EP2074098A2 - Quinoline compounds - Google Patents

Quinoline compounds

Info

Publication number
EP2074098A2
EP2074098A2 EP07844372A EP07844372A EP2074098A2 EP 2074098 A2 EP2074098 A2 EP 2074098A2 EP 07844372 A EP07844372 A EP 07844372A EP 07844372 A EP07844372 A EP 07844372A EP 2074098 A2 EP2074098 A2 EP 2074098A2
Authority
EP
European Patent Office
Prior art keywords
trifluoromethyl
phenyl
quinoline
phenoxy
methylsulfonyl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP07844372A
Other languages
German (de)
French (fr)
Inventor
Ronald Charles Bernotas
Robert Ray Singhaus Jr.
John William Ullrich
David Harry Kaufman
Robert Lester Morris
Jay E. Wrobel
Baihua Hu
James Winfield Jetter
Michael David Collini
Jeremy Mark Travins
Ronald Louis Magolda
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wyeth LLC
Original Assignee
Wyeth LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wyeth LLC filed Critical Wyeth LLC
Publication of EP2074098A2 publication Critical patent/EP2074098A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D215/00Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems
    • C07D215/02Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom
    • C07D215/12Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with substituted hydrocarbon radicals attached to ring carbon atoms
    • C07D215/14Radicals substituted by oxygen atoms
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • A61P15/08Drugs for genital or sexual disorders; Contraceptives for gonadal disorders or for enhancing fertility, e.g. inducers of ovulation or of spermatogenesis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/04Drugs for skeletal disorders for non-specific disorders of the connective tissue
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/06Antihyperlipidemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D215/00Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems
    • C07D215/02Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom
    • C07D215/16Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D215/18Halogen atoms or nitro radicals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D215/00Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems
    • C07D215/02Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom
    • C07D215/16Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D215/48Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/04Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/12Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D409/00Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/02Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings
    • C07D409/04Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D413/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/02Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
    • C07D413/10Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a carbon chain containing aromatic rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D413/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/02Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
    • C07D413/12Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a chain containing hetero atoms as chain links
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D495/00Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms
    • C07D495/02Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
    • C07D495/04Ortho-condensed systems

Definitions

  • This invention relates generally to quino line-based modulators of Liver X receptors (LXRs) and related methods.
  • LXRs Liver X receptors
  • Atherosclerosis is among the leading causes of death in developed countries. Some of the independent risk factors associated with atherosclerosis include the presence of relatively high levels of serum LDL cholesterol and relatively low levels of serum HDL cholesterol in affected patients. As such, some anti-atherosclerotic therapy regimens include the administration of agents (e.g., statins) to reduce elevated serum LDL cholesterol levels.
  • agents e.g., statins
  • HDL cholesterol is believed to play a major role in the transport of cholesterol from peripheral tissues to the liver for metabolism and excretion (this process is sometimes referred to as "reverse cholesterol transport").
  • ABCAl is a transporter gene involved in HDL production and reverse cholesterol transport. Upregulation of ABCAl can therefore result in increased reverse cholesterol transport as well as inhibition of cholesterol absorption in the gut.
  • HDL is also believed to inhibit the oxidation of LDL cholesterol, reduce the inflammatory response of endothelial cells, inhibit the coagulation pathway, and promote the availability of nitric oxide.
  • LXRs Liver X receptors
  • LXRs are members of the nuclear hormone receptor super family and are believed to be involved in the regulation of cholesterol and lipid metabolism. LXRs are ligand-activated transcription factors and bind to DNA as obligate heterodimers with retinoid X receptors. While LXR ⁇ is generally found in tissues such as liver, kidney, adipose tissue, intestine and macrophages,
  • LXR ⁇ displays a ubiquitous tissue distribution pattern. Activation of LXRs by oxysterols (endogenous ligands) in macrophages results in the expression of several genes involved in lipid metabolism and reverse cholesterol transport including the aforementioned ABCAl; ABCGl; and ApoE.
  • LXR ⁇ knock-out (k/o) LXR ⁇ k/o
  • double k/o mice LXR ⁇ k/o mice to determine the physiological role of LXRs in lipid homeostasis and atherosclerosis. The data from these studies suggested that in double k/o mice on normal chow diet, increased cholesterol accumulation was observed in macrophages (foam cells) of the spleen, lung and arterial wall.
  • LXR ⁇ k/o mice did not appear to show significant changes in hepatic gene expression, LXR ⁇ k/o mice showed 58% decrease in hepatic ABCAl expression and 208% increase in SREBPIc expression suggesting that LXR ⁇ may be involved in the regulation of liver SREBPIc expression.
  • LXRs activation of LXRs results in the inhibition of inflammation and proinflammatory gene expression. This hypothesis is based on data obtained from studies employing three different models of inflammation (LPS-induced sepsis, acute contact dermatitis of the ear and chronic atherosclerotic inflammation of the artery wall). These data suggest that LXR modulators can mediate both the removal of cholesterol from the macrophages and the inhibition of vascular inflammation.
  • This invention relates generally to quino line-based modulators of LXRs and related methods and compositions.
  • this invention features a compound having formula (I):
  • R 1 hydrogen, Ci-C 6 alkyl, NH 2 , NH(Ci-C 6 alkyl), or N(Ci-C 6 alkyl) 2 ;
  • R 2 is:
  • X is -C(O)-; -O-; -S(O) r , wherein t is 0-2; -NR 9 -; -C(O)NR 9 -; -C(NH)NR 9 ; -C(O)O-; -CH 2 O-; -NR 9 SO 2 -; or -SO 2 NR 9 -, wherein R 9 is hydrogen or Ci-C 6 alkyl; and R 8 is:
  • Ci-Ci 2 alkyl or Ci-Ci 2 haloalkyl each of which is optionally substituted with from 1-5 R a ; or
  • R 3 is C 6 -Ci 8 (e.g., C 6 -Ci 4 ) aryl or heteroaryl including 5-16 (e.g., 5-14) atoms, each of which is:
  • R 10 is WA, wherein:
  • W at each occurrence is, independently, a bond; -O-; -S(O) t -, wherein t is 0-2; -NR 9 -; -C(O)NR 9 -; Ci_ 6 alkylene; or C 2 . 6 alkynylene; -W 1 Cd -6 alkylene)-; or -(Ci_ 6 alkylene ⁇ 1 -; W 1 at each occurrence is, independently, -O-; -S(O) r , wherein t is 0-2;
  • a at each occurrence is, independently: (i) C 6 -Ci 0 aryl, which is: (a) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, or 1, e.g., 1-2) R f ; and
  • R f (a) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, or 1, e.g., 1-2) R f or includes a substituted ring atom selected from the group consisting of S(O) and SO 2 ;
  • (b) is optionally substituted with from 1 -4 R e ; provided that the heteroaryl including 5-10 atoms is not [l,2,4]-oxadiazolyl; or
  • arylazacyclyl including 8-12 atoms each of which is: (a) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, or 1, e.g., 1-2) R f , and
  • each of R 4 , R 5 , R 6 , and R 7 is, independently: (i) hydrogen; or (ii) R c ; or
  • R a at each occurrence is, independently:
  • NR k C(O)R -C(NR')R; -OC(O)NR s R h ; -NR k C(O)NR s R h ; -NR k C(O)OR; -S(O) n R m , wherein n is 1 or 2; -NR k S(O) n R m ; or -P(O)(OR s )(OR h ); or
  • R a at each occurrence is, independently, NR s R h ; nitro; azido; hydroxy; oxo; cyano; - C(O)R J , -C(O)OR; -OC(O)R; -C(O)SR; -SC(O)R; -C(S)SR; -SC(S)R; -C(0)NR s R h ; - NR k C(0)R; -C(NR')R; -0C(0)NR s R h ; -NR k C(O
  • R b at each occurrence is, independently:
  • NR k C(O)R -C(NR')R; -OC(O)NR s R h ; -NR k C(0)NR s R h ; -NR k C(O)OR; -S(O) n R m , wherein n is 1 or 2; -NR k S(O) n R m ; or -P(O)(OR s )(OR h ); or
  • Ci-C 20 alkyl or Ci-C 20 haloalkyl each of which is optionally substituted with from 1-10 R a ; or
  • C 2 -C 20 alkenyl or C 2 -C 20 alkynyl each of which is optionally substituted with from 1-10 R c ; or
  • R b at each occurrence is, independently, R a ; halo; Ci-C 20 alkoxy or Ci-C 20 haloalkoxy, each of which is optionally substituted with from 1-10 R a ; C 6 -CiS aryloxy or heteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10
  • Ci-C 20 alkyl or Ci-C 20 haloalkyl each of which is optionally substituted with from 1-10 R a ; C 2 -C 2 O alkenyl; C 2 -C 20 alkynyl; or C 6 -Ci 8 aryl or heteroaryl including 5-16 atoms, each of which is optionally substituted with from 1-10 R d ;
  • R d at each occurrence is, independently:
  • Ci-C 2O alkyl or Ci-C 2O haloalkyl each of which is optionally substituted with from 1-10 R a ;
  • R d at each occurrence is, independently, halo; NR s R h ; nitro; azido; hydroxy; Ci-C 20 alkyl, Ci-C 20 haloalkyl, C 2 -C 20 alkenyl; C 2 -C 20 alkynyl; C 3 -C 20 cycloalkyl; C 3 -C 20 cycloalkenyl, heterocyclyl including 3-20 atoms; heterocycloalkenyl including 3-20 atoms; C 7 -C 20 aralkyl; heteroaralkyl including 6-20 atoms; Ci-C 20 alkoxy; Ci-C 20 haloalkoxy; C 6 -Cig aryloxy; heteroaryloxy; C 7 -C 20 aralkoxy; heteroaralkoxy including 6-20 atoms; C 3 -Ci 6 cycloalkoxy; C 3 -C 20 cycloalkenyloxy; heterocyclyloxy including 3-20 atoms; hetero
  • R e at each occurrence is, independently, Ci-C 6 alkyl, optionally substituted with from 1-3 R a ; Ci-C 6 haloalkyl; phenyl; 4-fluorophenyl; halo; hydroxyl; NR s R h ; nitro; C 2 -C 6 alkenyl; C 2 -C 6 alkynyl; Ci-C 6 alkoxy; Ci-C 6 haloalkoxy; cyano; or -C(O)R;
  • R f at each occurrence is, independently:
  • n at each occurrence is, independently, 0, 1, or 2 (e.g., 1 or 2); or (ii) -NR k C(O)NR s R ⁇ -NR k C(O)OR, -OC(O)NR s R h , or -OC(O)OR; or (iii) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and optionally substituted with from 1 -3 R e ; or
  • heterocycloalkenyl including 5-10 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -3 R e ; or (v) -YR f , wherein Y at each occurrence is, independently, Ci-C 6 alkylene, -O-, or -
  • R f at each occurrence is, independently:
  • heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and optionally substituted with from 1 -3 R e ;
  • heterocycloalkenyl including 5-10 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -3 R e ;
  • each of R s , R h , R 1 , and R k , at each occurrence is, independently: (i) hydrogen; or
  • R J at each occurrence is, independently: (i) hydrogen; or
  • R m at each occurrence is, independently, R J , OR J , or NR s R h ;
  • R n at each occurrence is, independently, R J or NR s R h ;
  • this invention features a compound of formula (I), in which:
  • R 1 is hydrogen or Ci-Ce alkyl
  • X is -C(O)-; -O-; -S(O) r , wherein t is 0-2; -NR 9 -; -C(O)NR 9 -; -C(O)O-; -CH 2 O-; or -SO 2 NR 9 -, wherein R 9 is hydrogen or Ci-C 6 alkyl; each of R s , R h , R 1 , and R k , at each occurrence is, independently: (i) hydrogen; or
  • Ci-C 2 O alkyl or Ci-C 2 O haloalkyl each of which is optionally substituted with from 1-10 R a ;
  • this invention features any of the specific quinoline compounds delineated herein (e.g., as shown in the Examples).
  • the compound compound can be selected from the group consisting of the title compounds of Examples 43- 190, 192-198, 201, 202, 204-210, 212-217, 220-223, 226, 229-257, 259-267, 269-272, 274- 365, 367-370, 372, 374-391, 394-396, 400, 402-593, and 595-597, and each of the title compounds in Examples 397-399, 401, and 598-600.
  • title compound refers to (i) the compound name heading a particular example or (ii) each of the compound names delineated in Examples 397, 399, 401, and 598-600.
  • title compound is the final product of that multi-step synthesis.
  • Example 43 the title compound of Example 43 is "4- ⁇ 3-[3-(ethylsulfonyl)phenoxy]phenyl ⁇ -3-methyl-8-(trifluoromethyl)quinoline," and one of the title compounds of Example 397 is "4-[3'-(ethylsulfonyl)-4'-methylbiphenyl-3-yl]-3- methyl-8-(trifluoromethyl)quinoline.”
  • this invention features a pharmaceutical composition, which includes a compound of formula (I) (including any subgenera or specific compounds thereof) or a salt
  • the composition can include an effective amount of the compound or the salt thereof. In some embodiments, the composition can further include an additional therapeutic agent.
  • the invention also relates generally to modulating (e.g., activating) LXRs with the quinoline compounds described herein.
  • the methods can include, e.g., contacting an LXR in a sample (e.g., a tissue, a cell free assay medium, a cell-based assay medium) with a compound of formula (I) (including any subgenera or specific compounds thereof).
  • the methods can include administering a compound of formula (I) (including any subgenera or specific compounds thereof) to a subject (e.g., a mammal, e.g., a human, e.g., a human having or at risk of having one or more of the diseases or disorders described herein).
  • this invention also relates generally to methods of preventing or treating (e.g., controlling, ameliorating, alleviating, slowing the progression of, delaying the onset of, or reducing the risk of developing) one or more LXR-mediated diseases or disorders in a subject (e.g., a subject in need thereof).
  • the methods include administering to the subject an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
  • LXR-mediated diseases or disorders can include, e.g., cardiovascular diseases (e.g., acute coronary syndrome, restenosis), atherosclerosis, atherosclerotic lesions, type I diabetes, type II diabetes, Syndrome X, obesity, lipid disorders (e.g., dyslipidemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, low HDL and high LDL), cognitive disorders (e.g., Alzheimer's disease, dementia), inflammatory diseases (e.g., multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, endometriosis, LPS- induced sepsis, acute contact dermatitis of the ear, chronic atherosclerotic inflammation of the artery wall), celiac, thyroiditis, skin aging or connective tissue diseases.
  • cardiovascular diseases e.g., acute coronary syndrome, restenosis
  • atherosclerosis e.g., atherosclerosis, atherosclerotic les
  • this invention relates to methods of modulating (e.g., increasing) serum HDL cholesterol levels in a subject (e.g., a subject in need thereof), which includes administering to the subject an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
  • this invention relates to methods of modulating (e.g., decreasing) serum LDL cholesterol levels in a subject (e.g., a subject in need thereof), which includes administering to the subject an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
  • this invention relates to methods of modulating (e.g., increasing) reverse cholesterol transport in a subject (e.g., a subject in need thereof), which includes administering to the subject an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
  • this invention relates to methods of modulating (e.g., decreasing or inhibiting) cholesterol absorption in a subject (e.g., a subject in need thereof), which includes administering to the subject an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
  • this invention relates to methods of preventing or treating a cardiovascular disease (e.g., acute coronary syndrome, restenosis), which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
  • a cardiovascular disease e.g., acute coronary syndrome, restenosis
  • this invention relates to methods of preventing or treating atherosclerosis and/or atherosclerotic lesions, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
  • this invention relates to methods of preventing or treating diabetes (e.g., type I diabetes or type II diabetes), which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
  • diabetes e.g., type I diabetes or type II diabetes
  • this invention relates to methods of preventing or treating Syndrome X, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
  • this invention relates to methods of preventing or treating obesity, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
  • this invention relates to methods of preventing or treating a lipid disorder (e.g., dyslipidemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, low HDL and/or high LDL), which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
  • a lipid disorder e.g., dyslipidemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, low HDL and/or high LDL
  • this invention relates to methods of preventing or treating a cognitive disorder (e.g., Alzheimer's disease or dementia), which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
  • a cognitive disorder e.g., Alzheimer's disease or dementia
  • administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
  • this invention relates to methods of preventing or treating dementia, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
  • this invention relates to methods of preventing or treating Alzheimer's disease, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
  • this invention relates to methods of preventing or treating an inflammatory disease (e.g., multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, endometriosis, LPS-induced sepsis, acute contact dermatitis of the ear, chronic atherosclerotic inflammation of the artery wall), which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
  • an inflammatory disease e.g., multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, endometriosis, LPS-induced sepsis, acute contact dermatitis of the ear, chronic atherosclerotic inflammation of the artery wall
  • this invention relates to methods of preventing or treating rheumatoid arthritis, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
  • this invention relates to methods of preventing or treating celiac, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
  • this invention relates to methods of preventing or treating thyroiditis, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
  • this invention relates to methods of treating a connective tissue disease (e.g., osteoarthritis or tendonitis), which includes administering to a subject (e.g., a mammal, e.g., a human) in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
  • a subject e.g., a mammal, e.g., a human
  • the compound of formula (I) inhibits (e.g., reduces or otherwise diminishes) cartilage degradation.
  • the compound of formula (I) induces (e.g., increases or otherwise agments) cartilage regeneration.
  • the compound of formula (I) inhibits (e.g., reduces or otherwise diminishes) cartilage degradation and induces (e.g., increases or otherwise agments) cartilage regeneration. In embodiments, the compound of formula (I) inhibits (e.g., reduces or otherwise diminishes) aggrecanase activity. In embodiments, the compound of formula (I) inhibits (e.g., reduces or otherwise diminishes) elaboration of pro-inflammatory cytokines in osteoarthritic lesions.
  • this invention relates to methods of treating or preventing skin aging, the method comprising administering (e.g., topically administering) to a subject (e.g., a mammal, e.g., a human) in need thereof an effective amount of a compound of formula (I)
  • the skin aging can be derived from chronological aging, photoaging, steroid-induced skin thinning, or a combination thereof.
  • skin aging includes conditions derived from intrinsic chronological aging (for example, deepened expression lines, reduction of skin thickness, inelasticity, and/or unblemished smooth surface), those derived from photoaging (for example, deep wrinkles, yellow and leathery surface, hardening of the skin, elastosis, roughness, dyspigmentations (age spots) and/or blotchy skin), and those derived from steroid- induced skin thinning.
  • another aspect is a method of counteracting UV photodamage, which includes contacting a skin cell exposed to UV light with an effective amount of a compound of formula (I).
  • the compound of formula (I) does not substantially increase serum and/or hepatic triglyceride levels of the subject.
  • the administered compound of formula (I) can be an LXR agonist (e.g., an LXR ⁇ agonist or an LXR ⁇ agonist, e.g., an LXR ⁇ agonist).
  • an LXR agonist e.g., an LXR ⁇ agonist or an LXR ⁇ agonist, e.g., an LXR ⁇ agonist.
  • the subject can be a subject in need thereof (e.g., a subject identified as being in need of such treatment). Identifying a subject in need of such treatment can be in the judgment of a subject or a health care professional and can be subjective (e.g. opinion) or objective (e.g. measurable by a test or diagnostic method).
  • the subject can be a mammal. In certain embodiments, the subject is a human.
  • this invention also relates to methods of making compounds described herein.
  • the method includes taking any one of the intermediate compounds described herein and reacting it with one or more chemical reagents in one or more steps to produce a compound described herein.
  • this invention relates to a packaged product.
  • the packaged product includes a container, one of the aforementioned compounds in the container, and a legend (e.g., a label or an insert) associated with the container and indicating administration of the compound for treatment and control of the diseases or disorders described herein.
  • a legend e.g., a label or an insert
  • Embodiments can include one or more of the following features.
  • R 3 is C 6 -C 14 aryl, which is: (i) substituted with from 1-2 R 10 , and (ii) optionally substituted with from 1-4 R e ;
  • a at each occurrence is, independently, C 6 -Ci 0 aryl, which is: (a) substituted with from 1-2 R f ; and (b) optionally substituted with from 1-4 R e ; and
  • R f at each occurrence is, independently: (i) -S(O) n R 1 , -(CH 2 ) L6 S(O) n R 11 , -NR k S(O) n R n , or -OS(O) n R 1 , wherein n at each occurrence is, independently, O, 1, or 2 (e.g., 1 or 2); or
  • R 3 is heteroaryl including 5-14 atoms, which is: (i) substituted with from 1-2 R 10 , and
  • R f optionally substituted with from 1 -4 R e ; and A at each occurrence is, independently, C 6 -Ci 0 aryl, which is: (a) substituted with from 1-2 R f ; and (b) optionally substituted with from 1-4 R e ; and R f at each occurrence is, independently:
  • R 3 is C 6 -Ci 4 aryl, which is: (i) substituted with from 1-2 R 10 , and (ii) optionally substituted with from 1 -4 R e ; and
  • a at each occurrence is, independently, heteroaryl including 5-10 atoms, which is:
  • (b) is optionally substituted with from 1 -4 R e ; provided that the heteroaryl including 5-10 atoms is not optionally substituted [1,2,4]- oxadiazolyl; and
  • R f at each occurrence is, independently:
  • n at each occurrence is, independently, 1 or 2; or (ii) -NR k C(0)NR s R ⁇ -NR k C(0)0R, -0C(0)NR s R h , or -OC(O)OR; or
  • R 3 is C 6 -Ci 4 aryl, which is: (i) substituted with from 1-2 R 10 , and (ii) optionally substituted with from 1 -4 R e ; and A at each occurrence is, independently, C 6 -Ci 0 aryl, which is: (a) substituted with from 1-2 R f ; and (b) optionally substituted with from 1-4 R e ; and
  • R f at each occurrence is, independently:
  • heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and optionally substituted with from 1 -3 R e ; or (iv) heterocycloalkenyl including 5-10 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -3 R e ; or
  • RR 33 U is C 6 -Ci 4 aryl, which is: (i) substituted with from 1-2 R 10 , and (ii) optionally substituted with from 1-4 R e ; and A at each occurrence is, independently, arylazacyclyl including 8-12 atoms, each of which is: (a) substituted with from 1-2 R f , and (b) optionally substituted with from 1-4 R e ; and
  • R f at each occurrence is, independently: (i) -S(O) n R n , -(CH 2 ) L6 S(O) n R 11 , -NR k S(O) n R n , or -OS(O) n R 1 , wherein n at each occurrence is, independently, 1 or 2; or
  • R 3 is C 6 -C 14 aryl, which is: (i) substituted with from 1-2 R 10 , and (ii) optionally substituted with from 1-4 R e ; and
  • a at each occurrence is, independently, arylsulfinylcyclyl, heteroarylsulfinylcyclyl, arylsulfonylcyclyl or heteroarylsulfonylcyclyl, each of which includes 8-10 atoms and is optionally substituted with from 1 -4 R e ; or
  • R 3 is C 6 -C 14 aryl, which is: (i) substituted with from 1-2 R 10 , and (ii) optionally substituted with from 1 -4 R e ; and
  • a at each occurrence is, independently, [l,2,4]-oxadiazolyl, optionally substituted with from 1-2 R e .
  • R 1 can be hydrogen.
  • R 2 can be hydrogen.
  • R 2 can be: (ii) Ci-C 6 alkyl that is optionally substituted with from 1-2 R a ; or (iii) C 7 - Cio aralkyl that is optionally substituted with from 1-3 R b ; or (vii) -XR 8 .
  • R 2 can be Ci-C 6 alkyl, optionally substituted with from 1-2 R a (e.g., R 2 can be CH 3 ; or CH 2 CH 3 or CH(CH 3 ) 2 ).
  • R a can be NR s R h or hydroxyl.
  • R 2 can be CH 2 NR s R h .
  • R 2 can be C 7 -CiO aralkyl, optionally substituted with from 1-3 R b (e.g., R 2 can be benzyl).
  • R 2 can be cyano.
  • R 2 can be XR 8 (e.g., -SO 2 CH 3 , C(O)NH 2 , C(O)OH, or C(O)OEt).
  • R 3 can be C 6 -Ci 0 aryl, which is (a) substituted with from 1-2 (e.g., 1) R 10 ; and (b) optionally substituted with from 1 -2 R e .
  • R can be phenyl, which is (a) substituted with 1 R 10 ; and (b) optionally substituted with from 1 -2 R e .
  • R 3 can be phenyl, which is substituted with 1 R 10 .
  • R can have formula A as described herein in which W and A can be as defined anywhere herein (generically, subgenerically, or specifically):
  • R 3 can have formula (A-4):
  • R 3 can be heteroaryl including 5-10 atoms, which is (i) substituted with 1 R 10 , and (ii) optionally substituted with from 1 -2 R e .
  • R can be pyridyl, thienyl, thiazolyl, or pyrazolyl, which is (i) substituted with 1 R 10 , and (ii) optionally substituted with from 1-2 R e .
  • W can be -O-.
  • W can be a bond.
  • W can be Ci-C 3 alkylene (e.g., -CH 2 -).
  • W can be C 2 -C 4 alkynylene (e.g., -OC-).
  • W can be -0(C 1 -C 3 alkylene)- or -(C 1 -C 3 alkylene)O- (e.g., - OCH 2 - or -CH 2 O-).
  • W can be -0-, a bond, -0(C 1 -C 3 alkylene)-, and -(C 1 -C 3 alkylene)O-.
  • A can be: (i) phenyl, which is (a) substituted with 1 R f , and (b) optionally substituted with from 1-2 R e ; or (ii) heteroaryl including 5-8 atoms, which is (a) substituted with 1 R f , and (b) optionally substituted with from 1-3 R e , provided that the heteroaryl including 5-8 atoms is not [l,2,4]-oxadiazolyl; or (iii) tetrahydroquinolyl or tetrahydroisoquinolyl, which is (a) substituted with from 1 R f , and (b) optionally substituted with from 1 -2 R e .
  • R f can be -S(O) n R 1 (e.g., R f can be -SO 2 R n ).
  • R n can be C 1 -C 1 O alkyl, optionally substituted with from 1-2 R a .
  • R n can be unsubstituted C 1 -C 3 alkyl (e.g., R n can be CH 3 ).
  • R n can be C 2 -C 8 alkyl or C 3 -C 8 alkyl substituted with 1-2 (e.g., 1) R a .
  • R a can be hydroxyl; C 1 -C 3 alkoxy; NR s R h ; aryl heterocyclyl including 8-10 atoms optionally substituted with from 1-3 R b (e.g., oxo); or C(O)OR J ; or R a can be hydroxyl; C 1 -C3 alkoxy; NR s R h ; halo; arylheterocyclyl including 8-10 atoms, optionally substituted with from 1-3 R b ; cyano; or C(O)OR.
  • R n can be NR s R h .
  • R s and R h can each be, independently, hydrogen; Ci-Ci 0 alkyl, optionally substituted with from 1-2 R a ; C 7 -Ci 0 aralkyl, optionally substituted with from 1-3 R b ; or -C(O)R.
  • R s and R h are each, independently, hydrogen; Ci -C 6 unsubstituted alkyl; C 2 -C 8 alkyl substituted with hydroxyl or Ci-C 3 alkoxy; benzyl; or -C(O)CH 3 .
  • R n can be heterocyclyl including 5-10 atoms, optionally substituted with from 1-5 R b .
  • R n can be morpholin-4-yl, 1 -piperidyl, piperazin- 1 -yl, or pyrrolidin- 1 -yl, each of which is optionally substituted with from 1-3 R b .
  • R n can be C 7 -Ci 0 aralkyl or C 3 -C 8 cycloalkyl, each of which is optionally substituted with from 1-5 R b .
  • R n can be C 2 -Ci 0 alkenyl, optionally substituted with from 1-2 R c .
  • R n can be C 6 -Ci 0 aryl, optionally substituted with from 1-2 R d .
  • R f can be -NR k C(O)NR s R h , -NR k C(O)OR; or -NR k S(O) n R n .
  • R k can be hydrogen.
  • R h , and R can each be, independently, hydrogen; Ci-C 6 alkyl, optionally substituted with from 1-2 R a ; or C 6 -Ci 0 aryl, optionally substituted with from 1-2 R d .
  • R n can be Ci-C 6 alkyl, optionally substituted with from 1-2 R a ; or C 6 -Ci 0 aryl, optionally substituted with from 1-2 R d .
  • R f can be heterocyclyl including 5-7 atoms that is substituted with 1 oxo and optionally substituted with from 1 -2 R e .
  • R f can be heterocycloalkenyl including 5-7 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -2 R e .
  • R f can be 4,5-dihydrooxazolyl, 2-oxo-imidazolidinyl, 4,5-dihydro-lH-imidazolyl, 1,2,5,6-tetrahydro-pyrimidinyl, 5,6-dihydro-2H-[l,3]oxazinyl, or 2-oxo-oxazolidinyl.
  • R f can be lH-benzoimidazolyl.
  • R e at each occurrence can be, independently, halo, Ci-C 3 alkyl, Ci-C 3 haloalkyl, Ci- C 3 alkoxy, NR s R h , phenyl, or 4-fluorophenyl.
  • R can have formula D:
  • W is a bond; -O-; Ci_ 3 alkylene; C 2 _ 4 alkynylene; -O(Ci_ 3 alkylene)-; or -(C ⁇ alkylene)O-; one of R fl , R Q , R G , R f4 , and R ⁇ is:
  • heterocycloalkenyl including 5-10 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -3 R e ; or
  • R fl , R ⁇ , R G , R f4 , and R ⁇ can be: (i) -S(O) n R n or -NR k S(O) n R n ; or (ii) - NR k C(0)NR s R h or -NR k C(0)0R; or (iii) heterocyclyl including 5-7 atoms that is substituted with from 1 oxo and optionally substituted with from 1 -2 R e ; or (iv) heterocycloalkenyl including 5-7 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1-2 R e ; and the other four can each be, independently, hydrogen, halo, C 1 -C 3 alkyl, C 1 -C 3 haloalkyl, Ci-C 3 alkoxy, or NR s R h .
  • R fl , R ⁇ , R G , R f4 , and R f5 can be hydrogen.
  • R Q can be: (i) -S(O) n R n or -NR k S(O) n R n ; or (ii) -NR k C(0)NR s R h or -NR k C(0)0R; or (iii) heterocyclyl including 5-7 atoms that is substituted with from 1 oxo and optionally substituted with from 1-2 R e ; or (iv) heterocycloalkenyl including 5-7 atoms or IH- benzoimidazolyl, each of which is optionally substituted with from 1-2 R e ; and R fl , R G , R f4 , and R ⁇ can each be, independently, hydrogen, halo, Ci-C 3 alkyl, Ci-C 3 haloalkyl, Ci-C 3 alkoxy, or NR s R h .
  • R fl , R G , R f4 , and R ⁇ can be hydrogen.
  • R ⁇ can be -SO 2 R n .
  • R Q can be: (i) heterocyclyl including 5-7 atoms that is substituted with 1 oxo and optionally substituted with from 1-2 R e ; or (ii) heterocycloalkenyl including 5-7 atoms or, each of which is optionally substituted with from 1-2 R e .
  • R Q can be 4,5- dihydrooxazolyl, 2-oxo-imidazolidinyl, 4,5-dihydro-lH-imidazolyl, 1,2,5,6-tetrahydro- pyrimidinyl, 5,6-dihydro-2H-[l,3]oxazinyl, or 2-oxo-oxazolidinyl.
  • R 2f can be lH-benzoimidazolyl.
  • R 3 can have formula D- 1 :
  • R can be hydrogen or R e (e.g., halo, e.g., fluoro, or chloro);
  • W can be as defined anywhere herein (e.g., -O- or a bond); each of R ⁇ 2 and R ⁇ 3 is, independently, hydrogen or R e ; and one of R A24 and R A25 is R f (e.g., -SO 2 R n ), and the other is hydrogen or R e .
  • R A22 , R A23 , R A24 , and R A25 is provided that only one of R A22 , R A23 , R A24 , and R A25 is
  • R 3 can be heteroaryl including 5-10 (e.g., 5-6) atoms, which is (i) substituted with 1 R 10 , and (ii) optionally substituted with from 1 -2 R e ; and W can be a bond; and A can have formula (B-9):
  • each of R ⁇ 2 and R ⁇ 3 is, independently, hydrogen or R e ; and one of R A24 and R A25 is R f (e.g., -SO 2 R n ), and the other is hydrogen or R e ;
  • R 3 can have formula (A-4);
  • W can be a bond
  • A can be heteroaryl including 5-8 atoms, which is (a) substituted with 1 R f (e.g., - SO 2 R 11 ), and (b) optionally substituted with from 1 -3 R e , provided that the heteroaryl including 5-8 atoms is not [l,2,4]-oxadiazolyl.
  • R can have formula (A-4);
  • W can be a bond
  • A can be tetrahydroquinolyl or tetrahydroisoquinolyl, which is (a) substituted with 1 R f (e.g., -SO 2 R 1 ), and (b) optionally substituted with from 1-2 R e .
  • R 3 can have formula (A-4);
  • W can be a bond
  • A can be benzo[b]thienyl- 1,1 -dioxide, 3,4-dihydro-2H-thiopyrano[2,3-b]pyridyl-l,l- dioxide, or 2,3-dihydrobenzo[b]thienyl- 1,1 -dioxide, each of which is optionally substituted with from 1-3 R e .
  • R 3 can have formula D-I;
  • R 32 can be hydrogen or R e (e.g., halo, e.g., fluoro, or chloro); and
  • W can be as defined anywhere herein (e.g., -O- or a bond); each of R ⁇ 2 and R ⁇ 3 is, independently, hydrogen or R e ; and one of R A24 and R A25 is R f , e.g.:
  • heterocyclyl including 5-7 atoms that is substituted with 1 oxo and optionally substituted with from 1 -2 R e ;
  • heterocycloalkenyl including 5-7 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -2 R e ; and the other is hydrogen or R e .
  • R A22 , R A23 , R A24 , and R A25 is provided that only one of R A22 , R A23 , R A24 , and R A25 is
  • R can have formula (E) or (F) as defined anywhere herein.
  • R 32 can be hydrogen.
  • R 32 can be halo (e.g., chloro or fluoro).
  • A can be benzo[b]thienyl- 1,1 -dioxide, 3,4-dihydro-2H-thiopyrano[2,3-b]pyridyl-l,l- dioxide, or 2,3-dihydrobenzo[b]thienyl- 1,1 -dioxide, each of which is optionally substituted with from 1-3 R e .
  • R e at each occurrence can be, independently, halo; C 1 -C 3 alkyl, optionally substituted with from 1-2 R a ; C 1 -C 3 haloalkyl; C 1 -C 3 alkoxy; hydroxyl; nitro; cyano; NR s R h ; phenyl; or 4-fluorophenyl.
  • Each of R 4 , R 5 and R 6 can be hydrogen or fluoro. Each of R 4 , R 5 and R 6 can be hydrogen. Each of R 4 , R 5 and R 6 can be hydrogen, and R 7 can be other than hydrogen. R 7 can be chloro, cyano, C 1 -C 6 alkyl, C 1 -C 3 haloalkyl, C 1 -C 6 alkoxy, C(O)OR,
  • R 7 can be C 1 -C 6 (e.g., C 1 -C 3 ) haloalkyl (e.g., CF 3 ).
  • R 7 can be halo (e.g., chloro or bromo, preferably chloro).
  • R 7 can be SO 2 R 111 .
  • R m can be CH 3 .
  • R 7 can be hydrogen or cyano. In some embodiments, it is provided that when R f is SO 2 R n and R n is C 1 -C 6 alkyl, then R 7 is other than fluoro.
  • the compounds can have formula (III) or (V) as defined anywhere herein.
  • mammal includes organisms, which include mice, rats, cows, sheep, pigs, rabbits, goats, horses, monkeys, dogs, cats, and humans.
  • an effective amount refers to an amount of a compound that confers a therapeutic effect (e.g., treats, controls, ameliorates, prevents, delays the onset of, or reduces the risk of developing a disease, disorder, or condition or symptoms thereof) on the treated subject.
  • the therapeutic effect may be objective (i.e., measurable by some test or marker) or subjective (i.e., subject gives an indication of or feels an effect).
  • An effective amount of the compound described above may range from about 0.01 mg/Kg to about 1000 mg/Kg, (e.g., from about 0.1 mg/Kg to about 100 mg/Kg, from about 1 mg/Kg to about 100 mg/Kg). Effective doses will also vary depending on route of administration, as well as the possibility of co-usage with other agents.
  • halo refers to any radical of fluorine, chlorine, bromine or iodine.
  • substituent (radical) prefix names are derived from the parent hydride by either (i) replacing the "ane” in the parent hydride with the suffixes "yl,” “diyl,” “triyl,” “tetrayl,” etc.; or (ii) replacing the "e” in the parent hydride with the suffixes "yl,” “diyl,” “triyl,” “tetrayl,” etc.
  • alkyl refers to a saturated hydrocarbon chain that may be a straight chain or branched chain, containing the indicated number of carbon atoms (e.g., Ci-C 2O , Ci-Ci 0 ).
  • Ci-C 20 alkyl indicates that the group may have from 1 to 20 (inclusive) carbon atoms in it. Any atom can be substituted.
  • alkyl groups include without limitation methyl, ethyl, n-propyl, zsopropyl, and tert-butyl.
  • cycloalkyl refers to saturated monocyclic, bicyclic, tricyclic, or other polycyclic hydrocarbon groups (e.g., C 3 -C 20 , C 3 -Ci 0 , C 3 -C 6 ). Any atom can be substituted, e.g., by one or more substituents.
  • a ring carbon serves as the point of attachment of a cycloalkyl group to another moiety.
  • Cycloalkyl groups can contain fused rings. Fused rings are rings that share a common carbon atom.
  • Cycloalkyl moieties can include, e.g., cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, adamantyl, and norbornyl (bicycle[2.2.1]heptyl).
  • alkylene alkenylene
  • haloalkyl refers to an alkyl group (e.g., Ci-C 20 , e.g., Ci-Ci 0 ), in which at least one hydrogen atom is replaced by halo.
  • more than one hydrogen atom (2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,etc. hydrogen atoms) on a alkyl group can be replaced by more than one halogen (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, etc. halogen atoms).
  • the hydrogen atoms can each be replaced by the same halogen (e.g., fluoro) or the hydrogen atoms can be replaced by a combination of different halogens (e.g., fluoro and chloro).
  • Haloalkyl also includes alkyl moieties in which all hydrogens have been replaced by halo (e.g., perhaloalkyl, e.g., perfluoroalkyl, such as trifluoromethyl).
  • aralkyl refers to an alkyl moiety in which an alkyl hydrogen atom is replaced by an aryl group.
  • One of the carbons of the alkyl moiety serves as the point of attachment of the aralkyl group to another moiety.
  • Aralkyl includes groups in which more than one hydrogen atom on an alkyl moiety has been replaced by an aryl group. Any ring or chain atom can be substituted e.g., by one or more substituents.
  • Non- limiting examples of “aralkyl” include benzyl, 2-phenylethyl, 3-phenylpropyl, benzhydryl (diphenylmethyl), and trityl (triphenylmethyl) groups.
  • heterooaralkyl e.g., 5-16 atoms, 5-14 atoms, 5-10 atoms, 5-6 atoms
  • One of the carbons of the alkyl moiety serves as the point of attachment of the aralkyl group to another moiety.
  • Heteroaralkyl includes groups in which more than one hydrogen atom on an alkyl moiety has been replaced by a heteroaryl group. Any ring or chain atom can be substituted e.g., by one or more substituents. Heteroaralkyl can include, for example, 2- pyridylethyl.
  • alkenyl refers to a straight or branched hydrocarbon chain containing 2-20 (e.g., 2-12, 2-10, 2-6, 2-4) carbon atoms and having one or more double bonds. Any atom can be substituted, e.g., by one or more substituents.
  • Alkenyl groups can include internal or terminal double bond containing, e.g., allyl, 1-butenyl, 2-hexenyl and 3-octenyl groups. One of the double bond carbons can optionally be the point of attachment of the alkenyl substituent.
  • alkynyl refers to a straight or branched hydrocarbon chain containing 2-20 (e.g., 2-12, 2-10, 2-6, 2-4) carbon atoms and having one or more triple bonds. Any atom can be substituted, e.g., by one or more substituents.
  • Alkynyl groups can include internal or terminal triple bond containing moieties, e.g., ethynyl, propargyl, and 3-hexynyl.
  • One of the triple bond carbons can optionally be the point of attachment of the alkynyl substituent.
  • alkoxy refers to an -O-alkyl radical.
  • mercapto refers to an SH radical.
  • thioalkoxy refers to an -S-alkyl radical.
  • aryloxy and heteroaryloxy refer to an -O-aryl radical and -O-heteroaryl radical, respectively.
  • thioaryloxy and thioheteroaryloxy refer to an -S-aryl radical and -S-heteroaryl radical, respectively.
  • aralkoxy and “heteroaralkoxy” refer to an -O-aralkyl radical and -O- heteroaralkyl radical, respectively.
  • thioaralkoxy and “thioheteroaralkoxy” refer to an -S-aralkyl radical and -S-heteroaralkyl radical, respectively.
  • cycloalkoxy refers to an -O-cycloalkyl radical.
  • cycloalkenyloxy and “heterocycloalkenyloxy” refer to an -O-cycloalkenyl radical and -O-heterocycloalkenyl radical, respectively.
  • heterocyclyloxy refers to an -O-heterocyclyl radical.
  • thiocycloalkoxy refers to an -S-cycloalkyl radical.
  • thiocycloalkenyloxy and “thioheterocycloalkenyloxy” refer to an -S-cycloalkenyl radical and -S-heterocycloalkenyl radical, respectively.
  • thioheterocyclyloxy refers to an -S-heterocyclyl radical.
  • heterocyclyl refers to a saturated monocyclic, bicyclic, tricyclic or other polycyclic ring system having 1-4 heteroatoms if monocyclic, 1-8 heteroatoms if bicyclic, or 1-10 heteroatoms if tricyclic, said heteroatoms selected from O, N, or S (and mono and dioxides thereof, e.g., N ⁇ O ⁇ , S(O), SO 2 ).
  • a heterocyclyl ring includes carbon atoms and 1-4, 1-8, or 1-10 heteroatoms selected from N, O, or S if monocyclic, bicyclic, or tricyclic, respectively.
  • a ring heteroatom or ring carbon is the point of attachment of the heterocyclyl substituent to another moiety. Any atom can be substituted, e.g., by one or more substituents.
  • the heterocyclyl groups can contain fused rings. Fused rings are rings that share a common carbon or nitrogen atom.
  • Heterocyclyl groups can include, e.g., tetrahydrofuryl, tetrahydropyranyl, piperidyl (piperidino), piperazinyl, morpholinyl (morpholino), pyrrolinyl, and pyrrolidinyl.
  • cycloalkenyl refers to partially unsaturated monocyclic, bicyclic, tricyclic, or other polycyclic hydrocarbon groups (e.g., C 3 -C 2O , C 3 -Ci 0 , C 3 -C 6 ).
  • a ring carbon e.g., saturated or unsaturated is the point of attachment of the cycloalkenyl substituent. Any atom can be substituted e.g., by one or more substituents.
  • the cycloalkenyl groups can contain fused rings. Fused rings are rings that share a common carbon atom. Cycloalkenyl moieties can include, e.g., cyclohexenyl, cyclohexadienyl, or norbornenyl.
  • heterocycloalkenyl refers to partially unsaturated monocyclic, bicyclic, tricyclic, or other polycyclic hydrocarbon groups having 1-4 heteroatoms if monocyclic, 1-8 heteroatoms if bicyclic, or 1-10 heteroatoms if tricyclic, said heteroatoms selected from O, N, or S (and mono and dioxides thereof, e.g., N ⁇ O ⁇ , S(O), SO 2 ) (e.g., carbon atoms and 1-4, 1-8, or 1-10 heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic, respectively).
  • a ring carbon (e.g., saturated or unsaturated) or heteroatom is the point of attachment of the heterocycloalkenyl substituent. Any atom can be substituted, e.g., by one or more substituents.
  • the heterocycloalkenyl groups can contain fused rings. Fused rings are rings that share a common carbon or nitrogen atom.
  • Heterocycloalkenyl groups can include, e.g., tetrahydropyridyl, dihydropyranyl, 4,5-dihydrooxazolyl, 4,5-dihydro-lH-imidazolyl, 1,2,5,6- tetrahydro-pyrimidinyl, and 5,6-dihydro-2H-[l,3]oxazinyl.
  • aryl refers to a fully unsaturated, aromatic monocyclic, bicyclic, or tricyclic, hydrocarbon ring system (e.g., C 6 -Ci 8 , C 6 -Ci 4 , C 6 -Ci 0 ), wherein any ring atom can be substituted, e.g., by one or more substituents.
  • Aryl groups can contain fused rings. Fused rings are rings that share a common carbon atom.
  • Aryl moieties can include, e.g., phenyl, naphthyl, anthracenyl, and pyrenyl.
  • heteroaryl refers to a fully unsaturated, aromatic monocyclic, bicyclic, tricyclic, or other polycyclic hydrocarbon groups having 1-4 heteroatoms if monocyclic, 1-8 heteroatoms if bicyclic, or 1-10 heteroatoms if tricyclic, said heteroatoms independently selected from O, N, or S (and mono and dioxides thereof, e.g., N ⁇ O ⁇ , S(O), SO 2 ) (e.g., carbon atoms and 1-4, 1- 8, or 1-10 heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic, respectively).
  • Heteroaryl groups can contain fused rings. Fused rings are rings that share a common carbon or nitrogen atom. Heteroaryl groups can include, e.g., pyridyl, thienyl, furyl (furanyl), imidazolyl, indolyl, isoquinolyl, quinolyl and pyrrolyl.
  • arylheterocyclyl and “heteroarylheterocyclyl” refer to bicyclic, tricyclic, or other polycyclic ring systems that include an aryl or heteroaryl ring, respectively, that is fused to a heterocyclyl ring that includes from 1-3 heteroatoms independently selected from O, N, or S (and mono and dioxides thereof, e.g., N ⁇ O ⁇ , S(O), SO 2 ,).
  • the remaining ring atoms of the heterocyclyl ring are carbon. Any atom can be substituted, e.g., by one or more substituents.
  • a ring atom on either the aryl portion or the heterocyclyl portion can serve as the point of attachment of the arylheterocyclyl to another moiety.
  • Examples can include without limitation the ring systems delineated below under the definitions of arylazacyclyl, arylsulfinylcyclyl, heteroarylsulfinylcyclyl, arylsulfonylcyclyl, and heteroarylsulfonylcyclyl.
  • arylazacyclyl refers to bicyclic, tricyclic, or other polycyclic ring systems that include an aryl ring fused to a heterocyclyl ring that includes one nitrogen ring atom (the remaining ring atoms of the heterocyclyl ring are carbon). Any atom can be substituted, e.g., by one or more substituents.
  • a ring atom on either the aryl portion or the heterocyclyl portion can serve as the point of attachment of the arylazacyclyl to another moiety.
  • arylazacyclyl can include 1,2,3,4-tetrahydroquinolyl, 1,2,3,4-tetrahydroisoquinolyl, and isoindolinyl-l,3-dione (phthalimido).
  • arylsulfinylcyclyl and “heteroarylsulfinylcyclyl” (e.g., 8-20 ring atoms, 8-12 ring atoms, 8-10 ring atoms) refer to bicyclic, tricyclic, or other polycyclic ring systems that include an aryl or heteroaryl ring, respectively, that is fused to a heterocyclyl ring that includes one -S(O)- (sulfinyl) ring atom (i.e., the sulfur atom of which forms part of the ring system, and the remaining ring atoms of the heterocyclyl ring are carbon. Any atom can be substituted, e.g., by one or more substituents.
  • a carbon ring atom on either the aryl/heteroaryl portion or the heterocyclyl portion can serve as the point of attachment of the arylsulfinylcyclyl and heteroarylsulfinylcyclyl to another moiety.
  • such ring systems can include:
  • arylsulfonylcyclyl and “heteroarylsulfonylcyclyl” (e.g., e.g., 8-20 ring atoms, 8-12 ring atoms, 8-10 ring atoms) refer to bicyclic, tricyclic, or other polycyclic ring systems that include an aryl or heteroaryl ring, respectively, that is fused to a heterocyclyl ring that includes one -SO 2 - (sulfonyl) ring atom (i.e., the sulfur atom of which forms part of the ring system, and the remaining ring atoms of the heterocyclyl ring are carbon,).
  • Any atom can be substituted, e.g., by one or more substituents.
  • a carbon ring atom on either the aryl/heteroaryl portion or the heterocyclyl portion can serve as the point of attachment of the arylsulfonylcyclyl and heteroarylsulfonylcyclyl to another moiety.
  • such ring systems can include:
  • Descriptors such as C(O), C(S), and C(NR 1 ) refer to carbon atoms that are doubly bonded to an oxygen, sulfur, and nitrogen atom, respectively.
  • substituted refers to a group “substituted” on, e.g., an alkyl, haloalkyl, cycloalkyl, alkenyl, alkynyl, aralkyl, heteroaralkyl, heterocyclyl, heterocycloalkenyl, cycloalkenyl, aryl, or heteroaryl group at any atom of that group.
  • the substituent(s) (e.g., R d ) on a group are independently any one single, or any combination of two or more of the permissible atoms or groups of atoms delineated for that substituent.
  • a substituent may itself be substituted with any one of the above substituents (e.g., R d' ).
  • the compounds have agonist activity for genes involved with HDL production and cholesterol efflux (e.g., ABCAl) and antagonist activity for genes involved with triglyceride synthesis (e.g., SREBP-Ic).
  • agonist activity for genes involved with HDL production and cholesterol efflux e.g., ABCAl
  • antagonist activity for genes involved with triglyceride synthesis e.g., SREBP-Ic.
  • This invention relates generally to quino line-based modulators of LXRs and related methods and compositions.
  • the quino line -based LXR modulators have the general formula (I):
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , X, Y, W, W 1 , A, R a , R a' , R b , R b' , R c , R d , R d' , R e , R f , R f , R s , R 1 R, R k , R m , R n , n, and t can be as defined anywhere herein.
  • the range Ci-C 4 alkyl is understood to mean Ci, C 2 , C 3 , C 4 , Ci-C 4 , Ci-C 3 , Ci-C 2 , C 2 -C 4 , C 2 -C 3 , or C 3 -C 4 alkyl and the range 1-3 R a is understood to mean 1, 2, 3, 1-3, 1-2, or 2-3 R a .
  • R 1 can be hydrogen.
  • R 2 can be hydrogen.
  • R can be:
  • C 1 -C 12 e.g., C 1 -C 6 or C 1 -C 4 alkyl or C 1 -C 12 (e.g., C 1 -C 6 or C 1 -C 4 ) haloalkyl, each of which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) R a ; or
  • C 7 -C 20 e.g., C 7 -C 16 , C 7 -C 12 , C 7 -C 10
  • aralkyl or heteroaralkyl including 6-20 (e.g., 6-14, 6-12, 6-10) atoms, each of which is optionally substituted with from 1-10 (e.g., 1-5, 1-4, 1-3, 1-2, l) R b ; or
  • C 6 -C 18 e.g., C 6 -C 14 , C 6 -C 10 , phenyl
  • aryl or heteroaryl including 5-16 (e.g., 5-14, 5-10, 5-6) atoms, each of which is optionally substituted with from 1-10 (e.g., 1-5, 1-4, 1-3, 1- 2, 1) R d ; or
  • R 2 can be:
  • C 1 -C 12 e.g., C 1 -C 6 or C 1 -C 4 alkyl or C 1 -C 12 (e.g., C 1 -C 6 or C 1 -C 4 ) haloalkyl, each of which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) R a ; or (iii) C 7 -C 20 (e.g., C 7 -C 16 , C 7 -C 12 , C 7 -C 10 ) aralkyl or heteroaralkyl including 6-20 (e.g.,
  • R 2 can be: (ii) C 1 -C 6 alkyl that is optionally substituted with from 1-2 R a ; or (iii) C 7 -C 10 aralkyl that is optionally substituted with from 1-3 R b ; or (vii) -
  • R can be hydrogen
  • R can be C 1 -C 6 (e.g., C 1 -C 4 ) alkyl, which is optionally substituted with 1 or 2 R a (e.g., NR s R h , hydroxy, cyano, or -C(O)OR).
  • R a e.g., NR s R h , hydroxy, cyano, or -C(O)OR.
  • R can be CH 3 (methyl), ethyl, n-propyl, or iso-propyl.
  • An exemplary R 2 substituent is CH 3 .
  • R can be C 1 -C 6 (e.g., C 1 or C 2 ) alkyl substituted with one R a .
  • R a can be hydroxy or NR s R h .
  • R 2 can be CH 2 NR s R h .
  • R s and R h can be both hydrogen.
  • one of R s and R h can be hydrogen, and the other can be Ci-C 2 O (e.g., Ci-Ci 0 , Ci-C 6 , Ci-C 3 ) haloalkyl (e.g., fluoromethyl, trifluoromethyl, or fluoroethyl); or Ci-C 2O alkyl (e.g.
  • Ci-C 20 alkoxy e.g., Ci-Ci 0 , Ci-C 6 , Ci-C 3 , e.g., methoxy
  • cyano C 2 -C 20 (e.g., C 2 -Ci 0 , C 2 -C 6 , C 2 -C 3 ) alkenyl (e.g., allyl), or C 3 -C 20 cycloalkyl
  • R 2 can be C 7 -Ci 0 aralkyl, which is optionally substituted with from 1-3 (e.g., 1-2, 1) R b (e.g., C r C 3 alkyl; C r C 3 haloalkyl, e.g., Q-C 3 perfluoroalkyl; halogen; or CN).
  • R b e.g., C r C 3 alkyl; C r C 3 haloalkyl, e.g., Q-C 3 perfluoroalkyl; halogen; or CN.
  • An exemplary R 2 aralkyl substituent is benzyl.
  • R can be cyano. In certain embodiments, R 2 can be halo.
  • R can be C 1 -C 4 haloalkyl, (e.g., C 1 -C 4 perhaloalkyl, e.g., CF 3 ). In certain embodiments, R can be C 6 -Ci 0 aryl that is optionally substituted with from
  • R d e.g., Q-C 3 alkyl; Ci-C 3 haloalkyl, e.g., C r C 3 perfluoroalkyl; halogen; or CN.
  • R 2 can be phenyl optionally substituted with from 1-3 R d .
  • R 2 can be heteroaryl including 5-10atoms that is optionally substituted with from 1-3 (e.g., 1-2, 1) R d (e.g., C r C 3 alkyl; C r C 3 haloalkyl, e.g., Q-C 3 perfluoroalkyl; halogen; CN; NR s R h ; or Ci-C 3 alkoxy).
  • R d e.g., C r C 3 alkyl; C r C 3 haloalkyl, e.g., Q-C 3 perfluoroalkyl; halogen; CN; NR s R h ; or Ci-C 3 alkoxy.
  • R 2 can be pyridyl, pyrimidinyl, thienyl, benzisoxazolyl, benzothienyl, oxadiazolyl, pyrrolyl, pyrazolyl, imidazolyl, tetrazolyl, or furyl, each of which can be optionally substituted with from 1-3 R d .
  • An exemplary R 2 heteroaryl substituent is tetrazolyl.
  • R 2 can be C 3 -C 7 cycloalkyl or heterocyclyl including 3-7 atoms, each of which can be optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) R b .
  • R b when R b is present, R b can be attached to the same carbon atom that connects the cycloalkyl or heterocyclyl ring to the 3 -position of the quinoline core.
  • R 2 can be -XR 8 .
  • X can be -C(O)O-, thereby forming an ester moiety of the formula - C(O)OR 8 .
  • R 8 can be hydrogen or Ci-C 6 (e.g., Ci-C 4 ) alkyl (e.g., methyl or ethyl).
  • X can be -C(O)NR 9 -, thereby forming an amide moiety of the formula -C(O)NR 9 R 8 .
  • R 8 and R 9 can each be, independently, hydrogen or Ci-C 6 (e.g., C 1 -C 4 ) alkyl.
  • R 8 and R 9 can both be hydrogen; or one of R 8 and R 9 can be hydrogen, and the other can be Ci-C 6 (e.g., Ci-C 4 ) alkyl (e.g., CH 3 or ethyl).
  • X can be -S(O) r , thereby forming a sulfone moiety of the formula - S(O) t R 8 .
  • R 8 can be hydrogen or Ci-C 6 (e.g., Ci-C 4 ) alkyl (e.g., ethyl), and t can be 0, 1, or 2 (e.g., 2).
  • X can be -NR 9 -, thereby forming an amino moiety of the formula -NR 8 R 9 .
  • R 9 can be hydrogen or Ci-C 6 (e.g., Ci-C 4 ) alkyl, and R 8 can be as defined anywhere herein. In certain embodiment, R 8 and R 9 can both be hydrogen.
  • R 3 can be C 6 -Ci 8 (e.g., C 6 -Ci 4 , C 6 -Ci 0 , phenyl) aryl, which is
  • each R e can be independently of one another: Ci-C 3 alkyl; Ci-C 3 haloalkyl, e.g., Ci-C 3 perfluoroalkyl; halogen; or CN.
  • R can be C 6 -CiO aryl, which is (i) substituted with from 1-5
  • R 10 (e.g., 1-4, 1-3, 1-2, 1) R 10 and (ii) optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1) R e .
  • R 3 can be C 6 -CiO aryl, which is (i) substituted with 1 or 2 R 10 and (ii) optionally substituted with 1 or 2 R e .
  • R 3 can be naphthyl, which is (i) substituted with 1 or 2 R 10 and (ii) optionally substituted with 1 or 2 R e .
  • R 3 can be phenyl, which is (i) substituted with 1 or 2 R 10 and (ii) optionally substituted with 1 or 2 R e (e.g., 1 R e , which can be, e.g., halo, e.g., fluoro or chloro).
  • R 3 can be C 6 -Ci 0 aryl, which is (i) substituted with 1 R 10 and (ii) optionally substituted with 1 or 2 R e .
  • R 3 can be phenyl, which is (i) substituted with 1 R 10 and (ii) optionally substituted with 1 or 2 R e (e.g., halo).
  • R can have formula (A), in which R 10 (i.e., the moiety -WA) can be attached to a ring carbon that is ortho, meta, or para (preferably meta) with respect to the ring carbon that connects the phenyl ring to the 4-position of the quinoline ring, and R e , when present can be connected to ring carbons that are not occupied by WA.
  • R 3 can have formula (A-I) or (A-I '), in which R 10 (WA) is attached to the ring carbon that is meta with respect to the ring carbon that connects the phenyl ring to the 4-position of the quinoline ring in formula (I).
  • R 3 can be phenyl that is substituted with 1 R 10 , and R 3 can have formula (A-2), e.g., formula (A-3):
  • R can have formula (A-4):
  • W and A can be as defined anywhere herein; and R 32 can be hydrogen; or R e (e.g., halo, e.g., chloro or fluoro).
  • R 3 can be heteroaryl including 5-16 (e.g., 5-14, 5-10, 5-6) atoms, which is (i) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) R 10 and (ii) optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1) R e .
  • each R e can be independently of one another: Ci-C 3 alkyl; Ci-C 3 haloalkyl, e.g., Ci-C 3 perfluoroalkyl; halogen; or CN.
  • R can be heteroaryl including 5-10 atoms, which is (i) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) R 10 and (ii) optionally substituted with from
  • R 3 can be heteroaryl including 5-10 atoms, which is (i) substituted with from 1-4 (e.g., 1-3, 1-2, 1) R 10 and (ii) optionally substituted with 1 or 2 R e .
  • R 3 can be heteroaryl including 5-6 atoms, which is (i) substituted with from 1-4 (e.g., 1-3, 1-2, 1) R 10 and (ii) optionally substituted with 1 or 2 R e
  • Ci-C 3 haloalkyl e.g., Ci-C 3 perfluoroalkyl, e.g., Ci-C 2 perfluoroalkyl; or halogen.
  • R can be pyridyl, pyrimidinyl, thienyl, or furyl (e.g., pyridyl or pyrimidinyl), which is (i) substituted with from 1-4 (e.g., 1-3, 1-2, 1) R 10 and (ii) optionally substituted with 1 or 2 R e (e.g., Ci-C 3 haloalkyl, e.g., Ci-C 3 perfluoroalkyl, e.g., Ci-C 2 perfluoroalkyl; or halogen).
  • R e e.g., Ci-C 3 haloalkyl, e.g., Ci-C 3 perfluoroalkyl, e.g., Ci-C 2 perfluoroalkyl; or halogen.
  • R can be heteroaryl including 5-10 (e.g., 5-6) atoms, which is (i) substituted with 1 R 10 , and (ii) optionally substituted with from 1 -2 R e .
  • R 3 can be pyridyl, pyrimidinyl, thienyl, thiazolyl, pyrazoly, or furyl (e.g., pyridyl, thienyl, thiazolyl, or pyrazoly), which is (i) substituted with from 1 R 10 and (ii) optionally substituted with 1 or 2 R e (e.g., Ci-C 3 haloalkyl, e.g., Ci-C 3 perfluoroalkyl, e.g., Ci-C 2 perfluoroalkyl; or halogen).
  • R e e.g., Ci-C 3 haloalkyl, e.g., Ci-C 3 perfluoroalkyl, e.g., Ci-C 2 perfluoroalkyl; or halogen
  • R 3 can be pyridyl, thienyl, pyrazoly, or thiazolyl (e.g., thienyl or thiazolyl).
  • W can be -O-.
  • W can be a bond
  • W can be Ci-C 3 alkylene (e.g., CH 2 ).
  • W can be C 2 -C 4 alkynylene (e.g., -C ⁇ C-).
  • W can be alkylene)- or -(Ci-C 3 alkylene) W 1 - (e.g., -0(Ci-C 3 alkylene)- or -(C r C 3 alkylene)O-, e.g., -OCH 2 - or -CH 2 O-); or W can be -0-, a bond, -0(Ci-C 3 alkylene)-, and -(C r C 3 alkylene)O-.
  • A can be a cyclic group that is (a) substituted with one or more R f ; and (b) optionally substituted with from 1-4 R e .
  • A can be: (i-A) C 6 -Ci 0 (e.g., phenyl) aryl, which is (a) substituted with from 1-5 (e.g., 1-4, 1-3,
  • heteroaryl including 5-10 (e.g., 5-8) atoms which is (a) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1, e.g., 1) R f ; and (b) is optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1, e.g., 1-3) R e ; provided that the heteroaryl including 5-10 atoms is not [1,2,4]- oxadiazolyl; and/or
  • arylazacyclyl including 8-12 atoms e.g., tetrahydroquinolyl or tetrahydroisoquinolyl
  • which is (a) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1, e.g., 1) R f
  • R f e.g., 1, e.g., 1, e.g., 1, e.g., 1, e.g., 1-2) R e .
  • any one of the following combinations can apply for defining A:
  • A can be C 6 -Ci 0 aryl, which is (i) substituted with from 1-3 (e.g., 1-2, 1) R f and (ii) optionally substituted with 1 or 2 R e .
  • A can be naphthyl, which is (i) substituted with from 1-3 (e.g., 1-2, 1) R f and (ii) optionally substituted with 1 or 2 R e .
  • A can be phenyl, which is (i) substituted with from 1-3 (e.g., 1-2, 1) R f and (ii) optionally substituted with 1 or 2 R e .
  • A can be phenyl, which is (i) substituted with 1 R f and (ii) optionally substituted with 1 or 2 R e .
  • A can have formula (B-I), (B-2), or (B-3), in which R f can be attached to a ring carbon that is ortho, meta, or para, respectively (preferably meta) with respect to the ring carbon that is attached to W:
  • A can have formula (B-4), (B-5), (B-6), or (B-7) in which the phenyl ring is substituted with (a) 1 R f and (b) 1 R e :
  • A can have formula (B- ), in which the phenyl ring is substituted with (a) 1 R f and (b) 2 R e : (B-8)
  • A can have formula (B-9):
  • each of R ⁇ 2 and R ⁇ 3 can be, independently, hydrogen or R e ; and one of R A24 and R A25 can be R f (e.g., -SO 2 R n ), and the other is hydrogen or R e .
  • R A22 , R A23 , R A24 , and R A25 is provided that only one of R A22 , R A23 , R A24 , and R A25 is
  • R A25 can be R f (e.g., -SO 2 R n ), and each of R A22 , R A23 , and R ⁇ 4 can be hydrogen.
  • R ⁇ 5 can be R f (e.g., -SO 2 R n ), one of R A22 , R ⁇ 3 , and R A24 (e.g., R ⁇ 3 ) can be R e , and the other two can each be hydrogen.
  • R A24 can be R f (e.g., -SO 2 R n ), and each of R ⁇ 2 , R ⁇ 3 , and R A25 can be hydrogen.
  • R ⁇ 4 can be R f (e.g., -SO 2 R n ), one of R A22 , R A23 , and R A25 (e.g., R A22 ) can be R e , and the other two can each be hydrogen.
  • A can be heteroaryl including 5-10 atoms, which is (a) substituted with from 1-3 (e.g., 1-2, 1,) R f ; and (b) is optionally substituted with from 1-3 (e.g., 1-2, 1) R e ; provided that the heteroaryl including 5-10 atoms is not [l,2,4]-oxadiazolyl.
  • A can be heteroaryl including 5-10 atoms, which is (a) substituted with 1 R f ; and (b) is optionally substituted with from 1-3 (e.g., 1-2, 1) R e ; provided that the heteroaryl including 5-10 atoms is not [l,2,4]-oxadiazolyl.
  • A can be heteroaryl including 5-8 atoms, which is (a) substituted with 1 R f ; and (b) is optionally substituted with from 1-3 (e.g., 1-2, 1) R e ; provided that the heteroaryl including 5-10 atoms is not [l,2,4]-oxadiazolyl.
  • A can be pyrrolyl, pyridyl, pyridyl-N-oxide, pyrimidinyl, pyrazolyl, thienyl, furyl, quinolyl, oxazolyl, thiazolyl, imidazolyl, isoxazolyl, or indolyl, each of which is (a) substituted with 1 R f ; and (b) is optionally substituted with from 1-3 (e.g., 1-2, l) R e .
  • A can be pyrrolyl, pyridyl, pyrimidinyl, pyrazolyl, thienyl, furyl, quinolyl, oxazolyl, thiazolyl, imidazolyl, or isoxazolyl, each of which is (a) substituted with 1 R f ; and (b) is optionally substituted with from 1-3 (e.g., 1-2, 1) R e .
  • A can be pyridyl, pyrimidinyl, thienyl, furyl, oxazolyl, thiazolyl, imidazolyl, or isoxazolyl, each of which is (a) substituted with 1 R f ; and (b) is optionally substituted with from 1-3 (e.g., 1-2, 1) R e .
  • A can be pyridyl in which W is attached to the 2- or 3- position of the pyridiyl ring.
  • A can be pyridyl in which W is attached to the 2-position of the pyridyl ring, and R f is attached to the 4- or the 6-position of the pyridyl ring.
  • Such rings can be further substituted with 1, 2 or 3 R e (e.g., halo, e.g., chloro; or NR s R h , e.g., NH 2 ).
  • R e e.g., halo, e.g., chloro; or NR s R h , e.g., NH 2 .
  • A can be pyridyl in which W is attached to the 2-position of the pyridyl ring, R f is attached to the 6-position of the pyridyl ring, and 1 R e is attached to the 4-position of the pyridyl ring.
  • A can be pyridyl in which W is attached to the 2-position of the pyridyl ring, R f is attached to the 6-position of the pyridyl ring, and an R e substituent is attached to the 3-, 4-, and 5-positions of the pyridyl ring.
  • A can be pyridyl in which W is attached to the 3 -position of the pyridyl ring, and R f is attached to the 5-position of the pyridyl ring.
  • Such a ring can be further substituted with 1, 2 or 3 R e (e.g., halo, e.g., chloro; or NR s R h , e.g., NH 2 ).
  • A can be thienyl in which W is attached to the 2-position of the thienyl ring, and R f is attached to the 5-position of the thienyl ring.
  • Such a ring can be further substituted with 1 , 2 or 3 R e (e.g., halo, e.g., chloro; or NR s R h , e.g., NH 2 ).
  • A can be tetrahydroquinolyl or tetrahydroisoquinolyl, which is (a) substituted with from 1-3 (e.g., 1-2, 1) R f ; and (b) is optionally substituted with from 1-3 (e.g., 1-2, 1) R e .
  • A can be tetrahydroquinolyl or tetrahydroisoquinolyl, which is
  • A can be tetrahydroquinolyl or tetrahydroisoquinolyl, which is substituted with 1 R f .
  • W can be attached to the aromatic ring portion of the tetrahydroquinolyl or tetrahydroisoquinolyl ring (e.g., the 5-position).
  • R f can be attached to the tetrahydroquinolyl or tetrahydroisoquinolyl nitrogen ring atom (e.g., when R f is SO 2 R n ).
  • W can be attached to the 5- position of the tetrahydroquinolyl or tetrahydroisoquinolyl ring, R f is SO 2 R n , and the SO 2 R 1 group is attached to the tetrahydroquinolyl or tetrahydroisoquinolyl nitrogen ring atom.
  • R e at each occurrence can be, independently, halo (e.g., fluoro or chloro), Ci-C 3 alkyl (e.g., CH 3 ), C r C 3 haloalkyl (e.g., CF 3 ), Q-C 3 alkoxy (e.g., OCH 3 ), NR s R h (e.g., NH 2 ), phenyl, or 4-fluorophenyl.
  • halo e.g., fluoro or chloro
  • Ci-C 3 alkyl e.g., CH 3
  • C r C 3 haloalkyl e.g., CF 3
  • Q-C 3 alkoxy e.g., OCH 3
  • NR s R h e.g., NH 2
  • phenyl e.g., NH 2
  • R e at each occurrence can be, independently, halo (e.g., fluoro or chloro), Ci-C 3 alkyl (e.g., CH 3 ), Ci-C 3 haloalkyl (e.g., CF 3 ), Q-C 3 alkoxy (e.g., OCH 3 ), NR s R h (e.g., NH 2 ).
  • halo e.g., fluoro or chloro
  • Ci-C 3 alkyl e.g., CH 3
  • Ci-C 3 haloalkyl e.g., CF 3
  • Q-C 3 alkoxy e.g., OCH 3
  • NR s R h e.g., NH 2
  • A can be a cyclic group that (a) includes a substituted ring atom selected from the group consisting of S(O) and SO 2 , e.g., SO 2 ; and (b) is optionally substituted with from 1 -4 R e .
  • A can be heteroaryl including 5-10 (e.g., 5-8) atoms that (a) includes a substituted ring atom selected from the group consisting of S(O) and SO 2 ; and (b) is optionally substituted with from 1-4 (b) is optionally substituted with from 1-4 (e.g., 1-3, 1- 2, l, e.g., 1-3) R e .
  • A can be heteroaryl including 5-10 (e.g., 5-8) atoms that (a) includes a substituted ring atom selected from the group consisting of S(O) and SO 2 , e.g.,
  • A can be benzo[b]thienyl 1,1 -dioxide (e.g., in which W is attached to the phenyl ring portion of the benzo[b]thienyl ring system, e.g., the 4-position thereof; or W is attached to the thienyl ring portion of the benzo[b]thienyl ring system, e.g., the 3-position thereof).
  • A can be arylsulfonylcyclyl or heteroarylsulfonylcyclyl, each of which includes 8-10 atoms and is optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1, e.g., l-3)R e .
  • A can be heteroarylsulfonylcyclyl, which includes 8-10 atoms and is optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1, e.g., l-3)R e .
  • A can be 3,4-dihydro-2H- thiopyrano[2,3-b]pyridyl 1,1-dioxide (e.g., in which W is attached to the pyridyl ring portion of the thiopyrano[2,3-b]pyridyl ring system, e.g., the 2- or 4- position thereof).
  • A can be arylsulfonylcyclyl, which includes 8-10 atoms and is optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1, e.g., l-3)R e .
  • A can be 2,3-dihydro-benzo[b]thienyl 1,1 -dioxide (e.g., in which W is attached to the phenyl ring portion of the benzo[b]thienyl ring system, e.g., the 4-position thereof).
  • R e at each occurrence can be, independently, halo; C 1 -C 3 alkyl, optionally substituted with from 1-2 R a ; C 1 -C3 haloalkyl; C 1 -C3 alkoxy; hydroxyl; cyano; nitro; NR s R h ; phenyl; or 4-fluorophenyl.
  • R e at each occurrence can be, independently, halo; C 1 -C 3 alkyl, optionally substituted with from 1-2 R a (e.g., R a can be C(O)NR s R h ); hydroxyl; cyano; or nitro.
  • A can be[l,2,4]-oxadiazolyl, optionally substituted with from 1 R e .
  • A can have formula (C):
  • R e can be hydrogen; halo; C 1 -C 3 alkyl, optionally substituted with from 1-2 R a ; Ci- C3 haloalkyl; C 1 -C3 alkoxy; hydroxyl; cyano; nitro; NR s R h ; phenyl; or 4-fluorophenyl.
  • R e can be hydrogen; halo; Ci-Ce alkyl, optionally substituted with from 1-2 R a (e.g., R a can be C(O)NR s R h ); Ci-C 3 haloalkyl; Ci-C 3 alkoxy; NR s R h ; phenyl; or 4- fluorophenyl.
  • R e can be hydrogen; halo; C 1 -C 3 alkyl, optionally substituted with from 1-2 R a (e.g., R a can be C(O)NR s R h ); hydroxyl; cyano; or nitro.
  • R f at each occurrence can be: (i-F) -S(O) n R 1 or -NR k S(O) n R n , in which n is 0, 1 or 2 (e.g., 1 or 2); and/or (ii-F) -NR k C(O)NR s R h or -NR k C(O)OR; and/or (iii-F) heterocyclyl including 5-10 (e.g., 5-7) atoms that is substituted with from 1
  • 0x0 and optionally substituted with from 1-3 (e.g., 1-2, 1) R e ; and/or
  • any one of the following combinations can apply for defining
  • R f can be -S(O) n R n (e.g., -SO 2 R 11 ).
  • R n when R n is R J , then R J is other than hydrogen.
  • n can be 0; or n can be 1 or 2.
  • R n can be Ci-Ci 0 (e.g., Ci-C 5 or C 2 -C 8 or C 3 -C 8 ) alkyl or d-
  • Cio e.g., Ci-C 5 or Ci-C 3 haloalkyl, optionally substituted with from 1-2 R a .
  • R n can be Ci-Ci 0 (e.g., Ci-C 3 or C 2 -C 8 or C 3 -C 8 ) alkyl, optionally substituted with from 1-2 (e.g., 1) R a .
  • R n can be unsubstituted branched or unbranched Ci-Ci 0 (e.g., Ci-C 5 , Ci-C 3 , C 2 -C 8 , or C 3 -C 8 ) alkyl. In embodiments, R n can be unsubstituted Ci-C 3 alkyl.
  • R n can be methyl (CH 3 ).
  • R n can be ethyl (CH 2 CH 3 ).
  • R n can be zsopropyl (CH(CH 3 ) 2 ).
  • R n can be CH 2 CH 2 CH 3 , CH(CH 3 ) 2 , or CH(CH 3 )CH 2 CH 3 .
  • R n can be Ci-Ci 0 (e.g., Ci-C 5 or Ci-C 3 ) haloalkyl.
  • R n can be CF 3 or CH 2 CH 2 CH 2 Cl.
  • R n can be C 2 -C 8 alkyl or C 3 -C 8 alkyl substituted with 1 -2 (e.g., 1) R a .
  • R a can be hydroxyl; Q-C 3 alkoxy; NR s R h ; aryl heterocyclyl including 8-10 atoms optionally substituted with from 1-3 R b (e.g., oxo); or C(O)OR; or R a can be hydroxyl; Ci-C 3 alkoxy; NR s R h ; halo; arylheterocyclyl including 8-10 atoms, optionally substituted with from 1-3 R b ; cyano; or C(O)OR.
  • R n can be branched or unbranched C 3 -C 8 alkyl, which is substituted with 1-2 (e.g., 1) R a .
  • R a can be: (i) hydroxyl; or
  • Ci-C 3 alkoxy e.g., OCH 3
  • NR s R h e.g., R s and R h can be, independently of one another, hydrogen; Ci-Ce alkyl, optionally substituted with from 1-2 R a ; C 7 -Ci 0 aralkyl, optionally substituted with from
  • R a can be NH 2 , NHCH 3 , NH(Et), or NH(z-propyl)); or (iv) cyano; or
  • arylheterocyclyl including 8-20, e.g., 8-10, atoms optionally substituted with from 1-4, e.g., 1-2 R b (e.g., oxo, e.g., R a can be can be phthalimido); or
  • R a can be attached to a secondary or tertiary carbon atom of the alkyl group.
  • R n can be branched or unbranched Ci-C 8 (e.g., Ci, C 2 , or C 3 ) alkyl, which is substituted with 1 R a .
  • R a can be: (i) hydroxyl; or
  • arylheterocyclyl including 8-20, e.g., 8-10, atoms optionally substituted with from 1-4, e.g., 1-2 R b (e.g., oxo, e.g., R a can be can be phthalimido).
  • R n is alkyl substituted with one or more R a
  • R a is NR s R h
  • R s and R h can each be, independently, (i) hydrogen; or
  • Ci-C 8 alkyl e.g., CH 3 , CH 2 CH 3 , or CH(CH 3 )CH 2 CH 3
  • haloalkyl e.g., CH 2 CH 2 F or CH 2 CH 2 Cl
  • C 2 -CiO alkenyl or C 2 -C 2 O alkynyl e.g., C 3 alkenyl or alkynyl
  • C 7 -C 20 aralkyl e.g., benzyl
  • halo e.g., fluoro or chloro
  • R s and R h can be hydrogen or Ci-C 3 alkyl; and the other can be: (ii) Ci-C 8 (e.g., Ci-C 5 ) alkyl (e.g., CH 3 , CH 2 CH 3 , or CH(CH 3 )CH 2 CH 3 ) or haloalkyl (e.g., CH 2 CH 2 F or CH 2 CH 2 Cl), each of which is optionally substituted with cyano; or
  • C 2 -Ci 0 e.g., C 2 -C 6 alkenyl or C 2 -Ci 0 (e.g., C 2 -C 6 ) alkynyl (e.g., C 3 alkenyl or alkynyl); or
  • C 7 -C 20 e.g., C 7 -Ci 0
  • aralkyl e.g., benzyl
  • halo e.g., fluoro or chloro
  • R n can be -NR s R h .
  • R s and R h can each be, independently of one another:
  • Ci-Cio e.g., Ci-C 7 , Ci-C 6 , Ci-C 6 , Ci, C 2 -C 8 , C 2 , C 3 -C 8 alkyl (branched or unbranched as appropriate), optionally substituted with from 1-2 (e.g., 1) R a ; or (iii) C 6 -Ci 0 aryl (e.g., phenyl), optionally substituted with from 1-3 (e.g., 1-2, 1) R d
  • Ci e.g., Ci to C 3 alkyl, optionally substituted with 1-2 R a ; halogen, -CN or -CO 2 R);
  • C 7 -Ci 0 aralkyl e.g. benzyl
  • R b e.g., Ci to C 3 alkyl, optionally substituted with 1-2 R a ; halogen, -CN or -CO 2 R; or
  • R s and R h can each be, independently of one another, hydrogen; Ci-Ci 0 alkyl, optionally substituted with from 1-2 (e.g., 1) R a ; C 7 -Ci 0 aralkyl, optionally substituted with from 1-3 (e.g., 1-2, 1) R b ; or -C(O)R.
  • R s and R h can each be, independently of one another, hydrogen; Ci-C 6 unsubstituted alkyl; C 2 -C 8 alkyl substituted with hydroxyl or Ci-C 3 alkoxy; benzyl; or -C(O)CH 3 .
  • one of R s and R h can be hydrogen or Ci-C 3 alkyl; and the other can be:
  • Ci-Cio e.g., Ci-C 7 , Ci-C 6 , Ci-C 3 , Ci, C 2 -C 8 , C 2 , C 3 -C 8
  • alkyl or haloalkyl e.g., alkyl, e.g., branched or unbranched
  • 1-3 e.g., 1) R a
  • C 6 -Ci 0 aryl e.g., phenyl
  • C 7 -Ci 0 aralkyl e.g. benzyl
  • R b optionally substituted with from 1-3 (e.g., 1-2, 1) R b ;
  • R s and R h can both be: (i) hydrogen; or
  • R b can be C r C 20 (e.g., C r Ci 0 , Ci-C 6 , C r C 3 ) alkoxy (e.g., OCH 3 ).
  • R n can be -N(H)(R h ), -N(CH 3 )(R 11 ), or -N(CH 2 CH 3 )(R 11 ).
  • R h can be Ci-C 6 unsubstituted alkyl (e.g., CH 3 , CH 2 CH 3 , branched or unbranched C 3 -C 6 alkyl); C 2 -C 8 (e.g., C 3 -C 8 branched or unbranched alkyl), which is substituted with substituted with 1 R a .
  • R a can be hydroxyl, C 1 -C 3 alkoxy (e.g., OCH 3 ), NR s R h (e.g., NH 2 ), or cyano, preferably hydroxyl.
  • R h can be C 7 -Ci 0 aralkyl (e.g. benzyl), optionally substituted with 1 R b (e.g., halo, e.g., fluoro; or C 1 -C 6 alkoxy, e.g., OCH 3 ).
  • 1 R b e.g., halo, e.g., fluoro; or C 1 -C 6 alkoxy, e.g., OCH 3 .
  • R h can be -C(O)R (e.g., -C(O)CH 3 ).
  • R n can be heterocyclyl including 5-10 (e.g., 5-8, 5-6) atoms, optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1, e.g., 1) R b .
  • R n can be morpholin-4-yl, 1 -piperidyl, 4-piperidyl, piperazin-1-yl, or pyrrolidin- 1 -yl, each of which is optionally substituted with from 1-3 (e.g., 1-2, 1) R b .
  • R b can be C r C 3 alkyl or -C(O)OR (e.g., R can be Ci-C 4 alkyl, e.g., tert-butyl, or R can be Ci-C 4 alkyl, C 7 -C 20 (e.g., C 7 -Ci 0 ) aralkyl, e.g., benzyl).
  • R n can be C 7 -Ci 0 aralkyl (e.g., benzyl), optionally substituted with from 1-3 (e.g., 1-2, 1) R b .
  • R b can be Ci-C 3 alkyl, which is optionally substituted with from 1-2 (e.g., 1) R a ; halo; cyano; or C(O)OR.
  • R b can be Ci-C 3 alkyl (e.g., CH 3 ), which is optionally substituted with 1 R a (e.g., C(O)OR, e.g., C(O)OCH 3 ); or halo (e.g., fluoro).
  • R n can be C 3 -C 8 cycloalkyl (e.g., cyclopentyl), optionally substituted with from 1-3 (e.g., 1-2, 1) R b .
  • R n can be C 2 -C 6 alkenyl (e.g., allyl, 1-propenyl), optionally substituted with from 1-2 R c .
  • R n is C 6 -Ci 0 aryl, optionally substituted with from 1-2 R d .
  • RR dd ccaann be Ci-C 3 alkyl, which is optionally substituted with 1-2 (e.g., 1) R a ; halo; cyano; or C(O)OR.
  • R f can be -NR k S(O) n R n .
  • R k can be hydrogen.
  • R n can be Ci-C 6 alkyl (CH 3 , CH 2 CH 3 ), optionally substituted with from 1-2 R a ; or C 6 -Ci 0 (e.g., phenyl) aryl, optionally substituted with from 1- 2 R d (e.g., CH 3 ).
  • R f can be -NR k C(O)OR J or -NR k C(O)NR s R h .
  • R k can be hydrogen.
  • R s , R h , and R can each be, independently of one another, hydrogen; Ci-Ce alkyl, optionally substituted with from 1-2 R a (e.g., chloro) or C 6 -Ci 0 aryl, optionally substituted with from 1-2 R d (e.g., CH 3 ).
  • R J can be Ci-C 6 alkyl, optionally substituted with from 1-2 R a (e.g., chloro).
  • one of R s and R h can be hydrogen.
  • R f can be:
  • heterocyclyl including 5-7 atoms that is substituted with 1 oxo and optionally substituted with from 1 -2 R e ;
  • heterocycloalkenyl including 5-7 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -2 R e .
  • R f can be 4,5-dihydrooxazolyl, 2-oxo-imidazolidinyl, 4,5- dihydro-lH-imidazolyl, 1,2,5,6-tetrahydro-pyrimidinyl, 5,6-dihydro-2H-[l,3]oxazinyl, or 2- oxo-oxazolidinyl, each of which is optionally substituted with from 1-2 R e .
  • R f can be lH-benzoimidazolyl.
  • R e at each occurrence can be, independently, Ci to C 3 alkyl (e.g., CH 3 ) or haloalkyl, each of which is optionally substituted with from 1-2 R a (e.g., C(O)ORj, e.g., C(O)OH); or phenyl.
  • R a e.g., C(O)ORj, e.g., C(O)OH
  • each of R 4 , R 5 and R 6 can be, independently of one another, hydrogen or halo (e.g., fluoro). In certain embodiments, each of R 4 , R 5 and R 6 can be hydrogen. In certain embodiments, each of R 4 , R 5 and R 6 can be hydrogen, and R7 can be other than hydrogen (e.g., Ci-C 3 haloalkyl, e.g., CF 3 ).
  • R 7 can be hydrogen, halo, cyano, Ci-Ci 0 (e.g., Ci-C 6 or Ci-C 3 ) alkyl, or Ci-Ci 0 (e.g., Ci-C 6 or C r C 3 ) haloalkyl, Ci-C 20 alkoxy (e.g., methoxy), C(O)OR,
  • R 7 can be hydrogen, halo, cyano, Ci-Ci 0 (e.g., Ci-C 6 , Ci-C 3 ) alkyl, or Ci-Ci 0 (e.g., C r C 6 , C r C 3 ) haloalkyl, or SO 2 R m .
  • R 7 can be hydrogen, fluoro, chloro, cyano, Ci-Ci 0 (e.g., Ci-C 6 or Ci-C 3 ) alkyl, or Ci-Ci 0 (e.g., Ci-C 6 or Ci-C 3 ) haloalkyl, Ci-C 20 alkoxy (e.g., methoxy), C(O)OR, C(O)NR S R ⁇ or SO 2 R m .
  • R 7 can be hydrogen; chloro or bromo (e.g., chloro), cyano, Q- Ci 0 (e.g., Ci-C 6 , Ci-C 3 ) alkyl, or Q-Cio (e.g., Ci-C 6 , Ci-C 3 ) haloalkyl, or SO 2 R m
  • R 7 can be halo, cyano, Ci-Ci 0 (e.g., Ci-C 6 or Ci-C 3 ) alkyl, or Ci-Cio (e.g., Ci-C 6 or Ci-C 3 ) haloalkyl, Ci-C 20 alkoxy (methoxy), C(O)OR J , C(O)NR s R h , or c S ⁇ O 2 ⁇ R> m ⁇
  • R 7 can be halo, cyano, Ci-Ci 0 (e.g., Ci-C 6 , Ci-C 3 ) alkyl, or Q- Ci 0 (e.g., Ci-C 6 , Ci-C 3 ) haloalkyl, or SO 2 R m
  • R 7 can be fluoro, chloro, cyano, Ci-Ci 0 (e.g., Ci-C 6 or Ci-C 3 ) alkyl, or C r Ci 0 (e.g., Q-C 6 or Q-C 3 ) haloalkyl, Ci-C 20 alkoxy (e.g., methoxy), C(O)OR,
  • R 7 can be chloro or bromo (e.g., chloro); cyano, Ci-Ci 0 (e.g., Q-C 6 , Ci-C 3 ) alkyl, or Q-Q 0 (e.g., Q-C 6 , Q-C 3 ) haloalkyl, or SO 2 R m
  • R 7 can be chloro, cyano, Ci-C 6 alkyl, Ci-C 3 haloalkyl, Ci-C 6 alkoxy, C(O)OR, C(O)NR s R h , or SO 2 R m .
  • R 7 can be halo, Ci-Ci 0 (e.g., Ci-C 6 or Ci-C 3 ) alkyl, or Ci-Ci 0 (e.g., Q-C 6 or Q-C 3 ) haloalkyl, Q-C 20 alkoxy (e.g., methoxy), C(O)OR, C(O)NR s R h , or SO 2 R m
  • R 7 can be halo, Ci-Ci 0 (e.g., Ci-C 6 , Ci-C 3 ) alkyl, or Ci-Ci 0 (e.g., Q-C 6 , Q-C 3 ) haloalkyl, or SO 2 R m
  • R 7 can be fluoro, chloro, Ci-Ci 0 (e.g., Ci-C 6 or Ci-C 3 ) alkyl, or Q-Q 0 (e.g., Q-C 6 or Q-C 3 ) haloalkyl, Q-C 20 alkoxy (e.g., methoxy), C(O)OR, C(O)NR s R h , or SO 2 R m .
  • R 7 can be chloro or bromo (e.g., chloro); Ci-Ci 0 (e.g., Ci-C 6 , Ci-C 3 ) alkyl, or Q-Qo (e.g., Q-C 6 , Q-C 3 ) haloalkyl, or SO 2 R m
  • R 7 can be fluoro, C(O)OR, or C(O)NR s R h .
  • R 7 can be C(O)OR or C(O)NR s R h .
  • R 7 can be hydrogen; fluoro, chloro; cyano; CH 3 ; CF 3 ; or SO 2 CH 3 . In certain embodiments, R 7 can be fluoro; chloro; cyano; CH 3 ; CF 3 ; SO 2 CH 3 ; SO 2 CH 2 CH 3 ; or SO 2 CH(CH 3 ) 2 . In certain embodiments, R 7 can be other than fluoro, e.g., R 7 can be chloro; CH 3 ; CF 3 ; or SO 2 CH 3 . In certain embodiments, R 7 can be Ci-C 6 (e.g., Ci-C 3 ) haloalkyl (e.g., CF 3 ).
  • Ci-C 6 e.g., Ci-C 3
  • haloalkyl e.g., CF 3
  • R 7 can be halo (e.g., fluoro or chloro, e.g., chloro).
  • R 7 can be SO 2 R m (e.g., R m can be CH 3 , CH 2 CH 3 , or CH(CH 3 ) 2 ).
  • R 7 can be hydrogen or cyano. In certain embodiments, R 7 can be C 1 -C 2 0 alkoxy (e.g., OCH 3 )Jn certain embodiments, R 7 can be C(O)OR (e.g., C(O)OH or C(O)OCH 3 ) or C(0)NR s R h (e.g., C(O)NH 2 ).
  • R 7 is other than fluoro.
  • R 7 in the definitions above is other than halo (e.g., fluoro).
  • a subset of compounds includes those in which R 3 has formula (D):
  • W can be a bond; -0-; Ci_ 3 alkylene (e.g., -CH 2 -); C 2 ⁇ alkynylene (e.g., -C ⁇ C-); - O(Ci_ 3 alkylene)- (e.g., -OCH 2 -); or -(Ci -3 alkylene)O- (e.g., -CH 2 O-); one of R fl , R Q , R G , R f4 , and R ⁇ (e.g., R fl , R ⁇ , or R G ; e.g., R Q or R G ; e.g., R Q ) can be:
  • heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and optionally substituted with from 1 -3 R e ;
  • heterocycloalkenyl including 5-10 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -3 R e ; or
  • Y at each occurrence is, independently, Ci-C 6 alkylene, -0-, or - NR 9 -; and the others are each, independently, hydrogen or R e , in which R n , n, R k , R f , R s , R h , R J , and R e at each occurrence can be, independently of one another, as defined anywhere herein.
  • one of R fl , R Q , R G , R f4 , and R ⁇ (e.g., R fl , R Q , or R G ; e.g., R Q or R G ; e.g., R ⁇ ) can be:
  • (iii-F) heterocyclyl including 5-10 (e.g., 5-7) atoms that is substituted with from 1 oxo and optionally substituted with from 1-3 (e.g., 1-2, 1) R e ; or
  • R , R , R , and R can be hydrogen.
  • three of R fl , R Q , R G , R f4 , and R f5 can be hydrogen, and one of R fl , R ⁇ , R G , R f4 , and R f5 can R e (e.g., as shown in formula (B-4), (B-5), (B-6), or (B-7)).
  • one of R fl , R Q , R G , R f4 , and R f5 can be -S(O) n R n (e.g., n can be 2; e.g., R n can be C r Cio alkyl, optionally substituted with from 1-2 R a ; or NR s R h ).
  • Another subset of compounds includes those in which R has formula D- 1 :
  • R can be hydrogen; or R can be R e as defined anywhere herein (e.g., halo, e.g., fluoro, or chloro);
  • W can be as defined anywhere herein (e.g., -O- or a bond); each of R ⁇ 2 and R ⁇ 3 is, independently, hydrogen or R e ; and one of R A24 and R A25 is R f (e.g., -SO 2 R n ), and the other is hydrogen or R e .
  • R A22 , R A23 , R A24 , and R A25 are R e .
  • R ⁇ 2 , R A23 , R A24 , and R A25 can be as defined anywhere herein.
  • Other embodiments can include one of more other features described herein.
  • Another subset of compounds includes those in which:
  • R 3 is heteroaryl including 5-10 (e.g., 5-6) atoms, which is (i) substituted with 1 R 10 , and (ii) optionally substituted with from 1 -2 R e ; and W is a bond; and
  • A has formula (B-9):
  • each of R ⁇ 2 and R ⁇ 3 is, independently, hydrogen or R e ; and one of R A24 and R A25 is R f (e.g., -SO 2 R n ), and the other is hydrogen or R e ; In certain embodiments, it is provided that only one of R A22 , R A23 , R A24 , and R A25 is R e .
  • R ⁇ 2 , R A23 , R A24 , and R A25 can be as defined anywhere herein. Other embodiments can include one of more other features described herein.
  • Another subset of compounds includes those in which:
  • R 3 has formula (A-4); and W is a bond;
  • A is heteroaryl including 5-8 atoms, which is (a) substituted with 1 R f (e.g., -SO 2 R n ), and (b) optionally substituted with from 1-3 R e , provided that the heteroaryl including 5-8 atoms is not [l,2,4]-oxadiazolyl.
  • R f e.g., -SO 2 R n
  • R e optionally substituted with from 1-3 R e
  • Other embodiments can include one of more other features described herein.
  • Another subset of compounds includes those in which:
  • R 3 has formula (A-4); and W is a bond;
  • A is tetrahydroquinolyl or tetrahydroisoquinolyl, which is (a) substituted with 1 R f (e.g., -SO 2 R n ), and (b) optionally substituted with from 1-2 R e .
  • R f e.g., -SO 2 R n
  • Other embodiments can include one of more other features described herein.
  • Another subset of compounds includes those in which:
  • R 3 has formula (A-4); and W is a bond;
  • A is benzo[b]thienyl- 1,1 -dioxide, 3,4-dihydro-2H-thiopyrano[2,3-b]pyridyl-l,l- dioxide, or 2,3-dihydrobenzo[b]thienyl- 1,1 -dioxide, each of which is optionally substituted with from 1-3 R e .
  • Other embodiments can include one of more other features described herein.
  • Another subset of compounds includes those in which:
  • R 3 has formula D-I;
  • R 32 can be hydrogen or R e (e.g., halo, e.g., fluoro, or chloro);
  • W can be as defined anywhere herein (e.g., -O- or a bond);
  • each of R ⁇ 2 and R A23 is, independently, hydrogen or R e ; and
  • one of R A24 and R A25 is R f , e.g.:
  • R ⁇ 2 , R A23 , R A24 , and R A25 can be as defined anywhere herein. Other embodiments can include one of more other features described herein.
  • R 32 can be hydrogen; or R 32 can be halo (e.g., chloro or fluoro).
  • W can be a bond; -O-; Ci_ 3 alkylene (e.g., -CH 2 -); C 2 ⁇ alkynylene (e.g., -C ⁇ C-); - O(Ci_3 alkylene)- (e.g., -OCH 2 -); or -(Ci -3 alkylene)O- (e.g., -CH 2 O-);
  • R f can be: (i) -S(O) n R 1 , -(CH 2 ) L6 S(O) n R 0 , -NR k S(O) n R n , or -OS(O) n R 1 ; or
  • heterocycloalkenyl including 5-10 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -3 R e ; or
  • R e at each occurrence is, independently, halo; Ci-C 6 alkyl, optionally substituted with from 1-2 R a ; Q-C 3 haloalkyl; Q-C 3 alkoxy; NR s R h ; phenyl; or 4-fluorophenyl; in which R n , n, R k , R f , R s , R h , R J , and R e at each occurrence can be, independently of one another, as defined anywhere herein.
  • R f can be:
  • R f can be -S(O) n R n (e.g., n can be 2; e.g., R n can be Ci-Ci 0 alkyl, optionally substituted with from 1-2 R a ; or NR s R h ).
  • R e can be present or absent (i.e., the positions not occupied by W and R f can all be attached to hydrogen or R e ; or a combination thereof).
  • W can be attached to the 2-position of the pyridyl ring, and
  • R f can be attached to the 4- or the 6-position of the pyridyl ring.
  • Such rings can be further substituted with 1, 2 or 3 R e (e.g., halo, e.g., chloro; or NR s R h , e.g., NH 2 ).
  • R e e.g., halo, e.g., chloro; or NR s R h , e.g., NH 2
  • W can be attached to the 2-position of the pyridyl ring
  • R f can be attached to the 6-position of the pyridyl ring
  • 1 R e can be attached to the 4-position of the pyridyl ring.
  • W can be attached to the 2-position of the pyridyl ring
  • R f can be attached to the 6- position of the pyridyl ring
  • an R e substituent can be attached to the 3-, 4-, and 5-positions of the pyridyl ring.
  • W can be attached to the 3 -position of the pyridyl ring, and R f can be attached to the 5-position of the pyridyl ring.
  • R e e.g., halo, e.g., chloro; orNR s R h , e.g., NH 2 ).
  • a further subset of compounds includes those in which R 3 has formula F:
  • R e can be hydrogen; halo; C 1 -C 3 alkyl, optionally substituted with from 1-2 R a ; C 1 - C3 haloalkyl; C 1 -C3 alkoxy; hydroxyl; cyano; nitro; NR s R h ; phenyl; or 4-fluorophenyl.
  • R e can be hydrogen; halo; Ci-Ce alkyl, optionally substituted with from 1-2 R a (e.g., R a can be C(O)NR s R h ); C 1 -C 3 haloalkyl; C 1 -C 3 alkoxy; NR s R h ; phenyl; or 4- fluorophenyl.
  • R e can be hydrogen; halo; C 1 -C 3 alkyl, optionally substituted with from 1-2 R a (e.g., R a can be C(O)NR s R h ); hydroxyl; cyano; or nitro.
  • the compounds can have formula (II):
  • R 2 , R 3 , R 4 , R 5 , R 6 , and R 7 can be as defined anywhere herein (generically, subgenerically, or specifically).
  • the compounds can have formula (III):
  • R 2 , R 3 , and R 7 can be as defined herein (generically, subgenerically, or specifically).
  • the compounds can have formula (IV) or (IV-I):
  • R 2 , W, A, R 4 , R 5 , R 6 , R 7 , and R 32 can be as defined herein (generically, subgenerically, or specifically).
  • the compounds can have formula (V):
  • R 2 , W, A, R 7 , and R 32 can be as defined herein (generically, subgenerically, or specifically).
  • the compounds described herein can be synthesized according to methods described herein and/or conventional, organic chemical synthesis methods from commercially available starting materials and reagents.
  • the compounds described herein can be separated from a reaction mixture and further purified by a method such as column chromatography, high- pressure liquid chromatography, or recrystallization.
  • a method such as column chromatography, high- pressure liquid chromatography, or recrystallization.
  • further methods of synthesizing the compounds of the formulae herein will be evident to those of ordinary skill in the art. Additionally, the various synthetic steps may be performed in an alternate sequence or order to give the desired compounds.
  • Synthetic chemistry transformations and protecting group methodologies (protection and deprotection) useful in synthesizing the compounds described herein are known in the art and include, for example, those such as described in R.
  • Quino line -phenols (a nonlimiting example of which is compound 100 is shown at the top of Scheme 1) can be prepared, for example, as described in Collini et al., US 2005/0131014, which is incorporated by reference herein, and reacted with a halogenated arylsulfone (e.g., 102) or a halogenated arylsulfonamide (e.g., 101).
  • a halogenated arylsulfone e.g., 102
  • a halogenated arylsulfonamide e.g., 101
  • halogen is a fluorine or chlorine
  • an aromatic displacement is typically performed, usually in a polar, aprotic solvent such as DMF, DSMO, and the like in the presence of a base, e.g., potassium carbonate or cesium carbonate, at elevated temperatures, typically from about 100-150 0 C for several hours to several days.
  • a base e.g., potassium carbonate or cesium carbonate
  • a coupling procedure using a copper salt e.g., CuI
  • a ligand such as N,N-dimethylglycine or L-proline
  • a solvent such as 1,4-dioxane.
  • Halogenated arylsulfones can be prepared using a variety of conventional synthetic approaches.
  • the synthesis can include the partial reduction of a commercial halogenated arylsulfonyl chloride using sodium sulfite and sodium bicarbonate in water, typically at 95-100 0 C for 0.5 to 1 h to provide the sodium arylsulfinate.
  • the reaction is cooled, treated with an alkylating agent such as an alkylating agent R-LG in which LG is a leaving group such as a bromide, iodine, or tosylate.
  • alkylating agents can include without limitation ethyl iodide, 3-bromopropan-l-ol, and the like.
  • a phase transfer catalyst typically tetrabutylammonium bromide, is added and the two-phase mixture is heated at 40- 100 0 C for several hours to provide the halogenated arylsulfones (Scheme 2).
  • halogenated thiophenols can be alkylated with an alkylating agent in the presence of a base, typically potassium carbonate, in an appropriate solvent such as acetone.
  • a base typically potassium carbonate
  • the reaction is typically heated at 40 to 65°C for 1-4 h, cooled, and treated with aqueous sodium bicarbonate and Oxone. After 18-48 h, the desired halogenated arylsulfones is isolated (Scheme 3).
  • aryl bromides and iodides can be converted to halogenated arylsulfones, in particular methylsulfones, using a copper-catalyzed coupling reaction employing sodium methylsulfinate (Scheme 4).
  • halogenated arylsulfonamides can be prepared by reaction of halogenated arylsulfonyl chlorides with amines (Scheme 5).
  • biarylethers can be prepared by displacement reactions between 4-(3-hydroxyphenyl)-quino lines and halogenated arylsulfones in which the halogen is preferably fluorine or chlorine.
  • the reactions are typically heated at 100 to 150 0 C in a polar solvent such as DMF, DMSO, and N-methylpyrrolidine for several hours to several days (Scheme 6).
  • biarylethers can be synthesized by a coupling reaction between 4-(3-hydroxyphenyl)-quino lines and halogenated arylsulfones where the halogen is preferably bromine or iodine.
  • the reactions are typically heated at 100 to 150 0 C in a polar solvent such as DMSO, for several hours to several days, with a copper solubilizing reagent such as L-proline (Scheme 7).
  • the quinoline-biarylether-methylsulfones described herein can be further elaborated by forming the anion of the methylsulfone, typically using a strong base such as n-butyl lithium of sec-butyl lithium in a solvent such as ether or THF, typically at 0 0 C to ambient temperatures, followed by addition of an epoxide to form the 3- hydroxypropylsulfone as shown in Scheme 8 below.
  • biarylethers with sulfonamide groups can be prepared by displacement reactions between 4-(3-hydroxyphenyl)-quino lines and halogenated arylsulfonamides where the halogen is preferably fluorine.
  • the reactions are typically heated at 100 to 150 0 C in a polar solvent such as DMF, DMSO, or N-methylpyrrolidine for 2 hours to 2 days (Scheme 9).
  • biarylethers with sulfonamide substituents can be synthesized by a coupling reaction between 4-(3-hydroxyphenyl)-quino lines and halogenated arylsulfonamides where the halogen is preferably bromine or iodine.
  • the reactions are typically heated at 100 to 150 0 C in a solvent such as 1,4-dioxane, for several hours to several days, with a copper solubilizing reagent such as L-proline or N,N-dimethylglycine and a base such as cesium carbonate (Scheme 10).
  • alkylation of 4-(3-hydroxyphenyl)-quinolines with arylalkylhalides (aralkyl halides) in a solvent such as acetonitrile or DMF in the presence of a base, typically cesium carbonate or potassium carbonate, generally with heating at reflux for 6 to 24 hours, can provide the benzylsulfone substitution as shown in Scheme 11.
  • Preparation of quino line-aryl-CH 2 O-arylsulfones or quino line-aryl-CH 2 O- arylsulfonamides can be accomplished by conversion of a 4-(3-hydroxymethylphenyl) quinoline into the corresponding bromide by conventional methods, e.g., reaction with a brominating agent such as phosphorous tribromide in a solvent such as dichloromethane or the like.
  • a phenol (or heterophenol) can be alkylated with the benyzlic bromide under typical alkylation conditions as described in Scheme 11 above or using other conditions such as sodium hydride or other base in the presence of a solvent such as DMF or THF (Scheme 12).
  • biarylmethylenes can be prepared via the use of 4-(3- [(HO) 2 B] -phenyl-quino line by coupling methods using pinacolatoborane and an appropriate catalyst, e.g., a palladium catalyst, e.g., palladium tetrakistriphenylphosphine (Pd(PPh) 3 ) 4 with a base, typically a carbonate of cesium, sodium, or potassium.
  • a palladium catalyst e.g., palladium tetrakistriphenylphosphine (Pd(PPh) 3 ) 4
  • a base typically a carbonate of cesium, sodium, or potassium.
  • the borolane formed undergoes reaction with a benzylic halide, typically a benzylic bromide, to form the quinoline biarylmethylene (Scheme 13).
  • R' H or -CMe 2 CMe 2 -
  • biarylmethylenes can be prepared by employing the benzylhalide as described in Scheme 12, and using an arylboronic acid or heteroarylboronic acid and similar conditions to those described for Scheme 13 (Scheme 14).
  • quinoline-arylbenzylic halide to arylborolane coupling e.g., Biaryl-methylenes with sulfonamide substitution
  • biarylmethylenes with sulfonamide substitution can be prepared by coupling a borolane with a benzylic bromide as in Scheme 13 using analogous conditions.
  • the benzylic bromide contains a sulfonic acid ester with a leaving group such as pentafluorophenol which can be displaced by an amine (HNR s R h ) by heating in a solvent such as THF and the like in the presence of a tertiary amine base such as DBU and the like.
  • HNR s R h an amine
  • biaryl or aryl-heteroaryl compounds can be prepared by coupling of a bromide, iodide, or triflate on the 4-phenylquinoline with a boronic acid with suitable substitution using typical Suzuki conditions including a palladium catalyst such as Pd(PPh 3 ) 4 and the like along with a base, typically at elevated temperatures (50 - 110 0 C).
  • a palladium catalyst such as Pd(PPh 3 ) 4 and the like
  • biaryl or aryl-heteroaryl compounds can be prepared by coupling of a borolane containing 4-phenylquinoline with an arylbromide or aryliodide or with a heteroarylbromide or heteroaryliodide with suitable substitution.
  • Typical Suzuki conditions are used, e.g., as in Scheme 16, such as a palladium catalyst, e.g., Pd(PPh 3 ) 4 , with a base, typically at elevated temperatures (50 - 110 0 C).
  • biarylethersulfones contain a heteroaryl group such as a pyridine
  • 4-(3-hydroxyphenyl)quinoline can be reacted with 2,6-difluoropyridine in a polar solvent such as DMF, in the presence of a base, e.g., potassium carbonate, to afford a 2- fluoropyridine intermediate which can be reacted with sodium alkylsulfinate in a polar solvent such as DMF to give the target pyridine-sulfone (Scheme 19).
  • pyridine sulfone can be prepared by reaction of 2-chloro-4- fluoropyridine with a sodium salt of a thiol in a polar solvent such as DMF to afford a 4- alkylthio-2-chloropyridine which in turn is reacted with a 4-(3-hydroxyphenyl)quinoline under similar conditions to those above and the resulting sulfide can, if desired, be oxidized up to the corresponding sulfone using OXONE® (brand name for 2HKO 5 S-HKO 4 S-K 2 O 4 S) or other oxidants (Scheme 20).
  • OXONE® brand name for 2HKO 5 S-HKO 4 S-K 2 O 4 S
  • pyridine-sulfone can be prepared by the copper- induced coupling of 3-bromo-5-(methylsulfonyl)pyridine with a 4-(3-hydroxyphenyl)quinoline, typically using CuI in the presence of N,N-dimethylglycine hydrochloride in the presence of a base such as cesium carbonate in 1 ,4-dioxane at elevated temperature, typically at reflux (Scheme 21).
  • pyridine sulfone can be prepared by coupling a 4-bromo-2- alkylthio-pyridine with a 4-(3-hydroxyphenyl)quinoline under similar coupling conditions as in Scheme 21 followed by oxidation with OXONE® to the sulfone as in Scheme 20 (Scheme
  • substituted pyridylsulfones can be prepared as outlined in Scheme 23 using a trichloropyridine.
  • bicyclic pyridylsulfones can be prepared from known intermediates as shown in Scheme 25.
  • Scheme 25
  • quinolines containing biarylmethylenes with small heterocycles such as 2-imidazolinones and 2-oxazolidinones
  • quinolines containing biarylmethylenes with small heterocycles can be prepared by coupling of imidazolinones or oxazolidinones to an bromobenzyl alcohol or iodobenzyl alcohol using copper-induced coupling to afford the benzyl alcohols substituted with 2-imidazolinones or 2- oxazolidinones.
  • the alcohols can be converted to the bromides, typically using PBr 3 , as described in Scheme 12. These are coupled to quinoline containing a borolane under conditions like those in Scheme 13. (Scheme 26).
  • Quinoline biarylethers containing substitutents NHSO 2 R 11 , NHC(O)OR, and NHC(0)NHR h can be prepared by reacting a fluoronitrobenzene with a quinoline -phenol in a polar solvent such as DMF or DMA in the presence of a base, typically potassium carbonate at elevated temperatures, typically 80 - 150 0 C, for typically 4 to 24 hours.
  • the nitro group is reduced in the product, typically with tin metal in hydrochloric acid with a cosolvent such as methanol or ethanol, or by hydrogenation with a palladium catalyst where applicable.
  • the resulting amine can be reacted with isocyanates to afford ureas, with alkyl chloroformates to afford carbamates, and with alkylsulfonyl chlorides or arylsulfonyl chlorides to afford sulfonamides, as in Scheme 27.
  • isocyanates to afford ureas
  • alkyl chloroformates to afford carbamates
  • alkylsulfonyl chlorides or arylsulfonyl chlorides to afford sulfonamides
  • amide substitution in which the amide is secondary and contains a hydroxyl propyl or hydoxyethyl can be cyclized using triflic anhydride to afford the analogous oxazolines as in Scheme 28.
  • oxadiazoles can be prepared by the reaction of an ester with an amino-oxime as in Scheme 29.
  • imidazolines can be prepared by reaction of an ester with a diamine as in Scheme 30.
  • the compounds of this invention may contain one or more asymmetric centers and thus occur as racemates and racemic mixtures, single enantiomers, individual diastereomers and diastereomeric mixtures. All such isomeric forms of these compounds are expressly included in the present invention.
  • the compounds of this invention may also contain linkages (e.g., carbon-carbon bonds, carbon-nitrogen bonds such as amide bonds) wherein bond rotation is restricted about that particular linkage, e.g. restriction resulting from the presence of a ring or double bond. Accordingly, all cis/trans and E/Z isomers and rotational isomers are expressly included in the present invention.
  • the compounds of this invention may also be represented in multiple tautomeric forms, in such instances, the invention expressly includes all tautomeric forms of the compounds described herein, even though only a single tautomeric form may be represented (e.g., alkylation of a ring system may result in alkylation at multiple sites, the invention expressly includes all such reaction products). All such isomeric forms of such compounds are expressly included in the present invention. All crystal forms of the compounds described herein are expressly included in the present invention.
  • the compounds of this invention include the compounds themselves, as well as their salts and their prodrugs, if applicable.
  • a salt for example, can be formed between an anion and a positively charged substituent (e.g., amino) on a compound described herein. Suitable anions include chloride, bromide, iodide, sulfate, nitrate, phosphate, citrate, methanesulfonate, trifluoroacetate, and acetate.
  • a salt can also be formed between a cation and a negatively charged substituent (e.g., carboxylate) on a compound described herein.
  • Suitable cations include sodium ion, potassium ion, magnesium ion, calcium ion, and an ammonium cation such as tetramethylammonium ion.
  • Examples of prodrugs include esters and other pharmaceutically acceptable derivatives, which, upon administration to a subject, are capable of providing active compounds.
  • Pharmaceutically acceptable salts of the compounds of this invention include those derived from pharmaceutically acceptable inorganic and organic acids and bases.
  • suitable acid salts include acetate, adipate, alginate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, citrate, camphorate, camphorsulfonate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptanoate, glycolate, hemisulfate, heptanoate, hexanoate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethanesulfonate, lactate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, palmoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate,
  • Salts derived from appropriate bases include alkali metal (e.g., sodium), alkaline earth metal (e.g., magnesium), ammonium and N-(alkyl) 4 + salts.
  • alkali metal e.g., sodium
  • alkaline earth metal e.g., magnesium
  • ammonium e.g., ammonium
  • N-(alkyl) 4 + salts e.g., sodium
  • alkali metal e.g., sodium
  • alkaline earth metal e.g., magnesium
  • ammonium e.g., sodium
  • N-(alkyl) 4 + salts e.g., sodium
  • alkali metal e.g., sodium
  • alkaline earth metal e.g., magnesium
  • ammonium e.g., ammonium
  • N-(alkyl) 4 + salts e.g., sodium
  • alkaline earth metal e.g., magnesium
  • ammonium e.g.
  • pharmaceutically acceptable carrier or adjuvant refers to a carrier or adjuvant that may be administered to a subject (e.g., a patient), together with a compound of this invention, and which does not destroy the pharmacological activity thereof and is nontoxic when administered in doses sufficient to deliver a therapeutic amount of the compound.
  • compositions of this invention include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, self-emulsifying drug delivery systems (SEDDS) such as d- ⁇ - tocopherol polyethyleneglycol 1000 succinate, surfactants used in pharmaceutical dosage forms such as Tweens or other similar polymeric delivery matrices, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polylene glycol, glycine, sorbic acid, potassium
  • Cyclodextrins such as ⁇ -, ⁇ -, and ⁇ -cyclodextrin, or chemically modified derivatives such as hydroxyalkylcyclodextrins, including 2- and 3- hydroxypropyl- ⁇ -cyclodextrins, or other solubilized derivatives may also be advantageously used to enhance delivery of compounds of the formulae described herein.
  • the compounds described herein can be used for treating (e.g., controlling, ameliorating, preventing, delaying the onset of, or reducing the risk of developing) one or more diseases, disorders, conditions or symptoms mediated by LXRs (e.g., cardiovascular diseases (e.g., acute coronary syndrome, restenosis), atherosclerosis, atherosclerotic lesions, type I diabetes, type II diabetes, Syndrome X, obesity, lipid disorders (e.g., dyslipidemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, low HDL and high LDL), cognitive disorders (e.g., Alzheimer's disease, dementia), inflammatory diseases (e.g., multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, endometriosis, LPS-induced sepsis, acute contact dermatitis of the ear, chronic atherosclerotic inflammation of the artery wall), celiac, or thyroiditis)).
  • cardiovascular diseases
  • a disorder or physiological condition that is mediated by LXR refers to a disorder or condition wherein LXR can trigger the onset of the condition, or where inhibition of a particular LXR can affect signaling in such a way so as to treat, control, ameliorate, prevent, delay the onset of, or reduce the risk of developing the disorder or condition.
  • cardiovascular diseases e.g., acute coronary syndrome, restenosis
  • atherosclerosis atherosclerotic lesions
  • type I diabetes type II diabetes
  • Syndrome X obesity
  • lipid disorders e.g., dyslipidemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, low HDL and high LDL
  • cognitive disorders e.g., Alzheimer's disease, dementia
  • inflammatory diseases e.g., multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, endometriosis, LPS- induced sepsis, acute contact dermatitis of the ear, chronic atherosclerotic inflammation of the artery wall), celiac, or thyroiditis).
  • LXR modulators that activate cholesterol efflux e.g., upregulate ABCAl
  • SREBP-Ic expression and triglyceride synthesis in liver can both reduce atherosclerotic risk and minimize the likelihood of concommitantly increasing serum and hepatic triglyceride levels.
  • Candidate compounds having differential activity for regulating ABCAl (ABCGl) vs. SREBP-Ic can be can be evaluated using conventional pharmacological test procedures, which measure the affinity of a candidate compound to bind to LXR and to upregulate the gene ABCAl.
  • LXR ligands can be identified initially in cell- free LXR beta and LXR alpha competition binding assays. LXR ligands can be further characterized by gene expression profiling for tissue selective gene regulation. In some embodiments, the compounds described herein have agonist activity for
  • the compounds described herein preferentially antagonize SREBP-Ic activation (a marker for genes involved in cholesterol and fatty acid homeostasis) but do not substantially affect (e.g., have relatively minimal or additive effects) on ABCAl gene expression or genes known to enhance HDL biogenesis (based on a competition assay with known potent synthetic LXR agonists).
  • Cell type or tissue specificity may be further evaluated in additional cell lines, intestinal, CaCo2 or liver, HepG2 and Huh-7 cells where ABCAl activity is believed to influence net cholesterol absorption and reverse cholesterol transport.
  • additional cell lines intestinal, CaCo2 or liver, HepG2 and Huh-7 cells where ABCAl activity is believed to influence net cholesterol absorption and reverse cholesterol transport.
  • the compounds described herein have agonist activity for ABCAl and antagonist activity for SREBP-Ic (e.g., as determined by gene specific modulation in cell based assays).
  • the compounds described herein (in the agonist mode) have at least about 20% efficacy for ABCAl activation by LXR and do not substantially agonize SREBP-Ic (at most about 25% efficacy relative to a reference compound N-(2,2,2-trifluoro-ethyl)-N-[4-(2,2,2-trifluoro- 1 -hydroxy- 1 -trifluoromethyl-ethyl)- phenyl]-benzenesulfonamide (Schultz, Joshua R., Genes & Development (2000), 14(22), 2831-2838)).
  • the compounds described herein (in the antagonist mode) do not substantially antagonize ABCAl gene expression. While not wishing to be bound by theory, it is believed that there may be an additive effect on ABCAl gene expression relative to the reference compound at their EC50 concentration. In certain embodiments, the compounds described herein (in the antagonist mode) inhibited agonist- mediated SREBP-Ic gene expression in a dose dependent fashion. In some embodiments, to study the effect of the compounds of formula (I) on skin aging, for example, in a clinical trial, cells can be isolated and RNA prepared and analyzed for the levels of expression of TIMPl, ABCA 12, decorin, TNF ⁇ , MMPl, MMP3, and/or IL- 8.
  • the levels of gene expression can be quantified, for example, by Northern blot analysis or RT-PCR, by measuring the amount of protein produced, or by measuring the levels of activity of TIMP 1 , ABCA 12, decorin, TNF ⁇ , MMP 1 , MMP3 , and/or
  • the gene expression pattern can serve as a marker, indicative of the physiological response of the cells to the compounds of formula (I). Accordingly, this response state may be determined before, and at various points during, treatment of the individual with the compounds of formula (I).
  • expression levels of cytokines and metalloproteases described herein can be used to facilitate design and/or identification of compounds that treat skin aging through an LXR-based mechanism.
  • the invention provides methods (also referred to herein as “screening assays") for identifying modulators, i.e., LXR modulators, that have a stimulatory or inhibitory effect on, for example, TIMPl, ABCA 12, decorin, TNF ⁇ , MMPl, MMP3, and/or IL-8 expression.
  • modulators i.e., LXR modulators
  • An exemplary screening assay is a cell-based assay in which a cell that expresses LXR is contacted with a test compound, and the ability of the test compound to modulate TIMPl, ABCA12, decorin, TNF ⁇ , MMPl, MMP3, and/or IL-8 expression through an LXR- based mechanism.
  • Determining the ability of the test compound to modulate TIMPl, ABCA12, decorin, TNF ⁇ , MMPl, MMP3, and/or IL-8 expression can be accomplished by monitoring, for example, DNA, mRNA, or protein levels, or by measuring the levels of activity of TIMPl, ABCA12, decorin, TNF ⁇ , MMPl, MMP3, and/or IL-8, all by methods known to those of ordinary skill in the art.
  • the cell for example, can be of mammalian origin, e.g., human.
  • cells can be isolated and RNA prepared and analyzed for the levels of expression of ApoD and other genes implicated in osteoarthritis (for example, TNF ⁇ ).
  • the levels of gene expression i.e., a gene expression pattern
  • a gene expression pattern can be quantified by Northern blot analysis or RT-PCR, by measuring the amount of protein produced, or by measuring the levels of activity of ApoD or other genes, all by methods known to those of ordinary skill in the art.
  • the gene expression pattern can serve as a marker, indicative of the physiological response of the cells to the LXR modulator. Accordingly, this response state may be determined before, and at various points during, treatment of the individual with the LXR modulator.
  • An exemplary screening assay is a cell-based assay in which a cell that expresses LXR is contacted with a test compound, and the ability of the test compound to modulate ApoD expression and/or aggrecanase activity and/or cytokine elaboration through an LXR- based mechanism. Determining the ability of the test compound to modulate ApoD expression and/or aggrecanase activity and/or cytokine elaboration can be accomplished by monitoring, for example, DNA, mRNA, or protein levels, or by measuring the levels of activity of ApoD, aggrecanase, and/or TNF ⁇ , all by methods known to those of ordinary skill in the art.
  • the cell for example, can be of mammalian origin, e.g., human.
  • the compounds described herein can be coadministered with one or more other threapeutic agents.
  • the additional agents may be administered separately, as part of a multiple dose regimen, from the compounds of this invention (e.g., sequentially, e.g., on different overlapping schedules with the administration of one or more compounds of formula (I) (including any subgenera or specific compounds thereof)).
  • these agents may be part of a single dosage form, mixed together with the compounds of this invention in a single composition.
  • these agents can be given as a separate dose that is administered at about the same time that one or more compounds of formula (I) (including any subgenera or specific compounds thereof) are administered (e.g., simultaneously with the administration of one or more compounds of formula (I) (including any subgenera or specific compounds thereof)).
  • compositions of this invention include a combination of a compound of the formulae described herein and one or more additional therapeutic or prophylactic agents, both the compound and the additional agent can be present at dosage levels of between about 1 to
  • the compounds and compositions described herein can, for example, be administered orally, parenterally (e.g., subcutaneously, intracutaneously, intravenously, intramuscularly, intraarticularly, intraarterially, intrasynovially, intrasternally, intrathecally, intralesionally and by intracranial injection or infusion techniques), by inhalation spray, topically, rectally, nasally, buccally, vaginally, via an implanted reservoir, by injection, subdermally, intraperitoneally, transmucosally, or in an ophthalmic preparation, with a dosage ranging from about 0.01 mg/Kg to about 1000 mg/Kg, (e.g., from about 0.01 to about 100 mg/kg, from about 0.1 to about 100 mg/Kg, from about 1 to about 100 mg/Kg, from about 1 to about
  • compositions are administered by oral administration or administration by injection.
  • the methods herein contemplate administration of an effective amount of compound or compound composition to achieve the desired or stated effect.
  • the pharmaceutical compositions of this invention will be administered from about 1 to about 6 times per day or alternatively, as a continuous infusion. Such administration can be used as a chronic or acute therapy.
  • the amount of active ingredient that may be combined with the carrier materials to produce a single dosage form will vary depending upon the host treated and the particular mode of administration.
  • a typical preparation will contain from about 5% to about 95% active compound (w/w).
  • such preparations contain from about 20% to about 80% active compound. Lower or higher doses than those recited above may be required.
  • Specific dosage and treatment regimens for any particular patient will depend upon a variety of factors, including the activity of the specific compound employed, the age, body weight, general health status, sex, diet, time of administration, rate of excretion, drug combination, the severity and course of the disease, condition or symptoms, the patient's disposition to the disease, condition or symptoms, and the judgment of the treating physician.
  • a maintenance dose of a compound, composition or combination of this invention may be administered, if necessary. Subsequently, the dosage or frequency of administration, or both, may be reduced, as a function of the symptoms, to a level at which the improved condition is retained when the symptoms have been alleviated to the desired level. Patients may, however, require intermittent treatment on a long-term basis upon any recurrence of disease symptoms.
  • compositions of this invention may contain any conventional non- toxic pharmaceutically-acceptable carriers, adjuvants or vehicles.
  • pH of the formulation may be adjusted with pharmaceutically acceptable acids, bases or buffers to enhance the stability of the formulated compound or its delivery form.
  • compositions may be in the form of a sterile injectable preparation, for example, as a sterile injectable aqueous or oleaginous suspension.
  • This suspension may be formulated according to techniques known in the art using suitable dispersing or wetting agents (such as, for example, Tween 80) and suspending agents.
  • the sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol.
  • suitable vehicles and solvents that may be employed are mannitol, water, Ringer's solution and isotonic sodium chloride solution.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil may be employed including synthetic mono- or diglycerides.
  • Fatty acids, such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically-acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions.
  • These oil solutions or suspensions may also contain a long-chain alcohol diluent or dispersant, or carboxymethyl cellulose or similar dispersing agents which are commonly used in the formulation of pharmaceutically acceptable dosage forms such as emulsions and or suspensions.
  • surfactants such as Tweens or Spans and/or other similar emulsifying agents or bioavailability enhancers which are commonly used in the manufacture of pharmaceutically acceptable solid, liquid, or other dosage forms may also be used for the purposes of formulation.
  • compositions of this invention may be orally administered in any orally acceptable dosage form including, but not limited to, capsules, tablets, emulsions and aqueous suspensions, dispersions and solutions.
  • carriers which are commonly used include lactose and corn starch.
  • Lubricating agents such as magnesium stearate, are also typically added.
  • useful diluents include lactose and dried corn starch.
  • compositions of this invention may also be administered in the form of suppositories for rectal administration.
  • These compositions can be prepared by mixing a compound of this invention with a suitable non-irritating excipient which is solid at room temperature but liquid at the rectal temperature and therefore will melt in the rectum to release the active components.
  • suitable non-irritating excipient include, but are not limited to, cocoa butter, beeswax and polyethylene glycols.
  • Topical administration of the compositions of this invention is useful when the desired treatment involves areas or organs readily accessible by topical application.
  • the composition should be formulated with a suitable ointment containing the active components suspended or dissolved in a carrier.
  • Carriers for topical administration of the compounds of this invention include, but are not limited to, mineral oil, liquid petroleum, white petroleum, propylene glycol, polyoxyethylene polyoxypropylene compound, emulsifying wax and water.
  • the composition can be formulated with a suitable lotion or cream containing the active compound suspended or dissolved in a carrier with suitable emulsifying agents.
  • Suitable carriers include, but are not limited to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.
  • the compositions of this invention may also be topically applied to the lower intestinal tract by rectal suppository formulation or in a suitable enema formulation.
  • Topically-transdermal patches are also included in this invention. Also within the invention is a patch to deliver active chemotherapeutic combinations herein.
  • a patch includes a material layer (e.g., polymeric, cloth, gauze, bandage) and the compound of the formulae herein as delineated herein. One side of the material layer can have a protective layer adhered to it to resist passage of the compounds or compositions.
  • the patch can additionally include an adhesive to hold the patch in place on a subject.
  • An adhesive is a composition, including those of either natural or synthetic origin, that when contacted with the skin of a subject, temporarily adheres to the skin. It can be water resistant. The adhesive can be placed on the patch to hold it in contact with the skin of the subject for an extended period of time.
  • the adhesive can be made of a tackiness, or adhesive strength, such that it holds the device in place subject to incidental contact, however, upon an affirmative act (e.g., ripping, peeling, or other intentional removal) the adhesive gives way to the external pressure placed on the device or the adhesive itself, and allows for breaking of the adhesion contact.
  • the adhesive can be pressure sensitive, that is, it can allow for positioning of the adhesive (and the device to be adhered to the skin) against the skin by the application of pressure (e.g., pushing, rubbing,) on the adhesive or device.
  • compositions of this invention may be administered by nasal aerosol or inhalation.
  • Such compositions are prepared according to techniques well-known in the art of pharmaceutical formulation and may be prepared as solutions in saline, employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons, and/or other solubilizing or dispersing agents known in the art.
  • a composition having the compound of the formulae herein and an additional agent can be administered using any of the routes of administration described herein.
  • a composition having the compound of the formulae herein and an additional agent can be administered using an implantable device.
  • Implantable devices and related technology are known in the art and are useful as delivery systems where a continuous, or timed-release delivery of compounds or compositions delineated herein is desired. Additionally, the implantable device delivery system is useful for targeting specific points of compound or composition delivery (e.g., localized sites, organs). Negrin et al., Biomaterials, 22(6):563 (2001). Timed-release technology involving alternate delivery methods can also be used in this invention. For example, timed-release formulations based on polymer technologies, sustained-release techniques and encapsulation techniques (e.g., polymeric, liposomal) can also be used for delivery of the compounds and compositions delineated herein.
  • the title compound was prepared using 2-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and 3-bromo- l-propanol as the alkylating agent.
  • the title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and 4-bromo-2-methylbutan-2-ol as the alkylating agent.
  • Example 5 5-[(3-fluorophenyl)sulfonyl]pentan-l-ol
  • the title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and 5-bromo-l-pentanol as the alkylating agent.
  • MS (ES) m/z 246.9.
  • the title compound was prepared using 5-fluoro-2-methylbenzene-l-sulfonyl chloride as the arylsulfonyl chloride and iodomethane as the alkylating agent. mp 77 0 C; MS (ES) m/z 188.9.
  • the title compound was prepared using 5-bromo-2-methylbenzene-l-sulfonyl chloride as the arylsulfonyl chloride and iodoethane as the alkylating agent. mp 49 0 C; MS (ES) m/z 262.7.
  • the title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and l-bromo-3-methylbutane as the alkylating agent.
  • Example 11 l-fluoro-3-(isobutylsulfonyl)benzene
  • the title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and 1 -bromo-2-methylpropane as the alkylating agent.
  • the title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and 1 -iodopropane as the alkylating agent.
  • the title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and 3-bromo-l-propanol as the alkylating agent.
  • the title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and 2-iodopropane as the alkylating agent.
  • the title compound was prepared using 3,5-dichlorobenzenesulfonyl chloride as the arylsulfonyl chloride and 3-bromo-l-propanol as the alkylating agent. mp 80-82 0 C; MS (ES) m/z 268.9.
  • the title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and l-bromo-3-methoxypropane as the alkylating agent.
  • the title compound was prepared using 3,5-dichlorobenzenesulfonyl chloride as the arylsulfonyl chloride and l-bromo-3-methylbutane as the alkylating agent. mp 64-65 0 C; MS (ESI) m/z 280; HRMS: calcd for C 11 H 14 Cl 2 O 2 S, 280.00915; found (EI, M+.), 280.0078.
  • the title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and cyclopenyliodide as the alkylating agent.
  • the title compound was prepared using 2,5-dibromobenzenesulfonyl chloride as the arylsulfonyl chloride and methyliodode as the alkylating agent.
  • Example 23 4-bromo-l-methoxy-2-(methylsulfonyl)benzene The title compound was prepared using 5-bromo- 1 -methoxy-benzenesulfonyl chloride as the arylsulfonyl chloride and methyliodode as the alkylating agent. MS (ES) m/z 264.8.
  • Example 24 The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and iodopropane as the alkylating agent. l-fluoro-4-(propylsulfonyl)benzene
  • the title compound was prepared using 4-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and allylbromide as the alkylating agent.
  • the title compound was prepared using 4-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and l-(bromomethyl)-3-chlorobenzene as the alkylating agent.
  • the title compound was prepared using 4-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and ethyl 2-(4-(bromomethyl)phenyl)acetate as the alkylating agent.
  • Example 29 l-fluoro-4-[(3-methylbutyl)sulfonyl]benzene
  • the title compound was prepared using 4-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and l-bromo-3-methylbutane as the alkylating agent.
  • MS (ES) m/z 231.0.
  • the title compound was prepared using 4-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and 3-bromo- l-propanol as the alkylating agent.
  • the title compound was prepared using 4-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride andl-(bromomethyl)-2-fluorobenzene as the alkylating agent.
  • Example 34 2,5-dimethylbenzyl-4-fhiorophenyl sulfone
  • the title compound was prepared using 4-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and 2-(bromomethyl)-l,4-dimethylbenzene as the alkylating agent.
  • the title compound was prepared using 3-fluorobenzenethiol as the as the thiophenol and iodomethane as the alkylating agent.
  • the title compound was prepared using 3-fluorobenzenethiol as the as the thiophenol and 3-bromo-l-propanol as the alkylating agent.
  • the title compound was prepared using l-bromo-3-chloro-5-fluorobenzene as the arylbromide.
  • Example 42 l,3-difluoro-5-(methylsulfonyl)benzene
  • the title compound was prepared using l-bromo-3,5-difluorobenzene as the arylbromide.
  • Example 43 In a similar manner to that described for Example 43 above, the following compounds were prepared using the corresponding halogenated arylsulfone and quinoline phenol, and eluting with an appropriate eluent.
  • additional purification using reverse phase chromatography was used to further purify the compounds.
  • ethyl acetate was used in place of methylene chloride in the extraction step.
  • Example 67 3-benzyl-4- ⁇ 3-[4-(methylsulfonyl)phenoxy]phenyl ⁇ -8-(trifluoromethyl)quinoline MS (ES) m/z 533.8.
  • Example 68 3-benzyl-4- ⁇ 3-[3-(isobutylsulfonyl)phenoxy]phenyl ⁇ -8-(trifluoromethyl)quinoline
  • Example 84 4- ⁇ 3-[3-(ethylsulfonyl)phenoxy]phenyl ⁇ -8-(trifluoromethyl)quinoline mp 147 0 C; MS (ES) m/z 457.9; HRMS: calcd for C 24 H 18 F 3 NO 3 S + H+, 458.10322; found (ESI, [M+H] + ), 458.1019.
  • Example 85 4- ⁇ 3-[3-(propylsulfonyl)phenoxy]phenyl ⁇ -8-(trifluoromethyl)quinoline mp 133 0 C; MS (ESI) m/z 472.1199; HRMS: calcd for C 25 H 20 F 3 NO 3 S + H+, 472.11887; found (ESI, [M+H] + ), 472.1199.
  • Example 110 4- ⁇ 3-[4-methyl-3-(methylsulfonyl)phenoxy]phenyl ⁇ -8-(trifluoromethyl)quinoline mp 147-149 0 C; MS (ES) m/z 457.8.
  • Example 125 is the same compound as Example 1 10 but using the method described in Example 124.
  • Example 127 In a similar manner to that described for Example 127 above, the following compounds were prepared using the corresponding halogenated arylsulfonamide and quinoline phenol, and eluting with an appropriate eluent, varying temperature based on substitution.
  • meta-haloarylsulfonamides were subjected to higher temperatures, typically 150 0 C, while ortho- and para-haloarylsulfonamides can react at lower temperatures, typically 100 0 C to 150 0 C. In some instances, higher yields were obtained when R is not H.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Diabetes (AREA)
  • Biomedical Technology (AREA)
  • Obesity (AREA)
  • Hematology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Neurology (AREA)
  • Cardiology (AREA)
  • Neurosurgery (AREA)
  • Endocrinology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Rheumatology (AREA)
  • Reproductive Health (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Child & Adolescent Psychology (AREA)
  • Hospice & Palliative Care (AREA)
  • Psychiatry (AREA)
  • Emergency Medicine (AREA)
  • Gynecology & Obstetrics (AREA)
  • Pregnancy & Childbirth (AREA)
  • Vascular Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Immunology (AREA)
  • Pain & Pain Management (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

This invention relates generally to quinoline-based modulators of Liver X receptors (LXRs) and related methods.

Description

Ouinoline Compounds
CROSS REFERENCE TO RELATED APPLICATIONS This application claims the benefit of United States Provisional Application No.:
60/852,588, filed on October 18, 2006, which is incorporated herein by reference in its entirety.
TECHNICAL FIELD
This invention relates generally to quino line-based modulators of Liver X receptors (LXRs) and related methods.
BACKGROUND
Atherosclerosis is among the leading causes of death in developed countries. Some of the independent risk factors associated with atherosclerosis include the presence of relatively high levels of serum LDL cholesterol and relatively low levels of serum HDL cholesterol in affected patients. As such, some anti-atherosclerotic therapy regimens include the administration of agents (e.g., statins) to reduce elevated serum LDL cholesterol levels.
Agents that increase patient HDL cholesterol levels can also be useful in anti- atherosclerotic therapy regimens. HDL cholesterol is believed to play a major role in the transport of cholesterol from peripheral tissues to the liver for metabolism and excretion (this process is sometimes referred to as "reverse cholesterol transport"). ABCAl is a transporter gene involved in HDL production and reverse cholesterol transport. Upregulation of ABCAl can therefore result in increased reverse cholesterol transport as well as inhibition of cholesterol absorption in the gut. In addition, HDL is also believed to inhibit the oxidation of LDL cholesterol, reduce the inflammatory response of endothelial cells, inhibit the coagulation pathway, and promote the availability of nitric oxide.
Liver X receptors (LXRs), originally identified in the liver as orphan receptors, are members of the nuclear hormone receptor super family and are believed to be involved in the regulation of cholesterol and lipid metabolism. LXRs are ligand-activated transcription factors and bind to DNA as obligate heterodimers with retinoid X receptors. While LXRα is generally found in tissues such as liver, kidney, adipose tissue, intestine and macrophages,
LXRβ displays a ubiquitous tissue distribution pattern. Activation of LXRs by oxysterols (endogenous ligands) in macrophages results in the expression of several genes involved in lipid metabolism and reverse cholesterol transport including the aforementioned ABCAl; ABCGl; and ApoE. Studies have been conducted in LXRα knock-out (k/o), LXRβ k/o and double k/o mice to determine the physiological role of LXRs in lipid homeostasis and atherosclerosis. The data from these studies suggested that in double k/o mice on normal chow diet, increased cholesterol accumulation was observed in macrophages (foam cells) of the spleen, lung and arterial wall. The increased cholesterol accumulation was believed to be associated with the presence of reduced serum HDL cholesterol and increased LDL cholesterol, even though the total cholesterol levels in the mice were about normal. While LXRα k/o mice did not appear to show significant changes in hepatic gene expression, LXRβ k/o mice showed 58% decrease in hepatic ABCAl expression and 208% increase in SREBPIc expression suggesting that LXRβ may be involved in the regulation of liver SREBPIc expression.
Data obtained from studies employing two different atherosclerotic mouse models (ApoE k/o and LDLR k/o) suggest that agonists of LXRα or β can be relatively effective in upregulating ABCAl expression in macrophages. For example, inhibition of atherosclerotic lesions could be observed when ApoE k/o and LDLR k/o mice were treated with LXRα or β agonists for 12 weeks. The tested agonists were observed to have variable effects on serum cholesterol and lipoprotein levels and appeared to cause a relatively significant increase in serum HDL cholesterol and triglyceride levels. These in vivo data were found to be consistent with in vitro data obtained for the same agonists in macrophages.
In addition to the lipid and triglyceride effects described above, it is also believed that activation of LXRs results in the inhibition of inflammation and proinflammatory gene expression. This hypothesis is based on data obtained from studies employing three different models of inflammation (LPS-induced sepsis, acute contact dermatitis of the ear and chronic atherosclerotic inflammation of the artery wall). These data suggest that LXR modulators can mediate both the removal of cholesterol from the macrophages and the inhibition of vascular inflammation.
SUMMARY
This invention relates generally to quino line-based modulators of LXRs and related methods and compositions.
In one aspect, this invention features a compound having formula (I):
(I) wherein: R1 hydrogen, Ci-C6 alkyl, NH2, NH(Ci-C6 alkyl), or N(Ci-C6 alkyl)2;
R2 is:
(i) hydrogen, cyano, or halo; or
(ii) C1-C12 alkyl or C1-C12 haloalkyl, each of which is optionally substituted with from 1-5 Ra; or
(iii) C7-C20 aralkyl or heteroaralkyl including 6-20 atoms, each of which is optionally substituted with from 1 - 10 Rb; or
(iv) C2-C12 alkenyl or C2-C12 alkynyl, each of which is optionally substituted with from 1-10 Rc;
(v) C3-C10 cycloalkyl, heterocyclyl including 3-10 atoms, or heterocycloalkenyl including 3-10 atoms, each of which is optionally substituted with from 1-5 Rb; or (vi) C6-Ci8 aryl or heteroaryl including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd; or (vii) -XR8, wherein:
X is -C(O)-; -O-; -S(O)r, wherein t is 0-2; -NR9-; -C(O)NR9-; -C(NH)NR9; -C(O)O-; -CH2O-; -NR9SO2-; or -SO2NR9-, wherein R9 is hydrogen or Ci-C6 alkyl; and R8 is:
(i) hydrogen; or
(ii) Ci-Ci2 alkyl or Ci-Ci2 haloalkyl, each of which is optionally substituted with from 1-5 Ra; or (iii) C7-C20 aralkyl or heteroaralkyl including 6-20 atoms, each of which is optionally substituted with from 1-10 Rb; or
(iv) C2-C12 alkenyl or C2-C12 alkynyl, each of which is optionally substituted with from 1-10 Rc; (v) C3-Ci0 cycloalkyl or heterocyclyl including 3-10 atoms, each of which is optionally substituted with from 1-5 Rb; or
(vi) C6-Ci8 aryl or heteroaryl including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd;
R3 is C6-Ci8 (e.g., C6-Ci4) aryl or heteroaryl including 5-16 (e.g., 5-14) atoms, each of which is:
(i) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, or 1, e.g., 1-2) R10, and (ii) optionally substituted with from 1 -4 Re; wherein:
R10 is WA, wherein:
W at each occurrence is, independently, a bond; -O-; -S(O)t-, wherein t is 0-2; -NR9-; -C(O)NR9-; Ci_6 alkylene; or C2.6 alkynylene; -W1Cd-6 alkylene)-; or -(Ci_6 alkylene^1-; W1 at each occurrence is, independently, -O-; -S(O)r, wherein t is 0-2;
-NR9-; -C(O)NR9-; or C2.6 alkynylene; and
A at each occurrence is, independently: (i) C6-Ci0 aryl, which is: (a) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, or 1, e.g., 1-2) Rf; and
(b) optionally substituted with from 1-4 Re; or (ii) heteroaryl including 5-10 atoms, which is:
(a) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, or 1, e.g., 1-2) Rf or includes a substituted ring atom selected from the group consisting of S(O) and SO2; and
(b) is optionally substituted with from 1 -4 Re; provided that the heteroaryl including 5-10 atoms is not [l,2,4]-oxadiazolyl; or
(iii) arylazacyclyl including 8-12 atoms, each of which is: (a) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, or 1, e.g., 1-2) Rf, and
(b) optionally substituted with from 1-4 Re; or
(iv) arylsulfϊnylcyclyl, heteroarylsulfinylcyclyl, arylsulfonylcyclyl or heteroarylsulfonylcyclyl, each of which includes 8-10 atoms and is optionally substituted with from 1-4 Re; or
(v) [l,2,4]-oxadiazolyl, optionally substituted with from 1 Re;
each of R4, R5, R6, and R7 is, independently: (i) hydrogen; or (ii) Rc; or
(iii) C1-C20 alkyl or C1-C20 haloalkyl, each of which is optionally substituted with from 1-10 Ra; or
(iv) C2-C20 alkenyl or C2-C20 alkynyl, each of which is optionally substituted with from 1-10 Rc; or (v) C7-C20 aralkyl or heteroaralkyl, each of which is optionally substituted with from
1-10 Rb;
Ra at each occurrence is, independently:
(i) NRsRh; nitro; azido; hydroxy; oxo; thioxo; =NR; C1-C20 alkoxy or C1-C20 haloalkoxy, each of which is optionally substituted with from 1-10 Ra ; C6-Ci8 aryloxy or heteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd; C7-C2O aralkoxy, heteroaralkoxy including 6-20 atoms, C3-Ci6 cycloalkoxy, C3-C2O cycloalkenyloxy, heterocyclyloxy including 3-20 atoms, or heterocycloalkenyloxy including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb; mercapto; Ci-C2O thioalkoxy; Ci-C20 thiohaloalkoxy; C6-Ci8 thioaryloxy or thioheteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd; C7-C2O thioaralkoxy, thioheteroaralkoxy including 6-20 atoms, C3-Ci6 thiocycloalkoxy, C3-C2O thiocycloalkenyloxy, thioheterocyclyloxy including 3-20 atoms, or thioheterocycloalkenyloxy including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb; cyano; - C(O)R, -C(O)OR; -OC(O)R; -C(O)SR; -SC(O)R; -C(S)SR; -SC(S)R; -C(O)NRsRh; -
NRkC(O)R; -C(NR')R; -OC(O)NRsRh; -NRkC(O)NRsRh; -NRkC(O)OR; -S(O)nRm, wherein n is 1 or 2; -NRkS(O)nRm; or -P(O)(ORs)(ORh); or
(ii) C3-C20 cycloalkyl, C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms, heterocycloalkenyl including 3-20 atoms, arylheterocyclyl including 8-20 atoms, or heteroarylheterocyclyl including 8-20 atoms, each of which is optionally substituted with from 1-10 Rb; Ra at each occurrence is, independently, NRsRh; nitro; azido; hydroxy; oxo; cyano; - C(O)RJ, -C(O)OR; -OC(O)R; -C(O)SR; -SC(O)R; -C(S)SR; -SC(S)R; -C(0)NRsRh; - NRkC(0)R; -C(NR')R; -0C(0)NRsRh; -NRkC(O)NRsRh; -NRkC(0)0R; -S(O)nRm, wherein n is 1 or 2; -NRkS(O)nRm; -P(O)(ORs)(ORh); C3-C20 cycloalkyl, C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms, or heterocycloalkenyl including 3-20 atoms;
Rb at each occurrence is, independently:
(i) halo; NRsRh; nitro; azido; hydroxy; oxo; thioxo; =NR'; Ci-C20 alkoxy or Ci-C20 haloalkoxy, each of which is optionally substituted with from 1-10 Ra; C6-Qs aryloxy or heteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd; C7-C20 aralkoxy, heteroaralkoxy including 6-20 atoms, C3-Ci6 cycloalkoxy, C3-C20 cycloalkenyloxy, heterocyclyloxy including 3-20 atoms, or heterocycloalkenyloxy including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb ; mercapto; Ci-C20 thioalkoxy; Ci-C20 thiohaloalkoxy; C6-CiS thioaryloxy or thioheteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd; C7-C20 thioaralkoxy, thioheteroaralkoxy including 6-20 atoms, C3-Ci6 thiocycloalkoxy, C3-C20 thiocycloalkenyloxy, thioheterocyclyloxy including 3-20 atoms, or thioheterocycloalkenyloxy including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb ; cyano; - C(O)R, -C(O)OR; -OC(O)R; -C(O)SR; -SC(O)R; -C(S)SR; -SC(S)R; -C(O)NRsRh; -
NRkC(O)R; -C(NR')R; -OC(O)NRsRh; -NRkC(0)NRsRh; -NRkC(O)OR; -S(O)nRm, wherein n is 1 or 2; -NRkS(O)nRm; or -P(O)(ORs)(ORh); or
(ii) Ci-C20 alkyl or Ci-C20 haloalkyl, each of which is optionally substituted with from 1-10 Ra; or (iii) C2-C20 alkenyl or C2-C20 alkynyl, each of which is optionally substituted with from 1-10 Rc; or
(iv) C6-CiS aryl or heteroaryl including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd; or
(v) C3-C20 cycloalkyl, C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms, or heterocycloalkenyl including 3-20 atoms, each of which is optionally substituted with from 1-
10 Rb';
Rb at each occurrence is, independently, Ra ; halo; Ci-C20 alkoxy or Ci-C20 haloalkoxy, each of which is optionally substituted with from 1-10 Ra; C6-CiS aryloxy or heteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10
Rd; Ci-C20 alkyl or Ci-C20 haloalkyl, each of which is optionally substituted with from 1-10 Ra; C2-C2O alkenyl; C2-C20 alkynyl; or C6-Ci8 aryl or heteroaryl including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd;
Rc at each occurrence is, independently: (i) halo; NRsRh; nitro; azido; hydroxy; oxo; thioxo; =NR'; Ci-C2O alkoxy or Ci-C20 haloalkoxy, each of which is optionally substituted with from 1-10 Ra; C6-Ci8 aryloxy or heteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd; C7-C20 aralkoxy, heteroaralkoxy including 6-20 atoms, C3-Ci6 cycloalkoxy, C3-C20 cycloalkenyloxy, heterocyclyloxy including 3-20 atoms, or heterocycloalkenyloxy including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb; mercapto; Ci-C20 thioalkoxy; Ci-C20 thiohaloalkoxy; C6-Ci8 thioaryloxy or thioheteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd; C7-C20 thioaralkoxy, thioheteroaralkoxy including 6-20 atoms, C3-Ci6 thiocycloalkoxy, C3-C20 thiocycloalkenyloxy, thioheterocyclyloxy including 3-20 atoms, or thioheterocycloalkenyloxy including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb; cyano; -
C(O)R, -C(O)OR; -OC(O)R; -C(O)SR; -SC(O)R; -C(S)SR; -SC(S)R; -C(O)NRsRh; - NRkC(O)R; -C(NR')R; -OC(O)NRsRh; -NRkC(O)NRsRh; -NRkC(O)OR; -S(O)nRm, wherein n is 1 or 2; -NRkS(O)nRm; or -P(O)(ORs)(ORh); or
(ii) C3-C20 cycloalkyl, C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms, or heterocycloalkenyl including 3-20 atoms, each of which is optionally substituted with from 1-
10 Rb; or
(iii) C6-Ci8 aryl or heteroaryl including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd;
Rd at each occurrence is, independently:
(i) halo; NRsRh; nitro; azido; hydroxy; Ci-C20 alkoxy or Ci-C20 haloalkoxy, each of which is optionally substituted with from 1-10 Ra; C6-Ci8 aryloxy or heteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd ; C7-C20 aralkoxy, heteroaralkoxy including 6-20 atoms, C3-Ci6 cycloalkoxy, C3-C20 cycloalkenyloxy, heterocyclyloxy including 3-20 atoms, or heterocycloalkenyloxy including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb; mercapto; Ci-C20 thioalkoxy; Ci-C20 thiohaloalkoxy; C6-Ci8 thioaryloxy or thioheteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1 - 10 Rd ; C7-C20 thioaralkoxy, thioheteroaralkoxy including 6-20 atoms, C3-Ci6 thiocycloalkoxy, C3-C20 thiocycloalkenyloxy, thioheterocyclyloxy including 3-20 atoms, or thioheterocycloalkenyloxy including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb; cyano; -C(O)R, -C(O)OR1; -OC(O)RJ; -C(O)SRJ; -SC(O)RJ; -C(S)SR; -SC(S)R; -C(O)NRsRh; -NRkC(O)R; -C(NR)R; - OC(O)NRsRh; -NRkC(O)NRsRh; -NRkC(O)OR; -S(O)nRm, wherein n is 1 or 2; -NRkS(O)nRm; or -P(O)(ORs)(ORh);
(ii) Ci-C2O alkyl or Ci-C2O haloalkyl, each of which is optionally substituted with from 1-10 Ra; or
(iii) C2-C20 alkenyl or C2-C20 alkynyl, each of which is optionally substituted with from 1-10 Rc; or
(iv) C7-C20 aralkyl, heteroaralkyl including 6-20 atoms, C3-C20 cycloalkyl, C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms, or heterocycloalkenyl including 3-20 atoms, each of which is optionally substituted with from 1 - 10 Rb; or
(v) Cβ-Cig aryl or heteroaryl including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd ;
Rd at each occurrence is, independently, halo; NRsRh; nitro; azido; hydroxy; Ci-C20 alkyl, Ci-C20 haloalkyl, C2-C20 alkenyl; C2-C20 alkynyl; C3-C20 cycloalkyl; C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms; heterocycloalkenyl including 3-20 atoms; C7-C20 aralkyl; heteroaralkyl including 6-20 atoms; Ci-C20 alkoxy; Ci-C20 haloalkoxy; C6-Cig aryloxy; heteroaryloxy; C7-C20 aralkoxy; heteroaralkoxy including 6-20 atoms; C3-Ci6 cycloalkoxy; C3-C20 cycloalkenyloxy; heterocyclyloxy including 3-20 atoms; heterocycloalkenyloxy including 3-20 atoms; mercapto; Ci-C20 thioalkoxy; Ci-C20 thiohaloalkoxy; C6-CiS thioaryloxy; thioheteroaryloxy including 5-16 atoms; C7-C20 thioaralkoxy, thioheteroaralkoxy including 6-20 atoms, C3-Ci6 thiocycloalkoxy C3-C20 thiocycloalkenyloxy, thioheterocyclyloxy including 3-20 atoms, or thioheterocycloalkenyloxy including 3-20 atoms; cyano; -C(O)R, -C(O)OR; -OC(O)R; -C(O)SR; -SC(O)R; -C(S)SR; - SC(S)R; -C(O)NRsRh; -NRkC(O)R; -C(NR')R; -OC(O)NRsRh; -NRkC(O)NRsRh; - NRkC(O)OR; -S(O)nRm, wherein n is 1 or 2; -NRkS(O)nRm; or -P(O)(ORs)(ORh);
Re at each occurrence is, independently, Ci-C6 alkyl, optionally substituted with from 1-3 Ra; Ci-C6 haloalkyl; phenyl; 4-fluorophenyl; halo; hydroxyl; NRsRh; nitro; C2-C6 alkenyl; C2-C6 alkynyl; Ci-C6 alkoxy; Ci-C6 haloalkoxy; cyano; or -C(O)R;
Rf at each occurrence is, independently:
(i) -S(O)nR1, -(CH2)i_6S(O)nRn, -NRkS(O)nRn, or -OS(O)nR1, wherein n at each occurrence is, independently, 0, 1, or 2 (e.g., 1 or 2); or (ii) -NRkC(O)NRsR\ -NRkC(O)OR, -OC(O)NRsRh, or -OC(O)OR; or (iii) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and optionally substituted with from 1 -3 Re; or
(iv) heterocycloalkenyl including 5-10 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -3 Re; or (v) -YRf , wherein Y at each occurrence is, independently, Ci-C6 alkylene, -O-, or -
NR9-;
Rf at each occurrence is, independently:
(i) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and optionally substituted with from 1 -3 Re; or
(ii) heterocycloalkenyl including 5-10 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -3 Re;
each of Rs, Rh, R1, and Rk, at each occurrence is, independently: (i) hydrogen; or
(ii) C1-C20 alkyl or C1-C20 haloalkyl, each of which is optionally substituted with from 1-10 Ra; or
(iii) C2-C20 alkenyl or C2-C20 alkynyl, each of which is optionally substituted with from 1-10 Rc; or (iv) C3-C2O cycloalkyl, C3-C2O cycloalkenyl, heterocyclyl including 3-20 atoms, or heterocycloalkenyl including 3-20 atoms, C7-C20 aralkyl, or heteroaralkyl including 6-20 atoms, each of which is optionally substituted with from 1-10 Rb; or
(v) C6-Ci8 aryl or heteroaryl including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd; or (vi) -OR, -C(O)R, -C(O)OR; -C(O)NRsRh; or -S(O)nRm;
RJ at each occurrence is, independently: (i) hydrogen; or
(ii) C1-C20 alkyl or C1-C20 haloalkyl, each of which is optionally substituted with from 1-10 Ra; or
(iii) C2-C20 alkenyl or C2-C20 alkynyl, each of which is optionally substituted with from 1-10 Rc; or
(iv) C3-C2O cycloalkyl, C3-C2O cycloalkenyl, heterocyclyl including 3-20 atoms, or heterocycloalkenyl including 3-20 atoms, C7-C20 aralkyl, or heteroaralkyl including 6-20 atoms, each of which is optionally substituted with from 1-10 Rb; or (v) C6-Ci8 aryl or heteroaryl including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd; or
Rm at each occurrence is, independently, RJ, ORJ, or NRsRh;
Rn at each occurrence is, independently, RJ or NRsRh;
or an N-oxide and/or a pharmaceutically acceptable salt thereof.
In one aspect, this invention features a compound of formula (I), in which:
R1 is hydrogen or Ci-Ce alkyl;
X is -C(O)-; -O-; -S(O)r, wherein t is 0-2; -NR9-; -C(O)NR9-; -C(O)O-; -CH2O-; or -SO2NR9-, wherein R9 is hydrogen or Ci-C6 alkyl; each of Rs, Rh, R1, and Rk, at each occurrence is, independently: (i) hydrogen; or
(ii) Ci-C2O alkyl or Ci-C2O haloalkyl, each of which is optionally substituted with from 1-10 Ra; or
(iii) C2-C2O alkenyl or C2-C2O alkynyl, each of which is optionally substituted with from 1-10 Rc; or (iv) C3-C20 cycloalkyl, C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms, or heterocycloalkenyl including 3-20 atoms, C7-C2O aralkyl, or heteroaralkyl including 6-20 atoms, each of which is optionally substituted with from 1-10 Rb; or
(v) C6-Ci8 aryl or heteroaryl including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd; or (vi) -OR, -C(O)R, -C(O)OR; -C(O)NRsRh; or -S(O)nRm, wherein n is 1 or 2; n is 1 or 2; and
R2, R3, R4, R5, R6, R7, R8, R9, R10, Y, W, W1, A, Ra, Ra', Rb, Rb', Rc, Rd, Rd', Re, Rf, Rf , RJ, Rm, Rn, and t can be as defined above; or an N-oxide and/or a pharmaceutically acceptable salt thereof.
In another aspect, this invention features any of the specific quinoline compounds delineated herein (e.g., as shown in the Examples). In some embodiments, the compound compound can be selected from the group consisting of the title compounds of Examples 43- 190, 192-198, 201, 202, 204-210, 212-217, 220-223, 226, 229-257, 259-267, 269-272, 274- 365, 367-370, 372, 374-391, 394-396, 400, 402-593, and 595-597, and each of the title compounds in Examples 397-399, 401, and 598-600. As used herein, the term "title compound" refers to (i) the compound name heading a particular example or (ii) each of the compound names delineated in Examples 397, 399, 401, and 598-600. For purposes of clarification, when the Example sets forth a multi-step synthesis, the title compound is the final product of that multi-step synthesis. For example, the title compound of Example 43 is "4- {3-[3-(ethylsulfonyl)phenoxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline," and one of the title compounds of Example 397 is "4-[3'-(ethylsulfonyl)-4'-methylbiphenyl-3-yl]-3- methyl-8-(trifluoromethyl)quinoline."
In one aspect, this invention features a pharmaceutical composition, which includes a compound of formula (I) (including any subgenera or specific compounds thereof) or a salt
(e.g., a pharmaceutically acceptable salt) or a prodrug thereof and a pharmaceutically acceptable adjuvant, carrier or diluent. In some embodiments, the composition can include an effective amount of the compound or the salt thereof. In some embodiments, the composition can further include an additional therapeutic agent.
The invention also relates generally to modulating (e.g., activating) LXRs with the quinoline compounds described herein. In some embodiments, the methods can include, e.g., contacting an LXR in a sample (e.g., a tissue, a cell free assay medium, a cell-based assay medium) with a compound of formula (I) (including any subgenera or specific compounds thereof). In other embodiments, the methods can include administering a compound of formula (I) (including any subgenera or specific compounds thereof) to a subject (e.g., a mammal, e.g., a human, e.g., a human having or at risk of having one or more of the diseases or disorders described herein).
In one aspect, this invention also relates generally to methods of preventing or treating (e.g., controlling, ameliorating, alleviating, slowing the progression of, delaying the onset of, or reducing the risk of developing) one or more LXR-mediated diseases or disorders in a subject (e.g., a subject in need thereof). The methods include administering to the subject an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof. LXR-mediated diseases or disorders can include, e.g., cardiovascular diseases (e.g., acute coronary syndrome, restenosis), atherosclerosis, atherosclerotic lesions, type I diabetes, type II diabetes, Syndrome X, obesity, lipid disorders (e.g., dyslipidemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, low HDL and high LDL), cognitive disorders (e.g., Alzheimer's disease, dementia), inflammatory diseases (e.g., multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, endometriosis, LPS- induced sepsis, acute contact dermatitis of the ear, chronic atherosclerotic inflammation of the artery wall), celiac, thyroiditis, skin aging or connective tissue diseases.
In another aspect, this invention relates to methods of modulating (e.g., increasing) serum HDL cholesterol levels in a subject (e.g., a subject in need thereof), which includes administering to the subject an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In another aspect, this invention relates to methods of modulating (e.g., decreasing) serum LDL cholesterol levels in a subject (e.g., a subject in need thereof), which includes administering to the subject an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In another aspect, this invention relates to methods of modulating (e.g., increasing) reverse cholesterol transport in a subject (e.g., a subject in need thereof), which includes administering to the subject an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In another aspect, this invention relates to methods of modulating (e.g., decreasing or inhibiting) cholesterol absorption in a subject (e.g., a subject in need thereof), which includes administering to the subject an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In a further aspect, this invention relates to methods of preventing or treating a cardiovascular disease (e.g., acute coronary syndrome, restenosis), which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In one aspect, this invention relates to methods of preventing or treating atherosclerosis and/or atherosclerotic lesions, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In another aspect, this invention relates to methods of preventing or treating diabetes (e.g., type I diabetes or type II diabetes), which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof. In a further aspect, this invention relates to methods of preventing or treating Syndrome X, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof. In one aspect, this invention relates to methods of preventing or treating obesity, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In another aspect, this invention relates to methods of preventing or treating a lipid disorder (e.g., dyslipidemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, low HDL and/or high LDL), which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In a further aspect, this invention relates to methods of preventing or treating a cognitive disorder (e.g., Alzheimer's disease or dementia), which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In one aspect, this invention relates to methods of preventing or treating dementia, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In another aspect, this invention relates to methods of preventing or treating Alzheimer's disease, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In a further aspect, this invention relates to methods of preventing or treating an inflammatory disease (e.g., multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, endometriosis, LPS-induced sepsis, acute contact dermatitis of the ear, chronic atherosclerotic inflammation of the artery wall), which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In another aspect, this invention relates to methods of preventing or treating rheumatoid arthritis, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In a further aspect, this invention relates to methods of preventing or treating celiac, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In a further aspect, this invention relates to methods of preventing or treating thyroiditis, which includes administering to a subject in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In one aspect, this invention relates to methods of treating a connective tissue disease (e.g., osteoarthritis or tendonitis), which includes administering to a subject (e.g., a mammal, e.g., a human) in need thereof an effective amount of a compound of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof. In embodiments, the compound of formula (I) inhibits (e.g., reduces or otherwise diminishes) cartilage degradation. In embodiments, the compound of formula (I) induces (e.g., increases or otherwise agments) cartilage regeneration. In embodiments, the compound of formula (I) inhibits (e.g., reduces or otherwise diminishes) cartilage degradation and induces (e.g., increases or otherwise agments) cartilage regeneration. In embodiments, the compound of formula (I) inhibits (e.g., reduces or otherwise diminishes) aggrecanase activity. In embodiments, the compound of formula (I) inhibits (e.g., reduces or otherwise diminishes) elaboration of pro-inflammatory cytokines in osteoarthritic lesions.
In another aspect, this invention relates to methods of treating or preventing skin aging, the method comprising administering (e.g., topically administering) to a subject (e.g., a mammal, e.g., a human) in need thereof an effective amount of a compound of formula (I)
(including any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof. In embodiments, the skin aging can be derived from chronological aging, photoaging, steroid-induced skin thinning, or a combination thereof.
The term "skin aging" includes conditions derived from intrinsic chronological aging (for example, deepened expression lines, reduction of skin thickness, inelasticity, and/or unblemished smooth surface), those derived from photoaging (for example, deep wrinkles, yellow and leathery surface, hardening of the skin, elastosis, roughness, dyspigmentations (age spots) and/or blotchy skin), and those derived from steroid- induced skin thinning. Accordingly, another aspect is a method of counteracting UV photodamage, which includes contacting a skin cell exposed to UV light with an effective amount of a compound of formula (I). In some embodiments, the compound of formula (I) (including any subgenera or specific compounds thereof) does not substantially increase serum and/or hepatic triglyceride levels of the subject.
In some embodiments, the administered compound of formula (I) (including any subgenera or specific compounds thereof) can be an LXR agonist (e.g., an LXRα agonist or an LXRβ agonist, e.g., an LXRβ agonist).
In some embodiments, the subject can be a subject in need thereof (e.g., a subject identified as being in need of such treatment). Identifying a subject in need of such treatment can be in the judgment of a subject or a health care professional and can be subjective (e.g. opinion) or objective (e.g. measurable by a test or diagnostic method). In some embodiments, the subject can be a mammal. In certain embodiments, the subject is a human.
In a further aspect, this invention also relates to methods of making compounds described herein. Alternatively, the method includes taking any one of the intermediate compounds described herein and reacting it with one or more chemical reagents in one or more steps to produce a compound described herein.
In one aspect, this invention relates to a packaged product. The packaged product includes a container, one of the aforementioned compounds in the container, and a legend (e.g., a label or an insert) associated with the container and indicating administration of the compound for treatment and control of the diseases or disorders described herein. Embodiments can include one or more of the following features.
The substituent attached to the 4-position of the quinoline ring in formula (I) can be defined as follows:
(I) R3 is C6-C14 aryl, which is: (i) substituted with from 1-2 R10, and (ii) optionally substituted with from 1-4 Re; and
A at each occurrence is, independently, C6-Ci0 aryl, which is: (a) substituted with from 1-2 Rf; and (b) optionally substituted with from 1-4 Re; and
Rf at each occurrence is, independently: (i) -S(O)nR1, -(CH2)L6S(O)nR11, -NRkS(O)nRn, or -OS(O)nR1, wherein n at each occurrence is, independently, O, 1, or 2 (e.g., 1 or 2); or
(ii) -NRkC(O)NRsR\ -NRkC(O)OR, -OC(O)NRsRh, or -OC(O)OR; or
(H) R3 is heteroaryl including 5-14 atoms, which is: (i) substituted with from 1-2 R10, and
(ii) optionally substituted with from 1 -4 Re; and A at each occurrence is, independently, C6-Ci0 aryl, which is: (a) substituted with from 1-2 Rf; and (b) optionally substituted with from 1-4 Re; and Rf at each occurrence is, independently:
(i) -S(O)nRn, -(CH2)L6S(O)nR11, -NRkS(O)nRn, or -OS(O)nR1, wherein n at each occurrence is, independently, 1 or 2; or
(ii) -NRkC(0)NRsR\ -NRkC(0)0R, -0C(0)NRsRh, or -OC(O)OR; or
(III)
R3 is C6-Ci4 aryl, which is: (i) substituted with from 1-2 R10, and (ii) optionally substituted with from 1 -4 Re; and
A at each occurrence is, independently, heteroaryl including 5-10 atoms, which is:
(a) substituted with from 1 -2 Rf or includes a substituted ring atom selected from the group consisting of S(O) and SO2; and
(b) is optionally substituted with from 1 -4 Re; provided that the heteroaryl including 5-10 atoms is not optionally substituted [1,2,4]- oxadiazolyl; and
Rf at each occurrence is, independently:
(i) -S(O)nR1, -(CH2)L6S(O)nR11, -NRkS(O)nRn, or -OS(O)nR1, wherein n at each occurrence is, independently, 1 or 2; or (ii) -NRkC(0)NRsR\ -NRkC(0)0R, -0C(0)NRsRh, or -OC(O)OR; or
(IV)
R3 is C6-Ci4 aryl, which is: (i) substituted with from 1-2 R10, and (ii) optionally substituted with from 1 -4 Re; and A at each occurrence is, independently, C6-Ci0 aryl, which is: (a) substituted with from 1-2 Rf; and (b) optionally substituted with from 1-4 Re; and
Rf at each occurrence is, independently:
(iii) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and optionally substituted with from 1 -3 Re; or (iv) heterocycloalkenyl including 5-10 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -3 Re; or
(v) -YRf , wherein Y at each occurrence is, independently, Ci-C6 alkylene, -0-, or - NR9-; or
(V)
RR33 U is C6-Ci4 aryl, which is: (i) substituted with from 1-2 R10, and (ii) optionally substituted with from 1-4 Re; and A at each occurrence is, independently, arylazacyclyl including 8-12 atoms, each of which is: (a) substituted with from 1-2 Rf, and (b) optionally substituted with from 1-4 Re; and
Rf at each occurrence is, independently: (i) -S(O)nRn, -(CH2)L6S(O)nR11, -NRkS(O)nRn, or -OS(O)nR1, wherein n at each occurrence is, independently, 1 or 2; or
(ii) -NRkC(0)NRgR\ -NRkC(0)0R, -0C(0)NRgRh, or -OC(O)OR; or
(VI) R3 is C6-C14 aryl, which is: (i) substituted with from 1-2 R10, and (ii) optionally substituted with from 1-4 Re; and
A at each occurrence is, independently, arylsulfinylcyclyl, heteroarylsulfinylcyclyl, arylsulfonylcyclyl or heteroarylsulfonylcyclyl, each of which includes 8-10 atoms and is optionally substituted with from 1 -4 Re; or
(VII)
R3 is C6-C14 aryl, which is: (i) substituted with from 1-2 R10, and (ii) optionally substituted with from 1 -4 Re; and
A at each occurrence is, independently, [l,2,4]-oxadiazolyl, optionally substituted with from 1-2 Re.
R1 can be hydrogen. R2 can be hydrogen.
R2 can be: (ii) Ci-C6 alkyl that is optionally substituted with from 1-2 Ra; or (iii) C7- Cio aralkyl that is optionally substituted with from 1-3 Rb; or (vii) -XR8.
R2 can be Ci-C6 alkyl, optionally substituted with from 1-2 Ra (e.g., R2 can be CH3; or CH2CH3 or CH(CH3)2). Ra can be NRsRh or hydroxyl. For example, R2 can be CH2NRsRh. R2 can be C7-CiO aralkyl, optionally substituted with from 1-3 Rb (e.g., R2 can be benzyl). R2 can be cyano. R2 can be XR8 (e.g., -SO2CH3, C(O)NH2, C(O)OH, or C(O)OEt).
R3 can be C6-Ci0 aryl, which is (a) substituted with from 1-2 (e.g., 1) R10; and (b) optionally substituted with from 1 -2 Re. R can be phenyl, which is (a) substituted with 1 R 10 ; and (b) optionally substituted with from 1 -2 Re. R3 can be phenyl, which is substituted with 1 R10. R can have formula A as described herein in which W and A can be as defined anywhere herein (generically, subgenerically, or specifically):
(A).
R3 can have formula (A-4):
(A-4) in which W and A can be as defined anywhere herein, and R ,32 can be hydrogen or Re as defined anywhere herein (e.g., halo, e.g., chloro or fluoro).
R3 can be heteroaryl including 5-10 atoms, which is (i) substituted with 1 R10, and (ii) optionally substituted with from 1 -2 Re. For example, R can be pyridyl, thienyl, thiazolyl, or pyrazolyl, which is (i) substituted with 1 R10, and (ii) optionally substituted with from 1-2 Re.
W can be -O-. W can be a bond. W can be Ci-C3 alkylene (e.g., -CH2-). W can be C2-C4 alkynylene (e.g., -OC-). W can be -0(C1-C3 alkylene)- or -(C1-C3 alkylene)O- (e.g., - OCH2- or -CH2O-). W can be -0-, a bond, -0(C1-C3 alkylene)-, and -(C1-C3 alkylene)O-.
A can be: (i) phenyl, which is (a) substituted with 1 Rf, and (b) optionally substituted with from 1-2 Re; or (ii) heteroaryl including 5-8 atoms, which is (a) substituted with 1 Rf, and (b) optionally substituted with from 1-3 Re, provided that the heteroaryl including 5-8 atoms is not [l,2,4]-oxadiazolyl; or (iii) tetrahydroquinolyl or tetrahydroisoquinolyl, which is (a) substituted with from 1 Rf, and (b) optionally substituted with from 1 -2 Re.
Rf can be -S(O)nR1 (e.g., Rf can be -SO2Rn).
Rn can be C1-C1O alkyl, optionally substituted with from 1-2 Ra. Rn can be unsubstituted C1-C3 alkyl (e.g., Rn can be CH3). Rn can be C2-C8 alkyl or C3-C8 alkyl substituted with 1-2 (e.g., 1) Ra. Ra can be hydroxyl; C1-C3 alkoxy; NRsRh; aryl heterocyclyl including 8-10 atoms optionally substituted with from 1-3 Rb (e.g., oxo); or C(O)ORJ; or Ra can be hydroxyl; C1-C3 alkoxy; NRsRh; halo; arylheterocyclyl including 8-10 atoms, optionally substituted with from 1-3 Rb; cyano; or C(O)OR.
Rn can be NRsRh. In some embodiments, Rs and Rh can each be, independently, hydrogen; Ci-Ci0 alkyl, optionally substituted with from 1-2 Ra; C7-Ci0 aralkyl, optionally substituted with from 1-3 Rb; or -C(O)R. In certain embodiments, Rs and Rh are each, independently, hydrogen; Ci -C6 unsubstituted alkyl; C2-C8 alkyl substituted with hydroxyl or Ci-C3 alkoxy; benzyl; or -C(O)CH3.
Rn can be heterocyclyl including 5-10 atoms, optionally substituted with from 1-5 Rb. For example, Rn can be morpholin-4-yl, 1 -piperidyl, piperazin- 1 -yl, or pyrrolidin- 1 -yl, each of which is optionally substituted with from 1-3 Rb.
Rn can be C7-Ci0 aralkyl or C3-C8 cycloalkyl, each of which is optionally substituted with from 1-5 Rb. Rn can be C2-Ci0 alkenyl, optionally substituted with from 1-2 Rc. Rn can be C6-Ci0 aryl, optionally substituted with from 1-2 Rd. Rf can be -NRkC(O)NRsRh, -NRkC(O)OR; or -NRkS(O)nRn. Rk can be hydrogen. Rs,
Rh, and R can each be, independently, hydrogen; Ci-C6 alkyl, optionally substituted with from 1-2 Ra; or C6-Ci0 aryl, optionally substituted with from 1-2 Rd. Rn can be Ci-C6 alkyl, optionally substituted with from 1-2 Ra; or C6-Ci0 aryl, optionally substituted with from 1-2 Rd. Rf can be heterocyclyl including 5-7 atoms that is substituted with 1 oxo and optionally substituted with from 1 -2 Re.
Rf can be heterocycloalkenyl including 5-7 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -2 Re.
Rf can be 4,5-dihydrooxazolyl, 2-oxo-imidazolidinyl, 4,5-dihydro-lH-imidazolyl, 1,2,5,6-tetrahydro-pyrimidinyl, 5,6-dihydro-2H-[l,3]oxazinyl, or 2-oxo-oxazolidinyl.
Rf can be lH-benzoimidazolyl.
Re at each occurrence can be, independently, halo, Ci-C3 alkyl, Ci-C3 haloalkyl, Ci- C3 alkoxy, NRsRh, phenyl, or 4-fluorophenyl.
R can have formula D:
(D) wherein:
W is a bond; -O-; Ci_3 alkylene; C2_4 alkynylene; -O(Ci_3 alkylene)-; or -(C^ alkylene)O-; one of Rfl, RQ, RG, Rf4, and Rβ is:
(i) -S(O)nR1, -(CH2)L6S(O)nR11, -NRkS(O)nRn, or -OS(O)nR1; wherein n at each occurrence is, independently, 1 or 2; or
(ii) -NRkC(0)NRgR\ -NRkC(0)0R, -0C(0)NRgRh, or -OC(O)OR; or (iii) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and optionally substituted with from 1 -3 Re; or
(iv) heterocycloalkenyl including 5-10 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -3 Re; or
(v) -YRf , wherein Y at each occurrence is, independently, Ci-C6 alkylene, -0-, or - NR9-; and the others are each, independently, hydrogen or Re.
One of Rfl, RΩ, RG, Rf4, and Rβ can be: (i) -S(O)nRn or -NRkS(O)nRn; or (ii) - NRkC(0)NRsRh or -NRkC(0)0R; or (iii) heterocyclyl including 5-7 atoms that is substituted with from 1 oxo and optionally substituted with from 1 -2 Re; or (iv) heterocycloalkenyl including 5-7 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1-2 Re; and the other four can each be, independently, hydrogen, halo, C1-C3 alkyl, C1-C3 haloalkyl, Ci-C3 alkoxy, or NRsRh.
Four of Rfl, RΩ, RG, Rf4, and Rf5 can be hydrogen.
RQ can be: (i) -S(O)nRn or -NRkS(O)nRn; or (ii) -NRkC(0)NRsRh or -NRkC(0)0R; or (iii) heterocyclyl including 5-7 atoms that is substituted with from 1 oxo and optionally substituted with from 1-2 Re; or (iv) heterocycloalkenyl including 5-7 atoms or IH- benzoimidazolyl, each of which is optionally substituted with from 1-2 Re; and Rfl, RG, Rf4, and Rβ can each be, independently, hydrogen, halo, Ci-C3 alkyl, Ci-C3 haloalkyl, Ci-C3 alkoxy, or NRsRh. Each of Rfl, RG, Rf4, and Rβ can be hydrogen. RΩ can be -SO2Rn. RQ can be: (i) heterocyclyl including 5-7 atoms that is substituted with 1 oxo and optionally substituted with from 1-2 Re; or (ii) heterocycloalkenyl including 5-7 atoms or, each of which is optionally substituted with from 1-2 Re. For example, RQ can be 4,5- dihydrooxazolyl, 2-oxo-imidazolidinyl, 4,5-dihydro-lH-imidazolyl, 1,2,5,6-tetrahydro- pyrimidinyl, 5,6-dihydro-2H-[l,3]oxazinyl, or 2-oxo-oxazolidinyl. As another example, R2f can be lH-benzoimidazolyl.
R3 can have formula D- 1 :
(D-I) in which:
R can be hydrogen or Re (e.g., halo, e.g., fluoro, or chloro);
W can be as defined anywhere herein (e.g., -O- or a bond); each of R^2 and R^3 is, independently, hydrogen or Re; and one of RA24 and RA25 is Rf (e.g., -SO2Rn), and the other is hydrogen or Re.
In certain embodiments, it is provided that only one of RA22, RA23, RA24, and RA25 is
Re
R3 can be heteroaryl including 5-10 (e.g., 5-6) atoms, which is (i) substituted with 1 R10, and (ii) optionally substituted with from 1 -2 Re; and W can be a bond; and A can have formula (B-9):
in which: each of R^2 and R^3 is, independently, hydrogen or Re; and one of RA24 and RA25 is Rf (e.g., -SO2Rn), and the other is hydrogen or Re;
In certain embodiments, it is provided that only one of RA22, RA23, RA24, and RA25 is Re. R3 can have formula (A-4); and
W can be a bond; and
A can be heteroaryl including 5-8 atoms, which is (a) substituted with 1 Rf (e.g., - SO2R11), and (b) optionally substituted with from 1 -3 Re, provided that the heteroaryl including 5-8 atoms is not [l,2,4]-oxadiazolyl.
R can have formula (A-4); and
W can be a bond; and
A can be tetrahydroquinolyl or tetrahydroisoquinolyl, which is (a) substituted with 1 Rf (e.g., -SO2R1), and (b) optionally substituted with from 1-2 Re.
R3 can have formula (A-4); and
W can be a bond; and
A can be benzo[b]thienyl- 1,1 -dioxide, 3,4-dihydro-2H-thiopyrano[2,3-b]pyridyl-l,l- dioxide, or 2,3-dihydrobenzo[b]thienyl- 1,1 -dioxide, each of which is optionally substituted with from 1-3 Re.
R3 can have formula D-I; R32 can be hydrogen or Re (e.g., halo, e.g., fluoro, or chloro); and
W can be as defined anywhere herein (e.g., -O- or a bond); each of R^2 and R^3 is, independently, hydrogen or Re; and one of RA24 and RA25 is Rf, e.g.:
(i) heterocyclyl including 5-7 atoms that is substituted with 1 oxo and optionally substituted with from 1 -2 Re; or
(ii) heterocycloalkenyl including 5-7 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -2 Re; and the other is hydrogen or Re.
In certain embodiments, it is provided that only one of RA22, RA23, RA24, and RA25 is
Re
R can have formula (E) or (F) as defined anywhere herein. R32 can be hydrogen. R32 can be halo (e.g., chloro or fluoro). A can be benzo[b]thienyl- 1,1 -dioxide, 3,4-dihydro-2H-thiopyrano[2,3-b]pyridyl-l,l- dioxide, or 2,3-dihydrobenzo[b]thienyl- 1,1 -dioxide, each of which is optionally substituted with from 1-3 Re. Re at each occurrence can be, independently, halo; C1-C3 alkyl, optionally substituted with from 1-2 Ra; C1-C3 haloalkyl; C1-C3 alkoxy; hydroxyl; nitro; cyano; NRsRh; phenyl; or 4-fluorophenyl.
Each of R4, R5 and R6 can be hydrogen or fluoro. Each of R4, R5 and R6 can be hydrogen. Each of R4, R5 and R6 can be hydrogen, and R7 can be other than hydrogen. R7 can be chloro, cyano, C1-C6 alkyl, C1-C3 haloalkyl, C1-C6 alkoxy, C(O)OR,
R7 can be C1-C6 (e.g., C1-C3) haloalkyl (e.g., CF3). R7 can be halo (e.g., chloro or bromo, preferably chloro). R7 can be SO2R111. Rm can be CH3. R7 can be hydrogen or cyano. In some embodiments, it is provided that when Rf is SO2Rn and Rn is C1-C6 alkyl, then R7 is other than fluoro. The compounds can have formula (III) or (V) as defined anywhere herein.
The term "mammal" includes organisms, which include mice, rats, cows, sheep, pigs, rabbits, goats, horses, monkeys, dogs, cats, and humans.
"An effective amount" refers to an amount of a compound that confers a therapeutic effect (e.g., treats, controls, ameliorates, prevents, delays the onset of, or reduces the risk of developing a disease, disorder, or condition or symptoms thereof) on the treated subject. The therapeutic effect may be objective (i.e., measurable by some test or marker) or subjective (i.e., subject gives an indication of or feels an effect). An effective amount of the compound described above may range from about 0.01 mg/Kg to about 1000 mg/Kg, (e.g., from about 0.1 mg/Kg to about 100 mg/Kg, from about 1 mg/Kg to about 100 mg/Kg). Effective doses will also vary depending on route of administration, as well as the possibility of co-usage with other agents.
The term "halo" or "halogen" refers to any radical of fluorine, chlorine, bromine or iodine. In general, and unless otherwise indicated, substituent (radical) prefix names are derived from the parent hydride by either (i) replacing the "ane" in the parent hydride with the suffixes "yl," "diyl," "triyl," "tetrayl," etc.; or (ii) replacing the "e" in the parent hydride with the suffixes "yl," "diyl," "triyl," "tetrayl," etc. (here the atom(s) with the free valence, when specified, is (are) given numbers as low as is consistent with any established numbering of the parent hydride). Accepted contracted names, e.g., adamantyl, naphthyl, anthryl, phenanthryl, furyl, pyridyl, isoquinolyl, quinolyl, and piperidyl, and trivial names, e.g., vinyl, allyl, phenyl, and thienyl are also used herein throughout. Conventional numbering/lettering systems are also adhered to for substituent numbering and the nomenclature of fused, bicyclic, tricyclic, polycyclic rings.
The term "alkyl" refers to a saturated hydrocarbon chain that may be a straight chain or branched chain, containing the indicated number of carbon atoms (e.g., Ci-C2O, Ci-Ci0).
For example, Ci-C20 alkyl indicates that the group may have from 1 to 20 (inclusive) carbon atoms in it. Any atom can be substituted. Examples of alkyl groups include without limitation methyl, ethyl, n-propyl, zsopropyl, and tert-butyl.
The term "cycloalkyl" refers to saturated monocyclic, bicyclic, tricyclic, or other polycyclic hydrocarbon groups (e.g., C3-C20, C3-Ci0, C3-C6). Any atom can be substituted, e.g., by one or more substituents. A ring carbon serves as the point of attachment of a cycloalkyl group to another moiety. Cycloalkyl groups can contain fused rings. Fused rings are rings that share a common carbon atom. Cycloalkyl moieties can include, e.g., cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, adamantyl, and norbornyl (bicycle[2.2.1]heptyl).
The terms "alkylene," "alkenylene," and "alkynylene," refer to divalent alkyl (e.g., Ci-C6, e.g., -CH2-), alkenyl (e.g., C2-C6, e.g., -CH=CH-), and alkynyl (e.g., C2-C6, e.g., -OC- ) moieties, respectively.
The term "haloalkyl" refers to an alkyl group (e.g., Ci-C20, e.g., Ci-Ci0), in which at least one hydrogen atom is replaced by halo. In some embodiments, more than one hydrogen atom (2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,etc. hydrogen atoms) on a alkyl group can be replaced by more than one halogen (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, etc. halogen atoms). In these embodiments, the hydrogen atoms can each be replaced by the same halogen (e.g., fluoro) or the hydrogen atoms can be replaced by a combination of different halogens (e.g., fluoro and chloro). "Haloalkyl" also includes alkyl moieties in which all hydrogens have been replaced by halo (e.g., perhaloalkyl, e.g., perfluoroalkyl, such as trifluoromethyl).
The term "aralkyl" (e.g., C7-C20, C7-Ci2, C7-Ci0) refers to an alkyl moiety in which an alkyl hydrogen atom is replaced by an aryl group. One of the carbons of the alkyl moiety serves as the point of attachment of the aralkyl group to another moiety. Aralkyl includes groups in which more than one hydrogen atom on an alkyl moiety has been replaced by an aryl group. Any ring or chain atom can be substituted e.g., by one or more substituents. Non- limiting examples of "aralkyl" include benzyl, 2-phenylethyl, 3-phenylpropyl, benzhydryl (diphenylmethyl), and trityl (triphenylmethyl) groups. The term "heteroaralkyl" (e.g., 5-16 atoms, 5-14 atoms, 5-10 atoms, 5-6 atoms) refers to an alkyl moiety in which an alkyl hydrogen atom is replaced by a heteroaryl group. One of the carbons of the alkyl moiety serves as the point of attachment of the aralkyl group to another moiety. Heteroaralkyl includes groups in which more than one hydrogen atom on an alkyl moiety has been replaced by a heteroaryl group. Any ring or chain atom can be substituted e.g., by one or more substituents. Heteroaralkyl can include, for example, 2- pyridylethyl.
The term "alkenyl" refers to a straight or branched hydrocarbon chain containing 2-20 (e.g., 2-12, 2-10, 2-6, 2-4) carbon atoms and having one or more double bonds. Any atom can be substituted, e.g., by one or more substituents. Alkenyl groups can include internal or terminal double bond containing, e.g., allyl, 1-butenyl, 2-hexenyl and 3-octenyl groups. One of the double bond carbons can optionally be the point of attachment of the alkenyl substituent. The term "alkynyl" refers to a straight or branched hydrocarbon chain containing 2-20 (e.g., 2-12, 2-10, 2-6, 2-4) carbon atoms and having one or more triple bonds. Any atom can be substituted, e.g., by one or more substituents. Alkynyl groups can include internal or terminal triple bond containing moieties, e.g., ethynyl, propargyl, and 3-hexynyl. One of the triple bond carbons can optionally be the point of attachment of the alkynyl substituent.
The term "alkoxy" refers to an -O-alkyl radical. The term "mercapto" refers to an SH radical. The term "thioalkoxy" refers to an -S-alkyl radical. The terms "aryloxy" and "heteroaryloxy" refer to an -O-aryl radical and -O-heteroaryl radical, respectively. The terms "thioaryloxy" and "thioheteroaryloxy" refer to an -S-aryl radical and -S-heteroaryl radical, respectively.
The terms "aralkoxy" and "heteroaralkoxy" refer to an -O-aralkyl radical and -O- heteroaralkyl radical, respectively. The terms "thioaralkoxy" and "thioheteroaralkoxy" refer to an -S-aralkyl radical and -S-heteroaralkyl radical, respectively. The term "cycloalkoxy" refers to an -O-cycloalkyl radical. The terms "cycloalkenyloxy" and "heterocycloalkenyloxy" refer to an -O-cycloalkenyl radical and -O-heterocycloalkenyl radical, respectively. The term "heterocyclyloxy" refers to an -O-heterocyclyl radical. The term "thiocycloalkoxy" refers to an -S-cycloalkyl radical. The terms "thiocycloalkenyloxy" and "thioheterocycloalkenyloxy" refer to an -S-cycloalkenyl radical and -S-heterocycloalkenyl radical, respectively. The term "thioheterocyclyloxy" refers to an -S-heterocyclyl radical. The term "heterocyclyl" (e.g., 5-16 ring atoms, 5-14 ring atoms, 5-10 ring atoms, 5-6 ring atoms) refers to a saturated monocyclic, bicyclic, tricyclic or other polycyclic ring system having 1-4 heteroatoms if monocyclic, 1-8 heteroatoms if bicyclic, or 1-10 heteroatoms if tricyclic, said heteroatoms selected from O, N, or S (and mono and dioxides thereof, e.g., N→O~, S(O), SO2). Thus, a heterocyclyl ring includes carbon atoms and 1-4, 1-8, or 1-10 heteroatoms selected from N, O, or S if monocyclic, bicyclic, or tricyclic, respectively. A ring heteroatom or ring carbon is the point of attachment of the heterocyclyl substituent to another moiety. Any atom can be substituted, e.g., by one or more substituents. The heterocyclyl groups can contain fused rings. Fused rings are rings that share a common carbon or nitrogen atom. Heterocyclyl groups can include, e.g., tetrahydrofuryl, tetrahydropyranyl, piperidyl (piperidino), piperazinyl, morpholinyl (morpholino), pyrrolinyl, and pyrrolidinyl.
The term "cycloalkenyl" refers to partially unsaturated monocyclic, bicyclic, tricyclic, or other polycyclic hydrocarbon groups (e.g., C3-C2O, C3-Ci0, C3-C6). A ring carbon (e.g., saturated or unsaturated) is the point of attachment of the cycloalkenyl substituent. Any atom can be substituted e.g., by one or more substituents. The cycloalkenyl groups can contain fused rings. Fused rings are rings that share a common carbon atom. Cycloalkenyl moieties can include, e.g., cyclohexenyl, cyclohexadienyl, or norbornenyl.
The term "heterocycloalkenyl" (e.g., 5-16 ring atoms, 5-14 ring atoms, 5-10 ring atoms, 5-6 ring atoms) refers to partially unsaturated monocyclic, bicyclic, tricyclic, or other polycyclic hydrocarbon groups having 1-4 heteroatoms if monocyclic, 1-8 heteroatoms if bicyclic, or 1-10 heteroatoms if tricyclic, said heteroatoms selected from O, N, or S (and mono and dioxides thereof, e.g., N→O~, S(O), SO2) (e.g., carbon atoms and 1-4, 1-8, or 1-10 heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic, respectively). A ring carbon (e.g., saturated or unsaturated) or heteroatom is the point of attachment of the heterocycloalkenyl substituent. Any atom can be substituted, e.g., by one or more substituents. The heterocycloalkenyl groups can contain fused rings. Fused rings are rings that share a common carbon or nitrogen atom. Heterocycloalkenyl groups can include, e.g., tetrahydropyridyl, dihydropyranyl, 4,5-dihydrooxazolyl, 4,5-dihydro-lH-imidazolyl, 1,2,5,6- tetrahydro-pyrimidinyl, and 5,6-dihydro-2H-[l,3]oxazinyl.
The term "aryl" refers to a fully unsaturated, aromatic monocyclic, bicyclic, or tricyclic, hydrocarbon ring system (e.g., C6-Ci8, C6-Ci4, C6-Ci0), wherein any ring atom can be substituted, e.g., by one or more substituents. Aryl groups can contain fused rings. Fused rings are rings that share a common carbon atom. Aryl moieties can include, e.g., phenyl, naphthyl, anthracenyl, and pyrenyl.
The term "heteroaryl" (e.g., e.g., 5-16 ring atoms, 5-14 ring atoms, 5-10 ring atoms, 5-6 ring atoms) refers to a fully unsaturated, aromatic monocyclic, bicyclic, tricyclic, or other polycyclic hydrocarbon groups having 1-4 heteroatoms if monocyclic, 1-8 heteroatoms if bicyclic, or 1-10 heteroatoms if tricyclic, said heteroatoms independently selected from O, N, or S (and mono and dioxides thereof, e.g., N→O~, S(O), SO2) (e.g., carbon atoms and 1-4, 1- 8, or 1-10 heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic, respectively). Any atom can be substituted, e.g., by one or more substituents. Heteroaryl groups can contain fused rings. Fused rings are rings that share a common carbon or nitrogen atom. Heteroaryl groups can include, e.g., pyridyl, thienyl, furyl (furanyl), imidazolyl, indolyl, isoquinolyl, quinolyl and pyrrolyl.
The terms "arylheterocyclyl" and "heteroarylheterocyclyl" (e.g., 8-20 ring atoms, 8- 12 ring atoms, 8-10 ring atoms) refer to bicyclic, tricyclic, or other polycyclic ring systems that include an aryl or heteroaryl ring, respectively, that is fused to a heterocyclyl ring that includes from 1-3 heteroatoms independently selected from O, N, or S (and mono and dioxides thereof, e.g., N→O~, S(O), SO2,). The remaining ring atoms of the heterocyclyl ring are carbon. Any atom can be substituted, e.g., by one or more substituents. A ring atom on either the aryl portion or the heterocyclyl portion can serve as the point of attachment of the arylheterocyclyl to another moiety. Examples can include without limitation the ring systems delineated below under the definitions of arylazacyclyl, arylsulfinylcyclyl, heteroarylsulfinylcyclyl, arylsulfonylcyclyl, and heteroarylsulfonylcyclyl.
The term "arylazacyclyl" (e.g., 8-20 ring atoms, 8-12 ring atoms, 8-10 ring atoms) refers to bicyclic, tricyclic, or other polycyclic ring systems that include an aryl ring fused to a heterocyclyl ring that includes one nitrogen ring atom (the remaining ring atoms of the heterocyclyl ring are carbon). Any atom can be substituted, e.g., by one or more substituents. A ring atom on either the aryl portion or the heterocyclyl portion can serve as the point of attachment of the arylazacyclyl to another moiety. For example, arylazacyclyl can include 1,2,3,4-tetrahydroquinolyl, 1,2,3,4-tetrahydroisoquinolyl, and isoindolinyl-l,3-dione (phthalimido).
The terms "arylsulfinylcyclyl" and "heteroarylsulfinylcyclyl" (e.g., 8-20 ring atoms, 8-12 ring atoms, 8-10 ring atoms) refer to bicyclic, tricyclic, or other polycyclic ring systems that include an aryl or heteroaryl ring, respectively, that is fused to a heterocyclyl ring that includes one -S(O)- (sulfinyl) ring atom (i.e., the sulfur atom of which forms part of the ring system, and the remaining ring atoms of the heterocyclyl ring are carbon. Any atom can be substituted, e.g., by one or more substituents. A carbon ring atom on either the aryl/heteroaryl portion or the heterocyclyl portion can serve as the point of attachment of the arylsulfinylcyclyl and heteroarylsulfinylcyclyl to another moiety. For example, such ring systems can include:
The terms "arylsulfonylcyclyl" and "heteroarylsulfonylcyclyl" (e.g., e.g., 8-20 ring atoms, 8-12 ring atoms, 8-10 ring atoms) refer to bicyclic, tricyclic, or other polycyclic ring systems that include an aryl or heteroaryl ring, respectively, that is fused to a heterocyclyl ring that includes one -SO2- (sulfonyl) ring atom (i.e., the sulfur atom of which forms part of the ring system, and the remaining ring atoms of the heterocyclyl ring are carbon,). Any atom can be substituted, e.g., by one or more substituents. A carbon ring atom on either the aryl/heteroaryl portion or the heterocyclyl portion can serve as the point of attachment of the arylsulfonylcyclyl and heteroarylsulfonylcyclyl to another moiety. For example, such ring systems can include:
The term "oxo" refers to an oxygen atom, which forms a carbonyl (C=O) when attached to carbon, or which forms part of a sulfinyl or sulfonyl group when attached to a sulfur atom, or which forms part of an N-oxide when attached to a nitrogen. The term "thioxo" refers to an oxygen atom, which forms a thiocarbonyl (C=S) when attached to carbon. Descriptors such as C(O), C(S), and C(NR1) refer to carbon atoms that are doubly bonded to an oxygen, sulfur, and nitrogen atom, respectively.
The term "substituent" refers to a group "substituted" on, e.g., an alkyl, haloalkyl, cycloalkyl, alkenyl, alkynyl, aralkyl, heteroaralkyl, heterocyclyl, heterocycloalkenyl, cycloalkenyl, aryl, or heteroaryl group at any atom of that group. In one aspect, the substituent(s) (e.g., Rd) on a group are independently any one single, or any combination of two or more of the permissible atoms or groups of atoms delineated for that substituent. In another aspect, a substituent may itself be substituted with any one of the above substituents (e.g., Rd').
In general, when a definition for a particular variable includes both hydrogen and non-hydrogen (halo, alkyl, aryl, etc.) possibilities, the term "substituent(s) other than hydrogen" refers collectively to the non-hydrogen possibilities for that particular variable.
In some embodiments, the compounds have agonist activity for genes involved with HDL production and cholesterol efflux (e.g., ABCAl) and antagonist activity for genes involved with triglyceride synthesis (e.g., SREBP-Ic). The details of one or more embodiments of the invention are set forth in the description below. Other features and advantages of the invention will be apparent from the description and from the claims.
DETAILED DESCRIPTION
This invention relates generally to quino line-based modulators of LXRs and related methods and compositions.
The quino line -based LXR modulators have the general formula (I):
(I) in which R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, X, Y, W, W1, A, Ra, Ra', Rb, Rb', Rc, Rd, Rd', Re, Rf, Rf , Rs, R1 R, Rk, Rm, Rn, n, and t can be as defined anywhere herein.
For ease of exposition, it is understood that any recitation of ranges (e.g., C1-C12, 1-5) or subranges of a particular range (e.g., Ci-C4, C2-C6, 1-2) for any of R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, X, Y, W, W1, A, Ra, Ra', Rb, Rb', Rc, Rd, Rd', Re, Rf, Rf , Rs, Rh, R1 R, Rk, Rm, Rn, n, and t expressly includes each of the individual values that fall within the recited range, including the upper and lower limits of the recited range. For example, the range Ci-C4 alkyl is understood to mean Ci, C2, C3, C4, Ci-C4, Ci-C3, Ci-C2, C2-C4, C2-C3, or C3-C4 alkyl and the range 1-3 Ra is understood to mean 1, 2, 3, 1-3, 1-2, or 2-3 Ra.
For ease of exposition, it is also understood that where in this specification (including the claims), a group is defined by "as defined anywhere herein" (or the like), the definitions for that particular group include the first occurring and broadest generic definition as well as any sub-generic and specific definitions delineated anywhere in this specification.
Variable R1
In some embodiments, R1 can be hydrogen. Variable R2
In some embodiments, R can be:
(i) hydrogen, cyano, or halo; or
(ii) C1-C12 (e.g., C1-C6 or C1-C4) alkyl or C1-C12 (e.g., C1-C6 or C1-C4) haloalkyl, each of which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Ra; or
(iii) C7-C20 (e.g., C7-C16, C7-C12, C7-C10) aralkyl or heteroaralkyl including 6-20 (e.g., 6-14, 6-12, 6-10) atoms, each of which is optionally substituted with from 1-10 (e.g., 1-5, 1-4, 1-3, 1-2, l) Rb; or
(v) C3-C10 (e.g., C3-C7) cycloalkyl, optionally substituted with from 1-5 (e.g., 1-4, 1- 3, 1-2, l) Rb; or
(vi) C6-C18 (e.g., C6-C14, C6-C10, phenyl) aryl or heteroaryl including 5-16 (e.g., 5-14, 5-10, 5-6) atoms, each of which is optionally substituted with from 1-10 (e.g., 1-5, 1-4, 1-3, 1- 2, 1) Rd; or
(vii) -XR8.
In some embodiments, R2 can be:
(i) hydrogen or cyano; or
(ii) C1-C12 (e.g., C1-C6 or C1-C4) alkyl or C1-C12 (e.g., C1-C6 or C1-C4) haloalkyl, each of which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Ra; or (iii) C7-C20 (e.g., C7-C16, C7-C12, C7-C10) aralkyl or heteroaralkyl including 6-20 (e.g.,
6-14, 6-12, 6-10) atoms, each of which is optionally substituted with from 1-10 (e.g., 1-5, 1-4, 1-3, 1-2, l) Rb.
In some embodiments, R2 can be: (ii) C1-C6 alkyl that is optionally substituted with from 1-2 Ra; or (iii) C7-C10 aralkyl that is optionally substituted with from 1-3 Rb; or (vii) -
XR8.
In certain embodiments, R can be hydrogen.
In certain embodiments, R can be C1-C6 (e.g., C1-C4) alkyl, which is optionally substituted with 1 or 2 Ra (e.g., NRsRh, hydroxy, cyano, or -C(O)OR).
For example, R can be CH3 (methyl), ethyl, n-propyl, or iso-propyl. An exemplary R2 substituent is CH3.
In certain embodiments, R can be C1-C6 (e.g., C1 or C2) alkyl substituted with one Ra. In embodiments, Ra can be hydroxy or NRsRh. For example, R2 can be CH2NRsRh. In embodiments, Rs and Rh can be both hydrogen. In certain embodiments, one of Rs and Rh can be hydrogen, and the other can be Ci-C2O (e.g., Ci-Ci0, Ci-C6, Ci-C3) haloalkyl (e.g., fluoromethyl, trifluoromethyl, or fluoroethyl); or Ci-C2O alkyl (e.g. methyl, ethyl, or isopropyl), which is optionally substituted with Ci-C20 alkoxy (e.g., Ci-Ci0, Ci-C6, Ci-C3, e.g., methoxy), cyano, C2-C20 (e.g., C2-Ci0, C2-C6, C2-C3) alkenyl (e.g., allyl), or C3-C20 cycloalkyl
(e.g., cyclopropyl or cyclopentyl).
In certain embodiments, R2 can be C7-Ci0 aralkyl, which is optionally substituted with from 1-3 (e.g., 1-2, 1) Rb (e.g., CrC3 alkyl; CrC3 haloalkyl, e.g., Q-C3 perfluoroalkyl; halogen; or CN). An exemplary R2 aralkyl substituent is benzyl.
In certain embodiments, R can be cyano. In certain embodiments, R2 can be halo.
In certain embodiments, R can be C1-C4 haloalkyl, (e.g., C1-C4 perhaloalkyl, e.g., CF3). In certain embodiments, R can be C6-Ci0 aryl that is optionally substituted with from
1-3 (e.g., 1-2, 1) Rd (e.g., Q-C3 alkyl; Ci-C3 haloalkyl, e.g., CrC3 perfluoroalkyl; halogen; or CN). For example, R2 can be phenyl optionally substituted with from 1-3 Rd.
In certain embodiments, R2 can be heteroaryl including 5-10atoms that is optionally substituted with from 1-3 (e.g., 1-2, 1) Rd (e.g., CrC3 alkyl; CrC3 haloalkyl, e.g., Q-C3 perfluoroalkyl; halogen; CN; NRsRh; or Ci-C3 alkoxy). For example, R2 can be pyridyl, pyrimidinyl, thienyl, benzisoxazolyl, benzothienyl, oxadiazolyl, pyrrolyl, pyrazolyl, imidazolyl, tetrazolyl, or furyl, each of which can be optionally substituted with from 1-3 Rd. An exemplary R2 heteroaryl substituent is tetrazolyl.
In certain embodiments, R2 can be C3-C7 cycloalkyl or heterocyclyl including 3-7 atoms, each of which can be optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Rb. In embodiments, when Rb is present, Rb can be attached to the same carbon atom that connects the cycloalkyl or heterocyclyl ring to the 3 -position of the quinoline core. In certain embodiments, R2 can be -XR8.
For example, X can be -C(O)O-, thereby forming an ester moiety of the formula - C(O)OR8. In certain embodiments, R8 can be hydrogen or Ci-C6 (e.g., Ci-C4) alkyl (e.g., methyl or ethyl).
As another example, X can be -C(O)NR9-, thereby forming an amide moiety of the formula -C(O)NR9R8. In these embodiments, R8 and R9 can each be, independently, hydrogen or Ci-C6 (e.g., C1-C4) alkyl. In certain embodiments, R8 and R9 can both be hydrogen; or one of R8 and R9 can be hydrogen, and the other can be Ci-C6 (e.g., Ci-C4) alkyl (e.g., CH3 or ethyl). As one example, X can be -S(O)r, thereby forming a sulfone moiety of the formula - S(O)tR8. In certain embodiments, R8 can be hydrogen or Ci-C6 (e.g., Ci-C4) alkyl (e.g., ethyl), and t can be 0, 1, or 2 (e.g., 2).
As a further example, X can be -NR9-, thereby forming an amino moiety of the formula -NR8R9. In certain embodiments, R9 can be hydrogen or Ci-C6 (e.g., Ci-C4) alkyl, and R8 can be as defined anywhere herein. In certain embodiment, R8 and R9 can both be hydrogen.
Variable R3 In some embodiments, R3 can be C6-Ci8 (e.g., C6-Ci4, C6-Ci0, phenyl) aryl, which is
(i) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) R10 and (ii) optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1) Re. In embodiments, when R3 is substituted with Re, each Re can be independently of one another: Ci-C3 alkyl; Ci-C3 haloalkyl, e.g., Ci-C3 perfluoroalkyl; halogen; or CN. In some embodiments, R can be C6-CiO aryl, which is (i) substituted with from 1-5
(e.g., 1-4, 1-3, 1-2, 1) R10 and (ii) optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1) Re. In some embodiments, R3 can be C6-CiO aryl, which is (i) substituted with 1 or 2 R10 and (ii) optionally substituted with 1 or 2 Re.
In some embodiments, R3 can be naphthyl, which is (i) substituted with 1 or 2 R10 and (ii) optionally substituted with 1 or 2 Re.
In some embodiments, R3 can be phenyl, which is (i) substituted with 1 or 2 R10 and (ii) optionally substituted with 1 or 2 Re (e.g., 1 Re, which can be, e.g., halo, e.g., fluoro or chloro).
In some embodiments, R3 can be C6-Ci0 aryl, which is (i) substituted with 1 R10 and (ii) optionally substituted with 1 or 2 Re.
In certain embodiments, R3 can be phenyl, which is (i) substituted with 1 R10 and (ii) optionally substituted with 1 or 2 Re (e.g., halo). In these embodiments, R can have formula (A), in which R10 (i.e., the moiety -WA) can be attached to a ring carbon that is ortho, meta, or para (preferably meta) with respect to the ring carbon that connects the phenyl ring to the 4-position of the quinoline ring, and Re, when present can be connected to ring carbons that are not occupied by WA. For example, R3 can have formula (A-I) or (A-I '), in which R10 (WA) is attached to the ring carbon that is meta with respect to the ring carbon that connects the phenyl ring to the 4-position of the quinoline ring in formula (I).
(A) (A-I) (A-I')
In certain embodiments, R3 can be phenyl that is substituted with 1 R10, and R3 can have formula (A-2), e.g., formula (A-3):
(A-2) (A-3)
In still other embodiments, R can have formula (A-4):
in which W and A can be as defined anywhere herein; and R32 can be hydrogen; or Re (e.g., halo, e.g., chloro or fluoro).
In some embodiments, R3 can be heteroaryl including 5-16 (e.g., 5-14, 5-10, 5-6) atoms, which is (i) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) R10 and (ii) optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1) Re. In embodiments, when R3 is substituted with Re, each Re can be independently of one another: Ci-C3 alkyl; Ci-C3 haloalkyl, e.g., Ci-C3 perfluoroalkyl; halogen; or CN.
In some embodiments, R can be heteroaryl including 5-10 atoms, which is (i) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) R10 and (ii) optionally substituted with from
1-4 (e.g., 1-3, 1-2, 1) Re.
In some embodiments, R3 can be heteroaryl including 5-10 atoms, which is (i) substituted with from 1-4 (e.g., 1-3, 1-2, 1) R10 and (ii) optionally substituted with 1 or 2 Re.
In some embodiments, R3 can be heteroaryl including 5-6 atoms, which is (i) substituted with from 1-4 (e.g., 1-3, 1-2, 1) R10 and (ii) optionally substituted with 1 or 2 Re
(e.g., Ci-C3 haloalkyl, e.g., Ci-C3 perfluoroalkyl, e.g., Ci-C2 perfluoroalkyl; or halogen).
In certain embodiments, R can be pyridyl, pyrimidinyl, thienyl, or furyl (e.g., pyridyl or pyrimidinyl), which is (i) substituted with from 1-4 (e.g., 1-3, 1-2, 1) R10 and (ii) optionally substituted with 1 or 2 Re (e.g., Ci-C3 haloalkyl, e.g., Ci-C3 perfluoroalkyl, e.g., Ci-C2 perfluoroalkyl; or halogen).
In some embodiments, R can be heteroaryl including 5-10 (e.g., 5-6) atoms, which is (i) substituted with 1 R10, and (ii) optionally substituted with from 1 -2 Re.
In certain embodiments, R3 can be pyridyl, pyrimidinyl, thienyl, thiazolyl, pyrazoly, or furyl (e.g., pyridyl, thienyl, thiazolyl, or pyrazoly), which is (i) substituted with from 1 R10 and (ii) optionally substituted with 1 or 2 Re (e.g., Ci-C3 haloalkyl, e.g., Ci-C3 perfluoroalkyl, e.g., Ci-C2 perfluoroalkyl; or halogen).
In certain embodiments, R3 can be pyridyl, thienyl, pyrazoly, or thiazolyl (e.g., thienyl or thiazolyl).
Variable W
In some embodiments, W can be -O-.
In some embodiments, W can be a bond.
In some embodiments, W can be Ci-C3 alkylene (e.g., CH2).
In some embodiments, W can be C2-C4 alkynylene (e.g., -C≡C-). In some embodiments, W can be alkylene)- or -(Ci-C3 alkylene) W1- (e.g., -0(Ci-C3 alkylene)- or -(CrC3 alkylene)O-, e.g., -OCH2- or -CH2O-); or W can be -0-, a bond, -0(Ci-C3 alkylene)-, and -(CrC3 alkylene)O-.
Variable A
In some embodiments, A can be a cyclic group that is (a) substituted with one or more Rf; and (b) optionally substituted with from 1-4 Re.
In some embodiments, A can be: (i-A) C6-Ci0 (e.g., phenyl) aryl, which is (a) substituted with from 1-5 (e.g., 1-4, 1-3,
1-2, 1, e.g., 1) Rf; and (b) optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1, e.g., 1-2) Re; and/or
(ii-A) heteroaryl including 5-10 (e.g., 5-8) atoms, which is (a) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1, e.g., 1) Rf; and (b) is optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1, e.g., 1-3) Re; provided that the heteroaryl including 5-10 atoms is not [1,2,4]- oxadiazolyl; and/or
(iii-A) arylazacyclyl including 8-12 atoms (e.g., tetrahydroquinolyl or tetrahydroisoquinolyl), which is (a) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1, e.g., 1) Rf, and (b) optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1, e.g., 1-2) Re.
In embodiments, any one of the following combinations can apply for defining A:
• (i-A), (ii-A), or (iii-A); or
• (i-A) and (ii-A), or (i-A) and (iii-A), or (ii-A) and (iii-A); or • (i-A), (ii-A), and (iii-A).
In some embodiments, A can be C6-Ci0 aryl, which is (i) substituted with from 1-3 (e.g., 1-2, 1) Rf and (ii) optionally substituted with 1 or 2 Re.
In some embodiments, A can be naphthyl, which is (i) substituted with from 1-3 (e.g., 1-2, 1) Rf and (ii) optionally substituted with 1 or 2 Re.
In some embodiments, A can be phenyl, which is (i) substituted with from 1-3 (e.g., 1-2, 1) Rf and (ii) optionally substituted with 1 or 2 Re.
In certain embodiments, A can be phenyl, which is (i) substituted with 1 Rf and (ii) optionally substituted with 1 or 2 Re. For example, A can have formula (B-I), (B-2), or (B-3), in which Rf can be attached to a ring carbon that is ortho, meta, or para, respectively (preferably meta) with respect to the ring carbon that is attached to W:
(B-I) (B-2)
(B-3)
As another example, A can have formula (B-4), (B-5), (B-6), or (B-7) in which the phenyl ring is substituted with (a) 1 Rf and (b) 1 Re:
As another example, A can have formula (B- ), in which the phenyl ring is substituted with (a) 1 Rf and (b) 2 Re: (B-8) As a further example, A can have formula (B-9):
in which: each of R^2 and R^3 can be, independently, hydrogen or Re; and one of RA24 and RA25 can be Rf (e.g., -SO2Rn), and the other is hydrogen or Re.
In certain embodiments, it is provided that only one of RA22, RA23, RA24, and RA25 is
Re
In certain embodiments, RA25 can be Rf (e.g., -SO2Rn), and each of RA22, RA23, and R^4 can be hydrogen. In certain embodiments, R^5 can be Rf (e.g., -SO2Rn), one of RA22, R^3, and RA24 (e.g., R^3) can be Re, and the other two can each be hydrogen.
In other embodiments, RA24 can be Rf (e.g., -SO2Rn), and each of R^2, R^3, and RA25 can be hydrogen. In certain embodiments, R^4 can be Rf (e.g., -SO2Rn), one of RA22, RA23, and RA25 (e.g., RA22) can be Re, and the other two can each be hydrogen.
In other embodiments, A can be heteroaryl including 5-10 atoms, which is (a) substituted with from 1-3 (e.g., 1-2, 1,) Rf; and (b) is optionally substituted with from 1-3 (e.g., 1-2, 1) Re; provided that the heteroaryl including 5-10 atoms is not [l,2,4]-oxadiazolyl.
In some embodiments, A can be heteroaryl including 5-10 atoms, which is (a) substituted with 1 Rf; and (b) is optionally substituted with from 1-3 (e.g., 1-2, 1) Re; provided that the heteroaryl including 5-10 atoms is not [l,2,4]-oxadiazolyl. In some embodiments, A can be heteroaryl including 5-8 atoms, which is (a) substituted with 1 Rf; and (b) is optionally substituted with from 1-3 (e.g., 1-2, 1) Re; provided that the heteroaryl including 5-10 atoms is not [l,2,4]-oxadiazolyl.
In certain embodiments, A can be pyrrolyl, pyridyl, pyridyl-N-oxide, pyrimidinyl, pyrazolyl, thienyl, furyl, quinolyl, oxazolyl, thiazolyl, imidazolyl, isoxazolyl, or indolyl, each of which is (a) substituted with 1 Rf; and (b) is optionally substituted with from 1-3 (e.g., 1-2, l) Re.
In certain embodiments, A can be pyrrolyl, pyridyl, pyrimidinyl, pyrazolyl, thienyl, furyl, quinolyl, oxazolyl, thiazolyl, imidazolyl, or isoxazolyl, each of which is (a) substituted with 1 Rf; and (b) is optionally substituted with from 1-3 (e.g., 1-2, 1) Re.
In certain embodiments, A can be pyridyl, pyrimidinyl, thienyl, furyl, oxazolyl, thiazolyl, imidazolyl, or isoxazolyl, each of which is (a) substituted with 1 Rf; and (b) is optionally substituted with from 1-3 (e.g., 1-2, 1) Re.
In certain embodiments, A can be pyridyl in which W is attached to the 2- or 3- position of the pyridiyl ring.
In embodiments, A can be pyridyl in which W is attached to the 2-position of the pyridyl ring, and Rf is attached to the 4- or the 6-position of the pyridyl ring. Such rings can be further substituted with 1, 2 or 3 Re (e.g., halo, e.g., chloro; or NRsRh, e.g., NH2). For example, A can be pyridyl in which W is attached to the 2-position of the pyridyl ring, Rf is attached to the 6-position of the pyridyl ring, and 1 Re is attached to the 4-position of the pyridyl ring. As another example, A can be pyridyl in which W is attached to the 2-position of the pyridyl ring, Rf is attached to the 6-position of the pyridyl ring, and an Re substituent is attached to the 3-, 4-, and 5-positions of the pyridyl ring.
In other embodiments, A can be pyridyl in which W is attached to the 3 -position of the pyridyl ring, and Rf is attached to the 5-position of the pyridyl ring. Such a ring can be further substituted with 1, 2 or 3 Re (e.g., halo, e.g., chloro; or NRsRh, e.g., NH2).
In certain embodiments, A can be thienyl in which W is attached to the 2-position of the thienyl ring, and Rf is attached to the 5-position of the thienyl ring. Such a ring can be further substituted with 1 , 2 or 3 Re (e.g., halo, e.g., chloro; or NRsRh, e.g., NH2).
In some embodiments, A can be tetrahydroquinolyl or tetrahydroisoquinolyl, which is (a) substituted with from 1-3 (e.g., 1-2, 1) Rf; and (b) is optionally substituted with from 1-3 (e.g., 1-2, 1) Re. In some embodiments, A can be tetrahydroquinolyl or tetrahydroisoquinolyl, which is
(a) substituted with 1 Rf; and (b) is optionally substituted with 1 or 2 Re. In some embodiments, A can be tetrahydroquinolyl or tetrahydroisoquinolyl, which is substituted with 1 Rf. In certain embodiments, W can be attached to the aromatic ring portion of the tetrahydroquinolyl or tetrahydroisoquinolyl ring (e.g., the 5-position). In certain embodiments, Rf can be attached to the tetrahydroquinolyl or tetrahydroisoquinolyl nitrogen ring atom (e.g., when Rf is SO2Rn). In certain embodiments, W can be attached to the 5- position of the tetrahydroquinolyl or tetrahydroisoquinolyl ring, Rf is SO2Rn, and the SO2R1 group is attached to the tetrahydroquinolyl or tetrahydroisoquinolyl nitrogen ring atom.
In some embodiments, when A is (a) substituted with one or more Rf; and (b) substituted with from 1-4 Re, then Re at each occurrence can be, independently, halo (e.g., fluoro or chloro), Ci-C3 alkyl (e.g., CH3), CrC3 haloalkyl (e.g., CF3), Q-C3 alkoxy (e.g., OCH3), NRsRh (e.g., NH2), phenyl, or 4-fluorophenyl. In certain embodiments, Re at each occurrence can be, independently, halo (e.g., fluoro or chloro), Ci-C3 alkyl (e.g., CH3), Ci-C3 haloalkyl (e.g., CF3), Q-C3 alkoxy (e.g., OCH3), NRsRh (e.g., NH2).
In some embodiments, A can be a cyclic group that (a) includes a substituted ring atom selected from the group consisting of S(O) and SO2, e.g., SO2; and (b) is optionally substituted with from 1 -4 Re.
In some embodiments, A can be heteroaryl including 5-10 (e.g., 5-8) atoms that (a) includes a substituted ring atom selected from the group consisting of S(O) and SO2; and (b) is optionally substituted with from 1-4 (b) is optionally substituted with from 1-4 (e.g., 1-3, 1- 2, l, e.g., 1-3) Re.
In certain embodiments, A can be heteroaryl including 5-10 (e.g., 5-8) atoms that (a) includes a substituted ring atom selected from the group consisting of S(O) and SO2, e.g.,
SO2. For example, A can be benzo[b]thienyl 1,1 -dioxide (e.g., in which W is attached to the phenyl ring portion of the benzo[b]thienyl ring system, e.g., the 4-position thereof; or W is attached to the thienyl ring portion of the benzo[b]thienyl ring system, e.g., the 3-position thereof).
In some embodiments, A can be arylsulfonylcyclyl or heteroarylsulfonylcyclyl, each of which includes 8-10 atoms and is optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1, e.g., l-3)Re.
In certain embodiments, A can be heteroarylsulfonylcyclyl, which includes 8-10 atoms and is optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1, e.g., l-3)Re. For example, A can be 3,4-dihydro-2H- thiopyrano[2,3-b]pyridyl 1,1-dioxide (e.g., in which W is attached to the pyridyl ring portion of the thiopyrano[2,3-b]pyridyl ring system, e.g., the 2- or 4- position thereof).
In certain embodiments, A can be arylsulfonylcyclyl, which includes 8-10 atoms and is optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1, e.g., l-3)Re. For example, A can be 2,3-dihydro-benzo[b]thienyl 1,1 -dioxide (e.g., in which W is attached to the phenyl ring portion of the benzo[b]thienyl ring system, e.g., the 4-position thereof).
In some embodiments, when A is a cyclic group that (a) includes a substituted ring atom selected from the group consisting of S(O) and SO2, e.g., SO2; and (b) is substituted with from 1-4 Re, then Re at each occurrence can be, independently, halo; C1-C3 alkyl, optionally substituted with from 1-2 Ra; C1-C3 haloalkyl; C1-C3 alkoxy; hydroxyl; cyano; nitro; NRsRh; phenyl; or 4-fluorophenyl. In certain embodiments, Re at each occurrence can be, independently, halo; C1-C3 alkyl, optionally substituted with from 1-2 Ra (e.g., Ra can be C(O)NRsRh); hydroxyl; cyano; or nitro.
In some embodiments, A can be[l,2,4]-oxadiazolyl, optionally substituted with from 1 Re. In certain embodiments, A can have formula (C):
(C) in which Re can be hydrogen; halo; C1-C3 alkyl, optionally substituted with from 1-2 Ra; Ci- C3 haloalkyl; C1-C3 alkoxy; hydroxyl; cyano; nitro; NRsRh; phenyl; or 4-fluorophenyl. In certain embodiments, Re can be hydrogen; halo; Ci-Ce alkyl, optionally substituted with from 1-2 Ra (e.g., Ra can be C(O)NRsRh); Ci-C3 haloalkyl; Ci-C3 alkoxy; NRsRh; phenyl; or 4- fluorophenyl. In certain embodiments, Re can be hydrogen; halo; C1-C3 alkyl, optionally substituted with from 1-2 Ra (e.g., Ra can be C(O)NRsRh); hydroxyl; cyano; or nitro.
Variable Rf
In some embodiments, Rf at each occurrence can be: (i-F) -S(O)nR1 or -NRkS(O)nRn, in which n is 0, 1 or 2 (e.g., 1 or 2); and/or (ii-F) -NRkC(O)NRsRh or -NRkC(O)OR; and/or (iii-F) heterocyclyl including 5-10 (e.g., 5-7) atoms that is substituted with from 1
0x0 and optionally substituted with from 1-3 (e.g., 1-2, 1) Re; and/or
(iv-F) heterocycloalkenyl including 5-10 (e.g., 5-7) atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1-3 (e.g., 1-2, 1) Re.
In some embodiments, any one of the following combinations can apply for defining
Rf:
• (i-F), (ii-F), (iii-F) or (iv-F); or
• (i-F) and (ii-F), or (i-F) and (ϋi-F), or (i-F) and (iv-F) or (iii-F) and (iv-F); or
• (i-F), (iii-F), and (iii-F); or • (i-F), (ii-F), (iii-F) and (iv-F).
In some embodiments, Rf can be -S(O)nRn (e.g., -SO2R11). In embodiments, when Rn is RJ, then RJ is other than hydrogen. In embodiments, n can be 0; or n can be 1 or 2.
In some embodiments, Rn can be Ci-Ci0 (e.g., Ci-C5 or C2-C8 or C3-C8) alkyl or d-
Cio (e.g., Ci-C5 or Ci-C3) haloalkyl, optionally substituted with from 1-2 Ra.
In certain embodiments, Rn can be Ci-Ci0 (e.g., Ci-C3 or C2-C8 or C3-C8) alkyl, optionally substituted with from 1-2 (e.g., 1) Ra.
In certain embodiments, Rn can be unsubstituted branched or unbranched Ci-Ci0 (e.g., Ci-C5, Ci-C3, C2-C8, or C3-C8) alkyl. In embodiments, Rn can be unsubstituted Ci-C3 alkyl.
For example, Rn can be methyl (CH3). As another example, Rn can be ethyl (CH2CH3). As a further example, Rn can be zsopropyl (CH(CH3)2). In still another example, Rn can be CH2CH2CH3, CH(CH3)2, or CH(CH3)CH2CH3.
In certain embodiments, Rn can be Ci-Ci0 (e.g., Ci-C5 or Ci-C3) haloalkyl. For example, Rn can be CF3 or CH2CH2CH2Cl.
In certain embodiments, Rn can be C2-C8 alkyl or C3-C8 alkyl substituted with 1 -2 (e.g., 1) Ra. Ra can be hydroxyl; Q-C3 alkoxy; NRsRh; aryl heterocyclyl including 8-10 atoms optionally substituted with from 1-3 Rb (e.g., oxo); or C(O)OR; or Ra can be hydroxyl; Ci-C3 alkoxy; NRsRh; halo; arylheterocyclyl including 8-10 atoms, optionally substituted with from 1-3 Rb; cyano; or C(O)OR. For example, example, Rn can be branched or unbranched C3-C8 alkyl, which is substituted with 1-2 (e.g., 1) Ra. In certain embodiments, Ra can be: (i) hydroxyl; or
(ii) Ci-C3 alkoxy (e.g., OCH3); or
(iii) NRsRh (e.g., Rs and Rh can be, independently of one another, hydrogen; Ci-Ce alkyl, optionally substituted with from 1-2 Ra; C7-Ci0 aralkyl, optionally substituted with from
1-2 Ra; -C(O)R; or -S(O)nRm; e.g., Ra can be NH2, NHCH3, NH(Et), or NH(z-propyl)); or (iv) cyano; or
(v) arylheterocyclyl including 8-20, e.g., 8-10, atoms optionally substituted with from 1-4, e.g., 1-2 Rb (e.g., oxo, e.g., Ra can be can be phthalimido); or
(vi) C(O)ORJ (e.g., C(O)OCH3 or C(O)OH). In certain embodiments, Ra can be attached to a secondary or tertiary carbon atom of the alkyl group.
In some embodiments, Rn can be branched or unbranched Ci-C8 (e.g., Ci, C2, or C3) alkyl, which is substituted with 1 Ra. In certain embodiments, Ra can be: (i) hydroxyl; or
(iii) NRsRh; or (iv) cyano; or
(v) arylheterocyclyl including 8-20, e.g., 8-10, atoms optionally substituted with from 1-4, e.g., 1-2 Rb (e.g., oxo, e.g., Ra can be can be phthalimido).
In certain embodiments, when Rn is alkyl substituted with one or more Ra, and Ra is NRsRh, then Rs and Rh can each be, independently, (i) hydrogen; or
(ii) Ci-C8 alkyl (e.g., CH3, CH2CH3, or CH(CH3)CH2CH3) or haloalkyl (e.g., CH2CH2F or CH2CH2Cl), each of which is optionally substituted with cyano; or
(iii) C2-CiO alkenyl or C2-C2O alkynyl (e.g., C3 alkenyl or alkynyl); or (iv) C7-C20 aralkyl (e.g., benzyl), which is optionally substituted with halo (e.g., fluoro or chloro); or
(v) C(O)R (e.g., R can be CH3 or phenyl substituted with -COOH) or SO2Rm (e.g., Rm can be CH3).
For example, one of Rs and Rh can be hydrogen or Ci-C3 alkyl; and the other can be: (ii) Ci-C8 (e.g., Ci-C5) alkyl (e.g., CH3, CH2CH3, or CH(CH3)CH2CH3) or haloalkyl (e.g., CH2CH2F or CH2CH2Cl), each of which is optionally substituted with cyano; or
(iii) C2-Ci0 (e.g., C2-C6) alkenyl or C2-Ci0 (e.g., C2-C6) alkynyl (e.g., C3 alkenyl or alkynyl); or
(iv) C7-C20 (e.g., C7-Ci0) aralkyl (e.g., benzyl), which is optionally substituted with halo (e.g., fluoro or chloro); or
(v) C(O)R (e.g., R can be CH3 or phenyl substituted with -COOH) or SO2Rm (e.g., Rm can be CH3).
In some embodiments, Rn can be -NRsRh. In certain embodiments, Rs and Rh can each be, independently of one another:
(i) hydrogen; or
(ii) Ci-Cio (e.g., Ci-C7, Ci-C6, Ci-C6, Ci, C2-C8, C2, C3-C8) alkyl (branched or unbranched as appropriate), optionally substituted with from 1-2 (e.g., 1) Ra; or (iii) C6-Ci0 aryl (e.g., phenyl), optionally substituted with from 1-3 (e.g., 1-2, 1) Rd
(e.g., Ci to C3 alkyl, optionally substituted with 1-2 Ra; halogen, -CN or -CO2R);
(iv) C7-Ci0 aralkyl (e.g. benzyl), optionally substituted with from 1-3 (e.g., 1-2, 1) Rb (e.g., Ci to C3 alkyl, optionally substituted with 1-2 Ra; halogen, -CN or -CO2R); or
(v) C7-Ci0 cycloalkyl, optionally substituted with from 1-3 (e.g., 1-2, 1) Rb; or (vi) -C(O)R.
In certain embodiments, Rs and Rh can each be, independently of one another, hydrogen; Ci-Ci0 alkyl, optionally substituted with from 1-2 (e.g., 1) Ra; C7-Ci0 aralkyl, optionally substituted with from 1-3 (e.g., 1-2, 1) Rb; or -C(O)R.
In certain embodiments, Rs and Rh can each be, independently of one another, hydrogen; Ci-C6 unsubstituted alkyl; C2-C8 alkyl substituted with hydroxyl or Ci-C3 alkoxy; benzyl; or -C(O)CH3.
In certain embodiments, one of Rs and Rh can be hydrogen or Ci-C3 alkyl; and the other can be:
(ii) Ci-Cio (e.g., Ci-C7, Ci-C6, Ci-C3, Ci, C2-C8, C2, C3-C8) alkyl or haloalkyl (e.g., alkyl, e.g., branched or unbranched), each of which is optionally substituted with from 1-3 (e.g., 1) Ra; or (iii) C6-Ci0 aryl (e.g., phenyl), optionally substituted with from 1-3 (e.g., 1-2, 1) Rd; or
(iv) C7-Ci0 aralkyl (e.g. benzyl), optionally substituted with from 1-3 (e.g., 1-2, 1) Rb; or
(v) C7-Ci0 cycloalkyl, optionally substituted with from 1-3 (e.g., 1-2, 1) Rb; or (vi) -C(O)R.
In certain embodiments, Rs and Rh can both be: (i) hydrogen; or
(iv) C7-Ci0 aralkyl (e.g. benzyl), optionally substituted with from 1-3 (e.g., 1-2, 1) Rb. In embodiments, Rb can be CrC20 (e.g., CrCi0, Ci-C6, CrC3) alkoxy (e.g., OCH3). In certain embodiments, Rn can be -N(H)(Rh), -N(CH3)(R11), or -N(CH2CH3)(R11).
In certain embodiments, Rh can be Ci-C6 unsubstituted alkyl (e.g., CH3, CH2CH3, branched or unbranched C3-C6 alkyl); C2-C8 (e.g., C3-C8 branched or unbranched alkyl), which is substituted with substituted with 1 Ra. In certain embodiments, Ra can be hydroxyl, C1-C3 alkoxy (e.g., OCH3), NRsRh (e.g., NH2), or cyano, preferably hydroxyl.
In certain embodiments, Rh can be C7-Ci0 aralkyl (e.g. benzyl), optionally substituted with 1 Rb (e.g., halo, e.g., fluoro; or C1-C6 alkoxy, e.g., OCH3).
In certain embodiments, Rh can be -C(O)R (e.g., -C(O)CH3).
In some embodiments, Rn can be heterocyclyl including 5-10 (e.g., 5-8, 5-6) atoms, optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1, e.g., 1) Rb.
In certain embodiments, Rn can be morpholin-4-yl, 1 -piperidyl, 4-piperidyl, piperazin-1-yl, or pyrrolidin- 1 -yl, each of which is optionally substituted with from 1-3 (e.g., 1-2, 1) Rb. In certain embodiments, Rb can be CrC3 alkyl or -C(O)OR (e.g., R can be Ci-C4 alkyl, e.g., tert-butyl, or R can be Ci-C4 alkyl, C7-C20 (e.g., C7-Ci0) aralkyl, e.g., benzyl).
In some embodiments, Rn can be C7-Ci0 aralkyl (e.g., benzyl), optionally substituted with from 1-3 (e.g., 1-2, 1) Rb. In certain embodiments, Rb can be Ci-C3 alkyl, which is optionally substituted with from 1-2 (e.g., 1) Ra; halo; cyano; or C(O)OR. In certain embodiments, Rb can be Ci-C3 alkyl (e.g., CH3), which is optionally substituted with 1 Ra (e.g., C(O)OR, e.g., C(O)OCH3); or halo (e.g., fluoro).
In some embodiments, Rn can be C3-C8 cycloalkyl (e.g., cyclopentyl), optionally substituted with from 1-3 (e.g., 1-2, 1) Rb.
In some embodiments, Rn can be C2-C6 alkenyl (e.g., allyl, 1-propenyl), optionally substituted with from 1-2 Rc.
In some embodiments, Rn is C6-Ci0 aryl, optionally substituted with from 1-2 Rd. In certain eemmbbooddiimmeennttss,, RRdd ccaann be Ci-C3 alkyl, which is optionally substituted with 1-2 (e.g., 1) Ra; halo; cyano; or C(O)OR.
In some embodiments, Rf can be -NRkS(O)nRn. In certain embodiments, Rk can be hydrogen. In certain embodiments, Rn can be Ci-C6 alkyl (CH3, CH2CH3), optionally substituted with from 1-2 Ra; or C6-Ci0 (e.g., phenyl) aryl, optionally substituted with from 1- 2 Rd (e.g., CH3). In some embodiments, Rf can be -NRkC(O)ORJ or -NRkC(O)NRsRh. In certain embodiments, Rk can be hydrogen. In certain embodiments, Rs, Rh, and R can each be, independently of one another, hydrogen; Ci-Ce alkyl, optionally substituted with from 1-2 Ra (e.g., chloro) or C6-Ci0 aryl, optionally substituted with from 1-2 Rd (e.g., CH3). In certain embodiments, RJ can be Ci-C6 alkyl, optionally substituted with from 1-2 Ra (e.g., chloro). In certain embodiments, one of Rs and Rh can be hydrogen.
In some embodiments, Rf can be:
(i) heterocyclyl including 5-7 atoms that is substituted with 1 oxo and optionally substituted with from 1 -2 Re; or
(ii) heterocycloalkenyl including 5-7 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -2 Re.
In certain embodiments, Rf can be 4,5-dihydrooxazolyl, 2-oxo-imidazolidinyl, 4,5- dihydro-lH-imidazolyl, 1,2,5,6-tetrahydro-pyrimidinyl, 5,6-dihydro-2H-[l,3]oxazinyl, or 2- oxo-oxazolidinyl, each of which is optionally substituted with from 1-2 Re.
In certain embodiments, Rf can be lH-benzoimidazolyl.
In certain embodiments, Re at each occurrence can be, independently, Ci to C3 alkyl (e.g., CH3) or haloalkyl, each of which is optionally substituted with from 1-2 Ra (e.g., C(O)ORj, e.g., C(O)OH); or phenyl. Variables R4, R5, R6, and R7
In some embodiments, each of R4, R5 and R6 can be, independently of one another, hydrogen or halo (e.g., fluoro). In certain embodiments, each of R4, R5 and R6 can be hydrogen. In certain embodiments, each of R4, R5 and R6 can be hydrogen, and R7 can be other than hydrogen (e.g., Ci-C3 haloalkyl, e.g., CF3). In some embodiments, R7 can be hydrogen, halo, cyano, Ci-Ci0 (e.g., Ci-C6 or Ci-C3) alkyl, or Ci-Ci0 (e.g., Ci-C6 or CrC3) haloalkyl, Ci-C20 alkoxy (e.g., methoxy), C(O)OR,
In some embodiments, R7 can be hydrogen, halo, cyano, Ci-Ci0 (e.g., Ci-C6, Ci-C3) alkyl, or Ci-Ci0 (e.g., CrC6, CrC3) haloalkyl, or SO2Rm. In some embodiments, R7 can be hydrogen, fluoro, chloro, cyano, Ci-Ci0 (e.g., Ci-C6 or Ci-C3) alkyl, or Ci-Ci0 (e.g., Ci-C6 or Ci-C3) haloalkyl, Ci-C20 alkoxy (e.g., methoxy), C(O)OR, C(O)NRSR\ or SO2Rm.
In some embodiments, R7 can be hydrogen; chloro or bromo (e.g., chloro), cyano, Q- Ci0 (e.g., Ci-C6, Ci-C3) alkyl, or Q-Cio (e.g., Ci-C6, Ci-C3) haloalkyl, or SO2Rm In some embodiments, R7 can be halo, cyano, Ci-Ci0 (e.g., Ci-C6 or Ci-C3) alkyl, or Ci-Cio (e.g., Ci-C6 or Ci-C3) haloalkyl, Ci-C20 alkoxy (methoxy), C(O)ORJ, C(O)NRsRh, or c SπO2 τR>
In some embodiments, R7 can be halo, cyano, Ci-Ci0 (e.g., Ci-C6, Ci-C3) alkyl, or Q- Ci0 (e.g., Ci-C6, Ci-C3) haloalkyl, or SO2Rm
In some embodiments, R7 can be fluoro, chloro, cyano, Ci-Ci0 (e.g., Ci-C6 or Ci-C3) alkyl, or CrCi0 (e.g., Q-C6 or Q-C3) haloalkyl, Ci-C20 alkoxy (e.g., methoxy), C(O)OR,
In some embodiments, R7 can be chloro or bromo (e.g., chloro); cyano, Ci-Ci0 (e.g., Q-C6, Ci-C3) alkyl, or Q-Q0 (e.g., Q-C6, Q-C3) haloalkyl, or SO2Rm
In some embodiments, R7 can be chloro, cyano, Ci-C6 alkyl, Ci-C3 haloalkyl, Ci-C6 alkoxy, C(O)OR, C(O)NRsRh, or SO2Rm.
In some embodiments, R7 can be halo, Ci-Ci0 (e.g., Ci-C6 or Ci-C3) alkyl, or Ci-Ci0 (e.g., Q-C6 or Q-C3) haloalkyl, Q-C20 alkoxy (e.g., methoxy), C(O)OR, C(O)NRsRh, or SO2Rm
In some embodiments, R7 can be halo, Ci-Ci0 (e.g., Ci-C6, Ci-C3) alkyl, or Ci-Ci0 (e.g., Q-C6, Q-C3) haloalkyl, or SO2Rm
In some embodiments, R7 can be fluoro, chloro, Ci-Ci0 (e.g., Ci-C6 or Ci-C3) alkyl, or Q-Q0 (e.g., Q-C6 or Q-C3) haloalkyl, Q-C20 alkoxy (e.g., methoxy), C(O)OR, C(O)NRsRh, or SO2Rm.
In some embodiments, R7 can be chloro or bromo (e.g., chloro); Ci-Ci0 (e.g., Ci-C6, Ci-C3) alkyl, or Q-Qo (e.g., Q-C6, Q-C3) haloalkyl, or SO2Rm
In some embodiments, R7 can be fluoro, C(O)OR, or C(O)NRsRh.
In some embodiments, R7 can be C(O)OR or C(O)NRsRh.
In certain embodiments, R7 can be hydrogen; fluoro, chloro; cyano; CH3; CF3; or SO2CH3. In certain embodiments, R7 can be fluoro; chloro; cyano; CH3; CF3; SO2CH3; SO2CH2CH3; or SO2CH(CH3)2. In certain embodiments, R7 can be other than fluoro, e.g., R7 can be chloro; CH3; CF3; or SO2CH3. In certain embodiments, R7 can be Ci-C6 (e.g., Ci-C3) haloalkyl (e.g., CF3).
In certain embodiments, R7 can be halo (e.g., fluoro or chloro, e.g., chloro).
In certain embodiments, R7 can be SO2Rm (e.g., Rm can be CH3, CH2CH3, or CH(CH3)2).
In certain embodiments, R7 can be hydrogen or cyano. In certain embodiments, R7 can be C1-C20 alkoxy (e.g., OCH3)Jn certain embodiments, R7 can be C(O)OR (e.g., C(O)OH or C(O)OCH3) or C(0)NRsRh (e.g., C(O)NH2).
In some embodiments, when Rf is SO2R1 and Rn is Ci-C6 alkyl (e.g., CH3), then R7 is other than fluoro.
In some embodiments, R7 in the definitions above is other than halo (e.g., fluoro).
A subset of compounds includes those in which R3 has formula (D):
(D)
wherein:
W can be a bond; -0-; Ci_3 alkylene (e.g., -CH2-); C2^ alkynylene (e.g., -C≡C-); - O(Ci_3 alkylene)- (e.g., -OCH2-); or -(Ci-3 alkylene)O- (e.g., -CH2O-); one of Rfl, RQ, RG, Rf4, and Rβ (e.g., Rfl, RΩ, or RG; e.g., RQ or RG; e.g., RQ) can be:
(i) -S(O)nR1, -(CH2)L6S(O)nR11, -NRkS(O)nRn, or -OS(O)nRn; wherein n at each occurrence is, independently, 1 or 2; or
(ii) -NRkC(0)NRsR\ -NRkC(0)0R, -0C(0)NRsRh, or -OC(O)OR; or
(iii) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and optionally substituted with from 1 -3 Re; or
(iv) heterocycloalkenyl including 5-10 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -3 Re; or
(v) -YRf , wherein Y at each occurrence is, independently, Ci-C6 alkylene, -0-, or - NR9-; and the others are each, independently, hydrogen or Re, in which Rn, n, Rk, Rf , Rs, Rh, RJ, and Re at each occurrence can be, independently of one another, as defined anywhere herein.
In some embodiments, one of Rfl, RQ, RG, Rf4, and Rβ (e.g., Rfl, RQ, or RG; e.g., RQ or RG; e.g., RΩ) can be:
(i-F) -S(O)nR1 or -NRkS(O)nRn, in which n is 1 or 2; or (ii-F) -NRkC(O)NRsRh or -NRkC(O)ORJ; or
(iii-F) heterocyclyl including 5-10 (e.g., 5-7) atoms that is substituted with from 1 oxo and optionally substituted with from 1-3 (e.g., 1-2, 1) Re; or
(iv-F) heterocycloalkenyl including 5-10 (e.g., 5-7) atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1-3 (e.g., 1-2, 1) Re.
In certain embodiments, four of R , R , R , R , and R can be hydrogen.
In certain embodiments, three of Rfl, RQ, RG, Rf4, and Rf5 can be hydrogen, and one of Rfl, RΩ, RG, Rf4, and Rf5 can Re (e.g., as shown in formula (B-4), (B-5), (B-6), or (B-7)). In certain embodiments, one of Rfl, RQ, RG, Rf4, and Rf5 (e.g., Rfl, RQ, or RG; e.g., RE or RG; e.g., RΩ) can be -S(O)nRn (e.g., n can be 2; e.g., Rn can be CrCio alkyl, optionally substituted with from 1-2 Ra; or NRsRh).
Other embodiments can include one of more other features described herein.
Another subset of compounds includes those in which R has formula D- 1 :
(D-I) wherein:
R can be hydrogen; or R can be Re as defined anywhere herein (e.g., halo, e.g., fluoro, or chloro);
W can be as defined anywhere herein (e.g., -O- or a bond); each of R^2 and R^3 is, independently, hydrogen or Re; and one of RA24 and RA25 is Rf (e.g., -SO2Rn), and the other is hydrogen or Re.
In certain embodiments, it is provided that only one of RA22, RA23, RA24, and RA25 is Re. R^2, RA23, RA24, and RA25 can be as defined anywhere herein. Other embodiments can include one of more other features described herein.
Another subset of compounds includes those in which:
R3 is heteroaryl including 5-10 (e.g., 5-6) atoms, which is (i) substituted with 1 R10, and (ii) optionally substituted with from 1 -2 Re; and W is a bond; and A has formula (B-9):
wherein: each of R^2 and R^3 is, independently, hydrogen or Re; and one of RA24 and RA25 is Rf (e.g., -SO2Rn), and the other is hydrogen or Re; In certain embodiments, it is provided that only one of RA22, RA23, RA24, and RA25 is Re. R^2, RA23, RA24, and RA25 can be as defined anywhere herein. Other embodiments can include one of more other features described herein.
Another subset of compounds includes those in which:
R3 has formula (A-4); and W is a bond; and
A is heteroaryl including 5-8 atoms, which is (a) substituted with 1 Rf (e.g., -SO2Rn), and (b) optionally substituted with from 1-3 Re, provided that the heteroaryl including 5-8 atoms is not [l,2,4]-oxadiazolyl. Other embodiments can include one of more other features described herein.
Another subset of compounds includes those in which:
R3 has formula (A-4); and W is a bond; and
A is tetrahydroquinolyl or tetrahydroisoquinolyl, which is (a) substituted with 1 Rf (e.g., -SO2Rn), and (b) optionally substituted with from 1-2 Re. Other embodiments can include one of more other features described herein.
Another subset of compounds includes those in which:
R3 has formula (A-4); and W is a bond; and
A is benzo[b]thienyl- 1,1 -dioxide, 3,4-dihydro-2H-thiopyrano[2,3-b]pyridyl-l,l- dioxide, or 2,3-dihydrobenzo[b]thienyl- 1,1 -dioxide, each of which is optionally substituted with from 1-3 Re. Other embodiments can include one of more other features described herein.
Another subset of compounds includes those in which:
R3 has formula D-I; R32 can be hydrogen or Re (e.g., halo, e.g., fluoro, or chloro); W can be as defined anywhere herein (e.g., -O- or a bond); each of R^2 and RA23 is, independently, hydrogen or Re; and one of RA24 and RA25 is Rf, e.g.:
(i) heterocyclyl including 5-7 atoms that is substituted with 1 oxo and optionally substituted with from 1-2 Re; or (ii) heterocycloalkenyl including 5-7 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1-2 Re; and the other is hydrogen or Re. In certain embodiments, it is provided that only one of RA22, RA23, RA24, and RA25 is Re. R^2, RA23, RA24, and RA25 can be as defined anywhere herein. Other embodiments can include one of more other features described herein.
In these embodiments, R32 can be hydrogen; or R32 can be halo (e.g., chloro or fluoro).
Another subset of compounds includes those in which R has formula (E):
(E) in which:
W can be a bond; -O-; Ci_3 alkylene (e.g., -CH2-); C2^ alkynylene (e.g., -C≡C-); - O(Ci_3 alkylene)- (e.g., -OCH2-); or -(Ci-3 alkylene)O- (e.g., -CH2O-);
Rf can be: (i) -S(O)nR1, -(CH2)L6S(O)nR0, -NRkS(O)nRn, or -OS(O)nR1; or
(ii) -NRkC(0)NRsR\ -NRkC(0)0R, -0C(0)NRsRh, or -OC(O)OR; or (iii) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and optionally substituted with from 1 -3 Re; or
(iv) heterocycloalkenyl including 5-10 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -3 Re; or
(v) -YRf , wherein Y at each occurrence is, independently, Ci-C6 alkylene, -0-, or - NR9-; and the others are each, independently, hydrogen or Re; and
Re at each occurrence is, independently, halo; Ci-C6 alkyl, optionally substituted with from 1-2 Ra; Q-C3 haloalkyl; Q-C3 alkoxy; NRsRh; phenyl; or 4-fluorophenyl; in which Rn, n, Rk, Rf, Rs, Rh, RJ, and Re at each occurrence can be, independently of one another, as defined anywhere herein.
In some embodiments, Rf can be:
(i-F) -S(O)nR1 or -NRkS(O)nRn, in which n is 1 or 2; or
(ii-F) -NRkC(0)NRsRh or -NRkC(0)0R; or (iii-F) heterocyclyl including 5-10 (e.g., 5-7) atoms that is substituted with from 1 oxo and optionally substituted with from 1-3 (e.g., 1-2, 1) Re; or
(iv-F) heterocycloalkenyl including 5-10 (e.g., 5-7) atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1-3 (e.g., 1-2, 1) Re.
In certain embodiments, Rf can be -S(O)nRn (e.g., n can be 2; e.g., Rn can be Ci-Ci0 alkyl, optionally substituted with from 1-2 Ra; or NRsRh).
Re can be present or absent (i.e., the positions not occupied by W and Rf can all be attached to hydrogen or Re; or a combination thereof). In certain embodiments, W can be attached to the 2-position of the pyridyl ring, and
Rf can be attached to the 4- or the 6-position of the pyridyl ring. Such rings can be further substituted with 1, 2 or 3 Re (e.g., halo, e.g., chloro; or NRsRh, e.g., NH2). For example, W can be attached to the 2-position of the pyridyl ring, Rf can be attached to the 6-position of the pyridyl ring, and 1 Re can be attached to the 4-position of the pyridyl ring. As another example, W can be attached to the 2-position of the pyridyl ring, Rf can be attached to the 6- position of the pyridyl ring, and an Re substituent can be attached to the 3-, 4-, and 5-positions of the pyridyl ring.
In other embodiments, W can be attached to the 3 -position of the pyridyl ring, and Rf can be attached to the 5-position of the pyridyl ring. Such a ring can be further substituted with 1, 2 or 3 Re (e.g., halo, e.g., chloro; orNRsRh, e.g., NH2).
Other embodiments can include one of more other features described herein.
A further subset of compounds includes those in which R3 has formula F:
(F) in which Re can be hydrogen; halo; C1-C3 alkyl, optionally substituted with from 1-2 Ra; C1- C3 haloalkyl; C1-C3 alkoxy; hydroxyl; cyano; nitro; NRsRh; phenyl; or 4-fluorophenyl. In certain embodiments, Re can be hydrogen; halo; Ci-Ce alkyl, optionally substituted with from 1-2 Ra (e.g., Ra can be C(O)NRsRh); C1-C3 haloalkyl; C1-C3 alkoxy; NRsRh; phenyl; or 4- fluorophenyl. In certain embodiments, Re can be hydrogen; halo; C1-C3 alkyl, optionally substituted with from 1-2 Ra (e.g., Ra can be C(O)NRsRh); hydroxyl; cyano; or nitro.
Other embodiments can include one of more other features described herein.
In some embodiments, the compounds can have formula (II):
(H) in which R2, R3, R4, R5, R6, and R7 can be as defined anywhere herein (generically, subgenerically, or specifically).
In some embodiments, the compounds can have formula (III):
(III) in which R2, R3, and R7 can be as defined herein (generically, subgenerically, or specifically). In some embodiments, the compounds can have formula (IV) or (IV-I):
in which R2, W, A, R4, R5, R6, R7, and R32 can be as defined herein (generically, subgenerically, or specifically).
In some embodiments, the compounds can have formula (V):
in which R2, W, A, R7, and R32 can be as defined herein (generically, subgenerically, or specifically).
Other embodiments of the compounds of formulas (II), (III), (IV), (IV-I), (V), and (V-I) can include any one or more of the features described herein. It is understood that the actual electronic structure of some chemical entities cannot be adequately represented by only one canonical form (i.e. Lewis structure). While not wishing to be bound by theory, the actual structure can instead be some hybrid or weighted average of two or more canonical forms, known collectively as resonance forms or structures. Resonance structures are not discrete chemical entities and exist only on paper. They differ from one another only in the placement or "localization" of the bonding and nonbonding electrons for a particular chemical entity. It can be possible for one resonance structure to contribute to a greater extent to the hybrid than the others. Thus, the written and graphical descriptions of the embodiments of the present invention are made in terms of what the art recognizes as the predominant resonance form for a particular species.
The compounds described herein can be synthesized according to methods described herein and/or conventional, organic chemical synthesis methods from commercially available starting materials and reagents. The compounds described herein can be separated from a reaction mixture and further purified by a method such as column chromatography, high- pressure liquid chromatography, or recrystallization. As can be appreciated by the skilled artisan, further methods of synthesizing the compounds of the formulae herein will be evident to those of ordinary skill in the art. Additionally, the various synthetic steps may be performed in an alternate sequence or order to give the desired compounds. Synthetic chemistry transformations and protecting group methodologies (protection and deprotection) useful in synthesizing the compounds described herein are known in the art and include, for example, those such as described in R. Larock, Comprehensive Organic Transformations, VCH Publishers (1989); T.W. Greene and P.G.M. Wuts, Protective Groups in Organic Synthesis, 2d. Ed., John Wiley and Sons (1991); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), and subsequent editions thereof.
Synthesis of Quinoline-Biarylether-sulfones and sulfonamides In general, compounds in which W is oxygen (O) can be prepared as shown in Scheme 1 below.
Scheme 1
Quino line -phenols (a nonlimiting example of which is compound 100 is shown at the top of Scheme 1) can be prepared, for example, as described in Collini et al., US 2005/0131014, which is incorporated by reference herein, and reacted with a halogenated arylsulfone (e.g., 102) or a halogenated arylsulfonamide (e.g., 101). When the halogen is a fluorine or chlorine, an aromatic displacement is typically performed, usually in a polar, aprotic solvent such as DMF, DSMO, and the like in the presence of a base, e.g., potassium carbonate or cesium carbonate, at elevated temperatures, typically from about 100-1500C for several hours to several days. When the halogen on the halogenated arylsulfone or halogenated arylsulfonamide is a bromine or iodine, a coupling procedure using a copper salt, e.g., CuI, can be used in the presence of a ligand such as N,N-dimethylglycine or L-proline, in a solvent such as 1,4-dioxane. Such coupling reactions can be performed using conventional methods known in the art. Examples of the preparation of the halogenated arylsulfones and halogenated arylsulfonamides as well as the procedures for forming the biarylethers where W = oxygen are described below are described elsewhere. Synthesis of Halogenated Aryl Sulfones
Halogenated arylsulfones can be prepared using a variety of conventional synthetic approaches. In some embodiments, the synthesis can include the partial reduction of a commercial halogenated arylsulfonyl chloride using sodium sulfite and sodium bicarbonate in water, typically at 95-1000C for 0.5 to 1 h to provide the sodium arylsulfinate. The reaction is cooled, treated with an alkylating agent such as an alkylating agent R-LG in which LG is a leaving group such as a bromide, iodine, or tosylate. Such alkylating agents can include without limitation ethyl iodide, 3-bromopropan-l-ol, and the like. A phase transfer catalyst, typically tetrabutylammonium bromide, is added and the two-phase mixture is heated at 40- 100 0C for several hours to provide the halogenated arylsulfones (Scheme 2).
Scheme 2
In other embodiments, halogenated thiophenols can be alkylated with an alkylating agent in the presence of a base, typically potassium carbonate, in an appropriate solvent such as acetone. The reaction is typically heated at 40 to 65°C for 1-4 h, cooled, and treated with aqueous sodium bicarbonate and Oxone. After 18-48 h, the desired halogenated arylsulfones is isolated (Scheme 3).
Scheme 3
rtZ18 to 48 h
In still other embodiments, aryl bromides and iodides can be converted to halogenated arylsulfones, in particular methylsulfones, using a copper-catalyzed coupling reaction employing sodium methylsulfinate (Scheme 4).
Scheme 4
Synthesis of Halogenated Aryl Sulfonamides
In general, halogenated arylsulfonamides can be prepared by reaction of halogenated arylsulfonyl chlorides with amines (Scheme 5).
Scheme 5
Preparation of Biarylether sulfones by phenol to arylhalide displacement In some embodiments, biarylethers can be prepared by displacement reactions between 4-(3-hydroxyphenyl)-quino lines and halogenated arylsulfones in which the halogen is preferably fluorine or chlorine. The reactions are typically heated at 100 to 150 0C in a polar solvent such as DMF, DMSO, and N-methylpyrrolidine for several hours to several days (Scheme 6).
Scheme 6
Preparation of Biarylether sulfones by phenol to arylhalide coupling In some embodiments, biarylethers can be synthesized by a coupling reaction between 4-(3-hydroxyphenyl)-quino lines and halogenated arylsulfones where the halogen is preferably bromine or iodine. The reactions are typically heated at 100 to 150 0C in a polar solvent such as DMSO, for several hours to several days, with a copper solubilizing reagent such as L-proline (Scheme 7).
Scheme 7
Preparation of Biarylether sulfones by alkylation of methylsulfones In some embodiments, the quinoline-biarylether-methylsulfones described herein can be further elaborated by forming the anion of the methylsulfone, typically using a strong base such as n-butyl lithium of sec-butyl lithium in a solvent such as ether or THF, typically at 00C to ambient temperatures, followed by addition of an epoxide to form the 3- hydroxypropylsulfone as shown in Scheme 8 below.
Scheme 8
Preparation of Biarylether sulfonamides by phenol to arylhalide displacement In some embodiments, biarylethers with sulfonamide groups can be prepared by displacement reactions between 4-(3-hydroxyphenyl)-quino lines and halogenated arylsulfonamides where the halogen is preferably fluorine. The reactions are typically heated at 100 to 1500C in a polar solvent such as DMF, DMSO, or N-methylpyrrolidine for 2 hours to 2 days (Scheme 9).
Scheme 9
Preparation of Biarylether sulfonamides by phenol to arylhalide coupling In other embodiments, biarylethers with sulfonamide substituents can be synthesized by a coupling reaction between 4-(3-hydroxyphenyl)-quino lines and halogenated arylsulfonamides where the halogen is preferably bromine or iodine. The reactions are typically heated at 100 to 1500C in a solvent such as 1,4-dioxane, for several hours to several days, with a copper solubilizing reagent such as L-proline or N,N-dimethylglycine and a base such as cesium carbonate (Scheme 10).
Scheme 10
Preparation of Ar-OCH^-Ar' compounds
Via phenol alkylation
In some embodiments, alkylation of 4-(3-hydroxyphenyl)-quinolines with arylalkylhalides (aralkyl halides) in a solvent such as acetonitrile or DMF in the presence of a base, typically cesium carbonate or potassium carbonate, generally with heating at reflux for 6 to 24 hours, can provide the benzylsulfone substitution as shown in Scheme 11.
Scheme 11
Preparation of Quino line -Ar-CH2O-Ar' compounds
Via Quinoline-Ar-CH2Br reaction with Ar 'OH
Preparation of quino line-aryl-CH2O-arylsulfones or quino line-aryl-CH2O- arylsulfonamides can be accomplished by conversion of a 4-(3-hydroxymethylphenyl) quinoline into the corresponding bromide by conventional methods, e.g., reaction with a brominating agent such as phosphorous tribromide in a solvent such as dichloromethane or the like. A phenol (or heterophenol) can be alkylated with the benyzlic bromide under typical alkylation conditions as described in Scheme 11 above or using other conditions such as sodium hydride or other base in the presence of a solvent such as DMF or THF (Scheme 12).
Scheme 12
Preparation of Biarylmethylenes Via arylborolane to benzylic halide coupling
In some embodiments, biarylmethylenes can be prepared via the use of 4-(3- [(HO)2B] -phenyl-quino line by coupling methods using pinacolatoborane and an appropriate catalyst, e.g., a palladium catalyst, e.g., palladium tetrakistriphenylphosphine (Pd(PPh)3)4 with a base, typically a carbonate of cesium, sodium, or potassium. The borolane formed undergoes reaction with a benzylic halide, typically a benzylic bromide, to form the quinoline biarylmethylene (Scheme 13).
Scheme 13
R' = H or -CMe2CMe2-
Pd(PPh3)4 or other catalyst
Na2CO3 or other base Solvent
Via quinoline-arylbenzylic halide to arylborolane coupling In other embodiments, biarylmethylenes can be prepared by employing the benzylhalide as described in Scheme 12, and using an arylboronic acid or heteroarylboronic acid and similar conditions to those described for Scheme 13 (Scheme 14).
Scheme 14
Hal = preferred Br, or I or Cl
Via quinoline-arylbenzylic halide to arylborolane coupling (e.g., Biaryl-methylenes with sulfonamide substitution)
In some embodiments, biarylmethylenes with sulfonamide substitution can be prepared by coupling a borolane with a benzylic bromide as in Scheme 13 using analogous conditions. The benzylic bromide contains a sulfonic acid ester with a leaving group such as pentafluorophenol which can be displaced by an amine (HNRsRh) by heating in a solvent such as THF and the like in the presence of a tertiary amine base such as DBU and the like. This provides the quinoline-biarylmethylenesulfonamide (Scheme 15).
Scheme 15
Preparation of Biaryls Via Suzuki Coupling with boronic acids In some embodiments, biaryl or aryl-heteroaryl compounds can be prepared by coupling of a bromide, iodide, or triflate on the 4-phenylquinoline with a boronic acid with suitable substitution using typical Suzuki conditions including a palladium catalyst such as Pd(PPh3 )4 and the like along with a base, typically at elevated temperatures (50 - 110 0C). (Scheme 16) Scheme 16
Via Suzuki Coupling with borolanes
In other embodiments, biaryl or aryl-heteroaryl compounds can be prepared by coupling of a borolane containing 4-phenylquinoline with an arylbromide or aryliodide or with a heteroarylbromide or heteroaryliodide with suitable substitution. Typical Suzuki conditions are used, e.g., as in Scheme 16, such as a palladium catalyst, e.g., Pd(PPh3 )4, with a base, typically at elevated temperatures (50 - 1100C). (Scheme 17)
Scheme 17
R' = H or
R' = -CMe2CMe2 "
Preparation of Quinoline-Ar-alkvne-Ar" and Quinoline-Ar-CH2CH2-Ar' Coupling an appropriate aryl bromide in the presence of a palladium catalyst with trimethyl-tributylstannanylethynyl-silane followed by desilation can provide the aryl- acetylene. The acetylene can be coupled with an appropriate aryl-halide (bromo or iodo) in the presence of a palladium catalyst to provide the diphenyl substituted acetylene. Modification of the acetylene linker can be conveniently carried out using hydrogenation with heterogeneous catalysis (Scheme 18).
Scheme 18
Preparation of Pyridine-Sulfones
In embodiments where the biarylethersulfones contain a heteroaryl group such as a pyridine, 4-(3-hydroxyphenyl)quinoline can be reacted with 2,6-difluoropyridine in a polar solvent such as DMF, in the presence of a base, e.g., potassium carbonate, to afford a 2- fluoropyridine intermediate which can be reacted with sodium alkylsulfinate in a polar solvent such as DMF to give the target pyridine-sulfone (Scheme 19).
Scheme 19
In other embodiments, pyridine sulfone can be prepared by reaction of 2-chloro-4- fluoropyridine with a sodium salt of a thiol in a polar solvent such as DMF to afford a 4- alkylthio-2-chloropyridine which in turn is reacted with a 4-(3-hydroxyphenyl)quinoline under similar conditions to those above and the resulting sulfide can, if desired, be oxidized up to the corresponding sulfone using OXONE® (brand name for 2HKO5S-HKO4S-K2O4S) or other oxidants (Scheme 20).
Scheme 20
OXONE
In other embodiments, pyridine-sulfone can be prepared by the copper- induced coupling of 3-bromo-5-(methylsulfonyl)pyridine with a 4-(3-hydroxyphenyl)quinoline, typically using CuI in the presence of N,N-dimethylglycine hydrochloride in the presence of a base such as cesium carbonate in 1 ,4-dioxane at elevated temperature, typically at reflux (Scheme 21).
Scheme 21
HCI
In other embodiments, pyridine sulfone can be prepared by coupling a 4-bromo-2- alkylthio-pyridine with a 4-(3-hydroxyphenyl)quinoline under similar coupling conditions as in Scheme 21 followed by oxidation with OXONE® to the sulfone as in Scheme 20 (Scheme
22).
Scheme 22
In some embodiments, substituted pyridylsulfones can be prepared as outlined in Scheme 23 using a trichloropyridine.
Scheme 23
In other embodiments, other halogenated pyridylsulfones can be prepared as in Scheme 24.
Scheme 24
In some embodiments, bicyclic pyridylsulfones (constrained) can be prepared from known intermediates as shown in Scheme 25. Scheme 25
Preparation of quinoline-biarylethers with small heterocycle substitutents In some embodiments, quinolines containing biarylmethylenes with small heterocycles, such as 2-imidazolinones and 2-oxazolidinones, can be prepared by coupling of imidazolinones or oxazolidinones to an bromobenzyl alcohol or iodobenzyl alcohol using copper-induced coupling to afford the benzyl alcohols substituted with 2-imidazolinones or 2- oxazolidinones. The alcohols can be converted to the bromides, typically using PBr3, as described in Scheme 12. These are coupled to quinoline containing a borolane under conditions like those in Scheme 13. (Scheme 26).
Scheme 26
trans-1 ,2-diaminocyclohexane
Hal = I, Br reflux
Preparation of quinoline-biarylethers with NHSO2R", NHC(O)OR, and
NHC(0)NHRh
Quinoline biarylethers containing substitutents NHSO2R11, NHC(O)OR, and NHC(0)NHRh can be prepared by reacting a fluoronitrobenzene with a quinoline -phenol in a polar solvent such as DMF or DMA in the presence of a base, typically potassium carbonate at elevated temperatures, typically 80 - 1500C, for typically 4 to 24 hours. The nitro group is reduced in the product, typically with tin metal in hydrochloric acid with a cosolvent such as methanol or ethanol, or by hydrogenation with a palladium catalyst where applicable. The resulting amine can be reacted with isocyanates to afford ureas, with alkyl chloroformates to afford carbamates, and with alkylsulfonyl chlorides or arylsulfonyl chlorides to afford sulfonamides, as in Scheme 27. Several products can be elaborated further by cyclization to
2-imidazolinones (from the ureas) and 2-oxazolidinones (from the carbamates), as also indicated in Scheme 27:
General preparation of oxazoline and related substituents In some embodiments, amide substitution in which the amide is secondary and contains a hydroxyl propyl or hydoxyethyl can be cyclized using triflic anhydride to afford the analogous oxazolines as in Scheme 28.
Scheme 28
L = O, CH2, or a bond L = O, CH2, or a bond n = 1 or 2 n = 1 or 2
In some embodiments, oxadiazoles can be prepared by the reaction of an ester with an amino-oxime as in Scheme 29.
Scheme 29
In some embodiments, imidazolines can be prepared by reaction of an ester with a diamine as in Scheme 30.
Scheme 30
Preparation of quino lines with 8-H or 8-SO2R
In some embodiments, compounds in which R7 is hydrogen or SO2Rn can be prepared according to Scheme 31.
Scheme 31
Hydrogenation
The compounds of this invention may contain one or more asymmetric centers and thus occur as racemates and racemic mixtures, single enantiomers, individual diastereomers and diastereomeric mixtures. All such isomeric forms of these compounds are expressly included in the present invention. The compounds of this invention may also contain linkages (e.g., carbon-carbon bonds, carbon-nitrogen bonds such as amide bonds) wherein bond rotation is restricted about that particular linkage, e.g. restriction resulting from the presence of a ring or double bond. Accordingly, all cis/trans and E/Z isomers and rotational isomers are expressly included in the present invention. The compounds of this invention may also be represented in multiple tautomeric forms, in such instances, the invention expressly includes all tautomeric forms of the compounds described herein, even though only a single tautomeric form may be represented (e.g., alkylation of a ring system may result in alkylation at multiple sites, the invention expressly includes all such reaction products). All such isomeric forms of such compounds are expressly included in the present invention. All crystal forms of the compounds described herein are expressly included in the present invention.
The compounds of this invention include the compounds themselves, as well as their salts and their prodrugs, if applicable. A salt, for example, can be formed between an anion and a positively charged substituent (e.g., amino) on a compound described herein. Suitable anions include chloride, bromide, iodide, sulfate, nitrate, phosphate, citrate, methanesulfonate, trifluoroacetate, and acetate. Likewise, a salt can also be formed between a cation and a negatively charged substituent (e.g., carboxylate) on a compound described herein. Suitable cations include sodium ion, potassium ion, magnesium ion, calcium ion, and an ammonium cation such as tetramethylammonium ion. Examples of prodrugs include esters and other pharmaceutically acceptable derivatives, which, upon administration to a subject, are capable of providing active compounds.
Pharmaceutically acceptable salts of the compounds of this invention include those derived from pharmaceutically acceptable inorganic and organic acids and bases. Examples of suitable acid salts include acetate, adipate, alginate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, citrate, camphorate, camphorsulfonate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptanoate, glycolate, hemisulfate, heptanoate, hexanoate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethanesulfonate, lactate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, palmoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, salicylate, succinate, sulfate, tartrate, thiocyanate, tosylate and undecanoate. Other acids, such as oxalic, while not in themselves pharmaceutically acceptable, may be employed in the preparation of salts useful as intermediates in obtaining the compounds of the invention and their pharmaceutically acceptable acid addition salts. Salts derived from appropriate bases include alkali metal (e.g., sodium), alkaline earth metal (e.g., magnesium), ammonium and N-(alkyl)4 + salts. This invention also envisions the quaternization of any basic nitrogen-containing groups of the compounds disclosed herein. Water or oil-soluble or dispersible products may be obtained by such quaternization. Salt forms of the compounds of any of the formulae herein can be amino acid salts of carboxy groups (e.g. L-arginine, -lysine, -histidine salts). The term "pharmaceutically acceptable carrier or adjuvant" refers to a carrier or adjuvant that may be administered to a subject (e.g., a patient), together with a compound of this invention, and which does not destroy the pharmacological activity thereof and is nontoxic when administered in doses sufficient to deliver a therapeutic amount of the compound.
Pharmaceutically acceptable carriers, adjuvants and vehicles that may be used in the compositions of this invention include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, self-emulsifying drug delivery systems (SEDDS) such as d-α- tocopherol polyethyleneglycol 1000 succinate, surfactants used in pharmaceutical dosage forms such as Tweens or other similar polymeric delivery matrices, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol and wool fat. Cyclodextrins such as α-, β-, and γ-cyclodextrin, or chemically modified derivatives such as hydroxyalkylcyclodextrins, including 2- and 3- hydroxypropyl-β-cyclodextrins, or other solubilized derivatives may also be advantageously used to enhance delivery of compounds of the formulae described herein.
In general, the compounds described herein can be used for treating (e.g., controlling, ameliorating, preventing, delaying the onset of, or reducing the risk of developing) one or more diseases, disorders, conditions or symptoms mediated by LXRs (e.g., cardiovascular diseases (e.g., acute coronary syndrome, restenosis), atherosclerosis, atherosclerotic lesions, type I diabetes, type II diabetes, Syndrome X, obesity, lipid disorders (e.g., dyslipidemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, low HDL and high LDL), cognitive disorders (e.g., Alzheimer's disease, dementia), inflammatory diseases (e.g., multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, endometriosis, LPS-induced sepsis, acute contact dermatitis of the ear, chronic atherosclerotic inflammation of the artery wall), celiac, or thyroiditis)).
A disorder or physiological condition that is mediated by LXR refers to a disorder or condition wherein LXR can trigger the onset of the condition, or where inhibition of a particular LXR can affect signaling in such a way so as to treat, control, ameliorate, prevent, delay the onset of, or reduce the risk of developing the disorder or condition. Examples of such disorders include, but are not limited to cardiovascular diseases (e.g., acute coronary syndrome, restenosis), atherosclerosis, atherosclerotic lesions, type I diabetes, type II diabetes, Syndrome X, obesity, lipid disorders (e.g., dyslipidemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, low HDL and high LDL), cognitive disorders (e.g., Alzheimer's disease, dementia), inflammatory diseases (e.g., multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, endometriosis, LPS- induced sepsis, acute contact dermatitis of the ear, chronic atherosclerotic inflammation of the artery wall), celiac, or thyroiditis).
While not wishing to be bound by theory, it is believed that LXR modulators that activate cholesterol efflux (e.g., upregulate ABCAl), but do not substantially increase
SREBP-Ic expression and triglyceride synthesis in liver, can both reduce atherosclerotic risk and minimize the likelihood of concommitantly increasing serum and hepatic triglyceride levels. Candidate compounds having differential activity for regulating ABCAl (ABCGl) vs. SREBP-Ic can be can be evaluated using conventional pharmacological test procedures, which measure the affinity of a candidate compound to bind to LXR and to upregulate the gene ABCAl.
In some embodiments, LXR ligands can be identified initially in cell- free LXR beta and LXR alpha competition binding assays. LXR ligands can be further characterized by gene expression profiling for tissue selective gene regulation. In some embodiments, the compounds described herein have agonist activity for
ABCAl transactivation but do not substantially affect (e.g., inhibit) SREBP-Ic gene expression in differentiated THP-I macrophages. Gene expression analysis in an antagonist mode can be used to further delineate differential regulation of ABCAl and SREBP-Ic gene expression. In certain embodiments, the compounds described herein preferentially antagonize SREBP-Ic activation (a marker for genes involved in cholesterol and fatty acid homeostasis) but do not substantially affect (e.g., have relatively minimal or additive effects) on ABCAl gene expression or genes known to enhance HDL biogenesis (based on a competition assay with known potent synthetic LXR agonists). Cell type or tissue specificity may be further evaluated in additional cell lines, intestinal, CaCo2 or liver, HepG2 and Huh-7 cells where ABCAl activity is believed to influence net cholesterol absorption and reverse cholesterol transport. The test procedures performed, and results obtained therefrom are described in the Examples section.
In some embodiments, the compounds described herein have agonist activity for ABCAl and antagonist activity for SREBP-Ic (e.g., as determined by gene specific modulation in cell based assays). In certain embodiments, the compounds described herein (in the agonist mode) have at least about 20% efficacy for ABCAl activation by LXR and do not substantially agonize SREBP-Ic (at most about 25% efficacy relative to a reference compound N-(2,2,2-trifluoro-ethyl)-N-[4-(2,2,2-trifluoro- 1 -hydroxy- 1 -trifluoromethyl-ethyl)- phenyl]-benzenesulfonamide (Schultz, Joshua R., Genes & Development (2000), 14(22), 2831-2838)). In certain embodiments, the compounds described herein (in the antagonist mode) do not substantially antagonize ABCAl gene expression. While not wishing to be bound by theory, it is believed that there may be an additive effect on ABCAl gene expression relative to the reference compound at their EC50 concentration. In certain embodiments, the compounds described herein (in the antagonist mode) inhibited agonist- mediated SREBP-Ic gene expression in a dose dependent fashion. In some embodiments, to study the effect of the compounds of formula (I) on skin aging, for example, in a clinical trial, cells can be isolated and RNA prepared and analyzed for the levels of expression of TIMPl, ABCA 12, decorin, TNFα, MMPl, MMP3, and/or IL- 8. The levels of gene expression (i.e., a gene expression pattern) can be quantified, for example, by Northern blot analysis or RT-PCR, by measuring the amount of protein produced, or by measuring the levels of activity of TIMP 1 , ABCA 12, decorin, TNFα, MMP 1 , MMP3 , and/or
IL- 8, all by methods known to those of ordinary skill in the art. In this way, the gene expression pattern can serve as a marker, indicative of the physiological response of the cells to the compounds of formula (I). Accordingly, this response state may be determined before, and at various points during, treatment of the individual with the compounds of formula (I). In one embodiment, expression levels of cytokines and metalloproteases described herein can be used to facilitate design and/or identification of compounds that treat skin aging through an LXR-based mechanism. Accordingly, the invention provides methods (also referred to herein as "screening assays") for identifying modulators, i.e., LXR modulators, that have a stimulatory or inhibitory effect on, for example, TIMPl, ABCA 12, decorin, TNFα, MMPl, MMP3, and/or IL-8 expression.
An exemplary screening assay is a cell-based assay in which a cell that expresses LXR is contacted with a test compound, and the ability of the test compound to modulate TIMPl, ABCA12, decorin, TNFα, MMPl, MMP3, and/or IL-8 expression through an LXR- based mechanism. Determining the ability of the test compound to modulate TIMPl, ABCA12, decorin, TNFα, MMPl, MMP3, and/or IL-8 expression can be accomplished by monitoring, for example, DNA, mRNA, or protein levels, or by measuring the levels of activity of TIMPl, ABCA12, decorin, TNFα, MMPl, MMP3, and/or IL-8, all by methods known to those of ordinary skill in the art. The cell, for example, can be of mammalian origin, e.g., human. In some embodiments, to study the effect of the compounds of formula (I) on osteoarthritis, for example, in a clinical trial, cells can be isolated and RNA prepared and analyzed for the levels of expression of ApoD and other genes implicated in osteoarthritis (for example, TNFα). The levels of gene expression (i.e., a gene expression pattern) can be quantified by Northern blot analysis or RT-PCR, by measuring the amount of protein produced, or by measuring the levels of activity of ApoD or other genes, all by methods known to those of ordinary skill in the art. In this way, the gene expression pattern can serve as a marker, indicative of the physiological response of the cells to the LXR modulator. Accordingly, this response state may be determined before, and at various points during, treatment of the individual with the LXR modulator.
An exemplary screening assay is a cell-based assay in which a cell that expresses LXR is contacted with a test compound, and the ability of the test compound to modulate ApoD expression and/or aggrecanase activity and/or cytokine elaboration through an LXR- based mechanism. Determining the ability of the test compound to modulate ApoD expression and/or aggrecanase activity and/or cytokine elaboration can be accomplished by monitoring, for example, DNA, mRNA, or protein levels, or by measuring the levels of activity of ApoD, aggrecanase, and/or TNFα, all by methods known to those of ordinary skill in the art. The cell, for example, can be of mammalian origin, e.g., human.
In some embodiments, the compounds described herein can be coadministered with one or more other threapeutic agents. In certain embodiments, the additional agents may be administered separately, as part of a multiple dose regimen, from the compounds of this invention (e.g., sequentially, e.g., on different overlapping schedules with the administration of one or more compounds of formula (I) (including any subgenera or specific compounds thereof)). Alternatively, these agents may be part of a single dosage form, mixed together with the compounds of this invention in a single composition. In still another embodiment, these agents can be given as a separate dose that is administered at about the same time that one or more compounds of formula (I) (including any subgenera or specific compounds thereof) are administered (e.g., simultaneously with the administration of one or more compounds of formula (I) (including any subgenera or specific compounds thereof)). When the compositions of this invention include a combination of a compound of the formulae described herein and one or more additional therapeutic or prophylactic agents, both the compound and the additional agent can be present at dosage levels of between about 1 to
100%, and more preferably between about 5 to 95% of the dosage normally administered in a monotherapy regimen.
The compounds and compositions described herein can, for example, be administered orally, parenterally (e.g., subcutaneously, intracutaneously, intravenously, intramuscularly, intraarticularly, intraarterially, intrasynovially, intrasternally, intrathecally, intralesionally and by intracranial injection or infusion techniques), by inhalation spray, topically, rectally, nasally, buccally, vaginally, via an implanted reservoir, by injection, subdermally, intraperitoneally, transmucosally, or in an ophthalmic preparation, with a dosage ranging from about 0.01 mg/Kg to about 1000 mg/Kg, (e.g., from about 0.01 to about 100 mg/kg, from about 0.1 to about 100 mg/Kg, from about 1 to about 100 mg/Kg, from about 1 to about
10 mg/kg) every 4 to 120 hours, or according to the requirements of the particular drug. The interrelationship of dosages for animals and humans (based on milligrams per meter squared of body surface) is described by Freireich et al., Cancer Chemother. Rep. 50, 219 (1966). Body surface area may be approximately determined from height and weight of the patient. See, e.g., Scientific Tables, Geigy Pharmaceuticals, Ardsley, New York, 537 (1970). In certain embodiments, the compositions are administered by oral administration or administration by injection. The methods herein contemplate administration of an effective amount of compound or compound composition to achieve the desired or stated effect. Typically, the pharmaceutical compositions of this invention will be administered from about 1 to about 6 times per day or alternatively, as a continuous infusion. Such administration can be used as a chronic or acute therapy. The amount of active ingredient that may be combined with the carrier materials to produce a single dosage form will vary depending upon the host treated and the particular mode of administration. A typical preparation will contain from about 5% to about 95% active compound (w/w). Alternatively, such preparations contain from about 20% to about 80% active compound. Lower or higher doses than those recited above may be required. Specific dosage and treatment regimens for any particular patient will depend upon a variety of factors, including the activity of the specific compound employed, the age, body weight, general health status, sex, diet, time of administration, rate of excretion, drug combination, the severity and course of the disease, condition or symptoms, the patient's disposition to the disease, condition or symptoms, and the judgment of the treating physician.
Upon improvement of a patient's condition, a maintenance dose of a compound, composition or combination of this invention may be administered, if necessary. Subsequently, the dosage or frequency of administration, or both, may be reduced, as a function of the symptoms, to a level at which the improved condition is retained when the symptoms have been alleviated to the desired level. Patients may, however, require intermittent treatment on a long-term basis upon any recurrence of disease symptoms.
The compositions of this invention may contain any conventional non- toxic pharmaceutically-acceptable carriers, adjuvants or vehicles. In some cases, the pH of the formulation may be adjusted with pharmaceutically acceptable acids, bases or buffers to enhance the stability of the formulated compound or its delivery form.
The compositions may be in the form of a sterile injectable preparation, for example, as a sterile injectable aqueous or oleaginous suspension. This suspension may be formulated according to techniques known in the art using suitable dispersing or wetting agents (such as, for example, Tween 80) and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are mannitol, water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono- or diglycerides. Fatty acids, such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically-acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions. These oil solutions or suspensions may also contain a long-chain alcohol diluent or dispersant, or carboxymethyl cellulose or similar dispersing agents which are commonly used in the formulation of pharmaceutically acceptable dosage forms such as emulsions and or suspensions. Other commonly used surfactants such as Tweens or Spans and/or other similar emulsifying agents or bioavailability enhancers which are commonly used in the manufacture of pharmaceutically acceptable solid, liquid, or other dosage forms may also be used for the purposes of formulation.
The compositions of this invention may be orally administered in any orally acceptable dosage form including, but not limited to, capsules, tablets, emulsions and aqueous suspensions, dispersions and solutions. In the case of tablets for oral use, carriers which are commonly used include lactose and corn starch. Lubricating agents, such as magnesium stearate, are also typically added. For oral administration in a capsule form, useful diluents include lactose and dried corn starch. When aqueous suspensions and/or emulsions are administered orally, the active ingredient may be suspended or dissolved in an oily phase is combined with emulsifying and/or suspending agents. If desired, certain sweetening and/or flavoring and/or coloring agents may be added.
The compositions of this invention may also be administered in the form of suppositories for rectal administration. These compositions can be prepared by mixing a compound of this invention with a suitable non-irritating excipient which is solid at room temperature but liquid at the rectal temperature and therefore will melt in the rectum to release the active components. Such materials include, but are not limited to, cocoa butter, beeswax and polyethylene glycols.
Topical administration of the compositions of this invention is useful when the desired treatment involves areas or organs readily accessible by topical application. For application topically to the skin, the composition should be formulated with a suitable ointment containing the active components suspended or dissolved in a carrier. Carriers for topical administration of the compounds of this invention include, but are not limited to, mineral oil, liquid petroleum, white petroleum, propylene glycol, polyoxyethylene polyoxypropylene compound, emulsifying wax and water. Alternatively, the composition can be formulated with a suitable lotion or cream containing the active compound suspended or dissolved in a carrier with suitable emulsifying agents. Suitable carriers include, but are not limited to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water. The compositions of this invention may also be topically applied to the lower intestinal tract by rectal suppository formulation or in a suitable enema formulation.
Topically-transdermal patches are also included in this invention. Also within the invention is a patch to deliver active chemotherapeutic combinations herein. A patch includes a material layer (e.g., polymeric, cloth, gauze, bandage) and the compound of the formulae herein as delineated herein. One side of the material layer can have a protective layer adhered to it to resist passage of the compounds or compositions. The patch can additionally include an adhesive to hold the patch in place on a subject. An adhesive is a composition, including those of either natural or synthetic origin, that when contacted with the skin of a subject, temporarily adheres to the skin. It can be water resistant. The adhesive can be placed on the patch to hold it in contact with the skin of the subject for an extended period of time. The adhesive can be made of a tackiness, or adhesive strength, such that it holds the device in place subject to incidental contact, however, upon an affirmative act (e.g., ripping, peeling, or other intentional removal) the adhesive gives way to the external pressure placed on the device or the adhesive itself, and allows for breaking of the adhesion contact. The adhesive can be pressure sensitive, that is, it can allow for positioning of the adhesive (and the device to be adhered to the skin) against the skin by the application of pressure (e.g., pushing, rubbing,) on the adhesive or device.
The compositions of this invention may be administered by nasal aerosol or inhalation. Such compositions are prepared according to techniques well-known in the art of pharmaceutical formulation and may be prepared as solutions in saline, employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons, and/or other solubilizing or dispersing agents known in the art.
A composition having the compound of the formulae herein and an additional agent (e.g., a therapeutic agent) can be administered using any of the routes of administration described herein. In some embodiments, a composition having the compound of the formulae herein and an additional agent (e.g., a therapeutic agent) can be administered using an implantable device. Implantable devices and related technology are known in the art and are useful as delivery systems where a continuous, or timed-release delivery of compounds or compositions delineated herein is desired. Additionally, the implantable device delivery system is useful for targeting specific points of compound or composition delivery (e.g., localized sites, organs). Negrin et al., Biomaterials, 22(6):563 (2001). Timed-release technology involving alternate delivery methods can also be used in this invention. For example, timed-release formulations based on polymer technologies, sustained-release techniques and encapsulation techniques (e.g., polymeric, liposomal) can also be used for delivery of the compounds and compositions delineated herein.
The invention will be further described in the following examples. It should be understood that these examples are for illustrative purposes only and are not to be construed as limiting this invention in any manner.
EXAMPLES
Example 1 l-(ethylsulfonyl)-3-fluorobenzene
A stirred mixture of 3-fluorobenzenesulfonyl chloride (0.973 g, 5.00 mmol), sodium bicarbonate (0.84 g, 10.0 mmol), and sodium sulfite (1.16 g, mmol) was heated in water (7 mL) at 95-100 0C for 1 h under nitrogen. The reaction was cooled to -50 0C, treated with (nBu)4NBr (100 mg) and ethyl iodide (2.5 mL) and heated at 70 0C for 18 h. The reaction was cooled, treated with water (10 mL) and extracted with dichloromethane (3 x 15 mL). The extracts were dried with MgSO4 and concentrated in vacuo. Chromatography on silica gel eluting with an ethyl acetate/hexane gradient of 10/90 to 40/60 afforded the title compound as a colorless oil (878 mg).
Examples 2-34
In a similar manner to that described for Example 1 above, the following compounds were prepared using the corresponding halogenated arylsulfonylchloride and alkylating agent, and eluting with an appropriate eluent.
Example 2 3-[(2-fluorophenyl)sulfonyl]propan-l-ol
The title compound was prepared using 2-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and 3-bromo- l-propanol as the alkylating agent.
MS (ES) m/z 219.0; HRMS: calcd for C9H11FO3S + H+, 219.04857; found (ESI, [M+H]+), 219.0489. Example 3 l-fluoro-3-(methylsulfonyl)benzene
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and iodomethane as the alkylating agent. MS (ES) m/z 175.0.
Example 4 3-[(3-fluorophenyl)sulfonyl]-2,2-dimethylpropan-l-ol
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and 4-bromo-2-methylbutan-2-ol as the alkylating agent.
MS (ES) m/z 246.9.
Example 5 5-[(3-fluorophenyl)sulfonyl]pentan-l-ol The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and 5-bromo-l-pentanol as the alkylating agent. MS (ES) m/z 246.9.
Example 6 l,3-difluoro-5-(methylsulfonyl)benzene
The title compound was prepared using 3,5-difluorobenzenesulfonyl chloride as the arylsulfonyl chloride and iodomethane as the alkylating agent. MS (EI) m/z 192.
Example 7
4-fluoro-l-methyl-2-(methylsulfonyl)benzene
The title compound was prepared using 5-fluoro-2-methylbenzene-l-sulfonyl chloride as the arylsulfonyl chloride and iodomethane as the alkylating agent. mp 77 0C; MS (ES) m/z 188.9.
Example 8
4-bromo-l-methyl-2-(methylsulfonyl)benzene
The title compound was prepared using 5-bromo-2-methylbenzene-l-sulfonyl chloride as the arylsulfonyl chloride and iodomethane as the alkylating agent. mp 121 0C. Example 9 4-bromo-2-(ethylsulfonyl)-l-methylbenzene
The title compound was prepared using 5-bromo-2-methylbenzene-l-sulfonyl chloride as the arylsulfonyl chloride and iodoethane as the alkylating agent. mp 49 0C; MS (ES) m/z 262.7.
Example 10 l-fluoro-3-[(3-methylbutyl)sulfonyl]benzene
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and l-bromo-3-methylbutane as the alkylating agent.
MS (ES) m/z 231.0.
Example 11 l-fluoro-3-(isobutylsulfonyl)benzene The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and 1 -bromo-2-methylpropane as the alkylating agent.
MS (ES) m/z 217.0.
Example 12 l-fluoro-3-(propylsulfonyl)benzene
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and 1 -iodopropane as the alkylating agent.
MS (ES) m/z 203.0.
Example 13
3-[(3-fluorophenyl)sulfonyl]propan-l-ol
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and 3-bromo-l-propanol as the alkylating agent.
MS (ES) m/z 218.9; HRMS: calcd for C9H11FO3S + H+, 219.04857; found (ESI, [M+H]+), 219.0475.
Example 14 l-fluoro-3-(isopropylsulfonyl)benzene
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and 2-iodopropane as the alkylating agent.
MS (ES) m/z 203.0. Example 15 l-(benzylsulfonyl)-3-fluorobenzene
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and benzylbromide as the alkylating agent. mp 134-135 0C; HRMS: calcd for C13H11FO2S, 250.04638; found (EI, M+.), 250.0469.
Example 16 l,3-dichloro-5-(propylsulfonyl)benzene
The title compound was prepared using 3,5-dichlorobenzenesulfonyl chloride as the arylsulfonyl chloride and 1 -iodopropane as the alkylating agent. mp 59-61 0C; MS (ES) m/z 252.9; HRMS: calcd for C9H10Cl2O2S, 251.97785; found (EI, M+.), 251.9776.
Example 17
3-[(3,5-dichlorophenyl)sulfonyl]propan-l-ol
The title compound was prepared using 3,5-dichlorobenzenesulfonyl chloride as the arylsulfonyl chloride and 3-bromo-l-propanol as the alkylating agent. mp 80-82 0C; MS (ES) m/z 268.9.
Example 18 l-fluoro-3-[(3-methoxypropyl)sulfonyl] benzene
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and l-bromo-3-methoxypropane as the alkylating agent.
MS (ES) m/z 233.0; HRMS: calcd for C10H13FO3S + H+, 233.06422; found (ESI, [M+H]+), 233.0643.
Example 19 1 ,3-dichloro-5- [(3-methylbutyl)sulfonyl] benzene
The title compound was prepared using 3,5-dichlorobenzenesulfonyl chloride as the arylsulfonyl chloride and l-bromo-3-methylbutane as the alkylating agent. mp 64-65 0C; MS (ESI) m/z 280; HRMS: calcd for C11H14Cl2O2S, 280.00915; found (EI, M+.), 280.0078.
Example 20 l-(cyclopentylsulfonyl)-3-fluorobenzene
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and cyclopenyliodide as the alkylating agent.
MS (ES) m/z 229.0.
Example 21
4- [(3-fluorophenyl)sulfonyl] -2-methylbutan-2-ol
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and 4-bromo-2-methylbutan-2-ol as the alkylating agent. MS (ES) m/z 229 A [M+H-H20]+l
Example 22 l,4-dibromo-2-(methylsulfonyl)benzene
The title compound was prepared using 2,5-dibromobenzenesulfonyl chloride as the arylsulfonyl chloride and methyliodode as the alkylating agent.
MS (ES) m/z 312.6.
Example 23 4-bromo-l-methoxy-2-(methylsulfonyl)benzene The title compound was prepared using 5-bromo- 1 -methoxy-benzenesulfonyl chloride as the arylsulfonyl chloride and methyliodode as the alkylating agent. MS (ES) m/z 264.8.
Example 24 The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and iodopropane as the alkylating agent. l-fluoro-4-(propylsulfonyl)benzene
MS (ES) m/z 203.1.
Example 25 l-(allylsulfonyl)-4-fluorobenzene
The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and allylbromide as the alkylating agent.
MS (ES) m/z 201.0.
Example 26 l-chloro-3-{[(4-fluorophenyl)sulfonyl]methyl}benzene
The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and l-(bromomethyl)-3-chlorobenzene as the alkylating agent.
MS (ES) m/z 282.9.
Example 27 l-fluoro-4-(isobutylsulfonyl)benzene
The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and l-bromo-3-methylbutane as the alkylating agent. MS (ES) m/z 217.0.
Example 28 ethyl (4-{[(4-fluorophenyl)sulfonyl]methyl}phenyl)acetate
The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and ethyl 2-(4-(bromomethyl)phenyl)acetate as the alkylating agent.
MS (ES) m/z 337.0.
Example 29 l-fluoro-4-[(3-methylbutyl)sulfonyl]benzene The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and l-bromo-3-methylbutane as the alkylating agent. MS (ES) m/z 231.0.
Example 30 l-(cyclopentylsulfonyl)-4-fluorobenzene
The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and iodocyclopentane as the alkylating agent. MS (ES) m/z 229.0.
Example 31
3-[(4-fluorophenyl)sulfonyl]propan-l-ol
The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and 3-bromo- l-propanol as the alkylating agent.
MS (ES) m/z 219.0; HRMS: calcd for C9H11FO3S + H+, 219.04857; found (ESI, [M+H]+), 219.048. Example 32 l-(butylsulfonyl)-4-fluorobenzene
The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and iodobutane as the alkylating agent. MS (ES) m/z 217.0.
Example 33 l-fluoro-2-{[(4-fluorophenyl)sulfonyl]methyl}benzene
The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride andl-(bromomethyl)-2-fluorobenzene as the alkylating agent.
MS (EI) m/z 268.
Example 34 2,5-dimethylbenzyl-4-fhiorophenyl sulfone The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the arylsulfonyl chloride and 2-(bromomethyl)-l,4-dimethylbenzene as the alkylating agent. MS (ESI) m/z 278.
Example 35 l-fluoro-3-(isopropylsulfonyl)benzene
A stirred mixture of 3-fluorobenzenethiol (3.38 mL, 40.0 mmol), potassium carbonate (11.04 g, 80.0 mmol), and 2-iodopropane (6.00 mL, 60.0 mmol) was heated in acetone (120 mL) at 65-70 0C for 2.5 h under nitrogen. The reaction was cooled, treated with 0.3 M sodium bicarbonate in water (240 mL) and then, in portions, OXONE® (61.6 g) and stirred at ambient temperature for 18 h. The reaction was treated with water (100 mL) and extracted with dichloromethane (2 x 150 mL). The extracts were dried with MgSθ4 and concentrated in vacuo. Chromatography on silica gel eluting with ethyl acetate/hexane gradient of 25/75 to 50/50 afforded the title compound as a slightly orange liquid (6.21 g). HRMS: calcd for C9H11FO2S, 202.04638; found (EI, M+.), 202.0469.
Examples 36 to 39
rt/18 to 48 h In a similar manner to that described for Example 35 above, the following compounds were prepared using the corresponding halogenated thiophenol and alkylating agent R-LG, and eluting with an appropriate eluent.
Example 36 l-fluoro-3-(methylsulfonyl)benzene
The title compound was prepared using 3-fluorobenzenethiol as the as the thiophenol and iodomethane as the alkylating agent.
MS (ES) m/z 175.1
Example 37 l-(ethylsulfonyl)-3-fluorobenzene
The title compound was prepared using 3-fluorobenzenethiol as the as the thiophenol and iodoethane as the alkylating agent. MS (ES) m/z 189.0
Example 38 3-[(3-fluorophenyl)sulfonyl]propan-l-ol
The title compound was prepared using 3-fluorobenzenethiol as the as the thiophenol and 3-bromo-l-propanol as the alkylating agent.
MS (ES) m/z 218.9
Example 39
4- [(3-fluorophenyl)sulfonyl] -2-methylbutan-2-ol The title compound was prepared using 3-fluorobenzenethiol as the as the thiophenol and 3-hydroxy-3-methylbutyl 4-methylbenzenesulfonate as the alkylating agent. MS (ES) m/z 229.1 [M+H-H20]+l
Example 40 l-fluoro-3-(methylsulfonyl)benzene
A stirred mixture of l-bromo-3-fluorobenzene (10.0 g, 57.1 mmol), sodium methanesulfmate (7.00 g, 68.6 mmol), CuI (1.08 g, 5.71 mmol), L-proline (1.31 g, 11.4 mmol) and sodium hydroxide (0.456 g, 11.4 mmol) was heated in DMSO (135 mL) at 95 0C overnight (-18 h). The reaction was cooled, diluted with water, and then extracted with ethyl acetate (2 x 150 mL). The extracts were dried with MgSθ4 and concentrated in vacuo. Chromatography on silica gel eluting with 25/75 ethyl acetate/hexane afforded the title compound as a colorless solid (6.21 g). MS (ES) m/z 175.1.
Examples 41 to 42
In a similar manner to that described for Example 40 above, the following compounds were prepared using the appropriate arylbromide and eluting with an appropriate eluent.
Example 41 l-chloro-3-fluoro-5-(methylsulfonyl)benzene
The title compound was prepared using l-bromo-3-chloro-5-fluorobenzene as the arylbromide.
MS (EI) m/z 208
Example 42 l,3-difluoro-5-(methylsulfonyl)benzene The title compound was prepared using l-bromo-3,5-difluorobenzene as the arylbromide.
MS (EI) m/z 192.
Example 43 4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline
A stirred mixture of 3-(3-methyl-8-(trifluoromethyl)quinolin-4-yl)phenol (91 mg, 0.30 mmol), l-(ethylsulfonyl)-3-fluorobenzene (85 mg, 0.45 mmol), and potassium carbonate (58 mg, 0.60 mmol) was heated in DMF (1.5 mL) at 150 0C for 18 h under nitrogen. The reaction was cooled, treated with water (5 mL), and extracted with dichloromethane (3 x 5 mL). The extracts were dried with MgSθ4 and concentrated in vacuo. Chromatography on silica gel eluting with ethyl acetate/hexane gradient of 10/90 to 40/60, affordedthe title compound as an off- white solid (136 mg). MS (ES) m/z 471.8. HRMS: calcd for C25H20F3NO3S + H+, 472.11887; found (ESI, [M+H]+), 472.1194. Examples 44 to 128
In a similar manner to that described for Example 43 above, the following compounds were prepared using the corresponding halogenated arylsulfone and quinoline phenol, and eluting with an appropriate eluent. When normal phase purification on silica gel did not provide pure compounds, additional purification using reverse phase chromatography was used to further purify the compounds. In some instances, ethyl acetate was used in place of methylene chloride in the extraction step.
Example 44 3-methyl-4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 485.8; HRMS: calcd for C26H22F3NO3S + H+, 486.13452; found (ESI, [M+H]+), 486.1326.
Example 45
4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-3-methyl-8- (trifluoromethyl)quinoline
MS (ES) m/z 485.8; HRMS: calcd for C26H22F3NO3S + H+, 486.13452; found (ESI, [M+H]+), 486.1349.
Example 46 4-{3-[3-(benzylsulfonyl)phenoxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline
MS (ES) m/z 533.8; HRMS: calcd for C30H22F3NO3S + H+, 534.13452; found (ESI, [M+H]+), 534.1346.
Example 47 3-methyl-4-{3-[2-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline mp 203-205 0C; MS (ES) m/z 457.8; HRMS: calcd for C24H18F3NO3S + H+, 458.10322; found (ESI, [M+H]+), 458.1016.
Example 48 4-{3-[3-(isobutylsulfonyl)phenoxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline
MS (ES) m/z 499.8; HRMS: calcd for C27H24F3NO3S + H+, 500.15017; found (ESI, [M+H]+), 500.1494.
Example 49
3-methyl-4-(3-{3-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-8- (trifluoromethyl)quinoline
MS (ES) m/z 513.8; HRMS: calcd for C28H26F3NO3S + H+, 514.16582; found (ESI, [M+H]+), 514.1642.
Example 50
3-[(2-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan-l-ol mp 73-75 0C (not very sharp); MS (ES) m/z 501.8; HRMS: calcd for C26H22F3NO4S + H+, 502.12944; found (ESI, [M+H]+), 502.1281.
Example 51
4-{3-[3-chloro-5-(propylsulfonyl)phenoxy]phenyl}-3-methyl-8- (trifluoromethyl)quinoline MS (ES) m/z 519.7; HRMS: calcd for C26H21ClF3NO3S + H+, 520.09555; found
(ESI, [M+H]+), 520.0947.
Example 52
3-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan-l-ol
MS (ES) m/z 501.8; HRMS: calcd for C26H22F3NO4S + H+, 502.12944; found (ESI, [M+H]+), 502.1304.
Example 53 4-(3-{3-[(3-methoxypropyl)sulfonyl]phenoxy}phenyl)-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 515.9; HRMS: calcd for C27H24F3NO4S + H+, 516.14509; found (ESI, [M+H]+), 516.1458.
Example 54 4-(3-{3-chloro-5-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-3-methyl-8- (trifluoromethyl)quinoline
MS (ES) m/z 548.0; HRMS: calcd for C28H25ClF3NO3S + H+, 548.12685; found (ESI, [M+H]+), 548.1264.
Example 55
3-[(4-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan-l-ol
MS (ES) m/z 502.0; HRMS: calcd for C26H22F3NO4S + H+, 502.12944; found (ESI, [M+H]+), 502.1301.
Example 56 3-methyl-4-{3-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 458.0; HRMS: calcd for C24H18F3NO3S + H+, 458.10322; found (ESI, [M+H]+), 458.1037.
Example 57
2-methyl-4-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl] phenoxy}phenyl)sulfonyl] butan-2-ol MS (ES) m/z 529.8; HRMS: calcd for C28H26F3NO4S + H+, 530.16074; found (ESI,
[M+H]+), 530.159.
Example 58 3-benzyl-8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline MS (ES) m/z 499.9; HRMS: calcd for C29H22ClNO3S + H+, 500.10817; found (ESI,
[M+H]+), 500.1083.
Example 59 3-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline MS (ES) m/z 457.8; HRMS: calcd for C24H18F3NO3S + H+, 458.10322; found (ESI,
[M+H]+), 458.1017.
Example 60
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-3-methyl-8- (trifluoromethyl)quinoline
MS (ES) m/z 475.8. Example 61
8-chloro-3-methyl-4- {3- [3-(methylsulfonyl)phenoxy] phenyl} quinoline
MS (ES) m/z 424.1; HRMS: calcd for C23H18ClNO3S + H+, 424.07687; found (ESI, [M+H]+), 424.0781.
Example 62
4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-3-methyl-8- (trifluoromethyl)quinoline MS (ES) m/z 491.7.
Example 63
2,2-dimethyl-3-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan-l-ol MS (ES) m/z 529.9.
Example 64
4-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]butan-l-ol MS (ES) m/z 515.9; HRMS: calcd for C27H24F3NO4S + H+, 516.14509; found (ESI,
[M+H]+), 516.1459;
Example 65
5-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]pentan-l-ol
MS (ES) m/z 529.9; HRMS: calcd for C28H26F3NO4S + H+, 530.16074; found (ESI, [M+H]+), 530.1598;
Example 66 3-benzyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 533.8.
Example 67 3-benzyl-4-{3-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline MS (ES) m/z 533.8. Example 68 3-benzyl-4-{3-[3-(isobutylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 575.8.
Example 69
3-benzyl-4-(3-{3-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-8- (trifluoromethyl)quinoline
MS (ES) m/z 589.8.
Example 70
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline mp 147-148 0C; MS (ES) m/z 443.9.
Example 71 3-[(3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan-l-ol
MS (ES) m/z 577.8.
Example 72 3-benzyl-4-{3-[4-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 548.0.
Example 73 3-benzyl-4-{3-[4-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline MS (ES) m/z 562.0.
Example 74 4-{3-[4-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 458.0.
Example 75 4-{3-[4-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 474.0.
Example 76
4-{3-[4-(isopropylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline MS (ES) m/z 472.0.
Example 77 4-{3-[4-(isobutylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline MS (ES) m/z 486.0.
Example 78
4-(3-{4-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-8-(trifluoromethyl)quinoline MS (ES) m/z 500.0.
Example 79
4-(3-{4-[(2-fluorobenzyl)sulfonyl]phenoxy}phenyl)-8-(trifluoromethyl)quinoline MS (ES) m/z 537.9.
Example 80
3-[(4-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]propan-l-ol
MS (ES) m/z 488.0.
Example 81 4-{3-[4-(butylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 486.0.
Example 82 2-[(4-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]ethanol MS (ES) m/z 472.0.
Example 83 4-{3-[4-(allylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 4102.
Example 84 4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline mp 147 0C; MS (ES) m/z 457.9; HRMS: calcd for C24H18F3NO3S + H+, 458.10322; found (ESI, [M+H]+), 458.1019.
Example 85 4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline mp 133 0C; MS (ESI) m/z 472.1199; HRMS: calcd for C25H20F3NO3S + H+, 472.11887; found (ESI, [M+H]+), 472.1199.
Example 86
4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 472.0.
Example 87 4-{3-[3-(isobutylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 486.0.
Example 88 4-(3-{3-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-8-(trifluoromethyl)quinoline MS (ES) m/z 500.0.
Example 89 4-{3-[3-(cyclopentylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 497.9.
Example 90 4-{3-[3-(benzylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 519.9.
Example 91
3-[(3-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]propan-l-ol
MS (ES) m/z 488.0.
Example 92 ethyl (4-{[(4-{3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl] methyl} phenyl)acetate
MS (ES) m/z 606.0.
Example 93 4-(3-{4-[(2,5-dimethylbenzyl)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline mp 94-96 0C; MS (ES) m/z 548.0.
Example 94 4-{3-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline mp 88-90 0C; MS (ES) m/z 444.0.
Example 95
3-benzyl-4-{3-[4-(isopropylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline mp 64-66 0C; MS (ES) m/z 562.0.
Example 96
3-benzyl-4-{3-[4-(isobutylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline mp 77-79 0C; MS (ES) m/z 576.1.
Example 97
3-benzyl-4-(3-{4-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-8- (trifluoromethyl)quinoline
MS (ES) m/z 590.0.
Example 98
3-benzyl-4-(3-{4-[(2-fluorobenzyl)sulfonyl]phenoxy}phenyl)-8- (trifluoromethyl)quinoline mp 99-101 0C; MS (ES) m/z 628.0.
Example 99
3-[(4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan-l-ol
MS (ES) m/z 578.0.
Example 100
4-{3-[4-(allylsulfonyl)phenoxy]phenyl}-3-benzyl-8-(trifluoromethyl)quinoline
MS (ES) m/z 560.2.
Example 101
3-benzyl-4-{3-[4-(butylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline MS (ES) m/z 576.0.
Example 102 3-benzyl-4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline MS (ES) m/z 548.0.
Example 103
3-benzyl-4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 562.0.
Example 104
3-benzyl-4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline
MS (ES) m/z 562.0.
Example 105
3-benzyl-4-{3-[3-(benzylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 610.0.
Example 106
3-benzyl-4-(3-{3-[(3-methoxypropyl)sulfonyl]phenoxy}phenyl)-8- (trifluoromethyl)quinoline
MS (ES) m/z 592.0.
Example 107
3-benzyl-4-{3-[3-(cyclopentylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline
MS (ES) m/z 588.0.
Example 108
4- [(3-{3- [3-benzyl-8-(trifluoromethyl)quinolin-4-yl] phenoxy} phenyl)sulfonyl] -2- methylbutan-2-ol
MS (ES) m/z 606.0.
Example 109
4-{3-[4-methyl-2-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline mp 83-84 0C; MS (ES) m/z 457.9.
Example 110 4-{3-[4-methyl-3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline mp 147-149 0C; MS (ES) m/z 457.8.
Example 111
4-{3-[2-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 461.8.
Example 112
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline- 3-carbonitrile
MS (ES) m/z 486.8.
Example 113
4-(3- {3- [(3-hydroxy-3-methylbutyl)sulfonyl] phenoxy}phenyl)-8- (trifluoromethyl)quinoline-3-carbonitrile
MS (ES) m/z 540.8.
Example 114
4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carbonitrile
MS (ES) m/z 496.8.
Example 115
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carbonitrile
MS (ES) m/z 482.8.
Example 116
4-{3-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carbonitrile
MS (ES) m/z 468.7.
Example 117 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carbonitrile
MS (ESI) m/z 469.
Example 118
[(4- {3- [3-benzyl-8-(trifhioromethyl)quinolin-4-yl] phenoxy} phenyl)sulfonyl] acetic acid
MS (ES) m/z 577.9; HRMS: calcd for C3iH22F3NO5S + H+, 578.12435; found (ESI, [M+H]+), 578.1264.
Example 119
N-{2-[(4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]ethyl}propan-2-amine
MS (ES) m/z 605.0; HRMS: calcd for C34H3IF3N2O3S + H+, 605.20802; found (ESI, [M+H]+), 605.2053.
Example 120
4-[3-(4-{[2-(isopropylamino)ethyl]sulfonyl}phenoxy)phenyl]-8- (trifluoromethyl)quinoline-3-carbonitrile MS (ES) m/z 540.0.
Example 121 ethyl 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carboxylate MS (ES) m/z 515.8.
Example 122
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carboxylic acid MS (ES) m/z 487.7.
Example 123
4-{3-[2-fluoro-4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline- 3-carbonitrile MS (ES) m/z 486.9. Example 124
4-{3-[4-methoxy-3-(methylsulfonyl)phenoxy]phenyl}-3-methyl-8- (trifluoromethyl)quinoline
The general procedure is essentially the same as that described by Dawei Ma and Qian Cai in Organic Letters 2003, 5, 3799-3802.
A stirred mixture of 3-(3-methyl-8-(trifluoromethyl)quinolin-4-yl)phenol (151 mg, 0.50 mmol), 4-bromo-l-methoxy-2-(methylsulfonyl)benzene (199 mg, 0.75 mmol), N,N- dimethylglycine hydrochloride (28 mg, 0.020 mmol), CuI (20 mg, 0.10 mmol) and CS2CO3 (326 mg, 1.00 mmol) was heated in 1,4-dioxane (3.0 mL) at 105-110 0C for 44 h under nitrogen. The reaction was cooled, treated with water, and extracted with dichloromethane. The extracts were dried with MgSO4 and concentrated in vacuo. Chromatography on silica gel eluting with ethyl acetate/hexane gradient of 10/90 to 20/80, with further purification on reverse phase chromatography, afforded the title compound as a white foam-solid (49 mg). MS (ES) m/z 487.7.
Examples 125 to 126
In a similar manner to that described for Example 124 above, or using cesium carbonate as base, N,N-dimethylglycine in place of L-proline, and 1,4-dioxane as solvent, the following compounds were prepared using the appropriate halogenated arylsulfone and quinoline phenol:
Example 125 is the same compound as Example 1 10 but using the method described in Example 124.
4-{3-[4-methyl-3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline mp 147-149 0C; MS (ES) m/z 457.8.
Example 126
3-methyl-4-(3-{3-[(methylsulfonyl)methyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline MS (ES) m/z 471.8.
Example 127 8-chloro-4-{3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl}-3-propylquinoline
A stirred mixture of 3-(8-chloro-3-propylquinolin-4-yl)phenol (108 mg, 0.40 mmol), 4-[(fluorophenyl)sulfonyl]morpholine (102 mg, 0.50 mmol), and potassium carbonate (70 mg, 0.50 mmol) was heated in DMF (1.0 mL) at 100 0C for 20 h under nitrogen. The reaction was cooled, treated with water (4 mL), and extracted with dichloromethane (2 x 5 mL). The extracts were dried with MgSθ4 and concentrated in vacuo. Chromatography on silica gel eluting with 35/65 ethyl acetate/hexane afforded the title compound as an oil (113 mg). mp 137-138 0C; MS (ES) m/z 523.1; HRMS: calcd for C28H27ClN2O4S + H+, 523.14528; found (ESI, [M+H]+), 523.1444.
Examples 128 to 173
In a similar manner to that described for Example 127 above, the following compounds were prepared using the corresponding halogenated arylsulfonamide and quinoline phenol, and eluting with an appropriate eluent, varying temperature based on substitution. In general, meta-haloarylsulfonamides were subjected to higher temperatures, typically 150 0C, while ortho- and para-haloarylsulfonamides can react at lower temperatures, typically 100 0C to 150 0C. In some instances, higher yields were obtained when R is not H.
Example 128 3-benzyl-4-{3-[3-(morpholin-4-ylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
MS (ES) m/z 605.2.
Example 129 4-{3-[3-(morpholin-4-ylsulfonyl)phenoxy]phenyl}-3-phenyl-8-
(trifluoromethyl)quinoline mp 88 0C; MS (ES) m/z 591.2. Example 130
4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-Λ/- methylbenzenesulfonamide mp 77-79 0C; MS (ES) m/z 549.1.
Example 131
4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-Λ/- ethylbenzenesulfonamide MS (ES) m/z 563.1.
Example 132
4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-ΛyV- dimethylbenzenesulfonamide MS (ES) m/z 563.1.
Example 133
4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-Λ/-ethyl-Λ/- methylbenzenesulfonamide mp 66 0C; MS (ES) m/z 577.2.
Example 134
4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-ΛyV- diethylbenzenesulfonamide mp 80 0C; MS (ES) m/z 591.2.
Example 135
3-benzyl-4-{3-[4-(pyrrolidin-l-ylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline mp 101 0C; MS (ES) m/z 589.2.
Example 136
3-benzyl-4-{3-[4-(piperidin-l-ylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline MS (ES) m/z 603.2. Example 137
3-benzyl-4-(3-{4-[(4-methylpiperazin-l-yl)sulfonyl]phenoxy}phenyl)-8- (trifluoromethyl)quinoline mp 77 0C; MS (ES) m/z 618.2.
Example 138
4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-Λ/- propylbenzenesulfonamide
MS (ES) m/z 577.2.
Example 139
4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-Λ/- isopropylbenzenesulfonamide
MS (ES) m/z 577.2.
Example 140
N-benzyl-4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide mp 98 0C; MS (ES) m/z 625.2.
Example 141
3-benzyl-4-{3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline mp 118 0C; MS (ES) m/z 605.2.
Example 142
3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-Λ/- methylbenzenesulfonamide
MS (ES) m/z 548.8.
Example 143
3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-ΛyV- dimethylbenzenesulfonamide
MS (ES) m/z 562.7.
Example 144 3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-Λ/-ethyl-Λ/- methylbenzenesulfonamide
MS (ES) m/z 576.8.
Example 145
3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-ΛyV- diethylbenzenesulfonamide
MS (ES) m/z 590.8.
Example 146
3-benzyl-4-{3-[3-(pyrrolidin-l-ylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline
MS (ES) m/z 588.8.
Example 147
3-benzyl-4-{3-[3-(piperidin-l-ylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline
MS (ES) m/z 602.8.
Example 148
3-benzyl-4-(3-{3-[(4-methylpiperazin-l-yl)sulfonyl]phenoxy}phenyl)-8- (trifluoromethyl)quinoline
MS (ES) m/z 617.9.
Example 149
3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-Λ/- propylbenzenesulfonamide
MS (ES) m/z 576.8.
Example 150
3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-Λ/- isopropylbenzenesulfonamide
MS (ES) m/z 574.6.
Example 151 Λ'-benzyl-3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide
MS (ES) m/z 622.6.
Example 152
3-methyl-4-{3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline mp 86-88 0C; MS (ES) m/z 529.2; HRMS: calcd for C27H23F3N2(MS + H+, 529.14034; found (ESI, [M+H]+), 529.1417.
Example 153
8-chloro-3-methyl-4- {3- [4-(morpholin-4-ylsulfonyl)phenoxy] phenyl} quinoline MS (ES) m/z 495.1 ; HRMS: calcd for C26H23ClN2O4S + H+, 495.1 1398; found (ESI, [M+H]+), 495.1 144.
Example 154
8-chloro-3-isopropyl-4-{3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl}quinoline mp 93-95 0C; MS (ES) m/z 523.1 ; HRMS: calcd for C28H27ClN2O4S + H+, 523.14528; found (ESI, [M+H]+), 523.1434.
Example 155
4- [3-(8-chloro-3-methylquinolin-4-yl)phenoxy] -N,N- dimethylbenzenesulfonamide
MS (ES) m/z 453.1 ; HRMS: calcd for C24HyClN2O3S + H+, 453.10342; found (ESI, [M+H]+), 453.1022.
Example 156
4- [3-(8-chloro-3-methylquinolin-4-yl)phenoxy] -N-ethyl-N- methylbenzenesulfonamide MS (ES) m/z 467.1 ; HRMS: calcd for C25H23ClN2O3S + H+, 467.1 1907; found (ESI,
[M+H]+), 467.1 195.
Example 157
8-chloro-3-methyl-4- {3- [4-(pyrrolidin-l-ylsulfonyl)phenoxy] phenyl} quinoline MS (ES) m/z 479.1 ; HRMS: calcd for C26H23ClN2O3S + H+, 479.1 1907; found (ESI,
[M+H]+), 479.1 171. Example 158 4-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-methylbenzenesulfonamide
MS (ES) m/z 437.1; HRMS: calcd for C23H19ClN2O3S + H+, 439.08777; found (ESI, [M+H]+), 439.086.
Example 159
8-chloro-4-{3-[3-fluoro-5-(morpholin-4-ylsulf()nyl)phenoxy]phenyl}-3- methylquinoline HRMS: calcd for C26H22ClFN2O4S + H+, 513.10456; found (ESI, [M+H]+),
513.1044;
Example 160 4-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-propylbenzenesulfonamide MS (ES) m/z 467.1; HRMS: calcd for C25H23ClN2O3S + H+, 467.11907; found (ESI,
[M+H]+), 467.1181.
Example 161 N-benzyl-4-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]benzenesulfonamide MS (ES) m/z 515.1; HRMS: calcd for C29H23ClN2O3S + H+, 515.11907; found (ESI,
[M+H]+), 515.1211.
Example 162 3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-Λ'-methylbenzenesulfonamide MS (ES) m/z 439.1 ; HRMS: calcd for C23H19ClN2O3S + H+, 439.08777; found (ESI,
[M+H]+), 439.0868.
Example 163 3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-Λ'-ethylbenzenesulfonamide MS (ES) m/z 453.1; HRMS: calcd for C24H21ClN2O3S + H+, 453.10342; found (ESI,
[M+H]+), 453.1044.
Example 164 3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-Λ'-propylbenzenesulfonamide MS (ES) m/z 467.1; HRMS: calcd for C25H23ClN2O3S + H+, 467.11907; found (ESI,
[M+H]+), 467.1195. Example 165 3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-Λ'-isopropylbenzenesulfonamide
MS (ES) m/z 467.1; HRMS: calcd for C25H23ClN2O3S + H+, 467.11907; found (ESI, [M+H]+), 467.1173.
Example 166 Λ'-benzyl-3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]benzenesulfonamide
MS (ES) m/z 515.1; HRMS: calcd for C29H23ClN2O3S + H+, 515.11907; found (ESI, [M+H]+), 515.1171.
Example 167
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-ΛyV- dimethylbenzenesulfonamide MS (ES) m/z 453.1; HRMS: calcd for C24H21ClN2O3S + H+, 453.10342; found (ESI,
[M+H]+), 453.1017.
Example 168
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-A'-ethyWV- methylbenzenesulfonamide
MS (ES) m/z 467.1; HRMS: calcd for C25H23ClN2O3S + H+, 467.11907; found (ESI, [M+H]+), 467.1183.
Example 169 8-chloro-3-methyl-4- {3- [3-(pyrrolidin-l-ylsulfonyl)phenoxy] phenyl} quinoline
MS (ES) m/z 479.1 ; HRMS: calcd for C26H23ClN2O3S + H+, 479.1 1907; found (ESI, [M+H]+), 479.1 186.
Example 170 3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-Λr^V-diethylbenzenesulfonamide
MS (ES) m/z 481.1 ; HRMS: calcd for C26H25ClN2O3S + H+, 481.13472; found (ESI, [M+H]+), 481.1336.
Example 171 8-chloro-3-methyl-4-{3-[3-(piperidin-l-ylsulfonyl)phenoxy]phenyl}quinoline MS (ES) m/z 493.1; HRMS: calcd for C27H25ClN2O3S + H+, 493.13472; found (ESI, [M+H]+), 493.1348.
Example 172
8-chloro-3-methyl-4-(3-{3-[(4-methylpiperazin-l- yl)sulfonyl]phenoxy}phenyl)quinoline
MS (ES) m/z 508.1 ; HRMS: calcd for C27H26ClN3O3S + H+, 508.14561 ; found (ESI, [M+H]+), 508.1456.
Example 173 8-chloro-3-methyl-4-{3-[3-(piperazin-l-ylsulfonyl)phenoxy]phenyl}quinoline
HRMS: calcd for C26H24ClN3O3S + H+, 494.12996; found (ESI, [M+H]+), 494.131 1.
Example 174 8-chloro-3-methyl-4- {3- [3-(morpholin-4-ylsulfonyl)phenoxy] phenyl} quinoline
A stirred mixture of 3-(8-chloro-3-methylquinolin-4-yl)phenol (100 mg, 0.37 mmol), 4-(3-bromophenylsulfonyl)morpholine (170 mg, 0.56 mmol), CuI (11 mg, 0.056 mmol), Me2NCH2CO2H hydrochloride (23 mg, 0.167 mmol) and cesium carbonate (70 mg, 0.50 mmol) was heated in 1,4-dioxane (3.0 mL) at 100 0C for -18 h under nitrogen. The reaction was cooled, treated with water, and extracted with ethyl acetate. The extracts were dried with MgSO4 and concentrated in vacuo. Chromatography on silica gel eluting with 30/70 ethyl acetate/hexane afforded the title compound as a tan solid (120 mg).
HRMS: calcd for C26H23ClN2O4S + H+, 495.11398; found (ESI, [M+H]+), 495.1146.
Examples 175 to 188 R2
In a similar manner to that described for Example 174 above, the following compounds were prepared using the corresponding brominated arylsulfonamide and quinoline phenol, and eluting with an appropriate eluent.
Example 175 8-chloro-3-methyl-4- {3- [3-(morpholin-4-ylsulfonyl)phenoxy] phenyl} quinoline
HRMS: calcd for C26H23ClN2O4S + H+, 495.11398; found (ESI, [M+H]+), 495.1146.
Example 176 tert-buty\ 4-({3-[3-(8-chloro-3-methylquinolin-4- yl)phenoxy]phenyl}sulfonyl)piperazine-l-carboxylate
HRMS: calcd for C3IH32ClN3O5S + H+, 594.18240; found (ESI, [M+H]+), 594.1791.
Example 177 3- [3-(8-chloro-3-methylquinolin-4-yl)phenoxy] -iV-(2- hydroxyethyl)benzenesulfonamide
HRMS: calcd for C24H21ClN2O4S + H+, 469.09833; found (ESI, [M+H]+), 469.0962.
Example 178 3- [3-(8-chloro-3-methylquinolin-4-yl)phenoxy] -N-(2- hydroxy ethyl)-^ methylbenzenesulfonamide
HRMS: calcd for C25H23ClN2O4S + H+, 483.11398; found (ESI, [M+H]+), 483.1148.
Example 179 3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-Λ/- propylbenzenesulfonamide
HRMS: calcd for C26H23F3N2O3S + H+, 501.14542; found (ESI, [M+H]+), 501.1465.
Example 180 N-ethyl-N-methyl-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide
HRMS: calcd for C26H23F3N2O3S + H+, 501.14542; found (ESI, [M+H]+), 501.144.
Example 181 iV-(2- hydroxy ethyl)-Λ'-methyl-3- {3- [3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide
MS (ES) m/z 516.8; HRMS: calcd for C26H23F3N2O4S + H+, 517.14034; found (ESI, [M+H]+), 517.141.
Example 182 Λ'-(2-hydroxyethyl)-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide
HRMS: calcd for C25H21F3N2O4S + H+, 503.12469; found (ESI, [M+H]+), 503.1231.
Example 183
Λ^l-hydroxypropylJ-S-JS-P-methyl-S-^rifluoromethylJquinolin^- yl]phenoxy}benzenesulfonamide
HRMS: calcd for C26H23F3N2O4S + H+, 517.14034; found (ESI, [M+H]+), 517.1384.
Example 184
^-(l-hydroxy-l-methylpropyO-S-JS-P-methyl-S-^rifluoromethylJquinolin^- yl]phenoxy}benzenesulfonamide
HRMS: calcd for C27H25F3N2O4S + H+, 531.15599; found (ESI, [M+H]+), 531.1558.
Example 185
A42-hydroxy-2-methylpropyl)-N-methyl-3-{3-[3-methyl-8- (trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide
MS (ES) m/z 544.9; HRMS: calcd for C28H27F3N2O4S + H+, 545.17164; found (ESI, [M+H]+), 545.1719.
Example 186
^-(l-methoxy-l-methylpropyO-S-JS-P-methyl-S-^rifluoromethylJquinolin^- yl]phenoxy}benzenesulfonamide
MS (ES) m/z 542.8; HRMS: calcd for C28H27F3N2O4S + H+, 545.17164; found (ESI, [M+H]+), 545.1698.
Example 187
A42-methoxy-2-methylpropyl)-N-methyl-3-{3-[3-methyl-8- (trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide MS (ES) m/z 558.9; HRMS: calcd for C29H29F3N2O4S + H+, 559.18729; found (ESI,
[M+H]+), 559.1882.
Example 188
^-(l-hydroxy-ljl-dimethylethylJ-S-JS-P-methyl-S-^rifluoromethylJquinolin^- yl]phenoxy}benzenesulfonamide MS (ES) m/z 528.8; HRMS: calcd for C27H25F3N2O4S + H+, 531.15599; found (ESI, [M+H]+), 531.1541.
Example 189 4- [3-(6-Fluoro-pyridin-2-yloxy)-phenyl] -3-methyl-8-trifluoromethyl-quinoline
3-[3-Methyl-8-(trifluoromethyl)quinolin-4-yl]phenol (0.200 g, 0.658 mmol), 2,6- difluoropyridine (0.098 g, 0.856 mmol) and K2CO3 (0.181 g, 1.32 mmol) were taken into DMF (5 mL) and heated at 60 0C overnight under nitrogen atmosphere. The reaction was cooled, diluted with water and extracted with ethyl acetate. The combined organics were washed with a solution of half-saturated brine and then dried over MgSO4. The ethyl acetate was removed and the resulting material was purified via column chromatography to afford the title compound as an oil (0.242 g, 92%).
Example 190 3-methyl-4-(3-{[6-(methylsulfonyl)pyridin-2-yl]oxy}phenyl)-8-
(trifluoromethyl)quinoline
4-[3-(6-Fluoro-pyridin-2-yloxy)-phenyl]-3-methyl-8-trifluoromethyl-quinoline (0.236 g, 0.59 mmol) and NaSO2Me (90 mg, 0.89 mmol) in DMF (5 mL) was heated at 60 0C for 3 h. Additional NaSO2Me was added and the reaction was heated at 150 0C overnight. Additional NaSO2Me was added and heating was continued overnight. The reaction was cooled, diluted with water, and extracted with ethyl acetate. The combined organics were washed with a solution of half-saturated brine and then dried over MgSO4. The ethyl acetate was removed and the resulting material was chromatographed to afford the title compound as a white solid (0.199 g, 74%). HRMS: calcd for C23H17F3N2O3S + H+, 459.09847; found (ESI, [M+H]+), 459.0972.
Example 191 2-chloro-4-(methylthio)pyridine
2-Chloro-4-fluoropyridine (1.00 g, 7.60 mmol) and MeSNa (0.639 g, 9.12 mmol) in DMF (8 mL) were stirred overnight at ambient temperature. The reaction was treated with water and extracted with ethyl acetate. The combined organics were washed with a solution of half-saturated brine, dried over MgSO4, and concentrated in vacuo. Chromatography afforded the title compound as a colorless oil (0.976 g, 81%). Example 192
3-Methyl-4-[3-(4-methylsulfanyl-pyridin-2-yloxy)-phenyl]-8-trifluoromethyl- quinoline
2-Chloro-4-(methylthio)pyridine (0.170 g, 1.07 mmol), 3 -[3 -methyl- 8- (trifluoromethyl)quinolin-4-yl]phenol (0.250 g, 0.822 mmol) and K2CO3 (0.227 g, 1.64 mmol) in DMF (5 mL) were heated at 80 0C overnight. TLC indicated no reaction. Additional pyridine compound and K2CO3 were added and the reaction was heated at 150 0C overnight. The reaction was cooled, diluted with water, and extracted with ethyl acetate. The combined organics were washed with a solution of half-saturated brine, dried over MgSO4, and concentrated in vacuo. The residue was purifed by chromatography to give the title compound contaminated with some of the phenol (0.310 g). This material was carried forward without further purification.
Example 193 3-methyl-4-(3-{[4-(methylsulfonyl)pyridin-2-yl]oxy}phenyl)-8-
(trifluoromethyl)quinoline
3-Methyl-4-[3-(4-methylsulfanyl-pyridin-2-yloxy)-phenyl]-8-trifluoromethyl- quinoline in acetone/water (20 mL of 1 : 1 mixture) was stirred with NaHCO3 (0.207 g, 2.46 mmol) and Oxone® (1.26 g, 2.06 mmol) overnight at room temperature. The acetone was removed under vacuum and the resulting solution was extracted with ethyl acetate. The combined organics were washed with brine, dried over MgSO4, and concentrated in vacuo. The residue was purified by chromatography to afford the title compound as a white foam (231 mg). MS (ES) m/z 458.8; HRMS: calcd for C23H17F3N2O3S + H+, 459.09847; found (ESI, [M+H]+), 459.0988.
Examples 194 to 195
In a manner similar to Example 190 to Example 193 above, but starting with 2,6- difluoropyridine in place of 2-chloro-4-fluoropyridine in the first step, the following 2,6- pyridine compounds were prepared using the appropriate sodium thiolate.
Example 194
2-methyl-4-[(6-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}pyridin-2- yl)sulfonyl] butan-2-ol HRMS: calcd for C27H25F3N2O4S + H+, 531.15599; found (ESI, [M+H]+), 531.1547. Example 195
4-[3-({6-[(3-methoxy-3-methylbutyl)sulfonyl]pyridin-2-yl}oxy)phenyl]-3-methyl- 8-(trifluoromethyl)quinoline
HRMS: calcd for C28H27F3N2(MS + H+, 545.17164; found (ESI, [M+H]+), 545.1656.
Example 196
3-methyl-4-(3-{[5-(methylsulfonyl)pyridin-3-yl]oxy}phenyl)-8- (trifluoromethyl)quinoline
3-Bromo-5-(methanesulfonyl)pyridine (233 mg, 0.989 mmol, see, e.g., WO 2002/060438 for a description of the synthesis) was added to a mixture of 3 -[3 -methyl- 8-
(trifluoromethyl)quinolin-4-yl]phenol (150 mg, 0.494 mmol), CuI (9 mg, 0.0494 mmol), N- N-dimethylglycine hydrochloride (25 mg, 0.185 mmol), Cs2CO3 (482 mg, 1.47 mmol) in 1,4- dioxane (5 mL). The reaction was heated at reflux overnight, then cooled and treated with water. The mixture was extracted with ethyl acetate and the combined organics dried over MgSθ4 and concentrated in vacuo. The residue was chromatographed to yield the title compound (140 mg, 62%) as a white solid. MS (ESI) m/z 459; HRMS: calcd for C23H17F3N2O3S + H+, 459.09847; found (ESI, [M+H]+), 459.1004.
Example 197 3- Methyl-4- [3-(2-methylsulfanyl-pyridin-4-yloxy)-phenyl] -8-trifluoromethyl- quinoline
4-Bromo-2-(methylthio)pyridine (201 mg, 0.989 mmol) was added to a mixture of 3- [3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenol (200 mg, 0.659 mmol), CuI (13 mg, 0.066 mmol), N-N-dimethylglycine hydrochloride (35 mg, 0.24 mmol), Cs2CO3 (644 mg, 1.98 mmol) in 1,4-dioxane (5 mL). After heating at reflux overnight, the reaction was cooled, treated with water, and extracted with ethyl acetate. The combined extracts were dried over MgSθ4 and concentrated in vacuo. The residue was chromatographed to afford the title compound as a white, tacky solid (279 mg). MS (ES+): 458.9.
Example 198
3-methyl-4-(3-{[2-(methylsulfonyl)pyridin-4-yl]oxy}phenyl)-8- (trifluoromethyl)quinoline
3-Methyl-4-[3-(2-methylsulfanyl-pyridin-4-yloxy)-phenyl]-8-trifluoromethyl- quinoline (226 mg, 0.529 mmol) in a 1 : 1 mixture of acetone/water (10 mL) was treated with NaHCO3 (132 mg, 1.58 mmol) and Oxone® (325 mg, 1.32 mmol) and stirred overnight at ambient temperature. The acetone was removed in vacuo and the resulting aqueous mixture was extracted with ethyl acetate. The combined extracts were dried over MgSO/t, concentrated in vacuo, and the residue purified via column chromatography to afford the title compound as a white solid (169 mg). MS (ES) m/z All S).
Example 199
3,4-Dihydro-2H-thiopyrano [2,3-b] pyridine 1 ,1 ,8-trioxide
30% H2O2 (40.0 mL, 352 mmol) was added slowly to trifluoroacetic acid (225 mL) at 0 0C. The ice bath was removed and the bicyclic pyridyl-sulfide (6.10 g, 40.4 mmol, for preparation see, e.g., Taylor and Macor, J. Org. Chem. 1987, 52, 4280-4287) was added and the reaction was heated at 45 0C overnight. The reaction was concentrated and the residue triturated with hot MeOH. The mixture was cooled and filtered to afford the title compound as a white solid (7.00 g, 87%). MS (ESI) m/z 200.
Example 200 7-Bromo-3,4-dihydro-2H-thiopyrano[2,3-b]pyridine 1,1-dioxide (A) and 5-
Bromo-3,4-dihydro-2H-thiopyrano[2,3-b]pyridine 1,1-dioxide (B)
3,4-Dihydro-2H-thiopyrano[2,3-b]pyridine 1,1,8-trioxide (1.00 g, 5.02 mmol) and P(O)Br3 (10.0 g) were heated at 65 0C for 0.5 h. The reaction was cooled and carefully treated with saturated NaHCO3 with some ethyl acetate to reduce foaming. Solid K2CO3 was then added until the reaction became basic. The mixture was extracted with ethyl acetate and the combined extracts were dried over MgSθ4 and concentrated in vacuo. The residue was chromatographed to afford the separated title compounds A (0.245 g) and B (0.156 g) used in the next step.
Example 201
7-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-3,4-dihydro-2H- thiopyrano [2,3-b] pyridine 1,1-dioxide
(3-[3-Methyl-8-(trifluoromethyl)quinolin-4-yl]phenol (172 mg, 0.57 mmol) was added to a mixture of 7-bromo-3,4-dihydro-2H-thiopyrano[2,3-b]pyridine 1,1-dioxide (100 mg, 0.38 mmol), CuI (11 mg, 0.057 mmol), N-N-dimethylglycine HCl (30 mg, 0.213 mmol),
Cs2CO3 (557 mg, 1.71 mmol) in 1,4-dioxane (5 mL) and heated at reflux overnight. The cooled mixture was extracted with ethyl acetate and the combined extracts were dried over MgSθ4 and concentrated in vacuo. The residue was chromatographed to afford the separated title compound as a white solid (168 mg). MS (ES) m/z 484.9; HRMS: calcd for C25H19F3N2O3S + H+, 485.11412; found (ESI, [M+H]+), 485.114. Example 202
5-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-3,4-dihydro-2H- thiopyrano[2,3-b] pyridine 1,1-dioxide (3-[3-Methyl-8-(trifluoromethyl)quinolin-4-yl]phenol (269 mg, 0.89 mmol) was added to a solution of 5-bromo-3,4-dihydro-2H-thiopyrano[2,3-b]pyridine 1,1-dioxide (156 mg, 0.595 mmol), CuI (17 mg, 0.089 mmol), N-N-dimethylglycine HCl (46 mg, 0.333 mmol), CS2CO3 (869 mg, 2.67 mmol) in 1,4-dioxane (5 mL) and heated at reflux overnight. The cooled mixture was extracted with ethyl acetate and the combined extracts were dried over MgSO4 and concentrated in vacuo. The residue was chromatographed to afford the separated title compound as a white solid (127 mg). MS (ES) m/z 485.0; HRMS: calcd for C25H19F3N2O3S + H+, 485.11412; found (ESI, [M+H]+), 485.1151.
Example 203 2,4,6-Trichloro-pyridine 1-oxide
2,4,6-Trichloropyridine (4.26 g, 23.4 mmol) was dissolved in trifluoroacetic acid (25 mL) and treated with 30% H2O2 (5.9 mL). The mixture was heated at 100 0C for 4 h, then cooled and poured into water (150 mL). The mixture was extracted with dichloromethane and the combined extracts were washed with saturated aqueous NaHCO3, dried over MgSO4 and concentrated in vacuo. The residue was chromatographed to afford the title compound, which was used without further analysis.
Example 204
4-[3-(4,6-Dichloro-l-oxy-pyridin-2-yloxy)-phenyl]-3-methyl-8-trifluoromethyl- quinoline
2,4,6-Trichloro-pyridine 1-oxide (0.244 g, 1.23 mmol), 3 -[3 -methyl- 8- (trifluoromethyl)quinolin-4-yl]phenol (0.250 g, 0.822 mmol) and K2CO3 (0.227 g, 1.64 mmol) were taken into DMF (5 mL) and heated at 80 0C overnight. The reaction was cooled, diluted with water and extracted with ethyl acetate. The combined organics were washed with a solution of half-saturated brine, dried over MgSO4, and concentrated in vacuo. The residue was chromatographed to afford the title compound as a white solid (0.330 g, 86%) used without further analysis.
Example 205 4-(3-{[4-chloro-6-(methylsulfonyl)-l-oxidopyridin-2-yl]oxy}phenyl)-3-methyl-8- (trifluoromethyl)quinoline
4-[3-(4,6-Dichloro-l-oxy-pyridin-2-yloxy)-phenyl]-3-methyl-8-trifluoromethyl- quinoline (330 mg, 0.709 mmol) and sodium methanesulfϊnate (72 mg, 0.709 mmol) in DMF (5 mL) were heated at 80 0C overnight. The reaction was cooled, diluted with water and extracted with ethyl acetate. The combined organics were washed with a solution of half- saturated brine, dried over MgSO4, and concentrated in vacuo. The residue was chromatographed to afford the title compound as a white solid (190 mg, 53%). MS (ES) m/z 508.9; HRMS: calcd for C23H16ClF3N2O4S + H+, 509.05442; found (ESI, [M+H]+), 509.0532.
Example 206
4-[3-(4-Chloro-6-methanesulfonyl-pyridin-2-yloxy)-phenyl]-3-methyl-8- trifluoromethyl-quinoline
4-[3-(4-Chloro-6-methanesulfonyl-l-oxy-pyridin-2-yloxy)-phenyl]-3-methyl-8- trifluoromethyl-quinoline (0.122 g, 0.239 mmol) was dissolved in dichloromethane (5 mL) and treated with PBr3 (0.358 mL of a 1.0M solution in dichloromethane, 0.358 mmol) and stirred overnight. The reaction was quenched with saturated aqueous NaHCO3, extracted with ethyl acetate, and the combined extracts dried over MgSO4 and concentrated in vacuo. The residue was chromatographed to afford the title compound as a white solid (75 mg, 64%). HRMS: calcd for C23H16ClF3N2O3S + H+, 493.05950; found (ESI, [M+H]+), 493.0591.
Example 207
3,5-dichloro-2-fluoro-6-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}pyridin-4-amine 4-Amino-3,5-dichloro-2,6-difluoropyridine (0.850 g, 4.28 mmol) was added to a solution 3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenol (1.00 g, 3.29 mmol), K2CO3 (0.909 g, 6.58 mmol) in acetonitrile (10 mL) and the reaction heated at 50 0C overnight. LC- MS showed that some of the starting phenol was still present. An additional 0.5 g of the pyridine was added and heating was continued for 2 h. The cooled reaction was treated with water and extracted with ethyl acetate. The combined extracts were dried over MgSO4, concentrated in vacuo, and the residue was purified by chromatography to afford the title compound as a white foam (1.09 g, 69%). MS (ES) m/z 481.7.
Example 208 3,5-dichloro-2-(methylsulfonyl)-6-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl] phenoxy}pyridin-4-amine 3,5-Dichloro-2-fluoro-6- {3-[3-methyl-8-(trifluoromethyl)quinorin-4- yl]phenoxy}pyridin-4-amine (1.068 g, 2.21 mmol) was added to a solution of sodium methanesulfinate (0.399 g, 3.32 mmol) in DMF (15 mL) and heated at 100 0C for 60 h. Additional sodium methanesulfinate and DMF were added and the reaction was heated at 120 0C overnight. The cooled reaction was treated with water, extracted with ethyl acetate, and the combined extracts washed with half-saturated brine. The MgSO4-dried extracts were concentrated in vacuo and the residue chromatographed to afford the title compound as a white foam (0.828 g, 70%). MS (ES) m/z 541.7.
Example 209
2-Methanesulfonyl-6-[3-(3-methyl-8-trifluoromethyl-quinolin-4-yl)-phenoxy]- pyridin-4-ylamine
3,5-Dichloro-2-methanesulfonyl-6-[3-(3-methyl-8-trifluoromethyl-quinolin-4-yl)- phenoxy]-pyridin-4-ylamine (0.692 g, 1.27 mmol) was added to a solution of ammonium formate (3.50 g, 55.5 mmol) and 10% palladium on carbon (0.139 g) in MeOH (5 mL) and heated at 60 0C overnight. The reaction was treated with 1.6 g of additional ammonium formate and another portion of 10% Pd/C and heating continued for several more hours. More MeOH was added along with 2.5 g of ammonium formate and 0.050 g of 10% Pd/C. The reaction was heated for another overnight period. The reaction was cooled and filtered through Celite. The mother liquor was concentrated and the resulting material was purified via column chromatography to give the title compound, which was carried forward to the next step (0.400 g, 67%).
Example 210
4-(3-{[4-fluoro-6-(methylsulfonyl)pyridin-2-yl]oxy}phenyl)-3-methyl-8- (trifluoromethyl)quinoline
2-Methanesulfonyl-6-[3-(3-methyl-8-trifluoromethyl-quinolin-4-yl)-phenoxy]- pyridin-4-ylamine (0.300 g, 0.633 mmol) was added to 70% HF-pyridine (5 mL) in a Teflon round-bottomed flask and cooled to 0 0C. Sodium nitrite (0.262 g, 3.80 mmol) is added in portions. The reaction was stirred at 20 0C for 2 h, then at 60 0C for 1 h. The reaction was cooled to 20 0C and treated with ice followed by neutralization with solid NaHCO3. The mixture was extracted with ethyl acetate and the combined extracts were washed with water and dried over MgSO4. The extracts were concentrated in vacuo and the residue chromatographed to afford the title compound as a white foam (0.159 g, 53%). MS (ES) m/z
477.1. Example 211 l-(bromomethyl)-4-(methylsulfonyl)benzene
A stirred mixture of l-methanesulfonyl-4-methyl-benzene (1.30 g, 7.5 mmol), n- bromosuccinimide (1.30 g, 7.10 mmol), and benzoyl peroxide (70 mg, 0.30 mmol) in CCl4 (70 mL) was heated at reflux for 4 h. The reaction was cooled, filtered, and concentrated in vacuo. The combined organic phases were concentrated and the residue chromatographed eluting with 1 :9 ethyl acetate :hexane to afford the title compound as a white solid (0.700 g, 38%). mp 99-101 0C; MS (ES) m/z 248.9..
Example 212
4-(3-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-(trifluoromethyl)quinoline
A mixture of 3-(8-trifluoromethyl-quinolin-4-yl)-phenol (0.100 g, 0.35 mmol), 1- (bromomethyl)-3-(methylsulfonyl)benzene (0.130 g, 0.52 mmol), and cesium carbonate (676 mg, 2.10 mmol) in acetonitrile (5 mL) was stirred at room temperature for 3 h. The reaction was filtered and concentrated in vacuo and the residue was chromatographed eluting with 1 : 1 ethyl acetate :hexane to afford the title compound as a white solid foam (0.147 g, 93%). mp 63-65 0C. Calculated mass for C24H18F3NO3S is 457.47; found (ES, [M+H]+), 458.2.
Examples 213 to 215
The following compounds were prepared in a similar manner to that described for Example 212 above substituting the appropriate quino line-phenol and benzylhalide.
Example 213 4-(3-{[4-(methylsulfonyl)benzyl]oxy}phenyl)-8-(trifluoromethyl)quinoline mp 75-77 0C; MS (ES) m/z 458.2.
Example 214
3-benzyl-4-(3-{[4-(methylsulfonyl)benzyl]oxy}phenyl)-8- (trifluoromethyl)quinoline mp 94-95 0C; MS (ES) m/z 548.0. Example 215
3-benzyl-4-(3-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8- (trifluoromethyl)quinoline mp 77-79 0C; MS (ES) m/z 548.0.
Example 216 3-Methyl-4-{3-[3-(methylsulfonyl)benzyl]phenyl}-8-(trifluoromethyl)quinoline
3-Methyl-4-[3-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)phenyl]-8- (trifluoromethyl)quinoline (0.150 g, 0.363 mmol) was added to a solution of 1-
(bromomethyl)-3-(methanesulfonyl)benzene (0.181 g, 0.726 mmol), Pd(PPh3)4 (0.021 g, 0.0181 mmol), toluene (5 mL) and EtOH (1 mL) in 2M Na2CO3 (0.55 mL, 1.10 mmol) and refluxed for 2.5 h. The reaction was cooled, diluted with water, and extracted with ethyl acetate. The combined organics were washed with water and brine, dried over MgSO4, and concentrated in vacuo. The residue was chromatographed to afford the title compound as a yellow solid (0.149 g, 90%). HRMS: calcd for C25H20F3NO2S + H+, 456.12396; found (HRMS, [M+H]+), 456.1224.
Example 217 3-benzyl-4-{3-[3-(ethylsulfonyl)benzyl]phenyl}-8-(trifluoromethyl)quinoline
To a stirred mixture of 3-benzyl-4-[3-(bromomethyl)phenyl]-8-
(trifluoromethyl)quinoline (182 mg, 0.40 mmol) and 3-ethylsulfonyl-phenylboronic acid (129 mg, 0.60 mmol) in DME (4.0 mL), and 2M aqueous Na2CO3 (0.60 mL, 1.20 mmol) was added Pd(PPh3)4 (0.023 g, 0.020 mmol). The mixture was heated at 80 0C for 18 h, cooled, treated with water (15 mL), and extracted with dichloromethane (2 x 15 mL). The extracts are dried (MgSO4) and concentrated in vacuo. The residue was chromatographed on silica gel eluting with a gradient of 30:70 to 50:50 ethyl acetate:hexanes and the resulting material (Rf ~ 0.5 in the latter solvent system) was further purified on reverse phase using a gradient of 0: 100 to 100:0 acetonitrile:water to afford the title compound as a white foam solid (81 mg). MS (ES) m/z 545.8; HRMS: calcd for C32H26F3NO2S + H+, 546.17091; found (ESI,
[M+H]+), 546.1702.
Example 218 Pentafluorophenyl 3-methylbenzenesulfonate OT-Tolylsulfonyl chloride (2.83 g, 14.8 mmol) was added to a solution of pentafluorophenol (3.27 g, 17.0 mmol) and triethylamine (3.10 mL, 22.3 mmol) in dichloromethane (50 mL) and stirred overnight at 20 0C. The reaction was concentrated and the residue was taken into ethyl acetate and washed sequentially with water, IN aqueous HCl, 2N aqueous NaOH and brine. The organic layer was dried over MgSO4, concentrated in vacuo, and chromatographed to afford the title compound as a colorless liquid (4.82 g, 96%).
Example 219
Pentafluorophenyl 3-(bromomethyl)benzenesulfonate
A solution of pentafluorophenyl 3-methylbenzenesulfonate (4.76 g, 14.1 mmol), N- bromosuccinimide (2.79 g, 15.5 mmol) and AIBN (0.115 g, 0.70 mmol) in CCl4 (75 mL) was heated at reflux for 2 h. Catalytic benzoyl peroxide was added and heating continued overnight. The cooled reaction was filtered through Celite and concentrated in vacuo. The residue was chromatographed to afford the title compound.
Example 220 3- [3-(3-Methyl-8-trifluoromethyl-quinolin-4-yl)-benzyl] -benzenesulfonic acid pentafluorophenyl ester
3-Methyl-4-[3-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)phenyl]-8- (trifluoromethyl)quinoline (0.575 g, 1.81 mmol) was added to a stirred solution of pentafluorophenyl 3-(bromomethyl)benzenesulfonate (1.50 g, 3.62 mmol) and Pd(PPh3 )4 (0.105 g, 0.091 mmol) in 2M aqueous Na2CO3 (2.7 mL, 5.4 mmol), toluene (15 mL) and
EtOH (3 mL) and heated at reflux for 3 h. The reaction was cooled, diluted with water, and extracted with ethyl acetate. The combined organics were washed with water and then brine and dried over MgSO4. The residue from concentration was chromatographed to afford the title compound sufficiently pure for the next step (0.90 g).
Example 221
3-{3-[3-Methyl-8-(trifluoromethyl)quinolin-4-yl]benzyl}-Λ/- propylbenzenesulfonamide
A solution of 3-[3-(3-methyl-8-trifluoromethyl-quinolin-4-yl)-benzyl]- benzenesulfonic acid pentafluorophenyl ester (0.150 g, 0.253 mmol), 1 -propylamine (0.044 g, 0.759 mmol) and DBU (0.056 mL, 0.38 mmol) in THF was heated at 65 0C for 3 h. The reaction was cooled and 2N aqueous HCl is added. The reaction mixture was extracted with ethyl acetate and dried over MgSO4. The material was chromatographed to afford the title compound as a white solid (0.154 g). MS (ES) m/z 497.0; HRMS: calcd for C27H25F3N2O2S + H+, 499.16616; found (ESI, [M+H]+), 499.1689. Examples 222 to 223
The following compounds were prepared in a similar manner to that described above using the appropriate amine in place of 1 -propylamine.
Example 222
Λ'-Ethyl-Λ'-methyl-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]benzyl}benzenesulfonamide
MS (ES) m/z 499.0; HRMS: calcd for C27H25F3N2O2S + H+, 499.16616; found (ESI, [M+H]+), 499.1651.
Example 223
Λf-(2-Hydroxyethyl)-Λf-methyl-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]benzyl}benzenesulfonamide
MS (ES) m/z 515.0; HRMS: calcd for C27H25F3N2O3S + H+, 515.16107; found (ESI, [M+H]+), 515.1599.
Example 224 l-(3-Hydroxymethyl-phenyl)-imidazolidin-2-one 3-Iodobenzylalcohol (1.84 g, 7.9 mmol) and 2-imidazolidone (10.15 g, 1 18 mmol) are added to a mixture of CuI (0.149 g, 0.79 mmol), K3PO4 (3.33 g, 15.7 mmol), and N,N'- dimethylethylenediamine (0.17 mL, 1.57 mmol) in DMF (30 mL) and the mixture was heated at 120 0C overnight. The reaction was cooled, diluted with ethyl acetate, and filtered through Celite. Water and NaCl were added and the layers separated. The aqueous layer was extracted several more times and the combined organics were dried over MgSO4 and concentrated. The resulting material was chromatographed to afford the title compound (0.22 g).
Example 225 l-(3-Bromomethyl-phenyl)-imidazolidin-2-one l-(3-Hydroxymethyl-phenyl)-imidazolidin-2-one. (0.220 g, 1.14 mmol) in THF (7 mL) was treated with 1.0 M PBr3 in dichloromethane (2.28 mL, 2.28 mmol). After 1 h, the reaction was concentrated in vacuo and treated with ethyl acetate and dilute aqueous NaHCθ3 solution. The layers were separated and the organic layer washed with more NaHCθ3 solution. The organics were dried over MgSO4, concentrated, and the residue chromatographed to afford the title compound (0.180 g).
Example 226 l-(3-{3-[3-Methyl-8-(trifluoromethyl)quinolin-4-yl]benzyl}phenyl)imidazolidin- 2-one
3-Methyl-4-[3-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)phenyl]-8- (trifluoromethyl)quinoline (0.150 g, 0.363 mmol) was added to a solution of l-(3- bromomethyl-phenyl)-imidazolidin-2-one (0.185 g, 0.73 mmol), Pd(PPh3)4 (0.021 g, 0.018 mmol), toluene (5 mL) and EtOH (1 mL) in 2M aqueous Na2COs (0.55 mL, 1.09 mmol) and refluxed for 2 h. The reaction was cooled, diluted with water, and extracted with ethyl acetate. The combined organics were washed with water and brine, then dried over MgSO4. After concentration, the residue was chromatographed afford the title compound as a white solid (0.137 g). HRMS: calcd for C27H22F3N3O + H+, 462.17877; found (ESI, [M+H]+), 462.1799.
Example 227 3-(3-Hydroxymethyl-phenyl)-oxazolidin-2-one 3-Bromobenzyl alcohol (1.56 g, 8.34 mmol) and 2-oxazolidone (0.871 g, 10.00 mmol) were added to trans- 1 ,2-diaminocyclohexane (0.10 mL, 0.83 mmol), CuI (0.079 g, 0.417 mmol), and K2CO3 (2.30 g, 16.7 mmol) in dioxane (40 mL) and refluxed overnight. Additional 2-oxazolidone (1.0 g), CuI and trans- 1 ,2-diaminocyclohexane (0.3 mL) were added and heating continued 7 h. The reaction mixture was concentrated and the residue chromatographed to afford the title compound, which was sufficiently pure for the next step (1.94 g).
Example 228 3-(3-Bromomethyl-phenyl)-oxazolidin-2-one 3-(3-Hydroxymethyl-phenyl)-oxazolidin-2-one (1.61 g, 8.34 mmol, from previous step) in THF (50 mL) was treated with 1.0 M PBr3 in dichloromethane (16.7 mL, 16.7 mmol) and stirred for 1 h. The reaction was concentrated to a residue which was treated with ethyl acetate and dilute aqueous NaHCO3 solution. The layers were separated and the organic layer was washed with more dilute aqueous NaHCO3. The organic layer was dried over MgSO4 and concentrated in vacuo. The residue was chromatographed to afford the title compound (1.03 g). Example 229
3-(3-{3-[3-Methyl-8-(trifluoromethyl)quinolin-4-yl]benzyl}phenyl)-l,3- oxazolidin-2-one 3-Methyl-4-[3-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)phenyl]-8-
(trifluoromethyl)quinoline (0.150 g, 0.363 mmol) was added to 3-(3-bromomethyl-phenyl)- oxazolidin-2-one (0.185 g, 0.726 mmol) and Pd(PPh3)4 (0.021 g, 0.018 mmol) in toluene (5 mL) and EtOH (1 mL) in 2M aqueous Na2CO3 (0.55 mL, 1.09 mmol) and refluxed for 2 h. The cooled reaction was diluted with water and extracted with ethyl acetate. The combined organics were washed with water and brine, and dried over MgSO4. After concentration in vacuo, the residue was chromatographed to yield afford the title compound as an off-white solid (0.163 g). MS (ES) m/z 463.1; HRMS: calcd for C27H21F3N2O2 + H+, 463.16279; found (ESI, [M+H]+), 463.1626.
Example 230
8-Chloro-3-methyl-4- [3-(3-nitro-phenoxy)-phenyl] -quinoline
A stirred mixture of 3-(8-chloro-3-methyl-quinolin-4-yl)-phenol (2.50 g, 9.26 mmol), l-fluoro-3 -nitrobenzene (1.97 mL, 18.5 mmol), and K2CO3 (2.56 g, 18.53 mmol) in DMF (30 mL) was heated at reflux for 4 h. The reaction was cooled, diluted with water, and extracted with ethyl acetate. The combined organics were washed with a solution of half-saturated brine and dried over MgSO4. The material was chromatographed eluting with 15:85 ethyl acetate:hexane afford the title compound as an off- white solid (2.71 g, 75%). MS (ES) m/z: 391.1
Example 231
3- [3-(8-Chloro-3-methyl-quinolin-4-yl)-phenoxy] -phenylamine
8-Chloro-3-methyl-4-[3-(3-nitro-phenoxy)-phenyl]-quinoline (2.49 g, 6.37 mmol) in a mixture of concentrated hydrochloric acid (20 mL) and methanol (20 mL) was treated with tin metal (3.02 g, 25.5 mmol) and heated at 50 0C for 2.5 h. The reaction was cooled and poured into a large Erlenmeyer flask containing NaHCO3, (50 g), water (100 mL) and some ethyl acetate. This mixture was stirred for an hour and then extracted with ethyl acetate. The combined organics were washed with water and brine and dried over MgSO4. The product was chromatographed eluting with 30:70 ethyl acetate :hexane afford the title compound as a yellow solid (1.19 g). MS (ES) m/z: 361.1.
Example 232 Λ'-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}benzenesulfonamide
A solution of 3-[3-(8-chloro-3-methyl-quinolin-4-yl)-phenoxy]-phenylamine (0.100 g, 0.277 mmol) and triethylamine (0.080 mL, 0.55 mmol) in THF (3 mL) was treated with benzenesulfonyl chloride (0.043 mL, 0.33 mmol) and stirred at 20 0C overnight. The reaction was filtered and concentrated. The residue was purified by reverse phase HPLC (10 to 100% acetonitrile in water) to afford the title compound as a white solid (0.027 g). MS (ES) m/z 499.1; HRMS: calcd for C28H21ClN2O3S + H+, 501.10342; found (ESI, [M+H]+), 501.1042.
Examples 233 to 237
The following compounds were prepare in a similar manner to that described above in Example 232 employing the appropriate quinoline -phenol, fluoronitrobenzene, and RSO2Cl or chloroformate ROC(O)Cl. Example 233 N-{3-[3-(8-chloro-3-methylquinoh'n-4-yl)phenoxy]phenyl}methanesulfonamide
Procedure was essentially the same as above except that benzenesulfonyl chloride was replaced with methanesulfonyl chloride. MS (ES) m/z 437.0; HRMS: calcd for C23H19ClN2O3S + H+, 439.08777; found (ESI, [M+H]+), 439.0871.
Example 234 Λ'-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}ethanesulfonamide
Procedure was essentially the same as above except that benzenesulfonyl chloride was replaced with ethanesulfonyl chloride. MS (ES) m/z 451.0; HRMS: calcd for
C24H21ClN2O3S + H+, 453.10342; found (ESI, [M+H]+), 453.1033.
Example 235
Methyl {3- [3-(8-chloro-3-methylquinolin-4-yl)phenoxy] phenyl} carbamate Procedure was essentially the same as above except that benzenesulfonyl chloride was replaced with methyl chloroformate. MS (ES) m/z 419.1; HRMS: calcd for C24H19ClN2O3 + H+, 419.11570; found (ESI, [M+H]+), 419.1154.
Example 236 Ethyl {3- [3-(8-chloro-3-methylquinolin-4-yl)phenoxy] phenyl} carbamate
Procedure was essentially the same as above except that benzenesulfonyl chloride was replaced with ethyl chloroformate. MS (ES) m/z 431.1; HRMS: calcd for C25H21ClN2O3 + H+, 433.13135; found (ESI, [M+H]+), 433.1322.
Example 237
Isobutyl {3- [3-(8-chloro-3-methylquinolin-4-yl)phenoxy] phenyl} carbamate
Procedure was essentially the same as above except that benzenesulfonyl chloride was replaced with isobutyl chloroformate. MS (ES) m/z 459.1; HRMS: calcd for C27H25ClN2O3 + H+, 461.16265; found (ESI, [M+H]+), 461.1628.
Example 238
Λ'-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}-iV-ethylurea 3-[3-(8-Chloro-3-methyl-quinolin-4-yl)-phenoxy]-phenylamine (0.100 g, 0.277 mmol) in THF (3 mL) was treated with ethyl isocyanate (0.024 mL, 0.31 mmol) and stirred at 20 0C overnight. The reaction was filtered and concentrated. The residue was purified via reverse phase HPLC (10 to 100% acetonitrile in water) to afford the title compound as a white solid (0.037 g). MS (ES) m/z 430.1; HRMS: calcd for C25H22ClN3O2 + H+, 432.14733; found (ESI, [M+H]+), 432.1456.
Examples 239 to 242 The following compounds were prepared in an analogous manner employing the appropriate quinoline biarylether aniline and isocyanate.
Example 239 N-{3-[3-(8-chloro-3-methylquinoh'n-4-yl)phenoxy]phenyl}-A^-isopropylurea Procedure was essentially the same as that described above except that ethyl isocyanate was replaced with isopropyl isocyanate. MS (ES) m/z 444.1; HRMS: calcd for C26H24ClN3O2 + H+, 446.16298; found (ESI, [M+H]+), 446.1638.
Example 240 Λ'-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}-iV-phenylurea
Procedure was essentially the same as that described above except that ethyl isocyanate was replaced with phenyl isocyanate. MS (ES) m/z 478.1; HRMS: calcd for C29H22ClN3O2 + H+, 480.14733; found (ESI, [M+H]+), 480.1473.
Example 241
Λ^-(2-Chloroethyl)-7V- {3- [3-(8-chloro-3-methylquinolin-4- yl)phenoxy]phenyl}urea
Prepared in a similar manner to that described above, but adding chloroethyl isocyanate initially at 0 0C before warming to 20 0C. The title compound was isolated as a brown foam. HRMS: calcd for C25H21Cl2N3O2 + H+, 466.10836; found (ESI, [M+H]+),
466.1083.
Example 242
2-Chloroethyl {3- [3-(8-chloro-3-methylquinolin-4-yl)phenoxy] phenyl} carbamate
3-[3-(8-Chloro-3-methyl-quinolin-4-yl)-phenoxy]-phenylamine (0.265 g, 0.734 mmol) and triethylamine (0.107 mL, 0.77 mmol) in toluene (5 mL) was treated with 2- chloroethyl chloroformate (0.075 mL, 0.734 mmol) for 1 h. The reaction was quenched with water and extracted with ethyl acetate. The combined organics were washed with water, dried over MgSO4 and concentrated. The residue was chromatographed eluting with 30:70 ethyl acetate:hexanes to afford the title compound as white foam (0.245 g, 72%). HRMS: calcd for C25H20Cl2N2O3 + H+, 467.09237; found (ESI, [M+H]+), 467.0942.
Example 243 8-Chloro-3-methyl-4-{3-[3-(5-methyl-4,5-dihydro-l,3-oxazol-2- yl)phenoxy] phenyl} quinoline
A solution of 3-[3-(8-chloro-3-methyl-qumorin-4-yl)-phenoxy]-N-(2-hydroxy- propyl)-benzamide (0.096 g, 0.214 mmol) and DMAP (0.078 g, 0.642 mmol) in dichloromethane (5 mL) cooled to -40 0C was treated with triflic anhydride (0.054 mL, 0.322 mmol) and the reaction stirred at 20 0C for 1.5 h. Additional triflic anhydride was added and the reaction stirred overnight. The reaction was passed through a short silica gel plug eluting with 20:80 methanol:dichloromethane. The solvent was removed and the residue purified via reverse phase chromatography to afford the title compound as a white solid (17 mg). MS (ES) m/z 429.1; HRMS: calcd for C26H21ClN2O2 + H+, 429.13643; found (ESI, [M+H]+), 429.1356.
Example 244 l-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}-3-methylimidazolidin- 2-one 1 - {3-[3-(8-Chloro-3-methyl-quinolin-4-yl)-phenoxy]-phenyl} -imidazolidin-2-one
(0.100 g, 0.232 mmol) in DMF (3 mL) was stirred with 60% NaH in mineral oil (0.011 g, 0.279 mmol) for 15 min. Iodomethane (0.017 mL, 0.28 mmol) was added and the reaction stirred overnight. The reaction was quenched with IN HCl and the layers were separated. The aqueous layer was extracted with ethyl acetate. The combined organics were washed with half- saturated brine and dried over MgSO4. The product was chromatographed to afford the title compound as a white solid (0.087 g, 85%). HRMS: calcd for C26H22ClN3O2 + H+, 444.14733; found (ESI, [M+H]+), 444.1457.
Example 245 l-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}-3-ethylimidazolidin-2- one
The procedure was essentially the same as above (Example 244) except that iodomethane was replaced with iodoethane. MS (ES) m/z 458.3. HRMS: calcd for C27H24ClN3O2 + H+, 458.16298; found (ESI, [M+H]+), 458.1599. Example 246
8-Chloro-4-{3-[3-(4-isopropyl-4,5-dihydro-l,3-oxazol-2-yl)phenoxy]phenyl}-3- methylquinoline
3-[3-(8-Chloro-3-methyl-quinolin-4-yl)-phenoxy]-N-(l-hydroxymethyl-2-methyl- propyl)-benzamide (0.059 g, 0.127 mmol) and DAST (0.020 mL, 0.153 mmol) in dichloromethane (3 mL) was stirred at 20 0C overnight. The reaction was treated with saturated aqueous NaHCO3 for 0.5 h. The layers were separated and the organic layer was dried over MgSO/t. The crude material was chromatographed to afford the title compound as yellow oil. HRMS: calcd for C28H25ClN2O2 + H+, 457.16773; found (ESI, [M+H]+), 457.1683.
Example 247
8-Chloro-3-methyl-4-{3-[3-(4-propyl-4,5-dihydro-l,3-oxazol-2- yl)phenoxy] phenyl} quinoline The procedure was essentially the same as above (Example 246) except that 3-[3-(8- chloro-3 -methyl-quinolin-4-yl)-phenoxy] -N-( 1 -hydroxymethyl-2-methyl-propyl)-benzamide was replaced with 3-[3-(8-chloro-3-methyl-quinolin-4-yl)-phenoxy]-N-(l-hydroxymethyl- butyl)-benzamide. HRMS: calcd for C28H25ClN2O2 + H+, 457.16773; found (ESI, [M+H]+), 457.1681.
Example 248
8-Chloro-4-{3-[3-(4,4-dimethyl-4,5-dihydro-l,3-oxazol-2-yl)phenoxy]phenyl}-3- methylquinoline
The procedure was essentially the same as Example 246 except that 3-[3-(8-chloro-3- methyl-quinolin-4-yl)-phenoxy] -N-(I -hydroxymethyl-2-methyl-propyl)-benzamide was replaced with 3-[3-(8-chloro-3-methyl-quinolin-4-yl)-phenoxy]-N-(2-hydroxy- 1 , 1 -dimethyl- ethyl)-benzamide. HRMS: calcd for C27H23ClN2O2 + H+, 443.15208; found (ESI, [M+H]+), 443.1497.
Example 249 3-{3-[3-(8-Chloro-3-methyl-quinolin-4-yl)-phenoxy]-phenyl}-2-oxo-imidazolidin- l-yl)-acetic acid methyl ester
1 - {3-[3-(8-Chloro-3-methyl-quinolin-4-yl)-phenoxy]-phenyl} -imidazolidin-2-one (0.100 g, 0.232 mmol) in THF (3 mL) was treated with 1.0 M potassium t-butoxide in THF (0.255 mL, 0.255 mmol) for 15 min. Then methyl bromoacetate (0.044 mL, 0.46 mmol) was added and the reaction was stirred overnight. The reaction was quenched with 1 N HCl and extracted with ethyl acetate. The combined extracts were dried over MgSθ4 and concentrated. The residue was chromatographed to afford the title compound as a yellow oil (0.055 g) carried on to the acid.
Example 250 (3-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}-2-oxoimidazolidin-l- yl)acetic acid
(3 - {3 - [3 -(8-Chloro-3 -methyl-quinolin-4-yl)-phenoxy] -phenyl} -2-oxo-imidazolidin- 1 - yl)-acetic acid methyl ester (0.055 g, 0.109 mmol) and 1.0M aqueous LiOH (1 mL) in THF (3 mL) were stirred at 20 0C overnight. The THF was removed in vacuo and the residue was acidified with 2 N aqueous HCl and extracted with ethyl acetate. The extracts were dried over MgSθ4 and concentrated. The residue was chromatographed to yield afford the title compound as yellow solid. HRMS: calcd for C27H22ClN3O4 + H+, 488.13716; found (ESI, [M+H]+), 488.1361.
Example 251
4-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl] phenoxy}phenyl)sulfonyl] butan-2-ol
4-[3-(3-Methanesulfonyl-phenoxy)-phenyl]-3-methyl-8-trifluoromethyl-quinoline (0.150 g, 0.328 mmol) in ether (2 mL) was treated with 1.4 M s-BuLi in cyclohexane (0.35 mL, 0.49 mmol) and stirred for 15 min. Propylene oxide (0.23 mL, 3.28 mmol) and THF (1 mL) were added and the reaction stirred overnight. The reaction was quenched with saturated ammonium chloride and extracted with ethyl acetate. The combined organics were dried over MgSO4 and concentrated. The resulting material was chromatographed to afford the title compound as tan solid. MS (ES) m/z 515. HRMS: calcd for C27H24F3NO4S + H+, 516.14509; found (ESI, [M+H]+), 516.1465.
Example 252 l-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl] phenoxy}phenyl)sulfonyl] pentan-3-ol The procedure was essentially the same as Example 251 above except that propylene oxide was replaced with 1 ,2-epoxybutane. MS (ES) m/z 529.8. HRMS: calcd for C28H26F3NO4S + H+, 530.16074; found (ESI, [M+H]+), 530.1555.
Example 253 l-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl] phenoxy}phenyl)sulfonyl] hexan-3-ol The procedure was essentially the same as Example 251 except that propylene oxide was replaced with 1,2-epoxypentane. MS (ES) m/z 543.8. HRMS: calcd for C29H28F3NO4S + H+, 544.17639; found (ESI, [M+H]+), 544.1757.
Example 254
4-({3- [3-(8-chloro-3-methylquinolin-4-yl)phenoxy] phenyl} sulfonyl)butan-2-ol
DMSO (0.073 g, 0.940 mmol) in THF (1.5 mL) was cooled to 0 0C. w-BuLi (0.19 mL, 0.47 mmol, 2.5 M solution in hexanes) was added and stirred 5 min. 8-Chloro-4-[3-(3- methanesulfonyl-phenoxy)-phenyl]-3-methyl-quinoline (0.100 g, 0.235 mmol) in THF (1 mL) was added quickly. After stirring for 30 min at 20 0C, propylene oxide (0.050 mL, 0.71 mmol) was added. After stirring overnight, the reaction was quenched with 1 N aqueous HCl and extracted with ethyl acetate. The extracts were dried over MgSO4 and concentrated. The residue was chromatographed to afford the title compound as an off-white foam-solid (0.048 g). MS (ES) m/z 482.1; HRMS: calcd for C26H24ClNO4S + H+, 482.11873; found (ESI, [M+H]+), 482.1169.
Example 255
4-({3- [3-(8-chloro-3-methylquinolin-4-yl)phenoxy] phenyl} sulfonyl)-2- methylbutan-2-ol The procedure was essentially the same as above except that propylene oxide was replaced with 1 ,2-epoxy-2-methylpropane and 1 N HCl was replaced with saturated ammonium chloride. MS (ES) m/z 495.7; HRMS: calcd for C27H26ClNO4S + H+, 496.13438; found (ESI, [M+H]+), 496.1336.
Example 256
4-(3-{3-[3-(tert-Butyl-dimethyl-silanyloxy)-propane-l-sulfonyl]-phenoxy}- phenyl)-8-chloro-3-methyl-quinoline
The procedure was essentially the same as above except that propylene oxide was replaced with (2-bromoethoxy)-t-butyldimethylsilane and 1 N HCl was replaced with saturated ammonium chloride. The compound was carried forward to the next step without further purification.
Example 257 3-({3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}sulfonyl)propan-l-ol A solution of 4-(3-{3-[3-(tert-butyl-dimethyl-silanyloxy)-propane-l-sulfonyl]- phenoxy}-phenyl)-8-chloro-3-methyl-quinoline in THF (5 mL) was treated with tetrabutylammonium fluoride (3 equiv) and stirred at 20 0C for 1 h. The reaction was treated with saturated ammonium chloride and water and extracted with ethyl acetate. The extracts were washed with brine, dried over MgSθ4 and concentrated. The residue was chromatographed to afford the title compound as a yellow solid. MS (ES) m/z 467.7; HRMS: calcd for C25H22ClNO4S + H+, 468.10308; found (ESI, [M+H]+), 468.1026.
Example 258 3- [3-cyano-8-(trifhioromethyl)quinolin-4-yl] phenyl trifluoromethanesulfonate
A stirred mixture of 4-(3-hydroxy-phenyl)-8-trifluoromethyl-quinoline-3-carbonitrile (260 mg, 0.828 mmol) and N-phenylbis(trifluoromethanesulphonimide) (414 mg, 1.16 mmol) in THF (20 mL) was cooled to 0 0C and treated with potassium tert-butoxide (120 mg, 1.08 mmol) in a lump sum. The resulting orange mixture was stirred at 0 0C for 1 h, then quenched with water and extracted with ethyl acetate. The organic extracts were dried over MgSO4 and concentrated in vacuo. The residue was chromatographed eluting with ethyl acetate :hexane gradient to afford the title compound as a brown powder (136 mg, 37% yield). MS (ESI) m/z 447.8.
Example 259
^-{3 '- [3-cyano-8-(trifluoromethyl)quinolin-4-yl] biphenyl-3- yljmethanesulfonamide
A mixture of 3-[3-cyano-8-(trifluoromethyl)quinolin-4-yl]phenyl trifluoromethanesulfonate (45 mg, 0.10 mmol), 3-(methanesulfonylamino)phenylboronic acid (44 mg, 0.20 mmol), K3PO4 (64 mg, 0.30 mmol) and Pd(PPh3)4 (15 mg, 0.13 mmol) in dioxane (5 mL) was heated at reflux 2 h. The reaction was filtered and the filtrate concentrated in vacuo. The residue was purified by HPLC to obtain the title compound as a white solid (25 mg). MS (ES) m/z 467.8; HRMS: calcd for C24H16F3N3O2S + H+, 468.09881; found (ESI, [M+H]+), 468.0981.
Examples 260 to 266
The following compounds were prepared in a similar manner to Example 259 above using the appropriate arylboronic acid and quinoline-aryltriflate.
Example 260 4- [3 '-(methylsulfonyl)biphenyl-3-yl] -8-(trifluoromethyl)quinoline-3-carbonitrile
MS (ES) m/z 452.8; HRMS: calcd for C24H15F3N2O2S + H+, 453.08791; found (ESI, [M+H]+), 453.0871.
Example 261 4-[3'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-carbonitrile
MS (ES) m/z 466.8.
Example 262
^-{3 '- [3-cyano-8-(trifluoromethyl)quinolin-4-yl] biphenyl-4- yljmethanesulfonamide
MS (ES) m/z 467.8.
Example 263
Λ'-{3'-[3-cyano-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}-4- methylbenzenesulfonamide
MS (ES) m/z 543.9.
Example 264 4-[4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-carbonitrile MS (ES) m/z 452.8.
Example 265
4-{3-[l-(phenylsulfonyl)-l//-indol-3-yl]phenyl}-8-(trifluoromethyl)quinoline-3- carbonitrile MS (ES) m/z 553.8.
Example 266 3'-[3-cyano-8-(trifluoromethyl)quinolin-4-yl]-Λ'-methylbiphenyl-3-sulfonamide
MS (ES) m/z 468.
Example 267
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-3-(l/7-tetrazol-5-yl)-8- (trifluoromethyl)quinoline
A mixture of 4- {3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline- 3-carbonitrile (30 mg, 0.06 mmol), NaN3 (100 mg, 1.54 mmol), triethylamine hydrochloride (200 mg, 1.45 mmol) in DMF (5 mL) was heated at 95 0C overnight. The solid was removed and the liquid was chromatographed eluting with ethyl acetate :hexane gradient to give the title compound as a white solid (25 mg, 80%). MS (ES) m/z 512.1.
Example 268 4-(3-bromomethyl-phenyl)-3-methyl-8-trifluoromethyl-quinoline
A stirred mixture of [3-(3-methyl-8-trifluoromethyl-quinolin-4-yl)-phenyl]-methanol (150 mg, 0.471 mmol) in dry toluene (5 mL) at 0 0C was treated with 1.0 M phosphorous tribromide in CH2CI2, (2.9 mL, 2.9 mmol). After 15 min, the reaction was allowed to warm to 20 0C. After 3 h, the reaction was quenched with water and extracted with ethyl acetate. The combined organics were dried over MgSθ4 and concentrated in vacuo. The residue was chromatographed eluting with ethyl acetate:hexane to afford the title compound as a light brown powder (178 mg, 84%). MS (ESI) m/z 380.02.
Example 269
3-methyl-4-[3-({[l-(methylsulfonyl)-l,2,3,4-tetrahydroquinolin-5- yl]oxy}methyl)phenyl]-8-(trifluoromethyl)quinoline l-Methanesulfonyl-l,2,3,4-tetrahydro-quinolin-5-ol (59 mg, 0.26 mmol) in dry DMF (4 mL) was stirred with 60% sodium hydride in oil (12 mg, 0.31 mmol) for 15 min at 20 0C and then treated with 4-(3-bromomethyl-phenyl)-3-methyl-8-trifluoromethyl-quinoline (90 mg, 0.237 mmol). After 3 h, the reaction was quenched with water and concentrated in vacuo to afford a brown powder which was purified by HPLC (water: acetonitrile gradient) to afford the title compound as an off-white powder (49 mg, 39%). MS (ESI) m/z 526.8. Example 270 to 272
The following compounds were prepare in a similar manner to Example 269 except using the appropriate benzylbromide-quinoline and phenol:
Example 270
3-benzyl-4-[3-({[l-(methylsulfonyl)-l,2,3,4-tetrahydroquinolin-5- yl] oxy} methyl)phenyl] -8-(trifluoromethyl)quinoline
MS (ESI) m/z 602.9.
Example 271
3-benzyl-4-[3-({[2-(methylsulfonyl)-l,2,3,4-tetrahydroisoquinolin-5- yl] oxy} methyl)phenyl] -8-(trifluoromethyl)quinoline
MS (ESI) m/z 602.8.
Example 272
3-methyl-4-[3-({[2-(methylsulfonyl)-l,2,3,4-tetrahydroisoquinolin-5- yl] oxy} methyl)phenyl] -8-(trifluoromethyl)quinoline
MS (ESI) m/z 526.8
Example 273 3-(2-methoxy-2-oxoethylthio)phenylboronic acid
A mixture of 3-mecraptophenylboronic acid (0.50 g, 3.2 mmol), methyl bromoacetate (1.5 g, 10 mmol), and potassium carbonate (5.0 g, 37 mmol) in 15 mL of DMF was heated at
45 0C overnight. The reaction was poured into water and extracted with ethyl acetate. The extracts were dried over MgSO4 and concentrated. The crude material was used for the next reaction without any further purification. Example 274 Methyl 2-(3'-(3-cyano-8-(trifluoromethyl)quinolin-4-yl)biphenyl-3-ylthio)acetate
The title compound was prepared as described in Example 259 using 3-(2-methoxy-2- oxoethylthio)phenylboronic acid and 3-[3-cyano-8-(trifluoromethyl)quinolin-4-yl]phenyl trifluoromethanesulfonate.
Example 275 ({S'-P-cyano-S-^rifluoromethylJquinolin^-yllbiphenyl-S-ylJsulfonylJacetic acid
A mixture of methyl 2-(3'-(3-cyano-8-(trifluoromethyl)quinolm-4-yl)biphenyl-3- ylthio)acetate (25 mg, 0.05 mmol), acetic acid (5 mL), 30% H2O2 was heated at 50 0C for 3 h. The mixture was poured into water and extracted with n-BuOH. The solvent was removed to give the title compound as a white solid (10 mg, 37%). MS (ES) m/z 497.0.
Example 276 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carboxamide
A mixture of 4- {3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline- 3-carboxylic acid (100 mg, 0.205 mmol) and N,N-carbonyldiimidazole (85 mg, 0.053 mmol) in DMF (5 mL) was heated at 60 0C for 1 h. The mixture was cooled and THF (10 mL) and concentrated NH4OH (15 mL) were added. The reaction was stirred overnight at room temperature and purified by HPLC to provide the title compound as a white solid (64 mg). MS (ES) m/z 486.9.
Examples 277 to 278
The following compounds were prepared in a similar manner to that described in Example 276.
Example 277 iV-methyl-4- {3- [3-(methylsulfonyl)phenoxy] phenyl}-8- (trifluoromethyl)quinoline-3-carboxamide
MS (ES) m/z 501.1.
Example 278
Λ'-ethyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline- 3-carboxamide
MS (ES) m/z 515.2.
Example 279
3-methyl-4- [3 '-(methylsulfonyl)biphenyl-3-yl] -8-(trifluoromethyl)quinoline
4-(3-Bromo-phenyl)-3-methyl-8-trifluoromethyl-quinoline (0.050 g, 0.14 mmol) in toluene (3 mL) and ethanol (0.5 mL) was treated with 3-(methanesulfonyl)benzeneboronic acid (0.30 mmol), 2 M aqueous Na2CO3 (0.25 mL, 0.50 mmol), and Pd(PPh3)4 (9 mg, 0.0075 mmol). The reaction was heated at 90 0C for 8 h. The solvent was removed and the residue chromatographed using 10:90 ethyl acetate:hexane obtain 0.051 g of the title compound.
MS(ES) m/z 441.8.
Examples 280 to 288
The following compounds were prepared in a similar manner to that described in Example 279 using the appropriate halogenated arylsulfone and quinoline aryl bromide or borolane, and using an appropriate base chosen from Na2CO3, K2CO3, or Cs2CO3 and an appropriate solvent including toluene:ethanol mixtures and DMF.
Example 280
3-benzyl-4- [3 '-(methylsulfonyl)biphenyl-3-yl] -8-(trifluoromethyl)quinoline
MS (ESI) m/z 518.
Example 281 4- [3 '-(methylsulfonyl)biphenyl-3-yl] -8-(trifhioromethyl)quinoline
MS (ES) m/z 427.8.
Example 282 3-ethyl-4- [3 '-(methylsulfonyl)biphenyl-3-yl] -8-(trifluoromethyl)quinoline
MS (ES) m/z 455.8.
Example 283
3 '- [3-methyl-8-(trifluoromethyl)quinolin-4-yl] biphenyl-3-sulfonamide MS (ES) m/z 442.8.
Example 284
4- [3 '-(methylsulfonyl)biphenyl-3-yl] -3-propyl-8-(trifluoromethyl)quinoline
Example 285
3-isopropyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
Example 286
3-chloro-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
Example 287
4-[3-(2-chloro-pyrimidin-4-yl)-phenyl]-3-methyl-8-trifluoromethyl-quinoline MS (ES) m/z 400.0.
Example 288
4-[3-(6-chloro-pyrimidin-4-yl)-phenyl]-3-methyl-8-trifluoromethyl-quinoline
MS (ES) m/z 400.0.
Alternatively, compounds of formula I can be prepared by converting an aryl bromide into the borolane, followed by coupling with an appropriately halogen substituted aryl or heteroaryl unit. Example 289
3-methyl-4-[3-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)phenyl]-8- (trifluoromethyl)quinoline
4-(3-Bromophenyl)-3-methyl-8-(trifluoromethyl)quinoline (3.45 g, 9.40 mmol), bis(pinacolato)diboron (2.87 g, 11.3 mmol) and potassium acetate (2.9 g (30 mmol) were stirred in toluene (70 mL) under a nitrogen atmosphere. Pd(PPh3 )4 was added and the reaction heated at 90 0C for 8 h. The reaction mixture was partitioned between ethyl acetate and water. The organic layer was washed with brine dried and concentrated in vacuo and the residue chromatographed to provide the title compound as a white solid (2.30 g, 58%). MS (ESI) m/z 414.
Example 290 3'-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-Λf-(2-hydroxy-2- methylpropyl)biphenyl-3-sulfonamide
3-Methyl-4-[3-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)phenyl]-8- (trifluoromethyl)quinoline (0.10 g, 0.20 mmol) was dissolved in DMF (3 mL) and treated with 3-bromo-N-(2-hydroxy-2-methylpropyl)-benzenesulfonamide (0.25 mmol), CS2CO3 (0.20 g, 0.60 mmol) and Pd(PPh3)4 (0.012 g, 0.01 mmol). The reaction was heated at 100 0C for 12 h. The solvent was removed and the residue purified by chromatography eluting with 20:80 ethyl acetate:hexane to afford the title compound as a tan solid (0.017 g). MS (ES) m/z 590.8.
Examples 291 to 365
The following compounds were prepared in a similar manner to that described above using the appropriate halogenated arylsulfone and quinoline aryl boronic acid or boronic ester.
Example 291
3'-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-Λ'-(2-hydroxyethyl)biphenyl-3- sulfonamide
MS (ES) m/z 562.8.
Example 292
3-benzyl-4- [3 '-(morpholin-4-ylsulfonyl)biphenyl-3-yl] -8- (trifluoromethyl)quinoline
MS (ES) m/z 588.8.
Example 293
3'-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-Λ'-(2-hydroxyethyl)-Λ'- methylbiphenyl-3-sulfonamide
MS (ES) m/z 576.8.
Example 294
3-benzyl-4-[3'-chloro-4'-(propylsulfonyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline
MS (ES) m/z 579.9.
Example 295
3-benzyl-4-[3'-chloro-4'-(isopropylsulfonyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline
MS (ES) m/z 579.9.
Example 296
3-benzyl-4-[3'-chloro-4'-(isobutylsulfonyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline
MS (ES) m/z 593.9.
Example 297 3-benzyl-4-{3'-chloro-4'-[(3-methylbutyl)sulfonyl]biphenyl-3-yl}-8- (trifluoromethyl)quinoline
MS (ES) m/z 608.0.
Example 298
3-benzyl-4-[3'-chloro-4'-(ethylsulfonyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline
MS (ES) m/z 565.9.
Example 299
4- [4'-(allylsulfonyl)-3 '-chlorobiphenyl-3-yl] -3-benzyl-8- (trifluoromethyl)quinoline
MS (ES) m/z 578.0.
Example 300
3-({3'-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-3-chlorobiphenyl-4- yl}sulfonyl)propan-l-ol
MS (ES) m/z 595.9.
Example 301
3-benzyl-4-[3'-(propylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 546.0.
Example 302 3-benzyl-4- [3 '-(isopropylsulfonyl)biphenyl-3-yl] -8-(trifhioromethyl)quinoline
MS (ES) m/z 546.0.
Example 303
3-benzyl-4- [3 '-(isobutylsulfonyl)biphenyl-3-yl] -8-(trifluoromethyl)quinoline MS (ES) m/z 560.1.
Example 304
3-benzyl-4-{3'-[(3-methylbutyl)sulfonyl]biphenyl-3-yl}-8- (trifluoromethyl)quinoline MS (ES) m/z 574.1. Example 305
3-benzyl-4- [3 '-(ethylsulfonyl)biphenyl-3-yl] -8-(trifluoromethyl)quinoline
MS (ES) m/z 532.0. Example 306 4-[3'-(allylsulfonyl)biphenyl-3-yl]-3-benzyl-8-(trifluoromethyl)quinoline
MS (ES) m/z 544.0.
Example 307
3-({3'-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propan- l-ol
MS (ES) m/z 562.0.
Example 308
3-benzyl-4-{3-[5-(methylsulfonyl)pyridin-3-yl]phenyl}-8- (trifluoromethyl)quinoline
MS (ES) m/z 518.9.
Example 309
3-benzyl-4-[4'-(pyrrolidin-l-ylsulfonyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline
MS (ES) m/z 572.9.
Example 310
3-benzyl-4-[3'-(pyrrolidin-l-ylsulfonyl)-5'-(trifluoromethyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline
MS (ES) m/z 641.0.
Example 311
4-[3'-(allylsulfonyl)-5'-(trifluoromethyl)biphenyl-3-yl]-3-benzyl-8- (trifluoromethyl)quinoline
MS (ES) m/z 611.9.
Example 312
3-benzyl-4-[3'-(isobutylsulfonyl)-5'-(trifluoromethyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline
MS (ES) m/z 627.9. Example 313
3-benzyl-4-[3'-(propylsulfonyl)-5'-(trifluoromethyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline MS (ES) m/z 613.9.
Example 314
3-benzyl-4- [3 '- [(3-methylbutyl)sulfonyl] -5'-(trifluoromethyl)biphenyl-3-yl] -8- (trifluoromethyl)quinoline MS (ES) m/z 641.9.
Example 315
3-{[3'-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-5-(trifluoromethyl)biphenyl-3- yl]sulfonyl}propan-l-ol MS (ES) m/z 629.9.
Example 316
3-benzyl-4-[3'-(isopropylsulfonyl)-5'-(trifluoromethyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline MS (ES) m/z 613.9.
Example 317
4- [3 '-(ethylsulfonyl)biphenyl-3-yl] -3-methyl-8-(trifluoromethyl)quinoline MS (ES) m/z 455.8.
Example 318
3-methyl-4- [3 '-(propylsulfonyl)biphenyl-3-yl] -8-(trifluoromethyl)quinoline
MS (ES) m/z 469.8.
Example 319
3-({3 '- [3-methyl-8-(trifluoromethyl)quinolin-4-yl] biphenyl-3-yl} sulfonyl)propan- l-ol
MS (ES) m/z 485.8.
Example 320 4- [3 '-chloro-4'-(methylsulfonyl)biphenyl-3-yl] -3-methyl-8- (trifluoromethyl)quinoline
MS (ES) m/z 475.7.
Example 321
4- [3 '-chloro-4'-(ethylsulfonyl)biphenyl-3-yl] -3-methyl-8- (trifluoromethyl)quinoline
MS (ES) m/z 489.7.
Example 322
4- [3 '-chloro-4'-(propylsulfonyl)biphenyl-3-yl] -3-methyl-8- (trifluoromethyl)quinoline
MS (ES) m/z 503.7.
Example 323
3-({3-chloro-3 '- [3-methyl-8-(trifluoromethyl)quinolin-4-yl] biphenyl-4- yl}sulfonyl)propan-l-ol
MS (ES) m/z 519.7.
Example 324
3-methyl-4-{3-[5-(methylsulfonyl)pyridin-3-yl]phenyl}-8- (trifluoromethyl)quinoline
MS (ES) m/z 442.8.
Example 325
3-methyl-4-[4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 441.8.
Example 326 4-{3-[5-(ethylsulfonyl)pyridin-3-yl]phenyl}-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 456.8.
Example 327 4- [4'-(allylsulfonyl)-3 '-chlorobiphenyl-3-yl] -3-methyl-8-
(trifluoromethyl)quinoline MS (ES) m/z 501.7.
Example 328 3-benzyl-4-[4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline MS (ES) m/z 517.7.
Example 329
3-benzyl-4-{3-[5-(ethylsulfonyl)pyridin-3-yl]phenyl}-8- (trifluoromethyl)quinoline MS (ES) m/z 532.7.
Example 330
3-benzyl-4-[3'-chloro-4'-(methylsulfonyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline MS (ES) m/z 551.7.
Example 331
3-methyl-4-{3'-[(l£')-prop-l-en-l-ylsulfonyl]biphenyl-3-yl}-8- (trifluoromethyl)quinoline MS (ES) m/z 465.7.
Example 332 4-[3'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 441.7.
Example 333 4-[3'-(propylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 455.7.
Example 334
4-{3'-[(l£)-prop-l-en-l-ylsulfonyl]biphenyl-3-yl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 453.7.
Example 335 3-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propan-l-ol
MS (ES) m/z 471.7. Example 336 4-[3'-chloro-4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 461.6.
Example 337 4-[3'-chloro-4'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 475.6.
Example 338
4-[3'-chloro-4'-(propylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 489.6.
Example 339 4-{3'-chloro-4'-[(l£)-prop-l-en-l-ylsulfonyl]biphenyl-3-yl}-8-
(trifluoromethyl)quinoline
MS (ES) m/z 487.6.
Example 340 3-({3-chloro-3 '- [8-(trifluoromethyl)quinolin-4-yl] biphenyl-4-yl} sulfonyl)propan- l-ol
MS (ES) m/z 505.6.
Example 341 4-{3-[5-(methylsulfonyl)pyridin-3-yl]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 428.7.
Example 342 4-[4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline MS (ES) m/z 427.7.
Example 343 4-{3-[5-(ethylsulfonyl)-l-oxidopyridin-3-yl]phenyl}-8-(trifluoromethyl)quinoline
MS (ESI) m/z 459.
Example 344 4-{3-[5-(ethylsulfonyl)pyridin-3-yl]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 442.9.
Example 345 N-methyl-3 M3-methyl-8-(trifluoromethyl)quinolin-4-yl] biphenyl-3-sulfonamide
MS (ES) m/z 456.9.
Example 346 Λ'-ethyl-3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide MS (ES) m/z 470.9.
Example 347
3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]-Λ'-propylbiphenyl-3-sulfonamide
MS (ES) m/z 484.9.
Example 348
N-isopropyl^ '- [3-methyl-8-(trifluoromethyl)quinolin-4-yl] biphenyl-3- sulfonamide
MS (ES) m/z 484.9.
Example 349
3-methyl-4-[3'-(pyrrolidin-l-ylsulfonyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline
MS (ES) m/z 496.8.
Example 350
Λ/-methyl-3'-[8-(trifhioromethyl)quinolin-4-yl] biphenyl-3-sulfonamide
MS (ES) m/z 442.8.
Example 351
Λ'-ethyl-3'-[8-(trifluoromethyl)quinolin-4-yl] biphenyl-3-sulfonamide
MS (ES) m/z 456.8.
Example 352 Λ'-propyl-3'-[8-(trifluoromethyl)quinolin-4-yl] biphenyl-3-sulfonamide
MS (ES) m/z 470.8. Example 353
Λ'-isopropyl-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide MS (ES) m/z 470.9.
Example 354
4-[3'-(pyrrolidin-l-ylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline MS (ES) m/z 482.8.
Example 355
4-[4'-methyl-3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 442.1.
Example 356 4-[3'-(ethylsulfonyl)-4'-methylbiphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 456.1.
Example 357
4-[4'-(methylsulfonyl)-2'-(trifluoromethyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline
MS (ES) m/z 496.1.
Example 358
4-[4'-(ethylsulfonyl)-2'-(trifluoromethyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline
MS (ES) m/z 510.2.
Example 359
3-methyl-4-[4'-methyl-3'-(methylsulfonyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline
MS (ES) m/z 456.1.
Example 360
3-methyl-4-[4'-(methylsulfonyl)-2'-(trifluoromethyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline
MS (ES) m/z 510.1. Example 361
4-[4'-(ethylsulfonyl)-2'-(trifluoromethyl)biphenyl-3-yl]-3-methyl-8- (trifluoromethyl)quinoline MS (ES) m/z 524.2.
Oxidation of sulfides (Oxone® Method)
Where the quinoline described above has a sulfide, the sulfur can be oxidized to a sulfone using Oxone® as is described in the literature, and in Example 35 above for the preparation of halogenated arylsulfones from thiophenols.
Example 362
3-benzyl-4-[3-(l,l-dioxido-l-benzothien-4-yl)phenyl]-8- (trifluoromethyl)quinoline
MS (ES) m/z 528.0.
Example 363
3-methyl-4-{3-[2-(methylsulfonyl)pyrimidin-4-yl]phenyl}-8 (trifluoromethyl)- quinoline
MS (ES) m/z 444.1.
Example 364
4-[3-(l,l-dioxido-l-benzothien-3-yl)phenyl]-3-methyl-8- (trifluoromethyl)quinoline
MS (ES) m/z 451.8.
Example 365
4-[3-(6-Methanesulfonyl-pyrimidin-4-yl)-phenyl]-3-methyl-8-trifluoromethyl- quinoline
MS (ES) m/z 444.1.
Example 366 3-Benzyl-4-(3-ethynylphenyl)-8-(trifluoromethyl)-quinoline A solution of 3-benzyl-4-(3-bromo-phenyl)-8-trifluoromethyl-quinoline (1.02 g, 2.3 mmol) and trimethyl-tributylstannanylethynyl-silane (1.30 g, 3.4 mmol) in toluene (25 mL) was treated with Pd(PPh3)4 (270 mg) and heated at 120 0C for 3 h. The reaction was then cooled and concentrated in vacuo. The residue was chromatographed with 10:90 ethyl acetate:hexane to afford 3-benzyl-8-trifluoromethyl-4-(3-trimethylsilanylethynyl-phenyl)- quinoline as an oil. MS (ESI) m/z 460.0.
A solution of this oil, 3-benzyl-8-trifluoromethyl-4-(3-trimethylsilanylethynyl- phenyl)-quinoline (730 mg, 1.6 mmol) and potassium carbonate (220 mg, 1.6 mmol) in methanol (30 mL) was stirred at ambient temperature for 3 h. The reaction mixture was concentrated to dryness and the residue taken up in ethyl acetate and washed with 30 mL (IN HCl). The organic layer was dried and concentrated in vacuo to provide after chromatography the title compound (870 mg, 80%). MS (ESI) m/z 388.
Example 367
3-benzyl-4-(3-{[5-(methylsulfonyl)pyridin-3-yl]ethynyl}phenyl)-8- (trifluoromethyl)quinoline
A solution of 3-benzyl-4-(3-ethynyl-phenyl)-8-trifluoromethyl-quinoline (80 mg, 0.20 mmol), 3-bromopyridinemethylsulfone 93 mg, 0.40 mmol), piperidine (80 mg, 0.90 mmol) in toluene (2.0 mL) was treated with Pd(Cl)2(PPh3)2 (8.0 mg) and heated at 90 0C for 3 h. The reaction was then cooled and concentrated in vacuo. The residue was taken up in ethyl acetate and washed with IN aqueous HCl (10 mL). The organic layer was dried and concentrated in vacuo to provide after chromatography the title compound (75 mg, 70%). MS (ES) m/z 542.9.
Examples 368 to 370
The following compounds were prepared in a similar manner to that described in Examples 366 and 367 using the appropriate halogenated aryl or heteroaryl and quinoline acetylene.
Example 368
3-benzyl-4-(3-{[4-(pyrrolidin-l-ylsulfonyl)phenyl]ethynyl}phenyl)-8- (trifluoromethyl)quinoline
MS (ES) m/z 597.0.
Example 369
3-benzyl-4-(3-{[3-(pyrrolidin-l-ylsulfonyl)phenyl]ethynyl}phenyl)-8- (trifluoromethyl)quinoline
MS (ES) m/z 597.0.
Example 370
3-benzyl-4-(3-{[3-(pyrrolidin-l-ylsulfonyl)-5- (trifluoromethyl)phenyl]ethynyl}phenyl)-8-(trifluoromethyl)quinoline
MS (ES) m/z 665.0.
Example 371
6-Fluoro-2,3-dihydro-benzo[b]thiophene 1,1-dioxide
A mixture of l-(bromomethyl)-4-fluoro-2-(methanesulfonyl)benzene (0.250 g, 0.94 mmol) and sodium hydride (0.042 g, 1.1 mmol) in DMF (10 mL) was stirred at 20 0C for 6 h.
The reaction was poured into water and extracted with ethyl acetate. The extracts were dried with brine and then MgSO4, filtered, and concentrated in vacuo. The combined organic phases were concentrated and the residue was chromatographed with 1:9 ethyl acetate:hexanes to afford the title compound as a white solid (0.090 g, 52%). mp 119-121 0C. Calculated mass for C8H7FO2S is 186.21; found (ES, [M+H]+), 186.9.
Example 372
4-{3-[(l,l-dioxido-2,3-dihydro-l-benzothien-6-yl)oxy]phenyl}-8- (trifluoromethyl)quinoline
3-[8-(Trifluoromethyl)-quinolin-4-yl]-phenol (0.070 g, 0.244 mmol), 6-fluoro-2,3- dihydro-benzo[b]thiophene 1,1 -dioxide (0.091 g, 0.488 mmol) and K2CO3 (0.070 g, 0.488 mmol) were combined in DMF (5 mL) and heated at 150 0C for 2 d. The reaction was cooled, filtered and purified by HPLC to afford the title compound as a white foamy solid (0.040 g, 36%). mp 161-163 0C; calculated mass for C24H16F3NO3S is 455.47; found (ES, [M+H]+), 455.7.
Example 373
3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-N-(2-hydroxypropyl)benzamide
A stirred mixture of 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-benzoic acid (0.102 g, 0.249 mmol), 2-amino-l-propanol (0.093 g, 1.2 mmol), EDCI, (0.238 g, 1.23 mmol), and 4-dimethylaminopyridine (0.083 g, 0.49 mmol) was heated in acetonitrile (70 mL) at reflux for 3 h. The reaction was cooled, filtered, and concentrated in vacuo. The combined organic phases were concentrated and the residue chromatographed using 1 :8 ethyl acetate :hexane to afford the title compound as a clear tacky solid (0.021 g, 18%). Calculated mass for C27H23F3O2N2 is 464.49; found (ES, [M+H]+), 465.2
Examples 374 to 375
The following compounds were prepared in a similar manner to that described in Example 373 using the appropriate aminoalcohol and quinoline. Example 374
3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-N-(2-hydroxy-2- phenylethyl)benzamide mp 95-97; MS (ES) m/z 525.2.
Example 375
3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N-(3- hydroxypropyl)benzamide mp 122-1247; MS (ES) m/z 556.8.
Example 376
3-benzyl-4-{3-[3-(5-methyl-4,5-dihydro-l,3-oxazol-2-yl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline
3-(3-Benzyl-8-(trifluoromethyl)quinolin-4-yl)-N-(2-hydroxyethyl)benzamide (0.100 g, 0.179 mmol) and Burgess Reagent (0.086 g, 0.359 mmol) was taken into THF (5 mL) and heated at 75 0C for 2 hours. The reaction was cooled, filtered and the solvent is removed in vacuo. The residue was chromatographed with 1 :9 ethyl acetate:hexanes to afford the title compound as a clear tacky solid (0.070 g, 71%). Calculated mass for C33H27F3N2O3 is 538.56; found (ES, [M+H]+), 539.2.
Example 377 to 381
The following compounds were prepared in a manner similar to that described in Example 376 starting from the appropriate quino lines.
Example 377
3-benzyl-4-{3-[3-(4,5-dihydro-l,3-oxazol-2-yl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline tan syrup; MS (ES) m/z 525.2. Example 378
3-benzyl-4-{3-[3-(5-phenyl-4,5-dihydro-l,3-oxazol-2-yl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline mp 98- 100 0C; MS (ES) m/z 601.2.
Example 379
3-benzyl-4-{3-[3-(4-methyl-4,5-dihydro-l,3-oxazol-2-yl)phenoxy]phenyl}-8- trifhioromethyl)quinoline yellow tacky solid; MS (ES) m/z 539.2.
Example 380
3-benzyl-4-{3-[3-(4,4-dimethyl-4,5-dihydro-l,3-oxazol-2-yl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline mp 65-67 0C; MS (ES) m/z 553.2.
Example 381
3-benzyl-4-{3-[3-(5,6-dihydro-4H-l,3-oxazin-2-yl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline tan syrup; MS (ES) m/z 539.
Example 382
3-benzyl-4-{3-[3-(4,5-dihydro-lH-imidazol-2-yl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline Methyl 3-(3-(3-benzyl-8-(trifluoromethyl)quinolin-4-yl)phenoxy)benzoate (0.100 g,
0.179 mmol), ethylenediamine (0.060 g, 0.97 mmol), and 2.0 M trimethylaluminum in toluene (0.49 ml, 0.97 mmol) was taken into toluene (3 mL) and heated at reflux for 1.5 h. The reaction was cooled, poured into 2 N HCl and extracted with dichloromethane. The organic layers were washed with brine and dried over MgSO4, filtered and the solvent removed in vacuo. The residue was purified by chromatography eluting with 1 :9 ethyl acetate:hexanes to afford the title compound as a white solid (0.081 g, 81%). mp 110-112 0C; calculated mass for C32H24F3N3O is 523.56; found (ES, [M+H]+), 524.2.
Examples 383 to 387
The following compounds were prepared in a similar manner to that described in Example 382 using the appropriate quinoline and diamine.
Example 383
4-{3-[3-(lH-benzimidazol-2-yl)phenoxy]phenyl}-3-benzyl-8- (trifluoromethyl)quinoline mp 65-67 0C; MS (ES) m/z 572.2.
Example 384
3-benzyl-4-{3-[3-(4-methyl-4,5-dihydro-lH-imidazol-2-yl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline yellow tacky solid; MS (ES) m/z 537.9.
Example 385
3-benzyl-4-{3-[3-(l-methyl-4,5-dihydro-lH-imidazol-2-yl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline creamy colored tacky solid; MS (ES) m/z 537.9.
Example 386
3-benzyl-4-{3-[3-(l,4,5,6-tetrahydropyrimidin-2-yl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline creamy colored tacky solid; MS (ES) m/z 537.8.
Example 387
3-benzyl-4- {3- [3-(l-methyl-l ,4,5,6-tetrahydropyrimidin-2-yl)phenoxy] phenyl} -8- (trifluoromethyl)quinoline mp 137-139 0C; MS (ES) m/z 552. Example 388
3-benzyl-4- [3-(3-methyl-l ,2,4-oxadiazol-5-yl)phenyl] -8- (trifluoromethyl)quinoline
3-(3-Benzyl-8-trifluoromethyl-quinolin-4-yl)-benzoic acid methyl ester (0.100 g, 0.237 mmol), N'-hydroxyacetimidamide (0.0090 g, 0.119 mmol), and 60% sodium hydride in oil (7.0 mg, 0.131 mmol) was taken into THF (3 mL) and heated at reflux overnight. The reaction was cooled, poured into water and extracted with ethyl acetate. The organic layers were dried with brine and MgSO4, filtered and the solvent was removed in vacuo. The residue was loaded onto silica gel diskette and chromatographed with a Biotage Horizon in hexanes:ethyl acetate (9:1) to afford 0.038 g (71%) of oxadiazole as a tan tacky solid. Calculated mass for C26IS4F3N3O is 445.44; found (ES, [M+H]+), 445.8.
Examples 389-391
The following compounds were prepared in a similar manner to that described in Example 388 using the appropriate quinoline and amino-oxime.
Example 389 3-benzyl-4-{3-[3-(4-fluorophenyl)-l,2,4-oxadiazol-5-yl]phenyl}-8-
(trifluoromethyl)quinoline mp 111-113 0C; MS (ES) m/z 525.8.
Example 390 2-(5-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}-l,2,4-oxadiazol-3- yl)acetamide mp 91-93 0C; MS (ES) m/z 489.
Example 391 3-benzyl-4-[3-(3-phenyl-l,2,4-oxadiazol-5-yl)phenyl]-8- (trifluoromethyl)quinoline clear tacky syrup; MS (ES) m/z 508.0.
Example 392
(2-amino-3-bromophenyl)(3-hydroxyphenyl)methanone
To a stirred mixture of 1 M BCl3 in p-xylenes (39.0 mL, 39.0 mmol) in 1- chlorobenzene (50 mL) cooled to 0 0C under nitrogen was added 2-bromoaniline (10.32 g, 60.0 mmol) in chlorobenzene (50 mL) over 5 min. Additional chlorobenzene (50 mL) was added and, after 10 min, 3-methoxybenzonitrile (3.66 mL, 30.0 mmol) and AlCl3 (5.21 g, 39.0 mmol) were added and the reaction heated at 90 0C for 3 h, then at 130 0C for 20 h. The reaction was cooled, ice (50 g) and 2M hydrochloric acid (50 mL) were added and the reaction was heated at 70-80 0C for 0.5 to 1 h. After cooling, the reaction was diluted with water (50 mL) and extracted with dichloromethane (100 mL, 50 mL). The combined extracts were dried over MgSO4, and concentrated in vacuo. The residue was chromatographed using a 10/90 to 50/50 ethyl acetate/hexane gradient to afford the title compound as a yellow solid (3.10 g).
Example 393 3-(8-bromo-3-methylquinolin-4-yl)phenol
A stirred solution of (2-amino-3-bromophenyl)(3-hydroxyphenyl)methanone (3.06 g, 10.0 mmol) and propionaldehyde diethylacetal (4.90 mL, 30 mmol) in acetic acid (30 mL) was treated with concentrated H2SO4 (20 pipet drops, about 0.5 mL) and heated at 110 0C for 24 h. The reaction was cooled, concentrated in vacuo to remove most of the acetic acid. The residue was treated with aqueous saturated NaHCO3 (100 mL) and extracted with dichloromethane (2 x 100 mL). The extracts were dried over MgSO4 and concentrated in vacuo. Chromatography eluting with a gradient of 10:90 to 30:70 ethyl acetate :hexane afforded the title compound as a yellow solid (1.90 g). MS (ES) m/z 314.0; HRMS: calcd for Ci6H12BrNO + H+, 314.01750; found (ESI, [M+H]+), 314.0174.
Example 394
8-bromo-3-methyl-4- {3- [3-(methylsulfonyl)phenoxy] phenyl} quinoline
This compound was prepared using essentially the same method described in Example 43 starting with 3-(8-bromo-3-methylquinolin-4-yl)phenol. MS (ES) m/z 468.0; HRMS: calcd for C23H18BrNO3S + H+, 468.02635; found (ESI, [M+H]+), 468.025. Example 395
3-methyl-8-(methylsulfonyl)-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
This compound was prepared using essentially the same method described in Example 43 starting with 8-bromo-3-methyl-4- {3-[3- (methylsulfonyl)phenoxy]phenyl}quinoline. HRMS: calcd for C24H21NO5S2 + H+,
468.09339; found (ESI, [M+H]+), 468.0928.
Example 396
3-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
A mixture of 8-bromo-3-methyl-4- {3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline (230 mg, 0.50 mmol), ammonium formate (252 mg, 2.00 mmol), and 10% palladium on carbon (50 mg) in methanol (10 mL) was heated at 60 0C for 3 h. The reaction was cooled, filtered, and concentrated in vacuo to a solid. The residue was treated with saturated aqueous NaHCθ3 (10 mL), extracted with dichloromethane (2 x 10 mL), and the extracts concentrated in vacuo. The residue was chromatographed eluting with a gradient of 50/50 to 100/0 ethyl acetate/hexane to provide the title compound as a slightly yellow solid (152 mg, 80%).
HRMS: calcd for C23H19NO3S + H+, 390.11584; found (ESI, [M+H]+), 390.1176.
Example 397
The following compounds were prepared in a manner similar to that described in one or more of Examples 1-396.
A. 4-[3'-(ethylsulfonyl)-4'-methylbiphenyl-3-yl]-3-methyl-8- (trifluoromethyl)quinoline
MS (ES) m/z 470.2;
B. 4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline-3-carbonitrile
MS (ES) m/z 503.1;
C. S-chloro^-JS-P^methylsulfonylJphenoxylphenylJquinoline-S-carbonitrile
MS (ES) m/z 435.1; HRMS: calcd for C23H15ClN2O3S + H+, 435.05647; found (ESI, [M+H]+), 435.0553;
Dl. 4- {3- [3-(methylsulfonyl)phenoxy] phenyl} quinoline-3-carboxamide MS (ES) m/z 419.1; HRMS: calcd for C23H18N2O4S + H+, 419.10600; found (ESI,
[M+H]+), 419.1044; D2. 4-[4'-bromo-3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 506.0;
E. 4-[4'-bromo-3'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 520.0;
F. 4-[2',5'-difluoro-4'-(methylsulfonyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline MS (ES) m/z 464.1;
G. 4-[4'-(ethylsulfonyl)-2',5'-difluorobiphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 478.1;
H. 4-[2',4'-difluoro-5'-(methylsulfonyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline
MS (ES) m/z 464.1;
I. 4-[5'-(ethylsulfonyl)-2',4'-difluorobiphenyl-3-yl]-8-(trifluoromethyl)quinoline MS (ES) m/z 478.1;
J. 2-methyl-4- [(3-{3- [8-(trifluoromethyl)quinolin-4- yl] phenoxy}phenyl)sulfonyl] butan-2-ol mp 77-79 0C; MS (ES) m/z 516.2;
K. 4-{3-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carboxamide
MS (ES) m/z 487.1;
L. 4-{3-[2-fhioro-4-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline-3-carboxamide
MS (ES) m/z 505.0;
M. 4-{3-[4-chloro-3-(methylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline mp 100- 102 0C; MS (ES) m/z 478.0; HRMS: calcd for C23H15ClF3NO3S + H+, 478.04860; found (ESI, [M+H]+), 478.0479;
N. 4-[4'-bromo-3Hethylsulfonyl)biphenyl-3-yl]-3-methyl-8- (trifluoromethyl)quinoline
MS (ES) m/z 533.9;
O. 4-[2',5'-difluoro-4'-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8- (trifluoromethyl)quinoline MS (ES) m/z 478.0;
P. 4-[4'-(ethylsulfonyl)-2',5'-difluorobiphenyl-3-yl]-3-methyl-8- (trifluoromethyl)quinoline
MS (ES) m/z 492.0;
Q. 4-[2',4'-difluoro-5'-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8- (trifluoromethyl)quinoline
MS (ES) m/z 478.0;
R. 4-[5'-(ethylsulfonyl)-2',4'-difluorobiphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 492.0;
S. 4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline-3-carboxamide
MS (ES) m/z 505.0;
T. 4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline-3-carboxamide MS (ES) m/z 521.0;
U. 3-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile
MS (ES) m/z 415.1 ; HRMS: calcd for C24H18N2O3S + H+, 415.1 1 109; found (ESI, [M+H]+), 415.1 1 10; V. 4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carboxamide
MS (ES) m/z 515.1;
W. 4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3- carboxylic acid
MS (ES) m/z 472.0;
X. Ethyl 4- [3 '-(methylsulfonyl)biphenyl-3-yl] -8-(trifluoromethyl)quinoline-3- carboxylate
MS (ES) m/z 500.0;
Y. 4- [3 '-(methylsulfonyl)biphenyl-3-yl] -8-(trifhioromethyl)quinoline-3- carboxamide MS (ES) m/z 471.0;
Z. 4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carboxamide
MS (ES) m/z 515.0;
AA. 4-[4'-bromo-3'-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8- (trifluoromethyl)quinoline
MS (ES) m/z 520.0;
AB. 4-[3'-(isopropylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3- carbonitrile
MS (ES) m/z 481.1; HRMS: calcd for C26H19F3N2O2S + H+, 481.11921; found (ESI- FTMS, [M+H]l+), 481.12001;
AC. Ethyl 8-fluoro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3- carboxylate
MS (ES) m/z 466.1; HRMS: calcd for C25H20FNO5S + H+, 466.11190; found (ESI- FTMS, [M+H]l+), 466.11303;
AD. 8-fluoro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide MS (ES) m/z 437.0; HRMS: calcd for C23H17FN2O4S + H+, 437.09658; found (ESI- FTMS, [M+H] l+), 437;
AE. 8-chloro-4-{3- [3-(methylsulfonyl)phenoxy] phenyl} quinoline mp 1 17- 1 19 0C; MS (ES) m/z 410.0;
AF. 4-[4'-methoxy-3'-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8- (trifluoromethyl)quinoline
MS (ES) m/z 472.1;
AG. 4-[4'-methoxy-3'-(methylsulfonyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline
MS (ES) m/z 458.1;
AH. 3-({4-methyl-3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3- yl}sulfonyl)propan-l-ol
MS (ES) m/z 500.2;
AL 3-({4-methyl-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3- yl}sulfonyl)propan-l-ol
MS (ES) m/z 486.1 ;
AJ. 8-chloro-4- {3- [3-(methylsulfonyl)phenoxy] phenyl} quinoline-3-carboxamide
MS (ES) m/z 453.0; HRMS: calcd for C23H17ClN2O4S - H+, 451.05248; found (ESI, [M-H]-), 451.0526;
AK. 8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxylic acid
MS (ES) m/z 454.1 ; HRMS: calcd for C23H16ClNO5S + H+, 454.05105; found (ESI, [M+H]+), 454.0517;
AL. 3-({4-chloro-3 '- [3-methyl-8-(trifluoromethyl)quinolin-4-yl] biphenyl-3- yl}sulfonyl)propan-l-ol
MS (ES) m/z 520.1 ; AM. 4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carboxamide
MS (ES) m/z 501.1 ;
AN. 4- [3 '-(ethylsulfonyl)biphenyl-3-yl] -8-(trifluoromethyl)quinoline-3- carboxamide
MS (ES) m/z 484.9;
AO. 3-({4-bromo-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3- yl}sulfonyl)propan-l-ol
MS (ES) m/z 550.0;
AP. 4-{3'-[(dimethylamino)sulfonyl]biphenyl-3-yl}-8-(trifluoromethyl)quinoline- 3-carboxamide MS (ES) m/z 499.9;
AQ. 8-chloro-4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}quinoline
MS (ES) m/z 423.9; HRMS: calcd for C23H18ClNO3S + H+, 424.07687; found (ESI, [M+H]+), 424.0772;
AR. 8-chloro-4-{3-[3-(propylsulfonyl)phenoxy]phenyl}quinoline
MS (ES) m/z 437.9; HRMS: calcd for C24H20ClNO3S + H+, 438.09252; found (ESI, [M+H]+), 438.0933;
AS. 3-({4-chloro-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3- yl}sulfonyl)propan-l-ol
MS (ES) m/z 505.8;
AT. 4-[3'-(isopropylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline MS (ES) m/z 455.9;
AU. 8-chloro-4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}quinoline
MS (ES) m/z 437.9;
HRMS: calcd for C24H20ClNO3S + H+, 438.09252; found (ESI, [M+H]+), 438.0935; AV. 4- [3 '-(aminosulfonyl)biphenyl-3-yl] -8-(trifluoromethyl)quinoline-3- carboxamide
MS (ES) m/z 471.9;
AW. 2-methyl-4-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3- yl} sulfonyl)butan-2-ol
MS (ES) m/z 499.9;
AX. 2-methyl-4-({3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3- yl} sulfonyl)butan-2-ol
MS (ES) m/z 513.9;
AY. 8-cyano-4- {3- [3-(methylsulfonyl)phenoxy] phenyl} quinoline-3-carboxamide
HRMS: calcd for C24H17N3O4S + H+, 444.10125; found (ESI, [M+H]+), 444.101;
AZ. 4-(3-{3-[(dimethylamino)sulfonyl]phenoxy}phenyl)-8- (trifluoromethyl)quinoline-3-carboxamide
MS (ES) m/z 515.9; and
AAA. 4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
MS (ES) m/z 478.0.
Example 398
R1 , R2 = H, Me, Et, iPr
A. 3-[(3-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]propan- 1-amine
Step 1 : A mixture of 3-fluorothiophenol (1.28 g, 10 mmol), N-(3- bromopropyl)phthalimide (2.68 g, 10 mmol), and cesium carbonate (6.52 g, 20 mmol) in DMF (20 mL) was stirred at room temperature for 2 h. The reaction mixture was quenched with water and extracted with ethyl acetate. The combined organic layers were dried and concentracted to give 2-{3-[(3-fluorophenyl)thio]propyl}-lH-isoindole-l,3(2H)-dione as a white solid (3.0 g, 95%) . MS (ES) m/z 316.0. Step 2: H2O2 (30 mL, 50% in water) was added to 2- {3-[(3- fluorophenyl)thio]propyl}-lH-isoindole-l,3(2H)-dione (2.9 g, 9.2 mmol) in acetic acid (30 mL) at room temperature. The mixture was heated at 60 0C for 2 hours and poured into water. The solid was collected and dried to give 2-{3-[(3-fluorophenyl)sulfonyl]propyl}-lH- isoindole-l,3(2H)-dione (2.5 g, 78 %) as a white solid. MS (ES) m/z 348.0. Step 3: A mixture of 2-{3-[(3-fluorophenyl)sulfonyl]propyl}-lH-isoindole-l,3(2H)- dione (0.69 g, 2 mmol), 3-(8-(trifluoromethyl)quinolin-4-yl)phenol (0.29 g, 1 mmol), potassium carbonate (3.29 g, 23.8 mmol) in 10 mL DMF was heated overnight at 140 0C . The mixture was poured into water and extracted with ethyl acetate. The combined organic was purified by silica gel chromatography (ethyl acetate/hexanes) to give 2- {3-[(3-{3-[8- (trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]propyl}-lH-isoindole-l,3(2H)-dione
(0.31 g, 50%) as a white solid. MS (ES) m/z 616.9; ΗRMS: calcd for C33H23F3N2O5S + H+, 617.13525; found (ESI, [M+H]+), 617.1353.
Step 4: 2-{3-[(3-{3-[8-(Trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propyl}-lH-isoindole-l,3(2H)-dione (0.1 g, 0.16 mmol) was dissolved in ethanol (15 mL) and 2 mL of hydrazine was added. The solution was refluxed for 2 h and the solvent was removed. The residue was purified via reverse phase ΗPLC (AcCN/water) to elute out 25 mg (32%) of the title compound as a gummy solid. MS (ES) m/z 487.0; ΗRMS: calcd for C25H21F3N2O3S + H+, 487.12977; found (ESI, [M+H]+), 487.1299.
B. N-methyl-3-(3-(3-(8-(trifluoromethyl)quinolin-4- yl)phenoxy)phenylsulfonyl)propan-l-amine
Step 1 : At room temperature under a nitrogen atmosphere methanesulfonyl chloride (46 mg, 0.399 mmol) was added to a stirred solution of 3-[(3-{3-[8-(trifluoromethyl)quinolm- 4-yl]phenoxy}phenyl)sulfonyl]propan-l-ol (162 mg, 0.333 mmol) and pyridine (34 mg, 0.432 mmol) in CH2Cl2 (2.5 mL). After 30 min the reaction mixture was quenched with water (0.5 ml), extraction, separation and concentration in vacuo to a brown syrup. Purification of this same syrup was done by RP-HPLC (acetonitrile: water) afforded 3-(3-(3-(8- (trifluoromethyl)quinolin-4-yl)phenoxy)phenylsulfonyl)propyl methanesulfonate as a light brown powder (138 mg, 73% yield). MS (ES) m/z 566.0. Step 2: To a vial containing a magnetic stir bar was placed 3-(3-(3-(8- (trifluoromethyl)quinolin-4-yl)phenoxy)phenylsulfonyl)propyl methanesulfonate (55 mg, 0.11 mmol) and methylamine 7N in EtOH (5 ml) and THF (5 ml). The vial was capped and heated at 45°C for 15 h. The resulting yellow solution was concentrated in vacuo to a yellow syrup. This same syrup was purified by RP-HPLC resulted in the title compound as a light brown powder 27.7 mg (47% yield). MS (ES) m/z 501.0.
Example 399
The following compounds were prepared in a manner similar to that described in Example 398B
A. 3-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan-l-amine
MS (ES) m/z 500.9; HRMS: calcd for C26H23F3N2O3S + H+, 501.14542; found (ESI, [M+H]+), 501.1456;
B. N-methyl-3-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan-l-amine
MS (ES) m/z 514.9; HRMS: calcd for C27H25F3N2O3S + H+, 515.16107; found (ESI, [M+H]+), 515.1611;
C. N-ethyl-3-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan-l-amine
MS (ES) m/z 528.9; HRMS: calcd for C28H27F3N2O3S + H+, 529.17672; found (ESI, [M+H]+), 529.1771;
D. Λ'-isopropyl-3-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan-l-amine
MS (ES) m/z 542.9; HRMS: calcd for C29H29F3N2O3S + H+, 543.19237; found (ESI, [M+H]+), 543.1925;
E. Λ^-ethyl-3- [(3- {3- [8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan-l-amine
MS (ES) m/z 515.1; and F. N-isopropyl-3-(3-(3-(8-(trifluoromethyl)quinolin-4- yl)phenoxy)phenylsulfonyl)propan-l-amine
MS (ES) m/z 528.9.
Example 400
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline Step 1 : 4-(2-chloro-5-methoxyphenyl)-8-(trifluoromethyl)quinoline
A stream of nitrogen gas was bubbled through a mixture of 4-chloro-8- (trifluoromethyl)quinoline (347 mg, 1.5 mmol), 2-chloro-5-methoxyphenylboronic acid (355 mg, 1.88 mmol), 2M aqueous Na2CO3 (3 mL, 6 mmol) in dimethoxyethane (6 mL) for 10 min. Tetrakis-triphenylphosphine palladium (175 mg, 0.15 mmol) was added and the mixture was stirred at 85 0C for 3 h. The suspension was cooled and poured into a mixture of ethyl acetate (60 mL) and aqueous NaHCO3. The layers were separated and the organic layer was further washed with aqueous NaHCO3 (10 mL), water (10 mL), and brine (20 mL). The organic layer was dried with Na24 and concentrated in vacuo. The residue was purified by SiO2 chromatography using a gradient of 0: 100 to 20:80 E:H to afford an off-white gummy solid. HRMS: calcd for Ci7H11ClF3NO + H+, 338.05540; found (ESI, [M+H]+ Obs'd), 338.0562.
Step 2: 4-chloro-3-[8-(trifluoromethyl)quinolin-4-yl] phenol To the 4-(2-chloro-5-methoxyphenyl)-8-(trifluoromethyl)quinoline obtained in step 1 was added pyridine hydrochloride (4 g) and the mixture was heated to 200 0C, during which it became a homogenous solution. After 1.5 h, the reaction was poured into water (40 mL) and ethyl acetate (60 mL) and the layers were separated. The organic layer was further washed with 5% aqueous citric acid (3 x 10 mL), saturated aqueous NaHCO3 (10 mL), and brine (20 mL). The organic layer was dried with Na2SO4 and concentrated in vacuo. The residue was purified by SiO2 chromatography using a gradient of 0: 100 to 30:70 E:H to afford 4-chloro-3- [8-(trifluoromethyl)quinolin-4-yl]phenol as a white foamy solid. MS (ES) m/z 324.1; HRMS: calcd for C16H9ClF3NO + H+, 324.03975; found (ESI, [M+H]+), 324.0406.
Step 3: 4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8 (trifluoromethyl)quinoline
A mixture of 4-chloro-3-[8-(trifluoromethyl)quinolin-4-yl]phenol (80 mg, 0.25 mmol), K2CO3 (69 mg, 0.5 mmol), and l-fluoro-3-(methylsulfonyl)benzene (64 mg, 0.37 mmol) in DMF (3 mL) was heated at 150 C for 24 h. The reaction was cooled and diluted with EtOAc (50 mL) and water (10 mL). The layers were separated and the organic layer was washed water (4 x 10 mL), and brine (20 mL). The organic layer was dried with Na2SO4 and concentrated in vacuo. The residue was purified by SiO2 chromatography eluting with a gradient of 0:100 to 25:75 E:H. The residual material was further purified by C18 reverse- phase chromatography using a gradient of 5:95 to 100:0 acetonitrile:H2O to afford 4-{2- chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline as a white foamy solid. MS (ES) m/z 478.0. HRMS: calcd for C23H15ClF3NO3S + H+, 478.04860; found (ESI, [M+H]+), 478.0488.
Example 401
The following compounds were prepared in a manner similar to that described in Example 400, step 3.
A. 3-[(3-{4-chloro-3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan-l-ol Prepared as in Example 400, step 3, except using 4-chloro-3-[8-
(trifluoromethyl)quinolin-4-yl]phenol and 3-[(3-fluorophenyl)sulfonyl]propan-l-ol as the reactants to afford the title compound as a white solid. MS (ES) m/z 522.0; HRMS: calcd for C25H19ClF3NO4S + H+, 522.07482; found (ESI, [M+H]+), 522.0748.
B. 4-{2-chloro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
Prepared as in Example 400, step 3, except using 4-chloro-3-[8-
(trifluoromethyl)quinolin-4-yl]phenol and 3-fluoro-l-(isopropylsulfonyl)benzene as the reactants to afford the title compound as a white foam. MS (ES) m/z 506.0; HRMS: calcd for C25H19ClF3NO3S + H+, 506.07990; found (ESI, [M+H]+), 506.0802.
C. 4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
Prepared as in Example 400, step 3, except using 4-chloro-3-[8-
(trifluoromethyl)quinolin-4-yl]phenol and l-(ethylsulfonyl)-3-fluorobenzene as the reactants to afford the title compound as a white foam. MS (ES) m/z 492.0; HRMS: calcd for
C24H17ClF3NO3S + H+, 492.06425; found (ESI, [M+H]+), 492.0645.
D. 4-{2-chloro-5-[4-(methylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline Prepared as in Example 400, step 3, except using 4-chloro-3-[8-
(trifluoromethyl)quinolin-4-yl]phenol and 4-fluoro- 1 -(methylsulfonyl)benzene as the reactants to afford the title compound as a white foam. MS (ES) m/z 478.0; HRMS: calcd for C23H15ClF3NO3S + H+, 478.04860; found (ESI, [M+H]+), 478.0487.
Example 402
4-{2-chloro-5-[4-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline 4-chloro-3-[8-(trifluoromethyl)quinolin-4-yl]phenol (107 mg, 0.33 mmol), Cs2CO3 (215 mg, 0.66 mmol), and 4-(ethylsulfonyl)- 1 -fluorobenzene (94 mg, 0.5 mmol) in dimethylacetamide (3 mL) was heated at 120 C for 16 h. The reaction was cooled and diluted with EtOAc (50 mL) and water (10 mL). The layers were separated and the organic layer was washed with water (4 x 10 mL) and brine (20 mL). The organic layer was dried with Na2SO4 and concentrated in vacuo. The residue was purified by SiO2 chromatography eluting with a gradient of 0: 100 to 25:75 E:H. The residual material was further purified by C18 reverse-phase chromatography using a gradient of 5:95 to 100:0 acetonitrile:H2O to afford the title compound as a white foam. MS (ES) m/z 491.6; HRMS: calcd for C24H17ClF3NO3S + H+, 492.06425; found (ESI, [M+H]+), 492.0644.
Example 403
4-{2-chloro-5-[4-(isopropylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline Prepared as in Example 402, except using 4-chloro-3-[8-(trifluoromethyl)quinolin-4- yl]phenol and 4-fluoro- 1 -(isopropylsulfonyl)-benzene as the reactants to afford the title compound as a white foam. MS (ES) m/z 505.6; HRMS: calcd for C25H19ClF3NO3S + H+, 506.07990; found (ESI, [M+H]+), 506.0797.
Example 404 4-{5-[4-(ethylsulfonyl)phenoxy]-2-fluorophenyl}-8-(trifluoromethyl)quinoline
Step 1 : 4-(2-fluoro-5-methoxyphenyl)-8-(trifluoromethyl)quinoline
Prepared as in Example 400, step 1, except using 4-chloro-8-
(trifluoromethyl)quinoline and 2-fluoro-5-methoxyphenylboronic acid as the reactants to afford the title compound as a white foam. MS (ES) m/z 322.6; HRMS: calcd for C17H11F4NO + H+, 322.08495; found (ESI, [M+H]+), 322.0852.
Step 2: 4-fluoro-3-[8-(trifluoromethyl)quinolin-4-yl] phenol
Prepared as in Example 400, step 2, except using 4-(2-fluoro-5-methoxyphenyl)-8-
(trifluoromethyl)quinoline as the reactant to afford the title compound as a white foam. MS (ES) m/z 308.0; HRMS: calcd for C16H9F4NO + H+, 308.06930; found (ESI, [M+H]+
Obs'd), 308.0696.
Step 3: 4-{5-[4-(ethylsulfonyl)phenoxy]-2-fluorophenyl}-8- (trifluoromethyl)quinoline Prepared as in Example 402, except using 4-fluoro-3-[8-(trifluoromethyl)qumolin-4- yl]phenol and l-(ethylsulfonyl)-4-fluorobenzene as the reactants to afford the title compound as a white foam. MS (ES) m/z 475.7; HRMS: calcd for C24H17F4NO3S + H+, 476.09380; found (ESI, [M+H]+), 476.0938.
Example 405
4-{2-fhioro-5-[4-(isopropylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline
Prepared as in Example402, except using 4-fluoro-3-[8-(trifluoromethyl)quinolin-4-yl]phenol and 4-fluoro- 1 -(isopropylsulfonyl)-benzene as the reactants to afford the title compound as a white foam. MS (ES) m/z 489.7; HRMS: calcd for C25H19F4NO3S + H+, 490.10945; found (ESI, [M+H]+), 490.1094.
Example 406
4-{2-chloro-5-[2-fluoro-4-(methylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline
Prepared as in Example 402, except using 4-chloro-3-[8-(trifluoromethyl)quinolin-4- yl]phenol and 1 ,2-difluoro-4-(methylsulfonyl)benzene as the reactants to afford the title compound as a white foam. MS (ES) m/z 495.6; HRMS: calcd for C23H14ClF4NO3S + H+,
496.03918; found (ESI, [M+H]+ Obs'd), 496.0395.
Example 407
4-{5-[3-(ethylsulfonyl)phenoxy]-2-fluorophenyl}-8-(trifluoromethyl)quinoline
Prepared as in Example 402, except using 4-fluoro-3-[8-(trifluoromethyl)quinolin-4-yl]phenol and l-(ethylsulfonyl)-3-fluorobenzene as the reactants to afford the title compound as a white foam. MS (ES) m/z 475.7; HRMS: calcd for C24H17F4NO3S + H+, 476.09380; found (ESI, [M+H]+ Obs'd), 476.0943.
Example 408
4-{2-fluoro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline Prepared as in Example 402, except using 4-fluoro-3-[8-(trifluoromethyl)quinolin-4-yl]phenol and 3-fluoro-l-(methylsulfonyl)-benzene as the reactants to afford the title compound as a white foam. MS (ES) m/z 461.6; HRMS: calcd for C23H15F4NO3S + H+, 462.07815; found (ESI, [M+H]+), 462.0779.
Example 409 4-{2-fluoro-5- [3-fluoro-5-(methylsulfonyl)phenoxy] phenyl}-8-
(trifluoromethyl)quinoline
Prepared as in Example 402, except using 4-fluoro-3-[8-(trifluoromethyl)quinolin-4-yl]phenol and l,3-difluoro-5-(methylsulfonyl)benzene as the reactants to afford the title compound as a white foam. MS (ES) m/z 479.6; HRMS: calcd for C23H14F5NO3S + H+, 480.06873; found (ESI, [M+H]+), 480.0685.
Example 410
4-{2-chloro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline
Prepared as in Example 402, except using 4-chloro-3-[8-(trifluoromethyl)quinolin-4- yl]phenol and l,3-difluoro-5-(methylsulfonyl)benzene as the reactants to afford the title compound as a white foam. MS (ES) m/z 495.6; HRMS: calcd for C23H14ClF4NO3S + H+, 496.03918; found (ESI, [M+H]+), 496.0389.
Example 411
3-[(4-{4-chloro-3-[8-(trifhioromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan-l-ol
Prepared as in Example 402, except using 4-chloro-3-[8-(trifluoromethyl)quinolin-4- yl]phenol and 3-[(4-fluorophenyl)sulfonyl]propan-l-ol as the reactants to afford the title compound as a white foam. MS (ES) m/z 521.6; HRMS: calcd for C25H19ClF3NO4S + H+,
522.07482; found (ESI, [M+H]+), 522.0748.
Example 412
4-{2-fluoro-5-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
Prepared as in Example 402, except using 4-fluoro-3-[8-(trifluoromethyl)quinolin-4-yl]phenol and 4-fluoro-l-(methylsulfonyl)-benzene as the reactants to afford the title compound as a white foam. MS (ES) m/z 461.6; HRMS: calcd for C23H15F4NO3S + H+, 462.07815; found (ESI, [M+H]+ Obs'd), 462.0783.
Example 413
4-{2-chloro-5- [2-chloro-4-(methylsulfonyl)phenoxy] phenyl}-8- (trifluoromethyl)quinoline
Prepared as in Example 400, step 3, except using 4-chloro-3-[8-(trifluoromethyl)qumolin-4- yl]phenol and 1 ,2-dichloro-4-(methylsulfonyl)benzene as the reactants in dimethylacetamide to afford the title compound as a white foam. MS (ES) m/z 511.9; HRMS: calcd for C23H14Cl2F3NO3S + H+, 512.00963; found (ESI, [M+H]+ Obs'd), 512.0099.
Example 414
[(4- {4-chloro-3- [8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]acetonitrile Prepared as in Example 400, step 3, except using 4-chloro-3-[8-(trifluoromethyl)qumolin-4- yl]phenol and 1 ,2-dichloro-4-(methylsulfbnyl)benzene as the reactants in dimethylacetamide to afford the title compound as a white foam. MS (ES) m/z 503.0; HRMS: calcd for C24H14ClF3N2O3S + H+, 503.04385; found (ESI, [M+H]+ Obs'd), 503.0443.
Example 415
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline Step 1 : 2,2-dimethyl-5-[(E)-{[2-(methylsulfonyl)phenyl]imino}methyl]-l,3- dioxane-4,6-dione
A mixture of 2,2-dimethyl-l,3-dioxane-4,6-dione (1.59 g, 11.0 mmol) and trimethyl orthoformate (10 mL) was heated for 2 h at 105 0C. The mixture was cooled to 90 0C and 2- (methylsulfonyl)aniline (1.71 g, 10.0 mmol) in DMF (10 mL) was added. The mixture was heated for 3 h at 125 0C, and then was slowly poured into ice-water (200 mL). The precipitate was collected, washed with water, and dried under high vacuum, giving the title compound as an off-white powder. MS (ES) m/z 323.7, HRMS: calcd for Ci4H15NO6S + NH4 +, 343.09583; found (ESI, [M+NH4]+ Obs'd), 343.0960.
Step 2: 4-chloro-8-(methylsulfonyl)quinoline
2,2-Dimethyl-5-[(E)-{[2-(methylsulfonyl)phenyl]imino}methyl]-l,3-dioxane-4,6- dione (1.20 g, 3.7 mmol) was heated in Dowtherm A (5 mL) for 4 h at 260 0C (gas evolution).
The mixture was allowed to cool to ambient temperature resulting in a precipitate. The reaction was diluted with diethyl ether (50 mL). The brown solid was collected, washed with ether, and dried under vacuum. The solid was heated in phosphorous oxychloride (5 mL) at 90 0C for 2 h. The mixture was carefully pouring into a stirred mixture of ice-water (100 mL) and EtOAc (75 mL). The mixture was carefully neutralized with solid potassium carbonate and the layers were separated. The organic layer was washed with 2M aqueous Na2CO3, water (50 mL), and brine (50 mL). After drying over Na2SO4 and evaporation of the solvent, the resulting material was purified by SiO2 chromatography using a 2:98 to 30:70 E:H gradient, yielding the title compound as an off-white solid. MS (ES) m/z 241.7; HRMS: calcd for CI0H8CINO2S + H+, 242.00370; found (ESI, [M+H]+ Obs'd), 242.0040.
Step 3: 3-[8-(methylsulfonyl)quinolin-4-yl]phenol Prepared as in Example 400, step 1, except using 4-chloro-8-
(methylsulfonyl)quinoline and 3-hydroxyphenylboronic acid as the reactants to afford the title compound as a white foam. MS (ES) m/z 299.9; HRMS: calcd for Ci6H13NO3S + H+, 300.06889; found (ESI, [M+H]+ Obs'd), 300.0695.
Step 4: 4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8- (methylsulfonyl)quinoline
Prepared as in Example 402, except using 3-[8-(methylsulfonyl)quinolin-4-yl]phenol and l,3-difluoro-5-(methylsulfonyl)benzene as the reactants in dimethylacetamide to afford the title compound as a white foam. MS (ES) m/z 471.6; HRMS: calcd for C23H18FNO5S2 + H+, 472.06832; found (ESI, [M+H]+ Obs'd), 472.0684.
Example 416
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline Prepared as in Example 402, except using 3-[8-(methylsulfonyl)quinolin-4-yl]phenol and 1- (ethylsulfonyl)-3-fluorobenzene as the reactants in dimethylacetamide to afford the title compound as a white foam. MS (ES) m/z 467.9; HRMS: calcd for C24H21NO5S2 + H+, 468.09339; found (ESI, [M+H]+ Obs'd), 468.0938;
Example 417 4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline
Prepared as in Example 402, except using 3-[8-(methylsulfonyl)quinolin-4-yl]phenol and 3- fluoro- 1 -(isopropylsulfonyl)-benzene as the reactants in dimethylacetamide to afford the title compound as a white foam. MS (ES) m/z 481.9; HRMS: calcd for C25H23NO5S2 + H+, 482.10904; found (ESI, [M+H]+ Obs'd), 482.1091. Example 418
3-[(3-{3-[8-(methylsulfonyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]propan-l-ol
Prepared as in Example 402, except using 3-[8-(methylsulfonyl)quinolin-4-yl]phenol and 3- [(3-fluorophenyl)sulfonyl]propan-l-ol as the reactants in dimethylacetamide to afford the title compound as a white foam. MS (ES) m/z 497.9; HRMS: calcd for C25H23NO6S2 + H+,
498.10396; found (ESI, [M+H]+ Obs'd), 498.1045.
Example 419
4-{3-[4-(ethylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline
Prepared as in Example 402, except using 3-[8-(methylsulfonyl)quinolin-4-yl]phenol and 1- (ethylsulfonyl)-4-fluorobenzene as the reactants in dimethylacetamide to afford the title compound as a white foam. MS (ES) m/z 467.9; HRMS: calcd for C24H21NO5S2 + H+, 468.09339; found (ESI, [M+H]+ Obs'd), 468.0933.
Example 420
8-(methylsulfonyl)-4- {3- [4-(propylsulfonyl)phenoxy] phenyl} quinoline Prepared as in Example 402, except using 3-[8-(methylsulfonyl)quinolin-4-yl]phenol and 4- fluoro-l-(propylsulfonyl)-benzene as the reactants in dimethylacetamide to afford the title compound as a white foam. MS (ES) m/z 481.9; HRMS: calcd for C25H23NO5S2 + H+, 482.10904; found (ESI, [M+H]+ Obs'd), 482.1093.
Example 421 4-{3-[4-(isopropylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline
Prepared as in Example 402, except using 3-[8-(methylsulfonyl)quinolin-4-yl]phenol and 4- fluoro- 1 -(isopropylsulfonyl)-benzene as the reactants in dimethylacetamide to afford the title compound as a white foam. MS (ES) m/z 481.9; HRMS: calcd for C25H23NO5S2 + H+, 482.10904; found (ESI, [M+H]+ Obs'd), 482.1091.
Example 422
8-(methylsulfonyl)-4- {3- [3-(methylsulfonyl)phenoxy] phenyl} quinoline
Prepared as in Example 402, except using 3-[8-(methylsulfonyl)quinolin-4-yl]phenol and 3- fluoro- 1 -(methylsulfonyl)-benzene as the reactants in dimethylacetamide to afford the title compound as a white foam. MS (ES) m/z 453.6; HRMS: calcd for C23H19NO5S2 + H+, 454.07774; found (ESI, [M+H]+), 454.0781.
Example 423
8-(methylsulfonyl)-4- {3- [4-(methylsulfonyl)phenoxy] phenyl} quinoline Prepared as in Example 402, except using 3-[8-(methylsulfonyl)quinolin-4-yl]phenol and 4- fluoro- 1 -(methylsulfonyl)-benzene as the reactants in dimethylacetamide to afford the title compound as a white foam. MS (ES) m/z 453.6; HRMS: calcd for C23H19NO5S2 + H+, 454.07774; found (ESI, [M+H]+), 454.0782.
Example 424
4-{3-[2-fluoro-4-(methylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline
Prepared as in Example 402, except using 3-[8-(methylsulfonyl)quinolin-4-yl]phenol and 1,2- difluoro-4-(methylsulfonyl)benzene as the reactants in dimethylacetamide to afford the title compound as a white foam. MS (ES) m/z 471.6; HRMS: calcd for C23H18FNO5S2 + H+, 472.06832; found (ESI, [M+H]+), 472.0682.
Example 425 3-(methylsulfonyl)-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
Step 1 : 4-(3-methoxyphenyl)-3-(methylsulfonyl)-8-(trifluoromethyl)quinoline
A stirred mixture of [2-amino-3-(trifluoromethyl)phenyl](3-methoxyphenyl)methanone (147 mg, 0.50 mmol) and l,l-diethoxy-2-(methylsulfonyl)ethane (98 mg, 0.50 mmol) in glacial acetic acid (3.0 mL) was treated with one pipette drop of concentrated sulfuric acid and heated at 110 0C for 20 h. The cooled reaction was treated with NaHCO3 (5 g) in water (20 mL) and extracted with dichloromethane. The extracts were dried with MgSθ4 and concentrated in vacuo. The reside was purified by chromatography eluting with a 35:65 to 100:0 E:H gradient to afford the title compound as a white solid (122 mg, Rf ~ 0.15 in initial solvent system). MS (ES) m/z 382.1; HRMS: calcd for C18H14F3NO3S + H+, 382.07192; found (ESI, [M+H]+), 382.0719. Step 2 : 3- [3-(methylsulfonyl)-8-(trifluoromethyl)quinolin-4-yl] phenol
A mixture of 4-(3-methoxyphenyl)-3-(methylsulfonyl)-8-(trifluoromethyl)quinoline (1.18 g, 3.10 mmol) in pyridine hydrochloride (4.6 g) were heated at 200 0C for 2 h, then poured onto ice. The ice was allowed to melt and the mixture was extracted with dichloromethane (30 mL, 20 mL). The extracts were dried with MgSO4 and concentrated in vacuo. Chromatography eluting with a gradient of 20:80 to 50:50 E:H gave the title compound as a white solid (1.13 g, Rf - 0.35 in 50:50 E:H). MS (ES) m/z 368.1; HRMS: calcd for C17H12F3NO3S + H+, 368.05627; found (ESI, [M+H]+), 368.0567.
Step 3: 3-(methylsulfonyl)-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
A mixture of 3-[3-(methylsulfonyl)-8-(trifluoromethyl)quinolin-4-yl]phenol (183 mg, 0.50 mmol), 3-MeSO2PhB(OH)2 (150 g, 0.75 mmol), Cu(OAc)2 (91 mg), pyridine (0.12 mL, 1.5 mmol), and powdered 4A molecular sieves (0.50 g) in dichloromethane (10 mL) were stirred at ambient temperature, partly open to air, for 64 h. The green reaction was filtered through Celite, treated with water (15 mL), and extracted with dichloromethane. The extracts were dried over MgSO4 and concentrated in vacuo. The residue was chromatographed with a gradient of 50:50 to 100:0 E:H, and further purified by reverse phase chromatography to afford the title compound as a white solid (188 mg). MS (ES) m/z 521.8; HRMS: calcd for C24H18F3NO5S2 + H+, 522.06512; found (ESI, [M+H]+), 522.0652.
Examples 426 to 459
The following compounds in Examples 426 to 459 were prepared in a similar manner to the procedure of Example 43 except using the appropriate corresponding halogenated arylsulfone and quinoline phenol for the desired substitution pattern.
Example 426
3-(methylsulfonyl)-4- {3- [3-(propylsulfonyl)phenoxy] phenyl}-8- (trifluoromethyl)quinoline
Prepared as in Example 43 except using 3-[3-(methylsulfonyl)-8- (trifluoromethyl)quinolin-4-yl]phenol and 3-fluoro-l-(propylsulfonyl)-benzene as the reactants to afford the title compound as an off- white solid. MS (ES+) m/z 549.8 [M+H]+; HRMS: calcd for C26H22F3NO5S2 + H+, 550.09642; found (ESI, [M+H]+ Obs'd), 550.0955.
Example 427 4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-3-(methylsulfonyl)-8-
(trifluoromethyl)quinoline Prepared as in Example 43 except using 3-[3-(methylsulfonyl)-8-(trifluoromethyl)quinolm-4- yl]phenol and l-(isopropylsulfonyl)-3-fluorobenzene as the reactants to afford the title compound as a white solid. MS (ES+) m/z 549.8 [M+H]+; HRMS: calcd for C26H22F3NO5S2 + H+, 550.09642; found (ESI, [M+H]+ Obs'd), 550.0959.
Example 428
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-3-(methylsulfonyl)-8- (trifluoromethyl)quinoline
Prepared as in Example 43 except using 3-[3-(methylsulfonyl)-8-(trifluoromethyl)quinolin-4- yljphenol and 3,5-difluoro-l-(methylsulfonyl)benzene as the reactants to afford the title compound as a white solid. MS (ES+) m/z 539.8 [M+H]+; HRMS: calcd for C24H17F4NO5S2 + H+, 540.05570; found (ESI, [M+H]+ Obs'd), 540.0552.
Example 429 4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-3-(methylsulfonyl)-8-
(trifluoromethyl)quinoline
Prepared as in Example 43 except using 3-[3-(methylsulfonyl)-8-
(trifluoromethyl)quinolin-4-yl]phenol and 3-chloro-5-fluoro-l-(methylsulfonyl)benzene as the reactants to afford the title compound as a white solid. MS (ES+) m/z 555.8 [M+H]+; HRMS: calcd for C24H17ClF3NO5S2 + H+, 556.02615; found (ESI, [M+H]+ Obs'd), 556.0256.
Example 430
4-{3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-3-methyl-8- (trifluoromethyl)quinoline Prepared as in Example 43 except using 3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenol and 3,5-difluoro-l-(ethylsulfonyl)benzene as the reactants to afford the title compound as a white solid. MS (ES) m/z 489.8; HRMS: calcd for C25H19F4NO3S + H+, 490.10945; found (ESI, [M+H]+ Obs'd), 490.1094.
Example 431
8-chloro-3-isopropyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
Prepared as in Example 43 except using 3-isopropyl-8-chloro-quinolin-4-yl]phenol and 3- fluoro- 1 -(methylsulfonyl)benzene as the reactants to afford the title compound as a white solid. MS (ES) m/z 451.9; HRMS: calcd for C25H22ClNO3S + H+, 452.1082; found (ESI, [M+H]+ Obs'd), 452.1085. Example 432
3-methyl-8-(trifluoromethyl)-4-(3-{3-[(trifluoromethyl) sulfonyl]phenoxy}phenyl)quinoline
Step 1 : l-fluoro-3-trifluoromethanesulfonyl-benzene
A mixture of 3-fluorobenzene-l-sulfonyl chloride (5.0 g, 25.7 mmol), 18-crown-6 (0.170 g, 0.642 mmol), and potassium fluoride (7.46 g, 128 mmol) in acetonitrile (51 mL) was stirred for 4 h. Saturated aqueous NaHCθ3 (200 mL) was added and the mixture was extracted with ethyl acetate. The combined organics were washed with saturated aqueous
NaHCθ3 (200 mL), dried over MgSO4, and concentrated to afford the intermediate 3- fluorobenzenesulfonyl fluoride as a yellow oil (4.20 g, 92%) which was used without further purification in the next step. 3-Fluorobenzene-l-sulfonyl fluoride (4.20 g, 23.6 mmol) and tris(dimethylamino)sulfur(trimethylsilyl)difluoride (0.649 g, 2.36 mmol) in THF (24 mL) was treated drop wise with (trifluoromethyl)trimethylsilane (7.06 ml, 47.1 mmol) in THF (24 mL) over 0.25 h, under a N2 atmosphere, and the reaction was stirred overnight at room temperature. Water was added and the mixture extracted with ethyl acetate. The combined organic extracts were washed several times with water, then with half- saturated brine, dried over MgSO4 and concentrated. Purification by chromatography eluting with a gradient of 0: 100 to 20:80 E:H afforded the title compound as a yellow liquid (3.32 g, 62%).
Step 2: 3-methyl-8-(trifhioromethyl)-4-(3-{3- [(trifluoromethyl)sulfonyl]phenoxy}phenyl)quinoline
Prepared as in Example 43 except using 3-methyl-8-(trifluoromethyl)quinolm-4- yl]phenol and 3-fluoro-l-(trifluoromethylsulfonyl)benzene as the reactants, heating at 100 0C, to afford the title compound as a white solid. MS (ES+) m/z 511.7 [M+H]+; HRMS: calcd for C24H15F6NO3S + H+, 512.07496; found (ESI, [M+H]+ Obs'd), 512.0750.
Example 433 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3-amine Step 1 : 2-(4-(3-methoxyphenyl)-8-(trifluoromethyl)quinolin-3-yl)isoindoline- 1 ,3- dione
Prepared as in Example 24, step 1, except using (2-amino-3- (trifluoromethyl)phenyl)(3-methoxyphenyl)methanone and 2-(2,2-diethoxyethyl)isoindoline-
1,3-dione as the reactants to afford the title compound as a white solid. MS (ES+) m/z 449.1
[M+H]+.
Step 2: 4-(3-methoxyphenyl)-8-(trifluoromethyl)quinolin-3-amine Prepared as in Step 4 of Example 398 except using 2-(4-(3-methoxyphenyl)-8-
(trifluoromethyl)quinolin-3-yl)isoindoline-l,3-dione as the reactant to afford the title compound as a yellow solid. MS (ES) m/z 319.1.
Step 3: 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3- amine
After demethylation of the methoxy group from the above, the title compound was prepared from 2-(4-(3-hydroxyphenyl)-8-(trifluoromethyl)quinolin-3-yl)isoindoline- 1 ,3-dione in a manner similar to that described in Example 43. MS (ES) m/z 458.7; HRMS: calcd for C23H17F3N2O3S + H+, 459.09847; found (ESI, [M+H]+), 459.0985.
Example 434
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-fluoroquinoline
The title compound was prepared in a similar manner to that described for Example 43. MS (ES) m/z 427.6; HRMS: calcd for C22H15ClFNO3S + H+, 428.05179; found (ESI, [M+H]+ Obs'd), 428.0521.
Example 435 4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
The title compound was prepared in a similar manner to that described for Example 43. MS (ES) m/z 409.7; HRMS: calcd for C22H16ClNO3S + H+, 410.06122; found (ESI,
[M+H]+), 410.0618.
Example 436
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-fluoroquinoline-3- carboxylic acid The title compound was prepared in a similar manner to that described for Example 43.
MS (ES) m/z 471.6; HRMS: calcd for C23H15ClFNO5S + H+, 472.04163; found (ESI, [M+H]+), 472.0419.
Example 437
3-methyl-4-{l-[3-(methylsulfonyl)phenyl]-lH-pyrazol-4-yl}-8- (trifluoromethyl)quinoline
Step 1 : 3-methyl-4-(lH-pyrazol-4-yl)-8-(trifluoromethyl)quinoline The title compound was prepared in a similar manner to that described for Example
259. MS (ES) m/z 277.6; HRMS: calcd for Ci4H10F3N3 + H+, 278.08996; found (ESI, [M+H]+ Obs'd), 278.0903.
Step 2: 3-methyl-4-{l-[3-(methylsulfonyl)phenyl]-lH-pyrazol-4-yl}-8- (trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example 43. MS (ES) m/z 432.0; HRMS: calcd for C2IH16F3N3O2S + H+, 432.09881; found (ESI, [M+H]+ Obs'd), 432.0992.
Example 438
8-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxylic acid
The title compound was prepared in a similar manner to that described for Example 43. MS (ES) m/z 434.1; HRMS: calcd for C24H19NO5S + H+, 434.10567; found (ESI, [M+H]+ Obs'd), 434.1065.
Example 439
8-chloro-4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide Step 1 : ethyl 8-chloro-4-(3-hydroxyphenyl)quinoline-3-carboxylate A well-stirred mixture of ethyl 4-bromo-8-chloroquinoline-3-carboxylate (5.20 g, 16.6 mmol), 3-hydroxybenzene boronic acid (4.53 g, 33.1 mmol), sodium carbonate (6.85 g,
49.7 mmol), tetrakis(triphenylphosphine)palladium(0) (5.73 g, 4.97 mmol), toluene (160 mL), H2O (80 mL), and ethanol (40 mL) was heated at reflux for 4 h. The cooled reaction was treated with water (75 mL) and extracted several times with ethyl acetate. The combined extracts were washed with brine (25 mL), dried with MgSO4, filtered, and concentrated in vacuo to a brown syrup. Purification by chromatography afforded the title compound as a yellow powder (4.19 g, 77%). MS (ES) m/z 328.1; HRMS: calcd for Ci8H14ClNO3 + H+, 328.07350; found (ESI, [M+H]+), 328.0748.
Step 2 : 8-chloro-4- {3- [3-(ethylsulfonyl)phenoxy] phenyl} quinoline-3-carboxamide The title compound was prepared from ethyl 8-chloro-4-(3-hydroxyphenyl)quinoline-
3-carboxylate and l-(ethylsulfonyl)-3-fluorobenzene according to the procedure for Example 43. MS (ES) m/z 466.8.
Example 440 S-chloro^-JS-P-chloro-S^methylsulfonylJphenoxylphenylJquinoline-S- carboxamide
The title compound was prepared from ethyl 8-chloro-4-(3-hydroxyphenyl)quinoline- 3-carboxylate and l,3-dichloro-5-(methylsulfonyl)benzene according to the procedure for Example 43. MS (ES) m/z 486.6.
Example 441
8-fluoro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
Step 1 : 3-(8-Fluoroquinolin-4-yl)phenol
The title compound was prepared in a similar manner to that described for Example 259. MS (ES) m/z 237.8; HRMS: calcd for Ci5H10FNO + H+, 240.08192; found (ESI,
[M+H]+), 240.0818.
Step 2: 8-fluoro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline The title compound was prepared in a similar manner to that described for Example 43. MS (ES) m/z 393.6; HRMS: calcd for C22Hi6FNO3S + H+, 394.09077; found (ESI, [M+H]+ Obs'd), 394.0912.
Example 442 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-3-phenyl-8-(trifluoromethyl)quinoline Prepared as in Example 43 except using 3-[3-phenyl-8-(trifluoromethyl)quinolm-4- yl]phenol and 3-fluoro-l-(methylsulfonyl)-benzene as the reactants to afford the title compound as an clear syrup. MS (ES) m/z 520.0; HRMS: calcd for C29H20F3NO3S + H+, 520.11887; found (ESI, [M+H]+ Obs'd), 520.1190.
Example 443
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile Step 1 : 4-hydroxyquinoline-8-carbonitrile
Prepared as in Example 415, step 2, first part, except using 2-{[(2,2-dimethyl-4,6- dioxo-l,3-dioxan-5-ylidene)methyl]amino}benzonitrile as the reactant to afford the title compound as a tan solid. MS (ES) m/z 171.3.
Step 2: 4-bromoquinoline-8-carbonitrile
Prepared as in Example 415, step 2, second part, except using 4-hydroxyquinoline-8- carbonitrile and P(O)Br3 in DMF as the reactants to afford the title compound as a tan solid. MS (ES) m/z 232.8.
Step 3: 4-(3-hydroxyphenyl)quinoline-8-carbonitrile
A mixture of 4-bromoquinoline-8-carbonitrile (700 mg, 3.1 mmol), 3-hydroxyphenyl boronic acid (832 mg, 6.10 mmol), Pd(PPh3)4 (488 mg, 0.42 mmol), and K3PO4 (1.60 g, 7.5 mmol) in 1,4 dioxane (50 mL) were stirred at reflux for 3 h. The reaction was cooled, filtered into a separatory funnel with 100 mL of water and extracted with ethyl acetate. The extracts were dried over MgSO4 and concentrated in vacuo. The residue was chromatographed with a gradient of 10:90 to 50:50 E:H to afford the title compound as a yellow solid (600 mg). MS (ES) m/z 246.8.
Step 4: 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile
Prepared as in Example 43 except using 4-(3-hydroxyphenyl)quinoline-8-carbonitrile and l-fluoro-3-(methylsulfonyl)benzene as the reactants to afford the title compound as an off-white solid. MS (ES) m/z 400.7.
Example 444
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile
Prepared as in Example 43 except using 4-(3-hydroxyphenyl)quinoline-8-carbonitrile and l-(ethylsulfonyl)-3-fluorobenzene as the reactants to afford the title compound as an off- white solid. MS (ES) m/z 414.7.
Example 445
4-{3-[3-(propylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile Prepared as in Example 43 except using 4-(3-hydroxyphenyl)quinoline-8-carbonitrile and l-fluoro-3-(propylsulfonyl)benzene as the reactants to afford the title compound as an tan solid. MS (ES) m/z 428.8. Example 446 4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile
Prepared as in Example 43 except using 4-(3-hydroxyphenyl)quinoline-8-carbonitrile and l-fluoro-3-(isopropylsulfonyl)benzene as the reactants to afford the title compound as an off-white solid. MS (ES) m/z 428.8.
Example 447 4-{3-[3-(benzylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile
Prepared as in Example 43 except using 4-(3-hydroxyphenyl)quinoline-8-carbonitrile and l-(benzylsulfonyl)-3-fluorobenzene as the reactants to afford the title compound as a red solid. MS (ES) m/z 476.8.
Example 448 4-(3-{3-[(3-hydroxypropyl)sulfonyl]phenoxy}phenyl)quinoline-8-carbonitrile Prepared as in Example 43 except using 4-(3-hydroxyphenyl)quinoline-8-carbonitrile and 3-[(3-fluorophenyl)sulfonyl]propan-l-ol as the reactants to afford the title compound as an off-white solid. MS (ES) m/z 444.7.
Example 449 4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile
Prepared as in Example 43 except using 4-(3-hydroxyphenyl)quinoline-8-carbonitrile and l,3-difluoro-5-(methylsulfonyl)benzene as the reactants to afford the title compound as an off-white solid. MS (ES) m/z 418.7.
Example 450
4-{3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}quinoline-8-carbonitrile
Prepared as in Example 43 except using 4-(3-hydroxyphenyl)quinoline-8-carbonitrile and l,3-difluoro-5-(ethylsulfonyl)benzene as the reactants to afford the title compound as a light yellow solid. MS (ES) m/z 432.7.
Example 451
4-{3-[4-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile Prepared as in Example 43 except using 4-(3-hydroxyphenyl)quinoline-8-carbonitrile and l-fluoro-4-(methylsulfonyl)benzene as the reactants to afford the title compound as an off-white solid. MS (ES) m/z 400.7. Example 452 4-{3-[4-(ethylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile
Prepared as in Example 43 except using 4-(3-hydroxyphenyl)quinoline-8-carbonitrile and 4-(ethylsulfonyl)-l-fluorobenzene as the reactants to afford the title compound as an off- white solid; MS (ES) m/z 414.7.
Example 453
Step 1 : 4-(2-chloro-5-methoxyphenyl)quinoline-8-carbonitrile
Prepared as in Example 400, step 2, except using 4-bromoquinoline-8-carbonitrile and 2-chloro-5-(methoxyphenyl)boronic acid as the reactants to afford the title compound as an off-white solid.
Step 2: 4-(2-chloro-5-hydroxyphenyl)quinoline-8-carbonitrile Prepared as in Example 400, step 2, except using 4-(2-chloro-5- methoxyphenyl)quinoline-8-carbonitrile as the reactant to afford the title compound as an off- white solid. MS (ES) m/z 281.0; HRMS: calcd for Ci6H9ClN2O + H+, 281.04762; found (ESI, [M+H]+ Obs'd), 281.0482.
Step 3 : 4- {2-chloro-5- [3-(methylsulfonyl)phenoxy] phenyl} quinoline-8- carbonitrile
Prepared as in Example 43 except using 4-(2-chloro-5-hydroxyphenyl)quinoline-8- carbonitrile and l-fluoro-3-(methylsulfonyl)benzene as the reactants to afford the title compound as an off-white solid. MS (ES) m/z 434.9; HRMS: calcd for C23H15ClN2O3S + H+, 435.05647; found (ESI, [M+H]+ Obs'd), 435.0568.
Example 454
8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline Prepared as in Example 43 except using 3-(8-chloroquinolin-4-yl)phenol and 1- fluoro-3-(methylsulfonyl)benzene as the reactants to afford the title compound as an off-white solid. MS (ES) m/z 410.0; HRMS: calcd for C22H16ClNO3S + H+, 410.06122; found (ESI,
[M+H]+ Obs'd), 410.0615.
Example 455 8-chloro-4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}quinoline Prepared as in Example 43 except using 3-(8-chloroquinolin-4-yl)phenol and l-(ethylsulfonyl)-3-fluorobenzene as the reactants to afford the title compound as a white solid. MS (ES) m/z 423.9; HRMS: calcd for C23H18ClNO3S + H+, 424.07687; found (ESI, [M+H]+), 424.0772.
Example 456 8-chloro-4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
Step 1 : 4-bromo-8-chloroquinoline
Prepared as in Example 415, step 2 except using 8-chloro-quinolin-4-ol as the reactant and P(O)Br3 in DMF to afford the title compound as a tan solid. MS (ES) m/z 241.9; HRMS: calcd for C9H5BrClN + H+, 241.93666; found (ESI, [M+H]+ Obs'd), 241.9372.
Step 2: 8-chloro-4-(2-chloro-5-methoxyphenyl)quinoline
Prepared as in Example 415, step 3 above except using 4-bromo-8-chloroquinoline and (2-chloro-5-methoxyphenyl)boronic acid as the reactants to afford the title compound as an off-white solid. MS (ES) m/z 304.0; HRMS: calcd for Ci6H11Ci2NO + H+, 304.02904; found (ESI, [M+H]+ Obs'd), 304.0294.
Step 3: 4-chloro-3-(8-chloroquinolin-4-yl)phenol
Prepared as in Example 415, step 4 above except using 8-chloro-4-(2-chloro-5- methoxyphenyl)quinoline as the reactant to afford the title compound as an off-white solid. HRMS: calcd for Ci5H9Q2NO + H+, 290.01339; found (ESI, [M+H]+ Obs'd), 290.0141.
Step 4: 8-chloro-4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}quinoline Prepared as in Example 43 except using 4-chloro-3-(8-chloroquinolin-4-yl)phenol and 3-fluoro-l-(methylsulfonyl)benzene as the reactants to afford the title compound as an off-white solid. MS (ES) m/z 443.9; HRMS: calcd for C22Hi5Cl2NO3S + H+, 444.02224; found
(ESI, [M+H]+ Obs'd), 444.0226.
Example 457 8-chloro-4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}quinoline Prepared as in Example 43 except using 4-chloro-3-(8-chloroquinolin-4-yl)phenol and l-(ethylsulfonyl)-3-fluorobenzene as the reactants to afford the title compound as an off- white solid. MS (ES) m/z 458.1; HRMS: calcd for C23Hi7Cl2NO3S + H+, 458.03789; found (ESI, [M+H]+ Obs'd), 458.0386.
Example 458
8-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline Step 1 : 3-(8-methylquinolin-4-yl)phenol
Prepared as in Example 415, step 3, above except using 4-bromo-8-methylquinoline as the reactant to afford the title compound as a yellow solid. MS (ES) m/z 236.2; HRMS: calcd for C16H13NO + H+, 236.10699; found (ESI, [M+H]+ Obs'd), 236.1074.
Step 2 : 8-methyl-4- {3- [3-(methylsulfonyl)phenoxy] phenyl} quinoline Prepared as in Example 43 except using 3-(8-methylquinolin-4-yl)phenol and 3- fluoro- 1 -(methylsulfonyl)benzene as the reactants to afford the title compound as an off- white solid. MS (ES) m/z 390.1; HRMS: calcd for C23H19NO3S + H+, 390.11584; found (ESI, [M+H]+ Obs'd), 390.1165.
Example 459
8-methoxy-4- {3- [3-(methylsulfonyl)phenoxy] phenyl} quinoline
Step 1 : 3-(8-methoxyquinolin-4-yl)phenol Prepared as in Example 415, step 3, above except using 4-bromo-8-methoxyquinoline as the reactant to afford the title compound as a yellow solid. MS (ES) m/z 252.0; HRMS: calcd for C16H13NO2 + H+, 252.10190; found (ESI, [M+H]+ Obs'd), 252.1029.
Step 2 : 8-methoxy-4- {3- [3-(methylsulfonyl)phenoxy] phenyl} quinoline Prepared as in Example 43 except using 3-(8-methoxyquinolin-4-yl)phenol and 3- fluoro- 1 -(methylsulfonyl)benzene as the reactants to afford the title compound as an off- white solid. MS (ES) m/z 405.9; HRMS: calcd for C23H19NO4S + H+, 406.11076; found (ESI, [M+H]+ Obs'd), 406.1110.
In the preparation of primary and secondary sulfonamides (Rf = SO2Rn, and Rn =
NRsRh), the sulfonamide may be prepared as a 4-methoxybenzyl-protected compound. Treatment with trifluoroacetic acid (TFA) removes the 4-methoxybenzyl group, leaving a hydrogen.
Example 460
HCI
ΛyV-bis(4-methoxybenzyl)-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide
Step 1 : 3-bromo-N-(4-methoxybenzyl)benzenesulfonamide
A stirred mixture of 3-bromobenzenesulfonyl chloride (5.11 g, 20.0 mmol) and triethylamine (3.07 mL, 22.0 mmol) in dichloromethane (100 mL) was treated with 4- methoxybenzylamine (2.85 mL, 22.0 mmol) over 5 min. After 2 h at ambient temperature, the reaction was treated with saturated aqueous NaHCO3 (100 mL) and extracted with dichloromethane (2 x 50 mL). The combined extracts were dried (MgSO/t) and concentrated in vacuo to a solid. Chromatography eluting with a 30:70 to 50:50 E:H gradient affords the title compound as a white solid (6.18 g, Rf ~ 0.4 in 50:50 E:H). MS (ES-) m/z 353.6 [M-H]-+
Step 2: 3-bromo-N,N-bis(4-methoxybenzyl)benzenesulfonamide A solution of 3-bromo-N-(4-methoxybenzyl)benzenesulfonamide (3.56 g, 10.0 mmol) in DMF (20 mL) was treated with 60% NaH in oil (440 mg, 11.0 mmol). Gas evolved. After 20 min, 4-methoxybenzyl chloride (1.63 mL, 12.0 mmol) was added and the reaction was stirred at ambient temperature for 5 h. The reaction was poured into water (60 mL) resulting in a white precipitate. The precipitate was filtered off, washed with water, and dried in vacuo to afford the title compound as a white solid (4.92 g, Rf ~ 0.5 in E:H). MS (ES+) m/z 475 [M+H]+.
Step 3 : 7V,Λ'-bis(4-methoxybenzyl)-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide
A stirred mixture of 3-methyl-8-trifluoromethyl-4-(3-hydroxyphenyl)quinoline (303 mg, 1.00 mmol), 3-bromo-N,N-bis(4-methoxybenzyl)benzenesulfonamide (714 mg, 1.50 mmol), copper (I) iodide (40 mg, 0.20 mmol), N,N-dimethylglycine hydrochloride (53 mg, 0.38 mmol), cesium carbonate (977 mg, 3.00 mmol) in dioxane (20 mL) was heated at 100 0C for 18 h. The cooled reaction was treated with water (50 mL) and extracted with ethyl acetate (3 x 30 mL). The extracts were dried with MgSO/t, concentrated in vacuo, and chromatographed eluting with a gradient of 15:85 to 50:50 E:H to afford the title compound as a white solid (352 mg). MS (ES) m/z 699.0; HRMS: calcd for C39H33F3N2O5S + H+, 699.2135; found (ESI, [M+H]+ Obs'd), 699.2128.
Example 461
ΛyV-bis(4-methoxybenzyl)-3-{3-[8-(trifluoromethyl)quinolin-4- yl] phenoxyjbenzenesulfonamide
In the same manner as Example 460 but using 4-(3-hydroxyphenyl)-8- trifluoromethyl-quinoline and 3-bromo-N,N-bis(4-methoxybenzyl)benzenesulfonamide was prepared the title compound as a white solid. MS (ESI) m/z 685; HRMS: calcd for C38H31F3N2O5S + H+, 685.1979; found (ESI, [M+H]+ Obs'd), 685.1984.
Example 462
ΛyV-bis(4-methoxybenzyl)-4-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl] phenoxyjbenzenesulfonamide
Step 1 : 4-fluoro-N-(4-methoxybenzyl)benzenesulfonamide
The title compound was prepared by essentially the same procedure of Example 460, step 1, except starting with 4-fluorobenzenesulfonyl chloride in place of 3- bromobenzenesulfonyl chloride, isolating a white solid. MS (ESI) m/z 293.9 [M-H]-.
Step 2: 4-fluoro-N,N-bis(4-methoxybenzyl)benzenesulfonamide A solution of 4-fluoro-N-(4-methoxybenzyl)benzenesulfonamide (2.95 g, 10.0 mmol) in DMF (20 mL) was treated with 60% NaH in oil (440 mg, 11.0 mmol). Gas evolved. After 20 min, 4-methoxybenzyl chloride (1.63 mL, 12.0 mmol) was added and the reaction was stirred at ambient temperature for 5 h. The reaction was treated with water (60 mL) producing a white precipitate. The material was chromatographed using a 20:80 to 40:60 E:H gradient to afford the title compound as a white solid (3.08 g). MS (ES) m/z 415.
Step 3 : ΛyV-bis(4-methoxybenzyl)-4-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide
A stirred mixture of 3-methyl-8-trifluoromethyl-4-(3-hydroxyphenyl)quinoline (303 mg, 1.00 mmol), 4-fluoro-N,N-bis(4-methoxybenzyl)benzenesulfonamide (499 mg, 1.20 mmol), K2CO3 (276 mg, 2.00 mmol) in DMF (5.0 mL) was heated at 130 0C for 18 h. The cooled reaction was treated with water (20 mL) and brine (2 mL). The mixture was extracted with ethyl acetate (3 x 10 mL). The extracts were dried with MgSO4, concentrated in vacuo, and chromatographed eluting with a gradient of 15:85 to 40:60 E:H to afford the title compound as a white solid (582 mg). MS (ES) m/z 699.1; HRMS: calcd for C39H33F3N2O5S + H+, 699.21350; found (ESI, [M+H]+ Obs'd), 699.2129.
Example 463
ΛyV-bis(4-methoxybenzyl)-4-{3-[8-(trifluoromethyl)quinolin-4- yl] phenoxyjbenzenesulfonamide In the same manner as Example 462, step 3, but using 8-trifluoromethyl-4-(3- hydroxyphenyl)quinoline and 4-fluoro-N,N-bis(4-methoxybenzyl)benzenesulfonamide as substrates was prepared the title compound as an off-white solid. MS (ESI) m/z 685; HRMS: calcd for C38H31F3N2O5S + H+, 685.19785; found (ESI, [M+H]+ Obs'd), 685.1978.
Example 464
3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide
A mixture of N,N-bis(4-methoxybenzyl)-3- {3-[3-methyl-8-(trifluoromethyl)quinolin- 4-yl]phenoxy}benzenesulfonamide (302 mg, 0.43 mmol) in trifluoroacetic acid (4 mL) and CH2CI2 (4 mL) was stirred at ambient temperature under nitrogen for 18 h. The reaction was concentrated in vacuo, treated with saturated aqueous NaHCθ3 (10 mL) and extracted with CH2CI2 (2 x 5 mL). The dried (MgSO/t) extracts were chromatographed using a gradient of 20:80 to 50:50 E:H to afford the title compound as a white solid (199 mg). MS (ES) m/z 458.9; HRMS: calcd for C23H17F3N2O3S + H+, 459.09847; found (ESI, [M+H]+ Obs'd), 459.0987.
Example 465 4-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide In the same manner as Example 464 but using N,N-bis(4-methoxybenzyl)-3- {3-[8-
(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide as substrate was prepared the title compound as an off-white solid. MS (ES) m/z 444.9; HRMS: calcd for C22H15F3N2O3S + H+, 445.0828; found (ESI, [M+H]+ Obs'd), 445.0835.
Example 466
4-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide
In essentially the same manner as Example 464 but using N,N-bis(4-methoxybenzyl)- 4- {3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide as substrate was prepared the title compound as a white solid. MS (ES) m/z 458.9; HRMS: calcd for C23H17F3N2O3S + H+, 459.09847; found (ESI, [M+H]+ Obs'd), 459.0988.
Example 467 4-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide
In essentially the same manner as Example 464 but using N,N-bis(4-methoxybenzyl)- 4-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide as substrate was prepared the title compound as an off-white solid. MS (ES) m/z 444.6; HRMS: calcd for C22H15F3N2O3S + H+, 445.08282; found (ESI, [M+H]+ Obs'd), 445.0833.
Example 468 3-isopropyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
Step 1 : 3-isopropyl-4-(3-methoxyphenyl)-8-(trifluoromethyl)quinoline
In the same manner as Example 425, step 1, but using [2-amino-3-
(trifluoromethyl)phenyl](3-methoxyphenyl)methanone and 3-methylbutanal as substrates was prepared the title compound as an pale yellow solid. MS (ES) m/z 346.0; HRMS: calcd for C20H18F3NO + H+, 346.1413; found (ESI, [M+H]+ Obs'd), 346.1422.
Step 2: 3- [3-isopropyl-8-(trifluoromethyl)quinolin-4-yl] phenol
In the same manner as Example 425, step 2, but using 3-isopropyl-4-(3- methoxyphenyl)-8-(trifluoromethyl)quinoline as substrate was prepared the title compound as an off-white solid. MS (ES) m/z 332.1; HRMS: calcd for C19H16F3NO + H+, 332.1257; found (ESI, [M+H]+ Obs'd), 332.1266.
Step 3: 3-isopropyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline
In the same manner as Example 43 but using 3-[3-isopropyl-8-
(trifluoromethyl)quinolin-4-yl]phenol and l-fluoro-3-(methylsulfonyl)benzene as substrates was prepared the title compound. MS (ES) m/z 485.9.
Example 469
3-methyl-4-(3-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8- (trifluoromethyl)quinoline
In the same manner as Example 212, except using 3-methyl-4-(3-hydroxyphenyl)-8- (trifluoromethyl)quinoline and l-(bromomethyl)-3-(methylsulfonyl)benzene as substrates was prepared the title compound as a white solid. MS (ES) m/z 472.0; HRMS: calcd for
C25H20F3NO3S + H+, 472.1189; found (ESI, [M+H]+ Obs'd), 472.1191.
Example 470
3-methyl-4-(3-{[4-(methylsulfonyl)benzyl]oxy}phenyl)-8- (trifluoromethyl)quinoline
In the same manner as Example 212, except using 3-methyl-4-(3-hydroxyphenyl)-8- (trifluoromethyl)quinoline and l-(chloromethyl)-4-(methylsulfonyl)benzene as substrates was prepared the title compound as a white solid. MS (ES) m/z 472.0; HRMS: calcd for C25H20F3NO3S + H+, 472.1189; found (ESI, [M+H]+ Obs'd), 472.1192.
Examples 471 to 482
The following compounds in Examples 471 to 482 were prepared essentially according to the procedure of Example 259 except using the appropriate reactants for the desired substitution pattern.
Example 471
4-{5-[3-(ethylsulfonyl)phenyl]-2-thienyl}-3-methyl-8-(trifluoromethyl)quinoline The title compound was prepared in a similar manner to that described for Example 259. MS (ES) m/z 461.7; HRMS: calcd for C23H18F3NO2S2 + H+, 462.08038; found (ESI, [M+H]+), 462.0800.
Example 472
4-{5-[3-(ethylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example 259. MS (ES) m/z 447.7; HRMS: calcd for C22H16F3NO2S2 + H+, 448.06473; found (ESI, [M+H]+ Obs'd), 448.0653.
Example 473
3-methyl-4- {5- [3-(methylsulfonyl)phenyl] -1 ,3-thiazol-2-yl}-8- (trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example 259. MS (ES) m/z 448.9; HRMS: calcd for C21H15F3N2O2S2 + H+, 449.05998; found (ESI,
[M+H]+ Obs'd), 449.0603.
Example 474 ethyl 4-{5-[3-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline-3- carboxylate
The title compound was prepared in a similar manner to that described for Example
259.
Example 475 4-{5-[3-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline-3- carboxamide
The title compound was prepared in a similar manner to that described for Example 276. MS (ES) m/z 477.0.
Example 476 ethyl 4-{5'-[3-(methylsulfonyl)phenyl]-2,2'-bithiophen-5-yl}-8- (trifluoromethyl)quinoline-3-carboxylate
The title compound was prepared in a similar manner to that described for Example 259. MS (ES) m/z 587.9; HRMS: calcd for C28H20F3NO4S3 + H+, 588.05793; found (ESI, [M+H]+ Obs'd), 588.0582. Example 477
8-fluoro-4- [3 '-(methylsulfonyl)biphenyl-3-yl] quinoline
Step 1 : 3-(8-fluoroquinolin-4-yl)phenyl trifluoromethanesulfonate The compound was prepared in a similar manner to that described for Example 258.
MS (ES) m/z 371.7.
Step 2: 8-fluoro-4-[3'-(methylsulfonyl)biphenyl-3-yl]quinoline The title compound was prepared in a similar manner to that described for Example 259. MS (ES) m/z 378.3; HRMS: calcd for C22H16FNO2S + H+, 378.09585; found (ESI,
[M+H]+ Obs'd), 378.0963.
Example 478
3-methyl-4-{5-[3-(methylsulfonyl)phenyl]-2-thienyl}-8- (trifluoromethyl)quinoline
Step 1 : 4-(5-chloro-2-thienyl)-3-methyl-8-(trifluoromethyl)quinoline
The compound was prepared in a similar manner to that described for Example 259. MS (ES) m/z 327.6; HRMS: calcd for Ci5H9ClF3NS + H+, 328.01691; found (ESI, [M+H]+ Obs'd), 328.0175.
Step 2: 3-methyl-4-{5-[3-(methylsulfonyl)phenyl]-2-thienyl}-8- (trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example 259. MS (ES) m/z 447.6; HRMS: calcd for C22H16F3NO2S2 + H+, 448.06473; found (ESI, [M+H]+ Obs'd), 448.0650.
Example 479
4- [3-(methylsulfonyl)phenyl] -8-(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example 259. MS (ES) m/z 351.9.
Example 480
4-{5-[3-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline Step 1 : 4-(5-chloro-2-thienyl)-8-(trifluoromethyl)quinoline The compound was prepared in a similar manner to that described for Example 259.
MS (ES) m/z 313.6. Step 2: 4-{5-[3-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example 259. MS (ES) m/z 433.6.
Example 481
N,N-dimethyl-3-{5-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]-2- thienyljbenzenesulfonamide
The title compound was prepared in a similar manner to that described for Example 259. MS (ES) m/z 476.6; HRMS: calcd for C23H19F3N2O2S2 + H+, 477.09128; found (ESI,
[M+H]+ Obs'd), 477.0911.
Example 482
3-methyl-4-{5-[4-(methylsulfonyl)phenyl]-2-thienyl}-8- (trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example 259. MS (ES) m/z 447.6; HRMS: calcd for C22H16F3NO2S2 + H+, 448.06473; found (ESI, [M+H]+ Obs'd), 448.0648.
Examples 483 to 506
The following compounds in Examples 483 to 506 were prepared essentially according to the procedure of Example 279 except using the appropriate reactants for the desired substitution pattern.
Example 483
4- [3 '-(methylsulfonyl)biphenyl-3-yl] -8-(trifluoromethyl)quinoline
Prepared as in Example 279 except using 4-(3-bromophenyl)-8-(trifluoro-methyl)quinoline and 3-(methylsulfonyl)phenylboronic acid as the reactants to afford the title compound as a white solid. MS (ES) m/z 427.8.
Example 484
4-[4'-methyl-3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline Prepared as in Example 279 except using 4-(3-bromophenyl)-8-(trifluoro- methyl)quinoline and 4-methyl-3-(methylsulfonyl)phenylboronic acid as the reactants to afford the title compound as a white solid. MS (ES) m/z 442.1. Example 485
4- [3 '-(methylsulfonyl)biphenyl-3-yl] -3-phenyl-8-(trifluoromethyl)quinoline
Prepared as in Example 279 except using 4-(3-bromophenyl)-3-phenyl-8- (trifluoromethyl)quinolone and 3-(methylsulfbnyl)phenylboronic acid as the reactants to afford the title compound as an off- white solid. MS (ES) m/z 503.7.
Example 486
3 '- [8-(trifluoromethyl)quinolin-4-yl] biphenyl-3-sulfonamide
Prepared as in Example 279 except using 4-(3-bromophenyl)-8-(trifluoro- methyl)quinoline and 3-sulfamoylphenylboronic acid as the reactants to afford the title compound as a tan solid. MS (ES) m/z 429 A.
Example 487 ethyl 4-(3 '-(3-(1 ,3-dioxoisoindolin-2-yl)propylthio)biphenyl-3-yl)-8- (trifluoromethyl)quinoline-3-carboxylate
Prepared as in Example 279 except using ethyl 8-(trifluoromethyl)-4-(3-(trifluoro- methylsulfonyloxy)phenyl)quinoline-3-carboxylate and 3-(3-(l ,3-dioxoisoindolin-2- yl)propylthio)phenylboronic acid as the reactants to afford the title compound as a tan solid. MS (ES) m/z 640.1.
Example 488
2-amino-4- [3 '-(methylsulfonyl)biphenyl-3-yl] -8-(trifluoromethyl)quinoline-3- carboxamide
Step 1 : 2-amino-4-(3-bromophenyl)-8-(trifluoromethyl)quinoline-3-carboxamide
A stirred mixture of (2-amino-3-(trifluoromethyl)phenyl)(3-bromophenyl)methanone (1.0 g, 2.9 mmol) and 2-cyanoacetamide (366 mg, 4.4 mmol) in DMSO (5.0 mL) was treated with NaH (348 mg, 8.7 mmol, 60% dispersion in oil). After gas evolution the reaction vessel was capped and heated at 110 0C for 20 h. The cooled reaction was poured into water (80 mL) and extracted with ethyl acetate. The extracts were dried with MgSO4 and concentrated in vacuo. The reside was purified by chromatography eluting with a 20:80 to 100:0 E:H gradient to afford the title compound as a white solid (713 mg, 60%). MS (ES) m/z 409.6; HRMS: calcd for CnH11BrF3N3O + H+, 410.01103; found (ESI, [M+H]+ Obs'd), 410.0114.
Step 2: 2-amino-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline-3-carboxamide
Prepared as in Example 279 except using 2-amino-4-(3-bromophenyl)-8- (trifluoromethyl)quinoline-3-carboxamide and 3-(methylsulfonyl)phenylboronic acid as the reactants to afford the title compound as a white solid. MS (ES) m/z 486.0; HRMS: calcd for C24H18F3N3O3S + H+, 486.10937; found (ESI, [M+H]+ Calc'd), 486.1094.
Example 489
4-[4'-fluoro-3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
Prepared as in Example 279 except using using 4-(3-(4,4,5,5-tetramethyl- 1,3,2- dioxaborolan-2-yl)phenyl)-8-(trifluoromethyl)quinoline and 4-chloro- 1 -fluoro-2- (methylsulfonyl)benzene, potassium phosphate and palladium (II) acetate as the reactants to afford the title compound as a white solid. MS (ES) m/z 445.8.
Example 490
4- [4'-fluoro-3 '-(methylsulfonyl)biphenyl-3-yl] -3-methyl-8- (trifluoromethyl)quinoline
Prepared as in Example 279 except using using 3-methyl-4-(3-(4,4,5,5-tetramethyl- 1 ,3,2-dioxaborolan-2-yl)phenyl)-8-(trifluoromethyl)quinolone and 4-chloro- 1 -fluoro-2- (methylsulfonyl)benzene, potassium phosphate and palladium (II) acetate as the reactants to afford the title compound as a white solid. MS (ES) m/z 459.8.
Example 491
2- [3-({3 '- [8-(trifluoromethyl)quinolin-4-yl] biphenyl-3-yl} thio)propyl] -IH- isoindole-l,3(2H)-dione
Prepared as in Example 279 except using 4-(3-bromophenyl)-8-(trifluoro-methyl)- quinoline and 2-(3-(3-(4,4,5,5-tetramethyl- 1 ,3,2-dioxaborolan-2-yl)phenylthio)- propyl)isoindoline-l,3-dione as the reactants to afford the title compound as a white solid. MS (ES) m/z 568.7.
Example 492 Λf-ethyl-3-({3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3- yl}sulfonyl)propan-l-amine Prepared as in Example 279 except using 3-methyl-4-(3-(4,4,5,5-tetramethyl- 1,3,2- dioxaborolan-2-yl)phenyl)-8-(trifluoromethyl)quinolone and 3-(3-bromophenylsulfonyl)-N- ethylpropan- 1 -amine as the reactants to afford the title compound as a white solid. MS (ES) m/z 513.1.
Example 493
Λ^-methyl-3-({3 '- [3-methyl-8-(trifluoromethyl)quinolin-4-yl] biphenyl-3- yl}sulfonyl)propan-l-amine
Prepared as in Example 279 except using 3-methyl-4-(3-(4,4,5,5-tetramethyl- 1,3,2- dioxaborolan-2-yl)phenyl)-8-(trifluoromethyl)quinolone and 3-(3-bromophenylsulfonyl)-N- methylpropan- 1 -amine as the reactants to afford the title compound as a white solid. MS (ES) m/z 499.1.
Example 494 Λ'-ethyl-3-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propan-
1-amine
Prepared as in Example 279 except using 4-(3-bromophenyl)-8-(trifluoro-methyl)- quinoline and 3-(3-bromophenylsulfonyl)-N-ethylpropan-l-amine as the reactants to afford the title compound as a white solid. MS (ES) m/z 499.0.
Example 495
Λ^-methyl-3-({3 '- [8-(trifluoromethyl)quinolin-4-yl] biphenyl-3- yl}sulfonyl)propan-l-amine
Prepared as in Example 279 except using 4-(3-bromophenyl)-8-(trifluoro-methyl)- quinoline and 3-(3-bromophenylsulfonyl)-N-methylpropan-l -amine as the reactants to afford the title compound as a white solid. MS (ES) m/z 484.1.
Example 496
8-chloro-4- [3 '-(methylsulfonyl)biphenyl-3-yl] quinoline Step 1 : 4-(3-bromophenyl)-8-chloroquinoline
4-Bromo-8-chloroquinoline (0.200 g, 0.82 mmol) in dioxane (3 mL) was treated with 3-bromophenylboronic acid (0.15 mmol), potassium phosphate (0.26 g, 1.2 mmol), and Pd(PPh3)4 (20 mg, 0.017 mmol). The reaction was heated at 90 0C for 8 h. The solvent was removed and the residue was chromatographed using 10:90 E:H to obtain 0.085 g of the title compound. MS (ES) m/z 317.8. Step 2: 8-chloro-4-[3'-(methylsulfonyl)biphenyl-3-yl]quinoline
Prepared as in Example 279 except using 4-(3-bromophenyl)-8-chloroquinoline and
3-(methylsulfbnyl)phenylboronic acid as the reactants to afford the title compound as a white solid. MS (ES) m/z 393.9.
Example 497
5-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}thiophene-2-sulfonamide Prepared as in Example 279 except using 3-methyl-4-(3-(4,4,5,5-tetramethyl- 1,3,2- dioxaborolan-2-yl)phenyl)-8-(trifluoromethyl)quinolone and 5-bromothiophene-2- sulfonamide as the reactants to afford the title compound as a white solid. MS (ES) m/z 449.1.
Example 498 5-{3-[8-(trifluoromethyl)quinolin-4-yl]phenyl}thiophene-2-sulfonamide
Prepared as in Example 279 except using 4-(3-bromophenyl)-8-(trifluoro-methyl)- quinoline and 5-bromothiophene-2-sulfonamide as the reactants to afford the title compound as a white solid. MS (ES) m/z 434.9.
Example 499
3-methyl-4-{3-[5-(methylsulfonyl)-2-thienyl]phenyl}-8- (trifluoromethyl)quinoline
Prepared as in Example 279 except using 3-methyl-4-(3-(4,4,5,5-tetramethyl- 1,3,2- dioxaborolan-2-yl)phenyl)-8-(trifluoromethyl)quinolone and 2-bromo-5-(methyl- sulfonyl)thiophene as the reactants to afford the title compound as a white solid.MS (ES) m/z 447.9.
Example 500
4-{3-[5-(ethylsulfonyl)-2-thienyl]phenyl}-3-methyl-8-(trifluoromethyl)quinoline Stepl : 2-bromo-5-(ethylsulfonyl)thiophene
The title compound was prepared as in Example 1 using 5-bromothiophene-2- sulfonyl chloride as the arylsulfonyl chloride and iodoethane as the alkylating agent.
MS (ES) m/z 253.9.
Step2: 4-{3-[5-(ethylsulfonyl)-2-thienyl]phenyl}-3-methyl-8- (trifluoromethyl)quinoline Prepared as in Example 279 except using 3-methyl-4-(3-(4,4,5,5-tetramethyl- 1,3,2- dioxaborolan-2-yl)phenyl)-8-(trifluoromethyl)quinolone and 2-bromo-5-(ethylsulfonyl)- thiophene as the reactants to afford the title compound as a white solid. MS (ES) m/z 462.0.
Example 501 3-methyl-4-{3-[5-(propylsulfonyl)-2-thienyl]phenyl}-8-
(trifluoromethyl)quinolone
Step 1 : 2-bromo-5-(propylsulfonyl)thiophene
The title compound was prepared as in Example 1 except using 5-bromothiophene-2- sulfonyl chloride as the arylsulfonyl chloride and 1 -iodopropane as the alkylating agent. MS (ES) m/z 268.9.
Step 2: 3-methyl-4-{3-[5-(propylsulfonyl)-2-thienyl]phenyl}-8- (trifluoromethyl)quinolone
Prepared as in Example 279 except using 3-methyl-4-(3-(4,4,5,5-tetramethyl- 1,3,2- dioxaborolan-2-yl)phenyl)-8-(trifluoromethyl)quinolone and 2-bromo-5-
(propylsulfonyl)thiophene as the reactants to afford the title compound as a white solid. MS (ES) m/z 476.0.
Example 502 4-{3-[5-(isopropylsulfonyl)-2-thienyl]phenyl}-3-methyl-8-
(trifluoromethyl)quinoline
Step 1 : 2-bromo-5-(isopropylsulfonyl)thiophene
The title compound was prepared as in Example 1 except using 5-bromothiophene-2- sulfonyl chloride as the arylsulfonyl chloride and 1 -iodo-2-methylpropane as the alkylating agent. MS (ES) m/z 268.9.
Step 2: 4-{3-[5-(isopropylsulfonyl)-2-thienyl]phenyl}-3-methyl-8- (trifluoromethyl)quinoline
Prepared as in Example 279 except using 3-methyl-4-(3-(4,4,5,5-tetramethyl- 1,3,2- dioxaborolan-2-yl)phenyl)-8-(trifluoromethyl)quinolone and 2-bromo-5-(isopropyl- sulfonyl)thiophene as the reactants to afford the title compound as a white solid. MS (ES) m/z 476.0.
Example 503 3-[(5-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}-2-thienyl)sulfonyl]- propan-1-ol Prepared as in Example 279 except using 3-methyl-4-(3-(4,4,5,5-tetramethyl- 1,3,2- dioxaborolan-2-yl)phenyl)-8-(trifluoromethyl)quinolone and 3-(5-bromothiophen-2- ylsulfonyl)propan-l-ol as the reactants to afford the title compound as a white solid. MS (ES) m/z 492.0.
Example 504
4-{3-[5-(methylsulfonyl)-2-thienyl]phenyl}-8-(trifluoromethyl)quinoline
Step 1 : 2-bromo-5-(methylsulfonyl)thiophene
The title compound was prepared using 5-bromothiophene-2-sulfonyl chloride as the arylsulfonyl chloride and iodomethane as the alkylating agent.
MS (ES) m/z 240.9.
Step 2: 4-{3-[5-(methylsulfonyl)-2-thienyl]phenyl}-8-(trifluoromethyl)quinoline Prepared as in Example 279 except using 4-(3-bromophenyl)-8-(trifluoromethyl)- quinoline and 2-bromo-5-(methylsulfonyl)thiophene as the reactants to afford the title compound as a white solid. MS (ES) m/z 433.9.
Example 505 4-{3-[5-(ethylsulfonyl)-2-thienyl]phenyl}-8-(trifluoromethyl)quinoline Prepared as in Example 279 except using 4-(3-bromophenyl)-8-(trifluoromethyl)- quinoline and 2-bromo-5-(ethylsulfonyl)-thiophene as the reactants to afford the title compound as a white solid. MS (ES) m/z 447.9.
Example 506 4-{3-[5-(isopropylsulfonyl)-2-thienyl]phenyl}-8-(trifluoromethyl)quinoline
Prepared as in Example 279 except using 4-(3-bromophenyl)-8-(trifluoro-methyl)- quinoline and 2-bromo-5-(isopropylsulfonyl)thiophene as the reactants to afford the title compound as a white solid. MS (ES) m/z 462.0.
Example 507 The following compound of Example 507 was prepared essentially according to the procedure of Example 233.
N-(4-(3-(3-(methylsulfonyl)phenoxy)phenyl)-8-(trifluoromethyl)quinolin-3- yl)methanesulfonamide
The title compound was prepared in a manner similar to that described in Example 233. MS (ES) m/z 536.9; HRMS: calcd for C24H19F3N2O5S2 + H+, 537.07602; found (ESI, [M+H]+ Obs'd), 537.0757.
Examples 508 to 526 The following compounds in Examples 508 to 526 were prepared in a manner similar to that described in Example 276, except using the appropriate reactants.
Example 508 S-chloro^-JS-P-^ethylsulfonylJphenoxylphenylJquinoline-S-carboxamide MS (ES) m/z 453.0; HRMS: calcd for C23H17ClN2O4S - H+, 451.05248; found (ESI,
[M-H]"), 451.0526.
Example 509
N-benzyl-3-[(3-{3-[8-(trifhioromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan-l-amine
MS (ES) m/z 576.9; HRMS: calcd for C32H27F3N2O3S + H+, 577.17672; found (ESI, [M+H]+ Obs'd), 577.1766.
Example 510 N-(4-fluorobenzyl)-3-[(3-{3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan-l-amine
MS (ES) m/z 594.8; HRMS: calcd for C32H26F4N2O3S + H+, 595.16730; found (ESI, [M+H]+ Obs'd), 595.1685.
Example 511
N-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propyl}prop-2-en-l-amine
MS (ES) m/z 526.8.
Example 512
3-({3-[(3-{3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propyl}amino)propanenitrile
MS (ES) m/z 539.8; HRMS: calcd for C28H24F3N3O3S + H+, 540.15632; found (ESI, [M+H]+ Obs'd), 540.1561. Example 513
N-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propyl}prop-2-yn-l-amine
MS (ES) m/z 524.8; HRMS: calcd for C28H23F3N2O3S + H+, 525.14542; found (ESI, [M+H]+ Obs'd), 525.1456.
Example 514
N-(2-fluoroethyl)-3-[(3-{3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan-l-amine MS (ES) m/z 532.8.
Example 515
N-methoxy-3-[(3-{3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan-l-amine MS (ES) m/z 516.8; HRMS: calcd for C26H23F3N2O4S + H+, 517.14034; found (ESI,
[M+H]+), 517.1399.
Example 516 4-(3-{3-[(3-chloropropyl)sulfonyl]phenoxy}phenyl)-8-(trifluoromethyl)quinoline The product was isolated from the above reaction (Example 515) using N-methyl hydroxyamine hydrochloride as the starting material. MS (ES) m/z 505.7; HRMS: calcd for C25H19ClF3NO3S + H+, 506.07990; found (ESI, [M+H]+ Obs'd), 506.0796.
Example 517 N-methyl-N-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propyl}prop-2-yn-l-amine
MS (ES) m/z 538.8; HRMS: calcd for C29H25F3N2O3S + H+, 539.16107; found (ESI, [M+H]+ Obs'd), 539.1608.
Example 518
(2R)-N-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propyl}butan-2-amine
MS (ESI) m/z 543; HRMS: calcd for C29H29F3N2O3S + H+, 543.19237; found (ESI, [M+H]+ Obs'd), 543.1935. Example 519
(2S)-N-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propyl}butan-2-amine
MS (ES) m/z 542.9; HRMS: calcd for C29H29F3N2O3S + H+, 543.19237; found (ESI, [M+H]+ Obs'd), 543.1922.
Example 520
N-(3-chlorobenzyl)-3-[(3-{3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan-l-amine MS (ES) m/z 610.8; HRMS: calcd for C32H26ClF3N2O3S + H+, 611.13775; found
(ESI, [M+H]+ Obs'd), 611.1386.
Example 521
(4-(3-(3-(methylsulfonyl)phenoxy)phenyl)-8-(trifluoromethyl)quinolin-3- yl)methanamine
MS (ES) m/z 473.0; HRMS: calcd for C24H19F3N2O3S + H+, 473.11412; found (ESI, [M+H]+ Obs'd), 473.1143.
Example 522 4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-fluoroquinoline-3- carboxamide
The title compound was prepared in a similar manner to that described for Example 276. MS (ES) m/z 470.6; HRMS: calcd for C23H16ClFN2O4S + H+, 471.05761; found (ESI, [M+H]+), 471.0578.
Example 523
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-cyanoquinoline-3- carboxamide
The title compound was prepared in a similar manner to that described for Example 276. MS (ES) m/z 478.0.
Example 524 8-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide
The title compound was prepared in a similar manner to that described for Example 276. MS (ES) m/z 433.0; HRMS: calcd for C24H20N2O4S + H+, 433.12165; found (ESI,
[M+H]+ Obs'd), 433.1225. Example 525
4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline- 3-carboxamide
The title compound was prepared from ethyl 8-trifluoromethyl-4-(3- hydroxyphenyl)quinoline-3-carboxylate and 1 ,3-dichloro-5-(methylsulfonyl)benzene according to the procedure for Example 276. MS (ES) m/z 521.0.
Example 526
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carboxamide
The title compound was prepared from ethyl 8-trifluoromethyl-4-(3- hydroxyphenyl)quinoline-3-carboxylate and l-(ethylsulfonyl)-3-fluorobenzene according to the procedure for Example 276. MS (ES) m/z 501.1.
In embodiments, sulfide precursors to compounds in which Rf is -S(O)2R11 can be oxidized to the corresponding sulfone using Oxone® under conventional conditions, and according to Example 35 above for the preparation of halogenated arylsulfones from thiophenols.
Example 527 ethyl 4-(3'-{[3-(l,3-dioxo-l,3-dihydro-2H-isoindol-2-yl)propyl]sulfonyl}biphenyl- 3-yl)-8-(trifhioromethyl)quinoline-3-carboxylate
Prepared as in Example 35 except using ethyl 4-(3'-(3-(l,3-dioxoisoindolin-2-yl)- propylthio)biphenyl-3-yl)-8-(trifluoromethyl)quinoline-3-carboxylate as the reactant to afford the title compound as a white solid. MS (ES) m/z 612.1.
Example 528 2- [3-({3 '- [3-methyl-8-(trifluoromethyl)quinolin-4-yl] biphenyl-3- yl} sulfonyl)propyl] -lH-isoindole-1 ,3(2//)-dione
Prepared as in Example 35 except using 2-(3-(3'-(3-methyl-8-
(trifluoromethyl)quinolin-4-yl)biphenyl-3-ylthio)propyl)isoindoline-l,3-dione as the reactant to afford the title compound as a white solid. MS (ES) m/z 614.7.
Example 529
2- [3-({3 '- [8-(trifluoromethyl)quinolin-4-yl] biphenyl-3-yl} sulfonyl)propyl] -IH- isoindole-l,3(2H)-dione
Prepared as in Example 35 except using 2-[3-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl- 3-yl}thio)propyl]-lH-isoindole-l,3(2H)-dione as the reactant to afford the title compound as a white solid. MS (ES) m/z 600.6.
In some embodiments, Rn can be alkyl substituted with a phthaloyl group. In these embodiments, the corresponding primary amine can be obtained by treatment of the phthaloyl-substituted compound, e.g., with hydrazine in a solvent, generally heated at reflux for several hours.
Example 530
3-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propan-l-amine
2-(3-(3'-(8-(trifluoromethyl)quinolin-4-yl)biphenyl-3-ylsulfonyl)propyl)isoindoline-l,3-dione (0.050 g, 0.083 mmol) was dissolved in ethanol (15 mL) and hydrazine (1.0 mL) was added. The solution was refluxed for 3 h and the solvent was removed. The residue was purified via reverse phase ΗPLC (acetonitrile/water) to obtain the title compound as a gummy solid (25 mg). MS (ES) m/z 470.7.
Example 531 3-({3 '- [3-methyl-8-(trifluoromethyl)quinolin-4-yl] biphenyl-3-yl} sulfonyl)propan- 1-amine
Prepared as in Step 4 of Example 398 except using 2-(3-(3'-(3-methyl-8-(trifluoro- methyl)quinolin-4-yl)biphenyl-3-ylsulfonyl)propyl)isoindoline-l,3-dione as the reactant to afford the title compound as a semi-solid. MS (ES) m/z 484.7.
Example 532 ethyl 4- {3 '- [(3-aminopropyl)sulfonyl] biphenyl-3-yl}-8- (trifluoromethyl)quinoline-3-carboxylate
Prepared as in Step 4 of Example 398 except using ethyl 4-(3'- {[3-(l,3-dioxo-l,3- dihydro-2H-isoindol-2-yl)propyl]sulfonyl}biphenyl-3-yl)-8-(trifluoromethyl)quinolme-3- carboxylate as the reactant to afford the title compound as a semi-solid. MS (ES) m/z 542.7.
3-(4,5-dihydro-lΗ-imidazol-2-yl)-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline
A mixture of 4- {3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline- 3-carbonitrile (50 mg, 0.10 mmol), ethylenediamine (10 mL), and P2S5 (5 mg) was heated at 70 0C for 4 h. The mixture was poured into water, extracted with ethyl acetate, and concentrated. The residue was chromatographed eluting with an E:H gradient to give the title compound as a yellowish solid (15 mg). MS (ES) m/z 511.8; HRMS: calcd for C26H20F3N3O3S + H+, 512.12502; found (ESI, [M+H]+ Obs'd), 512.1247.
Examples 534 to 536
Example 534 benzyl 4- [(3- {3- [8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)thio]piperidine-l-carboxylate
Step 1 : 3-(l-(benzyloxycarbonyl)piperidin-4-ylthio)phenylboronic acid
A mixture of 3-mercaptophenylboronic acid (0.77 g, 5.00 mmol), benzyl 4- bromopiperidine-1-carboxylate (1.49 g, 5.00 mmol), and cesium carbonate (5.00 g, 15.2 mmol) in DMF (15 mL) was stirred at room temperature for 2 h. The reaction was poured into water and extracted with ethyl acetate. The extracts were dried over MgSO4 and concentrated to give 3-(l-(benzyloxycarbonyl)piperidin-4-ylthio)phenylboronic acid. The crude material was used for the next reaction without any further purification.
Step 2: benzyl 4-[(3-{3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)thio]piperidine-l-carboxylate
A mixture of 3-(l-(benzyloxycarbonyl)piperidin-4-ylthio)phenylboronic acid (0.190 g, 0.50 mmol), 3-(8-(trifluoromethyl)quinolin-4-yl)phenol (0.15 g, 0.5 mmol), Cu(II) acetate (0.18 g, 1.0 mmol), triethylamine (0.25 g, 3.5 mmol), and 4A molecular sieves in dichloromethane (15 mL) was stirred at room temperature overnight. The solid was filtered off and the liquid was poured into water and extracted with ethyl acetate. The extracts were dried over MgSO4 and concentrated. The residue was chromatographed eluting with an E:H gradient to give the title compound as a white solid (130 mg). MS (ES) m/z 615.0; HRMS: calcd for C35H29F3N2O3S + H+, 615.19237; found (ESI, [M+H]+ Obs'd), 615.1923.
Example 535 benzyl 4- [(3- {3- [8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]piperidine-l-carboxylate
A mixture of benzyl 4-[(3- {3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)thio]piperidine-l-carboxylate (100 mg, 0.16 mmol) and 50% H2O2 (3.0 mL) in acetic acid (3.0 mL) was heated at 60 0C for 1 h. The mixture was poured into water, extracted with ethyl acetate, and concentrated. The residue was chromatographed eluting with a gradient of E:H to give the title compound as solid (45 mg). (ES) m/z 647.0; HRMS: calcd for C35H29F3N2O5S + H+, 647.18220; found (ESI, [M+H]+), 647.1821.
Example 536 4-{3-[3-(piperidin-4-ylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
A solution of 48% HBr (1.0 mL) in acetic acid (45% volume) was added drop wise to a mixture of benzyl 4-[(3-{3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]piperidine-l-carboxylate (30 mg, 0.050 mmol) in acetic acid (ImL). The mixture was stirred at room temperature for 0.5 h. Diethyl ether was added and the solid was collected to give the title compound as an off- white solid (21 mg). MS (ES) m/z
513.0; HRMS: calcd for C27H23F3N2O3S + H+, 513.14542; found (ESI, [M+H]+ Obs'd), 513.1454.
Examples 537 to 539
Example 537 benzyl 4-({3 '- [8-(trifluoromethyl)quinolin-4-yl] biphenyl-3-yl} thio)piperidine-l- carboxylate
The title compound was prepared in a manner similar to that described in Example 259.
MS (ES) m/z 598.7; HRMS: calcd for C35H29F3N2O2S + H+, 599.19746; found (ESI, [M+H]+ Obs'd), 599.1967.
Example 538 benzyl 4-({3 '- [8-(trifluoromethyl)quinolin-4-yl] biphenyl-3-yl} sulfonyl)piperidine-
1-carboxylate
The title compound was prepared in a manner similar to that described in Example
535. MS (ES) m/z 631.0; HRMS: calcd for C35H29F3N2O4S + H+, 631.18729; found (ESI, [M+H]+ Obs'd), 631.1862.
Example 539
4- [3 '-(piperidin-4-ylsulfonyl)biphenyl-3-yl] -8-(trifluoromethyl)quinoline
The title compound was prepared in a manner similar to that described in Example
536. MS (ES) m/z 496.7; HRMS: calcd for C27H23F3N2O2S + H+, 497.15051; found (ESI, [M+H]+ Obs'd), 497.1502.
Example 540 methyl 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carboxylate
A solution of 4-(3-(3-(methylsulfonyl)phenoxy)phenyl)-8-(trifluoromethyl)quinoline- 3-carboxylic acid (5.00 g, 10.3 mmol), methyl iodide (3.0 mL, 42 mmol), and K2CO3 (5.0 g, 36 mmol) in acetone (50 mL) was heated to reflux. After 2 h, the reaction was cooled, filtered and concentrated . The product was purified by column chromatography eluting with a 25:75 E:H gradient to give a yellow foam (3.50 g, 68%). MS (ES) m/z 502.0. Example 541
[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3- yl] methanol
To a cooled (0 0C) solution of methyl 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline-3-carboxylate (0.10 g, 0.20 mmol) in THF (5.0 mL) was added a solution of 1.0 M LiAlH4 in THF (0.25 mL). After 1 h, the reaction was poured in 2N aqueous HCl and extracted with ethyl acetate. The organic layer was dried (MgSO4), concentrated, and purified by column chromatography eluting with 50:50 E:H to give a white foam (35 mg, 37%). MS (ES) m/z 474.0.
Example 542
4-[3-(3-{[3-(methylamino)propyl]sulfonyl}phenoxy)phenyl]-8- (trifluoromethyl)quinoline-3-carboxamide Step 1 : methyl 4-(3-(3-(3-(methylsulfonyloxy)propylsulfonyl)phenoxy)phenyl)-8-
(trifluoromethyl)quinoline-3-carboxylate
To a cooled (0 0C) solution of methyl 4-(3-(3-(3- hydroxyproylsulfonyl)phenoxy)phenyl)-8-(trifluoromethyl)quinoline-3-carboxylate
(1.20 g, 2.2 mmol) in CH2Cl2 (20 mL) and NEt3 (1.00 mL, 7.2 mmol) was added methanesulfonyl chloride (0.30 mL, 4.0 mmol). After 1 h, the reaction was poured in 2N aqueous HCl and extracted with CH2Cl2. The organic layer was dried (MgSO4) and concentrated to give the title compound as an oil (1.20 g, 88%), which was used without further purification. MS (ES) m/z 623.8.
Step 2: methyl 4-(3-(3-(3-(terbutoxycarbonyl(methyl)amino)propylsulfonyl) phenoxy)phenyl)-8-(trifluoromethyl)quinoline-3-carboxylate
A solution of methyl 4-(3-(3-(3-
(methylsulfonyloxy)propylsulfonyl)phenoxy)phenyl)-8-(trifluoromethyl)quinoline-3- carboxylate (0.80 g, 1.30 mmol) and a solution of 2.0 M methylamine in methanol (20 mL) was stirred at ambient temperature. After 40 h, the reaction was concentrated and taken up into ethyl actate. The organic layer was washed with saturated aqueous NaHCO3, dried, and concentrated. The resulting oil was dissolved in CH2Cl2 (10 mL) and di-t-butyl dicarbonate (1.00 g, 4.6 mmol) was added. The reaction was stirred at ambient temperature for 24 h and then concentrated. The crude product was purified by column chromatography eluting with 30:70 E:H to afford the title compound as an oil (0.15 g, 18%). MS (ES) m/z 658.9.
Step 3 : 4-(3-(3-(3-(tert-butoxycarbonyl(methyl)amino)propylsulfonyl) phenoxy)phenyl)-8-(trifluoromethyl)quinoline-3-carboxylic acid
A solution of methyl 4-(3-(3-(tert-butoxycarbonyl(methyl)amino)propylsulfonyl) phenoxy)phenyl)-8-(trifluoromethyl)quinoline-3-carboxylate (0.15 g, 0.23 mmol) and 2.0 M aqueous NaOH (1 mL) in THF/MeOH (5 mL) was heated to reflux. After 3 h, the reaction was poured into water (100 mL) containing IN aqueous HCl (3 mL) and extracted with ethyl acetate. The organic layer was dried and concentrated to give the title compound as a foam (0.12 g, 81%). MS (ES) m/z 645.0.
Step 4: tert-butyl 2-(3-(3-(3-carbamoyl-8-(trifluoromethyl)quinolin-4- yl)phenoxy)phenylsulfonyl)propyl(methyl)carbamate
A solution of 4-(3 -(3 -(3 -(tert-butoxycarbonyl(methyl)amino)propylsulfonyl)phenoxy) henyl)-8-(trifluoromethyl)quinoline-3-carboxylic acid (0.12 g, 0.19 mmol) and carbonyl diimidazole (0.15 g, 0.95 mmol) in DMF (5.0 mL) was heated to 60 0C. After 1 h, the reaction was cooled to room temperature and concentrated ammonium hydroxide (2 mL) solution was added. After 1 h, the reaction was poured into water and extracted with EtOAc. The EtOAc was dried and concentrated to give an oil (0.10 g, 82%). MS (ES) m/z 643.9.
Step 5: 4-[3-(3-{[3-(methylamino)propyl]sulfonyl}phenoxy)phenyl]-8-
(trifluoromethyl)quinoline-3-carboxamide
A solution of tert-butyl 3-(3-(3-(3-carbamoyl-8-(trifluoromethyl)quinolin-4- yl)phenoxy)phenylsulfonyl)propyl(methyl)carbamate (0.10 g, 0.16 mmol) and trifluoroacetic acid (0.5 mL) in CH2Cl2 (5 mL) was stirred at room temperature. After 2 h, the reaction was washed with aqueous saturated NaHCO3, dried, and concentrated to give the title compound as a foam (0.050 g, 57%). MS (ES) m/z 543.9. Example 543
N-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl] propyl} methanesulfonamide
A mixture of 3-(3-(3-(8-(trifluoromethyl)quinolin-4- yl)phenoxy)phenylsulfonyl)propan-l -amine (50 mg, 0.103 mmol), methanesulfonyl chloride (41 mg, 0.124 mmol), and pyridine (12 mg, 0.14 mmol) in CH2CI2 (5 mL) was stirred 1.5 h and then concentrated in vacuo to a brown powder. The crude product was purified by reverse phase-HPLC eluting with an acetonitrile: water gradient to afford the title compound as an off-white powder (42 mg, 72%). MS (ES) m/z 564.8.
Example 544 l-ethyl-3-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl] propyljurea
A mixture of 3-(3-(3-(8-(trifluoromethyl)quinolin-4- yl)phenoxy)phenylsulfonyl)propan- 1 -amine (50 mg, 0.103 mmol), ethyl isocyanate (9.0 mg, 0.124 mmol) in CH2Cl2 (5 mL) was stirred 1.5 h and then concentrated in vacuo to a brown powder. The crude product was purified by reverse phase-HPLC eluting with an acetonitrile:water gradient to afford the title compound as an off- white powder (52 mg, 91%).
MS (ES) m/z 557.9.
Example 545
N-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl] propyl} acetamide
A mixture of 3-(3-(3-(8-(trifluoromethyl)quinolin-4- yl)phenoxy)phenylsulfonyl)propan- 1 -amine (50 mg, 0.103 mmol), acetyl chloride (1 1 mg, 0.124 mmol), pyridine (12 mg, 0.14 mmol) in CH2Cl2 (5 mL) was stirred 1.5 h and then concentrated in vacuo to a powder. The crude product was purified by reverse phase-HPLC eluting with an acetonitrile:water gradient to afford the title compound as an off-white powder
(39 mg, 68%). MS (ES) m/z 528.8.
Example 546
2-({3-[(3-{3-[8-(trifluoromethyl)quinolin-4- yl] phenoxy}phenyl)sulfonyl] propyl} carbamoyl)benzoic acid
A mixture of 3-(8-(trifluoromethyl)quinolin-4-yl)phenol (200 mg, 0.69 mmol), 1- fluoro-3-(methylsulfonyl)benzene (212 mg, 1.04 mmol), and potassium carbonate (286 mg, 2.08 mmol) in DMA (5 mL) was sealed in a vial and heated at 210 0C for 1 h. Cooling to room temperature and filtration afforded as filtrate a brown syrup. The crude intermediate was purified by reverse phase-HPLC eluting with an acetonitrile:water gradient to afford 2- (3-(3-(3-(8-(trifluoromethyl)quinolin-4-yl)phenoxy)phenylsulfonyl)propyl)isoindoline-l,3- dione a as a brown powder (310 mg, 73%). To this brown powder was added anhydrous hydrazine (1.0 mL) in ethanol (5 mL) and the reaction heated at 60 0C for 3 h. Cooling to room temperature concentrated in vacuo to a brown powder. The crude product was purified by reverse phase-HPLC eluting with an acetonitrile: water gradient to afford the title compound as a yellow syrup (9 mg, 6%). MS (ES) m/z 634.8.
Example 547
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carboximidamide Step 1 : To a suspension of ammonium chloride (1.07 g, 20 mmol) in toluene (20 mL) at 0 to 5 0C was slowly added 2 M trimethylaluminum in toluene (10 mL). After the addition was complete the reaction was allowed to warm to room temperature and was stirred for 1 h.
Step 2: To a solution of 4-(3-(3-(methylsulfonyl)phenoxy)phenyl)-8- (trifluoromethyl)quinoline-3-carbonitrile (15 mg) in toluene (2 mL) was added 2 M trimethylaluminum in toluene (3 mL). The solution was heated to 80 0C for 24 h. The reaction mixture was cooled and the aluminum complex was decomposed by carefully pouring the solution into a slurry of silica gel in chloroform. The mixture was stirred for 5 min and the silica gel was filtered. The filter cake was washed with methanol. The solution was concentrated in vacuo. Purification by chromatography afforded the title compound. MS (ES) m/z 486.0.
Example 548
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carboxylic acid
4-{3-[3-(Methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile (300 mg, 0.75 mmol) was heated in AcOH (5 mL) and concentrated H2SO4 at 120 0C for 20 h. The reaction was cooled and poured into ice water (100 mL). Upon stirring vigorously, a precipitate formed which was filtered, washed with water, and dried in vacuo to afford the title compound as an off-white solid (256 mg). MS (ESI) m/z 420; HRMS: calcd for C23H17NO5S + H+' 420.09002; found (ESI, [M+H]+ Obs'd), 420.0905.
Example 549 methyl 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carboxylate 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carboxylic acid (200 mg, 0.47 mmol), was heated in MeOH (40 mL) and cone. H2SO4 (2 mL) at 80 0C for 12 h. The reaction was cooled, treated with water (50 mL), and extracted with ethyl acetate (3 x 50 mL). The extracts were dried with MgSO4 and concentrated in vacuo to afford the title compound as a white solid (189 mg). MS (ES) m/z 433.9; HRMS: calcd for C24H19NO5S + H+, 434.10567; found (ESI, [M+H]+ Obs'd), 434.1059.
Example 550 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carboxamide
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carboxylic acid (70 mg, 0.17 mmol) and carbonyldiimidazole (76 mg, 0.47 mmol) was heated in DMF (10 mL) at 60 0C for 1 h. The reaction was cooled, and treated with NH4OH (4.0 mL, 64 mmol) and stirred at room temperature for 1O h. The reaction mixture was treated with water (50 mL) and extracted with ethyl acetate (3 x 50 mL). The extracts were dried with MgSO4 and concentrated in vacuo. Chromatography on silica gel eluting with a 10:90 to 100:0 E:H gradient gave the title compound as an off-white solid (36 mg). MS (ES) m/z 418.8; HRMS: calcd for C23H18N2O4S + H+, 419.10600; found (ESI, [M+H]+ Obs'd), 419.1064.
Example 551
Na2SO3, NaHCO3 nBu4NI, CH3I, 35 0C
4-{3-[4-chloro-3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline Step 1 : 5-bromo-2-chlorobenzenesulfonyl chloride 5-Bromo-2-chloroaniline (2.6 g, 9.7 mmol) was combined with acetic acid (8 mL) and cone. HCl (4 mL) in acetonitrile. NaNO2 (802 mg, 11.6 mmol) in water (3 mL) was added drop wise over 10 minutes and the reaction was cooled in an ice bath. After 20 min, sulfur dioxide gas was bubble through the reaction for 1 h. A solution Of CuCl2 (1.62 g, 12.1 mmol) in water (3 mL) was added and the reaction was stirred at ambient temperature overnight. The reaction was poured into ice water (100 mL). Upon stirring vigorously, a precipitate formed. The precipitate was filtered, washed with water, and dried in vacuo to afford the title compound as a white solid (3.1 g), used without further purification.
Step 2: 4-bromo-l-chloro-2-(methylsulfonyl)benzene
In a similar manner to that described for Example 1 , the title compound was prepared using 5-bromo-2-chlorobenzenesulfonyl chloride and iodomethane. MS (ES) m/z 268.7.
Step 3: 4-{3-[4-chloro-3-(methylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline
Prepared as in Example 124 except using 3-[8-(trifluoromethyl)quinolin-4-yl]phenol and 4-bromo-l-chloro-2-(methylsulfonyl)benzene as the reactants to afford the title compound as an off-white solid. MS (ES) m/z 478.0; HRMS: calcd for C23H15ClF3NO3S + H+, 478.0486; found (ESI, [M+H]+ Obs'd), 478.0479.
Example 552 4-{4-[3-(methylsulfonyl)phenyl]pyridin-2-yl}-8-(trifluoromethyl)quinoline
Step 1 : 2-chloro-4-[3-(methylsulfonyl)phenyl] pyridine Nitrogen was bubbled through a vigorously stirred mixture of 2-chloro-4- iodopyridine (478 mg, 2 mmol), 3-(methylsulfonyl)phenylboronic acid (400 mg, 2.00 mmol), 2 M aqueous Na2CO3 (2.0 mL, 4.0 mmol), and dimethoxyethane (6.0 mL) for 10 min. Palladium tetrakis-triphenylphosphine (119 mg, 0.100 mmol) was added and the mixture was vigorously stirred at 80 0C for 6 h. The mixture was cooled and partitioned between ethyl acetate (40 mL) and water (30 mL). The layers were separated and the organic layer was washed with water (2 x 10 mL) and brine (20 mL). The organic layer was dried with Na24 and concentrated in vacuo. The residue was purified by SiO2 chromatography eluting with a gradient of 5:95 to 50:50 E:H to yield the title compound as an off-white solid. MS (ES) m/z 267.8; HRMS: calcd for Ci2H10CINO2S + H+, 268.01935; found (ESI, [M+H]+ Obs'd), 268.0196. Step 2: 4-{4-[3-(methylsulfonyl)phenyl]pyridin-2-yl}-8-(trifluoromethyl)quinoline A mixture of 4-chloro-8-(trifluoromethyl)quinoline (462 mg, 2 mmol), bis(pinacolato)diboron (560 mg, 2.2 mmol), Pd2(dba)3 (50 mg, 0.055 mmol), 2- (dicyclohexylphosphino)biphenyl (100 mg, 0.29 mmol), and KOAc (300 mg 3 mmol) was heated in dioxane (12 mL) at 90 0C for 16 h. The mixture was cooled and partitioned between ethyl acetate (40 mL) and water (20 mL). The layers were separated and the organic layer was washed with saturated aqueous NaHCO3 (2 x 10 mL), water (20 mL) and brine (20 mL). The organic layer was dried with Na24 and concentrated in vacuo. The residue was purified by SiO2 chromatography eluting with a gradient of 0: 100 to 15:85 E:H, yielding 4- (4,4,5,5-tetramethyl- 1 ,3,2-dioxaborolan-2-yl)-8-(trifluoromethyl)quinoline which was contaminated with 8-trifluoromethylquinoline (- 1 :1 ratio). The crude material (310 mg) was put in a vial with 2-chloro-4-[3-(methylsulfonyl)phenyl]pyridine (140 mg, 0.52 mmol), aqueous Na2CO3 (2.0 M, 2.0 mL, 4.0 mmol), and dimethoxyethane (5 mL). Nitrogen was bubbled through the mixture for 10 min and palladium tetrakis-triphenylphosphine (120 mg, 0.100 mmol) was added. The mixture was heated at 85 0C for 4 h, then the mixture was cooled and partitioned between ethyl acetate (40 mL) and water (20 mL). The layers were separated and the organic layer was washed with water (2 x 20 mL) and brine (20 mL). The organic layer was dried with Na24 and concentrated in vacuo. The residue was purified by SiO2 chromatography eluting with a gradient of 2:98 to 50:50 E:H. The residual material was further purified by C18 reverse-phase chromatography using a gradient of 5:95 to 100:0 acetonitrile:H2O to afford the title compound as a white foam. MS (ES) m/z 428.7; HRMS: calcd for C22H15F3N2O2S + H+, 429.08791; found (ESI, [M+H]+), 429.0882
Example 553
3-methyl-4-{4-[3-(methylsulfonyl)phenyl]-2-thienyl}-8- (trifluoromethyl)quinoline
Step 1 : 3-methyl-4-(thiophen-2-yl)-8-(trifluoromethyl)quinoline The compound was prepared in a similar manner to that described for Example 279. MS (ES) m/z 293.3.
Step 2 : 4-(4-bromothiophen-2-yl)-3-methyl-8-(trifluoromethyl)quinoline
To a mixture of 3-methyl-4-(thiophen-2-yl)-8-(trifluoromethyl)quinoline (250 mg, 0.896 mmol) and sodium acetate (294 mg, 2.69 mmol) in water (10 mL) was added drop wise bromine (429 mg, 2.69 mmol) in water (5 mL) over 30 min. Zinc (175 mg, 2.69 mmol) was added and the resulting brown mixture was heated at 50 0C for 15 h. The cooled brown mixture was extracted with ethyl acetate (20 mL), filtered, dried with MgSO4, and concentration in vacuo to a crude brown powder as 4-(4-bromothiophen-2-yl)-3-methyl-8- (trifluoromethyl)quinoline (360 mg). MS (ES) m/z 372.0. This product was used in the next step without purification.
Step 3: 3-methyl-4-{4-[3-(methylsulfonyl)phenyl]-2-thienyl}-8- (trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example 279. MS (ES) m/z 447.9.
Example 554
3-methyl-4-{5-[3-(methylsulfonyl)phenyl]-3-thienyl}-8- (trifluoromethyl)quinoline
Step 1 : 4-bromo-2-(3-(methylsulfonyl)phenyl)thiophene
The intermediate was prepared in a similar manner to that described for Example 279. MS (ES) m/z 317.2.
Step 2: 3-methyl-4-{5-[3-(methylsulfonyl)phenyl]-3-thienyl}-8- (trifluoromethyl)quinoline In a reaction vial at room temperature was placed 4-bromo-2-(3- (methylsulfonyl)phenyl)thiophene (88 mg, 0.276 mmol), 4-bromo-6-methyl-8- (trifluoromethyl)quinoline acid (80 mg, 0.276 mmol), 4,4,4',4',5,5,5',5'-octamethyl-2,2'- bi(l,3,2-dioxaborolane) (77 mg, 0.304 mmol), potassium carbonate (81 mg, 0.828 mmol), dichlorobis(triphenylphosphine)pallidum (II) (49 mg, 0.276 mmol) in DMSO (2.0 mL). The vial was capped and heated at 90 0C for 3 h. After cooling and filtration, the filtrate was subjected to purification by RP-HPLC (acetonitrile:H2O) to afford the title compound as a yellow powder (17 mg, 28%). MS (ES) m/z 447.9.
Example 555
N-(4-methoxybenzyl)-N-methyl-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide
Prepared as in Example 460, step 3, except using 3-[3-(methylsulfonyl)-8- (trifluoromethyl)quinolin-4-yl]phenol and 3-bromo-N-(4-methoxybenzyl)-N- methylbenzenesulfonamide as the reactants to afford the title compound as a white solid. MS (ES) m/z 593.0.
Example 556
N-(4-methoxybenzyl)-N-methyl-4-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide
Prepared as in Example 462, step 3, except using 3-[3-(methylsulfonyl)-8- (trifluoromethyl)quinolin-4-yl]phenol and 4-bromo-N-(4-methoxybenzyl)-N- methylbenzenesulfonamide as the reactants to afford the title compound as a white solid.. MS (ES) m/z 593.0.
Example 557
N-methyl-3- {3- [3-methyl-8-(trifluoromethyl)quinolin-4- yl] phenoxyjbenzenesulfonamide
Prepared as in Example 464, except using N-(4-methoxybenzyl)-N-methyl-3-{3-[3- methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide as the reactant to afford the title compound as a white solid. MS (ES) m/z 472.8.
Example 558
N-methyl-4- {3- [3-methyl-8-(trifluoromethyl)quinolin-4- yl] phenoxyjbenzenesulfonamide Prepared as in Example 464, except using N-(4-methoxybenzyl)-N-methyl-4-{3-[3- methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide as the reactant to afford the title compound as a white solid. MS (ES) m/z 472.8.
Example 559
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-3-isopropyl-8-(trifluoromethyl)quinoline
Prepared as in Example 43, except using 3-[3-isopropyl-8-(trifluoromethyl)quinolin- 4-yl]phenol and 3-(ethylsulfonyl)-l-fluorobenzene as substrates to afford the title compound. MS (ES) m/z 499.8.
Example 560
3-isopropyl-4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline
Prepared as in Example 43, except using 3-[3-isopropyl-8-(trifluoromethyl)quinolin- 4-yl]phenol and 3-fluoro-l-(propylsulfonyl)-benzene as substrates to afford the title compound. MS (ES) m/z 513.9.
Example 561
3-isopropyl-4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline
Prepared as in Example 43, except using 3-[3-isopropyl-8-(trifluoromethyl)quinolin- 4-yl]phenol and 3-fluoro-l-(isopropylsulfonyl)-benzene as substrates to afford the title compound. MS (ES) m/z 513.8.
Example 562
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-3-isopropyl-8- (trifluoromethyl)quinoline
Prepared as in Example 43, except using 3-[3-isopropyl-8-(trifluoromethyl)quinolin- 4-yl]phenol and 3,5-difluoro-l-(methylsulfonyl)benzene as substrates to afford the title compound. MS (ES) m/z 503.8.
Example 563
4-{3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-3-isopropyl-8- (trifluoromethyl)quinoline Prepared as in Example 43, except using 3-[3-isopropyl-8-(trifluoromethyl)quinolin- 4-yl]phenol and 3,5-difluoro-l-(ethylsulfonyl)benzene as substrates to afford the title compound. MS (ES) m/z 517.8.
Example 564
4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-3-isopropyl-8- (trifluoromethyl)quinoline
Prepared as in Example 43, except using 3-[3-isopropyl-8-(trifluoromethyl)quinolin- 4-yl]phenol and 3,5-dichloro-l-(methylsulfonyl)benzene as substrates to afford the title compound. MS (ES) m/z 519.8.
Example 565
3-isopropyl-4-{3-[2-(methylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline Prepared as in Example 43, except using 3-[3-isopropyl-8-(trifluoromethyl)quinolin-
4-yl]phenol and 2-fluoro-l-(methylsulfonyl)-benzene as substrates to afford the title compound. MS (ES) m/z 485.8.
Example 566 3-isopropyl-4-{3-[4-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
Prepared as in Example 43, except using 3-[3-isopropyl-8-(trifluoromethyl)quinolin- 4-yl]phenol and 4-fluoro-l-(methylsulfonyl)-benzene as substrates to afford the title compound. MS (ES) m/z 485.8.
Example 567
4-{3-[4-(ethylsulfonyl)phenoxy]phenyl}-3-isopropyl-8-(trifluoromethyl)quinoline
Prepared as in Example 43, except using 3-[3-isopropyl-8-(trifluoromethyl)quinolin- 4-yl]phenol and l-(ethylsulfonyl)-4-fluorobenzene as substrates to afford the title compound. MS (ES) m/z 499.8.
Example 568
8-Methoxy-4- {3- [3-(methylsulfonyl)phenoxy] phenyl} quinoline
Prepared as in Example 43, except heating in a microwave reactor at 205-210 0C for 1 h and using 3-(8-methoxyquinolin-4-yl)phenol and 3-fluoro-l-(methylsulfonyl)benzene as substrates to afford the title compound. MS (ES) m/z 405.9; HRMS: calcd for C23H19NO4S + H+, 406.11076; found (ESI, [M+H]+ Obs'd), 406.1110.
Example 569
4-{3-[3-(Ethylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline Prepared as in Example 43, except heating in a microwave reactor at 205-210 0C for 1 h and using 3-(8-methoxyquinolin-4-yl)phenol and l-(ethylsulfonyl)-3-fluorobenzene as substrates to afford the title compound. MS (ES) m/z 420.0; HRMS: calcd for C24H21NO4S + H+, 420.12641; found (ESI, [M+H]+ Obs'd), 420.1268
Example 570 4-{3-[3-(Isopropylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline
Prepared as in Example 43, except heating in a microwave reactor at 205-210 0C for 1 h and using 3-(8-methoxyquinolin-4-yl)phenol and 3-fluoro-l-(isopropylsulfonyl)benzene as substrates to afford the title compound. MS (ES) m/z 434.1; HRMS: calcd for C25H23NO4S + H+, 434.14206; found (ESI, [M+H]+ Obs'd), 434.1426. Example 571
4-{3-[3-Fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline Prepared as in Example 43, except heating in a microwave reactor at 205-210 0C for 1 h and using 3-(8-methoxyquinolin-4-yl)phenol and 3,5-difluoro-l-(methylsulfonyl)benzene as substrates to afford the title compound. MS (ES) m/z 423.9; HRMS: calcd for C23H18FNO4S + H+, 424.10133; found (ESI, [M+H]+ Obs'd), 424.1015.
Example 572
4-{3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-8-methoxyquinoline Prepared as in Example 43, except heating in a microwave reactor at 205-210 0C for 1 h and using 3-(8-methoxyquinolin-4-yl)phenol and 3,5-difluoro-l-(ethylsulfonyl)benzene as substrates to afford the title compound. MS (ES) m/z 438.0; HRMS: calcd for C24H20FNO4S + H+, 438.11698; found (ESI, [M+H]+ Obs'd), 438.1176.
Example 573
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-methylquinoline Prepared as in Example 43, except heating in a microwave reactor at 205-210 0C for 1 h and using 3-(8-methylquinolin-4-yl)phenol and l-(ethylsulfonyl)-3-fluorobenzene as substrates to afford the title compound. MS (ES) m/z 404.0; HRMS: calcd for C24H21NO3S + H+, 404.13149; found (ESI, [M+H]+ Obs'd), 404.1319.
Example 574
4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-methylquinoline Prepared as in Example 43, except heating in a microwave reactor at 205-210 0C for 1 h and using 3-(8-methylquinolin-4-yl)phenol and 3-fluoro-l-(isopropylsulfonyl)benzene as substrates to afford the title compound. MS (ES) m/z 418.1; HRMS: calcd for C25H23NO3S + H+, 418.14714; found (ESI, [M+H]+ Obs'd), 418.1473.
Example 575
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-methylquinoline Prepared as in Example 43, except heating in a microwave reactor at 205-210 0C for 1 h and using 3-(8-methylquinolin-4-yl)phenol and 3,5-difluoro-l-(methylsulfonyl)benzene as substrates to afford the title compound. MS (ES) m/z 407.9; HRMS: calcd for C23H18FNO3S + H+, 408.10642; found (ESI, [M+H]+ Obs'd), 408.1066.
Example 576 4-{3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-8-methylquinoline
Prepared as in Example 43, except heating in a microwave reactor at 205-210 0C for 1 h and using 3-(8-methylquinolin-4-yl)phenol and 3,5-difluoro-l-(ethylsulfonyl)benzene as substrates to afford the title compound. MS (ES) m/z 422.1; HRMS: calcd for C24H20FNO3S + H+, 422.12207; found (ESI, [M+H]+ Obs'd), 422.1225. Example 577
3-({3-[3-(8-methylquinolin-4-yl)phenoxy]phenyl}sulfonyl)propan-l-ol Prepared as in Example 43, except heating in a microwave reactor at 205-210 0C for 1 h and using 3-(8-methylquinolin-4-yl)phenol and 3-[(3-fluorophenyl)sulfonyl]propan-l-ol as substrates to afford the title compound. MS (ES) m/z 433.8; HRMS: calcd for C25H23NO4S + H+, 434.14206; found (ESI, [M+H]+ Obs'd), 434.1420.
Example 578
4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-8-methylquinoline Prepared as in Example 43, except heating in a microwave reactor at 205-210 0C for 1 h and using 3-(8-methylquinolin-4-yl)phenol and 3,5-dichloro-l-(methylsulfonyl)benzene as substrates to afford the title compound. MS (ES) m/z 423.7; HRMS: calcd for C23H18ClNO3S + H+, 424.07687; found (ESI, [M+H]+ Obs'd), 424.0766.
Example 579
4-{4-[3-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example 259. MS (ES) m/z 433.8; HRMS: calcd for C21H14F3NO2S2 + H+, 434.04908; found (ESI,
[M+H]+ Obs'd), 434.0486.
Example 580
4-{4-[2-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example 259. MS (ES) m/z 433.8; HRMS: calcd for C21H14F3NO2S2 + H+, 434.04908; found (ESI,
[M+H]+ Obs'd), 434.0491. Example 581
4-{4-[4-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example 259. MS (ES) m/z 433.8; HRMS: calcd for C21H14F3NO2S2 + H+, 434.04908; found (ESI, [M+H]+ Obs'd), 434.0484.
Example 582
4-{5-[3-(methylsulfonyl)phenyl]-3-thienyl}-8-(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example 259. MS (ES) m/z 433.8; HRMS: calcd for C21H14F3NO2S2 + H+, 434.04908; found (ESI, [M+H]+ Obs'd), 434.0484.
Examples 583 to 593
The following compounds in Examples 583-593 were prepared in a manner similar to that described in Example 276.
Example 583
({[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3- yl] methyl} amino)acetonitrile
MS (ES) m/z 511.9.
Example 584
2-methoxy-N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinolin-3-yl]methyl}ethanamine
MS (ES) m/z 531.0.
Example 585
N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3- yl] methyl}propan-2-amine
MS (ES) m/z 515.0.
Example 586
N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3- yl] methyl}prop-2-en-l-amine
MS (ES) m/z 513.0. Example 587 l-cyclopropyl-N-^-^-P^methylsulfonylJphenoxylphenylJ-S- (trifluoromethyl)quinolin-3-yl] methyl} methanamine
MS (ES) m/z 527.0.
Example 588
N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3- yl] methyl} ethanamine
MS (ES) m/z 500.9.
Example 589
N-methyl-l-[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinolin-3-yl] methanamine
MS (ES) m/z 486.9.
Example 590
3-({[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3- yl] methyl} amino)propanenitrile
MS (ES) m/z 525.9.
Example 591
2-fluoro-N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinolin-3-yl]methyl}ethanamine
MS (ES) m/z 519.0.
Example 592
N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3- yl] methyl}propan-l-amine
MS (ES) m/z 515.0.
Example 593
N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3- yl] methyl} cyclopentanamine
MS (ES) m/z 541.0. Example 594
2-amino-4-(3-methoxyphenyl)-8-(trifluoromethyl)quinoline-3-carboxamide
Prepared as in Example 488, except using (2-ammo-3-(trifluoromethyl)phenyl)(3- methoxyphenyl)methanone and 2-cyanoacetamide as the reactants to afford the title compound as a white solid. MS (ES) m/z 362.0; HRMS: calcd for Ci8H14F3N3O2 + H+, 362.11109; found (ESI, [M+H]+ Calc'd), 362.1111.
Example 595
2-amino-4- [3 '-(methylsulfonyl)biphenyl-3-yl] -8-(trifluoromethyl)quinoline-3- carbonitrile
Step 1 : 2-amino-4-(3-bromophenyl)-8-(trifluoromethyl)quinoline-3-carbonitrile
Prepared as in Example 488, except using (2-ammo-3-(trifluoromethyl)phenyl)(3- bromophenyl)methanone and malononitrile as the reactants to afford the title compound as a white solid. MS (ES) m/z 391.8. Step 2 : 2-amino-4- [3 '-(methylsulfonyl)biphenyl-3-yl] -8-
(trifluoromethyl)quinoline-3-carbonitrile
Prepared as in Example 279, except using 2-amino-4-(3-bromophenyl)-8- (trifluoromethyl)quinoline-3-carbonitrile and 3-(methylsulfonyl)phenylboronic acid as the reactants to afford the title compound as a white solid. MS (ES) m/z 467.9.
Example 596
2-amino-4- [3 '-(methylsulfonyl)biphenyl-3-yl] -8-(trifluoromethyl)quinoline-3- carboxylic acid
Step 1 : 2-amino-4-(3-bromophenyl)-8-(trifluoromethyl)quinoline-3-carboxylic acid A solution of 2-amino-4-(3-bromophenyl)-8-(trifluoromethyl)quinoline-3-carbonitrile
(1.0 g, 2.5 mmol) and AcOHiH2SO4 (cone) (1 : 1) was heated to reflux. After 48 h, the reaction was poured into water (100 mL) and extracted with ethyl acetate. The organic layer was dried and concentrated to give the title compound as a white solid (0.89 g, 85%). MS (ES) m/z 410.8.
Step 2: 2-amino-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline-3-carboxylic acid Prepared as in Example 279 except using 2-amino-4-(3-bromophenyl)-8-(trifluoro- methyl)quinoline-3-carboxylic acid and 3-(methylsulfbnyl)phenylboronic acid as the reactants to afford the title compound as a white solid. MS (ES) m/z 486.9.
Example 597 4- [3 '-(methylsulfonyl)biphenyl-3-yl] -8-(trifluoromethyl)quinolin-2-amine
Step 1 : 4-(3-bromophenyl)-8-(trifluoromethyl)quinolin-2-amine
A solution of 2-amino-4-(3-bromophenyl)-8-(trifluoromethyl)quinoline-3-carboxylic acid (0.1 g, 0.24 mmol) in a minimal amount of Dowtherm (5 mL) was heated to 250 0C. After 1 h, N2 (g) was passed over the reaction and the Dowtherm removed and the residue chromatographed eluting with a gradient of 15:85 to 40:60 E:H to afford the title compound as a white solid (80 mg). MS (ES) m/z 366.8.
Step 2 : 4- [3 '-(methylsulfonyl)biphenyl-3-yl] -8-(trifluoromethyl)quinolin-2-amine
Prepared as in Example 279, except using 4-(3-bromophenyl)-8-(trifluoromethyl)-quinolin-2- amine and 3-(methylsulfonyl)phenylboronic acid as the reactants to afford the title compound as a white solid. MS (ES) m/z 443.0.
Example 598
The compounds below are prepared similar to the reaction conditions described in Example 43, using the appropriate starting materials.
A. 4-{2-chloro-5- [3-(methylsulfonyl)phenoxy] phenyl}-8-methoxyquinoline
B. 4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline
C. 4-{2-chloro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline D. 4-{2-chloro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline
E. 4-{2-chloro-5-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-8-methoxyquinoline
F. 4-{2-chloro-5-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline
G. 4-{5-[3-chloro-5-(methylsulfonyl)phenoxy]2-fluorophenyl}-8-methoxyquinoline H. 4-{2-fluoro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline I. 4-{5-[3-(ethylsulfonyl)-5-fluorophenoxy]2-fluorophenyl}-8-methoxyquinoline
J. 4-{2-fluoro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline
K. 4-{5-[3-(ethylsulfonyl)phenoxy]-2-fluorophenyl}-8-methoxyquinoline
L. 4-{2-fluoro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline
M. 4-{2-chloro-5- [3-(methylsulfonyl)phenoxy] phenyl}-8-(methylsufonyl)quinoline N. 4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(methylsufonyl)quinoline
O. 4-{2-chloro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(methylsufonyl)quinoline P. 4-{2-chloro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-
(methylsufonyl)quinoline Q. 4-{2-chloro-5-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-8-
(methylsufonyl)quinoline R. 4-{2-chloro-5- [3-chloro-5-(methylsulfonyl)phenoxy] phenyl}-8-
(methylsufonyl)quinoline S. 4-{5-[3-chloro-5-(methylsulfonyl)phenoxy]2-fluorophenyl}-8-
(methylsufonyl)quinoline
T. 4-{2-fluoro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8- (methylsufonyl)quinoline
U. 4-{5-[3-(ethylsulfonyl)-5-fluorophenoxy]2-fluorophenyl}-8-
(methylsufonyl)quinoline
V. 4-{2-fluoro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-(methylsufonyl)quinoline W. 4-{5-[3-(ethylsulfonyl)phenoxy]-2-fluorophenyl}-8-(methylsufonyl)quinoline X. 4-{2-fluoro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(methylsufonyl)quinoline Y. 2-methyl-4-{3- [3-(methylsulfonyl)phenoxy] phenyl}-8-(trifluoromethyl)quinoline Z. 4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-2-methyl-8-(trifluoromethyl)quinoline AA. 4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline BB. 4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline CC. 4-{3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline
DD. 2-methyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline EE. 4-{2-fluoro-5-[3-(methylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline FF. 4-{5-[3-(ethylsulfonyl)phenoxy]2-fluoro-phenyl}-2-methyl-8-
(trifluoromethyl)quinoline
GG. 4-{2-fluoro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-2-methyl-8- (trifluoromethyl)quinoline
HH. 4-{2-fluoro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline II. 4-{5-[3-(ethylsulfonyl)-5-fluorophenoxy]2-fluoro-phenyl}-2-methyl-8-
(trifluoromethyl)quinoline JJ. 4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-2-methyl-8- (trifluoromethyl)quinoline KK. 4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline LL. 4-{2-chloro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline MM. 4-{2-chloro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline NN. 4-{2-chloro-5-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline
OO. 4-{2-methyl-5- [4-(methylsulfonyl)phenoxy] phenyl}-8-(trifluoromethyl)quinoline PP. 4-{5-[4-(ethylsulfonyl)phenoxy]2-methylphenyl}-8-(trifluoromethyl)quinoline QQ. 4-{5-[4-(isopropylsulfonyl)phenoxy]2-methylphenyl}-8-
(trifluoromethyl)quinoline RR. [(4- {4-methyl-3- [8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]acetonitrile SS. 8-chloro-4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-2-methylquinoline TT. 8-chloro-4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-2-methylquinoline UU. 8-chloro-4-{2-chloro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-2-methylquinoline VV. 8-chloro-4-{2-chloro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-2- methylquinoline WW. 8-chloro-4-{2-chloro-5-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-2- methylquinoline
XX. 8-chloro-4-{2-fluoro-5-[3-(methylsulfonyl)phenoxy]phenyl}-2-methylquinoline YY. 8-chloro-4-{2-fluoro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-2-methylquinoline ZZ. 8-chloro-4-{2-fluoro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-2-methylquinoline AAA. 8-chloro-4-{2-fluoro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-2- methylquinoline BBB. 8-chloro-4-{2-fluoro-5-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-2- methylquinoline
CCC. 8-chloro-4-{5-[3-(methylsulfonyl)phenoxy]phenyl}-2-methylquinoline DDD. 8-chloro-4-{5-[3-(ethylsulfonyl)phenoxy]phenyl}-2-methylquinoline
EEE. 8-chloro-4-{5-[3-(isopropylsulfonyl)phenoxy]phenyl}-2-methylquinoline FFF. 8-chloro-4-{5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-2-methylquinoline GGG. 8-chloro-4-{5-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-2-methylquinoline
Example 599 The compounds below are prepared similar to the reaction conditions described in Example 212, using the appropriate starting materials.
A. 2-methyl-4-(3-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8- (trifluoromethyl)quinoline
B. 4-(2-fluoro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-2-methyl-8- (trifluoromethyl)quinoline
C. 4-(2-chloro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-2-methyl-8- (trifluoromethyl)quinoline D. 4-(2-fluoro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-methoxyquinoline
E. 4-(2-chloro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-methoxyquinoline
F. 4-(2-fluoro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8- (methanesulfonyl)quinoline
G. 4-(2-chloro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8- (methanesulfonyl)quinoline
H. 8-chloro-4-(2-fluoro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-2- methylquinoline I. 8-chloro-4-(2-chloro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-2- methylquinoline
Example 600
The compounds below are prepared similar to the reaction conditions described in Example 259, using the appropriate starting materials.
A. 2-methyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
B . 4- [4-chloro-3 '-(methylsulfonyl)biphenyl-5-yl] -2-methyl-8- (trifluoromethyl)quinoline
C. 4- [4-fhioro-3 '-(methylsulfonyl)biphenyl-5-yl] -2-methyl-8- (trifluoromethyl)quinoline
D. 4-[4-chloro-3'-(methylsulfonyl)biphenyl-5-yl]-8-methoxyquinoline
E. 4-[4-fluoro-3'-(methylsulfonyl)biphenyl-5-yl]-8-methoxyquinoline
F. 4-[4-chloro-3'-(methylsulfonyl)biphenyl-5-yl]-8-(methanesulfonyl)quinoline
G. 4-[4-fluoro-3'-(methylsulfonyl)biphenyl-5-yl]-8-(methanesulfonyl)quinoline H. 8-methoxy-4-[3'-(methylsulfonyl)biphenyl-3-yl]quinoline
I. 8-(methanesulfonyl)-4- [3 '-(methylsulfonyl)biphenyl-3-yl] quinoline Example 601
The intermediates below are prepared similar to the reaction conditions described in Example 258, using the appropriate starting materials.
A. 4-chloro-3-[2-methyl-8-(trifluoromethyl)quinolin-4-yl]phenyl trifluoromethanesulfonate
B . 4-fluoro-3- [2-methyl-8-(trifluoromethyl)quinolin-4-yl] phenyl trifluoromethanesulfonate C. 3-(8-methoxyquinolin-4-yl)phenyl trifluoromethanesulfonate
D. 4-chloro-3-(8-methoxyquinolin-4-yl)phenyl trifluoromethanesulfonate
E. 4-fluoro-3-(8-methoxyquinolin-4-yl)phenyl trifluoromethanesulfonate
F. 4-chloro-3-(8-(methanesulfonyl)quinolin-4-yl)phenyl trifluoromethanesulfonate
G. 4-fluoro-3-(8-(methanesulfonyl)quinolin-4-yl)phenyl trifluoromethanesulfonate H. 3-(8-chloro-2-methylquinolin-4-yl)phenyl trifluoromethanesulfonate
I. 4-chloro-3-(8-chloroquinolin-4-yl)phenyl trifluoromethanesulfonate J. 8-chloro-(4-fluoro-3-quinolin-4-yl)phenyl trifluoromethanesulfonate K. 8-chloro-(4-chloro-3-quinolin-4-yl)phenyl trifluoromethanesulfonate
Example 602
The intermediates below are prepared similar to the reaction conditions described in Example 400, step 2, using the appropriate starting materials.
A. 3-[2-methyl-8-(trifluoromethyl)quinolin-4-yl]phenol B . 4-chloro-3- [2-methyl-8-(trifluoromethyl)quinolin-4-yl] phenol
C. 4-fluoro-3-[2-methyl-8-(trifluoromethyl)quinolin-4-yl]phenol
D. 4-chloro-3-[8-methoxyquinolin-4-yl] phenol
E. 4-fluoro-3- [8-methoxyquinolin-4-yl] phenol
F. 4-methyl-3-[8-(trifluoromethyl)quinolin-4-yl]phenol G. 4-chloro-3-[8-(methanesulfonyl)quinolin-4-yl]phenol
H. 4-fluoro-3-[8-(methanesulfonyl)quinolin-4-yl]phenol I. 3-(8-chloro-2-methylquinolin-4-yl)phenol J. 3-(8-chloro-2-methylquinolin-4-yl)4-fluorophenol K. 4-chloro-3-(8-chloro-2-methylquinolin-4-yl)phenol
Example 603 The intermediates below are prepared similar to the reaction conditions described in Example 400, step 1, using the appropriate starting materials.
A. 4-(2-fluoro-5-methoxyphenyl)-2-methyl-8-(trifluoromethyl)quinoline B . 4-(2-chloro-5-methoxyphenyl)-2-methyl-8-(trifluoromethyl)quinoline
C. 4-(3-methoxyphenyl)-2-methyl-8-(trifluoromethyl)quinoline
D. 4-(3-methoxy-6-methylphenyl)-8-(trifluoromethyl)quinoline
E. 4-(2-fluoro-5-methoxyphenyl)-8-methoxyquinoline
F. 4-(2-chloro-5-methoxyphenyl)-8-methoxyquinoline G. 4-(2-fluoro-5-methoxyphenyl)-8-(methanesulfonyl)quinoline
H. 4-(2-chloro-5-methoxyphenyl)-8-(methanesulfonyl)quinoline
I. 8-chloro-4-(2-chloro-5-methoxyphenyl)-2-methylquinoline
J. 8-chloro-4-(2-fluoro-5-methoxyphenyl)-2-methylquinoline
Example 604
Biological testing
Representative compounds of this invention were evaluated in conventional pharmacological test procedures which measured their affinity to bind to LXR and to upregulate the gene ABCAl, which causes cholesterol efflux from atherogenic cells, such as macrophages.
LXR activation can be critical for maintaining cholesterol homeostasis, but its coincident regulation of fatty acid metabolism may lead to increased serum and hepatic triglyceride levels. Selective LXR modulators that activate cholesterol efflux with minimal impact on SREBP- Ic expression and triglyceride synthesis in liver would be expected to reduce atherosclerotic risk with an improved therapeutic index and minimize the potential for deleterious effects on metabolic balance.
Accordingly, LXR ligands were identified initially in cell-free LXR beta and LXR alpha competition binding assays. LXR ligands were further characterized by gene expression profiling for tissue selective gene regulation. Selective LXR modulators demonstrate agonist activity for ABCAl transactivation.
The test procedures performed, and results obtained are briefly described in the following sections: I. Ligand-Binding Test Procedure for Human LXRβ
II. Ligand-Binding Test Procedure for Human LXRα III. Quantitative Analysis of ABCAl Gene Regulation in THP- I Cells
IV. Results
I. Ligand-Binding Test Procedure for Human LXRβ. Ligand-binding to the human LXRβ was demonstrated for representative compounds of formula (I) by the following procedure.
Materials and Methods:
Buffer: 10OmM KCl, 10OmM TRIS (pH 7.4 at +4°C), 8.6%glycerol, 0. ImM PMSF*, 2mM MTG* ,0.2% CHAPS (* not used in wash buffer)
Tracer: 3H T0901317
Receptor source: E.coli extract from cells expressing biotinylated hLXRβ. Extract was made in a similar buffer as above, but with 5OmM TRIS.
Dav l Washed streptavidin and coated flash plates with wash buffer.
Diluted receptor extract to give Bmax ~ 4000 cpm and add to the wells.
Wrapped the plates in aluminum foil and stored them at +4°C over night.
Day 2
Made a dilution series in DMSO of the test ligands. Made a 5nM solution of the radioactive tracer in buffer.
Mixed 250μl diluted tracer with 5μl of the test ligand from each concentration of the dilution series.
Washed the receptor-coated flash plates.
Added 200μl per well of the ligand/radiolabel mixture to the receptor-coated flash plates. Wrapped the plates in aluminum foil and incubate at +4°C over night.
Day 3
Aspirated wells, and wash the flashed plates. Sealed the plate.
Measured the remaining radioactivity in the plate.
II. Ligand-Binding Test Procedure for Human LXRα.
Ligand-binding to the human LXRα was demonstrated for representative compounds of formula (I) by the following procedure.
Materials and Methods: Buffer: 10OmM KCl, 10OmM TRIS (pH 7.4 at +4°C), 8.6%glycerol, O.lmM PMSF*, 2mM MTG* ,0.2% CHAPS (* not used in wash buffer)
Tracer: 3H T0901317
Receptor source: E.coli extract from cells expressing biotinylated hLXRα. Extract was made in a similar buffer as above, but with 5OmM TRIS.
Day 1
Washed streptavidin and coated flash plates with wash buffer.
Diluted receptor extract to give Bmax ~ 4000 cpm and add to the wells.
Wrapped the plates in aluminum foil and stored them at +4°C over night. Day 2
Made a dilution series in DMSO of the test ligands.
Made a 5nM solution of the radioactive tracer in buffer.
Mixed 250μl diluted tracer with 5μl of the test ligand from each concentration of the dilution series. Washed the receptor-coated flash plates.
Added 200μl per well of the ligand/radiolabel mixture to the receptor-coated flash plates.
Wrapped the plates in aluminum foil and incubate at +4°C over night.
Day 3 Aspirated wells, and wash the flashed plates. Sealed the plate. Measured the remaining radioactivity in the plate.
III. Quantitative Analysis of ABCAl Gene Regulation in THP-I Cells.
The compounds of formula (I) effect on the regulation of the ABCAl gene was evaluated using the following procedure.
Materials and Methods
Cell culture: The THP-I monocytic cell line (ATCC # TIB-202) was obtained from American Type Culture Collection (Manassas, VA) and cultured in RPMI 1640 medium (Gibco, Carlsbad, Ca) containing 10% FBS, 2 mM L-glutamine, and 55 uM beta-
Mercaptoethanol (BME). Cells were plated in 96-well format at a density of 7.5 X 104in complete medium containing 50-100 ng/ml phorbal 12,13-dibutyrate (Sigma, St.Louis, Mo) for three days to induce differentiation into adherent macrophages. Differentiated THP-I cells were treated with test compounds or ligands dissolved in DMSO (Sigma, D-8779) in culture medium lacking phorbal ester. Final concentrations of DMSO did not exceed 0.3% of the media volume. Dose response effects were measured in duplicate, in the range of 0.001 to 30 micromolar concentrations and treated cells were incubated for an additional 18 hrs prior to RNA isolation. Unstimulated cells treated with vehicle were included as negative controls on each plate. An LXR agonist reference, N-(2,2,2-trifluoro-ethyl)-N-[4-(2,2,2-trifluoro-l- hydroxy-l-trifluoromethyl-ethyl)-phenyl]-benzenesulfonamide (Schultz, Joshua R., Genes & Development (2000), 14(22), 2831-2838), was dosed at 1.0 uM and served as a positive control. In antagonist mode, the compound under study is analyzed in the presence of 15OnM GW3965, trifluoromethyl-benzyl)-(2,2-diphenyl-ethyl)-amino]-propoxy]-phenyl)- acetic acid (Collins, J.L., J. Med. Chem. (2000), 45: 1963-1966.). Results of antagonist analysis are expressed as % antagonism and IC50 (in μM).
RNA isolation and quantitation: Total cellular RNA was isolated from treated cells cultured in 96-well plates using PrepStation 6100 (Applied Biosystems, Foster City, Ca), according to the manufacturer's recommendations. RNA was resuspended in ribonuclease-free water and stored at -700C prior to analysis. RNA concentrations were quantitated with RiboGreen test procedure, #R-11490 (Molecular Probes, Eugene, OR).
Gene expression analysis: Gene-specific mRNA quantitation was performed by real-time PCR with the Perkin Elmer Corp. chemistry on an ABI Prism 7700 Sequence detection system (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. Samples (50-100 ng) of total RNA were assayed in duplicate or triplicate in 50 ul reactions using one-step RT-PCR and the standard curve method to estimate specific mRNA concentrations. Sequences of gene-specific primer and probe sets were designed with Primer Express Software (Applied Biosystems, Foster City, CA). The human ABCAl primer and probe sequences are: forward, CAACATGAATGCCATTTTCCAA, reverse, ATAATCCCCTGAACCCAAGGA, and probe, 6FAM-
TAAAGCCATGCCCTCTGCAGGAACA-TAMRA. RT and PCR reactions were performed according to PE Applied Biosystem's protocol for Taqman Gold RT-PCR or Qiagen's protocl for Quantitect probe RT-PCR. Relative levels of ABCAl mRNA are normalized using GAPDH mRNA or 18S rRNA probe/primer sets purchased commercially (Applied Biosystems, Foster City, CA). Statistics:
Mean, standard deviation and statistical significance of duplicate evaluations of RNA samples were assessed using ANOVA, one-way analysis of variance using SAS analysis.
Reagents:
- GAPDH Probe and Primers - Taqman GAPDH Control Reagents 402869 or 4310884E 18S Ribosomal RNA - Taqman 18S Control Reagents 4308329 10 Pack Taqman PCR Core Reagent Kit 402930 Qiagen Quantitect probe RT-PCR 204443.
IV. Results
Based on the results obtained in the standard pharmacological test procedures, the compounds of this invention can be useful in treating or inhibiting LXR mediated diseases. In particular, the compounds of this invention can be useful in the treatment and inhibition of atherosclerosis and atherosclerotic lesions, lowering LDL cholesterol levels, increasing HDL cholesterol levels, increasing reverse cholesterol transport, inhibiting cholesterol absorption, treatment or inhibition of Alzheimer's disease, type I diabetes, type II diabetes, multiple sclerosis, rheumatoid arthritis, acute coronary syndrome, restenosis, inflammatory bowel disease (IBD), Crohn's disease, endometriosis, celiac, and thyroiditis.
A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are in the claims.

Claims

WHAT IS CLAIMED IS:
1. A compound having formula (I):
(I) wherein:
R1 is hydrogen, Ci-C6 alkyl, NH2, NH(Ci-C6 alkyl), or N(CrC6 alkyl)2;
R2 is: (i) hydrogen, cyano, or halo; or
(ii) C1-C12 alkyl or C1-C12 haloalkyl, each of which is optionally substituted with from 1-5 Ra; or
(iii) C7-C20 aralkyl or heteroaralkyl including 6-20 atoms, each of which is optionally substituted with from 1-10 Rb; or (iv) C2-C12 alkenyl or C2-C12 alkynyl, each of which is optionally substituted with from 1- 10 Rc;
(v) C3-Ci0 cycloalkyl, heterocyclyl including 3-10 atoms, or heterocycloalkenyl including 3-10 atoms, each of which is optionally substituted with from 1-5 Rb; or
(vi) C6-Ci8 aryl or heteroaryl including 5-16 atoms, each of which is optionally substituted with from 1 - 10 Rd; or (vii) -XR8, wherein:
X is -C(O)-; -O-; -S(O)r, wherein t is 0-2; -NR9-; -C(O)NR9-; -C(NH)NR9-; -C(O)O-; -CH2O-; -NR9SO2-; or -SO2NR9-, wherein R9 is hydrogen or Ci-C6 alkyl; and R8 is:
(i) hydrogen; or
(ii) Ci-Ci2 alkyl or Ci-Ci2 haloalkyl, each of which is optionally substituted with from 1-5 Ra; or
(iii) C7-C2O aralkyl or heteroaralkyl including 6-20 atoms, each of which is optionally substituted with from 1 - 10 Rb; or (iv) C2-C12 alkenyl or C2-C12 alkynyl, each of which is optionally substituted with from 1-10 Rc;
(v) C3-Ci0 cycloalkyl or heterocyclyl including 3-10 atoms, each of which is optionally substituted with from 1-5 Rb; or (vi) C6-Ci8 aryl or heteroaryl including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd;
R3 is C6-C14 aryl or heteroaryl including 5-14 atoms, each of which is: (i) substituted with from 1-2 R10, and (ii) optionally substituted with from 1 -4 Re; wherein:
R10 is WA, wherein:
W at each occurrence is, independently, a bond; -O-; -S(O)r, wherein t is 0-2; -NR9-; -C(O)NR9-; Ci_6 alkylene; or C2-6 alkynylene; -W1Cd-C6 alkylene)-; or -(Ci-C6 alkylene^1-;
W1 at each occurrence is, independently, -O-; -S(O)r, wherein t is 0-2; -NR9-; -C(O)NR9-; or C2.6 alkynylene; and
A at each occurrence is, independently: (i) Cβ-Cio aryl, which is:
(a) substituted with from 1 -2 Rf; and
(b) optionally substituted with from 1-4 Re; or
(ii) heteroaryl including 5-10 atoms, which is:
(a) substituted with from 1 -2 Rf or includes a substituted ring atom selected from the group consisting of S(O) and SO2; and
(b) is optionally substituted with from 1-4 Re; provided that the heteroaryl including 5-10 atoms is not [ 1 ,2,4]-oxadiazolyl; or (iii) arylazacyclyl including 8-12 atoms, each of which is:
(a) substituted with from 1-2 Rf, and
(b) optionally substituted with from 1-4 Re; or
(iv) arylsulfinylcyclyl, heteroarylsulfinylcyclyl, arylsulfonylcyclyl or heteroarylsulfonylcyclyl, each of which includes 8-10 atoms and is optionally substituted with from 1-4 Re; or (v) [l,2,4]-oxadiazolyl, optionally substituted with 1 Re;
each of R4, R5, R6, and R7 is, independently: (i) hydrogen; or (ii) Rc; or (iii) Ci-C2O alkyl or Ci-C20 haloalkyl, each of which is optionally substituted with from 1-10 Ra; or
(iv) C2-C2O alkenyl or C2-C2O alkynyl, each of which is optionally substituted with from 1-10 Rc; or
(v) C7-C2O aralkyl or heteroaralkyl, each of which is optionally substituted with from 1-10 Rb;
Ra at each occurrence is, independently:
(i) NRsRh; nitro; azido; hydroxy; oxo; thioxo; =NR; Ci-C20 alkoxy or Ci-C20 haloalkoxy, each of which is optionally substituted with from 1-10 Ra ; Cβ-Cig aryloxy or heteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10
Rd; C7-C20 aralkoxy, heteroaralkoxy including 6-20 atoms, C3-C16 cycloalkoxy, Cs-C20 cycloalkenyloxy, heterocyclyloxy including 3-20 atoms, or heterocycloalkenyloxy including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb; mercapto; C1-C20 thioalkoxy; C1-C20 thiohaloalkoxy; C6-Ci8 thioaryloxy or thioheteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd; C7-C2O thioaralkoxy, thioheteroaralkoxy including 6-20 atoms, C3-Ci6 thiocycloalkoxy, C3-C2O thiocycloalkenyloxy, thioheterocyclyloxy including 3-20 atoms, or thioheterocycloalkenyloxy including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb; cyano; - C(O)RJ, -C(O)OR; -OC(O)R; -C(O)SR; -SC(O)R; -C(S)SR; -SC(S)R; -C(O)NRsRh; - NRkC(O)R; -C(NR')R; -OC(O)NRsRh; -NRkC(O)NRsRh; -NRkC(O)OR; -S(O)nRm, wherein n is 1 or 2; -NRkS(O)nRm; or -P(O)(ORs)(ORh); or
(ii) C3-C2O cycloalkyl, C3-C2O cycloalkenyl, heterocyclyl including 3-20 atoms, heterocycloalkenyl including 3-20 atoms, arylheterocyclyl including 8-20 atoms, or heteroarylheterocyclyl including 8-20 atoms, each of which is optionally substituted with from 1-10 Rb;
Ra at each occurrence is, independently, NRsRh; nitro; azido; hydroxy; oxo; cyano; - C(O)R, -C(O)OR; -OC(O)R; -C(O)SR; -SC(O)R; -C(S)SR; -SC(S)R; -C(O)NRsRh; - NRkC(O)R; -C(NR')R; -OC(O)NRsRh; -NRkC(O)NRsRh; -NRkC(O)OR; -S(O)nRm, wherein n is 1 or 2; -NRkS(O)nRm; -P(O)(ORs)(ORh); C3-C20 cycloalkyl, C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms, or heterocycloalkenyl including 3-20 atoms;
Rb at each occurrence is, independently:
(i) halo; NRsRh; nitro; azido; hydroxy; oxo; thioxo; =NR'; Ci-C20 alkoxy or Ci-C20 haloalkoxy, each of which is optionally substituted with from 1-10 Ra; C6-Ci8 aryloxy or heteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10
Rd; C7-C20 aralkoxy, heteroaralkoxy including 6-20 atoms, C3-Ci6 cycloalkoxy, C3-C20 cycloalkenyloxy, heterocyclyloxy including 3-20 atoms, or heterocycloalkenyloxy including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb ; mercapto; Ci-C20 thioalkoxy; Ci-C20 thiohaloalkoxy; C6-Ci8 thioaryloxy or thioheteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd; C7-C20 thioaralkoxy, thioheteroaralkoxy including 6-20 atoms, C3-Ci6 thiocycloalkoxy, C3-C20 thiocycloalkenyloxy, thioheterocyclyloxy including 3-20 atoms, or thioheterocycloalkenyloxy including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb ; cyano; - C(O)R, -C(O)OR; -OC(O)R; -C(O)SR; -SC(O)R; -C(S)SR; -SC(S)R; -C(O)NRsRh; - NRkC(O)R; -C(NR')R; -OC(O)NRsRh; -NRkC(O)NRsRh; -NRkC(O)OR; -S(O)nRm, wherein n is 1 or 2; -NRkS(O)nRm; or -P(O)(ORs)(ORh); or (ii) C1-C20 alkyl or C1-C20 haloalkyl, each of which is optionally substituted with from 1-10 Ra; or
(iii) C2-C20 alkenyl or C2-C20 alkynyl, each of which is optionally substituted with from 1-10 Rc; or (iv) C6-Ci8 aryl or heteroaryl including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd; or
(v) C3-C2O cycloalkyl, C3-C2O cycloalkenyl, heterocyclyl including 3-20 atoms, or heterocycloalkenyl including 3-20 atoms, each of which is optionally substituted with from 1- 10 Rb';
Rb at each occurrence is, independently, Ra ; halo; C1-C20 alkoxy or C1-C20 haloalkoxy, each of which is optionally substituted with from 1-10 Ra; C6-CiS aryloxy or heteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd; C1-C20 alkyl or C1-C20 haloalkyl, each of which is optionally substituted with from 1-10 Ra; C2-C20 alkenyl; C2-C20 alkynyl; or C6-Qg aryl or heteroaryl including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd;
Rc at each occurrence is, independently:
(i) halo; NRsRh; nitro; azido; hydroxy; oxo; thioxo; =NR'; C1-C20 alkoxy or C1-C20 haloalkoxy, each of which is optionally substituted with from 1-10 Ra; C6-Ci 8 aryloxy or heteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd; C7-C2O aralkoxy, heteroaralkoxy including 6-20 atoms, C3-Ci6 cycloalkoxy, C3-C2O cycloalkenyloxy, heterocyclyloxy including 3-20 atoms, or heterocycloalkenyloxy including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb; mercapto; Ci-C2O thioalkoxy; Ci-C20 thiohaloalkoxy; C6-Ci8 thioaryloxy or thioheteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd; C7-C2O thioaralkoxy, thioheteroaralkoxy including 6-20 atoms, C3-Ci6 thiocycloalkoxy, C3-C2O thiocycloalkenyloxy, thioheterocyclyloxy including 3-20 atoms, or thioheterocycloalkenyloxy including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb; cyano; - C(O)R, -C(O)OR; -OC(O)R; -C(O)SR; -SC(O)R; -C(S)SR; -SC(S)R; -C(O)NRsRh; -
NRkC(O)R; -C(NR')R; -OC(O)NRsRh; -NRkC(O)NRsRh; -NRkC(O)OR; -S(O)nRm, wherein n is 1 or 2; -NRkS(O)nRm; or -P(O)(ORs)(ORh); or
(ii) C3-C20 cycloalkyl, C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms, or heterocycloalkenyl including 3-20 atoms, each of which is optionally substituted with from 1- 10 Rb; or (iii) C6-Qg aryl or heteroaryl including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd;
Rd at each occurrence is, independently: (i) halo; NRsRh; nitro; azido; hydroxy; Ci-C2O alkoxy or Ci-C2O haloalkoxy, each of which is optionally substituted with from 1-10 Ra; C6-Ci8 aryloxy or heteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd ; C7-C2O aralkoxy, heteroaralkoxy including 6-20 atoms, C3-Ci6 cycloalkoxy, C3-C20 cycloalkenyloxy, heterocyclyloxy including 3-20 atoms, or heterocycloalkenyloxy including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb; mercapto; Ci-C2O thioalkoxy; Ci-C2O thiohaloalkoxy; C6-Qg thioaryloxy or thioheteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1 - 10 Rd ; C7-C2O thioaralkoxy, thioheteroaralkoxy including 6-20 atoms, C3-Ci6 thiocycloalkoxy, C3-C2O thiocycloalkenyloxy, thioheterocyclyloxy including 3-20 atoms, or thioheterocycloalkenyloxy including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb; cyano; -C(O)R, -C(O)OR;
-OC(O)R; -C(O)SR; -SC(O)R; -C(S)SR; -SC(S)R; -C(O)NRsRh; -NRkC(O)R; -C(NR)R; - OC(O)NRsRh; -NRkC(O)NRsRh; -NRkC(O)OR; -S(O)nRm, wherein n is 1 or 2; -NRkS(O)nRm; or -P(O)(ORs)(ORh);;
(ii) Ci-C2O alkyl or Ci-C2O haloalkyl, each of which is optionally substituted with from 1-10 Ra; or
(iii) C2-C2O alkenyl or C2-C2O alkynyl, each of which is optionally substituted with from 1-10 Rc; or
(iv) C7-C20 aralkyl, heteroaralkyl including 6-20 atoms, C3-C20 cycloalkyl, C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms, or heterocycloalkenyl including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb; or
(v) C6-CiS aryl or heteroaryl including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd ;
Rd at each occurrence is, independently, halo; NRsRh; nitro; azido; hydroxy; Ci-C20 alkyl, Ci-C20 haloalkyl, C2-C20 alkenyl; C2-C20 alkynyl; C3-C20 cycloalkyl; C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms; heterocycloalkenyl including 3-20 atoms; C7-C20 aralkyl; heteroaralkyl including 6-20 atoms; Ci-C20 alkoxy; Ci-C20 haloalkoxy; C6-Qg aryloxy; heteroaryloxy; C7-C20 aralkoxy; heteroaralkoxy including 6-20 atoms; C3-Ci6 cycloalkoxy; C3-C20 cycloalkenyloxy; heterocyclyloxy including 3-20 atoms; heterocycloalkenyloxy including 3-20 atoms; mercapto; Ci-C20 thioalkoxy; Ci-C20 thiohaloalkoxy; C6-Qg thioaryloxy; thioheteroaryloxy including 5-16 atoms; C7-C20 thioaralkoxy, thioheteroaralkoxy including 6-20 atoms, C3-C16 thiocycloalkoxy C3-C20 thiocycloalkenyloxy, thioheterocyclyloxy including 3-20 atoms, or thioheterocycloalkenyloxy including 3-20 atoms; cyano; -C(O)RJ, -C(O)ORJ; -OC(O)RJ; -C(O)SR; -SC(O)R; -C(S)SR; - SC(S)R; -C(O)NRsRh; -NRkC(O)R; -C(NR')R; -OC(O)NRsRh; -NRkC(O)NRsRh; - NRkC(O)OR; -S(O)nRm, wherein n is 1 or 2; -NRkS(O)nRm; or -P(O)(ORs)(ORh);
Re at each occurrence is, independently, Ci-C6 alkyl, optionally substituted with from 1-3 Ra; Ci-C6 haloalkyl; phenyl; 4-fluorophenyl; halo; hydroxyl; NRsRh; nitro; C2-C6 alkenyl; C2-C6 alkynyl; Ci-C6 alkoxy; Ci-C6 haloalkoxy; cyano; or -C(O)R1;
Rf at each occurrence is, independently:
(i) -S(O)nR1, -(CH2)i_6S(O)nRn, -NRkS(O)nRn, or -OS(O)nR1, wherein n at each occurrence is, independently, 1 or 2; or
(ii) -NRkC(0)NRsR\ -NRkC(0)0R, -0C(0)NRsRh, or -OC(O)OR; or (iii) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and optionally substituted with from 1 -3 Re; or
(iv) heterocycloalkenyl including 5-10 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -3 Re; or
(v) -YRf , wherein Y at each occurrence is, independently, Ci-C6 alkylene, -O-, or - NR9-;
Rf at each occurrence is, independently:
(i) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and optionally substituted with from 1 -3 Re; or (ii) heterocycloalkenyl including 5-10 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -3 Re;
each of Rs, Rh, R1, and Rk, at each occurrence is, independently: (i) hydrogen; or (ii) Ci-C2O alkyl or Ci-C2O haloalkyl, each of which is optionally substituted with from
1-10 Ra; or
(iii) C2-C2O alkenyl or C2-C2O alkynyl, each of which is optionally substituted with from 1-10 Rc; or
(iv) C3-C2o cycloalkyl, C3-Q0 cycloalkenyl, heterocyclyl including 3-20 atoms, or heterocycloalkenyl including 3-20 atoms, C7-C2O aralkyl, or heteroaralkyl including 6-20 atoms, each of which is optionally substituted with from 1-10 Rb; or (v) Cβ-Cig aryl or heteroaryl including 5-16 atoms, each of which is optionally substituted with from 1-10 Rd; or
(vi) -ORJ, -C(O)RJ, -C(O)OR; -C(O)NRsRh; or -S(O)nRm, wherein n is 1 or 2;
RJ at each occurrence is, independently:
(i) hydrogen; or
(ii) Ci-C2O alkyl or Ci-C2O haloalkyl, each of which is optionally substituted with from 1-10 Ra; or
(iii) C2-C2O alkenyl or C2-C2O alkynyl, each of which is optionally substituted with from 1-10 Rc; or
(iv) C3-C2o cycloalkyl, C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms, or heterocycloalkenyl including 3-20 atoms, C7-C2O aralkyl, or heteroaralkyl including 6-20 atoms, each of which is optionally substituted with from 1-10 Rb; or
(v) Cβ-Cig aryl or heteroaryl including 5-16 atoms, each of which is optionally substituted with from 1 - 10 Rd; or
Rm at each occurrence is, independently, R, OR, or NRsRh;
Rn at each occurrence is, independently, RJ or NRsRh;
or an N-oxide and/or a pharmaceutically acceptable salt thereof.
2. The compound of claim 1, wherein:
R is C6-C14 aryl, which is: (i) substituted with from 1-2 R10, and (ii) optionally substituted with from 1 -4 Re; and
A at each occurrence is, independently, C6-Ci0 aryl, which is:
(a) substituted with from 1-2 Rf; and
(b) optionally substituted with from 1-4 Re; and
Rf at each occurrence is, independently:
(i) -S(O)nR1, -(CH2)L6S(O)nR11, -NRkS(O)nRn, or -OS(O)nR1, wherein n at each occurrence is, independently, 1 or 2; or
(ii) -NRkC(O)NRsR\ -NRkC(O)OR, -OC(O)NRsRh, or -OC(O)OR.
3. The compound of claim 1 , wherein:
R3 is heteroaryl including 5-14 atoms, which is:
(i) substituted with from 1-2 R10, and
(ii) optionally substituted with from 1-4 Re; and
A at each occurrence is, independently, C6-Ci0 aryl, which is:
(a) substituted with from 1-2 Rf; and
(b) optionally substituted with from 1-4 Re; and
Rf at each occurrence is, independently: (i) -S(O)nR1, -(CH2)i_6S(O)nRn, -NRkS(O)nRn, or -OS(O)nR1, wherein n at each occurrence is, independently, 1 or 2; or
(ii) -NRkC(0)NRsR\ -NRkC(0)0R, -0C(0)NRsRh, or -OC(O)OR.
4. The compound of claim 1, wherein: R is C6-C14 aryl, which is:
(i) substituted with from 1-2 R10, and (ii) optionally substituted with from 1 -4 Re; and
A at each occurrence is, independently, heteroaryl including 5-10 atoms, which is:
(a) substituted with from 1 -2 Rf or includes a substituted ring atom selected from the group consisting of S(O) and SO2; and
(b) is optionally substituted with from 1-4 Re; provided that the heteroaryl including 5-10 atoms is not optionally substituted [1,2,4]- oxadiazolyl; and
Rf at each occurrence is, independently:
(i) -S(O)nR1, -(CH2)L6S(O)nR11, -NRkS(O)nRn, or -OS(O)nR1, wherein n at each occurrence is, independently, 1 or 2; or
(ii) -NRkC(0)NRsR\ -NRkC(O)OR, -OC(O)NRsRh, or -OC(O)OR.
5. The compound of claim 1, wherein: R is C6-C14 aryl, which is: (i) substituted with from 1-2 R10, and
(ii) optionally substituted with from 1 -4 Re; and
A at each occurrence is, independently, C6-Ci0 aryl, which is: (a) substituted with from 1 -2 Rf; and (b) optionally substituted with from 1-4 Re; and
Rf at each occurrence is, independently:
(iii) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and optionally substituted with from 1 -3 Re; or (iv) heterocycloalkenyl including 5-10 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -3 Re; or
(v) -YRf , wherein Y at each occurrence is, independently, Ci-C6 alkylene, -O-, or - NR9-; and
Rf at each occurrence is, independently: (i) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and optionally substituted with from 1 -3 Re; or
(ii) heterocycloalkenyl including 5-10 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -3 Re;
6. The compound of claim 1, wherein:
R3 is C6-Ci4 aryl, which is:
(i) substituted with from 1-2 R10, and
(ii) optionally substituted with from 1 -4 Re; and
A at each occurrence is, independently, arylazacyclyl including 8-12 atoms, each of which is:
(a) substituted with from 1 -2 Rf, and
(b) optionally substituted with from 1-4 Re; and
Rf at each occurrence is, independently:
(i) -S(O)nR1, -(CH2)L6S(O)nR11, -NRkS(O)nRn, or -OS(O)nR1, wherein n at each occurrence is, independently, 1 or 2; or
(ii) -NRkC(O)NRsR\ -NRkC(O)OR, -OC(O)NRsRh, or -OC(O)OR.
7. The compound of claim 1, wherein:
R is C6-C14 aryl, which is:
(i) substituted with from 1-2 R10, and
(ii) optionally substituted with from 1 -4 Re; and
A at each occurrence is, independently, arylsulfinylcyclyl, heteroarylsulfinylcyclyl, arylsulfonylcyclyl or heteroarylsulfonylcyclyl, each of which includes 8-10 atoms and is optionally substituted with from 1 -4 Re.
8. The compound of claim 1 , wherein:
R is C6-C14 aryl, which is: (i) substituted with from 1-2 R10, and (ii) optionally substituted with from 1 -4 Re; and
A at each occurrence is, independently, [l,2,4]-oxadiazolyl, optionally substituted with from 1-2 Re.
9. The compound of claim 1, wherein R3 is Cβ-Cio aryl, which is (i) substituted with 1 R10; and (ii) optionally substituted with from 1 -2 Re.
10. The compound of claim 1, wherein R has formula (A-4):
(A_4)
wherein R is hydrogen or Re.
11. The compound of claim 1, wherein R is heteroaryl including 5-10 atoms, which is (i) substituted with 1 R10, and (ii) optionally substituted with from 1-2 Re.
12. The compound of claim 1, wherein R3 is pyridyl, thienyl, thiazolyl, or pyrazolyl, which is (i) substituted with 1 R10, and (ii) optionally substituted with from 1-2 Re
13. The compound of claim 1, wherein W is selected from the group consisting of
-O-, a bond, -0(C1-C3 alkylene)-, and -(C1-C3 alkylene)O-.
14. The compound of claim 1, wherein A is phenyl, which is (a) substituted with 1 Rf, and (b) optionally substituted with from 1 -2 Re.
15. The compound of claim 1, wherein A is heteroaryl including 5-8 atoms, which is (a) substituted with 1 Rf, and (b) optionally substituted with from 1 -3 Re, provided that the heteroaryl including 5-8 atoms is not [l,2,4]-oxadiazolyl.
16. The compound of claim 1, wherein A is tetrahydroquinolyl or tetrahydroisoquinolyl, which is (a) substituted with from 1 Rf, and (b) optionally substituted with from 1-2 Re.
17. The compound of claim 1 , wherein A is benzo[b]thienyl- 1 , 1 -dioxide, 3,4- dihydro-2H-thiopyrano[2,3-b]pyridyl- 1 , 1-dioxide, or 2,3-dihydrobenzo[b]thienyl- 1 , 1 -dioxide, each of which is optionally substituted with from 1-3 Re.
18. The compound of claim 1 , wherein Rf is -SO2R1.
19. The compound of claim 18, wherein Rn is C1-C10 alkyl, optionally substituted with from 1-2 Ra.
20. The compound of claim 19, wherein Rn is unsubstituted C1-C3 alkyl.
21. The compound of claim 19, wherein Rn is CH3.
22. The compound of claim 19, wherein Rn is C3-Cg alkyl, which is substituted with from 1-2 Ra, wherein Ra at each occurrence is, independently, hydroxyl; C1-C3 alkoxy; NRsRh; halo; arylheterocyclyl including 8-10 atoms, optionally substituted with from 1-3 Rb; cyano; or C(O)OR.
23. The compound of claim 18, wherein Rn is NRsRh.
24. The compound of claim 23, wherein Rs and Rh are each, independently, hydrogen; Ci-Cio alkyl, optionally substituted with from 1-2 Ra; C7-C10 aralkyl, optionally substituted with from 1-3 Rb; or -C(O)R.
25. The compound of claim 18, wherein Rn is heterocyclyl including 5-10 atoms,
C7-Ci0 aralkyl, or C3-C8 cycloalkyl, each of which is optionally substituted with from 1-5 Rb.
26. The compound of claim 1 , wherein Rf is:
(i) heterocyclyl including 5-7 atoms that is substituted with 1 oxo and optionally substituted with from 1 -2 Re; or
(ii) heterocycloalkenyl including 5-7 atoms that is optionally substituted with from 1- 2 Re.
27. The compound of claim 26, wherein Rf is 4,5-dihydrooxazolyl, 2-oxo- imidazolidinyl, 4,5-dihydro-lH-imidazolyl, 1,2,5,6-tetrahydro-pyrimidinyl, 5,6-dihydro-2H-
[l,3]oxazinyl, or 2-oxo-oxazolidinyl.
28. The compound of claim 1, wherein Rf is lH-benzoimidazolyl.
29. The compound of claim 1, wherein R has formula D-I :
(D-I) wherein:
R32 is hydrogen or Re;
W is -O- or a bond; each of R^2 and R^3 is, independently, hydrogen or Re; and one of RA24 and RA25 is -SO2Rn, and the other is hydrogen or Re; provided that only one of RA22, RA23, RA24, and RA25 is Re.
30. The compound of claim 29, wherein R is hydrogen, fluoro, or chloro.
31. The compound of claim 1 , wherein:
R3 is heteroaryl including 5-10 atoms, which is (i) substituted with 1 R10, and (ii) optionally substituted with from 1 -2 Re; and W is a bond; and A has formula (B-9):
wherein: each of R^2 and R^3 is, independently, hydrogen or Re; and one of RA24 and RA25 is -SO2Rn, and the other is hydrogen or Re; provided that only one of RA22, RA23, RA24, and RA25 is Re.
32. The compound of claim 1, wherein:
R3 has formula (A-4):
(A-4)
wherein R is hydrogen or Re; and
W is a bond; and
A is heteroaryl including 5-8 atoms, which is (a) substituted with 1 Rf, and (b) optionally substituted with from 1-3 Re, provided that the heteroaryl including 5-8 atoms is not [l,2,4]-oxadiazolyl.
33. The compound of claim 1, wherein:
R3 has formula (A-4):
(A-4)
wherein R is hydrogen or Re; and W is a bond; and
A is tetrahydroquinolyl or tetrahydroisoquinolyl, which is (a) substituted with from 1 Rf, and (b) optionally substituted with from 1 -2 Re.
34. The compound of claim 1, wherein: R3 has formula (A-4):
(A-4)
wherein R , 32 . is hydrogen or Re; and
W is a bond; and
A is benzo[b]thienyl- 1,1 -dioxide, 3,4-dihydro-2H-thiopyrano[2,3-b]pyridyl-l,l- dioxide, or 2,3-dihydrobenzo[b]thienyl- 1,1 -dioxide, each of which is optionally substituted with from 1-3 Re.
35. The compound of claim 1, wherein R has formula D-I :
(D-I) wherein:
R32 is hydrogen or Re;
W is -O- or a bond; each of R^2 and R^3 is, independently, hydrogen or Re; and
one ofRA24 and RA25 is:
(i) heterocyclyl including 5-7 atoms that is substituted with 1 oxo and optionally substituted with from 1 -2 Re; or
(ii) heterocycloalkenyl including 5-7 atoms or lH-benzoimidazolyl, each of which is optionally substituted with from 1 -2 Re; and the other is hydrogen or Re; provided that only one of RA22, RA23, RA24, and RA25 is Re.
36. The compound of claim 1, wherein R3 has formula F:
(F)
wherein Re at each occurrence is, independently, hydrogen; halo; Ci-C6 alkyl, optionally substituted with from 1-2 Ra; CrC3 haloalkyl; CrC3 alkoxy; NRsRh; phenyl; or 4- fluorophenyl.
37. The compound of any one of claims 1 to 36, wherein R1 is hydrogen.
38. The compound of any one of claims 1 to 37, wherein R2 is hydrogen.
39. The compound of any one of claims 1 to 37, wherein R is: (ii) Ci-C6 alkyl that is optionally substituted with from 1-2 Ra; or (iii) C7-C10 aralkyl that is optionally substituted with from 1-3 Rb; or (vii) -XR8.
40. The compound of any one of claims 1 to 39, wherein each of R4, R5 and R6 is hydrogen.
41. The compound of any one of claims 1 to 40, wherein R7 is chloro, cyano, Q- C6 alkyl, Ci-C3 haloalkyl, Ci-C6 alkoxy, C(O)OR, C(O)NRsRh, or SO2R31.
42. The compound of claim 41, wherein R7 is C1-C3 haloalkyl.
43. The compound of claim 42, wherein R7 is CF3.
44. The compound of claim 1, wherein the compound is selected from the group consisting of:
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline; 3-methyl-4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline; 4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline; 4- {3-[3-(benzylsulfonyl)phenoxy]phenyl} -3-methyl-8-(trifluoromethyl)quinoline;
3-methyl-4-{3-[2-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline; 4-{3-[3-(isobutylsulfonyl)phenoxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline; 3-methyl-4-(3- {3-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-8- (trifluoromethyl)quinoline; 3-[(2- {3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan- 1 -ol;
4-{3-[3-chloro-5-(propylsulfonyl)phenoxy]phenyl}-3-methyl-8- (trifluoromethyl)quinoline;
3-[(3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan- 1 -ol;
4-(3- {3-[(3-methoxypropyl)sulfonyl]phenoxy}phenyl)-3-methyl-8- (trifluoromethyl)quinoline;
4-(3- {3-chloro-5-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-3-methyl-8- (trifluoromethyl)quinoline; 3-[(4- {3-[3-methyl-8-(trifluoromethyl)quinolm-4- yl]phenoxy}phenyl)sulfonyl]propan- 1 -ol;
3-methyl-4- {3-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline; 2-methyl-4-[(3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]butan-2-ol; 3-benzyl-8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
3-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline; 4- {3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl} -3-methyl-8- (trifluoromethyl)quinoline;
8-chloro-3-methyl-4- {3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline; 4- {3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl} -3-methyl-8-
(trifluoromethyl)quinoline; 2,2-dimethyl-3-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan- 1 -ol;
4-[(3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]butan- l-ol;
5-[(3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]pentan- 1 -ol;
3-benzyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-benzyl-4-{3-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline; 3-benzyl-4- {3-[3-(isobutylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinoline;
3 -benzyl-4-(3 - {3 - [(3 -methylbutyl)sulfonyl]phenoxy } phenyl)- 8- (trifluoromethyl)quinoline;
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-[(3- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan- 1 -ol;
3-benzyl-4-{3-[4-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-benzyl-4-{3-[4-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[4-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[4-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline; 4- {3-[4-(isopropylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinoline;
4-{3-[4-(isobutylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-(3- {4-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-8-(trifluoromethyl)quinoline;
4-(3- {4-[(2-fluorobenzyl)sulfonyl]phenoxy}phenyl)-8-(trifluoromethyl)quinoline;
3-[(4- {3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]propan- 1 -ol; 4-{3-[4-(butylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
2- [(4- {3 - [8-(trifluoromethyl)quinolin-4-yl]phenoxy } phenyl)sulfonyl] ethanol;
4-{3-[4-(allylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline; 4- {3-[3-(isopropylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinoline;
4-{3-[3-(isobutylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-(3- {3-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-8-(trifluoromethyl)quinoline;
4-{3-[3-(cyclopentylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[3-(benzylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline; 3-[(3- {3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]propan- 1 -ol; ethyl (4- {[(4- {3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]methyl}phenyl)acetate;
4-(3- {4-[(2,5-dimethylbenzyl)sulfonyl]phenoxy}phenyl)-8- (trifluoromethyl)quinoline; 4- {3-[4-(methylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinoline;
3-benzyl-4-{3-[4-(isopropylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-benzyl-4-{3-[4-(isobutylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-benzyl-4-(3-{4-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-8- (trifluoromethyl)quinoline; 3-benzyl-4-(3-{4-[(2-fluorobenzyl)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline;
3-[(4- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan- 1 -ol;
4-{3-[4-(allylsulfonyl)phenoxy]phenyl}-3-benzyl-8-(trifluoromethyl)quinoline; 3-benzyl-4- {3-[4-(butylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(benzylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline; 3-benzyl-4-(3-{3-[(3-methoxypropyl)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline;
3-benzyl-4- {3-[3-(cyclopentylsulfonyl)phenoxy]phenyl} -8- (trifluoromethyl)quinoline;
4- [(3 - {3 - [3 -benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy } phenyl)sulfonyl] -2- methylbutan-2-ol;
4-{3-[4-methyl-2-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[4-methyl-3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[2-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carbonitrile;
4-(3-{3-[(3-hydroxy-3-methylbutyl)sulfonyl]phenoxy}phenyl)-8- (trifluoromethyl)quinoline-3-carbonitrile;
4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carbonitrile; 4- {3-[3-(ethylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinoline-3-carbonitrile; 4-{3-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carbonitrile;
4- { 3 - [3 - (methylsulfonyl)phenoxy]phenyl } - 8 -(trifluoromethyl)quinoline- 3 - carbonitrile; [(4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]acetic acid;
N- {2-[(4- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy} phenyl)sulfonyl] ethyl} propan-2-amine;
4-[3-(4-{[2-(isopropylamino)ethyl]sulfonyl}phenoxy)phenyl]-8- (trifluoromethyl)quinoline-3 -carbonitrile; ethyl 4- {3-[3-(methylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinoline-3- carboxylate;
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-carboxylic acid; 4-{3-[2-fluoro-4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carbonitrile;
4- { 3 - [4-methoxy-3 - (methylsulfonyl)phenoxy ]phenyl } - 3 -methyl- 8 - (trifluoromethyl)quinoline;
3 -methyl-4- (3 - { 3 - [(methylsulfony l)methyl]phenoxy } phenyl) - 8 - (trifluoromethyl)quinoline;
8-chloro-4-{3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl}-3-propylquinoline;
3-benzyl-4- {3-[3-(morpholin-4-ylsulfonyl)phenoxy]phenyl} -8- (trifluoromethyl)quinoline;
4-{3-[3-(morpholin-4-ylsulfonyl)phenoxy]phenyl}-3-phenyl-8- (trifluoromethyl)quinoline;
4- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy} -N- methylbenzenesulfonamide;
4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N- ethylbenzenesulfonamide; 4- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy} -N,N- dimethylbenzenesulfonamide;
4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N-ethyl-N- methylbenzenesulfonamide;
4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N,N- diethylbenzenesulfonamide; 3-benzyl-4- {3-[4-(pyrrolidin- 1 -ylsulfonyl)phenoxy]phenyl} -8- (trifluoromethyl)quinoline;
3-benzyl-4- {3-[4-(piperidin- l-ylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline; 3-benzyl-4-(3- {4-[(4-methylpiperazin- 1 -yl)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline;
4- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy} -N- propylbenzenesulfonamide;
4- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N- isopropylbenzenesulfonamide;
N-benzyl-4- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide;
3-benzyl-4- {3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl} -8- (trifluoromethyl)quinoline; 3- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N- methylbenzenesulfonamide;
3- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy} -N5N- dimethylbenzenesulfonamide;
3- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N-ethyl-N- methylbenzenesulfonamide;
3- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy} -N5N- diethylbenzenesulfonamide;
3-benzyl-4- {3-[3-(pyrrolidin- 1 -ylsulfonyl)phenoxy]phenyl} -8- (trifluoromethyl)quinoline; 3-benzyl-4- {3-[3-(piperidin- 1 -ylsulfonyl)phenoxy]phenyl} -8-
(trifluoromethyl)quinoline;
3-benzyl-4-(3- {3-[(4-methylpiperazin- 1 -yl)sulfonyl]phenoxy}phenyl)-8- (trifluoromethyl)quinoline;
3- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N- propylbenzenesulfonamide;
3- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy} -N- isopropylbenzenesulfonamide;
N-benzyl-3- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide; 3-methyl-4- {3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline; 8-chloro-3-methyl-4- {3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl}quinoline;
8-chloro-3-isopropyl-4- {3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl}quinoline;
4- [3 -(8-chloro-3 -methylquinolin-4-yl)phenoxy] -N,N-dimethylbenzenesulfonamide;
4-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-ethyl-N- methylbenzenesulfonamide;
8-chloro-3-methyl-4- {3-[4-(pyrrolidin-l-ylsulfonyl)phenoxy]phenyl}quinoline;
4-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-methylbenzenesulfonamide;
S-chloro^- IS-fS-fluoro-S-Cmorpholin^-ylsulfony^phenoxylphenylj-S- methylquinoline; 4-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-propylbenzenesulfonamide;
N-benzyl-4-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]benzenesulfonamide;
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-methylbenzenesulfonamide;
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-ethylbenzenesulfonamide;
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-propylbenzenesulfonamide; 3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-isopropylbenzenesulfonamide;
N-benzyl-3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]benzenesulfonamide;
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N,N-dimethylbenzenesulfonamide;
3 - [3 -(8-chloro-3 -methylquinolin-4-yl)phenoxy] -N-ethyl-N- methylbenzenesulfonamide; S-chloro-S-methyl^- jS-fS-Cpyrrolidin-l-ylsulfony^phenoxylphenyllquinoline;
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N,N-diethylbenzenesulfonamide;
8-chloro-3-methyl-4- {3-[3-(piperidin-l-ylsulfonyl)phenoxy]phenyl}quinoline;
8-chloro-3-methyl-4-(3- {3-[(4-methylpiperazin- 1 - yl)sulfonyl]phenoxy}phenyl)quinoline; 8-chloro-3-methyl-4- {3-[3-(piperazin-l-ylsulfonyl)phenoxy]phenyl}quinoline;
8-chloro-3-methyl-4- {3-[3-(morpholin-4-ylsulfonyl)phenoxy]phenyl}quinoline;
8-chloro-3-methyl-4- {3-[3-(morpholin-4-ylsulfonyl)phenoxy]phenyl}quinoline; tert-butyl 4-({3-[3-(8-chloro-3-methylquinolin-4- yl)phenoxy]phenyl} sulfonyl)piperazine- 1 -carboxylate; 3 - [3 -(8-chloro-3 -methylquinolin-4-yl)phenoxy] -N-(2- hydroxyethyl)benzenesulfonamide;
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-(2-hydroxyethyl)-N- methylbenzenesulfonamide;
3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N- propylbenzenesulfonamide; N-ethyl-N-methyl-3 - {3 - [3 -methyl- 8-(trifluoromethyl)quino lin-4- yl]phenoxy}benzenesulfonamide;
N-(2-hydroxyethyl)-N-methyl-3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide; N-(2-hydroxyethyl)-3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide;
N-(2-hydroxypropyl)-3 - {3 - [3 -methyl- 8-(trifluoromethyl)quino lin-4- yl]phenoxy}benzenesulfonamide;
N-(2-hydroxy-2-methylpropyl)-3- {3-[3-methyl-8-(trifluoromethyl)quinolm-4- yl]phenoxy}benzenesulfonamide;
N-(2-hydroxy-2-methylpropyl)-N-methyl-3- {3-[3-methyl-8- (trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide;
N-(2-methoxy-2-methylpropyl)-3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide; N-(2-methoxy-2-methylpropyl)-N-methyl-3- {3-[3-methyl-8-
(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide;
N-(2-hydroxy- l, l-dimethylethyl)-3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide;
4-[3-(6-fluoro-pyridin-2-yloxy)-phenyl]-3-methyl-8-trifluoromethyl-quinoline; 3-methyl-4-(3- {[6-(methylsulfonyl)pyridin-2-yl]oxy}phenyl)-8-
(trifluoromethyl)quinoline;
3-methyl-4-[3-(4-methylsulfanyl-pyridin-2-yloxy)-phenyl]-8-trifluoromethyl- quinoline;
3-methyl-4-(3- {[4-(methylsulfonyl)pyridin-2-yl]oxy}phenyl)-8- (trifluoromethyl)quinoline;
2-methyl-4-[(6- {3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}pyridin-2- yl)sulfonyl]butan-2-ol;
4-[3-({6-[(3-methoxy-3-methylbutyl)sulfonyl]pyridin-2-yl}oxy)phenyl]-3-methyl-8- (trifluoromethyl)quinoline; 3-methyl-4-(3- {[5-(methylsulfonyl)pyridin-3-yl]oxy}phenyl)-8-
(trifluoromethyl)quinoline;
3- Methyl-4-[3-(2-methylsulfanyl-pyridin-4-yloxy)-phenyl]-8-trifluoromethyl- quinoline;
3-methyl-4-(3- {[2-(methylsulfonyl)pyridin-4-yl]oxy}phenyl)-8- (trifluoromethyl)quinoline; 7-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-3,4-dihydro-2H- thiopyrano[2,3-b]pyridine 1 , 1 -dioxide;
5-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-3,4-dihydro-2H- thiopyrano[2,3-b]pyridine 1 , 1 -dioxide; 4-[3-(4,6-Dichloro- 1 -oxy-pyridin-2-yloxy)-phenyl]-3-methyl-8-trifluoromethyl- quinoline;
4-(3- {[4-chloro-6-(methylsulfonyl)-l-oxidopyridin-2-yl]oxy}phenyl)-3-methyl-8- (trifluoromethyl)quinoline;
4-[3-(4-Chloro-6-memanesulfonyl-pyridin-2-yloxy)-phenyl]-3-methyl-8- trifluoromethyl-quinoline;
3,5-dichloro-2-fluoro-6-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}pyridin-4-amine;
3,5-dichloro-2-(methylsulfonyl)-6-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}pyridin-4-amine; 2-methanesulfonyl-6-[3-(3-methyl-8-trifluoromethyl-quinolin-4-yl)-phenoxy]- pyridin-4-ylamine;
4-(3- {[4-fluoro-6-(methylsulfonyl)pyridin-2-yl]oxy}phenyl)-3-methyl-8- (trifluoromethyl)quinoline;
4-(3- {[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-(trifluoromethyl)quinoline; 4-(3- {[4-(methylsulfonyl)benzyl]oxy}phenyl)-8-(trifluoromethyl)quinoline;
3-benzyl-4-(3-{[4-(methylsulfonyl)benzyl]oxy}phenyl)-8-(trifluoromethyl)quinoline;
3-benzyl-4-(3-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-(trifluoromethyl)quinoline;
3-Methyl-4-{3-[3-(methylsulfonyl)benzyl]phenyl}-8-(trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(ethylsulfonyl)benzyl]phenyl}-8-(trifluoromethyl)quinoline; 3-[3-(3-methyl-8-trifluoromethyl-quinolin-4-yl)-benzyl]-benzenesulfonic acid pentafluorophenyl ester;
3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]benzyl} -N- propylbenzenesulfonamide;
N-ethyl-N-methyl-3 - {3 - [3 -methyl- 8-(trifluoromethyl)quinolin-4- yl]benzyl}benzenesulfonamide;
N-(2-hydroxyethyl)-N-methyl-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]benzyl}benzenesulfonamide; l-(3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]benzyl}phenyl)imidazolidin-2- one; 3-(3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]benzyl}phenyl)- 1 ,3-oxazolidin-2- one; 8-chloro-3-methyl-4-[3-(3-nitro-phenoxy)-phenyl]-quinoline;
3 - [3 -(8-chloro-3 -methyl-quinolin-4-yl)-phenoxy] -phenylamine;
N-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}benzenesulfonamide;
N-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}methanesulfonamide; N- {3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl} ethanesulfonamide; methyl {3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}carbamate; ethyl {3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}carbamate; isobutyl {3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}carbamate;
N-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}-N-ethylurea; N- {3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl} -N-isopropylurea;
N-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}-N-phenylurea;
N-(2-chloroethyl)-N- {3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}urea;
2-chloroethyl {3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}carbamate ;
8-chloro-3-methyl-4- {3-[3-(5-methyl-4,5-dihydro-l,3-oxazol-2- yl)phenoxy]phenyl}quinoline; l-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}-3-methylimidazolidin-2- one;
1 - {3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl} -3-ethylimidazolidin-2- one; 8-chloro-4- {3-[3-(4-isopropyl-4,5-dihydro-l,3-oxazol-2-yl)phenoxy]phenyl}-3- methylquinoline;
8-chloro-3-methyl-4- {3-[3-(4-propyl-4,5-dihydro-l,3-oxazol-2- yl)phenoxy]phenyl} quinoline;
8-chloro-4-{3-[3-(4,4-dimethyl-4,5-dihydro-l,3-oxazol-2-yl)phenoxy]phenyl}-3- methylquinoline;
3-{3-[3-(8-chloro-3-methyl-quinolin-4-yl)-phenoxy]-phenyl}-2-oxo-imidazolidin-l- yl)-acetic acid methyl ester;
(3- {3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl} -2-oxoimidazolidin- 1 - yl)acetic acid; 4-[(3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]butan-
2-ol;
1 -[(3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]pentan-3-ol; l-[(3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]hexan- 3-ol;
4-({3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}sulfonyl)butan-2-ol; 4-({3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}sulfonyl)-2-methylbutan- 2-ol;
4-(3- {3-[3-(tert-Butyl-dimethyl-silanyloxy)-propane- 1 -sulfonylj-phenoxy} -phenyl)- 8-chloro-3-methyl-quinoline; 3-( {3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl} sulfonyl)propan- 1 -ol;
N-{3'-[3-cyano-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}methanesulfonamide;
4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-carbonitrile;
4-[3'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-carbonitrile;
N-{3'-[3-cyano-8-(trifluoromethyl)quinolin-4-yl]biphenyl-4-yl}methanesulfonamide; N- {3'-[3-cyano-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl} -A- methylbenzenesulfonamide;
4-[4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-carbonitrile;
4-{3-[l-(phenylsulfonyl)-lH-indol-3-yl]phenyl}-8-(trifluoromethyl)quinoline-3- carbonitrile; 3 '- [3 -cyano- 8-(trifluoromethyl)quinolin-4-yl] -N-methylbiphenyl-3 -sulfonamide;
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-3-(lH-tetrazol-5-yl)-8- (trifluoromethyl)quinoline;
3 -methyl-4- [3 -( { [ 1 -(methylsulfonyl)- 1 ,2,3 ,4-tetrahydroquinolin-5- yl]oxy}methyl)phenyl]-8-(trifluoromethyl)quinoline; 3-benzyl-4-[3-({[l -(methylsulfonyl)- l,2,3,4-tetrahydroquinolin-5- yl]oxy}methyl)phenyl]-8-(trifluoromethyl)quinoline;
3-benzyl-4-[3-({[2-(methylsulfonyl)-l,2,3,4-tetrahydroisoquinolin-5- yl]oxy}methyl)phenyl]-8-(trifluoromethyl)quinoline;
3-methyl-4-[3-({[2-(methylsulfonyl)-l,2,3,4-tetrahydroisoquinolin-5- yl]oxy}methyl)phenyl]-8-(trifluoromethyl)quinoline;
Methyl 2-(3'-(3-cyano-8-(trifluoromethyl)quinolin-4-yl)biphenyl-3-ylthio)acetate;
({3'-[3-cyano-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)acetic acid;
4- { 3 - [3 - (methylsulfonyl)phenoxy]phenyl } - 8 -(trifluoromethyl)quinoline- 3 - carboxamide; N-methyl-4- {3-[3-(methylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinoline-3- carboxamide;
N-ethyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carboxamide;
3-methyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline; 3-benzyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline; 3-ethyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide;
4-[3'-(methylsulfonyl)biphenyl-3-yl]-3-propyl-8-(trifluoromethyl)quinoline;
3-isopropyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline; 3-chloro-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[3-(2-chloro-pyrimidin-4-yl)-phenyl]-3-methyl-8-trifluoromethyl-quinoline;
4-[3-(6-chloro-pyrimidin-4-yl)-phenyl]-3-methyl-8-trifluoromethyl-quinoline;
3-methyl-4-[3-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)phenyl]-8- (trifluoromethyl)quinoline; 3'-[3-benzyl-8-(trifluoromethyl)quinolm-4-yl]-N-(2-hydroxy-2- methylpropyl)biphenyl-3-sulfonamide;
3 '- [3 -benzyl-8-(trifluoromethyl)quinolin-4-yl] -N-(2-hydroxyethyl)biphenyl-3 - sulfonamide;
3-benzyl-4-[3'-(morpholin-4-ylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline; 3'-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-N-(2-hydroxyethyl)-N- methylbiphenyl-3-sulfonamide;
3-benzyl-4-[3'-chloro-4'-(propylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3 -benzyl-4- [3 '-chloro-4'-(isopropylsulfonyl)biphenyl-3 -yl] -8- (trifluoromethyl)quinoline; 3 -benzyl-4- [3 '-chloro-4'-(isobutylsulfonyl)biphenyl-3 -yl] -8-
(trifluoromethyl)quinoline;
3-benzyl-4-{3'-chloro-4'-[(3-methylbutyl)sulfonyl]biphenyl-3-yl}-8- (trifluoromethyl)quinoline;
3-benzyl-4-[3'-chloro-4'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline; 4-[4'-(allylsulfonyl)-3'-chlorobiphenyl-3-yl]-3-benzyl-8-(trifluoromethyl)quinoline;
3-({3'-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-3-chlorobiphenyl-4- yl} sulfonyl)propan- 1 -ol;
3-benzyl-4-[3'-(propylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3-benzyl-4-[3'-(isopropylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline; 3-benzyl-4-[3'-(isobutylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3-benzyl-4-{3'-[(3-methylbutyl)sulfonyl]biphenyl-3-yl}-8-(trifluoromethyl)quinoline;
3 -benzyl-4- [3 '-(ethylsulfonyl)biphenyl-3 -yl] -8-(trifluoromethyl)quino line;
4-[3'-(allylsulfonyl)biphenyl-3-yl]-3-benzyl-8-(trifluoromethyl)quinoline;
3-( {3'-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl} sulfonyl)propan- 1 - ol;
3-benzyl-4-{3-[5-(methylsulfonyl)pyridin-3-yl]phenyl}-8-(trifluoromethyl)quinoline; 3-benzyl-4-[4'-(pyrrolidin-l-ylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3-benzyl-4-[3'-(pyrrolidin-l-ylsulfonyl)-5'-(trifluoromethyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline;
4-[3'-(allylsulfonyl)-5'-(trifluoromethyl)biphenyl-3-yl]-3-benzyl-8- (trifluoromethyl)quinoline;
S-benzyl^-tS'-CisobutylsulfonyO-S'-Ctrifluoromethy^biphenyl-S-yll-δ- (trifluoromethyl)quinoline;
3-benzyl-4-[3'-(propylsulfonyl)-5'-(trifluoromethyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline; S-benzyl^-tS'-CCS-methylbutyOsulfonylJ-S'-CtrifluoromethyObiphenyl-S-yll-S-
(trifluoromethyl)quinoline;
3-{[3'-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-5-(trifluoromethyl)biphenyl-3- yl]sulfonyl}propan- 1 -ol;
3-benzyl-4-[3'-(isopropylsulfonyl)-5'-(trifluoromethyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline;
4-[3'-(ethylsulfonyl)biphenyl-3-yl]-3-methyl-8-(trifluoromethyl)quinoline;
3-methyl-4-[3'-(propylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3-({3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propan-l- ol; 4-[3'-chloro-4'-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline;
4-[3'-chloro-4'-(ethylsulfonyl)biphenyl-3-yl]-3-methyl-8-(trifluoromethyl)quinoline;
4-[3'-chloro-4'-(propylsulfonyl)biphenyl-3-yl]-3-methyl-8-(trifluoromethyl)quinoline;
3 -( {3 -chloro-3 '- [3 -methyl- 8-(trifluoromethyl)quinolin-4-yl]biphenyl-4- yl}sulfonyl)propan-l-ol;
3-methyl-4-{3-[5-(methylsulfonyl)pyridin-3-yl]phenyl}-8-(trifluoromethyl)quinoline;
3-methyl-4-[4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-{3-[5-(ethylsulfonyl)pyridin-3-yl]phenyl}-3-methyl-8-(trifluoromethyl)quinoline;
4-[4'-(allylsulfonyl)-3'-chlorobiphenyl-3-yl]-3-methyl-8-(trifluoromethyl)quinoline; 3-benzyl-4-[4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3-benzyl-4-{3-[5-(ethylsulfonyl)pyridin-3-yl]phenyl}-8-(trifluoromethyl)quinoline;
3 -benzyl-4- [3 '-chloro-4'-(methylsulfonyl)biphenyl-3 -yl]- 8-(trifluoromethyl)quinoline;
3-methyl-4- {3'-[(l£)-prop- 1 -en- 1 -ylsulfonyl]biphenyl-3-yl} -8- (trifluoromethyl)quinoline; 4-[3'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[3'-(propylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline; 4- {3'-[(l£)-prop- 1 -en- 1 -ylsulfonyl]biphenyl-3-yl} -8-(trifluoromethyl)quinoline;
3-( {3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl} sulfonyl)propan- 1 -ol;
4-[3'-chloro-4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[3'-chloro-4'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline; 4-[3'-chloro-4'-(propylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-{3'-chloro-4'-[(l£)-prop-l-en-l-ylsulfonyl]biphenyl-3-yl}-8- (trifluoromethyl)quinoline;
3-( {3-chloro-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-4-yl} sulfonyl)propan- 1 -ol;
4-{3-[5-(methylsulfonyl)pyridin-3-yl]phenyl}-8-(trifluoromethyl)quinoline; 4-[4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4- {3-[5-(ethylsulfonyl)- 1 -oxidopyridin-3-yl]phenyl} -8-(trifluoromethyl)quinoline;
4-{3-[5-(ethylsulfonyl)pyridin-3-yl]phenyl}-8-(trifluoromethyl)quinoline;
N-methyl-3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide;
N-ethyl-3 '- [3 -methyl- 8-(trifluoromethyl)quinolin-4-yl]biphenyl-3 -sulfonamide; 3 '- [3 -methyl-8-(trifluoromethyl)quinolin-4-yl] -N-propylbiphenyl-3 -sulfonamide;
N-isopropyl-3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide;
3-methyl-4-[3'-(pyrrolidin-l-ylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
N-methyl-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide;
N-ethyl-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide; N-propyl-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide;
N-isopropyl-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide;
4-[3'-(pyrrolidin-l-ylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[4'-methyl-3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[3'-(ethylsulfonyl)-4'-methylbiphenyl-3-yl]-8-(trifluoromethyl)quinoline; 4-[4'-(methylsulfonyl)-2'-(trifluoromethyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline;
4-[4'-(ethylsulfonyl)-2'-(trifluoromethyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3-methyl-4-[4'-methyl-3'-(methylsulfonyl)biphenyl-3-yl]-8- (trifluoromethyl)quinoline; 3-methyl-4-[4'-(methylsulfonyl)-2'-(trifluoromethyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline;
4-[4'-(ethylsulfonyl)-2'-(trifluoromethyl)biphenyl-3-yl]-3-methyl-8- (trifluoromethyl)quinoline;
3-benzyl-4-[3-(l , 1 -dioxido- 1 -benzothien-4-yl)phenyl]-8-(trifluoromethyl)quinoline; 3-methyl-4- {3-[2-(methylsulfonyl)pyrimidin-4-yl]phenyl} -8 (trifluoromethyl)- quinoline; 4-[3-(l , 1 -dioxido- 1 -benzothien-3-yl)phenyl]-3-methyl-8-(trifluoromethyl)quinoline;
4- [3 -(6-Methanesulfonyl-pyrimidin-4-yl)-phenyl] -3 -methyl- 8-trifluoromethyl- quinoline;
3-benzyl-4-(3-{[5-(methylsulfonyl)pyridm-3-yl]ethynyl}phenyl)-8- (trifluoromethyl)quinoline;
3-benzyl-4-(3-{[4-(pyrrolidm-l-ylsulfonyl)phenyl]ethynyl}phenyl)-8- (trifluoromethyl)quinoline;
3 -benzyl-4-(3 - { [3 -(pyrrolidin- 1 -ylsulfonyl)phenyl] ethynyl} phenyl)-8- (trifluoromethyl)quinoline; 3-benzyl-4-(3- {[3 -(pyrrolidin- 1 -ylsulfonyl)-5-
(trifluoromethyl)phenyl]ethynyl}phenyl)-8-(trifluoromethyl)quinoline;
4- {3- [(1 , 1 -dioxido-2,3-dihydro- 1 -benzothien-6-yl)oxy]phenyl} -8- (trifluoromethyl)quinoline;
3 - [3 -benzyl- 8-(trifluoromethyl)quinolin-4-yl] -N-(2-hydroxy-2- phenylethyl)benzamide;
3- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy} -N-(3- hydroxypropyl)benzamide;
3-benzyl-4-{3-[3-(5-methyl-4,5-dihydro-l,3-oxazol-2-yl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline; 3-benzyl-4-{3-[3-(4,5-dihydro-l,3-oxazol-2-yl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(5-phenyl-4,5-dihydro-l,3-oxazol-2-yl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(4-methyl-4,5-dihydro-l,3-oxazol-2-yl)phenoxy]phenyl}-8- trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(4,4-dimethyl-4,5-dihydro-l,3-oxazol-2-yl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(5,6-dihydro-4H-l,3-oxazin-2-yl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline; 3-benzyl-4-{3-[3-(4,5-dihydro-lH-imidazol-2-yl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline;
4-{3-[3-(lH-benzimidazol-2-yl)phenoxy]phenyl}-3-benzyl-8- (trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(4-methyl-4,5-dihydro-lH-imidazol-2-yl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline; 3-benzyl-4-{3-[3-(l-methyl-4,5-dihydro-lH-imidazol-2-yl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(l,4,5,6-tetrahydropyrimidin-2-yl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline; 3-benzyl-4- {3-[3-(l -methyl- 1 ,4,5,6-tetrahydropyrimidin-2-yl)phenoxy]phenyl} -8-
(trifluoromethyl)quinoline;
3-benzyl-4-[3-(3-methyl-l,2,4-oxadiazol-5-yl)phenyl]-8-(trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(4-fluorophenyl)-l,2,4-oxadiazol-5-yl]phenyl}-8- (trifluoromethyl)quinoline; 2-(5- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl} - 1 ,2,4-oxadiazol-3- yl)acetamide;
3-benzyl-4-[3-(3-phenyl-l,2,4-oxadiazol-5-yl)phenyl]-8-(trifluoromethyl)quinoline;
8-bromo-3-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
3-methyl-8-(methylsulfonyl)-4- {3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline; 3-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
4-[3'-(ethylsulfonyl)-4'-methylbiphenyl-3-yl]-3-methyl-8-(trifluoromethyl)quinoline;
4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carbonitrile;
8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carbonitrile; 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide;
4-[4'-bromo-3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[4'-bromo-3'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[2',5'-difluoro-4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[4'-(ethylsulfonyl)-2',5'-difluorobiphenyl-3-yl]-8-(trifluoromethyl)quinoline; 4-[2',4'-difluoro-5'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[5'-(ethylsulfonyl)-2',4'-difluorobiphenyl-3-yl]-8-(trifluoromethyl)quinoline;
2-methyl-4- [(3 - {3 - [8-(trifluoromethyl)quinolin-4-yl]phenoxy } phenyl)sulfonyl]butan- 2-ol;
4-{3-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carboxamide;
4-{3-[2-fluoro-4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carboxamide;
4-{3-[4-chloro-3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-[4'-bromo-3'-(ethylsulfonyl)biphenyl-3-yl]-3-methyl-8-(trifluoromethyl)quinoline; 4-[2',5'-difluoro-4'-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline; 4-[4'-(ethylsulfonyl)-2',5'-difluorobiphenyl-3-yl]-3-methyl-8- (trifluoromethyl)quinoline;
4-[2',4'-difluoro-5'-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8- (trifluoromethyl)quinoline; 4-[5'-(ethylsulfonyl)-2',4'-difluorobiphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline;
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carboxamide;
4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carboxamide;
3-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile;
4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carboxamide;
4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-carboxylic acid; Ethyl 4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3- carboxylate;
4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-carboxamide;
4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carboxamide; 4-[4'-bromo-3'-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline;
4- [3 '-(isopropylsulfonyl)biphenyl-3 -yl] - 8-(trifluoromethyl)quinoline-3 -carbonitrile; ethyl 8-fluoro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxylate;
8-fluoro-4- {3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide; 8-chloro-4- {3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
4-[4'-methoxy-3'-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8- (trifluoromethyl)quinoline;
4-[4'-methoxy-3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3 -( {4-methyl-3 '- [3 -methyl- 8-(trifluoromethyl)quinolin-4-yl]biphenyl-3 - yl}sulfonyl)propan-l-ol;
3 -( {4-methyl-3 '- [8-(trifluoromethyl)quinolin-4-yl]biphenyl-3 -yl} sulfonyl)propan- 1 - ol;
8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide;
8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxylic acid; 3-({4-chloro-3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3- yl} sulfonyl)propan- 1 -ol; 4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carboxamide;
4-[3'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-carboxamide;
3-( {4-bromo-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl} sulfonyl)propan- 1 - ol;
4-{3'-[(dimethylamino)sulfonyl]biphenyl-3-yl}-8-(trifluoromethyl)quinoline-3- carboxamide;
8-chloro-4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}quinoline;
8-chloro-4-{3-[3-(propylsulfonyl)phenoxy]phenyl}quinoline; 3-( {4-chloro-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl} sulfonyl)propan- 1 -ol;
4- [3 '-(isopropylsulfonyl)biphenyl-3 -yl] - 8-(trifluoromethyl)quinoline;
8-chloro-4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}quinoline;
4-[3'-(aminosulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-carboxamide;
2-methyl-4-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)butan-2-ol; 2-methyl-4-({3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3- yl} sulfonyl)butan-2-ol;
8-cyano-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide;
4-(3- {3-[(dimethylamino)sulfonyl]phenoxy}phenyl)-8-(trifluoromethyl)quinoline-3- carboxamide; 4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-[(3- {3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]propan- 1 -amine;
N-methyl-3-(3-(3-(8-(trifluoromethyl)quinolin-4-yl)phenoxy)phenylsulfonyl)propan- 1 -amine;
3-[(3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan- 1 -amine;
N-methyl-3-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan- 1 -amine;
N-ethyl-3-[(3- {3-[3-methyl-8-(trifluoromethyl)quinolm-4- yl]phenoxy}phenyl)sulfonyl]propan- 1 -amine; N-isopropyl-3-[(3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan- 1 -amine;
N-ethyl-3-[(3- {3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]propan- 1 -amine;
N-isopropyl-3-(3-(3-(8-(trifluoromethyl)quinolin-4- yl)phenoxy)phenylsulfonyl)propan- 1 -amine;
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline; 3-[(3- {4-chloro-3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan- 1 -ol;
4-{2-chloro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline; 4- {2-chloro-5-[4-(methylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinoline;
4-{2-chloro-5-[4-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4- {2-chloro-5- [4-(isopropylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinoline;
4-{5-[4-(ethylsulfonyl)phenoxy]-2-fluorophenyl}-8-(trifluoromethyl)quinoline;
4- {2-fluoro-5- [4-(isopropylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinoline; 4-{2-chloro-5-[2-fluoro-4-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline;
4-{5-[3-(ethylsulfonyl)phenoxy]-2-fluorophenyl}-8-(trifluoromethyl)quinoline;
4-{2-fluoro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{2-fluoro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline;
4-{2-chloro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline;
3-[(4- {4-chloro-3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan- 1 -ol; 4-{2-fluoro-5-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4- {2-chloro-5-[2-chloro-4-(methylsulfonyl)phenoxy]phenyl} -8- (trifluoromethyl)quinoline;
[(4-{4-chloro-3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]acetonitrile; 4- {3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl} -8-(methylsulfonyl)quinoline;
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline;
4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline;
3-[(3- {3-[8-(methylsulfonyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]propan- 1 -ol;
4-{3-[4-(ethylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline; 8-(methylsulfonyl)-4-{3-[4-(propylsulfonyl)phenoxy]phenyl}quinoline;
4-{3-[4-(isopropylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline;
8-(methylsulfonyl)-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
8-(methylsulfonyl)-4-{3-[4-(methylsulfonyl)phenoxy]phenyl}quinoline;
4-{3-[2-fluoro-4-(methylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline; 3-(methylsulfonyl)-4- {3-[3-(methylsulfonyl)phenoxy]phenyl} -8-
(trifluoromethyl)quinoline; 3-(methylsulfonyl)-4- {3-[3-(propylsulfonyl)phenoxy]phenyl} -8- (trifluoromethyl)quinoline;
4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-3-(methylsulfonyl)-8- (trifluoromethyl)quinoline; 4- {3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl} -3-(methylsulfonyl)-8-
(trifluoromethyl)quinoline;
4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-3-(methylsulfonyl)-8- (trifluoromethyl)quinoline;
4- {3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl} -3-methyl-8- (trifluoromethyl)quinoline;
8-chloro-3-isopropyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
3-methyl-8-(trifluoromethyl)-4-(3-{3-[(trifluoromethyl) sulfonyl]phenoxy}phenyl)quinoline;
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3-amine; 4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-fluoroquinoline;
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-fluoroquinoline-3-carboxylic acid;
3-methyl-4- { 1 -[3-(methylsulfonyl)phenyl]- lH-pyrazol-4-yl} -8- (trifluoromethyl)quinoline;
8-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxylic acid;
8-chloro-4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide;
8-chloro-4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}quinoline-3- carboxamide; 8-fluoro-4- {3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-3-phenyl-8-(trifluoromethyl)quinoline;
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile;
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile;
4-{3-[3-(propylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile; 4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile;
4-{3-[3-(benzylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile;
4-(3- {3-[(3-hydroxypropyl)sulfonyl]phenoxy}phenyl)quinoline-8-carbonitrile;
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile;
4-{3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}quinoline-8-carbonitrile; 4-{3-[4-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile;
4-{3-[4-(ethylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile; 4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile;
8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
8-chloro-4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}quinoline;
8-chloro-4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}quinoline; 8-chloro-4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}quinoline;
8 -methyl-4- { 3 - [3 - (methylsulfonyl)phenoxy ]phenyl } quinoline ;
8-methoxy-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
N,N-bis(4-methoxybenzyl)-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide; N,N-bis(4-methoxybenzyl)-3- {3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide;
N,N-bis(4-methoxybenzyl)-4-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide;
N,N-bis(4-methoxybenzyl)-4-{3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide;
3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide;
4-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide;
4-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide;
4-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide; 3-isopropyl-4- {3-[3-(methylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinoline;
3-methyl-4-(3- {[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-(trifluoromethyl)quinoline;
3-methyl-4-(3- {[4-(methylsulfonyl)benzyl]oxy}phenyl)-8-(trifluoromethyl)quinoline;
4-{5-[3-(ethylsulfonyl)phenyl]-2-thienyl}-3-methyl-8-(trifluoromethyl)quinoline;
4-{5-[3-(ethylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline; 3-methyl-4-{5-[3-(methylsulfonyl)phenyl]-l,3-thiazol-2-yl}-8-
(trifluoromethyl)quinoline; ethyl 4- {5-[3-(methylsulfonyl)phenyl]-2-thienyl} -8-(trifluoromethyl)quinoline-3- carboxylate;
4-{5-[3-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline-3- carboxamide; ethyl 4- {5'-[3-(methylsulfonyl)phenyl]-2,2'-bithiophen-5-yl} -8- (trifluoromethyl)quinoline-3-carboxylate;
8-fluoro-4-[3'-(methylsulfonyl)biphenyl-3-yl]quinoline;
3-methyl-4-{5-[3-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline; 4-[3-(methylsulfonyl)phenyl]-8-(trifluoromethyl)quinoline;
4-{5-[3-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline; N,N-dimethyl-3-{5-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]-2- thienyl } benzenesulfonamide ;
3-methyl-4-{5-[4-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline;
4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline; 4-[4'-methyl-3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[3'-(methylsulfonyl)biphenyl-3-yl]-3-phenyl-8-(trifluoromethyl)quinoline;
3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide; ethyl 4-(3'-(3-(l,3-dioxoisoindohn-2-yl)propylthio)biphenyl-3-yl)-8- (trifluoromethyl)quinoline-3-carboxylate; 2-amino-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3- carboxamide;
4-[4'-fluoro-3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4- [4'-fluoro-3 '-(methylsulfonyl)biphenyl-3 -yl] -3 -methyl- 8-(trifluoromethyl)quinoline;
2-[3-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}thio)propyl]-lH-isoindole- l,3(2H)-dione;
N-ethyl-3-({3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3- yl} sulfonyl)propan- 1 -amine;
N-methyl-3-({3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3- yl} sulfonyl)propan- 1 -amine; N-ethyl-3-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propan-l- amine;
N-methyl-3-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propan-l- amine;
8-chloro-4-[3'-(methylsulfonyl)biphenyl-3-yl]quinoline; 5-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}thiophene-2-sulfonamide;
5-{3-[8-(trifluoromethyl)quinolin-4-yl]phenyl}thiophene-2-sulfonamide;
3-methyl-4-{3-[5-(methylsulfonyl)-2-thienyl]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[5-(ethylsulfonyl)-2-thienyl]phenyl}-3-methyl-8-(trifluoromethyl)quinoline;
3-methyl-4-{3-[5-(propylsulfonyl)-2-thienyl]phenyl}-8-(trifluoromethyl)quinolone; 4- {3-[5-(isopropylsulfonyl)-2-thienyl]phenyl} -3-methyl-8-(trifluoromethyl)quinoline;
3 - [(5 - { 3 - [3 -methyl- 8 - (trifluoromethyl)quinolin-4-yl]phenyl } -2-thienyl)sulfonyl] - propan- 1 -ol;
4-{3-[5-(methylsulfonyl)-2-thienyl]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[5-(ethylsulfonyl)-2-thienyl]phenyl}-8-(trifluoromethyl)quinoline; 4- {3-[5-(isopropylsulfonyl)-2-thienyl]phenyl} -8-(trifluoromethyl)quinoline; N-(4-(3-(3-(methylsulfonyl)phenoxy)phenyl)-8-(trifluoromethyl)quinolin-3- yl)methanesulfonamide;
8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide; N-benzyl-3 - [(3 - {3 - [8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan- 1 -amine;
N-(4-fluorobenzyl)-3-[(3-{3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan- 1 -amine;
N- {3-[(3- {3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propyl}prop-2-en- 1 -amine; 3-({3-[(3-{3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propyl}amino)propanenitrile;
N- {3-[(3- {3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propyl}prop-2-yn- 1 -amine;
N-(2-fluoroethyl)-3-[(3-{3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan- 1 -amine;
N-methoxy-3 - [(3 - {3 - [8-(trifluoromethyl)qumolm-4- yl]phenoxy}phenyl)sulfonyl]propan- 1 -amine;
4-(3- {3-[(3-chloropropyl)sulfonyl]phenoxy}phenyl)-8-(trifluoromethyl)quinoline; N-methyl-N- {3-[(3- {3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propyl}prop-2-yn- 1 -amine;
(2R)-N- {3-[(3- {3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propyl}butan-2-amine;
(2S)-N- {3-[(3- {3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propyl}butan-2-amine; N-(3-chlorobenzyl)-3-[(3- {3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propan- 1 -amine;
(4-(3-(3-(methylsulfonyl)phenoxy)phenyl)-8-(trifluoromethyl)quinolin-3- yl)methanamine ;
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-fluoroquinoline-3- carboxamide;
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-cyanoquinoline-3- carboxamide;
8-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide; 4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carboxamide; 4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3- carboxamide; ethyl 4-(3'-{[3-(l, 3-dioxo-l, 3-dihydro-2H-isoindol-2-yl)propyl]sulfonyl}biphenyl-3- yl)-8-(trifluoromethyl)quinoline-3-carboxylate; 2-[3-({3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propyl]- lH-isoindole-l,3(2H)-dione;
2-[3-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propyl]-lH- isoindole- 1 ,3(2H)-dione;
3-( {3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl} sulfonyl)propan- 1 -amine; 3 -( {3 '- [3 -methyl- 8-(trifluoromethyl)quinolin-4-yl]biphenyl-3 -yl} sulfonyl)propan- 1 - amine; ethyl 4- {3'-[(3-aminopropyl)sulfonyl]biphenyl-3-yl} -8-(trifluoromethyl)quinoline-3- carboxylate;
3-(4,5-dihydro-lΗ-imidazol-2-yl)-4- {3-[3-(methylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinoline; benzyl 4-[(3- {3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)thio]piperidine-l- carboxylate; benzyl 4-[(3- {3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]piperidine- 1 -carboxylate; 4- {3-[3-(piperidin-4-ylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinoline; benzyl 4-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}thio)piperidine-l- carboxylate; benzyl 4-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)piperidine-l- carboxylate; 4-[3'-(piperidin-4-ylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline; methyl 4- {3-[3-(methylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinoline-3- carboxylate;
[4- {3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3- yljmethanol; 4-[3-(3- {[3-(methylamino)propyl]sulfonyl}phenoxy)phenyl]-8-
(trifluoromethyl)quinoline-3-carboxamide;
N-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl] propyl } methanesulfonamide ; l-ethyl-3- {3-[(3-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl] propyljurea; N-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl] propyl} acetamide;
2-({3-[(3-{3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]propyl}carbamoyl)benzoic acid; 4- {3-[3-(methylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinoline-3- carboximidamide;
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carboxylic acid; methyl 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carboxylate;
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carboxamide; 4- {3-[4-chloro-3-(methylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinoline;
4-{4-[3-(methylsulfonyl)phenyl]pyridin-2-yl}-8-(trifluoromethyl)quinoline;
3-methyl-4-{4-[3-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline;
3-methyl-4-{5-[3-(methylsulfonyl)phenyl]-3-thienyl}-8-(trifluoromethyl)quinoline;
N-(4-methoxybenzyl)-N-methyl-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide;
N-(4-methoxybenzyl)-N-methyl-4-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide;
N-methyl-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}benzenesulfonamide; N-methyl-4- {3-[3-methyl-8-(trifluoromethyl)quinolm-4- yl]phenoxy}benzenesulfonamide;
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-3-isopropyl-8-(trifluoromethyl)quinoline;
3-isopropyl-4- {3-[3-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3 -isopropyl-4- {3 - [3 -(isopropylsulfonyl)phenoxy]phenyl} - 8- (trifluoromethyl)quinoline;
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-3-isopropyl-8- (trifluoromethyl)quinoline;
4-{3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-3-isopropyl-8- (trifluoromethyl)quinoline; 4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-3-isopropyl-8-
(trifluoromethyl)quinoline;
3-isopropyl-4- {3-[2-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-isopropyl-4- {3-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[4-(ethylsulfonyl)phenoxy]phenyl}-3-isopropyl-8-(trifluoromethyl)quinoline; 8-methoxy-4- {3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
4- {3-[3-(ethylsulfonyl)phenoxy]phenyl} -8-methoxyquinoline; 4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline;
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline;
4-{3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-8-methoxyquinoline;
4- {3-[3-(ethylsulfonyl)phenoxy]phenyl} -8-methylquinoline; 4- {3-[3-(isopropylsulfonyl)phenoxy]phenyl} -8-methylquinoline;
4- {3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl} -8-methylquinoline;
4- {3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl} -8-methylquinoline;
3-( {3-[3-(8-methylquinolin-4-yl)phenoxy]phenyl} sulfonyl)propan- 1 -ol;
4- {3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl} -8-methylquinoline; 4- {4-[3-(methylsulfonyl)phenyl]-2-thienyl} -8-(trifluoromethyl)quinoline;
4-{4-[2-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline;
4-{4-[4-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline;
4- { 5 - [3 - (methylsulfonyl)phenyl] - 3 -thienyl } - 8 -(trifluoromethy l)quinoline ;
({[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3- yl]methyl}amino)acetonitrile;
2-methoxy-N- {[4- {3-[3-(methylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinolin-3-yl]methyl}ethanamine;
N-{[4- {3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3- yl]methyl}propan-2-amine; N- { [4- {3-[3-(methylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinolin-3- yl]methyl}prop-2-en- 1 -amine; l-cyclopropyl-N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8- (trifluoromethyl)quinolin-3-yl]methyl}methanamine;
N-{[4- {3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3- yl]methyl}ethanamine;
N-methyl-l-[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin- 3-yl]methanamine;
3-({[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3- yljmethyl} amino)propanenitrile; 2-fluoro-N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-
3-yl]methyl} ethanamine;
N-{[4- {3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3- yl]methyl}propan- 1 -amine;
N-{[4- {3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3- yl]methyl}cyclopentanamine; 2-amino-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3- carbonitrile;
2-amino-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3- carboxylic acid; 4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinolin-2-amine;
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline;
4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline;
4-{2-chloro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline;
4-{2-chloro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline; 4-{2-chloro-5-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-8-methoxyquinoline;
4-{2-chloro-5-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline;
4-{5-[3-chloro-5-(methylsulfonyl)phenoxy]2-fluorophenyl}-8-methoxyquinoline;
4-{2-fluoro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline;
4-{5-[3-(ethylsulfonyl)-5-fluorophenoxy]2-fluorophenyl}-8-methoxyquinoline; 4-{2-fluoro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline;
4-{5-[3-(ethylsulfonyl)phenoxy]-2-fluorophenyl}-8-methoxyquinoline;
4-{2-fluoro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline;
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-(methylsufonyl)quinoline;
4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(methylsufonyl)quinoline; 4-{2-chloro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(methylsufonyl)quinoline;
4-{2-chloro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8- (methylsufonyl)quinoline;
4- {2-chloro-5-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl} -8- (methylsufonyl)quinoline; 4- {2-chloro-5-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl} -8-
(methylsufonyl)quinoline;
4- {5-[3-chloro-5-(methylsulfonyl)phenoxy]2-fluorophenyl} -8- (methylsufonyl)quinoline;
4-{2-fluoro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8- (methylsufonyl)quinoline;
4- {5-[3-(ethylsulfonyl)-5-fluorophenoxy]2-fluorophenyl} -8- (methylsufonyl)quinoline;
4-{2-fluoro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-(methylsufonyl)quinoline;
4-{5-[3-(ethylsulfonyl)phenoxy]-2-fluorophenyl}-8-(methylsufonyl)quinoline; 4-{2-fluoro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(methylsufonyl)quinoline;
2-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline; 4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-2-methyl-8-(trifluoromethyl)quinoline;
4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-2-methyl-8-(trifluoromethyl)quinoline;
4- {3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl} -2-methyl-8- (trifluoromethyl)quinoline; 4- {3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl} -2-methyl-8-
(trifluoromethyl)quinoline;
2-methyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-{2-fluoro-5-[3-(methylsulfonyl)phenoxy]phenyl}-2-methyl-8- (trifluoromethyl)quinoline; 4- {5-[3-(ethylsulfonyl)phenoxy]2-fluoro-phenyl} -2-methyl-8-
(trifluoromethyl)quinoline;
4-{2-fluoro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-2-methyl-8- (trifluoromethyl)quinoline;
4-{2-fluoro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-2-methyl-8- (trifluoromethyl)quinoline;
4-{5-[3-(ethylsulfonyl)-5-fluorophenoxy]2-fluoro-phenyl}-2-methyl-8- (trifluoromethyl)quinoline;
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-2-methyl-8- (trifluoromethyl)quinoline; 4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline;
4-{2-chloro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-2-methyl-8- (trifluoromethyl)quinoline;
4-{2-chloro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-2-methyl-8- (trifluoromethyl)quinoline;
4-{2-chloro-5-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-2-methyl-8- (trifluoromethyl)quinoline;
4-{2-methyl-5-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{5-[4-(ethylsulfonyl)phenoxy]2-methylphenyl}-8-(trifluoromethyl)quinoline; 4- {5-[4-(isopropylsulfonyl)phenoxy]2-methylphenyl} -8-(trifluoromethyl)quinoline;
[(4-{4-methyl-3-[8-(trifluoromethyl)quinolin-4- yl]phenoxy}phenyl)sulfonyl]acetonitrile;
8-chloro-4- {2-chloro-5- [3-(methylsulfonyl)phenoxy]phenyl} -2-methylquinoline;
8-chloro-4- {2-chloro-5- [3-(ethylsulfonyl)phenoxy]phenyl} -2-methylquinoline; 8-chloro-4-{2-chloro-5-[3-(isopropylsulfonyl)phenoxy]phenyl} -2-methylquinoline; 8-chloro-4-{2-chloro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-2- methylquinoline;
8-chloro-4- {2-chloro-5-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-2- methylquinoline; 8-chloro-4- {2-fluoro-5-[3-(methylsulfonyl)phenoxy]phenyl} -2-methylquinoline;
8-chloro-4-{2-fluoro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-2-methylquinoline;
8-chloro-4-{2-fluoro-5-[3-(isopropylsulfonyl)phenoxy]phenyl} -2-methylquinoline;
8-chloro-4-{2-fluoro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-2- methylquinoline; 8-chloro-4-{2-fluoro-5-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-2- methylquinoline;
8-chloro-4- {5- [3-(methylsulfonyl)phenoxy]phenyl} -2-methylquinoline;
8-chloro-4-{5-[3-(ethylsulfonyl)phenoxy]phenyl} -2-methylquinoline;
8-chloro-4-{5-[3-(isopropylsulfonyl)phenoxy]phenyl} -2-methylquinoline; 8-chloro-4- {5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl} -2-methylquinoline;
8-chloro-4-{5-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl} -2-methylquinoline;
2-methyl-4-(3- {[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-(trifluoromethyl)quinoline;
4-(2-fluoro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-2-methyl-8- (trifluoromethyl)quinoline; 4-(2-chloro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-2-methyl-8-
(trifluoromethyl)quinoline;
4-(2-fluoro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-methoxyquinoline;
4-(2-chloro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-methoxyquinoline;
4-(2-fluoro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8- (methanesulfonyl)quinoline;
4-(2-chloro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8- (methanesulfonyl)quinoline;
8-chloro-4-(2-fluoro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-2-methylquinoline;
8-chloro-4-(2-chloro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-2-methylquinoline; 2-methyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[4-chloro-3'-(methylsulfonyl)biphenyl-5-yl]-2-methyl-8-(trifluoromethyl)quinoline;
4-[4-fluoro-3'-(methylsulfonyl)biphenyl-5-yl]-2-methyl-8-(trifluoromethyl)quinoline;
4-[4-chloro-3'-(methylsulfonyl)biphenyl-5-yl]-8-methoxyquinoline;
4-[4-fluoro-3'-(methylsulfonyl)biphenyl-5-yl]-8-methoxyquinoline; 4-[4-chloro-3'-(methylsulfonyl)biphenyl-5-yl]-8-(methanesulfonyl)quinoline;
4-[4-fluoro-3'-(methylsulfonyl)biphenyl-5-yl]-8-(methanesulfonyl)quinoline; 8-methoxy-4-[3'-(methylsulfonyl)biphenyl-3-yl]quinoline; and 8-(methanesulfonyl)-4-[3'-(methylsulfonyl)biphenyl-3-yl]quinoline.
45. A pharmaceutical composition comprising a compound of any one of claims 1 to 44, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
46. A method of preventing or treating a Liver X receptor-mediated disease or disorder, the method comprising administering to a subject in need of such treatment an effective amount of a compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
47. A method of preventing or treating a cardiovascular disease, the method comprising administering to a subject in need of such treatment an effective amount of a compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
48. The method of claim 47, wherein the cardiovascular disease is acute coronary syndrome or restenosis.
49. A method of preventing or treating Alzheimer's disease or dementia, the method comprising administering to a subject in need of such treatment an effective amount of a compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
50. A method of preventing or treating type I or type II diabetes, the method comprising administering to a subject in need of such treatment an effective amount of a compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
51. A method of preventing or treating atherosclerosis and/or atherosclerotic lesions, the method comprising administering to a subject in need of such treatment an effective amount of a compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
52. A method of preventing or treating Syndrome X, the method comprising administering to a subject in need of such treatment an effective amount of a compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
53. A method of preventing or treating obesity, the method comprising administering to a subject in need of such treatment an effective amount of a compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
54. A method of preventing or treating one or more lipid disorders selected from the group consisting of dyslipidemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, low HDL and high LDL, the method comprising administering to a subject in need of such treatment an effective amount of a compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
55. A method of preventing or treating an inflammatory disease, the method comprising administering to a subject in need of such treatment an effective amount of a compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
56. The method of claim 55, wherein the inflammatory disease is multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, endometriosis, LPS-induced sepsis, acute contact dermatitis of the ear, or chronic atherosclerotic inflammation of the artery wall.
57. The method of claim 55, wherein the inflammatory disease is rheumatoid arthritis.
58. A method of preventing or treating celiac, the method comprising administering to a subject in need of such treatment an effective amount of a compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
59. A method of preventing or treating thyroiditis, the method comprising administering to a subject in need of such treatment an effective amount of a compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
60. A method of treating a connective tissue disease, the method comprising administering to a mammal in need thereof an effective amount of a compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
61. The method of claim 60, wherein the compound inhibits cartilage degradation and induces cartilage regeneration.
62. The method of claim 60, wherein the compound inhibits aggrecanase activity.
63. The method of claim 60, wherein the compound inhibits elaboration of pro- inflammatory cytokines in osteoarthritic lesions.
64. The method of claim 60, wherein the connective tissue disease is osteoarthritis or tendonitis.
65. The method of claim 60, wherein the mammal is a human.
66. A method of treating skin aging, the method comprising administering to a mammal in need thereof an effective amount of a compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
67. The method of claim 66, wherein the mammal is a human.
68. The method of claim 66, wherein the compound is topically administered.
69. The method of claim 66, wherein the skin aging is derived from chronological aging, photoaging, steroid-induced skin thinning, or a combination thereof.
70. A method of increasing serum HDL cholesterol levels in a subject, the method comprising administering to the subject an effective amount of a compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
71. A method of decreasing serum LDL cholesterol levels in a subject, the method comprising administering to the subject an effective amount of a compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
72. A method of increasing reverse cholesterol transport in a subject, the method comprising administering to the subject an effective amount of a compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
73. A method of decreasing cholesterol absorption in a subject, the method comprising administering to the subject an effective amount of a compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
EP07844372A 2006-10-18 2007-10-18 Quinoline compounds Withdrawn EP2074098A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US85258806P 2006-10-18 2006-10-18
PCT/US2007/081738 WO2008049047A2 (en) 2006-10-18 2007-10-18 Quinoline compounds

Publications (1)

Publication Number Publication Date
EP2074098A2 true EP2074098A2 (en) 2009-07-01

Family

ID=38962854

Family Applications (1)

Application Number Title Priority Date Filing Date
EP07844372A Withdrawn EP2074098A2 (en) 2006-10-18 2007-10-18 Quinoline compounds

Country Status (9)

Country Link
EP (1) EP2074098A2 (en)
JP (1) JP2010506954A (en)
CN (1) CN101541751A (en)
AU (1) AU2007311046A1 (en)
CA (1) CA2666508A1 (en)
CL (1) CL2007002996A1 (en)
MX (1) MX2009003942A (en)
TW (1) TW200825054A (en)
WO (1) WO2008049047A2 (en)

Families Citing this family (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080186971A1 (en) * 2007-02-02 2008-08-07 Tarari, Inc. Systems and methods for processing access control lists (acls) in network switches using regular expression matching logic
EP2025674A1 (en) 2007-08-15 2009-02-18 sanofi-aventis Substituted tetra hydro naphthalines, method for their manufacture and their use as drugs
GB0801416D0 (en) * 2008-01-25 2008-03-05 Piramed Ltd Pharmaceutical compounds
WO2009127822A2 (en) * 2008-04-16 2009-10-22 Biolipox Ab Bis-aryl compounds for use as medicaments
EP2367801A1 (en) * 2008-11-19 2011-09-28 Wyeth LLC Polar quinazolines as liver x receptors ( lxrs ) modulators
SI2396307T1 (en) 2009-02-11 2015-02-27 Merck Patent Gmbh Novel amino azaheterocyclic carboxamides
WO2011107494A1 (en) 2010-03-03 2011-09-09 Sanofi Novel aromatic glycoside derivatives, medicaments containing said compounds, and the use thereof
US8198300B2 (en) 2010-04-29 2012-06-12 Universidad De Chile Method for preventing tau protein aggregation and treating Alzheimer's disease with a quinoline derivative compound
EP2582709B1 (en) 2010-06-18 2018-01-24 Sanofi Azolopyridin-3-one derivatives as inhibitors of lipases and phospholipases
JP2013531007A (en) * 2010-07-08 2013-08-01 ワイス・エルエルシー New quinoline esters useful for the treatment of skin disorders
AU2011282684B2 (en) * 2010-07-29 2015-05-21 Merck Patent Gmbh Cyclic amine azaheterocyclic carboxamides
CN103402986A (en) * 2010-11-24 2013-11-20 阿勒根公司 Modulators of S1P receptors
EP2567959B1 (en) 2011-09-12 2014-04-16 Sanofi 6-(4-hydroxy-phenyl)-3-styryl-1h-pyrazolo[3,4-b]pyridine-4-carboxylic acid amide derivatives as kinase inhibitors
CN103906735B (en) 2011-11-04 2016-12-07 霍夫曼-拉罗奇有限公司 New aryl-quinoline derivatives
SG10201607345YA (en) 2012-03-02 2016-11-29 Ralexar Therapeutics Inc Liver x receptor (lxr) modulators for the treatment of dermal diseases, disorders and conditions
AU2013302861A1 (en) 2012-08-13 2015-03-05 The Rockefeller University Treatment and diagnosis of melanoma
RS60479B1 (en) 2013-09-04 2020-08-31 Ellora Therapeutics Inc Liver x receptor (lxr) modulators
JP2016532713A (en) 2013-09-04 2016-10-20 アレクサー セラピューティクス, インク. Liver X receptor (LXR) modulator
CN103539734B (en) * 2013-09-25 2015-10-14 上海交通大学 The preparation method of 3-allyl group quinoline
WO2017027883A1 (en) * 2015-08-13 2017-02-16 San Diego State University Research Foundation Atropisomerism for increased kinase inhibitor selectivity
EP3402477A4 (en) 2016-01-11 2019-08-21 The Rockefeller University METHODS FOR THE TREATMENT OF DISORDERS ASSOCIATED WITH SUPPRESSIVE CELLS DERIVED FROM MYELOID CELLS
WO2018026877A1 (en) 2016-08-05 2018-02-08 Calitor Sciences, Llc Process for preparing substituted quinolin-4-ol compounds
AU2018236233A1 (en) * 2017-03-14 2019-09-19 Dana-Farber Cancer Institute, Inc. Small molecule sensitization of BAX activation for induction of cell death
CA3078981A1 (en) 2017-11-21 2019-05-31 Rgenix, Inc. Polymorphs and uses thereof
EP3746070A4 (en) * 2018-01-29 2021-09-01 Capulus Therapeutics, LLC SREBP INHIBITORS INCLUDING A 6-CHAIN CENTRAL CORE
LT3796975T (en) 2018-05-22 2023-12-11 Orsobio, Inc. Sulfonylaminobenzamide derivatives
TWI748194B (en) 2018-06-28 2021-12-01 德商菲尼克斯 Fxr有限責任公司 Novel lxr modulators with bicyclic core moiety
CA3127828A1 (en) * 2019-01-28 2020-08-06 Capulus Therapeutics, Llc Srebp inhibitors comprising a thiophene central ring
KR20220087497A (en) 2019-10-18 2022-06-24 더 리전츠 오브 더 유니버시티 오브 캘리포니아 Compounds and methods for targeting pathogenic blood vessels
US12590298B2 (en) 2019-10-18 2026-03-31 The Regents Of The University Of California Ex vivo tumor angiogenesis model
TWI888447B (en) 2019-12-13 2025-07-01 美商因思博納公司 Metal salts and uses thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5916891A (en) * 1992-01-13 1999-06-29 Smithkline Beecham Corporation Pyrimidinyl imidazoles
US5837719A (en) * 1995-08-10 1998-11-17 Merck & Co., Inc. 2,5-substituted aryl pyrroles, compositions containing such compounds and methods of use
AU2004298486A1 (en) * 2003-12-12 2005-06-30 Wyeth Quinolines useful in treating cardiovascular disease
CA2564355C (en) * 2004-05-07 2012-07-03 Amgen Inc. Protein kinase modulators and method of use
CA2612765A1 (en) * 2005-07-06 2007-01-18 Merck And Co., Inc. Antidiabetic oxazolidinediones and thiazolidinediones

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2008049047A2 *

Also Published As

Publication number Publication date
CA2666508A1 (en) 2008-04-24
CL2007002996A1 (en) 2008-06-13
AU2007311046A1 (en) 2008-04-24
WO2008049047A3 (en) 2008-07-24
JP2010506954A (en) 2010-03-04
TW200825054A (en) 2008-06-16
MX2009003942A (en) 2009-04-24
CN101541751A (en) 2009-09-23
WO2008049047A2 (en) 2008-04-24

Similar Documents

Publication Publication Date Title
WO2008049047A2 (en) Quinoline compounds
EP2231660A1 (en) Imidazo [1,2-a] pyridine compounds
US6509352B1 (en) 2-oxoquinoline compounds and medicinal uses thereof
AU2008345696A1 (en) Benzimidazole compounds
CA2710458A1 (en) Imidazo [1,2-b] pyridazine compounds as modulators of liver x receptors
AU2002303061A1 (en) Novel, arylsulfonamide compounds for the treatment of obesity, type II diabetes and CNS-disorders
WO2002092585A1 (en) Novel, arylsusfonamide compounds for the treatment of obesity, type ii diabetes and cns-disorders
CA2742023A1 (en) Polar quinazolines as liver x receptors ( lxrs ) modulators
WO2009020683A2 (en) Quinazoline compounds
EP2055703B1 (en) Novel pyrimidine compound having benzyl(pyridylmethyl)amine structure and pharmaceutical comprising the compound
AU2008345687A1 (en) Pyrazolo [1,5-a] pyrimidine compounds
IL186676A (en) 4-phenyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline derivatives as medicaments for the treatment of infertility
CA2741537A1 (en) Quinoxaline-based lxr modulators
CN101730684B (en) Sulfonyl-quinoline derivatives
EP1879866B1 (en) Dihydropyridine derivatives
CA2630739A1 (en) New compounds
HK1142601A (en) Quinazoline compounds
HK1110855B (en) Dihydropyridine derivatives

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20090330

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC MT NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA HR MK RS

RIN1 Information on inventor provided before grant (corrected)

Inventor name: MAGOLDA, RONALD LOUIS

Inventor name: TRAVINS, JEREMY MARK

Inventor name: COLLINI, MICHAEL DAVID

Inventor name: JETTER, JAMES WINFIELD

Inventor name: HU, BAIHUA

Inventor name: WROBEL, JAY E.

Inventor name: MORRIS, ROBERT LESTER

Inventor name: KAUFMAN, DAVID HARRY

Inventor name: ULLRICH, JOHN WILLIAM

Inventor name: SINGHAUS, ROBERT RAY JR.

Inventor name: BERNOTAS, RONALD CHARLES

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20090817

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: WYETH LLC

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20120225