EP2167662A2 - Pharmaceutical compounds comprising abasic oligonucleotides - Google Patents
Pharmaceutical compounds comprising abasic oligonucleotidesInfo
- Publication number
- EP2167662A2 EP2167662A2 EP08717702A EP08717702A EP2167662A2 EP 2167662 A2 EP2167662 A2 EP 2167662A2 EP 08717702 A EP08717702 A EP 08717702A EP 08717702 A EP08717702 A EP 08717702A EP 2167662 A2 EP2167662 A2 EP 2167662A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- compounds
- antigens
- compound
- group
- hydrogen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7024—Esters of saccharides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/10—Antimycotics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/117—Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/17—Immunomodulatory nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
- C12N2310/332—Abasic residue
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the present invention relates to compounds which are capable of modulating Toll- like receptor (TLR) activity.
- TLR Toll- like receptor
- TLRs Toll- like receptors
- TLR3 Most of the TLRs localize to the cell surface. However, for several of the receptors, an intracellular localization has been shown: TLR3, TLR7/8 and TLR9 localize to the intracellular endosomal compartment.
- TLR3 recognizes dsRNA
- TLR7/8 recognize ssRNA
- TLR9 is believed to be activated dependent on unmethylated CpG motifs of DNA.
- CpG- motifs are suppressed and usually methylated
- bacterial and viral DNA contain many stretches of unmethylated CpG regions. Therefore, it was postulated that TLR9 acts as a receptor for unmethylated CpG-motif containing DNA which has been taken up by endosomes and thus recognizes "foreign" DNA.
- TLR7 and TLR9 activate, like all TLR-receptors, the innate and, in certain cases, also the adaptive immune response. Ligand-binding presumably leads to the stabilization of TLR dimers and further downstream signaling.
- Known and identified members of these downstream pathways are the mitogen activating protein kinases (MAPK) as well as NFKB.
- MAPK mitogen activating protein kinases
- Such ligands may act as immunotherapeutic compounds.
- agonists of TLR-signaling may be used for active treatment or vaccination.
- antagonists of TLR-signaling may be used in diseases, in which the immune system is up-regulated despite the lack of "foreign" signal, such as in most of the autoimmune diseases (e.g., lupus erythematosus).
- the inventors have surprisingly found that removal of bases from known CpG oligonuleotides still allows the abasic pentose-containing oligomeric backbone structure to bind to Toll-like receptors. Dependent on whether the pentose units of the backbone structure are linked by a phosphodiester (also-called "phosphate bridging group") or an analogue thereof an activating or suppressing activity is observed.
- a phosphodiester also-called "phosphate bridging group”
- an analogue thereof an activating or suppressing activity is observed.
- the invention in one embodiment thus relates to a pharmaceutical composition
- a pharmaceutical composition comprising a compound having at least one structural unit according to formula (I) - A -
- n is an integer from 4 to 99;
- X is a phosphate bridging group and/or an analogue thereof such as a phosphorothioate bridging group
- Y is selected from the group comprising hydrogen and OH; and no pyrimidine base, purine base or analogues thereof are bonded to the Ci atom of the pentose ring; and optionally at least one pharmaceutically acceptable excipient.
- the structural unit may comprise in the order of 20 pentose units.
- n may be an integer of 5 to 49, 7 to 39, 9 to 29, 14 to 24, 15 to 23, 16 to 22, 17 to 21 18 to 20 or 19.
- the phosphate bridging group may correspond to formula (II):
- the phosphorothioate bridging group may correspond to formula (III):
- the substituent Y may be selected from the group comprising hydrogen, OH, CH 3 , CH 2 CH 3 , OCH 3 and OCH 2 CH 3 . Hydrogen and OH can be preferred.
- the compound may be essentially identical to the structural unit.
- the structural unit may have a hydrogen at its 5 ' and 3 ' end.
- the Ci position of the cyclic pentose unit is bonded to a hydrogen, CH 3 or OCH 3 . Hydrogen at the Ci position can be preferred.
- the pharmaceutical compositions may comprise the compound in the form of its pharmaceutically acceptable salts or equally active derivates, such as the free base.
- Salts can include the Li, Na, K, Ca, Mg and Mn salts.
- the pharmaceutical compositions may be formulated for oral, nasal, buccal, rectal , i.v., i.m., peritoneal and transdermal application.
- the afore-described compounds can be formulated into the pharmaceutical compositions as colloidial dispersion systems.
- Such system may take the form of lipid-based systems including oil- in- water emulsions, micelles, liposomes and tranfersomes.
- the compounds may be associated with with a lipid and/or lipid-like carrier and preferably with a cationic lipid.
- Such cationic lipid can be selected from the group comprising DOTAP, lipofectamine, DODAP, DODMA, DMDMA, DC- Chol, DDAB, DODAC, DMRIE, DOPSA and DOGS.
- DOTAP can be a preferred lipid.
- the pharmaceutical preparations will comprise compounds wherein the majority of X is a phosphate bridging group. In one even more preferred embodiment, every X will be phosphate bridging group.
- Such pharmaceutical compositions can be used to activate and/or support the (innate and/or adaptive) immune system. This may be achieved by influencing the activity of TLRs and preferably of TLR7 and/or TLR9.
- compositions can also be used to treat conditions such as cancer, infections including viral, bacterial, fungal or parasitic infections, allergies and/or asthma.
- the pharmaceutical compositions thus comprise besides the above-mentioned compounds an antigen which can be used as a vaccine against the aforementioned conditions.
- the above-mentioned compounds will act inter alia as an adjuvants.
- Such antigens can be selected from the group comprising cancer antigens, bacterial antigens, fungal antigens, parasitic antigens, viral antigens, herbal antigens, allergic antigens, asthmatic antigens and food antigens.
- compositions of the present invention can comprise a pharmaceutically active compound selected from the group comprising anti-cancer compounds, anti-bacterial compounds, anti-fungal compounds, anti-parasitic compounds, anti-viral compounds, anti-allergic compounds and anti-asthmatic compounds.
- the pharmaceutical preparations will comprise compounds wherein the majority of bridging groups are formed by analogues of a phosphate bridging group.
- the bridging group may be a phosphorothioate bridging group.
- every X will be an analogue of a phosphate bridging group. In such case, it can be preferred that every X is a phosphorothioate bridging group.
- Other analogues of phosphate bridging groups which can be used to achieve an effect as attained by phosphorothioate bridging groups are mentioned below.
- Such pharmaceutical compositions can be used to suppress and/or inhibit the (innate and/or adaptive) immune system. This may be achieved by influencing the activity of TLRs and preferably o f TLR7 and/or TLR9.
- compositions can therefore be used to treat autoimmune diseases including lupus eyrthematosus.
- Such medicaments in general can be used in conditions resulting from and/or afflicted by an alteration of TLR activity and preferably of TLR7 and/or TLR9 activity.
- the present invention thus relates to the use of a pharmaceutical compound having at least one structural unit according to formula (I) wherein 3 ' n is an integer from 4 to 99;
- X is a phosphate bridging group and/or an analogue thereof such as a phosphorothioate with the majority being phosphate bridging groups;
- Y is selected from the group comprising hydrogen and OH; and no pyrimidine base, purine base or analogues thereof are bonded to the Ci atom of the pentose ring; in the manufacture of a medicament for activating and/or supporting an immune response.
- the medicament may be suitable for treating conditions comprising cancer, infections including viral, bacterial, fungal or parasitic infections, allergies and/or asthma.
- the medicament may comprise the aforementioned antigens and additionally or alternatively at least one pharmaceutically active compound selected from the group comprising anti-cancer compounds, anti-bacterial compounds, anti-fungal compounds, anti-parasitic compounds, anti-viral compounds, anti-allergic compounds and anti-asthmatic compounds.
- the present invention relates to the use of a pharmaceutical compound having at least one structural unit according to formula (I)
- n is an integer from 4 to 99;
- X is a phosphate bridging and/or an analogue thereof such as a phosphorothioate bridging group with the majority being analogue bridging groups;
- Y is selected from the group comprising hydrogen and OH; and no pyrimidine base, purine base or analogues thereof are bonded to the Ci atom of the pentose ring; in the manufacture of a medicament for suppressing and/or inhibiting an immune response.
- Such medicaments can preferably be used to treat autoimmune diseases such as lupus erythematosus.
- the present invention relates to methods of treating human or animal subjects with the aforementioned pharmaceutical compositions and compounds.
- Figure 1 Influence of various compounds on the IL-6 production of Flt3L-WT cells.
- WT Flt3L-DCs (lxlO 6 /well) were incubated for 18h with indicated amounts of compounds.
- the amount of DOTAP was always 10 ⁇ g and the concentration of the corresponding compound complexed with DOTAP was tested over a range as indicated.
- IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
- Figure 2 Influence of various compounds on the IFN alpha production of FU3L-WT cells.
- WT Flt3L-DCs (lxlO 6 /well) were incubated for 18h with indicated amounts of compounds.
- the amount of DOTAP was always 10 ⁇ g and the concentration of the corresponding compound complexed with DOTAP was tested over a range as indicated.
- IFN alpha levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
- FIG. 3 Influence of various compounds on the IL-6 production of Flt3L- TLR9 ' cells.
- TLR9 "7" Flt3 L-DCs (lxlO 6 /well) were incubated for 18h with indicated amounts of compounds.
- the amount of DOTAP was always 10 ⁇ g and the concentration of the corresponding compound complexed with DOTAP was tested over a range as indicated.
- IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
- Figure 4 Influence of various compounds on the IL-6 production of Flt3L- MyD88 -'- cells.
- Figure 5 Influence of DNase/RNase treatment on the IL-6 production of Flt3L- WT cells.
- WT Flt3L-DCs (0.75xl0 6 /well) were incubated for 18h with indicated amounts of compounds.
- the amount of DOTAP was always 10 ⁇ g and the concentration of the corresponding compound complexed with DOTAP was tested over a range as indicated.
- Samples shown in the left part of the figure were not treated with DNase/RNase. Samples shown in the middle part of the figure were treated in the following way: DNase/RNase was added during the time the cells were allowed to adhere to the plates (about 2-3 h) to digest any DNA or RNA present in the supernatant of the medium.
- WT Flt3L-DCs (0.75xl0 6 /well) were incubated for 18h with indicated amounts of compounds.
- the amount of DOTAP was always 10 ⁇ g and the concentration of the corresponding compound complexed with DOTAP was tested over a range as indicated.
- Samples shown in the left part of the figure were not treated with DNase/RNase. Samples shown in the middle part of the figure were treated in the following way: DNase/RNase was added during the time the cells were allowed to adhere to the plates (about 2-3 h) to digest any DNA or RNA present in the supernatant of the medium.
- Figure 7 Influence of various compounds on the IL12-p40 production of Flt3L- WT cells.
- WT Flt3L-DCs (0.5xl0 6 /well) were incubated for 18h with indicated amounts of compounds.
- the amount of DOTAP was always 10 ⁇ g and the concentration of the corresponding compound complexed with DOTAP was tested over a range as indicated.
- IL12-p40 levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
- Figure 8 Influence of various compounds on the IL-6 production of FU3L-WT cells.
- WT Flt3L-DCs (0.5xl0 6 /well) were incubated for 18h with indicated amounts of compounds.
- the amount of DOTAP was always 10 ⁇ g and the concentration of the corresponding compound complexed with DOTAP was tested over a range as indicated.
- IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
- FIG. 9 Influence of various compounds on the IL-6 production of Flt3L- TLR9 -'- (left side) and Flt3L-MyD88 ' cells (right side).
- TLR9 "7" Flt3 L-DCs or MyDS ⁇ "7” Flt3 L-DCs (lxlO 6 /well) were incubated for 18h with indicated amounts of compounds.
- the amount of DOTAP and Lipofectamin used was 10 ⁇ g.
- IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
- Figure 10 Determination of pJNK levels after stimulation by various compounds by Westernblot analysis.
- WT Flt3L-DCs (2.5xlO 6 / 6-well) were incubated for 30 minutes with indicated compounds. Amounts were: 2 ⁇ g ODN, complexed where indicated with 10 ⁇ g of DOTAP. Cells and samples were treated according to standard-methods for Westernblot analysis as set out in the method-section. Endogenous pJNK is detected by two bands due to isoforms present in the cells.
- FIG 11 Detailed representation of sequence and structure of ODN and ODN- related molecules.
- ODN Sequences used in this study.
- Canonical CpG-motif underlined, s phosphorothioate linkage (PS).
- PS phosphorothioate linkage
- FIG. 12 TLR9 immunobiology of natural PD DNA.
- a, b WT or TLR9 "7" Flt3L-DCs (lxlO 6 /well) were incubated for 18h with 3 ⁇ M PD CpG-B ODN 3 '-extended with poly-G tails of different lengths or control PS CpG-B ODN.
- IL-6 (a) and IFN- ⁇ (b) levels were detected in culture supernatants by enzyme-linked immunosorbant assay.
- Figure 14 Role of the DNA sugar backbone in TLR9 activation.
- a WT Flt3L-DCs (lxlO 6 /well) were incubated for 18h with 3 ⁇ M of indicated PD ODN alone or PD ODN complexed to DOTAP.
- IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay, b, c WT, TLR9 ⁇ ⁇ or TLR7 ⁇ ⁇ Flt3 L-DCs (1 xlO 6 /well) were incubated for 18h with 3 ⁇ M of indicated PD ODN or hybrid DNA/RNA molecules complexed to DOTAP.
- IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay, d WT, TLR7 ⁇ ⁇ , TLR9 " ' " or MVD88- 7 - Flt3 L-DCs (lxlO 6 /well) were incubated for 18h with 3 ⁇ M of PD ODN or PD polyU-2-deoxyribose complexed to DOTAP. IL-6 levels were detected in culture supernatants by enzyme- linked immunosorbant assay. All data are representative of 3 independent experiments.
- FIG. 15 Opposing effects of PD vs PS 2-deoxyribose on TLR9.
- a WT or TLR9 "7" Flt3L-DCs (1 xlO 6 /well) were incubated for 18h with 3 ⁇ M of the indicated ODN (20mer), PD 2'-deoxyribose (20mer) or controls, all complexed to DOTAP.
- IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay, b SPR analysis of 10OnM murine TLR9-ect binding to biotinylated ODN or sugar backbone molecules immobilized at equimolar amounts on a streptavidin-coated biosensor chip.
- mTLR2-ect was used as a control.
- mice were injected i.v. with 2,5nmol PD CpG-B ODN ⁇ indicated amounts of PS or PD backbone molecules, all complexed to DOTAP. Blood samples were obtained 2h after injection. Serum-IL-6 levels were detected by enzyme-linked immunosorbant assay. All data are representative of at least 3 independent experiments.
- FIG. 16 TLR9 immunobiology of natural PD DNA.
- a WT Flt3L-DCs (0,5x10 6 /well) were incubated with 2 ⁇ M of Cy5-labelled ODN for 45 min as indicated.
- Relative fluorescence intensity representative of intracellular ODN, was measured by fluorescence activated cell sorting (FACS).
- Red Medium; blue: PD CpG-B ODN; green: PD CpG-B + 24pG ODN; orange: CpG-A ODN.
- b WT Flt3L-DCs (0,5x10 6 /well) were incubated for 16h with 3 ⁇ M ODN. Cells were then washed, stained, fixed and analysed by fluorescence activated cell sorting (FACS).
- FIG. 17 Role of the DNA sugar backbone in TLR9 activation.
- a WT, TLR9 "7” or TLR7 “7” Flt3L-DCs (1 xlO 6 /well) were incubated for 18h with 3 ⁇ M PD non-CpG API ODN or hybrid DNA/RNA molecules complexed to DOTAP.
- IFN- ⁇ levels were detected in culture supernatants by enzyme-linked immunosorbant assay
- b WT, TLR9 "7” or TLR7 “7” Flt3L-DCs (1 xlO 6 /well) were incubated for 18h with 3 ⁇ M PD CpG-B ODN or hybrid DNA/RNA molecules complexed to DOTAP.
- IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay, c WT, TLR7-/-, TLR9-/- or MyD88-/- Flt3 L-DCs (lxlO 6 /well) were incubated for 18h with 3 ⁇ M of PD CpG-B ODN or PD poly-U-2-deoxyribose, all complexed to DOTAP.
- IFN- ⁇ levels were detected in culture supernatants by enzyme-linked immunosorbant assay, d WT Flt3L-DCs (lxlO 6 /well) were incubated for 18h with 2 ⁇ M stimulatory PD CpG-B ODN ⁇ indicated concentrations of PS or PD ODN.
- IL- 6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
- Figure 18 Inhibition of TLR7-mediated IL-6 production by PS 2-deoxyribose backbone.
- WT Flt3L-DCs (lxlO 6 /well) were incubated for 18h with indicated amounts of compounds (The PS 2-deoxyribose backbone as 20mer).
- the amount of DOTAP used was always 10 ⁇ g and the concentration of the corresponding compound complexed with DOTAP was tested over a range as indicated.
- IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
- Figure 19 Binding affinities of PD and PS 2-deoxyribose to TLR7 and TLR9, resp. a AlphaScreen (homogenous ligand binding assay) assessment of human TLR7-ect binding to biotinylated sugar backbone molecules as indicated.
- hTLR2ect was used as a control. No hTLR2ect binding to any of the backbone molecules was detected,
- hTLR2ect was used as a control. No hTLR2ect binding to any of the backbone molecules was detected.
- a and b Calculated EC50 values for the respective binding are depicted underneath the graphs.
- Figure 20 CpG-Independent TLR9 Activation by Natural PD ODNs.
- WT Flt3L-DCs (lxlO 6 /well) were incubated for 18 h with indicated concentrations of ODN alone or ODN 3 ' extended with 24Gs (a) and ODN alone or ODN complexed to DOTAP (b). IL-6 concentrations were detected in culture supernatants by enzyme- linked immunosorbant assay. Values for PD 1668 and PD non-CpG AP-I in (a) and (b) are taken from the same set of experiments. Mean values and standard deviations of 3 independent experiments are shown. Figure 21: PD and PS ribose display specific low-aff ⁇ ne binding only to hTLR7- ect but not to hTLR9-ect.
- AlphaScreen (homogenous ligand binding assay) assessment of hTLR9-ect and hTLR7-ect binding to biotinylated sugar backbone molecules was used as a control. No hTLR2-ect binding to any of the sugar backbone molecules was detected.
- PS 2' deoxyribose homopolymer is a competitive inhibitor of TLR9 ligand binding.
- PS 2' deoxyribose homopolymer is a TLR9 and TLR7 antagonist.
- the present invention partially resides in the surprising finding that removal of bases from known CpG oligonucleotides nevertheless allows the remaining backbone structures to bind to TLRs. Depending on the bridging group of the backbone structures, an activation or suppression TLR activity is observed.
- nucleic acid and oligonucleotide refer to DNA, RNA in its various forms and derivatives thereof.
- Derivatives of DNA and/or RNA are understood to include different bases than A, T, G, C and U, to include sugar units other than ribose or 2-deoxyribose and/or to include bridging groups between the sugar units other than a phosphate bridging group.
- derivatives of DNA and/or RNA are understood to contain bases.
- abasic oligonuclelotide refers to the back bone structure of nucleic acid molecules with approximately 5 to approximately 100 cyclic pentose units in which bases have been removed or which have been e.g. synthetically build without bases at the Ci position of the cyclic pentose unit..
- base in the context of oligonucleotides refers to pyrimidines such as Cytosine (C), Thymidine (T) and Uracil (U) and purine bases such as Adenine (A) and Guanine (G).
- analogue of (purine or pyrimidine) bases refers to other naturally occurring or non-naturally occurring synthetic bases such as inosine, N 6 -methyl-dA, 5-Methyl-dC, hypoxanthine, dihydrouracil, pseudouracil, 2-thiouracil, 4-thiouracil, 5-aminouracil, 5-(Ci-C6)-alkyluracil, 5-(C2-C6)-alkenyluracil, 5 -(C 2 -C 6 )- alkinyluracil, 5-(hydroxymethyl)uracil, 5-chlorouracil, 5-fluorouracil, 5-bromouracil, 5-hydroxycytosine, 5-(Ci-C6)-alkylcytosine, 5-(C2-C6)-alkenylcytosine, 5-(C 2 -C 6 )- alkinylcytosine, 5-chlorocytosine, 5-fluorocytosine, 5-bromocytosine, N 2
- the guanine base can be a substituted or modified guanine such as 7-deazaguanine, 8-azaguanine, 7-deaza-7-substituted guanine (such as 7-deaza-7-(C2-C6)alkynylguanine), 7-deaza-8-substituted guanine, hypoxanthine, 2,6-diaminopurine, 2-aminopurine, 8-substituted guanine such as 8- hydroxyguanine and 6-thioguanine.
- 7-deazaguanine such as 7-deazaguanine, 8-azaguanine, 7-deaza-7-substituted guanine (such as 7-deaza-7-(C2-C6)alkynylguanine), 7-deaza-8-substituted guanine, hypoxanthine, 2,6-diaminopurine, 2-aminopurine, 8-substituted gu
- the cyclic pentose unit of compounds as they are used for preferred embodiments of the pharmaceutical compositions and methods of the present invention is preferably a ribose, i.e. carries a hydrogen at the C 2 position.
- the abasic oligonucleotides may be based on DNA.
- the C 2 position can also be modified with a OH group.
- the abasic oligonucleotides are based on RNA.
- the cyclic pentose units can carry other modifications at the C 2 position.
- a DNA oligomer of 20 nucleotides from which the bases have been removed is capable of activating TLR 7 and TLR 9.
- a DNA oligomer of 20 nucleotides from which the bases have been removed and which has phosphorothioate bridging groups is capable of suppressing TLR 7 and TLR 9 activity.
- the invention is at least partially based on the finding that nucleic acid oligonucleotides from which the bases have been removed can bind to and activate or inhibit TLR mediated signaling.
- the invention thus relates to a compound having at least one structural unit according to formula (I)
- n is an integer from 4 to 99;
- X is a phosphate bridging group or an analogue thereof such as a phosphorothioate bridging group
- Y is selected from the group comprising hydrogen and OH; no pyrimidine base, purine base or analogues thereof are bonded to the Ci atom of the pentose ring; and optionally at least one pharmaceutically acceptable excipients.
- Such compounds can be used as a pharmaceutically active compound, i.e. take the form of a pharmaceutical preparation.
- the structural unit may comprise in the order of 20 pentose units.
- n may be an integer of 5 to 69, 6 to 59, 7 to 49, 8 to 39, 9 to 29, 14 to 24, 15 to 23, 16 to 22, 17 to 21 18 to 20 or 19.
- N may also be an integer of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30.
- the rest Y may be selected from the group comprising hydrogen, OH, CH 3 , CH 2 CH 3 , OCH 3 , OCH 2 CH 3 , benzyl, phenyl.
- Y may also be a branched or straight Ci to C20, preferably a branched or straight Ci to C 10 or more preferably a branched or straight Ci to C5 alkyl, a branched or straight Ci to C 2 o, preferably a branched or straight Ci to C 10 or more preferably a branched or straight Ci to C5 alkenyl, a branched or straight Ci to C 2 o, preferably a branched or straight C 1 to C 10 or more preferably a branched or straight Ci to C5 alkinyl, a branched or straight Ci to C 2 o, preferably a branched or straight Ci to C 10 or more preferably a branched or straight Ci to C5 heteroalkyl, a branched or straight Ci to C 2 o, preferably a branched or straight Ci to C 2 o, preferably a branched
- the rest Y may be selected from the group comprising hydrogen, OH, CH 3 , or OCH 3 . Hydrogen and OH can be particularly preferred.
- the compound may be essentially identical to the structural unit.
- the 25 structural unit may have a hydrogen at its 5 ' and/or 3 ' end.
- the structural unit may be terminated at its 5' and/or 3' end with CH 3 , CH 2 CH 3 , OCH 3 , OCH 2 CH 3 , benzyl, phenyl.
- Ci to C 2 o preferably a branched or straight Ci to C 10 or more preferably a branched or straight Ci to C5 alkyl, a branched or straight Ci to C 2 o, preferably a branched or straight Ci to Cio or more preferably a branched or straight Ci to C5 alkenyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C 10 or more preferably a branched or straight Ci to C5 alkinyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C 10 or more preferably a branched or straight Ci to C5 heteroalkyl, a branched or straight Ci to C20, preferably a branched or straight Ci to Cio or more preferably a branched or straight Ci to C5 alkoxyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C20, preferably a branched or
- head and tail groups can also be used. These include e.g. FAM or FITC. Such head and/or tail groups may thus be markers that are detectable by e.g. fluorescence spectroscopy or by chemical reactions.
- polyG-tail a poly guanosin sequence
- This polyG-tail can comprise 4, 12, 24, 25, 35, 40, 44, 50, 55, 60 or 100 guanosines to form the polyG-tail.
- Hydrogen, OH, CH 3 , CH 2 CH 3 , OCH 3 , OCH 2 CH 3 , benzyl, phenyl, FAM, FITC or a polyG-tail can be preferred as head and/or tail groups.
- the Ci position of the cyclic pentose unit can be bonded to a hydrogen, CH3 or OCH3.
- the cyclic pentose at the Ci unit can also be bonded to CH 2 CH 3 , OCH 2 CH 3 , benzyl, phenyl.
- Ci to C20 may also be bonded to a branched or straight Ci to C20, preferably a branched or straight Ci to C 10 or more preferably a branched or straight Ci to C5 alkyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C 10 or more preferably a branched or straight Ci to C5 alkenyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C 10 or more preferably a branched or straight Ci to C5 alkinyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C 10 or more preferably a branched or straight Ci to C5 heteroalkyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C 10 or more preferably a branched or straight Ci to C5 alkoxyl, a branched or straight Ci to C20, preferably a branched or
- Ci position may not be linked to a pyrimidine base, a purine base or an analogue thereof as defined above.
- the Ci position may preferably carry an hydrogen, CH 3 , OCH 3 , benzyl or phenyl. Hydrogen can be particularly preferred.
- X may be a phosphate bridging group of formula (II):
- Such "phosphate bridging groups" allow to connect the cyclic pentose units from the Cs position of one cyclic pentose unit to the C3 position of another cyclic pentose unit.
- the compounds and pharmaceutical preparations comprising these compounds can be used to activate and/or support the (innate or adaptive) immune system of a human or animal subject. This is inter alia the result of the capability such compounds to activate TLR7 and TLR9 as shown below.
- these compounds and pharmaceutical preparations can be used to treat conditions such as cancer, infections including viral, bacterial, fungal or parasitic infections, allergies and/or asthma. These aspects will be discussed further below.
- the invention is at least partially based on the finding that nucleic acid oligonucleotides from which the bases have been removed and which has a backbone with the cyclic pentose units being linked by analogues of a phosphate bridging group as defined above can bind to and inhibit TLR mediated signaling.
- analogues of a phosphate bridging groups refer to bridging groups other than the above-mentioned phosphate bridging group but still allowing to connect the cyclic pentose units from the C5 position of one cyclic pentose unit to the C3 position of another cyclic pentose unit.
- An analogue of a phosphate bridging group will have to allow the compounds in accordance with the invention to bind to TLRs and preferably to TLR7 and/or TLR9 and to inhibit the activity thereof.
- a preferred analogue of a phosphate bridging group is a phosphorothioate bridging group of formula (III):
- analogues of a phosphate bridging group include without being limited thereto alkylphosponate, arylphosphonate, alkylphosphorothioate, arylphosphorothioate, methylphosphonate, methylphosphorothioate, phosphorodithioate, p-ethoxy, morpholino, and combinations thereof.
- Modified backbones such as phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries.
- Aryl- and alkyl-phosphonates can be made, e.g., as described in U.S. Pat. No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Pat. No. 5,023,243 and European Pat. No. 092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described.
- the compounds having analogues of phosphate bridging groups in their backbone may have the advantage of being relatively resistant to degradation (e.g., are stabilized).
- a “stabilized compound” shall mean a compound of the present invention that is relatively resistant to in vivo degradation (e.g., via an exo- or endo- nuclease). Stabilization can be a function of length or secondary structure.
- a compound according to the invention has an analogue of a phosphate bridging group in the backbone
- the abasic oligonucleotide does not necessarily has to comprise a phosphorothioate bridging group (or other analogues) at every backbone position. It may well be that the backbone comprises phosphate bridging group as well as analogues thereof. Depending on the extent of analogues such compounds may be capable of activating or inhibiting TLR signaling.
- X is a phosphate bridging group this refers to the situation that at least 60%, preferably at least 70%, more preferably at least 80%, even more preferably at least 90% and most preferably at least 95% of X is a phosphate brigding group.
- X is an analogue of a phosphate bridging group this refers to the situation that at least 60%, preferably at least 70%, more preferably at least 80%, even more preferably at least 90% and most preferably at least 95% of X is an analogue of a phosphate bridging group such as a phosphorothioate bridging group.
- analogues of a phosphate bridging group it may be considered to introduce such analogues at selected positions of a backbone which otherwise consists only of phosphate bridging groups to reduce liability to degradation while the compound retains its stimulating potential. It can be preferred that the backbone consists of either only phosphate bridging groups or only analogues thereof with posphorothioate being a preferred analogue.
- the compound and pharmaceutical compositions of the present invention depending on the nature and content of the bridging group in their backbone structure can have an activating or inhibiting effect on TLR signaling and thus can activate, i.e. stimulate the immune system.
- stimulation of the immune system includes the stimulation of immune cells and of non- immune cells to secrete or express factors which participate in and/or characterize immune activation.
- This term thus includes, without limitation, stimulation of cytokine secretion by various types of cells including lymphocytes, antigen-presenting cells (APCs, including dendritic cells), and epithelial cells, stimulation of immunoglobulin secretion by B cells; and stimulation of cell surface molecule expression of costimulatory molecules and coreceptors on T cells, B cells, natural killer (NK) cells, monocytes, macrophages, and APCs.
- cytokine induction and secretion are well known in the art and include enzyme-linked immunosorbent assay (ELISA), intracellular fluorescence-activated cell sorting (FACS), and bioassay.
- Methods for determining e.g. NK cell activity are also well known in the art and include determination of target cell killing (cell lysis), cell surface expression of activation marker CD69 (e. g., by FACS), and secretion of interferon gamma (IFN-y ; e. g., byELISA).
- FACS fluorescence-activated cell sorting
- IFN-y secretion of interferon gamma
- Additional examples of specific cell surface markers of immune activation can include, without limitation, expression ofCDllb, CD25, CD28, CD43, CD54, CD62L, CD71, CD80, CD86, CD95L, CD106, CD134, and CD134L
- TLR signaling refers to an ability of a TLR polypeptide upon binding of a ligand to activate the TLR/IL-IR (TIR) signaling pathway, also referred to herein as the TLR signal transduction pathway.
- Changes in TLR activity can be measured by assays such as those disclosed herein, including expression of genes under control of [kappa]B-sensitive promoters and enhancers.
- genes under control of [kappa]B-sensitive promoters and enhancers include the genes encoding IL-I [beta], IL-6, IL-8, the p40 subunit of interleukin 12 (IL-12 p40), and the costimulatory molecules CD80 and CD86.
- Other genes can be placed under the control of such regulatory elements (see below) and thus serve to report the level of TLR signaling.
- TLR7 signaling refers to an ability of a TLR7 polypeptide upon binding of a ligand to activate the TLR/IL-IR (TIR) signaling pathway, also referred to herein as the TLR signal transduction pathway. Changes in TLR7 activity can be measured by assays such as those disclosed herein, including expression of genes under control of [kappa]B-sensitive promoters and enhancers. Such naturally occurring genes include the genes encoding IL-I [beta], IL-6, IL-8, the p40 subunit of interleukin 12 (IL-12 p40), and the costimulatory molecules CD80 and CD86. Other genes can be placed under the control of such regulatory elements (see below) and thus serve to report the level of TLR7 signaling.
- TIR TLR/IL-IR
- TLR9 signaling refers to an ability of a TLR9 polypeptide upon binding of a ligand to activate the TLR/IL-IR (TIR) signaling pathway, also referred to herein as the TLR signal transduction pathway.
- TLR/IL-IR signaling pathway involves signaling via the molecules myeloid differentiation marker 88 (MyD88) and tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6), leading to activation of kinases of the I[kappa]B kinase complex and the c-jun NH2 -terminal kinases (e.g., Jnk 1/2) (Hacker H et al.
- TLR9 activity can be measured by assays such as those disclosed herein, including expression of genes under control of [kappa]B-sensitive promoters and enhancers.
- genes under control of [kappa]B-sensitive promoters and enhancers include the genes encoding IL-I [beta], IL-6, IL-8, the p40 subunit of interleukin 12 (IL-12 p40), and the costimulatory molecules CD80 and CD86.
- Other genes can be placed under the control of such regulatory elements (see below) and thus serve to report the level of TLR9 signaling.
- TLR7 polypeptide or a “TLR9 polypeptide” refers to a polypeptide including a full-length TLR7 or TLR9, orthologues, allelic variants, SNPs, variants incorporating conservative amino acid substitutions, TLR7 or TLR9 fusion proteins, and functional fragments of any of the foregoing.
- Preferred embodiments include human and or murine TLR7 or TLR9 polypeptides.
- measuring the expression of IL-6, IFN alpha, IL12-p40, MyD88, IRF6 can be used to determine whether a compound and/or pharmaceutical composition of the present invention has a stimulating (activating, supporting) effect or inhibiting (suppressing) effect on TLR signaling and particularly on TLR7 and/or TLR9 signaling.
- an increase in expression of any of the above mentioned factors relative to an appropriate control is observed, this will be indicative of a activating effect.
- an activation of TLR signaling and particularly of TLR7 and/or TLR9 signaling is considered to be indicative of activation of the (innate or adaptive) immune system.
- an increase in IL-6 or IFN alpha is indicative of a stimulation of the innate immune system.
- An increase in IL12-p40 can be considered to be indicative of a stimulation of the adaptive immune system.
- Appropriate controls include negative controls and positive controls.
- a negative control may be a molecule known to have no effect on TLR signaling. This may e.g. be a buffer.
- Another very robust negative control can be knock out mice for TLRs such as TLR9 and TLR7 or knock out mice for factors being activated by TLRs but acting downstream thereof such MyD88.
- Positive controls include compounds known to activate TLRs such as CpG oligonucleotides or mutant mice which express constitutively active versions of TLRs.
- An inhibitory compound or pharmaceutical compositions comprising such compounds will typically not increase expression of any of the aforementioned factors in comparison to an appropriate control. It will moreover be able to block, e.g. cross-compete activation of TLRs. This may be detected by co-incubating these inhibitory compounds or compositions in the presence of a known activating compound or composition. It may also be able to down regulate activity of an activated TLR. Examples for determining the suppressing effect of compounds or compositions in accordance with the present invention are depicted below.
- the compounds and pharmaceutical compositions of the invention thus allow to treat conditions which result from and/or are afflicted by an up- or down regulation of TLR signaling and particularly of TLR7 and/or TLR9 signaling.
- the capacity of the compounds and pharmaceutical compositions of the present invention to increase TLR activity and thus to stimulate the immune system particularly if the backbone of the compounds consists essentially of phosphate bridging groups can also be used in the treatment of conditions such as cancer, asthma, allergies and infections.
- a vaccine may comprise an antigen such as a cancer antigen that is capable of directing the immune system's attention and activity towards this cancer-specific antigen thus allowing to fight the cancer.
- the compounds in accordance with the invention can act e.g. as an adiuvants supporting the immune system's activity and specificity.
- a pharmaceutically active anti-cancer agent such as a cytotoxic agent that directly attacks the cancer.
- a pharmaceutically active anti-cancer agent such as a cytotoxic agent that directly attacks the cancer.
- the compounds and pharmaceutical compositions in accordance with the invention support and assist the immune system's activity due to their activating effect on TLR activity.
- the term "antigen" refers to a molecule capable of provoking an immune response.
- antigen broadly includes any type of molecule that is recognized by a host system as being foreign.
- Antigens include but are not limited to infectious antigens including microbial (bacterial), viral, fungal, herbal and parasitic antigens, cancer antigens, and allergens.
- Antigens include, but are not limited to, cells, cell extracts, proteins, polypeptides, peptides, polysaccharides, polysaccharide conjugates, peptide and non-peptide mimics of polysaccharides and other molecules, small molecules, lipids, glyco lipids, and carbohydrates. Many antigens are protein or polypeptide in nature, as proteins and polypeptides are generally more antigenic than carbohydrates or fats.
- the antigen may be an antigen that is encoded by a nucleic acid vector or it may not be encoded in a nucleic acid vector. In the former case the nucleic acid vector is administered to the subject and the antigen is expressed in vivo. In the latter case the antigen may be administered directly to the subject.
- An antigen not encoded in a nucleic acid vector as used herein refers to any type of antigen that is not a nucleic acid. For instance, in some aspects of the invention the antigen not encoded in a nucleic acid vector is a peptide or a polypeptide.
- Minor modifications of the primary amino acid sequences of peptide or polypeptide antigens may also result in a polypeptide which has substantially equivalent antigenic activity as compared to the unmodified counterpart polypeptide. Such modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous. All of the polypeptides produced by these modifications are included herein as long as antigenicity still exists.
- the peptide or polypeptide may be, for example, virally derived.
- the antigens useful in the invention may be any length, ranging from small peptide fragments of a full length protein or polypeptide to the full length form. For example, the antigen may be less than 5, less than 8, less than 10, less than 15, less than 20, less than 30, less than 50, less than 70, less than 100, or more amino acid residues in length, provided it stimulates a specific immune response.
- the nucleic acid encoding the antigen is operatively linked to a gene expression sequence which directs the expression of the antigen nucleic acid within a eukaryotic cell.
- the gene expression sequence is any regulatory nucleotide sequence, such as a promoter sequence or promoter-enhancer combination, which facilitates the efficient transcription and translation of the antigen nucleic acid to which it is operatively linked.
- the gene expression sequence may, for example, be a mammalian or viral promoter, such as a constitutive or inducible promoter.
- Constitutive mammalian promoters include, but are not limited to, the promoters for the following genes: hypoxanthine phosphoribosyl transferase (HPRT), adenosine deaminase, pyruvate kinase, beta-actin promoter and other constitutive promoters.
- HPRT hypoxanthine phosphoribosyl transferase
- adenosine deaminase pyruvate kinase
- beta-actin promoter and other constitutive promoters.
- Exemplary viral promoters which function constitutively in eukaryotic cells include, for example, promoters from the cytomegalovirus (CMV), simian virus (e.g., SV40), papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, the long terminal repeats (LTR) of Moloney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus.
- CMV cytomegalovirus
- simian virus e.g., SV40
- papilloma virus e.g., SV40
- HIV human immunodeficiency virus
- Rous sarcoma virus Rous sarcoma virus
- LTR long terminal repeats
- thymidine kinase promoter of herpes simplex virus thymidine kinase promoter of herpes simplex virus.
- the gene expression sequence shall include, as necessary, 5' non- transcribing and 5' non-translating sequences involved with the initiation of transcription and translation, respectively, such as a TATA box, capping sequence, CAAT sequence, and the like.
- 5' non-transcribing sequences will include a promoter region which includes a promoter sequence for transcriptional control of the operably joined antigen nucleic acid.
- the gene expression sequences optionally include enhancer sequences or upstream activator sequences as desired.
- the antigen nucleic acid is operatively linked to the gene expression sequence.
- the antigen nucleic acid sequence and the gene expression sequence are said to be operably linked when they are covalently linked in such a way as to place the expression or transcription and/or translation of the antigen coding sequence under the influence or control of the gene expression sequence.
- Two DNA sequences are said to be operably linked if induction of a promoter in the 5' gene expression sequence results in the transcription of the antigen sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame- shift mutation, (2) interfere with the ability of the promoter region to direct the transcription of the antigen sequence, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein.
- a gene expression sequence would be operably linked to an antigen nucleic acid sequence if the gene expression sequence were capable of effecting transcription of that antigen nucleic acid sequence such that the resulting transcript is translated into the desired protein or polypeptide.
- the antigen nucleic acid of the invention may be delivered to the immune system alone or in association with a vector.
- a vector is any vehicle capable of facilitating the transfer of the antigen nucleic acid to the cells of the immune system so that the antigen can be expressed and presented on the surface of the immune cell.
- the vector generally transports the nucleic acid to the immune cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector.
- the vector optionally includes the above-described gene expression sequence to enhance expression of the antigen nucleic acid in immune cells.
- the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the antigen nucleic acid sequences.
- Viral vectors are a preferred type of vector and include, but are not limited to, nucleic acid sequences from the following viruses: retrovirus, such as Moloney murine leukemia virus, Harvey murine sarcoma virus, murine mammary tumor virus, and Rous sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus.
- retrovirus such as Moloney murine leukemia virus, Harvey murine sarcoma virus, murine mammary tumor virus, and Rous sarcoma virus
- adenovirus adeno-associated virus
- SV40-type viruses polyoma viruses
- Epstein-Barr viruses Epstein-Barr viruses
- papilloma viruses herpes virus
- vaccinia virus vaccinia virus
- Non-cytopathic viral vectors are based on non-cytopathic eukaryotic viruses in which nonessential genes have been replaced with the gene of interest.
- Non-cytopathic viruses include retroviruses, the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA.
- Retroviruses have been approved for human gene therapy trials. Most useful are those retroviruses that are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle).
- retroviral expression vectors have general utility for the high- efficiency transduction of genes in vivo.
- a preferred virus for certain applications is the adeno-associated virus, a double- stranded DNA virus.
- the adeno-associated virus can be engineered to be replication- deficient and is capable of infecting a wide range of cell types and species. It further has advantages, such as heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages, including hemopoietic cells; and lack of superinfection inhibition thus allowing multiple series of transductions.
- wild-type adeno-associated virus manifest some preference for integration sites into human cellular DNA, thereby minimizing the possibility of insertional mutagenesis and variability of inserted gene expression characteristic of retroviral infection.
- adeno-associated virus infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event.
- the adeno-associated virus can also function in an extrachromosomal fashion. Recombinant adeno-associated viruses that lack the replicase protein apparently lack this integration sequence specificity.
- Cancer is a disease which involves the uncontrolled growth (i.e., division) of cells.
- Some of the known mechanisms which contribute to the uncontrolled proliferation of cancer cells include growth factor independence, failure to detect genomic mutation, and inappropriate cell signaling. The ability of cancer cells to ignore normal growth controls may result in an increased rate of proliferation.
- the causes of cancer have not been firmly established, there are some factors known to contribute, or at least predispose a subject, to cancer. Such factors include particular genetic mutations (e.g., BRCA gene mutation for breast cancer, APC for colon cancer), exposure to suspected cancer-causing agents, or carcinogens (e.g., asbestos, UV radiation) and familial disposition for particular cancers such as breast cancer.
- the cancer may be a malignant or non-malignant cancer.
- Cancers or tumors include but are not limited to biliary tract cancer; brain cancer; breast cancer; cervical cancer; choriocarcinoma; colon cancer; endometrial cancer; esophageal cancer; gastric cancer; intraepithelial neoplasms; lymphomas; liver cancer; lung cancer (e.g., small cell and non-small cell); melanoma; neuroblastomas; oral cancer; ovarian cancer; pancreas cancer; prostate cancer; rectal cancer; sarcomas; skin cancer; testicular cancer; thyroid cancer; and renal cancer, as well as other carcinomas and sarcomas.
- the cancer is hairy cell leukemia, chronic myelogenous leukemia, cutaneous T-cell leukemia, multiple myeloma, follicular lymphoma, malignant melanoma, squamous cell carcinoma, renal cell carcinoma, prostate carcinoma, bladder cell carcinoma, or colon carcinoma.
- cancer antigen is a compound, such as a peptide or protein, associated with a tumor or cancer cell surface and which is capable of provoking an immune response when expressed on the surface of an antigen presenting cell in the context of an MHC molecule.
- Cancer antigens can be prepared from cancer cells either by preparing crude extracts of cancer cells, for example, as described in Cohen P A et al. (1994) Cancer Res 54:1055-8, by partially purifying the antigens, by recombinant technology, or by de novo synthesis of known antigens.
- Cancer antigens include but are not limited to antigens that are recombinantly expressed, an immunogenic portion of, or a whole tumor or cancer. Such antigens can be isolated or prepared recombinantly or by any other means known in the art.
- cancer antigen and “tumor antigen” are used interchangeably and refer to antigens which are differentially expressed by cancer cells and can thereby be exploited in order to target cancer cells.
- Cancer antigens are antigens which can potentially stimulate apparently tumor- specific immune responses. Some of these antigens are encoded, although not necessarily expressed, by normal cells. These antigens can be characterized as those which are normally silent (i.e., not expressed) in normal cells, those that are expressed only at certain stages of differentiation and those that are temporally expressed such as embryonic and fetal antigens.
- cancer antigens are encoded by mutant cellular genes, such as oncogenes (e.g., activated ras oncogene), suppressor genes (e.g., mutant p53), fusion proteins resulting from internal deletions or chromosomal translocations. Still other cancer antigens can be encoded by viral genes such as those carried on RNA and DNA tumor viruses.
- tumor antigens examples include MAGE, MART-1/Melan-A, gplOO, Dipeptidyl peptidase IV (DPPIV), adenosine deaminase-binding protein (ADAbp), cyclophilin b, Colorectal associated antigen (CRC)-COl 7- 1A/GA733, Carcinoembryonic Antigen (CEA) and its immunogenic epitopes CAP-I and CAP-2, etv ⁇ , amll, Prostate Specific Antigen (PSA) and its immunogenic epitopes PSA-I, PSA-2, and PSA-3, prostate-specific membrane antigen (PSMA), T-cell receptor/CD3-zeta chain, MAGE-family of tumor antigens (e.g., MAGE-Al, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE- A8, MAGE-A9, MAGE-AlO, MAGE
- Cancers or tumors and tumor antigens associated with such tumors include acute lymphoblastic leukemia (etv ⁇ ; amll; cyclophilin b), B cell lymphoma (Ig-idiotype), glioma (E-cadherin; [alpha] -catenin; [beta] -catenin; [gamma] -catenin; pl20ctn), bladder cancer (p21ras), biliary cancer (p21ras), breast cancer (MUC family; HER2/neu; c-erbB-2), cervical carcinoma (p53; p21ras), colon carcinoma (p21ras; HER2/neu; c-erbB-2; MUC family), colorectal cancer (Colorectal associated antigen (CRC)-CO 17- 1 A/GA733; APC), choriocarcinoma (CEA), epithelial cell cancer (cyclophilin b), gastric cancer (HER2/neu; c
- An infectious antigen as used herein is an antigen of a microorganism and includes but is not limited to antigens associated with viruses, bacteria, fungi, and parasites.
- antigens include the intact microorganism as well as natural isolates and fragments or derivatives thereof and also synthetic compounds which are identical to or similar to natural microorganism antigens and induce an immune response specific for that microorganism.
- a compound is similar to a natural microorganism antigen if it induces an immune response (humoral and/or cellular) to a natural microorganism antigen.
- Bacterial antigens may be derived from infectious bacteria.
- Bacteria are unicellular organisms which multiply asexually by binary fission. They are classified and named based on their morphology, staining reactions, nutrition and metabolic requirements, antigenic structure, chemical composition, and genetic homology. Bacteria can be classified into three groups based on their morphological forms, spherical (coccus), straight-rod (bacillus) and curved or spiral rod (vibrio, Campylobacter, spirillum, and spirochaete). Bacteria are also more commonly characterized based on their staining reactions into two classes of organisms, gram-positive and gram-negative. Gram refers to the method of staining which is commonly performed in microbiology labs. Gram-positive organisms retain the stain following the staining procedure and appear a deep violet color. Gram-negative organisms do not retain the stain but take up the counter-stain and thus appear pink.
- Infectious bacteria include, but are not limited to, gram negative and gram positive bacteria.
- Gram positive bacteria include, but are not limited to Pasteurella species, Staphylococci species, and Streptococcus species.
- Gram negative bacteria include, but are not limited to, Escherichia coli, Pseudomonas species, and Salmonella species.
- infectious bacteria include but are not limited to: Helicobacter pyloris, Borrelia burgdorferi, Legionella pneumophilia, Mycobacteria sps (e.g., M. tuberculosis, M. avium, M. intracellulare, M. kansasii, M.
- Viral antigens may be derived from infectious viruses.
- Viruses are small infectious agents which generally contain a nucleic acid core and a protein coat, but are not independently living organisms. Viruses can also take the form of infectious nucleic acids lacking a protein. A virus cannot survive in the absence of a living cell within which it can replicate. Viruses enter specific living cells either by endocytosis or direct injection of DNA (phage) and multiply, causing disease. The multiplied virus can then be released and infect additional cells. Some viruses are DNA-containing viruses and others are RNA-containing viruses.
- the invention also intends to treat diseases in which prions are implicated in disease progression such as for example bovine spongiform encephalopathy (i.e., mad cow disease, BSE) or scrapie infection in animals, or Creutzfeldt- Jakob disease in humans.
- diseases in which prions are implicated in disease progression such as for example bovine spongiform encephalopathy (i.e., mad cow disease, BSE) or scrapie infection in animals, or Creutzfeldt- Jakob disease in humans.
- Viruses include, but are not limited to, enteroviruses (including, but not limited to, viruses that the family picornaviridae, such as polio virus, coxsackie virus, echo virus), rotaviruses, adenovirus, hepatitis virus.
- enteroviruses including, but not limited to, viruses that the family picornaviridae, such as polio virus, coxsackie virus, echo virus
- rotaviruses e.g., human immunodeficiency viruses, such as HIV-I (also referred to as HTLV-III, LAV or
- HTLV-III/LAV or HIV-III
- other isolates such as HIV-LP; Picornaviridae (e.g., polio viruses, hepatitis A virus; enteroviruses, human Coxsackie viruses, rhinoviruses, echoviruses); Calciviridae (e.g., strains that cause gastroenteritis); Togaviridae (e.g., equine encephalitis viruses, rubella viruses); Flaviviridae (e.g., dengue viruses, encephalitis viruses, yellow fever viruses); Coronaviridae (e.g., coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g., ebola viruses); Paramyxoviridae (e.g., parainfluenza viruses, mumps virus, measles virus, respiratory syncytial virus); Orthomyx
- Fungal antigens may be derived from infectious fungi.
- Fungi are eukaryotic organisms, only a few of which cause infection in vertebrate mammals. Because fungi are eukaryotic organisms, they differ significantly from prokaryotic bacteria in size, structural organization, life cycle and mechanism of multiplication. Fungi are classified generally based on morphological features, modes of reproduction and culture characteristics. Although fungi can cause different types of disease in subjects, such as respiratory allergies following inhalation of fungal antigens, fungal intoxication due to ingestion of toxic substances, such as Amanita phalloides toxin and phallotoxin produced by poisonous mushrooms and aflatoxins, produced by aspergillus species, not all fungi cause infectious disease.
- Infectious fungi can cause systemic or superficial infections.
- Primary systemic infection can occur in normal healthy subjects, and opportunistic infections are most frequently found in immunocompromised subjects.
- the most common fungal agents causing primary systemic infection include Blastomyces, Coccidioides, and Htoplasma.
- Common fungi causing opportunistic infection in immunocompromised or immunosuppressed subjects include, but are not limited to, Candida albicans, Cryptococcus neoformans, and various Aspergillus species.
- Systemic fungal infections are invasive infections of the internal organs. The organism usually enters the body through the lungs, gastrointestinal tract, or intravenous catheters. These types of infections can be caused by primary pathogenic fungi or opportunistic fungi.
- Superficial fungal infections involve growth of fungi on an external surface without invasion of internal tissues.
- Typical superficial fungal infections include cutaneous fungal infections involving skin, hair, or nails.
- Diseases associated with fungal infection include aspergillosis, blastomycosis, candidiasis, chromoblastomycosis, coccidioidomycosis, cryptococcosis, fungal eye infections, fungal hair, nail, and skin infections, histoplasmosis, lobomycosis, mycetoma, otomycosis, paracoccidioidomycosis, disseminated Penicillium marneffei, phaeohyphomycosis, rhinosporidioisis, sporotrichosis, and zygomycosis.
- Parasitic antigens may be derived from infectious parasites.
- Parasites are organisms which depend upon other organisms in order to survive and thus must enter, or infect, another organism to continue their life cycle.
- the infected organism i.e., the host, provides both nutrition and habitat to the parasite.
- parasite can include all infectious agents (i.e., bacteria, viruses, fungi, protozoa and helminths), generally speaking, the term is used to refer solely to protozoa, helminths, and ectoparasitic arthropods (e.g., ticks, mites, etc.).
- Protozoa are single-celled organisms which can replicate both intracellularly and extracellularly, particularly in the blood, intestinal tract or the extracellular matrix of tissues. Helminths are multicellular organisms which almost always are extracellular (an exception being Trichinella spp.). Helminths normally require exit from a primary host and transmission into a secondary host in order to replicate. In contrast to these aforementioned classes, ectoparasitic arthropods form a parasitic relationship with the external surface of the host body. Parasites include intracellular parasites and obligate intracellular parasites.
- Examples of parasites include but are not limited to Plasmodium falciparum, Plasmodium ovale, Plasmodium malariae, Plasmdodium vivax, Plasmodium knowlesi, Babesia microti, Babesia divergens, Trypanosoma cruzi, Toxoplasma gondii, Trichinella spiralis, Leishmania major, Leishmania donovani, Leishmania braziliensis, Leishmania tropica, Trypanosoma gambiense, Trypanosoma rhodesiense and Schistosoma mansoni.
- Allergic conditions include but are not limited to eczema, allergic rhinitis or coryza, hay fever, allergic conjunctivitis, bronchial asthma, urticaria (hives) and food allergies, other atopic conditions including atopic dermatitis; anaphylaxis; drug allergy; and angioedema.
- Allergic diseases include but are not limited to rhinitis (hay fever), asthma, urticaria, and atopic dermatitis.
- Allergy is a disease associated with the production of antibodies from a particular class of immunoglobulin, IgE, against allergens.
- IgE-mediated response to common aeroallergens is also a factor which indicates predisposition towards the development of asthma. If an allergen encounters a specific IgE which is bound to an IgE Fc receptor (Fc[epsilon]R) on the surface of a basophil (circulating in the blood) or mast cell (dispersed throughout solid tissue), the cell becomes activated, resulting in the production and release of mediators such as histamine, serotonin, and lipid mediators.
- Fc[epsilon]R IgE Fc receptor
- allergen as used herein is a molecule capable of provoking an immune response characterized by production of IgE.
- An allergen is a substance that can induce an allergic or asthmatic response in a susceptible subject.
- allergen means a specific type of antigen which can trigger an allergic response which is mediated by IgE antibody.
- the method and preparations of this invention extend to a broad class of such allergens and fragments of allergens or haptens acting as allergens.
- the list of allergens is enormous and can include pollens, insect venoms, animal dander, dust, fungal spores, and drugs (e.g., penicillin).
- Examples of natural, animal and plant allergens include but are not limited to proteins specific to the following genera: Agropyron (e. g., Agropyron repens) ; Agrostis (e.g., Agrostis alba) ; Alder ; Alnus (Alnus gultinoasa) ; Alternaria (Alternaria alternat) ;
- Agropyron e. g., Agropyron repens
- Agrostis e.g., Agrostis alba
- Alder Alnus (Alnus gultinoasa)
- Alternaria Alternaria alternat
- Ambrosia Ambrosia artemiisfolia
- Anthoxanthum e. g., Anthoxanthum odoratum
- Apis e. g., Apis multiflorum
- Arrhenatherum e.g., Arrhenatherum elatius
- Artemisia Artemisia vulgaris
- Avena e. g., Avena sativa
- Betula Betulaverrucosa
- Blattella e. g., Blattellagermanica
- Bromus e. g.,Bromes inermis
- Chamaecyparis e.
- Cryptomeria (Cryptomeria japonica) ; Cupressus (e. g., Cupressussempervirens, Cupressus arizonica, andCupressus macrocarpa) ; Dactylis (e. g., Dactylisglomerata) ;Dermatophagoides (e. g., Dermatophagoides farinae) ; Felis (Felis domesticus) ;Festuca (e. g., Festuca elatior) ; Holcus (e. g., Holcus lanatus) ; Junipers (e.
- Junipers sabinoides Juniperus virginiana, Juniperus communis, and Juniperus ashei
- Lolium e. g., Sodium perenne or Lolium multiflorum
- Olea Olea europa
- Parietaria e. g., Parietariaofficitaalis or Parietaria judaica
- Paspalum e. g., Paspalum notatum
- Periplaneta e. g.,Periplafaeta americana
- Phalaris e. g., Phalaris arundinacea
- Phleum e.
- Phlegm pratense e.g., Phlegm pratense
- Plantago e. g., Plantago lanceolata
- Poa e. g.,Poa pratensis or Poa compressa
- Quercus Quercusalba
- Secale e. g., Secale cereale
- Sorghum e. g., Sorghum halepensis
- Thuya e. g., Thuya orientalis
- Triticum e. g., Triticum aestivum
- asthma refers to a disorder of the respiratory system characterized by inflammation, narrowing of the airways, and increased reactivity of the airways to inhaled agents. Asthma is frequently, although not exclusively, associated with an atopic or allergic condition. Symptoms of asthma include recurrent episodes of wheezing, breathlessness, and chest tightness, and coughing, resulting from airflow obstruction. Airway inflammation associated with asthma can be detected through observation of a number of physiological changes, such as, denudation of airway epithelium, collagen deposition beneath basement membrane, edema, mast cell activation, inflammatory cell infiltration, including neutrophils, inosineophils, and lymphocytes.
- Airflow limitations include acute bronchoconstriction, airway edema, mucous plug formation, and airway remodeling, features which often lead to bronchial obstruction.
- sub-basement membrane fibrosis may occur, leading to persistent abnormalities in lung function.
- Asthma is a complex disorder which arises at different stages in development and can be classified based on the degree of symptoms as acute, subacute or chronic.
- An acute inflammatory response is associated with an early recruitment of cells into the airway.
- the subacute inflammatory response involves the recruitment of cells as well as the activation of resident cells causing a more persistent pattern of inflammation.
- Chronic inflammatory response is characterized by a persistent level of cell damage and an ongoing repair process, which may result in permanent abnormalities in the airway.
- ThI immune activation refers to the activation of immune cells to express ThI -like secreted products, including certain cytokines, chemokines, and subclasses of immunoglobulin; and activation of certain immune cells.
- ThI -like secreted products include, for example, the cytokines IFN-[gamma], IL-2, IL-12, IL- 18, TNF-[alpha], and the chemokine IP-IO (CXCLlO).
- ThI immune activation stimulates secretion of IgG2a.
- ThI immune activation also may include activation of NK cells and dendritic cells, i.e., cells involved in cellular immunity. ThI immune activation is believed to counter-regulate Th2 immune activation.
- Th2 immune activation refers to the activation of immune cells to express Th2-like secreted products, including certain cytokines and subclasses of immunoglobulin. Th2-like secreted products include, for example, the cytokines IL-4 and IL-10. In the mouse, Th2 immune activation stimulates secretion of IgGl and IgE. Th2 immune activation is believed to counter-regulate ThI immune activation.
- the pharmaceutical compositions in accordance with the invention may allow to treat asthma by stimulating TLR activity and particularly TLR7 and/or TLR9 activity and thus to channel Th2 activity to ThI activity.
- the compounds and pharmaceutical compositions of the invention are also useful for redirecting an immune response from a Th2 immune response to a ThI immune response. Redirection of an immune response from a Th2 to a ThI immune response can be assessed by measuring the levels of cytokines produced in response to the nucleic acid (e. g., by inducing monocytic cells and other cells to produce ThI cytokines, including IL-12,IFN-y and GM-CSF).
- compositions of the present invention can comprise pharmaceutically active compounds for treating asthma, cancer etc. even if these compounds are not antigens useful for vaccination.
- chemotherapy refers to therapy using chemical and/or biological agents to attack cancer cells. Unlike localized surgery or radiation, chemotherapy is generally administered in a systemic fashion and thus toxicity to normal tissues is a major concern. Because many chemotherapy agents target cancer cells based on their proliferative profiles, tissues such as the gastrointestinal tract and the bone marrow which are normally proliferative are also susceptible to the effects of the chemotherapy.
- myelo suppression including anemia, neutropenia and thrombocytopenia
- Cancer medicaments function in a variety of ways. Some cancer medicaments work by targeting physiological mechanisms that are specific to tumor cells. Examples include the targeting of specific genes and their gene products (i.e., proteins primarily) which are mutated in cancers.
- Such genes include but are not limited to oncogenes (e.g., Ras, Her2, bcl-2), tumor suppressor genes (e.g., EGF, p53, Rb), and cell cycle targets (e.g., CDK4, p21, telomerase).
- Cancer medicaments can alternately target signal transduction pathways and molecular mechanisms which are altered in cancer cells. Targeting of cancer cells via the epitopes expressed on their cell surface is accomplished through the use of monoclonal antibodies. This latter type of cancer medicament is generally referred to herein as immunotherapy.
- cancer medicaments target cells other than cancer cells.
- some medicaments prime the immune system to attack tumor cells (i.e., cancer vaccines).
- Still other medicaments called angiogenesis inhibitors, function by attacking the blood supply of solid tumors. Since the most malignant cancers are able to metastasize (i.e., exit the primary tumor site and seed a another site, thereby forming a secondary tumor), medicaments that impede this metastasis are also useful in the treatment of cancer.
- Angiogenic mediators include basic FGF, VEGF, angiopoietins, angiostatin, endostatin, TNF-[alpha], TNP-470, thrombospondin-1, platelet factor 4, CAI, and certain members of the integrin family of proteins.
- a metalloproteinase inhibitor which inhibits the enzymes used by the cancer cells to exist the primary tumor site and extravasate into another tissue.
- anti-cancer agents and, equivalently, chemotherapeutic agents or chemotherapy agents
- Chemotherapeutic agents encompass both chemical and biological agents. These agents function to inhibit a cellular activity upon which the cancer cell is dependent for continued survival. Categories of chemotherapeutic agents include alkylating/alkaloid agents, antimetabolites, hormones or hormone analogs, and miscellaneous antineoplastic drugs. Most if not all of these agents are directly toxic to cancer cells and do not require immune stimulation. Combination chemotherapy and immunostimulatory nucleic acid administration increases the maximum tolerable dose of chemotherapy
- chemotherapeutic agents which can be used according to the invention include
- Aminoglutethimide Amsacrine (m- AMSA), Asparaginase, Azacitidine,
- MGBG Mitotane
- MitoxantroneHCl Octreotide
- Paclitaxel Pentostatin (2'deoxycoformycin)
- Plicamycin ProcarbazineHCl
- Semustine methyl- CCNU
- Streptozotocin Teamoxifen citrate
- Teniposide VM-26
- Thioguanine Thiotepa
- Vinblastine sulfate Vinblastine sulfate
- Vindesine sulfate Monoclonal antibodies such as Rituxan, Avastin or Herceptin are also covered by the term anti-cancer agents.
- Infection medicaments include but are not limited to anti-bacterial agents, anti- viral agents, anti-fungal agents and anti-parasitic agents.
- Phrases such as “anti-infective agent”, “antibiotic”, “anti-bacterial agent”, “anti-viral agent”, “anti-fungal agent”, “anti-parasitic agent” and “parasiticide” have well-established meanings to those of ordinary skill in the art and are defined in standard medical texts. Briefly, antibacterial agents kill or inhibit bacteria, and include antibiotics as well as other synthetic or natural compounds having similar functions.
- Anti- viral agents can be isolated from natural sources or synthesized and are useful for killing or inhibiting viruses.
- Anti-fungal agents are used to treat superficial fungal infections as well as opportunistic and primary systemic fungal infections.
- Anti-parasite agents kill or inhibit parasites.
- Many antibiotics are low molecular weight molecules which are produced as secondary metabolites by cells, such as microorganisms. In general, antibiotics interfere with one or more functions or structures which are specific for the microorganism and which are not present in host cells.
- Antibacterial antibiotics which are effective for killing or inhibiting a wide range of bacteria are referred to as broad-spectrum antibiotics.
- Other types of antibacterial antibiotics are predominantly effective against the bacteria of the class gram-positive or gram-negative. These types of antibiotics are referred to as narrow-spectrum antibiotics.
- Other antibiotics which are effective against a single organism or disease and not against other types of bacteria, are referred to as limited-spectrum antibiotics.
- Anti-bacterial agents are sometimes classified based on their primary mode of action.
- anti-bacterial agents are cell wall synthesis inhibitors, cell membrane inhibitors, protein synthesis inhibitors, nucleic acid synthesis or functional inhibitors, and competitive inhibitors.
- Cell wall synthesis inhibitors inhibit a step in the process of cell wall synthesis, and in general in the synthesis of bacterial peptidoglycan.
- Cell wall synthesis inhibitors include [beta] -lactam antibiotics, natural penicillins, semisynthetic penicillins, ampicillin, clavulanic acid, cephalosporins, and bacitracin.
- the [beta] -lactams are antibiotics containing a four-membered [beta] -lactam ring which inhibits the last step of peptidoglycan synthesis, [beta] -lactam antibiotics can be synthesized or natural.
- the [beta]-lactam antibiotics produced by penicillium are the natural penicillins, such as penicillin G or penicillin V. These are produced by fermentation of Penicillium chrysogenum.
- the natural penicillins have a narrow spectrum of activity and are generally effective against Streptococcus, Gonococcus, and Staphylococcus.
- Other types of natural penicillins, which are also effective against gram-positive bacteria include penicillins F, X, K, and O.
- Semi- synthetic penicillins are generally modifications of the molecule 6- aminopenicillanic acid produced by a mold.
- the 6-aminopenicillanic acid can be modified by addition of side chains which produce penicillins having broader spectrums of activity than natural penicillins or various other advantageous properties.
- Some types of semi- synthetic penicillins have broad spectrums against gram-positive and gram-negative bacteria, but are inactivated by penicillinase. These semi- synthetic penicillins include ampicillin, carbenicillin, oxacillin, azlocillin, mezlocillin, and piperacillin.
- Other types of semi-synthetic penicillins have narrower activities against gram-positive bacteria, but have developed properties such that they are not inactivated by penicillinase.
- Some of the broad spectrum semi-synthetic penicillins can be used in combination with [beta] -lactamase inhibitors, such as clavulanic acids and sulbactam.
- the [beta]-lactamase inhibitors do not have anti-microbial action but they function to inhibit penicillinase, thus protecting the semi- synthetic penicillin from degradation.
- Penicillin allergies are very serious and can cause death rapidly.
- cephalosporins Another type of [beta] -lactam antibiotic is the cephalosporins. They are sensitive to degradation by bacterial [beta]-lactamases, and thus, are not always effective alone. Cephalosporins, however, are resistant to penicillinase. They are effective against a variety of gram-positive and gram-negative bacteria.
- Cephalosporins include, but are not limited to, cephalothin, cephapirin, cephalexin, cefamandole, cefaclor, cefazolin, cefuroxine, cefoxitin, cefotaxime, cefsulodin, cefetamet, cefixime, ceftriaxone, cefoperazone, ceftazidine, and moxalactam.
- Bacitracin is another class of antibiotics which inhibit cell wall synthesis, by inhibiting the release of muropeptide subunits or peptidoglycan from the molecule that delivers the subunit to the outside of the membrane. Although bacitracin is effective against gram-positive bacteria, its use is limited in general to topical administration because of its high toxicity.
- Carbapenems are another broad- spectrum [beta] -lactam antibiotic, which is capable of inhibiting cell wall synthesis.
- carbapenems include, but are not limited to, imipenems.
- Monobactams are also broad-spectrum [beta]-lactam antibiotics, and include, euztreonam.
- An antibiotic produced by Streptomyces, vancomycin, is also effective against gram-positive bacteria by inhibiting cell membrane synthesis.
- anti-bacterial agents that are cell membrane inhibitors. These compounds disorganize the structure or inhibit the function of bacterial membranes.
- Polymyxin interfere with membrane function by binding to membrane phospholipids. Polymyxin is effective mainly against Gram-negative bacteria and is generally used in severe Pseudomonas infections or Pseudomonas infections that are resistant to less toxic antibiotics.
- cell membrane inhibitors include Amphotericin B and Nystatin which are antifungal agents used predominantly in the treatment of systemic fungal infections and Candida yeast infections.
- Imidazoles are another class of antibiotic that is a cell membrane inhibitor. Imidazoles are used as anti-bacterial agents as well as antifungal agents, e.g., used for treatment of yeast infections, dermatophytic infections, and systemic fungal infections. Imidazoles include but are not limited to clotrimazole, miconazole, ketoconazole, itraconazole, and fluconazole.
- Anti-bacterial agents are protein synthesis inhibitors. These compounds prevent bacteria from synthesizing structural proteins and enzymes and thus cause inhibition of bacterial cell growth or function or cell death. In general these compounds interfere with the processes of transcription or translation.
- Anti-bacterial agents that block transcription include but are not limited to Rifampins and Ethambutol.
- Rifampins which inhibit the enzyme RNA polymerase, have a broad spectrum activity and are effective against gram-positive and gram-negative bacteria as well as Mycobacterium tuberculosis.
- Ethambutol is effective against Mycobacterium tuberculosis.
- Anti-bacterial agents which block translation interfere with bacterial ribosomes to prevent mRNA from being translated into proteins.
- this class of compounds includes but is not limited to tetracyclines, chloramphenicol, the macro lides (e.g., erythromycin) and the aminoglycosides (e.g., streptomycin).
- the aminoglycosides are a class of antibiotics which are produced by the bacterium Streptomyces, such as, for instance streptomycin, kanamycin, tobramycin, amikacin, and gentamicin. Aminoglycosides have been used against a wide variety of bacterial infections caused by Gram-positive and Gram-negative bacteria. Streptomycin has been used extensively as a primary drug in the treatment of tuberculosis. Gentamicin is used against many strains of Gram-positive and Gram-negative bacteria, including Pseudomonas infections, especially in combination with Tobramycin. Kanamycin is used against many Gram-positive bacteria, including penicillin-resistant Staphylococci.
- the tetracyclines are a class of antibiotics that are broad- spectrum and are effective against a variety of gram-positive and gram-negative bacteria.
- Examples of tetracyclines include tetracycline, minocycline, doxycycline, and chlortetracycline. They are important for the treatment of many types of bacteria but are particularly important in the treatment of Lyme disease.
- Anti-bacterial agents such as the macro lides bind reversibly to the 50 S ribosomal subunit and inhibit elongation of the protein by peptidyl transferase or prevent the release of uncharged tRNA from the bacterial ribosome or both.
- These compounds include erythromycin, roxithromycin, clarithromycin, oleandomycin, and azithromycin.
- chloramphenicol Another type of translation inhibitor is chloramphenicol.
- Chloramphenicol binds the 70 S ribosome inhibiting the bacterial enzyme peptidyl transferase thereby preventing the growth of the polypeptide chain during protein synthesis.
- One serious side effect associated with chloramphenicol is aplastic anemia. Aplastic anemia develops at doses of chloramphenicol which are effective for treating bacteria in a small proportion (1/50,000) of patients.
- Some anti-bacterial agents disrupt nucleic acid synthesis or function, e.g., bind to DNA or RNA so that their messages cannot be read.
- These include but are not limited to quinolones and co-trimoxazole, both synthetic chemicals and rifamycins, a natural or semi-synthetic chemical.
- the quinolones block bacterial DNA replication by inhibiting the DNA gyrase, the enzyme needed by bacteria to produce their circular DNA. They are broad spectrum and examples include norfloxacin, ciprofloxacin, enoxacin, nalidixic acid and temafloxacin.
- Nalidixic acid is a bactericidal agent that binds to the DNA gyrase enzyme (topoisomerase) which is essential for DNA replication and allows supercoils to be relaxed and reformed, inhibiting DNA gyrase activity.
- the main use of nalidixic acid is in treatment of lower urinary tract infections (UTI) because it is effective against several types of Gram-negative bacteria such as E. coli, Enterobacter aerogenes, K. pneumoniae and Proteus species which are common causes of UTI.
- UTI lower urinary tract infections
- Co-trimoxazole is a combination of sulfamethoxazole and trimethoprim, which blocks the bacterial synthesis of folic acid needed to make DNA nucleotides.
- Rifampicin is a derivative of rifamycin that is active against Gram-positive bacteria (including Mycobacterium tuberculosis and meningitis caused by Neisseria meningitidis) and some Gram-negative bacteria. Rifampicin binds to the beta subunit of the polymerase and blocks the addition of the first nucleotide which is necessary to activate the polymerase, thereby blocking mRNA synthesis.
- Another class of anti-bacterial agents is compounds that function as competitive inhibitors of bacterial enzymes.
- the competitive inhibitors are mostly all structurally similar to a bacterial growth factor and compete for binding but do not perform the metabolic function in the cell.
- These compounds include sulfonamides and chemically modified forms of sulfanilamide which have even higher and broader antibacterial activity.
- the sulfonamides e.g., gantrisin and trimethoprim
- Anti- viral agents are compounds which prevent infection of cells by viruses or replication of the virus within the cell. There are many fewer antiviral drugs than antibacterial drugs because the process of viral replication is so closely related to DNA replication within the host cell, that non-specific antiviral agents would often be toxic to the host. There are several stages within the process of viral infection which can be blocked or inhibited by antiviral agents. These stages include, attachment of the virus to the host cell (immunoglobulin or binding peptides), uncoating of the virus (e.g. amantadine), synthesis or translation of viral mRNA (e.g. interferon), replication of viral RNA or DNA (e.g. nucleoside analogues), maturation of new virus proteins (e.g. protease inhibitors), and budding and release of the virus.
- attachment of the virus to the host cell immunoglobulin or binding peptides
- uncoating of the virus e.g. amantadine
- synthesis or translation of viral mRNA e
- nucleoside analogues are synthetic compounds which are similar to nucleosides, but which have an incomplete or abnormal deoxyribose or ribose group. Once the nucleoside analogues are in the cell, they are phosphorylated, producing the triphosphate form which competes with normal nucleotides for incorporation into the viral DNA or
- Nucleoside analogues include, but are not limited to, acyclovir (used for the treatment of herpes simplex virus and varicella- zoster virus), gancyclovir (useful for the treatment of cytomegalovirus), idoxuridine, ribavirin (useful for the treatment of respiratory syncitial virus), dideoxyinosine, dideoxycytidine, and zidovudine (azidothymidine).
- interferons are cytokines which are secreted by virus-infected cells as well as immune cells.
- the interferons function by binding to specific receptors on cells adjacent to the infected cells, causing the change in the cell which protects it from infection by the virus, [alpha] and [beta] -interferon also induce the expression of Class I and Class II MHC molecules on the surface of infected cells, resulting in increased antigen presentation for host immune cell recognition, [alpha] and [beta]- interferons are available as recombinant forms and have been used for the treatment of chronic hepatitis B and C infection.
- Immuno globulin therapy is used for the prevention of viral infection.
- Immunoglobulin therapy for viral infections is different from bacterial infections, because rather than being antigen-specific, the immunoglobulin therapy functions by binding to extracellular virions and preventing them from attaching to and entering cells which are susceptible to the viral infection.
- the therapy is useful for the prevention of viral infection for the period of time that the antibodies are present in the host.
- immunoglobulin therapies there are two types of immunoglobulin therapies, normal immune globulin therapy and hyper-immune globulin therapy.
- Normal immune globulin therapy utilizes a antibody product which is prepared from the serum of normal blood donors and pooled.
- Hyper- immune globulin therapy utilizes antibodies which are prepared from the serum of individuals who have high titers of an antibody to a particular virus. Those antibodies are then used against a specific virus.
- hyper- immune globulins examples include zoster immune globulin (useful for the prevention of varicella in immunocompromised children and neonates), human rabies immune globulin (useful in the post-exposure prophylaxis of a subject bitten by a rabid animal), hepatitis B immune globulin (useful in the prevention of hepatitis B virus, especially in a subject exposed to the virus), and RSV immune globulin (useful in the treatment of respiratory syncitial virus infections).
- Anti- fungal agents are useful for the treatment and prevention of infective fungi. Anti- fungal agents are sometimes classified by their mechanism of action. Some anti-fungal agents function as cell wall inhibitors by inhibiting glucose synthase. These include, but are not limited to, basiungin/ECB. Other anti-fungal agents function by destabilizing membrane integrity. These include, but are not limited to, imidazoles, such as clotrimazole, sertaconzole, fluconazole, itraconazole, ketoconazole, miconazole, and voriconacole, as well as FK 463, amphotericin B, BAY 38-9502, MK 991, pradimicin, UK 292, butenafine, and terbinafine. Other anti- fungal agents function by breaking down chitin (e.g., chitinase) or immunosuppression (501 cream).
- chitin e.g., chitinase
- immunosuppression
- Parasiticides are agents that kill parasites directly. Such compounds are known in the art and are generally commercially available. Examples of parasiticides useful for human administration include but are not limited to albendazole, amphotericin B, benznidazole, bithionol, chloroquine HCl, chloroquine phosphate, clindamycin, dehydroemetine, diethylcarbamazine, diloxamide furoate, eflornithine, furazolidaone, glucocorticoids, halofantrine, iodoquinol, ivermectin, mebendazole, mefloquine, meglumine antimoniate, melarsoprol, metrifonate, metronidazole, niclosamide, nifurtimox, oxamniquine, paromomycin, pentamidine isethionate, piperazine, praziquantel, primaquine phosphate,
- Anti asthma compounds also referred to as asthma medicaments” include, but are not limited, PDE-4 inhibitors, bronchodilator/beta-2 agonists, K+ channel openers, VLA-4 antagonists, neurokin antagonists, thromboxane A2 (TXA2) synthesis inhibitors, xanthines, arachidonic acid antagonists, 5 lipoxygenase inhibitors, TXA2 receptor antagonists, TXA2 antagonists, inhibitor of 5-lipox activation proteins, and protease inhibitors.
- PDE-4 inhibitors bronchodilator/beta-2 agonists, K+ channel openers, VLA-4 antagonists, neurokin antagonists, thromboxane A2 (TXA2) synthesis inhibitors, xanthines, arachidonic acid antagonists, 5 lipoxygenase inhibitors, TXA2 receptor antagonists, TXA2 antagonists, inhibitor of 5-lipox activation proteins, and protease inhibitors.
- Bronchodilator/[beta]2 agonists are a class of compounds which cause bronchodilation or smooth muscle relaxation.
- Bronchodilator/[beta]2 agonists include, but are not limited to, salmeterol, salbutamol, albuterol, terbutaline, D2522/formoterol, fenoterol, bitolterol, pirbuerol methylxanthines and orciprenaline.
- Long-acting [beta]2 agonists and bronchodilators are compounds which are used for long-term prevention of symptoms in addition to the anti- inflammatory therapies.
- Long-acting [beta]2agonists include, but are not limited to, salmeterol and albuterol.
- Methylxanthines including for instance theophylline, have been used for long-term control and prevention of symptoms. These compounds cause bronchodilation resulting from phosphodiesterase inhibition and likely adenosine antagonism.
- Anti-allergy medicaments include, but are not limited to, anti-histamines, steroids, and prostaglandin inducers.
- Anti-histamines are compounds which counteract histamine released by mast cells or basophils. These compounds are well known in the art and commonly used for the treatment of allergy.
- Anti-histamines include, but are not limited to, astemizole, azelastine, betatastine, buclizine, ceterizine, cetirizine analogues, CS 560, desloratadine, ebastine, epinastine, fexofenadine, HSR 609, levocabastine, loratidine, mizolastine, norastemizole, terfenadine, and tranilast.
- the asthma/allergy medicaments also include steroids and immunomodulators.
- the steroids include, but are not limited to, beclomethasone, fluticasone, triamcinolone, budesonide, corticosteroids and budesonide.
- Corticosteroids include, but are not limited to, beclomethasome dipropionate, budesonide, flunisolide, fluticaosone propionate, and triamcinolone acetonide.
- the compounds of the invention and the pharmaceutical compositions comprising these compounds can be used for inhibiting the immune system if the backbone of the compounds primarily comprises analogues of a phosphate bridging group.
- SLE systemic lupus erythematosus
- autoimmune diseases such as acute disseminated encephalomyelitis (ADEM), Addison's disease, ankylosing spondylitisis, antiphospho lipid antibody syndrome (APS), aplastic anemia, autoimmune hepatitis, autoimmune oophoritis, coeliac disease, Crohn's disease, diabetes mellitus, Goodpasture's syndrome, Grave's disease, Guillain-Barre syndrome (GBS), Hashimoto's disease, Idiopathic thrombocytopenic purpura, Kawasaki's disease, multiple sclerosis (MS), opsoclonus myoclonus syndrome (OMS), optic neuritis, Ord's thyroiditis, Pemphigus, pernicious anaemia, primary biliary cirrhosis, rheumatoid arthritis, Reiter's syndrome, Sjogren's syndrome, Takayasu's arteritis,
- ADAM acute disseminated encephalomye
- the compounds and pharmaceutical compositions of the invention can be administered by any suitable route for administering medications.
- a variety of administration routes are available. The particular mode selected will depend, of course, upon the particular agent or agents selected, the particular condition being treated, and the dosage required for therapeutic efficacy.
- the methods of this invention may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of an immune response without causing clinically unacceptable adverse effects. Preferred modes of administration are discussed herein.
- a pharmaceutically effective amount of compounds of the invention (and other therapeutic agent) can be administered to a subject by any mode that delivers the agent to the desired surface, e.g., mucosal, systemic.
- Administering the pharmaceutical composition of the present invention may be accomplished by any means known to the skilled artisan.
- Routes of administration include but are not limited to oral, parenteral, intravenous, intramuscular, intranasal, sublingual, intratracheal, inhalation, subcutaneous, ocular, vaginal, and rectal.
- such compounds are preferably inhaled, ingested or administered by systemic routes.
- Systemic routes include oral and parenteral.
- Inhaled medications are preferred in some embodiments because of the direct delivery to the lung, the site of inflammation, primarily in asthmatic patients.
- Several types of devices are regularly used for administration by inhalation. These types of devices include metered dose inhalers (MDI), breath-actuated MDI, dry powder inhaler (DPI), spacer/holding chambers in combination with MDI, and nebulizers.
- MDI metered dose inhalers
- DPI dry powder inhaler
- spacer/holding chambers in combination with MDI and nebul
- the therapeutic agents of the invention may be delivered to a particular tissue, cell type, or to the immune system, or both, with the aid of a vector.
- a "vector" is any vehicle capable of facilitating the transfer of the compositions to the target cells.
- the vector generally transports the compounds and/or pharmaceutical compositions of the invention (and potentially disorder- specific medicaments) to the target cells with reduced degradation relative to the extent of'degradation that would result in the absence of the vector.
- the vectors useful in the invention are divided into two classes: biological vectors and chemical/physical vectors.
- Biological vectors and chemical/physical vectors are useful in the delivery and/or uptake of therapeutic agents of the invention.
- chemical/physical vectors may be used to deliver therapeutic agents including the compounds of the invention as well as antibodies, antigens, and disorder-specific medicaments.
- a "chemical/physical vector” refers to a natural or synthetic molecule, other than those derived from bacteriological or viral sources, capable of delivering the nucleic acid and/or other medicament.
- a preferred chemical/physical vector of the invention is a colloidal dispersion system.
- Colloidal dispersion systems include lipid-based systems including oil-in- water emulsions, micelles, mixed micelles, and liposomes.
- a preferred colloidal system of the invention is a liposome or a transfersome.
- Liposomes are artificial membrane vessels which are useful as a delivery vector in vivo or in vitro. It has been shown that large unilamellar vesicles (LUVs), which range in size from 0.2-4.0 [mu]m can encapsulate large macromolecules. RNA, DNA and intact virions can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form. Fraley et al. (1981) Trends Biochem Sci 6:77.
- Liposomes may be targeted to a particular tissue by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glyco lipid, or protein.
- Ligands which may be useful for targeting a liposome to an immune cell include, but are not limited to: intact or fragments of molecules which interact with immune cell specific receptors and molecules, such as antibodies, which interact with the cell surface markers of immune cells. Such ligands may easily be identified by binding assays well known to those of skill in the art.
- the liposome may be targeted to the cancer by coupling it to a one of the immunotherapeutic antibodies discussed earlier.
- the vector may be coupled to a nuclear targeting peptide, which will direct the vector to the nucleus of the host cell.
- Lipid formulations for transfection are commercially available from QIAGEN, for example, as EFFECTENE(TM) (a non-liposomal lipid with a special DNA condensing enhancer) and SUPERFECT(TM) (a novel acting dendrimeric technology).
- EFFECTENE(TM) a non-liposomal lipid with a special DNA condensing enhancer
- SUPERFECT(TM) a novel acting dendrimeric technology
- Liposomes are commercially available from Gibco BRL, for example, as LIPOFECTIN(TM) and LIPOFECTACE(TM), which are formed of cationic lipids such as N-[I -(2,3 dioleyloxy)-propyl]-N,N,N-trimethylammonium chloride (DOTMA) and dimethyl dioctadecylammonium bromide (DDAB).
- LIPOFECTIN(TM) and LIPOFECTACE(TM) which are formed of cationic lipids such as N-[I -(2,3 dioleyloxy)-propyl]-N,N,N-trimethylammonium chloride (DOTMA) and dimethyl dioctadecylammonium bromide (DDAB).
- DOTMA N-[I -(2,3 dioleyloxy)-propyl]-N,N,N-trimethylammonium chloride
- DDAB dimethyl dioctadecylam
- charged lipid refers to a lipid species having either a cationic charge or negative charge or which is a zwitterion which is not net neutrally charged, and generally requires reference to the pH of the solution in which the lipid is found.
- cationic charged lipids which may be used, at physiological pH include, but are not limited to, N,N-dioleyl-N,N-dimethylammonium chloride ("DODAC”); N- (2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (“DOTMA”); N 5 N- distearyl-N,N-dimethylammonium bromide (“DDAB”); N-(2,3-dioleyloxy)propyl)- N,N,N-trimethylammonium chloride (“DOTAP”); 3[beta]-(N-(N',N'- dimethylaminoethane)-carbamoyl)cholesterol (“DC-Choi”) and N-(1, 2- dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium bromide (“DMRIE”).
- DODAC N,N-dioleyl-N
- catioinic lipids are available which can be used in the present invention. These include, for example, Lipofectin(TM) (commercially available cationic liposomes comprising DOTMA and l,2-dioleoyl-sn-3-phosphoethanolamine ("DOPE”), from GIBCO/BRL, Grand Island, N.Y., USA); Lipofectamine(TM) (commercially available cationic liposomes comprising N-(l-(2,3-dioleyloxy)propyl)-N-(2-(sperminecarboxamido)ethyl)-N,N- dimethylammonium trifluoroacetate (“DOSPA”) and DOPE from GIBCO/BRL); and Transfectam(TM) (commercially available cationic lipids comprising dioctadecylamidoglycyl carboxyspermine ("DOGS”) in ethanol from Promega Corp., Madison, Wis., USA).
- DOPE l,2-dio
- Anionic charged lipids at physiological pH include, but are not limited to, phosphatidyl inositol, phosphatidyl serine, phosphatidyl glycerol, phosphatidic acid, diphosphatidyl glycerol, poly(ethylene glycol)-phosphatidyl ethanolamine, dimyristoylphosphatidyl glycerol, dioleoylphosphatidvl glycerol, dilauryloylphosphatidyl glycerol, dipalmitoylphosphatidyl glycerol, distearyloylphosphatidyl glycerol, dimyristoyl phosphatic acid, dipalmitoyl phosphatic acid, dimyristoyl phosphatidyl serine, dipalmitoyl phosphatidyl serine, brain phosphatidyl serine, and the like.
- neutral lipid refers to any of a number of lipid species which exist either in an uncharged or neutral zwitterionic form a physiological pH.
- lipids include, for example, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, cephalin, cholesterol, cerebrosides and diacylglycerols
- Preferred cationic lipids which may not only be used for formation of liposomes include DOTAP, lipofectamine, DODAP, DODMA, DMDMA, DC-Choi, DDAB, DODAC, DMRIE, DOPSA and DOGS.
- the vehicle is a biocompatible microparticle or implant that is suitable for implantation or administration to the mammalian recipient.
- bioerodible implants that are useful in accordance with this method are described in PCT International application no. PCT/US/03307 (Publication No. WO95/24929, entitled “Polymeric Gene Delivery System”.
- PCT/US/0307 describes a biocompatible, preferably biodegradable polymeric matrix for containing an exogenous gene under the control of an appropriate promoter. The polymeric matrix can be used to achieve sustained release of the therapeutic agent in the subject.
- the polymeric matrix preferably is in the form of a microparticle such as a microsphere (wherein the nucleic acid and/or the other therapeutic agent is dispersed throughout a solid polymeric matrix) or a microcapsule (wherein the nucleic acid and/or the other therapeutic agent is stored in the core of a polymeric shell).
- Other forms of the polymeric matrix for containing the therapeutic agent include films, coatings, gels, implants, and stents.
- the size and composition of the polymeric matrix device is selected to result in favorable release kinetics in the tissue into which the matrix is introduced.
- the size of the polymeric matrix further is selected according to the method of delivery which is to be used, typically injection into a tissue or administration of a suspension by aerosol into the nasal and/or pulmonary areas.
- the polymeric matrix and the nucleic acid and/or the other therapeutic agent are encompassed in a surfactant vehicle.
- the polymeric matrix composition can be selected to have both favorable degradation rates and also to be formed of a material which is bioadhesive, to further increase the effectiveness of transfer when the matrix is administered to a nasal and/or pulmonary surface that has sustained an injury.
- the matrix composition also can be selected not to degrade, but rather, to release by diffusion over an extended period of time.
- the nucleic acid are administered to the subject via an implant while the other therapeutic agent is administered acutely.
- Biocompatible microspheres that are suitable for delivery, such as oral or mucosal delivery, are disclosed in Chickering et al. (1996) Biotech Bioeng 52:96-101 and Mathiowitz E et al. (1997) Nature 386:410-414 and PCT Pat. Application WO97/03702.
- Both non-biodegradable and biodegradable polymeric matrices can be used to deliver the nucleic acid and/or the other therapeutic agent to the subject.
- Biodegradable matrices are preferred.
- Such polymers may be natural or synthetic polymers.
- the polymer is selected based on the period of time over which release is desired, generally in the order of a few hours to a year or longer. Typically, release over a period ranging from between a few hours and three to twelve months is most desirable, particularly for the nucleic acid agents.
- the polymer optionally is in the form of a hydrogel that can absorb up to about 90% of its weight in water and further, optionally is cross-linked with multi-valent ions or other polymers.
- Bioadhesive polymers of particular interest include bioerodible hydrogels described by H. S. Sawhney, C. P. Pathak and J. A. Hubell in Macromolecules, (1993) 26:581-587, the teachings of which are incorporated herein.
- polyhyaluronic acids casein, gelatin, glutin, polyanhydrides, polyacrylic acid, alginate, chitosan, poly(methyl methacrylates), poly(ethyl methacrylates), poly(butylmethacrylate), poly(isobutyl methacrylate), poly(hexylmethacrylate), poly(isodecyl methacrylate), poly(lauryl methacrylate), poly(phenyl methacrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), and poly(octadecyl acrylate).
- compositions of the invention may be made from the compounds of the invention alone or they may comprise pharmaceutically acceptable excipients (being equivalent to pharmaceutically acceptable carriers). Such compositions may also be designated as formulations.
- compositions of the invention can be administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients.
- pharmaceutically acceptable carrier or “pharmaceutically acceptable excipients” means one or more compatible solid or liquid filler, diluents or encapsulating substances which are suitable for administration to a human or other vertebrate animal.
- carrier or excipients denote an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
- the components of the pharmaceutical compositions also are capable of being commingled with the compounds of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficiency.
- the compounds of the invention can be formulated readily by combining the active compound(s) with pharmaceutically acceptable carriers well known in the art.
- Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject to be treated.
- Pharmaceutical preparations for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
- Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl- cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP).
- disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
- the oral formulations may also be formulated in saline or buffers for neutralizing internal acid conditions or may be administered without any carriers.
- the compositions may take the form of tablets or lozenges formulated in conventional manner.
- the compounds for use according to the present invention may be conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
- a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
- a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
- a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide
- the compounds when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
- Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
- the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- compositions for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
- the active compounds may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
- a suitable vehicle e.g., sterile pyrogen-free water
- the compounds may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
- the compounds may also be formulated as a depot preparation.
- Such long-acting formulations may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
- compositions also may comprise suitable solid or gel phase carriers or excipients.
- suitable solid or gel phase carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
- Suitable liquid or solid pharmaceutical preparation forms are, for example, aqueous or saline solutions for inhalation, microencapsulated, encochleated, coated onto microscopic gold particles, contained in liposomes, nebulized, aerosols, pellets for implantation into the skin, or dried onto a sharp object to be scratched into the skin.
- the pharmaceutical compositions also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above.
- the pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of methods for drug delivery, see Langer R (1990) Science 249:1527-1533, which is incorporated herein by reference.
- compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing the compounds into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the compounds into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.
- Liquid dose units are vials or ampoules. Solid dose units are tablets, capsules and suppositories.
- Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the compounds, increasing convenience to the subject and the physician.
- Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer base systems such as poly(lactide-glycolide), copolyoxalates, polycapro lactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Pat. No. 5,075,109.
- Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono-, di-, and tri-glycerides; hydrogel release systems; silastic systems; peptide-based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like.
- lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono-, di-, and tri-glycerides
- hydrogel release systems silastic systems
- peptide-based systems such as those described in U.S. Pat. Nos. 4,452,775, 4,675,189, and 5,736,152
- diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Pat. Nos. 3,854,480, 5,133,974 and 5,407,686.
- pump-based hardware delivery systems can be used, some of which are adapted
- DC dendritic cells
- mice C57BL/6 WT mice (commercially available from Jackson Laboratories), TLR9- and TLR7-deficient mice (provided by Dr. Akira, Osaka University, Osaka, Japan), MyD88-def ⁇ cient mice (Dr. Akira) and male IRF7-deficient mice (provided by T. Taniguchi, Tokyo, Japan). All mice were on C57BL6 genetic background.
- Flt3-L-dependent dendritic cells Flt3 DC
- mouse bone marrow cells were isolated and treated as previously described (Spies B. et al (2003) J. Immunol. 171 :5908-5912).
- bone marrow cells were harvested from femurs and tibias of mice and cultured in the presence of recombinant murine Flt3-ligand (WEHI, Melbourne, Australia) for 8 days in complete RPMI medium (RPMI 1640 with L-glutamine, heat inactivated 10% FCS, 100 ⁇ g/ml streptomycin and 50 ⁇ M 2- ME; all from PAA Laboratories).
- a mixture of conventional DC (cDC) and plasmacytoid DC (pDC) was used for the in vitro cell culture experiments.
- cDC conventional DC
- pDC plasmacytoid DC
- the Flt3-L DC cultures obtained as described above were analysed on a FACS Calibur flow cytometer (BD Biosciences) for the relative percentages of cDC and pDC and the respective DC activation status by staining with monoclonal antibodies specific for CDl Ic, CD45 RA, B220, CDl Ib and CD62L.
- the resulting cells were > 90% CDl Ic positive, and 30-40% of the cells displayed a plasmacytoid phenotype (CDl lc pos , CD45 RA hlgh , B220 hlgh , CDl lb low ).
- DC containing about 60% cDC and 40% pDC were incubated for 18 - 24 h with the respective stimulus as indicated in the bars of the respective figures.
- test compounds were obtained from: CpG A (2216), B (1826), C (1668) ODN were from Coley Pharmaceuticals. Other ODN were commercially synthesized by TIB Molbiol.
- PD/PS 2-deoxyribose 20mer also referred to as DRS/ DRS S
- DNA/RNA hybrid molecules and ODN 5Mabelled with Cy3 or Cy5 were from IBA GmbH.
- 2-deoxyribose-5 -phosphate monomer was from Sigma- Aldrich.
- API non-CpG: GCTTGATGACTCAGCCGGAA
- API 44pA A 44 poly- A nucleotide sequence conjugated to the 3" end of API
- API 44pG A 44 poly-G nucleotide sequence conjugated to the 3" end of API
- pTC (non-CpG): TCTCTCTCTCTCTCTCTCTCT pTC 44pA: A 44 poly- A nucleotide sequence conjugated to the 3" end of pTC
- pTC 44pG A 44 poly-G nucleotide sequence conjugated to the 3" end ofpTC
- API Ribose base sequence of API, but on an RNA-backbone
- API Ribose + 24pG-DNA A 24 poly-G nucleotide sequence conjugated to the 3" end of API Ribose
- LPS lipopolysaccharide
- FAM-DRS 20mer deoxy-RiboSpacer (5 ⁇ -FAM-labeled and 3'-OH)
- DRS S / PS 2-deoxyribose 20mer deoxy-RiboSpacer (5' and 3' OH) with PTO- modifications between all units Stimulation of dendritic cells (DC) derived from mouse bone marrow
- cytokine induction For measurement of cytokine induction, culture supernatants were collected for analysis by enzyme-linked immunoabsorbant assay (ELISA) specific for mouse IL-6 (BD Biosciences) and mouse IFN alpha [compiled from rat anti-mouse interferon alpha antibody (Tebu-Bio), rabbit anti- mouse interferon alpha antibody (Tebu-Bio), POX-donkey anti-rabbit IgG antibody (Jackson)]] and mouse IL12-p40.
- ELISA enzyme-linked immunoabsorbant assay
- mouse IFN alpha compiled from rat anti-mouse interferon alpha antibody (Tebu-Bio), rabbit anti- mouse interferon alpha antibody (Tebu-Bio), POX-donkey anti-rabbit IgG antibody (Jackson)]] and mouse IL12-p40.
- ELISA enzyme-linked immunoabsorbant assay
- test compounds were complexed to DOTAP or to lipofectamine
- the following protocols were used: Complexes of test compounds with DOTAP (Roche) were prepared according to the manufacturer's instructions. In brief, the indicated amount of test compound in 50 ⁇ l Opti-MEM (Gibco) were combined with 10 ⁇ g DOTAP in 50 ⁇ l Opti-MEM. After 15 min incubation at room temperature, the complexes were added to the cells.
- Complexes of test compounds with lipofectamine (Invitrogen) were prepared according to the manufacturer's instructions. In brief, the indicated amount of test compound in 50 Opti-MEM were combined with 10 ⁇ g lipofectamine in 50 ⁇ l Opti-MEM. After 15 min incubation at room temperature, the complexes were added to the cells.
- Antibodies used in the experiments were obtained as mentioned and from: anti- mouse B220-PE, anti-CD86-PE, anti CD 107a (Lampl) antibodies were all from BD Biosciences. Anti-mouse 120G8 (-FITC or -Biotin) antibodies were provided by Anne Krug.
- WT-DC cells were stimulated with compounds as depicted in figure 10 for 30 minutes.
- Cell lysates were prepared according to standard methods. Equal amounts of protein samples were denatured with SDS-buffer and equal volumes of the samples loaded onto a denaturing gel followed by a denaturing SDS-PAGE and transfer of the proteins to a membrane according to standard-blotting methods. Next, detection of pJNK immobilized on the membrane was performed using standard methods [1. antibody: anti-pJNK antibody (Cell Signaling, MA,USA), 2. antibody: anti-rabbit antibody-Peroxidase conjugate (Santa Cruz, USA)]. Bands were detected using luminescence.
- ODN uptake was measured as described by Roberts et al. (2005) J. Immuno.175, 3569-76.
- 0,5 x 10 6 FK3L-DC were incubated with Cy5-labelled ODN for 45 minutes in 500 ⁇ l complete RPMI.
- Harvested cells were washed with ice cold PBS, incubated with 12,5 mg/ml dextran sulphate (SIGMA) for 10 minutes on ice (to remove ODN bound to the cell surface), washed in PBS, fixed with 2% paraformaldehyde and analysed by FACS. Localization studies using confocal imaging
- hTLR9-Fc protein (human TLR9-Fc) was purified from lysates of HEK293 cells stably expressing a fusion protein containing the ectodomain of human TLR9 linked to the Fc portion of mouse IgG2a.
- Cells were grown in serum- free media (CD293, Invitrogen), harvested by centrifugation, washed twice in ice cold PBS and lysed in lysis buffer on ice [1% CHAPS, 50 mM Tris-Cl, 150 mM naCl, ImM EDTAm 10% glycerol, 12 mM 2-ME, protease inhibitors (Complete, Roche)].
- the protein was captured by protein A chromatographie (Amersham) at 4°C using automated FPLC. After extensive washing of the columns in lysis buffer, the protein was eluted by a continuous gradient from pH 7.4 to pH 3 (low pH buffer: 50 mM citric acid, pH 3, 150 niM NaCl, 1 niM EDTA, 10% glycerol, 12 niM 2-ME). The low pH was neutralised by addition of 1/10 th of the volume 1 M Tris-Cl, pH 8 into each of the fractions.
- HTLR2-Fc protein was purified as above, except that the protein was purified from supernatants of HEK293 cells growing under serum- free conditions. The cells stably expressed a fusion protein containing the ectodaomain of human TLR2 linked to the Fc portion of mouse IgG2a.
- MTLR9-Fc and mTLR2-Fc protein were obtained and purified as described in Rutz et al (2004) Eur. J. Immunol. 34, 2541-50.
- ODN binding of mTLR9ect or mTLR2ect was analyzed in a Biacore X device (Biacore AB, Uppsala, Sweden) on SA-chips at 25°C.
- the biotinylated ODN were diluted to a final concentration of 100 nM in 50 mM MES; pH 6.5, supplemented with 150 mM NaCl and 1 mM MgCl 2 (which was also used as running buffer in all SPR biosensor measurements) and bound at equimolar immobilization levels (about 1700 RU for 1668 and AP-I, about 600 RU for C3-spacer, deoxyribose and ribose) to the SA in one of the two flow cells.
- the second flow cell served as a blank control for the subtraction of nonspecific analyte binding and of bulk refractive index background.
- 45 ⁇ l of 100 nM recombinant protein in running buffer was injected into the biosensor at a flow rate of 10 ⁇ l/min. After a 300 s dissociation period, the biosensor chip was regenerated by two 5 ⁇ l- injections of a solution containing 50 niM NaOH and 1 M NaCl and extensive re-equilibration in running buffer.
- the AlphaScreen (Amplified Luminescent Proximity Homogeneous Assay) was set up as an association assay.
- TLRect-Fc protein was incubated with biotinylated ligand in 50 mM HEPES, pH 6.5, 150 mM NaCl, 5 mM EDTA, 0.1% BSA and 0.01% Tween 20 for 60 min. Subsequently, protein A coated acceptor beads and streptavidin-coated donor beads (Alphascreen beads, Perkin Elmer) were added from 5 x stock concentrations.
- mice were sacrificed and blood samples were collected by intracardial puncture. Samples were centrifuged after coagulation was complete. Serum was added for analysis by enzyme-linked immunosorbant assay.
- Example 1 Determination of the IL-6 amounts produced by WT-cells after 18 h of stimulation
- FIG. 1 shows the results of the experiment.
- 2216 is a well-known TLR9 agonist and leads to the production of IL-6.
- LPS as known TLR4 agonist also shows stimulatory effect in contrast to Imiquimod, a TLR7 agonist, which has no effect on the IL-6 production under the present experimental conditions.
- API PD leads to the production of IL-6 either in complex with DOTAP in a concentration dependent manner or with a poly G-tail, in both cases also via TLR9.
- small stimulatory effects can be observed either in complex with DOTAP or with a poly G-tail, presumably in a TLR7-dependent manner.
- 2'-O-methylated API PD does not show a stimulatory effect on the IL-6 production.
- Free DRS at a final concentration of 2 ⁇ M does not lead to the production of IL-6.
- DRS in a complex with DOTAP leads to a concentration-dependent increase in the production of IL-6.
- DRS was used in concentrations ranging from 0,01 ⁇ M to 5 ⁇ M as indicated, in each case in complex with a fixed amount of 10 ⁇ g DOTAP.
- 2 ⁇ M DRS in complex with lipofectamine shows a stimulatory effect on the production of IL-6.
- DRS in complex with DOTAP (which increases endosomal uptake) or lipofectamine (which results in cytosolic uptake) leads to the production of IL-6 in WT-DC.
- Example 2 Determination of the IFN alpha amounts produced by WT-cells after 18 h of stimulation
- DRS in complex with DOTAP or lipofectamine not only leads to the production of IL-6, but also to the production of IFN CC as central cytokine of the immune reaction in WT-DC.
- Example 3 Determination of the IL-6 amounts produced by TLR9-deficient cells after 18 h of stimulation
- Example 4 Determination of the IL-6 amounts produced by MyD88-deficient cells after 18 h of stimulation
- MyDSS "7" cells the only test compound capable of inducing IL-6 production is DRS in complex with lipofectamine (figure 4).
- MyD88 is the central adapter molecule for integrating signals of TLR-mediated pathways independent on the class of TLR-receptors. 2216 and API as known TLR9 agonists, LPS as known TLR4 agonist and API PD Ribose as TLR7 agonist do not lead to IL-6 production.
- DRS is taken up by endosomes, it is presumably also acting as TLR9 agonist and in a setup with MyD ⁇ "7" cells, no stimulatory effect can be observed.
- the lipofectamine mediated cytosolic uptake of DRS surprisingly leads to the production of IL-6.
- Example 5 Effect of pre-treatment with DNase and RNase on the production of IL-6 and effect of stimulating the cells with DRS-monomers
- Figure 5 shows the amounts of IL-6 produced under mentioned conditions. Without any DNase/ RNase treatment, there is some residual production of IL-6 when DOTAP is added to the cells in the absence of any test compound. This might be explained by the presence of "endogenous" DNA/ RNA in the medium. There is no IL-6 detectable in case lipofectamine without any test compound is present, as well as in case DRS- monomers of different concentrations and in preformed complexes with DOTAP are present.
- Example 6 Effect of pre-treatment with DNase and RNase on the production of IFN alpha and effect of stimulating the cells with DRS-monomers
- FIG. 6 shows the amounts of IFN CC produced under mentioned conditions. Without any DNase/ RNase treatment, there is again some residual production of IFN CC when DOTAP is added to the cells in the absence of any test compound. In case DRS-monomers of different concentrations and in preformed complexes with DOTAP are present, no IFN CC is produced.
- Example 7 Determination of the IL12-p40 amounts produced by WT cells after 18 h of stimulation
- Figure 7 shows the amounts of IL12-p40 produced under mentioned conditions.
- IL12-p40 represents a central molecule for linking the innate and adaptive immune response, because it is a signaling molecule for the activation of T-cells, which are part of the adaptive branch of the immune system. 2216 and 1826 S are stimulating the production of IL12-p40.
- FAM-DRS alone shows only background activity, but FAM-DRS in complex with DOTAP leads to the production of IL12-p40 in a concentration dependent manner. As before, the DRS-monomers are not capable of inducing the IL12-p40 production.
- DRS in complex with DOTAP is not only capable of inducing the production of IL-6 or IFN CC, but also of inducing the production of IL12-p40 as signaling molecule in the adaptive immune response.
- Example 8 Determination of the IL6 amounts produced by WT cells after 18 h of stimulation
- Example 9 Determination of the IL-6 amounts produced by TLR9- and MyD88- deficient cells after 18 h of stimulation
- Example 10 determination of pJNK leves after various stimuli by Westernblot
- API 6 APl-44pA
- DOTAP control 16. standard MW-marker, 72 kDA band marked
- the band pattern in figure 10 shows the expression levels of endogenous pJNK.
- the protein is present in two iso forms, which run differently in the SDS-PAGE and, therefore, two bands are detected.
- the TLR4 agonist LPS and the TLR9 agonist 1668 induce expression of pJNK.
- API alone and API with a 3 "-conjugated 24mer poly A tail do not induce expression of pJNK.
- an increase in the expression level can be observed with the 3 "-conjugated 24mer poly G tail and an even more pronounced increase can be observed with API in complex with DOTAP (lane 7).
- Lanes 8 to 11 show the corresponding expression levels for pTC under different conditions: pTC and pTC conjugated 3" to a 19mer poly A sequence do not influence pJNK- expression, whereas the molecule with the 3 "-conjugated 19mer poly G sequence and pTC in complex with DOTAP again positively influence the pJNK expression.
- Lane 12 shows the effect of adding FAM-DRS alone: Compared to the medium-control, the pJNK level is not altered. In case the FAM-DRS is applied in complex with DOTAP (see lane 14 for the DOTAP control), the pJNK level is increased.
- DRS in complex with DOTAP induces the expression of pJNK as one of the most important signaling molecules in the immune response leading to a variety of further downstream events.
- Example 11 Determination of the IL-6 and IFN alpha amounts produced by WT and TLR9-def ⁇ cient cells after 18 h of stimulation
- the unmodified PD CpG-B and PD non-CpG AP-I also translocate to "late" endosomes (Fig. 13 b). These ODN lacked interferon- inducing activity (Fig. 12 d). In contrast, 3' poly-G-extended PD ODN, which was shown to trigger TLR9- dependent IFN- ⁇ production (Fig. 12 d), colocalises with interferon- inducing CpG-A 2216 (Fig. 13 c) in LAMP-1 -negative compartments.
- Example 13 Determination of the produced IL-6 / IFN alpha amounts induced by compounds with different sugar-backbones
- the ODN PD IRS 869 and PD IRS 954 used derive from the corresponding PS- compounds, namely PS IRS 869 and PS IRS 854, both of which have been shown to be inhibitory.
- PS-type namely PS IRS 869 and PS IRS 854, both of which have been shown to be inhibitory.
- the PD non CpG AP-I activatory effect is TLR9-dependent (figure 14 b) and changing the backbone to ribose renders the effect dependent on TLR7, as already described, whereas the 2'-methylation of the ribose completely abolishes any effect (figure 14 b).
- PD 1668 (figure 14 c).
- the PD 2-deoxyribose backbone even renders TLR9 permissive for nucleic acid bases usually not present in natural DNA, as a hybrid 20mer combining a PD 2- deoxyribose backbone with uracil RNA bases (PD poly-U-2-deoxyribose) activates both TLR9 and TLR7 in a MyD88-dependent manner (Fig. 14 d).
- PD poly-U-2-deoxyribose activates both TLR9 and TLR7 in a MyD88-dependent manner.
- Fig. 14 d Exactly the same experimental setup just described for experiments analyzing IL-6 amounts (figures 14 b to l4 d) was applied for analyzing IFN alpha amounts. Those results are shown in figures 17 a to 17 c. The results correspond the those analysing the IL-6-amounts.
- Figure 15 a again shows the activatory effect of the PD-backbone in complex with DOTAP on the production of IL-6.
- PD 1668 and PD Ap-I are included in this study.
- figure 15 b the binding of murine TLR9 ectodomain (ect) to different compounds is analyzed.
- the PD-backbone displays low, but significant binding.
- the PTO modified 2'-deoxyribose clearly inhibits the production of IL-6 in a dose-dependent manner. It was used at concentrations of 0.5 and 5 mM, resp. Interestingly, the DNA sugar backbone PS 2' deoxyribose also inhibits PD RNA- mediated TLR7 activation in DCs (figure 23b; also compare figure 18).
- FIG. 16 a shows that PD CpG-B ODN without a polyG-tail is taken up by the cells (blue). Adding a 24polyG-tail, the uptake is increased (green) and corresponds to the uptake of CpG- A ODN (orange). PD non-CpG AP-I ODN (blue) cannot be detected within cells in contrast to PD non-CpG AP-I ODN with a 3'24pG tail (green) as depicted in figure 16 b.
- the ODN tested are taken up by the cells and localize to intracellular compartments, as surface-bounds molecules are washed away in the assay shown.
- Example 16 Induction of IFN alpha / IL-6 production by either pDC or mDC after stimulation of WT cells
- Example 17 Induction of IFN alpha production in WT compared to IR7-deficient cells
- IRF7 interferon regulatory factor 7
- TLR-receptor pathway 7 represents a central transcription factor for integrating signals via the TLR-receptor pathway.
- the results depicted in figure 16 d show that the IFN alpha production is not stimulated in cells lacking the central integrator IRF7.
- IL-6 production is still activated via U-APl RNA (left side of figure 18).
- IRS 661 with a PS backbone is known to inhibit TLR7. Titrating in this compound in complex with DOTAP in concentrations ranging form 0.5 ⁇ M to 5 ⁇ M also inhibits IL-6 production (right side of figure 18).
- API PS i.e. the base sequence of AP-I on a PTO-modified sugar backbone.
- the change of the backbones from the PTO-type to the PD-type leads to the opposite effect, i.e. to the increase of the production of IL-6 (right side of figure 18).
- Example 19 binding of PD deoxyribose to TLR 7 and TLR9 in comparison to binding of PS deoxyribose to TLR7 and TLR9
- the results show very high binding affinity of PTO modified 2 '-deoxyribose to TLR7 and TLR9, with TLR7 binding even better than TLR9.
- the PD modified T- deoxyribose binds to both receptors as well, but in a range of about two magnitudes lower.
- the inhibitory action of PTO modified 2 '-deoxyribose can be extended to TLR7.
- PD and PS ribose display specific low-affine binding only to hTLR7-ect but not to hTLR9-ect.
- Example 20 Competitive inhibition of TLR9 ligand binding by PS 2Meoxyribose homopolvmer
- PS 2Meoxyribose homopolvmer shows that they might function as competitive inhibitors of TLR9 and TLR7 activation.
- plasmon resonance analysis reveals dose-dependent inhibition of PD CpG-B ODN-binding to mTLR9-ect by PS 2' deoxyribose (20mer) ( Figure22a).
- PD 2' deoxyribose homopolymers exhibit low competitive effects only at very high concentrations, consistent with their comparatively low affinity to TLR9 ( Figure 22b).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Organic Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Pulmonology (AREA)
- Wood Science & Technology (AREA)
- Epidemiology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Virology (AREA)
- Biochemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention relates to compounds which are capable of modulating Toll-like receptor (TLR) activity. Compounds are of the following Formula (I).
Description
Pharmaceutical compounds comprising abasic oligonucleotides
OBJECT OF THE INVENTION
The present invention relates to compounds which are capable of modulating Toll- like receptor (TLR) activity.
BACKGROUND OF THE INVENTION
It is a fundamental characteristic of the immune system of human or animal subjects to be capable of distinguishing between "foreign" and "self molecules. This capability allows recognizing foreign invaders and to selectively fighting e.g. viral pathogens without impairing the functionality of e.g. self organs.
Toll- like receptors (TLRs) contribute to recognition of "foreign" molecules including pathogen-associated molecules of various types. These molecules may comprise carbohydrates, lipids, proteins, nucleic acids, and the like.
Most of the TLRs localize to the cell surface. However, for several of the receptors, an intracellular localization has been shown: TLR3, TLR7/8 and TLR9 localize to the intracellular endosomal compartment.
Those endosomal TLRs possess certain specificities. TLR3 recognizes dsRNA, TLR7/8 recognize ssRNA and TLR9 is believed to be activated dependent on unmethylated CpG motifs of DNA. In contrast to mammalian DNA, in which CpG- motifs are suppressed and usually methylated, bacterial and viral DNA contain many stretches of unmethylated CpG regions. Therefore, it was postulated that TLR9 acts as a receptor for unmethylated CpG-motif containing DNA which has been taken up by endosomes and thus recognizes "foreign" DNA.
This assumption seems to fit with the physiological function of TLRs. In general, TLR7 and TLR9 activate, like all TLR-receptors, the innate and, in certain cases, also the adaptive immune response. Ligand-binding presumably leads to the
stabilization of TLR dimers and further downstream signaling. Known and identified members of these downstream pathways are the mitogen activating protein kinases (MAPK) as well as NFKB. Because of the ability of the TLR-receptors to act on the immune system and its presumed capability to distinguish between foreign and self molecules, a lot of attention has been and still is drawn to compounds influencing TLR-signaling.
Such ligands may act as immunotherapeutic compounds. In certain diseases, such as cancer or infectious diseases, in which the immune system needs to be activated, agonists of TLR-signaling may be used for active treatment or vaccination. In contrast to this, antagonists of TLR-signaling may be used in diseases, in which the immune system is up-regulated despite the lack of "foreign" signal, such as in most of the autoimmune diseases (e.g., lupus erythematosus).
Most of the pre-clinical and clinical studies addressing the role of TLRs as a drug target have been and are still performed with CpG-motif containing DNA with phosphorothioate-modifϊed sugar-backbones.
While these studies have led to promising results, there remains an interest in compounds affecting the activity of TLRs.
OBJECTIVE AND SUMMARY OF THE INVENTION
It is one objective of the present invention to provide compounds and pharmaceutical preparations that allow activating and/or supporting the immune system of a human or animal subject.
It is another objective of the present invention to provide compounds and pharmaceutical preparations that allow suppressing and/or inhibiting the immune system of a human or animal subject.
It is among the further objectives of the present invention to provide methods of treatment that allow activating and/or supporting or suppressing and/or inhibiting the immune system of a human or animal subject.
These and other objectives as they will become apparent from the ensuing description are attained by the subject matter of the independent claims. The dependent claims relate to some of the preferred embodiments of the present invention.
The inventors have surprisingly found that removal of bases from known CpG oligonuleotides still allows the abasic pentose-containing oligomeric backbone structure to bind to Toll-like receptors. Dependent on whether the pentose units of the backbone structure are linked by a phosphodiester (also-called "phosphate bridging group") or an analogue thereof an activating or suppressing activity is observed.
The invention in one embodiment thus relates to a pharmaceutical composition comprising a compound having at least one structural unit according to formula (I)
- A -
3' wherein n is an integer from 4 to 99; and
X is a phosphate bridging group and/or an analogue thereof such as a phosphorothioate bridging group;
Y is selected from the group comprising hydrogen and OH; and no pyrimidine base, purine base or analogues thereof are bonded to the Ci atom of the pentose ring; and optionally at least one pharmaceutically acceptable excipient.
In one of the preferred embodiments, the structural unit may comprise in the order of 20 pentose units. Thus, n may be an integer of 5 to 49, 7 to 39, 9 to 29, 14 to 24, 15 to 23, 16 to 22, 17 to 21 18 to 20 or 19.
The phosphate bridging group may correspond to formula (II):
The phosphorothioate bridging group may correspond to formula (III):
I (III) O
S=P-O — OH
In one embodiment, the substituent Y may be selected from the group comprising hydrogen, OH, CH3, CH2CH3, OCH3 and OCH2CH3. Hydrogen and OH can be preferred.
Further, the compound may be essentially identical to the structural unit. Thus, the structural unit may have a hydrogen at its 5 ' and 3 ' end.
In one embodiment, the Ci position of the cyclic pentose unit is bonded to a hydrogen, CH3 or OCH3. Hydrogen at the Ci position can be preferred.
In one embodiment, the pharmaceutical compositions may comprise the compound in the form of its pharmaceutically acceptable salts or equally active derivates, such as the free base. Salts can include the Li, Na, K, Ca, Mg and Mn salts.
The pharmaceutical compositions may be formulated for oral, nasal, buccal, rectal , i.v., i.m., peritoneal and transdermal application. In one of the preferred embodiments the afore-described compounds can be formulated into the pharmaceutical compositions as colloidial dispersion systems. Such system may take the form of lipid-based systems including oil- in- water emulsions, micelles, liposomes and tranfersomes.
To this end the compounds may be associated with with a lipid and/or lipid-like carrier and preferably with a cationic lipid. Such cationic lipid can be selected from the group comprising DOTAP, lipofectamine, DODAP, DODMA, DMDMA, DC- Chol, DDAB, DODAC, DMRIE, DOPSA and DOGS. DOTAP can be a preferred lipid.
In one preferred embodiment of the invention, the pharmaceutical preparations will comprise compounds wherein the majority of X is a phosphate bridging group. In one even more preferred embodiment, every X will be phosphate bridging group.
Such pharmaceutical compositions can be used to activate and/or support the (innate and/or adaptive) immune system. This may be achieved by influencing the activity of TLRs and preferably of TLR7 and/or TLR9.
Such pharmaceutical compositions can also be used to treat conditions such as cancer, infections including viral, bacterial, fungal or parasitic infections, allergies and/or asthma.
In one embodiment, the pharmaceutical compositions thus comprise besides the above-mentioned compounds an antigen which can be used as a vaccine against the aforementioned conditions. In this context, the above-mentioned compounds will act inter alia as an adjuvants.
Such antigens can be selected from the group comprising cancer antigens, bacterial antigens, fungal antigens, parasitic antigens, viral antigens, herbal antigens, allergic antigens, asthmatic antigens and food antigens.
Alternatively or additionally, the pharmaceutical compositions of the present invention can comprise a pharmaceutically active compound selected from the group comprising anti-cancer compounds, anti-bacterial compounds, anti-fungal
compounds, anti-parasitic compounds, anti-viral compounds, anti-allergic compounds and anti-asthmatic compounds.
In another preferred embodiment of the invention, the pharmaceutical preparations will comprise compounds wherein the majority of bridging groups are formed by analogues of a phosphate bridging group. Preferably, the bridging group may be a phosphorothioate bridging group. In an even more preferred embodiment, every X will be an analogue of a phosphate bridging group. In such case, it can be preferred that every X is a phosphorothioate bridging group. Other analogues of phosphate bridging groups which can be used to achieve an effect as attained by phosphorothioate bridging groups are mentioned below.
Such pharmaceutical compositions can be used to suppress and/or inhibit the (innate and/or adaptive) immune system. This may be achieved by influencing the activity of TLRs and preferably o f TLR7 and/or TLR9.
These compositions can therefore be used to treat autoimmune diseases including lupus eyrthematosus.
The compounds and pharmaceutical preparations as mentioned before and hereinafter can be used in the manufacture of a medicament.
Such medicaments in general can be used in conditions resulting from and/or afflicted by an alteration of TLR activity and preferably of TLR7 and/or TLR9 activity.
In one embodiment, the present invention thus relates to the use of a pharmaceutical compound having at least one structural unit according to formula (I)
wherein 3' n is an integer from 4 to 99;
X is a phosphate bridging group and/or an analogue thereof such as a phosphorothioate with the majority being phosphate bridging groups;
Y is selected from the group comprising hydrogen and OH; and no pyrimidine base, purine base or analogues thereof are bonded to the Ci atom of the pentose ring; in the manufacture of a medicament for activating and/or supporting an immune response.
In this aspect of the invention, the medicament may be suitable for treating conditions comprising cancer, infections including viral, bacterial, fungal or parasitic infections, allergies and/or asthma. To this end the medicament may comprise the aforementioned antigens and additionally or alternatively at least one pharmaceutically active compound selected from the group comprising anti-cancer compounds, anti-bacterial compounds, anti-fungal compounds, anti-parasitic compounds, anti-viral compounds, anti-allergic compounds and anti-asthmatic compounds.
In another embodiment, the present invention relates to the use of a pharmaceutical compound having at least one structural unit according to formula (I)
3' wherein n is an integer from 4 to 99;
X is a phosphate bridging and/or an analogue thereof such as a phosphorothioate bridging group with the majority being analogue bridging groups;
Y is selected from the group comprising hydrogen and OH; and no pyrimidine base, purine base or analogues thereof are bonded to the Ci atom of the pentose ring; in the manufacture of a medicament for suppressing and/or inhibiting an immune response.
Such medicaments can preferably be used to treat autoimmune diseases such as lupus erythematosus.
In other embodiments, the present invention relates to methods of treating human or animal subjects with the aforementioned pharmaceutical compositions and compounds.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1: Influence of various compounds on the IL-6 production of Flt3L-WT cells.
WT Flt3L-DCs (lxlO6/well) were incubated for 18h with indicated amounts of compounds. The amount of DOTAP was always 10 μg and the concentration of the corresponding compound complexed with DOTAP was tested over a range as indicated. IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
Figure 2: Influence of various compounds on the IFN alpha production of FU3L-WT cells.
WT Flt3L-DCs (lxlO6/well) were incubated for 18h with indicated amounts of compounds. The amount of DOTAP was always 10 μg and the concentration of the corresponding compound complexed with DOTAP was tested over a range as indicated. IFN alpha levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
Figure 3: Influence of various compounds on the IL-6 production of Flt3L- TLR9 ' cells. TLR9"7" Flt3 L-DCs (lxlO6/well) were incubated for 18h with indicated amounts of compounds. The amount of DOTAP was always 10 μg and the concentration of the corresponding compound complexed with DOTAP was tested over a range as indicated. IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
Figure 4: Influence of various compounds on the IL-6 production of Flt3L- MyD88 -'- cells.
MyDSδ"7" Flt3 L-DCs (lxlO6/well) were incubated for 18h with indicated amounts of compounds. The amount of DOTAP was always 10 μg and the concentration of the corresponding compound complexed with DOTAP was tested over a range as indicated. IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
Figure 5: Influence of DNase/RNase treatment on the IL-6 production of Flt3L- WT cells.
WT Flt3L-DCs (0.75xl06/well) were incubated for 18h with indicated amounts of compounds. The amount of DOTAP was always 10 μg and the concentration of the corresponding compound complexed with DOTAP was tested over a range as indicated. Samples shown in the left part of the figure were not treated with DNase/RNase. Samples shown in the middle part of the figure were treated in the following way: DNase/RNase was added during the time the cells were allowed to adhere to the plates (about 2-3 h) to digest any DNA or RNA present in the supernatant of the medium. Samples shown in the right part of the figure were treated the following way: DNase/RNase was added to the falcon tubes after the DOTAP complexes were allowed to form inside the tubes. IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
Figure 6: Influence of DNase/RNase treatment on the IFN alpha production of FU3L-WT cells.
WT Flt3L-DCs (0.75xl06/well) were incubated for 18h with indicated amounts of compounds. The amount of DOTAP was always 10 μg and the concentration of the corresponding compound complexed with DOTAP was tested over a range as
indicated. Samples shown in the left part of the figure were not treated with DNase/RNase. Samples shown in the middle part of the figure were treated in the following way: DNase/RNase was added during the time the cells were allowed to adhere to the plates (about 2-3 h) to digest any DNA or RNA present in the supernatant of the medium. Samples shown in the right part of the figure were treated the following way: DNase/RNase was added to the falcon tubes after the DOTAP complexes were allowed to form inside the tubes. IFN alpha levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
Figure 7: Influence of various compounds on the IL12-p40 production of Flt3L- WT cells.
WT Flt3L-DCs (0.5xl06/well) were incubated for 18h with indicated amounts of compounds. The amount of DOTAP was always 10 μg and the concentration of the corresponding compound complexed with DOTAP was tested over a range as indicated. IL12-p40 levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
Figure 8: Influence of various compounds on the IL-6 production of FU3L-WT cells.
WT Flt3L-DCs (0.5xl06/well) were incubated for 18h with indicated amounts of compounds. The amount of DOTAP was always 10 μg and the concentration of the corresponding compound complexed with DOTAP was tested over a range as indicated. IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
Figure 9: Influence of various compounds on the IL-6 production of Flt3L- TLR9 -'- (left side) and Flt3L-MyD88 ' cells (right side).
TLR9"7" Flt3 L-DCs or MyDSδ"7" Flt3 L-DCs (lxlO6/well) were incubated for 18h with indicated amounts of compounds. The amount of DOTAP and Lipofectamin used was 10 μg. IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
Figure 10: Determination of pJNK levels after stimulation by various compounds by Westernblot analysis.
WT Flt3L-DCs (2.5xlO6/ 6-well) were incubated for 30 minutes with indicated compounds. Amounts were: 2 μg ODN, complexed where indicated with 10 μg of DOTAP. Cells and samples were treated according to standard-methods for Westernblot analysis as set out in the method-section. Endogenous pJNK is detected by two bands due to isoforms present in the cells.
Figure 11: Detailed representation of sequence and structure of ODN and ODN- related molecules. a ODN Sequences used in this study. Canonical CpG-motif underlined, s = phosphorothioate linkage (PS). b Chemical structures of modified and unmodified backbone molecules.
Figure 12: TLR9 immunobiology of natural PD DNA. a, b WT or TLR9"7" Flt3L-DCs (lxlO6/well) were incubated for 18h with 3μM PD CpG-B ODN 3 '-extended with poly-G tails of different lengths or control PS CpG-B ODN. IL-6 (a) and IFN-α (b) levels were detected in culture supernatants by enzyme-linked immunosorbant assay. Insets: PD PoIy-G tails alone were used as controls, c, d WT or TLR9"7" Flt3L-DCs (lxlO6/well) were incubated for 18h with 3μM ODN, ODN 3 -extended with 24Gs or ODN complexed to DOTAP. IL-6 (c) and IFN-α (d) levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
Figure 13: 3'-poly-G extension of PD ODN leads to differential endosomal compartmentalisation in pDCs. pDCs were enriched from Flt3L-cultures by MACS-sorting with pDC-specific α-
120G8 Ab. a Purified pDCs (0,IxIO6) were first incubated with 2μM of Cy5-labelled CpG-A
ODN or Cy5-PS CpG-B ODN for 45 min and then fixed. Late endosomal/lysosomal compartments were stained with rat α-Lamp-1/α-rat IgG Alexa 546 Abs. Fixed cells were analysed by confocal microscopy (left panels: ODN; middle panels: α-LAMP-
1; right panels: overlay). b Upper panels: Purified pDCs (0,IxIO6) were first incubated with 2μM Cy5-labelled
PD Non-CpG pTC ODN or Cy5-PD Non-CpG pTC + 35pG ODN. Lower panels:
First incubation with Cy5-PD CpG-B ODN or Cy5-PD CpG-B + 24pG PD ODN.
Cells were then fixed, stained and analysed as in (a). Only overlay panels are shown. c Purified pDCs (0,IxIO6) were coincubated with 2μM prototypical IFN-α- inducing CpG-A ODN and either PD CpG-B + 24pG ODN (upper panels) or PD non-CpG pTC + 35pG ODN (lower panels). After 45 min, live cells were washed with PBS and analysed by confocal microscopy at 37°C. All data are representative of at least 3 independent experiments.
Figure 14: Role of the DNA sugar backbone in TLR9 activation. a WT Flt3L-DCs (lxlO6/well) were incubated for 18h with 3μM of indicated PD ODN alone or PD ODN complexed to DOTAP. IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay, b, c WT, TLR9 ~ ~ or TLR7 ~ ~ Flt3 L-DCs (1 xlO6/well) were incubated for 18h with 3μM of indicated PD ODN or hybrid DNA/RNA molecules complexed to DOTAP. IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay, d WT, TLR7 ~ ~, TLR9" '" or MVD88-7- Flt3 L-DCs (lxlO6/well) were incubated for 18h with 3μM of PD ODN or PD polyU-2-deoxyribose complexed to DOTAP. IL-6 levels were detected in
culture supernatants by enzyme- linked immunosorbant assay. All data are representative of 3 independent experiments.
Figure 15: Opposing effects of PD vs PS 2-deoxyribose on TLR9. a WT or TLR9"7" Flt3L-DCs (1 xlO6/well) were incubated for 18h with 3μM of the indicated ODN (20mer), PD 2'-deoxyribose (20mer) or controls, all complexed to DOTAP. IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay, b SPR analysis of 10OnM murine TLR9-ect binding to biotinylated ODN or sugar backbone molecules immobilized at equimolar amounts on a streptavidin-coated biosensor chip. mTLR2-ect was used as a control. No mTLR2ect binding to any of the ODN/backbone molecules was detected, c AlphaScreen (homogenous ligand binding assay) assessment of human TLR9-ect binding to biotinylated ODN or sugar backbone molecules. hTLR2ect was used as a control. No hTLR2ect binding to any of the ODN/backbone molecules was detected. d WT Flt3L-DCs (lxlO6/well) were incubated for 18h with 2μM stimulatory PD CpG-B ODN ± indicated concentrations of PS or PD backbone molecules. IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay. e C57BL6 WT mice were injected i.v. with 2,5nmol PD CpG-B ODN ± indicated amounts of PS or PD backbone molecules, all complexed to DOTAP. Blood samples were obtained 2h after injection. Serum-IL-6 levels were detected by enzyme-linked immunosorbant assay. All data are representative of at least 3 independent experiments.
Figure 16: TLR9 immunobiology of natural PD DNA. a WT Flt3L-DCs (0,5x106/well) were incubated with 2μM of Cy5-labelled ODN for 45 min as indicated. Relative fluorescence intensity, representative of intracellular ODN, was measured by fluorescence activated cell sorting (FACS). Red: Medium; blue: PD CpG-B ODN; green: PD CpG-B + 24pG ODN; orange: CpG-A ODN. b WT Flt3L-DCs (0,5x106/well) were incubated for 16h with 3μM ODN. Cells were
then washed, stained, fixed and analysed by fluorescence activated cell sorting (FACS). Red: Medium; blue: PD non-CpG AP-I ODN; green: PD non-CpG AP-I + 24pG ODN. c FACS Aria-purified pDCs and mDCs (0,5x106/well) were incubated for 18h with ODN as indicated. IL-6 and IFNα levels were detected in culture supernatants by enzyme- linked immunosorbant assay, d WT or IRF7 ~ ~ Flt3L-DCs (lxlO6/well) were incubated for 18h with ODN as indicated. IFN-α levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
Figure 17: Role of the DNA sugar backbone in TLR9 activation. a WT, TLR9"7" or TLR7"7" Flt3L-DCs (1 xlO6/well) were incubated for 18h with 3μM PD non-CpG API ODN or hybrid DNA/RNA molecules complexed to DOTAP. IFN-α levels were detected in culture supernatants by enzyme-linked immunosorbant assay, b WT, TLR9"7" or TLR7"7" Flt3L-DCs (1 xlO6/well) were incubated for 18h with 3μM PD CpG-B ODN or hybrid DNA/RNA molecules complexed to DOTAP. IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay, c WT, TLR7-/-, TLR9-/- or MyD88-/- Flt3 L-DCs (lxlO6/well) were incubated for 18h with 3μM of PD CpG-B ODN or PD poly-U-2-deoxyribose, all complexed to DOTAP. IFN-α levels were detected in culture supernatants by enzyme-linked immunosorbant assay, d WT Flt3L-DCs (lxlO6/well) were incubated for 18h with 2μM stimulatory PD CpG-B ODN ± indicated concentrations of PS or PD ODN. IL- 6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
Figure 18: Inhibition of TLR7-mediated IL-6 production by PS 2-deoxyribose backbone.
WT Flt3L-DCs (lxlO6/well) were incubated for 18h with indicated amounts of compounds (The PS 2-deoxyribose backbone as 20mer). The amount of DOTAP used was always 10 μg and the concentration of the corresponding compound
complexed with DOTAP was tested over a range as indicated. IL-6 levels were detected in culture supernatants by enzyme-linked immunosorbant assay. All data are representative of 3 independent experiments.
Figure 19: Binding affinities of PD and PS 2-deoxyribose to TLR7 and TLR9, resp. a AlphaScreen (homogenous ligand binding assay) assessment of human TLR7-ect binding to biotinylated sugar backbone molecules as indicated. hTLR2ect was used as a control. No hTLR2ect binding to any of the backbone molecules was detected, b AlphaScreen (homogenous ligand binding assay) assessment of human TLR9-ect binding to biotinylated sugar backbone molecules as indicated. hTLR2ect was used as a control. No hTLR2ect binding to any of the backbone molecules was detected. For a and b: Calculated EC50 values for the respective binding are depicted underneath the graphs.
Figure 20: CpG-Independent TLR9 Activation by Natural PD ODNs.
WT Flt3L-DCs (lxlO6/well) were incubated for 18 h with indicated concentrations of ODN alone or ODN 3 ' extended with 24Gs (a) and ODN alone or ODN complexed to DOTAP (b). IL-6 concentrations were detected in culture supernatants by enzyme- linked immunosorbant assay. Values for PD 1668 and PD non-CpG AP-I in (a) and (b) are taken from the same set of experiments. Mean values and standard deviations of 3 independent experiments are shown.
Figure 21: PD and PS ribose display specific low-affϊne binding only to hTLR7- ect but not to hTLR9-ect.
AlphaScreen (homogenous ligand binding assay) assessment of hTLR9-ect and hTLR7-ect binding to biotinylated sugar backbone molecules. hTLR2-ect was used as a control. No hTLR2-ect binding to any of the sugar backbone molecules was detected.
Figure 22: PS 2' deoxyribose homopolymer is a competitive inhibitor of TLR9 ligand binding.
(a and b) SPR analysis of 200 nM mTLR9-ect binding to biotinylated PD CpG-B 1668 immobilised on a streptavidin-coated biosensor chip in the presence or absence of different concentrations of competing PS (a) or PD (b) 2' deoxyribose (20mer).
Figure 23: PS 2' deoxyribose homopolymer is a TLR9 and TLR7 antagonist.
(a) WT Flt3L-DCs (lxlO6/well) were incubated for 18 h with 2 μM stimulatory PD CpG-B ODN ± indicated concentrations of PS 2' deoxyribose (20mer) or PS IRS ODN. IL-6 concentrations were detected in culture supernatants by enzyme-linked immunosorbant assay. Portions of this graph are from the same set of experiments as in figure 15 d.
(b) WT Flt3L-DCs (lxlO6/well) were incubated for 18 h with 0,5 μM of TLR7- stimulatory PD RNA (ORN AP-I) complexed to DOTAP. Indicated concentrations of PS or PD 2' deoxyribose (20mer) had been added to the culture 15 min prior to stimulation. IL-6 concentrations were detected in culture supernatants by enzyme- linked immunosorbant assay. Mean values and standard deviations of 3 independent experiments are shown.
DETAILED DESCRIPTION OF THE INVENTION
As has been set out above, the present invention partially resides in the surprising finding that removal of bases from known CpG oligonucleotides nevertheless allows the remaining backbone structures to bind to TLRs. Depending on the bridging group of the backbone structures, an activation or suppression TLR activity is observed.
Before some of the embodiments of the present invention are described in more detail, the following definitions are introduced.
As used in this specification and in the intended claims, the singular forms of "a" and "an" also include the respective plurals unless the context clearly dictates otherwise.
The terms "about" and "approximately" in the context of the present invention denote an interval of accuracy that a person skilled in the art will understand to still ensure the technical effect of the feature in question. The term typically indicates a deviation from the indicated numerical value of ±10 % and preferably of ±5 %.
It is to be understood that the term "comprising" is not limiting. For the purposes of the present invention the term "consisting of is considered to be a preferred embodiment of the term "comprising of. If hereinafter a group is defined to comprise at least a certain number of embodiments, this is meant to also encompass a group which preferably consists of these embodiments only.
The terms "nucleic acid" and "oligonucleotide" refer to DNA, RNA in its various forms and derivatives thereof. Derivatives of DNA and/or RNA are understood to include different bases than A, T, G, C and U, to include sugar units other than ribose or 2-deoxyribose and/or to include bridging groups between the sugar units other
than a phosphate bridging group. However, derivatives of DNA and/or RNA are understood to contain bases.
In the context of the present invention the term "abasic oligonuclelotide" refers to the back bone structure of nucleic acid molecules with approximately 5 to approximately 100 cyclic pentose units in which bases have been removed or which have been e.g. synthetically build without bases at the Ci position of the cyclic pentose unit..
Unless indicated otherwise, the term "base" in the context of oligonucleotides refers to pyrimidines such as Cytosine (C), Thymidine (T) and Uracil (U) and purine bases such as Adenine (A) and Guanine (G).
The term "analogue of (purine or pyrimidine) bases" refers to other naturally occurring or non-naturally occurring synthetic bases such as inosine, N6-methyl-dA, 5-Methyl-dC, hypoxanthine, dihydrouracil, pseudouracil, 2-thiouracil, 4-thiouracil, 5-aminouracil, 5-(Ci-C6)-alkyluracil, 5-(C2-C6)-alkenyluracil, 5 -(C2-C6)- alkinyluracil, 5-(hydroxymethyl)uracil, 5-chlorouracil, 5-fluorouracil, 5-bromouracil, 5-hydroxycytosine, 5-(Ci-C6)-alkylcytosine, 5-(C2-C6)-alkenylcytosine, 5-(C2-C6)- alkinylcytosine, 5-chlorocytosine, 5-fluorocytosine, 5-bromocytosine, N2 - dimethylguanine, 2,4-diamino-purine, 8-azapurine (including, in particular, 8- azaguanine), a substituted 7-deazapurine (including, in particular, 7-deazaguanine), including 7-deaza-7-substituted and/or 7-deaza-8-substituted purine, or other modifications of a natural bases. This list is meant to be exemplary and is not to be interpreted to be limiting. In particular, the guanine base can be a substituted or modified guanine such as 7-deazaguanine, 8-azaguanine, 7-deaza-7-substituted guanine (such as 7-deaza-7-(C2-C6)alkynylguanine), 7-deaza-8-substituted guanine, hypoxanthine, 2,6-diaminopurine, 2-aminopurine, 8-substituted guanine such as 8- hydroxyguanine and 6-thioguanine.
The cyclic pentose unit of compounds as they are used for preferred embodiments of the pharmaceutical compositions and methods of the present invention is preferably a ribose, i.e. carries a hydrogen at the C2 position. In this case, the abasic oligonucleotides may be based on DNA. However, the C2 position can also be modified with a OH group. In this case being also a preferred embodiment, the abasic oligonucleotides are based on RNA. However, the cyclic pentose units can carry other modifications at the C2 position.
As is shown hereinafter, a DNA oligomer of 20 nucleotides from which the bases have been removed is capable of activating TLR 7 and TLR 9. However, it was also found that a DNA oligomer of 20 nucleotides from which the bases have been removed and which has phosphorothioate bridging groups is capable of suppressing TLR 7 and TLR 9 activity. Thus, the invention is at least partially based on the finding that nucleic acid oligonucleotides from which the bases have been removed can bind to and activate or inhibit TLR mediated signaling.
In one embodiment, the invention thus relates to a compound having at least one structural unit according to formula (I)
3' wherein n is an integer from 4 to 99; and
X is a phosphate bridging group or an analogue thereof such as a phosphorothioate bridging group;
Y is selected from the group comprising hydrogen and OH; no pyrimidine base, purine base or analogues thereof are bonded to the Ci atom of the pentose ring; and optionally at least one pharmaceutically acceptable excipients.
Such compounds can be used as a pharmaceutically active compound, i.e. take the form of a pharmaceutical preparation.
As mentioned above, the structural unit may comprise in the order of 20 pentose units. Thus, n may be an integer of 5 to 69, 6 to 59, 7 to 49, 8 to 39, 9 to 29, 14 to 24, 15 to 23, 16 to 22, 17 to 21 18 to 20 or 19. N may also be an integer of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30.
In one embodiment, the rest Y may be selected from the group comprising hydrogen, OH, CH3, CH2CH3, OCH3, OCH2CH3, benzyl, phenyl. Y may also be a branched or straight Ci to C20, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 alkyl, a branched or straight Ci to C2o, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 alkenyl, a branched or straight Ci to C2o, preferably a branched or straight C1 to C10 or more preferably a branched or straight Ci to C5 alkinyl, a branched or straight Ci to C2o, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 heteroalkyl, a branched or straight Ci to C2o, preferably a branched
10 or straight Ci to C10 or more preferably a branched or straight Ci to C5 alkoxyl, a branched or straight Ci to C2o, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 arylalkyl, a branched or straight Ci to C2o, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 cycloalkyl, a branched or straight Ci to C2o, preferably a branched or
15 straight Ci to C10 or more preferably a branched or straight Ci to C5 heterocycloalkyl, a branched or straight Ci to C2o, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 arylalkoxyl, a branched or straight Ci to Cio, preferably a branched or straight Ci to C5 aryl, a branched or straight Ci to C 10 or preferably a branched or straight Ci to C5 heteroaryl. zυ
In a preferred embodiment, the rest Y may be selected from the group comprising hydrogen, OH, CH3, or OCH3. Hydrogen and OH can be particularly preferred.
Further, the compound may be essentially identical to the structural unit. Thus, the 25 structural unit may have a hydrogen at its 5 ' and/or 3 ' end. However, the structural unit may be terminated at its 5' and/or 3' end with CH3, CH2CH3, OCH3, OCH2CH3, benzyl, phenyl. It may also be terminated with a branched or straight Ci to C2o, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 alkyl, a branched or straight Ci to C2o, preferably a branched or straight Ci
to Cio or more preferably a branched or straight Ci to C5 alkenyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 alkinyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 heteroalkyl, a branched or straight Ci to C20, preferably a branched or straight Ci to Cio or more preferably a branched or straight Ci to C5 alkoxyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 arylalkyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 cycloalkyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 heterocycloalkyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 arylalkoxyl, a branched or straight Ci to C 10, preferably a branched or straight Ci to C5 aryl, a branched or straight Ci to C10 or preferably a branched n orr straight Ci to C5 heteroaryl.
Other head and tail groups can also be used. These include e.g. FAM or FITC. Such head and/or tail groups may thus be markers that are detectable by e.g. fluorescence spectroscopy or by chemical reactions.
As known to the person skilled in the art, the addition of a poly guanosin sequence (polyG- tail) to the 3 ' end of ODN leads to enhanced endosomal translocation/uptake. In one embodiment of the invention, a polyG-tail is attached to the 3' end of the compound. This polyG-tail can comprise 4, 12, 24, 25, 35, 40, 44, 50, 55, 60 or 100 guanosines to form the polyG-tail.
Hydrogen, OH, CH3, CH2CH3, OCH3, OCH2CH3, benzyl, phenyl, FAM, FITC or a polyG-tail can be preferred as head and/or tail groups.
In one embodiment, the Ci position of the cyclic pentose unit can be bonded to a hydrogen, CH3 or OCH3. The cyclic pentose at the Ci unit can also be bonded to CH2CH3, OCH2CH3, benzyl, phenyl. It may also be bonded to a branched or straight Ci to C20, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 alkyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 alkenyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 alkinyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 heteroalkyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 alkoxyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 arylalkyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 cycloalkyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 heterocycloalkyl, a branched or straight Ci to C20, preferably a branched or straight Ci to C10 or more preferably a branched or straight Ci to C5 arylalkoxyl, a branched or straight Ci to Cio, preferably a branched or straight Ci to C5 aryl, a branched or straight Ci to C10 or preferably a branched or straight Ci to C5 heteroaryl.
It is understood that the Ci position may not be linked to a pyrimidine base, a purine base or an analogue thereof as defined above.
The Ci position may preferably carry an hydrogen, CH3, OCH3, benzyl or phenyl. Hydrogen can be particularly preferred.
As mentioned above X may be a phosphate bridging group of formula (II):
O
O=P- O — OH
II
Such "phosphate bridging groups" allow to connect the cyclic pentose units from the Cs position of one cyclic pentose unit to the C3 position of another cyclic pentose unit.
In such cases, the compounds and pharmaceutical preparations comprising these compounds can be used to activate and/or support the (innate or adaptive) immune system of a human or animal subject. This is inter alia the result of the capability such compounds to activate TLR7 and TLR9 as shown below.
As a consequence, these compounds and pharmaceutical preparations can be used to treat conditions such as cancer, infections including viral, bacterial, fungal or parasitic infections, allergies and/or asthma. These aspects will be discussed further below.
As mentioned above, the invention is at least partially based on the finding that nucleic acid oligonucleotides from which the bases have been removed and which has a backbone with the cyclic pentose units being linked by analogues of a phosphate bridging group as defined above can bind to and inhibit TLR mediated signaling.
Such "analogues of a phosphate bridging groups" refer to bridging groups other than the above-mentioned phosphate bridging group but still allowing to connect the cyclic pentose units from the C5 position of one cyclic pentose unit to the C3 position of another cyclic pentose unit. An analogue of a phosphate bridging group will have to allow the compounds in accordance with the invention to bind to TLRs and preferably to TLR7 and/or TLR9 and to inhibit the activity thereof.
A preferred analogue of a phosphate bridging group is a phosphorothioate bridging group of formula (III):
O S=P-O —
OH
III
Other analogues of a phosphate bridging group include without being limited thereto alkylphosponate, arylphosphonate, alkylphosphorothioate, arylphosphorothioate, methylphosphonate, methylphosphorothioate, phosphorodithioate, p-ethoxy, morpholino, and combinations thereof.
Modified backbones such as phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries. Aryl- and alkyl-phosphonates can be made, e.g., as described in U.S. Pat. No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Pat. No. 5,023,243 and European Pat. No. 092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described.
For use in vivo, the compounds having analogues of phosphate bridging groups in their backbonemay have the advantage of being relatively resistant to degradation (e.g., are stabilized). A "stabilized compound" shall mean a compound of the present invention that is relatively resistant to in vivo degradation (e.g., via an exo- or endo- nuclease). Stabilization can be a function of length or secondary structure.
For the embodiment where a compound according to the invention (and pharmaceutical compositions comprising these compounds) has an analogue of a phosphate bridging group in the backbone, it is to be understood that the abasic oligonucleotide does not necessarily has to comprise a phosphorothioate bridging group (or other analogues) at every backbone position. It may well be that the backbone comprises phosphate bridging group as well as analogues thereof. Depending on the extent of analogues such compounds may be capable of activating or inhibiting TLR signaling.
If in the context of the present invention, it is stated that the majority of X is a phosphate bridging group this refers to the situation that at least 60%, preferably at least 70%, more preferably at least 80%, even more preferably at least 90% and most preferably at least 95% of X is a phosphate brigding group.
If in the context of the present invention, it is stated that the majority of X is an analogue of a phosphate bridging group this refers to the situation that at least 60%, preferably at least 70%, more preferably at least 80%, even more preferably at least 90% and most preferably at least 95% of X is an analogue of a phosphate bridging group such as a phosphorothioate bridging group.
It is, however, clear from the experiments set out below that if a compound comprises essentially only phosphate bridging groups, it will be activating. If it
comprises essentially only analogues of phosphate bridging groups (such as phosphorothioate) it will be inhibiting.
Given the stabilising effect on analogues of a phosphate bridging group it may be considered to introduce such analogues at selected positions of a backbone which otherwise consists only of phosphate bridging groups to reduce liability to degradation while the compound retains its stimulating potential. It can be preferred that the backbone consists of either only phosphate bridging groups or only analogues thereof with posphorothioate being a preferred analogue.
It has been mentioned above that the compound and pharmaceutical compositions of the present invention depending on the nature and content of the bridging group in their backbone structure can have an activating or inhibiting effect on TLR signaling and thus can activate, i.e. stimulate the immune system.
As used herein "stimulation of the immune system" includes the stimulation of immune cells and of non- immune cells to secrete or express factors which participate in and/or characterize immune activation. This term thus includes, without limitation, stimulation of cytokine secretion by various types of cells including lymphocytes, antigen-presenting cells (APCs, including dendritic cells), and epithelial cells, stimulation of immunoglobulin secretion by B cells; and stimulation of cell surface molecule expression of costimulatory molecules and coreceptors on T cells, B cells, natural killer (NK) cells, monocytes, macrophages, and APCs.
Methods for determining e.g. cytokine induction and secretion are well known in the art and include enzyme-linked immunosorbent assay (ELISA), intracellular fluorescence-activated cell sorting (FACS), and bioassay. Methods for determining e.g. NK cell activity are also well known in the art and include determination of target cell killing (cell lysis), cell surface expression of activation marker CD69 (e.
g., by FACS), and secretion of interferon gamma (IFN-y ; e. g., byELISA). Additional examples of specific cell surface markers of immune activation can include, without limitation, expression ofCDllb, CD25, CD28, CD43, CD54, CD62L, CD71, CD80, CD86, CD95L, CD106, CD134, and CD134L
As used herein "TLR signaling" refers to an ability of a TLR polypeptide upon binding of a ligand to activate the TLR/IL-IR (TIR) signaling pathway, also referred to herein as the TLR signal transduction pathway. Changes in TLR activity can be measured by assays such as those disclosed herein, including expression of genes under control of [kappa]B-sensitive promoters and enhancers. Such naturally occurring genes include the genes encoding IL-I [beta], IL-6, IL-8, the p40 subunit of interleukin 12 (IL-12 p40), and the costimulatory molecules CD80 and CD86. Other genes can be placed under the control of such regulatory elements (see below) and thus serve to report the level of TLR signaling.
As used herein "TLR7 signaling" refers to an ability of a TLR7 polypeptide upon binding of a ligand to activate the TLR/IL-IR (TIR) signaling pathway, also referred to herein as the TLR signal transduction pathway. Changes in TLR7 activity can be measured by assays such as those disclosed herein, including expression of genes under control of [kappa]B-sensitive promoters and enhancers. Such naturally occurring genes include the genes encoding IL-I [beta], IL-6, IL-8, the p40 subunit of interleukin 12 (IL-12 p40), and the costimulatory molecules CD80 and CD86. Other genes can be placed under the control of such regulatory elements (see below) and thus serve to report the level of TLR7 signaling.
As used herein "TLR9 signaling" refers to an ability of a TLR9 polypeptide upon binding of a ligand to activate the TLR/IL-IR (TIR) signaling pathway, also referred to herein as the TLR signal transduction pathway. Without meaning to be held to any particular theory, it is believed that the TLR/IL-IR signaling pathway involves
signaling via the molecules myeloid differentiation marker 88 (MyD88) and tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6), leading to activation of kinases of the I[kappa]B kinase complex and the c-jun NH2 -terminal kinases (e.g., Jnk 1/2) (Hacker H et al. (2000) J Exp Med, 192, 595-600). Changes in TLR9 activity can be measured by assays such as those disclosed herein, including expression of genes under control of [kappa]B-sensitive promoters and enhancers. Such naturally occurring genes include the genes encoding IL-I [beta], IL-6, IL-8, the p40 subunit of interleukin 12 (IL-12 p40), and the costimulatory molecules CD80 and CD86. Other genes can be placed under the control of such regulatory elements (see below) and thus serve to report the level of TLR9 signaling.
As used herein a "TLR7 polypeptide" or a "TLR9 polypeptide" refers to a polypeptide including a full-length TLR7 or TLR9, orthologues, allelic variants, SNPs, variants incorporating conservative amino acid substitutions, TLR7 or TLR9 fusion proteins, and functional fragments of any of the foregoing. Preferred embodiments include human and or murine TLR7 or TLR9 polypeptides.
As will become clear from the experiments described hereinafter, measuring the expression of IL-6, IFN alpha, IL12-p40, MyD88, IRF6 can be used to determine whether a compound and/or pharmaceutical composition of the present invention has a stimulating (activating, supporting) effect or inhibiting (suppressing) effect on TLR signaling and particularly on TLR7 and/or TLR9 signaling.
If an increase in expression of any of the above mentioned factors relative to an appropriate control is observed, this will be indicative of a activating effect. In general, an activation of TLR signaling and particularly of TLR7 and/or TLR9 signaling is considered to be indicative of activation of the (innate or adaptive) immune system. Typically an increase in IL-6 or IFN alpha is indicative of a
stimulation of the innate immune system. An increase in IL12-p40 can be considered to be indicative of a stimulation of the adaptive immune system.
The person skilled in the art knows how to select an appropriate control. Appropriate controls include negative controls and positive controls. A negative control may be a molecule known to have no effect on TLR signaling. This may e.g. be a buffer. Another very robust negative control can be knock out mice for TLRs such as TLR9 and TLR7 or knock out mice for factors being activated by TLRs but acting downstream thereof such MyD88. Positive controls include compounds known to activate TLRs such as CpG oligonucleotides or mutant mice which express constitutively active versions of TLRs.
An inhibitory compound or pharmaceutical compositions comprising such compounds will typically not increase expression of any of the aforementioned factors in comparison to an appropriate control. It will moreover be able to block, e.g. cross-compete activation of TLRs. This may be detected by co-incubating these inhibitory compounds or compositions in the presence of a known activating compound or composition. It may also be able to down regulate activity of an activated TLR. Examples for determining the suppressing effect of compounds or compositions in accordance with the present invention are depicted below.
In general, the compounds and pharmaceutical compositions of the invention thus allow to treat conditions which result from and/or are afflicted by an up- or down regulation of TLR signaling and particularly of TLR7 and/or TLR9 signaling.
The capacity of the compounds and pharmaceutical compositions of the present invention to increase TLR activity and thus to stimulate the immune system particularly if the backbone of the compounds consists essentially of phosphate
bridging groups can also be used in the treatment of conditions such as cancer, asthma, allergies and infections.
There are different approaches for treating these conditions. One approach is to treat and/or prevent these conditions by administering vaccines to a human or animal subject. A vaccine may comprise an antigen such as a cancer antigen that is capable of directing the immune system's attention and activity towards this cancer-specific antigen thus allowing to fight the cancer. In such an approach the compounds in accordance with the invention can act e.g. as an adiuvants supporting the immune system's activity and specificity.
In another approach one uses e.g. a pharmaceutically active anti-cancer agent such as a cytotoxic agent that directly attacks the cancer. Again the compounds and pharmaceutical compositions in accordance with the invention support and assist the immune system's activity due to their activating effect on TLR activity.
These principles, of course, also apply to other conditions such as infections, asthma etc.
For the purposes of the present invention the term "antigen" refers to a molecule capable of provoking an immune response.
The term antigen broadly includes any type of molecule that is recognized by a host system as being foreign. Antigens include but are not limited to infectious antigens including microbial (bacterial), viral, fungal, herbal and parasitic antigens, cancer antigens, and allergens.
Antigens include, but are not limited to, cells, cell extracts, proteins, polypeptides, peptides, polysaccharides, polysaccharide conjugates, peptide and non-peptide
mimics of polysaccharides and other molecules, small molecules, lipids, glyco lipids, and carbohydrates. Many antigens are protein or polypeptide in nature, as proteins and polypeptides are generally more antigenic than carbohydrates or fats.
The antigen may be an antigen that is encoded by a nucleic acid vector or it may not be encoded in a nucleic acid vector. In the former case the nucleic acid vector is administered to the subject and the antigen is expressed in vivo. In the latter case the antigen may be administered directly to the subject. An antigen not encoded in a nucleic acid vector as used herein refers to any type of antigen that is not a nucleic acid. For instance, in some aspects of the invention the antigen not encoded in a nucleic acid vector is a peptide or a polypeptide. Minor modifications of the primary amino acid sequences of peptide or polypeptide antigens may also result in a polypeptide which has substantially equivalent antigenic activity as compared to the unmodified counterpart polypeptide. Such modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous. All of the polypeptides produced by these modifications are included herein as long as antigenicity still exists. The peptide or polypeptide may be, for example, virally derived. The antigens useful in the invention may be any length, ranging from small peptide fragments of a full length protein or polypeptide to the full length form. For example, the antigen may be less than 5, less than 8, less than 10, less than 15, less than 20, less than 30, less than 50, less than 70, less than 100, or more amino acid residues in length, provided it stimulates a specific immune response.
The nucleic acid encoding the antigen is operatively linked to a gene expression sequence which directs the expression of the antigen nucleic acid within a eukaryotic cell. The gene expression sequence is any regulatory nucleotide sequence, such as a promoter sequence or promoter-enhancer combination, which facilitates the efficient transcription and translation of the antigen nucleic acid to which it is operatively linked. The gene expression sequence may, for example, be a mammalian or viral
promoter, such as a constitutive or inducible promoter. Constitutive mammalian promoters include, but are not limited to, the promoters for the following genes: hypoxanthine phosphoribosyl transferase (HPRT), adenosine deaminase, pyruvate kinase, beta-actin promoter and other constitutive promoters. Exemplary viral promoters which function constitutively in eukaryotic cells include, for example, promoters from the cytomegalovirus (CMV), simian virus (e.g., SV40), papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, the long terminal repeats (LTR) of Moloney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus. Other constitutive promoters are known to those of ordinary skill in the art. The promoters useful as gene expression sequences of the invention also include inducible promoters. Inducible promoters are expressed in the presence of an inducing agent. For example, the metallothionein promoter is induced to promote transcription and translation in the presence of certain metal ions. Other inducible promoters are known to those of ordinary skill in the art.
In general, the gene expression sequence shall include, as necessary, 5' non- transcribing and 5' non-translating sequences involved with the initiation of transcription and translation, respectively, such as a TATA box, capping sequence, CAAT sequence, and the like. Especially, such 5' non-transcribing sequences will include a promoter region which includes a promoter sequence for transcriptional control of the operably joined antigen nucleic acid. The gene expression sequences optionally include enhancer sequences or upstream activator sequences as desired.
The antigen nucleic acid is operatively linked to the gene expression sequence. As used herein, the antigen nucleic acid sequence and the gene expression sequence are said to be operably linked when they are covalently linked in such a way as to place the expression or transcription and/or translation of the antigen coding sequence under the influence or control of the gene expression sequence. Two DNA sequences
are said to be operably linked if induction of a promoter in the 5' gene expression sequence results in the transcription of the antigen sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame- shift mutation, (2) interfere with the ability of the promoter region to direct the transcription of the antigen sequence, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein. Thus, a gene expression sequence would be operably linked to an antigen nucleic acid sequence if the gene expression sequence were capable of effecting transcription of that antigen nucleic acid sequence such that the resulting transcript is translated into the desired protein or polypeptide.
The antigen nucleic acid of the invention may be delivered to the immune system alone or in association with a vector. In its broadest sense, a vector is any vehicle capable of facilitating the transfer of the antigen nucleic acid to the cells of the immune system so that the antigen can be expressed and presented on the surface of the immune cell. The vector generally transports the nucleic acid to the immune cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. The vector optionally includes the above-described gene expression sequence to enhance expression of the antigen nucleic acid in immune cells. In general, the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the antigen nucleic acid sequences. Viral vectors are a preferred type of vector and include, but are not limited to, nucleic acid sequences from the following viruses: retrovirus, such as Moloney murine leukemia virus, Harvey murine sarcoma virus, murine mammary tumor virus, and Rous sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other vectors not named but known in the art
Preferred viral vectors are based on non-cytopathic eukaryotic viruses in which nonessential genes have been replaced with the gene of interest. Non-cytopathic viruses include retroviruses, the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA. Retroviruses have been approved for human gene therapy trials. Most useful are those retroviruses that are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle). Such genetically altered retroviral expression vectors have general utility for the high- efficiency transduction of genes in vivo. Standard protocols for producing replication-deficient retroviruses (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a packaging cell lined with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and infection of the target cells with viral particles) are provided in Kriegler, M., Gene Transfer and Expression, A Laboratory Manual, W.H. Freeman Co., New York (1990) and Murray, E. J. Methods in Molecular Biology, vol. 7, Humana Press, Inc., Cliffton, N.J. (1991).
A preferred virus for certain applications is the adeno-associated virus, a double- stranded DNA virus. The adeno-associated virus can be engineered to be replication- deficient and is capable of infecting a wide range of cell types and species. It further has advantages, such as heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages, including hemopoietic cells; and lack of superinfection inhibition thus allowing multiple series of transductions. Reportedly, wild-type adeno-associated virus manifest some preference for integration sites into human cellular DNA, thereby minimizing the possibility of insertional mutagenesis and variability of inserted gene expression characteristic of retroviral infection. In addition, wild-type adeno-associated virus infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying
that the adeno-associated virus genomic integration is a relatively stable event. The adeno-associated virus can also function in an extrachromosomal fashion. Recombinant adeno-associated viruses that lack the replicase protein apparently lack this integration sequence specificity.
Cancer is a disease which involves the uncontrolled growth (i.e., division) of cells. Some of the known mechanisms which contribute to the uncontrolled proliferation of cancer cells include growth factor independence, failure to detect genomic mutation, and inappropriate cell signaling. The ability of cancer cells to ignore normal growth controls may result in an increased rate of proliferation. Although the causes of cancer have not been firmly established, there are some factors known to contribute, or at least predispose a subject, to cancer. Such factors include particular genetic mutations (e.g., BRCA gene mutation for breast cancer, APC for colon cancer), exposure to suspected cancer-causing agents, or carcinogens (e.g., asbestos, UV radiation) and familial disposition for particular cancers such as breast cancer.
The cancer may be a malignant or non-malignant cancer. Cancers or tumors include but are not limited to biliary tract cancer; brain cancer; breast cancer; cervical cancer; choriocarcinoma; colon cancer; endometrial cancer; esophageal cancer; gastric cancer; intraepithelial neoplasms; lymphomas; liver cancer; lung cancer (e.g., small cell and non-small cell); melanoma; neuroblastomas; oral cancer; ovarian cancer; pancreas cancer; prostate cancer; rectal cancer; sarcomas; skin cancer; testicular cancer; thyroid cancer; and renal cancer, as well as other carcinomas and sarcomas.
In one embodiment the cancer is hairy cell leukemia, chronic myelogenous leukemia, cutaneous T-cell leukemia, multiple myeloma, follicular lymphoma, malignant melanoma, squamous cell carcinoma, renal cell carcinoma, prostate carcinoma, bladder cell carcinoma, or colon carcinoma.
A "cancer antigen" as used herein is a compound, such as a peptide or protein, associated with a tumor or cancer cell surface and which is capable of provoking an
immune response when expressed on the surface of an antigen presenting cell in the context of an MHC molecule. Cancer antigens can be prepared from cancer cells either by preparing crude extracts of cancer cells, for example, as described in Cohen P A et al. (1994) Cancer Res 54:1055-8, by partially purifying the antigens, by recombinant technology, or by de novo synthesis of known antigens. Cancer antigens include but are not limited to antigens that are recombinantly expressed, an immunogenic portion of, or a whole tumor or cancer. Such antigens can be isolated or prepared recombinantly or by any other means known in the art.
The terms "cancer antigen" and "tumor antigen" are used interchangeably and refer to antigens which are differentially expressed by cancer cells and can thereby be exploited in order to target cancer cells. Cancer antigens are antigens which can potentially stimulate apparently tumor- specific immune responses. Some of these antigens are encoded, although not necessarily expressed, by normal cells. These antigens can be characterized as those which are normally silent (i.e., not expressed) in normal cells, those that are expressed only at certain stages of differentiation and those that are temporally expressed such as embryonic and fetal antigens. Other cancer antigens are encoded by mutant cellular genes, such as oncogenes (e.g., activated ras oncogene), suppressor genes (e.g., mutant p53), fusion proteins resulting from internal deletions or chromosomal translocations. Still other cancer antigens can be encoded by viral genes such as those carried on RNA and DNA tumor viruses. Examples of tumor antigens include MAGE, MART-1/Melan-A, gplOO, Dipeptidyl peptidase IV (DPPIV), adenosine deaminase-binding protein (ADAbp), cyclophilin b, Colorectal associated antigen (CRC)-COl 7- 1A/GA733, Carcinoembryonic Antigen (CEA) and its immunogenic epitopes CAP-I and CAP-2, etvβ, amll, Prostate Specific Antigen (PSA) and its immunogenic epitopes PSA-I, PSA-2, and PSA-3, prostate-specific membrane antigen (PSMA), T-cell receptor/CD3-zeta chain, MAGE-family of tumor antigens (e.g., MAGE-Al, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-
A8, MAGE-A9, MAGE-AlO, MAGE-Al 1, MAGE-A12, MAGE-Xp2 (MAGE-B2), MAGE-Xp3 (MAGE-B3), MAGE-Xp4 (MAGE-B4), MAGE-Cl, MAGE-C2, MAGE-C3, MAGE-C4, MAGE-C5), GAGE-family of tumor antigens (e.g., GAGE- 1, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7, GAGE-8, GAGE-9), BAGE, RAGE, LAGE-I, NAG, GnT-V, MUM-I, CDK4, tyrosinase, p53, MUC family, HER2/neu, p21ras, RCASl, [alpha] -fetoprotein, E-cadherin, [alpha] -catenin, [beta]-catenin and [gamma] -catenin, pl20ctn, gpl00<Pmell l7> , PRAME, NY- ESO-I, cdc27, adenomatous polyposis coli protein (APC), fodrin, Connexin 37, Ig- idiotype, pl5, gp75, GM2 and GD2 gangliosides, viral products such as human papilloma virus proteins, Smad family of tumor antigens, lmp-1, PlA, EBV-encoded nuclear antigen (EBNA)-I, brain glycogen phosphorylase, SSX-I, SSX-2 (HOM- MEL-40), SSX-I, SSX-4, SSX-5, SCP-I and CT-7, and c-erbB-2.
Cancers or tumors and tumor antigens associated with such tumors (but not exclusively), include acute lymphoblastic leukemia (etvβ; amll; cyclophilin b), B cell lymphoma (Ig-idiotype), glioma (E-cadherin; [alpha] -catenin; [beta] -catenin; [gamma] -catenin; pl20ctn), bladder cancer (p21ras), biliary cancer (p21ras), breast cancer (MUC family; HER2/neu; c-erbB-2), cervical carcinoma (p53; p21ras), colon carcinoma (p21ras; HER2/neu; c-erbB-2; MUC family), colorectal cancer (Colorectal associated antigen (CRC)-CO 17- 1 A/GA733; APC), choriocarcinoma (CEA), epithelial cell cancer (cyclophilin b), gastric cancer (HER2/neu; c-erbB-2; ga733 glycoprotein), hepatocellular cancer ([alpha]-fetoprotein), Hodgkins lymphoma (lmp-1; EBNA-I), lung cancer (CEA; MAGE-3; NY-ESO-I), lymphoid cell-derived leukemia (cyclophilin b), melanoma (pi 5 protein, gp75, oncofetal antigen, GM2 and GD2 gangliosides), myeloma (MUC family; p21ras), non-small cell lung carcinoma (HER2/neu; c-erbB-2), nasopharyngeal cancer (lmp-1; EBNA- 1), ovarian cancer (MUC family; HER2/neu; c-erbB-2), prostate cancer (Prostate Specific Antigen (PSA) and its immunogenic epitopes PSA-I, PSA-2, and PSA-3; PSMA; HER2/neu; c-erbB-2), pancreatic cancer (p21ras; MUC family; HER2/neu;
c-erbB-2; ga733 glycoprotein), renal cancer (HER2/neu; c-erbB-2), squamous cell cancers of cervix and esophagus (viral products such as human papilloma virus proteins), testicular cancer (NY-ESO-I), T-cell leukemia (HTLV-I epitopes), and melanoma (Melan-A/MART-1; cdc27; MAGE-3; p21ras; gpl00<Pmell l7> ). [0191] For examples of tumor antigens which bind to either or both MHC class I and MHC class II molecules, see the following references: Coulie, Stem Cells 13:393- 403, 1995; Traversari et al. J Exp Med 176:1453-1457, 1992; Chaux et al. J Immunol 163:2928-2936, 1999; Fujie et al. Int J Cancer 80:169-172, 1999; Tanzarella et al. Cancer Res 59:2668-2674, 1999; van der Bruggen et al. Eur J Immunol 24:2134- 2140, 1994; Chaux et al. J Exp Med 189:767-778, 1999; Kawashima et al. Hum
Immunol 59:1-14, 1998; Tahara et al. Clin Cancer Res 5:2236-2241, 1999; Gaugler et al. J Exp Med 179:921-930, 1994; van der Bruggen et al. Eur J Immunol 24:3038- 3043, 1994; Tanaka et al. Cancer Res 57:4465-4468, 1997; Oiso et al. Int J Cancer 81 :387-394, 1999; Herman et al. Immunogenetics 43:377-383, 1996; Manici et al. J Exp Med 189:871-876, 1999; Duffour et al. Eur J Immunol 29:3329-3337, 1999; Zorn et al. Eur J Immunol 29:602-607, 1999; Huang et al. J Immunol 162:6849- 6854, 1999; Boel et al. Immunity 2:167-175, 1995; Van den Eynde et al. J Exp Med 182:689-698, 1995; De Backer et al. Cancer Res 59:3157-3165, 1999; Jager et al. J Exp Med 187:265-270, 1998; Wang et al. J Immunol 161 :3596-3606, 1998; Aarnoudse et al. Int J Cancer 82:442-448, 1999; Guilloux et al. J Exp Med 183:1173- 1183, 1996; Lupetti et al. J Exp Med 188:1005-1016, 1998; Wόlfel et al. Eur J Immunol 24:759-764, 1994; Skipper et al. J Exp Med 183:527-534, 1996; Kang et al. J Immunol 155:1343-1348, 1995; Morel et al. Int J Cancer 83:755-759, 1999; Brichard et al. Eur J Immunol 26:224-230, 1996; Kittlesen et al. J Immunol 160:2099-2106, 1998; Kawakami et al. J Immunol 161 :6985-6992, 1998; Topalian et al. J Exp Med 183:1965-1971, 1996; Kobayashi et al. Cancer Research 58:296-301, 1998; Kawakami et al. J Immunol 154:3961-3968, 1995; Tsai et al. J Immunol 158:1796-1802, 1997; Cox et al. Science 264:716-719, 1994; Kawakami et al. Proc Natl Acad Sci USA 91 :6458-6462, 1994; Skipper et al. J Immunol 157:5027-5033,
1996; Robbins et al. J Immunol 159:303-308, 1997; Castelli et al. J Immunol 162:1739-1748, 1999; Kawakami et al. J Exp Med 180:347-352, 1994; Castelli et al. J Exp Med 181 :363-368, 1995; Schneider et al. Int J Cancer 75:451-458, 1998; Wang et al. J Exp Med 183:1131-1140, 1996; Wang et al. J Exp Med 184:2207- 2216, 1996; Parkhurst et al. Cancer Research 58:4895-4901, 1998; Tsang et al. J Natl Cancer Inst 87:982-990, 1995; Correale et al. J Natl Cancer Inst 89:293-300, 1997; Coulie et al. Proc Natl Acad Sci USA 92:7976-7980, 1995; Wόlfel et al. Science 269:1281-1284, 1995; Robbins et al. J Exp Med 183:1185-1192, 1996; Brandle et al. J Exp Med 183:2501-2508, 1996; ten Bosch et al. Blood 88:3522-3527, 1996; Mandruzzato et al. J Exp Med 186:785-793, 1997; Gueguen et al. J Immunol
160:6188-6194, 1998; Gjertsen et al. Int J Cancer 72:784-790, 1997; Gaudin et al. J Immunol 162:1730-1738, 1999; Chiari et al. Cancer Res 59:5785-5792, 1999; Hogan et al. Cancer Res 58:5144-5150, 1998; Pieper et al. J Exp Med 189:757-765, 1999; Wang et al. Science 284:1351-1354, 1999; Fisk et al. J Exp Med 181 :2109-2117, 1995; Brossart et al. Cancer Res 58:732-736, 1998; Rόpke et al. Proc Natl Acad Sci USA 93:14704-14707, 1996; Ikeda et al. Immunity 6:199-208, 1997; Ronsin et al. J Immunol 163:483-490, 1999; Vonderheide et al. Immunity 10:673-679, 1999. These antigens as well as others are disclosed in PCT Application PCT/US98/18601
An infectious antigen as used herein is an antigen of a microorganism and includes but is not limited to antigens associated with viruses, bacteria, fungi, and parasites. Such antigens include the intact microorganism as well as natural isolates and fragments or derivatives thereof and also synthetic compounds which are identical to or similar to natural microorganism antigens and induce an immune response specific for that microorganism. A compound is similar to a natural microorganism antigen if it induces an immune response (humoral and/or cellular) to a natural microorganism antigen. Such antigens are used routinely in the art and are well known to those of ordinary skill in the art.
Bacterial antigens may be derived from infectious bacteria. Bacteria are unicellular organisms which multiply asexually by binary fission. They are classified and named based on their morphology, staining reactions, nutrition and metabolic requirements, antigenic structure, chemical composition, and genetic homology. Bacteria can be classified into three groups based on their morphological forms, spherical (coccus), straight-rod (bacillus) and curved or spiral rod (vibrio, Campylobacter, spirillum, and spirochaete). Bacteria are also more commonly characterized based on their staining reactions into two classes of organisms, gram-positive and gram-negative. Gram refers to the method of staining which is commonly performed in microbiology labs. Gram-positive organisms retain the stain following the staining procedure and appear a deep violet color. Gram-negative organisms do not retain the stain but take up the counter-stain and thus appear pink.
Infectious bacteria include, but are not limited to, gram negative and gram positive bacteria. Gram positive bacteria include, but are not limited to Pasteurella species, Staphylococci species, and Streptococcus species. Gram negative bacteria include, but are not limited to, Escherichia coli, Pseudomonas species, and Salmonella species. Specific examples of infectious bacteria include but are not limited to: Helicobacter pyloris, Borrelia burgdorferi, Legionella pneumophilia, Mycobacteria sps (e.g., M. tuberculosis, M. avium, M. intracellulare, M. kansasii, M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic species), Streptococcus pneumoniae, pathogenic Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacteriumsp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides
sp., Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema pallidum, Treponema pertenue, Leptospira, Rickettsia, and Actinomyces israelii.
Viral antigens may be derived from infectious viruses. Viruses are small infectious agents which generally contain a nucleic acid core and a protein coat, but are not independently living organisms. Viruses can also take the form of infectious nucleic acids lacking a protein. A virus cannot survive in the absence of a living cell within which it can replicate. Viruses enter specific living cells either by endocytosis or direct injection of DNA (phage) and multiply, causing disease. The multiplied virus can then be released and infect additional cells. Some viruses are DNA-containing viruses and others are RNA-containing viruses. In some aspects, the invention also intends to treat diseases in which prions are implicated in disease progression such as for example bovine spongiform encephalopathy (i.e., mad cow disease, BSE) or scrapie infection in animals, or Creutzfeldt- Jakob disease in humans.
Viruses include, but are not limited to, enteroviruses (including, but not limited to, viruses that the family picornaviridae, such as polio virus, coxsackie virus, echo virus), rotaviruses, adenovirus, hepatitis virus. Specific examples of viruses that have been found in humans include but are not limited to: Retroviridae (e.g., human immunodeficiency viruses, such as HIV-I (also referred to as HTLV-III, LAV or
HTLV-III/LAV, or HIV-III; and other isolates, such as HIV-LP; Picornaviridae (e.g., polio viruses, hepatitis A virus; enteroviruses, human Coxsackie viruses, rhinoviruses, echoviruses); Calciviridae (e.g., strains that cause gastroenteritis); Togaviridae (e.g., equine encephalitis viruses, rubella viruses); Flaviviridae (e.g., dengue viruses, encephalitis viruses, yellow fever viruses); Coronaviridae (e.g., coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g., ebola viruses); Paramyxoviridae (e.g., parainfluenza viruses, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (e.g., influenza viruses); Bungaviridae (e.g., Hantaan viruses, bunga viruses, phleboviruses
and Nairo viruses); Arenaviridae (hemorrhagic fever viruses); Reoviridae (e.g., reoviruses, orbiviurses and rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvoviridae (parvoviruses); Papovaviridae (papillomaviruses, polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella zoster virus, cytomegalovirus (CMV)); Poxviridae (variola viruses, vaccinia viruses, pox viruses); Iridoviridae (e.g., African swine fever virus); and unclassified viruses (e.g., the etiological agents of spongiform encephalopathies, the agent of delta hepatitis (thought to be a defective satellite of hepatitis B virus), the agents of non-A, non-B hepatitis (class l=internally transmitted; class 2=parenterally transmitted (i.e., Hepatitis C); Norwalk and related viruses, and astro viruses).
Fungal antigens may be derived from infectious fungi. Fungi are eukaryotic organisms, only a few of which cause infection in vertebrate mammals. Because fungi are eukaryotic organisms, they differ significantly from prokaryotic bacteria in size, structural organization, life cycle and mechanism of multiplication. Fungi are classified generally based on morphological features, modes of reproduction and culture characteristics. Although fungi can cause different types of disease in subjects, such as respiratory allergies following inhalation of fungal antigens, fungal intoxication due to ingestion of toxic substances, such as Amanita phalloides toxin and phallotoxin produced by poisonous mushrooms and aflatoxins, produced by aspergillus species, not all fungi cause infectious disease.
Infectious fungi can cause systemic or superficial infections. Primary systemic infection can occur in normal healthy subjects, and opportunistic infections are most frequently found in immunocompromised subjects. The most common fungal agents causing primary systemic infection include Blastomyces, Coccidioides, and Htoplasma. Common fungi causing opportunistic infection in immunocompromised or immunosuppressed subjects include, but are not limited to, Candida albicans,
Cryptococcus neoformans, and various Aspergillus species. Systemic fungal infections are invasive infections of the internal organs. The organism usually enters the body through the lungs, gastrointestinal tract, or intravenous catheters. These types of infections can be caused by primary pathogenic fungi or opportunistic fungi.
Superficial fungal infections involve growth of fungi on an external surface without invasion of internal tissues. Typical superficial fungal infections include cutaneous fungal infections involving skin, hair, or nails.
Diseases associated with fungal infection include aspergillosis, blastomycosis, candidiasis, chromoblastomycosis, coccidioidomycosis, cryptococcosis, fungal eye infections, fungal hair, nail, and skin infections, histoplasmosis, lobomycosis, mycetoma, otomycosis, paracoccidioidomycosis, disseminated Penicillium marneffei, phaeohyphomycosis, rhinosporidioisis, sporotrichosis, and zygomycosis.
Parasitic antigens may be derived from infectious parasites. Parasites are organisms which depend upon other organisms in order to survive and thus must enter, or infect, another organism to continue their life cycle. The infected organism, i.e., the host, provides both nutrition and habitat to the parasite. Although in its broadest sense the term parasite can include all infectious agents (i.e., bacteria, viruses, fungi, protozoa and helminths), generally speaking, the term is used to refer solely to protozoa, helminths, and ectoparasitic arthropods (e.g., ticks, mites, etc.). Protozoa are single-celled organisms which can replicate both intracellularly and extracellularly, particularly in the blood, intestinal tract or the extracellular matrix of tissues. Helminths are multicellular organisms which almost always are extracellular (an exception being Trichinella spp.). Helminths normally require exit from a primary host and transmission into a secondary host in order to replicate. In contrast to these aforementioned classes, ectoparasitic arthropods form a parasitic relationship with the external surface of the host body.
Parasites include intracellular parasites and obligate intracellular parasites. Examples of parasites include but are not limited to Plasmodium falciparum, Plasmodium ovale, Plasmodium malariae, Plasmdodium vivax, Plasmodium knowlesi, Babesia microti, Babesia divergens, Trypanosoma cruzi, Toxoplasma gondii, Trichinella spiralis, Leishmania major, Leishmania donovani, Leishmania braziliensis, Leishmania tropica, Trypanosoma gambiense, Trypanosoma rhodesiense and Schistosoma mansoni.
Other medically relevant microorganisms have been described extensively in the literature, e.g., see C. G. A Thomas, Medical Microbiology, Bailliere Tindall, Great Britain 1983, the entire contents of which is hereby incorporated by reference. Each of the foregoing lists is illustrative and is not intended to be limiting.
An "allergy" refers to acquired hypersensitivity to a substance (allergen). Allergic conditions include but are not limited to eczema, allergic rhinitis or coryza, hay fever, allergic conjunctivitis, bronchial asthma, urticaria (hives) and food allergies, other atopic conditions including atopic dermatitis; anaphylaxis; drug allergy; and angioedema. Allergic diseases include but are not limited to rhinitis (hay fever), asthma, urticaria, and atopic dermatitis.
Allergy is a disease associated with the production of antibodies from a particular class of immunoglobulin, IgE, against allergens. The development of an IgE- mediated response to common aeroallergens is also a factor which indicates predisposition towards the development of asthma. If an allergen encounters a specific IgE which is bound to an IgE Fc receptor (Fc[epsilon]R) on the surface of a basophil (circulating in the blood) or mast cell (dispersed throughout solid tissue), the cell becomes activated, resulting in the production and release of mediators such as histamine, serotonin, and lipid mediators.
The generic name for molecules that cause an allergic reaction is allergen. An "allergen" as used herein is a molecule capable of provoking an immune response characterized by production of IgE. An allergen is a substance that can induce an allergic or asthmatic response in a susceptible subject. Thus, in the context of this invention, the term allergen means a specific type of antigen which can trigger an allergic response which is mediated by IgE antibody. The method and preparations of this invention extend to a broad class of such allergens and fragments of allergens or haptens acting as allergens. The list of allergens is enormous and can include pollens, insect venoms, animal dander, dust, fungal spores, and drugs (e.g., penicillin).
Examples of natural, animal and plant allergens include but are not limited to proteins specific to the following genera: Agropyron (e. g., Agropyron repens) ; Agrostis (e.g., Agrostis alba) ; Alder ; Alnus (Alnus gultinoasa) ; Alternaria (Alternaria alternat) ;
Ambrosia (Ambrosia artemiisfolia) ; Anthoxanthum (e. g., Anthoxanthum odoratum) ; Apis (e. g., Apis multiflorum); Arrhenatherum (e.g., Arrhenatherum elatius); Artemisia (Artemisia vulgaris); Avena (e. g., Avena sativa) ; Betula (Betulaverrucosa) ; Blattella (e. g., Blattellagermanica) ; Bromus (e. g.,Bromes inermis) ; Canine(Canis familiaris) ; Chamaecyparis (e. g.,Chamaecyparis obtusa) ; Cryptomeria (Cryptomeria japonica) ; Cupressus (e. g., Cupressussempervirens, Cupressus arizonica, andCupressus macrocarpa) ; Dactylis (e. g., Dactylisglomerata) ;Dermatophagoides (e. g., Dermatophagoides farinae) ; Felis (Felis domesticus) ;Festuca (e. g., Festuca elatior) ; Holcus (e. g., Holcus lanatus) ; Junipers (e. g., Junipers sabinoides, Juniperus virginiana, Juniperus communis, and Juniperus ashei) ;Lolium (e. g., Sodium perenne or Lolium multiflorum) ; Olea (Olea europa) ; Parietaria (e. g., Parietariaofficitaalis or Parietaria judaica) ; Paspalum (e. g., Paspalum notatum) ;Periplaneta (e. g.,Periplafaeta americana) ; Phalaris (e. g., Phalaris arundinacea) ; Phleum (e. g., Phlegm pratense) ; Plantago (e. g.,
Plantago lanceolata) ; Poa (e. g.,Poa pratensis or Poa compressa) ;Quercus (Quercusalba) ; Secale (e. g., Secale cereale) ; Sorghum (e. g., Sorghum halepensis) ; Thuya (e. g., Thuya orientalis) ; and Triticum (e. g., Triticum aestivum) .
"Asthma" as used herein refers to a disorder of the respiratory system characterized by inflammation, narrowing of the airways, and increased reactivity of the airways to inhaled agents. Asthma is frequently, although not exclusively, associated with an atopic or allergic condition. Symptoms of asthma include recurrent episodes of wheezing, breathlessness, and chest tightness, and coughing, resulting from airflow obstruction. Airway inflammation associated with asthma can be detected through observation of a number of physiological changes, such as, denudation of airway epithelium, collagen deposition beneath basement membrane, edema, mast cell activation, inflammatory cell infiltration, including neutrophils, inosineophils, and lymphocytes. As a result of the airway inflammation, asthma patients often experience airway hyper-responsiveness, airflow limitation, respiratory symptoms, and disease chronicity. Airflow limitations include acute bronchoconstriction, airway edema, mucous plug formation, and airway remodeling, features which often lead to bronchial obstruction. In some cases of asthma, sub-basement membrane fibrosis may occur, leading to persistent abnormalities in lung function.
Research over the past several years has revealed that asthma likely results from complex interactions among inflammatory cells, mediators, and other cells and tissues resident in the airway. Mast cells, inosineophils, epithelial cells, macrophage, and activated T-cells all play an important role in the inflammatory process associated with asthma. Djukanovic R et al. (1990) Am Rev Respir Dis 142:434-457. It is believed that these cells can influence airway function through secretion of preformed and newly synthesized mediators which can act directly or indirectly on the local tissue. It has also been recognized that subpopulations of T-lymphocytes (Th2) play an important role in regulating allergic inflammation in the airway by
releasing selective cytokines and establishing disease chronicity. Robinson D S et al. (1992) N Engl J Med 326:298-304.
Asthma is a complex disorder which arises at different stages in development and can be classified based on the degree of symptoms as acute, subacute or chronic. An acute inflammatory response is associated with an early recruitment of cells into the airway. The subacute inflammatory response involves the recruitment of cells as well as the activation of resident cells causing a more persistent pattern of inflammation. Chronic inflammatory response is characterized by a persistent level of cell damage and an ongoing repair process, which may result in permanent abnormalities in the airway.
"ThI immune activation" as used herein refers to the activation of immune cells to express ThI -like secreted products, including certain cytokines, chemokines, and subclasses of immunoglobulin; and activation of certain immune cells. ThI -like secreted products include, for example, the cytokines IFN-[gamma], IL-2, IL-12, IL- 18, TNF-[alpha], and the chemokine IP-IO (CXCLlO). In the mouse, ThI immune activation stimulates secretion of IgG2a. ThI immune activation also may include activation of NK cells and dendritic cells, i.e., cells involved in cellular immunity. ThI immune activation is believed to counter-regulate Th2 immune activation.
"Th2 immune activation" as used herein refers to the activation of immune cells to express Th2-like secreted products, including certain cytokines and subclasses of immunoglobulin. Th2-like secreted products include, for example, the cytokines IL-4 and IL-10. In the mouse, Th2 immune activation stimulates secretion of IgGl and IgE. Th2 immune activation is believed to counter-regulate ThI immune activation.
The pharmaceutical compositions in accordance with the invention may allow to treat asthma by stimulating TLR activity and particularly TLR7 and/or TLR9 activity
and thus to channel Th2 activity to ThI activity. Thus the compounds and pharmaceutical compositions of the invention are also useful for redirecting an immune response from a Th2 immune response to a ThI immune response. Redirection of an immune response from a Th2 to a ThI immune response can be assessed by measuring the levels of cytokines produced in response to the nucleic acid (e. g., by inducing monocytic cells and other cells to produce ThI cytokines, including IL-12,IFN-y and GM-CSF).
As mentioned above, the pharmaceutical compositions of the present invention can comprise pharmaceutically active compounds for treating asthma, cancer etc. even if these compounds are not antigens useful for vaccination.
For example, chemotherapy refers to therapy using chemical and/or biological agents to attack cancer cells. Unlike localized surgery or radiation, chemotherapy is generally administered in a systemic fashion and thus toxicity to normal tissues is a major concern. Because many chemotherapy agents target cancer cells based on their proliferative profiles, tissues such as the gastrointestinal tract and the bone marrow which are normally proliferative are also susceptible to the effects of the chemotherapy. One of the major side effects of chemotherapy is myelo suppression (including anemia, neutropenia and thrombocytopenia) which results from the death of normal hemopoietic precursors.
Many chemo therapeutic agents have been developed for the treatment of cancer. Not all tumors, however, respond to chemotherapeutic agents and others although initially responsive to chemotherapeutic agents may develop resistance. As a result, the search for effective anti-cancer drugs has intensified in an effort to find even more effective agents with less non-specific toxicity.
Cancer medicaments function in a variety of ways. Some cancer medicaments work by targeting physiological mechanisms that are specific to tumor cells. Examples include the targeting of specific genes and their gene products (i.e., proteins primarily) which are mutated in cancers. Such genes include but are not limited to oncogenes (e.g., Ras, Her2, bcl-2), tumor suppressor genes (e.g., EGF, p53, Rb), and cell cycle targets (e.g., CDK4, p21, telomerase). Cancer medicaments can alternately target signal transduction pathways and molecular mechanisms which are altered in cancer cells. Targeting of cancer cells via the epitopes expressed on their cell surface is accomplished through the use of monoclonal antibodies. This latter type of cancer medicament is generally referred to herein as immunotherapy.
Other cancer medicaments target cells other than cancer cells. For example, some medicaments prime the immune system to attack tumor cells (i.e., cancer vaccines). Still other medicaments, called angiogenesis inhibitors, function by attacking the blood supply of solid tumors. Since the most malignant cancers are able to metastasize (i.e., exit the primary tumor site and seed a another site, thereby forming a secondary tumor), medicaments that impede this metastasis are also useful in the treatment of cancer. Angiogenic mediators include basic FGF, VEGF, angiopoietins, angiostatin, endostatin, TNF-[alpha], TNP-470, thrombospondin-1, platelet factor 4, CAI, and certain members of the integrin family of proteins. One category of this type of medicament is a metalloproteinase inhibitor, which inhibits the enzymes used by the cancer cells to exist the primary tumor site and extravasate into another tissue.
As used herein, "anti-cancer agents" (and, equivalently, chemotherapeutic agents or chemotherapy agents) embrace all other forms of cancer medicaments which do not fall into the categories of immunotherapeutic agents or cancer vaccines. Chemotherapeutic agents as used herein encompass both chemical and biological agents. These agents function to inhibit a cellular activity upon which the cancer cell is dependent for continued survival. Categories of chemotherapeutic agents include
alkylating/alkaloid agents, antimetabolites, hormones or hormone analogs, and miscellaneous antineoplastic drugs. Most if not all of these agents are directly toxic to cancer cells and do not require immune stimulation. Combination chemotherapy and immunostimulatory nucleic acid administration increases the maximum tolerable dose of chemotherapy
Thus, chemotherapeutic agents which can be used according to the invention include
Aminoglutethimide, Amsacrine (m- AMSA), Asparaginase, Azacitidine,
Busulfan, Carboplatin, Chlorambucil, Cisplatin, Cyclophosphamide, CytarabineHCl, Dactinomycin, DaunorubicinHCl, Erythropoietin, Estramustine phosphate sodium, Etoposide(VP 16-213), Floxuridine, Fluorouracil (5-FU), Flutamide, Hexamethylmelamine (HMM), Hydroxyurea (hydroxycarbamide), Ifosfamide, Leuprolide acetate (LHRH-releasing factor analogue), Lomustine(CCNU), Mechlorethamine HC 1 (nitrogen mustard), Mercaptopurine, Mesna, Mitoguazone (methyl-GAG; methyl glyoxal bis- guanylhydrazone;
MGBG), Mitotane (o, p'-DDD), MitoxantroneHCl, Octreotide, Paclitaxel, Pentostatin (2'deoxycoformycin), Plicamycin, ProcarbazineHCl, Semustine (methyl- CCNU), Streptozotocin,Tamoxifen citrate, Teniposide (VM-26),Thioguanine, Thiotepa,
Vinblastine sulfate, and Vindesine sulfate. Monoclonal antibodies such as Rituxan, Avastin or Herceptin are also covered by the term anti-cancer agents.
Infection medicaments include but are not limited to anti-bacterial agents, anti- viral agents, anti-fungal agents and anti-parasitic agents. Phrases such as "anti-infective agent", "antibiotic", "anti-bacterial agent", "anti-viral agent", "anti-fungal agent", "anti-parasitic agent" and "parasiticide" have well-established meanings to those of ordinary skill in the art and are defined in standard medical texts. Briefly, antibacterial agents kill or inhibit bacteria, and include antibiotics as well as other
synthetic or natural compounds having similar functions. Anti- viral agents can be isolated from natural sources or synthesized and are useful for killing or inhibiting viruses. Anti-fungal agents are used to treat superficial fungal infections as well as opportunistic and primary systemic fungal infections. Anti-parasite agents kill or inhibit parasites. Many antibiotics are low molecular weight molecules which are produced as secondary metabolites by cells, such as microorganisms. In general, antibiotics interfere with one or more functions or structures which are specific for the microorganism and which are not present in host cells.
Antibacterial antibiotics which are effective for killing or inhibiting a wide range of bacteria are referred to as broad-spectrum antibiotics. Other types of antibacterial antibiotics are predominantly effective against the bacteria of the class gram-positive or gram-negative. These types of antibiotics are referred to as narrow-spectrum antibiotics. Other antibiotics which are effective against a single organism or disease and not against other types of bacteria, are referred to as limited-spectrum antibiotics.
Anti-bacterial agents are sometimes classified based on their primary mode of action. In general, anti-bacterial agents are cell wall synthesis inhibitors, cell membrane inhibitors, protein synthesis inhibitors, nucleic acid synthesis or functional inhibitors, and competitive inhibitors. Cell wall synthesis inhibitors inhibit a step in the process of cell wall synthesis, and in general in the synthesis of bacterial peptidoglycan. Cell wall synthesis inhibitors include [beta] -lactam antibiotics, natural penicillins, semisynthetic penicillins, ampicillin, clavulanic acid, cephalosporins, and bacitracin.
The [beta] -lactams are antibiotics containing a four-membered [beta] -lactam ring which inhibits the last step of peptidoglycan synthesis, [beta] -lactam antibiotics can be synthesized or natural. The [beta]-lactam antibiotics produced by penicillium are the natural penicillins, such as penicillin G or penicillin V. These are produced by fermentation of Penicillium chrysogenum. The natural penicillins have a narrow
spectrum of activity and are generally effective against Streptococcus, Gonococcus, and Staphylococcus. Other types of natural penicillins, which are also effective against gram-positive bacteria, include penicillins F, X, K, and O.
Semi- synthetic penicillins are generally modifications of the molecule 6- aminopenicillanic acid produced by a mold. The 6-aminopenicillanic acid can be modified by addition of side chains which produce penicillins having broader spectrums of activity than natural penicillins or various other advantageous properties. Some types of semi- synthetic penicillins have broad spectrums against gram-positive and gram-negative bacteria, but are inactivated by penicillinase. These semi- synthetic penicillins include ampicillin, carbenicillin, oxacillin, azlocillin, mezlocillin, and piperacillin. Other types of semi-synthetic penicillins have narrower activities against gram-positive bacteria, but have developed properties such that they are not inactivated by penicillinase. These include, for instance, methicillin, dicloxacillin, and nafcillin. Some of the broad spectrum semi-synthetic penicillins can be used in combination with [beta] -lactamase inhibitors, such as clavulanic acids and sulbactam. The [beta]-lactamase inhibitors do not have anti-microbial action but they function to inhibit penicillinase, thus protecting the semi- synthetic penicillin from degradation.
One of the serious side effects associated with penicillins, both natural and semisynthetic, is penicillin allergy. Penicillin allergies are very serious and can cause death rapidly.
Another type of [beta] -lactam antibiotic is the cephalosporins. They are sensitive to degradation by bacterial [beta]-lactamases, and thus, are not always effective alone. Cephalosporins, however, are resistant to penicillinase. They are effective against a variety of gram-positive and gram-negative bacteria. Cephalosporins include, but are not limited to, cephalothin, cephapirin, cephalexin, cefamandole, cefaclor, cefazolin,
cefuroxine, cefoxitin, cefotaxime, cefsulodin, cefetamet, cefixime, ceftriaxone, cefoperazone, ceftazidine, and moxalactam.
Bacitracin is another class of antibiotics which inhibit cell wall synthesis, by inhibiting the release of muropeptide subunits or peptidoglycan from the molecule that delivers the subunit to the outside of the membrane. Although bacitracin is effective against gram-positive bacteria, its use is limited in general to topical administration because of its high toxicity.
Carbapenems are another broad- spectrum [beta] -lactam antibiotic, which is capable of inhibiting cell wall synthesis. Examples of carbapenems include, but are not limited to, imipenems. Monobactams are also broad-spectrum [beta]-lactam antibiotics, and include, euztreonam. An antibiotic produced by Streptomyces, vancomycin, is also effective against gram-positive bacteria by inhibiting cell membrane synthesis.
Another class of anti-bacterial agents is the anti-bacterial agents that are cell membrane inhibitors. These compounds disorganize the structure or inhibit the function of bacterial membranes.
One clinically useful cell membrane inhibitor is Polymyxin. Polymyxins interfere with membrane function by binding to membrane phospholipids. Polymyxin is effective mainly against Gram-negative bacteria and is generally used in severe Pseudomonas infections or Pseudomonas infections that are resistant to less toxic antibiotics.
Other cell membrane inhibitors include Amphotericin B and Nystatin which are antifungal agents used predominantly in the treatment of systemic fungal infections and Candida yeast infections. Imidazoles are another class of antibiotic that is a cell
membrane inhibitor. Imidazoles are used as anti-bacterial agents as well as antifungal agents, e.g., used for treatment of yeast infections, dermatophytic infections, and systemic fungal infections. Imidazoles include but are not limited to clotrimazole, miconazole, ketoconazole, itraconazole, and fluconazole.
Many anti-bacterial agents are protein synthesis inhibitors. These compounds prevent bacteria from synthesizing structural proteins and enzymes and thus cause inhibition of bacterial cell growth or function or cell death. In general these compounds interfere with the processes of transcription or translation. Anti-bacterial agents that block transcription include but are not limited to Rifampins and Ethambutol. Rifampins, which inhibit the enzyme RNA polymerase, have a broad spectrum activity and are effective against gram-positive and gram-negative bacteria as well as Mycobacterium tuberculosis. Ethambutol is effective against Mycobacterium tuberculosis.
Anti-bacterial agents which block translation interfere with bacterial ribosomes to prevent mRNA from being translated into proteins. In general this class of compounds includes but is not limited to tetracyclines, chloramphenicol, the macro lides (e.g., erythromycin) and the aminoglycosides (e.g., streptomycin).
The aminoglycosides are a class of antibiotics which are produced by the bacterium Streptomyces, such as, for instance streptomycin, kanamycin, tobramycin, amikacin, and gentamicin. Aminoglycosides have been used against a wide variety of bacterial infections caused by Gram-positive and Gram-negative bacteria. Streptomycin has been used extensively as a primary drug in the treatment of tuberculosis. Gentamicin is used against many strains of Gram-positive and Gram-negative bacteria, including Pseudomonas infections, especially in combination with Tobramycin. Kanamycin is used against many Gram-positive bacteria, including penicillin-resistant Staphylococci.
Another type of translation inhibitor anti-bacterial agent is the tetracyclines. The tetracyclines are a class of antibiotics that are broad- spectrum and are effective against a variety of gram-positive and gram-negative bacteria. Examples of tetracyclines include tetracycline, minocycline, doxycycline, and chlortetracycline. They are important for the treatment of many types of bacteria but are particularly important in the treatment of Lyme disease.
Anti-bacterial agents such as the macro lides bind reversibly to the 50 S ribosomal subunit and inhibit elongation of the protein by peptidyl transferase or prevent the release of uncharged tRNA from the bacterial ribosome or both. These compounds include erythromycin, roxithromycin, clarithromycin, oleandomycin, and azithromycin.
Another type of translation inhibitor is chloramphenicol. Chloramphenicol binds the 70 S ribosome inhibiting the bacterial enzyme peptidyl transferase thereby preventing the growth of the polypeptide chain during protein synthesis. One serious side effect associated with chloramphenicol is aplastic anemia. Aplastic anemia develops at doses of chloramphenicol which are effective for treating bacteria in a small proportion (1/50,000) of patients.
Some anti-bacterial agents disrupt nucleic acid synthesis or function, e.g., bind to DNA or RNA so that their messages cannot be read. These include but are not limited to quinolones and co-trimoxazole, both synthetic chemicals and rifamycins, a natural or semi-synthetic chemical. The quinolones block bacterial DNA replication by inhibiting the DNA gyrase, the enzyme needed by bacteria to produce their circular DNA. They are broad spectrum and examples include norfloxacin, ciprofloxacin, enoxacin, nalidixic acid and temafloxacin. Nalidixic acid is a bactericidal agent that binds to the DNA gyrase enzyme (topoisomerase) which is
essential for DNA replication and allows supercoils to be relaxed and reformed, inhibiting DNA gyrase activity. The main use of nalidixic acid is in treatment of lower urinary tract infections (UTI) because it is effective against several types of Gram-negative bacteria such as E. coli, Enterobacter aerogenes, K. pneumoniae and Proteus species which are common causes of UTI. Co-trimoxazole is a combination of sulfamethoxazole and trimethoprim, which blocks the bacterial synthesis of folic acid needed to make DNA nucleotides. Rifampicin is a derivative of rifamycin that is active against Gram-positive bacteria (including Mycobacterium tuberculosis and meningitis caused by Neisseria meningitidis) and some Gram-negative bacteria. Rifampicin binds to the beta subunit of the polymerase and blocks the addition of the first nucleotide which is necessary to activate the polymerase, thereby blocking mRNA synthesis.
Another class of anti-bacterial agents is compounds that function as competitive inhibitors of bacterial enzymes. The competitive inhibitors are mostly all structurally similar to a bacterial growth factor and compete for binding but do not perform the metabolic function in the cell. These compounds include sulfonamides and chemically modified forms of sulfanilamide which have even higher and broader antibacterial activity. The sulfonamides (e.g., gantrisin and trimethoprim) are useful for the treatment of Streptococcus pneumoniae, beta-hemo lytic streptococci and E. coli, and have been used in the treatment of uncomplicated UTI caused by E. coli, and in the treatment of meningococcal meningitis.
Anti- viral agents are compounds which prevent infection of cells by viruses or replication of the virus within the cell. There are many fewer antiviral drugs than antibacterial drugs because the process of viral replication is so closely related to DNA replication within the host cell, that non-specific antiviral agents would often be toxic to the host. There are several stages within the process of viral infection which can be blocked or inhibited by antiviral agents. These stages include,
attachment of the virus to the host cell (immunoglobulin or binding peptides), uncoating of the virus (e.g. amantadine), synthesis or translation of viral mRNA (e.g. interferon), replication of viral RNA or DNA (e.g. nucleoside analogues), maturation of new virus proteins (e.g. protease inhibitors), and budding and release of the virus.
Another category of anti- viral agents are nucleoside analogues. Nucleoside analogues are synthetic compounds which are similar to nucleosides, but which have an incomplete or abnormal deoxyribose or ribose group. Once the nucleoside analogues are in the cell, they are phosphorylated, producing the triphosphate form which competes with normal nucleotides for incorporation into the viral DNA or
RNA. Once the triphosphate form of the nucleoside analogue is incorporated into the growing nucleic acid chain, it causes irreversible association with the viral polymerase and thus chain termination. Nucleoside analogues include, but are not limited to, acyclovir (used for the treatment of herpes simplex virus and varicella- zoster virus), gancyclovir (useful for the treatment of cytomegalovirus), idoxuridine, ribavirin (useful for the treatment of respiratory syncitial virus), dideoxyinosine, dideoxycytidine, and zidovudine (azidothymidine).
Another class of anti- viral agents includes cytokines such as interferons. The interferons are cytokines which are secreted by virus-infected cells as well as immune cells. The interferons function by binding to specific receptors on cells adjacent to the infected cells, causing the change in the cell which protects it from infection by the virus, [alpha] and [beta] -interferon also induce the expression of Class I and Class II MHC molecules on the surface of infected cells, resulting in increased antigen presentation for host immune cell recognition, [alpha] and [beta]- interferons are available as recombinant forms and have been used for the treatment of chronic hepatitis B and C infection.
Immuno globulin therapy is used for the prevention of viral infection. Immunoglobulin therapy for viral infections is different from bacterial infections, because rather than being antigen-specific, the immunoglobulin therapy functions by binding to extracellular virions and preventing them from attaching to and entering cells which are susceptible to the viral infection. The therapy is useful for the prevention of viral infection for the period of time that the antibodies are present in the host. In general there are two types of immunoglobulin therapies, normal immune globulin therapy and hyper-immune globulin therapy. Normal immune globulin therapy utilizes a antibody product which is prepared from the serum of normal blood donors and pooled. This pooled product contains low titers of antibody to a wide range of human viruses, such as hepatitis A, parvovirus, enterovirus (especially in neonates). Hyper- immune globulin therapy utilizes antibodies which are prepared from the serum of individuals who have high titers of an antibody to a particular virus. Those antibodies are then used against a specific virus. Examples of hyper- immune globulins include zoster immune globulin (useful for the prevention of varicella in immunocompromised children and neonates), human rabies immune globulin (useful in the post-exposure prophylaxis of a subject bitten by a rabid animal), hepatitis B immune globulin (useful in the prevention of hepatitis B virus, especially in a subject exposed to the virus), and RSV immune globulin (useful in the treatment of respiratory syncitial virus infections).
Anti- fungal agents are useful for the treatment and prevention of infective fungi. Anti- fungal agents are sometimes classified by their mechanism of action. Some anti-fungal agents function as cell wall inhibitors by inhibiting glucose synthase. These include, but are not limited to, basiungin/ECB. Other anti-fungal agents function by destabilizing membrane integrity. These include, but are not limited to, imidazoles, such as clotrimazole, sertaconzole, fluconazole, itraconazole, ketoconazole, miconazole, and voriconacole, as well as FK 463, amphotericin B, BAY 38-9502, MK 991, pradimicin, UK 292, butenafine, and terbinafine. Other anti-
fungal agents function by breaking down chitin (e.g., chitinase) or immunosuppression (501 cream).
Parasiticides are agents that kill parasites directly. Such compounds are known in the art and are generally commercially available. Examples of parasiticides useful for human administration include but are not limited to albendazole, amphotericin B, benznidazole, bithionol, chloroquine HCl, chloroquine phosphate, clindamycin, dehydroemetine, diethylcarbamazine, diloxamide furoate, eflornithine, furazolidaone, glucocorticoids, halofantrine, iodoquinol, ivermectin, mebendazole, mefloquine, meglumine antimoniate, melarsoprol, metrifonate, metronidazole, niclosamide, nifurtimox, oxamniquine, paromomycin, pentamidine isethionate, piperazine, praziquantel, primaquine phosphate, proguanil, pyrantel pamoate, pyrimethanmine-sulfonamides, pyrimethanmine-sulfadoxine, quinacrine HCl, quinine sulfate, quinidine gluconate, spiramycin, stibogluconate sodium (sodium antimony gluconate), suramin, tetracycline, doxycycline, thiabendazole, tinidazole, trimethroprim-sulfamethoxazole, and tryparsamide.
"Anti asthma compounds" (also referred to as asthma medicaments" include, but are not limited, PDE-4 inhibitors, bronchodilator/beta-2 agonists, K+ channel openers, VLA-4 antagonists, neurokin antagonists, thromboxane A2 (TXA2) synthesis inhibitors, xanthines, arachidonic acid antagonists, 5 lipoxygenase inhibitors, TXA2 receptor antagonists, TXA2 antagonists, inhibitor of 5-lipox activation proteins, and protease inhibitors.
Bronchodilator/[beta]2 agonists are a class of compounds which cause bronchodilation or smooth muscle relaxation. Bronchodilator/[beta]2 agonists include, but are not limited to, salmeterol, salbutamol, albuterol, terbutaline, D2522/formoterol, fenoterol, bitolterol, pirbuerol methylxanthines and orciprenaline. Long-acting [beta]2 agonists and bronchodilators are compounds which are used for
long-term prevention of symptoms in addition to the anti- inflammatory therapies. Long-acting [beta]2agonists include, but are not limited to, salmeterol and albuterol.
Methylxanthines, including for instance theophylline, have been used for long-term control and prevention of symptoms. These compounds cause bronchodilation resulting from phosphodiesterase inhibition and likely adenosine antagonism.
Anti-allergy medicaments include, but are not limited to, anti-histamines, steroids, and prostaglandin inducers. Anti-histamines are compounds which counteract histamine released by mast cells or basophils. These compounds are well known in the art and commonly used for the treatment of allergy. Anti-histamines include, but are not limited to, astemizole, azelastine, betatastine, buclizine, ceterizine, cetirizine analogues, CS 560, desloratadine, ebastine, epinastine, fexofenadine, HSR 609, levocabastine, loratidine, mizolastine, norastemizole, terfenadine, and tranilast.
The asthma/allergy medicaments also include steroids and immunomodulators. The steroids include, but are not limited to, beclomethasone, fluticasone, triamcinolone, budesonide, corticosteroids and budesonide.
Corticosteroids include, but are not limited to, beclomethasome dipropionate, budesonide, flunisolide, fluticaosone propionate, and triamcinolone acetonide.
As has been set out above, the compounds of the invention and the pharmaceutical compositions comprising these compounds can be used for inhibiting the immune system if the backbone of the compounds primarily comprises analogues of a phosphate bridging group.
Given that some conditions and particularly auto-immune diseases result from the incapability of the immune system to distinguish between "self and "foreign", the
compounds and pharmaceutical preparations of the invention can be used to treat these conditions. One of the most prominent diseases being treatable by the compounds and pharmaceutical preparations of the invention is systemic lupus erythematosus (SLE). Other diseases being treatable by the compounds and pharmaceutical preparations of the invention are further autoimmune diseases such as acute disseminated encephalomyelitis (ADEM), Addison's disease, ankylosing spondylitisis, antiphospho lipid antibody syndrome (APS), aplastic anemia, autoimmune hepatitis, autoimmune oophoritis, coeliac disease, Crohn's disease, diabetes mellitus, Goodpasture's syndrome, Grave's disease, Guillain-Barre syndrome (GBS), Hashimoto's disease, Idiopathic thrombocytopenic purpura, Kawasaki's disease, multiple sclerosis (MS), opsoclonus myoclonus syndrome (OMS), optic neuritis, Ord's thyroiditis, Pemphigus, pernicious anaemia, primary biliary cirrhosis, rheumatoid arthritis, Reiter's syndrome, Sjogren's syndrome, Takayasu's arteritis, giant cell arteritis, warm autoimmune haemo lytic anemia, Wegener's granulomatosis, Alopecia universalis, Behcet's disease, Chaga's disease, chronic fatigue syndrome, dysautonomia, endometriosis, hidradenitis suppurativa, interstitial cystitis, Lyme disease, neuromyotonia, psoriasis, sarcoidosis, schizophrenia, scleroderma, ulcerative colitis, Vitiligo or Vulvodynia.
The compounds and pharmaceutical compositions of the invention can be administered by any suitable route for administering medications. A variety of administration routes are available. The particular mode selected will depend, of course, upon the particular agent or agents selected, the particular condition being treated, and the dosage required for therapeutic efficacy. The methods of this invention, generally speaking, may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of an immune response without causing clinically unacceptable adverse effects. Preferred modes of administration are discussed herein. For use in therapy, a pharmaceutically effective amount of compounds of the invention (and other therapeutic agent) can be
administered to a subject by any mode that delivers the agent to the desired surface, e.g., mucosal, systemic.
Administering the pharmaceutical composition of the present invention may be accomplished by any means known to the skilled artisan. Routes of administration include but are not limited to oral, parenteral, intravenous, intramuscular, intranasal, sublingual, intratracheal, inhalation, subcutaneous, ocular, vaginal, and rectal. For the treatment or prevention of asthma or allergy, such compounds are preferably inhaled, ingested or administered by systemic routes. Systemic routes include oral and parenteral. Inhaled medications are preferred in some embodiments because of the direct delivery to the lung, the site of inflammation, primarily in asthmatic patients. Several types of devices are regularly used for administration by inhalation. These types of devices include metered dose inhalers (MDI), breath-actuated MDI, dry powder inhaler (DPI), spacer/holding chambers in combination with MDI, and nebulizers.
The therapeutic agents of the invention may be delivered to a particular tissue, cell type, or to the immune system, or both, with the aid of a vector. In its broadest sense, a "vector" is any vehicle capable of facilitating the transfer of the compositions to the target cells. The vector generally transports the compounds and/or pharmaceutical compositions of the invention (and potentially disorder- specific medicaments) to the target cells with reduced degradation relative to the extent of'degradation that would result in the absence of the vector.
In general, the vectors useful in the invention are divided into two classes: biological vectors and chemical/physical vectors. Biological vectors and chemical/physical vectors are useful in the delivery and/or uptake of therapeutic agents of the invention.
In addition to the biological vectors discussed herein, chemical/physical vectors may be used to deliver therapeutic agents including the compounds of the invention as well as antibodies, antigens, and disorder-specific medicaments. As used herein, a "chemical/physical vector" refers to a natural or synthetic molecule, other than those derived from bacteriological or viral sources, capable of delivering the nucleic acid and/or other medicament.
A preferred chemical/physical vector of the invention is a colloidal dispersion system. Colloidal dispersion systems include lipid-based systems including oil-in- water emulsions, micelles, mixed micelles, and liposomes. A preferred colloidal system of the invention is a liposome or a transfersome. Liposomes are artificial membrane vessels which are useful as a delivery vector in vivo or in vitro. It has been shown that large unilamellar vesicles (LUVs), which range in size from 0.2-4.0 [mu]m can encapsulate large macromolecules. RNA, DNA and intact virions can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form. Fraley et al. (1981) Trends Biochem Sci 6:77.
Liposomes may be targeted to a particular tissue by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glyco lipid, or protein. Ligands which may be useful for targeting a liposome to an immune cell include, but are not limited to: intact or fragments of molecules which interact with immune cell specific receptors and molecules, such as antibodies, which interact with the cell surface markers of immune cells. Such ligands may easily be identified by binding assays well known to those of skill in the art. In still other embodiments, the liposome may be targeted to the cancer by coupling it to a one of the immunotherapeutic antibodies discussed earlier. Additionally, the vector may be coupled to a nuclear targeting peptide, which will direct the vector to the nucleus of the host cell.
Lipid formulations for transfection are commercially available from QIAGEN, for example, as EFFECTENE(TM) (a non-liposomal lipid with a special DNA condensing enhancer) and SUPERFECT(TM) (a novel acting dendrimeric technology).
Liposomes are commercially available from Gibco BRL, for example, as LIPOFECTIN(TM) and LIPOFECTACE(TM), which are formed of cationic lipids such as N-[I -(2,3 dioleyloxy)-propyl]-N,N,N-trimethylammonium chloride (DOTMA) and dimethyl dioctadecylammonium bromide (DDAB). Methods for making liposomes are well known in the art and have been described in many publications. Liposomes also have been reviewed by Gregoriadis G (1985) Trends Biotechnol 3:235-241.
The term "charged lipid" refers to a lipid species having either a cationic charge or negative charge or which is a zwitterion which is not net neutrally charged, and generally requires reference to the pH of the solution in which the lipid is found.
Other cationic charged lipids which may be used, at physiological pH include, but are not limited to, N,N-dioleyl-N,N-dimethylammonium chloride ("DODAC"); N- (2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride ("DOTMA"); N5N- distearyl-N,N-dimethylammonium bromide ("DDAB"); N-(2,3-dioleyloxy)propyl)- N,N,N-trimethylammonium chloride ("DOTAP"); 3[beta]-(N-(N',N'- dimethylaminoethane)-carbamoyl)cholesterol ("DC-Choi") and N-(1, 2- dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium bromide ("DMRIE"). Additionally, a number of commercial preparations of catioinic lipids are available which can be used in the present invention. These include, for example, Lipofectin(TM) (commercially available cationic liposomes comprising DOTMA and l,2-dioleoyl-sn-3-phosphoethanolamine ("DOPE"), from GIBCO/BRL, Grand Island, N.Y., USA); Lipofectamine(TM) (commercially available cationic liposomes
comprising N-(l-(2,3-dioleyloxy)propyl)-N-(2-(sperminecarboxamido)ethyl)-N,N- dimethylammonium trifluoroacetate ("DOSPA") and DOPE from GIBCO/BRL); and Transfectam(TM) (commercially available cationic lipids comprising dioctadecylamidoglycyl carboxyspermine ("DOGS") in ethanol from Promega Corp., Madison, Wis., USA).
One may also use anionic charged lipids. Anionic charged lipids at physiological pH include, but are not limited to, phosphatidyl inositol, phosphatidyl serine, phosphatidyl glycerol, phosphatidic acid, diphosphatidyl glycerol, poly(ethylene glycol)-phosphatidyl ethanolamine, dimyristoylphosphatidyl glycerol, dioleoylphosphatidvl glycerol, dilauryloylphosphatidyl glycerol, dipalmitoylphosphatidyl glycerol, distearyloylphosphatidyl glycerol, dimyristoyl phosphatic acid, dipalmitoyl phosphatic acid, dimyristoyl phosphatidyl serine, dipalmitoyl phosphatidyl serine, brain phosphatidyl serine, and the like.
The term "neutral lipid" refers to any of a number of lipid species which exist either in an uncharged or neutral zwitterionic form a physiological pH. Such lipids include, for example, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, cephalin, cholesterol, cerebrosides and diacylglycerols
Preferred cationic lipids which may not only be used for formation of liposomes include DOTAP, lipofectamine, DODAP, DODMA, DMDMA, DC-Choi, DDAB, DODAC, DMRIE, DOPSA and DOGS.
In one embodiment, the vehicle is a biocompatible microparticle or implant that is suitable for implantation or administration to the mammalian recipient. Exemplary bioerodible implants that are useful in accordance with this method are described in PCT International application no. PCT/US/03307 (Publication No. WO95/24929, entitled "Polymeric Gene Delivery System". PCT/US/0307 describes a
biocompatible, preferably biodegradable polymeric matrix for containing an exogenous gene under the control of an appropriate promoter. The polymeric matrix can be used to achieve sustained release of the therapeutic agent in the subject.
The polymeric matrix preferably is in the form of a microparticle such as a microsphere (wherein the nucleic acid and/or the other therapeutic agent is dispersed throughout a solid polymeric matrix) or a microcapsule (wherein the nucleic acid and/or the other therapeutic agent is stored in the core of a polymeric shell). Other forms of the polymeric matrix for containing the therapeutic agent include films, coatings, gels, implants, and stents. The size and composition of the polymeric matrix device is selected to result in favorable release kinetics in the tissue into which the matrix is introduced. The size of the polymeric matrix further is selected according to the method of delivery which is to be used, typically injection into a tissue or administration of a suspension by aerosol into the nasal and/or pulmonary areas. Preferably when an aerosol route is used the polymeric matrix and the nucleic acid and/or the other therapeutic agent are encompassed in a surfactant vehicle.
The polymeric matrix composition can be selected to have both favorable degradation rates and also to be formed of a material which is bioadhesive, to further increase the effectiveness of transfer when the matrix is administered to a nasal and/or pulmonary surface that has sustained an injury. The matrix composition also can be selected not to degrade, but rather, to release by diffusion over an extended period of time. In some preferred embodiments, the nucleic acid are administered to the subject via an implant while the other therapeutic agent is administered acutely. Biocompatible microspheres that are suitable for delivery, such as oral or mucosal delivery, are disclosed in Chickering et al. (1996) Biotech Bioeng 52:96-101 and Mathiowitz E et al. (1997) Nature 386:410-414 and PCT Pat. Application WO97/03702.
Both non-biodegradable and biodegradable polymeric matrices can be used to deliver the nucleic acid and/or the other therapeutic agent to the subject. Biodegradable matrices are preferred. Such polymers may be natural or synthetic polymers. The polymer is selected based on the period of time over which release is desired, generally in the order of a few hours to a year or longer. Typically, release over a period ranging from between a few hours and three to twelve months is most desirable, particularly for the nucleic acid agents. The polymer optionally is in the form of a hydrogel that can absorb up to about 90% of its weight in water and further, optionally is cross-linked with multi-valent ions or other polymers. [0303] Bioadhesive polymers of particular interest include bioerodible hydrogels described by H. S. Sawhney, C. P. Pathak and J. A. Hubell in Macromolecules, (1993) 26:581-587, the teachings of which are incorporated herein. These include polyhyaluronic acids, casein, gelatin, glutin, polyanhydrides, polyacrylic acid, alginate, chitosan, poly(methyl methacrylates), poly(ethyl methacrylates), poly(butylmethacrylate), poly(isobutyl methacrylate), poly(hexylmethacrylate), poly(isodecyl methacrylate), poly(lauryl methacrylate), poly(phenyl methacrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), and poly(octadecyl acrylate).
The pharmaceutical compositions of the invention may be made from the compounds of the invention alone or they may comprise pharmaceutically acceptable excipients (being equivalent to pharmaceutically acceptable carriers). Such compositions may also be designated as formulations.
The compositions of the invention can be administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients.
The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipients" means one or more compatible solid or liquid filler, diluents or encapsulating substances which are suitable for administration to a human or other vertebrate animal. The terms carrier or excipients denote an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The components of the pharmaceutical compositions also are capable of being commingled with the compounds of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficiency.
For oral administration, the compounds of the invention (and other therapeutic agents) can be formulated readily by combining the active compound(s) with pharmaceutically acceptable carriers well known in the art. Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject to be treated. Pharmaceutical preparations for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl- cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. Optionally the oral formulations may also be formulated in saline or buffers for neutralizing internal acid conditions or may be administered without any carriers.
For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.
For administration by inhalation, the compounds for use according to the present invention may be conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g. gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
The compounds, when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which
increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
Alternatively, the active compounds may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
The compounds may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
In addition to the formulations described previously, the compounds may also be formulated as a depot preparation. Such long-acting formulations may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
The pharmaceutical compositions also may comprise suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
Suitable liquid or solid pharmaceutical preparation forms are, for example, aqueous or saline solutions for inhalation, microencapsulated, encochleated, coated onto microscopic gold particles, contained in liposomes, nebulized, aerosols, pellets for implantation into the skin, or dried onto a sharp object to be scratched into the skin. The pharmaceutical compositions also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders,
coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above. The pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of methods for drug delivery, see Langer R (1990) Science 249:1527-1533, which is incorporated herein by reference.
The compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing the compounds into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the compounds into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product. Liquid dose units are vials or ampoules. Solid dose units are tablets, capsules and suppositories.
Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the compounds, increasing convenience to the subject and the physician. Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer base systems such as poly(lactide-glycolide), copolyoxalates, polycapro lactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Pat. No. 5,075,109. Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono-, di-, and tri-glycerides; hydrogel release systems; silastic systems; peptide-based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which an agent of the invention is contained in a form within a matrix such as those
described in U.S. Pat. Nos. 4,452,775, 4,675,189, and 5,736,152, and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Pat. Nos. 3,854,480, 5,133,974 and 5,407,686. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.
In the following the invention will be described by way of examples. However, these examples are for illustrative purposes and not be construed as limiting the invention in any way.
EXAMPLES
Before the examples are described in detail, the following materials and methods are given.
Preparation and characterization of dendritic cells (DC) derived from mouse bone marrow
The following mice were used in the studies: C57BL/6 WT mice (commercially available from Jackson Laboratories), TLR9- and TLR7-deficient mice (provided by Dr. Akira, Osaka University, Osaka, Japan), MyD88-defϊcient mice (Dr. Akira) and male IRF7-deficient mice (provided by T. Taniguchi, Tokyo, Japan). All mice were on C57BL6 genetic background.
To obtain functional Flt3-L-dependent dendritic cells (Flt3 DC), mouse bone marrow cells were isolated and treated as previously described (Spies B. et al (2003) J. Immunol. 171 :5908-5912). In short, bone marrow cells were harvested from femurs and tibias of mice and cultured in the presence of recombinant murine Flt3-ligand (WEHI, Melbourne, Australia) for 8 days in complete RPMI medium (RPMI 1640
with L-glutamine, heat inactivated 10% FCS, 100 μg/ml streptomycin and 50 μM 2- ME; all from PAA Laboratories).
If not indicated otherwise, a mixture of conventional DC (cDC) and plasmacytoid DC (pDC) was used for the in vitro cell culture experiments. To this purpose, the Flt3-L DC cultures obtained as described above were analysed on a FACS Calibur flow cytometer (BD Biosciences) for the relative percentages of cDC and pDC and the respective DC activation status by staining with monoclonal antibodies specific for CDl Ic, CD45 RA, B220, CDl Ib and CD62L. Typically, the resulting cells were > 90% CDl Ic positive, and 30-40% of the cells displayed a plasmacytoid phenotype (CDl lcpos, CD45 RAhlgh, B220hlgh, CDl lblow). DC containing about 60% cDC and 40% pDC (Yasuda et al (2005) J. Immunol 170:6129-6136) were incubated for 18 - 24 h with the respective stimulus as indicated in the bars of the respective figures.
In case the cell population was separated, the following protocol was used: conventional DC (cDC) and plasmacytoid DC (pDC) were enriched from Flt3-L- cultures using magnetic-activated cell sorting (MACS, Miltenyj Biotech) as described (Honda et al (2005) Nature 433, 1035-40). In short, collected cells were incubated with the pDC-specific rat-monoclonal 120G8-Biotin antibody (Asselin- Paturel et al (2003), J. Immuno. 171, 6466-77) and anti-Bio tin microbeads (Miltenyj Biotech) and separated into pDCs (positively selected cells) and mDCs (flow-trough cells) using a magnetic-activated cell sorting (MACS)-column (Miltenyj Biotech). For further experiments, FK3L-DC subsets were highly enriched by FACS with anti- 120G8-FITC and anti-B220-PE antibodies. Live/dead discrimination was performed with propidium iodide (Molecular Probes). The purity of the sorted cells was controlled on a CyAn ADP Lx (Dako) and found to be >99%.
Test compounds
The test compounds were obtained from: CpG A (2216), B (1826), C (1668) ODN were from Coley Pharmaceuticals. Other ODN were commercially synthesized by TIB Molbiol. PD/PS 2-deoxyribose 20mer (also referred to as DRS/ DRS S) and PD ribose 20mer (+/- 5'-FAM/ carboxyfluorescein succinimidyl ester; +/- 3 "-Bio tin according to experimental requirements) were synthesized by both IBA GmbH and TIP Molbiol. DNA/RNA hybrid molecules and ODN 5Mabelled with Cy3 or Cy5 were from IBA GmbH. 2-deoxyribose-5 -phosphate monomer was from Sigma- Aldrich. Some of the compounds are depicted in figure 11 and, additionally, the following list is provided (s indicates a thioat-bond):
2216 (CpG A): GsGsGGGACGATCGTCGsGsGsGsGsG
1826 S (CpG B): TsCsCsAsTsGsAsCsGsTsTsCsCsTsGsAsCsGsTsT
1668 (CpG B): TCCATGACGTTCCTGATGCT
API (non-CpG): GCTTGATGACTCAGCCGGAA
API 44pA: A 44 poly- A nucleotide sequence conjugated to the 3" end of API
API 44pG: A 44 poly-G nucleotide sequence conjugated to the 3" end of API
pTC (non-CpG): TCTCTCTCTCTCTCTCTCTCT
pTC 44pA: A 44 poly- A nucleotide sequence conjugated to the 3" end of pTC
pTC 44pG: A 44 poly-G nucleotide sequence conjugated to the 3" end ofpTC
API Ribose: base sequence of API, but on an RNA-backbone
U-APl : base sequence of AP-I, but Thymidines substituted with Uracils
API Ribose + 24pG-DNA: A 24 poly-G nucleotide sequence conjugated to the 3" end of API Ribose
Imiquimod: TLR7 agonist
LPS: lipopolysaccharide
DRS / PD 2-deoxyribose: 20mer deoxy-RiboSpacer (5' and 3' OH)
FAM-DRS: 20mer deoxy-RiboSpacer (5^-FAM-labeled and 3'-OH)
DRS S / PS 2-deoxyribose: 20mer deoxy-RiboSpacer (5' and 3' OH) with PTO- modifications between all units
Stimulation of dendritic cells (DC) derived from mouse bone marrow
Mixed Flt3-DCs or separated conventional DC (cDC) and plasmacytoid DC (pDC) as depicted in the figures were suspended in 500 μl RPMI 1640 with 10% FCS, 50 μM 2-ME on 24-well plates (typically at densities of 1 x 106, 7.5 x 105or 5 x 105 cells per well or as indicated) and incubated for indicated times at indicated concentrations with ODN, backbone molecules or controls. For measurement of cytokine induction, culture supernatants were collected for analysis by enzyme-linked immunoabsorbant assay (ELISA) specific for mouse IL-6 (BD Biosciences) and mouse IFN alpha [compiled from rat anti-mouse interferon alpha antibody (Tebu-Bio), rabbit anti- mouse interferon alpha antibody (Tebu-Bio), POX-donkey anti-rabbit IgG antibody (Jackson)]] and mouse IL12-p40. For analysis of surface markers, cells were harvested, washed twice with ice cold PBS/ 3% FCS, incubated with anti CD86 PE antibody for 30 min, washed twice, fixed with 2% paraformaldehyde and analyzed by FACS.
In case the test compounds were complexed to DOTAP or to lipofectamine, the following protocols were used: Complexes of test compounds with DOTAP (Roche) were prepared according to the manufacturer's instructions. In brief, the indicated amount of test compound in 50 μl Opti-MEM (Gibco) were combined with 10 μg DOTAP in 50 μl Opti-MEM. After 15 min incubation at room temperature, the complexes were added to the cells. Complexes of test compounds with lipofectamine (Invitrogen) were prepared according to the manufacturer's instructions. In brief, the indicated amount of test compound in 50 Opti-MEM were combined with 10 μg lipofectamine in 50 μl Opti-MEM. After 15 min incubation at room temperature, the complexes were added to the cells.
Experiments were performed at least in triplicates and the results are depicted as mean values +/- standard deviations.
Antibodies
Antibodies used in the experiments were obtained as mentioned and from: anti- mouse B220-PE, anti-CD86-PE, anti CD 107a (Lampl) antibodies were all from BD Biosciences. Anti-mouse 120G8 (-FITC or -Biotin) antibodies were provided by Anne Krug.
Westernblot-analysis of endogenous pJNK
WT-DC cells were stimulated with compounds as depicted in figure 10 for 30 minutes. Cell lysates were prepared according to standard methods. Equal amounts of protein samples were denatured with SDS-buffer and equal volumes of the samples loaded onto a denaturing gel followed by a denaturing SDS-PAGE and transfer of the proteins to a membrane according to standard-blotting methods. Next, detection of pJNK immobilized on the membrane was performed using standard methods [1. antibody: anti-pJNK antibody (Cell Signaling, MA,USA), 2. antibody: anti-rabbit antibody-Peroxidase conjugate (Santa Cruz, USA)]. Bands were detected using luminescence.
ODN uptake
ODN uptake was measured as described by Roberts et al. (2005) J. Immuno.175, 3569-76. In short, 0,5 x 106 FK3L-DC were incubated with Cy5-labelled ODN for 45 minutes in 500 μl complete RPMI. Harvested cells were washed with ice cold PBS, incubated with 12,5 mg/ml dextran sulphate (SIGMA) for 10 minutes on ice (to remove ODN bound to the cell surface), washed in PBS, fixed with 2% paraformaldehyde and analysed by FACS.
Localization studies using confocal imaging
For analysis of live cells, 0,4 x 106 /ml pDC were incubated with 1-5 μM fluorescent ODN (Cy3 or Cy5) in 250 μl RPMI + 10% FCS on 8-well ibiTreat μ-slides (Ibidi) for 45 min at 37°C, then washed Ix with PBS and used for microscopy in a chamber heated to 37°C. For analysis of antibody- stained cells, 0,4 x 106 /ml pDC were incubated with 1-5 μM fluorescent ODN (Cy5) in 250 μl RPMI + 10% FCS on 96- well plates for 45 min, washed 3x with ice cold PBS, fixed in PBS containing 1% paraformaldehyde at room temperature for 15 min and permeabilized/b locked with 0,25% saponin, 1% BSA in PBS for 30 min. Labelling was performed with rat anti- Lamp- 1 antibody at 1 μg/ml for 1 h and goat anti-rat IgG Alexa546 antibody at 10 μg/ml (30 min) in 0,25% saponin, 1% BSA/PBS. Fixed cells were washed 1 x with PBS, resuspended in 250 μl PBS on 8-well ibiTreat μ-slides (Ibidi) and used for microscopy. Confocal images were acquired using a Leica SP5 confocal microscope, 63x/l,4NA objective, with the pinhole set to 1 airy unit in each channel. Dual colour images were acquired using a sequential acquisition mode to avoid cross-excitation.
Protein purifications
hTLR9-Fc protein (human TLR9-Fc) was purified from lysates of HEK293 cells stably expressing a fusion protein containing the ectodomain of human TLR9 linked to the Fc portion of mouse IgG2a. Cells were grown in serum- free media (CD293, Invitrogen), harvested by centrifugation, washed twice in ice cold PBS and lysed in lysis buffer on ice [1% CHAPS, 50 mM Tris-Cl, 150 mM naCl, ImM EDTAm 10% glycerol, 12 mM 2-ME, protease inhibitors (Complete, Roche)]. After pelleting nuclei at 14.000 x g and 0.45 μm filtration of the lysates (Sartobran 300, Sartorius), the protein was captured by protein A chromatographie (Amersham) at 4°C using automated FPLC. After extensive washing of the columns in lysis buffer, the protein was eluted by a continuous gradient from pH 7.4 to pH 3 (low pH buffer: 50 mM
citric acid, pH 3, 150 niM NaCl, 1 niM EDTA, 10% glycerol, 12 niM 2-ME). The low pH was neutralised by addition of 1/10th of the volume 1 M Tris-Cl, pH 8 into each of the fractions. As a poslishing step, purified hTLR9-Fc was separated by size exclusion chromatography (superpose 6, Amersham) and TLR9-Fc containing fractions were pooled and concentrated. HTLR2-Fc protein was purified as above, except that the protein was purified from supernatants of HEK293 cells growing under serum- free conditions. The cells stably expressed a fusion protein containing the ectodaomain of human TLR2 linked to the Fc portion of mouse IgG2a.
The same protocol was applied for purification of hTLR7-Fc.
MTLR9-Fc and mTLR2-Fc protein were obtained and purified as described in Rutz et al (2004) Eur. J. Immunol. 34, 2541-50.
SPR-analysis of ODN binding to mTLR9ect and competitive binding analyses
ODN binding of mTLR9ect or mTLR2ect was analyzed in a Biacore X device (Biacore AB, Uppsala, Sweden) on SA-chips at 25°C. In brief, the biotinylated ODN were diluted to a final concentration of 100 nM in 50 mM MES; pH 6.5, supplemented with 150 mM NaCl and 1 mM MgCl2 (which was also used as running buffer in all SPR biosensor measurements) and bound at equimolar immobilization levels (about 1700 RU for 1668 and AP-I, about 600 RU for C3-spacer, deoxyribose and ribose) to the SA in one of the two flow cells. The second flow cell served as a blank control for the subtraction of nonspecific analyte binding and of bulk refractive index background. For SPR monitoring of the mTLR9ect or mTLR2ect interaction to the surface immobilized ODN, 45 μl of 100 nM recombinant protein in running buffer was injected into the biosensor at a flow rate of 10 μl/min. After a 300 s dissociation period, the biosensor chip was regenerated by two 5 μl- injections of a
solution containing 50 niM NaOH and 1 M NaCl and extensive re-equilibration in running buffer.
Competitive binding analyses were performed by 10 min pre-incubation of 200 nM mTLR9-ect with the PD or PS variants of 2' deoxyribose (20mer), non-CpG ODN AP-I and IRS ODN 869 at concentrations of 0.01, 0.1, 1 and 10 mM and subsequent injection of the mixture over a PD CpG-B ODN 1668 coupled biosensor surface.
AlphaScreen-analysis of TLR-binding to ODN or sugar backbone molecules
The AlphaScreen (Amplified Luminescent Proximity Homogeneous Assay) was set up as an association assay. TLRect-Fc protein was incubated with biotinylated ligand in 50 mM HEPES, pH 6.5, 150 mM NaCl, 5 mM EDTA, 0.1% BSA and 0.01% Tween 20 for 60 min. Subsequently, protein A coated acceptor beads and streptavidin-coated donor beads (Alphascreen beads, Perkin Elmer) were added from 5 x stock concentrations. After 30 min incubation at 25°C in the dark, samples in white 384-well plates (Proxiplate, Perkin Elmer) were read using the Envision HT microplate reader (Perkin Elmer). Data were analyzed by GraphPad Prism version 4.00 for Macintosh (GraphPad Software, San Diego California USA).
Setup for intravenous injections into mice and collection of blood samples
C57BL6 WT mice were injected with pre-prepared DOTPA-complexes (30 μl
DOPAT at a final volume of 200 μl in sterile PBS) of 2,5 nmol stimulatory CpG-B- ODN 1668 alone or in combination with 0,5 nmol or 2,5 nmol of 2-deoxyribose backbone molecules (20mer; PS or PD) into the tail-vein. After 2h, mice were sacrificed and blood samples were collected by intracardial puncture. Samples were centrifuged after coagulation was complete. Serum was added for analysis by enzyme-linked immunosorbant assay.
Example 1 : Determination of the IL-6 amounts produced by WT-cells after 18 h of stimulation
Figure 1 shows the results of the experiment. 2216 is a well-known TLR9 agonist and leads to the production of IL-6. LPS as known TLR4 agonist also shows stimulatory effect in contrast to Imiquimod, a TLR7 agonist, which has no effect on the IL-6 production under the present experimental conditions. API PD leads to the production of IL-6 either in complex with DOTAP in a concentration dependent manner or with a poly G-tail, in both cases also via TLR9. For the AP-I base sequence on an RNA backbone, small stimulatory effects can be observed either in complex with DOTAP or with a poly G-tail, presumably in a TLR7-dependent manner. 2'-O-methylated API PD does not show a stimulatory effect on the IL-6 production. Free DRS at a final concentration of 2 μM does not lead to the production of IL-6. In contrast to this, DRS in a complex with DOTAP leads to a concentration-dependent increase in the production of IL-6. DRS was used in concentrations ranging from 0,01 μM to 5 μM as indicated, in each case in complex with a fixed amount of 10 μg DOTAP. Furthermore, 2 μM DRS in complex with lipofectamine shows a stimulatory effect on the production of IL-6.
Therefore, the addition of DRS in complex with DOTAP (which increases endosomal uptake) or lipofectamine (which results in cytosolic uptake) leads to the production of IL-6 in WT-DC.
Example 2: Determination of the IFN alpha amounts produced by WT-cells after 18 h of stimulation
The results are depicted in figure 2. In this experimental setup, 2216 and API PD either in complex with DOTAP or conjugated to a 24 poly G-sequence show
stimulatory effects on the production of IFN CC. Free DRS does not lead to the production of IFN CC, but DRS in complex with DOTAP leads to a concentration- dependent increase in the production of IFN CC. DRS was again used in concentrations ranging from 0,01 μM to 5 μM as indicated with a fixed amount of DOTAP of 10 μg. Also, 2 μM DRS in complex with lipofectamine shows a stimulatory effect on the production of IFN CC.
Therefore, DRS in complex with DOTAP or lipofectamine not only leads to the production of IL-6, but also to the production of IFN CC as central cytokine of the immune reaction in WT-DC.
Example 3: Determination of the IL-6 amounts produced by TLR9-deficient cells after 18 h of stimulation
As it can be deduced from figure 3, only LPS, DRS in complex with lipofectamine and API PD Ribose either in complex with DOTAP or as 3 '-poly G fusion are stimulating the IL-6 production of the TLR9 ~ ~ cells. As mentioned above, 2216 is a well-known TLR9 agonist. Using TLR9 ~ ~ cells in the assay, 2216 is not able to induce the production of IL-6. As API PD also acts via TLR9, it does not lead to production of IL-6, neither in complex with DOTAP nor with a poly G-tail. In contrast to these result, LPS as a known TLR4 agonist does show stimulatory capacity. For the API base sequence on an RNA backbone, stimulatory effects can be observed in complex with DOTAP or with a poly G-tail as mentioned above. This can be explained with TLR7 being the responsible receptor for API Ribose. 2 -0- methylated API does not show a stimulatory effect on the IL-6 production. Free DRS or DRS in complex with DOTAP does not show a stimulatory effect on the production of IL-6. In contrast to this, DRS in a complex with lipofectamine surprisingly induces the production of IL-6, presumably via a cytosolic mechanism.
These results imply that the stimulatory effect of DRS, if taken up by endosomes, on the IL-6 production is also mediated via TLR9, as already known for 2216 and API.
Example 4: Determination of the IL-6 amounts produced by MyD88-deficient cells after 18 h of stimulation
Using MyDSS"7" cells in the assay, the only test compound capable of inducing IL-6 production is DRS in complex with lipofectamine (figure 4). MyD88 is the central adapter molecule for integrating signals of TLR-mediated pathways independent on the class of TLR-receptors. 2216 and API as known TLR9 agonists, LPS as known TLR4 agonist and API PD Ribose as TLR7 agonist do not lead to IL-6 production. In case DRS is taken up by endosomes, it is presumably also acting as TLR9 agonist and in a setup with MyDδδ"7" cells, no stimulatory effect can be observed. In contrast to this, the lipofectamine mediated cytosolic uptake of DRS surprisingly leads to the production of IL-6.
These results emphasize that DRS, in case it is taken up by endosomes, mediates its effects through TLR-signaling.
Example 5: Effect of pre-treatment with DNase and RNase on the production of IL-6 and effect of stimulating the cells with DRS-monomers
It was the purpose of the next set of experiments to analyze the influence of DNA and RNA, which are present in the supernatant of the medium without the addition of test compounds on the IL-6 production of WT-DC. During the time course of the experiments, very few cells in a well die and release fragments of DNA and RNA among other cell interior material into the supernatant of the medium. Because DOTAP is present in excess in the complexes with test compounds, it can, in principle, also form complexes with these "endogenously" present DNA or RNA
molecules. This can, in principle, also lead to activation of TLR and, therefore, to IL- 6 production. A further purpose of the experiments described was to test the influence of DRS-monomers on the IL-6 production of WT-DC. Figure 5 shows the amounts of IL-6 produced under mentioned conditions. Without any DNase/ RNase treatment, there is some residual production of IL-6 when DOTAP is added to the cells in the absence of any test compound. This might be explained by the presence of "endogenous" DNA/ RNA in the medium. There is no IL-6 detectable in case lipofectamine without any test compound is present, as well as in case DRS- monomers of different concentrations and in preformed complexes with DOTAP are present. Pretreatment of the medium on the plates with DNase and RNase as well as the addition of DNase and RNase to the falcon tubes after incubation to form complexes of test compounds and DOTAP leads to a loss of the residual DOTAP activity due to the digestion of any DNA/ RNA outside the complexes.
Therefore, the addition of DOTAP alone is inducing IL-6 production by forming complexes with DNA and RNA, which are present in the medium of the cells. This effect, however, is clearly smaller than the observed effect after incubation with DRS-DOTAP complexes. Second, DRS-monomers are not sufficient to induce IL-6 production.
Example 6: Effect of pre-treatment with DNase and RNase on the production of IFN alpha and effect of stimulating the cells with DRS-monomers
It was the purpose of the following experiments to analyze the influence of DNA and RNA, which are present in the supernatant of the medium without the addition of test compounds on the IFN CC production of WT-DC in an analogous way to the production of IL-6. Figure 6 shows the amounts of IFN CC produced under mentioned conditions. Without any DNase/ RNase treatment, there is again some residual production of IFN CC when DOTAP is added to the cells in the absence of any test
compound. In case DRS-monomers of different concentrations and in preformed complexes with DOTAP are present, no IFN CC is produced. Pretreatment of the medium on the plates with DNase and RNase as well as the addition of DNase and RNase to the falcon tubes after incubation to form complexes of test compounds and DOTAP leads to a loss of the residual DOTAP activity observed under conditions without the treatment.
Therefore, the addition of DOTAP alone is also inducing IFN CC production. This effect, however, is very small compared to the effect after incubation with DRS- DOTAP complexes. Second, DRS-monomers are not sufficient to induce IFN cc production.
Example 7: Determination of the IL12-p40 amounts produced by WT cells after 18 h of stimulation
Figure 7 shows the amounts of IL12-p40 produced under mentioned conditions. IL12-p40 represents a central molecule for linking the innate and adaptive immune response, because it is a signaling molecule for the activation of T-cells, which are part of the adaptive branch of the immune system. 2216 and 1826 S are stimulating the production of IL12-p40. FAM-DRS alone shows only background activity, but FAM-DRS in complex with DOTAP leads to the production of IL12-p40 in a concentration dependent manner. As before, the DRS-monomers are not capable of inducing the IL12-p40 production.
Therefore, DRS in complex with DOTAP is not only capable of inducing the production of IL-6 or IFN CC, but also of inducing the production of IL12-p40 as signaling molecule in the adaptive immune response.
Example 8: Determination of the IL6 amounts produced by WT cells after 18 h of stimulation
In this example, controls for the FAM mojety of FAM-DRS and a PTO-modifϊed backbone of the DRS were included. Figure 8 shows the results of the experiments. FAM alone is not capable of inducing the IL-6 production, neither together with DRS PD nor with DRS S. Furthermore, only DRS with PD leads to the production of IL-6 in a concentration dependent manner, the PTO-modified DRS is not active.
These results indicate, that only DRS with PD and not with a PTO modified backbone is a potent agonist. Furthermore, they show that the FAM mojety of the FAM-DRS molecule is not responsible for the observed effects.
Example 9: Determination of the IL-6 amounts produced by TLR9- and MyD88- deficient cells after 18 h of stimulation
As it can be deduced from figure 9, only LPS and Imiquimod are stimulating the IL- 6 production of the TLR9" " cells. As mentioned above, 2216 is a well-known TLR9 agonist and cannot induce the production of IL-6 in cells lacking TLR9. In MyDSS"7" cells, there is no detection of IL-6 in the supernatant at all.
The results of figure 9 emphasize again, that DRS functions via TLR-signaling. Furthermore, they serve as controls for the FAM mojety of FAM-DRS as being not active.
Example 10: determination of pJNK leves after various stimuli by Westernblot
Samples loaded in lanes are:
1. standard MW-marker, 72 kDA band marked
2. medium control
3. LPS
4. 1668 S
5. API 6. APl-44pA
7. APl-44pG
8. API complexed with DOTAP
9. pTC
10. pTC-44pA H. pTC-44pG
12. pTC complexed with DOTAP
13. Abasic PD: FAM-DRS
14. Abasic PD: FAM-DRS complexed with DOTAP
15. DOTAP control 16. standard MW-marker, 72 kDA band marked
The band pattern in figure 10 shows the expression levels of endogenous pJNK. The protein is present in two iso forms, which run differently in the SDS-PAGE and, therefore, two bands are detected. Compared to the medium (negative control, shown in lane 1), the TLR4 agonist LPS and the TLR9 agonist 1668 induce expression of pJNK. API alone and API with a 3 "-conjugated 24mer poly A tail do not induce expression of pJNK. In contrast to this, an increase in the expression level can be observed with the 3 "-conjugated 24mer poly G tail and an even more pronounced increase can be observed with API in complex with DOTAP (lane 7). Lanes 8 to 11 show the corresponding expression levels for pTC under different conditions: pTC and pTC conjugated 3" to a 19mer poly A sequence do not influence pJNK- expression, whereas the molecule with the 3 "-conjugated 19mer poly G sequence and pTC in complex with DOTAP again positively influence the pJNK expression. Lane 12 shows the effect of adding FAM-DRS alone: Compared to the medium-control,
the pJNK level is not altered. In case the FAM-DRS is applied in complex with DOTAP (see lane 14 for the DOTAP control), the pJNK level is increased.
Therefore, DRS in complex with DOTAP induces the expression of pJNK as one of the most important signaling molecules in the immune response leading to a variety of further downstream events.
Example 11 : Determination of the IL-6 and IFN alpha amounts produced by WT and TLR9-defϊcient cells after 18 h of stimulation
The purpose of the next experiments was to address the question, whether the addition of a polyG-tail of varying length to PD CpG-B has an effect on the production of IL-6 and IFN alpha. As mentioned before, a polyG-tail leads to enhanced endosomal uptake. As figure 12 a and b show, an increase on the production of IL-6 and IFN alpha can be observed depending on the length of the polyG-tail with a plateau at about 24pG. Thus, the enforced endosomal uptake of PD CpG-B leads to an increase of the production of IL-6 and IFN alpha in a TLR9 dependent manner, as TLR9 knockout cells do not respond to the stimuli. As can be deduced from figure 12 c and 12d, either the addition of a poly-G tail or the use of DOTAP confers TLR9-activation potential to all oligonucleotides with a PD backbone tested. This is independent of the presence of CpG-methylation or the presence of CpG sequences. Across a wide range of ODN concentrations, the TLR9- activating potential of 3 ' poly-G extended PD ODNs is similar to that of PD ODNs complexed to N-[l-(2,3-dioleoyloxy)]-N,N,N-trimethylammonium propan methylsulfate (DOTAP) (Figures 20 a and 20 b).
If a PS backbone, however, is used, it was surprisingly found that there is no stimulation any more compared to the corresponding PD backbone oligonucleotide.
Example 12: Localization of certain compounds to endosomal compartments
The so called "late" endosomas/lysosomal compartments are stained in this assay by antibodies directed to the protein Lamp-1 and a corresponding secondary fluorescence-coupled antibody (figure 13). PS CpG-B ODNs co localize with Lamp-1 in this compartment in contrast to CpG-A 2216 (Figure 13 a) in accordance with the finding that they differ in their ability to induce interferon activity (PS CpG-B is a strong inducer, CpG A without any polyG-tail is not; see experiments above). The addition of a poly-G tail leads to a change in localization compared to the non- conjugated species of PD CpG-B and PD pTC, resp. The unmodified PD CpG-B and PD non-CpG AP-I also translocate to "late" endosomes (Fig. 13 b). These ODN lacked interferon- inducing activity (Fig. 12 d). In contrast, 3' poly-G-extended PD ODN, which was shown to trigger TLR9- dependent IFN-α production (Fig. 12 d), colocalises with interferon- inducing CpG-A 2216 (Fig. 13 c) in LAMP-1 -negative compartments. Since 3' poly-G extension of ODN leads to G-tetrad-mediated formation of nanoparticular ODN multimers similar to A-type CpG , these results imply that the interferon- inducing capacity of ODN is sequence-independent Iy conveyed by ODN multimerisation. Nanoparticular ODN structures seem to favour routing to "early" endosomes where the interferon-inducing MyD88/IRF7 signaling pathway is activated.
Example 13: Determination of the produced IL-6 / IFN alpha amounts induced by compounds with different sugar-backbones
The ODN PD IRS 869 and PD IRS 954 used derive from the corresponding PS- compounds, namely PS IRS 869 and PS IRS 854, both of which have been shown to be inhibitory. Surprisingly, changing the backbone from a PS-type to a PD-type, the compounds now become (in a complex with DOTAP) activatory (figure 14 a) for the
production of IL-6. The PD non CpG AP-I activatory effect is TLR9-dependent (figure 14 b) and changing the backbone to ribose renders the effect dependent on TLR7, as already described, whereas the 2'-methylation of the ribose completely abolishes any effect (figure 14 b). The same applies for PD 1668 (figure 14 c). The PD 2-deoxyribose backbone even renders TLR9 permissive for nucleic acid bases usually not present in natural DNA, as a hybrid 20mer combining a PD 2- deoxyribose backbone with uracil RNA bases (PD poly-U-2-deoxyribose) activates both TLR9 and TLR7 in a MyD88-dependent manner (Fig. 14 d). Exactly the same experimental setup just described for experiments analyzing IL-6 amounts (figures 14 b to l4 d) was applied for analyzing IFN alpha amounts. Those results are shown in figures 17 a to 17 c. The results correspond the those analysing the IL-6-amounts.
Example 14: Opposing effects of PD vs. PS 2-deoxyribose on TLR9
Figure 15 a again shows the activatory effect of the PD-backbone in complex with DOTAP on the production of IL-6. For comparison reasons, PD 1668 and PD Ap-I are included in this study. There is a significant effect on the induction of IL-6 production. In figure 15 b, the binding of murine TLR9 ectodomain (ect) to different compounds is analyzed. Compared to the binding of PD 1668 and PD AP-I to mTLR9ect, the PD-backbone displays low, but significant binding. In a luminescent proximity assay based on the transfer of singlet oxygen between closely opposed donor and acceptor molecules, however, PS 2'-deoxyribose surprisingly binds to human TLR9ect with an extremely high affinity (Figure 15 c). Next, results of experiments for investigating a possible dominant negative effect of PS T- deoxyribose are shown. Figure 15 d depicts the in vitro data gained in a cell culture assay as described avobe: PS 2 '-deoxyribose surprisingly blocks PD CpG-B induced induction of TLR9-dependent IL-6 production in a dose-dependent manner. PS IRS ODN 869 or 954 manifests comparable inhibition (see figure 23a). Even more surprisingly, the in vivo data clearly shows that this effect is also true after injecting
DOTAP complexed PS 2'-deoxyribose into mice (figure 15 e). PS 2'-deoxyribose was used at 0.5 and 2.5 nmol. The stimulatory effect of PD 2'-deoxyribose might be masked in this experiment or, consistent with the results above, the amount of PD backbone needs to be higher in order to have an agonistic effect on the production of IL-6. Further experiments performed to test the inhibitory potential of the PS backbone confirmed the results: Figure 17 d shows another in vitro setup, this time with CpB PD as stimulatory TLR9-ligand. The PTO modified 2'-deoxyribose clearly inhibits the production of IL-6 in a dose-dependent manner. It was used at concentrations of 0.5 and 5 mM, resp. Interestingly, the DNA sugar backbone PS 2' deoxyribose also inhibits PD RNA- mediated TLR7 activation in DCs (figure 23b; also compare figure 18).
Example 15: uptake of ODN
In this experiment, the intracellular ODN-uptake is confirmed. Figure 16 a shows that PD CpG-B ODN without a polyG-tail is taken up by the cells (blue). Adding a 24polyG-tail, the uptake is increased (green) and corresponds to the uptake of CpG- A ODN (orange). PD non-CpG AP-I ODN (blue) cannot be detected within cells in contrast to PD non-CpG AP-I ODN with a 3'24pG tail (green) as depicted in figure 16 b.
Therefore, the ODN tested are taken up by the cells and localize to intracellular compartments, as surface-bounds molecules are washed away in the assay shown.
Example 16: Induction of IFN alpha / IL-6 production by either pDC or mDC after stimulation of WT cells
In the experiments shown in figure 16 c, separated pDC and mDC cells were used in the stimulation assays. The cells were separated according to the protocol set out in
the beginning of the example-section. IFN alpha is produced by pDC, whereas IL-6 is mainly produced by mDC upon stimulation by the compounds shown.
Example 17: Induction of IFN alpha production in WT compared to IR7-deficient cells
The next experiments were done to look at further downstream effects upon induction. In the pathway initiated by MyD88 mentioned above, IRF7 (interferon regulatory factor 7) represents a central transcription factor for integrating signals via the TLR-receptor pathway. The results depicted in figure 16 d show that the IFN alpha production is not stimulated in cells lacking the central integrator IRF7.
Example 18: Inhibition of TLR7 by PS backbones
It was the purpose of the next experiments to analyze the dominant negative action of the PS 2'-deoxyribose on TLR7. As described before, ssRNA has been identified as ligand for TLR7 and TLR7 also localizes to endosomes. U-AP-I RNA is used in this setup to active TLR7 (figure 18). By titrating in PS 2'-deoxyribose (d-R-p PS) in complex with DOTAP in concentrations ranging from 0.5 μM to 5 μM, the production of IL-6 is suppressed. Using the corresponding PD-polymer (d-R-p PD) in the same concentration range, the IL-6 production is still activated via U-APl RNA (left side of figure 18). As mentioned above, IRS 661 with a PS backbone is known to inhibit TLR7. Titrating in this compound in complex with DOTAP in concentrations ranging form 0.5 μM to 5 μM also inhibits IL-6 production (right side of figure 18). The same applies for API PS, i.e. the base sequence of AP-I on a PTO-modified sugar backbone. For both types of molecules, the change of the backbones from the PTO-type to the PD-type leads to the opposite effect, i.e. to the increase of the production of IL-6 (right side of figure 18).
These results show that PTO modified 2'-deoxyribose also inhibits TLR7-mediated signaling in a dose-dependent manner.
Example 19: binding of PD deoxyribose to TLR 7 and TLR9 in comparison to binding of PS deoxyribose to TLR7 and TLR9
In the next set of experiments, the binding affinity of PTO modified 2 '-deoxyribose towards TLR7 (figure 19 a) and TLR9 (figure 19 b) was determined and compared to the PD modified 2 '-deoxyribose. The same setup as described before for experiments shown in figure 15 c was applied. For the binding of PTO modified 2 '-deoxyribose to TLR7, an EC50 of 6.74Oe-OlO was determined (compared to an EC50 of 6.965e- 008 for PD modified 2 '-deoxyribose). The PTO modified 2 '-deoxyribose shows an extremely high binding affinity towards TLR7. Concerning binding to TLR9, the data mentioned above was confirmed. The PTO modified 2 '-deoxyribose also has a very high binding affinity to TLR9 with an EC50 of 1.365e-009.
The results show very high binding affinity of PTO modified 2 '-deoxyribose to TLR7 and TLR9, with TLR7 binding even better than TLR9. The PD modified T- deoxyribose binds to both receptors as well, but in a range of about two magnitudes lower. Thus, taking experiments 18 and 19 into account, the inhibitory action of PTO modified 2 '-deoxyribose can be extended to TLR7.
As shown in figure 21, PD and PS ribose display specific low-affine binding only to hTLR7-ect but not to hTLR9-ect.
Example 20: Competitive inhibition of TLR9 ligand binding by PS 2Meoxyribose homopolvmer
The observation that non-activating PS T deoxyribose homopolymers display high affinity to both TLR9 and TLR7 (see figures 15c and 19a) suggests that they might function as competitive inhibitors of TLR9 and TLR7 activation. In support, plasmon resonance analysis reveals dose-dependent inhibition of PD CpG-B ODN-binding to mTLR9-ect by PS 2' deoxyribose (20mer) (Figure22a). In contrast, PD 2' deoxyribose homopolymers exhibit low competitive effects only at very high concentrations, consistent with their comparatively low affinity to TLR9 (Figure 22b).
Claims
1. Pharmaceutical composition comprising a compound having at least one structural unit according to formula (I)
3'
wherein n is an integer from 4 to 39; and X is a phosphate bridging group and/or an analogue thereof such as a phosphorothioate bridging goup;
Y is selected from the group comprising hydrogen and OH; no pyrimidine base, purine base or analogues thereof is bonded to the Ci atom of the pentose ring; and optionally at least one pharmaceutically acceptable excipient.
2. Pharmaceutical composition according to claim 1 wherein the majority of X is a phosphate bridging group and wherein said composition additionally comprises an antigen.
3. Pharmaceutical composition according to claim 2 wherein said antigen is selected from the group comprising cancer antigens, bacterial antigens, fungal antigens, parasitic antigens, viral antigens, herbal antigens, allergic antigens, asthmatic antigens and food antigens.
4. Pharmaceutical composition according to any of claims 1 to 3 wherein the majority of X is a phosphate bridging group and wherein said composition additionally comprises a pharmaceutically active compound selected from the group comprising anti-cancer compounds, anti-bacterial compounds, anti- fungal compounds, anti-parasitic compounds, anti-viral compounds, anti-allergic compounds and anti-asthmatic compounds.
5. Pharmaceutical composition according to claim 1 wherein the majority of X is a phosphorothioate bridging group.
6. Pharmaceutical composition according to any of claims 1 to 5 wherein n is a integer from 14 to 24 and preferably of 19.
7. Pharmaceutical composition according to any of claims 1 to 6 wherein said compound is present in the form of its pharmaceutically acceptable salts or equally active derivates, such as the free base.
8. Pharmaceutical composition according to any of claims 1 to 7 wherein said compound is terminated at the 5 ' and 3 ' end with a hydrogen.
9. Pharmaceutical composition according to any of claims 1 to 8 wherein the Ci atom of the pentose ring is bonded to a hydrogen.
10. Pharmaceutical composition according to any of claims 1 to 9 wherein Y is hydrogen or OH.
11. Pharmaceutical composition according to claim 10 wherein said compound is terminated at the 5' end with FAM and at the 3' end with hydrogen, wherein the Ci atom of the pentose ring is bonded to a hydrogen and wherein n is about 19.
12. Pharmaceutical composition according to any of claims 1 to 11 wherein said compound is associated with a lipid and/or lipid-like carrier, preferably with a cationic lipid.
13. Pharmaceutical composition according to claim 12 wherein the cationic lipid is selected from the group comprising DOTAP, lipofectamine, DODAP, DODMA, DMDMA, DC-Choi, DDAB, DODAC, DMRIE, DOPSA and DOGS.
14. Pharmaceutical composition according to claim 13 wherein DOTAP is used as cationic lipid.
15. Use of a pharmaceutical compound having at least one structural unit according to formula (I)
3'
wherein n is an integer from 4 to 39;
X is a phosphate bridging group and/or an analogue thereof such as a phosphorothioate with the majority being phosphate bridging groups; Y is selected from the group comprising hydrogen and OH; and no pyrimidine base, purine base or analogues thereof are bonded to the Ci atom of the pentose ring; in the manufacture of a medicament for activating and/or supporting an immune response in a human or animal subject.
16. Use according to claim 15 for activating and/or supporting the innate immune response.
17. Use according to claim 15 or 16 for activating and/or supporting the adaptive immune response.
18. Use according to any of claims 15 to 17 for treating a condition being affected by TLR-signaling, preferably by TLR7 and/or TLR9-signaling.
19. Use according to any of claims 15 to 18 for treating a condition selected from the group comprising cancer, infectious diseases including viral, bacterial, parasitic and fungal infections, allergies and asthma.
20. Use according to any of claims 15 to 19 wherein said compound is used as an adjuvants in a vaccine in addition to an antigen.
21. Use according to claim 20 wherein said antigen is selected from the group comprising cancer antigens, bacterial antigens, fungal antigens, parasitic antigens,
viral antigens, herbal antigens, allergic antigens, asthmatic antigens and food antigens.
22. Use according to any of claims 15 to 21 wherein the medicament additionally comprises a pharmaceutically active compound selected from the group comprising anti-cancer compounds, anti-bacterial compounds, anti-fungal compounds, antiparasitic compounds, anti-viral compounds, anti-allergic compounds and antiasthmatic compounds.
23. Use of a pharmaceutical compound having at least one structural unit according to formula (I)
3'
wherein n is an integer from 4 to 39;
X is a phosphate bridging and/or an analogue thereof such as a phosphorothioate bridging group with the majority being analogue bridging groups;
Y is selected from the group comprising hydrogen and OH; and
no pyrimidine base, purine base or analogues thereof are bonded to the Ci atom of the pentose ring; in the manufacture of a medicament for suppressing and/or inhibiting an immune response.
24. Use according to claim 23 for suppressing and/or inhibiting the innate immune response.
25. Use according to claim 23 or 24 for suppressing and/or inhibiting the adaptive immune response.
26. Use according to any of claims 23 to 25 for inhibiting an immune response which is activated via TLR-signaling, preferably via TLR9- and/or TLR7-signaling.
27. Use according to any of claims 23 to 26 for treating autoimmune diseases.
28. Use according to any of claims 23 to 27 for treating lupus erythematosus.
29. Use according to any of claims 15 to 30 wherein n is a integer from 14 to 24 and preferably of 19.
30. Use according to any of claims 15 to 29 wherein said compound is present in the form of its pharmaceutically acceptable salts or equally active derivates, such as the free base.
31. Use according to any of claims 15 to 30 wherein said compound is terminated at the 5 ' and 3 ' end with a hydrogen.
32. Use according to any of claims 15 to 31 wherein the Ci atom of the pentose ring is bonded to a hydrogen.
33. Use according to any of claims 15 to 32 wherein Y is hydrogen or OH.
34. Use according to claim 33 wherein said compound is terminated at the 5' end with FAM and at the 3' end with hydrogen, wherein the Ci atom of the pentose ring is bonded to a hydrogen and wherein n is about 19.
35. Use according to any of claims 15 to 34 wherein said compound is associated with a lipid and/or lipid-like carrier, preferably with a cationic lipid.
36. Use according to claim 35 wherein said cationic lipid is selected from the group comprising DOTAP, lipofectamine, DODAP, DODMA, DMDMA, DC-Choi, DDAB, DODAC, DMRIE, DOPSA and DOGS
38. Use according to claim 36 wherein DOTAP is used.
39. Method of preparing a pharmaceutical composition comprising at least the steps of: providing a compound having at least one structural unit according to formula
(I)
3' wherein n is an integer from 9 to 29;
X is a phosphate bridging group and/or an analogue thereof such as a phosphorothioate bridging group;
Y is selected from the group comprising hydrogen and OH; and no pyrimidine base, purine base or analogues thereof are bonded to the
Ci atom of the pentose ring; and mixing said compound with at least one pharmaceutically acceptable excipient.
40. Method of activating and/or supporting an immune response in a human or animal subject comprising administering to a subject, in an amount effective to activate and/or support an immune response, a compound having at least one structural unit according to formula (I)
wherein 3' n is an integer from 4 to 39;
X is a phosphate bridging group and/or an analogue thereof such as a phosphorothioate with the majority being phosphate bridging groups;
Y is selected from the group comprising hydrogen and OH; and no pyrimidine base, purine base or analogues thereof are bonded to the
Ci atom of the pentose ring.
41. Method according to claim 40 further comprising administering an antigen.
42. Method according to claim 41 wherein said antigen is selected from the group comprising cancer antigens, bacterial antigens, fungal antigens, parasitic antigens,
viral antigens, herbal antigens, allergic antigens, asthmatic antigens and food antigens.
43. Method according to any of claims 40 to 42 further comprising a pharmaceutically active compound selected from the group comprising anti-cancer compounds, anti-bacterial compounds, anti-fungal compounds, anti-parasitic compounds, anti-viral compounds, anti-allergic compounds and anti-asthmatic compounds.
44. Method of suppressing and/or inhibiting an immune response in a human or animal subject comprising administering to a subject, in an amount effective to suppress an immune response, a compound having at least one structural unit according to formula
(I)
wherein n is an integer from 4 to 39;
X is a phosphate bridging and/or an analogue thereof such as a phosphorothioate bridging group with the majority being analogue bridging groups,
Y is selected from the group comprising hydrogen and OH; and no pyrimidine base, purine base or analogues thereof are bonded to the Ci atom of the pentose ring.
45. Method according to any of claims 40 to 44, wherein n is a integer from 14 to 24 and preferably of 19.
46. Method according to any of claims 40 to 45 wherein said compound is present in the form of its pharmaceutically acceptable salts or equally active derivates, such as the free base.
47. Method according to any of claims 40 to 46 wherein said compound is terminated at the 5 ' and 3 ' end with a hydrogen.
48. Method according to any of claims 40 to 47 wherein the Ci atom of the pentose ring is bonded to a hydrogen.
49. Method according to claim 48 wherein said compound is terminated at the 5' end with FAM and at the 3' end with hydrogen, wherein the Ci atom of the pentose ring is bonded to a hydrogen and wherein n is about 19.
50. Method according to any of claims 40 to 49 wherein said compound is associated with a lipid and/or lipid-like carrier, preferably with a cationic lipid.
51. Method according to claim 50 wherein said cationic lipid is selected from the group comprising DOTAP, lipofectamine, DODAP, DODMA, DMDMA, DC-Choi, DDAB, DODAC, DMRIE, DOPSA and DOGS.
52. Method according to claim 51 wherein DOTAP is used as cationic lipid and n = 19.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP08717702A EP2167662A2 (en) | 2007-05-14 | 2008-03-12 | Pharmaceutical compounds comprising abasic oligonucleotides |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP07108181 | 2007-05-14 | ||
| EP08717702A EP2167662A2 (en) | 2007-05-14 | 2008-03-12 | Pharmaceutical compounds comprising abasic oligonucleotides |
| PCT/EP2008/052956 WO2008138658A2 (en) | 2007-05-14 | 2008-03-12 | Pharmaceutical compounds comprising abasic oligonucleotides |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP2167662A2 true EP2167662A2 (en) | 2010-03-31 |
Family
ID=39420344
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP08717702A Withdrawn EP2167662A2 (en) | 2007-05-14 | 2008-03-12 | Pharmaceutical compounds comprising abasic oligonucleotides |
Country Status (2)
| Country | Link |
|---|---|
| EP (1) | EP2167662A2 (en) |
| WO (1) | WO2008138658A2 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10913767B2 (en) | 2010-04-22 | 2021-02-09 | Alnylam Pharmaceuticals, Inc. | Oligonucleotides comprising acyclic and abasic nucleosides and analogs |
| ES2951684T3 (en) | 2017-03-24 | 2023-10-24 | BioNTech SE | Methods and compositions to stimulate the immune response |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1678303A2 (en) * | 2003-10-30 | 2006-07-12 | Coley Pharmaceutical GmbH | C-class oligonucleotide analogs with enhanced immunostimulatory potency |
| US20080113929A1 (en) * | 2004-06-08 | 2008-05-15 | Coley Pharmaceutical Gmbh | Abasic Oligonucleotide as Carrier Platform for Antigen and Immunostimulatory Agonist and Antagonist |
| AU2006241149A1 (en) * | 2005-04-26 | 2006-11-02 | Coley Pharmaceutical Gmbh | Modified oligoribonucleotide analogs with enhanced immunostimulatory activity |
-
2008
- 2008-03-12 EP EP08717702A patent/EP2167662A2/en not_active Withdrawn
- 2008-03-12 WO PCT/EP2008/052956 patent/WO2008138658A2/en not_active Ceased
Non-Patent Citations (1)
| Title |
|---|
| See references of WO2008138658A2 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2008138658A2 (en) | 2008-11-20 |
| WO2008138658A3 (en) | 2009-04-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8354522B2 (en) | Immunostimulatory oligoribonucleotides | |
| EP3006043B1 (en) | Immunostimulatory g,u-containing oligoribonucleotides | |
| US20060241076A1 (en) | Modified oligoribonucleotide analogs with enhanced immunostimulatory activity | |
| US20080113929A1 (en) | Abasic Oligonucleotide as Carrier Platform for Antigen and Immunostimulatory Agonist and Antagonist | |
| US20100144846A1 (en) | Oligoribonucleotides and uses thereof | |
| EP1928500A2 (en) | Modulation of tlr-mediated immune responses using adaptor oligonucleotides | |
| DK2179039T3 (en) | RNA sequence motifs associated with defined internucleotide bonds that induce specific immunomodulatory profiles | |
| WO2008138658A2 (en) | Pharmaceutical compounds comprising abasic oligonucleotides | |
| CN101331229B (en) | Immunostimulatory oligoribonucleotides | |
| HK1220636B (en) | Immunostimulatory g,u-containing oligoribonucleotides | |
| MX2008006770A (en) | Immunostimulatory oligoribonucleotides | |
| MX2008004141A (en) | Modulation of tlr-mediated immune responses using adaptor oligonucleotides |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20091214 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT RO SE SI SK TR |
|
| AX | Request for extension of the european patent |
Extension state: AL BA MK RS |
|
| 17Q | First examination report despatched |
Effective date: 20100506 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20101117 |