EP2059812A1 - Methods of screening for agents that inhibit binding between mphosph1 and prc1 - Google Patents
Methods of screening for agents that inhibit binding between mphosph1 and prc1Info
- Publication number
- EP2059812A1 EP2059812A1 EP07806304A EP07806304A EP2059812A1 EP 2059812 A1 EP2059812 A1 EP 2059812A1 EP 07806304 A EP07806304 A EP 07806304A EP 07806304 A EP07806304 A EP 07806304A EP 2059812 A1 EP2059812 A1 EP 2059812A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- polypeptide
- mphosphl
- seq
- prcl
- amino acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57557—Immunoassay; Biospecific binding assay; Materials therefor for cancer of other specific parts of the body, e.g. brain
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/10—Drugs for disorders of the urinary system of the bladder
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/02—Screening involving studying the effect of compounds C on the interaction between interacting molecules A and B (e.g. A = enzyme and B = substrate for A, or A = receptor and B = ligand for the receptor)
Definitions
- the present invention relates to screening methods using the binding of M-phase phosphoprotein 1 (MPHOSPHl) to Protein regulator of cytokinesis 1 (PRCl) as an index.
- Agents applicable for treating or preventing cancer, in particular bladder cancer, can be identified through the methods.
- Bladder cancer is the second most common genitourinary tumor in human populations, having an incidence of approximately 357,000 new cases each year worldwide (Parkin DM et al, CA Cancer J Clin 2005, 55: 74-108). About a third of the patients are suspected to suffer from invasive or metastatic disease at the time of diagnosis (Parkin DM et al, CA Cancer J Clin 2005, 55: 74-108; Sternberg CN, Ann Oncol 1995, 6: 113-26; Ardavanis A et al, Br J Cancer 2005, 92: 645-50).
- radical cystectomy is considered the "gold standard" for the treatment of patients with localized but muscle-invasive bladder cancer, about 50% of such patients develop metastases within two years after cystectomy and subsequently die of the disease (Sternberg CN, Ann Oncol 1995, 6: 113-26).
- cisplatin-based combination chemotherapy regimens such as CMV (cisplatin, methotrexate, and vinblastine) and M-VAC (methotrexate, vinblastine, doxorubicin, and cisplatin)
- CMV cisplatin, methotrexate, and vinblastine
- M-VAC metalhotrexate, vinblastine, doxorubicin, and cisplatin
- CMV cisplatin, methotrexate, and vinblastine
- M-VAC metalhotrexate, vinblastine, doxorubicin, and cisplatin
- cDNA microarray has been proven to be an effective tool for simultaneously analyzing the expression patterns of thousands of genes. Comparison of genome- wide expression profiles between cancers and normal cells by cDNA microarray provides useful information that enables the discovery candidate target molecules for development of diagnosis and treatment of cancer (Debouck C et al, Nat Genet 1999, 21 : 48-50). Recent drug development investigations have focused on targeting important molecules involved in the oncogenic pathways, represented by imatinib, mesylate and trastuzumab. The combination of cancer- expression profiling with RNAi should enable the identification of such drug targets for therapy (Clarke PA et al, Eur J Cancer 2004, 40: 2560-91).
- MPHOSPHl was previously identified as a protein that is specifically phosphorylated at G2/M transition, and therefore characterized as a plus-end-directed kinesin related protein (Abaza A et al, J Biol Chem 2003, 278: 27844-52).
- the MPHOSPHl cDNA encodes a 1780-amino acid protein that is composed of three domains characteristic of an NH2-type kinesin-related protein: an NH2-kinesin motor domain, a central coiled coil-stalk domain, and a C-globular tail domain.
- MPHOSPHl was previously documented to be plus-end-directed molecular motor with a crucial role in cytokinesis, and to accumulate in the midzone of the spindle during anaphase to telophase in HeLa cells (Abaza A et al, J Biol Chem 2003, 278: 27844-52; Kamimoto T et al, J Biol Chem 2001, 276: 37520-8).
- PRCl was reported to interact with several kinesin family proteins (Ban R et al, J Biol Chem 2004, 279: 16394-402; Kurasawa Y et al, EMBO J 2004, 23: 3237-48; Zhu C & Jiang W, Proc Natl Acad Sci USA 2005, 102: 343-8; Gruneberg U et al, J Cell Biol 2006, 172: 363-72). Suppression of PRCl by anti-PRCl antibodies in HeLa cells is reported to cause an increase of bi-nucleated cells (Mollinari C et al, J Cell Biol 2002, 157: 1175-86).
- PRC 1 could interact with several molecules, for example KIF4 or KIF 14, which are associated with mitotic events, especially cytokinesis (Kurasawa Y et al, EMBO J 2004, 23: 3237-48; Mollinari C et al., MoI Biol Cell 2005, 16: 1043-55). Moreover, PRCl was identified by the present inventors to be over-expressed in breast cancer (WO 2005/28676).
- the present invention is based, at least in part, on the discovery of the interaction between MPHOSPHl and PRCl in vivo.
- Both proteins, MPHOSPHl and PRCl are over- expressed in bladder cancer cells, and the expression of MPHOSPHl is only observed in bladder cancer cells and normal testis tissue.
- the inhibition of one of the genes coding for these proteins suppresses cytokinesis and induces multinuclearization, which, in turn, ultimately leads to suppression of the proliferation of cells expressing the genes.
- the present invention provides a method of screening for an agent that inhibits the binding between MPHOSPHl and PRCl . More specifically, the method includes the steps of: a) contacting MPHOSPHl with PRCl in the presence of an agent; b) detecting the level of binding level between MPHOSPHl and PRCl; c) comparing the binding level of MPHOSPHl and PRCl with that detected in the absence of the agent; and d) selecting the agent that reduces the binding level of MPHOSPHl and PRCl.
- fragments may be used in place of the full-length MPHOSPHl or full-length PRCl, so long as each fragment retains the ability to bind to its partner ligand.
- Particularly preferred fragments of MPHOSPHl to be used for the present screening include those including the amino acid residues 1188 to 1718 of SEQ ID NO: 2.
- the present invention also provides methods of identifying agents that suppress the proliferation of bladder cancer cells as well as agents for treating or preventing bladder cancer.
- Figure 1 depicts the expression of MPHOSPHl in bladder cancer and normal tissues.
- Panel A depicts the expression of MPHOSPHl in tumor cells from 10 bladder cancer patients and normal human tissues (microdissected normal bladder transitional cells, heart, lung, liver and kidney) examined by semi-quantitative RT-PCR. The expression of GAPDH served as a quantity control.
- Panel B depicts the results of Northern blot analysis of the MPHOSPHl transcript in bladder cancer cell lines (HTl 197, UMUC3, J82, HT 1376, SW780 and RT4) and normal human organs (heart, lung, liver, kidney, brain, pancreas, testis and bladder).
- Panel C depicts the results of Northern blot analysis of the MPHOSPHl transcript in various human tissues.
- Panel D depicts the expression of MPHOSPHl protein in surgically resected bladder cancer tissues (2 superficial bladder cancer and 2 invasive bladder cancer cases) and normal bladder tissue sections by immunohistochemical staining using affinity-purified anti- MPHOSPHl polyclonal antibody.
- Figure 2 depicts the subcellular localization of endogenous MPHOSPHl protein in bladder cancer cells during cell cycle. UMUC cells were immunohistochemically stained with affinity-purified MPHOSPHl polyclonal antibody (green). DAPI (blue) reveals nuclear staining.
- Figure 3 depicts the growth inhibitory effects of MPHOSPH 1-siRNA on bladder cancer cell lines, J82 and UMUC3.
- Panel A depicts the expression of MPHOSPHl by
- Panel B depicts the results of colony formation assays performed on J82 and UMUC3 cells transfected with plasmids expressing MPHOSPH 1-siRNA, a control siRNA (EGFP), or MPHOSPHl mismatch siRNA.
- Panel C depicts the viability of J82 and UMUC3 cells evaluated by MTT assays in response to MPHOSPH 1-siRNA introduction in comparison with the introduction of the control.
- Figure 4 depicts the growth-promoting effect of exogenous MPHOSPHl in NIH3T3 cells.
- Panel A depicts the results of Western blot analysis on cells expressing high levels of exogenous MPHOSPHl or those transfected with mock vector. Exogenous introduced MPHOSPHl expression was validated with anti-HA-tag monoclonal antibody. Beta-actin served as a loading control.
- Panel B depicts the in vitro growth of NIH3T3 -MPHOSPHl cells.
- NIH3T3 cells transfected with MPHOSPHl NIH3T3-MPHOSPH1-#1, -#2, -#3
- mock NIH3T3-Mock-#1, -#2, -#3
- NIH3T3-MPHOSPH1 NIH3T3 -MPHO SPH 1-#1
- -mock Nffl3T3-Mock-#l
- Panel D depicts the results of an in vivo tumor growth assay performed on NIH3T3 -MPHO SPHl cells.
- the diameters of the tumors were measured by calipers and the tumor volumes were determined using the following formula; 0.5 x (larger diameter) x (smaller diameter) 2 . Unpaired /-test was performed to evaluate the difference between NIH3T3-MPHOSPH1 and NIH3T3-Mock on day 21 post-injection, (p ⁇ 0.001; unpaired Mest).
- Figure 5 depicts the interaction between MPHOSPHl and PRCl.
- Panel A depicts the expression of MPHOSPHl and PRCl in bladder cancer cases by semi-quantitative RT-PCR. Expression of GAPDH served as a quantity control.
- Panel B depicts the co- immunoprecipitation of MPHOSPHl and PRCl. Cell lysates from C0S7 cells transfected with HA tagged MPHOSPHl and myc tagged PRCl proteins were immunoprecipitated with anti-HA or anti-myc. Immunoprecipitates were immunoblotted using monoclonal anti-HA or anti-myc antibodies.
- Panel C depicts the subcellular localization of endogenous MPHOSPHl and exogenous PRCl in UMUC3 cells. Endogenous MPHOSPHl protein (green) co- localized with exogenous PRCl protein (red).
- Figure 6 depicts the determined regions of MPHOSPHl that interact with PRCl.
- Panel A is a schematic illustration of the MPHOSPHl fragments and full-length used for immunoprecipitation experiments.
- Panel B depicts the co-immunoprecipitation of a series of fragments of MPHOSPHl and PRCl.
- Cell lysates from C0S7 cells transfected with HA tagged MPHOSPHl and myc tagged PRCl proteins were immunoprecipitated with anti-HA or anti-myc. Immunoprecipitates were immunoblotted using monoclonal anti-HA or anti-myc antibodies as described in the legend of Fig.5.
- Figure 7 depicts the significant role of MPHOSPHl and PRCl in cell proliferation of bladder cancer.
- Panel A depicts the effects of si-PRCl or control siRNA (si-EGFP) on J82 cells, analyzed by semi-quantitative RT-PCR (top left), colony formation assays (bottom left), or MTT assays (right).
- Panel B depicts the effects of si-PRCl or control siRNA (si-EGFP) on UMUC3 cells, analyzed by semi-quantitative RT-PCR (top left), colony formation assays (bottom left) or MTT assays (right).
- Panel C depicts the morphology of UMUC cells transfected with si-MPHOSPHl, si-PRCl or si-EGFP as a control.
- Morphology of UMUC cells transfected si-MPHOSPHl, si-PRCl or si-EGFP as a control siRNA was observed under microscope (upper panel) or evaluated by immunocytochemistry (bottom panel).
- UMUC cells treated by siRNAs were stained with DAPI and phalloidin in order to distinguish nuclear and cytoplasm.
- MPHOSPHl M-phase phosphoprotein 1 (SEQ ID NO: 1) (NM 016195), a gene that is highly over-expressed in a great majority of the examined bladder cancer cells.
- Northern blot analysis showed that the expression o ⁇ MPHOSPHl was barely detectable in any of the examined normal human tissues except testis.
- immunohistochemical staining experiments using anti-MPHOSPHl polyclonal antibody clearly indicated the up-regulation of MPHOSPHl (SEQ ID NO: 2) expression in bladder cancer cells, suggesting that MPHOSPHl is a cancer-testis antigen (Kanehira M et al., Cancer Res.
- MPHOSPHl was localized in the nucleus of bladder cancer cells at interphase, in the midzone at late anaphase, and on the contractile ring at telophase. Moreover, knockdown of endogenous MPHOSPHl by siRNAs was demonstrated to induce failure of cytokinesis in bladder cancer cells and result in accumulation of multi-nuclear cells leading to subsequent cell death. Hence, biological roles of MPHOSPHl in bladder cancer cells were examined by identification of its interacting protein(s).
- MPHOSPHl was found to interact with PRCl (SEQ ID NO: 37 encoded by SEQ ID NO: 36) (AF044588) (Protein Regulator of Cytokinesis 1), a gene whose expression is also up-regulated in bladder cancers. Due to their functional similarity and common over- expression in bladder cancer cells, PRCl was selected as a candidate to interact with PRCl (SEQ ID NO: 37 encoded by SEQ ID NO: 36) (AF044588) (Protein Regulator of Cytokinesis 1), a gene whose expression is also up-regulated in bladder cancers. Due to their functional similarity and common over- expression in bladder cancer cells, PRCl was selected as a candidate to interact with PRCl (SEQ ID NO: 37 encoded by SEQ ID NO: 36) (AF044588) (Protein Regulator of Cytokinesis 1), a gene whose expression is also up-regulated in bladder cancers. Due to their functional similarity and common over- expression in bladder cancer cells, P
- MPHOSPHl As shown in Fig. 5, in vivo interaction and co-localization of MPHOSPHl and PRCl (Protein regulator of cytokinesis 1) were demonstrated during interphase to anaphase in bladder cancer cells, while MPHOSPHl surrounded PRCl that localized in the center of midbody in telophase cells (Fig. 5C). Thus, the association and co-localization of MPHOSPHl and PRCl on the mitotic spindle further support the proposition that
- MPHOSPHl is a motor protein that translocates PRCl along the mitotic spindles during mitosis.
- Their co-transactivation in bladder cancer cases suggest that their interaction play a crucial role in bladder carcinogenesis.
- suppression of either of ' MPHOSPHl or PRCl expression using specific siRNAs thereto induced the formation of multi-nucleated cells, followed by cell death.
- the expression of either endogenous MPHOSPHl or PRCl was knocked down with specific- siRNAs in bladder cancer lines, J82 or UMUC3 that showed high levels of expression of MPHOSPHl and PRCl.
- the microarray data obtained by the present inventors revealed exclusive over- expression of MPHOSPHl in bladder cancers.
- the protein PRCl which was discovered to interact with MPHOSPHl, was not only over-expressed in bladder cancer cells but also in several other types of human tumors (data not shown). While it has been reported that PRCl could interact with several molecules, for example KIF4 or KIF 14, which are associated with mitotic events, especially cytokinesis (Kurasawa Y et al, EMBO J 2004, 23: 3237-48; Mollinari C et al, MoI Biol Cell 2005, 16: 1043-55), neither KIF4 nor KIF14 was expressed in bladder cancers according to the expression profiles of bladder cancers obtained by the present inventors.
- the MPH0SPH1/PRC1 pathway is likely to have an oncogenic function in bladder cancer cells, and may be a promising molecular target for the development of anti-cancer drugs against bladder cancer.
- the development of agents to suppress or inhibit the binding of MPHOSPHl with PRCl may be a rational strategy for bladder cancer therapy.
- the evidence provided herein contributes to more profound understanding of bladder cancer carcinogenesis and to develop novel therapies for bladder cancers.
- isolated and purified used herein in relation to a substance indicate that the substance is substantially free from at least one substance that may else be included in the natural source.
- an isolated or purified antibody refers to antibodies that is substantially free of cellular material such as carbohydrate, lipid, or other contaminating proteins from the cell or tissue source from which the protein (antibody) is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized.
- substantially free of cellular material includes preparations of a polypeptide in which the polypeptide is separated from cellular components of the cells from which it is isolated or recombinantly produced.
- a polypeptide that is substantially free of cellular material includes preparations of polypeptide having less than about 30%, 20%, 10%, or 5% (by dry weight) of heterologous protein (also referred to herein as a "contaminating protein").
- heterologous protein also referred to herein as a "contaminating protein”
- the polypeptide is recombinantly produced, it is also preferably substantially free of culture medium, which includes preparations of polypeptide with culture medium less than about 20%, 10%, or 5% of the volume of the protein preparation.
- the polypeptide is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, which includes preparations of polypeptide with chemical precursors or other chemicals involved in the synthesis of the protein less than about 30%, 20%, 10%, 5% (by dry weight) of the volume of the protein preparation.
- That a particular protein preparation contains an isolated or purified polypeptide can be shown, for example, by the appearance of a single band following sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis of the protein preparation and Coomassie Brilliant Blue staining or the like of the gel.
- SDS sodium dodecyl sulfate
- antibodies of the present invention are isolated or purified.
- nucleic acid molecule such as a cDNA molecule
- nucleic acid molecules encoding antibodies of the present invention are isolated or purified.
- polypeptide amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is a modified residue, or a non-naturally occurring residue, such as an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.
- amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that similarly functions to the naturally occurring amino acids.
- Naturally occurring amino acids are those encoded by the genetic code, as well as those modified after translation in cells (e.g., hydroxyproline, ⁇ - carboxyglutamate, and O-phosphoserine).
- amino acid analog refers to compounds that have the same basic chemical structure (an ⁇ carbon bound to a hydrogen, a carboxy group, an amino group, and an R group) as a naturally occurring amino acid but have a modified R group or modified backbones (e.g., homoserine, norleucine, methionine, sulfoxide, methionine methyl sulfonium).
- modified R group or modified backbones e.g., homoserine, norleucine, methionine, sulfoxide, methionine methyl sulfonium.
- amino acid mimetic refers to chemical compounds that have different structures but similar functions to general amino acids.
- Amino acids may be referred to herein by their commonly known three letter symbols or the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
- the terms "polynucleotides”, “nucleotides”, “nucleic acids”, and “nucleic acid molecules” are used interchangeably unless otherwise specifically indicated and, similarly to the amino acids, are referred to by their commonly accepted single-letter codes. Similar to the amino acids, they encompass both naturally-occurring and non-naturally occurring nucleic acid polymers.
- the nucleotide sequence of the human MPHOSPHl gene is shown in SEQ ED NO:
- MPHOSPHl gene encompasses the human MPHOSPH 1 gene as well as those of other animals including non-human primate, mouse, rat, dog, cat, horse, and cow.
- the present invention is not limited thereto, and includes allelic mutants and genes found in other animals as corresponding to the MPHOSPHl gene.
- the amino acid sequence encoded by the human MPHOSPHl gene is shown in SEQ ID NO: 2 (GenBank Accession NP 057279.2).
- the polypeptide encoded by the MPHOSPHl gene is referred to as "MPHOSPHl”, and sometimes as “MPHOSPHl polypeptide” or "MPHOSPHl protein”.
- the nucleotide sequence of human PRCl gene is shown in SEQ ID NO: 36. Furthermore, three different transcriptional variants, composed of 15, 14, and 14 exons, respectively, are known in the art.
- GenBank accession No. NM_003981, NMJ99413, and NMJ 99414 are referred to as Vl, V2 and V3, respectively; and corresponding amino acid sequences can be found as GenBank Accession Nos. NP 003972.1, NP_955445.1, and NP_955446.1, respectively). Except alternative variations in exon 13 and 14 of Vl, all other exons were common to the three variants.
- V2 variant has no exon 14 of Vl, and a novel early stop codon is included within the last exon.
- Exon 14 of V3 variant was completely deleted, exon 13 of V3 was 77bp shorter at the 3' end than that of Vl, and included a novel early stop codon within the last exon.
- the variants Vl, V2, and V3 respectively encode proteins of 620, 606, and 566 amino acids.
- PRCl gene encompasses all of the human PRCJ gene variants as well as those of other animals including non-human primate, mouse, rat, dog, cat, horse, and cow but is not limited thereto, and includes allelic mutants and genes found in other animals as corresponding to the PRCl gene.
- the amino acid sequence encoded by the human PRCl gene is shown in SEQ ID NO: 37.
- the polypeptide encoded by the PRCl gene is referred to as "PRCl”, and sometimes as “PRCl polypeptide” or "PRCl protein”.
- a “functional equivalent” of a protein is a polypeptide that has a biological activity, in particular, the binding activity equivalent to the protein. Namely, any polypeptide that retains the activity of the MPHOSPHl protein to the PRC 1 protein, or the activity of the PRC 1 protein to the MPHOSPHl protein may be used as such a functional equivalent of the polypeptides in the present invention.
- Such functional equivalents include those wherein one or more amino acids are substituted, deleted, added, or inserted to the natural occurring amino acid sequence of the MPHOSPHl or PRCl protein.
- mutated or modified proteins proteins having amino acid sequences modified by substituting, deleting, inserting, and/or adding one or more amino acid residues of a certain amino acid sequence, have been known to retain the original biological activity (Mark et al., Proc Natl Acad Sci USA 81 : 5662-6 (1984); Zoller and Smith, Nucleic Acids Res 10:6487-500 (1982); Dalbadie-McFarland et al., Proc Natl Acad Sci USA 79: 6409-13 (1982)).
- the number of amino acid mutations is not particularly limited. However, it is generally preferred to alter 5% or less of the amino acid sequence. Accordingly, in a preferred embodiment, the number of amino acids to be mutated in such a mutant is generally 30 amino acids or less, preferably 20 amino acids or less, more preferably 10 amino acids or less, more preferably 6 amino acids or less, and even more preferably 3 amino acids or less.
- amino acid residue to be mutated is preferably mutated into a different amino acid in which the properties of the amino acid side-chain are conserved (a process known as conservative amino acid substitution).
- properties of amino acid side chains are hydrophobic amino acids (alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, tyrosine, valine), hydrophilic amino acids (arginine, aspartic acid, aspargin, cystein, glutamic acid, glutamine, glycine, histitidine, lysine, serine, threonine), and side chains having the following functional groups or characteristics in common: an aliphatic side-chain (glycine, alanine, valine, leucine, isoleucine, praline); a hydroxyl group containing side-chain (serine, threonine, tyrosine); a sulfur atom containing side-chain (C, M); a carboxylic acid
- Such conservatively modified polypeptides are included in the present MPHOSPHl or PRCl protein.
- the present invention is not restricted thereto and the MPHOSPHl and PRCl proteins include non-conservative modifications so long as the binding activity of the original proteins is retained.
- the modified proteins do not exclude polymorphic variants, interspecies homologues, and those encoded by alleles of these proteins.
- Fusion proteins are fusions of the MPHOSPHl or PRCl protein and other peptides or proteins, which also can be used in the present invention. Fusion proteins can be made by techniques well known to a person skilled in the art, such as by linking the DNA encoding the MPHOSPHl or PRCl protein with a DNA encoding other peptides or proteins, so that the frames match, inserting the fusion DNA into an expression vector and expressing it in a host. There is no restriction as to the peptides or proteins fused to the MPHOSPHl or PRCl protein so long as the resulting fusion proteins retain the activity of the original proteins to bind to each other.
- FLAG Hopp TP et al, Biotechnology 1988 6: 1204-10
- 6xHis containing six His (histidine) residues lOxHis
- Influenza agglutinin (HA) Influenza agglutinin
- human c- myc fragment VSP-GP fragment
- p 18HIV fragment T7-tag
- proteins that may be fused to a protein of the invention include GST (glutathione- S- transferase), Influenza agglutinin (HA), immunoglobulin constant region, ⁇ -galactosidase, MBP (maltose-binding protein), and such. Fusion proteins can be prepared by fusing commercially available DNA, encoding the fusion peptides or proteins discussed above, with the DNA encoding the MPHOSPHl or PRCl protein and expressing the fused DNA prepared.
- modified proteins do not exclude polymorphic variants, interspecies homologues, and those encoded by alleles of these proteins.
- MPHOSPH JOT PRCl DNA sequence e.g., SEQ ID NO: 1 or 36
- the proteins used for the present invention include those that are encoded by DNA that hybridize under stringent conditions with a whole or part of the DNA sequence encoding the human MPHOSPHl or PRCl protein and are functional equivalent to the human MPHOSPHl or PRCl protein.
- These proteins include mammal homologues corresponding to the protein derived from human or mouse (for example, a protein encoded by a monkey, rat, rabbit and bovine gene).
- tissues from testis, or bladder cancer In isolating a cDNA highly homologous to the DNA encoding the human MPHOSPHl protein from animals, it is particularly preferable to use tissues from testis, or bladder cancer.
- tissues from testis and bladder cancer in addition to the tissues from testis and bladder cancer, tissues from breast cancer may also be used.
- hybridization refers to conditions under which a nucleic acid molecule will hybridize to its target sequence, typically in a complex mixture of nucleic acids, but not detectably to other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures.
- T m thermal melting point
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- a positive signal is at least two times of background, preferably 10 times of background hybridization.
- Exemplary stringent hybridization conditions include the following: 50% formamide, 5x SSC, and 1% SDS, incubating at 42°C, or, 5x SSC, 1% SDS, incubating at 65°C, with wash in 0.2x SSC, and 0.1% SDS at 50°C.
- a suitable condition of hybridization for isolating a DNA encoding a polypeptide functionally equivalent to the human MPHOSPHl or PRCl protein can be routinely selected by a person skilled in the art.
- hybridization may be performed by conducting prehybridization at 68°C for 30 min or longer using "Rapid-hyb buffer" (Amersham LIFE SCIENCE), adding a labeled probe, and warming at 68°C for 1 h or longer.
- the following washing step can be conducted, for example, in a low stringent condition.
- An exemplary low stringency condition may include, for example, 42°C, 2x SSC, 0.1% SDS, or preferably 50 0 C, 2x SSC, 0.1% SDS. More preferably, a high stringency condition is used.
- An exemplary high stringent condition may include, for example, washing 3 times in 2x SSC, 0.01% SDS at room temperature for 20 min, then washing 3 times in Ix SSC, 0.1% SDS at 37°C for 20 min, and washing twice in Ix SSC, 0.1% SDS at 5O 0 C for 20 min.
- temperature and salt concentration can influence the stringency of hybridization and one skilled in the art can suitably select the factors to achieve the requisite stringency.
- a gene amplification method for example, the polymerase chain reaction (PCR) method, can be utilized to isolate a DNA encoding a protein functional equivalent to the human MPHOSPHl or PRCl protein, using a primer synthesized based on the sequence information of the DNA (SEQ ID NO: 1 for MPHOSPHl and SEQ ID NO: 36 for PRCl) encoding the human MPHOSPHl or PRCl protein (SEQ ID NO: 2 or 37).
- PCR polymerase chain reaction
- Proteins that are functional equivalent to the human MPHOSPHl or PRCl protein encoded by the DNA isolated through the above hybridization techniques or gene amplification techniques normally have a high homology (also referred to as sequence identity) to the amino acid sequence of the human MPHOSPHl or PRCl protein.
- “High homology” typically refers to the degree of identity between two optimally aligned sequences (either polypeptide or polynucleotide sequences).
- high homology or identity refers to homology of 40% or higher, preferably 60% or higher, more preferably 80% or higher, even more preferably 85%, 90%, 95%, 98%, 99%, or higher.
- the degree of homology or identity between two polypeptide or polynucleotide sequences can be determined by following the algorithm in "Wilbur, WJ & Lipman DJ, Proc Natl Acad Sci USA 1983, 80: 726-30".
- a protein useful in the context of the present invention may have variations in amino acid sequence, molecular weight, isoelectric point, the presence or absence of sugar chains, or form, depending on the cell or host used to produce it or the purification method utilized. Nevertheless, so long as it retains the binding activity possessed by the corresponding natural protein (MPHOSPHl (SEQ ID NO: 1) or PRCl (SEQ ID NO: 37)), it is useful in the present invention.
- the present invention also encompasses the use of partial peptides of the MPHOSPHl or PRCl protein.
- a partial peptide has an amino acid sequence specific to the protein of the MPHOSPHl or PRCl and is composed of less than about 400 amino acids, usually less than about 200 and often less than about 100 amino acids, and at least about 7 amino acids, preferably about 8 amino acids or more, and more preferably about 9 amino acids or more.
- a partial peptide of MPHOSPHl used for the screenings of the present invention suitably contains at least the binding site to PRCl of the MPHOSPHl protein, and a partial peptide of PRCl used for the screenings of the present invention suitably contains at least the binding site to MPHOSPHl of the PRCl protein.
- Such partial peptides are also encompassed by the phrase "functional equivalent" of the MPHOSPHl or PRCl protein.
- the present inventors revealed that amino acid residues from 1188 to 1465 and 1662 to 1718 of SEQ ID NO: 2 function as the binding region of MPHOSPHl to PRCl. Therefore, a partial peptide of MPHOSPHl to be used for the present screenings should contain at least the amino acid residues from 1188 to 1465 or 1662 to 1718 of SEQ ID NO: 2.
- the MPHOSPHl protein used for the screening methods includes at least the amino acid residues 1188 to 1718 of SEQ ID NO: 2.
- the phrase “MPHOSPHl gene” encompasses polynucleotides that encode the MPHOSPHl protein or any of the functional equivalents of the MPHOSPHl protein.
- PRCl gene encompasses polynucleotides that encode the PRCl protein or any of the functional equivalents of the PRCl protein.
- agents to be identified through the present screening methods may be any compound or composition including several compounds.
- the test agent exposed to a cell or protein according to the screening methods of the present invention may be a single compound or a combination of compounds.
- the compounds may be contacted sequentially or simultaneously.
- Any test agent for example, cell extracts, cell culture supernatant, products of fermenting microorganism, extracts from marine organism, plant extracts, purified or crude proteins, peptides, non-peptide compounds, synthetic micromolecular compounds (including nucleic acid constructs, such as antisense RNA, siRNA, libozymes, etc.) and natural compounds can be used in the screening methods of the present invention.
- test agent of the present invention can be also obtained using any of the numerous approaches in combinatorial library methods known in the art, including (1) biological libraries, (2) spatially addressable parallel solid phase or solution phase libraries, (3) synthetic library methods requiring deconvolution, (4) the "one-bead one-compound” library method and (5) synthetic library methods using affinity chromatography selection.
- biological libraries using affinity chromatography selection is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, Anticancer Drug Des 1997, 12: 145-67).
- the screened test agent is a protein
- for obtaining a DNA encoding the protein either the whole amino acid sequence of the protein may be determined to deduce the nucleic acid sequence coding for the protein, or partial amino acid sequence of the obtained protein may be analyzed to prepare an oligo DNA as a probe based on the sequence, and screen cDNA libraries with the probe to obtain a DNA encoding the protein The obtained DNA is confirmed it's usefulness in preparing the test agent which is a candidate for treating or preventing cancer
- Test agents useful in the screenings described herein can also be antibodies that specifically bind to the MPHOSPHl or PRCl protein or partial peptides thereof that lack the biological activity of the original proteins in vivo
- antibodies e.g., monoclonal antibodies
- an antibody refers to an immunoglobulin molecule having a specific structure, that interacts (i.e , binds) only with the antigen that was used for synthesizing the antibody or with an antigen closely related thereto
- an antibody may be a fragment of an antibody or a modified antibody, so long as it binds to the proteins encoded by the MPHOSPHl or PRCl gene
- the antibody fragment may be Fab, F(ab') 2 , Fv, or single chain Fv (scFv), in which Fv fragments from H and L chains are ligated by an appropriate linker (Huston JS et al , Proc Natl Acad Sci USA 1988, 85 5879-83)
- an antibody fragment may be generated by treating an antibody with an enzyme, such as papain or pepsin
- a gene encoding the antibody fragment may be constructed, inserted into an expression vector, and expressed in an appropriate host cell (see, for example, Co MS et
- An antibody may be modified by conjugation with a variety of molecules, such as polyethylene glycol (PEG) Such modified antibodies can also be used in the context of the present invention
- the modified antibody can be obtained by chemically modifying an antibody
- Such modification methods are conventional in the field
- an antibody may take the form of a chimeric antibody having a variable region derived from a nonhuman antibody and a constant region derived from a human antibody, or a humanized antibody, having a complementarity determining region (CDR) derived from a nonhuman antibody, the frame work region (FR) derived from a human antibody and the constant region.
- CDR complementarity determining region
- FR frame work region
- Humanization can be performed by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody (see e.g., Verhoeyen et al, Science 1988, 239: 1534-6). Accordingly, such humanized antibodies are chimeric antibodies, wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
- Fully human antibodies composed of human variable regions in addition to human framework and constant regions can also be used. Such antibodies can be produced using various techniques known in the art. For example in vitro methods involve use of recombinant libraries of human antibody fragments displayed on bacteriophage (e.g., Hoogenboom & Winter, J MoI Biol 1991, 227: 381-8). Similarly, human antibodies can be made by introducing of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. This approach is described, e.g., in U.S. Patent Nos. 6,150,584, 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016.
- test agent libraries are well known in the art, herein below, additional guidance in identifying test agents and construction libraries of such agents for the present screening methods are provided. (i) Molecular modeling
- test agent libraries are facilitated by knowledge of the molecular structure of compounds known to have the properties sought, and/or the molecular structure of the target molecules to be inhibited, i.e., MPHOSPHl and PRCl.
- MPHOSPHl and PRCl One approach to preliminary screening of test agents suitable for further evaluation is computer modeling of the interaction between the test agent and its target.
- modeling the interaction between MPHOSPHl and/or PRCl provides insight into both the details of the interaction itself, and suggests possible strategies for disrupting the interaction, including potential molecular inhibitors of the interaction.
- Computer modeling technology allows the visualization of the three-dimensional atomic structure of a selected molecule and the rational design of new compounds that will interact with the molecule.
- the three-dimensional construct typically depends on data from x-ray crystallographic analysis or NMR imaging of the selected molecule.
- the molecular dynamics require force field data.
- the computer graphics systems enable prediction of how a new compound will link to the target molecule and allow experimental manipulation of the structures of the compound and target molecule to perfect binding specificity. Prediction of what the molecule-compound interaction will be when small changes are made in one or both requires molecular mechanics software and computationally intensive computers, usually coupled with user-friendly, menu-driven interfaces between the molecular design program and the user.
- CHARMm performs the energy minimization and molecular dynamics functions.
- QUANTA performs the construction, graphic modeling and analysis of molecular structure. QUANTA allows interactive construction, modification, visualization, and analysis of the behavior of molecules with each other.
- test agents may be screened using the methods of the present invention to identify test agents of the library that disrupt the association of MPHOSPHl and PRCl.
- Combinatorial libraries of test agents may be produced as part of a rational drug design program involving knowledge of core structures existing in known inhibitors of the interaction between MPHOSPHl and PRCl. This approach allows the library to be maintained at a reasonable size, facilitating high throughput screening.
- simple, particularly short, polymeric molecular libraries may be constructed by simply synthesizing all permutations of the molecular family making up the library.
- An example of this latter approach would be a library of all peptides six amino acids in length. Such a peptide library could include every 6 amino acid sequence permutation. This type of library is termed a linear combinatorial chemical library.
- Combinatorial chemical libraries include, but are not limited to, peptide libraries (see, e.g., US Patent 5,010,175; Furka, Int J Pept Prot Res 1991, 37: 487-93; Houghten et al, Nature 1991, 354: 84-6).
- peptide libraries see, e.g., US Patent 5,010,175; Furka, Int J Pept Prot Res 1991, 37: 487-93; Houghten et al, Nature 1991, 354: 84-6.
- Other chemistries for generating chemical diversity libraries can also be used. Such chemistries include, but are not limited to: peptides (e.g., PCT Publication No.
- WO 91/19735) encoded peptides (e.g., WO 93/20242), random bio-oligomers (e.g., WO 92/00091), benzodiazepines (e.g., US Patent 5,288,514), diversomers such as hydantoins, benzodiazepines and dipeptides (DeWitt et al , Proc Natl Acad Sci USA 1993, 90:6909- 13), vinylogous polypeptides (Hagihara et al, JAmer Chem Soc 1992, 114: 6568), nonpeptidal peptidomimetics with glucose scaffolding (Hirschmann et al., JAmer Chem Soc 1992, 114: 9217-8), analogous organic syntheses of small compound libraries (Chen et al, J.
- an agent that inhibits the binding between MPHOSPHl and PRCl is expected to suppress the proliferation of bladder cancer cells, and thus is useful for treating or preventing bladder cancer. Therefore, the present invention also provides a method for screening an agent that suppresses the proliferation of bladder cancer cells, and a method for screening an agent for treating or preventing bladder cancer.
- the method includes the steps of:
- “inhibition of binding” between two proteins refers to at least reducing binding between the proteins.
- the percentage of binding pairs in a sample will be decreased compared to an appropriate (e.g., not treated with test compound or from a non-cancer sample, or from a cancer sample) control.
- the reduction in the amount of proteins bound may be, e.g., less than 90%, 80%, 70%, 60%, 50%, 40%, 25%, 10%, 5%, 1% or less (e.g., 0%), than the pairs bound in a control sample.
- the MPHOSPHl protein and PRCl protein may include functional equivalents of these proteins as described above.
- the MPHOSPHl or PRCl protein or functional equivalents thereof used in the screening can be prepared as a recombinant protein or natural protein, by methods well known to those skilled in the art.
- the proteins may be obtained adopting any known genetic engineering methods for producing polypeptides (e.g., Morrison J., J Bacteriology 1977, 132: 349-51; Clark-Curtiss & Curtiss, Methods in
- a recombinant protein can be prepared by inserting a DNA , which encodes the protein (for example, the DNA having the nucleotide sequence of SEQ ID NO: 1 or 36), into an appropriate expression vector, introducing the vector into an appropriate host cell, obtaining the extract, and purifying the protein by subjecting the extract to chromatography, for example, ion exchange chromatography, reverse phase chromatography, gel filtration, or affinity chromatography utilizing a column to which antibodies against the protein of the present invention is fixed, or by combining more than one of aforementioned columns.
- chromatography for example, ion exchange chromatography, reverse phase chromatography, gel filtration, or affinity chromatography utilizing a column to which antibodies against the protein of the present invention is fixed, or by combining more than one of aforementioned columns.
- the protein useful in the context of the present invention when expressed within host cells (for example, animal cells and E. col ⁇ ) as a fusion protein with glutathione- S-transferase protein or as a recombinant protein supplemented with multiple histidines, the expressed recombinant protein can be purified using a glutathione column or nickel column.
- host cells for example, animal cells and E. col ⁇
- the expressed recombinant protein can be purified using a glutathione column or nickel column.
- a natural protein can be isolated by methods known to a person skilled in the art, for example, by contacting the affinity column, in which antibodies binding to the MPHOSPHl or PRCl protein described above are bound, with the extract of tissues or cells expressing the protein.
- the antibodies can be polyclonal antibodies, monoclonal antibodies, or any modified antibodies so long as it binds to the MPHOSPHl or PRCl protein.
- the MPHOSPHl or PRCl protein or functional equivalents thereof may also be produced in vitro adopting an in vitro translation system.
- partial peptides of the MPHOSPHl and PRCl proteins may also be used for the invention so long as they retain their binding activity to each other.
- Such partial peptides can be produced by genetic engineering, by known methods of peptide synthesis, or by digesting the natural MPHOSPHl or PRCl protein with an appropriate peptidase.
- peptide synthesis for example, solid phase synthesis or liquid phase synthesis may be used.
- Conventional peptide synthesis methods that can be adopted for the synthesis include: 1) Peptide Synthesis, Interscience, New York, 1966;
- polypeptides or fragments thereof may be further linked to other substances, so long as the polypeptides and fragments retain their original ability to bind to each other.
- Usable substances include: peptides, lipids, sugar and sugar chains, acetyl groups, natural and synthetic polymers, etc. These kinds of modifications may be performed to confer additional functions or to stabilize the polypeptide and fragments.
- the MPHOSPHl and PRCl polypeptides or functional equivalent thereof to be contacted in the presence of a test agent can be, for example, purified polypeptides, soluble proteins, or fusion proteins fused with other polypeptides.
- the screening methods of the present invention provide efficient and rapid identification of test agents that have a high probability of interfering with the association of MPHOSPHl with its binding partner PRCl.
- any method that determines the ability of a test agent to interfere with such association is suitable for use with the present invention.
- competitive and non-competitive inhibition assays in an ELISA format may be utilized.
- Control experiments should be performed to determine maximal binding capacity of system (e.g., contacting bound MPHOSPHl with PRCl, and determining the amount of protein bound to MPHOSPHl).
- identifying agents that inhibit the binding of the present invention many methods well known by one skilled in the art can be used.
- Such identification can be carried out as an in vitro assay system, for example, in a cellular system. More specifically, first, either MPHOSPHl or its PRCl partner is bound to a support, and the other protein is contacted together with a test agent thereto. Next, the mixture is incubated, washed and the other protein bound to the support is detected and/or measured.
- Example of supports that may be used for binding the proteins include insoluble polysaccharides, such as agarose, cellulose and dextran; and synthetic resins, such as polyacrylamide, polystyrene and silicon; preferably commercially available beads and plates (e.g., multi-well plates, biosensor chip, etc.) prepared from the above materials may be used.
- beads When using beads, they may be filled into a column.
- magnetic beads is also known in the art, and enables to readily isolate proteins bound on the beads via magnetism.
- the binding of a protein to a support may be conducted according to routine methods, such as chemical bonding and physical adsorption.
- a protein may be bound to a support via antibodies specifically recognizing the protein.
- binding of a protein to a support can also be conducted by means of interacting molecules, such as the combination of avidin and biotin.
- interacting molecules such as the combination of avidin and biotin.
- the binding between proteins is carried out in buffer, for example, but are not limited to, phosphate buffer and Tris buffer, as long as the buffer does not inhibit the binding between the proteins.
- a biosensor using the surface plasmon resonance phenomenon may be used as a means for detecting or quantifying the bound protein.
- the interaction between the proteins can be observed real-time as a surface plasmon resonance signal, using only a minute amount of polypeptide and without labeling (for example, BIAcore, Pharmacia). Therefore, it is possible to evaluate the binding between the MPHOSPHl and PRCl using a biosensor such as BIAcore.
- either MPHOSPHl or PRCl may be labeled, and the label of the bound protein may be used to detect or measure the bound protein. Specifically, after pre- labeling one of the proteins, the labeled protein is contacted with the other protein in the presence of a test compound, and then bound proteins are detected or measured according to the label after washing.
- Labeling substances such as radioisotope (e.g., 3 H, 14 C, 32 P, 33 P, 35 S, 125 I, 131 I), enzymes (e.g., alkaline phosphatase, horseradish peroxidase, ⁇ -galactosidase, ⁇ -glucosidase), fluorescent substances (e.g., fluorescein isothiocyanate (FITC), fluorescein, Texas red, green fluorescent protein, and rhodamine), magnetic beads (e.g., DYNABEADSTM), calorimetric labels (e.g., colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) beads), and biotin/avidin, may be used for the labeling of a protein in the present method.
- radioisotope e.g., 3 H, 14 C, 32 P, 33 P, 35 S, 125 I, 131 I
- enzymes e
- Patents teaching the use of such labels include US Patent Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241.
- the present invention is not restricted thereto and any label detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means may be used.
- the detection or measurement can be carried out by liquid scintillation.
- proteins labeled with enzymes can be detected or measured by adding a substrate of the enzyme to detect the enzymatic change of the substrate, such as generation of color, with absorptiometer.
- the bound protein may be detected or measured using fluorophotometer.
- the binding in the present screening method can be also detected or measured using an antibody against MPHOSPHl or PRCl.
- an antibody against MPHOSPHl or PRCl For example, after contacting MPHOSPHl immobilized on a support with a test agent and PRCl, the mixture is incubated and washed, and detection or measurement can be conducted using an antibody against PRCl .
- PRCl may be immobilized on a support, and an antibody against MPHOSPHl may be used as the antibody.
- the antibody is preferably labeled with one of the labeling substances mentioned above, and detected or measured based on the labeling substance.
- the antibody against the MPHOSPHl or PRCl may be used as a primary antibody to be detected with a secondary antibody that is labeled with a labeling substance.
- the antibody bound to the protein in the screening of the present invention may be detected or measured using protein G or protein A column.
- a two-hybrid system utilizing cells may be used ("MATCHMAKER Two-Hybrid system”, “Mammalian MATCHMAKER Two-Hybrid Assay Kit”, “MATCHMAKER one- Hybrid system” (Clontech); “HybriZAP Two-Hybrid Vector System” (Stratagene); the references “Dalton and Treisman, Cell 1992, 68: 597-612", “Fields and Sternglanz, Trends Genet 1994, 10: 286-92").
- MPHOSPHl is fused to the SRF-binding region or GAL4-binding region and expressed in yeast cells.
- PRCl is fused to the VP 16 or GAL4 transcriptional activation region and also expressed in the yeast cells in the existence of a test agent.
- PRCl may be fused to the SRF-binding region or GAL4-binding region, and MPHOSPHl to the VP 16 or GAL4 transcriptional activation region.
- the test agent does not inhibit the binding between MPHOSPHl and PRCl, the binding of the two activates a reporter gene, making positive clones detectable.
- a reporter gene for example, Ade2 gene, lacZ gene, CAT gene, luciferase gene and such can be used besides HIS3 gene.
- the binding level between MPHOSPHl and PRCl can be also measured as any change occurring after the binding of MPHOSPHl and PRCl.
- screening can be performed by contacting a test agent with a cell that expresses MPHOSPHl and PRCl, such as J82 or UMUC cells.
- the suppression of cell proliferation may be detected to determine the influence of a test agent on the binding of MPHOSPHl and PRCl .
- a competitive ELISA format may include MPHOSPHl (or PRCl) bound to a solid support.
- the bound MPHOSPHl (or PRCl) would be incubated with PRCl (or MPHOSPHl) and a test agent. After sufficient time to allow the test agent and/or PRCl (or MPHOSPHl) to bind MPHOSPHl (or PRCl), the substrate would be washed to remove unbound material. The amount of PRCl bound to MPHOSPHl is then determined.
- MPHOSPHl (or PRCl) is labeled with an affinity tag. Labeled MPHOSPHl (or PRCl) is then incubated with a test agent and PRCl (or MPHOSPHl), then immunoprecipitated. The immunoprecipitate is then subjected to Western blotting using an antibody against PRCl (or MPHOSPHl). As with the previous competitive assay format, the amount of PRCl (or MPHOSPHl) found associated with MPHOSPHl (or PRCl) is inversely proportional to the ability of the test agent to interfere with the association of MPHOSPHl and PRCl. 2. Non-competitive assay format
- Non-competitive binding assays may also find utility as an initial screen for testing agent libraries constructed in a format that is not readily amenable to screening using competitive assays, such as those described herein.
- An example of such a library is a phage display library (see, e.g., Barrett et al, Anal Biochem 1992, 204: 357-64).
- Phage libraries find utility in being able to produce quickly working quantities of large numbers of different recombinant peptides. Phage libraries do not lend themselves to competitive assays of the invention, but can be efficiently screened in a non-competitive format to determine which recombinant peptide test agents bind MPHOSPHl or PRCl. Test agents identified as binding can then be produced and screened using a competitive assay format.
- An exemplary non-competitive assay would follow an analogous procedure to the one described for the competitive assay, without the addition of one of the components (MPHOSPHl or PRCl).
- the ability of test agent to bind both MPHOSPHl and PRCl needs to be determined for each candidate.
- binding of the test agent to immobilized MPHOSPHl may be determined by washing away unbound test agent; eluting bound test agent from the support, followed by analysis of the eluate; e.g., by mass spectroscopy, protein determination (Bradford or Lowry assay, or Abs. at 280nm determination ).
- the elution step may be eliminated and binding of test agent determined by monitoring changes in the spectroscopic properties of the organic layer at the support surface.
- Methods for monitoring spectroscopic properties of surfaces include, but are not limited to, absorbance, reflectance, transmittance, birefringence, refractive index, diffraction, surface plasmon resonance, ellipsometry, resonant mirror techniques, grating coupled waveguide techniques and multipolar resonance spectroscopy, all of which are known to those of skill in the art.
- a labeled test agent may also be used in the assay to eliminate need for an elution step. In this instance, the amount of label associated with the support after washing away unbound material is directly proportional to test agent binding.
- the components necessary for the present screening methods may be provided as a kit for screening agents that inhibit the binding between MPHOSPHl and PRCl, or agents that suppress proliferation of bladder cancer cells, or agents for treating or preventing bladder cancer.
- the kit may contain, for example, the MPHOSPHl polypeptide or a function equivalent thereof, and/or PRCl polypeptide or a functional equivalent thereof.
- the kit may include control reagents (positive and/or negative), detectable labels, reaction buffers, cell culture medium, containers required for the screening, instructions (e.g., written, tape, VCR, CD-ROM, etc.) for carrying out the method, and so on.
- the components and reagents may be packaged in separate containers.
- An agent isolated by any of the methods of the invention can be administered as a pharmaceutical or can be used for the manufacture of pharmaceutical (therapeutic or prophylactic) compositions for humans and other mammals, such as mice, rats, guinea-pigs, rabbits, cats, dogs, sheep, pigs, cattle, monkeys, baboons, and chimpanzees for treating or preventing bladder cancer.
- the term "preventing” means that the agent is administered prophylactically to retard or suppress the forming of tumor or retards, suppresses, or alleviates at least one clinical symptom of cancer.
- Assessment of the state of tumor in a subject can be made using standard clinical protocols.
- Prophylactic administration may occur prior to the manifestation of overt clinical symptoms of disease, such that a disease or disorder is prevented or, alternatively, delayed in its progression.
- prevention encompasses any activity which reduces the burden of mortality or morbidity from disease. Prevention can occur at primary, secondary and tertiary prevention levels.
- the isolated agents can be directly administered or can be formulated into dosage form using known pharmaceutical preparation methods.
- Pharmaceutical formulations may include those suitable for oral, rectal, nasal, topical (including buccal and sub-lingual), vaginal or parenteral (including intramuscular, sub-cutaneous and intravenous) administration, or for administration by inhalation or insufflation.
- the agents can be taken orally, as sugar-coated tablets, capsules, elixirs and microcapsules; or non-orally, in the form of injections of sterile solutions or suspensions with water or any other pharmaceutically acceptable liquid.
- the agents can be mixed with pharmaceutically acceptable carriers or media, specifically, sterilized water, physiological saline, plant-oils, emulsifiers, suspending agents, surfactants, stabilizers, flavoring agents, excipients, vehicles, preservatives, binders, and such, in a unit dose form required for generally accepted drug implementation.
- pharmaceutically acceptable carriers or media specifically, sterilized water, physiological saline, plant-oils, emulsifiers, suspending agents, surfactants, stabilizers, flavoring agents, excipients, vehicles, preservatives, binders, and such, in a unit dose form required for generally accepted drug implementation.
- the amount of active ingredients in these preparations makes a suitable dosage within the indicated range acquirable.
- additives that can be mixed to tablets and capsules are, binders such as gelatin, corn starch, tragacanth gum and arabic gum; excipients such as crystalline cellulose; swelling agents such as corn starch, gelatin and alginic acid; lubricants such as magnesium stearate; sweeteners such as sucrose, lactose or saccharin; and flavoring agents such as peppermint, Gaultheria adenothrix oil and cherry.
- a liquid carrier such as an oil, can also be further included in the above ingredients.
- Sterile composites for injections can be formulated following normal drug implementations using vehicles such as distilled water used for injections.
- Physiological saline, glucose, and other isotonic liquids including adjuvants can be used as aqueous solutions for injections.
- adjuvants such as D-sorbitol, D-mannose, D-mannitol, and sodium chloride
- Suitable solubilizers such as alcohol, specifically ethanol, polyalcohols such as propylene glycol and polyethylene glycol, non- ionic surfactants, such as Polysorbate 80 (TM) and HCO-50.
- Sesame oil or Soy-bean oil can be used as a oleaginous liquid and may be used in conjunction with benzyl benzoate or benzyl alcohol as a solubilizer and may be formulated with a buffer, such as phosphate buffer and sodium acetate buffer; a pain-killer, such as procaine hydrochloride; a stabilizer, such as benzyl alcohol and phenol; and an anti-oxidant.
- the prepared injection may be filled into a suitable ampule.
- compositions suitable for oral administration may conveniently be presented as discrete units, such as capsules, cachets or tablets, each containing a predetermined amount of the active ingredient; as a powder or granules; or as a solution, a suspension or as an emulsion.
- the active ingredient may also be presented as a bolus electuary or paste, and be in a pure form, i.e., without a carrier.
- Tablets and capsules for oral administration may contain conventional excipients such as binding agents, fillers, lubricants, disintegrant or wetting agents.
- a tablet may be made by compression or molding, optionally with one or more formulational ingredients.
- Compressed tablets may be prepared by compressing in a suitable machine the active ingredients in a free-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, lubricating, surface active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may be coated according to methods well known in the art. Oral fluid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for constitution with water or other suitable vehicle before use.
- Such liquid preparations may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous vehicles (which may include edible oils), or preservatives.
- the tablets may optionally be formulated so as to provide slow or controlled release of the active ingredient therein.
- Formulations for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.
- the formulations may be presented in unit dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline, water-for-injection, immediately prior to use.
- the formulations may be presented for continuous infusion.
- Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.
- Formulations for rectal administration may be presented as a suppository with the usual carriers such as cocoa butter or polyethylene glycol.
- Formulations for topical administration in the mouth for example buccally or sublingualis include lozenges, containing the active ingredient in a flavored base such as sucrose and acacia or tragacanth, and pastilles containing the active ingredient in a base such as gelatin and glycerin or sucrose and acacia.
- the compounds obtained by the invention may be ' used as a liquid spray or dispersible powder or in the form of drops. Drops may be formulated with an aqueous or non-aqueous base, and may include one or more dispersing agents, solubilizing agents or suspending agents. Liquid sprays are conveniently delivered from pressurized packs.
- the compounds are conveniently delivered from an insufflator, nebulizer, pressurized packs or other convenient means of delivering an aerosol spray.
- Pressurized packs may include a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- the compounds may take the form of a dry powder composition, for example a powder mix of the compound and a suitable powder base such as lactose or starch.
- the powder composition may be presented in unit dosage form, in for example, capsules, cartridges, gelatin or blister packs from which the powder may be administered with the aid of an inhalator or insufflators.
- compositions adapted to give sustained release of the active ingredient, may be employed.
- the pharmaceutical compositions may also contain other active ingredients such as antimicrobial agents, immunosuppressants or preservatives.
- Preferred unit dosage formulations are those containing an effective dose, as recited below, or an appropriate fraction of the active ingredient.
- Methods well known to one skilled in the art may be used to administer an agent screened by the present methods to patients, for example, as intraarterial, intravenous, or percutaneous injections and also as intranasal, intramuscular or oral administrations.
- the dosage and method of administration vary according to the body- weight and age of a patient and the administration method; however, one skilled in the art can routinely select a suitable method of administration. If said agent is encodable by a DNA, the DNA can be inserted into a vector for gene therapy and the vector administered to a patient to perform the therapy.
- the dosage and method of administration vary according to the body-weight, age, and symptoms of the patient but one skilled in the art can suitably select them.
- the compositions may be administered at a dose of from about 0.1 to about 250 mg/kg per day.
- the dose range for adult humans is generally from about 5 mg to about 17.5 g/day, preferably about 5 mg to about 10 g/day, and most preferably about 100 mg to about 3 g/day.
- Tablets or other unit dosage forms of presentation provided in discrete units may conveniently contain an amount which is effective at such dosage or as a multiple of the same, for instance, units containing about 5 mg to about 500 mg, usually from about 100 mg to about 500 mg.
- the agents are preferably administered orally or by injection (intravenous or subcutaneous), and the precise amount administered to a subject will be determined under the responsibility of the attendant physician, considering a number of factors, including the age and sex of the subject, the precise disorder being treated, and its severity. Also the route of administration may vary depending upon the condition and its severity.
- the agents screened by the present methods further can be used for treating or preventing bladder cancer in a subject.
- Administration can be prophylactic or therapeutic to a subject at risk of (or susceptible to) a disorder or having a disorder associated with the binding between the MPHOSPHl and PRCl proteins.
- the method includes decreasing the binding between MPHOSPHl and PRCl in bladder cancer cells.
- the function can be inhibited through the administration of an agent obtained by any of the screening methods of the present invention.
- Bladder cancer cell lines and tissue samples Human bladder cancer cell lines, HT 1197, UM-UC-3 , J82, HT 1376, SW780 and
- RT4 were purchased from American Type Culture Collection (ATCC; Rockville, MD). All of the bladder cancer cell lines, COS7 and NIH3T3 cells were grown in monolayer in appropriate medium; i.e. EMEM (Sigma, St. Louis, MO) with O. lmM essential amino acid (Roche), ImM sodium pyruvate (Roche), for HT 1197, UMUC3, J82 and HT 1376; L- 15 for SW 780; McCoy's 5a (Sigma) for RT-4; and Dulbecco's modified Eagle's medium (Invitrogen, Carlsbad, CA) for C0S7 and NIH3T3.
- RNAs were extracted from cultured cells and clinical tissues using RNeasy Micro Kits (Qiagen, Valencia, CA). Extracted RNAs and normal human tissue polyA+ RNAs were treated with DNase I (Nippon Gene, Tokyo, Japan), and reversely transcribed using oligo (dT) primer and Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). Semiquantitative reverse transcription-PCR (RT-PCR) experiments were carried out with the following MPHOSPH J -specific primers or with GAPDH-specific primers as internal control: MPHOSPHJ, 5 1 -CCGGGAAAGTAAACTGACTCAC-3 l (SEQ ID NO: 3) and
- HA-tagged pCAGGS expression vector and the EcoRl and Xho ⁇ site of FLAG-tagged pCAGGS, respectively. DNA sequences of these constructs were confirmed by DNA sequencing.
- the primers for amplification of truncated MPHOSPHl sequences were as follows: 1188 to 1302, forward: 5'-ATAAGAATGCGGCCGCTATGGAAATCACACAGTTAACAAATAATTTGC-
- Plasmid designed to express a part of MPHOSPHl (1612-1780 a.a.) or PRCl (234- 360 a.a.) with His-tagged epitope at their C-terminus was prepared using pET21 vector (Novagen, Madison, WI).
- the recombinant peptides were expressed in Escherichia coli BL21 codon-plus strain (Stratagene, La Jolla, CA), respectively, and purified using Ni-NTA resin agarose (Qiagen) and TALON (Takara Clontech) according to the supplier's protocols.
- the purified recombinant proteins were inoculated into rabbits, and the immune sera were purified on affinity columns according to standard methodology.
- Affinity-purified anti- MPHOSPHl antibodies and anti-PRCl antibodies were used for Western blotting, immunoprecipitation, and immunocytostaining as described below. These antibodies were confirmed to specifically recognize endogenous MPHOSPHl protein in UMUC3 bladder cancer cells by Western blot analysis.
- UMUC3 cells were seeded at 1x10 5 cells per well. After 24 hr, the cells were fixed with PBS containing 4% paraformaldehyde, and then rendered permeable with PBS containing 0.1% Triton X-100 for 2 min at room temperature. Subsequently, the cells were covered with 3% BSA in PBS for 12 hr at 4 0 C, to block nonspecific antibody-binding sites. Then, the cells were incubated with affinity-purified anti-MPHOSPHl specific polyclonal antibody diluted 1 : 100 in the blocking solution.
- the UMUC3 cells were stained with an Alexa488-conjugated anti-rabbit secondary antibody (Molecular Probe) at 1 : 1000 dilutions. Nuclei were counter-stained with 4', 6'-diamidine-2'-phenylindole dihydrochloride (DAPI). Fluorescent images were obtained under a microscope (Leica, Tokyo, Japan).
- RNAi RNA interference
- siRNA in mammalian cells
- Plasmids designed to express siRNA were prepared by cloning of double-stranded oligonucleotides into the psiU ⁇ BX vector.
- the siRNA-expression vector was transfected using Lipofectamine2000 (Invitrogen) or FuGENE ⁇ (Roche) into J82 or UMUC cells, respectively, according to the supplier's recommendations.
- the transfected-cells were cultured for 28 or 21 days in the presence of 0.6 or 1.0 mg/ml of geneticin (G418), respectively, and the numbers of colonies were counted by Giemsa staining. Viability of the cells was evaluated by MTT assay on day 28 or 14 after the treatment.
- the target sequences of the synthetic oligonucleotides for RNAi were as follows: EGFP as a control, 5'-GAAGCAGCACGACTTCTTC-S' (SEQ ID NO:24); siRNA-MPHOSPHl, 5'-GTGAAGAAGTGCGACCGAA-S' (SEQ ID NO:25); siRNA-MPHOSPHl mismatch, 5'-TTGTAGAAGTGCGACCGAG-S' (SEQ ID NO 26); siRNA-PRCl #1, 5'-GGAAAGACTCATCAAAAGC-S ' (SEQ ID NO 27); siRNA-PRCl #2, 5'-GCATATCCGTCTGTCAGAAT-S ' (SEQ ID NO:31); and siRNA-PRCl #2 mismatch, 5'-TCATATCCCTCTGTAAGAT-S' (SEQ ID NO: 35).
- MPHOSPHl expression vector or mock vector was transfected into NIH3T3 cells using FUGENE6 as describe above. Transfected cells were incubated in culture medium containing 0.9 mg/ml of geneticin (G418) (Invitrogen). Clonal NIH3T3 cells were subcloned by limiting dilution. Expression of HA-tagged MPHOSPHl was assessed by Western blot analysis using anti-HA monoclonal antibody. Eventually, several clones were established and designated as MPHOSPH1-NIH3T3.
- lysis buffer 50 mM Tris-HCL (pH 8.0), 150 mM NaCl, 0.5% NP-40 and Protease Inhibitor Cocktail Set III (Calbiochem, San Diego, CA)). Equal amounts of total proteins were incubated at 4 0 C for 2 hr with 2 ⁇ g of rat anti-HA (Roche) or mouse anti-c-myc (Sigma) antibody. Immunocomplexes were incubated with protein G-Sepharose (Zymed Laboratories, South San Francisco, CA) for 2 hr and then washed with lysis buffer. Co-precipitated proteins were separated by SDS-PAGE.
- Proteins separated by SDS-PAGE were transferred on nitrocellulose membranes, and then incubated with mouse anti-c-myc (Sigma) or rat anti-HA (Roche) antibody. Then, after incubation with secondary antibody conjugated to HRP, signals were visualized with ECL kit (Amersham Biosciences).
- MPHOSPHl UMUC3 cells were synchronized using aphidicolin to examine the localization of MPHOSPHl at different cell-cycle points.
- endogenous MPHOSPHl protein was localized in the cytoplasm of prophase, metaphase and early anaphase.
- the protein accumulated on the midzone of the cells in late anaphase and finally concentrated at the contractile ring when the cells were at telophase.
- Figs. 3B and 3C Colony- formation and MTT assays using these siRNA constructs (Figs. 3B and 3C) indicated that the introduction of MPHOSPHl -specific siRNA suppressed the growth of J82 and UMUC3 cells. Furthermore, siRNA that contained 3-bp replacement in si-MPHOSPHl (si- MPHOSPHl -mismatch, see Materials and methods) were constructed and examined, which, in turn, led to the discovery that it had no suppressive effect on the expression of MPHOSPHl or the growth of bladder cancer cells (Fig. 3A).
- NIH3T3-derivative cells that stably expressed exogenous MPHOSPHl (NIH3T3-MPHOSPH1 - 1 , -2, and -3 cells) were established.
- the Western-blot analysis indicated high levels of exogenous MPHOSPHl protein in three derivate clones (Fig. 4A).
- MTT assays showed that three derivative cell lines, NIH3T3-MPHOSPH1-1, -2 and -3, grew much faster than cells transfected with mock plasmid (NIH3T3Mock-l, -2 and -3 cells) (Fig. 4B), indicating MPHOSPHl expression was likely to enhance cell growth.
- NIH3T3-mock cells returned to almost the G0/G1 phase at 12 hr, whereas the NIH3T3 -MPHOSPHl cells passed over the G0/G1 phase and went into the S phase at 12 hr (Fig. 4C).
- NIH3T3-MPHOSPH1 cells or NIH3T3-Mock cells were transplanted into BALB/cA Jcl-nu mice by s.c. (female, 7 weeks old). All of the 12 animals transplanted with either NIH3T3-MPHOSPH1 cells (-#1 or -#2) formed significantly faster, and larger tumors in the nude mice as compared with those transplanted with NIH3T3-Mock (-#1 or -#2) cells (Fig. 4D).
- MPHOSPHl interacting proteins were investigated.
- the search resulted in the identification of protein- regulating cytokinesis 1 (PRCl) protein as a possible candidate to interact with MPHOSPH, since this protein is known to localize in the midbody or near the contractile ring in late anaphase or telophase cells, and to function in midzone formation and cytokinesis.
- PRCl protein-regulating cytokinesis 1
- these proteins were further observed to co-localize during M-phase, especially in late anaphase, translocate to the spindle midzone where they co-localize as a series of narrow microtubule-bundle bars at the midozone.
- the two proteins were separately localized in telophase cells.
- PRCl red
- MPHOSPHl green
- PRCl-specific siRNA expression vectors were constructed to examine the knockdown effect of each of the constructs in J82 and UMUC3 bladder cancer cell lines, which over-expresses PRCl.
- Semi-quantitative RT-PCR showed that si-PRCl#l and si-PRCl#2 have drastic knockdown effects on PRCl expression, whereas si-PRCl -mismatch construct which contained 3-bp replacement to si-PRCl#l or a negative control si-EGFP revealed to have no or little knockdown effect.
- Fig. 7C immunocytochemical analysis was performed to examine the knockdown effect of MPHOSPHl or PRCl on cytokinesis of cancer cells.
- MPHOSPHl or PRCl -specific siRNA expression vectors were transfected into UMUC3 cells, respectively, to observe cell morphology during the 4 days after the transfection.
- formation of multiple nuclei was observed in cells transfected with either of the two siRNAs on day 4 after the transfection (Fig. 7C).
- the finding indicates that the absence of MPHOSPHl or PRCl results in cytokinesis failure, which, in turn, results in the formation of multi-nucleated cells that ultimately induce cell death.
- the present invention relates to a method for identifying or screening a therapeutic or preventive agent for cancer, in particular, bladder cancer, by detecting compounds that inhibit the binding of the MPHOSPHl protein with the PRCl.
- a therapeutic or preventive agent for cancer in particular, bladder cancer
- the present screening method might hold promise for development of a new therapeutic strategy for the treatment and prevention of bladder cancer.
- the data reported herein add to a comprehensive understanding of bladder cancer, and provide clues for identification of molecular targets for therapeutic drugs and preventive agents. Such information contributes to a more profound understanding of carcinogenesis, and provides indicators for developing novel strategies for treatment and ultimately prevention of bladder cancer.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Urology & Nephrology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- General Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Hematology (AREA)
- Cell Biology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The present invention provides a method of identifying agents that inhibit or suppress the binding between MPHOSPH1 and PRC1. Such agents are expected to suppress the proliferation of cell expressing MPHOSPH1 and PRC1, and function as agents to prevent or treat cancer, such as bladder cancer.
Description
DESCRIPTION
METHODS OF SCREENING FOR AGENTS THAT INHIBIT BINDING BETWEEN
MPHOSPHl AND PRCl
This application claims the benefit of U.S. Provisional Application Serial No. 60/840, 124 filed August 25 2006, the contents of which are hereby incorporated by reference in their entirety.
FIELD OF THE INVENTION
The present invention relates to screening methods using the binding of M-phase phosphoprotein 1 (MPHOSPHl) to Protein regulator of cytokinesis 1 (PRCl) as an index. Agents applicable for treating or preventing cancer, in particular bladder cancer, can be identified through the methods.
BACKGROUND OF THE INVENTION
Bladder cancer is the second most common genitourinary tumor in human populations, having an incidence of approximately 357,000 new cases each year worldwide (Parkin DM et al, CA Cancer J Clin 2005, 55: 74-108). About a third of the patients are suspected to suffer from invasive or metastatic disease at the time of diagnosis (Parkin DM et al, CA Cancer J Clin 2005, 55: 74-108; Sternberg CN, Ann Oncol 1995, 6: 113-26; Ardavanis A et al, Br J Cancer 2005, 92: 645-50). Although radical cystectomy is considered the "gold standard" for the treatment of patients with localized but muscle-invasive bladder cancer, about 50% of such patients develop metastases within two years after cystectomy and subsequently die of the disease (Sternberg CN, Ann Oncol 1995, 6: 113-26).
In the last two decades, cisplatin-based combination chemotherapy regimens, such as CMV (cisplatin, methotrexate, and vinblastine) and M-VAC (methotrexate, vinblastine, doxorubicin, and cisplatin), have been primarily applied to patients with advanced bladder cancers (Ardavanis A et al, Br J Cancer 2005, 92: 645-50; Lehmann J et al, World J Urol 2002, 20: 144-50). However, the overall prognosis remains very poor. Moreover, side effects of M-VAC chemotherapy are significantly severe (Vaughn DJ, Semin Oncol 1999, 26(suppl 2): 117-22). Therefore, the development of new molecular target drugs against bladder cancer is earnestly desired. cDNA microarray has been proven to be an effective tool for simultaneously analyzing the expression patterns of thousands of genes. Comparison of genome- wide expression
profiles between cancers and normal cells by cDNA microarray provides useful information that enables the discovery candidate target molecules for development of diagnosis and treatment of cancer (Debouck C et al, Nat Genet 1999, 21 : 48-50). Recent drug development investigations have focused on targeting important molecules involved in the oncogenic pathways, represented by imatinib, mesylate and trastuzumab. The combination of cancer- expression profiling with RNAi should enable the identification of such drug targets for therapy (Clarke PA et al, Eur J Cancer 2004, 40: 2560-91).
Through genome-wide expression analysis, a number of oncogenes involved in development and/or progression of hepatocellular carcinomas (Hamamoto R et al, Nat Cell Biol 2004, 6: 731-40; Yagyu R et al, Int J Oncol 2002, 20: 1173-8), synovial sarcomas (Nagayama S et al, Oncogene 2004, 23: 5551-7; Nagayama S et al, Oncogene 2005, 24: 6201-12), renal cell carcinomas (Togashi A et al, Cancer Res 2005, 65: 4817-26), and breast cancers (WO 2005/28676) have been isolated. Such molecules are considered to be good candidate molecules for development of new therapeutic modalities. Since cytotoxic drugs, such as M-VAC, often cause severe adverse reactions, it is obvious that thoughtful selection of novel target molecules on the basis of well-characterized mechanisms of action should be very helpful to develop effective anti-cancer drugs having minimal risk of side effects. Toward this goal, expression profile analysis on 26 bladder cancers and 29 normal human tissue was previously performed, which, in turn, led to the discovery of multiple genes that are specifically over-expressed in bladder cancer (Takata R et al, Clin Cancer Res April 1, 2005, 11(7): 2625-36; Saito-Hisaminato A et al, DNA Res 2002, 9: 35-45). MPHOSPHl (referred to as C2093) was identified as one of the genes over-expressed in bladder cancer.
In addition, MPHOSPHl was previously identified as a protein that is specifically phosphorylated at G2/M transition, and therefore characterized as a plus-end-directed kinesin related protein (Abaza A et al, J Biol Chem 2003, 278: 27844-52). The MPHOSPHl cDNA encodes a 1780-amino acid protein that is composed of three domains characteristic of an NH2-type kinesin-related protein: an NH2-kinesin motor domain, a central coiled coil-stalk domain, and a C-globular tail domain. Moreover, MPHOSPHl was previously documented to be plus-end-directed molecular motor with a crucial role in cytokinesis, and to accumulate in the midzone of the spindle during anaphase to telophase in HeLa cells (Abaza A et al, J Biol Chem 2003, 278: 27844-52; Kamimoto T et al, J Biol Chem 2001, 276: 37520-8).
PRCl was reported to interact with several kinesin family proteins (Ban R et al, J Biol Chem 2004, 279: 16394-402; Kurasawa Y et al, EMBO J 2004, 23: 3237-48; Zhu C & Jiang W, Proc Natl Acad Sci USA 2005, 102: 343-8; Gruneberg U et al, J Cell Biol 2006, 172: 363-72). Suppression of PRCl by anti-PRCl antibodies in HeLa cells is reported to cause an increase of bi-nucleated cells (Mollinari C et al, J Cell Biol 2002, 157: 1175-86). Further, it has been reported that PRC 1 could interact with several molecules, for example KIF4 or KIF 14, which are associated with mitotic events, especially cytokinesis (Kurasawa Y et al, EMBO J 2004, 23: 3237-48; Mollinari C et al., MoI Biol Cell 2005, 16: 1043-55). Moreover, PRCl was identified by the present inventors to be over-expressed in breast cancer (WO 2005/28676).
SUMMARY OF THE INVENTION
The present invention is based, at least in part, on the discovery of the interaction between MPHOSPHl and PRCl in vivo. Both proteins, MPHOSPHl and PRCl, are over- expressed in bladder cancer cells, and the expression of MPHOSPHl is only observed in bladder cancer cells and normal testis tissue. As demonstrated herein, the inhibition of one of the genes coding for these proteins suppresses cytokinesis and induces multinuclearization, which, in turn, ultimately leads to suppression of the proliferation of cells expressing the genes.
Accordingly, the present invention provides a method of screening for an agent that inhibits the binding between MPHOSPHl and PRCl . More specifically, the method includes the steps of: a) contacting MPHOSPHl with PRCl in the presence of an agent; b) detecting the level of binding level between MPHOSPHl and PRCl; c) comparing the binding level of MPHOSPHl and PRCl with that detected in the absence of the agent; and d) selecting the agent that reduces the binding level of MPHOSPHl and PRCl. In the context of this method, fragments may be used in place of the full-length MPHOSPHl or full-length PRCl, so long as each fragment retains the ability to bind to its partner ligand. Particularly preferred fragments of MPHOSPHl to be used for the present screening include those including the amino acid residues 1188 to 1718 of SEQ ID NO: 2.
Given that the agents identified through the above mentioned method are likely to suppress the proliferation of cells expressing the proteins, such identified agents serve as candidates for treating or preventing bladder cancer. Thus, the present invention also provides methods of identifying agents that suppress the proliferation of bladder cancer cells
as well as agents for treating or preventing bladder cancer.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 depicts the expression of MPHOSPHl in bladder cancer and normal tissues. Panel A depicts the expression of MPHOSPHl in tumor cells from 10 bladder cancer patients and normal human tissues (microdissected normal bladder transitional cells, heart, lung, liver and kidney) examined by semi-quantitative RT-PCR. The expression of GAPDH served as a quantity control. Panel B depicts the results of Northern blot analysis of the MPHOSPHl transcript in bladder cancer cell lines (HTl 197, UMUC3, J82, HT 1376, SW780 and RT4) and normal human organs (heart, lung, liver, kidney, brain, pancreas, testis and bladder). Panel C depicts the results of Northern blot analysis of the MPHOSPHl transcript in various human tissues. Panel D depicts the expression of MPHOSPHl protein in surgically resected bladder cancer tissues (2 superficial bladder cancer and 2 invasive bladder cancer cases) and normal bladder tissue sections by immunohistochemical staining using affinity-purified anti- MPHOSPHl polyclonal antibody. Figure 2 depicts the subcellular localization of endogenous MPHOSPHl protein in bladder cancer cells during cell cycle. UMUC cells were immunohistochemically stained with affinity-purified MPHOSPHl polyclonal antibody (green). DAPI (blue) reveals nuclear staining.
Figure 3 depicts the growth inhibitory effects of MPHOSPH 1-siRNA on bladder cancer cell lines, J82 and UMUC3. Panel A depicts the expression of MPHOSPHl by
Western blot (upper panel) and semi-quantitative RT-PCR (lower panel). Panel B depicts the results of colony formation assays performed on J82 and UMUC3 cells transfected with plasmids expressing MPHOSPH 1-siRNA, a control siRNA (EGFP), or MPHOSPHl mismatch siRNA. Panel C depicts the viability of J82 and UMUC3 cells evaluated by MTT assays in response to MPHOSPH 1-siRNA introduction in comparison with the introduction of the control.
Figure 4 depicts the growth-promoting effect of exogenous MPHOSPHl in NIH3T3 cells. Panel A depicts the results of Western blot analysis on cells expressing high levels of exogenous MPHOSPHl or those transfected with mock vector. Exogenous introduced MPHOSPHl expression was validated with anti-HA-tag monoclonal antibody. Beta-actin served as a loading control. Panel B depicts the in vitro growth of NIH3T3 -MPHOSPHl cells. The growth of NIH3T3 cells transfected with MPHOSPHl (NIH3T3-MPHOSPH1-#1, -#2, -#3) and mock (NIH3T3-Mock-#1, -#2, -#3) were measured by MTT assay. In Panel C,
NIH3T3-MPHOSPH1 (NIH3T3 -MPHO SPH 1-#1) and -mock (Nffl3T3-Mock-#l) were synchronized by treatment of aphidicoline for 24 hr. After release, cell samples were prepared at the indicated time points. Panel D depicts the results of an in vivo tumor growth assay performed on NIH3T3 -MPHO SPHl cells. The diameters of the tumors were measured by calipers and the tumor volumes were determined using the following formula; 0.5 x (larger diameter) x (smaller diameter)2. Unpaired /-test was performed to evaluate the difference between NIH3T3-MPHOSPH1 and NIH3T3-Mock on day 21 post-injection, (p < 0.001; unpaired Mest).
Figure 5 depicts the interaction between MPHOSPHl and PRCl. Panel A depicts the expression of MPHOSPHl and PRCl in bladder cancer cases by semi-quantitative RT-PCR. Expression of GAPDH served as a quantity control. Panel B depicts the co- immunoprecipitation of MPHOSPHl and PRCl. Cell lysates from C0S7 cells transfected with HA tagged MPHOSPHl and myc tagged PRCl proteins were immunoprecipitated with anti-HA or anti-myc. Immunoprecipitates were immunoblotted using monoclonal anti-HA or anti-myc antibodies. Panel C depicts the subcellular localization of endogenous MPHOSPHl and exogenous PRCl in UMUC3 cells. Endogenous MPHOSPHl protein (green) co- localized with exogenous PRCl protein (red).
Figure 6 depicts the determined regions of MPHOSPHl that interact with PRCl. Panel A is a schematic illustration of the MPHOSPHl fragments and full-length used for immunoprecipitation experiments. Panel B depicts the co-immunoprecipitation of a series of fragments of MPHOSPHl and PRCl. Cell lysates from C0S7 cells transfected with HA tagged MPHOSPHl and myc tagged PRCl proteins were immunoprecipitated with anti-HA or anti-myc. Immunoprecipitates were immunoblotted using monoclonal anti-HA or anti-myc antibodies as described in the legend of Fig.5. Figure 7 depicts the significant role of MPHOSPHl and PRCl in cell proliferation of bladder cancer. Panel A depicts the effects of si-PRCl or control siRNA (si-EGFP) on J82 cells, analyzed by semi-quantitative RT-PCR (top left), colony formation assays (bottom left), or MTT assays (right). Panel B depicts the effects of si-PRCl or control siRNA (si-EGFP) on UMUC3 cells, analyzed by semi-quantitative RT-PCR (top left), colony formation assays (bottom left) or MTT assays (right). Panel C depicts the morphology of UMUC cells transfected with si-MPHOSPHl, si-PRCl or si-EGFP as a control. Morphology of UMUC cells transfected si-MPHOSPHl, si-PRCl or si-EGFP as a control siRNA was observed under microscope (upper panel) or evaluated by immunocytochemistry (bottom panel). UMUC
cells treated by siRNAs were stained with DAPI and phalloidin in order to distinguish nuclear and cytoplasm.
DETAILED DESCRIPTION OF THE INVENTION
Among up-regulated genes in bladder cancers detected by microarray analysis, the present invention focuses on MPHOSPHl (M-phase phosphoprotein 1) (SEQ ID NO: 1) (NM 016195), a gene that is highly over-expressed in a great majority of the examined bladder cancer cells. Northern blot analysis showed that the expression oϊMPHOSPHl was barely detectable in any of the examined normal human tissues except testis. Further, immunohistochemical staining experiments using anti-MPHOSPHl polyclonal antibody clearly indicated the up-regulation of MPHOSPHl (SEQ ID NO: 2) expression in bladder cancer cells, suggesting that MPHOSPHl is a cancer-testis antigen (Kanehira M et al., Cancer Res. 2007, 67 (7): 3276-85). Together, these results suggest that the MPHOSPHl gene may serve as a valuable target for the development of anti-cancer agents or cancer peptide-vaccine for bladder cancers. Furthermore, immunocytochemical staining experiments demonstrated that
MPHOSPHl was localized in the nucleus of bladder cancer cells at interphase, in the midzone at late anaphase, and on the contractile ring at telophase. Moreover, knockdown of endogenous MPHOSPHl by siRNAs was demonstrated to induce failure of cytokinesis in bladder cancer cells and result in accumulation of multi-nuclear cells leading to subsequent cell death. Hence, biological roles of MPHOSPHl in bladder cancer cells were examined by identification of its interacting protein(s).
MPHOSPHl was found to interact with PRCl (SEQ ID NO: 37 encoded by SEQ ID NO: 36) (AF044588) (Protein Regulator of Cytokinesis 1), a gene whose expression is also up-regulated in bladder cancers. Due to their functional similarity and common over- expression in bladder cancer cells, PRCl was selected as a candidate to interact with
MPHOSPHl. As shown in Fig. 5, in vivo interaction and co-localization of MPHOSPHl and PRCl (Protein regulator of cytokinesis 1) were demonstrated during interphase to anaphase in bladder cancer cells, while MPHOSPHl surrounded PRCl that localized in the center of midbody in telophase cells (Fig. 5C). Thus, the association and co-localization of MPHOSPHl and PRCl on the mitotic spindle further support the proposition that
MPHOSPHl is a motor protein that translocates PRCl along the mitotic spindles during mitosis. Their co-transactivation in bladder cancer cases (Fig. 5A) suggest that their interaction play a crucial role in bladder carcinogenesis.
Moreover, suppression of either of ' MPHOSPHl or PRCl expression using specific siRNAs thereto induced the formation of multi-nucleated cells, followed by cell death. To assess whether MPHOSPHl or PRCl plays a role in the growth or survival of bladder cancer cells, the expression of either endogenous MPHOSPHl or PRCl was knocked down with specific- siRNAs in bladder cancer lines, J82 or UMUC3 that showed high levels of expression of MPHOSPHl and PRCl. Each of the specific siRNAs significantly suppressed the expression of corresponding genes, and resulted in significant growth suppression of these cells, indicating that both MPHOSPHl and PRCl are essential for the growth of bladder cancer cells. Moreover, knockdown of MPHOSPHl or PRCl expression in UMUC3 cells caused significant increase of the multi-nucleated cells. These results support the suggestion in the literature that suppression of PRCl by microinjection of anti-PRCl antibodies into HeLa cells can cause an increase of bi-nucleated cells (Mollinari C et al, J Cell Biol 2002, 157: 1175-86). Since inhibition of their interaction may finally lead to cell death after the failure of cytokinesis in bladder cancer cells, an agent that inhibits their interaction would serve as a valuable target for the development of pharmaceuticals against bladder cancer.
The microarray data obtained by the present inventors revealed exclusive over- expression of MPHOSPHl in bladder cancers. However, the protein PRCl, which was discovered to interact with MPHOSPHl, was not only over-expressed in bladder cancer cells but also in several other types of human tumors (data not shown). While it has been reported that PRCl could interact with several molecules, for example KIF4 or KIF 14, which are associated with mitotic events, especially cytokinesis (Kurasawa Y et al, EMBO J 2004, 23: 3237-48; Mollinari C et al, MoI Biol Cell 2005, 16: 1043-55), neither KIF4 nor KIF14 was expressed in bladder cancers according to the expression profiles of bladder cancers obtained by the present inventors. These results suggest that regulation of cytokinesis by stabilizing the midozone microtubule bundles and permitting completion of cell cleavage through the interaction of MPHOSPHl and PRCl is an event specific to bladder cancer cells, although the roles of this interaction for cell proliferation and the presence of other binding partners still remain to be elucidated.
Finally, the present findings suggest that the MPH0SPH1/PRC1 pathway is likely to have an oncogenic function in bladder cancer cells, and may be a promising molecular target for the development of anti-cancer drugs against bladder cancer. The development of agents to suppress or inhibit the binding of MPHOSPHl with PRCl may be a rational strategy for bladder cancer therapy. Although further analysis on the binding between MPHOSPHl and
PRC 1 may be needed, the evidence provided herein contributes to more profound understanding of bladder cancer carcinogenesis and to develop novel therapies for bladder cancers.
The words "a", "an", and "the" as used herein mean "at least one" unless otherwise specifically indicated.
The terms "isolated" and "purified" used herein in relation to a substance (e.g., polypeptide, antibody, polynucleotide, etc.) indicate that the substance is substantially free from at least one substance that may else be included in the natural source. Thus, an isolated or purified antibody refers to antibodies that is substantially free of cellular material such as carbohydrate, lipid, or other contaminating proteins from the cell or tissue source from which the protein (antibody) is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized. The term "substantially free of cellular material" includes preparations of a polypeptide in which the polypeptide is separated from cellular components of the cells from which it is isolated or recombinantly produced. Thus, a polypeptide that is substantially free of cellular material includes preparations of polypeptide having less than about 30%, 20%, 10%, or 5% (by dry weight) of heterologous protein (also referred to herein as a "contaminating protein"). When the polypeptide is recombinantly produced, it is also preferably substantially free of culture medium, which includes preparations of polypeptide with culture medium less than about 20%, 10%, or 5% of the volume of the protein preparation. When the polypeptide is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, which includes preparations of polypeptide with chemical precursors or other chemicals involved in the synthesis of the protein less than about 30%, 20%, 10%, 5% (by dry weight) of the volume of the protein preparation. That a particular protein preparation contains an isolated or purified polypeptide can be shown, for example, by the appearance of a single band following sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis of the protein preparation and Coomassie Brilliant Blue staining or the like of the gel. In a preferred embodiment, antibodies of the present invention are isolated or purified.
An "isolated" or "purified" nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In a preferred embodiment, nucleic acid molecules encoding antibodies of the present invention are isolated or purified.
The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is a modified residue, or a non-naturally occurring residue, such as an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.
The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that similarly functions to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those modified after translation in cells (e.g., hydroxyproline, γ- carboxyglutamate, and O-phosphoserine). The phrase "amino acid analog" refers to compounds that have the same basic chemical structure (an α carbon bound to a hydrogen, a carboxy group, an amino group, and an R group) as a naturally occurring amino acid but have a modified R group or modified backbones (e.g., homoserine, norleucine, methionine, sulfoxide, methionine methyl sulfonium). The phrase "amino acid mimetic" refers to chemical compounds that have different structures but similar functions to general amino acids.
Amino acids may be referred to herein by their commonly known three letter symbols or the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. The terms "polynucleotides", "nucleotides", "nucleic acids", and "nucleic acid molecules" are used interchangeably unless otherwise specifically indicated and, similarly to the amino acids, are referred to by their commonly accepted single-letter codes. Similar to the amino acids, they encompass both naturally-occurring and non-naturally occurring nucleic acid polymers. The nucleotide sequence of the human MPHOSPHl gene is shown in SEQ ED NO:
1 (GenBank Accession NM 016195). Herein, the phrase "MPHOSPHl gene" encompasses the human MPHOSPH 1 gene as well as those of other animals including non-human primate, mouse, rat, dog, cat, horse, and cow. However, the present invention is not limited thereto, and includes allelic mutants and genes found in other animals as corresponding to the MPHOSPHl gene.
The amino acid sequence encoded by the human MPHOSPHl gene is shown in SEQ ID NO: 2 (GenBank Accession NP 057279.2). Herein, the polypeptide encoded by the MPHOSPHl gene is referred to as "MPHOSPHl", and sometimes as "MPHOSPHl
polypeptide" or "MPHOSPHl protein".
The nucleotide sequence of human PRCl gene is shown in SEQ ID NO: 36. Furthermore, three different transcriptional variants, composed of 15, 14, and 14 exons, respectively, are known in the art. The nucleotide and amino acid sequences of the variants can be found in GenBank (herein below, the variant with the sequences GenBank Accession No. NM_003981, NMJ99413, and NMJ 99414 are referred to as Vl, V2 and V3, respectively; and corresponding amino acid sequences can be found as GenBank Accession Nos. NP 003972.1, NP_955445.1, and NP_955446.1, respectively). Except alternative variations in exon 13 and 14 of Vl, all other exons were common to the three variants. V2 variant has no exon 14 of Vl, and a novel early stop codon is included within the last exon. Exon 14 of V3 variant was completely deleted, exon 13 of V3 was 77bp shorter at the 3' end than that of Vl, and included a novel early stop codon within the last exon. The variants Vl, V2, and V3 respectively encode proteins of 620, 606, and 566 amino acids.
Herein, the phrase "PRCl gene" encompasses all of the human PRCJ gene variants as well as those of other animals including non-human primate, mouse, rat, dog, cat, horse, and cow but is not limited thereto, and includes allelic mutants and genes found in other animals as corresponding to the PRCl gene.
The amino acid sequence encoded by the human PRCl gene is shown in SEQ ID NO: 37. Herein, the polypeptide encoded by the PRCl gene is referred to as "PRCl", and sometimes as "PRCl polypeptide" or "PRCl protein".
According to an aspect of the present invention, functional equivalents are also considered "MPHOSPHl polypeptides" and "PRCl polypeptides". Herein, a "functional equivalent" of a protein is a polypeptide that has a biological activity, in particular, the binding activity equivalent to the protein. Namely, any polypeptide that retains the activity of the MPHOSPHl protein to the PRC 1 protein, or the activity of the PRC 1 protein to the MPHOSPHl protein may be used as such a functional equivalent of the polypeptides in the present invention. Such functional equivalents include those wherein one or more amino acids are substituted, deleted, added, or inserted to the natural occurring amino acid sequence of the MPHOSPHl or PRCl protein. Generally, it is known that modifications of one or more amino acid in a protein do not influence the function of the protein (Mark DF et al., Proc Natl Acad Sci USA 1984, 81 : 5662-6; Zoller MJ & Smith M, Nucleic Acids Res 1982, 10: 6487-500; Wang A et al., Science 1984, 224: 1431-3; Dalbadie-McFarland G et a/., Proc Natl Acad Sci USA 1982, 79:
6409-13). In fact, mutated or modified proteins, proteins having amino acid sequences modified by substituting, deleting, inserting, and/or adding one or more amino acid residues of a certain amino acid sequence, have been known to retain the original biological activity (Mark et al., Proc Natl Acad Sci USA 81 : 5662-6 (1984); Zoller and Smith, Nucleic Acids Res 10:6487-500 (1982); Dalbadie-McFarland et al., Proc Natl Acad Sci USA 79: 6409-13 (1982)). Accordingly, one of skill in the art will recognize that individual additions, deletions, insertions, or substitutions to an amino acid sequence which alter a single amino acid or a small percentage of amino acids, or those considered to be "conservative modifications", wherein the alteration of a protein results in a protein with similar functions, are contemplated in the context of the instant invention.
So long as the activity the protein is maintained, the number of amino acid mutations is not particularly limited. However, it is generally preferred to alter 5% or less of the amino acid sequence. Accordingly, in a preferred embodiment, the number of amino acids to be mutated in such a mutant is generally 30 amino acids or less, preferably 20 amino acids or less, more preferably 10 amino acids or less, more preferably 6 amino acids or less, and even more preferably 3 amino acids or less.
An amino acid residue to be mutated is preferably mutated into a different amino acid in which the properties of the amino acid side-chain are conserved (a process known as conservative amino acid substitution). Examples of properties of amino acid side chains are hydrophobic amino acids (alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, tyrosine, valine), hydrophilic amino acids (arginine, aspartic acid, aspargin, cystein, glutamic acid, glutamine, glycine, histitidine, lysine, serine, threonine), and side chains having the following functional groups or characteristics in common: an aliphatic side-chain (glycine, alanine, valine, leucine, isoleucine, praline); a hydroxyl group containing side-chain (serine, threonine, tyrosine); a sulfur atom containing side-chain (C, M); a carboxylic acid and amide containing side-chain (aspartic acid, aspargine, glutamic acid, glutamine); a base containing side-chain (arginine, lysine, histidine); and an aromatic containing side-chain (histidine, phenylalanine, tyrosine, tryptophan). Furthermore, conservative substitution tables providing functionally similar amino acids are well known in the art. For example, the following eight groups each contain amino acids that are conservative substitutions for one another:
1) Alanine (A), Glycine (G);
2) Aspartic acid (D), Glutamic acid (E);
3) Aspargine (N), Glutamine (Q);
4) Arginine (R), Lysine (K);
5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V);
6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and
8) Cystein (C), Methionine (M) (see, e.g., Creighton, Proteins 1984).
Such conservatively modified polypeptides are included in the present MPHOSPHl or PRCl protein. However, the present invention is not restricted thereto and the MPHOSPHl and PRCl proteins include non-conservative modifications so long as the binding activity of the original proteins is retained. Furthermore, the modified proteins do not exclude polymorphic variants, interspecies homologues, and those encoded by alleles of these proteins.
An example of a protein modified by addition of one or more amino acids residues is a fusion protein. Fusion proteins are fusions of the MPHOSPHl or PRCl protein and other peptides or proteins, which also can be used in the present invention. Fusion proteins can be made by techniques well known to a person skilled in the art, such as by linking the DNA encoding the MPHOSPHl or PRCl protein with a DNA encoding other peptides or proteins, so that the frames match, inserting the fusion DNA into an expression vector and expressing it in a host. There is no restriction as to the peptides or proteins fused to the MPHOSPHl or PRCl protein so long as the resulting fusion proteins retain the activity of the original proteins to bind to each other.
Known peptides that can be used as peptides to be fused to the MPHOSPHl or PRCl protein include, for example, FLAG (Hopp TP et al, Biotechnology 1988 6: 1204-10), 6xHis containing six His (histidine) residues, lOxHis, Influenza agglutinin (HA), human c- myc fragment, VSP-GP fragment, p 18HIV fragment, T7-tag, HSV-tag, E-tag, SV40T antigen fragment, lck tag, α-tubulin fragment, B-tag, Protein C fragment, and the like. Examples of proteins that may be fused to a protein of the invention include GST (glutathione- S- transferase), Influenza agglutinin (HA), immunoglobulin constant region, β-galactosidase, MBP (maltose-binding protein), and such. Fusion proteins can be prepared by fusing commercially available DNA, encoding the fusion peptides or proteins discussed above, with the DNA encoding the MPHOSPHl or PRCl protein and expressing the fused DNA prepared.
Furthermore, the modified proteins do not exclude polymorphic variants,
interspecies homologues, and those encoded by alleles of these proteins.
An alternative method known in the art to isolate functional equivalent proteins is, for example, the method using a hybridization technique (Sambrook J et al., Molecular Cloning 2nd ed. 9.47-9.58, Cold Spring Harbor Lab. Press, 1989). One skilled in the art can readily isolate a DNA having high homology with a whole or part of the human
MPHOSPH JOT PRCl DNA sequence (e.g., SEQ ID NO: 1 or 36) encoding the human MPHOSPHl or PRCl protein, and isolate functional equivalent proteins to the human MPHOSPHl or PRCl protein from the isolated DNA. Thus, the proteins used for the present invention include those that are encoded by DNA that hybridize under stringent conditions with a whole or part of the DNA sequence encoding the human MPHOSPHl or PRCl protein and are functional equivalent to the human MPHOSPHl or PRCl protein. These proteins include mammal homologues corresponding to the protein derived from human or mouse (for example, a protein encoded by a monkey, rat, rabbit and bovine gene). In isolating a cDNA highly homologous to the DNA encoding the human MPHOSPHl protein from animals, it is particularly preferable to use tissues from testis, or bladder cancer. On the other hand, in isolating a cDNA highly homologous to the DNA encoding the human PRCl protein from animals, in addition to the tissues from testis and bladder cancer, tissues from breast cancer may also be used.
The condition of hybridization for isolating a DNA encoding a protein functional equivalent to the human MPHOSPHl or PRCl protein can be routinely selected by a person skilled in the art. The phrase "stringent (hybridization) conditions" refers to conditions under which a nucleic acid molecule will hybridize to its target sequence, typically in a complex mixture of nucleic acids, but not detectably to other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology- Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays" (1993). Generally, stringent conditions are selected to be about 5- 10°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions may also be achieved with the
addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least two times of background, preferably 10 times of background hybridization. Exemplary stringent hybridization conditions include the following: 50% formamide, 5x SSC, and 1% SDS, incubating at 42°C, or, 5x SSC, 1% SDS, incubating at 65°C, with wash in 0.2x SSC, and 0.1% SDS at 50°C.
In the context of the present invention, a suitable condition of hybridization for isolating a DNA encoding a polypeptide functionally equivalent to the human MPHOSPHl or PRCl protein can be routinely selected by a person skilled in the art. For example, hybridization may be performed by conducting prehybridization at 68°C for 30 min or longer using "Rapid-hyb buffer" (Amersham LIFE SCIENCE), adding a labeled probe, and warming at 68°C for 1 h or longer. The following washing step can be conducted, for example, in a low stringent condition. An exemplary low stringency condition may include, for example, 42°C, 2x SSC, 0.1% SDS, or preferably 500C, 2x SSC, 0.1% SDS. More preferably, a high stringency condition is used. An exemplary high stringent condition may include, for example, washing 3 times in 2x SSC, 0.01% SDS at room temperature for 20 min, then washing 3 times in Ix SSC, 0.1% SDS at 37°C for 20 min, and washing twice in Ix SSC, 0.1% SDS at 5O0C for 20 min. However, several factors such as temperature and salt concentration can influence the stringency of hybridization and one skilled in the art can suitably select the factors to achieve the requisite stringency. In place of hybridization, a gene amplification method, for example, the polymerase chain reaction (PCR) method, can be utilized to isolate a DNA encoding a protein functional equivalent to the human MPHOSPHl or PRCl protein, using a primer synthesized based on the sequence information of the DNA (SEQ ID NO: 1 for MPHOSPHl and SEQ ID NO: 36 for PRCl) encoding the human MPHOSPHl or PRCl protein (SEQ ID NO: 2 or 37). Proteins that are functional equivalent to the human MPHOSPHl or PRCl protein encoded by the DNA isolated through the above hybridization techniques or gene amplification techniques, normally have a high homology (also referred to as sequence identity) to the amino acid sequence of the human MPHOSPHl or PRCl protein. "High homology" (also referred to as "high identity") typically refers to the degree of identity between two optimally aligned sequences (either polypeptide or polynucleotide sequences). Typically, high homology or identity refers to homology of 40% or higher, preferably 60% or higher, more preferably 80% or higher, even more preferably 85%, 90%, 95%, 98%, 99%, or higher. The degree of homology or identity between two polypeptide or polynucleotide
sequences can be determined by following the algorithm in "Wilbur, WJ & Lipman DJ, Proc Natl Acad Sci USA 1983, 80: 726-30".
A protein useful in the context of the present invention may have variations in amino acid sequence, molecular weight, isoelectric point, the presence or absence of sugar chains, or form, depending on the cell or host used to produce it or the purification method utilized. Nevertheless, so long as it retains the binding activity possessed by the corresponding natural protein (MPHOSPHl (SEQ ID NO: 1) or PRCl (SEQ ID NO: 37)), it is useful in the present invention.
The present invention also encompasses the use of partial peptides of the MPHOSPHl or PRCl protein. A partial peptide has an amino acid sequence specific to the protein of the MPHOSPHl or PRCl and is composed of less than about 400 amino acids, usually less than about 200 and often less than about 100 amino acids, and at least about 7 amino acids, preferably about 8 amino acids or more, and more preferably about 9 amino acids or more. A partial peptide of MPHOSPHl used for the screenings of the present invention suitably contains at least the binding site to PRCl of the MPHOSPHl protein, and a partial peptide of PRCl used for the screenings of the present invention suitably contains at least the binding site to MPHOSPHl of the PRCl protein. Such partial peptides are also encompassed by the phrase "functional equivalent" of the MPHOSPHl or PRCl protein. The present inventors revealed that amino acid residues from 1188 to 1465 and 1662 to 1718 of SEQ ID NO: 2 function as the binding region of MPHOSPHl to PRCl. Therefore, a partial peptide of MPHOSPHl to be used for the present screenings should contain at least the amino acid residues from 1188 to 1465 or 1662 to 1718 of SEQ ID NO: 2. Moreover, according to a preferable embodiment of the present invention, the MPHOSPHl protein used for the screening methods includes at least the amino acid residues 1188 to 1718 of SEQ ID NO: 2.
Moreover, in the context of the present invention, the phrase "MPHOSPHl gene" encompasses polynucleotides that encode the MPHOSPHl protein or any of the functional equivalents of the MPHOSPHl protein. Similarly, the phrase "PRCl gene" encompasses polynucleotides that encode the PRCl protein or any of the functional equivalents of the PRCl protein.
In the context of the present invention, agents to be identified through the present screening methods may be any compound or composition including several compounds.
Furthermore, the test agent exposed to a cell or protein according to the screening methods of the present invention may be a single compound or a combination of compounds. When a combination of compounds is used in the methods, the compounds may be contacted sequentially or simultaneously. Any test agent, for example, cell extracts, cell culture supernatant, products of fermenting microorganism, extracts from marine organism, plant extracts, purified or crude proteins, peptides, non-peptide compounds, synthetic micromolecular compounds (including nucleic acid constructs, such as antisense RNA, siRNA, libozymes, etc.) and natural compounds can be used in the screening methods of the present invention. The test agent of the present invention can be also obtained using any of the numerous approaches in combinatorial library methods known in the art, including (1) biological libraries, (2) spatially addressable parallel solid phase or solution phase libraries, (3) synthetic library methods requiring deconvolution, (4) the "one-bead one-compound" library method and (5) synthetic library methods using affinity chromatography selection. The biological library methods using affinity chromatography selection is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, Anticancer Drug Des 1997, 12: 145-67). Examples of methods for the synthesis of molecular libraries can be found in the art (DeWitt et al, Proc Natl Acad Sci USA 1993, 90: 6909-13; Erb et al, Proc Natl Acad Sci USA 1994, 91 : 11422- 6; Zuckermann e/ α/ , J Med Chem 37: 2678-85, 1994; Cho et al, Science 1993, 261 : 1303- 5; Carell et al, Angew Chem Int Ed Engl 1994, 33: 2059; Carell et al, Angew Chem Int Ed Engl 1994, 33: 2061; Gallop et al, J Med Chem 1994, 37: 1233-51). Libraries of compounds may be presented in solution (see Houghten, Bio/Techniques 1992, 13: 412-21) or on beads (Lam, Nature 1991, 354: 82-4), chips (Fodor, Nature 1993, 364: 555-6), bacteria (US Pat. No. 5,223,409), spores (US Pat. No. 5,571,698; 5,403,484, and 5,223,409), plasmids (Cull et al, Proc Natl Acad Sci USA 1992, 89: 1865-9) or phage (Scott and Smith, Science 1990, 249: 386-90; Devlin, Science 1990, 249: 404-6; Cwirla et al, Proc Natl Acad Sci USA 1990, 87: 6378-82; Felici, J MoI Biol 1991, 222: 301-10; US Pat. Application 2002103360). A compound in which a part of the structure of the compound screened by any of the present screening methods is converted by addition, deletion and/or replacement, is included in the agents obtained by the screening methods of the present invention.
Furthermore, when the screened test agent is a protein, for obtaining a DNA
encoding the protein, either the whole amino acid sequence of the protein may be determined to deduce the nucleic acid sequence coding for the protein, or partial amino acid sequence of the obtained protein may be analyzed to prepare an oligo DNA as a probe based on the sequence, and screen cDNA libraries with the probe to obtain a DNA encoding the protein The obtained DNA is confirmed it's usefulness in preparing the test agent which is a candidate for treating or preventing cancer
Test agents useful in the screenings described herein can also be antibodies that specifically bind to the MPHOSPHl or PRCl protein or partial peptides thereof that lack the biological activity of the original proteins in vivo For example, antibodies (e.g., monoclonal antibodies) can be tested for their ability to block the binding between the MPHOSPHl and PRCl proteins
As used herein, the term "antibody" refers to an immunoglobulin molecule having a specific structure, that interacts (i.e , binds) only with the antigen that was used for synthesizing the antibody or with an antigen closely related thereto Furthermore, an antibody may be a fragment of an antibody or a modified antibody, so long as it binds to the proteins encoded by the MPHOSPHl or PRCl gene For instance, the antibody fragment may be Fab, F(ab')2, Fv, or single chain Fv (scFv), in which Fv fragments from H and L chains are ligated by an appropriate linker (Huston JS et al , Proc Natl Acad Sci USA 1988, 85 5879-83) More specifically, an antibody fragment may be generated by treating an antibody with an enzyme, such as papain or pepsin Alternatively, a gene encoding the antibody fragment may be constructed, inserted into an expression vector, and expressed in an appropriate host cell (see, for example, Co MS et al , J Immunol 1994, 152 2968-76, Better M & Horwitz AH, Methods Enzymol 1989, 178 476-96, Pluckthun A & Skerra A, Methods Enzymol 1989, 178 497-515, Lamoyi E, Methods Enzymol 1986, 121 652-63, Rousseaux J et al , Methods Enzymol 1986, 121 663-9, Bird RE & Walker BW, Trends Biotechnol 1991, 9 132-7)
An antibody may be modified by conjugation with a variety of molecules, such as polyethylene glycol (PEG) Such modified antibodies can also be used in the context of the present invention The modified antibody can be obtained by chemically modifying an antibody Such modification methods are conventional in the field Alternatively, an antibody may take the form of a chimeric antibody having a variable region derived from a nonhuman antibody and a constant region derived from a human antibody, or a humanized antibody, having a complementarity determining region (CDR) derived from a nonhuman
antibody, the frame work region (FR) derived from a human antibody and the constant region. Such antibodies can be prepared by using known technologies. Humanization can be performed by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody (see e.g., Verhoeyen et al, Science 1988, 239: 1534-6). Accordingly, such humanized antibodies are chimeric antibodies, wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
Fully human antibodies composed of human variable regions in addition to human framework and constant regions can also be used. Such antibodies can be produced using various techniques known in the art. For example in vitro methods involve use of recombinant libraries of human antibody fragments displayed on bacteriophage (e.g., Hoogenboom & Winter, J MoI Biol 1991, 227: 381-8). Similarly, human antibodies can be made by introducing of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. This approach is described, e.g., in U.S. Patent Nos. 6,150,584, 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016.
Although the construction of test agent libraries is well known in the art, herein below, additional guidance in identifying test agents and construction libraries of such agents for the present screening methods are provided. (i) Molecular modeling
Construction of test agent libraries is facilitated by knowledge of the molecular structure of compounds known to have the properties sought, and/or the molecular structure of the target molecules to be inhibited, i.e., MPHOSPHl and PRCl. One approach to preliminary screening of test agents suitable for further evaluation is computer modeling of the interaction between the test agent and its target. In the present invention, modeling the interaction between MPHOSPHl and/or PRCl provides insight into both the details of the interaction itself, and suggests possible strategies for disrupting the interaction, including potential molecular inhibitors of the interaction.
Computer modeling technology allows the visualization of the three-dimensional atomic structure of a selected molecule and the rational design of new compounds that will interact with the molecule. The three-dimensional construct typically depends on data from x-ray crystallographic analysis or NMR imaging of the selected molecule. The molecular dynamics require force field data. The computer graphics systems enable prediction of how
a new compound will link to the target molecule and allow experimental manipulation of the structures of the compound and target molecule to perfect binding specificity. Prediction of what the molecule-compound interaction will be when small changes are made in one or both requires molecular mechanics software and computationally intensive computers, usually coupled with user-friendly, menu-driven interfaces between the molecular design program and the user.
An example of the molecular modeling system described generally above includes the CHARMm and QUANTA programs, Polygen Corporation, Waltham, Mass. CHARMm performs the energy minimization and molecular dynamics functions. QUANTA performs the construction, graphic modeling and analysis of molecular structure. QUANTA allows interactive construction, modification, visualization, and analysis of the behavior of molecules with each other.
A number of articles review computer modeling of drugs interactive with specific proteins, such as Rotivinen et al Acta Pharmaceutica Fennica 1988, 97: 159-66; Ripka, New Scientist 1988, 54-8; McKinlay & Rossmann, Annu Rev Pharmacol Toxiciol 1989, 29: 111-22; Perry & Davies, Prog Clin Biol Res 1989, 291 : 189-93; Lewis & Dean, Proc R Soc Lond 1989, 236: 125-40, 141-62; and, with respect to a model receptor for nucleic acid components, Askew et al., JAm Chem Soc 1989, 111 : 1082-90.
Other computer programs that screen and graphically depict chemicals are available from companies such as BioDesign, Inc., Pasadena, Calif, Allelix, Inc, Mississauga, Ontario, Canada, and Hypercube, Inc., Cambridge, Ontario. See, e.g., DesJarlais et al, J Med Chem 1988, 31 : 722-9; Meng et al, J Computer Chem 1992, 13: 505-24; Meng et al, Proteins 1993, 17: 266-78; Shoichet et a}., Science 1993, 259: 1445-50.
Once a putative inhibitor of the interaction between MPHOSPHl and PRCl has been identified, combinatorial chemistry techniques can be employed to construct any number of variants based on the chemical structure of the identified putative inhibitor, as detailed below. The resulting library of putative inhibitors, or "test agents" may be screened using the methods of the present invention to identify test agents of the library that disrupt the association of MPHOSPHl and PRCl. (ii) Combinatorial chemical synthesis
Combinatorial libraries of test agents may be produced as part of a rational drug design program involving knowledge of core structures existing in known inhibitors of the interaction between MPHOSPHl and PRCl. This approach allows the library to be
maintained at a reasonable size, facilitating high throughput screening. Alternatively, simple, particularly short, polymeric molecular libraries may be constructed by simply synthesizing all permutations of the molecular family making up the library. An example of this latter approach would be a library of all peptides six amino acids in length. Such a peptide library could include every 6 amino acid sequence permutation. This type of library is termed a linear combinatorial chemical library.
Preparation of combinatorial chemical libraries is well known to those of skill in the art, and may be generated by either chemical or biological synthesis. Combinatorial chemical libraries include, but are not limited to, peptide libraries (see, e.g., US Patent 5,010,175; Furka, Int J Pept Prot Res 1991, 37: 487-93; Houghten et al, Nature 1991, 354: 84-6). Other chemistries for generating chemical diversity libraries can also be used. Such chemistries include, but are not limited to: peptides (e.g., PCT Publication No. WO 91/19735), encoded peptides (e.g., WO 93/20242), random bio-oligomers (e.g., WO 92/00091), benzodiazepines (e.g., US Patent 5,288,514), diversomers such as hydantoins, benzodiazepines and dipeptides (DeWitt et al , Proc Natl Acad Sci USA 1993, 90:6909- 13), vinylogous polypeptides (Hagihara et al, JAmer Chem Soc 1992, 114: 6568), nonpeptidal peptidomimetics with glucose scaffolding (Hirschmann et al., JAmer Chem Soc 1992, 114: 9217-8), analogous organic syntheses of small compound libraries (Chen et al, J. Amer Chem Soc 1994, 116: 2661), oligocarbamates (Cho et al, Science 1993, 261: 1303), and/or peptidylphosphonates (Campbell et al, J Org Chem 1994, 59: 658), nucleic acid libraries (see Ausubel, Current Protocols in Molecular Biology 1995 supplement; Sambrook et α/., Molecular Cloning: A Laboratory Manual, 1989, Cold Spring Harbor Laboratory, New York, USA), peptide nucleic acid libraries (see, e.g., US Patent 5,539,083), antibody libraries (see, e.g., Vaughan et al, Nature Biotechnology 1996, 14(3):309-14 and PCT/US96/10287), carbohydrate libraries (see, e.g., Liang et al, Science 1996, 274: 1520-22; US Patent
5,593,853), and small organic molecule libraries (see, e.g., benzodiazepines, Gordon EM. Curr Opin Biotechnol. 1995 Dec 1;6(6):624-31.; isoprenoids, US Patent 5,569,588; thiazolidinones and metathiazanones, US Patent 5,549,974; pyrrolidines, US Patents 5,525,735 and 5,519,134; morpholino compounds, US Patent 5,506,337; benzodiazepines, 5,288,514, and the like), (iii) Phage display
Another approach uses recombinant bacteriophage to produce libraries. Using the "phage method" (Scott & Smith, Science 1990, 249: 386-90; Cwirla et al, Proc Natl Acad
Sci USA 1990, 87: 6378-82; Devlin et al., Science 1990, 249: 404-6), very large libraries can be constructed {e.g., 106 -108 chemical entities). A second approach uses primarily chemical methods, of which the Geysen method (Geysen et ai, Molecular Immunology 1986, 23: 709- 15; Geysen et al., J Immunologic Method 1987, 102: 259-74); and the method of Fodor et al. {Science 1991, 251 : 767-73) are examples. Furka et al. (14th International Congress of
Biochemistry 1988, Volume #5, Abstract FR:013; Furka, Int J Peptide Protein Res 1991, 37: 487-93), Houghten (US Patent 4,631,211) and Rutter et al. (US Patent 5,010, 175) describe methods to produce a mixture of peptides that can be tested as agonists or antagonists.
Devices for the preparation of combinatorial libraries are commercially available {see, e.g., 357 MPS, 390 MPS, Advanced Chem Tech, Louisville KY, Symphony, Rainin, Woburn, MA, 433A Applied Biosystems, Foster City, CA, 9050 Plus, Millipore, Bedford, MA). In addition, numerous combinatorial libraries are themselves commercially available {see, e.g., ComGenex, Princeton, N.J., Tripos, Inc., St. Louis, MO, 3D Pharmaceuticals, Exton, PA, Martek Biosciences, Columbia, MD, etc.). The present invention provides a method of screening for an agent that inhibits the binding between MPHOSPHl and PRCl. An agent that inhibits the binding between MPHOSPHl and PRCl is expected to suppress the proliferation of bladder cancer cells, and thus is useful for treating or preventing bladder cancer. Therefore, the present invention also provides a method for screening an agent that suppresses the proliferation of bladder cancer cells, and a method for screening an agent for treating or preventing bladder cancer.
More specifically, the method includes the steps of:
(a) contacting a MPHOSPHl protein with a PRCl protein in the presence of an agent;
(b) detecting the level of binding between the MPHOSPHl and PRCl proteins; (c) comparing the binding level of the MPHOSPHl and PRCl proteins with that detected in the absence of the agent; and
(d) selecting the agent that reduces the binding level of MPHOSPHl and PRCl proteins as an agent that inhibits the binding between the MPHOSPHl and PRCl proteins, i.e., an agent that may be used to suppress the proliferation of bladder cancer cells and for treating or preventing bladder cancer.
In the context of the present invention, "inhibition of binding" between two proteins refers to at least reducing binding between the proteins. Thus, in some cases, the percentage
of binding pairs in a sample will be decreased compared to an appropriate (e.g., not treated with test compound or from a non-cancer sample, or from a cancer sample) control. The reduction in the amount of proteins bound may be, e.g., less than 90%, 80%, 70%, 60%, 50%, 40%, 25%, 10%, 5%, 1% or less (e.g., 0%), than the pairs bound in a control sample. Herein, the MPHOSPHl protein and PRCl protein may include functional equivalents of these proteins as described above. The MPHOSPHl or PRCl protein or functional equivalents thereof used in the screening can be prepared as a recombinant protein or natural protein, by methods well known to those skilled in the art. The proteins may be obtained adopting any known genetic engineering methods for producing polypeptides (e.g., Morrison J., J Bacteriology 1977, 132: 349-51; Clark-Curtiss & Curtiss, Methods in
Enzymology (eds. Wu et al.) 1983, 101 : 347-62). For example, a recombinant protein can be prepared by inserting a DNA , which encodes the protein (for example, the DNA having the nucleotide sequence of SEQ ID NO: 1 or 36), into an appropriate expression vector, introducing the vector into an appropriate host cell, obtaining the extract, and purifying the protein by subjecting the extract to chromatography, for example, ion exchange chromatography, reverse phase chromatography, gel filtration, or affinity chromatography utilizing a column to which antibodies against the protein of the present invention is fixed, or by combining more than one of aforementioned columns.
Also, when the protein useful in the context of the present invention is expressed within host cells (for example, animal cells and E. colϊ) as a fusion protein with glutathione- S-transferase protein or as a recombinant protein supplemented with multiple histidines, the expressed recombinant protein can be purified using a glutathione column or nickel column.
After purifying the fusion protein, it is also possible to exclude regions other than the objective protein by cutting with thrombin or factor-Xa as required. A natural protein can be isolated by methods known to a person skilled in the art, for example, by contacting the affinity column, in which antibodies binding to the MPHOSPHl or PRCl protein described above are bound, with the extract of tissues or cells expressing the protein. The antibodies can be polyclonal antibodies, monoclonal antibodies, or any modified antibodies so long as it binds to the MPHOSPHl or PRCl protein. The MPHOSPHl or PRCl protein or functional equivalents thereof may also be produced in vitro adopting an in vitro translation system.
Further, partial peptides of the MPHOSPHl and PRCl proteins may also be used for the invention so long as they retain their binding activity to each other. Such partial
peptides can be produced by genetic engineering, by known methods of peptide synthesis, or by digesting the natural MPHOSPHl or PRCl protein with an appropriate peptidase. For peptide synthesis, for example, solid phase synthesis or liquid phase synthesis may be used. Conventional peptide synthesis methods that can be adopted for the synthesis include: 1) Peptide Synthesis, Interscience, New York, 1966;
2) The Proteins, Vol. 2, Academic Press, New York, 1976;
3) Peptide Synthesis (in Japanese), Maruzen Co., 1975;
4) Basics and Experiment of Peptide Synthesis (in Japanese), Maruzen Co., 1985;
5) Development of Pharmaceuticals (second volume) (in Japanese), Vol. 14 (peptide synthesis), Hirokawa, 1991;
6) WO99/67288; and
7) Barany G. & Merrifield R B. , Peptides Vol. 2, "Solid Phase Peptide Synthesis", Academic Press, New York, 1980, 100-118.
The polypeptides or fragments thereof may be further linked to other substances, so long as the polypeptides and fragments retain their original ability to bind to each other. Usable substances include: peptides, lipids, sugar and sugar chains, acetyl groups, natural and synthetic polymers, etc. These kinds of modifications may be performed to confer additional functions or to stabilize the polypeptide and fragments.
The MPHOSPHl and PRCl polypeptides or functional equivalent thereof to be contacted in the presence of a test agent can be, for example, purified polypeptides, soluble proteins, or fusion proteins fused with other polypeptides.
The screening methods of the present invention provide efficient and rapid identification of test agents that have a high probability of interfering with the association of MPHOSPHl with its binding partner PRCl. Generally, any method that determines the ability of a test agent to interfere with such association is suitable for use with the present invention. For example, competitive and non-competitive inhibition assays in an ELISA format may be utilized. Control experiments should be performed to determine maximal binding capacity of system (e.g., contacting bound MPHOSPHl with PRCl, and determining the amount of protein bound to MPHOSPHl). As a method for identifying agents that inhibit the binding of the present invention, many methods well known by one skilled in the art can be used. Such identification can be carried out as an in vitro assay system, for example, in a cellular system. More specifically, first, either MPHOSPHl or its PRCl partner is bound to a support, and the other protein is
contacted together with a test agent thereto. Next, the mixture is incubated, washed and the other protein bound to the support is detected and/or measured.
Example of supports that may be used for binding the proteins include insoluble polysaccharides, such as agarose, cellulose and dextran; and synthetic resins, such as polyacrylamide, polystyrene and silicon; preferably commercially available beads and plates (e.g., multi-well plates, biosensor chip, etc.) prepared from the above materials may be used. When using beads, they may be filled into a column. Alternatively, the use of magnetic beads is also known in the art, and enables to readily isolate proteins bound on the beads via magnetism. The binding of a protein to a support may be conducted according to routine methods, such as chemical bonding and physical adsorption. Alternatively, a protein may be bound to a support via antibodies specifically recognizing the protein. Moreover, binding of a protein to a support can also be conducted by means of interacting molecules, such as the combination of avidin and biotin. The binding between proteins is carried out in buffer, for example, but are not limited to, phosphate buffer and Tris buffer, as long as the buffer does not inhibit the binding between the proteins.
In the present invention, a biosensor using the surface plasmon resonance phenomenon may be used as a means for detecting or quantifying the bound protein. When such a biosensor is used, the interaction between the proteins can be observed real-time as a surface plasmon resonance signal, using only a minute amount of polypeptide and without labeling (for example, BIAcore, Pharmacia). Therefore, it is possible to evaluate the binding between the MPHOSPHl and PRCl using a biosensor such as BIAcore.
Alternatively, either MPHOSPHl or PRCl may be labeled, and the label of the bound protein may be used to detect or measure the bound protein. Specifically, after pre- labeling one of the proteins, the labeled protein is contacted with the other protein in the presence of a test compound, and then bound proteins are detected or measured according to the label after washing.
Labeling substances such as radioisotope (e.g., 3H, 14C, 32P, 33P, 35S, 125I, 131I), enzymes (e.g., alkaline phosphatase, horseradish peroxidase, β-galactosidase, β-glucosidase), fluorescent substances (e.g., fluorescein isothiocyanate (FITC), fluorescein, Texas red, green fluorescent protein, and rhodamine), magnetic beads (e.g., DYNABEADS™), calorimetric labels (e.g., colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, latex,
etc.) beads), and biotin/avidin, may be used for the labeling of a protein in the present method. Patents teaching the use of such labels include US Patent Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241. However, the present invention is not restricted thereto and any label detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means may be used.
When the protein is labeled with radioisotope, the detection or measurement can be carried out by liquid scintillation. Alternatively, proteins labeled with enzymes can be detected or measured by adding a substrate of the enzyme to detect the enzymatic change of the substrate, such as generation of color, with absorptiometer. Further, in case where a fluorescent substance is used as the label, the bound protein may be detected or measured using fluorophotometer.
Furthermore, the binding in the present screening method can be also detected or measured using an antibody against MPHOSPHl or PRCl. For example, after contacting MPHOSPHl immobilized on a support with a test agent and PRCl, the mixture is incubated and washed, and detection or measurement can be conducted using an antibody against PRCl . Alternatively, PRCl may be immobilized on a support, and an antibody against MPHOSPHl may be used as the antibody.
When using an antibody in the present screening, the antibody is preferably labeled with one of the labeling substances mentioned above, and detected or measured based on the labeling substance. Alternatively, the antibody against the MPHOSPHl or PRCl may be used as a primary antibody to be detected with a secondary antibody that is labeled with a labeling substance. Furthermore, the antibody bound to the protein in the screening of the present invention may be detected or measured using protein G or protein A column. Alternatively, in another embodiment of the identification method of the present invention, a two-hybrid system utilizing cells may be used ("MATCHMAKER Two-Hybrid system", "Mammalian MATCHMAKER Two-Hybrid Assay Kit", "MATCHMAKER one- Hybrid system" (Clontech); "HybriZAP Two-Hybrid Vector System" (Stratagene); the references "Dalton and Treisman, Cell 1992, 68: 597-612", "Fields and Sternglanz, Trends Genet 1994, 10: 286-92"). In the two-hybrid system, for example, MPHOSPHl is fused to the SRF-binding region or GAL4-binding region and expressed in yeast cells. PRCl is fused to the VP 16 or GAL4 transcriptional activation region and also expressed in the yeast cells in the existence of a test agent. Alternatively, PRCl may be fused to the SRF-binding region
or GAL4-binding region, and MPHOSPHl to the VP 16 or GAL4 transcriptional activation region. When the test agent does not inhibit the binding between MPHOSPHl and PRCl, the binding of the two activates a reporter gene, making positive clones detectable. As a reporter gene, for example, Ade2 gene, lacZ gene, CAT gene, luciferase gene and such can be used besides HIS3 gene.
Herein, the binding level between MPHOSPHl and PRCl can be also measured as any change occurring after the binding of MPHOSPHl and PRCl. Specifically, such screening can be performed by contacting a test agent with a cell that expresses MPHOSPHl and PRCl, such as J82 or UMUC cells. For example, the suppression of cell proliferation may be detected to determine the influence of a test agent on the binding of MPHOSPHl and PRCl .
1. Competitive assay format
Competitive assays may be used for screening test agents of the present invention. By way of example, a competitive ELISA format may include MPHOSPHl (or PRCl) bound to a solid support. The bound MPHOSPHl (or PRCl) would be incubated with PRCl (or MPHOSPHl) and a test agent. After sufficient time to allow the test agent and/or PRCl (or MPHOSPHl) to bind MPHOSPHl (or PRCl), the substrate would be washed to remove unbound material. The amount of PRCl bound to MPHOSPHl is then determined. This may be accomplished in any of a variety of ways known in the art, for example, by using PRCl (or MPHOSPHl) species tagged with a detectable label, or by contacting the washed substrate with a labeled antibody against PRCl (or MPHOSPHl). The amount of PRCl (or MPHOSPHl) bound to MPHOSPHl (or PRCl) will be inversely proportional to the ability of the test agent to interfere with the association of MPHOSPHl to PRCl . Protein, including but not limited to, antibody, labeling is described in Harlow & Lane, Antibodies, A Laboratory Manual (1988).
In a variation, MPHOSPHl (or PRCl) is labeled with an affinity tag. Labeled MPHOSPHl (or PRCl) is then incubated with a test agent and PRCl (or MPHOSPHl), then immunoprecipitated. The immunoprecipitate is then subjected to Western blotting using an antibody against PRCl (or MPHOSPHl). As with the previous competitive assay format, the amount of PRCl (or MPHOSPHl) found associated with MPHOSPHl (or PRCl) is inversely proportional to the ability of the test agent to interfere with the association of MPHOSPHl and PRCl.
2. Non-competitive assay format
Non-competitive binding assays may also find utility as an initial screen for testing agent libraries constructed in a format that is not readily amenable to screening using competitive assays, such as those described herein. An example of such a library is a phage display library (see, e.g., Barrett et al, Anal Biochem 1992, 204: 357-64).
Phage libraries find utility in being able to produce quickly working quantities of large numbers of different recombinant peptides. Phage libraries do not lend themselves to competitive assays of the invention, but can be efficiently screened in a non-competitive format to determine which recombinant peptide test agents bind MPHOSPHl or PRCl. Test agents identified as binding can then be produced and screened using a competitive assay format. Production and screening of phage and cell display libraries is well-known in the art and discussed in, for example, Ladner et al, WO 88/06630; Fuchs et al, Biotechnology 1991, 9: 1369-72; Goward et al, TIBS 1993, 18: 136-40; Charbit et al, EMBO J 1986, 5: 3029-37; Cull et al, PNAS USA 1992, 89: 1865-9; Cwirla et al, PNAS USA 1990, 87: 6378-82.
An exemplary non-competitive assay would follow an analogous procedure to the one described for the competitive assay, without the addition of one of the components (MPHOSPHl or PRCl). However, as non-competitive formats determine test agents binding to MPHOSPHl or PRCl, the ability of test agent to bind both MPHOSPHl and PRCl needs to be determined for each candidate. Thus, by way of example, binding of the test agent to immobilized MPHOSPHl may be determined by washing away unbound test agent; eluting bound test agent from the support, followed by analysis of the eluate; e.g., by mass spectroscopy, protein determination (Bradford or Lowry assay, or Abs. at 280nm determination ). Alternatively, the elution step may be eliminated and binding of test agent determined by monitoring changes in the spectroscopic properties of the organic layer at the support surface. Methods for monitoring spectroscopic properties of surfaces include, but are not limited to, absorbance, reflectance, transmittance, birefringence, refractive index, diffraction, surface plasmon resonance, ellipsometry, resonant mirror techniques, grating coupled waveguide techniques and multipolar resonance spectroscopy, all of which are known to those of skill in the art. A labeled test agent may also be used in the assay to eliminate need for an elution step. In this instance, the amount of label associated with the support after washing away unbound material is directly proportional to test agent binding.
A number of well-known robotic systems have been developed for solution phase chemistries. These systems include automated workstations like the automated synthesis apparatus developed by Takeda Chemical Industries, LTD. (Osaka, Japan) and many robotic systems utilizing robotic arms (Zymate II, Zymark Corporation, Hopkinton, Mass.; Orca, Hewlett Packard, Palo Alto, Calif), which mimic the manual synthetic operations performed by a chemist. Any of the above devices are suitable for use with the present invention. The nature and implementation of modifications to these devices (if any) so that they can operate as discussed herein will be apparent to persons skilled in the relevant art. In addition, numerous combinatorial libraries are themselves commercially available (see, e.g., ComGenex, Princeton, N. J., Asinex, Moscow, Ru, Tripos, Inc., St. Louis, MO, ChemStar, Ltd, Moscow, RU, 3D Pharmaceuticals, Exton, PA, Martek Biosciences, Columbia, MD, etc.).
According to an aspect of the present invention, the components necessary for the present screening methods may be provided as a kit for screening agents that inhibit the binding between MPHOSPHl and PRCl, or agents that suppress proliferation of bladder cancer cells, or agents for treating or preventing bladder cancer. The kit may contain, for example, the MPHOSPHl polypeptide or a function equivalent thereof, and/or PRCl polypeptide or a functional equivalent thereof. Further, the kit may include control reagents (positive and/or negative), detectable labels, reaction buffers, cell culture medium, containers required for the screening, instructions (e.g., written, tape, VCR, CD-ROM, etc.) for carrying out the method, and so on. The components and reagents may be packaged in separate containers.
An agent isolated by any of the methods of the invention can be administered as a pharmaceutical or can be used for the manufacture of pharmaceutical (therapeutic or prophylactic) compositions for humans and other mammals, such as mice, rats, guinea-pigs, rabbits, cats, dogs, sheep, pigs, cattle, monkeys, baboons, and chimpanzees for treating or preventing bladder cancer.
Herein, the term "preventing" means that the agent is administered prophylactically to retard or suppress the forming of tumor or retards, suppresses, or alleviates at least one clinical symptom of cancer. Assessment of the state of tumor in a subject can be made using standard clinical protocols. Prophylactic administration may occur prior to the manifestation of overt clinical symptoms of disease, such that a disease or disorder is prevented or, alternatively, delayed in its progression. In the context of the present invention, "prevention" encompasses any activity which reduces the burden of mortality or morbidity from disease.
Prevention can occur at primary, secondary and tertiary prevention levels. While primary prevention avoids the development of a disease, secondary and tertiary levels of prevention encompass activities aimed at preventing the progression of a disease and the emergence of symptoms as well as reducing the negative impact of an already established disease by restoring function and reducing disease-related complications. Accordingly, the present invention encompasses a wide range of prophylactic therapies aimed at alleviating the severity of cancer, particularly bladder cancer.
The isolated agents can be directly administered or can be formulated into dosage form using known pharmaceutical preparation methods. Pharmaceutical formulations may include those suitable for oral, rectal, nasal, topical (including buccal and sub-lingual), vaginal or parenteral (including intramuscular, sub-cutaneous and intravenous) administration, or for administration by inhalation or insufflation. For example, according to the need, the agents can be taken orally, as sugar-coated tablets, capsules, elixirs and microcapsules; or non-orally, in the form of injections of sterile solutions or suspensions with water or any other pharmaceutically acceptable liquid. For example, the agents can be mixed with pharmaceutically acceptable carriers or media, specifically, sterilized water, physiological saline, plant-oils, emulsifiers, suspending agents, surfactants, stabilizers, flavoring agents, excipients, vehicles, preservatives, binders, and such, in a unit dose form required for generally accepted drug implementation. The amount of active ingredients in these preparations makes a suitable dosage within the indicated range acquirable.
Examples of additives that can be mixed to tablets and capsules are, binders such as gelatin, corn starch, tragacanth gum and arabic gum; excipients such as crystalline cellulose; swelling agents such as corn starch, gelatin and alginic acid; lubricants such as magnesium stearate; sweeteners such as sucrose, lactose or saccharin; and flavoring agents such as peppermint, Gaultheria adenothrix oil and cherry. When the unit-dose form is a capsule, a liquid carrier, such as an oil, can also be further included in the above ingredients. Sterile composites for injections can be formulated following normal drug implementations using vehicles such as distilled water used for injections.
Physiological saline, glucose, and other isotonic liquids including adjuvants, such as D-sorbitol, D-mannose, D-mannitol, and sodium chloride, can be used as aqueous solutions for injections. These can be used in conjunction with suitable solubilizers, such as alcohol, specifically ethanol, polyalcohols such as propylene glycol and polyethylene glycol, non- ionic surfactants, such as Polysorbate 80 (TM) and HCO-50.
Sesame oil or Soy-bean oil can be used as a oleaginous liquid and may be used in conjunction with benzyl benzoate or benzyl alcohol as a solubilizer and may be formulated with a buffer, such as phosphate buffer and sodium acetate buffer; a pain-killer, such as procaine hydrochloride; a stabilizer, such as benzyl alcohol and phenol; and an anti-oxidant. The prepared injection may be filled into a suitable ampule.
Pharmaceutical formulations suitable for oral administration may conveniently be presented as discrete units, such as capsules, cachets or tablets, each containing a predetermined amount of the active ingredient; as a powder or granules; or as a solution, a suspension or as an emulsion. The active ingredient may also be presented as a bolus electuary or paste, and be in a pure form, i.e., without a carrier. Tablets and capsules for oral administration may contain conventional excipients such as binding agents, fillers, lubricants, disintegrant or wetting agents. A tablet may be made by compression or molding, optionally with one or more formulational ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredients in a free-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, lubricating, surface active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may be coated according to methods well known in the art. Oral fluid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous vehicles (which may include edible oils), or preservatives. The tablets may optionally be formulated so as to provide slow or controlled release of the active ingredient therein. Formulations for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline, water-for-injection, immediately prior to use. Alternatively, the formulations may be presented for continuous infusion. Extemporaneous injection solutions and suspensions may be prepared from sterile
powders, granules and tablets of the kind previously described.
Formulations for rectal administration may be presented as a suppository with the usual carriers such as cocoa butter or polyethylene glycol. Formulations for topical administration in the mouth, for example buccally or sublingualis include lozenges, containing the active ingredient in a flavored base such as sucrose and acacia or tragacanth, and pastilles containing the active ingredient in a base such as gelatin and glycerin or sucrose and acacia. For intra-nasal administration the compounds obtained by the invention may be ' used as a liquid spray or dispersible powder or in the form of drops. Drops may be formulated with an aqueous or non-aqueous base, and may include one or more dispersing agents, solubilizing agents or suspending agents. Liquid sprays are conveniently delivered from pressurized packs.
For administration by inhalation the compounds are conveniently delivered from an insufflator, nebulizer, pressurized packs or other convenient means of delivering an aerosol spray. Pressurized packs may include a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount.
Alternatively, for administration by inhalation or insufflation, the compounds may take the form of a dry powder composition, for example a powder mix of the compound and a suitable powder base such as lactose or starch. The powder composition may be presented in unit dosage form, in for example, capsules, cartridges, gelatin or blister packs from which the powder may be administered with the aid of an inhalator or insufflators.
When desired, the above described formulations, adapted to give sustained release of the active ingredient, may be employed. The pharmaceutical compositions may also contain other active ingredients such as antimicrobial agents, immunosuppressants or preservatives.
Preferred unit dosage formulations are those containing an effective dose, as recited below, or an appropriate fraction of the active ingredient.
Methods well known to one skilled in the art may be used to administer an agent screened by the present methods to patients, for example, as intraarterial, intravenous, or percutaneous injections and also as intranasal, intramuscular or oral administrations. The dosage and method of administration vary according to the body- weight and age of a patient and the administration method; however, one skilled in the art can routinely select a suitable
method of administration. If said agent is encodable by a DNA, the DNA can be inserted into a vector for gene therapy and the vector administered to a patient to perform the therapy. The dosage and method of administration vary according to the body-weight, age, and symptoms of the patient but one skilled in the art can suitably select them. Although the dose of an agents screened by the present methods depends on the symptoms and such, the compositions may be administered at a dose of from about 0.1 to about 250 mg/kg per day. The dose range for adult humans is generally from about 5 mg to about 17.5 g/day, preferably about 5 mg to about 10 g/day, and most preferably about 100 mg to about 3 g/day. Tablets or other unit dosage forms of presentation provided in discrete units may conveniently contain an amount which is effective at such dosage or as a multiple of the same, for instance, units containing about 5 mg to about 500 mg, usually from about 100 mg to about 500 mg.
When administering parenterally, in the form of an injection to a normal adult (weight 60 kg), although there are some differences according to the patient, target organ, symptoms and method of administration, it is convenient to intravenously inject a dose of about 0.01 mg to about 30 mg per day, preferably about 0.1 to about 20 mg per day and more preferably about 0.1 to about 10 mg per day. Also, in the case of other animals too, it is possible to administer an amount converted to 60 kgs of body- weight.
The agents are preferably administered orally or by injection (intravenous or subcutaneous), and the precise amount administered to a subject will be determined under the responsibility of the attendant physician, considering a number of factors, including the age and sex of the subject, the precise disorder being treated, and its severity. Also the route of administration may vary depending upon the condition and its severity.
The agents screened by the present methods further can be used for treating or preventing bladder cancer in a subject. Administration can be prophylactic or therapeutic to a subject at risk of (or susceptible to) a disorder or having a disorder associated with the binding between the MPHOSPHl and PRCl proteins. The method includes decreasing the binding between MPHOSPHl and PRCl in bladder cancer cells. The function can be inhibited through the administration of an agent obtained by any of the screening methods of the present invention.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention
belongs. In case of conflict, the present specification, including definitions, will control.
Hereinafter, the present invention is described in more detail with reference to the Examples. However, the following materials, methods and examples only illustrate aspects of the invention and in no way are intended to limit the scope of the present invention. As such, methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention.
EXAMPLE
1. Materials and Methods
(1) Bladder cancer cell lines and tissue samples Human bladder cancer cell lines, HT 1197, UM-UC-3 , J82, HT 1376, SW780 and
RT4, were purchased from American Type Culture Collection (ATCC; Rockville, MD). All of the bladder cancer cell lines, COS7 and NIH3T3 cells were grown in monolayer in appropriate medium; i.e. EMEM (Sigma, St. Louis, MO) with O. lmM essential amino acid (Roche), ImM sodium pyruvate (Roche), for HT 1197, UMUC3, J82 and HT 1376; L- 15 for SW 780; McCoy's 5a (Sigma) for RT-4; and Dulbecco's modified Eagle's medium (Invitrogen, Carlsbad, CA) for C0S7 and NIH3T3. Each medium was supplemented with 10% fetal bovine serum (Cansera) and 1% antibiotic/antimycotic solution (Sigma). SW780 was maintained at 370C in atmosphere of humidified air without CO2, though the remaining cells were maintained at 37°C in atmosphere of humidified air with 5% CO2. Tissue samples from surgically-resected invasive or superficial bladder cancers, and their corresponding clinical information were obtained after obtaining written informed consent.
(2) Semi-quantitative RT-PCR analysis
Total RNAs were extracted from cultured cells and clinical tissues using RNeasy Micro Kits (Qiagen, Valencia, CA). Extracted RNAs and normal human tissue polyA+ RNAs were treated with DNase I (Nippon Gene, Tokyo, Japan), and reversely transcribed using oligo (dT) primer and Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). Semiquantitative reverse transcription-PCR (RT-PCR) experiments were carried out with the following MPHOSPH J -specific primers or with GAPDH-specific primers as internal control: MPHOSPHJ, 51-CCGGGAAAGTAAACTGACTCAC-3l (SEQ ID NO: 3) and
5'-TTCTAGCTCCTCAACCAAATCCT-31 (SEQ ID NO: 4); and GAPDH, 5'-CGACC ACTTTGTCAAGCTC A-31 (SEQ ID NO: 5) and
5'-GGTTGAGCACAGGGTACTTTATT-S ' (SEQ ID NO: 6). PCR reactions were optimized for the number of cycles to ensure product intensity within the logarithmic phase of amplification.
(3) Northern blot analysis Human multiple-tissue blots (Takara Clontech, Palo Alto, CA), and bladder cancer cell blots composed of mRNAs from 6 bladder cancer cell lines and 8 normal human organs were hybridized with 32P-labeled MPHOSPHl cDNA. The probe, MPHOSPH 1 cDNA, was prepared by RT-PCR using primers 51-TGCTGGTTCAGAACGAACTATG-3l (SEQ ID NO: 7) and 51-TCCTCGTGGCTAATGAAAGC-31 (SEQ ID NO: 8). Prehybridization, hybridization, and washing were performed according to the supplier's recommendations. The blots were autoradiographed with intensifying screens at -8O0C for 14 days.
(4) Expression vector construction
Open reading frame sequences of 'MPHOSPHl and PRCl were obtained by PCR using KOD-Plus DNA polymerase (Toyobo, Osaka, Japan) with following primer sets: MPHOSPHl, forward :
5'-ATAAGAATGCGGCCGC AATGGAATCTAATTTTAATC AAGAGG-31 (SEQ ID NO: 9), and reverse: 5'-ATAAGAATGCGGCCGCTTTGGCTGTTTTTGTTCGA-S' (SEQ ID NO: 10)
(underline indicates Notl restriction enzyme sites); and
PRCl, forward: 5 ' -CCGGAATTCTCCGCCATGAGGAGAAGTGA^ ' (SEQ ID NO: 11) (underline indicates EcoRl restriction enzyme sites), and reverse: 5'-TTGCCGCICGAGGGACTGGATGTTGGTTGAA-S ' (SEQ ID NO: 12)
(underline indicates Xho\ restriction enzyme sites).
The PCR products of MPHOSPHl and PRCl were inserted into the Notl site of
HA-tagged pCAGGS expression vector and the EcoRl and Xho\ site of FLAG-tagged pCAGGS, respectively. DNA sequences of these constructs were confirmed by DNA sequencing. The primers for amplification of truncated MPHOSPHl sequences were as follows: 1188 to 1302, forward: 5'-ATAAGAATGCGGCCGCTATGGAAATCACACAGTTAACAAATAATTTGC-
3' (SEQ ID NO: 13), and reverse: 5 '-ATAAGAATGCGGCCGC ACCTGAATGGTTCGCTGTTTCAT-3 ' (SEQ ID NO:
14); and 1295 to 1465, forward: 5'-CCGGAATTCATGAAACAGCGAACCATTCAG-3' (SEQ ID NO: 15), and
reverse: 5'-ATAAGAATGCGGCCGCTGTGTCAGTATTTCCATTTCATTCTGTT-S ' (SEQ ID NO: 16); 1456 to 1662, forward: 5'-CCGGAATTCATGAAGCAACAGAATGAAATGGAAATACT-S ' (SEO ID NO: 17), and reverse: 5 ' - ATAAGAATGCGGCCGCTCTGGACGTATGGC AACCTTTT-3 ' (SEQ ID NO : 18); 1655 to 1725, forward: 5'-ATAAGAATGCGGCCGCTATGGAACAAAAGGTTGCCATACGTC-S ' (SEQ ID NO: 19), and reverse: 5 ' - ATAAGAATGCGGCCGCTGTGCTTCTAC ATTTGAGAGCTTTGA-3 ' (SEQ ID NO:20); and 1718 to 1780, forward: 5' -CCGGAATTC ATGTC AAAGCTCTC AAATGTAGAAGC A-3 ' (SEQ ID NO:21), and reverse: 5'-ATAAGAATGCGGCCGCTTTGGCTGTTTTTGTTCGA-S ' (SEQ ID NO: 10)
(underlines indicate Noil or EcoRl restriction enzyme sites). (5) Anti-MPHOSPHl-specific polyclonal antibodies
Plasmid designed to express a part of MPHOSPHl (1612-1780 a.a.) or PRCl (234- 360 a.a.) with His-tagged epitope at their C-terminus was prepared using pET21 vector (Novagen, Madison, WI). The recombinant peptides were expressed in Escherichia coli BL21 codon-plus strain (Stratagene, La Jolla, CA), respectively, and purified using Ni-NTA resin agarose (Qiagen) and TALON (Takara Clontech) according to the supplier's protocols. The purified recombinant proteins were inoculated into rabbits, and the immune sera were purified on affinity columns according to standard methodology. Affinity-purified anti- MPHOSPHl antibodies and anti-PRCl antibodies were used for Western blotting, immunoprecipitation, and immunocytostaining as described below. These antibodies were confirmed to specifically recognize endogenous MPHOSPHl protein in UMUC3 bladder cancer cells by Western blot analysis.
(6) Synchronization and flow cytometry analysis
Cells were arrested in Gl phase 24 hr after transfection with aphidicolin (2μg/ml) for further 16 hr. Cell cycle was released by washing five times with PBS (-). After release from the cell cycle arrest, cells were collected at indicated time points. For FACS analysis, 400μl aliquot of synchronized adherent and detached cells were combined and fixed with 70% ethanol at 4°C. After washing with PBS (-), the cells were incubated for 30 min with
ImI of PBS containing lmg of RNase I at 370C. The cells were then stained in ImI of PBS containing 50mg of propidium iodide (PI). The percentages of each fraction of cell cycle phases were counted for at least 10000 cells in a flow cytometer (FACScalibur; Becton Dickinson, San Diego, CA). For immunocytochemical analysis, synchronized cells were fixed at indicated time points and stained as shown below.
(7) Immunocytochemical analysis
UMUC3 cells were seeded at 1x105 cells per well. After 24 hr, the cells were fixed with PBS containing 4% paraformaldehyde, and then rendered permeable with PBS containing 0.1% Triton X-100 for 2 min at room temperature. Subsequently, the cells were covered with 3% BSA in PBS for 12 hr at 40C, to block nonspecific antibody-binding sites. Then, the cells were incubated with affinity-purified anti-MPHOSPHl specific polyclonal antibody diluted 1 : 100 in the blocking solution. After washing with PBS, the UMUC3 cells were stained with an Alexa488-conjugated anti-rabbit secondary antibody (Molecular Probe) at 1 : 1000 dilutions. Nuclei were counter-stained with 4', 6'-diamidine-2'-phenylindole dihydrochloride (DAPI). Fluorescent images were obtained under a microscope (Leica, Tokyo, Japan).
(8) Immunohistochemical analysis
Conventional paraffin-embedded tissue sections from bladder cancers were obtained from surgical specimens. To investigate the expression of MPHOSPHl protein in clinical materials, tissue sections were stained using ENVISION+ KhVHRP (DakoCytomation, Glostrup, Denmark) after the sections were deparaffinized and autocraved for 15 min at 1080C in antigen retrieval solution high pH (DAKO). After blocking of endogenous peroxidase and proteins, these sections were incubated with anti-MPHOSPHl polyclonal antibody at 1 :80 dilutions. Immunodetection was done with peroxidase-labeled anti-rabbit immunoglobulin (Envision kit, Dako Cytomation, Carpinteria, CA). Finally, the reactants were developed with 3, 3 V-diaminobenzidine (Dako) and the cells were counter-stained with hematoxylin.
(9) Small-interfering RNA assay
A vector-based RNA interference (RNAi) system, psiU6BX3.0, had been previously established which system was designed to synthesize small-interfering RNAs
(siRNA) in mammalian cells (Shimokawa T et al., Cancer Res 2003, 63: 6116-20). Plasmids designed to express siRNA were prepared by cloning of double-stranded oligonucleotides into
the psiUόBX vector. The siRNA-expression vector was transfected using Lipofectamine2000 (Invitrogen) or FuGENEό (Roche) into J82 or UMUC cells, respectively, according to the supplier's recommendations. The transfected-cells were cultured for 28 or 21 days in the presence of 0.6 or 1.0 mg/ml of geneticin (G418), respectively, and the numbers of colonies were counted by Giemsa staining. Viability of the cells was evaluated by MTT assay on day 28 or 14 after the treatment.
To confirm suppression of MPHOSPHl protein expression, Western blot analysis was carried out using affinity-purified anti-MPHOSPHl specific polyclonal antibody and semi-quantitative RT-PCR according to standard protocol. Moreover, the knockdown effect of PRCl -specific siRNAs was confirmed by semi-quantitative RT-PCR using specific primers. The primers for GAPDH as internal control was the same as above, and PRCV-specific primers were as follows: 5'-GTTTGTCCCTTGGCTCTCATC-S' (SEQ ID NO: 22) and 5'-AGTCCACACTGGTAAGCTTTTGA-S ' (SEQ ID NO: 23). The target sequences of the synthetic oligonucleotides for RNAi were as follows: EGFP as a control, 5'-GAAGCAGCACGACTTCTTC-S' (SEQ ID NO:24); siRNA-MPHOSPHl, 5'-GTGAAGAAGTGCGACCGAA-S' (SEQ ID NO:25); siRNA-MPHOSPHl mismatch, 5'-TTGTAGAAGTGCGACCGAG-S' (SEQ ID NO 26); siRNA-PRCl #1, 5'-GGAAAGACTCATCAAAAGC-S ' (SEQ ID NO 27); siRNA-PRCl #2, 5'-GCATATCCGTCTGTCAGAAT-S ' (SEQ ID NO:31); and siRNA-PRCl #2 mismatch, 5'-TCATATCCCTCTGTAAGAT-S' (SEQ ID NO: 35).
(10) Establishment of NIH3T3 cells stably expressing MPHOSPHl
MPHOSPHl expression vector or mock vector was transfected into NIH3T3 cells using FUGENE6 as describe above. Transfected cells were incubated in culture medium containing 0.9 mg/ml of geneticin (G418) (Invitrogen). Clonal NIH3T3 cells were subcloned by limiting dilution. Expression of HA-tagged MPHOSPHl was assessed by Western blot analysis using anti-HA monoclonal antibody. Eventually, several clones were established and designated as MPHOSPH1-NIH3T3.
To investigate the growth-promoting effect of MPHOSPHl in vitro, 5000 cells were seeded to three independent MPHOSPHl -NIH3T3 cells and three independent MOCK- NIH3T3 cells, and the numbers of cells were counted by MTT assay everyday for five days. These experiments were done in triplicate.
In vivo experiments were performed in animal facility in accordance with
institutional guidelines. To further examine the effect of MPHOSPHl on tumor growth in nude mice, sixteen BALB/cA Jcl-nu mice (female, 7weeks old) were injected s.c. with NIH3T3-MPHOSPH1-#1, NIH3T3 -MPHO SPH l-#3, NIH3T3-Mock-#1 or NIH3T3-Mock-#3 (5 x 106 cells). Tumors were measured every 3 days for 3 weeks, and their volumes were estimated by following formula: 0.5 x (larger diameter) x (smaller diameter)2 as described previously.
(11) Immunoprecipitation and Western blotting
Cells were lysed in lysis buffer (50 mM Tris-HCL (pH 8.0), 150 mM NaCl, 0.5% NP-40 and Protease Inhibitor Cocktail Set III (Calbiochem, San Diego, CA)). Equal amounts of total proteins were incubated at 40C for 2 hr with 2 μg of rat anti-HA (Roche) or mouse anti-c-myc (Sigma) antibody. Immunocomplexes were incubated with protein G-Sepharose (Zymed Laboratories, South San Francisco, CA) for 2 hr and then washed with lysis buffer. Co-precipitated proteins were separated by SDS-PAGE.
Proteins separated by SDS-PAGE were transferred on nitrocellulose membranes, and then incubated with mouse anti-c-myc (Sigma) or rat anti-HA (Roche) antibody. Then, after incubation with secondary antibody conjugated to HRP, signals were visualized with ECL kit (Amersham Biosciences).
(12) Knockdown effects of MPHOSPHl and PRCl on cell growth
After UMUC3 cells were transfected with plasmids designed to express si-EGFP (negative control), si-MPHOSPHl, or si-PRCl (see the above-mentioned siRNA assay) using FuGENEό (Roche), their cellular morphologies were examined for 4 days. On day 4 after the transfection, the cells were immunocytochemically stained with Allexa594 phalloidin (Molecular probes) and DAPI. Fluorescent images were obtained under a confocal microscope (Leica, Tokyo, Japan). To examine the suppressive effect of siRNA on MPHOSPHl expression, Western blot analysis was carried out using affinity-purified anti- MPHOSPHl antibody according to standard protocol.
2. Results
(1) Identification of MPHOSPHl as an up-regulated gene in bladder cancers
To identify molecules that may be applicable as targets for novel therapeutic drugs, genome-wide expression profile analysis on 26 invasive bladder cancer cases were previously performed using cDNA microarray representing 27,648 genes or ESTs (Takata R et al, Clin Cancer Res April 1, 2005, 11(7): 2625-36).
Through this analysis, a set of genes whose expression was up-regulated in the majority of examined bladder cancer cells had been identified. Among them, MPHOSPHl (M-phase phosphoprotein 1) gene, whose up-regulation could be confirmed in clinical bladder cancer cases (Fig. IA) as well as bladder cancer cell lines (data not shown) by semi- quantitative RT-PCR analysis, but which expression was undetectable in any of examined normal organs except testis, was selected for further investigation. Subsequent Northern blot analysis confirmed that a transcript of approximately 7 kb of MPHOSPHl gene was up- regulated in all of the examined 6 bladder cancer cell lines, but not expressed in the examined normal organs except the testis (Fig. IB, C). Then, polyclonal antibody against MPHOSPHl was developed to investigate the expression of this protein in bladder cancer tissues {see Materials and Methods). Immunohistochemical analysis with affinity-purified anti-MPHOSPHl polyclonal antibodies revealed positive staining in the examined bladder cancer cells of clinical invasive bladder cancer tissue sections, while no staining was detected in the examined normal bladder tissues (Fig. ID). Further, up-regulated expression of MPHOSPHl was detected in the examined bladder cancers at an earlier stage (Fig. ID), although its up-regulation was initially identified through the expression profile analysis of invasive bladder cancers, which suggests the involvement of MPHOSPH 1 in the development, but not in the progression of bladder cancers.
(2) Subcellular localization of MPHOSPHl in bladder cancer cells To further characterize the MPHOSPH 1 gene, subcellular localization of endogenous MPHOSPHl was examined in UMUC3 bladder cell line by immunocytochemical analysis using anti-MPHOSPHl antibodies. Endogenous MPHOSPHl was mainly localized in the nucleus in cells at interphase, but was observed allover the cytoplasm in some M-phase cells after the disappearance of nuclear membrane. Since the immunocytochemical analysis suggested cell-cycle dependent expression pattern of
MPHOSPHl, UMUC3 cells were synchronized using aphidicolin to examine the localization of MPHOSPHl at different cell-cycle points. As shown in Fig. 2, endogenous MPHOSPHl protein was localized in the cytoplasm of prophase, metaphase and early anaphase. Furthermore, the protein accumulated on the midzone of the cells in late anaphase and finally concentrated at the contractile ring when the cells were at telophase. These findings suggest an important role for MPHOSPHl in cytokinesis.
(3) Oncogenic activity of MPHOSPHl
To assess the oncogenic role of MPHOSPHl, endogenous expression of MPHOSPHl was knocked down in bladder cancer cell lines, J82 and UMUC3, which cell lines showed high expression levels of MPHOSPH 1 , by means of the mammalian vector- based RNA interference (RNAi) technique (see Materials and Methods). The expression levels of MPHOSPHl were examined by semi-quantitative RT-PCR and Western blot analyses to find MPHOSPHl -specific siRNAs (si-MPHOSPHl) to significantly suppress the expression of this gene as compared with a control siRNA-construct (si-EGFP) (Fig. 3A). Colony- formation and MTT assays using these siRNA constructs (Figs. 3B and 3C) indicated that the introduction of MPHOSPHl -specific siRNA suppressed the growth of J82 and UMUC3 cells. Furthermore, siRNA that contained 3-bp replacement in si-MPHOSPHl (si- MPHOSPHl -mismatch, see Materials and methods) were constructed and examined, which, in turn, led to the discovery that it had no suppressive effect on the expression of MPHOSPHl or the growth of bladder cancer cells (Fig. 3A).
To further confirm the growth promoting effect of MPHOSPHl, NIH3T3 -derivative cells that stably expressed exogenous MPHOSPHl (NIH3T3-MPHOSPH1 - 1 , -2, and -3 cells) were established. The Western-blot analysis indicated high levels of exogenous MPHOSPHl protein in three derivate clones (Fig. 4A). Subsequent MTT assays showed that three derivative cell lines, NIH3T3-MPHOSPH1-1, -2 and -3, grew much faster than cells transfected with mock plasmid (NIH3T3Mock-l, -2 and -3 cells) (Fig. 4B), indicating MPHOSPHl expression was likely to enhance cell growth. Next, FACS analysis was performed to examine whether NIH3T3 -derivative cells that stably expressed exogenous MPHOSPHl enhance the progression of cell cycle. As shown in Fig. 4C, the cell cycle of NIH3T3-MPHOSPH1 cells progressed faster than that of NIH3T3-mock cells at all time points, especially in G2/M phase cells (6hr) (MPHOSPHl : mock=35.71%: 22.10%). Eventually, NIH3T3-mock cells returned to almost the G0/G1 phase at 12 hr, whereas the NIH3T3 -MPHOSPHl cells passed over the G0/G1 phase and went into the S phase at 12 hr (Fig. 4C).
To investigate the role of MPHOSPHl in vivo, either NIH3T3-MPHOSPH1 cells or NIH3T3-Mock cells were transplanted into BALB/cA Jcl-nu mice by s.c. (female, 7 weeks old). All of the 12 animals transplanted with either NIH3T3-MPHOSPH1 cells (-#1 or -#2) formed significantly faster, and larger tumors in the nude mice as compared with those transplanted with NIH3T3-Mock (-#1 or -#2) cells (Fig. 4D). These findings imply an
oncogenic role for MPHOSPHl in the development of bladder cancer both in vivo and in vitro.
(4) Interaction of MPHOSPHl with PRCl
To further study the role of MPHOSPHl in bladder cancer cells, MPHOSPHl interacting proteins were investigated. The search resulted in the identification of protein- regulating cytokinesis 1 (PRCl) protein as a possible candidate to interact with MPHOSPH, since this protein is known to localize in the midbody or near the contractile ring in late anaphase or telophase cells, and to function in midzone formation and cytokinesis. In addition, PRCl was reported to interact with several kinesin family proteins (Ban R et al., J Biol Chem 2004, 279: 16394-402; Kurasawa Y et al., EMBO J 2004, 23: 3237-48; Zhu C & Jiang W, Proc Natl Acad Sci USA 2005, 102: 343-8; Gruneberg U et al., J Cell Biol 2006, 172: 363-72).
Analysis of the expression pattern of PRCl in bladder cancer cases by semiquantitative RT-PCR analysis led to the discovery that PRCl and MPHOSPHl are co- upregulated in bladder cancer cases (Fig. 5A). Subsequently, co-immunoprecipitation experiments were performed using HA-tagged MPHOSPHl and FLAG-tagged PRCl that were co-transfected into COS7 cells. Using anti-FLAG or anti-HA antibodies, HA-tagged MPHOSPHl was identified to co-precipitate with FLAG-tagged PRCl or FLAG-tagged PRCl was identified to reversely co-precipitated with HA-tagged MPHOSPHl as well (Fig. 5B), indicating the interaction of these two proteins. Subsequent immunocytochemical analysis indicated that exogenous PRCl localized to stained fiber array filament and co- localized with endogenous MPHOSPHl at interphase of the UMUC cells (Fig. 5C).
In addition, these proteins were further observed to co-localize during M-phase, especially in late anaphase, translocate to the spindle midzone where they co-localize as a series of narrow microtubule-bundle bars at the midozone. However, interestingly, the two proteins were separately localized in telophase cells. PRCl (red) localized in the center of midbody as described previously, while MPHOSPHl (green) was present near the plus ends of the microtubule. These findings strongly suggest that MPHOSPHl interacts with PRCl during cell cycle except during bladder cell telophase.
(5) Determination of interaction of MPHOSPHl with PRCl To identify the region of MPHOSPHl responsible for interaction with PRCl, co- immunoprecipitation experiments were performed using a series of truncated forms of HA- tagged MPHOSPHl and FLAG-tagged full-length PRCl to be co-transfected into C0S7 cells
(Fig. 6A). Immunoblotting analysis with anti-FLAG or anti-HA antibodies showed that two constructs (1188-1456 and 1662-1718 amino acids) of MPHOSPHl bound to PRCl, indicating that MPHOSPHl interacts with PRCl through two binding regions at the C- terminus of the stalk region and the tail region of MPHOSPHl (Fig. 6B). (6) Growth-inhibitory effects of PRCl -specific siRNA in bladder cancer
To further validate the biological role of PRCl on bladder carcinogenesis, PRCl- specific siRNA expression vectors were constructed to examine the knockdown effect of each of the constructs in J82 and UMUC3 bladder cancer cell lines, which over-expresses PRCl. Semi-quantitative RT-PCR showed that si-PRCl#l and si-PRCl#2 have drastic knockdown effects on PRCl expression, whereas si-PRCl -mismatch construct which contained 3-bp replacement to si-PRCl#l or a negative control si-EGFP revealed to have no or little knockdown effect. The introduction of si-PRCl#l and si-PRCl#2 into in J82 and UMUC3 cells resulted in significant decrease in the number of colonies and cell viability, whereas control siRNAs and si-PRCl -mismatch had no or little effect on the colony formation or cell viability (Figs. 7A and 7B). These findings suggest that PRCl is also likely to play a crucial role in the growth of bladder cancer cells.
Furthermore, as shown in Fig. 7C, immunocytochemical analysis was performed to examine the knockdown effect of MPHOSPHl or PRCl on cytokinesis of cancer cells. MPHOSPHl or PRCl -specific siRNA expression vectors were transfected into UMUC3 cells, respectively, to observe cell morphology during the 4 days after the transfection. Interestingly, formation of multiple nuclei was observed in cells transfected with either of the two siRNAs on day 4 after the transfection (Fig. 7C). The finding indicates that the absence of MPHOSPHl or PRCl results in cytokinesis failure, which, in turn, results in the formation of multi-nucleated cells that ultimately induce cell death.
INDUSTRIAL APPLICABILITY
The present invention relates to a method for identifying or screening a therapeutic or preventive agent for cancer, in particular, bladder cancer, by detecting compounds that inhibit the binding of the MPHOSPHl protein with the PRCl. According to the present invention, it was shown that cytokinesis failure and formation of multiple nuclei were observed by knockdown of MPHOSPHl or PRCl . Thus, the present screening method might hold promise for development of a new therapeutic strategy for the treatment and prevention of bladder cancer.
The data reported herein add to a comprehensive understanding of bladder cancer, and provide clues for identification of molecular targets for therapeutic drugs and preventive agents. Such information contributes to a more profound understanding of carcinogenesis, and provides indicators for developing novel strategies for treatment and ultimately prevention of bladder cancer.
All patents, patent applications, and publications cited herein are incorporated by reference in their entirety.
Furthermore, while the invention has been described in detail and with reference to specific embodiments thereof, it is to be understood that the foregoing description is exemplary and explanatory in nature and is intended to illustrate the invention and its preferred embodiments. Through routine experimentation, one skilled in the art will readily recognize that various changes and modifications can be made therein without departing from the spirit and scope of the invention. Thus, the invention is intended to be defined not by the above description, but by the following claims and their equivalents.
Claims
1. A method of identifying an agent that inhibits the binding between MPHOSPHl and PRCl, said method comprising the steps of: a) contacting a first polypeptide selected from the group consisting of: i) a polypeptide comprising the amino acid sequence of SEQ ID NO: 2; ii) a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 wherein one or more amino acids are added, substituted, deleted, or inserted, provided the polypeptide has a binding activity to PRCl equivalent to that of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2; iii) a polypeptide comprising an amino acid sequence that is at least about 80% homologous to SEQ ID NO: 2, provided the polypeptide has a binding activity to PRCl equivalent to that of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2; and vi) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence of SEQ ID
NO: 1, provided the polypeptide has the binding activity to PRCl equivalent to that of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2; in the presence of an agent with a second polypeptide selected from the group consisting of: i) a polypeptide comprising the amino acid sequence of SEQ ID NO: 37; ii) a polypeptide comprising the amino acid sequence of SEQ ID NO: 37 wherein one or more amino acids are added, substituted, deleted, or inserted, provided the polypeptide has a binding activity to MPHOSPHl equivalent to that of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 37; iii) a polypeptide comprising the amino acid sequence that has at least about 80% homology to SEQ ID NO: 37, provided the polypeptide has a binding activity to MPHOSPHl equivalent to that of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 37; and vi) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence of SEQ ID
NO: 36, provided the polypeptide has the binding activity to MPHOSPHl equivalent to that of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 37; b) detecting the level of binding between the first polypeptide and the second polypeptide; c) comparing the binding level of the first and second polypeptides with that detected in the absence of the agent; and d) selecting the agent that reduces the binding level between the first and second polypeptides.
2. The method of claim 1, wherein the first polypeptide comprises the amino acid residues from 1188 to 1718 of SEQ ID NO: 2.
3. A method of identifying an agent that suppresses the proliferation of bladder cancer cells, said method comprising the steps of: a) contacting a first polypeptide selected from the group consisting of: i) a polypeptide comprising the amino acid sequence of SEQ ID NO: 2; ii) a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 wherein one or more amino acids are added, substituted, deleted, or inserted, provided the polypeptide .has a binding activity to PRCl equivalent to that of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2; iii) a polypeptide comprising the amino acid sequence that has at least about 80% homology to SEQ ID NO: 2, provided the polypeptide has a binding activity to PRCl equivalent to that of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2; and vi) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, provided the polypeptide has a binding activity to PRCl equivalent to that of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2; in the presence of an agent with a second polypeptide selected from the group consisting of: i) a polypeptide comprising the amino acid sequence of SEQ ID NO: 37; ii) a polypeptide comprising the amino acid sequence of SEQ ID NO: 37 wherein one or more amino acids are added, substituted, deleted, or inserted, provided the polypeptide has a binding activity to MPHOSPHl equivalent to that of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 37; iii) a polypeptide comprising the amino acid sequence that has at least about 80% homology to SEQ ID NO: 37, provided the polypeptide has a binding activity to MPHOSPHl equivalent to that of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 37; and vi) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 36, provided the polypeptide has a binding activity to MPHOSPHl equivalent to that of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 37; b) detecting the level of binding between the first and the second polypeptides; c) comparing the binding level of the first and second polypeptides with that detected in the absence of the agent; and d) selecting the agent that reduces the binding level between the first and second polypeptide as an agent that suppresses the proliferation of bladder cancer cells.
4. The method of claim 3, wherein the first polypeptide comprises the amino acid residues from 1188 to 1718 of SEQ ID NO: 2.
5. A method of identifying an agent for treating or preventing bladder cancer, said method comprising the steps of: a) contacting a first polypeptide selected from the group consisting of: i) a polypeptide comprising the amino acid sequence of SEQ ID NO: 2; ii) a polypeptide comprising the amino acid sequence of SEQ ED NO: 2 wherein one or more amino acids are added, substituted, deleted, or inserted, provided the polypeptide has a binding activity to PRCl equivalent to that of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2; iii) a polypeptide comprising the amino acid sequence that has at least about 80% homology to SEQ ID NO: 2, provided the polypeptide has a binding activity to PRCl equivalent to that of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 ; and vi) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, provided the polypeptide has a binding activity to PRCl equivalent to that of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2; in the presence of an agent with a second polypeptide selected from the group consisting of: i) a polypeptide comprising the amino acid sequence of SEQ ID NO: 37; ii) a polypeptide comprising the amino acid sequence of SEQ ID NO: 37 wherein one or more amino acids are added, substituted, deleted, or inserted, provided the polypeptide has a binding activity to MPHOSPHl equivalent to that of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 37; iii) a polypeptide comprising the amino acid sequence that has at least about 80% homology to SEQ ID NO: 37, provided the polypeptide has a binding activity to MPHOSPHl equivalent to that of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 37; and vi) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 36, provided the polypeptide has a binding activity to MPHOSPHl equivalent to that of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 37; b) detecting the level of binding between the first polypeptide and the second polypeptide; c) comparing the binding level of the first and second polypeptides with that detected in the absence of the agent; and d) selecting the agent that reduces the binding level between of the first and second polypeptides as an agent for treating or preventing bladder cancer.
6. The method of claim 5, wherein the first polypeptide comprises the amino acid residues from 1188 to 1718 of SEQ ID NO: 2.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US84012406P | 2006-08-25 | 2006-08-25 | |
| PCT/JP2007/066827 WO2008023842A1 (en) | 2006-08-25 | 2007-08-23 | Methods of screening for agents that inhibit binding between mphosph1 and prc1 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP2059812A1 true EP2059812A1 (en) | 2009-05-20 |
Family
ID=38824945
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP07806304A Withdrawn EP2059812A1 (en) | 2006-08-25 | 2007-08-23 | Methods of screening for agents that inhibit binding between mphosph1 and prc1 |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP2059812A1 (en) |
| JP (1) | JP2010501827A (en) |
| CN (1) | CN101558307A (en) |
| CA (1) | CA2661662A1 (en) |
| WO (1) | WO2008023842A1 (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP5564730B2 (en) | 2011-08-12 | 2014-08-06 | オンコセラピー・サイエンス株式会社 | MPHOSPH1 peptide and vaccine containing the same |
| SG11201802286PA (en) | 2015-10-08 | 2018-04-27 | Oncotherapy Science Inc | Mphosph1-derived peptide, and vaccine including same |
| WO2019236957A1 (en) * | 2018-06-07 | 2019-12-12 | The Regents Of The University Of Michigan | Prc1 inhibitors and methods of treatment therewith |
| CN119530291B (en) * | 2025-01-14 | 2025-06-27 | 青岛农业大学 | Application of PsCLF gene in regulation of dormancy and growth in peony buds |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004078205A1 (en) * | 2003-03-03 | 2004-09-16 | Arizona Board Of Regents On Behalf Of The University Of Arizona | Targeting a protein prc1 for the treatment of pancreatic cancer |
| CN101175862A (en) * | 2005-02-10 | 2008-05-07 | 肿瘤疗法科学股份有限公司 | Ways to Diagnose Bladder Cancer |
-
2007
- 2007-08-23 WO PCT/JP2007/066827 patent/WO2008023842A1/en not_active Ceased
- 2007-08-23 CN CNA2007800399240A patent/CN101558307A/en active Pending
- 2007-08-23 CA CA002661662A patent/CA2661662A1/en not_active Abandoned
- 2007-08-23 EP EP07806304A patent/EP2059812A1/en not_active Withdrawn
- 2007-08-23 JP JP2009505670A patent/JP2010501827A/en active Pending
Non-Patent Citations (1)
| Title |
|---|
| See references of WO2008023842A1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101558307A (en) | 2009-10-14 |
| JP2010501827A (en) | 2010-01-21 |
| CA2661662A1 (en) | 2008-02-28 |
| WO2008023842A1 (en) | 2008-02-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101835894A (en) | EBI3, DLX5, NPTX1 and CDKN3 as target genes for lung cancer treatment and diagnosis | |
| US20110263012A1 (en) | Screening and therapeutic method for nsclc targeting cdca1-kntc2 complex | |
| KR20090064378A (en) | Breast Cancer Related Genes and Polypeptides | |
| EP2362904B1 (en) | Method of screening compounds for use in inhibiting depdc1 - znf224 binding | |
| EP1787122B1 (en) | NON-SMALL CELL LUNG CANCER-RELATED GENE, ANLN, AND ITS INTERACTIONS WITH RhoA | |
| JP2010528584A (en) | Method for identifying methylation regulators of VEGFR1 by SMYD3 | |
| US20100184047A1 (en) | Screening and therapeutic method for nsclc targeting the cdca8-aurkb complex | |
| CN101855346A (en) | PKIB and NAALADL2 used as target genes for prostate cancer treatment and diagnosis | |
| WO2008023841A1 (en) | Breast cancer-associated gene, melk, and its interactions with bcl-g | |
| JP2009536516A (en) | NMU-GHSR1b / NTSR1 oncogenic signaling pathway as a therapeutic target for lung cancer | |
| WO2008023842A1 (en) | Methods of screening for agents that inhibit binding between mphosph1 and prc1 | |
| EP2785870B1 (en) | Smyd2 as a target gene for cancer therapy and diagnosis | |
| CN101528768A (en) | Genes and polypeptides relating to breast cancers | |
| WO2010023838A1 (en) | Tbc1d7 as tumor marker and therapeutic target for cancer | |
| WO2009113295A1 (en) | C2orf18 as target gene for cancer therapy and diagnosis | |
| WO2010023837A1 (en) | Breast cancer related gene rqcd1 | |
| WO2008020653A1 (en) | Use of holliday junction-recognizing protein related to cancer | |
| WO2010023854A1 (en) | Cancer related gene, lgn/gpsm2 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20090306 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC MT NL PL PT RO SE SI SK TR |
|
| AX | Request for extension of the european patent |
Extension state: AL BA HR MK RS |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN |
|
| 18W | Application withdrawn |
Effective date: 20090730 |