EP2079846A2 - Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same - Google Patents
Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using sameInfo
- Publication number
- EP2079846A2 EP2079846A2 EP07874512A EP07874512A EP2079846A2 EP 2079846 A2 EP2079846 A2 EP 2079846A2 EP 07874512 A EP07874512 A EP 07874512A EP 07874512 A EP07874512 A EP 07874512A EP 2079846 A2 EP2079846 A2 EP 2079846A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- udp
- polymer
- recombinant
- glycosaminoglycan
- acceptor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08B—POLYSACCHARIDES; DERIVATIVES THEREOF
- C08B37/00—Preparation of polysaccharides not provided for in groups C08B1/00 - C08B35/00; Derivatives thereof
- C08B37/006—Heteroglycans, i.e. polysaccharides having more than one sugar residue in the main chain in either alternating or less regular sequence; Gellans; Succinoglycans; Arabinogalactans; Tragacanth or gum tragacanth or traganth from Astragalus; Gum Karaya from Sterculia urens; Gum Ghatti from Anogeissus latifolia; Derivatives thereof
- C08B37/0063—Glycosaminoglycans or mucopolysaccharides, e.g. keratan sulfate; Derivatives thereof, e.g. fucoidan
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08B—POLYSACCHARIDES; DERIVATIVES THEREOF
- C08B37/00—Preparation of polysaccharides not provided for in groups C08B1/00 - C08B35/00; Derivatives thereof
- C08B37/006—Heteroglycans, i.e. polysaccharides having more than one sugar residue in the main chain in either alternating or less regular sequence; Gellans; Succinoglycans; Arabinogalactans; Tragacanth or gum tragacanth or traganth from Astragalus; Gum Karaya from Sterculia urens; Gum Ghatti from Anogeissus latifolia; Derivatives thereof
- C08B37/0063—Glycosaminoglycans or mucopolysaccharides, e.g. keratan sulfate; Derivatives thereof, e.g. fucoidan
- C08B37/0069—Chondroitin-4-sulfate, i.e. chondroitin sulfate A; Dermatan sulfate, i.e. chondroitin sulfate B or beta-heparin; Chondroitin-6-sulfate, i.e. chondroitin sulfate C; Derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08B—POLYSACCHARIDES; DERIVATIVES THEREOF
- C08B37/00—Preparation of polysaccharides not provided for in groups C08B1/00 - C08B35/00; Derivatives thereof
- C08B37/006—Heteroglycans, i.e. polysaccharides having more than one sugar residue in the main chain in either alternating or less regular sequence; Gellans; Succinoglycans; Arabinogalactans; Tragacanth or gum tragacanth or traganth from Astragalus; Gum Karaya from Sterculia urens; Gum Ghatti from Anogeissus latifolia; Derivatives thereof
- C08B37/0063—Glycosaminoglycans or mucopolysaccharides, e.g. keratan sulfate; Derivatives thereof, e.g. fucoidan
- C08B37/0072—Hyaluronic acid, i.e. HA or hyaluronan; Derivatives thereof, e.g. crosslinked hyaluronic acid (hylan) or hyaluronates
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08B—POLYSACCHARIDES; DERIVATIVES THEREOF
- C08B37/00—Preparation of polysaccharides not provided for in groups C08B1/00 - C08B35/00; Derivatives thereof
- C08B37/006—Heteroglycans, i.e. polysaccharides having more than one sugar residue in the main chain in either alternating or less regular sequence; Gellans; Succinoglycans; Arabinogalactans; Tragacanth or gum tragacanth or traganth from Astragalus; Gum Karaya from Sterculia urens; Gum Ghatti from Anogeissus latifolia; Derivatives thereof
- C08B37/0063—Glycosaminoglycans or mucopolysaccharides, e.g. keratan sulfate; Derivatives thereof, e.g. fucoidan
- C08B37/0075—Heparin; Heparan sulfate; Derivatives thereof, e.g. heparosan; Purification or extraction methods thereof
Definitions
- the present invention relates to methodology for the production of polymers, such as polysaccharides or oligosaccharides, by a glycosaminoglycan synthase and, more particularly, polymer production utilizing glycosaminoglycan synthases from Pasteurella multocida.
- glycosaminoglycans show potential as non-toxic therapeutic agents to modulate blood coagulation, cancer metastasis, or cell growth. Complex sugars cause biological effects by binding to target proteins including enzymes and receptors. Methodologies to synthesize many compounds, however, and to test for potency and selectivity are limiting steps in drug discovery. Moreover, glycosaminoglycans of different sizes can have dramatically different biological effects.
- the presently claimed and disclosed invention also relates to a chemoenzymatic synthesis methodology to create both pure, chimeric, and hybrid polymers composed of hyaluronan, chondroitin, keratan, dermatan, heparin units, and combinations thereof (e.g., chimeric or hybrid polymers), wherein the pure, chimeric and hybrid polymers are substantially monodisperse in size.
- a chemoenzymatic synthesis methodology to create both pure, chimeric, and hybrid polymers composed of hyaluronan, chondroitin, keratan, dermatan, heparin units, and combinations thereof (e.g., chimeric or hybrid polymers), wherein the pure, chimeric and hybrid polymers are substantially monodisperse in size.
- new structures or chemical groups may be incorporated into the glycosaminoglycan chain for forming unnatural polymers.
- Polysaccharides are large carbohydrate molecules comprising from about 25 sugar units to thousands of sugar units. Oligosaccharides are smaller carbohydrate molecules comprising less than about 25 sugar units. Animals, plants, fungi and bacteria produce an enormous variety of polysaccharide structures that are involved in numerous important biological functions such as structural elements, energy storage, and cellular interaction mediation. Often, the polysaccharide's biological function is due to the interaction of the polysaccharide with proteins such as receptors and growth factors.
- glycosaminoglycan class of polysaccharides and oligosaccharides which includes heparin, chondroitin, dermatan, keratan, and hyaluronic acid, plays major roles in determining cellular behavior (e.g., migration, adhesion) as well as the rate of cell proliferation in mammals.
- These polysaccharides and oligosaccharides are, therefore, essential for the correct formation and maintenance of the organs of the human body.
- pathogenic bacteria and fungi also take advantage of the polysaccharide's role in cellular communication.
- pathogenic microbes form polysaccharide surface coatings or capsules that are identical or chemically similar to host molecules.
- Group A & C Streptococcus and Type A Pasteurella multocida produce authentic hyaluronic acid capsules
- other Pasteurella multocida (Type F and D) and pathogenic Escherichia coli (K4 and K5) are known to make capsules composed of polymers very similar to chondroitin and heparin.
- the pathogenic microbes form the polysaccharide surface coatings or capsules because such a coating is nonimmunogenic and protects the bacteria from host defenses, thereby providing the equivalent of molecular camouflage.
- Enzymes alternatively called synthases, synthetases, or transferases, catalyze the polymerization of polysaccharides found in living organisms. Many of the known enzymes also polymerize activated sugar nucleotides. The most prevalent sugar donors contain UDP, but ADP, GDP, and CMP are also used depending on (1) the particular sugar to be transferred and (2) the organism. Many types of polysaccharides are found at, or outside of, the cell surface. Accordingly, most of the synthase activity is typically associated with either the plasma membrane on the cell periphery or the Golgi apparatus membranes that are involved in secretion. In general, these membrane-bound synthase proteins are difficult to manipulate by typical procedures, and only a few enzymes have been identified after biochemical purification.
- polysaccharides are commercially harvested from many sources, such as xanthan from bacteria, carrageenans from seaweed, and gums from trees. This substantial industry supplies thousands of tons of these raw materials for a multitude of consumer products ranging from ice cream desserts to skin cream cosmetics. Vertebrate tissues and pathogenic bacteria are the sources of more exotic polysaccharides utilized in the medical field e.g., as surgical aids, vaccines, and anticoagulants. For example, two glycosaminoglycan polysaccharides, heparin from pig intestinal mucosa and hyaluronic acid from rooster combs, are employed in several applications including clot prevention and eye surgery, respectively.
- Polysaccharides extracted from bacterial capsules are utilized to vaccinate both children and adults against disease with varying levels of success.
- chemical modification e.g., hydrolysis, sulfation, deacetylation
- the synthetic control and the reproducibility of large-scale reactions are not always successful.
- such polysaccharides are only available having a large molecular weight distribution, and oligosaccharides of the same repeat units are not available.
- Some of the current methods for designing and constructing carbohydrate polymers in vitro utilize: (i) difficult, multistep sugar chemistry, or (ii) reactions driven by transferase enzymes involved in biosynthesis, or (iii) reactions harnessing carbohydrate degrading enzymes catalyzing transglycosylation or hydrolysis.
- the latter two methods are often restricted by the specificity and the properties of the available naturally occurring enzymes. Many of these enzymes are neither particularly abundant nor stable but are almost always expensive. Overall, the procedures currently employed yield polymers containing between 2 and about 12 sugars. Unfortunately, many of the physical and biological properties of polysaccharides do not become apparent until the polymer contains 25, 100, or even thousands of monomers.
- Hyaluronic acid or HA is a linear polysaccharide of the glycosaminoglycan class and is composed of up to thousands of ⁇ (1 ,4)GlcUA- ⁇ (1 ,3)GlcNAc repeats.
- HA is a major structural element of the extracellular matrix and plays roles in adhesion and recognition. HA has a high negative charge density and numerous hydroxyl groups, therefore, the molecule assumes an extended and hydrated conformation in solution.
- the viscoelastic properties of cartilage and synovial fluid are, in part, the result of the physical properties of the HA polysaccharide.
- HA also interacts with proteins such as CD44, RHAMM, and fibrinogen thereby influencing many natural processes such as angiogenesis, cancer, cell motility, wound healing, and cell adhesion.
- HA has been widely used as a viscoelastic replacement for the vitreous humor of the eye in ophthalmic surgery during implantation of intraocular lenses in cataract patients.
- HA injection directly into joints is also used to alleviate pain associated with arthritis.
- Chemically cross-linked gels and films are also utilized to prevent deleterious adhesions after abdominal surgery.
- adsorbed HA coatings also improve the biocompatibility of medical devices such as catheters and sensors by reducing fouling and tissue abrasion.
- HA is also made by certain microbes that cause disease in humans and animals.
- Some bacterial pathogens namely Gram-negative Pasteurella multocida Type A and Gram- positive Streptococcus Group A and C, produce an extracellular HA capsule which protects the microbes from host defenses such as phagocytosis.
- Mutant bacteria that do not produce HA capsules are 10 2 - and 10 3 -fold less virulent in comparison to the encapsulated strains.
- the Paramecium bursaria Chlorella virus (PBCV-1) directs the algal host cells to produce a HA surface coating early in infection.
- HAS HA synthases
- the various HA synthases utilize UDP- GIcUA and UDP-GIcNAc sugar nucleotide precursors in the presence of a divalent Mn, Mg, or Co ion to polymerize long chains of HA.
- the HASs are membrane proteins localized to the lipid bilayer at the cell surface. During HA biosynthesis, the HA polymer is transported across the bilayer into the extracellular space. In all HASs, a single species of polypeptide catalyzes the transfer of two distinct sugars.
- HasA or spHAS
- Group A Streptococcus pyogenes was the first HA synthase to be described at the molecular level.
- the various vertebrate homologs Xenopus DG42 or XIHASI ; murine and human HAS1 , HAS2, and HAS3
- the viral enzyme, A98R are quite similar at the amino acid level to certain regions of the HasA polypeptide chain ( ⁇ 30% identity overall) and were discovered only after the sequence of spHAS was disclosed in 1994.
- At least 7 short motifs (5-9 residues) interspersed throughout these Class I enzymes are identical or quite conserved.
- the evolutionary relationship among these HA synthases from such dissimilar sources is not clear at present.
- the enzymes are predicted to have a similar overall topology in the bilayer: membrane-associated regions at the amino and the carboxyl termini flank a large cytoplasmic central domain ( ⁇ 200 amino acids).
- the amino terminal region appears to contain two transmembrane segments, while the carboxyl terminal region appears to contain three to five membrane-associated or transmembrane segments, depending on the species. Very little of these HAS polypeptide chains are expected to be exposed to the outside of the cell.
- HA made in mammalian cells was reported to have a covalently attached UDP group as measured by an incorporation of low amounts of radioactivity derived from 32 P-labeled UDP- sugar into an anionic polymer. This data implied that the last sugar was transferred to the reducing end of the polymer. Thus, it remains unclear if these rather similar HAS polypeptides from vertebrates and streptococci actually utilize different reaction pathways.
- the Class Il HAS, pmHAS has many useful catalytic properties including the ability to elongate exogenous acceptors at the non-reducing end with HA chains.
- chondroitin synthase, pmCS, and the heparosan synthases, pmHS1 and pmHS2 are also useful, but they add chondroitin or heparosan chains to the acceptor's non-reducing terminus, respectively.
- Chondroitin is one of the most prevalent glycosaminoglycans (GAGs) in vertebrates as well as part of the capsular polymer of Type F P. multocida, a minor fowl cholera pathogen.
- GAGs glycosaminoglycans
- This bacterium produces unsulfated chondroitin (DeAngelis et al., 2002) but animals possess sulfated chondroitin polymers.
- the first chondroitin synthase from any source to be molecularly cloned was the P. multocida pmCS (DeAngelis and Padgett- McCue, 2000).
- the pmCS contains 965 amino acid residues and is about 90% identical to pmHAS.
- a soluble recombinant Escherichia co//-derived pmCS 1"704 catalyzes the repetitive addition of sugars from UDP-GaINAc and UDP-GIcUA to chondroitin oligosaccharide acceptors in vitro.
- Heparosan [N-acetylheparosan], (-GlcUA- ⁇ 1 ,4-GlcNAc- ⁇ 1 ,4-), is the repeating sugar backbone of the polysaccharide found in the capsule of certain pathogenic bacteria as well as the biosynthetic precursor of heparin or heparan sulfate found in animals from hydra to vertebrates.
- the sulfated forms bind to a variety of extremely important polypeptides including hemostasis factors (e.g., antithrombin III, thrombin), growth factors (e.g., EGF, VEGF), and chemokines (e.g., IL-8, platelet factor 4) as well as the adhesive proteins for viral pathogens (e.g., herpes, Dengue fever).
- hemostasis factors e.g., antithrombin III, thrombin
- growth factors e.g., EGF, VEGF
- chemokines e.g., IL-8, platelet factor 4
- viral pathogens e.g., herpes, Dengue fever.
- heparin is extracted from animal tissue and used as an anticoagulant or antithrombotic drug.
- similar polymers and derivatives should also be useful for pharmacological intervention in a variety of pathologic conditions including neoplasia and viral infection.
- the heparosan synthases from P. multocida possess both a hexosamine and a glucuronic acid transfer site in the same polypeptide chain, as shown by mutagenesis studies (Kane, T.A. et. al, J. Biol. Chem. 2006), and are therefore referred to as "dual-action" or bifunctional glycosyltransferases. These enzymes are complex because they employ both an inverting and a retaining mechanism when transferring the monosaccharide from UDP precursors to the non-reducing terminus of a growing chain.
- the two Pasteurella heparosan synthases, PmHSI and PmHS2 are approximately 70% identical at the amino acid sequence level.
- PmHSI hssA
- hssB PmHS2
- the present invention provides a method for the production of glycosaminoglycans of HA, chondroitin, heparosan, and chimeric or hybrid molecules incorporating multiple glycosaminoglycans, wherein the glycosaminoglycans are substantially monodisperse and thus have a defined size distribution.
- the present invention also encompasses the use of one or more natural or modified synthases that have the ability to produce unnatural polymers.
- An advantage of these enzymes is that their altered specificity allows new useful groups or units to be added to the polymer.
- the present invention also encompasses the methodology of polysaccharide or oligosaccharide polymer grafting, i.e., HA, heparosan or chondroitin, using either a hyaluronan synthase (pmHAS) or a chondroitin synthase (pmCS) or a heparin synthase (pmHS, also referred to as pmHS1 , and PgIA, also referred to as pmHS2), respectively, from various types of P. multocida.
- Modified versions of the pmHAS or pmCS or pmHS1 , or pmHS2 enzymes can also be utilized to graft on polysaccharides of various size and composition.
- the present invention results in (1) the targeting of specific, desirable size distributions or size ranges; (2) the synthesis of monodisperse (narrow size distribution) polymers; and (3) the creation of new, unnatural polymers with altered chemical groups.
- FIG. 1 depicts a comparison of partial primary sequences of pmHAS and different pmCSs.
- Primary sequences of presumably chondroitin synthases from different Type F Pasteurella multocida were obtained by directly sequencing the products of colony-lysis PCR.
- the MULTALIN alignment indicates that most of the differences between pmHAS and pmCS are conserved among these independent strains.
- Residues that were substituted in site-mutagenesis studies were underlined.
- the mutant polypeptides contain a single or combination of different mutations, indicated by star(s). None of these mutations changes the specificity of the original enzymes.
- FIG. 2 depicts chimeric constructs of pmHAS 1 - 221 -CS 215 258 -HAS 266 - 703 and pmCS 1 - 214 -HAS 222"265 -CS 258"704 .
- Pm-FH and pPm7A DNA were used to create pmHAS 1 - 221 -CS 215 - 258 - HAS 266"703 .
- a very interesting result was that pmCS 1"214 -HAS 222"265 -CS 258 704 can transfer both GaINAc and GIcNAc to HA oligomer acceptor; this enzyme displays relaxed sugar specificity.
- FIG. 3 depicts a summary of enzyme activities of chimeric proteins.
- the enzymes are drawn as bars. Black bars represent pmCS.
- White bars represent pmHAS. +, active; -, inactive.
- PmCHC represents pmCS 1 - 214 -HAS 222"265 -CS 258 704 .
- the roles of the two domains are confirmed and we have localized a 44-residue region critical for distinguishing
- FIG. 4 is a graphical representation of a model of Pasteurella synthase polymerization. It is important to note that other uronic acid or hexosamine precursors may be combined or substituted as well. In addition, other acceptor molecules can substitute as the primer for reaction synchronization and size control.
- FIG. 5 is a graphical representation of a model of reaction synchronization.
- FIG. 6 is a graphical representation of a model of stoichiometric control of polymer size.
- FIG. 7 is an electrophoresis gel illustrating that in vitro generated HA can reach the molecular mass of 1.3 MDa. Lane 2, Bio-Rad 1 kilobase DNA ruler with the top band of
- Lane 3 Bioline DNA hyperLadder with the top band of 10 kb.
- FIG. 8 is a graphical representation illustrating control of HA product size by acceptor concentration. 100 ⁇ l of reactions were setup with 0.7 ⁇ g/ ⁇ l of pmHAS, 32mM of
- FIG. 9 is an electrophoresis gel illustrating in vitro synthesis of fluorescent HA.
- reaction products were analyzed with 0.8% agarose gel electrophoresis and viewed under UV light.
- FIG. 10 is an electrophoresis gel illustrating utilization of large HA acceptors.
- Reactions were carried out at 30 0 C for 48 hours.
- the 60 ⁇ l reaction contained 0.28 ⁇ g/ ⁇ l of pmHAS, 3.3 mM UDP-GIcNAc, 3.3 mM UDP-GIcUA and without (lane 2) or with various amounts of acceptors (lanes 3-5, 7-9 and 10).
- 1.0 ⁇ l of each reaction was loaded on 0.7% agarose gel and stained with STAINS-ALL.
- Lane 1 BIORAD kb ladder (top band is 15 kb).
- FIG. 11 is an electrophoresis gel that illustrates the migration of a ladder constructed of HA of defined size distribution for use as a standard.
- FIG. 12 is an electrophoresis gel illustrating various mondisperse chondroitin sulfate HA hybrid GAGs. The 1% agarose gel stained with STAINS-ALL shows a variety of chondroitin sulfates (either A, B or C) that were elongated with pmHAS, thus adding HA chains.
- Lanes 1 , 8, 15, 22 and 27 contain the Kilobase DNA ladder; lanes 2 and 7 contain starting CSA, while lanes 3-6 contain CSA-HA at 2 hrs, 4 hrs, 6 hrs and O/N, respectively; lanes 9 and 14 contain starting CSB, while lanes 10-13 contain CSB-HA at 2 hrs, 4 hrs, 6 hrs and O/N, respectively; lanes 16 and 21 contain starting CSC, while lanes 17-20 contain CSC-HA at 2 hrs, 4 hrs, 6 hrs and O/N, respectively; lanes 23-26 contain no acceptor at 2 hrs, 4 hrs, 6 hrs and O/N, respectively.
- FIG. 13 is an electrophoresis gel illustrating control of hybrid GAG size by stoichiometric control.
- the 1% agarose gel stained with STAINS-ALL shows chondroitin sulfate A that was elongated with pmHAS, thus adding HA chains.
- Lanes 1 , 7, 13, 19 and 25 contain the Kilobase ladder; lanes 2 and 6 contain 225 ⁇ g starting CSA, while lanes 3-5 contain 225 ⁇ g CSA-HA at 2 hrs, 6 hrs and O/N, respectively; lanes 8 and 12 contain 75 ⁇ g starting CSA, while lanes 9-11 contain 75 ⁇ g CSA-HA at 2 hrs, 6 hrs and O/N, respectively; lanes 14 and 18 contain 25 ⁇ g starting CSA, while lanes 15-17 contain 25 ⁇ g CSA-HA at 2 hrs, 6 hrs and O/N, respectively; lanes 20 and 24 contain 8.3 ⁇ g starting CSA, while lanes 21-23 contain 8.3 ⁇ g CSA-HA at 2 hrs, 6 hrs and O/N, respectively.
- FIG. 14 is an electrophoresis gel illustrating extension of HA with chondroitin chains using pmCS.
- the 1.2% agarose gel stained with STAINS-ALL shows a reaction with pmCS and UDP-GIcUA, UDP-GaINAc with either an 81 kDa HA acceptor (lanes 3-7) or no acceptor (lanes 9-13). Some reactions were "fed" UDP-sugar during the reaction at various times. Lanes 1 and 15 contain the Kilobase DNA standard. Lanes 2, 8 and 14 contain starting 81 kDa HA.
- Lanes 3-7 contain HA acceptor +HA-C at 2 hr, 4 hr, 4 hr (set O/N in incubator without 4 hr feeding), 6 hr and O/N, respectively.
- FIG. 15 illustrates size exclusion (or gel filtration) chromatography analysis coupled with multi-angle laser light scattering detection, which confirms the monodisperse nature of polymers created by the present invention.
- HA starting MW 81 kDa
- pmCS methoxycellulose
- FIG. 16 is an 0.7% agarose gel detected with Stains-all that compares the monodisperse, 'select HA 1 to commercially produced HA samples.
- the defined nature of 'selectHA' (the products in lanes 1-3) are evident compared to other extracted commercial HA in lanes 4-7 (DNA standard, lane 8).
- FIG. 17 is a gel analysis of recombinant heparosan synthase proteins (maltose binding protein (MBP) - PmHS fusions).
- MBP maltose binding protein
- This Coomassie Blue-stained polyacrylamide gel (8%) depicts substantial purification of the two enzymes by affinity chromatography on immobilized amylose.
- FIG. 18 depicts pH dependence of PmHSI and PmHS2 polymerization activity.
- Panel A PmHSI , 1.2% gel (S, Select-HATM LoLadder and HiLadder).
- Panel B PmHS2, 3% gel (S, Select-HATM LoLadder). All polymers were sensitive to heparin lyase III (not shown). The average molecular masses were determined by SEC-MALLS.
- FIG. 20 depicts mass spectral analyses of PmHS2-catalyzed single sugar addition of UDP-sugar analogs.
- the usage of UDP-substrates was detected by the formation of the target compound with the appropriate negative ion molecular mass by MALDI-ToF MS.
- the larger molecular weight peak (+ 22 Da) corresponds to the addition of sodium instead of a proton to the carboxylate.
- Panel A PmHS2 ( ⁇ 1-2 ⁇ g, 8 ⁇ l reaction, 3O 0 C, ⁇ 6-12 hrs) catalyzed the transfer of monosaccharide from various UDP-hexosamines (UDP-GIcNAc, UDP-GlcNPro or UDP-GlcNBut; -1-3 mM final) to a synthetic GIcUA- terminated acceptor, A-F-A ( ⁇ 0.6 mM; predicted 683.13 Da, observed 683.13 Da) to form longer molecules (A-F-A+2 GIcNAc product, predicted 1089.29 Da, observed 1089.12 Da; A- F-A+2 GlcNPro product, predicted 1117.32 Da, observed 1117.88 Da; A-F-A+2 GlcNBut product, predicted 1145.35 Da, observed 1145.19 Da).
- UDP-GIcNAc UDP-GlcNPro
- UDP-GlcNBut UDP-GlcN
- Panel B PmHS2 was tested with UDP-uronic acids (UDP-GIcUA or UDP-GlcNAcUA) and a synthetic GlcNAc-terminated acceptor, A-F-AN (predicted 886.21 Da, observed 886.09 Da), using the same conditions described above (A-F-AN+GlcUA product, predicted 1062.24 Da, observed 1062.03 Da; A- F-AN+2 GIcNAcUA product, predicted 1103.25 Da, observed 1103.10 Da). PmHS2 can mis-incorporate a variety of unnatural analogs.
- FIG. 21 depicts heparin lyase challenge of native and analog polymers.
- Two different polymers were synthesized with PmHS2 using UDP-GIcNAc and one of the indicated UDP-uronic acids (either UDP-GlcNAcUA analog or natural UDP-GIcUA).
- Half of the polymer sample was subjected to heparin lyase III treatment overnight before analysis on a 15% polyacrylamide gel (S, Select-HATM LoLadder and nanoHA 10-2 oTM ladder; key sizes denoted in kDa).
- S Select-HATM LoLadder and nanoHA 10-2 oTM ladder
- the GlcNAcUA-containing polymer was resistant to digestion while the native heparosan was totally degraded.
- FIG. 22 depicts mass spectral analyses of PmHS2 -catalyzed single sugar addition of UDP-GIcN[TFA].
- PmHS2 (-1-2 ⁇ g, 8 ⁇ l reaction, 3O 0 C, -6-12 hrs) catalyzed the addition of GIcNTFA to the nonreducing termini of a GlcUA-terminated synthetic glycoside acceptor, A-FA (-0.6 mM) (Eq.3). This was detected by MALDI-ToF MS and is evident by the formation of a peak with the expected larger mass (predicted exact mass 1197.18; observed mass 1197.21). The same type of result was observed for PmHAS.
- FIG. 23 depicts PAGE analyses of GIcN[TFA] containg polymers synthesized by PmHS2 and PmHAS.
- PmHS2 or PmHAS (-12 and 100 ⁇ g) respectively, were incubated with 25 mM UDP-GIcUA and either UDP- GIcNAc (NAc) or UDP-GIcN[TFA] (N[TFA]) at 3O 0 C, overnight. Reactions were run on polyacrylamide gels (12%) and polymers were detected by Alcian Blue stain. Natural and unnatural polymers were synthesized by the Pasteurella enzymes with approximately equal sizes and yields.
- FIG. 24 depicts lyase challenge of Natural and GIcN[TFA] containing polymers.
- Two different polymers were synthesized with PmHS2 or PmHAS using UDP-GIcUA and one of the indicated UDP-hexosamine sugars (either UDP-GIcN[TFA] analog or natural UDP- GIcNAc).
- Half of the polymer sample was subjected to hyaluronidase or heparosan lyase III treatment. Key sizes denoted in kDa.
- the GlcN[TFA]-containing polymers were not resistant to digestion.
- FIG. 25 is a diagram of GIcN[TFA] deprotection and potential medical applications.
- the GIcN[TFA] sugar can be added to any position within a polymer or oligosaccharide.
- the TFA group on the hexoasmine sugar can be deprotected with base treatment. This produces a primary amine that is potentially the site for N-sulfation, coupling to drugs and cross-linking site to form a gel; these applications are examples, and other chemistries and theraputics may also be employed.
- Glycosaminoglycans are linear polysaccharides composed of repeating disaccharide units containing a derivative of an amino sugar (either glucosamine or galactosamine).
- Hyaluronan [HA], chondroitin, and heparan sulfate/heparin contain a uronic acid as the other component of the disaccharide repeat while keratan contains a galactose.
- the GAGs are summarized in Table I. Table I
- An unnatural glycosaminoglycan would be a composition of matter not normally found in known living vertebrates, animals or microbes; different arrangements or structures of chemical groups are added by the hand of man.
- Vertebrates may contain all four types of GAGs, but the polysaccharide chain is often further modified after sugar polymerization. One or more modifications including O-sulfation of certain hydroxyls, deacetylation and subsequent N-sulfation, or epimerization of glucuronic acid to iduronic acid are found in most GAGs except HA.
- chondroitin sulfate and heparan sulfate/heparin Even within a single polymer chain.
- a few clever pathogenic microbes also produce unmodified GAG chains; the bacteria use extracellular polysaccharide coatings as molecular camouflage to avoid host defenses.
- the chondroitin and heparan sulfate/heparin chains in vertebrates are initially synthesized by elongation of a xylose-containing linkage tetrasaccharide attached to a variety of proteins. Keratan is either O-linked- or N-linked to certain proteins depending on the particular molecule.
- HA and all of the known bacterial GAGs are not part of the classification of proteins known as glycoproteins. All GAGs except HA are found covalently linked to a core protein, and such combination is referred to as a proteoglycan.
- Glycoproteins are usually much smaller than proteoglycans and only contain from 1-60% carbohydrate by weight in the form of numerous relatively short, branched oligosaccharide chains, whereas a proteoglycan can contain as much as 95% carbohydrate by weight.
- the core protein in a proteoglycan is also usually a glycoprotein, therefore usually contains other oligosaccharide chains besides the GAGs.
- GAGs and their derivatives are currently used in the medical field as ophthalmic and viscoelastic supplements, adhesion surgical aids to prevent post-operative adhesions, catheter and device coatings, and anticoagulants. Other current or promising future applications include anti-cancer medications, tissue engineering matrices, immune and neural cell modulators, anti-virals, proliferation modulators, and drug targeting agents.
- Complex carbohydrates, such as GAGs are information rich molecules. A major purpose of the sugars that make up GAGs is to allow communication between cells and extracellular components of multicellular organisms. Typically, certain proteins bind to particular sugar chains in a very selective fashion.
- a protein may simply adhere to the sugar, but quite often the protein's intrinsic activity may be altered and/or the protein transmits a signal to the cell to modulate its behavior. For example, in the blood coagulation cascade, heparin binding to inhibitory proteins helps shuts down the clotting response. In another case, HA binds to cells via the CD44 receptor that stimulates the cells to migrate and to proliferate. Even though long GAG polymers (i.e., >10 2 Da) are found naturally in the body, typically the protein's binding site interacts with a stretch of 4 to 10 monosaccharides. Therefore, oligosaccharides can be used to either (a) substitute for the polymer, or (b) to inhibit the polymer's action depending on the particular system.
- HA polysaccharide plays structural roles in the eye, skin, and joint synovium. Large HA polymers ( ⁇ 10 6 Da) also stimulate cell motility and proliferation. On the other hand, shorter HA polymers ( ⁇ 10 4 Da) often have the opposite effect.
- HA-oligosaccharides composed of 10 to 14 sugars [HA 10-I4 ] have promise for inhibition of cancer cell growth and metastasis.
- mice injected with various invasive and virulent tumor cell lines (melanoma, glioma, carcinomas from lung, breast and ovary) develop a number of large tumors and die within weeks. Treatment with HA oligosaccharides greatly reduced the number and the size of tumors. Metastasis, the escape of cancer cells throughout the body, is one of the biggest fears of both the ailing patient and the physician.
- HA or HA-like oligosaccharides appear to serve as a supplemental treatment to inhibit cancer growth and metatasis.
- the preliminary mode of action of the HA-oligosaccharide sugars is thought to be mediated by binding or interacting with one of several important HA-binding proteins (probably CD44 or RHAM) in the mammalian body.
- CD44 HA-binding proteins
- One proposed scenario for the anticancer action of HA-oligosaccharides is that multiple CD44 protein molecules in a cancer cell can bind simultaneously to a long HA polymer. This multivalent HA binding causes CD44 activation (perhaps mediated by dimerization or a receptor patching event) that triggers cancer cell activation and migration.
- each CD44 molecule individually binds a different HA molecule in a monovalent manner such that no dimerization/patching event occurs. Thus no activation signal is transmitted to the cell.
- the optimal HA-sugar size is 10 to 14 sugars. Although this size may be based more upon the size of HA currently available for testing rather than biological functionality - i.e., now that HA molecules and HA- like derivatives ⁇ 10 sugars are available according to the methodologies of the present invention, the optimal HA size or oligosaccharide composition may be found to be different.
- HA oligosaccharides are the stimulation of blood vessel formation and the stimulation of dendritic cell maturation. Enhancement of wound-healing and resupplying cardiac oxygenation may be additional applications that harness the ability of HA oligosaccharides to cause endothelial cells to form tubes and sprout new vessels.
- Dendritic cells possess adjuvant activity in stimulating specific CD4 and CD8 T cell responses. Therefore, dendritic cells are targets in vaccine development strategies for the prevention and treatment of infections, allograft reactions, allergic and autoimmune diseases, and cancer.
- Heparin interacts with many proteins in the body, but two extremely interesting classes are coagulation cascade proteins and growth factors.
- Antithrombin III [ATIII] and certain other hemostasis proteins are 100, 000-fold more potent inhibitors of blood clotting when complexed with heparin. Indeed, heparin is so potent it must be used in a hospital setting and requires careful monitoring in order to avoid hemorrhage. Newer, processed lower molecular weight forms of heparin are safer, but this material is still a complex mixture. It has been shown that a particular pentasaccharide (5 sugars long) found in heparin is responsible for the ATIII-anticoagulant effect.
- pentasaccharide since heparin is a very heterogeneous polymer, it is difficult to isolate the pentasaccharide (5 sugars long) in a pure state.
- the pentasaccharide can also be prepared in a conventional chemical synthesis involving -50 to 60 steps. However, altering the synthesis or preparing an assortment of analogs in parallel is not always feasible - either chemically or financially.
- VEGF vascular endothelial growth factor
- HBEGF heparin-binding epidermal growth factor
- FGF fibroblast growth factor
- Chondroitin is the most abundant GAG in the human body, but all of its specific biological roles are not yet clear. Phenomenon such as neural cell outgrowth appears to be modulated by chondroitin. Both stimulatory and inhibitory effects have been noted depending on the chondroitin form and the cell type. Therefore, chondroitin or similar molecules are of utility in re-wiring synaptic connections after degenerative diseases (e.g., Alzheimer's) or paralytic trauma.
- the epimerized form of chondroitin (GIcUA converted to the C5 isomer, iduronic acid or IdoUA), dermatan, selectively inhibits certain coagulation proteins such as heparin cofactor II.
- UDP-sugar precursors and divalent metal cofactors e.g., magnesium, cobalt, and/or manganese ion
- n ranges from about 25 to about 10,000. Smaller molecules may be made in vitro, as desired. If the GAG is polymerized by a single polypeptide, the enzyme is called a synthase or co-polymerase. [0067] As outlined in and incorporated by reference in the "Cross-Reference" section of this application hereinabove, the present Applicants have discovered four new dual-action enzyme catalysts from distinct isolates of the Gram-negative bacterium Pasteurella multocida using various molecular biology strategies. P. multocida infects fowl, swine, and cattle as well as many wildlife species.
- the enzymes are: a HA synthase, or (pmHAS); a chondroitin synthase, or (pmCS); and two heparosan synthases, or (pmHS1 and PmHS2). To date, no keratan synthase from any source has been identified or reported in the literature.
- pmHAS is unique in comparison to all other existing HA synthases of Streptococcus bacteria, humans and an algal virus. Specifically, recombinant pmHAS can elongate exogeneously-supplied short HA chains (e.g., 2-4 sugars) into longer HA chains (e.g., 3 to 150 sugars). The pmHAS synthase has been shown to add monosaccharides one at a time in a step-wise fashion to the growing chain.
- the pmHAS enzyme 's extraordinarily sugar transfer specificity results in the repeating sugar backbone of the GAG chain.
- the pmCS enzyme which is about 90% identical at the amino acid level to pmHAS, performs the same synthesis reactions but transfers GaINAc instead of GIcNAc.
- the pmCS enzyme was described and enabled in U.S. Serial No. 09/842,484.
- the pmHS1 and PmHS2 enzymes are not very similar at the amino acid level to pmHAS, but perform the similar synthesis reactions; the composition of sugars is identical but the linkages differ because heparosan is ( ⁇ -4GlcUA- ⁇ -4GlcNAc).
- the pmHS1 and PmHS2 enzymes were described and enabled in copending U.S.
- pmHAS possesses two independent catalytic sites in one polypeptide. Mutants were created that transferred only GIcUA, and distinct mutants were also created that transferred only GIcNAc. These mutants cannot polymerize HA chains individually, but if the two types of mutants are mixed together in the same reaction with an acceptor molecule, then polymerization was rescued.
- the chondroitin synthase, pmCS has a similar sequence and similar two-domain structure.
- the heparosan synthases, pmHS1 and PmHS2 also contain regions for the two active sites. Single action mutants have also been created for the chondroitin synthase, pmCS, and are described hereinafter in detail.
- the naturally occurring Pasteurella GAG synthases are very specific glycosyltransferases with respect to the sugar transfer reaction; only the correct monosaccharide from the authentic UDP-sugar is added onto acceptors.
- the epimers or other closely structurally related precursor molecules e.g., UDP-glucose
- the GAG synthases do, however, utilize certain heterologous acceptor sugars. For example, pmHAS will elongate short chondroitin acceptors with long HA chains. pmHS1 will also add long heparosan chains onto HA acceptor oligosaccharides as well as heparin oligosaccharides (see hereinbelow). Therefore, the presently claimed and disclosed invention encompasses a wide range of hybrid or chimeric GAG oligosaccharides prepared utilizing these P. multocida GAG catalysts.
- pmHAS oligosaccharide
- pmHS1 oligosaccharide
- pmHS2 polysaccharide acceptor molecule
- pmHAS Class II
- DSD[D/T]Y SEQ ID NO:69
- pmHAS Class II
- SEQ ID NO:68 SEQ ID NO:68
- DSD[D/T]Y SEQ ID NO:69
- a portion of the central region of the pmHAS is more homologous to the amino termini of other bacterial glycosyltransferases that produce different capsular polysaccharides or lipopolysaccharides.
- pmHAS is about twice as long as any other HAS enzyme.
- pmHAS When the pmHAS is given long elongation reaction times, HA polymers of at least 400 sugars long are formed.
- recombinant versions of pmHAS and pmCS produced in certain foreign hosts also have the ability to extend exogenously supplied HA or chondroitin oligosaccharides with long HA and chondroitin polymers in vitro, respectively.
- the recombinant pmHS1 and pmHS2 enzymes produced in a foreign host have the ability to extend HA, chondroitin, or heparin oligosaccharides with long heparosan chains in vitro. See e.g., U.S. Serial No.
- pmHAS or pmCS or pmHS1 or pmHS2 are supplied with functional acceptor oligosaccharides, total HA, chondroitin and heparin biosynthesis is increased up to 50-fold over reactions without the exogenous oligosaccharide.
- the native versions of the pmHAS, pmCS, pmHS1, and PmHS2 enzymes isolated from P. multocida do not perform such elongation reactions with exogenous acceptor (or perform with very low efficiency) due to the presence of a nascent HA, chondroitin, or heparin chain in the natural host.
- the nature of the polymer retention mechanism of the pmHAS, pmCS, pmHS1, and PmHS2 polypeptide might be the causative factor for this activity: i.e. a HA- or chondroitin- or heparin-binding site may exist that holds onto the HA or chondroitin or heparin chain during polymerization. Small HA or chondroitin or heparin oligosaccharides supplied by the hand of man are also capable of occupying this site of the recombinant enzyme and thereafter be extended into longer polysaccharide chains.
- the pmHAS 1"703 enzyme retains the ability of the parent enzyme to add onto either a long HA polymer, a short HA primer, a long chondroitin polymer, a short chondroitin primer, a short chondroitin polymer, as well as other exogenous acceptors.
- the chondroitin chain may also be sulfated.
- the purified pmHAS 1"703 enzyme is stable in an optimized buffer for days on ice and for hours at normal reaction temperatures.
- One formulation of the optimal buffer consists of 1 M ethylene glycol, 0.1 - 0.2 M ammonium sulfate, 5OmM Tris, pH 7.2, and protease inhibitors which also allow the stability and specificity at typical reaction conditions for sugar transfer.
- pmHAS 1"703 will also add a HA polymer onto plastic beads with an immobilized short HA primer or any other substrate capable of having an acceptor molecule or acceptor group thereon.
- Full-length, native sequence PmHSI or PmHS2 can be converted into higher yield, soluble proteins that are purifiable by the addition of fusion protein partners, such as, but not limited to, maltose-binding protein (MBP).
- MBP maltose-binding protein
- pmCS, pmHAS, pmHS1 , and PmHS2 possess two separate glycosyltransferase sites. Protein truncation studies demonstrated that residues 1-117 of pmHAS can be deleted without affecting catalytic activity; similar truncation of the homologous pmCS, pmHS1, and PmHS2 enzymes may also be preferred.
- the carboxyl-terminal boundary of the GIcUA- transferase of pmHAS resides within residues 686-703 and within residues 686-704 of pmCS. These sites each contain a DGS and DXD motif; all aspartate residues of these motifs are essential for HA synthase activity.
- Type F P. multocida synthesizes an unsulfated chondroitin ( ⁇ 3N- acetylgalactosamine [GalNAc]- ⁇ 4GlcUA) capsule. Domain swapping between pmHAS and the homologous chondroitin synthase, pmCS, has been performed.
- a chimeric or hybrid enzyme consisting of residues 1-427 of pmHAS and residues 421-704 of pmCS was an active HA synthase.
- the converse chimeric or hybrid enzyme consisting of residues 1-420 of pmCS and residues 428-703 of pmHAS was an active chondroitin synthase.
- the present invention encompasses methods of producing a variety of unique biocompatible molecules and coatings based on polysaccharides.
- Polysaccharides especially those of the glycosaminoglycan class, serve numerous roles in the body as structural elements and signaling molecules.
- the present invention also incorporates the propensity of certain recombinant enzymes, when prepared in a virgin state, to utilize various acceptor molecules as the seed for further polymer growth: naturally occurring forms of the enzyme or existing living wild- type host organisms do not display this ability.
- the present invention results in (a) the production of hybrid oligosaccharides or polysaccharides and (b) the formation of polysaccharide coatings.
- hybrid polymers can serve as "molecular glue" - i.e., when two cell types or other biomaterials interact with each half of a hybrid molecule, then each of the two phases are bridged.
- adding new chemical groups and thus forming unnatural glycosaminoglycan polymers may facilitate coupling to other molecules or surfaces, even cells.
- Such polysaccharide coatings are useful for integrating a foreign object within a surrounding tissue matrix.
- a prosthetic device is more firmly attached to the body when the device is coated with a naturally adhesive polysaccharide.
- the device's artificial components could be masked by the biocompatible coating to reduce immunoreactivity or inflammation.
- Another aspect of the present invention is the coating or grafting of GAGs onto various drug delivery matrices or bioadhesives or suitable medicaments to improve and/or alter delivery, half-life, persistence, targeting and/or toxicity.
- pmHAS and pmCS and pmHS1 and PmHS2 appear distinct from most other known HA and chondroitin and heparin synthases based on differences in sequence, topology in the membrane, and/or putative reaction mechanism.
- pmHAS the 972-residue membrane-associated hyaluronan synthase, catalyzes the transfer of both GIcNAc and GIcUA to form an HA polymer.
- pmHAS and pmCS mutants have been analyzed.
- pmHAS 1'703 is a soluble, active HA synthase suggesting that the carboxyl-terminus is involved in membrane association of the native enzyme.
- pmHAS 1"650 is inactive as a HA synthase, but retains GlcNAc-transferase activity.
- Pasteurella multocida Type F the minor fowl cholera pathogen, produces an extracellular polysaccharide capsule that is a putative virulence factor.
- the capsule of Pasteurella multocida Type F was removed by treating microbes with chondroitin AC lyase. It was found by acid hydrolysis that the polysaccharide contained galactosamine and glucuronic acid.
- a Type F polysaccharide synthase was molecularly cloned and its enzymatic activity was characterized.
- the 965- residue enzyme, called pmCS is 90% identical at the nucleotide and the amino acid level to the hyaluronan synthase, pmHAS, from P. multocida Type A.
- pmCS 965- residue enzyme
- a recombinant Escherichia co//-derived, truncated, soluble version of pmCS was shown to catalyze the repetitive addition of sugars from UDP-GaINAc and UDP-GIcUA to chondroitin oligosaccharide acceptors in vitro.
- pmCS a single polypeptide species
- PmHS2 a single polypeptide species that possess both transferase activities to catalyze heparin/heparosan.
- glycosaminoglycan chains composed of about 1 kDa to about 4 MDa (kDa is defined as 10 3 Da, whereas MDa is defined as 10 6 Da).
- the two current competing state-of-the-art techniques for creating the desired smaller size glycosaminoglycan [GAG] polymers are extremely limited and will not allow the medical potential of the sugars to be achieved.
- Small GAG molecules are presently made either by: (1) partially depolymerizing costly large polymers with degradative enzymes or with chemical means (e.g., heat, acid, sonication), or (2) highly demanding organic chemistry-based carbohydrate synthesis.
- the former method is difficult to control, inefficient, costly, and is in a relatively stagnant development stage.
- the enzyme wants to degrade the polymer to the 2 or 4 sugar end stage product, but this sugar is inactive for many therapeutic treatments.
- the use of acid hydrolysis also removes a fraction of the acetyl groups from the GIcNAc or GaINAc groups thereby introducing a positive charge into an otherwise anionic molecule.
- the latter method chemical synthesis, involves steps with low to moderate repetitive yield and has never been reported for a HA-oligosaccharide longer than 6 to 8 sugars in length.
- racemization e.g., production of the wrong isomer
- the inclusion of the wrong isomer in a therapeutic preparation in the past has had tragic consequences as evidenced by the birth defects spawned by the drug Thalidomide.
- sugars contain many similar reactive hydroxyl groups, in order to effect proper coupling between two sugars in a chemical synthesis, most hydroxyl groups must be blocked or protected. At the conclusion of the reaction, all of the protecting groups must be removed, but this process is not perfect; as a result, a fraction of the product molecules retain these unnatural moieties.
- the issues of racemization and side-products from chemical synthesis are not problems for the high-fidelity enzyme catalysts of the presently claimed and disclosed invention.
- GAG polymer and is essentially useless for creating novel sugars beyond simple derivatizations (e.g., esterifying some fraction of GIcUA residues in an indiscriminate fashion).
- Chemical synthesis may suffice in theory to make novel sugars, but the strategy needs to be customized for adding a new sugar, plus the problems with side- reactions/isomerization and the ultimate oligosaccharide size still pose the same trouble as described earlier.
- Another distinct method using the degradative enzymes to generate small molecules by running in reverse on mixtures of two polymers e.g., HA and chondroitin
- HA polysaccharide dictates its biological effect in many cellular and tissue systems based on many reports in the literature.
- no source of very defined, uniform HA polymers with sizes greater than 2-5 kDa is currently available. This situation is complicated by the observation that long and short HA polymers appear to have antagonistic or inverse effects on some biological systems. Therefore, HA preparations containing a mixture of both size populations may yield contradictory or paradoxical results.
- one of the objects of the present invention is to provide a method to produce HA with very narrow, substantially monodisperse size distributions that overcomes the disadvantages and defects of the prior art.
- the methods for enzymatically producing defined glycosaminoglycan polymers of the present invention involves providing at least one functional acceptor and at least one recombinant glycosaminoglycan transferase capable of elongating the functional acceptor in a controlled and/or repetitive fashion to form extended glycosaminoglycan-like molecules.
- At least one UDP-sugar (such as but not limited to, UDP-GIcUA, UDP-GaIUA UDP-GIcNAc, UDP-GIc, UDP-GaINAc, UDP-GIcN, UDP-GaIN), or a a structural variant or derivative thereof (including a monosaccharide with functional groups or combinations thereof not found in typical known organisms) is added in a stoichiometric ratio to the functional acceptor such that the recombinant glycosaminoglycan transferase elongates the at least one functional acceptor to provide glycosaminoglycan polymers having a desired size distribution and that are substantially monodisperse in size.
- UDP-sugar such as but not limited to, UDP-GIcUA, UDP-GaIUA UDP-GIcNAc, UDP-GIc, UDP-GaINAc, UDP-GIcN, UDP-GaIN
- a structural variant or derivative thereof including
- substantially monodisperse in size will be understood to refer to defined glycoasminoglycan polymers that have a very narrow size distribution.
- substantially monodisperse glycosaminoglycan polymers having a molecular weight in a range of from about 3.5 kDa to about 0.5 MDa will have a polydispersity value (i.e., Mw/Mn, where Mw is the average molecular weight and Mn is the number average molecular weight) in a range of from about 1.0 to about 1.1 , and preferably in a range from about 1.0 to about 1.05.
- substantially monodisperse glycosaminoglycan polymers having a molecular weight in a range of from about 0.5 MDa to about 4.5 MDa will have a polydispersity value in a range of from about 1.0 to about 1.5, and preferably in a range from about 1.0 to about 1.2.
- the functional acceptor utilized in accordance with the present invention will have at least one sugar unit of uronic acid, hexosamine, and structural variants or derivatives thereof, wherein the uronic acid may be GIcUA, IdoUA (iduronic acid), GaIUA, and structural variants or derivatives thereof; and the hexosamine may be GIcNAc, GaINAc, GIcN, GaIN, and structural variants or derivatives thereof.
- the functional acceptor may have at least two sugar units.
- the functional acceptor may be an HA oligosaccharide of about 3 sugar units to about 4.2 kDa, or an HA polymer having a mass of about 3.5 kDa to about 2MDa.
- the functional acceptor may be an HA oligosaccharide, polysaccharide or polymer; a chondroitin oligosaccharide, polysaccharide or polymer; a chondroitin sulfate oligosaccharide, polysaccharide or polymer; a heparosan oligosaccharide, polysaccharide or polymer; a heparin oligosaccharide, polysaccharide, or polymer; a heparin oligosaccharide, polysaccharide or polymer; a heparin oligosaccharide, polysaccharide or polymer; a heparosan-like oligosaccharide, polysaccharide or polymer
- the functional acceptor may be an extended acceptor such as HA chains, chondroitin chains, heparosan chains, mixed glycosaminoglycan chains, analog containing chains or any combination thereof.
- Another functional acceptor class that may be utilized in accordance with the present invention includes synthetic glycosides (i.e., sugars that have a non-sugar component at the reducing end) or similar synthetic carbohydrates. The synthetic portion substitutes for one of the natural sugar units; these molecules are less expensive and can possess useful groups.
- the functional acceptor utilized in accordance with the present invention may further comprise a moiety selected from the group consisting of a fluorescent tag, a radioactive tag or therapeutic, an affinity tag, a detection probe, a medicant, a biologically active agent, a therapeutic agent, and combinations thereof.
- the UDP-sugar provided in accordance with the present invention may be radioactive or nuclear magnetic resonance- active.
- any recombinant glycosaminoglycan transferase described or incorporated by reference herein may be utilized in the methods of the present invention.
- the recombinant glycosaminoglycan transferase utilized in accordance with the present invention may be a recombinant hyaluronan synthase, a recombinant chondroitin synthase, a recombinant heparosan synthase, or any active fragment or mutant thereof.
- the recombinant glycosaminglycan transferase may be capable of adding only one UDP-sugar described herein above or may be capable of adding two or more UDP-sugars described herein above.
- the recombinant glycosaminglycan transferases utilized in accordance with the present invention may be selected from the group consisting of: a recombinant heparosan synthase having an amino acid sequence as set forth in SEQ ID NO: 6, 8, 66, 70 or 71 ; a recombinant heparosan synthase encoded by the nucleotide sequence of SEQ ID NO: 5, 7 or 65; a recombinant heparosan synthase encoded by a nucleotide sequence capable of hybridizing to a complement of the nucleotide sequence of SEQ ID NOS:5, 7 or 65 under hybridization conditions comprising hybridization at a temperature of 68°C in 5x SSC/5x Denhardt's solution/1.0% SDS, followed with washing in 3x SSC at 42°C; a recombinant heparosan synthase encoded by a nucleot
- the present invention further includes recombinantly produced, isolated glycosaminglycan polymers produced by the methods described herein above. Such recombinantly produced, isolated glycosaminoglycan polymers are substantially monodisperse in size.
- the present invention further includes methods of doing business by producing the glycosaminoglycan polymers by the methods described herein above and selling and delivering such glycosaminoglycan polymers to a customer or providing such glycosaminoglycan polymers to a patient.
- methods of enzymatically producing glycosaminoglycan polymers having unnatural structures include providing at least one functional acceptor as described above, providing at least one recombinant glycosaminoglycan transferase as described above, and providing at least one UDP-sugar analog, wherein the at least one UDP-sugar analog is not found in mammals in a native state.
- the at least one recombinant glycosaminoglycan transferase then elongates the at least one functional acceptor to provide glycosaminoglycan polymers having the sugar analog incorporated therein, thereby providing glycosaminoglycan polymers having an unnatural structure.
- the at least one UDP-sugar analog is selected from the group consisting of UDP-GIcN, UDP-GlcNAcUA, UDP-GlcNAcNAc, UDP-GlcdiNAcUA, UDP- GIcN[TFA], UDP-GlcNBut, UDP-GlcNPro, UDP-6-F-6-deoxyGlcNAc, UDP-2-F-2- deoxyGlcUA, and combinations thereof.
- the at least one UDP-sugar analog may also further comprise a moiety selected from the group consisting of a fluorescent tag, a radioactive tag or therapeutic, an affinity tag, a detection probe, a medicant, a biologically active agent, a therapeutic agent, and combinations thereof.
- the at least one recombinant glycosaminoglycan transferase is selected from the group consisting of a recombinant hyaluronan synthase or active fragment or mutant thereof, a recombinant chondroitin synthase or active fragment or mutant thereof, a recombinant heparosan synthase or active fragment or mutant thereof and combinations thereof.
- the at least one recombinant glycosaminoglycan transferase comprises a recombinant single action glycosyltransferase capable of adding only one of GIcUA, GIcNAc, GIc, GaINAc, GIcN, GaIN or a structural variant or derivative thereof.
- the at least one recombinant glycosaminoglycan transferase comprises a recombinant synthetic chimeric glycosaminoglycan transferase capable of adding two or more of GIcUA 1 GIcNAc, GIc, GaINAc, GIcN, GaIN and a structural variant or derivative thereof.
- the at least one recombinant glycosaminoglycan transferase is selected from the group consisting of: a recombinant glycosaminoglycan transferase having an amino acid sequence essentially as set forth in SEQ ID NO:2, 4, ⁇ 6, 8, 9, 66, 70 or 71 ; a recombinant glycosaminoglycan transferase encoded by a nucleotide sequence essentially as set forth in SEQ ID NO:1 , 3, 5, 7, 10-46, 65 or 67; a recombinant glycosaminoglycan transferase encoded by a nucleotide sequence capable of hybridizing to a complement of a nucleotide sequence selected from the group consisting of SEQ ID NOS:1 , 3, 5, 7, 10-46, 65 or 67 under hybridization conditions comprising hybridization at a temperature of 68°C in 5x SSC/5x Denhardt's solution/1.0% SDS, followed with washing in 3x
- the present invention further includes a recombinantly produced, isolated glycosaminoglycan polymer having an unnatural structure, wherein the glycosaminoglycan polymer comprises at least one sugar analog that is not found in mammals in a native state, and wherein the recombinantly produced, isolated glycosaminoglycan polymer is produced by the methods described herein above.
- the glycosaminoglycan polymer having an unnatural structure comprises a glycosaminoglycan selected from the group consisting of an HA oligosaccharide, an HA polymer, a chondroitin oligosaccharide, a chondroitin polymer, a chondroitin sulfate polymer, a heparosan oligosaccharide, a heparin polymer, a heparin polymer, a heparosan polymer, and combinations thereof; and at least one sugar analog that is not found in mammals in a native state, wherein the at least one sugar analog is selected from the group consisting of UDP-GIcN, UDP-GlcNAcUA, UDP- GIcNAcNAc, UDP-GlcdiNAcUA, UDP-GIcN[TFA], UDP-GlcNBut, UDP-GlcNPro, UDP-6-F-6- deoxyGlc
- the present invention also includes methods of doing business by producing the glycosaminoglycan polymers having an unnatural structure by the methods described herein above and selling and delivering such glycosaminoglycan polymers to a customer or providing such glycosaminoglycan polymers to a patient.
- nucleic acid segment and “DNA segment” are used interchangeably and refer to a DNA molecule which has been isolated free of total genomic DNA of a particular species. Therefore, a “purified” DNA or nucleic acid segment as used herein, refers to a DNA segment which contains a Hyaluronate Synthase (“HAS") coding sequence or Chondroitin Synthase (CS) coding sequence or Heparin/Heparosan Synthase (HS) coding sequence yet is isolated away from, or purified free from, unrelated genomic DNA, for example, total Pasteurella multocida.
- HAS Hyaluronate Synthase
- CS Chondroitin Synthase
- HS Heparin/Heparosan Synthase
- DNA segment includes DNA segments and smaller fragments of such segments, and also recombinant vectors, including, for example, plasmids, cosmids, phage, viruses, and the like.
- a DNA segment comprising an isolated or purified pmHAS or pmCS or pmHS1 or PmHS2 gene refers to a DNA segment including HAS or CS or HS coding sequences isolated substantially away from other naturally occurring genes or protein encoding sequences.
- the term “gene” is used for simplicity to refer to a functional protein-, polypeptide- or peptide- encoding unit. As will be understood by those in the art, this functional term includes genomic sequences, cDNA sequences or combinations thereof.
- isolated substantially away from other coding sequences means that the gene of interest, in this case pmHAS orpmCS orpmHSI or PmHS2 forms the significant part of the coding region of the DNA segment, and that the DNA segment does not contain other non- relevant large portions of naturally-occurring coding DNA, such as large chromosomal fragments or other functional genes or DNA coding regions. Of course, this refers to the DNA segment as originally isolated, and does not exclude genes or coding regions later added to, or intentionally left in, the segment by the hand of man.
- prokaryotic sources Due to certain advantages associated with the use of prokaryotic sources, one will likely realize the most advantages upon isolation of the HAS or CS or HS gene from the prokaryote P. multocida.
- One such advantage is that, typically, eukaryotic genes may require significant post-transcriptional modifications that can only be achieved in a eukaryotic host. This will tend to limit the applicability of any eukaryotic HAS or CS or HS gene that is obtained.
- those of ordinary skill in the art will likely realize additional advantages in terms of time and ease of genetic manipulation where a prokaryotic enzyme gene is sought to be employed.
- DNA sequences utilized in accordance with the present invention will further include genetic control regions which allow the expression of the sequence in a selected recombinant host.
- the genetic control region may be native to the cell from which the gene was isolated, or may be native to the recombinant host cell, or may be an exaggerous segment that is compatible with and recognized by the transcriptional machinery of the selected recbominant host cell.
- the nature of the control region employed will generally vary depending on the particular use (e.g., cloning host) envisioned.
- the invention concerns the use of isolated DNA segments and recombinant vectors incorporating DNA sequences which encode a pmHAS orpmCS orpmHSI or PmHS2 gene, that includes within its amino acid sequence an amino acid sequence in accordance with SEQ ID NO:2, 4, 6, 8, 9, or 70, respectively.
- the invention concerns the use of isolated DNA segments and recombinant vectors incorporating DNA sequences which encode a gene that includes within its nucleic acid sequence an amino acid sequence encoding HAS or CS or HS peptides or peptide fragment thereof, and in particular to a HAS or CS or HS peptide or peptide fragment thereof, corresponding to Pasteurella multocida HAS or CS or HS.
- DNA segment or vector encodes a full length HAS or CS or HS protein, or is intended for use in expressing the HAS or CS or HS protein
- preferred sequences are those which are essentially as set forth in SEQ ID NO:1 , 3, 5, 7, 69, or 71 , respectively.
- Truncated glycosaminoglycan transferase genes (such as, but not limited to, pmHAS 1'703 , SEQ ID NO:71) also fall within the definition of preferred sequences as set forth above. For instance, at the carboxyl terminus, approximately 270-272 amino acids may be removed from the PmHAS sequence and still have a functioning HAS. Likewise, the removal of the last 50 residues or the first 77 residues of PmHSI (SEQ ID NOS: 70 and 71 , respectively) does not inactivate its catalytic function (Kane et al., 2006). Those of ordinary skill in the art would appreciate that simple amino acid removal from either end of the GAG synthase sequence can be accomplished.
- the truncated versions of the sequence simply have to be checked for activity in order to determine if such a truncated sequence is still capable of producing GAGs.
- the other GAG synthases disclosed and claimed herein are also amenable to truncation or alteration with preservation of activity, and the uses of such truncated or alternated GAG synthases also fall within the scope of the present invention.
- Nucleic acid segments having HAS or CS or HS activity may be isolated by the methods described herein.
- the term "a sequence essentially as set forth in SEQ ID NO:X means that the sequence substantially corresponds to a portion of SEQ ID NO:X and has relatively few amino acids or codons encoding amino acids which are not identical to, or a biologically functional equivalent of, the amino acids or codons encoding amino acids of SEQ ID NO:X.
- biologically functional equivalent is well understood in the art and is further defined in detail herein, as a gene having a sequence essentially as set forth in SEQ ID NO:X, and that is associated with the ability of prokaryotes to produce HA or a hyaluronic acid or chondroitin or heparin polymer in vitro or in vivo.
- X refers to either SEQ ID NO: 1 , 2, 3, 4, 5, 6, 7, 8, 9, 65, 66 or 67 or any additional sequences set forth herein, such as the truncated or mutated versions of pmHAS 1"703 that are contained generally in SEQ ID NOS: 10-48.
- nucleic acid sequence or an amino acid could make substitutions and changes to the nucleic acid sequence without changing its functionality (specific examples of such changes are given hereinafter and are generally set forth in SEQ ID NOS: 10-48).
- a substituted nucleic acid segment may be highly identical and retain its enzymatic activity with regard to its unadulterated parent, and yet still fail to hybridize thereto.
- present application discloses 4 enzymes and numerous mutants of these enzymes that still retain at least 50% of the enzymatic activity of the unmutated parent enzyme - i.e., V ⁇ of the dual action transferase activity of the unadulterated parent.
- the invention discloses nucleic acid segments encoding an enzymatically active HAS or CS or HS from P. multocida - pmHAS, pmCS, pmHS1 , and PmHS2, respectively.
- P. multocida - pmHAS, pmCS, pmHS1 , and PmHS2 respectively.
- substitutions can be made to the pmHAS or pmCS or pmHS1 or PmHS2 nucleic acid segments listed in SEQ ID NO:1, 3, 5, 7, 65 and 67, respectively, without deviating outside the scope and claims of the present invention. Indeed, such changes have been made and are described hereinafter with respect to the mutants produced. Standardized and accepted functionally equivalent amino acid substitutions are presented in Table II.
- Another preferred embodiment of the present invention is a purified nucleic acid segment that encodes a protein in accordance with SEQ ID NO:1 or 3 or 5 or 7 or 67, respectively, further defined as a recombinant vector.
- the term "recombinant vector” refers to a vector that has been modified to contain a nucleic acid segment that encodes an HAS or CS or HS protein, or fragment thereof.
- the recombinant vector may be further defined as an expression vector comprising a promoter operatively linked to said HAS- or CS- or HS- encoding nucleic acid segment.
- a further preferred embodiment of the present invention is a host cell, made recombinant with a recombinant vector comprising an HAS or CS or HS gene.
- the preferred recombinant host cell may be a prokaryotic cell.
- the recombinant host cell is an eukaryotic cell.
- engineered or “recombinant” cell is intended to refer to a cell into which a recombinant gene, such as a gene encoding HAS or CS or HS, has been introduced mechanically or by the hand of man. Therefore, engineered cells are distinguishable from naturally occurring cells which do not contain a recombinantly introduced gene.
- Engineered cells are thus cells having a gene or genes introduced through the hand of man.
- Recombinantly introduced genes will either be in the form of a cDNA gene, a copy of a genomic gene, or will include genes positioned adjacent to a promoter associated or not naturally associated with the particular introduced gene.
- the HAS- or CS- or HS- encoding DNA segments further include DNA sequences, known in the art functionally as origins of replication or "replicons", which allow replication of contiguous sequences by the particular host.
- origins of replication or "replicons” allow the preparation of extrachromosomally localized and replicating chimeric or hybrid segments or plasmids, to which HAS- or CS- or HS- encoding DNA sequences are ligated.
- the employed origin is one capable of replication in bacterial hosts suitable for biotechnology applications.
- the isolation and use of other replication origins such as the SV40, polyoma or bovine papilloma virus origins, which may be employed for cloning or expression in a number of higher organisms, are well known to those of ordinary skill in the art.
- the invention may thus be defined in terms of a recombinant transformation vector which includes the HAS- or CS- or HS- coding gene sequence together with an appropriate replication origin and under the control of selected control regions.
- a recombinant transformation vector which includes the HAS- or CS- or HS- coding gene sequence together with an appropriate replication origin and under the control of selected control regions.
- DNA fragments may be obtained which contain full complements of genes or cDNAs from a number of sources, including other strains of Pasteurella or from a prokaryot with similar glycosyltransferases or from eukaryotic sources, such as cDNA libraries.
- Virtually any molecular cloning approach may be employed for the generation of DNA fragments in accordance with the present invention.
- the only limitation generally on the particular method employed for DNA isolation is that the isolated nucleic acids should encode a biologically functional equivalent HAS or CS or HS.
- Typical useful vectors include plasmids and phages for use in prokaryotic organisms and even viral vectors for use in eukaryotic organisms. Examples include pKK223-3, pMAL-c, pSA3, recombinant lambda, SV40, polyoma, adenovirus, bovine papilloma virus and retroviruses.
- vectors capable of replication in both biotechnologically useful Gram-positive or Gram-negative bacteria e.g., Bacillus, Lactococcus, or E. coli
- Vectors such as these allow one to perform clonal colony selection in an easily manipulated host such as E. coli, followed by subsequent transfer back into a food grade Lactococcus or Bacillus strain for production of hyaluronan or chondroitin or heparin polymer.
- the recombinant vector is employed to make the functional GAG synthase for in vitro use.
- GRAS generally recognized as safe
- Another procedure to further augment HAS or CS or HS gene copy number is the insertion of multiple copies of the gene into the plasmid.
- Another technique would include integrating at least one copy of the HAS or CS or HS gene into chromosomal DNA. This extra amplification would be especially feasible, since the bacterial HAS or CS or
- the chromosomal DNA-ligated vector is employed to transfect the host that is selected for clonal screening purposes such as E. coli, through the use of a vector that is capable of expressing the inserted DNA in the chosen host.
- the invention concerns isolated DNA segments and recombinant vectors that include within their sequence a nucleic acid sequence essentially as set forth in SEQ ID NO:1 , 3, 5, 7, 65 or 67.
- nucleic acid sequence substantially corresponds to a portion of SEQ ID NO: 1 , 3, 5, 7, 65 or 67 and has relatively few codons which are not identical, or functionally equivalent, to the codons of SEQ ID NO: 1 , 3, 5, 7, 65 or 67.
- functionally equivalent codon is used herein to refer to codons that encode the same amino acid, such as the six codons for arginine or serine, and also refers to codons that encode biologically equivalent amino acids, as set forth in Table II.
- amino acid and nucleic acid sequences may include additional residues, such as additional N- or C-terminal amino acids or 5' or 3' nucleic acid sequences, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological protein activity where protein expression and enzyme activity is concerned.
- the addition of terminal sequences particularly applies to nucleic acid sequences which may, for example, include various non-coding sequences flanking either of the 5' or 3 1 portions of the coding region or may include various internal sequences, which are known to occur within genes.
- residues may be removed from the N- or C- terminal amino acids and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, as well.
- sequences which have between about 40% and about 99%; or more preferably, between about 60% and about 99%; or more preferably, between about 70% and about 99%; or more preferably, between about 80% and about 99%; or even more preferably, between about 90% and about 99% identity to the nucleotides of SEQ ID NO: 1, 3, 5, 7, 65 or 67 will be sequences which are "essentially as set forth in SEQ ID NO: 1 , 3, 5, 7, 65 or 67.
- Sequences which are essentially the same as those set forth in SEQ ID NO: 1 , 3, 5, 7, 65 or 67 may also be functionally defined as sequences which are capable of hybridizing to a nucleic acid segment containing the complement of SEQ ID NO: 1 , 3, 5, 7, 65 or 67 under standard stringent hybridization conditions, "moderately stringent hybridization conditions,” “less stringent hybridization conditions,” or “low stringency hybridization conditions.” Suitable standard or less stringent hybridization conditions will be well known to those of skill in the art and are clearly set forth hereinbelow. In a preferred embodiment, standard stringent hybridization conditions or less stringent hybridization conditions are utilized.
- standard stringent hybridization conditions “moderately stringent conditions,” and less stringent hybridization conditions or “low stringency hybridization conditions” are used herein, describe those conditions under which substantially complementary nucleic acid segments will form standard Watson-Crick base-pairing and thus “hybridize” to one another.
- a number of factors are known that determine the specificity of binding or hybridization, such as pH; temperature; salt concentration; the presence of agents, such as formamide and dimethyl sulfoxide; the length of the segments that are hybridizing; and the like.
- There are various protocols for standard hybridization experiments Depending on the relative similarity of the target DNA and the probe or query DNA, then the hybridization is performed under stringent, moderate, or under low or less stringent conditions.
- the hybridizing portion of the hybridizing nucleic acids is typically at least about 14 nucleotides in length, and preferably between about 14 and about 100 nucleotides in length.
- the hybridizing portion of the hybridizing nucleic acid is at least about 60%, e.g., at least about 80% or at least about 90%, identical to a portion or all of a nucleic acid sequence encoding a HAS or chondroitin or heparin synthase or its complement, such as SEQ ID NO: 1 , 3, 5, 7, 65 or 67 or the complement thereof.
- Hybridization of the oligonucleotide probe to a nucleic acid sample typically is performed under standard or stringent hybridization conditions.
- Nucleic acid duplex or hybrid stability is expressed as the melting temperature or T m , which is the temperature at which a probe nucleic acid sequence dissociates from a target DNA. This melting temperature is used to define the required stringency conditions. If sequences are to be identified that are related and substantially identical to the probe, rather than identical, then it is useful to first establish the lowest temperature at which only homologous hybridization occurs with a particular concentration of salt (e.g., SSC, SSPE, or HPB). Then, assuming that 1% mismatching results in a 1C decrease in the T m , the temperature of the final wash in the hybridization reaction is reduced accordingly (for example, if sequences having >95% identity with the probe are sought, the final wash temperature is decreased by about 5C).
- salt e.g., SSC, SSPE, or HPB
- the change in T m can be between about 0.5° and about 1.5° per 1% mismatch.
- standard stringent hybridization conditions include hybridizing at about 68C in 5x SSC/5x Denhardt's solution/1.0% SDS, followed with washing in 0.2x SSC/0.1% SDS at room temperature or hybridizing in
- Moderately stringent conditions include hybridizing as described above in 5xSSC ⁇ 5xDenhardt's solution 1% SDS washing in 3x SSC at 42C.
- the parameters of salt concentration and temperature can be varied to achieve the optimal level of identity between the probe and the target nucleic acid. Additional guidance regarding such conditions is readily available in the art, for example, by Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, (Cold Spring Harbor Press, N. Y.); and Ausubel et al. (eds.), 1995, Current Protocols in Molecular Biology, (John Wiley & Sons, N. Y.).
- low stringency protocols include: (A) hybridizing in 5X SSC, 5X Denhardts reagent, 30% formamide at about 3OC for about 20 hours followed by washing twice in 2X SSC 1 0.1% SDS at about 3OC for about 15 min followed by 0.5X SSC, 0.1% SDS at about 3OC for about 30 min (FEMS Microbiology Letters, 2000, vol. 193, p. 99-103); (B) hybridizing in 5X SSC at about 4 ⁇ C overnight followed by washing with 2X SSC, then by 0.7X SSC at about 55°. (J. Viological Methods, 1990, vol. 30, p. 141-150); or (C) hybridizing in 1.8XHPB at about 30° to about 45°; followed by washing in 1X HPB at 23°.
- the present invention also encompasses DNA segments which are complementary, or essentially complementary, to the sequences set forth in SEQ ID NO:1 or 3 or 5 or 7 or 65 or 67.
- Nucleic acid sequences which are "complementary” are those which are capable of base-pairing according to the standard Watson-Crick complementarity rules.
- sequence 5'-ATAGCG-3' is complementary to the sequence 5'-CGCTAT- 3" because when the two sequences are aligned, each "T” is able to base-pair with an "A", which each "G” is able to base pair with a "C”.
- complementary sequences means nucleic acid sequences which are substantially complementary, as may be assessed by the nucleotide comparison set forth above, or as defined as being capable of hybridizing to the nucleic acid segment of SEQ ID NO: 1, 3, 5, 7, 65 or 67 under standard stringent, moderately stringent, or less stringent hybridizing conditions.
- the nucleic acid segments of the present invention regardless of the length of the coding sequence itself, may be combined with other DNA sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, epitope tags, polyhistidine regions, other coding segments, and the like, such that their overall length may vary considerably.
- nucleic acid fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant DNA protocol.
- this invention is not limited to the particular amino acid and nucleic acid sequences of SEQ ID NO:1 , 2, 3, 4, 5, 6, 7, 8, 9, 65, 66 or 67.
- Recombinant vectors and isolated DNA segments may therefore variously include the HAS or CS or HS coding regions themselves, coding regions bearing selected alterations or modifications in the basic coding region, or they may encode larger polypeptides which nevertheless include HAS or CS or HS coding regions or may encode biologically functional equivalent proteins or peptides which have variant amino acid sequences.
- the DNA segments of the present invention encompass DNA segments encoding biologically functional equivalent HAS or CS or HS proteins and peptides. Such sequences may arise as a consequence of codon redundancy and functional equivalency which are known to occur naturally within nucleic acid sequences and the proteins thus encoded. Alternatively, functionally equivalent proteins or peptides may be created via the application of recombinant DNA technology, in which changes in the protein structure may be engineered, based on considerations of the properties of the amino acids being exchanged.
- Changes designed by man may be introduced through the application of site-directed mutagenesis techniques, e.g., to introduce improvements to the enzyme activity or to antigenicity of the HAS or CS or HS protein or to test HAS or CS or HS mutants in order to examine HAS or CS or HS activity at the molecular level or to produce HAS or CS or HS mutants having changed or novel enzymatic activity and/or sugar substrate specificity.
- site-directed mutagenesis techniques e.g., to introduce improvements to the enzyme activity or to antigenicity of the HAS or CS or HS protein or to test HAS or CS or HS mutants in order to examine HAS or CS or HS activity at the molecular level or to produce HAS or CS or HS mutants having changed or novel enzymatic activity and/or sugar substrate specificity.
- chemical or physical treatments of polysaccharides were required to join two dissimilar materials. For example, a reactive nucleophile group of one polymer or surface was exposed to
- the control of the chemical reaction cannot be refined, and differences in temperature and level of activation often result in a distribution of several final products that vary from lot to lot preparation. For instance, several chains may be cross-linked in a few random, ill-defined areas, and the resulting sample is not homogenous.
- the use of chemical reactions to join molecules often leaves an unnatural or nonbiological residue at the junction of biomaterials. For example, the use of an amine and an activated carboxyl group would result in an amide linkage. This inappropriate residue buried in a carbohydrate may pose problems with biological systems such as the subsequent production of degradation products which accumulate to toxic levels or the triggering of an immune response.
- sugar analog that is not found in mammals in a native state, that is, a sugar analog that is produced by the hand of man.
- This sugar unit may be a component of a precursor UDP-sugar, or an acceptor, or the monosaccharide itself.
- the presently claimed and disclosed invention also includes the addition of 1 or 2 sugars, as well as the addition of 2-100 sugars.
- the four known glycosaminoglycan synthesizing enzymes from Pasteurella multocida bacteria normally make polymers similar to or identical to vertebrate polymers. These bacteria employ the polysaccharide, either HA (Type A bacteria), chondroitin (Type F bacteria), or heparosan (unsulfated, unepimerized heparin; Type D bacteria) as an extracellular coating to serve as molecular camouflage. Native enzymes normally make polymer chains of a single type of sugar repeat.
- the enzyme can be forced to work on an exogenous functional acceptor molecule.
- the recombinant enzyme may be incubated with a polymer acceptor, and the recombinant enzyme will then elongate the acceptor with UDP-sugar precursors.
- the known native enzymes do not perform this reaction since they already contain a growing polymer chain that was formed in the living cell; enzyme preparations from native cells typically retain the polymer following isolation.
- pmHAS (SEQ ID NO:2), a 972 amino acid residue protein from Pasteurella multocida, is made in a functional state in recombinant Escherichia coli.
- the pmHAS gene is given in SEQ ID NO:1.
- Other functional derivatives of pmHAS for example an enzyme called pmHAS 1 703 (SEQ ID NO:9) and the pmHAS 1 703 gene (SEQ ID NO:67), have been produced which are soluble.
- the soluble form can be prepared in larger quantities and in a purer state than the naturally occurring full-length enzyme.
- the preferred E. coli strains do not have an UDP-GIc dehydrogenase and therefore the recombinant enzyme does not make HA chain in the foreign host.
- the enzyme is in a virgin state since the empty acceptor site can be occupied with foreign polymers.
- the recombinant enzyme may be incubated in a mixture comprising from about 10 to about 5OmM Tris pH 7.2, from 0.5 to about 20 mM MnCI 2 , from about 0.1 to about 30 mM UDP-GIcUA, from about 0.1 to about 30 mM UDP-GIcNAc, and a suitable acceptor at about 20-37° for from about 1 to about 600 minutes.
- Suitable acceptors can be any functional acceptor, such as a glycosaminoglycan acceptor or sugar acceptor, for example, but not by limitation, short HA chains (two or more sugar units such as HA 4 ) or short chondroitin sulfate chains (5 sugar units) or long chondroitin sulfate chains ( ⁇ 10 2 sugar units).
- HA 4 two or more sugar units
- chondroitin sulfate chains 5 sugar units
- long chondroitin sulfate chains ⁇ 10 2 sugar units.
- pmHAS or its derivatives
- the length of the HA chain added onto the acceptor is controlled by altering the concentration of UDP-sugars (thus changing the stoichiometry of UDP-sugar to acceptor) and/or the reaction time.
- Immobilized acceptors such as beads or other solid objects with bound acceptor oligosaccharides, can also be extended by the pmHAS enzyme using UDP-sugars. In this manner, the pmHAS enzyme (or its derivatives) can be used to attach polysaccharide chains to any suitable acceptor molecule.
- Type A P. multocida produces HA capsule [GlcUA-GlcNAc repeats] and possesses the pmHAS enzyme.
- Type F P. multocida produces a chondroitin or chondroitin-like polymer capsule [GIcUA-GaINAc repeats].
- the DNA encoding an open reading frame (GenBank accession #AF195517) that is 90% identical to pmHAS at the protein level has been cloned; this enzyme is called PmCS, the P. multocida chondroitin synthase.
- the amino acid sequence of pmCS is set forth in SEQ ID NO:4 and the pmCS gene sequence is set forth in SEQ ID NO:3.
- PmCS enzyme's sequence is so similar to pmHAS, one of ordinary skill in the art, given the present specification, is able to manipulate the pmCS in the same manner as that for pmHAS and any manipulation that is successful with regard to the pmHAS would be performable with the pmCS, with the exception that chondroitin chains would be grafted instead of HA. Either HA or chondroitin chains can serve as acceptors for pmCS as both acceptors serve well for pmHAS.
- the PmHSI and PmHS2 enzymes possess some similarities to these other GAG synthases, but elongate with heparosan, a distinct polymer, when supplied with UDP-GIcNAc and UDP- GIcUA. If the enzymes are supplied with analog sugar precursors, novel unnatural GAG extensions result.
- Such hybrid polysaccharide materials composed of HA, chondroitin and/or heparin within a single polymer chain cannot be formed in a controlled fashion (targeted size and monodisperse) especially with regard to medium to large size polymers (i.e., greater than 2 to 5KDa) by any other existing process without (1) leaving unnatural residues, and/or (2) producing undesirable crosslinking reactions.
- the testicular hyaluronidase method gives a variety of small products derived from quasi-random linkage of GAGs, HA and chondroitin. Very large polymers are not major or significant products.
- the chimeric or hybrid polysaccharide materials can serve as biocompatible molecular glue for cell/cell interactions in artificial tissues or organs and the HA/chondroitin/heparin hybrid mimics natural proteoglycans that normally contain an additional protein intermediate between polymer chains.
- the present invention therefore, obviates the requirement for a protein intermediary.
- a recombinant HA/chondroitin/heparin chimeric or hybrid polysaccharide, devoid of such an intermediary protein, is desirous since molecules from animal sources are potentially immunogenic - the chimeric or hybrid polysaccharide, however, would not appear as foreign to the host, thus no immune response is generated.
- the recombinant polymers can be made free of adventitious agents (e.g., prions, viruses etc.). In addition, the molecules are not degraded by proteases.
- An intrinsic and essential feature of polysaccharide synthesis is the repetitive addition of sugar monomer units to the growing polymer.
- the glycosyltransferase remains in association with the nascent chain. This feature is particularly relevant for HA biosynthesis as the HA polysaccharide product, in all known cases, is transported out of the cell; if the polymer was released, then the HAS would not have another chance to elongate that particular molecule.
- Four possible mechanisms for maintaining the growing polymer chain at the active site of the enzyme are immediately obvious. First, the enzyme possesses a carbohydrate polymer binding pocket or cleft. Second, the nascent chain is covalently attached to the enzyme during its synthesis. Third, the enzyme binds to the nucleotide base or the lipid moiety of the precursor while the nascent polymer chain is still covalently attached. Fourth, other molecules help retain the chain.
- pmHAS In the case of pmHAS, it appears that a HA-binding site exists near or at the sugar transferase catalytic site. In general, PmCS, PmHSI and PmHS2 should have similar architectures for their substrates.
- oligosaccharides that vary in size and composition are used to discern the nature of the interaction between pmHAS and the sugar chain. For example, it appears that the putative HA-polymer binding pocket of pmHAS will bind and elongate at least an intact HA disaccharide with increased efficiency occurring when a trisaccharide is used (reduced tetramer or a synthetic trisaccharide).
- Synthetic mimics i.e., glycosides
- Oligosaccharide binding to pmHAS appears to be somewhat selective because the heparosan pentamer, which only differs in the glycosidic linkages from HA-derived oligosaccharides, does not serve as an acceptor.
- chondroitin [GIcUA-GaINAc repeat] does serve as an acceptor for pmHAS.
- Both heparin and chondroitin are synthesized by the addition of sugar units to the nonreducing end of the polymer chain.
- the glycosyltransferases initiate chain elongation on at least primer monosaccharides [more preferably tetrasaccharides such as xylose-galactose-galactose-GlcUA] that are attached to serine residues of proteoglycan core molecules.
- Recombinant pmHAS adds single monosaccharides in a sequential fashion to the nonreducing termini of the nascent HA chain; elongation of HA polymers containing hundreds of sugars has been demonstrated in vitro.
- the simultaneous formation of the disaccharide repeat unit is not necessary for generating the alternating structure of the HA molecule.
- the intrinsic specificity and fidelity of each half-reaction e.g., GIcUA added to a GIcNAc residue or vice versa
- a great technical benefit resulting from the alternating disaccharide structure of HA is that the reaction can be dissected by controlling the availability of UDP-sugar nucleotides.
- the glycosyltransferase may be stopped and started at different stages of synthesis of the heteropolysaccharide.
- the glycosyltransferase enzymes that produce important homopolysaccharides such as chitin, cellulose, starch, and glycogen. This control also is possible for a targeted synthesis of GAGs with natural and/or unnatural sugars.
- pmHAS 1"650 (SEQ. ID NO: 10) can only add single GIcNAc sugars onto the non- reducing end (i.e., HA tetrasaccharide [GlcNAc-GlcUA-GlcNAc-GlcUA]) of an acceptor (i.e., forms the HA pentamer).
- a mutant has been created and called pmHAS 1 703 -D477N (SEQ.
- Pasteurella multocida Type D a causative agent of atrophic rhinitis in swine and pasteurellosis in other domestic animals, produces an extracellular polysaccharide capsule that is a putative virulence factor. It has been reported that the capsule of Type D was removed by treating microbes with heparin lyase III.
- a 617- residue enzyme, pmHS1 (SEQ ID NOS:5 and 66), and a 651 -residue enzyme, PmHS2 (SEQ ID NO:8), which are both authentic heparosan (unsulfated, unepimerized heparin) synthase enzymes have been molecularly cloned and are presently claimed and disclosed in copending U.S. Application Serial No. 10/142,143, incorporated herein previously by reference.
- Recombinant Escherichia co//-derived pmHS1 or PmHS2 catalyzes the polymerization of the monosaccharides from UDP-GIcNAc and UDP-GIcUA. Other structurally related sugar nucleotides do not substitute.
- Synthase activity was stimulated about 7- to 25-fold by the addition of an exogenous polymer acceptor. Molecules composed of ⁇ 500 to 3,000 sugar residues were produced in vitro. The polysaccharide was sensitive to the action of heparin lyase III but resistant to hyaluronan lyase.
- the sequence of pmHS1 enzyme is not very similar to the vertebrate heparin/heparan sulfate glycosyltransferases, EXT1/2 (SEQ ID NOS:61/62), or to other Pasteurella glycosaminoglycan synthases that produce hyaluronan or chondroitin.
- pmHS1 , pmHS2, and KfiA (SEQ ID NO:59) and KfiC (SEQ ID NO:60) motifs that do exist however, between the pmHS1 , pmHS2, and KfiA (SEQ ID NO:59) and KfiC (SEQ ID NO:60) thereby leading to deduced amino acid motifs that are conserved throughout this class of GAG synthases for the production of heparin/heparosan.
- the pmHS1 and PmHS2 enzymes are the first microbial dual-action glycosyltransferase to be described that form a polysaccharide composed of ⁇ 4GlcUA- ⁇ 4GlcNAc disaccharide repeats.
- heparosan biosynthesis in E. coli K5 requires at least two separate polypeptides, KfiA and KfiC, to catalyze the same polymerization reaction.
- DcbF The gene annotated as DcbF (SEQ ID NO:58) is truncated at the carboxyl terminus in comparison to the presently claimed and described P. multocida HS clones.
- the truncated (T) or the full-length (FL) open reading frames of DcbF were cloned into the expression system pETBIue-1 vector, as described hereinabove.
- Membranes isolated from the same host strain, E. coli Tuner with the various recombinant plasmids were tested in HS assays with both radiolabeled UDP-sugars. The results of these experiments are summarized in Table III.
- PgIA P. multocida genome project
- pmHS1 cloning project in the present Applicant(s)' laboratory, investigators at the University of Minnesota published the complete genome of a Pasteurella multocida isolate.
- the fragments of the presently claimed and disclosed pmHS1 gene were utilized as the query in a BLAST search against this P. multocida genome.
- a gene annotated as pglA, but with no ascribed, predicted or demonstrated function was found to be very similar to the pmHS1 gene.
- the pglA gene is not in the main capsule locus found by either the DeAngelis or the Adler groups.
- the pglA open reading frame was obtained from two different encapsulated strains: Type A (P-1059 from a turkey - this strain is not the same as the Univ. of Minnesota strain - clones denoted as "A") and Type D (P-3881 from a cow - clones denoted as "D").
- the pmHS2 gene was amplified from chromosomal templates prepared by method of Pitcher et a/ (Letters in Applied Microbiology, 1989 which is expressly incorporated herein by reference in its entirety). PCR with Taq polymerase (18 cycles) using custom flanking oligonucleotide primers that correspond to the region of the start codon and the stop codon of pmHS2.
- Clones were streak isolated, small cultures were grown, and preparations of the plasmid DNA were made.
- the plasmids were transformed into the expression host, E. coli Tuner (Novagen), and selected on LB with carbenicillin and chloramphenicol.
- E. coli Tuner Novagen
- small cultures were grown at 30° as the starting inoculum (1 :100) for larger cultures (50 ml) for protein expression and activity assay. These cultures were grown in the same LB supplemented with 1% casein amino acids and trace element solution with vigorous shaking (250 rpm) at 30°. The cells were grown to mid-logarithmic phase (2.5 hours), induced with 0.5 mm IPTG, and grown for 4.5 hours.
- PmHS2 is a dual- action synthase capable of sugar biosynthesis as shown by functional expression of activity of one recombinant gene in a foreign host that normally does not make GlcUA/GlcNAc polymers.
- the relaxed specificity of UDP-sugar incorporation of PmHS2 should be of use for the design and production of new polymers with altered characteristics.
- Type A and Type D isolates have the PmHS2, a synthase that incorporates both GIcUA and GIcNAc sugars.
- Table V shows PmHS2 Sugar Specificity test results. The experiments summarized in Table V are similar to the experiments summarized in Table IV (with less enzyme) except that other UDP-sugars that are not normally found in heparin or heparosan were also tested (note - 60 minute incubation times, 50 ⁇ l reactions).
- the Type A and the Type D enzymes behave in a similar fashion with relaxed sugar specificity in this test.
- the PmHS2 system can add a glucose instead of a GIcNAc sugar.
- the ability to co- polymerize the sugars that compose the authentic heparin backbone were tested by performing two parallel reactions: UDP-[ 14 C]GIcUA + various combinations of 2 nd UDP-sugars.
- P. m ⁇ ltocida Type F-derived recombinant pmHS2 is thus also a heparosan synthase. As shown in the following Table VII, the Type F PmHS2 can incorporate the authentic heparin sugars.
- the pmHS2 homolog of P. multocida Type F strain P-4218 was amplified with flanking primers as described for the Type A and D strains.
- the ORF was subcloned into the pETBIue-1 system in E. coli Tuner cells for use as a source of membrane preparations as described.
- Three independent clones (F 3, 4, 18) were assayed under standard HS assay measuring radiolabeled sugar incorporation with paper chromatography.
- a negative control, membranes from "Blank" vector and a positive control, the Type D pmHS2 clone D7, were tested in parallel. Reactions plus/minus the Type D polymer acceptor were assayed.
- Type A and the Type D clones were tested for stimulation by addition of the Type D polysaccharide acceptor (described hereinbefore with respect to pmHS1). Weaker stimulation of activity by acceptor on pmHS2 was observed in comparison to pmHS1 (comparison is not shown here).
- pmHS1 is a naturally occurring fusion of two different glycosyltransferase domains.
- the pmHS1 is a dual action enzyme that alone makes heparin/heparosan polymers because both sugar transferase sites exist in one polypeptide enzyme.
- pmHS1 The amino acid sequence of the heparosan synthase, pmHS1 , however, is very different from other Pasteurella GAG synthases, pmHAS and pmCS.
- EXT1 SEQ ID NO:61
- EXT2 EXT2
- coli K5 KFi locus the PmHS2 enzyme, and the pmHS1 from Type D capsular locus, allows for the initial assessment and bioinformatic prediction of new enzymes based on the amino acid sequence data.
- Motif I corresponds to the GIcUA transferase portion of the enzyme
- Motif Il corresponds to the GIcNAc transferase portion of the enzyme. With respect to the motifs:
- X any residue parentheses enclose a subset of potential residues [separated by a slash] that may be at a particular position (e.g., - (K/R) indicates that either K or R may be found at the position - i.e., there are semiconserved residues at that position.
- the consensus X spacing is shown with the number of residues in subscript (e.g., X12-17), but there are weaker constraints on these particular residues, thus spacing may be longer or shorter. conserveed residues may be slightly different in a few places especially if a chemically similar amino acid is substituted (e.g., K for a R, or E for a D).
- pmHAS- catalyzed synthesis in vitro was unique in comparison to all other existing HA synthases of Streptococcus, bacteria, humans or an algal virus.
- recombinant pmHAS can elongate exogenously supplied functional acceptors (described herein) into longer glycosaminoglycans.
- the pmHAS synthase adds monosaccharides one at a time in a stepwise fashion to the growing chain.
- the pmHAS extraordinarily transfer specificity results in the repeating sugar backbone of the GAG chain.
- the pmCS enzyme which is 90% identical at the amino acid level to pmHAS, performs the same synthesis reactions but incorporates GaINAc instead of GIcNAc.
- the pmHS1 and PmHS2 enzymes can also add heparosan chains onto exogenous supplied functional acceptors such as long or short heparosan polymers.
- the Pasteurella GAG synthases (pmHAS, pmCS, pmHS1 and PmHS2) are very specific glycosyltransferases with respect to the sugar transfer reaction: usually only the authentic sugar is added onto acceptors.
- the epimers or closely structurally related molecules are not utilized.
- GAG synthases from Pasteurella do utilize heterologous acceptor sugars.
- pmHAS elongates short chondroitin acceptors with HA chains.
- pmHS1 adds heparosan chains onto HA acceptor oligosaccharides.
- a diverse range of hybrid of chimeric or hybrid GAG oligosaccharides can be made with the disclosed GAG synthases (i.e., pmHAS, pmCS, pmHS1 , and PmHS2).
- the chemoenzymatic methodology can be used in either a liquid- phase synthesis of soluble, free sugars or in a solid-phase synthesis to build sugars on surfaces (as disclosed hereinafter).
- chimeric or hybrid GAGS can be made using the Pasteurella GAG synthases of the presently claimed and disclosed invention.
- Table VIII synthetic di- and tri-saccharides of heparosan, and HA can be elongated.
- Naturally derived HA tetramers can also be elongated.
- the reducing end is not required to be in a free state (aglycons are not a problem), therefore, the reducing end can serve as the tether site onto a surface, drug, or other synthetic or natural molecule.
- Exemplary compounds that can be made using the Pasteurella GAGs of the presently claimed and disclosed invention include, but are not limited to:
- HA hyaluronan
- C chondroitin
- CS chondroitin sulfate
- HP heparosan or heparin like molecules.
- Type D (0.38 ⁇ g) 4400 4500 80 60 sonicated
- pm-EG and pm-IK are not dual- action enzymes and do not have either pmHAS or pmCS activities.
- pm-FH which possesses pmCS residues 1-258, is an active pmCS, although its remaining part is from pmHAS residues 266-703.
- pmHAS sequence is replaced by pmHAS sequence as in pm-JL enzyme construct (which possesses pmCS residues 1-214 at the amino-terminal and pmHAS residues 222-703 at the carboxyl-terminal)
- the enzyme is converted into a catalyst with HAS activity.
- pmHAS and pmCS are conserved among those independent strains (FIG. 1).
- site-directed mutagenesis to change a single or multiple residues in this region.
- pmHAS1-703 DNA for I243-, l243/G244/L245-containing mutants
- pmCS 1"704 DNA for Y216-, L220-, or C221- containing mutants
- pmHAS 1"221 -CS 215"258 - HAS 266 - 703 F
- p mH AS 1 - 221 -CS 215 - 258 -HAS 266"703 did not express.
- pmCS 1"214 - HAS 222 265 -CS 258"704 could transfer both GIcNAc and GaINAc with preference for UDP-GaINAc as judged by HAS assay and CS assay, supporting our conclusion that this region in pmHAS and pmCS plays a critical role in determination of sugar substrate specificity.
- pmCS 1 - 214 -HAS 222 265 -CS 258 - 704 could transfer sugars other than GIcNAc and GaINAc 1 different sugar substrates, including UDP-glucose, UDP- galactose, UDP-mannose, UDP-xylose and UDP-glucosamine (GIcN), along with isotope- labeled GIcUA and HA oligosaccharide acceptor, were included when performing the polymerization assay.
- UDP-glucose UDP- galactose
- UDP-mannose UDP-mannose
- UDP-xylose UDP-glucosamine
- GIcN isotope- labeled GIcUA and HA oligosaccharide acceptor
- pmCS 1 - 214 -HAS 222 - 265 -CS 258"704 will use UDP-GIcNAc, UDP-GaINAc, or UDP-glucosamine Table IX.
- the possibility that the chimeric or hybrid enzyme could synthesize hybrid polymers with a blend of HA- and chondroitin-like sugars was also exploited. Reactions containing 3 H-UDP-GaINAc, 14 C-UDP-GIcNAc, UDP-GIcUA and HA acceptor were performed.
- PmHAS and PmCS each contain two separate glycosyltransferase sites (Jing and DeAngelis, 2003). Thus the novel "one polypeptide, two active sites" theory has been confirmed. A 44-residue region of the enzymes has been demonstrated to be critical for sugar-transfer specificity. Based on this discovery, an enzyme that can transfer GaINAc, GIcN, and GIcNAc has been engineered.
- Standard polymerization assays were performed in the presence of isotope- labeled GIcUA, HA oligosaccharide acceptor, and one of the following sugar substrates.
- the sugar incorporation was indicated as the percentage of the incorporation of UDP-GaINAc.
- PmCS 1 214 -HAS 222 265 -CS 258"704 can transfer GaINAc, GIcNAc, and Glucosamine.
- Type A Pasteurella multocida produces a hyaluronan [HA] capsule to enhance infection.
- the 972-residue hyaluronan synthase, pmHAS polymerizes the linear HA polysaccharide chain composed of GIcNAc and GIcUA.
- PmHAS possesses two separate glycosyltransferase sites. Protein truncation studies demonstrated that residues 1-117 can be deleted without affecting catalytic activity. The carboxyl-terminal boundary of the GIcUA- transferase resides within residues 686-703. Both sites contain a DXD motif. All four aspartate residues are essential for HA synthase activity.
- Type F P. multocida synthesizes an unsulfated chondroitin GaINAc and GIcUA capsule. Domain swapping between pmHAS and the homologous chondroitin synthase, pmCS, was performed. A chimeric or hybrid enzyme consisting of residues 1-427 of pmHAS and residues 421-704 of pmCS was an active HA synthase. On the other hand, the converse chimeric or hybrid enzyme consisting of residues 1-420 of pmCS and residues 428-703 of pmHAS was an active chondroitin synthase. Overall, these findings support the model of two independent transferase sites within a single polypeptide as well as further delineate the site boundaries.
- pmHAS utilizes two separate glycosyltransferase sites to catalyze the transfer of GIcNAc and GIcUA to form the HA polymer.
- pmHAS sequence there is a pair of duplicated domains which are similar to the "Domain A" proposed by Saxena.
- Both domains of pmHAS possess a short sequence motif containing DGS that is conserved among many ⁇ -glycosyltransferases. Changing the aspartate in either motif to asparagines, glutamate, or lysine significantly reduced or eliminated the HAS activity.
- the D196 mutants and the D477 mutants maintain high level of GlcUA-transferase and GIcNAc- transferase activity, respectively.
- pmCS contains 965 amino acid residues and is about 90% identical to pmHAS.
- a soluble recombinant Escherichia co//-derived pmCS 1"704 catalyzes the repetitive addition of sugars from UDP-GaINAc and UDP-GIcUA to chondroitin oligosaccharide acceptors in vitro.
- various recombinant truncated polypeptides were produced (pmHAS 46"703 , pmHAS 72'703 , pmHAS 96"703 and pmHAS 118"703 ) in E. coli.
- pmHAS 1"650 loses its GlcUA-transferase activity.
- pmHAS 1" 668 and pmHAS 1"686 were created. Both mutants also could not polymerize HA due to the loss of GlcUA-transferase activity, indicating that the carboxyl-terminal boundary of the GlcUA- transferase resides between residues 686 and 703.
- HA hyaluronan
- the size of the hyaluronan [HA] polysaccharide dictates its biological effect in many cellular and tissue systems based on many reports in the literature.
- no source of very defined, uniform HA polymers with sizes greater than 2 to 5 kDa is currently available. This situation is complicated by the observation that long and short HA polymers appear to have antagonistic or inverse effects on some biological systems. Therefore, HA preparations containing a mixture of both size populations may yield contradictory or paradoxical results.
- One embodiment of the novel method of the present invention produces HA with very narrow, monodisperse size distributions that are referred to herein as
- PmHAS The Pasteurella bacterial HA synthase enzyme, PmHAS, catalyzes the synthesis of HA polymers utilizing monosaccharides from UDP-sugar precursors in vivo and in vitro. PmHAS will also elongate exogenously supplied HA oligosaccharide acceptors in vitro; in fact, HA oligosaccharides substantially boost the overall incorporation rate.
- a purified recombinant, PmHAS derivative was employed herein to produce either native composition HA or derivatized HA. The same general behavior was exhibited by PmCS and PmHSI and PmHS2; the presence of acceptors stimulated polymerization.
- HA polymers of a desired size were constructed by controlling stoichiometry (i.e., ratio of precursors and acceptor molecules). The polymerization process is synchronized in the presence of acceptor, thus all polymer products are very similar. In contrast, without the use of an acceptor, the polymer products are polydisperse in size.
- stoichiometrically controlled synchronized synthesis reactions yielded a variety of HA preparations in the range of -15 kDa to about 1.5 MDa.
- Each specific size class had a polydispersity value in the range of 1.01 for polymers up to 0.5 MDa or ⁇ 1.2 for polymers of ⁇ 1.5 MDa (1 is the ideal monodisperse size distribution) as assessed by size exclusion chromatography/multi-angle laser light scattering analysis.
- the selectHA preparations migrate on electrophoretic gels (agarose or polyacrylamide) as very tight bands.
- PmCS and PmHSI will produce defined monodisperse polymers in reactions with acceptor.
- a modified acceptor allows the synthesis of selectHA polymers containing radioactive (e.g., 3H, 1251), fluorescent (e.g., fluorescein, rhodamine), detection (i.e., NMR or X-ray), affinity (e.g., biotin) or medicant tags.
- radioactive e.g., 3H, 1251
- fluorescent e.g., fluorescein, rhodamine
- detection i.e., NMR or X-ray
- affinity e.g., biotin
- medicant tags e.g., each molecule has a single detection agent located at the reducing terminus.
- radioactive UDP-sugar precursors allows the synthesis of uniformly labeled selectHA polymers with very high specific activities.
- the selectHA reagents should assist in the elucidation of the numerous roles of HA in health and disease due to their monodisperse size distributions and defined compositions. It must be emphasized that unpredicted kinetic properties of the Pasteurella GAG synthases in a recombinant virgin state in the presence of defined, unnatural reaction conditions facilitates targeted size range production of monodisperse polymers that are not synthesizable by previously reported methods.
- HA polymerization reactions were performed with purified pmHAS and UDP-sugar precursors under various conditions, and the reaction products were analyzed by agarose gel or acrylamide gel electrophoresis. The size distribution of HA products obtained were observed to be quite different based on the presence or absence of the HA4 acceptor in the reaction (Jing and DeAngelis, 2004). When 30 mM of UDP-sugars were present as well as 0.03 ug/ul of HA4, pmHAS synthesized smaller chains with a narrow size distribution.
- Mn determined by MALLS is 551.5kDa and its polydispersity (Mw/Mn) is 1.006 (Jing and DeAngelis, 2004). However, without HA4, pmHAS synthesized a more polydisperse product with the same amount of precursor sugars.
- Mn determined by MALLS is 1.53 MDa and its polydispersity (Mw/Mn) is 1.169.
- the synthase enzyme will preferentially add available UDP-sugar precursors to the acceptor termini. If there are many acceptors, thus many termini, then a limited amount of UDP-sugars will be distributed among many molecules and thus result in many short polymer chain extensions. Conversely, if there are few acceptors, thus few termini, then the limited amount of UDP-sugars will be distributed among few molecules and thus result in a few long polymer chain extensions (modeled in FIG. 6). It has previously been observed that chain initiation is the rate-limiting step for pmHAS, and the enzyme prefers to transfer sugars onto existing HA chains when acceptor is included in the reaction.
- HA4 should affect the final size of the HA product when the same amount of UDP-sugar is present.
- assays were performed with various levels of HA4 with fixed amount of UDP- sugar and pmHAS (Fig. 8A).
- HA polymer sizes were determined by size exclusion chromatography - Multi Angle Laser Light Scattering (SEC-MALLS, Fig. 8B).
- SEC-MALLS Size exclusion chromatography - Multi Angle Laser Light Scattering
- Fig. 8B Using the same strategy HA was generated from 27 kDa to 1.3 MDa with polydispersity ranging from 1.001 to 1.2.
- Fig. 8 demonstrates the monodispersity of the various HA polymers resulting from reaction synchronization. This range has been extended from 5 kDa to ⁇ 2.5 MDa.
- HA polymers can be used as starting acceptor for pmHAS; the enzyme will elongate existing chains with more sugars.
- the enzyme will elongate existing chains with more sugars.
- 575 kDa HA and 970 kDa HA small in vitro with pmHAS and HA4 as acceptor, using the previously described methods
- a commercially available HA sample ⁇ 2 MDa; Genzyme
- the ⁇ 2 MDa starting material in lane 11 was elongated to produce the larger (i.e., slower migrating) material in lane 10. Therefore, a method for creating higher value longer polymers is also described by the present invention.
- the length of the final product can be controlled stoichiometrically as shown in lanes 7-9; a lower starting acceptor concentration (lane 7) results in longer chains because the same limited amount of UDP-sugars is consumed, making a few long chains instead of many shorter chains (lane 9).
- PmHSI similarly can elongate longer polymer acceptors; for example, a ⁇ 50 kDa polymer served as an acceptor (Kane et al., 2006).
- HA as small as 10 kDa can be generated with polydispersity around 1.001.
- High molecular HAs are commercially available from animal or bacterial sources. Problems with those include possible contaminants leading to immunological responses as well as broad size distribution (Soltes etc., 2002). Polydispersities (Mw/Mn) are commonly higher than 1.5. Conclusions drawing from experimental data during biological research with these HA could be misleading. Thus there exists a need for uniform HA to perform biological study, as agreed by Uebelhart and Williams (1999).
- the unique technologies of the present invention allow the generation of a variety of defined, monodisperse HA tools for elucidating the numerous roles of HA in health and disease due to their monodisperse size distributions and defined compositions.
- the relaxed acceptor specificity of pmHAS allows the use of various chondroitin acceptors. This allows the production of monodisperse hybrid GAGs that have utility in medicine including tissue engineering and surgical aids.
- new protein-free proteoglycans are now possible that do not have antigenicity or allergenicity concerns compared to animal-derived products.
- chondroitin sulfate HA hybrid GAGs are created by elongating a variety of chondroitin sulfates (A, B, and C) with pmHAS, thus adding HA chains.
- Various amounts of HA were added to the preparations (at various times during reaction as noted) by adding more UDP-sugars.
- lanes 3-6 show hybrids with a constant amount of chondroitin sulfate and increasing HA chain lengths.
- the starting chondroitin sulfates stain weakly here, and the band position is marked with an arrow. Without the acceptor (lanes 23-26), no such defined bands are seen; after a long period, some HA polymer shows up (lane 26) which results from de novo initiation without acceptor.
- chondroitin sulfate A was elongated with pmHAS, thus adding HA chains.
- Various amounts of HA were added to the preparations by controlling the level of chondroitin acceptor (thus changing the UDP-sugar/acceptor ratio) as well as adding more UDP-sugars during the reaction. By changing the UDP-sugar/acceptor ratio, stoichiometric control of the hybrid GAG size was demonstrated.
- a chondroitin synthase such as but not limited to pmCS can be used to elongate an existing chondroitin sulfate polymer or HA polymer to produce defined hybrid GAG molecules of various structures. Again, these molecules may have use as surgical aids or tissue engineering scaffolds.
- pmCS and UDP-GIcUA UDP-GaINAc were reacted with either a 81 kDa HA acceptor (migration position marked with arrow; lanes 3-7) or no acceptor (lanes 9- 13).
- FIG. 15A Size exclusion (or gel filtration) chromatography analysis coupled with multi-angle laser light scattering detection confirms the monodisperse nature of polymers created by the present invention.
- HA starting MW 81 kDa
- pmCS methoxycellulose
- lane #7 overnight [O/N] extension
- the material was 280,000 Mw and polydispersity (Mw/Mn) was 1.003 +/- 0.024.
- Chondroitin sulfate HA extended with HA chains using pmHAS (same sample used in Fig. 12, lane #23) was analyzed and shown in FIG. 15B; the material was 427,000 Mw and polydispersity (Mw/Mn) was 1.006 +/- 0.024.
- FIG. 16 a 0.7% agarose gel detected with Stains-all compares the monodisperse, 'select HA 1 to commercially produce HA samples is shown.
- lanes 1-3 the mixture of various monodisperse HAs made by the present invention (separate reaction products that were recombined to run all in one lane; sizes from top to bottom of lane: 1.27 MDa, 946 kDa, 575 kDa, 284 kDa, 27 kDa) run as discrete, tight bands.
- the maltose binding protein/heparosan synthase fusion constructs (Sismey- Ragatz et al., 2007) had greatly increased protein expression in comparison to the earlier generation thioredoxin PmHSI fusion construct (Kane et al., 2006).
- the MBP also allowed for efficient purification as depicted in FIG. 17; in contrast, the thioredoxin affinity handle was observed to leach substantial amounts of target protein thus thwarting purification attempts (data not shown).
- both MBP-PmHS constructs possessed increased stability at useful reaction temperatures (e.g., active at pH 7.2 at 3O 0 C for 24 hrs).
- PmHS2 based on expected amino acid side-chain pKg values it may be likely that one or more histidine residues in PmHS2 (but not present in PmHSI) is protonated at the lower pH, thus gaining a positive charge, making a better contact or providing improved electrostatic steering for a negatively charged substrate (either a heparosan oligosaccharide or a UDP-sugar).
- a negatively charged substrate either a heparosan oligosaccharide or a UDP-sugar.
- glutamate or aspartate residues in PmHS2 but not PmHSI are protonated at lower pH, thus neutralized, reducing potential electrostatic repulsion of a negatively charged substrate.
- acceptor oligosaccharide preferred by each of the synthases was also examined.
- the heparosan tetrasaccharide was about -150-fold and ⁇ 8-fold better than the corresponding disaccharide for PmHSI or for PmHS2, respectively.
- the synthetic glycoside, AFA was also a useful acceptor for PmHSI and PmHS2.
- PmHSI catalyzes the synthesis of higher molecular weight monodisperse polymer when compared to PmHS2 due to its better ability to utilize and rapidly elongate exogenously supplied acceptors.
- PmHSI produced various sizes of monodisperse high molecular weight heparosan ( ⁇ 70% average yield based on starting UDP-sugars) while under identical conditions PmHS2 did not.
- Such monodisperse heparosan polymer may serve as the starting material for the creation of defined molecules that are more predictable with respect to biological responses and potency.
- this pocket must have limited dimensions because UDP-GlcNBut, a molecule with two more additional methylene units than the authentic donor, is a worse substrate.
- Other hydrophobic moieties with different structures are expected to serve as donors as well.
- a hydrophobic pocket on glycosaminoglycan binding proteins or receptors such as the HA-binding site of TSG-6 (Blundell et al., 2005) may bind with higher affinity to polymers containing hexosamines with longer acyl chains, thus new sugar ligand derivatives with more potent inhibition or signaling effects may be possible.
- TABLE X Donor Substrate Usage by PmHSI and by PmHS2.
- Each UDP-sugar analog was tested for its ability to substitute for UDP-GIcNAc or UDP- GIcUA by radiolabeled sugar polymerization assays and paper chromatography.
- An authentic UDP-sugar and the appropriate second UDP-sugar analog e.g., UDP-GIcUA and a potential UDP-GIcNAc substitute
- the GlcUA-transferase site of PmHS2, but not PmHSI is tolerant of extra chemical groups at the C2 or C3 positions (Table X).
- the UDP-GlcNAcUA analog possesses within a single pyranose unit both the C6 carboxylate and the C2 acetylated amide groups (normally found separately on two adjacent pyranose units in native heparosan). It was observed that the PmHS2 enzyme only utilizes this analog to substitute for the uronic acid unit of the disaccharide repeat, and not the hexosamine (Table X).
- PmHS2 The relaxed specificity of PmHS2 could be due to different active site geometry or different surrounding residues than PmHSI , which facilitates the favorable binding interactions and/or avoids certain hindrances (e.g., steric, electrostatic) with the analogs.
- hindrances e.g., steric, electrostatic
- model Il may be more likely. More DNA sequence information from other isolates and species may be required to establish whether PmHSI or PmHS2 was the primordial enzyme. Pathogenic bacteria are under extreme selective pressure from host defenses thus the potential to alter capsule composition and maintain virulence is a valuable asset.
- PmHS2 The promiscuity of PmHS2 makes it a useful catalyst for preparing glycosaminoglycan polymer analogs with new biological or chemical properties.
- unnatural polymers containing the GIcNAcUA monomer are not digested by heparin lyase III, an enzyme known to digest most other heparinoids (FIG. 21).
- similar heparinoids may have a slower turnover rate potentially making it a longer acting therapeutic.
- These new polymers should also prove to be very useful in the pursuit of understanding the structure/function relationships of the polymer and the interaction of heparinoids with various binding proteins including receptors, growth factors, and coagulation factors.
- GAGs mediate many of their biological effects via interactions with proteins.
- the binding properties and the sensitivity to degradation enzymes of the unnatural GIcN[TFA] polymer in comparison to the natural HA polymer were tested.
- One of the major HA binding proteins is CD44, a glycoprotein expressed on most cell surfaces and facilitates many signaling events as well as the cellular intake of HA. Only a portion of the CD44 protein (residues 1-199) was used in this study; this domain contains the link module which facilitates HA binding.
- HABP or aggrecan also specifically binds to HA and is a huge proteoglycan complex found in cartilage.
- Aggrecan is composed of three gobular domains and two extended regions, but in this assay, only the link module in the gobular 1 domain (HA binding region) was tested for binding.
- ELISA binding assays indicated that the GIcN[TFA] polymer binds at least 100-fold more weakly to both HA binding proteins, HABP and CD44, compared to HA polymer of similar size. Unlike PmHAS, which will bind and extend a GIcN[TFA] polymer, these HA binding proteins will not tolerate a TFA group at the C-2 position.
- the deprotected amine can hypothetical ⁇ be conjugated very effectively with any amine-reactive moiety or chemically cross linked to form a gel (FIG. 25). Furthermore, the amino group is the natural target for the N-sulfation enzyme, which will help to facilitate the bioenzymatic production of heparin.
- GAGs There are a multitude of roles for GAGs in the body. Some cellular or molecular systems will recognize and/or metabolize the GAG-analogs in a different fashion than the natural sugars or other related analogs; this avenue allows targeting or selectivity in a therapeutic treatment.
- Biomaterials also play a pivotal role in the field of tissue engineering.
- Biomimetic synthetic polymers have been created to elicit specific cellular functions and to direct cell-cell interactions both in implants that are initially cell-free, which may serve as matrices to conduct tissue regeneration, and in implants to support cell transplantation.
- Biomimetic approaches have been based on polymers endowed with bioadhesive receptor-binding peptides and mono- and oligosaccharides. These materials have been patterned in two- and three-dimensions to generate model multicellular tissue architectures, and this approach may be useful in future efforts to generate complex organizations of multiple cell types.
- Natural polymers have also played an important role in these efforts, and recombinant polymers that combine the beneficial aspects of natural polymers with many of the desirable features of synthetic polymers have been designed and produced.
- Biomaterials have been employed to conduct and accelerate otherwise naturally occurring phenomena, such as tissue regeneration in wound healing in the otherwise healthy subject; to induce cellular responses that might not be normally present, such as healing in a diseased subject or the generation of a new vascular bed to receive a subsequent cell transplant; and to block natural phenomena, such as the immune rejection of cell transplants from other species or the transmission of growth factor signals that stimulate scar formation.
- BBDS bioadhesive drug delivery systems
- bioadhesive controlled drug delivery is to localize a delivery device within the body to enhance the drug absorption process in a site-specific manner. Bioadhesion is affected by the synergistic action of the biological environment, the properties of the polymeric controlled release device, and the presence of the drug itself. The delivery site and the device design are dictated by the drug's molecular structure and its pharmacological behavior.
- one embodiment of the present invention is the use of sutures or bandages with heparosan-chains grafted on the surface or throughout the material in combination with the fibrinogen glue.
- the immobilized heparosan does not diffuse away as in current formulations, but rather remains at the wound site.
- Bioadhesive lattices of water-swollen poly(acrylic acid) nano-and microparticles have been synthesized using an inverse (W/O) emulsion polymerization method. They are stabilized by a co-emulsifier system consisting of SPANTM 80 and TWEEN TM 80 dispersed in aliphatic hydrocarbons.
- the initial polymerization medium contains emulsion droplets and inverse micelles which solubilize a part of the monomer solution.
- the polymerization is then initiated by free radicals, and particle dispersions with a narrow size distribution are obtained. The particle size is dependent on the type of radical initiator used.
- microparticles are obtained in the size range of 1 to 10 micrometer, indicating that these microparticles originate from the emulsion droplets since the droplet sizes of the W/O emulsion show similar distribution.
- lipophilic radical initiators such as azobis-isobutyronitrile
- nanoparticles are generated with diameters in the range of 80 to 150 nm, due to the limited solubility of oligomeric poly(acrylic acid) chains in the lipophilic continuous phase.
- These poly(acrylic acid) micro- and nanoparticles yielded excellent bioadhesive properties in an in-vitro assay and may, therefore, be suitable for the encapsulation of peptides and other hydrophilic drugs.
- HA heparosan or chondroitin chains
- poly(acrylic-acid) based materials These GAGs are negatively- charged polymers as is poly(acrylic-acid), but glycosaminoglycans are naturally occurring molecules in the vertebrate body and would not invoke an immune response like a poly(acrylic-acid) material.
- mucoadhesive polymers poly(acrylic acid)
- proteolytic enzymes a group consisting of pyruvate, pyruvate, pyruvate, pyruvate, pyruvate, pyruvate, pyruvate, pyruvate, pyruvate, pyruvate, pyruvate, pyruvate, pyruvate, pyruvate, hematomadhesive grafthelial cells.
- mucoadhesive polymers may therefore be considered as a novel class of multifunctional macromolecules with a number of desirable properties for their use as biologically active drug delivery adjuvants.
- bioadhesion probably may be better achieved using specific bioadhesive molecules. Ideally, these bind to surface structures of the epithelial cells themselves rather than to mucus by receptor-ligand-like interactions. Such compounds possibly can be found in the future among plant lectins, novel synthetic polymers, and bacterial or viral adhesion/invasion factors. Apart from the plain fixation of drug carriers within the Gl lumen, direct bioadhesive contact to the apical cell membrane possibly can be used to induce active transport processes by membrane-derived vesicles (endo- and transcytosis).
- bioadhesives/mucoadhesives in drug delivery to the gastrointestinal tract include: bioadhesives/mucoadhesives in drug delivery to the gastrointestinal tract; nanoparticles as a gastroadhesive drug delivery system; mucoadhesive buccal patches for peptide delivery; bioadhesive dosage forms for buccal/gingival administration; semisolid dosage forms as buccal bioadhesives; bioadhesive dosage forms for nasal administration; ocular bioadhesive delivery systems; nanoparticles as bioadhesive ocular drug delivery systems; and bioadhesive dosage forms for vaginal and intrauterine applications.
- the bioadhesive may also contain liposomes.
- Liposomes are unilamellar or multilamellar lipid vesicles which entrap a significant fraction of aqueous solution.
- the vesicular microreservoirs of liposomes can contain a variety of water-soluble materials, which are thus suspended within the emulsion.
- the preparation of liposomes and the variety of uses of liposomes in biological systems has been disclosed in U.S. Patent Nos. 4,708,861 ; 4,224,179; and 4,235,871.
- Liposomes are generally formed by mixing long chain carboxylic acids, amines, and cholesterol, as well as phospholipids, in aqueous buffers.
- liposomes spontaneously form multilamellar bilayer structures called liposomes. Depending on their composition and storage conditions, liposomes exhibit varying stabilities. Liposomes serve as models of cell membranes and also are used as drug delivery systems. [00229] Most attempts to use liposomes as drug delivery vehicles have envisioned liposomes as entities which circulate in blood, to be taken up by certain cells or tissues in which their degradation would slowly release their internal aqueous drug-containing contents. In an effort to aid in their up-take by a given target tissue, some liposomes have been Atailored@ by binding specific antibodies or antigens to the outer surface. Liposomes have also been devised as controlled release systems for the delivery of their contents in vivo.
- compositions in which liposomes containing biologically active agents are maintained and immobilized in polymer matrices, such as methylcellulose, collagen and agarose, for sustained release of the liposome contents are described in U.S. Patent No. 4,708,861 toffy et al.
- the present invention contemplates a bioadhesive comprising HA or chondroitin or heparin produced from pmHAS, pmCS, pmHS1 , or PmHS2.
- the present invention also contemplates a composition containing a bioadhesive comprising HA or chondroitin or heparin produced from pmHAS, pmCS, pmHS1 , or PmHS2 and an effective amount of a medicament, wherein the medicament can be entrapped or grafted directly within the HA or chondroitin or heparin bioadhesive or be suspended within a liposome which is entrapped or grafted within the HA or chondroitin or heparin bioadhesive.
- compositions are especially suited to the controlled release of medicaments.
- Such compositions are useful on the tissues, skin, and mucus membranes (mucosa) of an animal body, such as that of a human, to which the compositions adhere.
- the compositions so adhered to the mucosa, skin, or other tissue slowly release the treating agent to the contacted body area for relatively long periods of time, and cause the treating agent to be sorbed (absorbed or adsorbed) at least at the vicinity of the contacted body area.
- Such time periods are longer than the time of release for a similar composition that does not include the HA bioadhesive.
- the treating agents useful herein are selected generally from the classes of medicinal agents and cosmetic agents. Substantially any agent of these two classes of materials that is a solid at ambient temperatures may be used in a composition or method of the present invention. Treating agents that are liquid at ambient temperatures, e.g., nitroglycerine, can be used in a composition of this invention, but are not preferred because of the difficulties presented in their formulation.
- the treating agent may be used singly or as a mixture of two or more such agents.
- One or more adjuvants may also be included with a treating agent, and when so used, an adjuvant is included in the meaning of the phrase treating agent or medicament.
- exemplary of useful adjuvants are chelating agents such as EDTA that bind calcium ions and assist in passage of medicinal agents through the mucosa and into the blood stream.
- chelating agents such as EDTA that bind calcium ions and assist in passage of medicinal agents through the mucosa and into the blood stream.
- Another illustrative group of adjuvants are the quaternary nitrogen-containing compounds such as benzalkonium chloride that also assist medicinal agents in passing through the mucosa and into the blood stream.
- the treating agent is present in the compositions of this invention in an amount that is sufficient to prevent, cure and/or treat a condition for a desired period of time for which the composition of this invention is to be administered, and such an amount is referred herein as an effective amount.
- effective amounts of medicinal agents vary with the particular agent involved, the condition being treated and the rate at which the composition containing the medicinal agent is eliminated from the body, as well as varying with the animal in which it is being used, and the body weight of that animal. Consequently, effective amounts of treating agents may not be defined for each agent.
- an effective amount is that amount which in a composition of this invention provides a sufficient amount of the treating agent to provide the requisite activity of treating agent in or on the body of the treated animal for the desired period of time, and is typically less than that amount usually used.
- amounts of particular treating agents in the blood stream that are suitable for treating particular conditions are generally known, as are suitable amounts of treating agents used in cosmetics, it is a relatively easy laboratory task to formulate a series of controlled release compositions of this invention containing a range of such treating agent for a particular composition of this invention.
- the second principle ingredient of this embodiment of the present invention is a bioadhesive comprising an amount of hyaluronic acid (HA) from pmHAS or chondroitin from PmCS or heparin from pmHS1 or PmHS2.
- HA hyaluronic acid
- the various glycosaminoglycans produced by the methods of the present invention are promising materials for incorporation, either directly or indirectly, into a scaffold for cell growth and implantation.
- the polymers may be attached to surfaces or devices via acceptor moiety or a direct chain interaction.
- tissue-engineered skin is a significant advance in the field of wound healing and was developed due to limitations associated with the use of autografts. These limitations include the creation of a donor site which is at risk of developing pain, scarring, infection and/or slow healing. A number of products are commercially available and many others are in development.
- Cultured epidermal autografts can provide permanent coverage of large area from a skin biopsy. However, 3 weeks are needed for graft cultivation. Cultured epidermal allografts are available immediately and no biopsy is necessary. They can be cryopreserved and banked, but are not currently commercially available.
- a nonliving allogeneic acellular dermal matrix with intact basement membrane complex (Alloderm) is immunologically inert. It prepares the wound bed for grafting allowing improved cultured allograft 'take' and provides an intact basement membrane.
- a nonliving extracellular matrix of collagen and chondroitin-6-sulfate with silicone backing (Integra) serves to generate neodermis.
- a collagen and glycosaminoglycan dermal matrix inoculated with autologous fibroblasts and keratinocytes has been investigated but is not commercially available. It requires 3 to 4 weeks for cultivation. Dermagraft consists of living allogeneic dermal fibroblasts grown on degradable scaffold. It has good resistance to tearing.
- Apligraf An extracellular matrix generated by allogeneic human dermal fibroblasts (TransCyte) serves as a matrix for neodermis generation.
- Apligraf is a living allogeneic bilayered construct containing keratinocytes, fibroblasts and bovine type I collagen. It can be used on an outpatient basis and avoids the need for a donor site wound.
- Another living skin equivalent, composite cultured skin (OrCeI) consists of allogeneic fibroblasts and keratinocytes seeded on opposite sides of bilayered matrix of bovine collagen. There are limited clinical data available for this product, but large clinical trials are ongoing.
- the various glycosaminoglycans produced by the methods of the present invention are promising components for tissue engineered organs including skin.
- HSPGs heparan sulfate proteoglycans
- ECM extracellular matrix
- the basic HSPG structure consists of a protein core to which several linear heparan sulfate (HS) chains are covalently attached.
- the polysaccharide chains are typically composed of repeating hexuronic and D- glucosamine disaccharide units that are substituted to a varying extent with N- and O-linked sulfate moieties and N-linked acetyl groups.
- HS is involved in basic FGF (bFGF) receptor binding and mitogenic activity and its modulation by species of heparin, HS, and synthetic polyanionic 'heparin-mimicking' compounds.
- bFGF basic FGF
- the results are discussed in relation to the current thoughts on the dual involvement of low and high affinity receptor sites in the growth promoting and angiogenic activities of bFGF and other heparin-binding growth factors.
- the mimetics based on the various glycosaminoglycans produced by the methods of the present invention, including the hybrid or chimeric polymers, are promising due to their inherent abilities to interact, trigger, or bind a variety of molecules including cytokines, receptors, and growth factors. These GAG molecules should thus serve as modulators of cell behavior and/or growth via numerous natural pathways in mammals and humans.
- endothelial cell-matrix interactions are further supported by several ongoing clinical trials that analyze the effects of drugs blocking this interaction on angiogenesis-dependent growth of human tumors.
- the mimetics based on various glycosaminoglycans produced by the methods of the present invention, including the hybrid or chimeric polymers, are promising due to their inherent abilities to intearct, trigger, or bind a variety of molecules including cytokines, receptors, and growth factors. These molecules should thus serve as modulators of cell behavior and/or growth.
- glypicans are a family of heparan sulfate proteoglycans that are bound to the cell surface by a glycosyl-phosphatidylinositol anchor. Six members of this family have been identified in mammals. In general, glypicans are highly expressed during development, and their expression pattern suggests that they are involved in morphogenesis. One member of this family, glypican-3, is mutated in the Simpson-Golabi- Behmel syndrome. This syndrome is characterized by overgrowth and various developmental abnormalities that indicate that glypican-3 inhibits proliferation and cell survival in the embryo. It has consequently been proposed that glypicans can regulate the activity of several growth factors that play a critical role in morphogenesis. Defined heparosan derivatives could be used to modulate such activities.
- the various glycosaminoglycans produced by the methods of the present invention, especially the hybrid or chimeric polymers, are promising materials for incorporation, either directly or indirectly, onto cell surfaces.
- the polymers may be attached to cell surfaces or devices via acceptor moiety (for example, but not by way of limitation, a lipid conjugate).
- the monodisperse heparosan of the present invention is also a starting material for sulfated heparin-based anticoagulants, antivirals, proliferation modulators, etc. Size defined molecules as well as analogs should allow a multitude of therapeutics to be created with potential for enhanced activity and better control.
- Uronic acid was quantitated by the carbazole method.
- the latter enzyme employs an elimination mechanism to cleave the chain resulting in an unsaturated GIcUA residue at the nonreducing terminus of each fragment.
- some preparations were subjected to gel filtration with P-2 resin (BioRad) in 0.2 M ammonium formate and lyophilization.
- HA oligosaccharides were verified by matrix-assisted laser desorption ionization time-of-flight mass spectrometry.
- Sugars in water were mixed with an equal volume of 5 mg/ml 6-azo-2-thiothymine in 50% acetonitrile/0.1% trifluoroacetic acid, and rapidly air-dried on the target plate.
- the negative ions produced by pulsed nitrogen laser irradiation were analyzed in linear mode (20 kV acceleration; Perceptive Voyager).
- Other oligosaccharides that are structurally similar to HA were also tested in HAS assays. The structure of heparosan pentamer derived from the E.
- coli K5 capsular polysaccharide is ⁇ 4GlcUA- ⁇ 4GlcNAc; this carbohydrate has the same composition as HA but the glycosidic linkages between the monosaccharides are different.
- the chitin-derived oligosaccharides, chitotetraose and chitopentaose are ⁇ 4GlcNAc polymers made of 4 or 5 monosaccharides, respectively.
- oligosaccharides were radiolabeled by reduction with 4 to 6 equivalents of sodium borotritide (20 mM, NEN; 0.2 ⁇ Ci/mmol) in 15 mM NaOH at 3OC for 2 hrs. 3 H- oligosaccharides were desalted on a P-2 column in 0.2 M ammonium formate to remove unincorporated tritium and lyophilized. Some labeled oligosaccharides were further purified preparatively by paper chromatography with Whatman 1 developed in pyridine/ethyl acetate/acetic acid/H 2 O (5:5:1:3) before use as an acceptor.
- the size of GAG polymers was analyzed by chromatography on a Phenomenex PolySep-GFC-P 3000, P 4000 or P5000 column (300x7.8 mm) eluted with 0.2 M sodium nitrate at 0.6 ml/min on a Waters 600E system.
- the column was standardized with various size fluorescent dextrans (580, 50, and 12 kDa). Radioactive components were detected with a LB508 Radioflow Detector (EG & G Berthold) and Zinsser cocktail (1.8 ml/min).
- these 3 minute reactions contained twice the UDP-sugar concentrations, 0.06 ⁇ Ci UDP-[ 14 C]GIcUA, and 0.25 ⁇ g even-numbered GAG oligosaccharide. Also, addition of ethylenediamine tetracetic acid (final cone. 22 mM) and boiling (2 min) was employed to terminate the reactions instead of addition of SDS.
- a lambda library of Sau3A partially digested Type F P. multocida P-4679 DNA was made using the BamHI-cleaved Zap Express vector system (Stratagene).
- the plaque lifts were screened by hybridization (5x SSC, 50 0 C; 16 hrs) with the digoxigenin-labeled probe using the manufacturer guidelines for colorimetric development.
- E. coli XLI-Blue MRF was co-infected with the purified, individual positive lambda clones and ExAssist helper phage to yield phagemids. The resulting phagemids were transfected into E. coli XLOLR cells to recover the plasmids.
- pmCS Novel open reading frame
- pmHAS DNA sequence facilities at Oklahoma State University and University of Oklahoma HSC.
- pmHS1 DNA sequence facilities at Oklahoma State University and University of Oklahoma HSC.
- the ORF was amplified and sequenced from several highly encapsulated isolates (see hereinbelow); very similar sequences were obtained.
- pmCS ORF a portion of the pmCS ORF (residues 1-704) in the insert of one of the excised lambda clones, pPmF4A, was amplified by 20 cycles of PCR with Taq polymerase.
- the sense primer corresponded to the sequence at the deduced amino terminus of the ORF and the antisense primer encoded the new carboxyl terminus followed by an artificial stop codon.
- the resulting PCR product was purified and concentrated using GeneClean.
- This insert was cloned using the pETBIue-1 Acceptor system (Novagen) according to the manufacturer's instructions.
- the Taq-generated single A overhang is used to facilitate the cloning of the open reading frame downstream of the T7 promoter and the ribosome binding site of the vector.
- the ligated products were transformed into E. coli NovaBlue and plated on LB carbenicillin (50 ⁇ g/ml) under conditions for blue/white screening. White or light blue colonies were analyzed by restriction digestion.
- a clone containing a plasmid with the desired truncated ORF, pPm-CS 1"704 was transformed into E.
- coli Tuner the T7 RNA polymerase-containing expression host, and maintained on LB media with carbenicillin and chloramphenicol (34 ⁇ g/ml) at 3Q 0 C.
- Log phase cultures were induced with ⁇ - isopropylthiogalactoside (0.2 mM final) for 5 hrs.
- the cells were harvested by centrifugation, frozen, and extracted for 20 min with a mild detergent (bPer Il reagent, Pierce) at 7° in the presence of a broad-range protease inhibitor cocktail.
- the cells were removed by centrifugation and the soluble extract was used as the source of CS enzyme for in vitro assays.
- Truncated polypeptides were generated by amplifying the pPm7A insert by 13 cycles of PCR with Taq polymerase (Fisher) and synthetic oligonucleotide primers corresponding to various portions of the pmHAS open reading frame. Except for the construction of pmHAS 1"686 and pmHAS 1"668 , the primers contained EcoRI and Pstl restriction sites to facilitate cloning into the expression plasmid pKK223-3 (tac promoter; Pharmacia). The resulting recombinant constructs were transformed into E. coli TOP 10F cells (Invitrogen) and maintained on Luria-Bertani media with ampicillin selection.
- pmHAS 1"686 and pmHAS 1"668 were cloned into pETBIue-1 plasmid and expressed in Tuner (DE3)pLacl cells (Novagen) according to manufacturing instructions; these cells were maintained on Luria-Bertani media with carbenicillin and chloramphenicol selection.
- Point mutations were made using the QuickChange site-directed mutagenesis method (Stratagene) with the plasmid pKK223/pmHAS 1"703 DNA as template. The sequences of the mutant open reading frames were verified by automated DNA sequencing (Oklahoma State University Recombinant DNA/Protein Resource Facility).
- E. coli were grown in Luria-Bertani media with drug selection until OD 60O was 0.3-0.6 when cells were induced with 0.5 mM isopropyl-1-thio- ⁇ -D-galactoside. Cells were harvested 5 hours after induction.
- soluble truncated proteins and pmHAS 1"703 - derived mutants expressed in E. coli TOP10F cell cells were extracted with B-PerTM Il Bacterial Protein Extraction Reagent (an octylthioglucoside-based solution; Pierce) according to the manufacturer's instruction except that the procedure was performed at 7° in the presence of protease inhibitors.
- Tuner(DE3)pLacl lysis by ultrasonication followed by subcellular fractionation was performed and the supernatant after centrifugation at 100,000 x g was used.
- chondroitin synthase assay the same conditions as the HA synthase assay were used except that the other hexosamine precursor, UDP-GaINAc, was employed and there is no ammonium sulfate or ethylene glycol in the assay system.
- GalNAc-transferase activity was assayed under the same conditions as the GIcNAc- transferase assay except that 0.3 mM UDP-[ 3 H]GaINAc (0.2 ⁇ Ci; NEN) was used instead of UDP-[ 3 H]GIcNAc. Reactions were terminated by the addition of SDS to 2% (w/v).
- reaction products were separated from substrates by descending paper (Whatman 3M) chromatography with ethanol/1 M ammonium acetate, pH 5.5, development solvent (65:35 for the HAS, chondroitin synthase, and GlcUA-transferase assays; 75:25 for GIcNAc- transferase and GalNAc-transferase assay). All assays were adjusted to be linear with regard to incubation time and to protein concentration. Radiolabeled products were quantitated by liquid scintillation counting (Biosafe II, Research Products International).
- pmHAS polypeptides in membranes and extracts were analyzed using standard 8% polyacrylamide SDS gels and Western blotting utilizing a monospecific antibody directed against a synthetic peptide corresponding to residues 526 to 543 of pmHAS (acetyl-LDSDDYLEPDAVELCLKE-amide) as described hereinabove.
- the DNA encoding different segments of pmHAS-D or pmCS were generated by amplifying the pPm7A insert or pPmF4A insert, respectively, by 15 cycles of PCR with Taq polymerase (Fisher) and synthetic oligonucleotide primers corresponding to various portions of the pmHAS-D or pmCS open reading frame.
- Each internal primer contained overlaps with the other segment to allow joining of the two desired segments.
- the forward and reverse primers for pmCS residue 1-420 (D segment) were P1 and P2.
- the chimeric or hybrid synthases were created by 15 cycles of PCR with the gel-purified (GeneClean; Bio101) segments and outer primers (pm-AC used A and C segments with primer P1 and P4; pm-BD used B and D segments with primer P1 and P5).
- the purified PCR products were cloned into pETBIue-1 vector and the chimeric or hybrid proteins were expressed in Tuner(DE3)pl_acl cells (Novagen).
- the ⁇ 0.3-kb amplicon was generated using Taq DNA polymerase (Fisher), gel-purified, and labeled with digoxigenin (High Prime system, Boehringer Mannheim).
- pmHS1 a truncated version of pmHS1 was produced by PCR with the same sense primer but a different antisense primer (TATATTTACAGCAGTATCATTTTCTAAAGG ⁇ SEQ ID NO:56) to yield a predicted 501- residue protein, DcbF (SEQ ID NO:57) (GenBank Accession Number AAK17905); this variant corresponds to residues 1- 497 of pmHS1 followed by the residues TFRK.
- the current optimal constructs are fusions to the maltose-binding protein (pMAL-c vector, New England Biolabs; Sismey-Ragatz et al., 2007).
- E. coli ONE SHOT® Top 1OF' (Invitrogen, Carlsbad, CA) was used for the initial transformation on LB ampicillin (100 ⁇ g/ml) plates and grown at 30 ° C.
- E. coli XJa Zymo Research, Orange, CA
- a phage lysin enzyme was employed allowing for simple freeze/thaw lysis.
- the bacteria were resuspended in 20 mM Tris, pH 7.2, and protease inhibitors (p-[4-2- aminoethyl] benzenesulfonyl fluoride hydrochloride, pepstatin, benzamidine, N-[N-(L-3-trans- carboxyoxirane-2-carbonyl)-L-leucyl]-agmatine, leupeptin) on ice, frozen and thawed twice allowing lysin to degrade the cell walls. The lysates was clarified by centrifugation. The synthases were affinity purified via the MBP unit using amylose resin (New England BioLabs).
- Polymerization reactions typically contained 50 mM Tris, pH 7.2, 1 mM MnCI 2 , 0.5-1.0 mM UDP-GIcNAc, 0.5-1 mM UDP- GIcUA, 0.1 mCi UDP-[ 3 H]sugar and ⁇ 4-5 mg of enzyme (unless noted).
- the reactions were typically incubated at 30 0 C for 15 to 30 min then stopped with SDS (2% final). Descending paper chromatography was used to separate unincorporated UDP sugars from the polymer product (i.e. sugars longer than ⁇ 14 sugars). Three separate experiments were completed for each data set and each assay was verified to be in the linear range with respect to time and enzyme concentration.
- test compound was used at ⁇ 0.5-1.5 mM in the presence of carrier-free UDP-[ 3 H]GIcUA or UDP-[ 3 H]GIcNAc (0.1 ⁇ Ci) without acceptor for 12-48 hours.
- Single Sugar Addition Assays - Tests were performed under the same buffer conditions as polymerization assays, but contained only a single UDP-sugar substrate ( ⁇ 1-3 mM final) and an appropriately terminated acceptor (e.g., heparosan oligosaccharide, A-F-A or A-F-A-N). The incorporation of sugar from the donor substrate was detected by the increase in mass to the appropriate predicted molecular weight product by MALDI-ToF MS.
- an appropriately terminated acceptor e.g., heparosan oligosaccharide, A-F-A or A-F-A-N.
- the HA4 molecule was converted into a fluorescent derivative in two steps. First, reductive amination of HA4 with cyanoborohydride and excess diaminobutane in 0.1 M borate buffer, pH 8.5, was used to make an amino-HA4 derivative that was purified by gel filtration on P2 resin. Second, the amino-HA4 was derivatized with the N- hydroxysuccinimide ester of Oregon green 488 (Molecular Probes) and the Fluor-HA4 was purified by preparative normal-phase thin layer chromatography (silica developed with 2:1 :1 n-butanol/acetic acid/water).
- the fragments were purified by gel filtration on a P2 column (BioRad, Hercules, CA) in 0.2 M ammonium formate, followed by normal phase thin layer chromatography (TLC) on silica plates (Whatman, Clifton, NJ) with n-butanol/acetic acid/water (1 :1 :1). The bands were detected by staining of side lanes with napthoresorcinol. The size and purity of oligosaccharides were verified by matrix assisted laser desorption ionization time of flight mass spectrometry (MALDI-ToF MS).
- MALDI-ToF MS matrix assisted laser desorption ionization time of flight mass spectrometry
- A-F-A Fluorescein di- ⁇ -D-glucuronide
- Molecular Probes, Eugene, OR Molecular Probes, Eugene, OR
- A-F-A-N GlcUA-F-GlcUA-GlcNAc
- N-A-F-A-N GlcNAc-GlcUA-F-GlcUA- GIcNAc
- GAGs Glycosaminoglycans
- Optilab DSP interferometric refractometer and then a Dawn DSF laser photometer (632.8 nm; Wyatt Technology, Santa Barbara, CA) in the multi-angle mode.
- the manufacturer's software package was used to determine the absolute average molecular weight using a dn/dC coefficient of 0.153.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Materials Engineering (AREA)
- Medicinal Chemistry (AREA)
- Polymers & Plastics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- General Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Dermatology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Polysaccharides And Polysaccharide Derivatives (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Enzymes And Modification Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Description
Claims
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP13189930.4A EP2690178B1 (en) | 2006-10-03 | 2007-10-03 | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US84903406P | 2006-10-03 | 2006-10-03 | |
| US92129607P | 2007-03-30 | 2007-03-30 | |
| PCT/US2007/021213 WO2008130373A2 (en) | 2006-10-03 | 2007-10-03 | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP13189930.4A Division EP2690178B1 (en) | 2006-10-03 | 2007-10-03 | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP2079846A2 true EP2079846A2 (en) | 2009-07-22 |
| EP2079846A4 EP2079846A4 (en) | 2013-08-07 |
Family
ID=39876092
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP07874512.2A Withdrawn EP2079846A4 (en) | 2006-10-03 | 2007-10-03 | TARGETED GLYCOSAMINOGLYCAN POLYMERS OBTAINED BY POLYMER GRAFTING AND METHODS OF MAKING AND USING SAME |
| EP13189930.4A Not-in-force EP2690178B1 (en) | 2006-10-03 | 2007-10-03 | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP13189930.4A Not-in-force EP2690178B1 (en) | 2006-10-03 | 2007-10-03 | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same |
Country Status (4)
| Country | Link |
|---|---|
| EP (2) | EP2079846A4 (en) |
| AU (1) | AU2007351891A1 (en) |
| CA (1) | CA2701601C (en) |
| WO (1) | WO2008130373A2 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BR112012021995A8 (en) | 2010-03-01 | 2018-01-02 | Dsm Ip Assets Bv | COMPOSITION, NON-PATHOGENIC BACTERIAL HOST CELL, METHOD FOR THE PRODUCTION OF A CHONDROITIN SULFATE, CHONDROITIN, COMPOSITION AND ANTIBODY OR ANTIBODY FRAGMENT |
| CN120442737A (en) * | 2024-02-06 | 2025-08-08 | 复旦大学 | A preparation method of chondroitin |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CH624011A5 (en) | 1977-08-05 | 1981-07-15 | Battelle Memorial Institute | |
| US4235871A (en) | 1978-02-24 | 1980-11-25 | Papahadjopoulos Demetrios P | Method of encapsulating biologically active materials in lipid vesicles |
| US4708861A (en) | 1984-02-15 | 1987-11-24 | The Liposome Company, Inc. | Liposome-gel compositions |
| US7223571B2 (en) * | 1998-04-02 | 2007-05-29 | The Board Of Regents Of The Universtiy Of Oklahoma | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same |
| US20060105431A1 (en) * | 1998-11-11 | 2006-05-18 | Deangelis Paul L | Polymer grafting by polysaccharide synthases using artificial sugar acceptors |
| JP4365102B2 (en) | 2001-04-26 | 2009-11-18 | コーロン ライフ サイエンス インク | NOVEL SULFONAMIDE DERIVATIVE, INTERMEDIATE COMPOUND THEREOF, METHOD FOR PRODUCING THE SAME, AND PHARMACEUTICAL COMPOSITION CONTAINING SULFONAMIDE DERIVATIVE |
| US20060009409A1 (en) * | 2002-02-01 | 2006-01-12 | Woolf Tod M | Double-stranded oligonucleotides |
| WO2004003545A1 (en) * | 2002-07-01 | 2004-01-08 | Tufts University | Methods and compositions for inhibition of multi-drug resistance by hyaluronan oligomers |
| EP1768678A4 (en) * | 2004-06-30 | 2009-09-23 | Paul L Deangelis | Methods of selectively treating diseases with specific glycosaminoglycan polymers |
-
2007
- 2007-10-03 AU AU2007351891A patent/AU2007351891A1/en not_active Abandoned
- 2007-10-03 CA CA2701601A patent/CA2701601C/en not_active Expired - Fee Related
- 2007-10-03 WO PCT/US2007/021213 patent/WO2008130373A2/en not_active Ceased
- 2007-10-03 EP EP07874512.2A patent/EP2079846A4/en not_active Withdrawn
- 2007-10-03 EP EP13189930.4A patent/EP2690178B1/en not_active Not-in-force
Non-Patent Citations (10)
| Title |
|---|
| AVCI ET AL: "Enzymatic synthesis of glycosaminoglycans: Improving on nature" In: Demchenko (Editor): "Fronteirs in Modern Carbohydrate Chemistry / ACS Symposium Series", 13 March 2007 (2007-03-13), ACS, XP002699118, vol. 960, pages 253-284, * See pages 264-269 (Section 3); published in print after the first priority date * * |
| DEANGELIS: "Hyaluronan biosynthesis systems from microbes to man" In: Kamerling (Editor-in-chief): "Comprehensive Glycoscience", 2007, Elsevier, XP002699207, ISBN: 978-0-4445-2746-2 vol. 3, pages 325-341, * See pages 332-333 (section 3.18.4.3) and pages 335-337 (section 3.18.6); the date of publication is not yet available * * |
| JING ET AL: "Defined megadalton hyaluronan polymer standards", ANALYTICAL BIOCHEMISTRY, vol. 355, 23 June 2006 (2006-06-23), pages 183-188, XP024942078, * |
| KANE ET AL: "Functional characterization of PmHS1, a Pasteurella multocida heparosan synthase", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 281, 7 September 2006 (2006-09-07), pages 33192-33197, XP002699111, * |
| LINHARDT ET AL: "Enzymatic synthesis of glycosaminoglycan heparin", SEMINARS IN THROMBOSIS AND HEMOSTASIS, vol. 33, July 2007 (2007-07), pages 453-465, XP008163151, * |
| PUMMILL ET AL: "The functional molecular mass of the Pasteurella hyaluronan synthase is a monomer", BIOCHIMICA ET BIOPHYSICA ACTA, vol. 1770, 4 October 2006 (2006-10-04), pages 286-290, XP005818421, * |
| See also references of WO2008130373A2 * |
| SISMEY-RAGATZ ET AL: "Chemoenzymatic synthesis with distinct Pasteurella heparosan synthases", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 282, 11 July 2007 (2007-07-11), pages 28321-28327, XP002699113, * |
| TRACY ET AL: "Acceptor specificity of the Pasteurella hyaluronan and chondroitin synthases and production of chimeric glycosaminoglycans", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 282, 10 November 2006 (2006-11-10), pages 337-344, XP002699112, * |
| WILLIAMS ET AL: "Critical elements of oligosaccharide acceptor substrates for the Pasteurella multocida hyaluronan synthase", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 281, 16 December 2005 (2005-12-16), pages 5391-5397, XP002482219, * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2008130373A2 (en) | 2008-10-30 |
| CA2701601C (en) | 2020-06-30 |
| AU2007351891A1 (en) | 2008-10-30 |
| EP2690178B1 (en) | 2021-12-22 |
| WO2008130373A3 (en) | 2009-03-05 |
| EP2690178A1 (en) | 2014-01-29 |
| CA2701601A1 (en) | 2008-10-30 |
| EP2079846A4 (en) | 2013-08-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8088604B2 (en) | Production of defined monodisperse heparosan polymers and unnatural polymers with polysaccharide synthases | |
| US7579173B2 (en) | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using the same | |
| US7741091B2 (en) | Methods of producing hyaluronic acid and chimeric and hybrid glycosaminoglycan polymers | |
| US7575904B2 (en) | Polymer grafting by polysaccharide synthases | |
| US20080125393A1 (en) | Methods of selectively treating diseases with specific glycosaminoglycan polymers | |
| US7534589B2 (en) | Polymer grafting by polysaccharide synthases | |
| US20080108110A1 (en) | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same | |
| US20060105431A1 (en) | Polymer grafting by polysaccharide synthases using artificial sugar acceptors | |
| CA2701601C (en) | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same | |
| WO2003029261A9 (en) | Glycosaminoglycan polymers and methods of making and using same | |
| AU2013237670B2 (en) | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same | |
| US20160053290A1 (en) | Production of Defined Monodisperse Heparosan Polymers and Unnatural Polymers with Polysaccharide Synthases | |
| WO2004032830A2 (en) | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same | |
| CA2536016C (en) | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same | |
| Class et al. | Patent application title: Production of Defined Monodisperse Heparosan Polymers and Unnatural Polymers with Polysaccharide Synthases Inventors: Paul L. Deangelis (Edmond, OK, US) Paul L. Deangelis (Edmond, OK, US) Alison Sismey-Ragatz (Cassville, WI, US) | |
| US7060469B2 (en) | Polymer grafting by polysaccharide synthases | |
| AU1613900A (en) | Polymer grafting by polysaccharide synthases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20090501 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC MT NL PL PT RO SE SI SK TR |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: SISMEY-RAGATZ, ALISON Inventor name: DEANGELIS, PAUL, L. |
|
| DAX | Request for extension of the european patent (deleted) | ||
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20130708 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: C08B 37/00 20060101ALI20130628BHEP Ipc: C12P 19/28 20060101ALI20130628BHEP Ipc: C12P 19/18 20060101AFI20130628BHEP Ipc: C08B 37/08 20060101ALI20130628BHEP |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20140205 |