EP2282767A2 - Site-directed modification of factor ix - Google Patents
Site-directed modification of factor ixInfo
- Publication number
- EP2282767A2 EP2282767A2 EP09747101A EP09747101A EP2282767A2 EP 2282767 A2 EP2282767 A2 EP 2282767A2 EP 09747101 A EP09747101 A EP 09747101A EP 09747101 A EP09747101 A EP 09747101A EP 2282767 A2 EP2282767 A2 EP 2282767A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- polypeptide
- factor
- fix
- poly
- daltons
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6424—Serine endopeptidases (3.4.21)
- C12N9/644—Coagulation factor IXa (3.4.21.22)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
- A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
- A61K47/60—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
- C12Y304/21—Serine endopeptidases (3.4.21)
- C12Y304/21022—Coagulation factor IXa (3.4.21.22)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the invention relates to modified Factor IX polypeptides such as Factor IX polypeptides with one or more introduced cysteine sites.
- the modified Factor IX polypeptides may be conjugated to a biocompatible polymer.
- the invention also relates to methods of making modified Factor IX polypeptides, and methods of using modified Factor IX polypeptides, for example, to treat patients afflicted with hemophilia B.
- Hemophilia B effects one out of 34,500 males and is caused by various genetic defects in the gene encoding coagulation Factor IX (FIX) that result in either low or undetectable FIX protein in the blood (Kurachi, et al., Hematol. Oncol. Clin. North Am. 6:991-997, 1992; Lillicrap, Haemophilia 4:350-357, 1998). Insufficient levels of FIX lead to defective coagulation and symptoms that result from uncontrolled bleeding.
- FIX coagulation Factor IX
- Hemophilia B is treated effectively by the intravenous infusion of either plasma-derived or recombinant FIX protein either to stop bleeds that have already initiated or to prevent bleeding from occurring (prophylaxis) (Dargaud, et al., Expert Opin. Biol. Ther. 7:651-663; Giangrande, Expert Opin. Pharmacother. 6:1517-1524, 2005). Effective prophylaxis requires maintaining a minimum trough level of FIX of about 1% of normal levels (Giangrande, Expert Opin. Pharmacother. 6:1517-1524, 2005).
- FIX levels drop to less than 1% of normal levels within 3 to 4 days following bolus injection which necessitates repeat injection on average every three days to achieve effective prophylaxsis (Giangrande, Expert Opin. Pharmacother. 6:1517-1524, 2005).
- Such frequent intravenous injection is problematic for patients and is a hurdle for achieving effective prophylaxsis (Petrini, Haemophilia 13 Suppl 2:16-22, 2007), especially in children.
- a FIX protein with a longer half-life would enable less frequent administration and thus, be of significant medical benefit.
- FIX polypeptides also referred to modified FIX polypeptides or FIX variants
- a modified FIX polypeptide comprises at least one mutation selected from R338A and V86A, and at least one cysteine substitution selected from T148C, V153C, T163C, L165C, N167C, T169C, T172C, F175C, K201C, K247C, K413C, L414C, and T415C.
- a modified FIX polypeptide comprises at least one mutation selected from R338A and V86A, and at least one cysteine substitution selected from T148C, V153C, T163C, L165C, T172C, F175C, K247C, L414C, and T415C.
- a modified FIX polypeptide comprises a T169C, K201C, K247C, or L414C substitution or a T169C, K201C, K247C, or L414C substitution in combination with R338A, V86A, or both R338A and V86A.
- a modified FIX polypeptide comprises at least one cysteine amino acid introduced between amino acid residues 160-164. In some embodiments, a modified FIX polypeptide comprises at least two, three, four, or five cysteine amino acids introduced between amino acid residues 160-164. In some embodiments, a modified FIX polypeptide comprises a single cysteine residue inserted between residues A161 and E162. In some embodiments, a modified FIX polypeptide comprises a single cysteine residue inserted between residues Al 61 and El 62 in combination with R338A, V86A, or both R338A and V86A.
- a modified FIX polypeptide comprises at least one cysteine amino acid introduced between amino acid residues 160-161. In some embodiments, a modified FIX polypeptide comprises at least one cysteine amino acid introduced between amino acid residues 161-162. In some embodiments, a modified FIX polypeptide comprises at least one cysteine amino acid introduced between amino acid residues 162-163. In some embodiments, a modified FIX polypeptide comprises at least one cysteine amino acid introduced between amino acid residues 163-164. In some embodiments, a modified FIX polypeptide comprises a combination of the mutations described herein.
- the modified polypeptides have coagulation activity.
- the polypeptides comprise at least one mutation selected from R338A and V86A. In some embodiments, the polypeptides comprise both the R338A and V86A mutations.
- modified polypeptides having at least one substituted or introduced cysteine conjugated to a biocompatible polymer via the substituted or introduced cysteine residue.
- the biocompatible polymer is polyethylene glycol.
- the polyethylene glycol has a nominal average molecular weight in the range of from 3,000 Daltons to 150,000 Daltons. In some embodiments, the polyethylene glycol has a nominal average molecular weight in the range of from 5,000 Daltons to 85,000 Daltons.
- the modified polypeptides having at least one substituted or introduced cysteine are defined functionally.
- a modified FIX polypeptide is provided, wherein the at least one introduced or substituted cysteine does not reduce the amount of secreted polypeptide by more than 70% relative to the amount of secreted polypeptide lacking the at least one introduced or substituted cysteine.
- a modified FIX polypeptide wherein the at least one introduced or substituted cysteine does not reduce interaction of the polypeptide with at least one of Factor VIII (FVIII), Factor XI (FIX), or Factor X (FX) by more than 50% relative to interaction of the polypeptide lacking the at least one introduced or substituted cysteine with FVIII, FXI, or FX.
- FVIII Factor VIII
- FIX Factor XI
- FX Factor X
- a modified FIX polypeptide wherein conjugation to the polymer (via at least one introduced or substituted cysteine) does not reduce interaction of the polypeptide with at least one of FVIII, FXI, or FX by more than 50% relative to interaction of the unconjugated polypeptide with FVIII, FXI, or FX.
- a modified FIX polypeptide is provided, wherein conjugation to the polymer increases serum half-life of the polypeptide by at least 30% relative to the unconjugated polypeptide.
- a modified FIX polypeptide is provided, wherein the polypeptide has a specific activity of at least 100 units per mg of polypeptide.
- the application also provides FIX polypeptides comprising an R338A and a V86A mutation.
- the polypeptide has a specific activity of at least 700 units per mg of polypeptide.
- the application also provides pharmaceutical preparations comprising modified FIX polypeptides and a pharmaceutically acceptable carrier, wherein the preparation is pyrogen free.
- the application also provides methods for treating hemophilia B comprising administering to a subject in need thereof a therapeutically effective amount of the pharmaceutical preparations described herein.
- the application also provides DNA sequences encoding modified polypeptides, as well as eukaryotic host cells transfected with the DNA sequences.
- Figure 1 depicts a Western blot analysis of FIX in supernatants from HKBl 1 cells transfected with wild type FIX or FIX muteins.
- FIX protein was detected using an anti-Factor IX- HRP antibody.
- Figure 2 depicts FIX expression levels, activity, and specific activity in supernatants from HKBl 1 cells transfected with wild type FIX or various FIX muteins.
- the percentage of wild type expression and activity was calculated based on the expression and activity of wild type FIX in each individual experiment and represents the mean of 3 or 4 independent transfections. Error bars represent standard deviation.
- the expression level of the wild type protein varied from 0.5 to 2 ⁇ g/mL between experiments and the specific activity of wild type FIX varied between 80 and 150 IU/mg depending on the experiment.
- Figure 4 depicts a multiple sequence alignment of FIX sequences within the activation peptide from eight species.
- the amino acid sequence of mature FIX from eight species was aligned using a multiple alignment algorithm in Vector NTI (Informax). Only the region of the activation peptide is shown. A dash indicates that a gap was inserted to maximize the alignment.
- Figure 5 depicts gel analysis of L414C-PEG purified by method I (Q-SepharoseTM). Flow-though (FT) and eluate (EL) were collected and concentrated to smaller volumes by Centricon®. After gel electrophoresis, the same gel was stained with Coomassie Blue ( Figure 5a) followed by iodine ( Figure 5b), followed by silver staining ( Figure 5c) with a destaining step between each.
- PEGylation the covalent attachment of polyethylene glycol (PEG) to a molecule, is one method that has been demonstrated to increase the in vivo life-span of a protein.
- the PEG may be in a linear or branched form to produce different molecules with different features.
- PEGylation has been used to reduce antibody development to the therapeutic agent, protect the protein from protease digestion, and reduce the amount of protein removed in the kidney filtrate (Harris, et al., Clin. Pharmacokinet. 40:539-551, 2001).
- PEGylation may also increase the overall stability and solubility of the protein.
- the sustained plasma concentration of PEGylated proteins can reduce the extent of adverse side effects by reducing the trough to peak levels of the drug, thus eliminating the need to introduce super-physiological levels of protein at early time-points.
- PEGylation of proteins may be achieved by two general approaches.
- PEG is randomly linked to the primary amines of surface exposed residues, in particular lysine residues. Random modification of FIX by targeting primary amines (N-terminus and lysines) with large polymers such as PEG has been attempted (see, e.g., US Publication No. 2005/172459).
- the disadvantage of random PEGylation is that the resulting molecule does not have a defined structure and the activity of the protein can be significantly reduced.
- the protein is modified by the introduction of free cysteine residues (i.e., cysteines that are not involved in disulfide bonds) to which PEG may be attached using well described malaemide chemistry, for example, as described for GM-CSF (Doherty, et al., Bioconjug. Chem. 16:1291-1298, 2005), FVIII (U.S. Publication No. 2006/0115876) and EPO (Long, et al., Exp. Hematol. 34:697-704, 2006), among others.
- free cysteine residues i.e., cysteines that are not involved in disulfide bonds
- FVIII U.S. Publication No. 2006/0115876
- EPO Long, et al., Exp. Hematol. 34:697-704, 2006
- Site-specific PEGylation results in a molecule of defined structure and offers the opportunity to minimize the negative effect upon the protein activity by careful selection of the site of conjugation.
- the protein In order for site specific polymer conjugation to be successful, the protein must have no naturally occurring free cysteine residues such that the novel cysteine introduced into the protein is the only free cysteine available for linking to a polymer.
- PCT Publication WO 2007/135182 describes the general approach of making cysteine substitutions of FIX for the purpose of conjugation to polymers, but fails to demonstrate which of these sites can actually be used for this purpose.
- FIX Based on the amino acid sequence and available crystal structure, FIX does not appear to have any free cysteine residues such that mutations that create a novel free cysteine will create a single defined site for polymer conjugation. It has been described that introducing free cysteines may have a deleterious effect upon protein expression due to the reactivity of the free sulfhydryl. The introduction of new cysteine residues should be in surface exposed locations on the protein and should not disrupt the function of the protein or attenuate protein expression. For these reasons, the identification of appropriate sites for introducing a free cysteine is not obvious or trivial.
- native FIX is a single chain glycoprotein of about 55,000 Daltons. It has four structural domains: the GIa or gamma carboxyglutamate-rich domain; the EGF-like regions; the activation peptide; and the catalytic domain containing the active site (Thomson, Blood 67:565-572, 1986).
- FIX is synthesized in the liver as a single chain polypeptide of 461 amino acids and undergoes extensive post-translational modification during passage through the golgi and endoplasmic reticulum (Nemerson, et al., CRC Crit. Rev. Biochem. 9:45-85, 1980; Stenflo, et al., Annu. Rev. Biochem.
- Efficient gamma carboxylation is essential for the coagulation activity of FIX and in humans, twelve GIa residues are generated within the N terminal GIa domain, although gamma carboxylation on Gla36 and Gla40 is not required for function (DiScipio, et al., Biochemistry 18:899-904, 1979; Gillis, et al., Protein Sci. 6:185-196, 1997).
- native FIX contains two N-linked glycosylation sites (Nl 57, Nl 67), six O-linked glycosylation sites (S53, S61, T 159, T169, T172, T179), and one site each for Ser phosphorylation (S158), tyrosine sulfation (Y155), and ⁇ -hydroxylation (D64) (McMullen, et al., Biochem. Biophys. Res. Commun. 115: 8-14, 1983).
- Activated Factor VII initiates the normal hemostatic process by forming a complex with tissue factor (TF), exposed as a result of the injury to the vessel wall.
- the complex subsequently activates FIX; the active form is referred to as Factor IXa (FIXa).
- the activation peptide of FIX is removed by proteolytic cleavage at two sites by either FXIa or the tissue factor (TF)/FVIIa complex to generate the catalytically active molecule, FIXa.
- FIXa and Factor Villa (FVIIIa) convert FX to Factor Xa (FXa), which in turn converts prothrombin to thrombin.
- Thrombin finally converts fibrinogen to fibrin resulting in formation of a fibrin clot.
- FIX As wild-type FIX has numerous post-translational modifications some of which have been suggested to play a role in the in vivo pharmacokinetic profile, cysteine residues may be introduced at positions that do not affect these other modifications. Once produced, FIX should retain enzymatic activity and interact with FVIII, FXI, and FX in order to be an effective treatment for hemophilia B. The introduced cysteine residue or the conjugated polymer should not perturb these interactions and functions.
- the application provides a number of exemplary variants of FIX in which cysteine residues are introduced in order to provide sites for polymer conjugation. Moreover, the application demonstrates that these variants may be expressed in mammalian cells and demonstrate activity in a coagulation assay. Finally, these modification sites may be combined with alterations that enhance the specific activity of FIX, including but not limited to the R338A mutation and/or the V86A mutation (Chang, et al., J. Biol. Chem. 273:12089-12094, 1998; Chang, et al, J. Biol. Chem. 277:25393-25399, 2002). The combination with one or both of the R338A and V86A mutations compensates for any reduction in activity resulting from the addition of polymer conjugation sites such that the specific activity of the modified polypeptides is similar to or higher than that of wild type FIX.
- the application also provides, in part, polymer conjugated FIX polypeptides with minimal perturbation of function, which thus have utility for increasing the bioavailability of FIX.
- polymer conjugated polypeptides may be combined with alterations that enhance the specific activity of FIX, including but not limited to, the R338A mutation and/or the V86A mutation. Alterations that enhance the specific activity of FIX may compensate for potential loss of coagulation activity due to sequence modification or polymer conjugation, and also potentially prolong the efficacy of modified molecules by conferring efficacy at lower levels of protein.
- Modified FIX Polypeptides may be combined with alterations that enhance the specific activity of FIX, including but not limited to, the R338A mutation and/or the V86A mutation. Alterations that enhance the specific activity of FIX may compensate for potential loss of coagulation activity due to sequence modification or polymer conjugation, and also potentially prolong the efficacy of modified molecules by conferring efficacy at lower levels of protein.
- FIX polypeptides comprising one or more sites for polymer conjugation, that is, modified FIX polypeptides.
- "Factor IX” as used herein refers to a human plasma FIX glycoprotein that is a member of the intrinsic coagulation pathway and is essential to blood coagulation. It is to be understood that this definition includes native as well as recombinant forms of the human plasma FIX glycoprotein. Unless otherwise specified or indicated, as used herein FIX means any functional human FIX protein molecule in its normal role in coagulation, including any fragment, analogue and derivative thereof.
- fragment when referring to the polypeptides of the application, means fragments, derivatives, analogues, and variants of the polypeptides which retain substantially the same biological function or activity.
- Nonlimiting examples of FIX polypeptides include FIX, FIXa, and truncated versions of FIX having FIX activity.
- Biologically active fragments, deletion variants, substitution variants, or addition variants of any of the foregoing that maintain at least some degree of FIX activity can also serve as a FIX polypeptide.
- the FIX polypeptides may comprise an amino acid sequence at least about 70, 80, 90, or 95% identical to SEQ ID NO: 1.
- the modified FIX polypeptides are biologically active. Biological activity can be determined, for example, by coagulation assays described herein.
- Modified FIX polypeptides may also contain conservative substitutions of amino acids.
- a conservative substitution is recognized in the art as a substitution of one amino acid for another amino acid that has similar properties and include, for example, the changes of alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalan
- One aspect of the application provides modified FIX polypeptides, wherein polymer conjugation sites are introduced via a non- endogenous cysteine residue.
- the cysteine residue may be substituted for one or more endogenous FIX amino acid residues or by adding one or more cysteines to a FIX polypeptide.
- the addition of a cysteine residue may be between two existing amino acid residues, such as between amino acid residues 160 and 161, between 161 and 162, between 162 and 163, or between 163 and 164 of human FIX.
- the terminology for amino acid substitutions used is as follows.
- the first letter represents the amino acid residue naturally present at a position of human FIX.
- the following number represents the position in the mature human FIX amino acid sequence (SEQ ID NO:1).
- the second letter represent the different amino acid substituting for (replacing/substituting) the natural amino acid.
- R338A denotes that the arginine residue at position 338 of SEQ ID NO: 1 has been replaced with an alanine residue.
- FIX residue number system used in this document refers to that of the mature human FIX protein in which residue 1 represents the first amino acid of the mature FIX polypeptide following removal of both the signal sequence and the propeptide.
- Native or wild type FIX is the full length mature human FIX molecule as shown in SEQ ID NO: 1.
- the conjugation sites are engineered in FIX at locations that will not abolish the function of the protein or its expression in cells.
- the conjugation site is surface exposed. Surface exposure may be determined based on the solvent accessible surface area as determined in Autin, et al., (J. Thromb. Haemost. 3:2044- 2056, 2005).
- the introduction of a conjugation site does not introduce a mutation known to be associated with hemophilia B. Known mutations can be found on the world wide web at kcl.ac.uk/ip/petergreen/haemBdatabase.html and in Table 1.
- the modified FIX polypeptides having one or more introduced polymer conjugation sites may be conjugated to a biocompatible polymer. It is within the purview of one skilled in the art to select the most appropriate control polypeptide for comparison.
- the control polypeptide is identical to the modified polypeptide except for the one or more introduced polymer conjugation sites. In some embodiments, the control polypeptide is identical to the modified polypeptide except that the control polypeptide has not been conjugated to a polymer.
- Exemplary polypeptides include wild-type FIX polypeptide and FIX polypeptides comprising one or more activating mutations, such as R338A and/or V86A.
- modified FIX polypeptides having increased in vitro or in vivo stability over a control polypeptide. Enhanced serum half-life and in vivo stability may be desirable to reduce the frequency of dosing that is required to achieve therapeutic effectiveness. Accordingly, in certain embodiments, the modified FIX polypeptides have a serum half-life increased by about 20, 30, 40, 60, 80, 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, or 1000% relative to a control polypeptide.
- the modified FIX polypeptides have a serum half-life of at least one, at least two, at least three, at least four, at least five, at least ten, or at least twenty days or more. In some embodiments, the FIX polypeptides demonstrating an increased serum half-life are PEGylated.
- half-life as used herein in the context of administering a polypeptide drug to a patient, is defined as the time required for plasma concentration of a drug in a patient to be reduced by one half.
- Methods for pharmacokinetic analysis and determination of half-life and in vivo stability will be familiar to those skilled in the art. Details may be found in Kenneth, et al., Chemical Stability of Pharmaceuticals: A Handbook for Pharmacists and in Peters, et al., Pharmacokinetc analysis: A Practical Approach (1996). Reference is also made to "Pharmacokinetics,” M Gibaldi & D Perron, published by Marcel Dekker, 2nd Rev. edition (1982), which describes pharmacokinetic parameters such as t-alpha and t-beta half lives and area under the curve (AUC).
- modified FIX polypeptides can be described either as an absolute value, such as in units, or as a percentage of the activity of a control polypeptide.
- the modified FIX polypeptides may have a specific activity that is not reduced more than about 10, 20, 30, 40, 50, 60, 70, or 80% relative to a control protein.
- a modified FIX polypeptide may have a specific activity that is not reduced more than about 80% relative to a control FIX polypeptide, if the modified polypeptide maintains at least about 20% of the specific activity as compared to the specific activity of the control.
- Factor IX specific activity may be defined as the ability to function in the coagulation cascade, induce the formation of FXa via interaction with FVIIIa on an activated platelet, or support the formation of a blood clot.
- the activity may be assessed in vitro by techniques such as clot analysis, as described in, for example, McCarthy, et al., (Thromb Haemost. 87(5):824-830, 2002), and other techniques known to those skilled in the art.
- the activity may also be assessed in vivo using one of the several animal lines that have been intentionally bred with a genetic mutation for hemophilia B such that an animal produced from such a line is deficient for FIX.
- mice deficient in FIX are also available (Sabatino, et al., Blood 104:2767-2774, 2005).
- a test polypeptide is injected into the diseased animal, a small cut made and bleeding time compared to a healthy control.
- Human wild-type FIX has a specific activity of around 200 units per mg.
- One unit of Factor IX has been defined as the amount of FIX present in one milliliter of normal (pooled) human plasma (corresponding to a FIX level of 100%).
- the modified FIX polypeptides have a specific activity of at least 100 units per mg of FIX polypeptide. In some embodiments, the modified FIX polypeptides have a specific activity of at least about 120, 140, 160, 180, 200, 220, 240, 260 units or more per mg of FIX polypeptide.
- the specific activity of FIX is measured using the APTT or activated partial thromboplastin time assay (described by, e.g., Proctor, et al., Am. J. Clin. Pathol. 36:212, 1961 and see Examples).
- FIX polypeptide When expressed in cells, such as liver or kidney cells, FIX polypeptide may be synthesized by the cellular machinery, undergoes post-translational modification, and is then secreted by the cells into the extracellular milieu. The amount of FIX polypeptide secreted from cells is therefore dependent on both processes of protein translation and extracellular secretion. In some embodiments, the modified FIX polypeptides may be secreted in an amount that is not reduced more than about 10, 20, 30, 40, 50, 60, 70, or 80% relative to the amount secreted of a control protein.
- a modified FIX polypeptide may be secreted in an amount that is not reduced by more than about 80% relative to a control FIX polypeptide, if the modified polypeptide is secreted in an amount of at least about 20% as compared to the control.
- the amount of FIX polypeptide secreted may be measured, for example, by determining the protein levels in the extracellular medium using any art-known method.
- Traditional methodologies for protein quantification include 2-D gel electrophoresis, mass spectrometry, and antibody binding.
- Exemplary methods for assaying protein levels in a biological sample include antibody-based techniques, such as immunoblotting (western blotting), immunohistological assay, enzyme linked immunosorbent assay (ELISA), or radioimmunoassay (RIA).
- the modified FIX polypeptides interact with at least one of FVIII, FXI, or FX at a level not reduced more than about 40, 50, 60, 70, or 80% relative to the interaction of a control protein with at least one of FVIII, FXI, or FX.
- a modified FIX polypeptide interacts with at least one of FVIII, FXI, or FX at a level not reduced by more than about 80% relative to a control FIX polypeptide, if the modified polypeptide interacts with at least one of FVIII, FXI, or FX at a level of at least about 20% as compared to the control.
- FIX polypeptides comprising one or more polymer conjugation sites.
- the conjugation sites are free cysteine residues.
- the FIX polypeptides comprise (i) at least one cysteine substitution selected from T148C, V153C, T163C, L165C, N167C, T169C, T172C, F175C, K201C, K247C, K413C, and T415C and (ii) the R338A mutation, the V86A mutation, or both.
- the FIX polypeptides comprise (i) at least one cysteine substitution selected from T148C, V153C, T163C, L165C, T172C, F175C, K247C, and T415C and (ii) the R338A mutation, the V86A mutation, or both.
- the FIX polypeptides comprise (i) T148C and (ii) the R338A mutation, the V86A mutation, or both. In some embodiments, the FIX polypeptides comprise (i) V153C and (ii) the R338A mutation, the V86A mutation, or both. In some embodiments, the FIX polypeptides comprise (i) T163C (ii) the R338A mutation, the V86A mutation, or both. In some embodiments, the FIX polypeptides comprise (i) L165C and (ii) the R338A mutation, the V86A mutation, or both.
- the FIX polypeptides comprise (i) T172C and (ii) the R338A mutation, the V86A mutation, or both. In some embodiments, the FIX polypeptides comprise (i) F175C and (ii) the R338A mutation, the V86A mutation, or both. In some embodiments, the FIX polypeptides comprise (i) K247C and (ii) the R338A mutation, the V86A mutation, or both. In some embodiments, the FIX polypeptides comprise (i) T415C and (ii) the R338A mutation, the V86A mutation, or both.
- the FIX polypeptides are PEGylated on the introduced cysteine residue.
- PEGylation increases the serum half-life of the FIX polypeptides by at least about 20, 30, 40, 60, 80, 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, or 1000% relative to the corresponding non-PEGylated FIX polypeptide.
- FIX polypeptides are provided comprising a T169C, K201C, K247C, or L414C substitution. In some embodiments, these polypeptides further comprise the R338A mutation, the V86A mutation, or both. In some embodiments, these polypeptides are PEGylated on the introduced cysteine residue and PEGylation increases the serum half-life of the FIX polypeptide by at least about 20, 30, 40, 60, 80, 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, or 1000% relative to the corresponding non-PEGylated FIX polypeptide.
- the activation peptide (AP) of FIX is an attractive domain for site specific conjugation of polymers because it was shown that this domain can be removed without reducing catalytic activity of the protein and because the AP is removed upon activation of FIX to FIXa (Begbie, et al., Thromb. Haemost. 94:1138-1147, 2005). Therefore, modification of the AP domain, such as by polymer conjugation, is less likely to interfere with the catalytic activity of FIXa. Because there is no crystal structure of the AP, it is not possible to determine the solvent accessibility of residues within this domain.
- this domain contains six glycosylation sites suggesting that most of this domain is solvent exposed making it an attractive region for site specific polymer modification, including site specific PEGylation.
- this domain contains the majority of the post- translational modifications that occur on natural FIX, including both of the N-linked glycosylation sites (Asnl57, Asnl67), the tyrosine sulfation site (Tyrl55), the serine phosphorylation (Serl58), as well as four sites for O-linked glycosylation (Thrl59, Thrl69, Thrl72, Thrl79).
- Post-translational modifications are known to be important for the function of proteins and in particular, can play an important role in determining the pharmacokinetics in vivo.
- FIX post-translational modifications within the AP are important determinants of the in vivo recovery of the protein (the percentage of protein present in the blood immediately after injection), which can impact the therapeutic efficacy in hemophilia B patients (White, et al., Thromb. Haemost. 78:261-265, 1997). Therefore, it is desirable to maintain the naturally occurring post-translational modifications within the AP of FIX.
- the application provides, in part, FIX polypeptides comprising one or more polymer conjugation sites, for example, free cysteine residues, introduced in the activation peptide of FIX, specifically between amino acid residues 160 to 164.
- the multiple sequence alignment of the FIX sequence from 8 species demonstrated that the mouse, rat, and guinea pig sequences all have additional amino acids (between 7 and 10 residues) in the activation peptide that are not found in other species (human, rhesus, dog, rabbit, pig) ( Figure 4). These additional sequences are located between E 160 and E 162. This suggests that insertion of at least 10 amino acid residues is tolerated in the FIX structure at this site.
- up to 30, 25, 20, 18, 16, 14, or 12 amino acid residues may be inserted between amino acid residues 160 to 164 of human FIX. In some embodiments, up to 10 amino acids are inserted. In some embodiments, up to 9 amino acid are inserted.
- the apparent site at which the additional amino acids in rat, mouse, and guinea pig are found can vary such that the site can be either between E160 and A161, between A161 and E162, between E162 and T163, or between T163 and 1164 of the human FIX.
- one or more amino acids for example, one or more cysteine residues, are inserted between E160 and A161 and one or more amino acids are inserted between A161 and E162.
- one or more amino acids are inserted between E160 and A161 and one or more amino acids are inserted between E162 and T 163.
- one or more amino acids, including at least one cysteine residue are inserted between A161 and E162 and one or more amino acids, including at least one cysteine residue, are inserted between E 162 and T 163.
- one or more amino acids, including at least one cysteine residue are inserted between Tl 63 and 1164.
- up to 30, 25, 20, 18, 16, 14, or 12 total amino acid residues, including at least one cysteine residue are inserted between amino acid residues 161 to 164 of human FIX.
- up to 10 total amino acids, including at least one cysteine residue are inserted between amino acid residues 160 to 164 of human FIX. In some embodiments, up to 9 total amino acids, including at least one cysteine residue, are inserted between amino acid residues 160 to 164 of human FIX. In some embodiments, between 1 and 5 cysteine residues are introduced.
- up to 10 amino acids may be inserted between El 60 and Al 61, between A161 and E162, between E162 and T163, or between T163 and 1164, the inserted sequence containing between one and five cysteine residues with the remaining residues being composed of a mixture of Ala, Ser, GIy, Asp, and He.
- the inserted sequence may be designed to avoid predicted human T cell epitopes in order to reduce the chance of recognition of the inserted sequence by the human immune system when the modified protein is administered to patients.
- a single cysteine residue is inserted between A161 and E162.
- the polypeptide further comprises R338A, V86A, or both.
- modified FIX polypeptides comprising at least one or more introduced polymer conjugation sites, including at least one cysteine residue, and one or more mutations that increase the activity of FIX.
- activating FIX mutations include the R338A and the V86A mutations.
- modified FIX polypeptides comprise the R338A mutation.
- modified FIX polypeptides comprise the V86A mutation.
- modified FIX polypeptides comprise both the R338A and the V86A mutation.
- a further aspect of the application provides FIX polypeptides with increased specific activity.
- FIX polypeptides comprise an R338A and a V86A mutation.
- the polypeptides have a specific activity of at least about 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1400, 1600, 1800, or 2000 units per mg of polypeptide.
- the specific activity may be determined by, for example, using the APTT assay.
- These polypeptides are useful as therapeutic agents, for example, in patients afflicted with hemophilia B.
- These polypeptides may comprise further mutations or modifications, such as the polymer conjugation sites, including at least one cysteine residue, described herein.
- Amino acid residues may be inserted or substituted in order to introduce a polymer conjugation site.
- cysteine residues may be introduced by altering the amino acid sequence of FIX.
- Amino acid sequence alteration may be accomplished by a variety of techniques.
- modification of the nucleic acid sequence encoding the amino acid sequence may be achieved by site-specific mutagenesis. Techniques for site-specific mutagenesis are well known in the art and are described in, for example, Zoller et al., (DNA 3:479-488, 1984) or Horton, et al., (Gene 77:61-68, 1989, pp. 61-68).
- the nucleic acid construct encoding the FIX polypeptide may also be prepared synthetically by established standard methods, for example, the phosphoamidite method described by Beaucage, et al., (Gene Amplif. Anal. 3:1-26, 1983). According to the phosphoamidite method, oligonucleotides are synthesized, for example, in an automatic DNA synthesizer, purified, annealed, ligated, and cloned in suitable vectors. The DNA sequences encoding the human FIX polypeptides may also be prepared by polymerase chain reaction using specific primers, for example, as described in US Patent No.
- nucleic acid construct may be of mixed synthetic and genomic, mixed synthetic and cDNA, or mixed genomic and cDNA origin prepared by ligating fragments of synthetic, genomic, or cDNA origin (as appropriate), corresponding to various parts of the entire nucleic acid construct, in accordance with standard techniques.
- the DNA sequences encoding the FIX polypeptides may be inserted into a recombinant vector using recombinant DNA procedures.
- the choice of vector will often depend on the host cell into which the vector is to be introduced.
- the vector may be an autonomously replicating vector or an integrating vector.
- An autonomously replicating vector exists as an extrachromosomal entity and its replication is independent of chromosomal replication, for example, a plasmid.
- An integrating vector is a vector that integrates into the host cell genome and replicates together with the chromosome(s) into which it has been integrated.
- the vector may be an expression vector in which the DNA sequence encoding the modified FIX is operably linked to additional segments required for transcription, translation, or processing of the DNA, such as promoters, terminators, and polyadenylation sites.
- the expression vector may be derived from plasmid or viral DNA, or may contain elements of both.
- the term "operably linked" indicates that the segments are arranged so that they function in concert for their intended purposes, for example, transcription initiates in a promoter and proceeds through the DNA sequence coding for the polypeptide.
- Expression vectors for use in expressing FIX polypeptides may comprise a promoter capable of directing the transcription of a cloned gene or cDNA.
- the promoter may be any DNA sequence that shows transcriptional activity in the host cell of choice and may be derived from genes encoding proteins either homologous or heterologous to the host cell.
- Suitable promoters for directing the transcription of the DNA encoding the FIX polypeptides in mammalian cells are, for example, the SV40 promoter (Subramani, et al., MoI. Cell Biol. 1 :854-864, 1981), the MT-I (metallothionein gene) promoter (Palmiter, et al., Science 222:809-814, 1983), the CMV promoter (Boshart, et al., Cell 41 :521-530, 1985), or the adenovirus 2 major late promoter (Kaufman et al.,, MoI. Cell Biol, 2:1304-1319, 1982).
- the DNA sequences encoding the FIX polypeptide may also, if necessary, be operably connected to a suitable terminator, such as the human growth hormone terminator (Palmiter, et al., Science 222:809-814, 1983) or TPIl (Alber et al., J. MoI. Appl. Gen. 1 :419-434, 1982) or ADH3 (McKnight, et al., EMBO J. 4:2093-2099, 1985) terminators.
- the expression vectors may also contain a polyadenylation signal located downstream of the insertion site.
- Polyadenylation signals include the early or late polyadenylation signal from SV40, the polyadenylation signal from the adenovirus 5 EIb region, the human growth hormone gene terminator (DeNoto, et al., Nucl. Acids Res. 9:3719-3730, 1981), or the polyadenylation signal from the human FIX gene.
- the expression vectors may also include enhancer sequences, such as the SV40 enhancer.
- the native FIX secretory signal sequence may be used.
- a secretory signal sequence also known as a leader sequence, prepro sequence, or pre sequence
- the secretory signal sequence may be joined to the DNA sequences encoding the FIX analogues in the correct reading frame.
- Secretory signal sequences are commonly positioned 5' to the DNA sequence encoding the peptide.
- Exemplary signal sequences include, for example, the MPIF-I signal sequence and the stanniocalcin signal sequence.
- Cloned DNA sequences may be introduced into cultured mammalian cells by, for example, lipofection, DEAE-dextran-mediated transfection, microinj ection, protoplast fusion, calcium phosphate precipitation, retroviral delivery, electroporation, sonoporation, laser irradiation, magnetofection, natural transformation, and biolistic transformation (see, e.g., Mehier- Humbert, et al., Adv. Drug Deliv. Rev. 57:733-753, 2005).
- a gene that confers a selectable phenotype is generally introduced into cells along with the gene or cDNA of interest.
- Selectable markers include, for example, genes that confer resistance to drugs such as neomycin, puromycin, hygromycin, and methotrexate.
- the selectable marker may be an amplifiable selectable marker, which permits the amplification of the marker and the exogenous DNA when the sequences are linked.
- Exemplary amplifiable selectable markers include dihydrofolate reductase (DHFR) and adenosine deaminase. It is within the purview of one skilled in the art to choose suitable selectable markers (see, e.g., US Patent No. 5,238,820).
- appropriate growth medium means a medium containing nutrients and other components required for the growth of cells and the expression of the active FIX polypeptides.
- Media generally include, for example, a carbon source, a nitrogen source, essential amino acids, essential sugars, vitamins, salts, phospholipids, protein, and growth factors, and in the case of vitamin K dependent proteins such as FIX, vitamin K may also be provided.
- Drug selection is then applied to select for the growth of cells that are expressing the selectable marker in a stable fashion. For cells that have been transfected with an amplifiable selectable marker the drug concentration may be increased to select for an increased copy number of the cloned sequences, thereby increasing expression levels. Clones of stably transfected cells are then screened for expression of the FIX polypeptide.
- Examples of mammalian cell lines for use in the present invention are the COS-I (ATCC CRL 1650), baby hamster kidney (BHK), HKBI l cells (Cho, et al., J. Biomed. Sci, 9:631-638, 2002), and HEK-293 (ATCC CRL 1573; Graham, et al., J. Gen. Virol. 36:59-72, 1977) cell lines.
- COS-I ATCC CRL 1650
- BHK baby hamster kidney
- HKBI l cells Cho, et al., J. Biomed. Sci, 9:631-638, 2002
- HEK-293 ATCC CRL 1573; Graham, et al., J. Gen. Virol. 36:59-72, 1977
- rat Hep I rat hepatoma; ATCC CRL 1600
- rat Hep II rat hepatoma; ATCC CRL 1548
- TCMK-I ATCC CCL 139
- Hep-G2 ATCC HB 8065
- NCTC 1469 ATCC CCL 9.1
- CHO-Kl ATCC CCL 61
- CHO-DUKX cells Urlaub and Chasin, Proc. Natl. Acad. Sci. USA 77:4216-4220, 1980).
- FIX polypeptides may be recovered from cell culture medium and may then be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing (IEF), differential solubility (e.g., ammonium sulfate precipitation)), extraction (see, e.g., Protein Purification, Janson and Lars Ryden, editors, VCH Publishers, New York, 1989), or various combinations thereof.
- the polypeptides may be purified by affinity chromatography on an anti-FIX antibody column.
- Additional purification may be achieved by conventional chemical purification means, such as high performance liquid chromatography.
- Other methods of purification are known in the art, and may be applied to the purification of the modified FIX polypeptides (see, e.g., Scopes, R., Protein Purification, Springer-Verlag, N.Y., 1982).
- purified shall refer to a protein or peptide composition that has been subjected to fractionation to remove various other components, and which substantially retains its expressed biological activity. Where the term “substantially purified” is used, this designation shall refer to a composition in which the protein or peptide forms the major component of the composition, such as constituting about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, or more of the proteins in the composition.
- Various methods for quantifying the degree of purification of the polypeptide are known to those of skill in the art. These include, for example, determining the specific activity of an active fraction, or assessing the amount of polypeptides within a fraction by SDS/PAGE analysis.
- An exemplary method for assessing the purity of a fraction is to calculate the specific activity of the fraction, compare the activity to the specific activity of the initial extract, and to thus calculate the degree of purity, herein assessed by a "-fold purification number.”
- the actual units used to represent the amount of activity will, of course, be dependent upon the particular assay technique.
- the modified FIX polypeptides may comprise one or more polymer conjugation sites that may be used for attaching a polymer moiety.
- FIX polypeptides may be conjugated to a biocompatible polymer.
- the biocompatible polymer may be selected to provide the desired improvement in pharmacokinetics.
- the identity, size, and structure of the polymer may be selected so as to improve the circulation half-life of the polypeptide having FIX activity or decrease the antigenicity of the polypeptide without an unacceptable decrease in activity.
- polymers useful in the invention include, but are not limited to, poly(alkylene glycols) such as polyethylene glycol (PEG), poly(propylene glycol) (“PPG"), copolymers of ethylene glycol and propylene glycol and the like, poly(oxyethylated polyol), poly(olefmic alcohol), poly(vinylpyrrolidone), poly(hydroxyalkylmethacrylamide), poly(hydroxyalkylmethacrylate), poly(saccharides), poly(alpha-hydroxy acid), poly( vinyl alcohol), polyphosphazene, polyoxazoline, poly(N-acryloylmorpholine), polysialic acid, hydroxyethyl starch (HES), polyethylene oxide, alkyl-polyethylene oxides, bispolyethylene oxides, co-polymers or block co-polymers of polyalkyene oxides, poly(ethylene glycol-co-propylene glycol), poly(N-2- (hydroxyproply)me
- the polymer is not limited to a particular structure and may be linear (e.g., alkoxy PEG or bifunctional PEG), or non-linear such as branched, forked, multi-armed (e.g., PEGs attached to a polyol core), and dendritic.
- the internal structure of the polymer may be organized in any number of different patterns and may be selected from the group consisting of homopolymer, alternating copolymer, random copolymer, block copolymer, alternating tripolymer, random tripolymer, and block tripolymer.
- PEG and other water-soluble polymers may be activated with a suitable activating group appropriate for coupling to a desired site on the FIX polypeptide.
- a polymeric reagent will possess a reactive group for reaction with the FIX polypeptide.
- Representative polymeric reagents and methods for conjugating these polymers to an active moiety are known in the art and further described in Zalipsky, et al., ("Use of Functionalized Poly(Ethylene Glycols) for Modification of Polypeptides" in Polyethylene Glycol Chemistry: Biotechnical and Biomedical Applications, J. M. Harris, Plenus Press, New York (1992)), and Zalipsky (Adv. Drug Rev. 16:157-182, 1995)
- the weight-average molecular weight of the polymer may be from about 100 Daltons to about 150,000 Daltons. Exemplary ranges, however, include weight-average molecular weights in the range of greater than about 5,000 Daltons to about 100,000 Daltons, in the range of from about 6,000 Daltons to about 90,000 Daltons, in the range of from about 10,000 Daltons to about 85,000 Daltons, in the range of greater than about 10,000 Daltons to about 85,000 Daltons, in the range of from about 20,000 Daltons to about 85,000 Daltons, in the range of from about 53,000 Daltons to about 85,000 Daltons, in the range of from about 25,000 Daltons to about 120,000 Daltons, in the range of from about 29,000 Daltons to about 120,000 Daltons, in the range of from about 35,000 Daltons to about 120,000 Daltons, and in the range of from about 40,000 Daltons to about 120,000 Daltons.
- Exemplary weight-average molecular weights for the biocompatible polymer include about 100 Daltons, about 200 Daltons, about 300 Daltons, about 400 Daltons, about 500 Daltons, about 600 Daltons, about 700 Daltons, about 750 Daltons, about 800 Daltons, about 900 Daltons, about 1,000 Daltons, about 1,500 Daltons, about 2,000 Daltons, about 2,200 Daltons, about 2,500 Daltons, about 3,000 Daltons, about 4,000 Daltons, about 4,400 Daltons, about 4,500 Daltons, about 5,000 Daltons, about 5,500 Daltons, about 6,000 Daltons, about 7,000 Daltons, about 7,500 Daltons, about 8,000 Daltons, about 9,000 Daltons, about 10,000 Daltons, about 11,000 Daltons, about 12,000 Daltons, about 13,000 Daltons, about 14,000 Daltons, about 15,000 Daltons, about 20,000 Daltons, about 22,500 Daltons, about 25,000 Daltons, about 30,000 Daltons, about 35,000 Daltons, about 40,000 Daltons, about 45,000 Daltons, about 50,000 Daltons, about 55,000 Daltons, about
- the polymer is PEG.
- PEG is a well-known, water soluble polymer that is commercially available or can be prepared by ring-opening polymerization of ethylene glycol according to methods well known in the art (Sandler and Karo, Polymer Synthesis, Academic Press, New York, Vol. 3, pages 138-161).
- the term "PEG” is used broadly to encompass any polyethylene glycol molecule, without regard to size or to modification at an end of the PEG, and may be represented by the formula: X-O(CH 2 CH 2 O) n . 1 CH 2 CH 2 OH, where n is 20 to 2300 and X is H or a terminal modification, for example, a C 1 . 4 alkyl.
- PEG may contain further chemical groups which are necessary for binding reactions, which result from the chemical synthesis of the molecule, or which act as a spacer for optimal distance of parts of the molecule.
- a PEG may consist of one or more PEG side-chains which are linked together.
- PEGs with more than one PEG chain are called multiarmed or branched PEGs.
- Branched PEGs may be prepared, for example, by the addition of polyethylene oxide to various polyols including glycerol, pentaerythriol, and sorbitol.
- a four-armed branched PEG may be prepared from pentaerythriol and ethylene oxide. Examples of branched PEG are described in, for example, European Published Application No.
- PEG PEG side-chains linked via the primary amino groups of a lysine (Monfardini, et al., Bioconjugate Chem. 6:62-69, 1995).
- the polymer may be an end-capped polymer, that is, a polymer having at least one terminus capped with a relatively inert group, such as a lower Ci -6 alkoxy group, although a hydroxyl group may also be used.
- a relatively inert group such as a lower Ci -6 alkoxy group
- mPEG methoxy- PEG
- mPEG methoxy- PEG
- one terminus of the polymer has a methoxy (— OCH3) group, while the other terminus is a hydroxyl or other functional group that may be optionally chemically modified may be used.
- Multi-armed or branched PEG molecules such as those described in US Patent No. 5,932,462, may also be used as the PEG polymer.
- the PEG may comprise a forked PEG (see, e.g., PCT Publication No. WO 1999/45964, discloses various forked PEG structures capable of use in one or more embodiments of the present invention).
- the chain of atoms linking the Z functional groups to the branching carbon atom serve as a tethering group and may comprise, for example, alkyl chains, ether chains, ester chains, amide chains, and combinations thereof.
- the PEG polymer may also comprise a pendant PEG molecule having reactive groups, such as carboxyl, covalently attached along the length of the PEG rather than at the end of the PEG chain.
- the pendant reactive groups may be attached to the PEG directly or through a spacer moiety, such as an alkylene group.
- the hydroxyl end groups of the polymer molecule must be provided in activated form, that is, with reactive functional groups (examples of which include primary amino groups, hydrazide (HZ), thiol, succinate (SUC), succinimidyl succinate (SS), succinimidyl succinamide (SSA), succinimidyl propionate (SPA), succinimidyl butanoate (SBA), succinimidyl carboxymethylate (SCM), benzotriazole carbonate (BTC), N-hydroxysuccinimide (NHS), aldehyde, nitrophenylcarbonate (NPC), and tresylate (TRES)).
- reactive functional groups include primary amino groups, hydrazide (HZ), thiol, succinate (SUC), succinimidyl succinate (SS), succinimidyl succinamide (SSA), succinimidyl propionate (SPA), succinimidyl butanoate (SBA), succinimidyl carboxymethylate (S
- activated polymer molecules are commercially available, for example, NOF, Japan; Nektar Therapeutics, Inc., Huntsville, Ala.; PoIyMASC Pharmaceuticals pic, UK; or SunBio Corporation, Anyang City, South Korea.
- the polymer molecules may be activated by conventional methods known in the art (see, e.g., WO 90/13540).
- Specific examples of activated linear or branched polymer molecules suitable for use in the present invention are commercially available, for example, NOF, Japan; Nektar Therapeutics, Inc., Huntsville, Ala.
- activated PEG polymers include the following linear PEGs: NHS-PEG, SPA-PEG, SSPA-PEG, SBA-PEG, SS-PEG, SSA-PEG, SC-PEG, SG-PEG, SCM- PEG, NOR-PEG, BTC-PEG, EPOX-PEG, NCO-PEG, NPC-PEG, CDI-PEG, ALD-PEG, TRES- PEG, VS-PEG, OPSS-PEG, IODO-PEG, and MAL-PEG, and branched PEGs, such as PEG2- NHS, PEG2-MAL, and those disclosed in, for example, US Patent No. 5,932,462 and US Patent No. 5,643,575, both of which are incorporated herein by reference.
- the polymer has a sulfhydryl reactive moiety that may react with a free cysteine on a FIX polypeptide to form a covalent linkage.
- sulfhydryl reactive moieties include thiol, triflate, tresylate, aziridine, oxirane, S-pyridyl, or maleimide moieties.
- the polypeptide may be treated with a reducing agent, such as dithiothreitol (DDT) prior to PEGylation.
- DDT dithiothreitol
- the reducing agent may be subsequently removed by any conventional method, such as by desalting. Conjugation of PEG to a cysteine residue typically takes place in a suitable buffer at pH 6-9 at temperatures varying from 4°C to 25°C for periods up to about 16 hours.
- activated PEG polymers for coupling to cysteine residues include, for example, the following linear and branched PEGs: vinylsulfone-PEG (PEG-VS), such as vinylsulfone-mPEG (mPEG-VS); orthopyridyl-disulfide-PEG (PEG-OPSS), such as orthopyridyl-disulfide-mPEG (MPEG-OPSS); and maleimide-PEG (PEG-MAL), such as maleimide-mPEG (mPEG-MAL) and branched maleimide-mPEG2 (mPEG2-MAL).
- PEG-VS vinylsulfone-PEG
- PEG-OPSS orthopyridyl-disulfide-PEG
- MPEG-OPSS orthopyridyl-disulfide-mPEG
- PEG-MAL maleimide-PEG
- mPEG-MAL maleimide-mPEG
- FIX polypeptides having one or more introduced polymer conjugation sites may be expressed in cells grown in cell culture medium containing cysteines that "cap" the cysteine residues of the polypeptide by forming disulfide bonds.
- cysteine cap may be removed by mild reduction that releases the cap, and then a cysteine-specific polymer reagent is added.
- the application also provides a method for the preparation of a polymer conjugated FIX polypeptide comprising introducing a polymer conjugation site, that is, a cysteine residue into a nucleotide sequence that encodes a FIX polypeptide; expressing the mutated nucleotide sequence to produce a polypeptide comprising an introduced polymer conjugation site; purifying the polypeptide; reacting the polypeptide with a biocompatible polymer that has been activated to react with polypeptides at reduced cysteine residues such that a conjugate is formed; and purifying the conjugate.
- the application provides a method for site-directed PEGylation of a FIX polypeptide mutein comprising: (a) expressing a FIX polypeptide comprising an introduced polymer conjugation site, that is, a cysteine residue introduced on the exposed surface of the FIX polypeptide, wherein the cysteine is capped; (b) contacting the FIX polypeptide with a reductant under conditions to mildly reduce the introduced cysteine and release the cap; (c) removing the cap and the reductant from the FIX polypeptide; and (d) at least about 5, 15, or 30 minutes after the removal of the reductant, treating the FIX polypeptide with PEG comprising a sulfhydryl coupling moiety under conditions such that PEGylated FIX polypeptide is produced.
- the sulfhydryl coupling moiety of the PEG is selected from the group consisting of thiol, triflate, tresylate, aziridine, oxirane, S-pyridyl, and maleimide moieties.
- a purified FIX polypeptide comprising an introduced non-native cysteine residue is mildly reduced with reductants such as 0.7 mM Tris(2-carboxyethyl)phosphine (TCEP) or 0.07 mM dithiothreitol (DTT) for 30 minutes at 4°C to release the "cap.”
- reductants such as 0.7 mM Tris(2-carboxyethyl)phosphine (TCEP) or 0.07 mM dithiothreitol (DTT) for 30 minutes at 4°C to release the "cap.”
- the reductant is removed along with the "cap” by a size-exclusion chromatography (SEC) method such as running the sample through a spin column to allow disulfides to reform while leaving the introduced cysteine free and reduced.
- SEC size-exclusion chromatography
- the FIX polypeptide is treated with at least 10-fold molar excess of PEG-maleimide with sizes ranging from 5 to 85
- Polymer conjugation of FIX may be assessed by any of the methods known to one of skill in the art.
- polymer conjugated FIX may be analyzed by electrophoresis on a reducing 6% Tris-Glycine SDS polyacrylamide gel. Following electrophoresis, the gel may be stained with Coomassie Blue to identify all the proteins or subjected to a standard western blot protocol, in order to identify shifts in band molecular weight as compared to unconjugated FIX polypeptides. Barium-iodine staining which is specific for PEG, may be used to confirm that bands with a shift in molecular weight comprise a PEGylated protein.
- FIX polypeptides, before and after polymer conjugation may also be analyzed by matrix-assisted laser desorption/ionization (MALDI) mass spectrometry, in order to determine the extent and efficiency of polymer conjugation.
- MALDI matrix-assisted laser desorption/ionization
- compositions comprising FIX polypeptides with one or more introduced polymer conjugation sites as described herein.
- compositions are provided comprising FIX polypeptides conjugated to a biocompatible polymer.
- the compositions are suitable for in vivo administration and are pyrogen free.
- the compositions may also comprise a pharmaceutically acceptable carrier.
- pharmaceutically or pharmacologically acceptable refers to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human.
- pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients also can be incorporated into the compositions.
- compositions of the present invention include classic pharmaceutical preparations. Administration of these compositions according to the present invention may be via any common route so long as the target tissue is available via that route.
- the pharmaceutical compositions may be introduced into the subject by any conventional method, for example, by intravenous, intradermal, intramuscular, intramammary, intraperitoneal, intrathecal, retrobulbar, subcutaneous, intrapulmonary, oral, sublingual, nasal, anal, vaginal, or transdermal delivery, or by surgical implantation at a particular site.
- the treatment may consist of a single dose or a plurality of doses over a period of time.
- the active compounds may be prepared for administration as solutions of free base or pharmacologically acceptable salts in water, suitably mixed with a surfactant, such as hydroxypropylcellulose.
- Dispersions also may be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms.
- the pharmaceutical forms suitable for injectable use, include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
- the form should be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
- the carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like) sucrose, L-histidine, polysorbate 80, or suitable mixtures thereof, and vegetable oils.
- the proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants.
- the prevention of the action of microorganisms may be brought about by various antibacterial an antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
- the injectable compositions may include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions may be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
- Sterile injectable solutions may be prepared by incorporating the active compounds (e.g., FIX polypeptides) in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization.
- active compounds e.g., FIX polypeptides
- dispersions may be prepared by incorporating the various sterilized active ingredients into a sterile vehicle that contains the basic dispersion medium and the required other ingredients from those enumerated above.
- sterile powders for the preparation of sterile injectable solutions methods of preparation include, for example, vacuum-drying and freeze-drying techniques that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
- solutions may be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
- “Therapeutically effective amount” is used herein to refer to the amount of a polypeptide that is needed to provide a desired level of the polypeptide in the bloodstream or in the target tissue. The precise amount will depend upon numerous factors, for example, the particular FIX polypeptide, the components and physical characteristics of the therapeutic composition, intended patient population, mode of delivery, individual patient considerations, and the like, and can readily be determined by one skilled in the art, based upon the information provided herein.
- the formulations may be easily administered in a variety of dosage forms, such as injectable solutions, and the like.
- parenteral administration in an aqueous solution for example, the solution should be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose.
- aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration.
- FIX Dosages of FIX are normally expressed in units. One unit of FIX per kg of body weight may raise plasma levels by 0.01 U/ml, that is, 1%. Otherwise healthy patients have one unit of FIX per ml of plasma, that is, 100%. Mild cases of hemophilia B are defined by FIX plasma concentrations between 6-60%, moderate cases between 1-5%, and severe cases, which account for about half of the hemophilia B cases, have less than 1% FIX. Prophylactic treatment or treatment of minor hemorrhaging usually requires raising FIX levels to between 15-30%. Treatment of moderate hemorrhaging usually requires raising levels to between 30-50%, while treatment of major trauma may require raising levels from 50 to 100%.
- the total number of units needed to raise a patient's blood level can be determined as follows: 1.0 unit/kg x body weight (kg) x desired percentage increase (% of normal). Parenteral administration may be carried out with an initial bolus followed by continuous infusion to maintain therapeutic circulating levels of drug product. In some embodiments, between 15 to 150 units/kg of FIX polypeptide may be administered. Those of ordinary skill in the art will readily optimize effective dosages and administration regimens as determined by good medical practice and the clinical condition of the individual patient.
- the frequency of dosing will depend on the pharmacokinetic parameters of the agents and the routes of administration.
- the optimal pharmaceutical formulation may be determined by one of skill in the art depending on the route of administration and the desired dosage (see, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 20 th edition, 2000, incorporated herein by reference). Such formulations may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the administered agents.
- a suitable dose may be calculated according to body weight, body surface area, or organ size.
- exemplary dosing schedules include, without limitation, administration five times a day, four times a day, three times a day, twice daily, once daily, three times weekly, twice weekly, once weekly, twice monthly, once monthly, and any combination thereof.
- Appropriate dosages may be ascertained through the use of established assays for determining blood clotting levels in conjunction with relevant dose response data.
- the final dosage regimen may be determined by the attending physician, considering factors that modify the action of drugs, for example, the drug's specific activity, severity of the damage, and the responsiveness of the patient, the age, condition, body weight, sex and diet of the patient, the severity of any infection, time of administration, and other clinical factors.
- the composition may also include an antimicrobial agent for preventing or deterring microbial growth.
- antimicrobial agents suitable for the present invention include benzalkonium chloride, benzethonium chloride, benzyl alcohol, cetylpyridinium chloride, chlorobutanol, phenol, phenylethyl alcohol, phenylmercuric nitrate, thimersol, and combinations thereof.
- An antioxidant may be present in the composition as well. Antioxidants may be used to prevent oxidation, thereby preventing the deterioration of the preparation. Suitable antioxidants for use in the present invention include, for example, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, hypophosphorous acid, monothioglycerol, propyl gallate, sodium bisulfite, sodium formaldehyde sulfoxylate, sodium metabisulfite, and combinations thereof.
- a surfactant may be present as an excipient.
- exemplary surfactants include: polysorbates such as Tween®-20 (polyoxyethylenesorbitan monolaurate) and Tween®-80 (polyoxyethylenesorbitan monooleate) and pluronics such as F68 and F88 (both of which are available from BASF, Mount Olive, NJ.); sorbitan esters; lipids such as phospholipids such as lecithin and other phosphatidylcholines, phosphatidyl ethanolamines, fatty acids and fatty esters; steroids such as cholesterol; and chelating agents such as EDTA, zinc and other such suitable cations.
- Acids or bases may be present as an excipient in the composition.
- acids that may be used include hydrochloric acid, acetic acid, phosphoric acid, citric acid, malic acid, lactic acid, formic acid, trichloroacetic acid, nitric acid, perchloric acid, phosphoric acid, sulfuric acid, fumaric acid, and combinations thereof.
- suitable bases include, without limitation, sodium hydroxide, sodium acetate, ammonium hydroxide, potassium hydroxide, ammonium acetate, potassium acetate, sodium phosphate, potassium phosphate, sodium citrate, sodium formate, sodium sulfate, potassium sulfate, potassium fumerate, and combinations thereof.
- the amount of any individual excipient in the composition may vary depending on the activity of the excipient and particular needs of the composition.
- the optimal amount of any individual excipient may be determined through routine experimentation, that is, by preparing compositions containing varying amounts of the excipient (ranging from low to high), examining the stability and other parameters, and then determining the range at which optimal performance is attained with no significant adverse effects.
- the excipient may be present in the composition in an amount of about 1% to about 99% by weight, from about 5% to about 98% by weight, from about 15 to about 95% by weight of the excipient, with concentrations less than 30% by weight.
- compositions described herein may be used to treat any bleeding disorder associated with functional defects of FIX or deficiencies of FIX such as a shortened in vivo half-life of FIX, altered binding properties of FIX, genetic defects of FIX, and a reduced plasma concentration of FIX.
- Genetic defects of FIX comprise, for example, deletions, additions, and/or substitution of bases in the nucleotide sequence encoding FIX.
- the bleeding disorder may be hemophilia B.
- Symptoms of such bleeding disorders include, for example, severe epistaxis, oral mucosal bleeding, hemarthrosis, hematoma, persistent hematuria, gastrointestinal bleeding, retroperitoneal bleeding, tongue/retropharyngeal bleeding, intracranial bleeding, and trauma- associated bleeding.
- modified FIX polypeptides may be administered to a subject susceptible to or otherwise at risk of a disease state or injury to enhance the subject's own coagulative capability. Such an amount may be defined to be a "prophylactically effective dose.”
- Administration of the modified FIX polypeptides for prophylaxis includes situations where a patient suffering from hemophilia B is about to undergo surgery and the polypeptide is administered between one to four hours prior to surgery.
- the polypeptides are suited for use as a prophylactic against uncontrolled bleeding, optionally in patients not suffering from hemophilia.
- the polypeptide may be administered to a patient at risk for uncontrolled bleeding prior to surgery.
- polypeptides, materials, compositions, and methods described herein are intended to be representative examples of the invention, and it will be understood that the scope of the invention is not limited by the scope of the examples. Those skilled in the art will recognize that the invention may be practiced with variations on the disclosed polypeptides, materials, compositions and methods, and such variations are regarded as within the ambit of the invention.
- FoIdX A computer algorithm, FoIdX, was used to predict the effect of the mutation of each residue to cysteine upon the free energy of both the individual residue and the FIX protein structure overall.
- FoIdX is an empirical force field that was developed based on structure-activity data of protein engineering experiments (Guerois, et al., J. MoI. Biol. 320:369- 387, 2002; Schymkowitz, et al., Nucleic Acids Res. 33:W382-388, 2005; Schymkowitz, et al., Proc. Natl. Acad. Sci. USA 102:10147-10152, 2005).
- FIXa with a single mutation of Lys, Phe, or Leu to Cys had a stability energy range from 23.3 to 27.1 kcal/mole, with an average of 24.9 kcal/mole.
- the energy range contributed by the mutated residue to the stability of the protein is from -0.76 to 1.63 kcal/mole, with an average of 0.56 kcal/mole, compared to that of the wild- type structure having an energy range of -2.82 to -0.39 kcal/mole, with an average of -0.30 kcal/mole.
- Residues that resulted either in a decrease in the free energy or little change in free energy after mutation to cysteine were considered as more favorable.
- T4 and T5 Two complexes were considered the best models based on agreement with all the major contacts suggested by experimental data.
- the T5 model is the complex used in this analysis.
- the residues of FIX that are predicted to be farther than 8 A from the interface with FVIIIa based on this model were considered to be favorable.
- Naturally occurring substitution mutations in FIX but not mutations that result in stop codons or frame shifts
- hemophilia B in patients suggest that these specific residues are important for the function of FIX.
- the hemophilia B mutation data base (available at kcl.ac.uk/ip/petergreen/ haemBdatabase.html) was used to identify such mutations and exclude such residues as candidates for mutation to cysteine as indicated in Table 1.
- the energy range contributed by the mutated residue is from -0.76 to 1.67 kcal/mole, with an average of 0.55 kcal/mole, compared with the wild-type structure that has an energy range of -2.90 to 1.08 kcal/mole, with an average of 0.55 kcal/mole.
- the energies contributed by the residues for the FIX in the docked complex are mostly similar to those of the unbound FIX.
- the stability energy range is from 169.7 to 174.4 kcal/mole, with an average of 170.8 kcal/mole.
- the energy range contributed by the mutated residue is from -0.57 to 1.61 kcal/mole, with an average of 0.99 kcal/mole, which is similar to that of the wild-type structure having an energy range of -0.63 to 1.48 kcal/mole, with an average of 0.82 kcal/mole.
- the wild type pAGE16- FIX plasmid and the various mutated plasmids were transiently transfected into HKBl 1 cells, a human cell line generated by the fusion of HEK293 cells and a B cell lymphoma.
- HKBl 1 cells a human cell line generated by the fusion of HEK293 cells and a B cell lymphoma.
- various cell lines CHO, BHK21, HKBl 1
- HKBl 1 produced detectable FIX protein in the media by Western blot.
- Western blot analysis of the media from the transfected HKBl 1 cells using a polyclonal antibody against FIX demonstrated that all 14 substitution muteins were expressed at measurable levels and secreted into the media ( Figure 1).
- HKBl 1 cells were transfected with the modified FIX polypeptides and the supernatant was collected for determining protein levels and specific activity.
- Polypeptides comprising the 162C and R338A mutations were expressed at 38% and demonstrated a specific activity of 83% relative to polypeptides comprising only the R338A mutation.
- the data represents the mean of two independent transfections.
- the expression level of the R338A protein varied from 1.1 to 3.9 ug/mL between experiments and the activity of R338A varied between 0.5 and 0.33 IU/mL.
- a pair of PCR primers complementary to sequences at the 5' and 3' ends of the coding region of the human FIX cDNA were designed from the published cDNA sequence (NM_000133).
- the 5' primer (FIXFl ; ATCATAAGCTTGCCACCATGCAGCGCGTGAACATG; (SEQ ID NO: 2), start codon of FIX is in bold text) contained the first 18 nucleotides of the FIX coding region including the ATG start codon preceded by a consensus Kozak sequence (underlined) and a HindIII restriction site.
- the 3' primer (FIXR3, ATCATAAGCTTGATTAGTTAGTGAGA GGCCCTG (SEQ ID NO: 3)) contained 22 nucleotides of FIX sequence that lies 45 nucleotides 3' of the end of the FIX coding region preceded by a HindIII site.
- Amplification of first strand cDNA from normal human liver (Stratagene, San Diego, CA) using these primers and high fidelity proofreading polymerase (Invitrogen, Carlsbad, CA) resulted in a single band of the expected size for human FIX cDNA (1464 bp).
- the sequence of the resulting plasmid was determined by double strand DNA sequencing to have an insertion of 3 bp encoding one cysteine residue. Longer sequences of up to 12 amino acids containing between one and five cysteines are inserted between E160 and A161 or anywhere between E160 and 1164 by designing appropriate primers. In addition to cysteine, the inserted residues may be composed of combinations of Ala, GIy, Ser, Asp, and He residues and designed to avoid high affinity T cell epitopes as predicted by in silico analysis.
- sequence inserted (codes for Cys) is underlined in the sense (F) strand primer.
- Plasmids carrying each of the cysteine mutants of FIX in the vector pAGE16 were used as the template for site directed mutagenesis using primers designed to alter the sequence encoding arginine at amino acid position 338 of the mature FIX protein to the sequence encoding alanine.
- the sequence of the primers was as follows: forward primer; 5' GTTGACCGAGCCACATG CCTTGCATCTACAAAGTTCACCATC 3' (SEQ ID NO: 20), reverse primer; 5' GATGG TGAACTTTGTAGATGCAAGGCATGTGGCTCGGTCAAC 3' (SEQ ID NO: 21).
- HKBl 1 cells (a hybrid of HEK293 and a Burkitt B cell lymphoma line, 2B8) were grown in suspension culture on an orbital shaker (100-125 rpm) in a CO 2 (5%) incubator at 37 0 C in serum free media (RF#277) supplemented with 10 ng/mL soluble vitamin K 3 (Sigma- Aldrich, St. Louis, MO) and maintained at a density between 0.25 and 1.5 x 10 6 cells/mL.
- 293fectinTM reagent (Invitrogen) was mixed gently with 0.2 mL Opti-MEM® I medium and incubated at room temperature for 5 minutes.
- the diluted 293fectinTM was added to the diluted DNA solution, mixed gently, incubated at room temperature for 20-30 minutes and then added to each well that had been seeded with 5 x 10 6 (4.6 mL) HKBl 1 cells.
- the cells were then incubated on an orbital rotator (125 rpm) in a CO 2 incubator at 37°C for 3 days after which the cells were pelleted by centrifugation at 1000 rpm for 5 minutes, and the supernatant was collected and stored at 4 0 C.
- Mammalian expression vectors encoding FIX-R338A/L414C (human FIX in which arginine at 338 is substituted for alanine and leucine at position 414 is substituted for cysteine) or FIX-R338A/162C (human FIX in which arginine at 338 is substituted for alanine and a cysteine residue is inserted between amino acids 161 and 162 of the sequence shown in SEQ ID NO: 1) were transfected into HKBl 1 cells, and stable clones were obtained by selection with hygromycin.
- FIX protein was purified from the conditioned media of these cells by ion exchange chromatography.
- PEGylation reactions were performed on R338A-L414C, R338A-162C, and in parallel on R338A as a control for non-specific PEGylation.
- a 2 M CaCl 2 stock solution was added to each FIX protein to reach a final concentration of 10 mM CaCl 2 .
- reaction mixtures were incubated at room temperature for 3 hours before being passed through a Spin-6 ion exchange column(Bio-Rad, Hercules, CA) (pre- equilibrated with 10x reaction buffer) to remove the GSSG/GSH. The mixtures were then kept at 4°C overnight followed by addition of 25 mg PEG-maleimide in 100 ⁇ L Ix reaction buffer. The reaction mixtures were incubated at 4°C overnight and then stored at -80 0 C for further purification and analysis.
- the PEGylated FIX was purified from the reaction mixture using one of two methods.
- method I the L414C-PEG reaction mixture was dialyzed against Buffer A (50 mM Tris-HCl, pH 7.5, 100 mM NaCl) overnight at 4°C using a dialysis cassette (Pierce, Rockford, IL) with MW cutoff of 5 kD.
- Buffer A 50 mM Tris-HCl, pH 7.5, 100 mM NaCl
- the protein was purified on an 1 mL HiTrapQTM HP column (GE Healthcare, Piscataway, NJ) using sample loading and washing with Buffer A, and eluting with Buffer B (50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 20 mM CaCl 2 ) at a rate of 0.5 mL/min.
- Buffer B 50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 20 mM CaCl 2
- Gel analysis showed non-reacted PEG-maleimide was washed off the column while PEGylated and non- PEGylated R338A-L414C were in the eluate.
- the R338A-162C-PEG reaction mixture was diluted 4-fold with Buffer C (25 mM Tris-HCl, pH 7.5, 50 mM NaCl) before loading onto a 1 mL HiTrapQTM Heparin HP column (GE Healthcare, Piscataway, NJ) (loading rate 0.2 mL/min).
- Buffer C 25 mM Tris-HCl, pH 7.5, 50 mM NaCl
- the column was washed with Buffer C and the PEGylated and non-PEGylated R338A-L414C were eluted with Buffer D (50 mM Tris-HCl, pH 7.5, 60 OmM NaCl, 2OmM CaCl 2 ) using a sharp gradient (to 100% D in 1 minute, with washing and eluting rate 0.5 mL/min).
- Buffer D 50 mM Tris-HCl, pH 7.5, 60 OmM NaCl, 2OmM CaCl 2
- Fractions flow-through, wash, peak-1, and peak-2 were collected, concentrated on Centricon®- 10 kD (Millipore, Billerica, MA) and analyzed on gels. It was found that free PEG did not bind to the heparin column and that PEGylated and non-PEGylated R338A-L414C could be separated on the column given appropriate calcium gradient conditions.
- FIX-R338A-162C were assayed for their activities in the aPTT assay.
- the specific activity was calculated by determining the ratio of aPTT units to protein mass as determined by ELISA using an anti-FIX polyclonal antibody.
- the specific activity for FIX-R338A-162C was 440 ⁇ 60 IU/mg.
- the specific activity based on the ELISA was 400 IU/mg, but the ELISA value did not correlate well with the peak size on the column suggesting that the antibody used in the ELISA does not bind well to the PEGylated protein and therefore, underestimated the protein mass.
- the specific activity of FIX-R338A-162C-PEG was estimated at 120 IU/mg, suggesting that PEGylation of R338A-162C reduced the specific activity of the molecule by about 70%.
- the specific activity of PEGylated R338A-162C is still about 60% of the specific activity of plasma-derived FIX (specific activity about 200IU/mg) due to the presence of the R338A mutation that increases the catalytic activity of the molecule.
- the increased specific activity of the R338A FIX mutein helps to overcome the deleterious effects of PEGylation upon the catalytic activity.
- FIX antigen levels in cell culture supernatants were determined using a FIX ELISA kit (Hyphen Biomed/Aniara, Mason, OH). Cell culture supernatant was diluted in sample diluent buffer (supplied in the kit) to achieve a signal within the range of the standard curve.
- FIX protein purified from human plasma Hyphen Biomed/Aniara, Catalog No. RK032A, specific activity 196 U/mg
- sample diluent was used as to create a standard curve from 100 ng/mL to 0.2 ng/mL. Diluted samples and the standards were added to the ELISA plate that is pre-coated with a polyclonal anti-FIX capture antibody.
- FIX coagulation activity was determined using an aPTT assay in FIX deficient human plasma run on a ElectraTM 1800C automatic coagulation analyzer (Beckman Coulter, Fullerton, CA). Briefly, three dilutions of supernatant samples in coagulation diluent were created by the instrument, and 100 ⁇ L was then mixed with 100 ⁇ L FIX deficient plasma (Aniara, Mason, OH) and 100 ⁇ L automated aPTT reagent (rabbit brain phospholipid and micronized silica (bioMerieux, Inc., Durham, NC). After the addition of 100 ⁇ L 25 mM CaCl 2 solution, the time to clot formation was recorded.
- a standard curve was generated for each run using serial dilutions of the same purified human FIX (Hyphen Biomed/ Aniara) used as the standard in the ELISA assay.
- the standard curve was routinely a straight line with a correlation coefficient of 0.95 or better and was used to determine the FIX activity of the unknown samples.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- General Engineering & Computer Science (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Biomedical Technology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biochemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Diabetes (AREA)
- Epidemiology (AREA)
- Hematology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicinal Preparation (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US12456808P | 2008-04-16 | 2008-04-16 | |
| PCT/US2009/040691 WO2009140015A2 (en) | 2008-04-16 | 2009-04-15 | Site-directed modification of factor ix |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP2282767A2 true EP2282767A2 (en) | 2011-02-16 |
| EP2282767A4 EP2282767A4 (en) | 2012-07-11 |
Family
ID=41319239
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP09747101A Withdrawn EP2282767A4 (en) | 2008-04-16 | 2009-04-15 | Site-directed modification of factor ix |
Country Status (6)
| Country | Link |
|---|---|
| EP (1) | EP2282767A4 (en) |
| JP (1) | JP2011517950A (en) |
| KR (1) | KR20110015551A (en) |
| CN (1) | CN102065887A (en) |
| CA (1) | CA2721362A1 (en) |
| WO (1) | WO2009140015A2 (en) |
Families Citing this family (40)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| TR201813067T4 (en) | 2008-09-15 | 2018-09-21 | Uniqure Biopharma B V | The factor IX polypeptide mutant, its uses and a method for producing it. |
| PL3552619T3 (en) | 2010-07-09 | 2025-12-01 | Bioverativ Therapeutics Inc. | Factor ix polypeptides and methods of use thereof |
| TWI557135B (en) | 2010-11-03 | 2016-11-11 | 介控生化科技公司 | Modified ninth factor multi-peptide and use thereof |
| US9486507B2 (en) | 2011-06-10 | 2016-11-08 | Biogen Ma Inc. | Pro-coagulant compounds and methods of use thereof |
| WO2013016454A1 (en) | 2011-07-25 | 2013-01-31 | Biogen Idec Hemophilia Inc. | Assays to monitor bleeding disorders |
| MY190257A (en) | 2012-04-16 | 2022-04-11 | Cantab Biopharmaceuticals Patents Ltd | Optimised subcutaneous therapeutic agents |
| JP5967631B2 (en) * | 2012-04-27 | 2016-08-10 | 学校法人日本大学 | Treatment for epithelial and endothelial damage |
| US10001495B2 (en) | 2012-07-25 | 2018-06-19 | Bioverativ Therapeutics Inc. | Blood factor monitoring assay and uses thereof |
| HK1213521A1 (en) | 2012-09-25 | 2016-07-08 | Bioverativ Therapeutics Inc. | Methods of using fix polypeptides |
| HK1213767A1 (en) | 2012-10-18 | 2016-07-15 | Bioverativ Therapeutics Inc. | Methods of using a fixed dose of a clotting factor |
| US10717965B2 (en) | 2013-01-10 | 2020-07-21 | Gloriana Therapeutics, Inc. | Mammalian cell culture-produced neublastin antibodies |
| WO2014127215A1 (en) | 2013-02-15 | 2014-08-21 | Biogen Idec Ma Inc. | Optimized factor viii gene |
| WO2014144549A1 (en) | 2013-03-15 | 2014-09-18 | Biogen Idec Ma Inc. | Factor ix polypeptide formulations |
| HUE057005T2 (en) | 2013-09-25 | 2022-04-28 | Bioverativ Therapeutics Inc | Column virus inactivation procedures |
| EP3065769A4 (en) | 2013-11-08 | 2017-05-31 | Biogen MA Inc. | Procoagulant fusion compound |
| US10325687B2 (en) | 2013-12-06 | 2019-06-18 | Bioverativ Therapeutics Inc. | Population pharmacokinetics tools and uses thereof |
| WO2015095809A1 (en) | 2013-12-20 | 2015-06-25 | Biogen Idec Ma Inc. | Use of perfusion seed cultures to improve biopharmaceutical fed-batch production capacity and product quality |
| AU2015236340B2 (en) | 2014-03-24 | 2020-02-06 | Bioverativ Therapeutics Inc. | Lyophilized factor IX formulations |
| US11008561B2 (en) | 2014-06-30 | 2021-05-18 | Bioverativ Therapeutics Inc. | Optimized factor IX gene |
| GB201420139D0 (en) | 2014-11-12 | 2014-12-24 | Ucl Business Plc | Factor IX gene therapy |
| EA201890423A1 (en) | 2015-08-03 | 2018-07-31 | Биовератив Терапьютикс Инк. | SLIGHT PROTEINS OF THE FACTOR IX, METHODS OF THEIR RECEPTION AND APPLICATION |
| CA3012695A1 (en) | 2016-02-01 | 2017-08-10 | Bioverativ Therapeutics Inc. | Optimized factor viii genes |
| MX2019006444A (en) | 2016-12-02 | 2019-10-30 | Bioverativ Therapeutics Inc | HEMOPHILIC ARTHROPATHY TREATMENT METHODS USING CHEMERIC COAGULATION FACTORS. |
| EA201991768A1 (en) | 2017-01-31 | 2020-01-22 | Байоверетив Терапьютикс Инк. | FUSIONED PROTEINS BASED ON FACTOR IX AND METHODS OF PRODUCING THEM AND WAYS OF APPLICATION |
| NZ762100A (en) | 2017-08-09 | 2025-12-19 | Bioverativ Therapeutics Inc | Nucleic acid molecules and uses thereof |
| EP3687580A1 (en) | 2017-09-27 | 2020-08-05 | Sigilon Therapeutics, Inc. | Methods, compositions, and implantable elements comprising active cells |
| US11491212B1 (en) | 2017-09-27 | 2022-11-08 | Catalyst Biosciences, Inc. | Subcutaneous administration of modified factor IX polypeptides and treatment of hemophilia B |
| US20210145889A1 (en) | 2018-04-04 | 2021-05-20 | Sigilon Therapeutics, Inc. | Methods, compositions, and implantable elements comprising stem cells |
| BR112020020084A2 (en) | 2018-04-04 | 2021-01-05 | Sigilon Therapeutics, Inc. | PARTICLE, PREPARATION OF A PARTICLE PLURALITY, METHOD OF PREPARATION OF A PARTICLE, AND, PARTICLE COMPOSITION. |
| PL3793588T3 (en) | 2018-05-18 | 2025-09-01 | Bioverativ Therapeutics Inc. | Methods of treating hemophilia a |
| EP3833766A1 (en) | 2018-08-09 | 2021-06-16 | Bioverativ Therapeutics Inc. | Nucleic acid molecules and uses thereof for non-viral gene therapy |
| US10842885B2 (en) | 2018-08-20 | 2020-11-24 | Ucl Business Ltd | Factor IX encoding nucleotides |
| GB201813528D0 (en) | 2018-08-20 | 2018-10-03 | Ucl Business Plc | Factor IX encoding nucleotides |
| UY38389A (en) | 2018-09-27 | 2020-04-30 | Sigilon Therapeutics Inc | IMPLANTABLE DEVICES FOR CELLULAR THERAPY AND RELATED METHODS |
| SG11202111290WA (en) | 2019-04-17 | 2021-11-29 | Codiak Biosciences Inc | Compositions of exosomes and aav |
| KR20220097891A (en) | 2019-09-30 | 2022-07-08 | 바이오버라티브 테라퓨틱스 인크. | Lentiviral vector formulation |
| WO2021154414A2 (en) | 2020-01-29 | 2021-08-05 | Catalyst Biosciences, Inc. | Gene therapy for hemophilia b with a chimeric aav capsid vector encoding modified factor ix polypeptides |
| MX2023000156A (en) | 2020-06-24 | 2023-02-16 | Bioverativ Therapeutics Inc | METHODS FOR THE ELIMINATION OF FREE FACTOR VIII FROM PREPARATIONS OF LENTIVIRAL VECTORS MODIFIED TO EXPRESS SAID PROTEIN. |
| WO2024081309A1 (en) | 2022-10-11 | 2024-04-18 | Sigilon Therapeutics, Inc. | Engineered cells and implantable elements for treatment of disease |
| JP2025534667A (en) | 2022-10-11 | 2025-10-17 | シギロン セラピューティクス, インコーポレイテッド | Engineered cells and implantable elements for disease treatment |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6531298B2 (en) * | 1997-07-21 | 2003-03-11 | The University Of North Carolina At Chapel Hill | Factor IX antihemophilic factor with increased clotting activity |
| CA2571292C (en) * | 2004-06-30 | 2013-05-21 | Nektar Therapeutics Al, Corporation | Polymer-factor ix moiety conjugates |
| KR20090013816A (en) * | 2006-05-24 | 2009-02-05 | 노보 노르디스크 헬스 케어 악티엔게젤샤프트 | Factor VII Analogs with Extended In Vivo Half-Life |
| EP2423307A1 (en) * | 2006-06-19 | 2012-02-29 | Catalyst Biosciences, Inc. | Modified coagulation factor IV polypeptides and use thereof for treatment |
-
2009
- 2009-04-15 JP JP2011505176A patent/JP2011517950A/en active Pending
- 2009-04-15 EP EP09747101A patent/EP2282767A4/en not_active Withdrawn
- 2009-04-15 CN CN2009801227857A patent/CN102065887A/en active Pending
- 2009-04-15 KR KR1020107025563A patent/KR20110015551A/en not_active Withdrawn
- 2009-04-15 WO PCT/US2009/040691 patent/WO2009140015A2/en not_active Ceased
- 2009-04-15 CA CA2721362A patent/CA2721362A1/en not_active Abandoned
Also Published As
| Publication number | Publication date |
|---|---|
| EP2282767A4 (en) | 2012-07-11 |
| KR20110015551A (en) | 2011-02-16 |
| CN102065887A (en) | 2011-05-18 |
| WO2009140015A3 (en) | 2010-01-07 |
| CA2721362A1 (en) | 2009-11-19 |
| JP2011517950A (en) | 2011-06-23 |
| WO2009140015A2 (en) | 2009-11-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2282767A2 (en) | Site-directed modification of factor ix | |
| US20120164130A1 (en) | Modified Factor IX Polypeptides and Uses Thereof | |
| US20090252720A1 (en) | Prolonged FIX Analogues and Derivatives | |
| WO2009137254A2 (en) | Modified factor ix polypeptides and uses thereof | |
| JP5580283B2 (en) | Gla domain variants of factor VII or factor VIIa | |
| US9145552B2 (en) | Modified factor X polypeptides and uses thereof | |
| ZA200409475B (en) | Factor vii or vlla polypeptide variants | |
| US20120178693A1 (en) | Cofactors for Thrombin Activation of Factor VII and Uses Thereof | |
| HK1153383A (en) | Site-directed modification of factor ix | |
| HK1172840A (en) | Modified factor ix polypeptides and uses thereof | |
| HK1153481A (en) | Modified factor ix polypeptides and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20101116 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO SE SI SK TR |
|
| AX | Request for extension of the european patent |
Extension state: AL BA RS |
|
| DAX | Request for extension of the european patent (deleted) | ||
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20120612 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: A61K 38/48 20060101AFI20120605BHEP Ipc: C12N 9/64 20060101ALI20120605BHEP |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20121101 |