PL Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 Ref country code: GR Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180404 Ref country code: RS Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 Ref country code: BG Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180403 Ref country code: AT Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 |
|
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R097 Ref document number: 602011044729 Country of ref document: DE |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: RO Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 Ref country code: AL Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 Ref country code: EE Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 |
|
| PLBE | No opposition filed within time limit |
Free format text: ORIGINAL CODE: 0009261 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: DK Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 Ref country code: CZ Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 Ref country code: SK Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 Ref country code: MC Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 Ref country code: SM Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 |
|
| REG | Reference to a national code |
Ref country code: BE Ref legal event code: MM Effective date: 20180331 |
|
| 26N | No opposition filed |
Effective date: 20181005 |
|
| REG | Reference to a national code |
Ref country code: IE Ref legal event code: MM4A |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: LU Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20180301 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: IE Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20180301 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: SI Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 Ref country code: BE Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20180331 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: MT Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20180301 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: TR Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: PT Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20180103 Ref country code: HU Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT; INVALID AB INITIO Effective date: 20110301 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: MK Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20180103 |
|
| P01 | Opt-out of the competence of the unified patent court (upc) registered |
Effective date: 20230517 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: ES Payment date: 20250403 Year of fee payment: 15 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: CH Payment date: 20250401 Year of fee payment: 15 |
|
| REG | Reference to a national code |
Ref country code: CH Ref legal event code: U11 Free format text: ST27 STATUS EVENT CODE: U-0-0-U10-U11 (AS PROVIDED BY THE NATIONAL OFFICE) Effective date: 20260401 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: GB Payment date: 20260202 Year of fee payment: 16 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: DE Payment date: 20260128 Year of fee payment: 16 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: IT Payment date: 20260220 Year of fee payment: 16 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: FR Payment date: 20260209 Year of fee payment: 16 |