EP2320917A1 - Methods of preventing, arresting or reversing tumourigenesis and of identifying compounds capable of the same - Google Patents
Methods of preventing, arresting or reversing tumourigenesis and of identifying compounds capable of the sameInfo
- Publication number
- EP2320917A1 EP2320917A1 EP09803219A EP09803219A EP2320917A1 EP 2320917 A1 EP2320917 A1 EP 2320917A1 EP 09803219 A EP09803219 A EP 09803219A EP 09803219 A EP09803219 A EP 09803219A EP 2320917 A1 EP2320917 A1 EP 2320917A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- runx3
- cell
- catenin
- functional fragment
- tcf
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
- G01N2333/4701—Details
- G01N2333/4703—Regulators; Modulating activity
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/50—Determining the risk of developing a disease
Definitions
- the present invention relates to the field of prevention, arrest and reversal as well as diagnosis of tumorigenesis. Provided is also a corresponding method of identifying a compound capable of prevention, arrest and reversal of rumorigenesis.
- Cancer is a major cause of death worldwide, being the second-leading cause of death in developed countries and even the number one cause of death in e.g. Australia, Japan, Korea, Singapore and the male population of the UK and Spain. The number of people who develop cancer each year is increasing.
- cancer therapy involves surgery or focuses on the functional or genetic changes associated with the transformation of cells into malignant cells.
- An ideal anti-cancer drug should selectively kill, or at least inhibit, rapidly proliferating cancerous cells, while leaving non-cancerous cells unaffected.
- Recent approaches include immunotherapy using antibodies directed to markers of selected types of cancer cells (e.g.
- the invention relates to in vitro and in vivo methods of preventing, treating and diagnosing tumorigenesis, as well as a corresponding method of determining whether a compound is a suitable candidate for preventing and treating tumorigenesis.
- Treating tumorigenesis is understood as including at least one of inhibiting, arresting and reversing tumorigenesis. To emphasize this understanding the terms inhibit, arrest and reverse tumorigenesis are generally used in the following as well as in the appended claims.
- the present invention provides a method of preventing, inhibiting, arresting or reversing tumorigenesis in a cell.
- the method includes altering the formation of a complex between RUNX3, or a functional fragment thereof and one of (i) ⁇ -catenin, or a functional fragment thereof, and (ii) a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof and (iii) a combination thereof.
- altering the complex formation between RUNX3, or a functional fragment thereof and one or more of (i) ⁇ -catenin, or a functional fragment thereof, and (ii) a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof includes allowing the phosphorylation status of RUNX3, or a functional fragment thereof, to be altered.
- the present invention provides a method of inducing programmed cell death (apoptosis) in a tumor cell.
- the method includes altering the formation of a complex between RUNX3, or a functional fragment thereof and one of (i) ⁇ -catenin, or a functional fragment thereof, and (ii) a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof, in the cell and (iii) a combination thereof.
- the present invention provides a method of diagnosing the risk of tumorigenesis in a cell.
- the method includes assessing the formation of a complex between
- RUNX3 or a functional fragment thereof and one of (i) ⁇ -catenin, or a functional fragment thereof, and (ii) a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof, in the cell and (iii) a combination thereof.
- the present invention provides a method of diagnosing the risk of developing a neoplasm in a subject.
- the method includes assessing the formation of a complex between RUNX3, or a functional fragment thereof and one of (i) ⁇ -catenin, or a functional fragment thereof, and (ii) a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof, and (iii) a combination thereof, in the cell.
- the present invention provides an in-vitro method of identifying a compound capable of altering the formation of a complex between RUNX3, or a functional fragment thereof and one of (i) ⁇ -catenin, or a functional fragment thereof, and (ii) a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof, and (iii) a combination thereof.
- the method typically includes contacting the components that form said complex with each other.
- the method typically also includes adding a compound to the test tube suspected to modulate said complex formation. Further, the method typically includes detecting the said complex formation.
- the present invention provides a method of preventing, inhibiting, arresting or reversing tumorigenesis in a cell.
- the method includes altering the complex formation of ⁇ -catenin, or a functional fragment thereof, and RUNX3, or a functional fragment thereof, in the cell.
- the method includes altering the complex formation of a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof, and RUNX3, or a functional fragment thereof, in the cell, hi another embodiment the method includes altering the complex formation of ⁇ -catenin, or a functional fragment thereof, a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof, and RUNX3, or a functional fragment thereof, in the cell.
- the invention provides a method of inducing apoptosis in a tumor cell.
- the method includes altering the complex formation of ⁇ -catenin, or a functional fragment thereof, and RUNX3, or a functional fragment thereof, in the cell.
- the method includes altering the complex formation of a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof, and RUNX3, or a functional fragment thereof, in the cell.
- the method includes altering the complex formation of ⁇ -catenin, or a functional fragment thereof, a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof, and RUNX3, or a functional fragment thereof, in the cell.
- the invention provides a method of diagnosing the risk of tumorigenesis in a cell.
- a method according to this aspect may be a method of identifying a cell having a predisposition to turn tumorigenic.
- the method includes assessing the complex formation of ⁇ -catenin, or a functional fragment thereof, and RUNX3, or a functional fragment thereof, in the cell.
- the method includes assessing the complex formation of a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof, and RUNX3, or a functional fragment thereof, in the cell.
- the method includes assessing the complex formation of ⁇ -catenin, or a functional fragment thereof, a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof, and RUNX3, or a functional fragment thereof, in the cell.
- the invention provides a method of diagnosing the risk of developing a neoplasm in a subject.
- the method includes assessing the complex formation of ⁇ -catenin, or a functional fragment thereof, and RUNX3, or a functional fragment thereof.
- the method includes assessing the complex formation of a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof, and RUNX3, or a functional fragment thereof.
- the method includes assessing the complex formation of ⁇ -catenin, or a functional fragment thereof, a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof, and RUNX3, or a functional fragment thereof.
- the invention provides an in-vitro method of identifying a compound capable of altering the formation of a complex between a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof, and RUNX3, or a functional fragment thereof.
- the method includes contacting the components that form the respective complex with each other.
- the method includes adding a compound to the test tube suspected to modulate the complex formation of a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof, and RUNX3, or a functional fragment thereof.
- the method may also include detecting the said complex formation.
- the invention provides an in-vitro method of identifying a compound capable of altering the formation of a complex between ⁇ -catenin, or a functional fragment thereof, and RUNX3, or a functional fragment thereof.
- the method includes contacting the components that form the respective complex with each other.
- the method includes adding a compound to the test tube suspected to modulate the complex formation between ⁇ -catenin, or a functional fragment thereof, and RUNX3, or a functional fragment thereof.
- the method may also include detecting the said complex formation.
- the invention provides an in-vitro method of identifying a compound capable of altering the formation of a complex between ⁇ -catenin, or a functional fragment thereof, a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof, and RUNX3, or a functional fragment thereof.
- the method includes contacting the components that form the respective complex with each other.
- the method includes adding a compound to the test tube suspected to modulate the complex formation between ⁇ -catenin, or a functional fragment thereof, a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof.
- the method may also include detecting the said complex formation.
- the invention provides a method of treating cancer. The method includes the reactivation of RUNX3.
- Fig. 1 illustrates the degradation of ⁇ -catenin in a non-stimulated healty cell (A) and translocation of ⁇ -catenin to the nucleus as well as complex formation with a T cell factor (TCF) or a lymphoid enhancer-binding factor (LEF) upon Wnt signaling (B).
- TCF T cell factor
- LEF lymphoid enhancer-binding factor
- RUNX3 binds to the complex of ⁇ -catenin and the T cell factor (C), which may be diminished upon RUNX3 phosphorylation via AKT (D).
- Figure 2 depicts the expression of Runx3 in intestinal epithelial cells and up-regulation of ⁇ -catenin/Tcf4 activity in the Runx3 ⁇ / ⁇ intestine
- A Runx3 immunodetection in wild type and Runx3 ⁇ A jejunum
- B Runx3 immunodetection in wt and Runx3 'A proximal colon (left) and wt distal colon (right);
- C Hematoxylin and eosin staining of wt and Runx3 'A 40 weeks old mice
- D Detection of proliferating cells in wt and Runx3 'A jejunum and proximal colon (adult; 40 weeks old) and immunostaining with the anti-Ki67 antibody (neonate)
- E Number of BrdU (adult) and Ki67 (neonate) positive cells per crypt in wt and Runx3 'A intestine (*P ⁇ 0.001)
- F Relative growth
- FIG. 3 illustrates the formation of a ternary complex of ⁇ -catenin, TCF4 and RUNX3 and the attenuation of ⁇ -catenin/TCF4 transcriptional activity by RUNX3
- A Western analysis of RUNX3 expression in 22 human colorectal cancer cell lines
- B Coimmunoprecipitation of exogenously expressed ⁇ -catenin, TCF4 and RUNX3 in HCTl 16 cells
- C Two step-coimmunoprecipitation of exogenously expressed ⁇ -catenin and TCF4 and RUNX3 in 293 T cells
- D Immunoprecipitation of an endogenous ternary complex of ⁇ -catenin/TCF4/RUNX3 in nuclear extracts of HCTl 16 and SW620 cells
- E Binding of Myc-TCF4 and/or HA- ⁇ -catenin together
- Figure 4 illustrates an attenuation of DNA binding activity of ⁇ -catenin/ TCF4 by RUNX3
- A effect of exogenous RUNX3 on binding of ⁇ -catenin/TCF4 to TCF binding sites
- B occupancy of ⁇ -catenin/TCF4 at TCF binding sites after RUNX3 knockdown.
- C (Upper panel) ChIP assay in DLDl detecting binding of TCF4 to TCF binding sites in the presence RUNX3.
- E Western blot analysis of exogenous RUNX3 in DLDl and in HCTl 16 clones expressing antisense RUNX3 DNA (AS-Cl.1 and AS-C1.2);
- F Real-time PCR quantification of AXIN2, CD44, and DKKl mRNA in DLDl cells with inducible RUNX3 expression (left panel) and in HCTl 16 cells in which RUNX3 was knocked down;
- G TOPflash versus FOPflash activity for DLDl (white) and DLDl expressing RUNX3 (black; panel E) and HCTl 16 (black) and HCTl 16 in which RUNX3 was knocked down (white; panel E);
- H TOPflash/FOPflash activity (lower panel) after RUNX3 knockdown (expression in upper pannel) in HCTl 16, SW620, COLO320, SW480 and SW403).
- Figure 5 shows adenomatous polyps in the small intestine of Runx3 +/ ⁇ or Apc M ⁇ n/+ BALB/c mice and progression to adenocarcinoma in Runx3 +/' Apc Mllj/+ compound mice.
- A Hematoxylin and eosin staining of tumors in the small intestine of Runx3 +/ ⁇ , Apc M ⁇ n/+ and Runx3 +/' Apc Mm/+ mice. Boxed regions are enlarged on right.
- B Frequency of tumor formation in the small and large intestines of mice with indicated genotypes.
- C Number of tumors in the small intestine of individual mice with indicated genotypes.
- D Size distribution of polyps in the small intestine of mice with indicated genotypes.
- Figure 6 shows adenomatous polyps in the small intestines of Runx3 +/" BALB/c mice displaying down-regulated Runx3 and up-regulated cyclin Dl and c-Myc.
- A Immunodetection of Runx3, ⁇ -catenin, cyclin Dl, and c-Myc in adenomatous polyps formed in the small intestine of Runx3 +/' and Apc M ⁇ n/+ mice.
- B Anylysis of very small adenomas formed in jejunum of the compound mice.
- A, B, C Three patterns of ⁇ -catenin and RUNX3 expression in 35 human cases.
- Type A nuclear ⁇ -catenin with RUNX3 in nuclei (A), type B; membranous ⁇ -catenin without RUNX3 expression (B), and type C; membranous ⁇ -catenin with RUNX3 expression (C) in T4, T6, and T9 in panel F, respectively.
- D and E Up-regulation of cyclinD 1 and c-Myc in adenomas of type A (D) and type B (E).
- MSP Methylation specific PCR
- Figure 8 is an enlargement of immunohistochemistry of adenomas shown in Fig. 7 A, Fig. 7B and Fig. 7C of for better resolution.
- Figure 9 shows RUNX3 inactivation by gene silencing and protein mislocalization with concomitant accumulation of ⁇ -catenin in human colorectal cancers.
- A, B, C Differential staining patterns of RUNX3 in human colorectal cancers: positive (A), negative (B), and cytoplasmic positive (C).
- D Differential staining patterns of RUNX3 in human colorectal cancer cell lines: positive (HCTl 16 and SW480), negative (DLDl and RKO), and cytoplasmic positive (SW403 and CCK81).
- Figure 10 shows the morphology of wt and Runx3 ⁇ ' ⁇ epithelium of jejunum and colon stained by hematoxylin and eosin (A). Immunodetection of CD44 (B) and cyclin Dl (C) in wt and Runx3-/- intestines is also shown.
- Figure HA illustrates the mapping of the RUNX3 domain that interacts with TCF4.
- Fig. HB illustrates the mapping of the TCF4 domain that interacts with RUNX3.
- Fig. HC shows an immunoprecipitation using anti-Flag antibody in HCTl 16 cells transfected with Myc-TCFl/ Flag-RUNX3 (left), Lefl/Flag-RUNX3 (center), and Myc-TCF3/Flag-RUNX3
- Figure 12A shows EMSA analysis of the binding of ⁇ -catenin/TCF4 to a TCF binding site (TOP construct) by RUNX3, using nuclear extracts of 293 T cells expressing Myc-TCF4, S33Y ⁇ -catenin, Flag-RUNX3, or the vector (mock).
- Figure 12B shows a corresponding EMSA analysis using Wnt3a-treated Runx3 ⁇ ' ⁇ FID cells. *A non-specific band detected in all reactions of Fig. 12A and 12B.
- Figure 12C shows EMSA analysis of binding of RUNX3/PEBP2 ⁇ to the RUNX binding site of the IgCa promoter by ⁇ -catenin/TCF4, using nuclear extracts from 293T cells expressing Flag-RUNX3, Myc-TCF4, S33Y ⁇ -catenin or the vector (mock) and purified PEBP2 ⁇ protein. * Lower and upper RUNX3-probe and **lower and upper RUNX3/PEBP2 ⁇ -probe complexes were detected.
- Figure 13 A depicts genotyping of wild type epithelial cells (wt), Runx3 +/' adenomas (T1-T4) and their adjacent normal epithelial cells (N1-N4) in the small intestine of BALB/c mice (upper panel). Quantification of the wild type and knockout alleles of Runx3 in Runx3 +/ ⁇ adenomas by real-time PCR (T1-T7) is shown in the lower panel.
- Fig. 13B depicts genotyping of normal epithelial cells (N) and adenomas in Apc Min/+ (T1-T4) and Runx3 +/ ⁇ (T1-T3) small intestine of BALB/c mice.
- FIG. 13C depicts methylation-specific PCR (MSP) of the Runx3 promoter region in wild type epithelial cells (wt), Runx3 +/ ⁇ normal epithelial cells (N), and Rumc3 +/ ⁇ adenomas (Tl -T6) in the small intestine (lower panel).
- MSP methylation-specific PCR
- Figure 14A shows the frequency of tumor formation in small and large intestines.
- Figure 14B shows the number of tumors in the small intestine of individual mice.
- Figure 14C shows the size distribution of polyps in the small intestine of mice.
- Figure 14C shows stereomicroscopic images of polyps (arrowheads) formed in Apc mm + and Runx3 +/' Apc mn + small intestines of mice.
- Figure 15 depicts the up-regulation of CD44 in adenomas of type A and B (A and B, respectively).
- Figure 16 shows the morphology of small and large intestines of wild type mice reconstituted with R.UHX3 '1' (A-D) or Runx3 + ⁇ (E) bone marrow cells, one year after transplantation.
- Figure 17A depicts the relative proliferation of DLDl and HCTl 16 clones over time.
- Figure 17B depicts the tumorigenicity of DLDl and HCTl 16 clones (*P ⁇ 0.01).
- Figure 17C shows the tumor formation of Runx3 + + and Runx3 ⁇ ' FID and FIL cell lines in nude mice 60 days after inoculation.
- Figure 17D depicts the tumor formation of control (C) and Myc-tagged dominant negative TCF4 expressing Runx3 ⁇ ' FID and FIL cells (indicated as -1-2 in panel C) in nude mice 60 days after inoculation.
- Figure 18 depicts the expression patterns of ⁇ -catenin and RUNX3 (type A-C; cf. Fig. 7) and the methylation status of the RUNX3 promoter (M; methylated, U; unmethylated) of 35 human sporadic adenomatous polyps (T1-T35).
- Figure 19 shows the expression pattern of RUNX3 (P, N, and C; cf. Fig. 9) and the methylation status of the RUNX3 promoter (M; methylated, U; unmethylated) of 48 human colorectal cancers.
- Figure 20 illustrates the tumor formation in Runx3+/- mice.
- Figure 21 depicts the binding of RUNX3 to Aktl in vitro.
- Figure 22 depicts the formation of an endogenous protein complex in HCTl 16 nuclear extract.
- Figure 23 illustrates the domain mapping of the RUNX3/Akt interaction.
- Figure 24 illustrates the domain mapping of the RUNX3/Akt interaction.
- Figure 25 is a schematic showing that the kinase domain of Aktl binds to the Runt domain of RUNX3.
- Figure 26 shows that RUTSDG is phosphorylated in vitro.
- Figure 27 shows that RUNX3 is phosphorylated by Akt.
- Figure 28 shows that RUNX3 is phosphorylated by Akt in DLD-I cells.
- Figure 29 shows that the phosphorylation of RUNX3 by Akt reduces the affinity of
- RUNX3 for TCF4 (A: Copurification of TCF4 with Runt or the indicated mutant, B: Analysis of the intensity of the bands).
- the present invention is based on the surprising finding that RUNX3, a gastric tumor suppressor, forms a complex with ⁇ -catenin as well as a complex with a member of the TCF/LEF transcription co-factor family. Further, RUNX3 forms a ternary complex with ⁇ -catenin and a member of the TCF/LEF transcription co-factor family, and attenuates the Wnt signaling activity.
- the inventors have further surprisingly found that the phosphorylation state of RUNX3 is important for the formation of a ternary complex with ⁇ -catenin and a member of the TCF/LEF transcription co-factor family. They found that the phosphorylation state of RUNX3 can be altered via a member of the Akt proteins/Zprotein kinase B.
- RUNX3 (runt-related transcription factor 3) is involved in neurogenesis and thymopoiesis and functions as a tumor suppressor gene in gastric cancer. Failure to express RUNX3 because of a combination of hemizygous deletion and DNA hypermethylation of the RUNX3 promoter region has been found in about 60% of primary gastric cancer specimens (Li, Q. L., et al. (2002) Cell 109, 113-124). RUNX3-R122C is a mutation located in the conserved Runt domain that was discovered in a case of gastric cancer and it abolishes the tumor suppressive activity of RUTNRG (ibid.).
- RUNX3 inactivation is not limited to gastric cancer, and frequent inactivation of RUNX3 due to DNA hypermethylation has been reported in various other cancers, including lung cancer, liver cancer (hepatocellular carcinoma), breast cancer, colon cancer, pancreatic cancer, bladder cancer, bile duct cancer, prostate cancer, and laryngeal cancer.
- lung cancer liver cancer (hepatocellular carcinoma)
- breast cancer colon cancer
- pancreatic cancer bladder cancer
- bile duct cancer bile duct cancer
- prostate cancer and laryngeal cancer.
- RUNX3 is unique in that it is inactivated primarily by epigenetic silencing, rather than by mutations or deletions.
- RUNX3 can be reactivated and therefore considered to be a good drug target because mutations in its gene are rare.
- TGF- ⁇ transforming growth factor ⁇
- TGF- ⁇ can employ diverse mechanisms, such as down-regulating c-myc and CDK-2/CDK-4 activity by modulating the functions of pl5INK4B, p21Wafl/Cipl, and p27Kipl. Any genetic or epigenetic alteration of the TGF- ⁇ pathway can thus render normal cells vulnerable to tumorigenesis.
- Wnt/ ⁇ -catenin signaling is an ancient and highly conserved signaling pathway involved in various physiological processes such as development, in particuar embryonic development, tissue regeneration, specification and maintenance of precursor cell and stem cell lineages or stem cell self-renewal. It is also involved in a variety of conditions such as cardiovascular disease, bone malformation, aging, diabetes, neurodegeneration including schizophrenia or Alzheimer disease, acute renal failure and polycystic kidneys, and inflammation. Abnormal Wnt/ ⁇ -catenin signaling is further known to be associated with cancer.
- Wnt/ ⁇ -catenin signalling has also been found in ulcerative colitis, where the pathway is activated in early stages of malignant progression (van Dekken, H., et al., Acta Histochemica (2007) 109, 4, 266/272).
- Aberrant activation of Wnt/ ⁇ -catenin signaling is for example a major driving force in colon cancer (Vogelstein, B., and Kinzler, K. W. (1998). Identification of c-MYC as a target of the APC pathway. Science 281, 1509-1512; Su, L. K., Kinzler, K. W., Vogelstein, B., Preisinger, A. C, Moser, A. R., Luongo, C, Gould, K.
- This phosphorylation occurs while ⁇ -catenin is bound to a cytoplasmic destruction complex that includes the tumor suppressor adenomatous polyposis coli (APC), the scaffold protein axin, casein kinase 1 (CKI) and glycogen synthase kinase 3 ⁇ (GSK3 ⁇ ).
- APC tumor suppressor adenomatous polyposis coli
- CKI casein kinase 1
- GSK3 ⁇ glycogen synthase kinase 3 ⁇
- Non phosphorylated and thus stabilized ⁇ -catenin is thought to translocate into the nucleus.
- ⁇ -catenin interacts with downstream effectors that are members of the TCF/LEF transcription co-factor family, e.g. LEFl (lymphoid enhancer-binding factor 1) and TCF (T-cell factor), thereby for example converting LEFl into a transcriptional activator, ⁇ -catenin does not interact with DNA itself, but serves as a cofactor of TCF/LEF transcription factors.
- the TCF and LEF family of transcription factors includes LEFl (LEFl), TCF-I (TCF7), TCF-3 (TCF7L1), and TCF-4 (TCF7L2).
- TCF and LEF proteins bind directly to DNA through their high mobility group (HMG) domains and once bound to ⁇ -catenin transactivate their target genes.
- HMG high mobility group
- target genes such as Cyclin Dl and Myc are activated, which are genes associated with the regulation of cell proliferation and can thus lead to cell transformation.
- Further known targets of TCF and LEF include c-jun, multidrug resistance 1 (ABCBl), matrilysin (MMP7), axin 2 or surviving (BIRC5).
- TCF-4 which is expressed commonly in colorectal cancer cells, and has been implicated in the maintenance of undifferentiated intestinal crypt epithelial cells. Suppression of ⁇ -catenin-evoked gene transactivation of colorectal cancer cells by dominant-negative TCF-4 is known to switch off genes involved in cell proliferation and to switch on genes involved in cell differentiation. A couple of proteins such as Smads have been reported to interact with the ⁇ -catenin and TCF and LEF complexes and modulate their transcriptional activity.
- Wnt and TGF- ⁇ superfamily signaling are key pathways that ultimately influence the cell division and cell fate of gut epithelial cells. These pathways are known to be altered in gastrointestinal cancers. In colorectal cancers with stabilized ⁇ -catenin, the ⁇ -catenin/T cell factor-4 (TCF4) transcription factor complex is constitutively activated.
- TGF4 T cell factor-4
- Several components of the TGF- ⁇ signaling cascade are bona fide tumor suppressors that inhibit cell growth and cancer development. Inactivation of one of these components, such as the TGF- ⁇ receptor type II or Smad4, occurs frequently in gastrointestinal tumors.
- TGF- ⁇ receptor type II or Smad4 the molecular mechanisms that link the oncogenic Wnt and the tumor suppressive TGF- ⁇ pathways in intestinal carcinogenesis have not been fully elucidated.
- RUNX3 a strong gastric tumor suppressor candidate, is inactivated by gene silencing or protein mislocalization in more than 80% of gastric cancers (Li et al., 2002; Ito et al., 2005). More recently, inactivation of RUNX3 was reported in a wide range of other cancer types (Blyth et al., 2005).
- the RUNXS locus at Ip36 a region that undergoes frequent allelic loss in gastrointestinal cancers, is silenced by hypermethylation of its promoter region in a significant proportion of cancer-derived cell lines and clinical specimens, suggesting that it fulfills a tumor suppressive function in colorectal cancers (Goel et al., 2004; Ku et al., 2004).
- RUNX3 regulates target gene expression by forming a complex with Smad molecules.
- TGF- ⁇ regulates nuclear translocation of RUNX3 in gastric epithelial cells (Ito et al., 2005) and activates the transcription of p21 ipl and Bim, negative cell cycle regulator and a proapoptotic genes, respectively, in cooperation with RUNX3 and Smads (Chi et al., 2005; Yano et al., 2006; reviewed in Ito, 2008).
- TCF4/ ⁇ -catenin complex and attenuates Wnt signaling. Since Rnx3 undergoes interactions with both ⁇ -catenin and a member of the TCF/LEF transcription co-factor family, complex formation with one of these two binding partners is apparently sufficient to affect Wnt signaling.
- Phenotypic analysis of Runx3 -deficient mice as well as human specimens suggest that at an early stage of carcinogenesis, in particular colon carcinogenesis, biallelic inactivation of RUNX3, primarily by promoter hypermethylation, induces cancer formation, in particular human colon adenomas, independent of alterations of APC or ⁇ -catenin.
- the inventors' findings indicate that in a non-cancerous cell there is a balance between two mutually exclusive tumor suppressing effects of RUNX3 activity.
- the first of these activities is the function of RUTSfX3 as a transcription factor, where it mediates TGF- ⁇ -induced growth inhibition and apoptosis.
- the second activity is the derogation of the stimulation of gene expression via ⁇ -catenin in Wnt signalling by the formation of a complex.
- One application of a method of the invention is restoring a respective balance in a cell where the balance has been interrupted.
- a further application of a method of the invention is establishing a respective balance in a cell that is carcinogenic or at risk to turn carcinogenic.
- Yet a further application of a method of the invention is disrupting this balance in favor of one of the two above mutually exclusive tumor suppressing effects of RUNX3 activity.
- Activation of stimulation of this one of the two above mutually exclusive tumor suppressing effects may be in need in a cell due to e.g. a cellular defect such as a mutation or another dysfunction.
- the inventors' findings further indicate not only that RUNX3 forms a complex, or interacts, with a TCF/LEF transcription factor (which is a nuclear effector of Wnt signaling pathway) but also point to a new link to the Phosphatidylinositol 3-kinase (PI3K)/Akt pathway.
- PI3K Phosphatidylinositol 3-kinase
- This signaling pathway is known to be vital to the growth and survival of cancer cells, and thought to play an important role in tumorigenesis.
- PIK3CA Activating mutations of the pl lOalpha subunit of PI3K (PIK3CA, with CA standing for "constitutively active" have been identified in a broad spectrum of tumors.
- the PIK3CA mutation has for example been associated with poor prognosis in colorectal cancer.
- Such constitutively active mutants of PIK3 activate AKT signaling.
- 3-Phosphoinositide-dependent kinase 1 (PDKl) is the first node of the PI3K signal output and is required for activation of AKT. It catalyses phosphorylation of phosphatidylino- sitol-4,5-bisphosphate to phosphatidylinositol 3,4,5-trisphosphate (PIP3).
- PIP3 recruits the serine/threonine protein kinase AKT to the cell membrane, resulting in the phosphorylating of Akt at threonine-308, thereby activating AKT.
- Akt has been found to be hyperactivated in many tumors, and known to play a major role in cell survival and in resistance to tumor therapy, even though Akt is rarely mutated itself. So far various mechanisms of action have been suspected as Akt's role in tumorigenesis, such as stabilizing Myc and cyclin Dl or by inducing degradation of the cyclin-dependent kinase (Cdk) inhibitor p27 Ki P 1 , inactivation of pro-apoptotic molecules such as caspase-9 and the BH3-only protein Bad, by triggering the activity of the transcription factor NF- ⁇ B or via Foxo transcription factors or GSK3.
- Cdk cyclin-dependent kinase
- the present inventors' findings point to a phosphorylation of RUNX3 by AKT, which reduces the affinity of RUNX3 to TCF/LEF transcription factors. Accordingly, the formation of a complex between ⁇ -catenin, or a functional fragment thereof, a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof, and RUNX3, or a functional fragment thereof, can be modulated by modulating the activation status (via phosphorylation at threonine-308) of Akt.
- a method according to the invention can in some embodiments be termed a method of preventing, inhibiting, arresting or reversing tumorigenesis in a cell.
- a respective method can be termed a method of inducing apoptosis in a tumor cell.
- a method according to the invention can be termed a method of diagnosing the risk of tumorigenesis in a cell.
- Such an embodiment of diagnosis may also be termed a method of diagnosing the risk of developing a neoplasm in a subject.
- These methods include altering and/or assessing the formation of a complex between RUNX3, or a functional fragment thereof, and one or both of (i) a member of the TCF/LEF transcription co-factor family or a functional fragment thereof, and (ii) ⁇ -catenin, or a functional fragment thereof.
- the assessment of such complex formation serves diagnostic purposes, whereas altering such complex formation serves treatment of a rumor, including a cancer or ulcerative colitis.
- tumorigenesis may be prevented, inhibited, arrested or reversed - as well as diagnosed or predicted — in any organism, including for instance a mammal, a fish, an amphibian, a bird or a microorganism.
- a respective microorganism is in some embodiments a cell.
- the present invention also relates to compounds that are able to achieve the modulation of the complex formation as described above.
- a respective compound may for instance be a nucleic acid molecule, an immunoglobulin, an antagonist or agonist of a cell surface receptor, a compounds that modulates the degree of phosphorylation of one of the components of the above complex, as well as compounds that modulate the intracellular quantity of one or more of the components of the above complex.
- the invention also relates to the use of such compounds for the diagnosis of tumorigenesis.
- the invention also provides a method of identifying a compound that is capable of altering the formation of a respective complex.
- a method may be a method of identifying a candidate compound capable of preventing, inhibiting, arresting or reversing tumorigenesis in a cell and/or of inducing apoptosis in a tumor cell.
- An alteration such as an enhancement or a reduction of the formation of a complex between Runx3, or a functional fragment thereof, and one or both of (i) a member of the TCF/LEF transcription co-factor family or a functional fragment thereof, and (ii) ⁇ -catenin, or a functional fragment thereof indicates that the compound is capable of preventing tumorigenesis in a cell and/or of inducing apoptosis in a tumor cell
- the cell on which a method according to the invention is used may be any cell.
- the cell may for example be a cell of a tissue.
- a respective tissue may be any tissue, for example a tissue obtainable or obtained from an organism, such as an animal, e.g. a mammalian species, including a rodent species, an amphibian, e.g. of the subclass Lissamphibia that includes e.g. frogs, toads, salamanders or newts, an invertebrate species, or a plant.
- mammals include, but are not limited to, a rat, a mouse, a rabbit, a guinea pig, a squirrel, a hamster, a vole, a hedgehog, a platypus, an American pika, a galago ("bushbaby"), an armadillo, a dog, a lemur, a goat, a pig, a cattle (cow), an opossum, a horse, an elephant, a bat, a woodchuck, an orang-utan, a rhesus monkey, a woolly monkey, a macaque, a chimpanzee, an orang-utan, a tamarin (saguinus oedipus), a marmoset or a human.
- tissue is an organ or a portion thereof, such as adrenal, bone, bladder, brain, skin, cartilage, colon, eye, heart, kidney, liver, lung, muscle, nerve, ovary, spleen, adrenal, liver, lung, pancreas, bladder, prostate, skin, small intestine, spleen, stomach, testicular, thymus, tumor, vascular or uterus tissue, or connective tissue.
- the cell is obtained or derived from a host organism, which may be any organism. The cell may be directly taken from a respective host organism in form of a sample such as e.g. a biopsy or a blood sample.
- the cell may be included in a host organism. It may for instance be present in the blood or in tissue, including in an organ, of the host organism.
- the host organism from which the cell is derived or obtained, or in which it is included, may be any organism such as a microorganism, an animal, such as a fish, an amphibian, a reptile, a bird, a mammal, including a rodent species, an invertebrate species, e.g. of the subclass Lissamphibia that includes e.g. frogs, toads, salamanders or newts, or a plant.
- the cell may for example be an (e.g. isolated) individual cell or a cell of a cell population.
- the cell is a somatic cell.
- suitable somatic cells include, but are not limited to a fibroblast, a myeloid cell, a B lymphocyte, a T lymphocyte, a bone cell, a bone marrow cell, a pericyte, a dendritic cell, a keratinocyte, an adipose cell, a mesenchymal cell, an epithelial cell, an epidermal cell, an endothelial cell, a chondrocyte, a cumulus cell, a neural cell, a glial cell, an astrocyte, a cardiac cell, an oesophageal cell, a muscle cell (e.g.
- a somatic cell may be a cell of any tissue, such as the examples above.
- the cell is a tumor cell, e.g. a cancer cell.
- a respective tumor cell may also be obtained from an organism, e.g. from a mammal.
- the tumor cell may be included in a mammal, such as for example a rat, a cow, a pig, and a human.
- a respective tumor cell may also be cultured and/or be a cell of a cell culture.
- a cell of a cell line such as a melanoma cell line, e.g. A375, B16 (including B16-F10), BNl, K1735-M2, M14, OCM-I or WM793, colorectal cancer cell line, e.g. SW480, HT29, RKO, LST-Rl, Caco-2, WiDr, GP2d, HCTl 16, LoVo, LS174T, VACO5 HCA7, LS411, C70, LIM1863, SL-174T, SW1417, SW403, SW620, SW837 or VACO4A, a hepatoma cell line, e.g.
- a melanoma cell line e.g. A375, B16 (including B16-F10), BNl, K1735-M2, M14, OCM-I or WM793, colorectal cancer cell line, e.g. SW480, HT29, RKO, LST-Rl, Caco
- BGC823, KATO-III, MGC8O3, MKN-45, SGC7901 or an ovarian cancer cell line e.g. A2780, C13*, CAOV3, DOV-13, HO8910 (including HO-8910PM), OvCA 3, OvCA 420, OvCA 429, OvCA 432, OvCA 433, OvCar 3, OvCar 5, OvCA 420, OVHM or SKOV-3.
- the cell may in some embodiments be a cell of an organism, which may harbor cancerous tissue, a cell of a tissue, including a cancerous tissue.
- a cancer cell may for instance be a neuronal, glial, lung, liver, brain, breast, bladder, blood, leukemic, colon, endometrial, stomach, skin, ovarian, fat, bone, cervical, esophageal, pancreatic, prostate, kidney, or thyroid cell.
- a cancer includes, but is not limited to astrocytoma, acute myelogenous leukemia, breast carcinoma, bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial carcinoma, esophageal squamous cell carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, Hodgkin lymphoma, leukemia, lipoma, melanoma, mantle cell lymphoma, myxofibrosarcoma, multiple myeloma, neuroblastoma, non-Hodgkin lymphoma, lung carcinoma, non-small cell lung carcinoma, ovarian carcinoma, esophageal carcinoma, osteosarcoma, pancreatic carcinoma, prostate carcinoma, squamous cell carcinoma of the head and neck, thyroid carcinoma and urothelial carcinoma.
- astrocytoma acute myelogenous leukemia, breast carcinoma, bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial carcinoma,
- a cell used in a method of the present invention is typically capable of expressing the protein Runx3, or a functional fragment thereof, in that it includes a nucleic acid sequence encoding Runx3, generally in the form of a functional gene of RUNX3 (whether endogenous or exogenous).
- the cell expresses Runx3.
- a respective, for instance endogenous, gene encoding Runx3 is functionally active and expressing Runx3.
- an endogenous nucleic acid sequence encoding Runx3 is functionally inactive.
- Runx3 is nevertheless expressed - generally from an exogenous RUNX3 gene.
- An exogenous gene encoding Runx3 may be introduced by means of recombinant technology, for instance by means of a vector carrying a RUNX3 gene. It may in this regard be advantageous to further use a vector that contains a promoter effective to initiate transcription in the respective host cell (whether of endogenous or exogenous origin).
- vector relates to a single or double-stranded circular nucleic acid molecule that can be transfected into cells and replicated within or independently of a cell genome.
- a circular double-stranded nucleic acid molecule can be cut and thereby linearized upon treatment with restriction enzymes.
- restriction enzymes An assortment of nucleic acid vectors, restriction enzymes, and the knowledge of the nucleotide sequences cut by restriction enzymes are readily available to those skilled in the art.
- a nucleic acid molecule encoding Runx3 can be inserted into a vector by cutting the vector with restriction enzymes and ligating the two pieces together.
- Runt-related transcription factor 3 proteins which are also termed core-binding factor subunit al ⁇ ha-3, acute myeloid leukemia 2 protein, oncogene AML-2, acute myeloid leukemia 2 protein, Oncogene AML-2, polyomavirus enhancer-binding protein 2 alpha C subunit, polyomavirus enhancer-binding protein 2 alpha C subunit, SL3-3 enhancer factor 1 alpha C subunit, and SL3/AKV core-binding factor alpha C subunit. Examples include, but are not limited to, the mouse protein with the UniProtKB/ TrEMBL accession No.
- B6S2Q4 the chimpanzee protein encoded by the nucleotide sequence with the EMBL accession No. AY406594 and the protein of the smaller spotted catshark encoded by the nucleotide sequence with the EMBL accession No. DQ990014.
- a cell used in a method of the present invention is capable of expressing the protein ⁇ -catenin, also termed CTNNB, or a functional fragment thereof.
- the cell expresses ⁇ -catenin.
- a gene encoding ⁇ -catenin which may be an endogenous gene, is functionally active and expressing ⁇ -catenin.
- an endogenous nucleic acid sequence encoding ⁇ -catenin is functionally inactive, ⁇ -catenin may also be expressed from an exogenous ⁇ -catenin gene, which may be introduced by means of recombinant technology, e.g. using a vector carrying a ⁇ -catenin gene (see also above for Runx3).
- a cell used in a method of the present invention is capable of expressing a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof.
- the member of the TCF/LEF transcription co-factor family is expressed by the cell.
- a gene encoding the member of the TCF/LEF transcription co-factor family which may be an endogenous gene, is functionally active in the cell, thus expressing the member of the TCF/LEF transcription co-factor family.
- an endogenous nucleic acid sequence encoding the protein is functionally inactive.
- the member of the TCF/LEF transcription co-factor family is expressed from an exogenous gene encoding the same, which may be introduced by means of recombinant technology, e.g. using a vector carrying a gene of the member of the TCF/LEF transcription co-factor family (cf. also above).
- Tcf/Lef family are high mobility group (HMG) box transcription factors.
- the member of the TCF/LEF transcription co-factor family may for instance be Lymphoid enhancer-binding factor 1, abbreviated LEFl or T-cell factor 1, abbreviated TCF-I, also called T-cell-specific transcription factor 1 or Transcription factor 7. It may for instance also be HMG box transcription factor 3 (or simply transcription factor 3), abbreviated TCF-3, or T-cell transcription factor-4 (or simply transcription factor 4), abbreviated TCF-4, which has also been named immunoglobulin transcription factor 2 (ITF-2), SL3-3 enhancer factor 2 (SEF-2) or class A helix-loop-helix transcription factor ME2.
- IGF-2 immunoglobulin transcription factor 2
- SEF-2 SL3-3 enhancer factor 2
- ME2 class A helix-loop-helix transcription factor ME2.
- LEFl, Lymphocyte enhancer binding factor 1 may for instance, without being limited thereto, be the mouse protein with the UniProtKB/TrEMBL accession No. Q8BGZ9, the human protein with the UniProtKB/TrEMBL accession No. Q3ZCU4, the zebrafish protein with the UniProtKB/ TrEMBL accession No Q9W7C0, the dog protein with the UniProtKB/TrEMBL accession No. B6VCV6, the rat protein with the UniProtKB/TrEMBL accession No Q9QXN1 or an isoform or variant of such a protein.
- TCF-I examples include, but are not limited to, the human protein with the UniProtKB/TrEMBL accession No. P36402, the mouse protein with the UniProtKB/ TrEMBL accession No Q00417, the chicken protein with the UniProtKB/TrEMBL accession No. Q8JHX2, the zebrafish protein with the UniProtKB/ TrEMBL accession No Q9PU63, the protein of the western clawed frog Xenopus tropicalis_with the UniProtKB/TrEMBL accession No. Q7T265 or an isoform or variant of such a protein.
- TCF-3 examples include, but are not limited to, the human protein with the UniProtKB/TrEMBL accession No.
- Q9HCS4 the protein of the western clawed frog Xenopus tropicalis with the UniProtKB/TrEMBL accession No. Q6YJU5, the chicken protein with the UniProtKB/TrEMBL accession No. Q8 JHX3, the mouse protein with the UniProtKB/TrEMBL accession No Q9Z1 Jl, or an isoform or variant of such a protein.
- TCF-4 include, but are not limited to, the human protein with the UniProtKB/TrEMBL accession No. Q9NQB0, the mouse protein with the UniProtKB/TrEMBL accession No.
- a cell used in a method of the present invention is capable of expressing a member of the Akt family, such as Aktl, Akt2 or Akt3.
- Aktl include, but are not limited to, the human protein with the UniProtKB/TrEMBL accession No.
- Akt2 examples include, but are not limited to, the human protein with the UniProtKB/TrEMBL accession No. P31751, the zebrafish protein with the UniProtKB/TrEMBL accession No. Q8UUX0, the mouse protein with the UniProtKB/TrEMBL accession No Q60823, the chicken protein with the UniProtKB/TrEMBL accession No Q9PUJ3, the rat protein with the UniProtKB/TrEMBL accession No P47197, or an isoform or variant of such a protein.
- Akt3 examples include, but are not limited to, the human protein with the UniProtKB/TrEMBL accession No.
- nucleic acid refers to any nucleic acid molecule in any possible configuration, such as single stranded, double stranded or a combination thereof.
- Nucleic acids include for instance DNA molecules, RNA molecules, analogues of the DNA or RNA generated using nucleotide analogues or using nucleic acid chemistry, locked nucleic acid molecules (LNA), protein nucleic acids molecules (PNA) and tecto-RNA molecules (e.g. Liu, B., et al., J. Am. Chem. Soc. (2004) 126, 4076-4077).
- LNA locked nucleic acid molecules
- PNA protein nucleic acids molecules
- tecto-RNA molecules e.g. Liu, B., et al., J. Am. Chem. Soc. (2004) 126, 4076-4077.
- a PNA molecule is a nucleic acid molecule in which the backbone is a pseudopeptide rather than a sugar.
- PNA generally has a charge neutral backbone, in contrast to for example DNA or RNA. Nevertheless, PNA is capable of hybridising at least complementary and substantially complementary nucleic acid strands, just as e.g. DNA or RNA (to which PNA is considered a structural mimic).
- An LNA molecule has a modified RNA backbone with a methylene bridge between C4' and OT, which locks the furanose ring in a N-type configuration, providing the respective molecule with a higher duplex stability and nuclease resistance.
- an LNA molecule has a charged backbone.
- DNA or RNA may be of genomic or synthetic origin and may be single or double stranded. Such nucleic acid can be e.g.
- a respective nucleic acid may furthermore contain non-natural nucleotide analogues and/or be linked to an affinity tag or a label.
- nucleotide analogues are known and can be used in the method of the invention.
- a nucleotide analogue is a nucleotide containing a modification at for instance the base, sugar, or phosphate moieties.
- a substitution of 2'-OH residues of siRNA with 2'F, 2'0-Me or 2'H residues is known to improve the in vivo stability of the respective RNA.
- Modifications at the base moiety include natural and synthetic modifications of A, C, G, and TVU, different purine or pyrimidine bases, such as uracil-5-yl, hypoxanthin-9-yl, and 2-aminoadenin-9-yl, as well as non-purine or non-pyrimidine nucleotide bases.
- Other nucleotide analogues serve as universal bases.
- Universal bases include 3-nitropyrrole and 5-nitroindole. Universal bases are able to form a base pair with any other base. Base modifications often can be combined with for example a sugar modification, such as for instance 2'-O-methoxyethyl, e.g. to achieve unique properties such as increased duplex stability.
- Preventing, inhibiting, arresting or reversing tumorigenesis as well as inducing apoptosis in a tumor cell by modulating the formation of aforementioned complex can be performed in various ways. Generally this modulation can occur on the level of transcription, on the level of protein turnover, on the functional level by changing the activation state of the respective components of the complex or by a combination of any of these levels of action. A modulation on the level of transcription alters the amount of the respective protein present in the cell and thus available for the complex formation. An increased expression of a respective protein (e.g. Runx3 or ⁇ -catenin) may be established by stimulating the expression of a corresponding endogenous protein in the cell.
- a respective protein e.g. Runx3 or ⁇ -catenin
- transcription and translation of a respective endogenous gene of the cell encoding the respective DACT protein may be stimulated or a state of inhibition thereof may be reduced or terminated.
- the ability of RUNX3 to form a complex with ⁇ -catenin and/or a member of the TCF/LEF transcription co-factor family may be altered, e.g. increased or reduced, by changing the phosphorylation status of RUNX3, for example at a serine residue, a threonine residue or a tyrosine residue.
- RUNX3 a decreased or increased amount thereof in the cell
- altering the protein turnover e.g. by a reduced or increased degradation.
- increasing the amount of RUNX3 in a cell can lead to an increased complex formation between RUNX3 and ⁇ -catenin and/or a member of the TCF/LEF family.
- transcription of target genes of the TCF/LEF protein may be attenuated.
- tumorigenesis may be arrested, prevented or reversed.
- a modulation of the said complex formation on the functional level may include alterations of the components of the complex or a direct interference with the formation of the complex.
- One embodiment for achieving such and other modulations with consequent effects on the said complex formation includes administering a compound.
- the compound may be a modulator of a member of the family of PI3 kinase enzymes, in particular a class IA PI3 kinase, or a modulator of a lipid phosphatase that hydrolyses phosphatidylinositol 3,4,5-trisphosphate, e.g. to phosphatidylino- sitol-4,5-bisphosphate, such as PTEN (phosphatase and tensin homologue deleted in chromosome 10).
- PTEN phosphatase and tensin homologue deleted in chromosome 10.
- a phosphatase such as PTEN counteracts PBK-dependent Akt activation.
- PB kinase is a lipid kinase that phosphorylates phosphatidylinositol 4,5-bis- phosphate to phosphatidylinositol 3,4,5-trisphosphate. Elevated levels of phosphatidylinositol 3,4,5-trisphosphate in a cell are known to activate the serine/threonin kinase Akt (also termed protein kinase B), which translocates to the cytoplasm and to the nucleus (supra).
- Akt serine/threonin kinase B
- the compound is a general Cyclooxygenase-inhibitor such as Aspirin® or a Cyclooxygenase-2 inhibitor such as NS 398.
- Aspirin® or a Cyclooxygenase-2 inhibitor such as NS 398.
- Uddin S, et al. have recently provided data that suggest that inhibition of Cyclooxygenase-2 results in dephosphorylation and inactivation of Akt (M J Cancer, 2009, JuI 20, epub, "Cyclooxygenase-2 inhibition inhibits PI3K/AKT kinase activity in epithelial ovarian cancer").
- the compound used to modulate the said complex formation can be of any nature. It may for instance be a nucleic acid (see above), a peptide, a peptoid, an inorganic molecule and a small organic molecule. Peptoids can have a much higher cell permeability than peptides (see e.g. Kwon, Y.-U., and Kodadek, T., J. Am. Chem. Soc. (2007) 129, 1508-1509).
- a peptide may be of synthetic origin or isolated from a natural source by methods well-known in the art. The natural source may be mammalian, such as human, blood, semen, or tissue.
- a peptide, including a polypeptide may for instance be synthesized using an automated polypeptide synthesizer.
- polypeptides are an antibody, a fragment thereof and a proteinaceous binding molecule with antibody-like functions.
- Examples of (recombinant) antibody fragments are Fab fragments, Fv fragments, single-chain Fv fragments (scFv), diabodies or domain antibodies (Holt, L. J., et al., (2003) Trends Biotechnol, 21, 11, 484-490).
- a proteinaceous binding molecule with antibody-like functions is a mutein based on a polypeptide of the lipocalin family (WO 03/029462, Beste et al., (1999) Proc. Natl. Acad. Sd. U.S.A., 96, 1898-1903).
- Lipocalins such as the bilin binding protein, the human neutrophil gelatinase- associated lipocalin, human Apolipoprotein D or glycodelin, posses natural ligand-binding sites that can be modified so that they bind to selected small protein regions known as haptens.
- glubodies see WO 96/23879
- proteins based on the ankyrin scaffold Mosavi, L.K., et al., (2004) Protein Science 13, 6, 1435-1448
- crystalline scaffold WO 01/04144
- AdNectins tetranectins
- avimers contain so called A-domains that occur as strings of multiple domains in several cell surface receptors (Silverman, J., et al., (2005) Nature Biotechnology 23, 1556-1561).
- Adnectins derived from a domain of human fibronectin, contain three loops that can be engineered for immuno globulin- like binding to targets (Gill, D. S. & Damle, N.K., (2006) Current Opinion in Biotechnology 17, 653-658).
- Tetranectins derived from the respective human homotrimeric protein, likewise contain loop regions in a C-type lectin domain that can be engineered for desired binding (ibid.).
- Peptoids which can act as protein ligands, are oligo(N-alkyl) glycines that differ from peptides in that the side chain is connected to the amide nitrogen rather than the ⁇ carbon atom.
- Peptoids are typically resistant to proteases and other modifying enzymes and can have a much higher cell permeability than peptides (see e.g. Kwon, Y.-U., and Kodadek,T., (2007) J. Am. Chem. Soc. 129, 1508- 1509).
- a modifying agent may be used that further increases the affinity of the respective moiety for any or a certain form, class etc. of target matter.
- the compound may for instance be isolated from a biological or non-biological source or chemically or biotechnologically produced.
- Such compounds are, without being limited to, small organic molecules or bioactive polymers, such as polypeptides, for instance immunoglobulins or binding proteins with immunoglobulin-like functions, or oligonucleotides.
- One embodiment of such a compound is a nucleic acid molecule, in particular an RNA or DNA molecule, whereof in particular a non-coding nucleic acid molecule, such as for example an aptamer or a Spiegelmer® (described in WO 01/92655).
- a non-coding nucleic acid molecule may also be an nc-RNA molecule (see e.g. Costa, FF, Gene (2005), 357, 83-94 for an introduction on natural nc-RNA molecules).
- nc-RNA molecules include, but are not limited to, an anti-sense-RNA molecule, an L-RNA Spiegelmer®, a silencer-RNA molecule (such as the double-stranded Neuron Restrictive Silencer Element), a micro RNA (miRNA) molecule, a short hairpin RNA (shRNA) molecule, a small interfering RNA (siRNA) molecule, a repeat-associated small interfering RNA (rasiRNA) molecule or an RNA that interacts with Piwi proteins (piRNA).
- miRNA micro RNA
- shRNA short hairpin RNA
- siRNA small interfering RNA
- rasiRNA repeat-associated small interfering RNA
- piRNA Piwi proteins
- RNA interference represents a cellular mechanism that protects the genome.
- SiRNA molecules mediate the degradation of their complementary RNA by association of the siRNA with a multiple enzyme complex to form what is called the RNA-induced silencing Complex (RISC).
- RISC RNA-induced silencing Complex
- the siRNA becomes part of RISC and is targeted to the complementary RNA species which is then cleaved. This leads to the loss of expression of the respective gene (for a brief overview see Zamore, PD, & Haley, B (2005) Science 309, 1519-1524).
- This technique has for example been applied to silencing parasitic DNA sequences, such as the cleavage of HIV RNA, as disclosed in US patent application 2005/0191618.
- a typical embodiment of such a siRNA for the current invention includes an in vitro or in vivo synthesized molecule of 10 to 35 nucleotides, in some embodiments 15 to 25 nucleotides.
- a respective si-RNA molecule maybe directly synthesized within a cell of interest (including a cell that is part of a microorganism and an animal). It may also be introduced into a respective cell and/ or delivered thereto.
- An illustrative example of delivering a siRNA molecule into selected cells in vivo is its non-covalent binding to a fusion protein of a heavy-chain antibody fragment (Fab) and the nucleic acid binding protein protamin (Song, E. et al. (2005), Nature Biotech. 23 , 6, 709-717).
- siRNA molecules are used to induce a degradation of mRNA molecules encoding one or more components of the complex the formation of which is to be modulated.
- Another example of a compound used to modulate the said complex formation is a molecule that is able to change the phosphorylation status of cellular components, in particular proteins.
- Examples of compounds that are known to affect the phosphorylation status of proteins are broad-spectrum kinase inhibitors, serine/threonine kinase inhibitors, tyrosine kinase inhibitors, tyrosine phosphorylation stimulators or tyrosine phosphatase inhibitors.
- a protein kinase inhibitor see also below
- protein kinase activator in form of a synthetic small organic compound maybe used for this purpose.
- a respective compound is capable of altering the degree of phosphorylation of RUNX3 or a functional fragment thereof. In some embodiments a respective compound is capable of altering the degree of phosphorylation of Akt/protein kinase B.
- Illustrative examples of an inhibitors of Akt are the low molecular weight organic compounds A-443654, KP372-1, VQD-002 or phosphatidylinositol) analogs.
- phosphorylation of Akt may lead to activation of Akt, thereby causing phosphorylation of RUNX3.
- the formation of a complex between RUNX3 , or a functional fragment thereof and at least one of (i) ⁇ -catenin, or a functional fragment thereof, and (ii) a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof maybe attenuated.
- An illustrative selection of a compound that is able to change the phosphorylation status of cellular components is a modulator of the degree of tyrosine phosphorylation, of serine phosphorylation or of threonine phosphorylation of cellular proteins. This selection is based on the inventive finding that a change of the phosphorylation status of tyrosine residues in the cell has an effect on the efficiency of the complex formation of RUNX3 with ⁇ -catenin and/or a member of the TCF/LEF transcription factor family.
- the use of a compound that changes the phosphorylation status of threonine, serine or tyrosine residues in the cell is therefore also an embodiment of a method of altering the complex formation between RUNX3 , ⁇ -catenin and/or a member of the TCF/LEF transcription factor family.
- a suitable compound identified and used in the present invention may be selected from tyrosine kinase inhibitors, a large number of which are commercially available such as tyrphostins, quinazolines, quinoxalines, quinolines, 2-phenylaminopyrimidines, flavonoids, benzoquinoids, aminosalicylates or stilbenes (which are described in e.g. WO 9618738, WO 03035621 and references cited therein, for an example of their experimental identification see e.g. US 6,740,665).
- tyrosine kinase inhibitors a large number of which are commercially available such as tyrphostins, quinazolines, quinoxalines, quinolines, 2-phenylaminopyrimidines, flavonoids, benzoquinoids, aminosalicylates or stilbenes (which are described in e.g. WO 9618738, WO 03035621 and references cited therein
- tyrphostins examples include AG213, AG490, AG 879, AG 1295, AG 1478, AG 1517, AGL 2043, tyrphostin 46 and methyl 2,5-dihydroxycinnamate.
- Quinazolines are for instance PD153035, PD 156273, gefitinib or lapatinib; quinoxalines are for example PD153035 or ZD1839.
- An example for a quinoline is 5-methyl-5H-indolo[2,3- ⁇ ]quinoline
- an example for a 2-phenylaminopyrimidine is imatinib
- examples for flavonoids are genistein or quercetin
- an example for a benzoquinoid is herbimycin A
- an example for an aminosalicylate is lavendustin A
- an example for a stilbene is piceatannol.
- Suitable compounds may include a receptor tyrosine kinase inhibitor such as the tyrphostin erbstatin, an EGFR specific receptor tyrosine kinase inhibitor such as WHI-P97 or the tyrphostin AG 592, a tyrosine phosphorylation stimulator such as aurin tricarboxylic acid or a tyrosine phosphatase inhibitor such as sodium pervanadate or isoxazole carboxylic acids.
- a receptor tyrosine kinase inhibitor such as the tyrphostin erbstatin
- an EGFR specific receptor tyrosine kinase inhibitor such as WHI-P97 or the tyrphostin AG 592
- a tyrosine phosphorylation stimulator such as aurin tricarboxylic acid or a tyrosine phosphatase inhibitor such as sodium pervanadate or isoxazole
- a further example of such a compound modulating the tyrosine phosphorylation of a RUNX3 protein is an agonist or antagonist for a cell surface molecule that is able to induce the regulation of a protein kinase or protein phosphatase.
- cell surface molecules are receptor tyrosine kinases, membrane receptors with associated tyrosine kinase activity, and G protein coupled receptors, the signal transduction of which are interconnected with pathways regulating protein kinases and phosphatases.
- Examples for a receptor tyrosine kinase are a receptor for a platelet derived growth factor, a receptor for erythropoietin, a receptor for tumor necrosis factor, a receptor for leukaemia inhibitory factor, a receptor for an interferon, a receptor for insulin, a receptor for an insulin-like growth factor, a receptor for an interleukin, a receptor for a fibroblast growth factor, a receptor for a granulocyte-macrophage colony stimulating factor, a receptor for a transforming growth factor, or a receptor for an epidermal growth-factor (EGF).
- EGF epidermal growth-factor
- Such receptors are known to possess the ability to phosphorylate tyrosine residues of various proteins and to be themselves able to regulate further factors inside the cell that possess a similar effect (see e.g. Pazin MJ, Williams LT, Trends in Biochemical Sciences 17 (10), 1992, 374-378, for the EGF receptor see e.g. Janmaat ML, Giaccone G, Oncologist 8 (6), 2003, 576-586).
- the terms "agonist” and “antagonist” in this context therefore refer to the ability of the cell surface molecule to produce such effects and the modulation of this ability.
- One embodiment of such an agonist or antagonist is a proteinaceous molecule that binds to a molecule on the cell surface, which is able to induce the regulation of a tyrosine kinase or tyrosine phosphatase.
- immuno- globulins examples include immuno- globulins, (recombinant) immunoglobulin fragments such as Fab fragments, Fv fragments, single-chain Fv fragments (scFv), diabodies, triabodies (Iliades, P., et al., FEBS Lett (1997) 409, 437_441) 5 decabodies (Stone, E., et al., Journal of Immunological Methods (2007) 318, 88-94) and other domain antibodies (Holt, L. J., et al., Trends Biotechnol. (2003), 21, 11, 484-490).
- immuno- globulins such as Fab fragments, Fv fragments, single-chain Fv fragments (scFv), diabodies, triabodies (Iliades, P., et al., FEBS Lett (1997) 409, 437_441) 5 decabodies (Stone, E., et al.,
- Single-chain Fv fragments are for instance fusions of variable regions from one heavy chain and one light chain of an immunoglobulin molecule.
- An example of a proteinaceous binding molecule with antibody-like functions is a mutein based on a polypeptide of the lipocalin family (WO 2003/029462; WO 2005/019254; WO 2005/019255; WO 2005/019256; Beste et al, Proc. Natl. Acad. Sd. USA (1999) 96, 1898-1903).
- Lipocalins such as the bilin binding protein, the human neutrophil gelatinase-associated lipocalin, human Apolipoprotein D, human tear lipocalin, or glycodelin, posses natural ligand-binding sites that can be modified so that they bind to selected small protein regions known as haptens.
- further proteinaceous binding molecules so-called glubodies (see WO 96/23879), proteins based on the ankyrin scaffold (Mosavi, L.K., et al., Protein Science (2004) 13, 6, 1435-1448) or the crystalline scaffold (WO 2001/04144), the proteins described by Skerra (J. MoI. Recognit.
- AdNectins tetranectins
- avimers contain so called A-domains that occur as strings of multiple domains in several cell surface receptors (Silverman, J, et al., Nature Biotechnology (2005) 23, 1556-1561).
- Adnectins derived from a domain of human fibronectin, contain three loops that can be engineered for immuno- globulin-like binding to targets (Gill, D. S. & Damle, N.K., Current Opinion in Biotechnology (2006) 17, 653-658).
- Tetranectins derived from the respective human homotrimeric protein, likewise contain loop regions in a C-type lectin domain that can be engineered for desired binding (ibid.).
- Peptoids which can act as protein ligands, are oligo(N-alkyl) glycines that differ from peptides in that the side chain is connected to the amide nitrogen rather than the ⁇ carbon atom. Peptoids are typically resistant to proteases and other modifying enzymes and can have a much higher cell permeability than peptides (see e.g. Kwon, Y. -U., and Kodadek, T., J. Am. Chem. Soc. (2007) 129, 1508-1509).
- a modifying agent may be used that further increases the affinity of the respective moiety for any or a certain form, class etc. of target matter.
- a method according to the invention is a method of identifying a candidate compound that is capable of preventing tumorigenesis in a cell and/or of inducing apoptosis in a tumour cell. Such a method may include introducing the compound into a cell that is capable of expressing Runx3 or a functional fragment thereof and one or more of (i) ⁇ -catenin, or a functional fragment thereof, and (ii) a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof.
- the method includes determining the above complex formation, i.e. between Runx3 and (i) ⁇ -catenin, and/or (ii) a member of the TCF/LEF transcription co-factor family (including a functional fragments of the respective proteins).
- An alteration in the complex formation is an indication that the compound is capable of preventing tumorigenesis in a cell and/or of inducing apoptosis in a tumour cell.
- compounds may be used in form of a library. Examples of such libraries are collections of various small organic molecules, chemically synthesized as model compounds, or nucleic acid molecules containing a large number of sequence variants.
- a method of identifying a compound according to the invention may be carried out as a screening method, including a high-throughput method.
- a library of compounds may for example be screened to identify candidate compounds capable of altering the said complex formation.
- a plurality of candidate compounds are analysed according to a method of the present invention in order to identify a compound capable of preventing, inhibiting, arresting or reversing tumourigenesis, such an embodiment may typically called a screening process.
- These candidate compounds may be analysed independent from each other, e.g. concurrently, consecutively or in any way out of phase.
- the candidate compounds may for example be added to a cell culture medium or be administered to an organism, for example a mouse or a fruit fly.
- any number of steps of analysing a plurality of candidate compounds may for example be carried out automatically- also repeatedly, using for instance commercially available robots.
- any number of automation devices may be employed, for instance an automated read-out system, a pipetting robot, a rinsing robot, or a fully automated screening system.
- the process may be an in-vitro screening process, for example carried out in multiple- well microplates (e.g. conventional 48-, 96-, 384- or 1536 well plates) using one or more automated work stations.
- the invention provides a process of high-throughput screening.
- the method may also be carried out using a kit of parts, for instance designed for performing the present method
- Yet other related methods are in-vivo methods that include providing a host organism.
- Any desired host organism may be provided as long as it is capable of accommodating and growing a tumour cell, e.g. a cancer cell.
- a host organism include, but are not limited to, a mammal, a fish, an amphibian and a bird.
- Any desired cancer cell maybe used for this purpose (see above for examples).
- the method further includes introducing a cancer cell into the host organism.
- the method includes the use of a compound as described above, i.e.
- the cancer cell includes the compound. Accordingly the compound may be introduced into the cancer cell before introducing the same into the host organism. In some embodiments the compound is administered to the host organism, before, after or concurrently with introducing the cancer cell therein. Typically the compound is introduced into the cancer cell at a certain stage of the method. The method further includes monitoring the growth of tumours in the host organism. [0099] In some embodiments methods of prognosis and diagnosis according to the present invention include detecting the presence of one of the above complexes.
- Some methods and uses according to the invention include or aim at inducing apoptosis in a tumor cell.
- Apoptosis is a programmed cell death and typically a mechanism in a multicellular organism to remove undesired cells. Where a cell's capability to undergo or initiate apoptosis is impaired or abolished, a damaged cell is able to proliferate in an unchecked manner, thereby developing into a cancer cell.
- An apoptotic cell shows a characteristic morphology, by which it can be identified under a microscope.
- apoptosis in a tumor cell may be monitored, for example by propodium iodide staining or flow cytometry analysis, mitochondrial dysfunction or caspase 3 activation.
- the method of the invention triggers an apoptotic cell death response involving mitochondria disruption and caspase activation.
- Non-cancerous cells however show only a marginal cell death response, if any at all.
- a method according to the present invention may include determining cell viability in a respective cell. Respective methods are well established in the art.
- Some methods according to the present invention are methods of controlling tumorigenesis. These methods include in particular methods of preventing, inhibiting, arresting or reversing tumourigenesis.
- Tumourigenesis may for example be carcinogenesis, including the formation of malignant forms of carcinomas. Accordingly, the method may for example be included in a treatment or prevention of a proliferative disease or disorder, such as cancer.
- the present invention encompasses inter alia the assessment of one of the above named complexes in a cell for diagnostic, prognostic, and therapeutic purposes. Based on the inventors' findings the invention also provides methods of identifying a compound that is capable of preventing, inhibiting, arresting or reversing tumorigenesis, including carcinogenesis, in a cell and/or of inducing apoptosis in a tumor cell. Some of these methods are in vivo or ex vivo methods. Some of the methods are in-vitro methods of identifying a respective compound. The compound may be capable of influencing the formation of one of the above complexes. Some methods according to the invention include exposing the components of this complex to each other, whether in-vitro or in-vivo.
- One such method is an in-vitro method, which includes contacting the components that form, or are suspected to form, a complex with each other.
- the compound may be capable of altering the complex formation between the components thereof, e.g. between ⁇ -catenin, or a functional fragment thereof, and RUNX3, or a functional fragment thereof.
- a respective method includes contacting the compound and the components of the respective complex such as ⁇ -catenin, or a functional fragment thereof, and RUNX3, or a functional fragment thereof, hi such embodiments the formation of a complex is detected.
- the method further includes detecting the formation of the complex. Any suitable method of detecting a complex formation may be used.
- a detection method may for instance include electrophoresis, HPLC, flow cytometry, fluorescence correlation spectroscopy or a modified form of these techniques.
- Methods such as immunoprecipitation or copurification using a chromatography technique may be carried out under native conditions, i.e. conditions where at least substantially no denaturation of the proteins of interest occurs.
- Other techniques involve a measurement of the biomolecular binding itself. Such measurements may for instance rely on spectroscopic, photochemical, photometric, fluorometric, radiological, enzymatic or thermodynamic means.
- An enhancement or a reduction of the formation of a complex as named above indicates that the compound may be capable of preventing, inhibiting, arresting or reversing tumorigenesis in a cell and/or of inducing apoptosis in a tumor cell.
- Assessing the formation or presence of said complex may include a measurement of the binding of one or more of its components. Such measurements may for instance rely on spectroscopic, photochemical, photometric, fluorometric, radiological, enzymatic or thermodynamic means.
- An example for a spectroscopic detection method is fluorescence correlation spectroscopy.
- a photochemical method is for instance photochemical cross-linking.
- the use of photoactive, fluorescent, radioactive or enzymatic labels respectively represent illustrative examples for photometric, fluorometric, radiological and enzymatic detection methods.
- An example for a thermodynamic detection method is isothermal titration calorimetry. Some of these methods may include additional separation techniques such as electrophoresis or HPLC.
- examples for the use of a label include a compound as a probe or an immunoglobulin with an attached enzyme, the reaction catalysed by which leads to a detectable signal.
- An example of a method using a radioactive label and a separation by electrophoresis is an electrophoretic mobility shift assay.
- forming a complex as defined above includes the translocation of RUNX3 into the nucleus, in particular from the cytoplasm of the cell to the nucleus.
- releasing a respective complex may include the transfer of RUNX3 from the nucleus to another compartment or organelle of the cell, in particular the cytoplasm.
- one or more so far unknown factors may be responsible for arranging RUNX3 in the cell at a location that differs from the nucleus, in particular the cytoplasm.
- a compound according to the invention may accordingly affect the cellular location of RUNX3 and thereby influence the formation the formation of a complex of RUNX3, or a functional fragment thereof, with ⁇ -catenin, or a functional fragment thereof, and/or a member of the TCF/LEF transcription co-factor family, or a functional fragment thereof.
- a method of the invention, including a diagnostic and/or a therapeutic method may include determining the cellular location of RUNX3.
- a location of RUNX3 outside the nucleus may for instance be an indication that the respective cell bears a risk or has a predisposition of turning tumorigenic, including cancerogenic. Accordingly, an individual in whom such a cellular location has been identified may have an increased risk of developing a neoplasm, such as a tumor, including cancer or ulcerative colitis.
- the present invention also relates to a method of diagnosing the risk of developing a neoplasm, such as a tumor, including cancer, in a subject.
- a respective tumor may for example be a breast tumor, a lung tumor, a colorectal tumor, a tumor of the urinary bladder or a tumor of the fallopian tube (also termed oviduct).
- a respective cancer may for instance be breast cancer, lung cancer, colorectal cancer, cancer of the urinary bladder or cancer of the fallopian tube (also termed oviduct), including one of the corresponding carcinomas.
- An illustrative example of a carcinoma of lung cancer is a non-small cell lung carcinoma.
- the method includes determining the presence, possibly including determining the amount thereof, of one of the above named complexes.
- the measurement may in some embodiments be carried out in a sample, such as a tissue sample or a cell sample, from the subject.
- the method may also include comparing the results of measuring the presence and/or the amount of a omplex as described above.
- a sample may be used, in which the above described complex formation is known to be on a customary ("normal") level.
- an altered complex formation as compared to the control measurement indicates that the subject suffers from or is at risk of developing a neoplasm.
- Further methods of the invention are methods, both in-vivo and in-vitro methods, of identifying a compound capable of altering the said complex formation, i.e. a complex between RUNX3, or a functional fragment thereof, and one or both of (i) a member of the TCF/LEF transcription co-factor family or a functional fragment thereof, and (ii) ⁇ -catenin, or a functional fragment thereof.
- the compound may be capable of preventing, inhibiting, arresting or reversing tumorigenesis, including carcinogenesis.
- the compound may be capable of altering the forming of the afore described complex.
- these methods include exposing the components of this complex to each other in presence of the compound of interest, whether in-vitro or in-vivo.
- the method further includes detecting the formation of the complex.
- Fig. 1 Simplified schematic of important features of the Wnt/ ⁇ -catenin pathway:
- APC tumour suppressor adenomatous polyposis coli
- APC tumour suppressor adenomatous polyposis coli
- CKI casein kinase 1
- GSK3 ⁇ glycogen synthase kinase 3 ⁇
- B Upon binding of Wnt to the Frizzled (Fz) receptor and a low-density-lipoprotein (LDL) receptor related protein such as the LDL receptor related protein 6 (LRP6), DvI is recruited to this receptor, leading to its activation, whereupon a cascade of events is triggered.
- LDL low-density-lipoprotein
- LRP6 LDL receptor related protein 6
- hypophosphorylated ⁇ -catenin is stabilized, accumulates and translocates to the nucleus. There it forms a complex with a T cell factor (TCF) or a lymphoid enhancer-binding factor (LEF), thereby activating transcription of numerous genes, including c-MYC, cyclin Dl, gastrin or matrilysin.
- TCF T cell factor
- LEF lymphoid enhancer-binding factor
- RUNX3 binds to the complex of ⁇ -catenin and the T cell factor, thereby attenuating transcriptional activity.
- D It is contemplated that activation of AKT leads to RUNX3 phosphorylation, whereby the complex between RUNX3, ⁇ -catenin and the T cell factor according to the method of the invention may be abrogated, or at least weakened.
- FIG. 1 Figure 2. Expression of Runx3 in intestinal epithelial cells and up-regulation of ⁇ -catenin/Tcf4 activity in the RunxS '1' intestine.
- A Immunodetection of Runx3 in wild type (wt) and RunxS '1' jejunum. Note that Runx3 expression is greatly reduced in Paneth cells; ⁇ -catenin is detected in the nuclei of these cells
- Specimens were counterstained with hematoxylin (A, B, G, and H). Scale bars are equal to 50 ⁇ m (B, G, H) and 100 ⁇ m (A, C, D, and I).
- HCTl 16 cells were transfected with Myc-TCF4 and the vector (lane 1), Myc-TCF4 and Flag-RUNX3 (lane 2), Flag-RUNX3 and the vector (lane 3), Flag-RUNX3 and Myc-TCF4 (lane 4), Myc-TCF4, Flag-RUNX3 and the vector (lane 5), Myc-TCF4, Flag-RUNX3 and HA- ⁇ -catenin (lane 6).
- Proteins were immunoprecipitated with anti-Flag agarose (lanes 1 and 2), anti-Myc (lanes, 3 and 4), and anti-HA (lanes 5 and 6), and the immunoprecipitates subjected to Western blot analysis using anti-Myc, anti- ⁇ -catenin, anti-HA, and anti-Flag antibodies.
- *Murine IgG was detected (lanes 1 and 2).
- **Anti- ⁇ -catenin (for endogenous ⁇ -catenin; lanes 1-4) and anti-HA (for exogenous HA- ⁇ -catenin; lanes 5 and 6) antibodies were used.
- the first and second immunoprecipitates were subjected to Western analysis using anti-Myc, anti- ⁇ -catenin, and anti-Flag antibodies. *A non-specific band (lanes 3 and 4).
- the immnunoprecipitates were subjected to Western blot analysis using anti-dephospho- ⁇ -catenin, anti-TCF4, and anti-RUNX3 antibodies.
- E Interaction of in vitro translated His-tagged RUNX3 with in vitro translated Myc-TCF4 and/or HA- ⁇ -catenin, as revealed by pull-down assay with Ni-NTA agarose. Western analysis was performed using anti-HA, anti-His, and anti-Myc antibodies.
- Oncogenic ⁇ -catenins have a higher affinity for RUNX3 than wild type ⁇ -catenin.
- HCTl 16 cells were transfected with wild type ⁇ -catenin, ⁇ 45 ⁇ -catenin, or S33Y ⁇ -catenin, together with Flag-RUNX3 or control vector. Proteins immunoprecipitated with anti-Flag agarose were subjected to Western analysis using anti- ⁇ -catenin antibody.
- Flag-RUNX3 (R178Q) (lane 3). Proteins were immunoprecipitated with-anti-Flag agarose.
- Immunoprecipitates were subjected to Western analysis using anti-Myc, anti- ⁇ -catenin, and anti-Flag antibodies.
- Cells were stimulated by the medium containing 20% or 50% of conditioned medium of Wnt3a-expressing L cells.
- Exogenous RUNX3 attenuates the binding of ⁇ -catenin/TCF4 to TCF binding sites of the cyclin Dl and c-Myc promoters.
- DLDl clones expressing exogenous RUNX3 (+) or control vector (-) were subjected to ChIP analysis using antibodies against TCF4 (lanes 3 and 4), dephospho- ⁇ -catenin (lanes 6 and 7), or normal murine IgG (lanes 5 and 8). DNA precipitates were amplified by PCR (35 or 37 cycles).
- Figure 5 Adenomatous polyps in the small intestine of Runx3 +/ ⁇ or Apc M ⁇ n/+ BALB/c mice and progression to adenocarcinoma in Runx3 +/' Apc M ⁇ n/+ compound mice.
- Figure 6 Adenomatous polyps in the small intestines of Runx3 +/' BALB/c mice displaying down-regulated Runx3 and up-regulated cyclin Dl and c-Myc.
- Tl and T2 represent 2 pools of 3-4 polyps each from 1-2 mice with adenomas to provide sufficient material for the material for the ChIP assay.
- DNA fragments precipitated by anti- ⁇ -catenin antibody or control IgG were amplified by PCR (33 cycles). The G ⁇ pdh promoter region was amplified as a negative control.
- A-C Three patterns of ⁇ -catenin and RUNX3 expression in 35 human cases. Type A; nuclear ⁇ -catenin with RUNX3 in nuclei (A), type B; membranous ⁇ -catenin without RUNX3 expression (B), and type C; membranous ⁇ -catenin with RUNX3 expression (C) in T4, T6, and T9 in panel F, respectively. Enlargement of a part of panels A-C is shown in Figure 8. (D and E) Up-regulation of cyclinDl and c-Myc in adenomas of type A (D) and type B (E).
- MSP Methylation specific PCR
- the nucleotide sequence (sense strand) of MSP products from RUNX3 -positive and -negative tumors, DLDl and HCTl 16 cells were shown.
- the labeled C depicts resistance to bisulfite treatment due to methyaltion. Unmethylated C (not highlighted) was converted to T by the bisulfite treatment. Asterisks on T indicate unmethylated C residues in RUNX3 -negative tumors. Unmethylated C (not highlighted) was converted to T by the bisulfite treatment. Asterisks on T indicate unmethylated C residues in RUNX3 -negative tumors.
- FIG. 8 Enlargement of immunohistochemistry of adenomas shown in A, B and C of Figure 7 for better resolution.
- Figure 9 RUNX3 inactivation by gene silencing and protein mislocalization with concomitant accumulation of ⁇ -catenin in human colorectal cancers.
- A-C Differential staining patterns of RUNX3 in human colorectal cancers: positive (A), negative (B), and cytoplasmic positive (C), and summarized as P, N, and C, respectively in the entries of Fig. 19. Specimens were counterstained with hematoxylin. A scale bar is equal to 100 ⁇ m.
- D Differential staining patterns of RUNX3 in human colorectal cancer cell lines: positive (HCTl 16 and SW480), negative (DLDl and RKO), and cytoplasmic positive (SW403 and CCK81).
- FIG. 10 (A) Morphology of wt and Runx3 'A epithelium of jejunum and colon stained by hematoxylin and eosin. Three representative Runx3 ⁇ ' jejunums and colons (7-1-3) from individual adult mice at 30-40 weeks of age are shown. Inflammation was observed in a severe case of colon hyperplasia (-/-3 colon).
- FIG. 1 A and B Immunodetection of CD44 (B) and cyclin Dl (C) in wt and Runx3 'A intestines. Scale bars are equal to 500 ⁇ m (A) and 50 ⁇ m (B, C). [0123] Figure 11.
- C Interaction between RUNX3 and TCFs (TCFl, Lefl, and TCF3).
- HCTl 16 cells were transfected with Myc-TCF1/Flag-RUNX3 or Myc-TCFl /the vector (left), Lefl/Flag-RUNX3 or Lefl /the vector (center), and Myc-TCF3/Flag-RUNX3 or Myc-TCF3/the vector (right).
- Proteins were immunoprecipitated with anti-Flag antibody and subjected to Western blot analysis using anti-Myc, anti-Lefl, or anti-Flag antibodies.
- Murine IgG is detected
- FIG. 12 Attenuation of the binding of ⁇ -catenin/TCF4 to the TCF binding site of the TOP construct by RUNX3, as revealed by EMSA using nuclear extracts prepared from 293T cells expressing Myc-TCF4, S33Y ⁇ -catenin, Flag-RUNX3, or the vector (mock). All reactions contained the same amount of proteins, as normalized to mock extract.
- One dose of RUNX3 extract (Xl) is the same as the amount of TCF4 extract (1 ⁇ g protein).
- the activity of RUNX3 in the extract was confirmed by EMSA using a probe with a RUNX3 site (see panel B). Unlabeled probes were added at an 8-fold excess relative to labeled probes for competition. *A non-specific band detected in all reactions.
- T1-T4 and their adjacent normal epithelial cells (N1-N4) in the small intestine of BALB/c mice were genotyped.
- the ratio of heterozygosity in Runx3 +/ ⁇ tumors to that in adjacent normal epithelial cells was calculated as relative amount of wild type allele per knockout allele in T1-T7.
- the average of the ratio in seven Runx3 +/ ⁇ tumors was 1.03 ⁇ 0.22.
- Wild type epithelial cells (wt), Runx3 +/ ⁇ normal epithelial cells (N), and Runx3 +/ ⁇ adenomas (Tl -T6) in the small intestine were examined by methylation-specific PCR (MSP) using primers specific to the M1-M3 regions. Methylated (M) and unmethylated (U) DNA were detected. El, a mouse gastric cancer cell line with Runx3 promoter hypermethylation (Guo et al., 2002) was used as a positive control.
- MSP methylation-specific PCR
- FIG. 14 Frequency of tumor formation in small and large intestines. Analysis of adenomatous polyps induced in mice of the BALB/c:C57/B6 background at 25 weeks of age. Tumors larger than 0.2 mm in diameter were counted. (B) Number of tumors in the small intestine of individual mice. (C) Size distribution of polyps in the small intestine of mice.
- Figure 15 Up-regulation of CD44 in adenomas of type A and B (A and B, respectively; see Figure 7).
- a scale bars is equal to 100 ⁇ m.
- Figure 16. Morphology of small and large intestines of wild type mice reconstituted with Runx3 ⁇ A (A-D) or Runx3 +/ ⁇ (E) bone marrow cells, one year after transplantation. Jejunums and colons of five individual mice were stained by hematoxylin and eosin. Chimerisms of Runx3 ' ' ' or Runx3 +/' bone marrow cells were; A, 99.8%; B, 99.8%; C, 99.9%; D, 29.3%; E, 99.0%. Scale bars are equal to 500 ⁇ m.
- FIG. 1 Relative proliferation (arbitrary units) of DLDl and HCTl 16 clones (see Figure 4E). Cells were counted at indicated times.
- FIG. 1 Expression patterns of ⁇ -catenin and RUNX3 (type A-C; see the text and Figure 7) and the methylation status of the RUNX3 promoter (M; methylated, U; unmethylated as revealed by MSP) of 35 human sporadic adenomatous polyps (T1-T35) are summarized.
- FIG. 19 Expression pattern of RUNX3 (P, N, and C; see the text and Figure 9) and the methylation status of the RUNX3 promoter (M; methylated, U; unmethylated as revealed by
- MSP MSP of 48 human colorectal cancers are summarized, ⁇ -catenin was accumulated in the nuclei/cytoplasm of all cases except for No. 26, 33, and 42 marked in blue. DNA was not available in 11, 12, and 27 cases (n.a.).
- Figure 20 illustrates the tumor formation in Runx3+/- mice.
- FIG. 21 depicts the binding of RUNX3 to Aktl in vitro.
- 293 cells were transfected with Flag-tagged RUNX3 and myc-tagged AKTl.
- Immunoprecipitation (IP) was performed with anti-Myc polyclonal antibody and immunoblot was performed by either Flag monoclonal antibody or Myc monoclonal antibody.
- Myc epitope-tagged wild type Aktl (wt), constitutively active (CA) and dominant negative (DN) Aktl were used for immunoprecipitation and for direct immunoblotting.
- Immunoprecipitation was performed by using anti-RUNX3 polyclonal antibody from Active Motif (Carlsbad, CA 5 USA).
- Figure 22 depicts the formation of a homologous protein complex in HCTl 16 nuclear extract. Endogenously expressed RUNX3 and endogenously expressed AKT interaction was analyzed using immunoprecipitation using a nuclear extract from colorectal cancer-derived HCTl 16 cells. Immunoprecipitation was performed by using either anti-RUNX3 polyclonal antibody (Active Motif) or anti-AKTl polyclonal rabbit antibody from Cell Signaling. Immunoblotting was carried out by using either anti-RUNX3 monoclonal antibody, R3-5G4 generated in house or AKTl polyclonal antibody.
- Figure 23 illustrates the domain mapping of the RUNX3/Akt interaction, using immunoprecipitation with an anti-myc immunoglobulin (polyclonal). 293 cells were transfected with the indicated deletion constructs of Flag-tagged RUNX3 and Myc-tagged Aktl. Immunoblotting (lower panel) was carried out with an anti-Flag immunoglobulin.
- Figure 24 illustrates the domain mapping of the RUNX3/Akt interaction with a
- FLAG immunoglobulin (monoclonal). 293 cells were transfected with the indicated series of deletion constructs of Myc-tagged Aktl and with Flag-tagged RUNX3. Immunoprecipitation was performed with a Flag monoclonal immunoglobulin. Immunoblotting was carried out using an anti-Myc immunoglobulin.
- FIG. 25 is a schematic illustrating the regions involved. The kinase domain of Aktl and the Runt domain of RUNX3 interact.
- Figure 26 shows that RUNX3 is phosphorylated by Aktl in vitro. Within the highly conserved region of RUNX3, there is a typical consensus amino acid sequence motif known to be the target of phosphorylation by AKT. This figure shows that RUNX3 is a substrate of phosphorylation activity of AKT. A: His-RUNX3, B: His-RUNX3 (T151A), C: His-RUNX3 (T14A). The specifity of the Akt substrate phospho-(Ser/Thr) antibody is indicated at the bottom of the figure. His-tagged full length RUNX3 was prepared in house, commercially available AKTl kinase was from Cell Signaling (Danvers, MA, USA) and GSK3 ⁇ , a known substrate of Aktl (Cell Signaling).
- FIG. 27 shows that exogenously expressed RUNX3 is phosphorylated by endogenously expressing Akt. Endogenous proteins in 293 cells were immunoprecipitated using an immunoglobulin specific to proteins phosphorylated at an AKT-substrate specific phosphorylation site. Immunoblotting was performed by means of a Flag monoclonal immunoglobulin. Lane 2 shows endogenously phosphorylated RUNX3. Lanes 3 and 4 depict a reduced level of phosphorylation of RUNX3 due to knock down of Aktl by shRNAl (lane 3) or shRNA 2 (lane 4). Lane 5 is a positive control in which an exogenously expressed activated form of Aktl strongly phosporylates RUNX3.
- Figure 28 shows that endogenous RUNX3 is phosphorylated by Akt in DLD-I cells. This phosphorylation is inhibited by an inhibitor of AKT kinase.
- DLD-I PI3KCA -/wt
- Flag-RUNX3 was pre-incubated in 0.5 % serum prior to treatments.
- PI3KCA indicates the catalytic subunit of phosphatidylinositol 3-kinase (PI3K). Lysates were immunoprecipitated with either rabbit IgG or AKT-substrate polyclonal antibody.
- Figure 29 shows that the phosphorylation of RUNX3 by Akt reduces the affinity of RUNX3 for TCF4 (A: Copurification of TCF4 with Runt or the indicated mutant, B : Analysis of the intensity of the bands).
- Runx3 in intestinal epithelial cells and up-regulation of ⁇ -catenin/Tcf4 activity in the Runx3 'A intestine
- Runx3 protein was immunohistochemically detected in the epithelial cells of the small and large intestines ( Figure 2A, B). Runx3 is expressed in all epithelial cell types in the small intestine except for Paneth cells, where maturation is induced by Wnt signaling and accompanied by nuclear accumulation of ⁇ -catenin (Fig. 2A; van Es et al., 2005; Andreu et al., 2005). The present inventors reported that Runx3 "A mice of the C57BL/6J background die soon after birth due to starvation (Li et al., 2002). However, some Runx3 'A mice of the BALB/c background (less than 3% of all neonates) survive for about a year. These survivors were analyzed at the adult stage.
- Wnt- ⁇ -catenin/Tcf4 pathway Therefore, the inventors examined whether Wnt signaling is activated in Runx3 ⁇ ' intestinal epithelial cells.
- Target genes known to be positively regulated by ⁇ -catenin/Tcf4, such as CD44, cyclin Dl, c-Myc, Conductin, and EphB2 He et al, 1998; Tetsu and McCormick, 1999; Batlle et al., 2002; van de Wetering et al., 2002) were up-regulated in the ileum, jejunum and colon (Fig. 2G, H, J and Fig.
- EphB/EphrinB system controls the positioning of epithelial cells within the small intestinal mucosa (Batlle et al., 2002). Enhancement of ⁇ -catenin/Tcf4 activity in the 4£">def ⁇ cient small intestine where EphB/EphrinB system is dysregulated also causes displacement of epithelial cells (Sansom et al., 2004; Andreu et al., 2005). This phenomenon can be clearly recognized by the random localization of Paneth cells, which are normally tightly clustered at the bottom of the gland (Batlle et al., 2002).
- Paneth cells were distributed throughout the villi in the Runx3 '/" small intestine (Figure 21). It is noteworthy that the levels of ⁇ -catenin and Tcf4 were not noticeably altered in Runx3 ⁇ / ⁇ compared to wild type epithelial cells of the small and large intestines ( Figure 2J), indicating that the increase in Wnt signaling activity in Runx3 'A intestinal epithelial cells is not due to an increase in the levels of these proteins. It is worth noting that Runx3 '/' FID cells showed higher sensitivity to stimulation by Wnt3a than that of Runx3 +/+ cells (Fig. 3K).
- Runx3 appears to regulate Wnt signaling activity negatively.
- RUNX3 forms a ternary complex with ⁇ -catenin and TCF4
- FIG. 2J 3 the possibility that RUNX3 directly inhibits the function of ⁇ -catenin/TCF4 was examined.
- the inventors examined 22 well-characterized colon cancer cell lines for the expression of RUNX3 (Figure 3A). Only 8 cell lines, HCTl 16, SW480, COLO320, SW403, SW837, CCK81, SW620 and RCMl, express RUNX3 at various levels. It was found that exogenously-expressed TCF4, ⁇ -catenin, and RUNX3 could be co-immunoprecipitated in HCTl 16 cells (Fig.
- RUNX3 and TCF4 did not interact in SW480 cells (see below for significance of this results). Direct interactions between RUNX3 and TCF4 and between RUNX3 and ⁇ -catenin were also observed in a cell-free system (Fig. 3E). Since ⁇ -catenin and TCF4 directly interact, the obtained results suggest that each component in the ternary complex interacts directly with each of the other components. Furthermore, mapping experiments revealed that the Runt domain of RUNX3 and the HMG box of TCF4, which are DNA binding domains, are required for interaction between RUNX3 and TCF4 ( Figure HA, B).
- RUNX3 attenuates the trans activational potential of ⁇ -catenin/TCF4 in Wnt signaling
- ⁇ -catenin/TCF4 Wnt signaling
- TOP/FOPflash reporter system To elucidate the consequence of the interaction of RUNX3 with ⁇ -catenin/TCF4, the transactivation activity of ⁇ -catenin/TCF4 was examined using a TOP/FOPflash reporter system.
- DLDl increasing amounts of exogenous RUNX3 progressively repressed the relatively high TOP activity (Fig. 3G).
- the basal level of the cyclin Dl promoter significantly depended on the presence of a TCF binding site (Fig. 3 J; Lin et al., 2000).
- RUNX3 up-regulates p 21 WAF1/Cipl and inhibits cell growth (Chi et al., 2005). It seems, therefore, RUNX3 has two functions: one as a transcription factor with DNA binding activity and the other as an attenuator of ⁇ -catenin/TCF4 without involving DNA binding. RUNX mutant, RUNX3(R178Q) lacks DNA binding ability and hence transactivation activity (Inoue et al., 2007).
- RUNX3 attenuates the DNA binding activity of ⁇ -catenin/TCF4
- FIG. 4A A ChIP assay using DLDl cells revealed that ⁇ -catenin/TCF4 efficiently binds to consensus TCF binding sites in the cyclin Dl and c-Myc promoters (Fig. 4A, lanes 4 and 7), as previously reported (Nateri et al., 2005).
- RUNX3 was stably expressed in DLDl cells
- the ability of ⁇ -catenin/TCF4 to bind either promoter was greatly reduced (Fig. 4A, lanes 3 and 6, and Fig. 4D) and this was accompanied by the reduction of c-Myc and cyclin Dl proteins (Fig. 4E) and the TOP/FOP luciferase activity (Fig. 4G).
- Adenomatous polyps and adenocarcinomas are induced in the Runx3 +/ ⁇ and Runx3 ⁇ ' Apc M ⁇ n/+ intestines, respectively
- Runx3 ⁇ ' ⁇ FID and FIL cells were used. Only Runx3 ⁇ ' ⁇ FID and FIL cells, but not Runx3 +/+ cells, formed tumors in inoculated mice ( Figure 17C). Runx3 '/' FID and FIL cells stably expressing a dominant negative form of TCF4 (van de Wetering et al., 2002) showed that the tumorigenicity of Runx3 ⁇ ' ⁇ FID and FIL cells was indeed attenuated by inhibition of ⁇ -catenin/Tcf4 ( Figure 17D).
- the Runx3 +/ ⁇ mouse is an excellent model for studying oncogenesis, especially the model of intestinal oncogenesis particularly in its early stages.
- RUNX3 is frequently down-regulated in human adenomatous polyps without accumulation of ⁇ -catenin
- RUNX3 is frequently inactivated in human colorectal cancers with concomitant accumulation of ⁇ -catenin
- RUNX3 therefore, is inactive at least in 44 % of colon cancers. Most of these specimens showed nuclear/cytoplasmic accumulation of ⁇ -catenin (Fig. 19). This is in contrast to human colon adenomas in which there were none that showed nuclear/cytoplasmic accumulation of ⁇ -catenin and RUNX3 inactivation simultaneously so far tested ( Figure 7). These results altogether suggest that adenomas induced by inactivation of RUNX3 will progress to carcinomas and, during this progression period, nuclear/cytoplasmic accumulation of ⁇ -catenin appears to take place. Even in the specimens where RUNX3 is expressed in the nuclei, RUNX3 may not necessarily be functional as a cytostatic protein as mentioned above.
- RUNX3 was not detected in 14 out of 22 human colorectal cancer-derived cell lines (Fig. 3A) and excluded from the nucleus in SW403 and CCK81 cells ( Figure 9D). Therefore, the RUNX3 inactivation by gene silencing and protein mislocalization is prevalent in human colorectal cancer samples (44%; 21/48) and cell lines (73%; 16/22, 77%; 17/22 including the SW480 case without interaction between RUNX3 and TCF4).
- RUNX3 Cell growth inhibitory and tumor suppressive effects of RUNX3 in human colorectal cancer-derived cell lines, DLDl (RUNX3 -negative) and HCTl 16 (RUNX3 -positive), both of which are ⁇ -catenin-activated cell lines, were confirmed by exogenous expression of RUNX3 and knock-down of RUNX3, respectively ( Figure 17A, B).
- RUNX3 was reduced ( Figure 17A, B). Therefore, RUNX3 in these cell lines has cytostatic ability.
- knockdown of RUNX3 in SW480 and SW403 did not show significant increase of the TOP/FOP ratio due to a lack of interaction between RUNX3 and TCF4 and protein mislocalization, respectively (Fig. 4H), emphasizing the importance of the interaction between these two transcription factors for attenuation of Wnt signaling by RUNX3.
- CIMP CpG island methylator phenotype
- RUNX3 was identified as one of the five in a marker panel that most strongly satisfies the CIMP (Weisenberger et al., 2006).
- the transgenic mice over-expressing DNA methyltransferase Dnmt3b show the enhancement of tumorigenesis in Apc Min/+ mice (Linhart et al., 2007).
- tumor suppressor genes, Sfrp2, Sfrp4 and Sfrp5 are methylated and silenced, whereas genes often methylated in cancer cells, Mlhl, Mgmt, Cdkn2b, Ape, RbI, VhIh and Brcal are not.
- Runx3 is a downstream attenuator of Wnt signaling cascade. It is interesting to note that attenuators of Wnt signaling at upstream and downstream ends are apparently targeted for methylation and silenced during oncogenic development. It would be important to study whether Runx3 is a target of Dnmt3b during the early stage of carcinogenesis.
- Runx3 ⁇ ' ⁇ mice never developed epithelial tumors, unlike Runx3 +/' mice.
- certain threshold levels of PU.1, C/EBP ⁇ or GATA-I expression are required for carcinogenesis (reviewed by Rosenbauer et al., 2005). This observation would be in line with those observed in the leukemia cases.
- Gut development, and intestinal stem cell maintenance and differentiation are regulated by interactions between key signaling pathways.
- the observations made in this study provide a significant insight into the interaction between the Wnt and TGF- ⁇ superfamily pathways in intestinal tumorigenesis.
- Colorectal cancer cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. Cells were transfected with pcDNA3, pcDNA-Flag-RUNX3, or pEF-BOS-neo-RUNX3-AS as described previously (Ito et al., 2005). Stable transfectants were selected in the presence of 0.5 mg/ml G418 (GIBCO). An ecdysone-inducible Flag-RUNX3 clone of DLDl was established as described previously (Yamamura et al., 2006).
- shRNAs targeting RUNX3 (shl : gcccagagaagatgagtctat, SEQ ID NO: 1 ; sh2: aagcagctatgaatccattgt, SEQ ID NO: 2; sh3: tcagtagtgggtaccaatctt, SEQ ID NO: 3) and the control shRNA were obtained from SuperArray Bioscience (Maryland).
- pGeneClip-hMGFP Promega was used as the vector for the transfection. Sorted cells with the GFP expression were subjected to the Western blot analysis, and were transfected with reporter plasmids; TOP/FOPflash (Upstate).
- Immnunocytochemistry to detect RUNX3 in colorectal cancer cell lines was performed using anti-RUNX3 (MBL; R3-6E9) antibody as described previously (Ito et al., 2005).
- Mouse small and large intestinal epithelial cell lines, FID and FIL, respectively, were established from isolated intestinal epithelium of 16.5 dpc Rwvc3 +/+ p53 'A and RunxS ' ⁇ pSS ' ⁇ fetuses in C57BL/6J background and maintained as described previously for similarly obtained mouse gastric epithelial cell lines (Li et al., 2002).
- BALB/c:C57/B6 background used in this study were offspring of Fl Apc m ⁇ n/+ male and Fl Runx3 +/ ⁇ female mice.
- Bone marrow cells were collected from Runx3 'A and Runx3 +/ ⁇ neonate C57BL/6J mice and transplanted into wild type EGFP -transgenic C57BL/6J mice after irradiation. Chimerism was measured by the donor-derived marker in peripheral bloods of the recipient at 6 weeks and one year after transplantation. Studies were done in accordance with the guidelines of
- Tissues were fixed with 10% formalin (for human tissues) or 4% paraformaldehyde
- Anti-RUNX3 (MBL; R3-1E10 for mouse; Yano et al., 2006 and MBL; R3-6E9 for human; Ito et al, 2005), anti-Ki67 (DAKO; M7249), anti-c-Myc (Santa Cruz; sc-764 for mouse and Upstate; 06-340 for human), anti-EphrinBl (Santa Cruz; sc-910), anti-EphB2 (R&D; AF467), anti-lysozyme (DAKO; A0099), anti-cyclin Dl (Zymed; 13-4500 for mouse and Novocastra; NCL-CYCLIN Dl-GM for human), and anti- ⁇ -catenin (Santa Cruz; sc-7199) antibodies were used on rehydrated sections pretreated with Target Retrieval Solution (DAKO).
- DAKO Target Retrieval Solution
- Anti-CD44 (ENDOGEN; MA-4405 for mouse and Santa Cruz; sc-7297 for human) and anti-cyclin Dl (Zymed; 13 -4500) antibodies were used for the immunodetection on rehydrated sections pretreated with a Target Retrieval Solution (DAKO).
- An EnvisionTM+ system (HRP/DAB) (DAKO) was used for visualization.
- An EnvisionTM+ system (HRP/DAB) (DAKO) was used for visualization. BrdU incorporation and cellular proliferation were detected with the BrdU Labeling and Detection Kit II (Roche).
- nuclear extracts were prepared from colorectal cancer cell lines using NE-PER Nuclear and Cytoplasmic Extraction Reagents (PIERCE) and treated with DNase I (Promega). Immunoprecipitation was performed using anti-RUNX3 (MBL; R3-5G4), anti-TCF4 (Upstate; 05-511), or anti-dephosphorylated ⁇ -catenin (Alexis; ALX-804-260) antibodies or mouse normal IgG with Protein G Sepharose 4 Fast Flow, followed by Western blot analysis using the same antibodies as for immunoprecipitation.
- PIERCE NE-PER Nuclear and Cytoplasmic Extraction Reagents
- DNase I Promega
- HA-tagged ⁇ -catenin, 6Myc-tagged TCF4, and 6His-tagged RUNX3 were translated in vitro using the TNT® T7 Quick Coupled Transcription/Translation System (Promega; Ll 170). Proteins pulled down by Ni-NTA agarose (QIAGEN; 30210) were revealed by Western blot analysis using anti-HA (Santa Cruz; sc-7392), anti-Myc (Santa Cruz; sc-40), and anti-His (Clontech; 631212) antibodies.
- CyclinDl-mTCF was made by mutagenizing the TCF consensus sequence located near the nucleotide -80 (from CTTTGATC to CTTTGGCC) in Dl ⁇ -944pXP2 (CyclinDl-WT; Herber et al., 1994) using the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene).
- DLDl cells were transfected with reporter plasmids; TOP/FOPflash (Upstate), CyclinDl-WT, or CyclinDl-mTCF, along with pRL-TK (Promega) and effector plasmids; pcDNA3, pcDNA-Flag-RUNX3, or pcDNA-Flag-RUNX3 (Rl 78Q) using FuGENE 6 (Roche). Luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega) and normalized to the luciferase activity expressed by pRL-TK.
- FID cells were transfected with TOP/FOPflash and treated with conditioned media collected from Wnt3a-expressing or parental L cell cultures (Shibamoto et al., 1998) for 24h.
- ChIP Chromatin hnmunoprecipitation Assay Kit (Upstate) and anti-TCF4 (Santa Cruz; sc-13027), anti-dephosphorylated ⁇ -catenin (Alexis;
- ALX-804-260 antibodies or mouse normal IgG.
- the following primers were used for PCR amplification of DNA fragments containing the TCF consensus site: 5'-aggcgcggcggctca gggatg-3 1 , SEQ ID NO: 4, and 5'-actctgctgctcgctgctact-3', SEQ ID NO: 5, for the human cyclin
- Dl promoter (Nateri et al., 2005); 5'-ttgctgggttattttaatcat-3', SEQ ID NO: 6, and 5'-actgtttgacaaaccgcatcc-3', SEQ ID NO: 7, for the human c-Myc promoter (Nateri et al., 2005);
- 5'-aaaccgttaaccccttcctcccc-3' SEQ ID NO: 11, for the murine c-Myc promoter.
- the following primers were used for negative controls; 5'-cgtcttcaccaccatggaga-3', SEQ ID NO: 12, and 5'-cggccatcacgcgacagttt-3', SEQ ID NO: 13, for human GAPDH gene (Nateri et al., 2005);
- Quantitative RT-PCR was performed using RNeasy Kit (QIAGEN), Omniscript RT Kit (QIAGEN), 7500 Fast Real-Time PCR System (Applied Biosystems), and TaqMan® Gene
- MSP Methylation specific PCR
- Genomic DNA extracted by proteinase K digestion from rehydrated sections of human tissues or DLDl and HCTl 16 cells was treated with sodium bisulfite using the CpGenome DNA Modification Kit (Chemicon). PCR for experiments depicted in Fig.
- Primer sets used in experiments depicted in Figures 12, 17 and 18 for detection of unmethylated DNA were 5-ataaagagaaattaggtgt -3, SEQ ID NO: 34, and 5 -ataaccctcaaaaacaca-3, SEQ ID NO: 35 (M3), 5-tgtttgtttaggttgtagtggt tgt-3, SEQ ID NO: 36, and 5-cccccaaactcaaaattcaccata-3, SEQ ID NO: 37 (M2), and 5-tgtgattgg ttgtgttttgt-3, SEQ ID NO: 38, and 5-caaaaatacacataccaca-3, SEQ ID NO: 39 (Ml).
- proteins were immunoprecipitated from whole cell extracts of HCTl 16 or 293 T cells co-expressing either Flag-tagged RUNX3 derivatives with 6Myc-tagged full-length TCF4 or 6Myc-tagged TCF4 derivatives with Flag-tagged full-length RUNX3 using anti-Flag M2 agarose (Sigma; A2220) or anti-Myc (Santa Cruz; sc-789) with Protein G Sepharose 4 Fast Flow (Amersham), respectively, followed by Western blot analysis using anti-Myc (Santa Cruz; sc-40) or anti-Flag (Sigma; F7429) antibodies.
- proteins were immunoprecipitated from whole cell extracts of HCTl 16 or 293 T cells expressing Flag-tagged RUNX3 with Myc-tagged TCFl, Lefl, or Myc-tagged TCF3 using anti-Flag antibody (Sigma; F7429), followed by Western blot analysis using anti-Myc (Santa Cruz; sc-789), anti-Lefl (Upstate; 05-602) or anti-Flag antibodies.
- EMSA was performed using the LightShift Chemiluminescent EMSA kit and a Chemiluminescent Nucleic Acid Detection Module (PIERCE). Each binding reaction (15 ⁇ l) contained 50 ng/ ⁇ l poly (dl dC), 75 frnol labeled probe, and 3 ⁇ g nuclear extracts in the buffer supplied in the kit. Nuclear extracts were prepared from Runx3 +/+ and Runxi '1' FID cells treated with 50% of Wnt3a conditioned medium (see Fig.
- anti-Myc Santa Cruz; sc-40
- anti-dephosphorylated ⁇ -catenin Alexis; ALX-804-260
- anti-TCF4 Santa Cruz; sc-13027
- anti-RUNX3 R3-5G4
- anti-PEBP2 ⁇ MBL; D127-3
- mouse normal IgG mouse normal IgG
- the following 5' biotinylated oligonucleotides were used as labeled probes; 5'-gggggtaagatcaaagggggta-3', SEQ ID NO: 40 (TOP), 5'-gggggtaaggccaaagggggta -3', SEQ ID NO: 42 (FOP), IgCa-WT: 5'-acagccagaccacaggccagac -3', SEQ ID NO: 41, and IgCa-MT: 5'-acagccagaccctcggccagac-3', SEQ ID NO: 42.
- Anti-dephosphorylated ⁇ -catenin Alexis; ALX-804-260), anti-TCF4 (Upstate; 05-511), and anti-RUNX3 (MBL; R3-1E10) antibodies were used in Western blot analysis for FID cells. Allelic loss analysis
- tissues were microdissected using PALM MembraneSlides (P.A.L.M.) under a stereomicroscope and digested in 50 ⁇ l lysis buffer [5OmM Tris-HCl (pH 7.5), 10OmM NaCl, and 20 niM EDTA] containing 200 ⁇ g/ml proteinase K at 50 0 C for 3 hours, followed by heat inactivation at 95°C for 10 min.
- lysis buffer 5OmM Tris-HCl (pH 7.5), 10OmM NaCl, and 20 niM EDTA
- DNA amplified from 1 ⁇ l genomic DNA solution was digested by HindUI to produce 123 bp (Ape wt allele) and 144 bp (Ape mt allele) fragments, as reported previously (Luongo et al, 1994).
- ⁇ -catenin and TCF mediate cell positioning in the intestinal epithelium by controlling the expression of EphB/EphrinB. Cell 111, 251-263.
- RUNX3 suppresses gastric epithelial cell growth by inducing p2l WAF/Cipl expression in cooperation with transforming growth factor ⁇ -activated SMAD. MoI. Cell. Biol. 25, 8097-8107.
- CpG island methylator phenotype underlies sporadic microsatellite instability and is tightly associated with BRAF mutation in colorectal cancer. Nature Genet. 38, 787-793.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US8448608P | 2008-07-29 | 2008-07-29 | |
| PCT/SG2009/000268 WO2010014043A1 (en) | 2008-07-29 | 2009-07-29 | Methods of preventing, arresting or reversing tumourigenesis and of identifying compounds capable of the same |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP2320917A1 true EP2320917A1 (en) | 2011-05-18 |
| EP2320917A4 EP2320917A4 (en) | 2011-11-09 |
Family
ID=41610589
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP09803219A Withdrawn EP2320917A4 (en) | 2008-07-29 | 2009-07-29 | METHODS FOR PREVENTING, STOPPING OR INVERTING TUMORIGENESIS AND IDENTIFYING COMPOUNDS CAPABLE THEREFROM |
Country Status (2)
| Country | Link |
|---|---|
| EP (1) | EP2320917A4 (en) |
| WO (1) | WO2010014043A1 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BR112016017132B1 (en) * | 2014-01-28 | 2024-01-30 | Quest Diagnostics Investments Incorporated | METHODS FOR IDENTIFYING A CANCER STEM CELL LIKE ZONE, AN ADENOMA-ADENOCARCINOMA TRANSITION ZONE, A COLON TUMOR, CANCER STEM CELLS, AN INDIVIDUAL WITH COLORECTAL CANCER LIKELY TO RESPOND FAVORABLY TO TREATMENT WITH A PE TARGETED THERAPY LA VIA NF -KB, AN INDIVIDUAL WITH GENOMIC LOSS OF 18Q/SMAD4 AND 10Q/PTEN, TO DIAGNOSE AN INDIVIDUAL WITH HIGH GRADE COLON ADENOMA AND EARLY ADENOCARCINOMA, AND TO DETERMINE THE LIKELIHOOD OF A COLON TUMOR IN AN INDIVIDUAL UNDERGOING A TRANSFORMATION INVASIVE IF LEFT UNTREATMENT AND THE LIKELIHOOD THAT AN INDIVIDUAL WITH COLORECTAL CANCER (CRC) WILL RESPOND FAVORABLY TO TREATMENT WITH A THERAPY TARGETED BY THE TGF-BETA PATHWAY, AND, KIT TO IDENTIFY A TRANSITIONAL REGION OF (...). |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100475649B1 (en) * | 2001-01-29 | 2005-03-10 | 배석철 | RUNX3 gene showing anti-tumor activity and use thereof |
| US20070237770A1 (en) * | 2001-11-30 | 2007-10-11 | Albert Lai | Novel compositions and methods in cancer |
| WO2006057623A1 (en) * | 2004-11-29 | 2006-06-01 | National University Of Singapore | Runx3 antibodies and method of obtaining the antibodies |
| US7611847B2 (en) * | 2005-06-01 | 2009-11-03 | Agency For Science, Technology And Research | Method for identifying an intestinal phenotype |
| US7507536B2 (en) * | 2005-10-07 | 2009-03-24 | The Johns Hopkins University | Methylation markers for diagnosis and treatment of ovarian cancer |
| WO2008070082A2 (en) * | 2006-12-04 | 2008-06-12 | The Johns Hopkins University | Stem-progenitor cell specific micro-ribonucleic acids and uses thereof |
-
2009
- 2009-07-29 WO PCT/SG2009/000268 patent/WO2010014043A1/en not_active Ceased
- 2009-07-29 EP EP09803219A patent/EP2320917A4/en not_active Withdrawn
Also Published As
| Publication number | Publication date |
|---|---|
| EP2320917A4 (en) | 2011-11-09 |
| WO2010014043A1 (en) | 2010-02-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Choi et al. | YAP/TAZ initiates gastric tumorigenesis via upregulation of MYC | |
| Wu et al. | Somatic mutations of CADM1 in aldosterone-producing adenomas and gap junction-dependent regulation of aldosterone production | |
| Loregger et al. | The E3 ligase RNF43 inhibits Wnt signaling downstream of mutated β-catenin by sequestering TCF4 to the nuclear membrane | |
| Li et al. | USP26 promotes esophageal squamous cell carcinoma metastasis through stabilizing Snail | |
| Hong et al. | Upregulation of adenylate cyclase 3 (ADCY3) increases the tumorigenic potential of cells by activating the CREB pathway | |
| Mauri et al. | NR2F2 controls malignant squamous cell carcinoma state by promoting stemness and invasion and repressing differentiation | |
| Yan et al. | Contactin-1 reduces E-cadherin expression via activating AKT in lung cancer | |
| Nakamura et al. | Expression and regulatory effects on cancer cell behavior of NELL1 and NELL2 in human renal cell carcinoma | |
| JP2010531662A (en) | TRIM24 (TIF-1A) is a modulator of P53 and a cancer target | |
| Aripaka et al. | TRAF6 function as a novel co-regulator of Wnt3a target genes in prostate cancer | |
| Rodgers et al. | ETS1 induces transforming growth factor β signaling and promotes epithelial‐to‐mesenchymal transition in prostate cancer cells | |
| Matsui et al. | DICKKOPF‐4 and‐2 genes are upregulated in human colorectal cancer | |
| Shin et al. | ITF2 prevents activation of the β-catenin–TCF4 complex in colon cancer cells and levels decrease with tumor progression | |
| Muhammad et al. | FLYWCH1, a novel suppressor of nuclear β-catenin, regulates migration and morphology in colorectal cancer | |
| Zhao et al. | Threonine 32 (Thr32) of FoxO3 is critical for TGF-β-induced apoptosis via Bim in hepatocarcinoma cells | |
| Kubokura et al. | Differentiation-inducing factor-3 inhibits intestinal tumor growth in vitro and in vivo | |
| Horazna et al. | Msx1 loss suppresses formation of the ectopic crypts developed in the Apc-deficient small intestinal epithelium | |
| Li et al. | The threonine protease activity of testes-specific protease 50 (TSP50) is essential for its function in cell proliferation | |
| Lim et al. | TRAF6 mediates IL-1β/LPS-induced suppression of TGF-β signaling through its interaction with the type III TGF-β receptor | |
| Azzam et al. | CSF1 is a novel p53 target gene whose protein product functions in a feed-forward manner to suppress apoptosis and enhance p53-mediated growth arrest | |
| Zhu et al. | N-myristoylation by NMT1 is POTEE-dependent to stimulate liver tumorigenesis via differentially regulating ubiquitination of targets | |
| Yu et al. | The relationship between pepsinogen C and gastric carcinogenesis: a transgene and population study | |
| Fraizer et al. | Functional role of WT1 in prostate cancer | |
| US20170038384A1 (en) | Treatment of tumors expressing mutant p53 | |
| Feng et al. | A proteomic comparison of immature and mature mouse gonadotrophs reveals novel differentially expressed nuclear proteins that regulate gonadotropin gene transcription and RNA splicing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20110211 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO SE SI SK SM TR |
|
| AX | Request for extension of the european patent |
Extension state: AL BA RS |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: G01N 33/574 20060101ALI20110908BHEP Ipc: C12Q 1/00 20060101ALI20110908BHEP Ipc: A61K 35/00 20060101AFI20110908BHEP |
|
| DAX | Request for extension of the european patent (deleted) | ||
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20111012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20120201 |