EP2300613A2 - Mutated and chemically modified thermally stable dna polymerases - Google Patents

Mutated and chemically modified thermally stable dna polymerases

Info

Publication number
EP2300613A2
EP2300613A2 EP09767773A EP09767773A EP2300613A2 EP 2300613 A2 EP2300613 A2 EP 2300613A2 EP 09767773 A EP09767773 A EP 09767773A EP 09767773 A EP09767773 A EP 09767773A EP 2300613 A2 EP2300613 A2 EP 2300613A2
Authority
EP
European Patent Office
Prior art keywords
polymerase
dna polymerase
pol
dna
mutant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP09767773A
Other languages
German (de)
French (fr)
Other versions
EP2300613A4 (en
Inventor
Lei Xi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Life Technologies Corp
Original Assignee
Life Technologies Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Life Technologies Corp filed Critical Life Technologies Corp
Publication of EP2300613A2 publication Critical patent/EP2300613A2/en
Publication of EP2300613A4 publication Critical patent/EP2300613A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6848Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241Nucleotidyltransferases (2.7.7)
    • C12N9/1252DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/26Preparation of nitrogen-containing carbohydrates
    • C12P19/28N-glycosides
    • C12P19/30Nucleotides
    • C12P19/34Polynucleotides, e.g. nucleic acids, oligoribonucleotides

Definitions

  • the following disclosure relates to thermally stable DNA polymerase enzymes, methods for enhancing enzyme activity and reactivation of inactive enzymes by thermal means.
  • DNA polymerases derived from thermophilic bacteria have enabled researchers to replicate DNA in vitro and have advanced the studies of cell proliferation, genetics, diagnosis of diseases having DNA or RNA mutations and development of pharmaceutical drugs to prevent replication of viral, bacterial and cancer genomes.
  • Modified DNA polymerases have been developed to reduce non-specific amplification, primer-dimer formation and improve nucleic acid detection.
  • the most common method of DNA replication involves the polymerase chain reaction (PCR).
  • DNA polymerase acts to extend the primers in a 5' to 3' direction in two stages. Initially there is the association of the DNA polymerase with a priming site at the 3' OH end of the 3' most nucleotide of the primer followed by binding of a nucleotide (to form a new base pair with the template nucleotide). The result is simultaneous replication of each DNA strand by elongating the primer sequence using the denatured DNA molecule as a template.
  • mutant DNA polymerases having at least one Lysine to Arginine substitution.
  • the substitution can be in the DNA polymerase domain of a Pol A, Pol B, Pol C, Pol D, Pol X, or Pol Y DNA polymerase, or in a reverse transcriptase or ligase enzyme.
  • the substitution corresponds to at least one of amino acid position 505, 540 or 542 of Thermits aquaticus Taq polymerase A as shown in SEQ ID NO:1.
  • the mutant DNA polymerase can have at least one, at least two or three mutations corresponding to positions 505, 540 or 542 of Thermus aquaticus Taq polymerase A as shown in SEQ ID NO:1.
  • the mutant DNA polymerase can have one Lysine to Arginine substitutions corresponding to amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase I.
  • the mutant DNA polymerase can have two Lysine to Arginine substitutions corresponding to amino acid positions 540 and 542 of Thermus aquaticus Taq polymerase I.
  • Other potential amino acid substitutions for Lysine include Histidine or amino acids with hydrophilic side groups such as Asparagine, Glutamic acid, Glutamine or Aspartic acid.
  • the mutant DNA polymerase can be synthetic or naturally-occurring.
  • a chemically modified mutant DNA polymerase having at least one Lysine to Arginine substitution corresponding to at least one of amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase I (SEQ ID NO:1), wherein the chemically modified mutant DNA polymerase has substantially reduced polymerase activity, and wherein the chemical modification, modifies at least one Lysine residue of the polymerase, renders the polymerase substantially inactive at 4 0 C to 45 0 C for at least 20 minutes and is reversible upon incubation at a temperature above at least 50 0 C.
  • the chemically modified mutant DNA polymerase has one Lysine to Arginine substitution corresponding to amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase A as shown in SEQ ID NO:1 or two Lysine to Arginine substitutions or three Lysine to Arginine substitutions.
  • Other potential amino acid substitutions for Lysine include Histidine or amino acids with hydrophilic side groups such as Asparagine, Glutamic acid, Glutamine or Aspartic acid.
  • the chemically modified mutant DNA polymerase is modified with citraconic anhydride or cis-aconitic anhydride.
  • the DNA polymerase can be naturally-occurring or synthetic and is thermally stable.
  • the chemically modified mutant DNA polymerase is a Pol A, Pol B, Pol C, Pol D, Pol X, or Pol Y DNA polymerase.
  • the chemically modified mutant enzyme could also be a reverse transcriptase or a ligase, wherein select Lysine residues are substituted with Arginine residues or other amino acid residues having a charge such as Histidine or hydrophilic side groups such as Asparagine, Glutamic acid, Glutamine or Aspartic acid.
  • a method for the amplification of a target nucleic acid comprising: contacting said target nucleic acid with an amplification reaction mixture containing a primer complementary to said target nucleic acid and a chemically modified mutant DNA polymerase, wherein said polymerase has at least one Lysine to Arginine substitution corresponding to amino acid position 505, 540 or 542 of Thermits aquaticus Taq polymerase I as shown in SEQ ID NO:1, wherein said polymerase is rendered a thermally reversible inactive enzyme, and incubating the resulting mixture of the target nucleic acid and amplification reaction mixture at a temperature which is greater than about 50° C to allow formation of amplification products.
  • the chemically modified mutant DNA polymerase is modified with citraconic anhydride or cis-aconitic anhydride in which said DNA polymerase is a thermally stable DNA polymerase and amplification is performed at a temperature above 50° C or at a temperature above 60° C.
  • a method for determining a nucleotide base sequence of a DNA molecule comprising: incubating a DNA molecule annealed with a primer molecule able to hybridize to said DNA molecule in a vessel containing at least one deoxynucleoside triphosphate, a chemically modified mutant DNA polymerase having at least one Lysine to Arginine substitution corresponding to amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase I as shown in SEQ ID NO: 1, and at least one DNA synthesis terminating agent which terminates DNA synthesis at a specific nucleotide base, in an incubating reaction to allow formation of primer extension products; and separating the DNA products of the incubating reaction according to size whereby at least a part of the nucleotide base sequence of said DNA molecule can be determined.
  • the DNA polymerase is a thermally stable DNA polymerase and primer extension is performed at a temperature above 50° C or at a temperature
  • a reagent kit for primer extension comprising a mutated DNA polymerase in which Lysine is substituted with Arginine and the substitution corresponds to at least one of amino acid positions 505, 540 or 542 of Thermus aquaticus Taq polymerase I as shown in SEQ ID NO:1.
  • the mutant DNA polymerase can be synthetic or naturally-occurring.
  • the mutant DNA polymerase also has a greater level of enzyme activity as compared to the non-mutated wild type polymerase from which the polymerase was derived.
  • a chemically modified polymerase composition formed by reacting a mutant DNA polymerase having at least one Lysine to Arginine substitution corresponding to at least one of amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase I (SEQ ID NO:1) with a modifying reagent wherein the modifying reagent modifies at least one Lysine residue of the mutant polymerase to render the polymerase inactive at 4 0 C to 45 0 C for at least 20 min., and is reversible upon incubation at a temperature of at least 50 0 C.
  • the mutant DNA polymerase is selected from the group including a Pol A, Pol B, Pol C, Pol D, Pol E, Pol X and Pol Y-type DNA polymerase or a Type I, Type II and Type III DNA polymerase.
  • the modified mutant DNA polymerase in the reagent kit for primer extension is thermally stable and the kit can also contain dNTPs, buffer, salts and at least one terminating agent.
  • the chemically modified mutant DNA polymerase in the reagent kit for amplification is modified with citraconic anhydride or cis-aconitic anhydride.
  • the DNA polymerase is thermally stable and the kit can also contain dNTPs, buffer, salts and a control DNA.
  • a chemically modified mutant polymerase is prepared by a process including providing a mutant DNA polymerase having at least one Lysine to Arginine substitution corresponding to at least one of amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase I (SEQ ID NO: 1) and reacting the mutant DNA polymerase with a modifying reagent wherein the modifying reagent, modifies at least one Lysine residue of the mutant polymerase, renders the polymerase inactive at 4 0 C to 45 0 C for at least 20 min., and is reversible upon incubation at 50 0 C.
  • the chemical modification is citraconic anhydride or cis-aconitic anhydride and the polymerase is thermally stable.
  • the mutant DNA polymerase can be is selected from the group comprising a Pol A, Pol B, Pol C, Pol D, Pol E, Pol X and Pol Y-type DNA polymerase or a Type I, Type II and Type III DNA polymerase.
  • a modified mutant polymerase is prepared by a process including providing a DNA polymerase nucleotide sequence; converting the codons of the DNA polymerase to those of E. coli; inserting the codons optimized for an E. coli expression system into a plasmid; and extracting the expressed protein insert, wherein the resulting expressed protein has at least one Lysine to Arginine substitution corresponding to at least one of amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase I (SEQ ID NO: 1).
  • This mutant DNA polymerase is thermally stable and can be selected from the group including a Pol A, Pol B, Pol C, Pol D, Pol E, Pol X and Pol Y-type DNA polymerase or a Type I, Type II and Type III DNA polymerase.
  • FIG. 1 is an alignment of thermally stable DNA polymerases across various genera of bacteria.
  • FIG. 2 illustrates the conservation of Lysine residues within the DNA polymerase active site domain of FIG. 1.
  • FIG. 3 illustrates the location of Lysine residues substituted with Arginine residues as disclosed in FIG. 2.
  • FIG. 4 is an alignment of the nucleotide sequence of Taq Pol A DNA polymerase encoding the protein shown in FIG. 1, the wild type and its E. coli optimized counterpart.
  • FIG. 5 illustrates the site-directed mutagenesis method for 540D double-mutant enzyme.
  • FIG. 6 illustrates the enzyme reactivation rate for 505R.
  • FIG. 7 illustrates the enzyme reactivation rate for 540D.
  • FIG. 8 illustrates the higher relative earlier C T level in the chemically modified 505R mutant DNA polymerase versus AmpliTaq Gold® DNA polymerase. DETAILED DESCRIPTION
  • nucleic acid As used herein, the phrase “nucleic acid,” “oligonucleotide”, and polynucleotide(s)" are interchangeable.
  • the term "or combinations thereof refers to all permutations and combinations of the listed items preceding the term.
  • “A, B, C, or combinations thereof is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB.
  • expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, AAB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth.
  • BB BB
  • AAA AAA
  • AAB AAA
  • BBC AAABCCCCCC
  • CBBAAA CABABB
  • target polynucleotide in the plural includes both multiple separate polynucleotide strands and multiple regions on the same polynucleotide strand that are separately amplified and/or detected.
  • a target polynucleotide may be a single molecule of double- stranded or single-stranded polynucleotide, such as a length of genomic DNA, cDNA or viral genome including RNA, or a mixture of polynucleotide fragments, such as genomic DNA fragments or a mixture of viral and somatic polynucleotide fragments from an infected sample.
  • a target polynucleotide is double- stranded DNA which is denatured, e.g., by heating, to form single- stranded target molecules capable of hybridizing with primers and/or oligonucleotide probes.
  • p_hosphodiester linkage refers to the linkage - PO 4 - which is used to link nucleotide monomers. Phosphodiester linkages as contemplated herein are linkages found in naturally-occurring DNA.
  • the term "primer” refers to an oligonucleotide, typically between about 10 to 100 nucleotides in length, capable of selectively binding to a specified target nucleic acid or "template” by hybridizing with the template.
  • the primer can provide a point of initiation for template-directed synthesis of a polynucleotide complementary to the template, which can take place in the presence of appropriate enzyme(s), cofactors, substrates such as nucleotides and oligonucleotides and the like.
  • sequencing primer refers to an oligonucleotide primer that is used to initiate a sequencing reaction performed on a nucleic acid.
  • sequencing primer refers to both a forward sequencing primer and to a reverse sequencing primer.
  • 5' ⁇ 3' nuclease activity or “5' to 3' nuclease activity” refers to that activity of a template-specific nucleic acid polymerase including either a 5' ⁇ 3' exonuclease activity traditionally associated with some DNA polymerases whereby nucleotides are removed from the 5' end of an oligonucleotide in a sequential manner, (i.e., E. coli DNA polymerase I has this activity whereas the Klenow fragment does not), or a 5' — > 3' endonuclease activity wherein cleavage occurs more than one nucleotide from the 5' end, or both.
  • the phrase “thermostable” and “thermally stable” are interchangeable.
  • thermostable nucleic acid polymerase refers to an enzyme which is relatively stable to heat when compared, for example, to nucleotide polymerases from E. coli and which catalyzes the polymerization of nucleosides. Generally, the enzyme will initiate synthesis at the 3 '-end of the primer annealed to the target sequence, will proceed in the 5'-direction along the template and if possessing a 5' to 3' nuclease activity, hydrolyzing intervening, annealed probe to release both labeled and unlabeled probe fragments, until synthesis terminates.
  • a representative thermostable enzyme isolated from Thermus aquaticus (Taq) is described in U.S. Pat. No. 4,889,818 and a method for using it in conventional PCR are described in Saiki et al., (1988), Science 239:487.
  • Exemplary bacteria from which the DNA Pol A polymerase can be isolated include but are not limited to Thermus aquaticus, Thermus thermophilus, Thermatoga maritime, Bacillus caldotenax, Carboxydothermus hydro genformans, Thermoanaerobacter thermohydrosulfuricus, Thermus brokianus, Thermus caldophilus GK24, Thermus flavus, Thermus rubens, or a mutant thereof.
  • amplification primer refers to an oligonucleotide, which is capable of annealing to an RNA or DNA region adjacent a target sequence, and serving as an initiation primer for DNA synthesis under suitable conditions in which synthesis of a primer extension product is induced, i.e., in the presence of nucleotides and a polymerization-inducing agent such as a DNA-dependent DNA polymerase and at suitable temperature, pH, metal concentration, and salt concentration.
  • a PCR reaction employs a pair of amplification primers including an "upstream” or “forward” primer and a “downstream” or “reverse” primer, which delimit a region of the RNA or DNA to be amplified.
  • amplifying refers to a process whereby a portion of a nucleic acid is replicated using, for example, any of a broad range of primer extension reactions.
  • primer extension reactions include, but are not limited to, PCR.
  • amplifying refers to a single replication or to an arithmetic, logarithmic, or exponential amplification.
  • primer extension reaction refers to a reaction in which a polymerase catalyzes the template-directed synthesis of a nucleic acid from the 3' end of a primer.
  • primer extension product refers to the resultant nucleic acid.
  • a non-limiting exemplary primer extension reaction is the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • extension refers to the template-directed synthesis of a nucleic acid from the 3' end of a primer, which is catalyzed by a polymerase.
  • nucleic acid sequence can refer to the nucleic acid material itself and is not restricted to the sequence information (i.e. the succession of letters chosen among the five base letters A, C, G, T, or U) that biochemically characterizes a specific nucleic acid, for example, a DNA or RNA molecule. Nucleic acids shown herein are presented in a 5' -> 3' orientation unless otherwise indicated.
  • polynucleotide refers to a linear polymer of natural or modified monomers or linkages, including deoxyribonucleosides, ribonucleosides, polyamide nucleic acids, and the like, joined by inter- nucleosidic linkages and have the capability of specifically binding to a target polynucleotide by way of a regular pattern of monomer-to-monomer interactions, such as Watson-Crick type of base pairing, and capable of being ligated to another oligonucleotide in a template-driven reaction.
  • oligonucleotides ranging in size from a few monomeric units, e.g. 3-4, to several hundreds of monomeric units.
  • a polynucleotide such as an oligonucleotide is represented by a sequence of letters, such as "ATGCCTG,” it will be understood that the nucleotides are in 5' ⁇ 3' order from left to right and that "A” denotes deoxyadenosine, "C” denotes deoxycytidine, “G” denotes deoxyguanosine, and "T” denotes deoxy thymidine, unless otherwise noted.
  • nucleoside linkage is typically a phosphodiester bond, and the subunits are referred to as "nucleotides.”
  • the 3' end of one oligonucleotide points toward the 5' end of the other; the former may be called the "upstream” oligonucleotide and the latter the "downstream” oligonucleotide.
  • 5'-nuclease probe refers to a probe that comprises a signal moiety linked to a quencher moiety or a donor moiety through a short oligonucleotide link element. When the 5'-nuclease probe is intact, the quencher moiety or the donor moiety influences the detectable signal from the signal moiety. According to certain embodiments, the 5'-nuclease probe selectively hybridizes to a target nucleic acid sequence and is cleaved by a polypeptide having 5' to 3' exonuclease activity, e.g., when the probe is replaced by a newly polymerized strand during a primer extension reaction, such as PCR.
  • quencher moiety refers to a moiety that causes the detectable signal of a signal moiety to decrease when the quencher moiety is sufficiently close to the signal moiety.
  • signal moiety refers to a moiety that is capable of producing a detectable signal.
  • detectable signal refers to a signal that is capable of being detected under certain conditions. In certain embodiments, a detectable signal is detected when it is present in a sufficient quantity.
  • sequence determination includes determination of partial as well as full sequence information. That is, the term includes sequence comparisons, fingerprinting, and like levels of information about a target polynucleotide, as well as the express identification and ordering of each nucleoside of the target polynucleotide within a region of interest.
  • sequence determination comprises identifying a single nucleotide, while in other embodiments more than one nucleotide is identified. Identification of nucleosides, nucleotides, and/or bases are considered equivalent herein. It is noted that performing sequence determination on a polynucleotide typically yields equivalent information regarding the sequence of a perfectly complementary polynucleotide and thus is equivalent to sequence determination performed directly on a perfectly complementary polynucleotide.
  • references to templates, oligonucleotides, primers, etc. generally mean populations or pools of nucleic acid molecules that are substantially identical within a relevant region rather than single molecules.
  • a "template” generally means a plurality of substantially identical template molecules
  • a “primer” generally means a plurality of substantially identical primer molecules, and the like.
  • oligonucleotide probes includes sets of two or more oligonucleotide probes where there may be a single "common” oligonucleotide probe that is usually specific for a non- variable region of a target polynucleotide and one or more "wild-type” and/or “mutant” oligonucleotide probes that are usually specific for a region of a target polynucleotide that contains allelic or mutational variants in sequence.
  • wild type refers to a gene, a genotype, or a phenotype which predominates in the wild population or in the standard laboratory stock for a given organism.
  • mutant DNA refers to an alteration within a codon of at least a single base change in DNA (or RNA) which results in the sequence encoding for a different amino acid as compared to the same codon position in the wild type DNA sequence.
  • mutant protein refers to the protein resulting from the translation of the mutated DNA. The mutant protein is frequently referred to as having a missense mutation when amino acid substitution does not terminate translation and nonsense mutation when translation is suppressed.
  • chemically modified mutant DNA polymerase refers to the mutated protein (phenotype) encoded by a mutant DNA sequence (genotype) which has further undergone a chemical modification process with a modifier reagent resulting in a significant, if not essentially complete, reduction in activity of the protein encoded by the mutant DNA.
  • modifier refers to a chemical compound which binds to the side chains of amino acids and alters the composition of the polymerase to inhibit at least 90% to
  • modifier reagent refers to the chemical compound in solution which covalently binds to the side chains of amino acids and alters the composition of the polymerase to inhibit at least 90% to 99% of the polymerase activity at ambient temperatures but dissociates at high temperatures to restore polymerase activity.
  • modifiers of DNA polymerase citraconic anhydride and cis-aconitic anhydride
  • inactivated DNA polymerase refers to the loss of at least 99% of enzymatic activity at a temperature from about 4 0 C to about 45 0 C for at least 20 minutes and is reversible upon incubation at a temperature of at least 50 0 C.
  • substantially inactive refers to the loss of at least 90% to at least
  • reactivation refers to the thermal exposure of a chemically modified inactivated DNA polymerase, as incorporated into a reaction solution, to a temperature sufficient to restore at least 5% to 10% of enzymatic activity after ⁇ 2 minutes at 90 0 C to 98 0 C.
  • hot-start refers to the thermal exposure of a reaction solution, often a PCR reaction mix, to a temperature sufficient to restore enzymatic activity, i.e., thermal reactivation of a DNA polymerase which had been inactivated by chemical or antibody means.
  • substitution refers to the replacement of at least one base, nucleobase, nucleoside, nucleotide or amino acid with a different base, nucleobase, nucleoside, nucleotide or amino acid.
  • nucleic acid polymerase or “polymerase” refers to any polypeptide that catalyzes the synthesis of a polynucleotide using an existing polynucleotide as a template.
  • DNA polymerase refers to a nucleic acid polymerase that catalyzes the synthesis of DNA using an existing polynucleotide as a template.
  • thermostable DNA polymerase refers to a DNA polymerase that, at a temperature higher than 37 0 C, retains its ability to add at least one nucleotide onto the 3' end of a primer or primer extension product that is annealed to a target nucleic acid sequence.
  • a thermostable DNA polymerase remains active after exposure to a temperature greater than about 37 0 C.
  • a thermostable DNA polymerase remains active at a temperature greater than about 42 0 C.
  • a thermostable DNA polymerase remains active at a temperature greater than about 50 0 C.
  • a thermostable DNA polymerase remains active at a temperature greater than about 60 0 C. In certain embodiments, a thermostable DNA polymerase remains active at a temperature greater than about 70 0 C. In certain embodiments, a thermostable DNA polymerase remains active at a temperature greater than about 80 0 C. In certain embodiments, a thermostable polymerase remains active at a temperature greater than about 90 0 C.
  • nucleoside includes the natural nucleosides, including 2'-deoxy and 2'-hydroxyl forms, e.g. as described in Komberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992).
  • nucleosides in reference to nucleosides includes synthetic nucleosides having modified base moieties and/or modified sugar moieties, e.g. described by Scheit, Nucleotide Analogs (John Wiley, New York, 1980); Uhlman and Peyman, Chemical Reviews, 90: 543-584 (1990); or the like. Such analogs include synthetic nucleosides designed to enhance binding properties, reduce degeneracy, increase specificity, and the like. [0063] As used here, "mutant DNA polymerase enzyme” it is meant that the polymerase has at least one amino acid change compared to the wild type DNA polymerase enzyme. In general this change will comprise the substitution of at least one amino acid for another.
  • these changes will be conservative changes, to maintain the overall charge distribution of the protein.
  • the disclosure is not limited to only conservative substitutions. Non- conservative substitutions are also envisaged in the present invention.
  • the modification in the polymerase sequence may be a deletion or addition of one or more amino acids from or to the protein, provided that the polymerase has improved activity upon thermal reactivation.
  • primer extension refers to both to the synthesis of DNA resulting from the polymerization of individual nucleoside triphosphates using a primer as a point of initiation, and to the joining of additional oligonucleotides to the primer to extend the primer.
  • primer extension is intended to encompass the ligation of two oligonucleotides to form a longer product which can then serve as a target in future amplification cycles.
  • primer is intended to encompass the oligonucleotides used in ligation-mediated amplification processes which are extended by the ligation of a second oligonucleotide which hybridizes at an adjacent position.
  • DNA polymerases are known to those skilled in the art. DNA polymerases include DNA-dependent polymerases, which use DNA as a template, or RNA-dependent polymerases, such as reverse transcriptase, which use RNA as a template.
  • DNA-dependent DNA polymerases fall into one of six families (A, B, C, D, X, and Y), with most falling into one of three families (A, B, and C). See, e.g., Ito et al. (1991) Nucleic Acids Res. 19:4045-4057; Braithwaite et al. (1993) Nucleic Acids Res. 21:787-802; Filee et al. (2002) J. MoI. Evol. 54:763-773; and Alba (2001) Genome Biol. 2:3002.1-3002.4.
  • DNA polymerases may be single-chain polypeptides (e.g., certain family A and B polymerases) or multi-subunit enzymes (e.g., certain family C polymerases) with one of the subunits having polymerase activity.
  • a fusion protein may comprise a DNA polymerase selected from a family A, B, C, D, X, or Y polymerase.
  • Pol I, Pol II and Pol III all have 3 ' -5 ' exonuclease activity while Pol I is also implicated in DNA repair, having both 5 '-3' polymerase and 3 '-5' proofreading exonuclease activity.
  • Pol A Family A polymerases
  • Replicative members from this family include T7 DNA polymerase and the eukaryotic mitochondrial DNA Polymerase ⁇ .
  • repair polymerases are E. coli DNA Pol I, Thermus aquaticus Pol I (Taq DNA polymerase), and Bacillus stearothermophilus Pol I. Excision repair and processing of Okazaki fragments generated during lagging strand synthesis are performed by the repair polymerases Because most thermostable Pol A enzymes do not possess the 3' to 5' exonuclease activity, they are incapable of proofreading the newly synthesized nucleic acid strand and consequently have high error rates.
  • Pol B Family B polymerases
  • Pol B polymerases are substantially replicative polymerases including the major eukaryotic DNA polymerases ⁇ , ⁇ , ⁇ , and also DNA polymerase ⁇ .
  • Pol B polymerases also include DNA polymerases encoded by some bacteria and bacteriophages, of which the best characterized are from T4, PM29 and RB69 bacteriophages.
  • Pol B enzymes are involved in both leading and lagging strand synthesis and are noteworthy for their remarkable accuracy during replication as many have strong 3'-5' exonuclease activity the exceptions being DNA polymerase ⁇ and ⁇ which lack proofreading activity.
  • the instant invention enables the achievement of inactivation of both DNA polymerase activity and 5 '-3' exonuclease activity of Pol A at a low temperature (e.g. 50 0 C or lower), and restoration of both enzymatic activities at an elevated temperature.
  • the present invention provides methods and compositions for reversibly inactivating a thermally stable Pol A DNA polymerase, a thermally stable Pol A DNA polymerase, and methods and reagents for using the enzyme for performing "hot-start PCR" and primer extension reactions.
  • the altered polymerase may also be a family B polymerase, or a mutant or variant thereof, for example a mutant or variant Pfu or KOD DNA polymerase enzyme, or a polymerase not belonging to either family A or family B, such as for example reverse transcriptase.
  • Any thermally stable Pol A DNA polymerase can be reversibly inactivated according to methods known to one of ordinary skill in the art as disclosed in U.S. Pat. Nos. 5,677,152, 5,773,258 and 6,183,998.
  • a hallmark of the A family of DNA polymerases is both their replication and repair activities and many have strong 5' to 3' exonuclease activity, and several thermostable Pol A DNA Polymerases are available commercially, including those described as Taq, Tth, Tea, TfI, Tfi, T7, and Bst or sold under the trade names AmpliTaq®, AmpliTaq Gold®, DyNAzymeTM, and PhireTM Hot Start DNA Polymerases.
  • Suitable thermostable Pol A DNA polymerases for the present invention include naturally occurring Pol A polymerases as well as chimeric or recombinant Pol A DNA polymerases.
  • a Pol A DNA polymerase suitable for the present invention may comprise a family A DNA polymerase or a fragment or variant thereof having polymerase activity.
  • the family A polymerase is a polymerase from the genus Thermus, Thermatoga, Archaeglobus, Bacillus, Carboxydothermus, or Thermoanaerobacter.
  • the family A polymerase is Taq DNA polymerase or a fragment or variant thereof having polymerase activity.
  • a variant of Taq DNA polymerase comprises an amino acid sequence having at least 50%, 70%, 90%, 95%, 96%, 97%, 98%, or 99% identity to Taq.
  • a thermally stable enzyme that has an Arginine residue(s) substituted for a Lysine(s) residue in conjunction with the enzyme being chemically modified to render the enzyme thermally reversibly inactive has a shorter thermal reactivation time to render the enzyme active.
  • the mutated and modified thermally stable DNA polymerase according to the present teachings provides a thermally stable enzyme with reduced activity at temperatures below about 45 0 C to about 50 0 C.
  • Suitable chemical modifying reagents suitable for the present invention include maleic anhydride; substituted maleic anhydrides such as citraconic anhydride, cis- aconitic anhydride, and 2,3-dimethylmaleic anhydride; exo-cis-3,6-endoxo- ⁇ 4 -tetrahydropthalic anhydride; and 3,4,5,6-tetrahydrophthalic anhydride.
  • the reagents are commercially available from, for example, Aldrich Chemical Co.
  • thermostable DNA polymerases using the substituted maleic anhydride reagents citraconic anhydride and cis- aconitic anhydride are described in U.S. Pat. Nos. 5,677152 and 5,773,258.
  • DNA polymerase is an essential enzyme for all living organisms and necessary for
  • FIG. 1 the DNA polymerase designation from Table 1 is on the far left and the amino acid numbering for each sequence is on the far right.
  • the asterisk, period or colon below the aligned sequences designates positions of identical amino acids, related amino acid family members or highly conserved amino acid residues, respectively.
  • the alignment shown in FIG. 1 was made with the ClustalW2 program (European Biolnformatics Institute (EMBL/EMI), www.ebi.ac.uk/Tools/clustalw2/index.html).
  • the 5'-3' exonuclease domain of Taq is from residue 12 to 264 with another region also found from residues 295 to 415.
  • DNA polymerase Pol A active site domain is highly homologous between species and the Thermus, Geobacillus and Escherichia genera.
  • the DNA polymerase active site domain sequence as shown in FIG. 2 encompasses amino acid residues 451 to 832 in Taq which corresponds, for example, to residues 308 to 703 in E. coli phage T7 as determined using Pfam, Finn,R.D. (2006) Nucleic Acids Res. Database Issue 34:D247-D251).
  • the present teachings describe methods for replacing select Lysine residues with Arginine within the DNA polymerase domain of the enzyme and chemical modifications for the thermally reversed inactivation of thermally stable enzymes.
  • the mutant DNA polymerase is useful in sequencing reactions.
  • the chemically modified mutated enzymes are useful in primer-based nucleic acid amplification reactions such as the polymerase chain reaction (PCR) and reverse transcription polymerase chain reaction (RT-PCR).
  • PCR polymerase chain reaction
  • RT-PCR reverse transcription polymerase chain reaction
  • Lysine residue substituted with Arginine have been shown to improve enzymatic activity and more rapid rates of reactivation, additional amino acids may also be considered to be replacements for Lysine residues.
  • Such amino acids include Histidine or amino acids with hydrophilic side groups such as Asparagine, Glutamic acid, Glutamine or Aspartic acid.
  • the methods for mutating the DNA strand encoding the DNA polymerase may also be applicable to similarly mutating reverse transcriptase and ligase enzymes, including those enzymes which are thermally stable and find utility in hot-start applications. Such mutant enzymes would presumably result in more rapid reactivation rates and/or enhanced enzymatic activity.
  • the present teachings provide methods for mutating the DNA strand encoding the DNA polymerase enzyme of interest by sited-directed mutagenesis at selected codons encoding Lysine residues within the DNA polymerase domain of the enzyme. Lysine residues are known to be chemically modified to render the DNA polymerase substantially inactive at ambient temperatures but enzymatic activity is restored upon heating at temperatures above at least 50 0C.
  • Lysine positions 505, 540 and 542 as found in the DNA polymerase domain of Taq are positioned within the active site in the three-dimensional structure of the enzyme and are within the conserved DNA polymerase Pol A domain of Pol A DNA polymerases, especially among prokaryotic thermostable Pol A enzymes.
  • the aforementioned Lysine positions are conserved in other species and correspond, for example, to Escherichia coli DNA polymerase A residues 288, 312, and 314 and to Haemophilus influenzae DNA polymerase A residues 604, 638, and 640, respectively.
  • FIG. 3 The alignment of a 53-57 amino acid sequence segment of the DNA polymerase domain from various bacteria and a bacteriophage is shown in FIG. 3 and further illustrates the conservation of the domain between genera and species as well as the conservation of Lysine (K) residues within this domain.
  • Additional residues that were reported to interact with DNA include: (1) Asp785, Glu786, and Asp610 form the catalytic core of the polymerase and interact with the 3'hydroxyl of the primer; (2) Tyr671 and Phe667 interacting with the bases at the blunt end of the duplex; (3) Arg573, Glu655, Tyr671, Asn750, Gln745, His784 and Asp785, which are conserved among Pol A enzymes, contact DNA; and (4) Arg746, Asn580, Asn583, Ala568, Ser575, Ser543, Thr539, Asn485, Glu,615, Gln754, His 784, Val586, Glu537, Arg536, Ala516, and Ser515 which interact with the DNA helix.
  • Lysine is positively charged and positive residues often play a catalytic or structural role thus, changes to the active site could alter the enzyme's ability to bind to DNA, adversely impacting the enzyme's catalytic properties or the three dimensional structure.
  • Lysine has a basic pH while Arginine' s pH is strongly basic, therefore, a strongly basic amino acid would have a strong pairing with a negatively charged amino acid which would alter both the folding of the enzyme and its three dimensional structure.
  • Taq Gold was used as the control enzyme for comparing polymerase thermal reactivation and recovered enzyme activity.
  • Taq Gold is chemically modified with citraconic anhydride (CA) at Lysine residues (US Pat. Nos. 5,677,152 and 5,773,258) and requires a 10 minute thermal reactivation step at 95 0 C for most PCR applications.
  • Example 5 illustrates the procedures for creating the 540D mutant and the protocol is provided in Example 1.
  • the resulting mutations did not adversely impact enzyme stability and the resulting enzymes actually had more rapid reactivation rates when compared to the non-mutated, chemically modified Taq Gold enzyme.
  • the polymerase activity of the thermally stable Pol A DNA polymerase has both at least one Lysine to Arginine substitution at one of positions 505, 540 or 542 and as a result of chemical modification are completely inactivated (less than 1% of their original activity) or nearly completely inactivated (less than 5% of their original activity) as shown at time point zero in FIG. 6 and FIG. 7.
  • the enzymatic activity of the present mutated, chemically modified enzymes are reactivated more rapidly and the 5 '-3' exonuclease activity attains 100% of its activity prior to chemical modification when incubated at a more elevated temperature, i.e., above 50 0 C, at a temperature of 75 0 C to 98 0 C, and at a temperature of 95 0 C.
  • a more elevated temperature i.e., above 50 0 C
  • a temperature of 75 0 C to 98 0 C at a temperature of 95 0 C.
  • Such mutated, chemically modified enzymes may be employed in all applications involving a thermostable Pol A DNA polymerase, such as DNA amplification and ligation reactions.
  • the thermally stable Pol A DNA polymerases as disclosed herein can be used for primer-based primer extension or amplification reactions.
  • the methods as disclosed herein involve the use of a reaction mixture containing a reversibly inactivated thermally stable Pol A DNA polymerase and subjecting the reaction mixture to a high temperature incubation prior to, or as an integral part of, the amplification or primer extension reaction. The high temperature incubation results in deacylation of the amino groups and recovery of both the polymerase and 5 '-3' exonuclease activities.
  • the 5 '-3' exonuclease activity of the Pol A DNA polymerase also has Lysine residues substituted by Arginine residues and is also inactivated by chemical modification but is restored by thermal exposure.
  • the 5 '-3' exonuclease mutants also exhibit more rapid reactivation and have substantially 100% of enzyme activity upon reactivation.
  • Amplification reactions typically are carried out in a Tris-HCl buffer formulated to a pH of 8.0 to 9.0 at room temperature. At room temperature, the alkaline reaction buffer conditions favor the acylated form of the amino group.
  • the pH of the reaction buffer is adjusted to a pH of 8.0 to 9.0 at room temperature, the pH of a Tris-HCl reaction buffer decreases with increasing temperature. Thus, the pH of the reaction buffer is decreased at the elevated temperatures at which the amplification is carried out and, in particular, at which the activating incubation is carried out.
  • the decrease in pH of the reaction buffer favors deacylation of the amino groups.
  • buffer system used in a reaction determines the pH changes that occur as a result of high temperature reaction conditions, and the temperature dependence of pH for various buffers used in biological reactions is well-known (see e.g. Good et al., 1966, Biochemistry 5(2):467-477).
  • amplification reactions are typically carried out in a Tris- HCl buffer, amplification reactions may be carried out in buffers which exhibit a smaller or greater change of pH with temperature.
  • a more or less stable modified enzyme may be desirable. For example, using a modifying reagent which results in a less stable modified enzyme calls for recovery of sufficient enzyme activity under smaller changes of buffer pH.
  • Activation of the modified enzyme can be achieved by incubation at a temperature which is equal to or higher than the primer hybridization (annealing) temperature used in the amplification reaction to insure primer binding specificity.
  • the length of incubation required to recover enzyme activity depends on the temperature and pH of the reaction mixture and on the stability of the acylated amino groups of the enzyme, which depends on the modifier reagent used in the preparation of the modified enzyme.
  • a wide range of incubation conditions are usable; optimal conditions may be determined empirically for each reaction. In general, incubation is carried out in the amplification reaction buffer at a temperature greater than about 50 0 C for between about 1 second and about 20 minutes.
  • a PCR amplification is carried out using a mutated, chemically modified, reversibly inactivated thermally stable DNA polymerase.
  • the annealing temperature used in PCR amplification is typically about 50-75 0 C, and the pre -reaction incubation is carried out at a temperature equal to or higher than the annealing temperature, such as a temperature greater than about 50 0 C, greater than about 75 0 C to 98 0 C and greater than a temperature of 95 0 C.
  • the amplification reaction mixture can be incubated at about 90-100 0 C for as short as ⁇ 2 minutes and can go for up to about 10 minutes to reactivate the DNA polymerase prior to temperature cycling.
  • the first step in a typical PCR amplification includes heat denaturation of the double- stranded target nucleic acid.
  • the exact conditions required for denaturation of the sample nucleic acid depends on the length and composition of the sample nucleic acid. Typically, an incubation at 90-100 0 C for about 10 seconds up to about 4 minutes is effective to fully denature the sample nucleic acid.
  • the initial denaturation step can serve as the pre-reaction incubation to reactivate the DNA polymerase. However, depending on the length and temperature of the initial denaturation step, and on the modifier reagent used to inactivate the DNA polymerase, recovery of the DNA polymerase activity may be incomplete. If maximal recovery of enzyme activity is desired, the pre-reaction incubation may be extended or, alternatively, the number of amplification cycles can be increased.
  • the mutated and modified enzyme and initial denaturation conditions are chosen such that only a fraction of the recoverable enzyme activity is recovered during the initial incubation step. Subsequent cycles of a PCR, each involving a high- temperature denaturation step, result in further recovery of the enzyme activity. It is known that an excess of DNA polymerase contributes to non-specific amplification. In the present methods, the amount of DNA polymerase activity present is low during the initial stages of the amplification when the number of target sequences is low, which reduces the amount of nonspecific extension products formed. Maximal DNA polymerase activity is present during the later stages of the amplification when the number of target sequences is high, and which enables high amplification yields.
  • the number of amplification cycles can be increased to compensate for the lower amount of DNA polymerase activity present in the initial cycles.
  • the methods as disclosed herein require no manipulation of the reaction mixture following the initial preparation.
  • the methods can be used for automated amplification systems and with in-situ amplification methods, wherein the addition of reagents after the initial denaturation step or the use of wax barriers is inconvenient or impractical.
  • compositions as disclosed herein are suitable for the reduction of non-specific amplification in a PCR with high polymerization fidelity. Accordingly, the compositions and methods as disclosed herein are suitable for amplification of target nucleic acid sequences and for cloning of such long sequences, such as in genomics studies. [00104]
  • the methods and compositions as disclosed herein are not restricted to any particular amplification system.
  • the reversibly-inactivated enzymes as disclosed herein can be used in any primer-based amplification system which uses thermally stable Pol A DNA polymerases and relies on reaction temperature to achieve amplification specificity.
  • the present methods can be applied to isothermal amplification systems which use thermostable enzymes.
  • 5'-nuc lease assay Another suitable assay method, referred to as a 5'-nuc lease assay, is described in U.S. Pat. No. 5,210,015; and Holland et al, 1991, Proc. Natl. Acad. Sci. USA 88:7276-7280; both, incorporated herein by reference.
  • labeled probes are degraded concomitant with primer extension by the 5' to 3' exonuclease activity of the DNA polymerase, e.g., Taq DNA polymerase. Detection of probe breakdown product indicates both that hybridization between probe and target DNA occurred and that the amplification reaction occurred.
  • the DNA polymerase e.g., Taq DNA polymerase
  • the method of real-time PCR utilizes the 5'-nuclease assay method and allows for the simultaneous detection and quantification of DNA in a sample at each PCR cycle.
  • the incorporation of a fluorescently labeled reporter probe into the PCR reaction permits specific and reliable quantification of the target DNA being amplified.
  • the increase of double-stranded DNA resulting from the synthesis of target sequences results in a detectable increase in fluorescence.
  • a problem in this method is that the synthesis of non-target sequence, i.e., non-specific amplification, results in an increase in fluorescence which interferes with the measurement of the increase in fluorescence resulting from the synthesis of target sequences.
  • the methods as disclosed herein are useful because they reduce non-specific amplification, thereby minimizing the increase in fluorescence resulting from the amplification of non-target sequences.
  • FIG. 6 illustrates the results shown in FIG. 6 in terms of the detection of fluorescence in a realtime PCR reaction.
  • the relative fluorescence of mutant, chemically modified 505 R is an earlier detectable CT during the logarithmic phase of amplification.
  • PCR reactions involving reverse transcription the materials and methods as disclosed herein permit a continuous reaction to be carried out in one vessel, without interrupting the enzymatic reactions by additional handling steps.
  • the present invention also relates to kits, multicontainer units comprising useful components for practicing the present method.
  • a useful kit contains a mutated, reversibly- inactivated thermostable DNA polymerase and one or more reagents for carrying out an amplification reaction, such as oligonucleotide primers, substrate nucleoside triphosphates, cof actors, and an appropriate buffer.
  • kits comprising such a mutated, chemically modified inactivated thermostable enzyme together with a Tris-buffered reaction buffer or Tris-buffered reaction mixture.
  • the enzymes can relate to the use of RNase
  • RT-PCR reverse transcription polymerase chain reaction
  • the enzymes can also be hot-start activated thermally stable ligase enzymes for ligation reaction such as OLA and SNPlexTM
  • the starting plasmid is pFC64 (SEQ ID NO: 2) in which nucleotide positions 1291 to 3789 encode the full length Taq DNA polymerase.
  • the nucleotide codons encoding the enzyme have been optimized to correspond to the codon usage of E. coli (Integrated DNA Technologies, Coralville, IA).
  • WT Thermus aquaticus
  • SEQ ID NO:3 A comparison of the codons used by Thermus aquaticus (WT, SEQ ID NO:3) and the converted E. coli codon nucleotide sequence (Co-opt, nucleotides 1291 to 3789 of SEQ ID NO:2) is shown in FIG.
  • FC1246F TACAATCAAAGGAGATATACCAT, SEQ ID NO:6
  • FC3938R CACCTGAGGTTAATCACTTA, SEQ ID NO:7
  • PCR amplification of the target area was performed in a 50 ⁇ L reaction volume containing 25 ⁇ L of 2X Phusion Master Mix, 500 nM of each primer and 0.1 ng of plasmid template DNA.
  • the vessel was cycled 35 times between 98 0 C, 15 seconds, 50 0 C, 15 seconds and 72 0 C, 1 minute.
  • Thermal cycling was performed on an ABI 9600 thermal cycler and a pre- denaturation step was found to be optional.
  • the resulting about 1.5 Kb and about 1 Kb fragments were resolved on a 4% agarose/Ethidium bromide gel.
  • the two DNA bands were cut out from the gel and purified using the QIAquick® Gel Extraction Kit (QIAGEN Inc., Valencia, CA).
  • the two purified bands were mixed and amplified with FC1246F and FC3938R with similar PCR parameters as described supra. Because of the partial complimentary of 540Dfor and 540Drev, the two fragments could anneal to each other and amplification by the outermost primers leads to an almost 2.5 Kb fragment encoding the K540R and K542R mutations.
  • the mutant 2.5 Kb fragment was resolved on a 4% agarose/Ethidium bromide gel, cut out from the gel and purified with the QIAquick® Gel Extraction Kit.
  • the purified 2.5 Kb fragment was trimmed with Sma I and Pst I (New England Bioslabs) at the ends and subcloned into the Sma I and Pst I sites of pQE-TriSystem (QIAGEN) leading to p540D.
  • the mutation site and its vicinity was confirmed by BigDye® Dideoxy Sequencing (Applied Biosystems) from purified plasmid pFC64.
  • K505R was generated in a similar way as 540D, except that 540Dfor and 540Drev primers were replaced with 505Rf (CCAGCCATCGGCCGTACTGAGAAAACCGGC, SEQ ID NO: 1
  • the 540Dfor and 540Drev primers are replaced with 542R for (CTGACCAAACTGCGTTCGACCTACATC, SEQ ID NO:23) and 542Rrev (GGTCGAACGCAGTTTGGTCAGCTCACG, SEQ ID NO:24), respectively.
  • a starting solution of citraconic anhydride was created by diluting 11.06M citraconic anhydride (Aldrich, Milwaukee, WI) 100-fold in DMF (N,N dimethyl formamide).
  • the CA to enzyme ratio describe above is about 100 to 1, and other ratios, such as 800:1, 400:1, 200:1, 100:1, 50:1 and 20:1 can be used by adjusting the concentration of CA that is to be mixed with enzyme solution.
  • the resulting modified protein is referred to as 505R.
  • 540D was chemically modified using the method for chemically modifying 505R.
  • Activity assays contain IX AmpliTaq Gold® buffer, 2.5 mM MgCl 2 , 0.25 mM of each dNTP and 500 nM of Polsubl4 substrate in a 20 ⁇ L reaction volume. Activity assays were done with a fluorogenic substrate referred to as Polsubl4 that has the sequence 5' to 3': BHQl-
  • FAM-dT ATCATCATATCATCAACTGGCCGTCGTTTTACATATGTAAAACGACGGCCAG(FAM- dT)T (SEQ ID NO: 10).
  • BHQ1® Blackhole Quencher l(Biosearch Biotechnologies, Novato, CA)
  • FAM-dT deoxythymine with fluorescein (FAM) linked to the nucleobase.
  • FAM is a fluorophore which emits at 520 nm and can be quenched by BHQl when they stay in close proximity. The structure is shown below:
  • CA-Modified 505R is Better than AmpliTaq Gold in a Fast TaqMan Assay [00131 ]
  • This experiment illustrates a comparison of a mutated chemically modified DNA polymerase verse a non-mutated chemically modified DNA polymerase. The surprising result is that the mutation actually improves the rate of thermal reactivation of the enzyme showing the usefulness of the 505R enzyme in fast PCR protocols.
  • a side-by-side comparison of 505R, a mutated and chemically modified with citraconic anhydride (CA) DNA polymerase and AmpliTaq Gold DNA polymerase (CA- modified, wild type) was done in a TaqMan® real-time PCR assay where the forward primer is GAPDH Forward (GAAGGTGAAGGTCGGAGTC) (SEQ ID NO: 11), the reverse primer is GAPDH Reverse (GAAGATGGTGATGGGATTTC) (SEQ ID NO: 12) and the TaqMan probe is FAM-CAAGCTTCCCGTTCTCAGCC-TAMRA (SEQ ID NO: 13).
  • CA citraconic anhydride

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A mutant thermally stable DNA polymerase having at least one Lysine to Arginine substitution corresponding to at least one of amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase A. Said polymerase can also be chemically modified to substantially reduced polymerase activity at ambient temperatures, wherein the chemical modification modifies at least one Lysine residue of the polymerase and said reduced polymerase activity is reversible upon heating at a temperature of at least 50 0C. Methods for using and kits containing the mutant DNA polymerase and chemically modified, mutant DNA polymerase for primer extension and amplification, respectively, are also envisioned.

Description

MUTATED AND CHEMICALLY MODIFIED THERMALLY STABLE DNA
POLYMERASES
FIELD
[0001 ] The following disclosure relates to thermally stable DNA polymerase enzymes, methods for enhancing enzyme activity and reactivation of inactive enzymes by thermal means.
INTRODUCTION
[0002] DNA polymerases derived from thermophilic bacteria have enabled researchers to replicate DNA in vitro and have advanced the studies of cell proliferation, genetics, diagnosis of diseases having DNA or RNA mutations and development of pharmaceutical drugs to prevent replication of viral, bacterial and cancer genomes. Modified DNA polymerases have been developed to reduce non-specific amplification, primer-dimer formation and improve nucleic acid detection. There are at least two methods to modify DNA polymerase such that it is inactive at ambient temperatures, either through covalently bound inhibitors or binding of an antibody. Activity is restored upon exposure to elevated temperatures. [0003] The most common method of DNA replication involves the polymerase chain reaction (PCR). In a PCR reaction a pair of oligonucleotide primers anneal to a template, most often a double-stranded DNA molecule. DNA polymerase acts to extend the primers in a 5' to 3' direction in two stages. Initially there is the association of the DNA polymerase with a priming site at the 3' OH end of the 3' most nucleotide of the primer followed by binding of a nucleotide (to form a new base pair with the template nucleotide). The result is simultaneous replication of each DNA strand by elongating the primer sequence using the denatured DNA molecule as a template.
SUMMARY
[0004] There is a disclosed embodiment including mutant DNA polymerases having at least one Lysine to Arginine substitution. The substitution can be in the DNA polymerase domain of a Pol A, Pol B, Pol C, Pol D, Pol X, or Pol Y DNA polymerase, or in a reverse transcriptase or ligase enzyme. The substitution corresponds to at least one of amino acid position 505, 540 or 542 of Thermits aquaticus Taq polymerase A as shown in SEQ ID NO:1. The mutant DNA polymerase can have at least one, at least two or three mutations corresponding to positions 505, 540 or 542 of Thermus aquaticus Taq polymerase A as shown in SEQ ID NO:1. The mutant DNA polymerase can have one Lysine to Arginine substitutions corresponding to amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase I. The mutant DNA polymerase can have two Lysine to Arginine substitutions corresponding to amino acid positions 540 and 542 of Thermus aquaticus Taq polymerase I. Other potential amino acid substitutions for Lysine include Histidine or amino acids with hydrophilic side groups such as Asparagine, Glutamic acid, Glutamine or Aspartic acid. The mutant DNA polymerase can be synthetic or naturally-occurring.
[0005] In certain embodiments, there is also disclosed a chemically modified mutant DNA polymerase having at least one Lysine to Arginine substitution corresponding to at least one of amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase I (SEQ ID NO:1), wherein the chemically modified mutant DNA polymerase has substantially reduced polymerase activity, and wherein the chemical modification, modifies at least one Lysine residue of the polymerase, renders the polymerase substantially inactive at 4 0C to 45 0C for at least 20 minutes and is reversible upon incubation at a temperature above at least 50 0C. [0006] In certain embodiments, the chemically modified mutant DNA polymerase has one Lysine to Arginine substitution corresponding to amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase A as shown in SEQ ID NO:1 or two Lysine to Arginine substitutions or three Lysine to Arginine substitutions. Other potential amino acid substitutions for Lysine include Histidine or amino acids with hydrophilic side groups such as Asparagine, Glutamic acid, Glutamine or Aspartic acid.
[0007] In various embodiments, the chemically modified mutant DNA polymerase is modified with citraconic anhydride or cis-aconitic anhydride. The DNA polymerase can be naturally-occurring or synthetic and is thermally stable.
[0008] In certain embodiments, the chemically modified mutant DNA polymerase is a Pol A, Pol B, Pol C, Pol D, Pol X, or Pol Y DNA polymerase. The chemically modified mutant enzyme could also be a reverse transcriptase or a ligase, wherein select Lysine residues are substituted with Arginine residues or other amino acid residues having a charge such as Histidine or hydrophilic side groups such as Asparagine, Glutamic acid, Glutamine or Aspartic acid.
[0009] In certain embodiments there is disclosed a method for the amplification of a target nucleic acid comprising: contacting said target nucleic acid with an amplification reaction mixture containing a primer complementary to said target nucleic acid and a chemically modified mutant DNA polymerase, wherein said polymerase has at least one Lysine to Arginine substitution corresponding to amino acid position 505, 540 or 542 of Thermits aquaticus Taq polymerase I as shown in SEQ ID NO:1, wherein said polymerase is rendered a thermally reversible inactive enzyme, and incubating the resulting mixture of the target nucleic acid and amplification reaction mixture at a temperature which is greater than about 50° C to allow formation of amplification products.
[0010] In various embodiments, the chemically modified mutant DNA polymerase is modified with citraconic anhydride or cis-aconitic anhydride in which said DNA polymerase is a thermally stable DNA polymerase and amplification is performed at a temperature above 50° C or at a temperature above 60° C.
[0011 ] In certain embodiments there is disclosed a method for determining a nucleotide base sequence of a DNA molecule comprising: incubating a DNA molecule annealed with a primer molecule able to hybridize to said DNA molecule in a vessel containing at least one deoxynucleoside triphosphate, a chemically modified mutant DNA polymerase having at least one Lysine to Arginine substitution corresponding to amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase I as shown in SEQ ID NO: 1, and at least one DNA synthesis terminating agent which terminates DNA synthesis at a specific nucleotide base, in an incubating reaction to allow formation of primer extension products; and separating the DNA products of the incubating reaction according to size whereby at least a part of the nucleotide base sequence of said DNA molecule can be determined. The DNA polymerase is a thermally stable DNA polymerase and primer extension is performed at a temperature above 50° C or at a temperature above 60° C.
[0012] In certain embodiments there is disclosed a reagent kit for primer extension comprising a mutated DNA polymerase in which Lysine is substituted with Arginine and the substitution corresponds to at least one of amino acid positions 505, 540 or 542 of Thermus aquaticus Taq polymerase I as shown in SEQ ID NO:1. The mutant DNA polymerase can be synthetic or naturally-occurring. The mutant DNA polymerase also has a greater level of enzyme activity as compared to the non-mutated wild type polymerase from which the polymerase was derived.
[0013] In various embodiments there is disclosed a chemically modified polymerase composition formed by reacting a mutant DNA polymerase having at least one Lysine to Arginine substitution corresponding to at least one of amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase I (SEQ ID NO:1) with a modifying reagent wherein the modifying reagent modifies at least one Lysine residue of the mutant polymerase to render the polymerase inactive at 4 0C to 45 0C for at least 20 min., and is reversible upon incubation at a temperature of at least 50 0C. The mutant DNA polymerase is selected from the group including a Pol A, Pol B, Pol C, Pol D, Pol E, Pol X and Pol Y-type DNA polymerase or a Type I, Type II and Type III DNA polymerase.
[0014] In various embodiments, the modified mutant DNA polymerase in the reagent kit for primer extension is thermally stable and the kit can also contain dNTPs, buffer, salts and at least one terminating agent.
[0015] In various embodiments, the chemically modified mutant DNA polymerase in the reagent kit for amplification is modified with citraconic anhydride or cis-aconitic anhydride. The DNA polymerase is thermally stable and the kit can also contain dNTPs, buffer, salts and a control DNA.
[0016] In certain embodiments a chemically modified mutant polymerase is prepared by a process including providing a mutant DNA polymerase having at least one Lysine to Arginine substitution corresponding to at least one of amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase I (SEQ ID NO: 1) and reacting the mutant DNA polymerase with a modifying reagent wherein the modifying reagent, modifies at least one Lysine residue of the mutant polymerase, renders the polymerase inactive at 4 0C to 45 0C for at least 20 min., and is reversible upon incubation at 50 0C. In various embodiments the chemical modification is citraconic anhydride or cis-aconitic anhydride and the polymerase is thermally stable. The mutant DNA polymerase can be is selected from the group comprising a Pol A, Pol B, Pol C, Pol D, Pol E, Pol X and Pol Y-type DNA polymerase or a Type I, Type II and Type III DNA polymerase.
[0017] In certain embodiments a modified mutant polymerase is prepared by a process including providing a DNA polymerase nucleotide sequence; converting the codons of the DNA polymerase to those of E. coli; inserting the codons optimized for an E. coli expression system into a plasmid; and extracting the expressed protein insert, wherein the resulting expressed protein has at least one Lysine to Arginine substitution corresponding to at least one of amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase I (SEQ ID NO: 1). This mutant DNA polymerase is thermally stable and can be selected from the group including a Pol A, Pol B, Pol C, Pol D, Pol E, Pol X and Pol Y-type DNA polymerase or a Type I, Type II and Type III DNA polymerase. In the following description, certain aspects and embodiments will become evident. It should be understood that a given embodiment need not have all aspects and features described herein. It should be understood that these aspects and embodiments are merely exemplary and explanatory and are not restrictive of the invention.
[0018] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.
[0019] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several exemplary embodiments of the disclosure and together with the description, serve to explain certain teachings.
[0020] There still exists a need in the art for DNA polymerase enzymes that are thermally stable but inactive at temperatures below PCR annealing conditions to prevent primer-dimmer formation, mis-priming, depletion of PCR reagents and improve the throughput of the PCR reaction while maintaining sensitivity and specificity.
[0021 ] These and other features of the present teachings are set forth herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] The skilled artisan will understand that the drawings described below are for illustration purposes only. The drawings are not intended to limit the scope of the present teachings in any way.
FIG. 1 is an alignment of thermally stable DNA polymerases across various genera of bacteria.
FIG. 2 illustrates the conservation of Lysine residues within the DNA polymerase active site domain of FIG. 1.
FIG. 3 illustrates the location of Lysine residues substituted with Arginine residues as disclosed in FIG. 2.
FIG. 4 is an alignment of the nucleotide sequence of Taq Pol A DNA polymerase encoding the protein shown in FIG. 1, the wild type and its E. coli optimized counterpart.
FIG. 5 illustrates the site-directed mutagenesis method for 540D double-mutant enzyme.
FIG. 6 illustrates the enzyme reactivation rate for 505R. FIG. 7 illustrates the enzyme reactivation rate for 540D. FIG. 8 illustrates the higher relative earlier CT level in the chemically modified 505R mutant DNA polymerase versus AmpliTaq Gold® DNA polymerase. DETAILED DESCRIPTION
[0023] For the purposes of interpreting of this specification, the following definitions will apply and whenever appropriate, terms used in the singular will also include the plural and vice versa. In the event that any definition set forth below conflicts with the usage of that word in any other document, including any document incorporated herein by reference, the definition set forth below shall always control for purposes of interpreting this specification and its associated claims unless a contrary meaning is clearly intended (for example in the document where the term is originally used). It is noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the," include plural referents unless expressly and unequivocally limited to one referent. The use of "or" means "and/or" unless stated otherwise. The use of "comprise," "comprises," "comprising," "include," "includes," and "including" are interchangeable and not intended to be limiting. Furthermore, where the description of one or more embodiments uses the term "comprising," those skilled in the art would understand that, in some specific instances, the embodiment or embodiments can be alternatively described using the language "consisting essentially of and/or "consisting of."
[0024] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including but not limited to patents, patent applications, articles, books, and treatises are hereby expressly incorporated by reference in their entirety for any purpose. In the event that one or more of the incorporated documents defines a term that contradicts that term's definition in this application, this application controls.
[0025] As used herein, the phrase "nucleic acid," "oligonucleotide", and polynucleotide(s)" are interchangeable.
[0026] As used herein, the term "or combinations thereof refers to all permutations and combinations of the listed items preceding the term. For example, "A, B, C, or combinations thereof is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, AAB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth. The skilled artisan will understand that typically there is no limit on the number of items or terms in any combination, unless otherwise apparent from the context. [0027] As used in reference to the method of the invention, the term "target polynucleotide" in the plural includes both multiple separate polynucleotide strands and multiple regions on the same polynucleotide strand that are separately amplified and/or detected. A target polynucleotide may be a single molecule of double- stranded or single-stranded polynucleotide, such as a length of genomic DNA, cDNA or viral genome including RNA, or a mixture of polynucleotide fragments, such as genomic DNA fragments or a mixture of viral and somatic polynucleotide fragments from an infected sample. Typically, a target polynucleotide is double- stranded DNA which is denatured, e.g., by heating, to form single- stranded target molecules capable of hybridizing with primers and/or oligonucleotide probes.
[0028] As used herein, the term "p_hosphodiester linkage" refers to the linkage - PO4 - which is used to link nucleotide monomers. Phosphodiester linkages as contemplated herein are linkages found in naturally-occurring DNA.
[0029] As used herein, the term "primer" refers to an oligonucleotide, typically between about 10 to 100 nucleotides in length, capable of selectively binding to a specified target nucleic acid or "template" by hybridizing with the template. The primer can provide a point of initiation for template-directed synthesis of a polynucleotide complementary to the template, which can take place in the presence of appropriate enzyme(s), cofactors, substrates such as nucleotides and oligonucleotides and the like.
[0030] As used herein, the term "sequencing primer" refers to an oligonucleotide primer that is used to initiate a sequencing reaction performed on a nucleic acid. The term "sequencing primer" refers to both a forward sequencing primer and to a reverse sequencing primer. [0031] As defined herein, "5' → 3' nuclease activity" or "5' to 3' nuclease activity" refers to that activity of a template-specific nucleic acid polymerase including either a 5' → 3' exonuclease activity traditionally associated with some DNA polymerases whereby nucleotides are removed from the 5' end of an oligonucleotide in a sequential manner, (i.e., E. coli DNA polymerase I has this activity whereas the Klenow fragment does not), or a 5' — > 3' endonuclease activity wherein cleavage occurs more than one nucleotide from the 5' end, or both. [0032] As used herein, the phrase "thermostable" and "thermally stable" are interchangeable.
[0033] As used herein, the term "thermostable nucleic acid polymerase" refers to an enzyme which is relatively stable to heat when compared, for example, to nucleotide polymerases from E. coli and which catalyzes the polymerization of nucleosides. Generally, the enzyme will initiate synthesis at the 3 '-end of the primer annealed to the target sequence, will proceed in the 5'-direction along the template and if possessing a 5' to 3' nuclease activity, hydrolyzing intervening, annealed probe to release both labeled and unlabeled probe fragments, until synthesis terminates. A representative thermostable enzyme isolated from Thermus aquaticus (Taq) is described in U.S. Pat. No. 4,889,818 and a method for using it in conventional PCR are described in Saiki et al., (1988), Science 239:487.
[0034] Exemplary bacteria from which the DNA Pol A polymerase can be isolated include but are not limited to Thermus aquaticus, Thermus thermophilus, Thermatoga maritime, Bacillus caldotenax, Carboxydothermus hydro genformans, Thermoanaerobacter thermohydrosulfuricus, Thermus brokianus, Thermus caldophilus GK24, Thermus flavus, Thermus rubens, or a mutant thereof.
[0035] As used herein, the term "amplification primer" refers to an oligonucleotide, which is capable of annealing to an RNA or DNA region adjacent a target sequence, and serving as an initiation primer for DNA synthesis under suitable conditions in which synthesis of a primer extension product is induced, i.e., in the presence of nucleotides and a polymerization-inducing agent such as a DNA-dependent DNA polymerase and at suitable temperature, pH, metal concentration, and salt concentration. Typically, a PCR reaction employs a pair of amplification primers including an "upstream" or "forward" primer and a "downstream" or "reverse" primer, which delimit a region of the RNA or DNA to be amplified.
[0036] As used herein, the term "amplifying" refers to a process whereby a portion of a nucleic acid is replicated using, for example, any of a broad range of primer extension reactions. Exemplary primer extension reactions include, but are not limited to, PCR. Unless specifically stated, "amplifying" refers to a single replication or to an arithmetic, logarithmic, or exponential amplification.
[0037] As used here, the term "primer extension reaction" refers to a reaction in which a polymerase catalyzes the template-directed synthesis of a nucleic acid from the 3' end of a primer. The term "primer extension product" refers to the resultant nucleic acid. A non-limiting exemplary primer extension reaction is the polymerase chain reaction (PCR). The terms "extending" and "extension" refer to the template-directed synthesis of a nucleic acid from the 3' end of a primer, which is catalyzed by a polymerase.
[0038] The term "nucleic acid sequence" as used herein can refer to the nucleic acid material itself and is not restricted to the sequence information (i.e. the succession of letters chosen among the five base letters A, C, G, T, or U) that biochemically characterizes a specific nucleic acid, for example, a DNA or RNA molecule. Nucleic acids shown herein are presented in a 5' -> 3' orientation unless otherwise indicated.
[0039] As used herein, the terms "polynucleotide", "nucleic acid", or "oligonucleotide" refers to a linear polymer of natural or modified monomers or linkages, including deoxyribonucleosides, ribonucleosides, polyamide nucleic acids, and the like, joined by inter- nucleosidic linkages and have the capability of specifically binding to a target polynucleotide by way of a regular pattern of monomer-to-monomer interactions, such as Watson-Crick type of base pairing, and capable of being ligated to another oligonucleotide in a template-driven reaction. Usually monomers are linked by phosphodiester bonds or analogs thereof to form oligonucleotides ranging in size from a few monomeric units, e.g. 3-4, to several hundreds of monomeric units. Whenever a polynucleotide such as an oligonucleotide is represented by a sequence of letters, such as "ATGCCTG," it will be understood that the nucleotides are in 5' → 3' order from left to right and that "A" denotes deoxyadenosine, "C" denotes deoxycytidine, "G" denotes deoxyguanosine, and "T" denotes deoxy thymidine, unless otherwise noted. The letters A, C, G, and T can be used to refer to the bases themselves, to nucleosides, or to nucleotides comprising the bases, as is standard in the art. In naturally occurring polynucleotides, the inter- nucleoside linkage is typically a phosphodiester bond, and the subunits are referred to as "nucleotides."
[0040] When two different, non-overlapping oligonucleotides anneal to different regions of the same linear complementary nucleic acid sequence, the 3' end of one oligonucleotide points toward the 5' end of the other; the former may be called the "upstream" oligonucleotide and the latter the "downstream" oligonucleotide.
[0041] As used herein "5'-nuclease probe" refers to a probe that comprises a signal moiety linked to a quencher moiety or a donor moiety through a short oligonucleotide link element. When the 5'-nuclease probe is intact, the quencher moiety or the donor moiety influences the detectable signal from the signal moiety. According to certain embodiments, the 5'-nuclease probe selectively hybridizes to a target nucleic acid sequence and is cleaved by a polypeptide having 5' to 3' exonuclease activity, e.g., when the probe is replaced by a newly polymerized strand during a primer extension reaction, such as PCR.
[0042] As used herein "quencher moiety" refers to a moiety that causes the detectable signal of a signal moiety to decrease when the quencher moiety is sufficiently close to the signal moiety. [0043] As used herein "signal moiety" refers to a moiety that is capable of producing a detectable signal.
[0044] As used herein "detectable signal" refers to a signal that is capable of being detected under certain conditions. In certain embodiments, a detectable signal is detected when it is present in a sufficient quantity.
[0045] As used herein "sequence determination", "determining a nucleotide base sequence", "sequencing", and like terms includes determination of partial as well as full sequence information. That is, the term includes sequence comparisons, fingerprinting, and like levels of information about a target polynucleotide, as well as the express identification and ordering of each nucleoside of the target polynucleotide within a region of interest. In certain embodiments, "sequence determination" comprises identifying a single nucleotide, while in other embodiments more than one nucleotide is identified. Identification of nucleosides, nucleotides, and/or bases are considered equivalent herein. It is noted that performing sequence determination on a polynucleotide typically yields equivalent information regarding the sequence of a perfectly complementary polynucleotide and thus is equivalent to sequence determination performed directly on a perfectly complementary polynucleotide.
[0046] As will be appreciated by one of ordinary skill in the art, references to templates, oligonucleotides, primers, etc., generally mean populations or pools of nucleic acid molecules that are substantially identical within a relevant region rather than single molecules. For example, a "template" generally means a plurality of substantially identical template molecules; a "primer" generally means a plurality of substantially identical primer molecules, and the like. [0047] As used herein, "plurality" in reference to oligonucleotide probes includes sets of two or more oligonucleotide probes where there may be a single "common" oligonucleotide probe that is usually specific for a non- variable region of a target polynucleotide and one or more "wild-type" and/or "mutant" oligonucleotide probes that are usually specific for a region of a target polynucleotide that contains allelic or mutational variants in sequence. [0048] As used herein, "wild type" refers to a gene, a genotype, or a phenotype which predominates in the wild population or in the standard laboratory stock for a given organism. [0049] As used herein, "mutant DNA" refers to an alteration within a codon of at least a single base change in DNA (or RNA) which results in the sequence encoding for a different amino acid as compared to the same codon position in the wild type DNA sequence. [0050] As used herein "mutant protein" refers to the protein resulting from the translation of the mutated DNA. The mutant protein is frequently referred to as having a missense mutation when amino acid substitution does not terminate translation and nonsense mutation when translation is suppressed.
[0051 ] As used herein "chemically modified mutant DNA polymerase" refers to the mutated protein (phenotype) encoded by a mutant DNA sequence (genotype) which has further undergone a chemical modification process with a modifier reagent resulting in a significant, if not essentially complete, reduction in activity of the protein encoded by the mutant DNA.
[0052] As used herein, "modifier" refers to a chemical compound which binds to the side chains of amino acids and alters the composition of the polymerase to inhibit at least 90% to
99% of the polymerase activity at ambient temperatures but dissociates at high temperatures to restore polymerase activity.
[0053] As used herein, "modifier reagent" refers to the chemical compound in solution which covalently binds to the side chains of amino acids and alters the composition of the polymerase to inhibit at least 90% to 99% of the polymerase activity at ambient temperatures but dissociates at high temperatures to restore polymerase activity. The following are exemplary modifiers of DNA polymerase; citraconic anhydride and cis-aconitic anhydride,
[0054] As used herein "inactivated DNA polymerase" refers to the loss of at least 99% of enzymatic activity at a temperature from about 4 0C to about 45 0C for at least 20 minutes and is reversible upon incubation at a temperature of at least 50 0C.
[0055] As used herein "substantially inactive" refers to the loss of at least 90% to at least
99% of enzymatic activity at a temperature from about 4 0C to about 45 0C for at least 20 minutes and is reversible upon incubation at a temperature of at least 50 0C.
[0056] As used herein "reactivation" refers to the thermal exposure of a chemically modified inactivated DNA polymerase, as incorporated into a reaction solution, to a temperature sufficient to restore at least 5% to 10% of enzymatic activity after < 2 minutes at 90 0C to 98 0C.
[0057] As used herein "hot-start" refers to the thermal exposure of a reaction solution, often a PCR reaction mix, to a temperature sufficient to restore enzymatic activity, i.e., thermal reactivation of a DNA polymerase which had been inactivated by chemical or antibody means.
[0058] As used herein, "substitution" refers to the replacement of at least one base, nucleobase, nucleoside, nucleotide or amino acid with a different base, nucleobase, nucleoside, nucleotide or amino acid.
[0059] As used herein, "nucleic acid polymerase" or "polymerase" refers to any polypeptide that catalyzes the synthesis of a polynucleotide using an existing polynucleotide as a template. [0060] As used herein, "DNA polymerase" refers to a nucleic acid polymerase that catalyzes the synthesis of DNA using an existing polynucleotide as a template.
[0061] As used herein, "thermostable DNA polymerase" refers to a DNA polymerase that, at a temperature higher than 37 0C, retains its ability to add at least one nucleotide onto the 3' end of a primer or primer extension product that is annealed to a target nucleic acid sequence. In certain embodiments, a thermostable DNA polymerase remains active after exposure to a temperature greater than about 37 0C. In certain embodiments, a thermostable DNA polymerase remains active at a temperature greater than about 42 0C. In certain embodiments, a thermostable DNA polymerase remains active at a temperature greater than about 50 0C. In certain embodiments, a thermostable DNA polymerase remains active at a temperature greater than about 60 0C. In certain embodiments, a thermostable DNA polymerase remains active at a temperature greater than about 70 0C. In certain embodiments, a thermostable DNA polymerase remains active at a temperature greater than about 80 0C. In certain embodiments, a thermostable polymerase remains active at a temperature greater than about 90 0C. [0062] As used herein, "nucleoside" includes the natural nucleosides, including 2'-deoxy and 2'-hydroxyl forms, e.g. as described in Komberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992). "Analogs" in reference to nucleosides includes synthetic nucleosides having modified base moieties and/or modified sugar moieties, e.g. described by Scheit, Nucleotide Analogs (John Wiley, New York, 1980); Uhlman and Peyman, Chemical Reviews, 90: 543-584 (1990); or the like. Such analogs include synthetic nucleosides designed to enhance binding properties, reduce degeneracy, increase specificity, and the like. [0063] As used here, "mutant DNA polymerase enzyme" it is meant that the polymerase has at least one amino acid change compared to the wild type DNA polymerase enzyme. In general this change will comprise the substitution of at least one amino acid for another. In certain instances these changes will be conservative changes, to maintain the overall charge distribution of the protein. However, the disclosure is not limited to only conservative substitutions. Non- conservative substitutions are also envisaged in the present invention. Moreover, it is within the contemplation of the present invention that the modification in the polymerase sequence may be a deletion or addition of one or more amino acids from or to the protein, provided that the polymerase has improved activity upon thermal reactivation.
[0064] The term "primer extension" as used herein refers to both to the synthesis of DNA resulting from the polymerization of individual nucleoside triphosphates using a primer as a point of initiation, and to the joining of additional oligonucleotides to the primer to extend the primer. As used herein, the term "primer extension" is intended to encompass the ligation of two oligonucleotides to form a longer product which can then serve as a target in future amplification cycles. As used herein, the term "primer" is intended to encompass the oligonucleotides used in ligation-mediated amplification processes which are extended by the ligation of a second oligonucleotide which hybridizes at an adjacent position. [0065] Reference will now be made to various embodiments, examples of which are illustrated in the accompanying drawings.
[0066] DNA polymerases are known to those skilled in the art. DNA polymerases include DNA-dependent polymerases, which use DNA as a template, or RNA-dependent polymerases, such as reverse transcriptase, which use RNA as a template.
[0067] Based on sequence homology, bacterial DNA polymerases can be subdivided into seven different families: A, B, C, D, X, Y, and RT. DNA-dependent DNA polymerases fall into one of six families (A, B, C, D, X, and Y), with most falling into one of three families (A, B, and C). See, e.g., Ito et al. (1991) Nucleic Acids Res. 19:4045-4057; Braithwaite et al. (1993) Nucleic Acids Res. 21:787-802; Filee et al. (2002) J. MoI. Evol. 54:763-773; and Alba (2001) Genome Biol. 2:3002.1-3002.4. Certain DNA polymerases may be single-chain polypeptides (e.g., certain family A and B polymerases) or multi-subunit enzymes (e.g., certain family C polymerases) with one of the subunits having polymerase activity. Id. A fusion protein may comprise a DNA polymerase selected from a family A, B, C, D, X, or Y polymerase. [0068] There are five known DNA polymerases in bacteria. All have 5 '-3' polymerase activity and include Pol I, Pol II, Pol III, Pol IV and Pol V. Pol IV and Pol V are Y-family DNA polymerases, known to have weak fidelity on normal templates and can replicate through damaged DNA. Pol I, Pol II and Pol III all have 3 ' -5 ' exonuclease activity while Pol I is also implicated in DNA repair, having both 5 '-3' polymerase and 3 '-5' proofreading exonuclease activity.
[0069] Family A polymerases ("Pol A") include both replicative and repair polymerases. Replicative members from this family include T7 DNA polymerase and the eukaryotic mitochondrial DNA Polymerase γ. Among the repair polymerases are E. coli DNA Pol I, Thermus aquaticus Pol I (Taq DNA polymerase), and Bacillus stearothermophilus Pol I. Excision repair and processing of Okazaki fragments generated during lagging strand synthesis are performed by the repair polymerases Because most thermostable Pol A enzymes do not possess the 3' to 5' exonuclease activity, they are incapable of proofreading the newly synthesized nucleic acid strand and consequently have high error rates. [0070] Family B polymerases ("Pol B") are substantially replicative polymerases including the major eukaryotic DNA polymerases α, δ, ε, and also DNA polymerase ζ. Pol B polymerases also include DNA polymerases encoded by some bacteria and bacteriophages, of which the best characterized are from T4, PM29 and RB69 bacteriophages. Pol B enzymes are involved in both leading and lagging strand synthesis and are noteworthy for their remarkable accuracy during replication as many have strong 3'-5' exonuclease activity the exceptions being DNA polymerase α and ζ which lack proofreading activity.
[0071 ] In various embodiments of the present teachings it has been discovered that changing certain Lysine residues to Arginine within the DNA polymerase Pol A active site domain via site-directed mutagenesis positively impacts enzyme activity levels. By carefully choosing the Lysine residues in conjunction with chemical modification of the enzyme with reagents like citraconic anhydride, in various embodiments, the instant invention enables the achievement of inactivation of both DNA polymerase activity and 5 '-3' exonuclease activity of Pol A at a low temperature (e.g. 50 0C or lower), and restoration of both enzymatic activities at an elevated temperature. The new finding that not only is DNA polymerase activity restored with heating but that 5'-3' exonuclease activity is restored to within 100% of its original activity makes these findings especially useful for real time detection of PCR products. For a representative method for using a labeled oligonucleotide simultaneously with PCR for the detection of a target sequence during its amplification, see U.S. Pat. No. 5,210,015.
[0072] Unexpectedly, it has been discovered that substituting selective Lysine residues with Arginine followed by chemical modification, permits inactivation and more rapid thermal reactivation of both polymerase and 5' to 3' exonuclease activity of Pol A enzymes while not negatively impacting thermal stability. Heat activation restores both the polymerase and nuclease activities in a shorter period of time and with a greater level of activity compared to only chemically modified polymerase.
[0073] Accordingly, in various embodiments, the present invention provides methods and compositions for reversibly inactivating a thermally stable Pol A DNA polymerase, a thermally stable Pol A DNA polymerase, and methods and reagents for using the enzyme for performing "hot-start PCR" and primer extension reactions.
[0074] It is to be understood that the invention is not intended to be limited to mutants or variants of the family A polymerases. The altered polymerase may also be a family B polymerase, or a mutant or variant thereof, for example a mutant or variant Pfu or KOD DNA polymerase enzyme, or a polymerase not belonging to either family A or family B, such as for example reverse transcriptase.
Thermally stable Pol A DNA Polymerases
[0075] Any thermally stable Pol A DNA polymerase can be reversibly inactivated according to methods known to one of ordinary skill in the art as disclosed in U.S. Pat. Nos. 5,677,152, 5,773,258 and 6,183,998. As discussed above, a hallmark of the A family of DNA polymerases is both their replication and repair activities and many have strong 5' to 3' exonuclease activity, and several thermostable Pol A DNA Polymerases are available commercially, including those described as Taq, Tth, Tea, TfI, Tfi, T7, and Bst or sold under the trade names AmpliTaq®, AmpliTaq Gold®, DyNAzyme™, and Phire™ Hot Start DNA Polymerases. Suitable thermostable Pol A DNA polymerases for the present invention include naturally occurring Pol A polymerases as well as chimeric or recombinant Pol A DNA polymerases. [0076] In certain embodiments, a Pol A DNA polymerase suitable for the present invention may comprise a family A DNA polymerase or a fragment or variant thereof having polymerase activity. In certain such embodiments, the family A polymerase is a polymerase from the genus Thermus, Thermatoga, Archaeglobus, Bacillus, Carboxydothermus, or Thermoanaerobacter. In certain such embodiments, the family A polymerase is Taq DNA polymerase or a fragment or variant thereof having polymerase activity. In certain embodiments, a variant of Taq DNA polymerase comprises an amino acid sequence having at least 50%, 70%, 90%, 95%, 96%, 97%, 98%, or 99% identity to Taq.
Chemically Modified Thermostable Pol A DNA Polymerases
[0077] According to various embodiments of the present teachings, a thermally stable enzyme that has an Arginine residue(s) substituted for a Lysine(s) residue in conjunction with the enzyme being chemically modified to render the enzyme thermally reversibly inactive has a shorter thermal reactivation time to render the enzyme active. The mutated and modified thermally stable DNA polymerase according to the present teachings provides a thermally stable enzyme with reduced activity at temperatures below about 45 0C to about 50 0C. These enzymes have advantages over wild type enzymes with chemical modifications alone as described in Example 3, and FIG. 6 and FIG. 7, as the conditions for thermal reactivation are more rapid and provide for an enzyme with an extended optimum activity level compared with non-mutated but similarly chemically modified enzymes. Chemical modifications of DNA polymerases to render the enzyme thermally reversibly inactive are well known in the art as described for example in US Pat. Nos. 5,677,152, 5,773,258 and 6,183,998. [0078] Examples of suitable chemical modifying reagents suitable for the present invention include maleic anhydride; substituted maleic anhydrides such as citraconic anhydride, cis- aconitic anhydride, and 2,3-dimethylmaleic anhydride; exo-cis-3,6-endoxo-δ4 -tetrahydropthalic anhydride; and 3,4,5,6-tetrahydrophthalic anhydride. The reagents are commercially available from, for example, Aldrich Chemical Co. (Milwaukee, Wis.), Sigma Chemical Co. (St. Louis, Mo.), or Spectrum Chemical Mfg. Corp. (Gardena, Calif.). Modifications of Pol A thermostable DNA polymerases using the substituted maleic anhydride reagents citraconic anhydride and cis- aconitic anhydride are described in U.S. Pat. Nos. 5,677152 and 5,773,258.
DNA Polymerase 5 '-3' Exonuclease and Pol A Domains are Highly Conserved
[0079] DNA polymerase is an essential enzyme for all living organisms and necessary for
DNA replication. As shown in FIG. 1, the amino acid sequence is highly conserved in both thermophilic and E. coli bacteria. Table 1 identifies the GenBank Accession Numbers for both the polynucleotide sequences and the encoded amino acid sequences from various thermophiles and an E. coli bacterium and bacteriophage shown in FIG. 1.
TABLE 1
[0080] In FIG. 1 the DNA polymerase designation from Table 1 is on the far left and the amino acid numbering for each sequence is on the far right. The asterisk, period or colon below the aligned sequences designates positions of identical amino acids, related amino acid family members or highly conserved amino acid residues, respectively. The alignment shown in FIG. 1 was made with the ClustalW2 program (European Biolnformatics Institute (EMBL/EMI), www.ebi.ac.uk/Tools/clustalw2/index.html). The 5'-3' exonuclease domain of Taq is from residue 12 to 264 with another region also found from residues 295 to 415. Beginning at amino acid position 451 of Taq, it is readily apparent that the DNA polymerase Pol A active site domain is highly homologous between species and the Thermus, Geobacillus and Escherichia genera. The DNA polymerase active site domain sequence as shown in FIG. 2 encompasses amino acid residues 451 to 832 in Taq which corresponds, for example, to residues 308 to 703 in E. coli phage T7 as determined using Pfam, Finn,R.D. (2006) Nucleic Acids Res. Database Issue 34:D247-D251). Consequently, substitutions of a Lysine residue with an Arginine in one organism would be expected to confer similar, if not identical, properties to another organism with which there is mutual homology in the area of interest, including the 5 '-3' exonuclease and DNA polymerase active site domains. Additionally, chemical modifications would also be expected to impart similar if not identical properties when comparing homologous sequences. [0081 ] Chemical modification of thermally stable polymerases as a way to reversibly inactivate enzymatic activity has been shown in the art, however mutations within the DNA polymerase domain of thermally stable polymerases in conjunction with chemical modification has not heretofore been observed. Specifically, substitution of Lysine residues with Arginine within the active site of the DNA Polymerase Pol A domain as seen in the three-dimensional structure of DNA polymerase has been discovered to have more rapid thermal reactivation times. As shown in FIG. 6 and FIG. 7 mutant and chemically modified 505R and 540R Pol A DNA Polymerases have no detectable polymerase activity prior to thermal reactivation and show activity after reactivation. AmpliTaq Gold® DNA polymerase (Applied Biosystems) was used as the control.
[0082] The present teachings describe methods for replacing select Lysine residues with Arginine within the DNA polymerase domain of the enzyme and chemical modifications for the thermally reversed inactivation of thermally stable enzymes. The mutant DNA polymerase is useful in sequencing reactions. And, the chemically modified mutated enzymes are useful in primer-based nucleic acid amplification reactions such as the polymerase chain reaction (PCR) and reverse transcription polymerase chain reaction (RT-PCR). Although Lysine residue substituted with Arginine have been shown to improve enzymatic activity and more rapid rates of reactivation, additional amino acids may also be considered to be replacements for Lysine residues. Such amino acids include Histidine or amino acids with hydrophilic side groups such as Asparagine, Glutamic acid, Glutamine or Aspartic acid.
[0083] The methods for mutating the DNA strand encoding the DNA polymerase may also be applicable to similarly mutating reverse transcriptase and ligase enzymes, including those enzymes which are thermally stable and find utility in hot-start applications. Such mutant enzymes would presumably result in more rapid reactivation rates and/or enhanced enzymatic activity.
[0084] The present teachings provide methods for mutating the DNA strand encoding the DNA polymerase enzyme of interest by sited-directed mutagenesis at selected codons encoding Lysine residues within the DNA polymerase domain of the enzyme. Lysine residues are known to be chemically modified to render the DNA polymerase substantially inactive at ambient temperatures but enzymatic activity is restored upon heating at temperatures above at least 50 0C. While there may be in excess of twenty or more Lysine residues within the DNA polymerase gene, and Arginine is known to one of ordinary skill in the art to be a conservative substitution for Lysine, the effect of substituting Arginine for Lysine to reduce the time of reactivation of the enzyme can be dependent on the location of the Lysine residue within the DNA binding site of the enzyme. In other words, not all mutated Lysine residues when substituted with Arginine provided more rapid enzyme reactivation and may actually adversely impact thermostability (Table 2) or 5 '-3' exonuclease activity. FIG. 9 provides an alignment of the mutated codons and the encoded amino acids. One of ordinary skill in the art can convert the bacterial codon to an optimized codon used in an expression plasmid of choice using codon tables. Such a table, the Bacterial and Plant Plastid Code Table (Table 11), from the Taxonomy Browser on the National Center for Biotechnology Information website is provided:
i = initiation codon, * = termination codon [0085] Lysine positions 505, 540 and 542 as found in the DNA polymerase domain of Taq are positioned within the active site in the three-dimensional structure of the enzyme and are within the conserved DNA polymerase Pol A domain of Pol A DNA polymerases, especially among prokaryotic thermostable Pol A enzymes. The aforementioned Lysine positions are conserved in other species and correspond, for example, to Escherichia coli DNA polymerase A residues 288, 312, and 314 and to Haemophilus influenzae DNA polymerase A residues 604, 638, and 640, respectively. The alignment of a 53-57 amino acid sequence segment of the DNA polymerase domain from various bacteria and a bacteriophage is shown in FIG. 3 and further illustrates the conservation of the domain between genera and species as well as the conservation of Lysine (K) residues within this domain.
[0086] Various amino acid residues found within the active site cleft of Taq polymerase from Thermus aquaticus by co-crystal structure have been identified to bind to duplex DNA, including 540K (Eom, S.H., Wang J. and Steitz T.A. Nature 382(6588):278-81, (1996). It was shown that Lys540 together with Asn485 and Ser515 interact directly or indirectly with the DNA backbone across the minor groove. Additional residues that were reported to interact with DNA include: (1) Asp785, Glu786, and Asp610 form the catalytic core of the polymerase and interact with the 3'hydroxyl of the primer; (2) Tyr671 and Phe667 interacting with the bases at the blunt end of the duplex; (3) Arg573, Glu655, Tyr671, Asn750, Gln745, His784 and Asp785, which are conserved among Pol A enzymes, contact DNA; and (4) Arg746, Asn580, Asn583, Ala568, Ser575, Ser543, Thr539, Asn485, Glu,615, Gln754, His 784, Val586, Glu537, Arg536, Ala516, and Ser515 which interact with the DNA helix. No direct contact of other Lysine residues or either 505 K or 542K to DNA was reported but the later two are in the vicinity of the active site in the crystal structure. It is speculated that chemical modifications at these two sites in the DNA polymerase may disturb the local tertiary structure, rendering the polymerase incapable to bind to substrate DNA.
[0087] As indicated in Table 2, select Lysine residues mutated to Arginine within the DNA polymerase domain of Thermus aquaticus Taq polymerase A do not always result in more rapid reactivation of enzyme activity and may negatively impact enzyme thermostability. TABLE 2
*numbering corresponds to Thermus aquaticus DNA polymerase Pol A
1 Modification was made only to the enzymes that are thermally stable, except 500T which was also chemically modified
2 Twelve of the thirteen mutated Lysines are not in the active site, 542 is in the active site
[0088] The use of Arginine in place of Lysine at some mutated Lysine residue positions within the DNA polymerase domain, in particular, at the active site, would be considered counterintuitive by one of ordinary skill in the art. It is known that Lysine is positively charged and positive residues often play a catalytic or structural role thus, changes to the active site could alter the enzyme's ability to bind to DNA, adversely impacting the enzyme's catalytic properties or the three dimensional structure. Lysine has a basic pH while Arginine' s pH is strongly basic, therefore, a strongly basic amino acid would have a strong pairing with a negatively charged amino acid which would alter both the folding of the enzyme and its three dimensional structure. Chemical modification reduce the thermostability of Taq polymerase and in combination with the Lysine becoming a negatively charged residue, the stability of the enzyme at 4 0C is reduced, further leading the skilled artisan away from the disclosed teachings. Replacing Lysine residues with Arginine reduces the number of Lysine residues available for chemical modification which would be expected to adversely impact enzyme inactivation but would not substantially interfere with enzyme reactivation, such actions are also counterintuitive to the objective of creating a thermally stable, inactive at ambient temperatures but also thermally reactivatable enzyme. As indicated in Table 2, changing Lysine to Arginine at K51 IR or K663R resulted in a decrease in enzyme thermal stability and both K508R and K831R had negligible effect on thermostability or rate of reactivation. Thus, random substitutions of Arginine for Lysine within either the 5 '-3' exonuclease or the DNA polymerase Pol A domains requires both deliberate selection of the Lysine residue(s) to mutate and experimental testing in order to achieve the properties of the disclosed enzymes.
[0089] For purposes of comparison the chemically modified, control DNA polymerase AmpliTaq Gold® DNA polymerase (Applied Biosystems, Foster City, CA), herein referred to as "Taq Gold," was used as the control enzyme for comparing polymerase thermal reactivation and recovered enzyme activity. Taq Gold is chemically modified with citraconic anhydride (CA) at Lysine residues (US Pat. Nos. 5,677,152 and 5,773,258) and requires a 10 minute thermal reactivation step at 95 0C for most PCR applications.
[0090] As indicated above, mutations within the DNA encoding DNA polymerase at 51 IK and 663K shows a loss of enzymatic stability regardless if chemically modified. Surprisingly, the present disclosure reveals that the enzymatic activity of mutated and chemically modified thermally stable enzymes can be recovered by incubation at elevated temperatures in 50% less time than non- mutated chemically modified thermally stable enzymes. [0091 ] An unexpected result occurred when wild type Taq polymerase from Thermus aquaticus (SEQ ID NO:1) was mutated by site-directed mutagenesis at either K505R or a double-mutant at K540R/K542R, herein referred to as 505R and 540D, respectively. FIG. 5 illustrates the procedures for creating the 540D mutant and the protocol is provided in Example 1. The resulting mutations did not adversely impact enzyme stability and the resulting enzymes actually had more rapid reactivation rates when compared to the non-mutated, chemically modified Taq Gold enzyme.
Amplification Methods
[0092] In the methods as disclosed herein, the polymerase activity of the thermally stable Pol A DNA polymerase has both at least one Lysine to Arginine substitution at one of positions 505, 540 or 542 and as a result of chemical modification are completely inactivated (less than 1% of their original activity) or nearly completely inactivated (less than 5% of their original activity) as shown at time point zero in FIG. 6 and FIG. 7. Surprisingly, the enzymatic activity of the present mutated, chemically modified enzymes are reactivated more rapidly and the 5 '-3' exonuclease activity attains 100% of its activity prior to chemical modification when incubated at a more elevated temperature, i.e., above 50 0C, at a temperature of 75 0C to 98 0C, and at a temperature of 95 0C. Such mutated, chemically modified enzymes may be employed in all applications involving a thermostable Pol A DNA polymerase, such as DNA amplification and ligation reactions.
[0093] An important aspect of the heat-activatable enzymes as disclosed herein is their storage stability. In general, the chemically modified enzymes are stable for extended periods of time which eliminates the need for preparation immediately prior to each use. [0094] The thermally stable Pol A DNA polymerases as disclosed herein can be used for primer-based primer extension or amplification reactions. The methods as disclosed herein involve the use of a reaction mixture containing a reversibly inactivated thermally stable Pol A DNA polymerase and subjecting the reaction mixture to a high temperature incubation prior to, or as an integral part of, the amplification or primer extension reaction. The high temperature incubation results in deacylation of the amino groups and recovery of both the polymerase and 5 '-3' exonuclease activities.
[0095] In certain embodiments as disclosed herein the 5 '-3' exonuclease activity of the Pol A DNA polymerase also has Lysine residues substituted by Arginine residues and is also inactivated by chemical modification but is restored by thermal exposure. The 5 '-3' exonuclease mutants also exhibit more rapid reactivation and have substantially 100% of enzyme activity upon reactivation.
[0096] The deacylation of the modified amino groups, and the reactivation of the enzyme activities, result from both the increase in temperature and a concomitant decrease in pH. Amplification reactions typically are carried out in a Tris-HCl buffer formulated to a pH of 8.0 to 9.0 at room temperature. At room temperature, the alkaline reaction buffer conditions favor the acylated form of the amino group. Although the pH of the reaction buffer is adjusted to a pH of 8.0 to 9.0 at room temperature, the pH of a Tris-HCl reaction buffer decreases with increasing temperature. Thus, the pH of the reaction buffer is decreased at the elevated temperatures at which the amplification is carried out and, in particular, at which the activating incubation is carried out. The decrease in pH of the reaction buffer favors deacylation of the amino groups. [0097] It is well recognized that buffer system used in a reaction determines the pH changes that occur as a result of high temperature reaction conditions, and the temperature dependence of pH for various buffers used in biological reactions is well-known (see e.g. Good et al., 1966, Biochemistry 5(2):467-477). Although amplification reactions are typically carried out in a Tris- HCl buffer, amplification reactions may be carried out in buffers which exhibit a smaller or greater change of pH with temperature. Depending on the buffer used, a more or less stable modified enzyme may be desirable. For example, using a modifying reagent which results in a less stable modified enzyme calls for recovery of sufficient enzyme activity under smaller changes of buffer pH.
[0098] Activation of the modified enzyme can be achieved by incubation at a temperature which is equal to or higher than the primer hybridization (annealing) temperature used in the amplification reaction to insure primer binding specificity. The length of incubation required to recover enzyme activity depends on the temperature and pH of the reaction mixture and on the stability of the acylated amino groups of the enzyme, which depends on the modifier reagent used in the preparation of the modified enzyme. A wide range of incubation conditions are usable; optimal conditions may be determined empirically for each reaction. In general, incubation is carried out in the amplification reaction buffer at a temperature greater than about 50 0C for between about 1 second and about 20 minutes.
[0099] In certain embodiments, a PCR amplification is carried out using a mutated, chemically modified, reversibly inactivated thermally stable DNA polymerase. The annealing temperature used in PCR amplification is typically about 50-75 0C, and the pre -reaction incubation is carried out at a temperature equal to or higher than the annealing temperature, such as a temperature greater than about 50 0C, greater than about 75 0C to 98 0C and greater than a temperature of 95 0C. The amplification reaction mixture can be incubated at about 90-100 0C for as short as < 2 minutes and can go for up to about 10 minutes to reactivate the DNA polymerase prior to temperature cycling.
[00100] The first step in a typical PCR amplification includes heat denaturation of the double- stranded target nucleic acid. The exact conditions required for denaturation of the sample nucleic acid depends on the length and composition of the sample nucleic acid. Typically, an incubation at 90-100 0C for about 10 seconds up to about 4 minutes is effective to fully denature the sample nucleic acid. The initial denaturation step can serve as the pre-reaction incubation to reactivate the DNA polymerase. However, depending on the length and temperature of the initial denaturation step, and on the modifier reagent used to inactivate the DNA polymerase, recovery of the DNA polymerase activity may be incomplete. If maximal recovery of enzyme activity is desired, the pre-reaction incubation may be extended or, alternatively, the number of amplification cycles can be increased.
[00101 ] In certain embodiments, the mutated and modified enzyme and initial denaturation conditions are chosen such that only a fraction of the recoverable enzyme activity is recovered during the initial incubation step. Subsequent cycles of a PCR, each involving a high- temperature denaturation step, result in further recovery of the enzyme activity. It is known that an excess of DNA polymerase contributes to non-specific amplification. In the present methods, the amount of DNA polymerase activity present is low during the initial stages of the amplification when the number of target sequences is low, which reduces the amount of nonspecific extension products formed. Maximal DNA polymerase activity is present during the later stages of the amplification when the number of target sequences is high, and which enables high amplification yields. If necessary, the number of amplification cycles can be increased to compensate for the lower amount of DNA polymerase activity present in the initial cycles. [00102] In various embodiments of the methods as disclosed herein require no manipulation of the reaction mixture following the initial preparation. Thus, the methods can be used for automated amplification systems and with in-situ amplification methods, wherein the addition of reagents after the initial denaturation step or the use of wax barriers is inconvenient or impractical.
[00103] The methods and compositions as disclosed herein are suitable for the reduction of non-specific amplification in a PCR with high polymerization fidelity. Accordingly, the compositions and methods as disclosed herein are suitable for amplification of target nucleic acid sequences and for cloning of such long sequences, such as in genomics studies. [00104] The methods and compositions as disclosed herein, however, are not restricted to any particular amplification system. The reversibly-inactivated enzymes as disclosed herein can be used in any primer-based amplification system which uses thermally stable Pol A DNA polymerases and relies on reaction temperature to achieve amplification specificity. The present methods can be applied to isothermal amplification systems which use thermostable enzymes. Only a transient incubation at an elevated temperature is required to recover enzyme activity. After the reaction mixture is subjected to high temperature incubation in order to recover enzyme activity, the reaction is carried out at an appropriate reaction temperature. Other amplification methods in addition to PCR (U.S. Pat. Nos. 4,683,195; 4,683,202; and 4,965,188) include, but are not limited to, the following: Ligase Chain Reaction (LCR, Wu and Wallace, 1989, Genomics 4:560-569 and Barany, 1991, Proc. Natl. Acad. Sci. USA 88:189-193); Polymerase Ligase Chain Reaction (Barany, 1991, PCR Methods and Applic. 1:5-16); Gap-LCR (PCT Patent Publication No. WO 90/01069); Repair Chain Reaction (European Patent Publication No. 439,182 A2), 3SR (Kwoh et al 1989, Proc. Natl. Acad. Sci. USA 86: 1173-1177; Guatelli et al 1990, Proc. Natl. Acad. Sci. USA 87: 1874-1878; PCT Patent Publication No. WO 92/0880A), and NASBA (U.S. Pat. No. 5,130,238). All of the above references are incorporated herein by reference. This invention is not limited to any particular amplification system. As other systems are developed, those systems may benefit by practice of this invention. A recent survey of amplification systems was published in Abramson and Myers, 1993, Current Opinion in Biotechnology 4:41-47, incorporated herein by reference.
[00105] Sample preparation methods suitable for each amplification reaction are described in the art (see, for example, Molecular Cloning-A Laboratory Manual, Cold Spring Harbor, N. Y. (Sambrook et al. 1989), and the references describing the amplification methods cited above). Simple and rapid methods of preparing samples for the PCR amplification of target sequences are described in Higuchi, 1989, in PCR Technology (Erlich ed., Stockton Press, New York), and in PCR Protocols: A Guide to Methods and Applications, Chapters 18-20 (Innis et al., ed., Academic Press, San Diego, Calif., 1990), both incorporated herein by reference. One of skill in the art will be able to select and empirically optimize a suitable protocol. [00106] Methods for the detection of amplified products have been described extensively in the literature. Standard methods include analysis by gel electrophoresis or by hybridization with oligonucleotide probes. The detection of hybrids formed between probes and amplified nucleic acid can be carried out in variety of formats, including the dot-blot assay format and the reverse dot-blot assay format, including Saiki et al, 1986, Nature 324:163-166; Saiki et al., 1989, Proc. Natl. Acad. Sci. USA 86:6230; PCT Patent Publication No. 89/11548; U.S. Pat. Nos. 5,008,182, and 5,176,775; PCR Protocols: A Guide to Methods and Applications (ed. Innis et al., Academic Press, San Diego, Calif.), each incorporated herein by reference. Reverse dot-blot methods using microwell plates are described in e.g. U.S. Pat. No. 5,232,829; Loeffelholz et al., 1992, J. Clin. Microbiol. 30(ll):2847-2851; Mulder et al., 1994, J. Clin. Microbiol. 32(2):292-300; and Jackson et al., 1991, AIDS 5:1463-1467, each incorporated herein by reference. [00107] Another suitable assay method, referred to as a 5'-nuc lease assay, is described in U.S. Pat. No. 5,210,015; and Holland et al, 1991, Proc. Natl. Acad. Sci. USA 88:7276-7280; both, incorporated herein by reference. In the 5 '-nuclease assay, labeled probes are degraded concomitant with primer extension by the 5' to 3' exonuclease activity of the DNA polymerase, e.g., Taq DNA polymerase. Detection of probe breakdown product indicates both that hybridization between probe and target DNA occurred and that the amplification reaction occurred. The method of real-time PCR utilizes the 5'-nuclease assay method and allows for the simultaneous detection and quantification of DNA in a sample at each PCR cycle. The incorporation of a fluorescently labeled reporter probe into the PCR reaction permits specific and reliable quantification of the target DNA being amplified.
[00108] An alternative method for detecting the amplification of nucleic acid by monitoring the increase in the total amount of double-stranded DNA in the reaction mixture is described in Higuchi et al., 1992, Bio/Technology 10:413-417; Higuchi et al., 1993, Bio/Technology 11: 1026-1030; and European Patent Publication Nos. 487,218 and 512,334, each incorporated herein by reference. The detection of double-stranded target DNA relies on the increased fluorescence that ethidium bromide (EtBr) and other DNA binding labels exhibit when bound to double- stranded DNA. The increase of double-stranded DNA resulting from the synthesis of target sequences results in a detectable increase in fluorescence. A problem in this method is that the synthesis of non-target sequence, i.e., non-specific amplification, results in an increase in fluorescence which interferes with the measurement of the increase in fluorescence resulting from the synthesis of target sequences. Thus, the methods as disclosed herein are useful because they reduce non-specific amplification, thereby minimizing the increase in fluorescence resulting from the amplification of non-target sequences.
[00109] As shown in FIG. 6, 505R relative enzyme activity after two minutes at 96 0C was approximately 47% of recoverable activity while AmpTaq Gold enzyme's relative enzyme activity was only about 19% of recoverable activity. After about 5 minutes both enzymes were of comparable relative activity, yet the overall relative activity of 505R remained higher for up to 20 minutes. Therefore, 505R undergoes thermal reactivation more rapidly and maintains a higher level of activity when compared to AmpliTaq Gold DNA polymerase as shown in FIG. 6. FIG. 8 illustrates the results shown in FIG. 6 in terms of the detection of fluorescence in a realtime PCR reaction. The relative fluorescence of mutant, chemically modified 505 R is an earlier detectable CT during the logarithmic phase of amplification.
[00110] A similar result is shown in FIG. 7 for 540D in which thermal reactivation occurs in approximately 50% less time than Taq Gold enzyme. Taq Gold took 20 minutes to attain maximum activity versus only 10 minutes for 540D.
[00111] In PCR reactions involving reverse transcription (RT-PCR), the materials and methods as disclosed herein permit a continuous reaction to be carried out in one vessel, without interrupting the enzymatic reactions by additional handling steps.
[00112] The present invention also relates to kits, multicontainer units comprising useful components for practicing the present method. A useful kit contains a mutated, reversibly- inactivated thermostable DNA polymerase and one or more reagents for carrying out an amplification reaction, such as oligonucleotide primers, substrate nucleoside triphosphates, cof actors, and an appropriate buffer.
[00113] In certain embodiments, the present invention relates to kits comprising such a mutated, chemically modified inactivated thermostable enzyme together with a Tris-buffered reaction buffer or Tris-buffered reaction mixture.
[00114] In certain embodiments, as taught herein, the enzymes can relate to the use of RNase
H positive and RNase H negative reverse transcriptases in combination with inactivated Pol A
DNA polymerase for a continuous reverse transcription polymerase chain reaction (RT-PCR) to be performed in a single reaction tube without interrupting the enzymatic reactions by additional handling steps.
[00115] In certain embodiments, as disclosed herein, the enzymes can also be hot-start activated thermally stable ligase enzymes for ligation reaction such as OLA and SNPlex™
Genotyping reactions (Applied Biosystems).
[00116] Various embodiments of the teachings disclosed are demonstrated in the Examples to follow. The Examples are provided as illustrations, and not as a limitation, of the scope of the disclosure. Numerous embodiments of the disclosed teachings which are within the scope of the claims that follow the examples will be apparent to those of ordinary skill in the art from reading the foregoing text and following examples.
[00117] Standard protocols of molecular biology applications, enzymology, protein and nucleic acid chemistry are well described in printed publications such as Molecular Cloning-A
Laboratory Manual, Cold Spring Harbor, N. Y. (Sambrook et al. 1989); PCR Protocols-A Guide to Methods and Applications, Academic Press, N.Y. (Innis et al., Eds, 1990), PCR Primer-A
Laboratory Manual, CSHL Press (Dieffenbach and Dveksler, eds., 1995); and Methods in
Enzymology, Academic Press, Inc.
[00118] Aspects of the present teachings may be further understood in light of the following examples, which should not be construed as limiting the scope of the present teachings in any way.
EXAMPLES
[00119] Those having ordinary skill in the art will understand that many modifications, alternatives, and equivalents are possible. All such modifications, alternatives, and equivalents are intended to be encompassed herein. [00120] The following procedures are representative of procedures that can be employed for the mutation of DNA encoding DNA polymerase and chemical modifications of the resulting mutated enzyme.
Example 1
Procedure for Site-Directed Mutagenesis of Taq DNA polymerase from Thermus aquaticus [00121 ] The starting plasmid is pFC64 (SEQ ID NO: 2) in which nucleotide positions 1291 to 3789 encode the full length Taq DNA polymerase. In order to optimize expression of the enzyme in the plasmid host, the nucleotide codons encoding the enzyme have been optimized to correspond to the codon usage of E. coli (Integrated DNA Technologies, Coralville, IA). A comparison of the codons used by Thermus aquaticus (WT, SEQ ID NO:3) and the converted E. coli codon nucleotide sequence (Co-opt, nucleotides 1291 to 3789 of SEQ ID NO:2) is shown in FIG. 4. Codon optimization methods followed those of Puigbό et al. (Puigbό P, Guzman E, Romeu A, Garcia- Vallve S. OPTIMIZER: A web server for optimizing the codon usage of DNA sequences. Nucleic Acids Res. 2007 Jul;35(Web Server issue):W126-31. Epub 2007 Apr 16.PMID: 17439967). The rest of the sequence is the backbone of the plasmid pQE-TriSystem from Qiagen (Valencia, CA). A -1.5 Kb and a ~1 Kb fragment of DNA from Thermus aquaticus were amplified in PCR reactions with FC1246F (50OnM) and 540Drev (50OnM), and with 540Dfor (50OnM) and FC3938R (50OnM), respectively and with about 1 million copies of pFC64 as template using Phusion 2X Master Mix (Catalog No. F531S, New England Biolabs, Ipswich, MA). The 5 'end of the primer 540Dfor (CTGACCCGTCTGCGTTCGACCTACATC, SEQ ID NO:4) and the 5' end of the primer 540Drev
(GGTCGAACGCAGACGGGTCAGCTCACG, SEQ ID NO: 5) anneal to complimentary DNA stands and encode the mutated amino acids for K540R and K542R present in the double-mutant 540D. FC1246F (TACAATCAAAGGAGATATACCAT, SEQ ID NO:6) is a primer located on the coding strand and upstream (5') to the Taq DNA polymerase gene, and FC3938R (CACCTGAGGTTAATCACTTA, SEQ ID NO:7) is a primer located on the complimentary strand, down stream (3') from the Taq gene.
[00122] PCR amplification of the target area was performed in a 50 μL reaction volume containing 25 μL of 2X Phusion Master Mix, 500 nM of each primer and 0.1 ng of plasmid template DNA. The vessel was cycled 35 times between 98 0C, 15 seconds, 50 0C, 15 seconds and 72 0C, 1 minute. Thermal cycling was performed on an ABI 9600 thermal cycler and a pre- denaturation step was found to be optional. The resulting about 1.5 Kb and about 1 Kb fragments were resolved on a 4% agarose/Ethidium bromide gel. The two DNA bands were cut out from the gel and purified using the QIAquick® Gel Extraction Kit (QIAGEN Inc., Valencia, CA). The two purified bands were mixed and amplified with FC1246F and FC3938R with similar PCR parameters as described supra. Because of the partial complimentary of 540Dfor and 540Drev, the two fragments could anneal to each other and amplification by the outermost primers leads to an almost 2.5 Kb fragment encoding the K540R and K542R mutations. The mutant 2.5 Kb fragment was resolved on a 4% agarose/Ethidium bromide gel, cut out from the gel and purified with the QIAquick® Gel Extraction Kit. The purified 2.5 Kb fragment was trimmed with Sma I and Pst I (New England Bioslabs) at the ends and subcloned into the Sma I and Pst I sites of pQE-TriSystem (QIAGEN) leading to p540D. The mutation site and its vicinity was confirmed by BigDye® Dideoxy Sequencing (Applied Biosystems) from purified plasmid pFC64.
Side-directed mutagenesis of 505R
[00123] K505R was generated in a similar way as 540D, except that 540Dfor and 540Drev primers were replaced with 505Rf (CCAGCCATCGGCCGTACTGAGAAAACCGGC, SEQ ID
NO: 8) and 505Rr (GGTTTTCTC AGTACGGCCGATGGCTGGCAG, SEQ ID NO: 9), respectively.
Side-directed mutagenesis to make 540R and 542R
[00124] To make the single mutated gene of K540R, 540R, the same procedure to make 540D will be repeated except that 540D for and 540 Drev primers are replaced with 540Rfor (CTGACCCGTCTGAAGTCGACCTACATC, SEQ ID NO:21) and 540Rrev (GGTCGACTTCAGACGGGTCAGCTCACG, SEQ ID NO:22), respectively. To make the single mutated gene of K542R, 542R, the 540Dfor and 540Drev primers are replaced with 542R for (CTGACCAAACTGCGTTCGACCTACATC, SEQ ID NO:23) and 542Rrev (GGTCGAACGCAGTTTGGTCAGCTCACG, SEQ ID NO:24), respectively.
Example 2
Preparing Inactivated Family A DNA Polymerase Using Citraconic Anhydride [00125] Chemical modification of 505R was carried out as follows: 50 ml of 27 mM citraconic anhydride (CA) in DMF was mixed with 1 liter of purified 505R that had been kept at 4 0C and adjusted to A28o= 1 in absorbance and 9.0 in pH with buffer containing 50 mM Tris, pH 9.0, O.lmM EDTA, and 0.01% Tween. The mixture was kept mixing for 60 minutes at 4 0C before transferring to a storage buffer. A starting solution of citraconic anhydride was created by diluting 11.06M citraconic anhydride (Aldrich, Milwaukee, WI) 100-fold in DMF (N,N dimethyl formamide). The CA to enzyme ratio describe above is about 100 to 1, and other ratios, such as 800:1, 400:1, 200:1, 100:1, 50:1 and 20:1 can be used by adjusting the concentration of CA that is to be mixed with enzyme solution.
[00126] The resulting modified protein is referred to as 505R. Similarly, 540D was chemically modified using the method for chemically modifying 505R.
Example 3
DNA Polymerase Activity Assay
[00127] Activity assays contain IX AmpliTaq Gold® buffer, 2.5 mM MgCl2, 0.25 mM of each dNTP and 500 nM of Polsubl4 substrate in a 20 μL reaction volume. Activity assays were done with a fluorogenic substrate referred to as Polsubl4 that has the sequence 5' to 3': BHQl-
ATCATCATATCATCAACTGGCCGTCGTTTTACATATGTAAAACGACGGCCAG(FAM- dT)T (SEQ ID NO: 10). Where BHQ1® is Blackhole Quencher l(Biosearch Biotechnologies, Novato, CA) and FAM-dT is deoxythymine with fluorescein (FAM) linked to the nucleobase. FAM is a fluorophore which emits at 520 nm and can be quenched by BHQl when they stay in close proximity. The structure is shown below:
[00128] Polsubl4 assumes a hairpin secondary structure as shown:
τ FAM :
A GTAAAACGACGGCCAGTT
T CATTTTGCAGCCGGTCAACTACTATACTACTA-BHQl XA / [00129] The fluorescein (FAM) FRET donor attached to the base of dT at the penultimate position is separated from BHQl mostly by a single stranded region that assumes a random coiled conformation. This conformation allows BHQl to quench fluorescein effectively. Once the substrate is polymerized, the single stranded region becomes double stranded as shown :
τ FAM
/T\ I
A GTAAAACGACGGCCAGTTGATGATATGATGAT T CATTTTGCAGCCGGTCAACTACTATACTACTA-BHQl NA7 which separates BHQl from the fluorescein by a stiffer double stranded DNA, rendering the fluorescein to be de-quenched.
[00130] As shown in FIG. 6 and FIG. 7, 505R and 540D, respectively, had no detectable polymerase activity before thermal reactivation (time = 0 min.), while activity resumed after activation. AmpliTaq Gold® DNA polymerase (designated AmpliTaq Gold), was used as the chemically modified but not mutated control.
Example 4
CA-Modified 505R is Better than AmpliTaq Gold in a Fast TaqMan Assay [00131 ] This experiment illustrates a comparison of a mutated chemically modified DNA polymerase verse a non-mutated chemically modified DNA polymerase. The surprising result is that the mutation actually improves the rate of thermal reactivation of the enzyme showing the usefulness of the 505R enzyme in fast PCR protocols.
[00132] A side-by-side comparison of 505R, a mutated and chemically modified with citraconic anhydride (CA) DNA polymerase and AmpliTaq Gold DNA polymerase (CA- modified, wild type) was done in a TaqMan® real-time PCR assay where the forward primer is GAPDH Forward (GAAGGTGAAGGTCGGAGTC) (SEQ ID NO: 11), the reverse primer is GAPDH Reverse (GAAGATGGTGATGGGATTTC) (SEQ ID NO: 12) and the TaqMan probe is FAM-CAAGCTTCCCGTTCTCAGCC-TAMRA (SEQ ID NO: 13). In each respective reaction of 20 μL, there were 500 nM primers and probe, 100 pg human brain cDNA (Applied Biosystems), IX AmpliTaq Gold Buffer, 2.5 mM MgC12, 200 μ M dNTP and 0.1 unit/ μ L of enzyme. Reactions were executed in a fast protocol which consists of 2 minutes of heat reactivation and 50 cycles between 95 0C for 1 second and 60 0C for 30 seconds. It can be appreciated that in this fast protocol, which has limited time for reactivation, modified 505R gave an earlier CT than AmpliTaq Gold due to more rapid reactivation. This experiment also demonstrated the 505R retains the ability to perform PCR and TaqMan real-time reactions. The results are shown in FIG. 8.
[00133] While the foregoing specification teaches the principles of the present invention, with examples provided for the purpose of illustration, it will be appreciated by one skilled in the art from reading this disclosure that various changes in form and detail can be made without departing from the spirit and scope of the invention.

Claims

What is claimed:
1. A mutant DNA polymerase having at least one Lysine to Arginine substitution corresponding to at least one of amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase I (SEQ ID NO:1).
2. The mutant DNA polymerase according to claim 1, having at least two Lysine to Arginine substitutions.
3. The mutant DNA polymerase of claim 2, wherein the mutant DNA polymerase has two Lysine to Arginine substitutions corresponding to amino acid positions 540 and 542 of Thermus aquaticus Taq polymerase I (SEQ ID NO:1).
4. The mutant DNA polymerase according to claim 1, having the Lysine to Arginine substitution corresponding to amino acid position 505, 540 or 542 of Taq DNA polymerase (SEQ ID NO: 1).
5. A chemically modified mutant DNA polymerase having at least one Lysine to Arginine substitution corresponding to at least one of amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase I (SEQ ID NO:1), wherein the chemically modified mutant DNA polymerase has substantially reduced polymerase activity, and wherein the chemical modification,
(1) modifies at least one Lysine residue of the polymerase,
(2) renders the polymerase inactive at 4 0C to 45 0C for at least 20 minutes, and
(3) is reversible upon incubation at 50 0C.
6. The chemically modified mutant DNA polymerase of claim 5, wherein the chemically modified mutant DNA polymerase has one Lysine to Arginine substitution corresponding to amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase I (SEQ ID NO:1).
7. The chemically modified mutant DNA polymerase of claim 6, having at least two Lysine to Arginine substitutions.
8. The chemically modified mutant DNA polymerase of claim 7, wherein the chemically modified mutant DNA polymerase has two Lysine to Arginine substitutions corresponding to amino acid positions 540 and 542 of Thermus aquaticus Taq polymerase I (SEQ ID NO:1).
9. The chemically modified mutant DNA polymerase of claim 5, wherein said chemical modification is citraconic anhydride or cis-aconitic anhydride.
10. A method for amplification of a target nucleic acid comprising: a) contacting said target nucleic acid with an amplification reaction mixture containing a primer complementary to said target nucleic acid and a chemically modified mutant DNA polymerase, wherein said polymerase has at least one Lysine to Arginine substitution corresponding to amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase I (SEQ ID NO:1), wherein said polymerase is rendered a thermally reversible inactive enzyme, and b) incubating the resulting mixture of step a) at a temperature which is greater than about 50° C to allow formation of amplification products.
11. The method of claim 10, wherein said enzyme is a Pol A DNA polymerase.
12. The method of claim 10, wherein said chemical modification is citraconic anhydride or cis- aconitic anhydride.
13. The method of claim 11, wherein said DNA polymerase is a thermally stable DNA polymerase and amplification is performed at a temperature above 50° C.
14. The method of claim 11, wherein said DNA polymerase is a thermally stable DNA polymerase and said amplification is performed at a temperature above 60° C.
15. The method of claim 12, wherein said chemical modification is citraconic anhydride.
16. A method for determining a nucleotide base sequence of a DNA molecule comprising: a.) incubating a DNA molecule annealed with a primer molecule able to hybridize to said DNA molecule in a vessel containing at least one deoxynucleoside triphosphate, a mutant DNA polymerase having at least one Lysine to Arginine substitution corresponding to amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase I (SEQ ID NO:1), and at least one DNA synthesis terminating agent which terminates DNA synthesis at a specific nucleotide base, in an incubating reaction to allow formation of primer extension products; and b.) separating the primer extension products of the incubating reaction according to size whereby at least a part of the nucleotide base sequence of said DNA molecule can be determined.
17. The method of claim 16, wherein said DNA polymerase is a thermally stable DNA polymerase and primer extension is performed at a temperature above 50° C.
18. The method of claim 16 wherein said DNA polymerase is a thermally stable DNA polymerase and primer extension is performed at a temperature above 60° C.
19. A reagent kit for DNA primer extension comprising a modified DNA polymerase according to claim 1 and at least one DNA synthesis terminating agent.
20. A reagent kit for amplification of a target nucleic acid comprising a mutated and chemically modified DNA polymerase according to claim 5 and at least one control DNA sample.
21. The mutant DNA polymerase of claim 1, wherein said polymerase is either naturally- occurring or synthetic.
22. The mutant DNA polymerase of claim 1, wherein said polymerase is thermally stable.
23. The DNA polymerase of claim 1, wherein said polymerase is selected from the group comprising a Pol A, Pol B, Pol C, Pol D, Pol E, Pol X and Pol Y-type DNA polymerase or a Type I, Type II and Type III DNA polymerase.
24. The mutant DNA polymerase of claim 5, wherein said polymerase is naturally-occurring or synthetic.
25. The mutant DNA polymerase of claim 5, wherein said polymerase is thermally stable.
26. The DNA polymerase of claim 5, wherein said polymerase is selected from the group comprising a Pol A, Pol B, Pol C, Pol D, Pol E, Pol X and Pol Y-type DNA polymerase or a Type I, Type II and Type III DNA polymerase.
27. A chemically modified mutant polymerase prepared by a process comprising: a) providing a mutant DNA polymerase having at least one Lysine to Arginine substitution corresponding to at least one of amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase I (SEQ ID NO:1); b) reacting the mutant DNA polymerase with a modifying reagent wherein the modifying reagent,
(1) modifies at least one Lysine residue of the mutant polymerase,
(2) renders the polymerase inactive at 4 0C to 45 0C for at least 20 min., and
(3) is reversible upon incubation at 50 0C.
28. The composition of claim 27, wherein said chemical modification is citraconic anhydride or cis-aconitic anhydride.
29. The mutant DNA polymerase of claim 27, wherein said polymerase is thermally stable.
30. The mutant DNA polymerase of claim 27, wherein said polymerase is selected from the group comprising a Pol A, Pol B, Pol C, Pol D, Pol E, Pol X and Pol Y-type DNA polymerase or a Type I, Type II and Type III DNA polymerase.
31. The composition of claim 30, wherein said polymerase is a Pol A DNA polymerase.
32. A modified mutant polymerase prepared by a process comprising: a) providing a DNA polymerase nucleotide sequence; b) converting the codons of the DNA polymerase to those of E. coli; c) inserting the codons optimized for an E. coli expression system into a plasmid; and d) extracting the expressed protein insert, wherein the resulting expressed protein has at least one Lysine to Arginine substitution corresponding to at least one of amino acid position 505, 540 or 542 of Thermus aquaticus Taq polymerase I (SEQ ID NO:1).
33. The mutant DNA polymerase of claim 32, wherein said polymerase is thermally stable.
34. The mutant DNA polymerase of claim 32, wherein said polymerase is selected from the group comprising a Pol A, Pol B, Pol C, Pol D, Pol E, Pol X and Pol Y-type DNA polymerase or a Type I, Type II and Type III DNA polymerase.
35. The composition of claim 30, wherein said polymerase is a Pol A DNA polymerase.
EP09767773A 2008-06-18 2009-06-18 Mutated and chemically modified thermally stable dna polymerases Withdrawn EP2300613A4 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US7375408P 2008-06-18 2008-06-18
PCT/US2009/047862 WO2009155464A2 (en) 2008-06-18 2009-06-18 Mutated and chemically modified thermally stable dna polymerases

Publications (2)

Publication Number Publication Date
EP2300613A2 true EP2300613A2 (en) 2011-03-30
EP2300613A4 EP2300613A4 (en) 2011-11-09

Family

ID=41434700

Family Applications (1)

Application Number Title Priority Date Filing Date
EP09767773A Withdrawn EP2300613A4 (en) 2008-06-18 2009-06-18 Mutated and chemically modified thermally stable dna polymerases

Country Status (2)

Country Link
EP (1) EP2300613A4 (en)
WO (1) WO2009155464A2 (en)

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010062777A2 (en) 2008-11-03 2010-06-03 Kapabiosystems Modified type a dna polymerases
DE112011100467B4 (en) * 2010-02-05 2018-07-12 New England Biolabs, Inc. Restriction endonucleases with high accuracy
WO2012097318A2 (en) 2011-01-14 2012-07-19 Kap Abiosystems Modified dna polymerases for improved amplification
US9447388B2 (en) * 2011-07-12 2016-09-20 Kyushu University, National University Corporation DNA polymerases
DK2841589T3 (en) * 2012-04-23 2019-01-07 Dsm Ip Assets Bv PROCEDURE FOR EXPRESSION OF POLYPEPTIDES
DE102012216193B4 (en) 2012-09-12 2020-07-30 Continental Automotive Gmbh Method and device for operating a motor vehicle component using gestures
CN114835793A (en) * 2015-11-16 2022-08-02 Ubi蛋白公司 Method for extending protein half-life
WO2018203582A1 (en) * 2017-05-05 2018-11-08 주식회사 유비프로틴 Method for prolonging protein half-life
WO2021242041A1 (en) * 2020-05-29 2021-12-02 (주)제노텍 Dna polymerase variant with improved discrimination of genetic variants
CN115011579B (en) * 2022-04-28 2024-02-02 北京丹大生物技术有限公司 Taq DNA polymerase mutant and preparation method and application thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5773258A (en) * 1995-08-25 1998-06-30 Roche Molecular Systems, Inc. Nucleic acid amplification using a reversibly inactivated thermostable enzyme
GB0022458D0 (en) * 2000-09-13 2000-11-01 Medical Res Council Directed evolution method
KR100624490B1 (en) * 2004-05-27 2006-09-20 바이오퀘스트(주) Chemically Modified Thermostable DNA Polymerase

Also Published As

Publication number Publication date
WO2009155464A3 (en) 2010-05-06
WO2009155464A2 (en) 2009-12-23
EP2300613A4 (en) 2011-11-09

Similar Documents

Publication Publication Date Title
EP2300613A2 (en) Mutated and chemically modified thermally stable dna polymerases
US8470563B2 (en) Use of whole blood in PCR reactions
EP2539472B1 (en) Fast pcr for str genotyping
JP3227102B2 (en) Thermostable DNA polymerase
US5674738A (en) DNA encoding thermostable nucleic acid polymerase enzyme from thermus species Z05
EP0550696B1 (en) Purified thermostable nucleic acid polymerase enzyme from thermosipho africanus
CN105283558A (en) Methods for amplification and sequencing using thermostable TthPrimPol
EP1778866A2 (en) Novel hot start nucleic acid amplification
JPH08298991A (en) Modified DNA polymerase
JP2001511018A (en) Polymerase and use thereof for analyzing or typing polymorphic nucleic acid fragments
JP6579152B2 (en) Modified thermostable DNA polymerase
CA2831180A1 (en) Dna polymerases with improved activity
JPWO2002062993A1 (en) Amplified nucleic acid and immobilized product thereof
CA2624324A1 (en) Thermostable viral polymerases and methods of use
JP2022500046A (en) Mutant DNA polymerase with improved strand replacement capacity
US20180094250A1 (en) Methods And Compositions For PCR
JP2020182463A (en) Nucleic acid amplification reagent
US20050260606A1 (en) Use of whole blood in PCR reactions
CN114958797A (en) Mutant DNA polymerase, coding gene, recombinant expression vector, recombinant bacterium and application thereof
WO2007076461A1 (en) Thermostable dna polymerase from thermus scotoductus
WO2007117331A2 (en) Novel dna polymerase from thermoanaerobacter tengcongenesis
WO2007076464A2 (en) Thermostable dna polymerase from thermus filiformis
WO2007127893A2 (en) Thermostable dna polymerase from thermotoga naphthophila and thermotoga petrophellia
Class et al. Patent application title: METHODS FOR AMPLIFICATION AND SEQUENCING USING THERMOSTABLE TTHPRIMPOL Inventors: Angel J. Picher (Madrid, ES) Luis Blanco (Madrid, ES) Assignees: SYGNIS BIOTECH SLU
WO2007117857A2 (en) Novel dna polymerase from caldicellulosiruptor kristjanssonii

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20110114

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA RS

DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20111007

RIC1 Information provided on ipc code assigned before grant

Ipc: C12N 9/12 20060101ALI20110930BHEP

Ipc: C12N 9/10 20060101ALI20110930BHEP

Ipc: C12N 15/54 20060101AFI20110930BHEP

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20120505