EP1968568A2 - INHIBITORS OF Akt ACTIVITY - Google Patents

INHIBITORS OF Akt ACTIVITY

Info

Publication number
EP1968568A2
EP1968568A2 EP06846739A EP06846739A EP1968568A2 EP 1968568 A2 EP1968568 A2 EP 1968568A2 EP 06846739 A EP06846739 A EP 06846739A EP 06846739 A EP06846739 A EP 06846739A EP 1968568 A2 EP1968568 A2 EP 1968568A2
Authority
EP
European Patent Office
Prior art keywords
pyrrolo
amino
pyridin
thiophenecarboxamide
ethyl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP06846739A
Other languages
German (de)
French (fr)
Other versions
EP1968568A4 (en
Inventor
Mark Andrew Seefeld
Toshihiro Hamajima
David Kendall Jung
Hiroko Nakamura
Paul R. Reid
Michael John Reno
Meagan B. Rouse
Dirk A. Heerding
Jun Tang
Jizhou Wang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
GlaxoSmithKline LLC
Original Assignee
SmithKline Beecham Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SmithKline Beecham Corp filed Critical SmithKline Beecham Corp
Publication of EP1968568A2 publication Critical patent/EP1968568A2/en
Publication of EP1968568A4 publication Critical patent/EP1968568A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D471/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04Ortho-condensed systems
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D487/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/04Ortho-condensed systems

Definitions

  • This invention relates to novel thiophene compounds, the use of such compounds as inhibitors of protein kinase B (hereinafter PKB/Akt, PKB or Akt) activity and in the treatment of cancer and arthritis.
  • PKB/Akt, PKB or Akt protein kinase B
  • the present invention relates to thiophene containing compounds that are inhibitors of the activity of one or more of the isoforms of the serine/threonine kinase, Akt (also known as protein kinase B).
  • Akt serine/threonine kinase B
  • the present invention also relates to pharmaceutical compositions comprising such compounds and methods of using the instant compounds in the treatment of cancer and arthritis (Liu et al. Current Qpin. Pharmacology 3:317-22 (2003)).
  • Apoptosis (programmed cell death) plays essential roles in embryonic development and pathogenesis of various diseases, such as degenerative neuronal diseases, cardiovascular diseases and cancer.
  • PI3K phosphatidylinositol 3'-OH kinase
  • Akt/PKB pathway appears important for regulating cell survival/cell death (Kulik et al. MoI. Cell. Biol. 17:1595- 1606 (1997); Franke et al, Cell, 88:435-437 (1997); Kauffmann-Zeh et al. Nature 385:544-548 (1997) Hemmings Science, 275:628-630 (1997); Dudek et al., Science, 275:661-665 (1997)).
  • PI3K phosphatidylinositol 3'-OH kinase
  • PDGF platelet derived growth factor
  • NEF nerve growth factor
  • IGF-I insulin-like growth factor-1
  • Activated PI3K leads to the production of phosphatidylinositol (3,4,5)-triphosphate (Ptdlns (3,4,5)-P3), which in turn binds to, and promotes the activation of, the serine/ threonine kinase Akt, which contains a pleckstrin homology (PH)-domain (Franke et al Ce//, 81 :727-736 (1995); Hemmings Science, 277:534 (1997); Downward, Curr. Opin. Cell Biol. 10:262-267 (1998), Alessi et al., EMBO J. 15: 6541-6551 (1996)).
  • PH pleckstrin homology
  • PI3K or dominant negative Akt/PKB mutants abolish survival-promoting activities of these growth factors or cytokines. It has been previously disclosed that inhibitors of PI3K (LY294002 or wortmannin) blocked the activation of Akt/PKB by upstream kinases. In addition, introduction of constitutively active PI3K or Akt/PKB mutants promotes cell survival under conditions in which cells normally undergo apoptotic cell death (Kulik et al. 1997, Dudek et al. 1997).
  • Akt2 is overexpressed in a significant number of ovarian (J. Q. Cheung et al. Proc. Natl. Acad. Sci. U.S.A. 89:9267-9271 (1992)) and pancreatic cancers (J. Q. Cheung et al. Proc. Natl. Acad. Sci. U.S.A. 93:3636-3641 (1996)).
  • Akt3 was found to be overexpressed in breast and prostate cancer cell lines (Nakatani et al. J. Biol.Chem. 274:21528- 21532 (1999).
  • Akt-2 was over-expressed in 12% of ovarian carcinomas and that amplification of Akt was especially frequent in 50% of undifferentiated tumors, suggestion that Akt may also be associated with tumor aggressiveness (Bellacosa, et al., Int. J. Cancer, 64, pp. 280-285, 1995). Increased Akt1 kinase activity has been reported in breast, ovarian and prostate cancers (Sun et al. Am. J. Pathol. 159: 431-7 (2001 )).
  • the tumor suppressor PTEN a protein and lipid phosphatase that specifically removes the 3' phosphate of Ptdlns(3,4,5)-P3, is a negative regulator of the PI3K/Akt pathway (Li et al. Science 275:1943-1947 (1997), Stambolic et al. Cell 95:29-39 (1998), Sun et al. Proc. Nati. Acad. Sci. U.S.A. 96:6199-6204 (1999)).
  • Germline mutations of PTEN are responsible for human cancer syndromes such as Cowden disease (Liaw et al. Nature Genetics 16:64-67 (1997)).
  • PTEN is deleted in a large percentage of human tumors and tumor cell lines without functional PTEN show elevated levels of activated Akt (Li et al. supra, Guldberg et al. Cancer Research 57:3660-3663 (1997), Risinger et al. Cancer Research 57:4736-4738 (1997)).
  • Akt/PKBs Three members of the Akt/PKB subfamily of second-messenger regulated serine/threonine protein kinases have been identified and termed Akt1/ PKB ⁇ , Akt2/PKB ⁇ , and Akt3/PKB ⁇ respectively.
  • the isoforms are homologous, particularly in regions encoding the catalytic domains.
  • Akt/PKBs are activated by phosphorylation events occurring in response to PI3K signaling.
  • PI3K phosphorylates membrane inositol phospholipids, generating the second messengers phosphatidyl- inositol 3,4,5-trisphosphate and phosphatidylinositol 3,4- bisphosphate, which have been shown to bind to the PH domain of Akt/PKB.
  • Akt/PKB activation proposes recruitment of the enzyme to the membrane by 3'-phosphorylated phosphoinositides, where phosphorylation of the regulatory sites of Akt/PKB by the upstream kinases occurs (B.A. Hemmings, Science 275:628-630 (1997); B.A. Hemmings, Science 276:534 (1997); J. Downward, Science 279:673-674 (1998)).
  • Akt1/PKB ⁇ Phosphorylation of Akt1/PKB ⁇ occurs on two regulatory sites, Thr 3O ⁇ in the catalytic domain activation loop and on Ser 473 near the carboxy terminus (D. R. Alessi et al. EMBO J. 15:6541-6551 (1996) and R. Meier et al. J. Biol. Chem. 272:30491-30497 (1997)).
  • Equivalent regulatory phosphorylation sites occur in Akt2/PKB ⁇ and Akt3/PKB ⁇ .
  • the upstream kinase, which phosphorylates Akt/PKB at the activation loop site has been cloned and termed 3 '-phosphoinositide dependent protein kinase 1 (PDK1).
  • PDK1 phosphorylates not only Akt/PKB, but also p70 ribosomal S6 kinase, p90RSK, serum and glucocorticoid-regulated kinase (SGK), and protein kinase C.
  • the upstream kinase phosphorylating the regulatory site of Akt/PKB near the carboxy terminus has not been identified yet, but recent reports imply a role for the integrin-linked kinase (ILK-1 ), a serine/threonine protein kinase, or autophosphorylation.
  • ILK-1 integrin-linked kinase
  • serine/threonine protein kinase or autophosphorylation.
  • Akt activation and activity can be achieved by inhibiting PI3K with inhibitors such as LY294002 and wortmannin.
  • inhibitors such as LY294002 and wortmannin.
  • PI3K inhibition has the potential to indiscriminately affect not just all three Akt isozymes but also other PH domain-containing signaling molecules that are dependent on Pdtlns(3,4,5)- P3, such as the Tec family of tyrosine kinases.
  • Akt can be activated by growth signals that are independent of PI3K.
  • Akt activity can be inhibited by blocking the activity of the upstream kinase PDK1.
  • the compound UCN-01 is a reported inhibitor of PDK1. Biochem. J. 375(2):255 (2003).
  • Akt small molecule inhibitors of Akt are useful in the treatment of tumors, especially those with activated Akt (e.g. PTEN null tumors and tumors with ras mutations).
  • PTEN is a critical negative regulator of Akt and its function is lost in many cancers, including breast and prostate carcinomas, glioblastomas, and several cancer syndromes including Bannayan-Zonana syndrome (Maehama, T. et al.
  • Akt3 is up-regulated in estrogen receptor-deficient breast cancers and androgen- independent prostate cancer cell lines and Akt2 is over-expressed in pancreatic and ovarian carcinomas. Akt1 is amplified in gastric cancers (Staal, Proc. Natl. Acad. Sci.
  • Akt inhibitor is expected to be useful for the treatment of these types of cancer as well as other types of cancer. Akt inhibitors are also useful in combination with further chemotherapeutic agents. It is an object of the instant invention to provide novel compounds that are inhibitors of Akt/PKB.
  • compositions that comprise a pharmaceutical carrier and compounds useful in the methods of the invention. It is also an object of the present invention to provide a method for treating cancer that comprises administering such inhibitors of Akt/PKB activity.
  • This invention relates to novel compounds of Formula (I):
  • V is selected from the group consisting of: CH and N;
  • Z is selected from the group consisting of: CR and N, where R is selected
  • 20 20 from: hydrogen, -CO2R and Ci-3alkyl, where R is selected from: hydrogen and Ci_ 3 alkyl; W, X and Y are selected from the group consisting of CR , CR and N,
  • R is selected from: hydrogen, C-]-3alkyl, aryl, heteroaryl, -CO2R , -CN and
  • R and R are independently selected from: hydrogen, halogen, aryl, substituted aryl, heteroaryl, substituted heteroaryl, C-
  • R is selected from: hydrogen, -(CH2)m-a r y' > -(CH2)rrrC3-7cycloalkyl, Ci-
  • R is hydrogen or R is taken together with R or R to form a 4 to 7 member carbocyclic ring optionally containing 1 additional heteroatom,
  • R and R are independently selected from: hydrogen and Ci_5alkyl, or R
  • R or R is taken together with R to form a 4 to 7 member carbocyclic ring optionally containing 1 additional heteroatom, and
  • - 5 - Q is selected from: -(CH2)paryl(CH2)p-, substituted -(CH2)paryl(CH2)p- and ⁇ ( c H2)m where p is 0 to 4 and n is 0 to 4 and when n is not 0, the - (CH2)rr group is optionally substituted by oxo, where R is selected from the group consisting of: hydrogen and Ci_ 3alkyl,
  • Oc py selected from hydrogen and C- ⁇ salkyl, or R and R taken together with the nitrogen to which they are attached form a 4 to 6 member carbocyclic ring, optionally containing 1 or 2 additional heteroatoms, and
  • R and R are independently selected from: hydrogen and Ci- salkyl, and p where R is selected from: hydrogen and Ci-3alkyl;
  • This invention relates to a method of treating cancer, which comprises administering to a subject in need thereof an effective amount of an Akt/PKB inhibiting compound of Formula (I).
  • This invention relates to a method of treating arthritis, which comprises administering to a subject in need thereof an effective amount of an Akt/PKB inhibiting compound of Formula (I).
  • the present invention also relates to the discovery that the compounds of Formula (I) are active as inhibitors of Akt/PKB.
  • novel processes and novel intermediates useful in preparing the presently invented AKt/PKB inhibiting compounds are provided.
  • compositions that comprise a pharmaceutical carrier and compounds useful in the methods of the invention.
  • Also included in the present invention are methods of co-administering the presently invented Akt/PKB inhibiting compounds with further active ingredients.
  • This invention relates to compounds of Formula (I) as described above.
  • the presently invented compounds of Formula (I) inhibit Akt/PKB activity.
  • the compounds disclosed herein inhibit each of the three Akt/PKB isoforms.
  • Z is CR , where R is selected from: hydrogen and -CO2R , where R is selected from: hydrogen and Ci_3alkyl;
  • X and Y are selected from the group consisting of CR , CR and N,
  • R is selected from: hydrogen, Ci-3alkyl, aryl, heteroaryl, -CO2R , -CN and
  • R is selected from: hydrogen, halogen, aryl, substituted aryl, heteroaryl, substituted heteroaryl, C 1-3 alkyl, -NR R , cyano and -OR
  • L 1 is selected from: -NR 6 CO-, -CONR 6 -, -NR 6 S ⁇ 2-, -SO2NR 6 -, -NR 6 CH2-,
  • R is selected from: hydrogen, -(CH2)m-aryl, -(CH2)m-C3-7cycloalkyl, Ci-
  • R is hydrogen or R is taken together with R or R to form a 4 to 7 member carbocyclic ring
  • R and R are independently selected from: hydrogen and C-
  • R or R is taken together with R to form a 4 to 7 member carbocyclic ring, and Q is selected from: -(CH2)paryl(CH2)p-, substituted -(CH2)paryl(CH2)p- and
  • R and R are independently selected from: hydrogen and C-
  • R 7 7 20 20 Z is CR , where R is selected from: hydrogen and -CO2R , where R is selected from: hydrogen and Ci -3alkyl;
  • W, X and Y are selected from the group consisting of CR and CR , where
  • R is hydrogen, and R is a substituent of Formula (X):
  • R is selected from: hydrogen, halogen, aryl, heteroaryl and cyano
  • L is selected from: -NR CO- and -CONR -,
  • R is selected from: hydrogen, -(CH2)m-a
  • R is hydrogen or R is taken together with R or R to form a 4 to 7 member carbocyclic ring, 3 4 3
  • R and R are independently selected from: hydrogen and C-j.salkyl, or R
  • R or R is taken together with R to form a 4 to 7 member carbocyclic ring
  • Q is selected from; -(CH2)paryl(CH2)p- and -(CH2)m where p is 0 to 4 and n is 0 to 4 and when n is not 0, the -(CH2)rr group is optionally substituted by oxo, where R is selected from the group consisting of: hydrogen and C-
  • novel compounds useful in the present invention are:
  • 3-yl)-2-thiophenecarboxamide 3-amino-N-[5-(3-furanyl)-4-(2-methyl-1 H-pyrrolo[2,3-b]pyridin-3-yl)-2- thienyl]-2-(phenylmethyl)propanamide; 3-amino-2-(phenylmethyl)- ⁇ /-[4-(1/-/-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]propanamide;
  • Compounds of Formula (I) are included in the pharmaceutical compositions of the invention and used in the methods of the invention.
  • the compounds described herein may contain one or more chiral atoms, or may otherwise be capable of existing as two enantiomers. Accordingly, the compounds of this invention include mixtures of enantiomers as well as purified enantiomers or enantiomerically enriched mixtures. Also, it is understood that all tautomers and mixtures of tautomers are included within the scope of the compounds of formula I or Ia.
  • aryl and derivatives thereof, used alone or as part of a larger moiety as in “aralkyl”, “aralkoxy”, or “aryloxyalkyl” as used herein, unless otherwise defined, is meant monocyclic, bicyclic, and tricyclic ring systems having a total of five to fourteen ring members, wherein at least one ring system is aromatic and wherein each ring in the system contains 3 to 7 members, such as phenyl, naphthalene, tetrahydronaphthalene and biphenyl.
  • heteroaryl and derivatives thereof, used alone or as part of a larger moiety as in “heteroaralkyl”, “heteroaralkoxy”, or “heteroaryloxyalkyl” as used herein, unless otherwise defined, is meant monocyclic, bicyclic, and tricyclic ring systems having a total of five to fourteen ring members, wherein at least one ring system is aromatic, at least one ring in the system contains one or more heteroatoms, and wherein each ring in the system contains 3 to 7 members, such as 3,4-methylenedioxyphenyl, pyridine, quinoline, isoquinoline, tetrahydroquinoline, tetrahydroisoquinoline, pyrimidine, quinazoline, thiophene, furan, pyrrole, pyrazole, imidazole, indole, indole 3-yl, dihydroindole, indene, dihydroindene, pyrazine,
  • substituted as used herein, unless otherwise defined, is meant that the subject chemical moiety has from one to five substituents, suitably from one to three substituents, selected from the group consisting of: -CC ⁇ R ⁇ O, ar y
  • alkoxy as used herein is meant -Oalkyl where alkyl is as described herein including -OCH3 and -OC(CH3)2CH3.
  • cycloalkyl as used herein unless otherwise defined, is meant a nonaromatic, unsaturated or saturated, cyclic or polycyclic C 3 -C-] 2-
  • cycloalkyl and substituted cycloalkyl substituents as used herein include: cyclohexyl, aminocyclohexyl, cyclobutyl, aminocyclobutyl, A- hydroxy-cyclohexyl, 2-ethylcyclohexyl, propyl 4-methoxycyclohexyl, 4- methoxycyclohexyl, 4-carboxycyclohexyl, cyclopropyl, aminocyclopentyl, cyclopentyl.
  • cycloalkyl containing from 1 to 4 heteroatoms as used herein unless otherwise defined, is meant a nonaromatic, unsaturated or saturated, cyclic or polycyclic ring containing from 1 to 12 carbons and containing from one to four heteroatoms, provided that when the number of carbon atoms is 1 the aromatic ring contains at least four heteroatoms, when the number of carbon atoms is 2 the aromatic ring contains at least three heteroatoms, when the number of carbon atoms is 3 the nonaromatic ring contains at least two heteroatoms and when the number of carbon atoms is 4 the nonaromatic ring contains at least one heteroatom.
  • cycloalkyl containing from 1 to 4 heteroatoms and substituted cycloalkyl containing from 1 to 4 heteroatoms as used herein include: piperidyl, piperidine, pyrrolidine, 3-methyiaminopyrrolidine, piperazinly, tetrazole, hexahydrodiazepine, azetidinyl, pyran, tetrahydropyran, and morpholine.
  • acyloxy as used herein is meant -OC(O)alkyl where alkyl is as described herein.
  • Examples of acyloxy substituents as used herein include: - OC(O)CH 3 , -OC(O)CH(CH 3 ) 2 and -OC(O)(CH2)3CH 3 .
  • N-acylamino as used herein is meant -N(H)C(O )alkyl, where alkyl is as described herein.
  • Examples of N-acylamino substituents as used herein include: -N(H)C(O)CH 3 , -N(H)C(O)CH(CH 3 ) 2 and -N(H)C(O)(CH 2 )3CH 3 .
  • heteroatom oxygen, nitrogen or sulfur.
  • halogen as used herein is meant a substituent selected from bromide, iodide, chloride and fluoride.
  • alkyl and derivatives thereof and in all carbon chains as used herein, including alkyl chains defined by the term “-(CH2)n' ⁇ "-(CH2)m” a ⁇ d tne ⁇ e, is meant a linear or branched, saturated or unsaturated hydrocarbon chain, and unless otherwise defined, the carbon chain will contain from 1 to 12 carbon atoms.
  • alkyl and substituted alkyl substituents as used herein include: -CH3, - CH 2 -CH 3 , -CH 2 -CH 2 -CH 3 , -CH(CH 3 ) 2 , -CH 2 -CH 2 -C(CH 3 ) 3 , -CH 2 -CF 3 , -C ⁇ C- C(CH 3 ) 3 , -C ⁇ C-CH 2 -OH, cyclopropylmethyl, -CH 2 -C(CH 3 ) 2 -CH 2 -NH 2 , -C ⁇ C-
  • treating and derivatives thereof as used herein, is meant prophylatic and therapeutic therapy.
  • the term "effective amount” and derivatives thereof means that amount of a drug or pharmaceutical agent that will elicit the biological or medical response of a tissue, system, animal or human that is being sought, for instance, by a researcher or clinician.
  • therapeutically effective amount means any amount which, as compared to a corresponding subject who has not received such amount, results in improved treatment, healing, prevention, or amelioration of a disease, disorder, or side effect, or a decrease in the rate of advancement of a disease or disorder.
  • the term also includes within its scope amounts effective to enhance normal physiological function.
  • esters can be employed, for example methyl, ethyl, pivaloyloxymethyl, and the like for -COOH, and acetate maleate and the like for -OH, and those esters known in the art for modifying solubility or hydrolysis characteristics, for use as sustained release or prodrug formulations.
  • novel compounds of Formulas I and Ia are prepared as shown in Schemes 1 to 6 below, or by analogous methods, wherein the V, W, X, Y, Z, Q, L and 1 R 1 substituents are as defined in Formulas I and Ia respectively and provided that the V, W, X, Y, Z, Q, L and 'R' substituents do not include any such substituents that render inoperative the processes of Schemes 1 to 6. All of the starting materials are commercially available or are readily made from commercially available starting materials by those of skill in the art.
  • Reagents (a) DPPA, Et 3 N, t-BuOH, 85 0 C; (b) 1-(phenylsulfonyl)-4-(4,4,5,5- tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 /-/-pyrrolo[2,3-d]pyridine, K 2 CO 3 , Pd(PPh 3 ) 4 , dioxane/H 2 O; (c) HCI/dioxane; (d) PyBrop, (i-Pr) 2 Net, 3-( ⁇ [(1 ,1 - dimethylethyl)oxy]Garbonyl ⁇ amino)-2-phenylpropanoic acid, DCM, RT; (e) 6N NaOH, MeOH, 50° C; (f) HCI/dioxane.
  • Suzuki-like couplings are typically run using a palladium(O) catalyst such as Pd(PPh 3 ) 4 with an inorganic base, for example K 2 CO 3 , Na 2 CO 3 or K 3 PO 4, in an aqueous mixture containing ethereal solvents such as DME, dioxane, or THF.
  • a palladium(O) catalyst such as Pd(PPh 3 ) 4 with an inorganic base, for example K 2 CO 3 , Na 2 CO 3 or K 3 PO 4
  • an inorganic base for example K 2 CO 3 , Na 2 CO 3 or K 3 PO 4
  • an inorganic base for example K 2 CO 3 , Na 2 CO 3 or K 3 PO 4
  • an inorganic base for example K 2 CO 3 , Na 2 CO 3 or K 3 PO 4
  • ethereal solvents such as DME, dioxane, or THF.
  • Removal of the Boc protecting group of (I-3) was achieved using a protic acid such as trifluoroacetic
  • the coupling of a primary or secondary amine with a carboxylic acid can be accomplished with a variety of amide coupling reagents such as EDC, PyBrop, etc. to provide, for example amide (1-4).
  • amide coupling reagents such as EDC, PyBrop, etc.
  • Amide coupling reactions are generally run in solvents such as DCM or DMF, utilizing an organic base like Et 3 N or (J-Pr) 2 NEt. Removal of the arylsulfonyl group of (1-4) was accomplished with aqueous NaOH followed by acidic treatment with HCI or TFA to remove the Boc protecting group and produce (1-5).
  • Reagents (a) 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)- 1 /-/-pyrrolo[2,3-b]pyridine, K 2 CO 3 , Pd(PPh 3 ) 4 , dioxane/H 2 O; (b) H 2 (1 atm), Pd/C, MeOH/THF, RT; (c) PyBrop, (i-Pr) 2 Net, 3-( ⁇ [(1 ,1-dimethylethyl)oxy]carbonyl ⁇ amino)- 2-phenylpropanoic acid, DCM, RT; (d) 6N NaOH, MeOH, 50° C; (e) HCI/dioxane.
  • Reduction of the nitro functionality of (II-2) was accomplished using Pd/C catalyst in polar protic solvents, such as MeOH, under an atmosphere of hydrogen gas.
  • polar protic solvents such as MeOH
  • the coupling of a primary amine with a carboxylic acid, such as 3-( ⁇ [(1 ,1- dimethylethyl)oxy]carbonyl ⁇ amino)-2-phenylpropanoic acid can be accomplished with a variety of amide coupling reagents such as EDC, PyBrop, etc. to provide, for example amide (11-4).
  • Amide coupling reactions are generally run in solvents such as DCM or DMF, utilizing an organic base like Et 3 N or (i-Pr) 2 NEt.
  • Reagents (a) Phthalimide, PPh 3 , DEAD, THF, RT; (b) CH 3 NH 2 /H 2 O, MeOH, RT; (c) 111-3, PyBrop, (i-Pr) 2 Net, 3-( ⁇ [(1 ,1-dimethylethyl)oxy]carbonyl ⁇ amino)-2- phenylpropanoic acid, DCM, RT; (d) 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2- dioxaborolan-2-yl)-1 H-pyrrolo[2,3-6]pyridine, K 2 CO 3 , Pd(PPh 3 ) 4 , dioxane/H 2 O; (e) 6N NaOH, MeOH, 50° C; (f) HCI/dioxane.
  • Dibromide (111-5) was regioselectively coupled with arylboronate 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl- 1,3,2-dioxaborolan-2-yl)-1/-/-pyrrolo[2,3- ⁇ ]pyridine using a Suzuki coupling procedure.
  • Suzuki-like couplings are typically run using a palladium(O) catalyst such as Pd(PPh 3 ) 4 with an inorganic base, for example K 2 CO 3 , Na 2 CO 3 or K 3 PO 4 , in an aqueous mixture containing ethereal solvents such as DME, dioxane, or THF.
  • Reagents (a) (Boc) 2 O, pyridine, NH 4 HCO 3 , 3-( ⁇ [(1 ,1- dim ⁇ thyl ⁇ thyl)oxy]carbonyl ⁇ amino)-2-phenylpropanoic acid ; (b) i-(phenylsulfonyl)- 4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3-b]pyridine, K 2 CO 3 , Pd(PPh 3 ) 4 , dioxane/H 2 0; (c) IV-2, 1 ,2-diaminoethane, CuI, K 2 CO 3 , dioxane, 10O 0 C; (d) 6N NaOH, MeOH, 50° C; (e) HCI/dioxane.
  • Suzuki-like couplings are typically run using a palladium(O) catalyst such as Pd(PPh 3 ) 4 with an inorganic base, for example K 2 CO 3 , Na 2 CO 3 or K 3 PO 4 , in an aqueous mixture containing ethereal solvents such as DME, dioxane, or THF.
  • a palladium(O) catalyst such as Pd(PPh 3 ) 4 with an inorganic base, for example K 2 CO 3 , Na 2 CO 3 or K 3 PO 4
  • an inorganic base for example K 2 CO 3 , Na 2 CO 3 or K 3 PO 4
  • ethereal solvents such as DME, dioxane, or THF.
  • Methods for palladium mediated couplings are described in standard reference volumes, such as Schlosser "Organometallics in Synthesis” (published by Wiley and sons).
  • Bromide (IV-4) was coupled to amide (IV-2) using a procedure descibed by Buchwald (J
  • Reagents (a) Phthalimide, PPh 3 , DEAD, THF, RT; (b) HCI, dioxane, RT; (c) IU-4, PyBrop, (J-Pr) 2 NEt 1 DCM, RT; (d) 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2- dioxaborolan-2-yl)-1 f/-pyrrolo[2,3-b]pyridine, K 2 CO 3 , Pd(PPh 3 ) 4 , dioxane/H 2 O; (e) 6N NaOH, MeOH, RT; (f) NH 2 NH 2 , MeOH, 50° C.
  • Carboxylic acid (III— 4) was reacted with amine (V-3) to form amide (V-4).
  • a variety of amide coupling reagents such as EDC, PyBrop, etc. are commercially available. Amide coupling reactions are generally run in solvents such as DCM or DMF, utilizing an organic base like Et 3 N or (i-Pr) 2 NEt.
  • Dibromide (V-4) was regioselectively coupled with arylboronate 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 /-/- pyrrolo[2,3-/?]pyridine using a Suzuki coupling procedure.
  • Suzuki-like couplings are typically run using a palladium(O) catalyst such as Pd(PPh 3 ⁇ with an inorganic base, for example K 2 CO 3 , Na 2 CO 3 or K 3 PO 4 , in an aqueous mixture containing ethereal solvents such as DME, dioxane, or THF.
  • a palladium(O) catalyst such as Pd(PPh 3 ⁇ with an inorganic base, for example K 2 CO 3 , Na 2 CO 3 or K 3 PO 4
  • an aqueous mixture containing ethereal solvents such as DME, dioxane, or THF.
  • Reagents (a) DPPA, Et 3 N, t-BuOH, 85 0 C; (b) furan-3-boronic acid, K 2 CO 3 , Pd(PPh 3 ) 4 , dioxane/H 2 O; (c) 1-(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1,3,2- dioxaborolan-2-yl)-1 H-pyrrolo[2,3-ib]pyriciine, K 2 CO 3 , Pd(PPh 3 ) 4 , dioxane/H 2 O; (d) HCI/dioxane; (e) PyBrop, (i-Pr) 2 Net, 3-( ⁇ [(1 ,1-dimethylethyl)oxy]carbonyl ⁇ amino)-2- phenylpropanoic acid, DCM, RT; (f) 6N NaOH, MeOH, 50° C; (g) HCI/dioxane.
  • Suzuki-like couplings are typically run using a palladium(O) catalyst such as Pd(PPh 3 ) 4 with an inorganic base, for example K 2 CO 3 , Na 2 CO 3 or K 3 PO 4 , in an aqueous mixture containing ethereal solvents such as DME, dioxane, or THF.
  • a palladium(O) catalyst such as Pd(PPh 3 ) 4 with an inorganic base, for example K 2 CO 3 , Na 2 CO 3 or K 3 PO 4
  • an inorganic base for example K 2 CO 3 , Na 2 CO 3 or K 3 PO 4
  • ethereal solvents such as DME, dioxane, or THF.
  • Removal of the Boc protecting group of (Vl-3) was achieved using a protic acid such as trifluoroacetic acid or HCI in a polar solvent such as methanol.
  • the coupling of a primary or secondary amine with a carboxylic acid can be accomplished with a variety of amide coupling reagents such as EDC, PyBrop, etc. to provide, for example amide (VI-4).
  • Amide coupling reactions are generally run in solvents such as DCM or DMF, utilizing an organic base like EtsN or (i-Pr ⁇ NEt. Removal of the arylsulfonyl group of (VI-4) was accomplished with aqueous NaOH followed by acidic treatment with HCI or TFA to remove the Boc protecting group and produce (VI-5).
  • One skilled in the art can synthesize the remaining compounds of Formula I according to the above schemes and/or with information readily known to those of skill in the art, using intermediates known in the art or using intermediates readily prepared form intermediates known in the art.
  • one can synthesize compounds of Formula 1 (W N), using the methods described in Scheme 3 with intermediates described in Bioorg. Med. Chem. Lett. 2004, 14, 5247-5250.
  • co-administering and derivatives thereof as used herein is meant either simultaneous administration or any manner of separate sequential administration of an AKT inhibiting compound, as described herein, and a further active ingredient or ingredients, known to be useful in the treatment of cancer, including chemotherapy and radiation treatment, or to be useful in the treatment of arthritis.
  • further active ingredient or ingredients includes any compound or therapeutic agent known to or that demonstrates advantageous properties when administered to a patient in need of treatment for cancer or arthritis.
  • the compounds are administered in a close time proximity to each other.
  • the compounds are administered in the same dosage form, e.g. one compound may be administered topically and another compound may be administered orally.
  • any anti-neoplastic agent that has activity versus a susceptible tumor being treated may be co-administered in the treatment of cancer in the present invention.
  • examples of such agents can be found in Cancer Principles and Practice of Oncology by V.T. Devita and S. Hellman (editors), 6 lh edition (February 15, 2001), Lippincott Williams & Wilkins Publishers.
  • a person of ordinary skill in the art would be able to discern which combinations of agents would be useful based on the particular characteristics of the drugs and the cancer involved.
  • Typical anti- neoplastic agents useful in the present invention include, but are not limited to, anti- microtubule agents such as diterpenoids and vinca alkaloids; platinum coordination complexes; alkylating agents such as nitrogen mustards, oxazaphosphorines, alkylsulfonates, nitrosoureas, and triazenes; antibiotic agents such as anthracyclins, actinomycins and bleomycins; topoisomerase Il inhibitors such as epipodophyllotoxins; antimetabolites such as purine and pyrimidine analogues and anti-folate compounds; topoisomerase I inhibitors such as camptothecins; hormones and hormonal analogues; signal transduction pathway inhibitors; nonreceptor tyrosine kinase angiogenesis inhibitors; immunotherapeutic agents; proapoptotic agents; and cell cycle signaling inhibitors.
  • anti- microtubule agents such as diterpenoids and vinca alkaloids
  • Examples of a further active ingredient or ingredients (anti-neoplastic agent) for use in combination or co-administered with the presently invented AKT inhibiting compounds are chemotherapeutic agents.
  • Anti-microtubule or anti-mitotic agents are phase specific agents active against the microtubules of tumor cells during M or the mitosis phase of the cell cycle.
  • anti-microtubule agents include, but are not limited to, diterpenoids and vinca alkaloids.
  • Diterpenoids which are derived from natural sources, are phase specific anti -cancer agents that operate at the G 2 /M phases of the cell cycle. It is believed that the diterpenoids stabilize the ⁇ -tubulin subunit of the microtubules, by binding with this protein. Disassembly of the protein appears then to be inhibited with mitosis being arrested and cell death following. Examples of diterpenoids include, but are not limited to, paclitaxel and its analog docetaxel.
  • Paclitaxel has been approved for clinical use in the treatment of refractory ovarian cancer in the United States (Markman et al., Yale Journal of Biology and Medicine, 64:583, 1991 ; McGuire et al., Ann. Intern, Med., 111 :273,1989) and for the treatment of breast cancer (Holmes et al., J. Nat. Cancer Inst., 83:1797,1991.) It is a potential candidate for treatment of neoplasms in the skin (Einzig et. al., Proc. Am. Soc. Clin. Oncol., 20:46) and head and neck carcinomas (Forastire et. al., Sem. Oncol., 20:56, 1990).
  • the compound also shows potential for the treatment of polycystic kidney disease (Woo et. al., Nature, 368:750. 1994), lung cancer and malaria.
  • Treatment of patients with pac ⁇ taxel results in bone marrow suppression (multiple cell lineages, Ignoff, RJ. et. al, Cancer Chemotherapy Pocket Guide,,. 1998) related to the duration of dosing above a threshold concentration (5OnM) (Kearns, CM. et. al., Seminars in Oncology, 3(6) p.16-23, 1995).
  • 5OnM threshold concentration
  • Docetaxel is indicated for the treatment of breast cancer.
  • Docetaxel is a semisynthetic derivative of paclitaxel q.v., prepared using a natural precursor, 10-deacetyl-baccatin III, extracted from the needle of the European Yew tree.
  • the dose limiting toxicity of docetaxel is neutropenia.
  • Vinca alkaloids are phase specific antineoplastic agents derived from the periwinkle plant. Vinca alkaloids act at the M phase (mitosis) of the cell cycle by binding specifically to tubulin. Consequently, the bound tubulin molecule is unable to polymerize into microtubules. Mitosis is believed to be arrested in metaphase with cell death following. Examples of vinca alkaloids include, but are not limited to, vinblastine, vincristine, and vinorelbine.
  • Vinblastine vincaleukoblastine sulfate
  • VELBAN® as an injectable solution.
  • Myelosuppression is the dose limiting side effect of vinblastine.
  • Vincristine, vincaleukoblastine, 22-oxo-, sulfate is commercially available as
  • ONCOVIN® as an injectable solution.
  • Vincristine is indicated for the treatment of acute leukemias and has also found use in treatment regimens for Hodgkin's and non-Hodgkin's malignant lymphomas.
  • Alopecia and neurologic effects are the most common side effect of vincristine and to a lesser extent myelosupression and gastrointestinal mucositis effects occur.
  • Vinorelbine 3',4'-didehydro -4'-deoxy-C'-norvincaleukoblastine [R-(R * , R * )- 2,3-dihydroxybutanedioate (1 :2)(salt)], commercially available as an injectable solution of vinorelbine tartrate (NAVELBINE®), is a semisynthetic vinca alkaloid.
  • Vinorelbine is indicated as a single agent or in combination with other chemotherapeutic agents, such as cisplatin, in the treatment of various solid tumors, particularly non-small cell lung, advanced breast, and hormone refractory prostate cancers. Myelosuppression is the most common dose limiting side effect of vinorelbine.
  • Platinum coordination complexes are non-phase specific anti-cancer agents, which are interactive with DNA.
  • the platinum complexes enter tumor cells, undergo, aquation and form intra- and interstrand crosslinks with DNA causing adverse biological effects to the tumor.
  • Examples of platinum coordination complexes include, but are not limited to, cisplatin and carboplatin.
  • Cisplatin cis-diamminedichloroplatinum
  • PLATINOL® an injectable solution.
  • Cisplatin is primarily indicated in the treatment of metastatic testicular and ovarian cancer and advanced bladder cancer.
  • the primary dose limiting side effects of cisplatin are nephrotoxicity, which may be controlled by hydration and diuresis, and ototoxicity.
  • Carboplatin platinum, diammine [1 ,1-cyclobutane-dicarboxylate(2-)-O,O'], is commercially available as PARAPLATI N® as an injectable solution.
  • Carboplatin is primarily indicated in the first and second line treatment of advanced ovarian carcinoma. Bone marrow suppression is the dose limiting toxicity of carboplatin.
  • Alkylating agents are non-phase anti-cancer specific agents and strong electrophiles. Typically, alkylating agents form covalent linkages, by alkylation, to DNA through nucleophilic moieties of the DNA molecule such as phosphate, amino, sulfhydryl, hydroxyl, carboxyl, and imidazole groups. Such alkylation disrupts nucleic acid function leading to cell death.
  • alkylating agents include, but are not limited to, nitrogen mustards such as cyclophosphamide, melphalan, and chlorambucil; alky! sulfonates such as busulfan; nitrosoureas such as carmustine; and triazenes such as dacarbazine.
  • Cyclophospham ide 2-[bis(2 ⁇ ch loroethy I )amino]tetrahydro-2H- 1 ,3,2- oxazaphosphorine 2-oxide monohydrate, is commercially available as an injectable solution or tablets as CYTOXAN®. Cyclophosphamide is indicated as a single agent or in combination with other chemotherapeutic agents, in the treatment of malignant lymphomas, multiple myeloma, and leukemias. Alopecia, nausea, vomiting and leukopenia are the most common dose limiting side effects of cyclophosphamide.
  • Melphalan 4-[bis(2-chloroethyl)amino]-L-phenylalanine, is commercially available as an injectable solution or tablets as ALKERAN®. Melphalan is indicated for the palliative treatment of multiple myeloma and non-resectable epithelial carcinoma of the ovary. Bone marrow suppression is the most common dose limiting side effect of melphalan.
  • Chlorambucil 4-[bis(2-chloroethyl)amino]benzenebutanoic acid, is commercially available as LEUKERAN® tablets. Chlorambucil is indicated for the palliative treatment of chronic lymphatic leukemia, and malignant lymphomas such as lymphosarcoma, giant follicular lymphoma, and Hodgkin's disease. Bone marrow suppression is the most common dose limiting side effect of chlorambucil. Busulfan, 1 ,4-butanediol dimethanesulfonate, is commercially available as MYLERAN® TABLETS. Busulfan is indicated for the palliative treatment of chronic myelogenous leukemia.
  • Bone marrow suppression is the most common dose limiting side effects of busulfan.
  • Carmustine 1,3-[bis(2-chloroethyl)-1 -nitrosourea, is commercially available as single vials of lyophilized material as BiCNU®.
  • Carmustine is indicated for the palliative treatment as a single agent or in combination with other agents for brain tumors, multiple myeloma, Hodgkin's disease, and non-Hodgkin's lymphomas. Delayed myelosuppression is the most common dose limiting side effects of carmustine.
  • dacarbazine 5-(3,3-dimethyl-1-triazeno)-imidazole-4-carboxamide, is commercially available as single vials of material as DTIC-Dome®.
  • dacarbazine is indicated for the treatment of metastatic malignant melanoma and in combination with other agents for the second line treatment of Hodgkin's Disease. Nausea, vomiting, and anorexia are the most common dose limiting side effects of dacarbazine.
  • Antibiotic anti-neoplasties are non-phase specific agents, which bind or intercalate with DNA. Typically, such action results in stable DNA complexes or strand breakage, which disrupts ordinary function of the nucleic acids leading to cell death.
  • antibiotic antineoplastic agents include, but are not limited to, actinomycins such as dactinomycin, anthrocyclins such as daunorubicin and doxorubicin; and bleomycins.
  • Dactinomycin also know as Actinomycin D, is commercially available in injectable form as COSMEGEN®. Dactinomycin is indicated for the treatment of Wilm's tumor and rhabdomyosarcoma. Nausea, vomiting, and anorexia are the most common dose limiting side effects of dactinomycin.
  • Daunorubicin (8S-cis-)-8-acetyl-10-[(3-amino-2,3,6-trideoxy- ⁇ -L-lyxo- hexopyranosyl)oxy]-7,8,9,10-tetrahydro-6,8,11-trihydroxy-1-methoxy-5,12 naphthacenedione hydrochloride, is commercially available as a liposomal injectable form as DAUNOXOME® or as an injectable as CERUBIDINE®. Daunorubicin is indicated for remission induction in the treatment of acute nonlymphocytic leukemia and advanced HIV associated Kaposi's sarcoma. Myelosuppression is the most common dose limiting side effect of daunorubicin.
  • Doxorubicin (8S, 10S)-10-[(3-amino-2,3,6-trideoxy- ⁇ -L-lyxo- hexopyranosyl)oxy]-8-glycoloyl, 7, 8,9,10-tetrahydro-6, 8, 11 -trihydroxy-1-methoxy- 5,12 naphthacenedione hydrochloride, is commercially available as an injectable form as RUBEX® or ADRIAMYCIN RDF®.
  • Doxorubicin is primarily indicated for the treatment of acute lymphoblastic leukemia and acute myeloblastic leukemia, but is also a useful component in the treatment of some solid tumors and lymphomas.
  • Bleomycin a mixture of cytotoxic glycopeptide antibiotics isolated from a strain of Streptomyces verticillus, is commercially available as BLENOXANE®. Bleomycin is indicated as a palliative treatment, as a single agent or in combination with other agents, of squamous cell carcinoma, lymphomas, and testicular carcinomas. Pulmonary and cutaneous toxicities are the most common dose limiting side effects of bleomycin.
  • Topoisomerase Il inhibitors include, but are not limited to, epipodophyllotoxins.
  • Epipodophyllotoxins are phase specific anti-neoplastic agents derived from the mandrake plant. Epipodophyllotoxins typically affect cells in the S and G 2 phases of the cell cycle by forming a ternary complex with topoisomerase Il and DNA causing DNA strand breaks. The strand breaks accumulate and cell death follows. Examples of epipodophyllotoxins include, but are not limited to, etoposide and teniposide.
  • Etoposide 4'-demethyl-epipodophyllotoxin 9[4,6-0-(R )-ethylidene- ⁇ -D- glucopyranoside]
  • VePESID® an injectable solution or capsules
  • VP-16 an injectable solution or capsules
  • Etoposide is indicated as a single agent or in combination with other chemotherapy agents in the treatment of testicular and non-small cell lung cancers. Myelosuppression is the most common side effect of etoposide. The incidence of leucopenia tends to be more severe than thrombocytopenia.
  • Teniposide 4'-demethyl-epipodophyilotoxin 9[4,6-0-(R )-thenylidene- ⁇ -D- glucopyranoside], is commercially available as an injectable solution as VUMON® and is commonly known as VM-26.
  • Teniposide is indicated as a single agent or in combination with other chemotherapy agents in the treatment of acute leukemia in children. Myelosuppression is the most common dose limiting side effect of teniposide. Teniposide can induce both leucopenia and thrombocytopenia.
  • Antimetabolite neoplastic agents are phase specific anti-neoplastic agents that act at S phase (DNA synthesis) of the cell cycle by inhibiting DNA synthesis or by inhibiting purine or pyrimidine base synthesis and thereby limiting DNA synthesis. Consequently, S phase does not proceed and cell death follows.
  • Examples of antimetabolite anti-neoplastic agents include, but are not limited to, fluorouracil, methotrexate, cytarabine, mecaptopurine, thioguanine, and gemcitabine.
  • 5-fluorouracil 5-fluoro-2,4- (1 H,3H) pyrimidinedione
  • fluorouracil is commercially available as fluorouracil.
  • Administration of 5-fluorouracil leads to inhibition of thymidylate synthesis and is also incorporated into both RNA and DNA. The result typically is cell death.
  • 5-fluorouracil is indicated as a single agent or in combination with other chemotherapy agents in the treatment of carcinomas of the breast, colon, rectum, stomach and pancreas. Myelosuppression and mucositis are dose limiting side effects of 5-fluorouracil.
  • Other fluoropyrimidine analogs include 5-fluoro deoxyuridine (floxuridine) and 5-fluorodeoxyuridine monophosphate.
  • Cytarabine 4-amino-1- ⁇ D-arabinofuranosyl-2 (I H)-pyrimidinone, is commercially available as CYTOSAR-U® and is commonly known as Ara-C. It is believed that cytarabine exhibits cell phase specificity at S-phase by inhibiting DNA chain elongation by terminal incorporation of cytarabine into the growing DNA chain. Cytarabine is indicated as a single agent or in combination with other chemotherapy agents in the treatment of acute leukemia. Other cytidine analogs include 5-azacytidine and 2',2'-difluorodeoxycytidine (gemcitabine). Cytarabine induces leucopenia, thrombocytopenia, and mucositis.
  • Mercaptopurine 1,7-dihydro-6H-purine-6-thione monohydrate
  • PURINETHOL® a useful mercaptopurine analog
  • a useful mercaptopurine analog is azathioprine.
  • Thioguanine exhibits cell phase specificity at S-phase by inhibiting DNA synthesis by an as of yet unspecified mechanism.
  • Thioguanine is indicated as a single agent or in combination with other chemotherapy agents in the treatment of acute leukemia.
  • Myelosuppression including leucopenia, thrombocytopenia, and anemia, is the most common dose limiting side effect of thioguanine administration.
  • gastrointestinal side effects occur and can be dose limiting.
  • Other purine analogs include pentostatin, erythrohydroxynonyladenine, fludarabine phosphate, and cladribine.
  • Gemcitabine 2'-deoxy-2 ⁇ 2'-difluorocytidine monohydrochloride ( ⁇ -isomer), is commercially available as GEMZAR®.
  • Gemcitabine exhibits cell phase specificity at S-phase and by blocking progression of cells through the G1/S boundary.
  • Gemcitabine is indicated in combination with cisplatin in the treatment of locally advanced non-small cell lung cancer and alone in the treatment of locally advanced pancreatic cancer.
  • Myelosuppression including leucopenia, thrombocytopenia, and anemia, is the most common dose limiting side effect of gemcitabine administration.
  • Methotrexate N-[4[[(2,4-diamino-6-pteridinyl) methyl]methylamino] benzoyl]- L-glutamic acid, is commercially available as methotrexate sodium. Methotrexate exhibits cell phase effects specifically at S-phase by inhibiting DNA synthesis, repair and/or replication through the inhibition of dyhydrofolic acid reductase which is required for synthesis of purine nucleotides and thymidylate.
  • Methotrexate is indicated as a single agent or in combination with other chemotherapy agents in the treatment of choriocarcinoma, meningeal leukemia, non-Hodgkin's lymphoma, and carcinomas of the breast, head, neck, ovary and bladder.
  • Myelosuppression (leucopenia, thrombocytopenia, and anemia) and mucositis are expected side effect of methotrexate administration.
  • Camptothecins including, camptothecin and camptothecin derivatives are available or under development as Topoisomerase I inhibitors. Camptothecins cytotoxic activity is believed to be related to its Topoisomerase I inhibitory activity.
  • camptothecins include, but are not limited to irinotecan, topotecan, and the various optical forms of 7-(4-methylpiperazino-methylene)-10, 1 1 -ethylenedioxy- 20-camptothecin described below.
  • Irinotecan is a derivative of camptothecin which binds, along with its active metabolite SN-38, to the topoisomerase I — DNA complex.
  • cytotoxicity occurs as a result of irreparable double strand breaks caused by interaction of the topoisomerase I : DNA : irintecan or SN-38 ternary complex with replication enzymes.
  • Irinotecan is indicated for treatment of metastatic cancer of the colon or rectum.
  • the dose limiting side effects of irinotecan HCI are myelosuppression, including neutropenia, and Gl effects, including diarrhea.
  • Topotecan HCI (S)-10-[(dimethylamino)methyl]-4-ethyl-4,9-dihydroxy-1 H- pyrano[3',4',6,7]indolizi ⁇ o[1 ,2-b]quinoline-3,14-(4H,12H)-dione monohydrochloride, is commercially available as the injectable solution HYCAMTIN®.
  • Topotecan is a derivative of camptothecin which binds to the topoisomerase I — DNA complex and prevents religation of singles strand breaks caused by Topoisomerase I in response to torsional strain of the DNA molecule.
  • Topotecan is indicated for second line treatment of metastatic carcinoma of the ovary and small cell lung cancer.
  • the dose limiting side effect of topotecan HCI is myelosuppression, primarily neutropenia.
  • camptothecin derivative of formula A following, currently under development, including the racemic mixture (R,S) form as well as the R and S enantiomers:
  • Hormones and hormonal analogues are useful compounds for treating cancers in which there is a relationship between the hormone(s) and growth and/or lack of growth of the cancer.
  • hormones and hormonal analogues useful in cancer treatment include, but are not limited to, adrenocorticosteroids such as prednisone and prednisolone which are useful in the treatment of malignant lymphoma and acute leukemia in children; aminoglutethimide and other aromatase inhibitors such as anastrozole, letrazole, vorazole, and exemestane useful in the treatment of adrenocortical carcinoma and hormone dependent breast carcinoma containing estrogen receptors; progestrins such as megestrol acetate useful in the treatment of hormone dependent breast cancer and endometrial carcinoma; estrogens, androgens, and anti-androgens such as flutamide, nilutamide, bicalutamide, cyproterone acetate and 5 ⁇ -reductases
  • Signal transduction pathway inhibitors are those inhibitors, which block or inhibit a chemical process which evokes an intracellular change. As used herein this change is cell proliferation or differentiation.
  • Signal tranduction inhibitors useful in the present invention include inhibitors of receptor tyrosine kinases, non-receptor tyrosine kinases, SH2/SH3domain blockers, serine/threonine kinases, phosphatidyl inositol-3 kinases, myo-inositol signaling, and Ras oncogenes.
  • protein tyrosine kinases catalyse the phosphorylation of specific tyrosyl residues in various proteins involved in the regulation of cell growth.
  • protein tyrosine kinases can be broadly classified as receptor or non-receptor kinases.
  • Receptor tyrosine kinases are transmembrane proteins having an extracellular ligand binding domain, a transmembrane domain, and a tyrosine kinase domain. Receptor tyrosine kinases are involved in the regulation of cell growth and are generally termed growth factor receptors. Inappropriate or uncontrolled activation of many of these kinases, i.e. aberrant kinase growth factor receptor activity, for example by over-expression or mutation, has been shown to result in uncontrolled cell growth. Accordingly, the aberrant activity of such kinases has been linked to malignant tissue growth. Consequently, inhibitors of such kinases could provide cancer treatment methods.
  • Growth factor receptors include, for example, epidermal growth factor receptor (EGFr), platelet derived growth factor receptor (PDGFr), erbB2, erbB4, vascular endothelial growth factor receptor (VEGFr), tyrosine kinase with immunoglobulin-like and epidermal growth factor homology domains (TIE-2), insulin growth factor -I (IGFI) receptor, macrophage colony stimulating factor (cfms), BTK, ckit, cmet, fibroblast growth factor (FGF) receptors, Trk receptors (TrkA, TrkB, and TrkC), ephrin (eph) receptors, and the RET protooncogene.
  • EGFr epidermal growth factor receptor
  • PDGFr platelet derived growth factor receptor
  • erbB2 erbB4
  • VEGFr vascular endothelial growth factor receptor
  • TIE-2 vascular endothelial growth factor receptor
  • TIE-2 t
  • inhibitors of growth receptors include ligand antagonists, antibodies, tyrosine kinase inhibitors and anti-sense oligonucleotides.
  • Growth factor receptors and agents that inhibit growth factor receptor function are described, for instance, in Kath, John C, Exp. Opin. Ther. Patents (2000) 10(6):803-818; Shawver et al DDT VoI 2, No. 2 February 1997; and Lofts, F. J. et al, "Growth factor receptors as targets", New Molecular Targets for Cancer Chemotherapy, ed. Workman, Paul and Kerr, David, CRC press 1994, London.
  • Non-receptor tyrosine kinases which are not growth factor receptor kinases are termed non-receptor tyrosine kinases.
  • Non-receptor tyrosine kinases for use in the present invention include cSrc, Lck, Fyn, Yes, Jak, cAbl, FAK (Focal adhesion kinase), Brutons tyrosine kinase, and Bcr-Abl.
  • Such non-receptor kinases and agents which inhibit non-receptor tyrosine kinase function are described in Sinh, S. and Corey, SJ. , (1999) Journal of Hematotherapy and Stem Cell Research 8 (5): 465 - 80; and Bolen, J. B., Brugge, J. S., (1997) Annual review of Immunology. 15: 371-404.
  • SH2/SH3 domain blockers are agents that disrupt SH2 or SH3 domain binding in a variety of enzymes or adaptor proteins including, PI3-K p85 subunit, Src family kinases, adaptor molecules (She, Crk, Nek, Grb2) and Ras-GAP.
  • SH2/SH3 domains as targets for anti-cancer drugs are discussed in Smithgall, T.E. (1995), Journal of Pharmacological and Toxicological Methods. 34(3) 125-32.
  • Inhibitors of Serine/Threonine Kinases including MAP kinase cascade blockers which include blockers of Raf kinases (rafk), Mitogen or Extracellular Regulated Kinase (MEKs), and Extracellular Regulated Kinases (ERKs); and
  • Protein kinase C family member blockers including blockers of PKCs (alpha, beta, gamma, epsilon, mu, lambda, iota, zeta).
  • IkB kinase family IKKa, IKKb
  • PKB family kinases PKB family kinases
  • akt kinase family members TGF beta receptor kinases.
  • Serine/Threonine kinases and inhibitors thereof are described in Yamamoto, T., Taya, S., Kaibuchi, K., (1999), Journal of Biochemistry. 126 (5) 799-803; Brodt, P, Samani, A., and Navab, R. (2000), Biochemical Pharmacology, 60.
  • Myo-inositol signaling inhibitors such as phospholipase C blockers and Myoinositol analogues.
  • signal inhibitors are described in Powis, G., and Kozikowski A., (1994) New Molecular Targets for Cancer Chemotherapy ed., Paul Workman and David Kerr, CRC press 1994, London.
  • Ras Oncogene Another group of signal transduction pathway inhibitors are inhibitors of Ras Oncogene.
  • Such inhibitors include inhibitors of farnesyltransferase, geranyl-geranyl transferase, and CAAX proteases as well as anti-sense oligonucleotides, ribozymes and immunotherapy.
  • Such inhibitors have been shown to block ras activation in cells containing wild type mutant ras, thereby acting as anti proliferation agents.
  • Ras oncogene inhibition is discussed in Scharovsky, O. G., Rozados, V.R., Gervasoni, S.I. Matar, P. (2000), Journal of Biomedical Science. 7(4) 292-8; Ashby, M.N. (1998), Current Opinion in Lipidology. 9 (2) 99 - 102; and BioChim. Biophys. Acta, (19899) 1423(3):19-30.
  • antibody antagonists to receptor kinase ligand binding may also serve as signal transduction inhibitors.
  • This group of signal transduction pathway inhibitors includes the use of humanized antibodies to the extracellular ligand binding domain of receptor tyrosine kinases.
  • lmclone C225 EGFR specific antibody see Green, M. C. et al, Monoclonal Antibody Therapy for Solid Tumors, Cancer Treat.
  • Non-receptor kinase angiogenesis inhibitors may also be useful in the present invention.
  • Inhibitors of angiogenesis related VEGFR and TIE2 are discussed above in regard to signal transduction inhibitors (both receptors are receptor tyrosine kinases).
  • Angiogenesis in general is linked to erbB2/EGFR signaling since inhibitors of erbB2 and EGFR have been shown to inhibit angiogenesis, primarily VEGF expression. Accordingly, non-receptor tyrosine kinase inhibitors may be used in combination with the compounds of the present invention.
  • anti-VEGF antibodies which do not recognize VEGFR (the receptor tyrosine kinase), but bind to the ligand; small molecule inhibitors of integrin (alpha v betas) that will inhibit angiogenesis; endostatin and angiostatin (non-RTK) may also prove useful in combination with the disclosed compounds.
  • VEGFR the receptor tyrosine kinase
  • small molecule inhibitors of integrin alpha v betas
  • endostatin and angiostatin non-RTK
  • Agents used in immunotherapeutic regimens may also be useful in combination with the compounds of formula (I).
  • immunologic strategies to generate an immune response. These strategies are generally in the realm of tumor vaccinations.
  • the efficacy of immunologic approaches may be greatly enhanced through combined inhibition of signaling pathways using a small molecule inhibitor. Discussion of the immunologic/tumor vaccine approach against erbB2/EGFR are found in Reilly RT et al. (2000), Cancer Res. 60: 3569-3576; and Chen Y, Hu D, Eling DJ, Robbins J, and Kipps TJ. (1998), Cancer Res. 58: 1965-1971.
  • Agents used in proapoptotic regimens may also be used in the combination of the present invention.
  • Members of the Bcl-2 family of proteins block apoptosis. Upregulation of bcl-2 has therefore been linked to chemoresistance.
  • EGF epidermal growth factor
  • mcl- 1 the epidermal growth factor
  • strategies designed to downregulate the expression of bcl-2 in tumors have demonstrated clinical benefit and are now in Phase ll/lll trials, namely Genta's G3139 bcl-2 antisense oligonucleotide.
  • Cell cycle signalling inhibitors inhibit molecules involved in the control of the cell cycle.
  • a family of protein kinases called cyclin dependent kinases (CDKs) and their interaction with a family of proteins termed cyclins controls progression through the eukaryotic cell cycle. The coordinate activation and inactivation of different cyclin/CDK complexes is necessary for normal progression through the cell cycle.
  • CDKs cyclin dependent kinases
  • Several inhibitors of cell cycle signalling are under development. For instance, examples of cyclin dependent kinases, including CDK2, CDK4, and CDK6 and inhibitors for the same are described in, for instance, Rosania et al, Exp. Opin. Ther. Patents (2000) 10(2):215-230.
  • the cancer treatment method of the claimed invention includes the co-administration a compound of formula I and/or a pharmaceutically acceptable salt, hydrate, solvate or pro-drug thereof and at least one anti-neoplastic agent, such as one selected from the group consisting of anti-miGrotubule agents, platinum coordination complexes, alkylating agents, antibiotic agents, topoisomerase Il inhibitors, antimetabolites, topoisomerase I inhibitors, hormones and hormonal analogues, signal transduction pathway inhibitors, non-receptor tyrosine kinase angiogenesis inhibitors, immunotherapeutic agents, proapoptotic agents, and cell cycle signaling inhibitors.
  • the pharmaceutically active compounds of the present invention are active as AKT inhibitors they exhibit therapeutic utility in treating cancer and arthritis.
  • the present invention relates to a method for treating or lessening the severity of a cancer selected from brain (gliomas), glioblastomas, Bannayan- Zonana syndrome, Cowden disease, Lhermitte-Duclos disease, breast, colon, head and neck, kidney, lung, liver, melanoma, ovarian, pancreatic, prostate, sarcoma and thyroid.
  • a cancer selected from brain (gliomas), glioblastomas, Bannayan- Zonana syndrome, Cowden disease, Lhermitte-Duclos disease, breast, colon, head and neck, kidney, lung, liver, melanoma, ovarian, pancreatic, prostate, sarcoma and thyroid.
  • the present invention relates to a method for treating or lessening the severity of a cancer selected from ovarian, breast, pancreatic and prostate.
  • Insect cells expressing His-tagged AKT1 were lysed in 25 mM HEPES, 100 mM NaCI, 20 mM imidazole; pH 7.5 using a polytron (5 mLs lysis buffer/g cells). Cell debris was removed by centrifuging at 28,000 x g for 30 minutes. The supernatant was filtered through a 4.5-micron filter then loaded onto a nickel-chelating column pre-equilibrated with lysis buffer.
  • the column was washed with 5 column volumes (CV) of lysis buffer then with 5 CV of 20% buffer B, where buffer B is 25 mM HEPES, 100 mM NaCl, 300 mM imidazole; pH 7.5.
  • His- tagged AKT1 (aa 136-480) was eluted with a 20-100% linear gradient of buffer B over 10 CV. His-tagged AKT1 (136-480) eluting fractions were pooled and diluted 3-fold with buffer C, where buffer C is 25 mM HEPES, pH 7.5.
  • the sample was then chromatographed over a Q-Sepharose HP column pre-equilibrated with buffer C.
  • the column was washed with 5 CV of buffer C then step eluted with 5 CV 10%D, 5 CV 20% D, 5 CV 30% D, 5 CV 50% D and 5 CV of 100% D; where buffer D is 25 mM HEPES, 1000 mM NaCI; pH 7.5.
  • His-tagged AKT1 (aa 136-480) containing fractions were pooled and concentrated in a 10-kDa molecular weight cutoff concentrator. His-tagged AKT 1 (aa 136-480) was chromatographed over a Superdex 75 gel filtration column pre-equilibrated with 25 mM HEPES, 200 mM NaCI, 1 mM DTT; pH 7.5. His-tagged AKT1 (aa 136-480) fractions were examined using SDS-PAGE and mass spec. The protein was pooled, concentrated and frozen at -80C.
  • His-tagged AKT2 (aa 138-481 ) and His-tagged AKT3 (aa 135-479) were isolated and purified in a similar fashion.
  • AKT 1 , 2, and 3 protein serine kinase inhibitory activity were tested for AKT 1 , 2, and 3 protein serine kinase inhibitory activity in substrate phosphorylation assays.
  • This assay examines the ability of small molecule organic compounds to inhibit the serine phosphorylation of a peptide substrate.
  • the substrate phosphorylation assays use the catalytic domains of AKT 1 , 2, or 3.
  • AKT 1, 2 and 3 are also commercially available from Upstate USA, Inc.
  • the method measures the ability of the isolated enzyme to catalyze the transfer of the gamma-phosphate from ATP onto the serine residue of a biotinylated synthetic peptide SEQ. ID NO: 1 (Biotin-ahx- ARKRERAYSFGHHA-amide).
  • Substrate phosphorylation was detected by the following procedure:
  • Assays were performed in 384well U-bottom white plates. 10 nM activated AKT enzyme was incubated for 40 minutes at room temperature in an assay volume of 2OuI containing 5OmM MOPS, pH 7.5, 2OmM MgCl2, 4uM ATP, 8uM peptide, 0.04 uCi [g- P] ATP/well, 1 mM CHAPS, 2 mM DTT, and 1 ul of test compound in 100% DMSO.
  • the reaction was stopped by the addition of 50 ul SPA bead mix (Dulbecco's PBS without Mg 2+ and Ca 2+ , 0.1% Triton X-100, 5mM EDTA, 5OuM ATP, 2.5mg/ml Streptavidin-coated SPA beads.)
  • 50 ul SPA bead mix Dulbecco's PBS without Mg 2+ and Ca 2+ , 0.1% Triton X-100, 5mM EDTA, 5OuM ATP, 2.5mg/ml Streptavidin-coated SPA beads.
  • the plate was sealed, the beads were allowed to settle overnight, and then the plate was counted in a Packard Topcount Microplate Scintillation Counter (Packard Instrument Co., Meriden, CT).
  • Full-length human AKT1 gene was amplified by PCR from a plasmid containing myristylated-AKT1-ER (gift from Robert T. Abraham, Duke University under MTA, described in Klippel et al. in Molecular and Cellular Biology 1998 Volume 18 p.5699) using the 5' primer: SEQ.ID NO: 1 , 5' TATATAGGATCCATGAGCGACGTGGC 3' and the 3' primer: SEQ.ID NO: 2, AAATTTCTCGAGTCAGGCCGTGCTGCTGG 3'.
  • the 5' primer included a BamHI site and the 3'primer included an Xhol site for cloning purposes.
  • the resultant PCR product was subcloned in pcDNA3 as a BamHI / Xhol fragment.
  • a mutation in the sequence (TGC) coding for a Cysteine 25 was converted to the wild-type AKT1 sequence (CGC) coding for an Arginine 25 by site-directed mutagenesis using the QuikChange ® Site Directed Mutagenesis Kit (Stratagene).
  • the AKT1 mutagenic primer: SEQ.ID NO: 3, 5' ACCTGGCGGCCACGCTACTTCCTCC and selection primer: SEQ.ID NO: 4, 5' CTCGAGCATGCAACTAGAGGGCC (designed to destroy an Xbal site in the multiple cloning site of pcDNA3) were used according to manufacturer's suggestions.
  • AKT1 was isolated as a BamHI / Xhol fragment and cloned into the BamHI / Xhol sites of pFastbacHTb (Invitrogen). Expression of FL human AKT1 :
  • BAC-to-BAC Baculovirus Expression was done using the BAC-to-BAC Baculovirus Expression System from Invitrogen (catalog # 10359-016). Briefly 1 ) the cDNA was transferred from the FastBac vector into bacmid DNA, 2) the bacmid DNA was isolated and used to transfect Sf9 insect cells, 3) the virus was produced in Sf9 cells, 4) T. ni cells were infected with this virus and sent for purification.
  • 13O g sf9 cells (batch # 41646W02) were resuspended in lysis buffer (buffer A, 1 L, pH 7.5) containing 25 mM HEPES, 100 mM NaCI, and 20 mM imidazole.
  • the cell lysis was carried out by Avestin (2 passes at 15K-20K psi). Cell debris was removed by centrifuging at 16K rpm for 1 hour and the supernatant was batch bound to 10 mi Nickel Sepharose HP beads at 4 C for over night.
  • the beads were then transferred to column and the bound material was eluted with buffer B (25 mM HEPES, 100 mM NaCI, 300 mM imidazole, pH 7.5).
  • buffer B 25 mM HEPES, 100 mM NaCI, 300 mM imidazole, pH 7.5.
  • AKT eluting fractions were pooled and diluted 3 fold using buffer C (25 mM HEPES, 5 mM DTT; pH 7.5).
  • the sample was filtered and chromatographed over a 10 mL Q-HP column pre-equilibrated with buffer C at 2 mL/min.
  • the Q-HP column was washed with 3 column volume (CV) of buffer C, then step eluted with 5 CV 10%D, 5 CV 20% D, 5 CV 30% D, 5 CV 50% D and 5 CV of 100% D; where buffer D is 25 mM HEPES, 1000 mM NaCI, 5 mM DTT; pH 7.5. 5 mL fractions collected. AKT containing fractions were pooled and concentrated to 5 ml. The protein was next loaded to a 120 ml Superdex 75 sizing column that was pre-equilibrated with 25 mM HEPES, 200 mM NaCI, 5 mM DTT; pH 7.5. 2.5 mL fractions were collected.
  • CV column volume
  • AKT 1 eluting fractions were pooled, aliquoted (1 ml) and stored at -80C. Mass spec and SDS-PAGE analysis were used to confirm purity and identity of the purified full-length AKT1. Full length AKT2 and full length AKT3 were cloned, expressed and purified in a similar fashion.
  • AKT Enzyme Assay Compounds of the present invention are tested for AKT 1 , 2, and 3 protein serine kinase inhibitory activity in substrate phosphorylation assays.
  • This assay examines the ability of small molecule organic compounds to inhibit the serine phosphorylation of a peptide substrate.
  • the substrate phosphorylation assays use the catalytic domains of AKT 1 , 2, or 3.
  • AKT 1 , 2 and 3 are also commercially available from Upstate USA, Inc.
  • the method measures the ability of the isolated enzyme to catalyze the transfer of the gamma-phosphate from ATP onto the serine residue of a biotinylated synthetic peptide SEQ. ID NO: 5 (Biotin-ahx- ARKRERAYSFGHHA-amide).
  • Substrate phosphorylation is detected by the following procedure: Assays are performed in 384well U-bottom white plates. 10 nM activated
  • AKT enzyme is incubated for 40 minutes at room temperature in an assay volume of 2OuI containing 5OmM MOPS, pH 7.5, 2OmM MgCl2, 4uM ATP, 8uM peptide, 0.04 uCi [g- P] ATP/well, 1 mM CHAPS, 2 mM DTT, and 1ul of test compound in 100% DMSO.
  • the reaction is stopped by the addition of 50 ul SPA bead mix (Dulbecco's PBS without Mg 2+ and Ca 2+ , 0.1 % Triton X-100, 5mM EDTA, 5OuM
  • the data for dose responses are plotted as % Control calculated with the data reduction formula 100 * (U1-C2)/(C1-C2) versus concentration of compound where U is the unknown value, C1 is the average control value obtained for DMSO, and C2 is the average control value obtained for 0.1 M EDTA.
  • Compounds of the invention are tested for activity against AKT1 , AKT2, and AKT3 in the above assay.
  • the compounds of Examples 5, 7, 43, 49, 53, 58, 76, 78, 104, 144, 174, 184 and 185 were tested in the above AKT enzyme assay and each exhibited an 1C50 value less than or equal to 0.5uM against AKT1 , AKT2 and AKT3.
  • the pharmaceutically active compounds within the scope of this invention are useful as AKT inhibitors in mammals, particularly humans, in need thereof.
  • the present invention therefore provides a method of treating cancer, arthritis and other conditions requiring AKT inhibition, which comprises administering an effective compound of Formula (I) or a pharmaceutically acceptable salt, hydrate, solvate or pro-drug thereof.
  • the compounds of Formula (I) also provide for a method of treating the above indicated disease states because of their demonstrated ability to act as Akt inhibitors.
  • the drug may be administered to a patient in need thereof by any conventional route of administration, including, but not limited to, intravenous, intramuscular, oral, subcutaneous, intradermal, and parenteral.
  • Solid or liquid pharmaceutical carriers are employed.
  • Solid carriers include, starch, lactose, calcium sulfate dihydrate, terra alba, sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate, and stearic acid.
  • Liquid carriers include syrup, peanut oil, olive oil, saline, and water.
  • the carrier or diluent may include any prolonged release material, such as glyceryl monostearate or glyceryl distearate, alone or with a wax.
  • the amount of solid carrier varies widely but, preferably, will be from about 25 mg to about 1 g per dosage unit.
  • the preparation will be in the form of a syrup, elixir, emulsion, soft gelatin capsule, sterile injectable liquid such as an ampoule, or an aqueous or nonaqueous liquid suspension.
  • the pharmaceutical preparations are made following conventional techniques of a pharmaceutical chemist involving mixing, granulating, and compressing, when necessary, for tablet forms, or mixing, filling and dissolving the ingredients, as appropriate, to give the desired oral or parenteral products.
  • Doses of the presently invented pharmaceutically active compounds in a pharmaceutical dosage unit as described above will be an efficacious, nontoxic quantity preferably selected from the range of 0.001 - 100 mg/kg of active compound, preferably 0.001 - 50 mg/kg.
  • the selected dose is administered preferably from 1-6 times daily, orally or parenteraily.
  • Preferred forms of parenteral administration include topically, rectally, transdermally, by injection and continuously by infusion.
  • Oral dosage units for human administration preferably contain from 0.05 to 3500 mg of active compound. Oral administration, which uses lower dosages is preferred. Parenteral administration, at high dosages, however, also can be used when safe and convenient for the patient.
  • Optimal dosages to be administered may be readily determined by those skilled in the art, and will vary with the particular Akt inhibitor in use, the strength of the preparation, the mode of administration, and the advancement of the disease condition. Additional factors depending on the particular patient being treated will result in a need to adjust dosages, including patient age, weight, diet, and time of administration.
  • the method of this invention of inducing Akt inhibitory activity in mammals, including humans, comprises administering to a subject in need of such activity an effective Akt inhibiting amount of a pharmaceutically active compound of the present invention.
  • the invention also provides for the use of a compound of Formula (I) in the manufacture of a medicament for use as an Akt inhibitor.
  • the invention also provides for the use of a compound of Formula (I) in the manufacture of a medicament for use in therapy.
  • the invention also provides for the use of a compound of Formula (I) in the manufacture of a medicament for use in treating cancer.
  • the invention also provides for the use of a compound of Formula (I) in the manufacture of a medicament for use in treating arthritis.
  • the invention also provides for a pharmaceutical composition for use as an Akt inhibitor which comprises a compound of Formula (I) and a pharmaceutically acceptable carrier.
  • the invention also provides for a pharmaceutical composition for use in the treatment of cancer which comprises a compound of Formula (I) and a pharmaceutically acceptable carrier.
  • the invention also provides for a pharmaceutical composition for use in treating arthritis which comprises a compound of Formula (I) and a pharmaceutically acceptable carrier.
  • the pharmaceutically active compounds of the present invention can be co-administered with further active ingredients, such as other compounds known to treat cancer or arthritis, or compounds known to have utility when used in combination with an Akt inhibitor.
  • N-[3-(Dimethylamino)propyl]- ⁇ /'-ethylcarbodiimide hydrochloride (3.1 g, 16.0 mmol) was added to a solution of 5-bromo-2-thiophenecarboxylic acid (3.0 g, 14.5 mmol) and ⁇ [3-(methyloxy)phenyl]methyl ⁇ amine (2.0 g, 14.8 mmol) in DMF (150 ml_). And then, the mixture was stirred at rt for 1 h. The reaction mixture was diluted with aqueous NH 4 CI and extracted with AcOEt. The solvent was removed in vacuo to give 5-bromo- ⁇ /- ⁇ [3-(methyloxy)phenyl]methyl ⁇ -2-thiophenecarboxamide as a white solid.
  • Benzoylacetonitrile (2g, 13.8 mmol) in THF (35 mL) was added dropwise via addition funnel to a 0 0 C solution of LAH (1.6 g, 41.3 mmol) in THF (35 mL).
  • the resulting solution warmed to 25 °C and then was heated to 60 0 C for an additional 2h. After cooling to 0 0 C, a saturated solution of sodium potassium tartrate was added dropwise and the solution was extracted several times with DCM.
  • 2-(2-phenylethyl)oxirane (8.0 g, 54 mmol) was placed in a sealed tube with 7N NH 3 -MeOH (130 ml_) and stirred 2 hours at 70 °C followed by concentration to a clear oil ( and was used without further purification in the following step.
  • reaction mixture was heated to 70° C in a sealed tube for 4h.
  • the reaction solution was poured onto H 2 O (100 mL) and extracted with DCM.
  • reaction mixture was heated to 80° C in a sealed tube for 12h.
  • the reaction solution was poured onto H 2 O (100 mL) and extracted with DCM.
  • the racemic compound underwent chiral separation using a ChiralPak AD- H column affording the faster eluting enantiomer GSK1155752A (labled E1 , 86 mg, 99% ee) followed by the slower eluting enantiomer GSK1155753A (labeled E2, 89 mg, 98.5 %ee) with identical LCMS and 1 H NMR data to the parent racemic compound GSK1070771 A.
  • Boc protecting group was removed in 0.5h using TFA- DCM (1 :2, 0.1M) at 25 0 C.
  • the resulting solution was concentrated using a toluene azeotrope and the residue neutralized through a silica plug (2-10% MeOH in DCM (1% NH 4 OH)) affording the neutral compound.
  • the title compound was prepared as a yellow solid according to Example 7, except substituting 1 -(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2- yl)-1 H-pyrrolo[2,3-b]pyridine (289 mg, 0.751 mmol) for 1-(phenylsulfonyI)-4-(4,4,5,5- tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3-b]pyridine and 4,5-dibromo-2- thiophenecarboxylic acid (2.2 g, 7.69 mmol) for 5-bromo-2-thiophenecarboxylic acid.
  • Boc protecting group was removed in 0.5h using TFA- DCM (1 :2, 0.1M) at 25 0 C.
  • the resulting solution was concentrated using a toluene azeotrope and the residue neutralized through a silica plug (2-10% MeOH in DCM (1% NH 4 OH)) affording the neutral compound.
  • the title compound was prepared as a yellow solid according to Example 15, except substituting 1, 1-dimethylethyl (4-amino-4-phenylbutyl)carbamate (38 mg, 0.15 mmol) [preparared from 1 ,1-dimethylethyl (4-hydroxy-4-phenylbutyl)carbamate (Marshall, D. R. J. Chem. Soc, Perkin Trans. 2 1977, 1898.
  • the title compound was prepared as a brown solid according to Example 15, except substituting 1,1-dimethylethyl (4-amino-4-phenylbutyl)carbamate (38 mg, 0.15 mmol) [preparared from 1 ,1-dimethylethyl (4-hydroxy-4-phenylbutyl)carbamate (Marshall, D. R. J. Chem. Soc, Perkin Trans. 2 1977, 1898.
  • reaction mixture was heated to 70° C in a sealed tube for 4h.
  • Ethyl 1H-pyrrolo[2,3-6]pyridine-2-carboxylate 7-oxide (1.0 g, 5.0 mmol), which was prepared according to WO2000044753, and tetramethylammonium bromide (1.2 g, 7.5 mmol) were added to DMF (50 iml_).
  • the mixture was cooled to 0 0 C and methanesulfonic anhydride (1.7 g, 10 mmol) was added portion wise.
  • the resulting suspension was warmed up to rt and stirred for 6 h.
  • the mixture was poured in water (100 ml_) and the solution was neutralized with 50 % aqueous NaOH.
  • reaction mixture was heated to 80° C in a sealed tube for 12h.
  • the reaction solution was poured onto H 2 O (100 ml_) and extracted with DCM.
  • 2-thiophenecarboxylic acid (0.51 g, 1.1 mmole) in DCM (50 mL) was added PyBrop (0.64g, 1.38 mmole), Hunig's base (0.8 mL, 4.6 mmole) and 2-[(2S)-2-amino-3- phenylpropyl]-1H-isoindole-1 ,3(2/-/)-dione (0.36 g, 0.92 mmole).
  • the amine hydrochloride salt from above (1 mmole) was dissolved in DCM (50 mL) and to the solution was added PyBrop (0.70 g, 1.5 mmole), (iPr) 2 NEt (0.87 mL, 5.0 mmole) and 3-( ⁇ [(1 ,1-dimethylethyl)oxy]carbonyl ⁇ amino)-2- (phenylmethyl)propanoic acid (0.41 g, 1.5 mmole). After stirring at RT for 12h, the reaction solution was concentrated under vacuum and purified on silica
  • Boc-amine (crude from above) was dissolved in TFA/MeOH (1 :2, 3 mL) and stirred at RT for 30 min. The solution was then concentrated using a toluene azeotrope and neutralized through a silica plug (3% MeOH in DCM (1 % NH 4 OH)) affording the title compound as a free base (50 mg, 48%-2 steps).

Landscapes

  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Rheumatology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Invented are novel thiophene compounds, the use of such compounds as inhibitors of protein kinase B activity and in the treatment of cancer and arthritis.

Description

INHIBITORS OF Akt ACTIVITY
FIELD OF THE INVENTION
This invention relates to novel thiophene compounds, the use of such compounds as inhibitors of protein kinase B (hereinafter PKB/Akt, PKB or Akt) activity and in the treatment of cancer and arthritis.
BACKGROUND OF THE INVENTION The present invention relates to thiophene containing compounds that are inhibitors of the activity of one or more of the isoforms of the serine/threonine kinase, Akt (also known as protein kinase B). The present invention also relates to pharmaceutical compositions comprising such compounds and methods of using the instant compounds in the treatment of cancer and arthritis (Liu et al. Current Qpin. Pharmacology 3:317-22 (2003)). Apoptosis (programmed cell death) plays essential roles in embryonic development and pathogenesis of various diseases, such as degenerative neuronal diseases, cardiovascular diseases and cancer. Recent work has led to the identification of various pro- and anti-apoptotic gene products that are involved in the regulation or execution of programmed cell death. Expression of anti-apoptotic genes, such as Bcl2 or Bcl-xL, inhibits apoptotic cell death induced by various stimuli. On the other hand, expression of pro-apoptotic genes, such as Bax or Bad, leads to programmed cell death (Adams et al. Science, 281 :1322-1326 (1998)). The execution of programmed cell death is mediated by caspase -1 related proteinases, including caspase-3, caspase- 7, caspase-8 and casρase-9 etc (Thornberry et al. Science, 281 :1312-1316 (1998)).
The phosphatidylinositol 3'-OH kinase (PI3K)/Akt/PKB pathway appears important for regulating cell survival/cell death (Kulik et al. MoI. Cell. Biol. 17:1595- 1606 (1997); Franke et al, Cell, 88:435-437 (1997); Kauffmann-Zeh et al. Nature 385:544-548 (1997) Hemmings Science, 275:628-630 (1997); Dudek et al., Science, 275:661-665 (1997)). Survival factors, such as platelet derived growth factor (PDGF), nerve growth factor (NGF) and insulin-like growth factor-1 (IGF-I), promote cell survival under various conditions by inducing the activity of PI3K (Kulik et al. 1997, Hemmings 1997). Activated PI3K leads to the production of phosphatidylinositol (3,4,5)-triphosphate (Ptdlns (3,4,5)-P3), which in turn binds to, and promotes the activation of, the serine/ threonine kinase Akt, which contains a pleckstrin homology (PH)-domain (Franke et al Ce//, 81 :727-736 (1995); Hemmings Science, 277:534 (1997); Downward, Curr. Opin. Cell Biol. 10:262-267 (1998), Alessi et al., EMBO J. 15: 6541-6551 (1996)). Specific inhibitors of PI3K or dominant negative Akt/PKB mutants abolish survival-promoting activities of these growth factors or cytokines. It has been previously disclosed that inhibitors of PI3K (LY294002 or wortmannin) blocked the activation of Akt/PKB by upstream kinases. In addition, introduction of constitutively active PI3K or Akt/PKB mutants promotes cell survival under conditions in which cells normally undergo apoptotic cell death (Kulik et al. 1997, Dudek et al. 1997).
Analysis of Akt levels in human tumors showed that Akt2 is overexpressed in a significant number of ovarian (J. Q. Cheung et al. Proc. Natl. Acad. Sci. U.S.A. 89:9267-9271 (1992)) and pancreatic cancers (J. Q. Cheung et al. Proc. Natl. Acad. Sci. U.S.A. 93:3636-3641 (1996)). Similarly, Akt3 was found to be overexpressed in breast and prostate cancer cell lines (Nakatani et al. J. Biol.Chem. 274:21528- 21532 (1999). It was demonstrated that Akt-2 was over-expressed in 12% of ovarian carcinomas and that amplification of Akt was especially frequent in 50% of undifferentiated tumors, suggestion that Akt may also be associated with tumor aggressiveness (Bellacosa, et al., Int. J. Cancer, 64, pp. 280-285, 1995). Increased Akt1 kinase activity has been reported in breast, ovarian and prostate cancers (Sun et al. Am. J. Pathol. 159: 431-7 (2001 )).
The tumor suppressor PTEN, a protein and lipid phosphatase that specifically removes the 3' phosphate of Ptdlns(3,4,5)-P3, is a negative regulator of the PI3K/Akt pathway (Li et al. Science 275:1943-1947 (1997), Stambolic et al. Cell 95:29-39 (1998), Sun et al. Proc. Nati. Acad. Sci. U.S.A. 96:6199-6204 (1999)). Germline mutations of PTEN are responsible for human cancer syndromes such as Cowden disease (Liaw et al. Nature Genetics 16:64-67 (1997)). PTEN is deleted in a large percentage of human tumors and tumor cell lines without functional PTEN show elevated levels of activated Akt (Li et al. supra, Guldberg et al. Cancer Research 57:3660-3663 (1997), Risinger et al. Cancer Research 57:4736-4738 (1997)).
These observations demonstrate that the PI3K/Akt pathway plays important roles for regulating cell survival or apoptosis in tumorigenesis.
Three members of the Akt/PKB subfamily of second-messenger regulated serine/threonine protein kinases have been identified and termed Akt1/ PKBα, Akt2/PKBβ, and Akt3/PKBγ respectively. The isoforms are homologous, particularly in regions encoding the catalytic domains. Akt/PKBs are activated by phosphorylation events occurring in response to PI3K signaling. PI3K phosphorylates membrane inositol phospholipids, generating the second messengers phosphatidyl- inositol 3,4,5-trisphosphate and phosphatidylinositol 3,4- bisphosphate, which have been shown to bind to the PH domain of Akt/PKB. The current model of Akt/PKB activation proposes recruitment of the enzyme to the membrane by 3'-phosphorylated phosphoinositides, where phosphorylation of the regulatory sites of Akt/PKB by the upstream kinases occurs (B.A. Hemmings, Science 275:628-630 (1997); B.A. Hemmings, Science 276:534 (1997); J. Downward, Science 279:673-674 (1998)).
Phosphorylation of Akt1/PKBα occurs on two regulatory sites, Thr3Oδ in the catalytic domain activation loop and on Ser473 near the carboxy terminus (D. R. Alessi et al. EMBO J. 15:6541-6551 (1996) and R. Meier et al. J. Biol. Chem. 272:30491-30497 (1997)). Equivalent regulatory phosphorylation sites occur in Akt2/PKBβ and Akt3/PKBγ. The upstream kinase, which phosphorylates Akt/PKB at the activation loop site has been cloned and termed 3 '-phosphoinositide dependent protein kinase 1 (PDK1). PDK1 phosphorylates not only Akt/PKB, but also p70 ribosomal S6 kinase, p90RSK, serum and glucocorticoid-regulated kinase (SGK), and protein kinase C. The upstream kinase phosphorylating the regulatory site of Akt/PKB near the carboxy terminus has not been identified yet, but recent reports imply a role for the integrin-linked kinase (ILK-1 ), a serine/threonine protein kinase, or autophosphorylation.
Inhibition of Akt activation and activity can be achieved by inhibiting PI3K with inhibitors such as LY294002 and wortmannin. However, PI3K inhibition has the potential to indiscriminately affect not just all three Akt isozymes but also other PH domain-containing signaling molecules that are dependent on Pdtlns(3,4,5)- P3, such as the Tec family of tyrosine kinases. Furthermore, it has been disclosed that Akt can be activated by growth signals that are independent of PI3K. Alternatively, Akt activity can be inhibited by blocking the activity of the upstream kinase PDK1. The compound UCN-01 is a reported inhibitor of PDK1. Biochem. J. 375(2):255 (2003). Again, inhibition of PDK1 would result in inhibition of multiple protein kinases whose activities depend on PDK1 , such as atypical PKC isoforms, SGK, and S6 kinases (Williams et al. Curr. Biol. 10:439-448 (2000). Small molecule inhibitors of Akt are useful in the treatment of tumors, especially those with activated Akt (e.g. PTEN null tumors and tumors with ras mutations). PTEN is a critical negative regulator of Akt and its function is lost in many cancers, including breast and prostate carcinomas, glioblastomas, and several cancer syndromes including Bannayan-Zonana syndrome (Maehama, T. et al. Annual Review of Biochemistry, 70: 247 (2001)), Cowden disease (Parsons, R.; Simpson, L. Methods in Molecular Biology (Totowa, NJ, United States), 222 (Tumor Suppressor Genes, Volume 1): 147 (2003)), and Lhermitte-Duclos disease (Backman, S. et al. Current Opinion in Neurobiology, 12(5): 516 (2002)). Akt3 is up-regulated in estrogen receptor-deficient breast cancers and androgen- independent prostate cancer cell lines and Akt2 is over-expressed in pancreatic and ovarian carcinomas. Akt1 is amplified in gastric cancers (Staal, Proc. Natl. Acad. Sci. USA 84: 5034-7 (1987) and upregulated in breast cancers (Stal et al. Breast Cancer Res. 5: R37-R44 (2003)). Therefore a small molecule Akt inhibitor is expected to be useful for the treatment of these types of cancer as well as other types of cancer. Akt inhibitors are also useful in combination with further chemotherapeutic agents. It is an object of the instant invention to provide novel compounds that are inhibitors of Akt/PKB.
It is also an object of the present invention to provide pharmaceutical compositions that comprise a pharmaceutical carrier and compounds useful in the methods of the invention. It is also an object of the present invention to provide a method for treating cancer that comprises administering such inhibitors of Akt/PKB activity.
It is also an object of the present invention to provide a method for treating arthritis that comprises administering such inhibitors of Akt/PKB activity.
SUMMARY OF THE INVENTION
This invention relates to novel compounds of Formula (I):
(I) wherein:
V is selected from the group consisting of: CH and N;
Z is selected from the group consisting of: CR and N, where R is selected
20 20 from: hydrogen, -CO2R and Ci-3alkyl, where R is selected from: hydrogen and Ci_3alkyl; W, X and Y are selected from the group consisting of CR , CR and N,
5 8 where R is selected from: hydrogen, C-]-3alkyl, aryl, heteroaryl, -CO2R , -CN and
R 10
-COR , and R is a substituent of Formula (X):
where:
1 28
R and R are independently selected from: hydrogen, halogen, aryl, substituted aryl, heteroaryl, substituted heteroaryl, C-|-3alkyl, -
. I O14_15 , ^-.,30
NR R , cyano, and -OR ,
L1 is selected from: -NR6CO-, -CONR6-, -NR6Sθ2-, -SO2NR6-, -NR6CH2-, -CH2NR6-, -CH=CH-, -CF=CH- and -CH=CF-,
2 R is selected from: hydrogen, -(CH2)m-ary'> -(CH2)rrrC3-7cycloalkyl, Ci-
3alkyl, substituted -(CH2)m-aryl, substituted -(CH2)m-c3-7cycloa'kyl and substituted Ci-3alkyl, where m is 0 to 4,
25 25 3 4
R is hydrogen or R is taken together with R or R to form a 4 to 7 member carbocyclic ring optionally containing 1 additional heteroatom,
3 4 3
R and R are independently selected from: hydrogen and Ci_5alkyl, or R
4 and R taken together with the nitrogen to which they are attached form a 4 to 6 member carbocyclic ring, optionally containing 1 or 2
3 4 25 additional heteroatoms, or R or R is taken together with R to form a 4 to 7 member carbocyclic ring optionally containing 1 additional heteroatom, and
- 5 - Q is selected from: -(CH2)paryl(CH2)p-, substituted -(CH2)paryl(CH2)p- and ~(cH2)m where p is 0 to 4 and n is 0 to 4 and when n is not 0, the - (CH2)rr group is optionally substituted by oxo, where R is selected from the group consisting of: hydrogen and Ci_ 3alkyl,
30 R is selected from the group consisting of: hydrogen, - pβ py O~7
(CH2)qNR R and Ci_3alkyl, where q is 0 to 4 and R and R are
Oc py selected from hydrogen and C-μsalkyl, or R and R taken together with the nitrogen to which they are attached form a 4 to 6 member carbocyclic ring, optionally containing 1 or 2 additional heteroatoms, and
14 15
R and R are independently selected from: hydrogen and Ci- salkyl, and p where R is selected from: hydrogen and Ci-3alkyl;
10 provided that one and only one of W, X and Y is CR ; and provided that no more than 3 of V, W, X, Y and Z are N;
and/or pharmaceutically acceptable salts, hydrates, solvates and pro-drugs thereof.
This invention relates to a method of treating cancer, which comprises administering to a subject in need thereof an effective amount of an Akt/PKB inhibiting compound of Formula (I).
This invention relates to a method of treating arthritis, which comprises administering to a subject in need thereof an effective amount of an Akt/PKB inhibiting compound of Formula (I).
The present invention also relates to the discovery that the compounds of Formula (I) are active as inhibitors of Akt/PKB. In a further aspect of the invention there is provided novel processes and novel intermediates useful in preparing the presently invented AKt/PKB inhibiting compounds.
Included in the present invention are pharmaceutical compositions that comprise a pharmaceutical carrier and compounds useful in the methods of the invention.
Also included in the present invention are methods of co-administering the presently invented Akt/PKB inhibiting compounds with further active ingredients.
DETAILED DESCRIPTION OF THE INVENTION This invention relates to compounds of Formula (I) as described above. The presently invented compounds of Formula (I) inhibit Akt/PKB activity. In particular, the compounds disclosed herein inhibit each of the three Akt/PKB isoforms.
Included in the presently invented compounds of Formula (I) are compounds of Formula (Ia):
wherein:
7 7 20 20
Z is CR , where R is selected from: hydrogen and -CO2R , where R is selected from: hydrogen and Ci_3alkyl;
5 10 W, X and Y are selected from the group consisting of CR , CR and N,
5 8 where R is selected from: hydrogen, Ci-3alkyl, aryl, heteroaryl, -CO2R , -CN and
8 10
-COR , and R is a substituent of Formula (X): where:
1 R is selected from: hydrogen, halogen, aryl, substituted aryl, heteroaryl, substituted heteroaryl, C 1-3 alkyl, -NR R , cyano and -OR , L1 is selected from: -NR6CO-, -CONR6-, -NR6Sθ2-, -SO2NR6-, -NR6CH2-,
-CH2NR6-, -CH=CH-, -CF=CH- and -CH=CF-,
2 R is selected from: hydrogen, -(CH2)m-aryl, -(CH2)m-C3-7cycloalkyl, Ci-
3alkyl, substituted -(CH2)m-ai"yl, substituted -(CH2)m-C3-7cycloalkyl and substituted Ci-3alkyl, where m is O to 4,
25 25 3 4 R is hydrogen or R is taken together with R or R to form a 4 to 7 member carbocyclic ring,
3 4 3
R and R are independently selected from: hydrogen and C-|-5alkyl, or R
4 and R taken together with the nitrogen to which they are attached form a 4 to 6 member carbocyclic ring, optionally containing 1 or 2
3 4 25 additional heteroatoms, or R or R is taken together with R to form a 4 to 7 member carbocyclic ring, and Q is selected from: -(CH2)paryl(CH2)p-, substituted -(CH2)paryl(CH2)p- and
-(CH2)n-. where p is 0 to 4 and n is 0 to 4 and when n is not 0, the - (CH2)n- Qroup is optionally substituted by oxo, where R is selected from the group consisting of: hydrogen and C-|_
3alkyl,
30 R is selected from the group consisting of: hydrogen, -
Oft O7 QC QV
(CH2)qNR R and Ci_3alkyl, where q is 0 to 4 and R and R are selected from hydrogen and Ci_5alkyl, or R and R taken together with the nitrogen to which they are attached form a 4 to 6 member carbocyclic ring, optionally containing 1 or 2 additional heteroatoms, and
R and R are independently selected from: hydrogen and C-|_ 3alkyl, and o where R is selected from: hydrogen and C-|_3alkyl; provided that one and only one of W, X and Y is CR ; and provided that no more than 3 of W, X, Y and Z are N;
and/or pharmaceutically acceptable salts, hydrates, solvates and pro-drugs thereof.
Included among the presently invented compounds are compounds of Formula (Ia) in which:
7 7 20 20 Z is CR , where R is selected from: hydrogen and -CO2R , where R is selected from: hydrogen and Ci -3alkyl;
5 10
W, X and Y are selected from the group consisting of CR and CR , where
5 10
R is hydrogen, and R is a substituent of Formula (X):
where:
R is selected from: hydrogen, halogen, aryl, heteroaryl and cyano,
L is selected from: -NR CO- and -CONR -,
2
R is selected from: hydrogen, -(CH2)m-a|"y|> substituted -(CH2)m-aryl. where m is 0 to 4,
25 25 3 4 R is hydrogen or R is taken together with R or R to form a 4 to 7 member carbocyclic ring, 3 4 3
R and R are independently selected from: hydrogen and C-j.salkyl, or R
4 and R taken together with the nitrogen to which they are attached form a 4 to 6 member carbocyclic ring, optionally containing 1 or 2
3 4 25 additional heteroatoms, or R or R is taken together with R to form a 4 to 7 member carbocyclic ring, and
Q is selected from; -(CH2)paryl(CH2)p- and -(CH2)m where p is 0 to 4 and n is 0 to 4 and when n is not 0, the -(CH2)rr group is optionally substituted by oxo, where R is selected from the group consisting of: hydrogen and C-|. 3alkyl, and provided that one and only one of W, X and Y is CR ;
and/or pharmaceutically acceptable salts, hydrates, solvates and pro-drugs thereof.
Included among the novel compounds useful in the present invention are:
3-amino-2-phenyl-Λ/-[4-(1H-pyrrolo[2,3-b]pyridin-3-yl)-2- thienyl]propanamide;
3-amino-2-phenyl-A/-[5-(1H-pyrrolot2,3-fe]pyridin-3-yl)-2- thienyl]propanamide;
4-amino-2-phenyl-A/-[4-(1/-/-pyrrolo[2,3-6]pyridin-3-yl)-2-thienyl]butanamide;
4-amino-2-phenyl-Λ/-[5-(1/-/-pyrrolo[2,3-b]pyridin-3-yl)-2-thienyl]butanamide;
3-amino-2-phenyl-N-[5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]propanamide; 4-amino-2-phenyl-N-[5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2-thienyl]butanamide;
N-(2-amino-1-phenylethyl)-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-(2-amino-1-phenylethyl)-4-(1H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide; N-(2-amino-1-phenylethyl)-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide; ^bromo-N-p^methylamino^i-phenylethyO-S-CI H-pyrroloβ.S-bJpyridin^-yl)- 2-thioph en ecarboxa mid e;
N-(2-amino-1~phenylethyl)-4-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2- thiophenβGarboxamide; N-(2-amino-1-phenylethyl)-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2- thiophenecarboxamide;
N-(2-amino-1-phenylethyl)-5-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2- thiophenecarboxamide;
N-(2-amino-1-phenylethyl)-4-bromo-5-(1 H-pyrrolo[2,3-b]pyπdin-3-yl)-2- thiophenecarboxamide;
N-(3-amino-1-phenyipropyl)-5-(1H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-(3-amino-1-phenylpropyl)-4-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide; N-(3-amino-1-phenylpropyl)-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-(3-amino-1-phenylpropyl)-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-(4-amino-1 -phenylbutyl)-4-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-(4-amino-1-phenylbυtyl)-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
3-amino-2-phenyl-Λ/-[4-(1H-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]propanamide; 4-amino-2-phenyl-Λ/-[4-(1H-pyrrolo[2,3-ϋ]pyridin-4-yl)-2-thienyl]butanamide;
Λ/-[4-(1/-/-pyrrolo[2,3-b]pyridin-4-yl)-2-thienyl]phenylalaninamide;
2-amino-2-phenyl-Λ/-[4-(1f7-pyrrolo[2,3-b]pyridin-4-yl)-2-thienyl]acetamide;
Λ/-[5-(1H-pyrrolo[2,3-ib]pyridin-4-yl)-2-thienyl]phenylalaninamide;
3-amino-2-(phenylmethyl)-/V-[5-(1H-pyrrolo[2,3-fc)]pyridin-4-yl)-2- thienyl]propanamide;
3-arnino-Λ/-[4-bromo-5-(1/-/-pyrrolo[2,3-5]pyridin-4-yl)-2-thienyl]-2- phenylpropanamide;
3-amino-2-phenyl-Λ/-[5-(1H-pyrrolo[2,3-ό]pyridin-4-yl)-3- thienyl]propanamide; ethyl 4-[5-({[2-(dimethylamino)-1-phenylethyl]amino}carbonyl)-2-thienyl]-1 /-/- pyrrolo[2,3-ό]pyridine-2-carboxylate;
N-P-CDimethylaminoJ-i-phenylethyl^δ-CIH-pyrrolo^.S-blpyridin^-yl)^- thiophenecarboxamide; 4-Phenyl-Λ/-[5-(1 H-pyrrolo[2,3-5]pyridin-4-yl)-2-thienyl]-4- piperidinecarboxamide;
Λ/-{[5-(1 /-/-Pyrrolo[2,3-b]pyridin-4-yl)-2-thienyl]carboπyl}tyrosinamide; A/-[2-(4-Morpholinyl)-1-phenylethyl]-5-(1H-pyrrolo[2,3-ib]pyridin-4-yl)-2- thiophenecarboxamide; Λ/-[2-Phenyl-2-(1-pyrrolidinyl)ethyl]-5-(iH-pyrrolo[2,3-5]pyridin-4-yl)-2- thiophenecarboxamide;
Λ/-[(2-Aminophenyl)methyl]-5-(1H-pyrrolot2,3-ib]pyridin-4-yl)-2- thiophenecarboxamide;
Λ/-[(3-Aminophenyl)methyl]-5-(1 H-pyrrolo[2,3-6]pyridin-4-yl)-2- thiophenecarboxamide;
/V-(2-Aminoethyl)-5-(1H-pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide; Λ/-(2-amino-1-phenylethyl)-4-(3-pyridinyl)-5-(1/-/-pyrrolo[2!3-ib]pyridin-4-yl)-2- thiophenecarboxamide;
Λ/-(2-amino-1-phenylethyl)-4-(1H-pyrazol-4-yl)-5-(1H-pyrrolo[2,3-ib]pyridin-4- yl)-2-thiophenecarboxamide;
A/-(2-amino-1-phenylethyl)-4-θthGnyl-5-(1A7-pyrrolo[2,3-(b]pyridin-4-yl)-2- thiophenecarboxamide;
Λ/-(2-amino-1-phenylethyl)-4-cyclopropyl-5-(1 /-/-pyrrolo[2,3-ό]pyridin-4-yl)-2- thiophenecarboxamide; 3-amino-Λ/-[4-bromo-5-(1H-pyrrolot2,3-ό]pyridin-3-yl)-2-thienyl]-2- phenylpropanamide;
Λ/-t(1S)-2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1/-/-pyrrolo[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide;
Λ/-[(1 f?)-2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide;
Λ/-[(1 S)-2-amino-1 -(phenylmethyl)ethyl]-5-(1 H-pyrrolo[2,3-fe]pyridin-4-yl)-2- thiophenecarboxamide;
Λ/-[(1/:?)-2-amino-1-(phenylmethyl)ethyl]-5-(1/-/-pyrrolo[2,3-t»]pyridin-4-yl)-2- thiophenecarboxamide; Λ/-[2-amino-1-(phenylmethyl)ethyl]-5-(3-ρhenyl-1 H-pyrrolo[2,3-ό]pyridin-4- yl)-2-thiophenecarboxamide; Λ/-[2-amino-1-(phenylmethyl)ethyl]-4-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2- thiophenecarboxamide;
3-amino-N-[5-(3-furanyl)-4-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2-thienyl]-2- (phenylmethyl)propanamide; 3-amino-2-(phenylmethyl)-Λ/-[4-(1/V-pyrrolo[2,3-tι]pyridin-3-yl)-2- thienyl]propanamide;
Λ/-[2-amino-1-(phenylmethyl)ethyl]-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- furancarboxamide;
Λ/-[2-amino-1-(phenylmethyl)ethyl]-5-(1 /-/-pyrrolo[2,3-fa]pyridin-3-yl)-2- furancarboxamide;
3-amino-Λ/-[5-(3-furanyl)-4-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2-thienyl]-2- phenylpropaπamide;
N-[(1 R)-2-amino-1-(phenylmethyl)ethyl]-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- furancarboxamide; Λ/-[(1 S)-2-amino-1-(phenylmethyl)ethyl]-5-(1 /-/-pyrroIo[2,3-<b]pyridin-4-yl)-2- furancarboxamide;
Λ/-[(1R)-2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1H-pyrrolo[2,3-ib]pyridin- 4-yl)-2-furancarboxamide;
Λ/-[(1 S)-2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1W-pyrrolo[2,3-jb]pyridin- 4-yl)-2-furancarboxamide;
Λ/-[(1 S)-2-amino-1 -phenylethyl]-4-bromo-5-(1 H-pyrrolo[2,3-6]pyridin-4-yl)-2- thiophenecarboxamide;
N-[(1R)-2-amino-1-phenylethyl]-4-bromo-5-(1 /7-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide; Λ/-(2-amino-1 -phenylethyl)-5-(1 H-pyrrolo[2,3-ό]pyridin-4-yl)-3- furancarboxamide;
Λ/-(2-amino-1-phenylethyl)-5-(1H-pyrrolo[2,3-b]pyridin-3-yl)-3- furancarboxamide;
Λ/-[2-amino-1-(phenylmethyl)ethyl]-5-(1H-pyrro!o[2,3-b]pyridin-4-yl)-3- furancarboxamide;
Λ/-[2-amino-1-(phenylmethy))ethyl]-5-(1 /-/-pyrrolo[2,3-b]pyridin-3-yl)-3- furancarboxamide;
(2-amino-1-phenylethyl){[5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]methyl}amine; N-(2-amino-1-phenylethyl)-4-phenyl-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-(2-amino-1-phenylethyl)-4-methyl-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide; N-(2-amino-2-phenylethyl)-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-(2-amino-2-phenyIethyl)-5-(1 H-pyrro!o[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
(3-amino-2-phenylpropyl)[5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2-thienyl]amine; 3-amino-3-phenyl~N-[5-(1 H-pyrτo!o[2,3-b]pyridin-4-yl)-2- thienyl]propanamide;
4-amino-3-phenyl-N-[5-(1H-pyrrolo[2,3-b]pyridin-4-yl)-2-thieny]]butanamide;
N-(2-amino-1-phenylethyl)-4-bromo-5-(3-phenyl-1 H-pyrrolo[2,3-b]pyridin-4- yl)-2-thiophenecarboxamide; 4-amino-4-phenyl-N-[5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2-thienyl]butanamide;
4-bromo-N-[2-(methylamino)-1-(phenylmethyl)ethyl]-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)- 2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-3-(methyloxy)-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
3-[(2-aminoethyl)oxy]-N-[2-amino-1-(phenylrnethyl)ethyl]-4-bromo-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide;
N-p-amino-i-CphenylmethyOGthylM-chloro-δ-CI H-pyrrolo^S-blpyridin^-yl)- 2-thiophenecarboxamide;
N-(2-aminoethyl)-4-bromo-N-(phenylmethyl)-5-(1 H-pyrrolo[2,3-b]pyridin-4- yl)-2-thiophenecarboxamide;
N-(2-aminoethyl)-4-bromo-N-phenyl-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-3-fluoro-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
4-bromo-N-[2-[(1-methylethyl)amino]-1-(phenylmethyl)ethyl]-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide;
4-bromo-N-[2-(ethylamino)-1-(phenylmethyl)ethyl]-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
3-{[2-amino-1-(phenylmethyl)ethyl]oxy}-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylme1:hyl)ethyl]-4-bromo-N-ιnethyl-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-5-(6-amino-1 H-pyrrolo[2,3-b]pyridin-4-yl)- 2-thiophenecarboxamide; 3-[(2-aminoethyl)oxy]-N-[2-amino-1 -(phenylmethyl)ethyl]-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-5-(3-amino-1 H-pyrrolo[2,3-b]pyridin-4-yl)- 2-thiophenecarboxamide;
N^-CS-^p-amino-i^phenylmethyOethylJaminolcarbonyl^-thienyπ-I H- pyrrolo[2,3-b]pyridin-3-yl}-3-furancarboxamide;
3-amino-N-[4-(2-chloro-1 H-pyrrolo[2,3-b]pyridin-3-yl)-2-thienyl]-2- phenylpropanamide;
N-(2-amino-1-phenylethyl)-4-[2--(3-furanyl)-1 H-pyrrolo[2,3-b]pyridin-3-yl]-2- thiophenecarboxamide; 4-amino-N-[5-(3-furanyl)-4-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2-thienyl]-2- phenylbutanamide;
S-amino^-Cphenylmethyl^N-tδ-phenyl^-CI H-pyrroloP.S-ypyridin-S-yl)^- thieπyl]propanamide;
N-[2-amino-1-(phenylmethyl)ethyl]-5-(3-chloro-1 H-pyrrolo[2,3-blpyridin-4-yl)- 2-thiophenecarboxamide;
N-(2-amino-1-ρhenylethyl)-5-(1H-pyrrolo[2,3-b]pyridin-4-yl)-3- thiophenecarboxamide;
N-(2-amino-1-ρhenylethyl)-5-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-3- thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-3- thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-5-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-3- thiophenecarboxamide;
N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-bromo-5-(1H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-
2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-5-(3-furanyl)-4-(1 H-pyrrolo[2,3-b]pyridin-
3-yl)-2-thiophenecarboxamide; 3-amino-N-[5-(3-furanyl)-4-(2-methyl-1 H-pyrrolo[2,3-b]pyridin-3-yl)-2- thienyl]-2-(phenylmethyl)propanamide; 3-amino-2-(phenylmethyl)-Λ/-[4-(1/-/-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]propanamide;
N-[2-amino-1-(phenylmethyl)ethyl]-3,4-dibromo-5-(1 H-pyrrolo[2,3-b]pyridiπ- 4-yl)-2-thiophenecarboxamide; /V-[2-amino-1-(phenylmethyl)ethyl]-3-(4-methylphenyl)-4-(1 /-/-pyrrolo[2,3- ό]pyridin-4-yl)-2-thiophenecarboxamide;
Λ/-[2-amino-1-(phenylmethyl)ethyl]-3-(methyloxy)-4-(1f/-pyrrolo[2,3-jb]pyridin- 4-yl)-2-thiophenecarboxamide;
3-amino-A/-[4-bromo-5-(1H-pyrrolo[2,3-b]pyridin-4-yl)-2-thienyl]-2- (phenylmethyl)propanamide;
Λ/-[2-amino-1-(phenylmethyl)ethyl]-5-(1H-pyrazolo[3,4-c/]pyπmiciin-4-yl)-2- thiophenecarboxamide;
2-amino-1-(phenylmethyl)ethyl [4-bromo-5-(1 /-/-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]carbamate; 4-[5-({[2-amino-1-(phenylmethyl)ethyl]amino}carbonyl)-2-thienyl]-Λ/-(2- furanylmethyl)-1H-pyrrolo[2,3-i)]pyridine-3-carboxamide;
Λ/-[2-amino-1-(phenylmethyl)ethyl]-5-[2-(3-furanyl)-1 /-/-pyrrolo[2,3-i)]pyridin- 4-yl]-2-thiophenecarboxamide;
Λ/-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-/V-hydroxy-5-(1H-pyrrolo[2,3- t)]pyridin-4-yl)-2-thiophenecarboxamide
Λ/-[2-amino-1-(phenylmethyl)ethyl]-Λ/-hydroxy-4-(1 H-pyrrolo[2,3-jb]pyridin-4- yl)-2-thiophenecarboxamide;
Λ/-[2-amino-1-(phenylmethyl)ethyl]-Λ/-hydroxy-3-(1 /-/-pyrrolo[2,3-Jb]pyridin-3- yl)-2-thiophenecarboxamide; Λ/-t2-amino-1-(phenylmethyl)θthyl]-Λ/-[(phenylmethyl)oxy]-4-(1H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
Λ/-[2-amino-1-(phenylmethyl)ethyl]-Λ/'-hydroxy-5-(1/-/-pyrrolo[2,3-fe]pyridin-4- yl)-2-thiophenecarboximidamide;
/^/-[2-amino-1-(phenylmethyl)ethyl]-Λ^-hydroxy-5-(1H-pyrrolo[2,3-&]pyridin-4- yl)-2-thiophenecarboximidamide;
3-aιnino-2-(phenylmethyi)-Λ/-[5-(3-pyridinyl)-4-(1/-/-pyrrolo[2,3-ib]pyridin-3-yl)- 2-thienyl]propanamide;
3-amino-Λ/-[5-(1 ,3-oxazol-2-yl)-4-(1H-pyrrolot2,3-ύ]pyridin-3-yl)-2-thienyl]-2- (phenylmethyl)propanamide; N-{2-amino-1-[2-(methyloxy)phenyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-{2-amino-1-[3-(methyloxy)phenyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyndin-4-yl)-2- thiopheneGarboxamide; N-{2-amino-1-[4-(methyloxy)phenyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-{2-amino-1-[2-(methyloxy)phenyl]ethyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{2-amino-1-[3-(methyloxy)phenyl]ethyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridine-4-yl)-2-thiophenecarboxamide;
N-{2-amino-1-[4-(methyloxy)phβnyl]ethyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{(1 R)-2-amino-1-t(4-fluorophenyl)methyl]ethyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide; N-iCISJ^-amino-i-^-fluorophenyOmethy^ethylH-bromo-δ-CI H-pyrroloP.S- b]pyridin-4-yl)-2-thiophenecarboxamide
N-[1-(aminomethyl)-3-phenylpropyl]-4-bromo-5-(1H-pyrrolo[2,3-b]pyridin-4- yl)-2-thiophenecarboxamide;
N-^IS^-amino-i-^-CmethyloxyJphenyllmethy^ethylH-bromo-δ-CI H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide;
N-((1 R)-2-amino-1-{[4-(methyloxy)phenyl]methyl}ethyI)-4-bromo-5-(1 H- pyrro)o[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-(1H-pyrro!o[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide; N-((1 R)-2-amino-1 -{[4-(methyloxy)phenyl]methyl}ethyl)-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[4-(methyloxy)phenyl]methyl}ethyl)-5-(1H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{(1 R)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[4-(trifluoroιnethyl)phenyl]methyl}θthyl)-4-bromo-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[4-(trifluoromethyl)phenyl]methyl}Gthyl)-5-(1 H- pyrrolo[2,3-b]ρyridin-4-yl)-2-thiophenecarboxamide; S-^-aminoethyOoxyJ-N-CphenylmethyO-δ-CI H-pyrroloP.S-bjpyridin^-yl)^- thiophenecarboxamide; 3-[(2-aminoethyl)oxy]-N-(3-phenylpropyl)-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
3-[(2-aminoethyl)oxy]-N-(2-phenylethyl)-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluorornethyl)ρhenyl]methyl}ethyl)-5-(1H- pyrrolo[2,3-b]pyridin-4-yl)-2-furancarboxamide;
N-((1 S)-2-amino-1 -{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-furancarboxamide;
3-[(2-aminoethyl)oxy]-4-bromo-N-(phenylmethyl)-5-(1 H-pyrrolo[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide;
S-f^-aminoethyOoxyM-bromo-N-^-phenylpropyO-S-CI H-pyrrolop.S- b]pyridin-4-yl)-2-thiophenecarboxamide;
S-^-aminoethyl^xyl^-bromo-N^-phenylethyO-S-CI H-pyrrolop.S-bJpyridin- 4-yl)-2-thiophenecarboxamide; N^-amino-i-fS-CtrifluoromethyOphenylJethyll-δ-CI H-pyrrolop.S-blpyπdin^- yl)-2-thiopheπecarboxamide;
N-{2-amino-1-[3-(trifluoromethyl)phenyl]ethyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
4-bromo-N-[(1S)-2-hydroxy-1-(phenylmethyl)ethyl]-5-(1H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamidei
N-[(1S)-2-hydroxy-1-(phenylmethyl)ethyl]-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-{2-arnino-1-[2-(trifluoromethyl)phenyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyridin-4- yl)-2-thiophenecarboxamide; N-{2-amino-1 -[2-(trifluoromethyl)phenyl]ethy!}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
3-[(2-aminoethyl)oxy]-N-((1 S)-2-amino-1 -{[3-
(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1/-/-pyrrolo[2,3-6]pyridin-4-yl)-2- thiophenecarboxamide; Λ/-((1S)-2-amino-1-{[3-(tπfluoromethyl)phenyl]methyl}ethyl)-4-bromo-3-
(methyloxy)-5-(1H-pyrrolo[2,3-o]pyridin-4-yl)-2-thiophenecarboxamide;
Λ/-((1S)-2-amiπo-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-3-(methyloxy)-5-
(1/-/-pyrrolo[2,3-jb]pyridin-4-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-4-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide; N-[(2S)-2-amino-3-phenylpropyl]-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-[(2R)-2-amino-3-phenylpropyl]-4-bromo-5-(1H-pyrrolo[2,3-b]pyridin-4-yl)- 2-thiopheneGarboxamide; N-[(2S)-2-amino-3-phenylpropyl]-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-
2-thiophenecarboxamide;
N-[(2R)-2-amino-3-phenylpropyl]-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-(3-amino-1-phenylpropyl)-5-(1H-pyrrolo[2,3-b]pyridin-3-yl)-2- thiophenecarboxamide;
N-[2-amino-1-(4-fluorophenyl)ethyl]-4-bromo-5-(1H-pyrrolo[2,3-b]Dyπdine-3- yl)-2-thiophenecarboxamide;
N-[2-amino-1-(4-fluorophenyl)ethyl]-5-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2- thiophenecarboxamide; N-t2-amino-1-(2-fluorophenyl)ethyl]-5-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2- thiophenecarboxamide;
N-[2-amino-1-(2-fluorophenyl)ethyl]-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-3- yl)-2-thiophenecarboxamide;
N-[2-amino-1-(3-fluorophenyl)ethyl]-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-3- yl)-2-thiophenecarboxamide;
N-[2-amino-1-(3-fluorophenyl)ethyl]-5-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2- thiophenecarboxamide;
N-[(2R)-2-amino-3-(3-fluorophenyl)propy!]-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide N-{(1 R)-2-amino-1-[(2-fluorophenyl)methyI]ethyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{(1R)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{(1 R)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-flυorophenyl)methyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]Gthyl}-5-(1 H-pyrrolo[2,3-b]pyridin-
4-yl)-2-thiophenecarboxamide; N-{(1 R)-2-amino-1 -[(2-fluorophenyl)methyl]ethyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{(1 R)-2-amino-1-[(2-fiuorophenyl)methyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-3-[(3-aminopropyl)oxy]-4-bromo-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{2-amino-1-[(2,6-difluorophenyl)methyI]ethyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethy!}-4-bromo-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{2-amino-1-[(3,5-difluorophenyl)inethyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyndin- 4-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifIuoromethyl)phenyl]methyl}ethyl)-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)pheny!]methyl}ethyl)-4-bromo-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide;
N-((1 S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{t2-(trifIuoromethyl)pheny!]methyl}ethyl)-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{2-amino-1-[(2,6-difluorophenyl)methyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide;
N-[(1 S)-2-amino-1-(4-pyridinylmethyl)ethyl]-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide; N-[(1 S)-2-amino-1 -(4-pyridinylmethyl)ethyl]-5-(1 H-pyrrolot2,3-b]pyridin-4-yl)-
2-thiophenecarboxamide;
N-((1S)-2-amino-1-{t2-(trifluoromethyl)phenyi]methyl}ethyl)-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-furancarboxamide;
N-((1 S)-2-amino-1 -{t2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1 H- pyrrolo[2,3-b]Dyridine-4-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-3- (methyloxy)-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2-furancarboxamide;
3-[(2-aminoethyl)oxy]-Λ/-((1 S)-2-amino-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- furancarboxamide; and 3-[(2-aminoethyl)oxy]-Λ/-((1 S)-2-amino-1 -{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-5-(1 /-/-pyrrolo[2l3-b]pyridin-4-yl)-2- furancarboxamide;
and/or pharmaceutically acceptable salts, hydrates, solvates and pro-drugs thereof.
Compounds of Formula (I) are included in the pharmaceutical compositions of the invention and used in the methods of the invention.
Certain of the compounds described herein may contain one or more chiral atoms, or may otherwise be capable of existing as two enantiomers. Accordingly, the compounds of this invention include mixtures of enantiomers as well as purified enantiomers or enantiomerically enriched mixtures. Also, it is understood that all tautomers and mixtures of tautomers are included within the scope of the compounds of formula I or Ia.
By the term "aryl", and derivatives thereof, used alone or as part of a larger moiety as in "aralkyl", "aralkoxy", or "aryloxyalkyl" as used herein, unless otherwise defined, is meant monocyclic, bicyclic, and tricyclic ring systems having a total of five to fourteen ring members, wherein at least one ring system is aromatic and wherein each ring in the system contains 3 to 7 members, such as phenyl, naphthalene, tetrahydronaphthalene and biphenyl.
By the term "heteroaryl", and derivatives thereof, used alone or as part of a larger moiety as in "heteroaralkyl", "heteroaralkoxy", or "heteroaryloxyalkyl" as used herein, unless otherwise defined, is meant monocyclic, bicyclic, and tricyclic ring systems having a total of five to fourteen ring members, wherein at least one ring system is aromatic, at least one ring in the system contains one or more heteroatoms, and wherein each ring in the system contains 3 to 7 members, such as 3,4-methylenedioxyphenyl, pyridine, quinoline, isoquinoline, tetrahydroquinoline, tetrahydroisoquinoline, pyrimidine, quinazoline, thiophene, furan, pyrrole, pyrazole, imidazole, indole, indole 3-yl, dihydroindole, indene, dihydroindene, pyrazine, 1,3- dihydro-2H-benzimidazol, benzothiohpene and tetrazole.
The term "substituted" as used herein, unless otherwise defined, is meant that the subject chemical moiety has from one to five substituents, suitably from one to three substituents, selected from the group consisting of: -CC^R^O, ary|, cycloalkyl, cycloalkyl containing from 1 to 4 heteroatoms, hydroxyalkyl, alkoxy, acyloxy, alkyl, amino, alkylamino, aminoalkyl, dialkylamino, acyloxy, N-acylamino, hydroxy, nitro, tetrazole, cyano, oxo, halogen and trifluoromethyl, where R2^ is selected form hydrogen, C-}-C4alkyl, aryl and trifluoromethyl.
By the term "alkoxy" as used herein is meant -Oalkyl where alkyl is as described herein including -OCH3 and -OC(CH3)2CH3. The term "cycloalkyl" as used herein unless otherwise defined, is meant a nonaromatic, unsaturated or saturated, cyclic or polycyclic C3-C-] 2-
Examples of cycloalkyl and substituted cycloalkyl substituents as used herein include: cyclohexyl, aminocyclohexyl, cyclobutyl, aminocyclobutyl, A- hydroxy-cyclohexyl, 2-ethylcyclohexyl, propyl 4-methoxycyclohexyl, 4- methoxycyclohexyl, 4-carboxycyclohexyl, cyclopropyl, aminocyclopentyl, cyclopentyl.
The term "cycloalkyl containing from 1 to 4 heteroatoms" as used herein unless otherwise defined, is meant a nonaromatic, unsaturated or saturated, cyclic or polycyclic ring containing from 1 to 12 carbons and containing from one to four heteroatoms, provided that when the number of carbon atoms is 1 the aromatic ring contains at least four heteroatoms, when the number of carbon atoms is 2 the aromatic ring contains at least three heteroatoms, when the number of carbon atoms is 3 the nonaromatic ring contains at least two heteroatoms and when the number of carbon atoms is 4 the nonaromatic ring contains at least one heteroatom.
Examples of cycloalkyl containing from 1 to 4 heteroatoms and substituted cycloalkyl containing from 1 to 4 heteroatoms as used herein include: piperidyl, piperidine, pyrrolidine, 3-methyiaminopyrrolidine, piperazinly, tetrazole, hexahydrodiazepine, azetidinyl, pyran, tetrahydropyran, and morpholine. By the term "acyloxy" as used herein is meant -OC(O)alkyl where alkyl is as described herein. Examples of acyloxy substituents as used herein include: - OC(O)CH3, -OC(O)CH(CH3)2 and -OC(O)(CH2)3CH3.
By the term "N-acylamino" as used herein is meant -N(H)C(O )alkyl, where alkyl is as described herein. Examples of N-acylamino substituents as used herein include: -N(H)C(O)CH3, -N(H)C(O)CH(CH3)2 and -N(H)C(O)(CH2)3CH3.
By the term "heteroatom" as used herein is meant oxygen, nitrogen or sulfur.
By the term "halogen" as used herein is meant a substituent selected from bromide, iodide, chloride and fluoride.
By the term "alkyl" and derivatives thereof and in all carbon chains as used herein, including alkyl chains defined by the term "-(CH2)n'\ "-(CH2)m" aπd tne ^e, is meant a linear or branched, saturated or unsaturated hydrocarbon chain, and unless otherwise defined, the carbon chain will contain from 1 to 12 carbon atoms. Examples of alkyl and substituted alkyl substituents as used herein include: -CH3, - CH2-CH3, -CH2-CH2-CH3, -CH(CH3)2, -CH2-CH2-C(CH3)3, -CH2-CF3, -C≡C- C(CH3)3, -C≡C-CH2-OH, cyclopropylmethyl, -CH2-C(CH3)2-CH2-NH2, -C≡C-
C6H5, -C≡C-C(CH3)2-OH, -CH2-CH(OH)-CH(OH)-CH(OH)-CH(OH)-CH2-OH, piperidinylmethyl, methoxyphenylethyl, -C(CH3)3, -(CH2)3-CH3, -CH2-CH(CH3)2, -CH(CH3)-CH2-CH3, -CH=CH2, and -C≡C-CH3.
By the term "treating" and derivatives thereof as used herein, is meant prophylatic and therapeutic therapy.
As used herein, the term "effective amount" and derivatives thereof means that amount of a drug or pharmaceutical agent that will elicit the biological or medical response of a tissue, system, animal or human that is being sought, for instance, by a researcher or clinician. Furthermore, the term "therapeutically effective amount" and derivatives thereof means any amount which, as compared to a corresponding subject who has not received such amount, results in improved treatment, healing, prevention, or amelioration of a disease, disorder, or side effect, or a decrease in the rate of advancement of a disease or disorder. The term also includes within its scope amounts effective to enhance normal physiological function.
Compounds of Formula (I) are included in the pharmaceutical compositions of the invention and used in the methods of the invention. Where a -COOH or -OH group is present, pharmaceutically acceptable esters can be employed, for example methyl, ethyl, pivaloyloxymethyl, and the like for -COOH, and acetate maleate and the like for -OH, and those esters known in the art for modifying solubility or hydrolysis characteristics, for use as sustained release or prodrug formulations.
The novel compounds of Formulas I and Ia are prepared as shown in Schemes 1 to 6 below, or by analogous methods, wherein the V, W, X, Y, Z, Q, L and 1R1 substituents are as defined in Formulas I and Ia respectively and provided that the V, W, X, Y, Z, Q, L and 'R' substituents do not include any such substituents that render inoperative the processes of Schemes 1 to 6. All of the starting materials are commercially available or are readily made from commercially available starting materials by those of skill in the art.
General Schemes Scheme 1
Reagents: (a) DPPA, Et3N, t-BuOH, 85 0C; (b) 1-(phenylsulfonyl)-4-(4,4,5,5- tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 /-/-pyrrolo[2,3-d]pyridine, K2CO3, Pd(PPh3)4, dioxane/H2O; (c) HCI/dioxane; (d) PyBrop, (i-Pr)2Net, 3-({[(1 ,1 - dimethylethyl)oxy]Garbonyl}amino)-2-phenylpropanoic acid, DCM, RT; (e) 6N NaOH, MeOH, 50° C; (f) HCI/dioxane.
The commercially available carboxylic acid (1-1 ) was converted, in one pot, to the corresponding protected amine using the procedure described by J. Med. Chem. 1991 , 34, 1594-1605. Bromide (II-2) was coupled to aryl boronic ester [1- (phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3- όjpyridine]. Suzuki-like couplings are typically run using a palladium(O) catalyst such as Pd(PPh3)4 with an inorganic base, for example K2CO3, Na2CO3 or K3PO4, in an aqueous mixture containing ethereal solvents such as DME, dioxane, or THF. Removal of the Boc protecting group of (I-3) was achieved using a protic acid such as trifluoroacetic acid or HCI in a polar solvent such as methanol. The coupling of a primary or secondary amine with a carboxylic acid, such as 3-({[(1 , 1 - dimethylethyl)oxy]carbonyl}amino)-2-phenylpropanoic acid, can be accomplished with a variety of amide coupling reagents such as EDC, PyBrop, etc. to provide, for example amide (1-4). Amide coupling reactions are generally run in solvents such as DCM or DMF, utilizing an organic base like Et3N or (J-Pr)2NEt. Removal of the arylsulfonyl group of (1-4) was accomplished with aqueous NaOH followed by acidic treatment with HCI or TFA to remove the Boc protecting group and produce (1-5). Many different protecting groups are available to one skilled in the art and can be used here as long as they do not interfere with the processes listed herein. Methods for the protection of amines are described in standard reference volumes, such as Greene "Protective Groups in Organic Synthesis" (published by Wiley-lnterscience).
Scheme 2
Reagents: (a) 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)- 1 /-/-pyrrolo[2,3-b]pyridine, K2CO3, Pd(PPh3)4, dioxane/H2O; (b) H2 (1 atm), Pd/C, MeOH/THF, RT; (c) PyBrop, (i-Pr)2Net, 3-({[(1 ,1-dimethylethyl)oxy]carbonyl}amino)- 2-phenylpropanoic acid, DCM, RT; (d) 6N NaOH, MeOH, 50° C; (e) HCI/dioxane.
Comercially available bromide (11-1 ) was coupled to aryl boronic ester [1- (phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1/-/-pyrrolo[2,3- 6]pyridine] to yield (II-2). Suzuki-like couplings are typically run using a palladium(O) catalyst such as Pd(PPh3)4 with an inorganic base, for example K2CO3, Na2COs or K3PO4, in an aqueous mixture containing ethereal solvents such as DME, dioxane, or THF. Reduction of the nitro functionality of (II-2) was accomplished using Pd/C catalyst in polar protic solvents, such as MeOH, under an atmosphere of hydrogen gas. The coupling of a primary amine with a carboxylic acid, such as 3-({[(1 ,1- dimethylethyl)oxy]carbonyl}amino)-2-phenylpropanoic acid, can be accomplished with a variety of amide coupling reagents such as EDC, PyBrop, etc. to provide, for example amide (11-4). Amide coupling reactions are generally run in solvents such as DCM or DMF, utilizing an organic base like Et3N or (i-Pr)2NEt. Removal of the arylsulfonyl group of (11-4) was accomplished with aqueous NaOH followed by acidic treatment with HCI or TFA to remove the Boc protecting group and produce (11-5). Many different protecting groups are available to one skilled in the art and can be used here as long as they do not interfere with the processes listed herein. Methods for the protection of amines are described in standard reference volumes, such as Greene "Protective Groups in Organic Synthesis" (published by Wiley- Interscience).
Scheme 3
111-1 III-2 III-3
1-4 111-5
Reagents: (a) Phthalimide, PPh3, DEAD, THF, RT; (b) CH3NH2/H2O, MeOH, RT; (c) 111-3, PyBrop, (i-Pr)2Net, 3-({[(1 ,1-dimethylethyl)oxy]carbonyl}amino)-2- phenylpropanoic acid, DCM, RT; (d) 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2- dioxaborolan-2-yl)-1 H-pyrrolo[2,3-6]pyridine, K2CO3, Pd(PPh3)4, dioxane/H2O; (e) 6N NaOH, MeOH, 50° C; (f) HCI/dioxane.
Amino alcohol (III-1) was reacted under Mitsunobu conditions to provide the differentially protected diamine (HI-2). Mitsunobu reactions are well know to those skilled in the art of organic synthesis. Methods and reaction conditions for such transformations are discussed in Synthesis 1981 , 1-28. Selective deprotection of the phthalimide group of (III-2) using a nucleophilic amine such as hydrazine or methyl amine in a polar solvent such as methanol, afforded amine (III-3). Many different protecting groups are available to one skilled in the art and can be used here as long as they do not interfere with the processes listed herein. Methods for the protection of amines are described in standard reference volumes, such as Greene "Protective Groups in Organic Synthesis" (published by Wiley-lnterscience). Carboxylic acid (III-4) was reacted with amine (111-3) to form amide (HI-S). A variety of amide coupling reagents such as EDC, PyBrop, etc. are commercially available. Amide coupling reactions are generally run in solvents such as DCM or DMF, utilizing an organic base like Et3N or (i-Pr)2NEt. Dibromide (111-5) was regioselectively coupled with arylboronate 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl- 1,3,2-dioxaborolan-2-yl)-1/-/-pyrrolo[2,3-ό]pyridine using a Suzuki coupling procedure. Suzuki-like couplings are typically run using a palladium(O) catalyst such as Pd(PPh3)4 with an inorganic base, for example K2CO3, Na2CO3 or K3PO4, in an aqueous mixture containing ethereal solvents such as DME, dioxane, or THF. Methods for palladium-mediated couplings are described in standard reference volumes, such as Schlosser "Organometaliics in Synthesis" (published by Wiley and sons). Removal of the arylsulfonyl group of (III-6) was accomplished with aqueous NaOH followed by acidic treatment with HCI or TFA to remove the Boc protecting group and produce (III-7).
Scheme 4
IV-3
IV-4
IV-5 IV-6
Reagents: (a) (Boc)2O, pyridine, NH4HCO3, 3-({[(1 ,1- dimθthylθthyl)oxy]carbonyl}amino)-2-phenylpropanoic acid ; (b) i-(phenylsulfonyl)- 4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3-b]pyridine, K2CO3, Pd(PPh3)4, dioxane/H20; (c) IV-2, 1 ,2-diaminoethane, CuI, K2CO3, dioxane, 10O0C; (d) 6N NaOH, MeOH, 50° C; (e) HCI/dioxane.
Carboxylic acid (IV-1 ) was converted to its corresponding primary amide (IV-
2) in one pot following the procedure of Pozdnev (Tet. Lett. 1995, 36(39), 7115- 7118). Dibromide (IV-3) was regioselectively coupled with arylboronate 1- (phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yi)-1 H-pyrrolo[2,3- 6]pyridine using a Suzuki coupling procedure. Suzuki-like couplings are typically run using a palladium(O) catalyst such as Pd(PPh3)4 with an inorganic base, for example K2CO3, Na2CO3 or K3PO4, in an aqueous mixture containing ethereal solvents such as DME, dioxane, or THF. Methods for palladium mediated couplings are described in standard reference volumes, such as Schlosser "Organometallics in Synthesis" (published by Wiley and sons). Bromide (IV-4) was coupled to amide (IV-2) using a procedure descibed by Buchwald (J. Amer. Chem. Soc. 2002, 124, 7421-7428). Removal of the arylsulfonyl group of (IV-5) was accomplished with aqueous NaOH followed by acidic treatment with HCI or TFA to remove the Boc protecting group and produce (IV -6). Many different protecting groups are available to one skilled in the art and can be used here as long as they do not interfere with the processes listed herein. Methods for the protection of amines are described in standard reference volumes, such as Greene "Protective Groups in Organic Synthesis" (published by Wiley-lnterscience).
Scheme 5
V-1 V-2
Reagents: (a) Phthalimide, PPh3, DEAD, THF, RT; (b) HCI, dioxane, RT; (c) IU-4, PyBrop, (J-Pr)2NEt1 DCM, RT; (d) 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2- dioxaborolan-2-yl)-1 f/-pyrrolo[2,3-b]pyridine, K2CO3, Pd(PPh3)4, dioxane/H2O; (e) 6N NaOH, MeOH, RT; (f) NH2NH2, MeOH, 50° C. Amino alcohol (V-1) was reacted under Mitsunobu conditions to provide the differentially protected diamine (V -2). Mitsunobu reactions are well know to those skilled in the art of organic synthesis. Methods and reaction conditions for such transformations are discussed in Synthesis 1981 , 1-28. Selective BOG deprotection was provided by anhydrous HCI in organic solvents. Many different protecting groups are available to one skilled in the art and can be used here as long as they do not interfere with the processes listed herein. Methods for the protection of amines are described in standard reference volumes, such as Greene "Protective Groups in Organic Synthesis" (published by Wiley-lnterscience). Carboxylic acid (III— 4) was reacted with amine (V-3) to form amide (V-4). A variety of amide coupling reagents such as EDC, PyBrop, etc. are commercially available. Amide coupling reactions are generally run in solvents such as DCM or DMF, utilizing an organic base like Et3N or (i-Pr)2NEt. Dibromide (V-4) was regioselectively coupled with arylboronate 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 /-/- pyrrolo[2,3-/?]pyridine using a Suzuki coupling procedure. Suzuki-like couplings are typically run using a palladium(O) catalyst such as Pd(PPh3^ with an inorganic base, for example K2CO3, Na2CO3 or K3PO4, in an aqueous mixture containing ethereal solvents such as DME, dioxane, or THF. Methods for palladium-mediated couplings are described in standard reference volumes, such as Schlosser "Organometallics in Synthesis" (published by Wiley and sons). Removal of the arylsulfonyl group of (V-5) was accomplished with aqueous NaOH at RT followed by deprotection of the phthalimide group of using a nucleophilic amine such as hydrazine or methyl amine in a polar solvent such as methanol, afforded amine (V- 6).
Scheme 6
III-4 VI-1 VI-2
VI-3 Vl-4
VI-5
Reagents: (a) DPPA, Et3N, t-BuOH, 85 0C; (b) furan-3-boronic acid, K2CO3, Pd(PPh3)4, dioxane/H2O; (c) 1-(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1,3,2- dioxaborolan-2-yl)-1 H-pyrrolo[2,3-ib]pyriciine, K2CO3, Pd(PPh3)4, dioxane/H2O; (d) HCI/dioxane; (e) PyBrop, (i-Pr)2Net, 3-({[(1 ,1-dimethylethyl)oxy]carbonyl}amino)-2- phenylpropanoic acid, DCM, RT; (f) 6N NaOH, MeOH, 50° C; (g) HCI/dioxane.
The commercially available carboxylic acid (111-4) was converted, in one pot, to the corresponding protected amine using the procedure described by J. Med. Chem. 1991 , 34, 1594-1605. Bromide (VI-1) was coupled to furan-3-boronic acid followed sequentially by aryl boronic ester [1~(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2- dioxaborolan-2-yl)-1 /-/-pyrrolo[2,3-ό]pyridine]. Suzuki-like couplings are typically run using a palladium(O) catalyst such as Pd(PPh3)4 with an inorganic base, for example K2CO3, Na2CO3 or K3PO4, in an aqueous mixture containing ethereal solvents such as DME, dioxane, or THF. Removal of the Boc protecting group of (Vl-3) was achieved using a protic acid such as trifluoroacetic acid or HCI in a polar solvent such as methanol. The coupling of a primary or secondary amine with a carboxylic acid, such as 3-({[(1 ,1-dimethylethyl)oxy]carbonyl}amino)-2- phenylpropanoic acid, can be accomplished with a variety of amide coupling reagents such as EDC, PyBrop, etc. to provide, for example amide (VI-4). Amide coupling reactions are generally run in solvents such as DCM or DMF, utilizing an organic base like EtsN or (i-Pr^NEt. Removal of the arylsulfonyl group of (VI-4) was accomplished with aqueous NaOH followed by acidic treatment with HCI or TFA to remove the Boc protecting group and produce (VI-5). Many different protecting groups are available to one skilled in the art and can be used here as long as they do not interfere with the processes listed herein. Methods for the protection of amines are described in standard reference volumes, such as Greene "Protective Groups in Organic Synthesis" (published by Wiley-lnterscience).
One skilled in the art can synthesize the remaining compounds of Formula I according to the above schemes and/or with information readily known to those of skill in the art, using intermediates known in the art or using intermediates readily prepared form intermediates known in the art. For example, one can synthesize compounds of Formula 1 (Y = C-Ar, Z = CH or N) using the methods described in Scheme 3 with intermediates described in Synthesis 2005, 5, 771-780. Similarly, one can synthesize compounds of Formula 1 (W = N), using the methods described in Scheme 3 with intermediates described in Bioorg. Med. Chem. Lett. 2004, 14, 5247-5250. One can also synthesize compounds of Formula 1 (W = N, Z = N), using the methods described in Scheme 3 with intermediates described in J. Amer. Chem. Soc.1956, 78, 784-790.
By the term "co-administering" and derivatives thereof as used herein is meant either simultaneous administration or any manner of separate sequential administration of an AKT inhibiting compound, as described herein, and a further active ingredient or ingredients, known to be useful in the treatment of cancer, including chemotherapy and radiation treatment, or to be useful in the treatment of arthritis. The term further active ingredient or ingredients, as used herein, includes any compound or therapeutic agent known to or that demonstrates advantageous properties when administered to a patient in need of treatment for cancer or arthritis. Preferably, if the administration is not simultaneous, the compounds are administered in a close time proximity to each other. Furthermore, it does not matter if the compounds are administered in the same dosage form, e.g. one compound may be administered topically and another compound may be administered orally.
Typically, any anti-neoplastic agent that has activity versus a susceptible tumor being treated may be co-administered in the treatment of cancer in the present invention. Examples of such agents can be found in Cancer Principles and Practice of Oncology by V.T. Devita and S. Hellman (editors), 6lh edition (February 15, 2001), Lippincott Williams & Wilkins Publishers. A person of ordinary skill in the art would be able to discern which combinations of agents would be useful based on the particular characteristics of the drugs and the cancer involved. Typical anti- neoplastic agents useful in the present invention include, but are not limited to, anti- microtubule agents such as diterpenoids and vinca alkaloids; platinum coordination complexes; alkylating agents such as nitrogen mustards, oxazaphosphorines, alkylsulfonates, nitrosoureas, and triazenes; antibiotic agents such as anthracyclins, actinomycins and bleomycins; topoisomerase Il inhibitors such as epipodophyllotoxins; antimetabolites such as purine and pyrimidine analogues and anti-folate compounds; topoisomerase I inhibitors such as camptothecins; hormones and hormonal analogues; signal transduction pathway inhibitors; nonreceptor tyrosine kinase angiogenesis inhibitors; immunotherapeutic agents; proapoptotic agents; and cell cycle signaling inhibitors.
Examples of a further active ingredient or ingredients (anti-neoplastic agent) for use in combination or co-administered with the presently invented AKT inhibiting compounds are chemotherapeutic agents.
Anti-microtubule or anti-mitotic agents are phase specific agents active against the microtubules of tumor cells during M or the mitosis phase of the cell cycle. Examples of anti-microtubule agents include, but are not limited to, diterpenoids and vinca alkaloids.
Diterpenoids, which are derived from natural sources, are phase specific anti -cancer agents that operate at the G2/M phases of the cell cycle. It is believed that the diterpenoids stabilize the β-tubulin subunit of the microtubules, by binding with this protein. Disassembly of the protein appears then to be inhibited with mitosis being arrested and cell death following. Examples of diterpenoids include, but are not limited to, paclitaxel and its analog docetaxel.
Paclitaxel, 5β,20-epoxy-1,2α,4,7β,10β,13α-hexa-hydroxytax-11-en-9-one
4,10-diacetate 2-benzoate 13-ester with (2R,3S)-N-benzoyl-3-phenylisoserine; is a natural diterpene product isolated from the Pacific yew tree Taxus brevifolia and is commercially available as an injectable solution TAXOL®. It is a member of the taxane family of terpenes. It was first isolated in 1971 by Wani et al. J. Am. Chem, Soc, 93:2325. 1971 ), who characterized its structure by chemical and X-ray crystallographic methods. One mechanism for its activity relates to paclitaxePs capacity to bind tubulin, thereby inhibiting cancer cell growth. Schiff et al., Proc. Natl, Acad, Sci. USA, 77:1561-1565 (1980); Schiff et al., Nature, 277:665-667
(1979); Kumar, J. Biol, Chem, 256: 10435-10441 (1981). For a review of synthesis and anticancer activity of some paclitaxel derivatives see: D. G. I. Kingston et al., Studies in Organic Chemistry vol. 26, entitled "New trends in Natural Products Chemistry 1986", Attaur-Rahman, P.W. Le Quesne, Eds. (Elsevier, Amsterdam, 1986) pp 219-235.
Paclitaxel has been approved for clinical use in the treatment of refractory ovarian cancer in the United States (Markman et al., Yale Journal of Biology and Medicine, 64:583, 1991 ; McGuire et al., Ann. Intern, Med., 111 :273,1989) and for the treatment of breast cancer (Holmes et al., J. Nat. Cancer Inst., 83:1797,1991.) It is a potential candidate for treatment of neoplasms in the skin (Einzig et. al., Proc. Am. Soc. Clin. Oncol., 20:46) and head and neck carcinomas (Forastire et. al., Sem. Oncol., 20:56, 1990). The compound also shows potential for the treatment of polycystic kidney disease (Woo et. al., Nature, 368:750. 1994), lung cancer and malaria. Treatment of patients with pacϋtaxel results in bone marrow suppression (multiple cell lineages, Ignoff, RJ. et. al, Cancer Chemotherapy Pocket Guide,,. 1998) related to the duration of dosing above a threshold concentration (5OnM) (Kearns, CM. et. al., Seminars in Oncology, 3(6) p.16-23, 1995).
Docetaxel, (2R,3S)- N-carboxy-3-phenylisoserine,N-fert-butyl ester, 13-ester with 5β-20-epoxy-1 ,2α,4,7β,10β,13α-hexahydroxytax-11-en-9-one 4-acetate 2- benzoate, trihydrate; is commercially available as an injectable solution as
TAXOTERE®. Docetaxel is indicated for the treatment of breast cancer. Docetaxel is a semisynthetic derivative of paclitaxel q.v., prepared using a natural precursor, 10-deacetyl-baccatin III, extracted from the needle of the European Yew tree. The dose limiting toxicity of docetaxel is neutropenia. Vinca alkaloids are phase specific antineoplastic agents derived from the periwinkle plant. Vinca alkaloids act at the M phase (mitosis) of the cell cycle by binding specifically to tubulin. Consequently, the bound tubulin molecule is unable to polymerize into microtubules. Mitosis is believed to be arrested in metaphase with cell death following. Examples of vinca alkaloids include, but are not limited to, vinblastine, vincristine, and vinorelbine.
Vinblastine, vincaleukoblastine sulfate, is commercially available as VELBAN® as an injectable solution. Although, it has possible indication as a second line therapy of various solid tumors, it is primarily indicated in the treatment of testicular cancer and various lymphomas including Hodgkin's Disease; and lymphocytic and histiocytic lymphomas. Myelosuppression is the dose limiting side effect of vinblastine. Vincristine, vincaleukoblastine, 22-oxo-, sulfate, is commercially available as
ONCOVIN® as an injectable solution. Vincristine is indicated for the treatment of acute leukemias and has also found use in treatment regimens for Hodgkin's and non-Hodgkin's malignant lymphomas. Alopecia and neurologic effects are the most common side effect of vincristine and to a lesser extent myelosupression and gastrointestinal mucositis effects occur.
Vinorelbine, 3',4'-didehydro -4'-deoxy-C'-norvincaleukoblastine [R-(R*, R*)- 2,3-dihydroxybutanedioate (1 :2)(salt)], commercially available as an injectable solution of vinorelbine tartrate (NAVELBINE®), is a semisynthetic vinca alkaloid. Vinorelbine is indicated as a single agent or in combination with other chemotherapeutic agents, such as cisplatin, in the treatment of various solid tumors, particularly non-small cell lung, advanced breast, and hormone refractory prostate cancers. Myelosuppression is the most common dose limiting side effect of vinorelbine.
Platinum coordination complexes are non-phase specific anti-cancer agents, which are interactive with DNA. The platinum complexes enter tumor cells, undergo, aquation and form intra- and interstrand crosslinks with DNA causing adverse biological effects to the tumor. Examples of platinum coordination complexes include, but are not limited to, cisplatin and carboplatin.
Cisplatin, cis-diamminedichloroplatinum, is commercially available as PLATINOL® as an injectable solution. Cisplatin is primarily indicated in the treatment of metastatic testicular and ovarian cancer and advanced bladder cancer. The primary dose limiting side effects of cisplatin are nephrotoxicity, which may be controlled by hydration and diuresis, and ototoxicity.
Carboplatin, platinum, diammine [1 ,1-cyclobutane-dicarboxylate(2-)-O,O'], is commercially available as PARAPLATI N® as an injectable solution. Carboplatin is primarily indicated in the first and second line treatment of advanced ovarian carcinoma. Bone marrow suppression is the dose limiting toxicity of carboplatin.
Alkylating agents are non-phase anti-cancer specific agents and strong electrophiles. Typically, alkylating agents form covalent linkages, by alkylation, to DNA through nucleophilic moieties of the DNA molecule such as phosphate, amino, sulfhydryl, hydroxyl, carboxyl, and imidazole groups. Such alkylation disrupts nucleic acid function leading to cell death. Examples of alkylating agents include, but are not limited to, nitrogen mustards such as cyclophosphamide, melphalan, and chlorambucil; alky! sulfonates such as busulfan; nitrosoureas such as carmustine; and triazenes such as dacarbazine.
Cyclophospham ide , 2-[bis(2~ch loroethy I )amino]tetrahydro-2H- 1 ,3,2- oxazaphosphorine 2-oxide monohydrate, is commercially available as an injectable solution or tablets as CYTOXAN®. Cyclophosphamide is indicated as a single agent or in combination with other chemotherapeutic agents, in the treatment of malignant lymphomas, multiple myeloma, and leukemias. Alopecia, nausea, vomiting and leukopenia are the most common dose limiting side effects of cyclophosphamide.
Melphalan, 4-[bis(2-chloroethyl)amino]-L-phenylalanine, is commercially available as an injectable solution or tablets as ALKERAN®. Melphalan is indicated for the palliative treatment of multiple myeloma and non-resectable epithelial carcinoma of the ovary. Bone marrow suppression is the most common dose limiting side effect of melphalan.
Chlorambucil, 4-[bis(2-chloroethyl)amino]benzenebutanoic acid, is commercially available as LEUKERAN® tablets. Chlorambucil is indicated for the palliative treatment of chronic lymphatic leukemia, and malignant lymphomas such as lymphosarcoma, giant follicular lymphoma, and Hodgkin's disease. Bone marrow suppression is the most common dose limiting side effect of chlorambucil. Busulfan, 1 ,4-butanediol dimethanesulfonate, is commercially available as MYLERAN® TABLETS. Busulfan is indicated for the palliative treatment of chronic myelogenous leukemia. Bone marrow suppression is the most common dose limiting side effects of busulfan. Carmustine, 1,3-[bis(2-chloroethyl)-1 -nitrosourea, is commercially available as single vials of lyophilized material as BiCNU®. Carmustine is indicated for the palliative treatment as a single agent or in combination with other agents for brain tumors, multiple myeloma, Hodgkin's disease, and non-Hodgkin's lymphomas. Delayed myelosuppression is the most common dose limiting side effects of carmustine.
Dacarbazine, 5-(3,3-dimethyl-1-triazeno)-imidazole-4-carboxamide, is commercially available as single vials of material as DTIC-Dome®. Dacarbazine is indicated for the treatment of metastatic malignant melanoma and in combination with other agents for the second line treatment of Hodgkin's Disease. Nausea, vomiting, and anorexia are the most common dose limiting side effects of dacarbazine. Antibiotic anti-neoplasties are non-phase specific agents, which bind or intercalate with DNA. Typically, such action results in stable DNA complexes or strand breakage, which disrupts ordinary function of the nucleic acids leading to cell death. Examples of antibiotic antineoplastic agents include, but are not limited to, actinomycins such as dactinomycin, anthrocyclins such as daunorubicin and doxorubicin; and bleomycins.
Dactinomycin, also know as Actinomycin D, is commercially available in injectable form as COSMEGEN®. Dactinomycin is indicated for the treatment of Wilm's tumor and rhabdomyosarcoma. Nausea, vomiting, and anorexia are the most common dose limiting side effects of dactinomycin.
Daunorubicin, (8S-cis-)-8-acetyl-10-[(3-amino-2,3,6-trideoxy-α-L-lyxo- hexopyranosyl)oxy]-7,8,9,10-tetrahydro-6,8,11-trihydroxy-1-methoxy-5,12 naphthacenedione hydrochloride, is commercially available as a liposomal injectable form as DAUNOXOME® or as an injectable as CERUBIDINE®. Daunorubicin is indicated for remission induction in the treatment of acute nonlymphocytic leukemia and advanced HIV associated Kaposi's sarcoma. Myelosuppression is the most common dose limiting side effect of daunorubicin.
Doxorubicin, (8S, 10S)-10-[(3-amino-2,3,6-trideoxy-α-L-lyxo- hexopyranosyl)oxy]-8-glycoloyl, 7, 8,9,10-tetrahydro-6, 8, 11 -trihydroxy-1-methoxy- 5,12 naphthacenedione hydrochloride, is commercially available as an injectable form as RUBEX® or ADRIAMYCIN RDF®. Doxorubicin is primarily indicated for the treatment of acute lymphoblastic leukemia and acute myeloblastic leukemia, but is also a useful component in the treatment of some solid tumors and lymphomas. Myelosuppression is the most common dose limiting side effect of doxorubicin. Bleomycin, a mixture of cytotoxic glycopeptide antibiotics isolated from a strain of Streptomyces verticillus, is commercially available as BLENOXANE®. Bleomycin is indicated as a palliative treatment, as a single agent or in combination with other agents, of squamous cell carcinoma, lymphomas, and testicular carcinomas. Pulmonary and cutaneous toxicities are the most common dose limiting side effects of bleomycin.
Topoisomerase Il inhibitors include, but are not limited to, epipodophyllotoxins.
Epipodophyllotoxins are phase specific anti-neoplastic agents derived from the mandrake plant. Epipodophyllotoxins typically affect cells in the S and G2 phases of the cell cycle by forming a ternary complex with topoisomerase Il and DNA causing DNA strand breaks. The strand breaks accumulate and cell death follows. Examples of epipodophyllotoxins include, but are not limited to, etoposide and teniposide.
Etoposide, 4'-demethyl-epipodophyllotoxin 9[4,6-0-(R )-ethylidene-β-D- glucopyranoside], is commercially available as an injectable solution or capsules as VePESID® and is commonly known as VP-16. Etoposide is indicated as a single agent or in combination with other chemotherapy agents in the treatment of testicular and non-small cell lung cancers. Myelosuppression is the most common side effect of etoposide. The incidence of leucopenia tends to be more severe than thrombocytopenia. Teniposide, 4'-demethyl-epipodophyilotoxin 9[4,6-0-(R )-thenylidene-β-D- glucopyranoside], is commercially available as an injectable solution as VUMON® and is commonly known as VM-26. Teniposide is indicated as a single agent or in combination with other chemotherapy agents in the treatment of acute leukemia in children. Myelosuppression is the most common dose limiting side effect of teniposide. Teniposide can induce both leucopenia and thrombocytopenia.
Antimetabolite neoplastic agents are phase specific anti-neoplastic agents that act at S phase (DNA synthesis) of the cell cycle by inhibiting DNA synthesis or by inhibiting purine or pyrimidine base synthesis and thereby limiting DNA synthesis. Consequently, S phase does not proceed and cell death follows. Examples of antimetabolite anti-neoplastic agents include, but are not limited to, fluorouracil, methotrexate, cytarabine, mecaptopurine, thioguanine, and gemcitabine.
5-fluorouracil, 5-fluoro-2,4- (1 H,3H) pyrimidinedione, is commercially available as fluorouracil. Administration of 5-fluorouracil leads to inhibition of thymidylate synthesis and is also incorporated into both RNA and DNA. The result typically is cell death. 5-fluorouracil is indicated as a single agent or in combination with other chemotherapy agents in the treatment of carcinomas of the breast, colon, rectum, stomach and pancreas. Myelosuppression and mucositis are dose limiting side effects of 5-fluorouracil. Other fluoropyrimidine analogs include 5-fluoro deoxyuridine (floxuridine) and 5-fluorodeoxyuridine monophosphate.
Cytarabine, 4-amino-1-β~D-arabinofuranosyl-2 (I H)-pyrimidinone, is commercially available as CYTOSAR-U® and is commonly known as Ara-C. It is believed that cytarabine exhibits cell phase specificity at S-phase by inhibiting DNA chain elongation by terminal incorporation of cytarabine into the growing DNA chain. Cytarabine is indicated as a single agent or in combination with other chemotherapy agents in the treatment of acute leukemia. Other cytidine analogs include 5-azacytidine and 2',2'-difluorodeoxycytidine (gemcitabine). Cytarabine induces leucopenia, thrombocytopenia, and mucositis.
Mercaptopurine, 1,7-dihydro-6H-purine-6-thione monohydrate, is commercially available as PURINETHOL®. Mercaptopurine exhibits cell phase specificity at S-phase by inhibiting DNA synthesis by an as of yet unspecified mechanism. Mercaptopurine is indicated as a single agent or in combination with other chemotherapy agents in the treatment of acute leukemia. Myelosuppression and gastrointestinal mucositis are expected side effects of mercaptopurine at high doses. A useful mercaptopurine analog is azathioprine. Thioguanine, 2-amino-1 ,7-dihydro-6H-purine-6-thione, is commercially available as TABLOID®. Thioguanine exhibits cell phase specificity at S-phase by inhibiting DNA synthesis by an as of yet unspecified mechanism. Thioguanine is indicated as a single agent or in combination with other chemotherapy agents in the treatment of acute leukemia. Myelosuppression, including leucopenia, thrombocytopenia, and anemia, is the most common dose limiting side effect of thioguanine administration. However, gastrointestinal side effects occur and can be dose limiting. Other purine analogs include pentostatin, erythrohydroxynonyladenine, fludarabine phosphate, and cladribine.
Gemcitabine, 2'-deoxy-2\ 2'-difluorocytidine monohydrochloride (β-isomer), is commercially available as GEMZAR®. Gemcitabine exhibits cell phase specificity at S-phase and by blocking progression of cells through the G1/S boundary. Gemcitabine is indicated in combination with cisplatin in the treatment of locally advanced non-small cell lung cancer and alone in the treatment of locally advanced pancreatic cancer. Myelosuppression, including leucopenia, thrombocytopenia, and anemia, is the most common dose limiting side effect of gemcitabine administration.
Methotrexate, N-[4[[(2,4-diamino-6-pteridinyl) methyl]methylamino] benzoyl]- L-glutamic acid, is commercially available as methotrexate sodium. Methotrexate exhibits cell phase effects specifically at S-phase by inhibiting DNA synthesis, repair and/or replication through the inhibition of dyhydrofolic acid reductase which is required for synthesis of purine nucleotides and thymidylate. Methotrexate is indicated as a single agent or in combination with other chemotherapy agents in the treatment of choriocarcinoma, meningeal leukemia, non-Hodgkin's lymphoma, and carcinomas of the breast, head, neck, ovary and bladder. Myelosuppression (leucopenia, thrombocytopenia, and anemia) and mucositis are expected side effect of methotrexate administration. Camptothecins, including, camptothecin and camptothecin derivatives are available or under development as Topoisomerase I inhibitors. Camptothecins cytotoxic activity is believed to be related to its Topoisomerase I inhibitory activity. Examples of camptothecins include, but are not limited to irinotecan, topotecan, and the various optical forms of 7-(4-methylpiperazino-methylene)-10, 1 1 -ethylenedioxy- 20-camptothecin described below.
Irinotecan HCI, (4S)-4,11-diethyl-4-hydroxy-9~[(4-piperidinopiperidino) carbonyloxy]-1 H-pyrano[3',4',6,7]indolizino[1 ,2-b]quinoline-3,14(4H, 12H)-dione hydrochloride, is commercially available as the injectable solution CAMPTOSAR®. Irinotecan is a derivative of camptothecin which binds, along with its active metabolite SN-38, to the topoisomerase I — DNA complex. It is believed that cytotoxicity occurs as a result of irreparable double strand breaks caused by interaction of the topoisomerase I : DNA : irintecan or SN-38 ternary complex with replication enzymes. Irinotecan is indicated for treatment of metastatic cancer of the colon or rectum. The dose limiting side effects of irinotecan HCI are myelosuppression, including neutropenia, and Gl effects, including diarrhea.
Topotecan HCI, (S)-10-[(dimethylamino)methyl]-4-ethyl-4,9-dihydroxy-1 H- pyrano[3',4',6,7]indoliziπo[1 ,2-b]quinoline-3,14-(4H,12H)-dione monohydrochloride, is commercially available as the injectable solution HYCAMTIN®. Topotecan is a derivative of camptothecin which binds to the topoisomerase I — DNA complex and prevents religation of singles strand breaks caused by Topoisomerase I in response to torsional strain of the DNA molecule. Topotecan is indicated for second line treatment of metastatic carcinoma of the ovary and small cell lung cancer. The dose limiting side effect of topotecan HCI is myelosuppression, primarily neutropenia.
Also of interest, is the camptothecin derivative of formula A following, currently under development, including the racemic mixture (R,S) form as well as the R and S enantiomers:
known by the chemical name "7-(4-methylpiperazino-methylene)-10,11- ethylenedioxy-20(R,S)-camptothecin (racemic mixture) or "7-(4-methylpiperazino- methylene)-10,11-ethylenedioxy-20(R)~camptothecin (R enantiomer) or "7-(4- methylpiperazino-methylene)-10,11 -ethylenedioxy-20(S)-camptothecin (S enantiomer). Such compound as well as related compounds are described, including methods of making, in U.S. Patent Nos. 6,063,923; 5,342,947; 5,559,235; 5,491 ,237 and pending U.S. patent Application No. 08/977,217 filed November 24, 1997.
Hormones and hormonal analogues are useful compounds for treating cancers in which there is a relationship between the hormone(s) and growth and/or lack of growth of the cancer. Examples of hormones and hormonal analogues useful in cancer treatment include, but are not limited to, adrenocorticosteroids such as prednisone and prednisolone which are useful in the treatment of malignant lymphoma and acute leukemia in children; aminoglutethimide and other aromatase inhibitors such as anastrozole, letrazole, vorazole, and exemestane useful in the treatment of adrenocortical carcinoma and hormone dependent breast carcinoma containing estrogen receptors; progestrins such as megestrol acetate useful in the treatment of hormone dependent breast cancer and endometrial carcinoma; estrogens, androgens, and anti-androgens such as flutamide, nilutamide, bicalutamide, cyproterone acetate and 5α-reductases such as finasteride and dutasteride, useful in the treatment of prostatic carcinoma and benign prostatic hypertrophy; anti-estrogens such as tamoxifen, toremifene, raloxifene, droloxifene, iodbxyfene, as well as selective estrogen receptor modulators (SERMS) such those described in U.S. Patent Nos. 5,681 ,835, 5,877,219, and 6,207,716, useful in the treatment of hormone dependent breast carcinoma and other susceptible cancers; and gonadotropin-releasing hormone (GnRH) and analogues thereof which stimulate the release of leutinizing hormone (LH) and/or follicle stimulating hormone (FSH) for the treatment prostatic carcinoma, for instance, LHRH agonists and antagagonists such as goserelin acetate and luprolide. Signal transduction pathway inhibitors are those inhibitors, which block or inhibit a chemical process which evokes an intracellular change. As used herein this change is cell proliferation or differentiation. Signal tranduction inhibitors useful in the present invention include inhibitors of receptor tyrosine kinases, non-receptor tyrosine kinases, SH2/SH3domain blockers, serine/threonine kinases, phosphatidyl inositol-3 kinases, myo-inositol signaling, and Ras oncogenes.
Several protein tyrosine kinases catalyse the phosphorylation of specific tyrosyl residues in various proteins involved in the regulation of cell growth. Such protein tyrosine kinases can be broadly classified as receptor or non-receptor kinases.
Receptor tyrosine kinases are transmembrane proteins having an extracellular ligand binding domain, a transmembrane domain, and a tyrosine kinase domain. Receptor tyrosine kinases are involved in the regulation of cell growth and are generally termed growth factor receptors. Inappropriate or uncontrolled activation of many of these kinases, i.e. aberrant kinase growth factor receptor activity, for example by over-expression or mutation, has been shown to result in uncontrolled cell growth. Accordingly, the aberrant activity of such kinases has been linked to malignant tissue growth. Consequently, inhibitors of such kinases could provide cancer treatment methods. Growth factor receptors include, for example, epidermal growth factor receptor (EGFr), platelet derived growth factor receptor (PDGFr), erbB2, erbB4, vascular endothelial growth factor receptor (VEGFr), tyrosine kinase with immunoglobulin-like and epidermal growth factor homology domains (TIE-2), insulin growth factor -I (IGFI) receptor, macrophage colony stimulating factor (cfms), BTK, ckit, cmet, fibroblast growth factor (FGF) receptors, Trk receptors (TrkA, TrkB, and TrkC), ephrin (eph) receptors, and the RET protooncogene. Several inhibitors of growth receptors are under development and include ligand antagonists, antibodies, tyrosine kinase inhibitors and anti-sense oligonucleotides. Growth factor receptors and agents that inhibit growth factor receptor function are described, for instance, in Kath, John C, Exp. Opin. Ther. Patents (2000) 10(6):803-818; Shawver et al DDT VoI 2, No. 2 February 1997; and Lofts, F. J. et al, "Growth factor receptors as targets", New Molecular Targets for Cancer Chemotherapy, ed. Workman, Paul and Kerr, David, CRC press 1994, London.
Tyrosine kinases, which are not growth factor receptor kinases are termed non-receptor tyrosine kinases. Non-receptor tyrosine kinases for use in the present invention, which are targets or potential targets of anti-cancer drugs, include cSrc, Lck, Fyn, Yes, Jak, cAbl, FAK (Focal adhesion kinase), Brutons tyrosine kinase, and Bcr-Abl. Such non-receptor kinases and agents which inhibit non-receptor tyrosine kinase function are described in Sinh, S. and Corey, SJ. , (1999) Journal of Hematotherapy and Stem Cell Research 8 (5): 465 - 80; and Bolen, J. B., Brugge, J. S., (1997) Annual review of Immunology. 15: 371-404.
SH2/SH3 domain blockers are agents that disrupt SH2 or SH3 domain binding in a variety of enzymes or adaptor proteins including, PI3-K p85 subunit, Src family kinases, adaptor molecules (She, Crk, Nek, Grb2) and Ras-GAP. SH2/SH3 domains as targets for anti-cancer drugs are discussed in Smithgall, T.E. (1995), Journal of Pharmacological and Toxicological Methods. 34(3) 125-32. Inhibitors of Serine/Threonine Kinases including MAP kinase cascade blockers which include blockers of Raf kinases (rafk), Mitogen or Extracellular Regulated Kinase (MEKs), and Extracellular Regulated Kinases (ERKs); and
Protein kinase C family member blockers including blockers of PKCs (alpha, beta, gamma, epsilon, mu, lambda, iota, zeta). IkB kinase family (IKKa, IKKb), PKB family kinases, akt kinase family members, and TGF beta receptor kinases. Such Serine/Threonine kinases and inhibitors thereof are described in Yamamoto, T., Taya, S., Kaibuchi, K., (1999), Journal of Biochemistry. 126 (5) 799-803; Brodt, P, Samani, A., and Navab, R. (2000), Biochemical Pharmacology, 60. 1 101-1107; Massague, J., Weis-Garcia, F. (1996) Cancer Surveys. 27:41-64; Philip, P.A., and Harris, A.L. (1995), Cancer Treatment and Research. 78: 3-27, Lackey, K. et al Bioorganic and Medicinal Chemistry Letters, (10), 2000, 223-226; U.S. Patent No. 6,268,391 ; and Martinez-lacaci, L., et al, Int. J. Cancer (2000), 88(1), 44-52. Inhibitors of Phosphotidyl inositol-3 Kinase family members including blockers of PI3-kinase, ATM, DNA-PK, and Ku may also be useful in the present invention. Such kinases are discussed in Abraham, R.T. (1996), Current Opinion in Immunology. 8 (3) 412-8; Canman, C.E., Lim, D.S. (1998), Oncogene 17 (25) 3301- 3308; Jackson, S. P. (1997), International Journal of Biochemistry and Cell Biology. 29 (7):935-8; and Zhong, H. et al, Cancer res, (2000) 60(6), 1541-1545.
Also of interest in the present invention are Myo-inositol signaling inhibitors such as phospholipase C blockers and Myoinositol analogues. Such signal inhibitors are described in Powis, G., and Kozikowski A., (1994) New Molecular Targets for Cancer Chemotherapy ed., Paul Workman and David Kerr, CRC press 1994, London.
Another group of signal transduction pathway inhibitors are inhibitors of Ras Oncogene. Such inhibitors include inhibitors of farnesyltransferase, geranyl-geranyl transferase, and CAAX proteases as well as anti-sense oligonucleotides, ribozymes and immunotherapy. Such inhibitors have been shown to block ras activation in cells containing wild type mutant ras, thereby acting as anti proliferation agents. Ras oncogene inhibition is discussed in Scharovsky, O. G., Rozados, V.R., Gervasoni, S.I. Matar, P. (2000), Journal of Biomedical Science. 7(4) 292-8; Ashby, M.N. (1998), Current Opinion in Lipidology. 9 (2) 99 - 102; and BioChim. Biophys. Acta, (19899) 1423(3):19-30.
As mentioned above, antibody antagonists to receptor kinase ligand binding may also serve as signal transduction inhibitors. This group of signal transduction pathway inhibitors includes the use of humanized antibodies to the extracellular ligand binding domain of receptor tyrosine kinases. For example lmclone C225 EGFR specific antibody (see Green, M. C. et al, Monoclonal Antibody Therapy for Solid Tumors, Cancer Treat. Rev., (2000), 26(4), 269-286); Herceptin ® erbB2 antibody (see Tyrosine Kinase Signalling in Breast cancererbB Family Receptor Tyrosine Kniases, Breast cancer Res., 2000, 2(3), 176-183); and 2CB VEGFR2 specific antibody (see Brekken, R.A. et al, Selective Inhibition of VEGFR2 Activity by a monoclonal Anti-VEGF antibody blocks tumor growth in mice, Cancer Res. (2000) 60, 51 17-5124). Non-receptor kinase angiogenesis inhibitors may also be useful in the present invention. Inhibitors of angiogenesis related VEGFR and TIE2 are discussed above in regard to signal transduction inhibitors (both receptors are receptor tyrosine kinases). Angiogenesis in general is linked to erbB2/EGFR signaling since inhibitors of erbB2 and EGFR have been shown to inhibit angiogenesis, primarily VEGF expression. Accordingly, non-receptor tyrosine kinase inhibitors may be used in combination with the compounds of the present invention. For example, anti-VEGF antibodies, which do not recognize VEGFR (the receptor tyrosine kinase), but bind to the ligand; small molecule inhibitors of integrin (alphav betas) that will inhibit angiogenesis; endostatin and angiostatin (non-RTK) may also prove useful in combination with the disclosed compounds. (See Bruns CJ et al (2000), Cancer Res., 60: 2926-2935; Schreiber AB, Winkler ME, and Derynck R. (1986), Science, 232: 1250-1253; Yen L et al. (2000), Oncogene 19: 3460-3469).
Agents used in immunotherapeutic regimens may also be useful in combination with the compounds of formula (I). There are a number of immunologic strategies to generate an immune response. These strategies are generally in the realm of tumor vaccinations. The efficacy of immunologic approaches may be greatly enhanced through combined inhibition of signaling pathways using a small molecule inhibitor. Discussion of the immunologic/tumor vaccine approach against erbB2/EGFR are found in Reilly RT et al. (2000), Cancer Res. 60: 3569-3576; and Chen Y, Hu D, Eling DJ, Robbins J, and Kipps TJ. (1998), Cancer Res. 58: 1965-1971.
Agents used in proapoptotic regimens (e.g., bcl-2 antisense oligonucleotides) may also be used in the combination of the present invention. Members of the Bcl-2 family of proteins block apoptosis. Upregulation of bcl-2 has therefore been linked to chemoresistance. Studies have shown that the epidermal growth factor (EGF) stimulates anti-apoptotic members of the bcl-2 family (i.e., mcl- 1 ). Therefore, strategies designed to downregulate the expression of bcl-2 in tumors have demonstrated clinical benefit and are now in Phase ll/lll trials, namely Genta's G3139 bcl-2 antisense oligonucleotide. Such proapoptotic strategies using the antisense oligonucleotide strategy for bcl-2 are discussed in Water JS et al. (2000), J. Clin. Oncol. 18: 1812-1823; and Kitada S et al. (1994), Antisense Res. Dev. 4: 71-79.
Cell cycle signalling inhibitors inhibit molecules involved in the control of the cell cycle. A family of protein kinases called cyclin dependent kinases (CDKs) and their interaction with a family of proteins termed cyclins controls progression through the eukaryotic cell cycle. The coordinate activation and inactivation of different cyclin/CDK complexes is necessary for normal progression through the cell cycle. Several inhibitors of cell cycle signalling are under development. For instance, examples of cyclin dependent kinases, including CDK2, CDK4, and CDK6 and inhibitors for the same are described in, for instance, Rosania et al, Exp. Opin. Ther. Patents (2000) 10(2):215-230.
In one embodiment, the cancer treatment method of the claimed invention includes the co-administration a compound of formula I and/or a pharmaceutically acceptable salt, hydrate, solvate or pro-drug thereof and at least one anti-neoplastic agent, such as one selected from the group consisting of anti-miGrotubule agents, platinum coordination complexes, alkylating agents, antibiotic agents, topoisomerase Il inhibitors, antimetabolites, topoisomerase I inhibitors, hormones and hormonal analogues, signal transduction pathway inhibitors, non-receptor tyrosine kinase angiogenesis inhibitors, immunotherapeutic agents, proapoptotic agents, and cell cycle signaling inhibitors. Because the pharmaceutically active compounds of the present invention are active as AKT inhibitors they exhibit therapeutic utility in treating cancer and arthritis.
Suitably, the present invention relates to a method for treating or lessening the severity of a cancer selected from brain (gliomas), glioblastomas, Bannayan- Zonana syndrome, Cowden disease, Lhermitte-Duclos disease, breast, colon, head and neck, kidney, lung, liver, melanoma, ovarian, pancreatic, prostate, sarcoma and thyroid.
Suitably, the present invention relates to a method for treating or lessening the severity of a cancer selected from ovarian, breast, pancreatic and prostate.
Isolation and Purification of His-taqqed AKT1 (aa 136-480) Insect cells expressing His-tagged AKT1 (aa 136-480) were lysed in 25 mM HEPES, 100 mM NaCI, 20 mM imidazole; pH 7.5 using a polytron (5 mLs lysis buffer/g cells). Cell debris was removed by centrifuging at 28,000 x g for 30 minutes. The supernatant was filtered through a 4.5-micron filter then loaded onto a nickel-chelating column pre-equilibrated with lysis buffer. The column was washed with 5 column volumes (CV) of lysis buffer then with 5 CV of 20% buffer B, where buffer B is 25 mM HEPES, 100 mM NaCl, 300 mM imidazole; pH 7.5. His- tagged AKT1 (aa 136-480) was eluted with a 20-100% linear gradient of buffer B over 10 CV. His-tagged AKT1 (136-480) eluting fractions were pooled and diluted 3-fold with buffer C, where buffer C is 25 mM HEPES, pH 7.5. The sample was then chromatographed over a Q-Sepharose HP column pre-equilibrated with buffer C. The column was washed with 5 CV of buffer C then step eluted with 5 CV 10%D, 5 CV 20% D, 5 CV 30% D, 5 CV 50% D and 5 CV of 100% D; where buffer D is 25 mM HEPES, 1000 mM NaCI; pH 7.5. His-tagged AKT1 (aa 136-480) containing fractions were pooled and concentrated in a 10-kDa molecular weight cutoff concentrator. His-tagged AKT 1 (aa 136-480) was chromatographed over a Superdex 75 gel filtration column pre-equilibrated with 25 mM HEPES, 200 mM NaCI, 1 mM DTT; pH 7.5. His-tagged AKT1 (aa 136-480) fractions were examined using SDS-PAGE and mass spec. The protein was pooled, concentrated and frozen at -80C.
His-tagged AKT2 (aa 138-481 ) and His-tagged AKT3 (aa 135-479) were isolated and purified in a similar fashion.
His-taqqed AKT Enzyme Assay
Compounds of the present invention were tested for AKT 1 , 2, and 3 protein serine kinase inhibitory activity in substrate phosphorylation assays. This assay examines the ability of small molecule organic compounds to inhibit the serine phosphorylation of a peptide substrate. The substrate phosphorylation assays use the catalytic domains of AKT 1 , 2, or 3. AKT 1, 2 and 3 are also commercially available from Upstate USA, Inc. The method measures the ability of the isolated enzyme to catalyze the transfer of the gamma-phosphate from ATP onto the serine residue of a biotinylated synthetic peptide SEQ. ID NO: 1 (Biotin-ahx- ARKRERAYSFGHHA-amide). Substrate phosphorylation was detected by the following procedure:
Assays were performed in 384well U-bottom white plates. 10 nM activated AKT enzyme was incubated for 40 minutes at room temperature in an assay volume of 2OuI containing 5OmM MOPS, pH 7.5, 2OmM MgCl2, 4uM ATP, 8uM peptide, 0.04 uCi [g- P] ATP/well, 1 mM CHAPS, 2 mM DTT, and 1 ul of test compound in 100% DMSO. The reaction was stopped by the addition of 50 ul SPA bead mix (Dulbecco's PBS without Mg2+ and Ca2+, 0.1% Triton X-100, 5mM EDTA, 5OuM ATP, 2.5mg/ml Streptavidin-coated SPA beads.) The plate was sealed, the beads were allowed to settle overnight, and then the plate was counted in a Packard Topcount Microplate Scintillation Counter (Packard Instrument Co., Meriden, CT).
The data for dose responses were plotted as % Control calculated with the data reduction formula 100*(U1-C2)/(C1-C2) versus concentration of compound where U is the unknown value, C1 is the average control value obtained for DMSO, and C2 is the average control value obtained for 0.1 M EDTA. Data are fitted to the curve described by: y = ((Vmax * x) / ( K + x )) where Vmax is the upper asymptote and K is the lC50.
Cloning of full-length human (FU AKT1 :
Full-length human AKT1 gene was amplified by PCR from a plasmid containing myristylated-AKT1-ER (gift from Robert T. Abraham, Duke University under MTA, described in Klippel et al. in Molecular and Cellular Biology 1998 Volume 18 p.5699) using the 5' primer: SEQ.ID NO: 1 , 5' TATATAGGATCCATGAGCGACGTGGC 3' and the 3' primer: SEQ.ID NO: 2, AAATTTCTCGAGTCAGGCCGTGCTGCTGG 3'. The 5' primer included a BamHI site and the 3'primer included an Xhol site for cloning purposes. The resultant PCR product was subcloned in pcDNA3 as a BamHI / Xhol fragment. A mutation in the sequence (TGC) coding for a Cysteine25 was converted to the wild-type AKT1 sequence (CGC) coding for an Arginine25 by site-directed mutagenesis using the QuikChange® Site Directed Mutagenesis Kit (Stratagene). The AKT1 mutagenic primer: SEQ.ID NO: 3, 5' ACCTGGCGGCCACGCTACTTCCTCC and selection primer: SEQ.ID NO: 4, 5' CTCGAGCATGCAACTAGAGGGCC (designed to destroy an Xbal site in the multiple cloning site of pcDNA3) were used according to manufacturer's suggestions. For expression/purification purposes, AKT1 was isolated as a BamHI / Xhol fragment and cloned into the BamHI / Xhol sites of pFastbacHTb (Invitrogen). Expression of FL human AKT1 :
Expression was done using the BAC-to-BAC Baculovirus Expression System from Invitrogen (catalog # 10359-016). Briefly 1 ) the cDNA was transferred from the FastBac vector into bacmid DNA, 2) the bacmid DNA was isolated and used to transfect Sf9 insect cells, 3) the virus was produced in Sf9 cells, 4) T. ni cells were infected with this virus and sent for purification.
Purification of FL human AKT1 :
For the purification of full-length AKT1 , 13O g sf9 cells (batch # 41646W02) were resuspended in lysis buffer (buffer A, 1 L, pH 7.5) containing 25 mM HEPES, 100 mM NaCI, and 20 mM imidazole. The cell lysis was carried out by Avestin (2 passes at 15K-20K psi). Cell debris was removed by centrifuging at 16K rpm for 1 hour and the supernatant was batch bound to 10 mi Nickel Sepharose HP beads at 4 C for over night. The beads were then transferred to column and the bound material was eluted with buffer B (25 mM HEPES, 100 mM NaCI, 300 mM imidazole, pH 7.5). AKT eluting fractions were pooled and diluted 3 fold using buffer C (25 mM HEPES, 5 mM DTT; pH 7.5). The sample was filtered and chromatographed over a 10 mL Q-HP column pre-equilibrated with buffer C at 2 mL/min.
The Q-HP column was washed with 3 column volume (CV) of buffer C, then step eluted with 5 CV 10%D, 5 CV 20% D, 5 CV 30% D, 5 CV 50% D and 5 CV of 100% D; where buffer D is 25 mM HEPES, 1000 mM NaCI, 5 mM DTT; pH 7.5. 5 mL fractions collected. AKT containing fractions were pooled and concentrated to 5 ml. The protein was next loaded to a 120 ml Superdex 75 sizing column that was pre-equilibrated with 25 mM HEPES, 200 mM NaCI, 5 mM DTT; pH 7.5. 2.5 mL fractions were collected.
AKT 1 eluting fractions were pooled, aliquoted (1 ml) and stored at -80C. Mass spec and SDS-PAGE analysis were used to confirm purity and identity of the purified full-length AKT1. Full length AKT2 and full length AKT3 were cloned, expressed and purified in a similar fashion.
AKT Enzyme Assay Compounds of the present invention are tested for AKT 1 , 2, and 3 protein serine kinase inhibitory activity in substrate phosphorylation assays. This assay examines the ability of small molecule organic compounds to inhibit the serine phosphorylation of a peptide substrate. The substrate phosphorylation assays use the catalytic domains of AKT 1 , 2, or 3. AKT 1 , 2 and 3 are also commercially available from Upstate USA, Inc. The method measures the ability of the isolated enzyme to catalyze the transfer of the gamma-phosphate from ATP onto the serine residue of a biotinylated synthetic peptide SEQ. ID NO: 5 (Biotin-ahx- ARKRERAYSFGHHA-amide). Substrate phosphorylation is detected by the following procedure: Assays are performed in 384well U-bottom white plates. 10 nM activated
AKT enzyme is incubated for 40 minutes at room temperature in an assay volume of 2OuI containing 5OmM MOPS, pH 7.5, 2OmM MgCl2, 4uM ATP, 8uM peptide, 0.04 uCi [g- P] ATP/well, 1 mM CHAPS, 2 mM DTT, and 1ul of test compound in 100% DMSO. The reaction is stopped by the addition of 50 ul SPA bead mix (Dulbecco's PBS without Mg2+ and Ca2+, 0.1 % Triton X-100, 5mM EDTA, 5OuM
ATP, 2.5mg/ml Streptavidin-coated SPA beads.) The plate is sealed, the beads are allowed to settle overnight, and then the plate is counted in a Packard Topcount Microplate Scintillation Counter (Packard Instrument Co., Meriden, CT).
The data for dose responses are plotted as % Control calculated with the data reduction formula 100*(U1-C2)/(C1-C2) versus concentration of compound where U is the unknown value, C1 is the average control value obtained for DMSO, and C2 is the average control value obtained for 0.1 M EDTA. Data are fitted to the curve described by: y = ((Vmax * x) / ( K + x )) where Vmax is the upper asymptote and K is the lC50.
Compounds of the invention are tested for activity against AKT1 , AKT2, and AKT3 in the above assay. The compounds of Examples 5, 7, 43, 49, 53, 58, 76, 78, 104, 144, 174, 184 and 185 were tested in the above AKT enzyme assay and each exhibited an 1C50 value less than or equal to 0.5uM against AKT1 , AKT2 and AKT3.
The pharmaceutically active compounds within the scope of this invention are useful as AKT inhibitors in mammals, particularly humans, in need thereof.
The present invention therefore provides a method of treating cancer, arthritis and other conditions requiring AKT inhibition, which comprises administering an effective compound of Formula (I) or a pharmaceutically acceptable salt, hydrate, solvate or pro-drug thereof. The compounds of Formula (I) also provide for a method of treating the above indicated disease states because of their demonstrated ability to act as Akt inhibitors. The drug may be administered to a patient in need thereof by any conventional route of administration, including, but not limited to, intravenous, intramuscular, oral, subcutaneous, intradermal, and parenteral.
The pharmaceutically active compounds of the present invention are incorporated into convenient dosage forms such as capsules, tablets, or injectable preparations. Solid or liquid pharmaceutical carriers are employed. Solid carriers include, starch, lactose, calcium sulfate dihydrate, terra alba, sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate, and stearic acid. Liquid carriers include syrup, peanut oil, olive oil, saline, and water. Similarly, the carrier or diluent may include any prolonged release material, such as glyceryl monostearate or glyceryl distearate, alone or with a wax. The amount of solid carrier varies widely but, preferably, will be from about 25 mg to about 1 g per dosage unit. When a liquid carrier is used, the preparation will be in the form of a syrup, elixir, emulsion, soft gelatin capsule, sterile injectable liquid such as an ampoule, or an aqueous or nonaqueous liquid suspension.
The pharmaceutical preparations are made following conventional techniques of a pharmaceutical chemist involving mixing, granulating, and compressing, when necessary, for tablet forms, or mixing, filling and dissolving the ingredients, as appropriate, to give the desired oral or parenteral products.
Doses of the presently invented pharmaceutically active compounds in a pharmaceutical dosage unit as described above will be an efficacious, nontoxic quantity preferably selected from the range of 0.001 - 100 mg/kg of active compound, preferably 0.001 - 50 mg/kg. When treating a human patient in need of an Akt inhibitor, the selected dose is administered preferably from 1-6 times daily, orally or parenteraily. Preferred forms of parenteral administration include topically, rectally, transdermally, by injection and continuously by infusion. Oral dosage units for human administration preferably contain from 0.05 to 3500 mg of active compound. Oral administration, which uses lower dosages is preferred. Parenteral administration, at high dosages, however, also can be used when safe and convenient for the patient.
Optimal dosages to be administered may be readily determined by those skilled in the art, and will vary with the particular Akt inhibitor in use, the strength of the preparation, the mode of administration, and the advancement of the disease condition. Additional factors depending on the particular patient being treated will result in a need to adjust dosages, including patient age, weight, diet, and time of administration.
The method of this invention of inducing Akt inhibitory activity in mammals, including humans, comprises administering to a subject in need of such activity an effective Akt inhibiting amount of a pharmaceutically active compound of the present invention.
The invention also provides for the use of a compound of Formula (I) in the manufacture of a medicament for use as an Akt inhibitor.
The invention also provides for the use of a compound of Formula (I) in the manufacture of a medicament for use in therapy. The invention also provides for the use of a compound of Formula (I) in the manufacture of a medicament for use in treating cancer.
The invention also provides for the use of a compound of Formula (I) in the manufacture of a medicament for use in treating arthritis.
The invention also provides for a pharmaceutical composition for use as an Akt inhibitor which comprises a compound of Formula (I) and a pharmaceutically acceptable carrier.
The invention also provides for a pharmaceutical composition for use in the treatment of cancer which comprises a compound of Formula (I) and a pharmaceutically acceptable carrier. The invention also provides for a pharmaceutical composition for use in treating arthritis which comprises a compound of Formula (I) and a pharmaceutically acceptable carrier.
No unacceptable toxicological effects are expected when compounds of the invention are administered in accordance with the present invention. In addition, the pharmaceutically active compounds of the present invention can be co-administered with further active ingredients, such as other compounds known to treat cancer or arthritis, or compounds known to have utility when used in combination with an Akt inhibitor.
Without further elaboration, it is believed that one skilled in the art can, using the preceding description, utilize the present invention to its fullest extent. The following Examples are, therefore, to be construed as merely illustrative and not a limitation of the scope of the present invention in any way.
Experimental Details
The compounds of Examples 1 to 191 are readily made according to Schemes 1 to 6 or by analogous methods.
Preparation 1
Preparation of 1-(phenylsulfonylV3-(4.4,5,5-tetramethyl-1.3.2-dioxaborolan-2-ylV 1 H-pyrrolor2,3-b1pyridine a) 3-iodo-1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridine
To a solution of 3-iodo-1 H-pyrrolo[2,3-b]pyridine (42.4 mmol) [prepared according to J. Med. Chem. 1997 40, 2430], phenylsulfonyl chloride (11 mL, 85.7 mmol) and tetrabutylammonium hydrogensulfate (575 mg, 1.69 mmol) in DCM (211 mL) at 25 0C was added dropwise a solution of 6N NaOH (26 mL). After stirring 12h, the solution was partitioned between a saturated solution of ammonium chloride. The aqueous phase was back extracted several times with DCM and the combined organic fractions were dried (Na2SO4) and concentrated. The residue was then tritrated with MeOH and filtered affording the title compound (13g, 80%) as a brown solid; LCMS (m/e) 386 (M+H)+.
b) 1-(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H- pyrrolo[2,3-b]pyridine
A solution of 3-iodo-1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridine (4.2 g , 10.9 mmol), bis-pinacolatodiboron (5.6 g, 21.8 mmol), potassium acetate (3.2 g, 32.7 mmol) and Pd(dppf)CI2-complex with dichloromethane (788 mg, 0.982 mmol) in
DMF (40 mL) was stirred at 90 0C for 2h in a sealed tube. The solution was cooled by the addition of ice and made basic to pH 12-14 with 6N NaOH. The aqueous phase was extracted with DCM then made acidic to pH ~1 with 6N HCI. The aqeous phase was extracted several times with DCM and the combined fractions were dried (Na2SO4) and concentrated affording the title compound (4.2g, quant.) as a brown solid which was used without further purification; LCMS (m/e) 386 (boronic ester M+H)+, 303 (boronic acid M+H)+.
Preparation 2
Preparation of 1-(phenylsulfonyl')-4-(4,415,5-tetramethyl-1,3,2-dioxaborolan-2-yl)- 1 H-pyrrolor2,3-blpyridine
a) 7-azaindole-N-oxide
A solution of mCPBA (23 g, 0.103 mol) in EtOAC (56 ml_) was added dropwise to a 0 0C solution of 7-azaindole (10 g, 84.6 mmol) in EtOAc (84 ml_). An additional amount of EtOAc (50 mL) was added to assist in stirring and the solution warmed to 25 0C over 12h. A saturated solution of K2CO3 was added to Ph ~9 and the solution was extracted with EtOAc affording the title compound (6.7 g, 59%) as an off-white solid which was used directly: LCMS (m/e) 135 (M+H)+.
b) 4-bromo-1 H-pyrrolo[2,3-b]pyridine
To a 0 0C solution of 7-azaindole-N-oxide (3 g, 22.4 mmol) and tetrabutylammonium bromide (1 1 g, 33.6 mmol) in DMF (37 mL) was added dropwise a solution of methanesulfonic anhydride (5.9 g, 33.6 mmol) in DMF (10 mL). After 4h warming to 25 °C, the solution was added to H2O (50 mL) then neutralized using 1 N NaOH. The resulting precipitate was filtered, stirred in DCM at 0°C for 0.5h and filtered affording the title compound (1 g, 23%) as a pale white solid: LCMS (m/e) 198 (M+H)+.
c) 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3- b]pyridine The title compound was prepared as a brown solid according to Preparation
1 , except substituting 4-bromo-1 H-pyrrolo[2,3-b]pyridine (1 g, 5.08 mmol) for 3- iodo-1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridine: LCMS (m/e) 386 (boronic ester M+H)+, 303 (boronic acid M+H)\
Preparation 3
Preparation of 14(4-Methylphenyl)sulfonyl1-4-(4A5.5-tetramethyl-1,3.2- dioxaborolan-2-vO-1 H-pyrrolor2,3-ιblpvridine
Prepared according to the procedure of Preparation 2, except substituting benzenesulfonyl chloride for toluenesulfonyl chloride, the title compound was prepared as a brown solid (1.7 g, 77 %). 1H NMR (400MHz, DMSO-c/6) ppm 1.32 (s, 12H), 2.33 (s, 3H), 6.95 (d, 1 H1 J = 4.0 Hz), 7.40 (d, 2H, J = 8.1 Hz), 7.47 (d, 1 H, J = 4.5 Hz), 7.93-7.98 (m, 3H), 8.38 (d, 1 H, J = 4.5 Hz). LC/MS: m/z 399 (M+1)+.
Preparation 4
Preparation of A/-(r3-(Methyloxy)phenvπmethyl}-5-(4.4,5,5-tetramethyl-1.3,2- dioxaborolan^-vO-Σ-thiophenecarboxamide
a) 5-Bromo-Λ/-{[3-(methyloxy)phenyl]methyl}-2-thiophenecarboxamide —
N-[3-(Dimethylamino)propyl]-Λ/'-ethylcarbodiimide hydrochloride (3.1 g, 16.0 mmol) was added to a solution of 5-bromo-2-thiophenecarboxylic acid (3.0 g, 14.5 mmol) and {[3-(methyloxy)phenyl]methyl}amine (2.0 g, 14.8 mmol) in DMF (150 ml_). And then, the mixture was stirred at rt for 1 h. The reaction mixture was diluted with aqueous NH4CI and extracted with AcOEt. The solvent was removed in vacuo to give 5-bromo-Λ/-{[3-(methyloxy)phenyl]methyl}-2-thiophenecarboxamide as a white solid.
b) Λ/-{[3-(Methyloxy)phenyl]methyl}-5-(4J4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)- 2-thiophenecarboxamide
5-Bromo-Λ/-{[3-(methyloxy)phenyl]methyl}-2-thiophenecarboxamide (3.6 g,
10.9 mmol), 4,4,4',4',5,5,5',5I-octamethyl-2,2'-bi-1 ,3,2-dioxaborolane (5.5 g, 21.7 mmol), KOAc (3.2 g, 32.7 mmol) and Pd(dppf)CI2 (0.8 g, 1.1 mmol) in DMF (50 mL) was refluxed for 24 h under inert atmosphere. After cooling to rt, 1Λ/ aqueous NaOH was added till the aqueous layer was taken to pH 10. The above mixture was washed with CH2CI2. Then the aqueous layer was carefully acidified to pH 4 with 1 N aqueous HCI. Extracted with CH2Cl2 (2OmL X 3 times), and the organic layer was concentrated under reduced pressure, and the desired boronic ester was obtained as a brown solid (2.5 g, 61 %). 1H NMR (400MHz, DMSO-d6) ppm 1.29 (s, 12H), 3.73 (s, 3H), 4.42 (d, 2H, J = 6.1 Hz), 6.82 (ddd, 1 H1 J = 0.5, 2.5, 8.1 Hz), 6.86-6.89 (m, 2H), 7.25 (t, 1 H, J = 8.1 Hz), 7.54 (d, 1 H1 J = 3.8 Hz), 7.84 (d, 1 H, J = 3.8 Hz), 9.13 (t, 1 H, J = 6.1 Hz). LC/MS: m/z 372 (M-1 )-, 374 (M-M )+.
Preparation 5
Preparation of 5-Bromo-Λ/-r2-(dimethylaminoV1-phenylethyll-2- thiophenecarboxamide
Prepared according to the procedure of Preparation 4 (Step a) , except substituting Λ/',Λ/'-dimethyl-1-phenyl-1 ,2-ethanediamine for {[3- (methyloxy)phenyl]methyl}amine, to prepare the title compound.
Preparation 6
Preparation of 1 ,1-dimethylethyl (3-hvdroxy-3-phenylpropyπcarbamate
a) 3-amino-1-phenyl-1-propanol
Benzoylacetonitrile (2g, 13.8 mmol) in THF (35 mL) was added dropwise via addition funnel to a 0 0C solution of LAH (1.6 g, 41.3 mmol) in THF (35 mL). The resulting solution warmed to 25 °C and then was heated to 60 0C for an additional 2h. After cooling to 0 0C, a saturated solution of sodium potassium tartrate was added dropwise and the solution was extracted several times with DCM. The combined organic fractions were dried (Na2SO4), concentrated and purified via column chromatography (silica, 5-8% MeOH in DCM (1 % NH4OH)) affording the amino alcohol (1.4 g, 67%) as a clear oil: LCMS (ES) m/z 152 (M+H)+.
b) 1,1-dimethylethyl (3-hydroxy-3-phenylpropyl)carbamate
3-amino-1-phenyl-1-propanol (1.4 g, 9.27 mmol) was re-dissolved in THF (50 mL) and BoC2O (2.4 g, 11.1 mmol) was added in one portion. After 30 min., the solution was concentrated and the residue purified through a silica plug (0.5-1 % MeOH in DCM (1 % NH4OH)) affording the title compound (1.6 g, 69%) as a pale white solid: LCMS (ES) m/z 152 (M+H)+.
Preparation 7
Preparation of 2-[(2SV2-amino-3-Dhenylpropyll-1 H-isoindole-1 ,3(2HV-dione
a) 1 ,1-dimethylethyl [(1 S)-2-(1 ,3-dioxo-1 ,3-dihydro-2H-isoindol-2-yl)-1- (phenylmethyl)ethyl]carbamate
To a solution of (S)-(-)-2-(tert-butoxycarbonylamino)-3-phenyl-1-propanol (3.0 g, 11.9 mmole), PPh3 (3.74 g, 14.4 mmole) and phthalimide (1.93 g, 13.1 mmole) in THF (75 ml_) at RT was added DEAD (2.8 ml_, 17.8 mmole) over 5 min. After 1.5 h at RT, the reaction solution was concentrated and purified on silica (hexanes/EtOAC, 2:1) to give the title compound as a white solid (4.3 g, 95%): LCMS (ES) m/z 381 (M+H)+.
b) 2-[(2S)-2-amino-3-phenylpropyl]-1 H-isoindole-1 ,3(2H)-dione To a solution of 1 ,1-dimethylethyl [(1 S)-2-(1 ,3-dioxo-1,3-dihydro-2/-/-isoindol-
2-yl)-1-(phenylmethyl)ethyl]carbamate (4.3 g, 11.3 mmole) in MeOH (100 mi_) at RT was added 4M HCI in dioxane (50 ml_). After stirring for 3h at RT, the reaction solution was concentrated to a white solid (quant.) : LCMS (ES) m/z 281 (M+H)÷.
Preparation 8
Preparation of 3-(U(1.1-dimethylethvπoxy1carbonvi"i-aminoV2- (phenylmethvQpropanoic acid a) diethyl 2-[(1 ,3-dioxo-1 ,3-dihydro-2/-/-tsoindol-2-yl)methyl]-2- (phenylmethyl)butanedioate
To a suspension of NaH (2.2 g, 54 mmole) in THF (200 ml_) was added diethyl 2-(phenylmethyl)butanedioate (12.5 g, 49.9 mmole). After 30 min at RT, bromomethyl phthalimide was added to the reaction mixture and the contents were stirred for 14 h at RT. The reaction was quenched with H2O (15 mL), diluted with Et2O (300 mL) and layers separated. The organic layer was concentrated under vacuum and the resulting residue recrystallized from EtOH (0°) to give the title compound (13 g, 64%) as a white solid: LCMS (ES) m/z 410 (M+H)+.
b) 3-amino-2-(phenylmethyl)propanoic acid
A solution of diethyl 2-[(1 ,3-dioxo-1 ,3-dihydro-2/-/-isoindol-2-yl)methyl]-2-
(phenylmethyl)butanedioate (13 g, 31.8 mmole) in cone. HCI (125 mL) and HOAc (30 mL) was sealed in a 1 L screwcap reaction vessel and the contents heated to 1200C for 48h. The reaction solution was concentrated under vacuum and the resulting solids washed with Et2O affording the title compound (quant.) as a white solid: LCMS (ES) m/z 181 (M+H)+.
G) 3-({[(1.i-dimethylethyOoxylcarbonyllamino^-CphenylmethyOpropanoic acid
To a solution of 3-amino-2-(phenylmethyl)propanoic acid (from previous reaction) in dioxane (100 mL) and H2O (20 mL) was added Boc anhydride (10.1 g, 46.5 mmole) and 6M NaOH solution (26 mL). After stirring at RT for 12 h, the reaction solution was concentrated under vacuum, neutralized with 3M HCI and extratcted with DCM. The organic layer was dried over Na2SO4 and concentrated to a viscous oil. The oil was washed with pentane and dried under high vacuum to give the title compound (5.0 g, 17.9 mmole, 58% for 2 steps) as a white solid: LCMS (ES) m/z 280 (M+H)+.
Preparation 9
Preparation of 1.1-dimethylethyl {2-amino-2-r2-(methyloxy')phenyllethyl)carbamate
a) hydroxy[2-(methyloxy)phenyl]acetonitrile
2-(methyloxy)benzaldehyde (7.7g, 56.6 mmol) in AcOH was added drop wise over 30 minutes to a vigorously stirred mixture of KCN in Et2O at 0 "C. Upon complete addition, the reaction mixture was allowed to warm to room temperature over night. The reaction mixture was filtered to remove KOAc and Et2O removed to give the product (8.5 g, 95%) as a dear oil carried forward without further purification: LCMS (ES) m/z 164 (M+H)+.
b) 2-amino-1-[2-(methyloxy)phenyl]ethanol
hydroxy[2-(methyloxy)phenyl]acetonitrile (8.4 g, 52.3 mmol) in THF (100 mL) was added drop wise via addition funnel to a 25 0C solution of LAH (1.6 g, 41.3 mmol) in THF (100 mL) over 45 minutes allowing the reaction temperature to warm to about 60 0C. Upon complete addition of amine, the reaction temperature was allowed to cool to room temperature and reaction was determined to be complete by LCMS. After cooling to 0 0C, a saturated solution of sodium potassium tartrate was added drop wise and the solution was extracted several times with DCM. The combined organic fractions were dried (Na2SO4), concentrated affording the amino alcohol (7.7 g, 88%) as a clear oil that was carried forward without further purification: LCMS (ES) m/z 167 (M+H)+. c) 1 ,1-dimethylethyl {2-hydroxy-2-[2-(methyloxy)pheπyl]ethyl}carbamate
2-amino-1-[2-(methyloxy)phenyl]ethanol (7.7 g, 46.0 mmol) was re-dissolved in THF (50 mL) and BOC2O (2.4 g, 1 1.1 mmol) was added in one portion. After 30 min., the solution was concentrated and the residue purified through a silica plug (5% MeOH in DCM (0.5% NH4OH)) affording the title compound (10.0 g, 81%) as a pale white solid: LCMS (ES) m/z 268 (M+ H)+.
d) 1 , 1-dimethylethyl {2-(1 ,3-dioxo-1 ,3-dihydro-2H-isoindol-2-yl)-2-[2- (methyloxy)phenyl]ethyl}carbamate
To a solution of 1,1-dimethylethyl {2-hydroxy-2-[2-
(methyloxy)phenyl]ethyl}carbamate (1.0 g, 4.0 mmol), PPh3 (1.6 g, 6.1 mmol) and phthalimide (0.59 g, 4.0 mmol) in THF (20 mL) at RT was added DEAD (0.96 mL, 6.1 mmol) over 5 min. After 0.5 h at RT, the reaction solution was concentrated and purified on silica (hexanes/EtOAC, 2:1 ) to give the title compound as a white solid (0.8 g, 49%): LCMS (ES) m/z 397 (M+H)+.
e) 1 , 1 -dimethylethyl {2-amino-2-[2-(methyloxy)phenyl]ethyl}carbamate NH2NH2 (0.7 mL, 22.3 mmol) was added to a THF/MeOH (8mL/8mL) solution of 1 ,1-dimethylethyl {2-(1 ,3-dioxo-1,3-dihydro-2/-/-isoindol-2-yl)-2-[2- (methyloxy)phenyl]ethyl}carbamate (0.8 g, 1.97 mmol) and stirred overnight. After 12 hours, the solution was concentrated and purified by column chromatography using 5% MeOH in CHCI3 containing 0.5% NH4OH to give the title compound (328 mg, 30%) as a white solid: LC-MS (ES) m/z = 267 (M+H)+.
Preparation 10
Preparation of 1.1-dimethylethyl (2-amino-4-phenylbutyl')carbamate a) 2-(2-phenylethyl)oxirane
3-chlorobenzenecarboperoxoic acid (12.1 g, 54.0 mmol) is added in one portion to a solution of 3-buten-1-ylbenzene (7.15 g, 54.1 mmol) in CH2CI2 at 0 DC followed by warming to 25 0C overnight. Saturated NaHCO3 was added and the mixture separated and the resulting clear oil (8.0 g, quant.) was carried forward without further purification: LC-MS (ES) m/z = 149 (M+H)+.
b) 1-amino-4-phenyl-2-butanol
2-(2-phenylethyl)oxirane (8.0 g, 54 mmol) was placed in a sealed tube with 7N NH3-MeOH (130 ml_) and stirred 2 hours at 70 °C followed by concentration to a clear oil ( and was used without further purification in the following step.
c) 1,1-dimethylethyl (2-hydroxy-4-phenylbutyl)carbamate
1-amino-4-phenyl-2-butanol (7.4 g, 50.0 mmol) was dissolved in THF (50 mL) and BoC2O (13 g, 59.6 mmol) was added in one portion. After 30 min., the solution was concentrated and the residue purified through a silica plug (5% MeOH in DCM (0.5% NH4OH)) affording the title compound (13.1 g, 91%) as a clear yellow oil: LCMS (ES) m/z 266 (M+H)+.
d) 1,1-dimethylethyl [2-(1 ,3-dioxo-1,3-dihydro-2/-Wsoindol-2-yl)-4- phenylbutyl]carbamate
To a solution of 1,1-dimethylethyl (2-hydroxy-4-phenylbutyl)carbamate (3.0 g, 11.4 mmol), PPh3 (3.6 g, 13.7 mmol) and phthalimide (1.84 g, 12.5 mmol) in THF (60 ml_) at RT was added DEAD (1.8 mL, 11.4 mmol) over 5 min. After 0.5 h at RT, the reaction solution was concentrated and purified on silica (hexanes/EtOAC, 2:1) to give the title compound as a white solid (3.1 g, 69%): LCMS (ES) m/z 395 (IvHH)+.
e) 1 ,1-dimethylethyl (2-amino-4-phenylbutyl)carbamate NH2NH2 (2.5 mL, 79.6 mmol) was added to a THF/MeOH (40mL/40mL) solution of 1,1-dimethylethyl (2-amino-4-phenylbutyl)carbamate (3.1 g, 7.83 mmol) and stirred overnight. After 12 hours, the solution was concentrated and purified by column chromatography using 5% MeOH in CHCI3 containing 0.5% NH4OH to give the title compound (1.4 mg, 66%) as a white solid: LC-MS (ES) m/z = 265 (M+H)+.
Preparation 11
Preparation of 2-{(2S)-2-amino-3-r4-(methyloxy")phenvπpropyl>-1 f/-isoindole- 1 ,3(2/-ft-dione
a) 1 , 1-dimethylethyl ((1 S)-2-hydroxy-1-{[4- (methyloxy)phenyl]methyl}ethyl)carbamate
1M BH3 in THF (47 mL, 47 mmol) was added to a THF (35 ml_) solution of Λ/-{[(1 , 1-dimethylethyl)oxy]carbonyl}-O-methyl-L-tyrosine (2.7 g, 9.4 mmol) at 0 °C and stirred 2 hours then placed in freezer overnight. The reaction mixture was quenched by slow addition of a solution of AcOH (15 mL) in MeOH (30 mL) at 0 0C over 1 hour. The mixture was allowed to warm to room temperature and saturated NaHCO3 (100 mL) added. The layers were separated and organic layer evaporated to yield a clear oil (1.92 g, 78%) carried forward without further purification: LCMS (ES) m/z 266 (M+H)+.
b) 1 , 1-dimethylethyl ((1 S)-2-(1 ,3-dioxo-1 ,3-dihydro-2H-isoindol-2-yl)-1 -{[4- (methyloxy)phenyl]methyl}ethyl)carbamate
To a solution of 1 , 1-dimethylethyl ((1 S)-2-hydroxy-1-{[4- (methyloxy)phenyl]methyl}ethyl)carbamate (1.9 g, 7.2 mmol), PPh3 (2.9 g, 11.0 mmol) and phthalimide (1.1 g, 7.2 mmol) in THF (36 mL) at RT was added DEAD (4.3 mL, 10.9 mmol) over 5 min. After 0.5 h at RT, the reaction solution was concentrated and purified on silica (hexanes/EtOAC, 2:1) to give the title compound as a white solid (2.7 g, 83%): LCMS (ES) m/z 395 (M+H)+.
c) 2-{(2S)-2-amino-3-[4-(methyloxy)phenyl]propyl}-1 H-isoindole-1 ,3(2H)-dione
To a solution of 1 , 1-dimethylethyl ((1 S)-2-(1 ,3-dioxo-1 ,3-dihydro-2H- isoindol-2-yl)-1-{[4-(methyloxy)phenyl]methyl}ethyl)carbamate (2.7 g, 6.0 mmol) in CHCI3 (40 mL) and MeOH (2 mL) at RT was added 4M HCI in dioxane (20 mL). After stirring for overnight at RT, the reaction solution was concentrated to a white solid (quant.) : LCMS (ES) m/z 295 (M+H)+.
Example 1
Preparation of 3-amino-2-phenyl-Λ/-r4-f 1 A7-pyrrolor2.3-άipyridin-3-yl')-2- thienylipropanamide
a) 1 ,1-dimethylethyl (4-bromo-2-thienyl)carbamate
To a mixture of 5-bromothiophenecarboxylic acid (24.2 mmoles, 5.0 g) in t- BuOH (20 ml_) was added DPPA (31.4 mmoles, 6.8 mL) and triethyl amine (72.6 mmole, 10.1 mL). The mixture was heated to 85 °C for 15 h under an atmosphere of N2. After cooling to RT, the reaction was concentrated in vacuo. Flash chromatography (silica gel, hexanes/EtOAc, 4:1 )) gave the title compound (4.0 g, 60%) as a tan foam. LCMS (ES) m/z 278 (M+H)+.
b) 1,1-dimethylethyl {4-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin-3-yl]-2- thienyl}carbamate
To a solution of 1 ,1-dimethylethyl (4-bromo-2-thienyl)carbamate (1.26 g, 5.58 mmole) in dioxane (40 mL) and H2O (8 ml_) was added K2CO3 (2.31 g, 16.74 mmole), tetrakistriphenylphosphine Pd(O) (0.65 g, 0.56 mmole), and 1- (phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1H-pyrrolo[2,3- 6]pyridine (2.15 g, 5.58 mmole). The reaction mixture was heated to 70° C in a sealed tube for 4h. The reaction solution was poured onto H2O (100 mL) and extracted with DCM. The organics were dried (Na2SO4), concentrated under vacuum, and purified on silica gel (hexanes/EtOAc, 1 :1 ) to give the title compound (1.90 g, 75%) as a tan foam: LC-MS (ES) m/z = 456.
c) 1,1-dimethylethyl [3-oxo-2-phenyl-3-({4-[1-(phenylsulfonyl)-1 W-pyrrolo[2,3- b]pyridin-3-yl]-2-thienyl}amino)propyl]carbamate
To a solution of 1 ,1-dimethylethyl {4-[1-(phenylsulfonyl)-1 /-/-pyrrolo[2,3- ύ]pyridin-3-yl]-2-thienyl}carbamate (1 .0 g, 2.2 mmole) in methanol (20 mL) was added 4M HCI in dioxane (5 mL). The reaction was allowed to stir at RT for 4h and then concentrated to a solid under vacuum. To a solution of 3-({[(1 ,1-dimethylethyl)oxy]carbonyl}amino)-2- phenylpropanoic acid (0.87 g, 3.3 mmole) in DCM (50 ml_) was added PyBrop (1.54 g, 3.3 mmole) and Hunig's base (1.9 mL, 11.0 mmole). After 15 min., the residual amine from above was added to the reaction mixture in DCM (10 mL) and stirred for 12h at RT. The reaction solution was concentrated under vacuum and purified on silica gel (DCM/MeOH, 95:5) to give the title compound (1.0 g, 76%) as a tan foam: LC-MS (ES) m/z = 603.
d) 3-amino-2-phenyl-Λ/-[4-(1 H-pyrrolot2,3-6]pyridin-3-yl)-2-thienyl]propanamide
To a solution of 1 ,1-dimethylethyl [3-oxo-2-phenyl-3~({4-[1-(phenylsulfonyl)- 1W-pyrrolo[2,3-<b]pyridin-3-yl]-2-thienyl}amino)propyl]carbamate (1.0 g, 1.66 mmole) in THF (10 mL) and MeOH (20 mL) was added 6N NaOH (3 mL). After 1 h at 55 0C, the reaction mixture was neutralized with 1M aqueous HCI and extracted with DCM. The DCM solution was dried over Na2SO4, concentrated under vacuum, and purified on silica gel (DCM/MeOH, 95:5) to give a tan solid: LC-MS (ES) m/z = 463 (M+H)+.
The solid material from above was dissolved in MeOH (15 mL) and to the solution was added 4M HCI in dioxane (5 mL). After 2h at RT, the reaction solution was concentrated under vacuum to give the title compound (289 mg, 48%) as a yellow solid: LC-MS (ES) m/z = 363. (M+H)+. 1H NMR (d6-DMSO, 400 MHz) δ 8.68 (d, J = 7.9 Hz, 1 H), 8.43 (d, J = 5.3 Hz, 1 H), 8.29 (br s, 2H), 7.90 (s, 1 H), 7.35-7.47 (m, 5H), 7.32 (m 2H), 7.12 (s, 1 H), 4.32 (m, 1 H), 3.06 (m, 2H).
Example 2
Preparation of 3-amino-2-phenyl-Λ/-r5-M H-pyrrolor2.3-άlpyridin-3-yl)-2- thienylipropanamide
a) 3-(5-nitro-2-thienyl)-1 -(phenylsulfonyl)-i H-pyrrolo[2,3-o]pyridine
To a solution of %-bromo-2-nitrothiophene (1.08 g, 5.2 mmole) in dioxane (40 mL) and H2O (8 mL) was added K2CO3 (2.15 g, 16.74 mmole), tetrakistriphenylphosphine Pd(O) (0.60 g, 0.52 mmole), and 1-(phenylsulfonyl)-3- (4,4,5,5-tetramethyl-1 J3!2-dioxaborolan-2-yl)-1H-pyrro!o[2,3-ib]pyridine (2.0 g, 5.2 mmole). The reaction mixture was heated to 80° C in a sealed tube for 12h. The reaction solution was poured onto H2O (100 mL) and extracted with DCM. The organics were dried (Na2SO4), concentrated under vacuum, and purified on silica gel (hexanes/EtOAc, 1 :1 ) to give the title compound (1.1 g, 55%) as a tan foam: LC- MS (ES) m/z = 386.
b) 1 , 1-dimethylethyl [3-oxo-2-phenyl-3-({5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3- <b]pyridin-3-yl]-2-thienyl}amino)propyl]carbamate
To a solution of 3-(5-nitro-2-thienyl)-1-(phenylsulfonyl)-1H-pyrrolo[2,3- έ>]pyridine (0.90 g, 2.34 mmole) in THF (30 mL) and MeOH (30 mL) was added 10% Pd/C. The reaction mixture was placed under an atmosphere of H2 and vigorously stirred for 6 hours. The reaction solution was filtered through CeI ite (THF/MeOH) and concentrated under vacuum to give a brown solid which was used without further purification. The crude brown solid from above (0.5 g, 1.4 mmole) in DCM (15 ml_) was added to a DCM (50 ml_) solution of 3-({[(1,1-dimethylethyl)oxy]carbonyl}amino)-2- phenylpropanoic acid (0.56 g, 2.1 mmole), PyBrop (0.98 g, 2.1 mmole) and Hunig's base (0.73 mL, 4.2 mmole). After 12h at RT, the reaction solution was concentrated under vacuum and purified on silica gel (DCM/MeOH, 97:3) to give the title compound (0.55 g, 65%) as a tan solid: LC-MS (ES) m/z = 603.
c) 3-amino-2-phenyl-Λ/-[5-(1 /-/-pyrrolo[2,3-ib]pyπdin-3-yl)-2-thienyl]propanamide
To a solution of 1 ,1-dimethylethyl [3-oxo-2-phenyl-3-({5-[1-(phenylsulfonyl)-
1 H-pyrrolo[2,3-b]pyridin-3-yl]-2-thienyl}amino)propyl]carbamate (0.5 g, 0.83 mmole) in THF (10 mL) and MeOH (20 mL) was added 6N NaOH (3 mL). After 1 h at 55 0C, the reaction mixture was neutralized with 1M aqueous HCI and extracted with DCM. The DCM solution was dried over Na2SO4 and concentrated under vacuum. The solid residue was dissolved in MeOH (15 mL) and to the solution was added 4M
HCI in dioxane (5 mL). After 2h at RT, the reaction solution was concentrated under vacuum and purified on reverse-phase HPLC (C18 column: H2O/CH3CN gradient) to give the title compound (72 mg, 24%) as a yellow solid: LC-MS (ES) m/z = 363. (MH-H)+. 1H NMR (dδ-DMSO, 400 MHz) δ 8.29 (d, J = 5.3 Hz, 1 H), 8.21 (d, J = 7.8 Hz, 1 H), 7.95 (br s, 4H), 7.72 (s, 1 H), 7.35-7.51 (m, 4H), 7.29 (m 1 H), 7.12 (s, 1 H), 6.68 (s, 1 H), 4.05 (m, 1 H), 3.55 (m, 2H).
Example 3
Preparation of 4-amino-2-phenyl-/V-r4-(1 /-/-pyrrolor2.3-6ipyridin-3-yl)-2- thienyllbutanamide
The title compound was prepared as a tan solid according to the procedure of Example 1 , accept substituting 4-({[(1,1-dimethylethyl)oxy]carbonyl}amino)-2- phenylbutanoic acid (0.82 g, 2.97 mmole) for 3-({[(1,1- dimethylethyl)oxy]carbonyl}amino)-2-phenylpropanoic acid: LC-MS (ES) m/z = 377. (M+H)4. 1H NMR (d6-DMSO, 400 MHz) δ 8.61 (d, J = 7.9 Hz, 1 H), 8.43 (d, J = 5.3 Hz, 1 H), 8.14 (br s, 2H), 7.90 (s, 1 H), 7.35-7.45 (m, 5H), 7.30 (m 2H), 7.12 (s, 1 H), 4.00 (m, 1 H), 2.74 (m, 1 H), 2.65 (m, 1H), 2.44 (m, 1H), 2.09 (m, 1H).
Example 4
Preparation of 4-amino-2-phenyl-Λ/-r5-(1 /-/-pyrrolor2,3-ά1pyridin-3-yl)-2- thienylibutanamide
The title compound was prepared as a tan solid according to the procedure of Example 1 , accept substituting 4-({[(1,1-dirnethylethyl)oxy]carbonyl}amino)-2- phenylbutanoic acid (0.83 g, 2.98 mmole) for 3-({[(1, 1- dimethylethyl)oxy]carbonyl}amino)-2-phenylpropanoic acid: LC-MS (ES) m/z = 377.
(M+H)+. 1H NMR (d6-DMSO, 400 MHz) δ 8.29 (d, J = 5.1 Hz, 1 H), 8.23 (d, J = 7.9
Hz, 1 H), 7.82 (br s, 2H), 7.71 (s, 1 H), 7.40 (m, 3H), 7.35 (m, 1H), 7.25 (m, 1 H), 7.19 (m, 1 H), 7.09 (m, 1 H), 6.68 (d, J = 3.9 Hz, 1 H), 3.79 (m, 1 H), 2.72 (m, 2H),
2.32 (m, 1 H), 2.03 (m, 1 H).
Example 5
Preparation of 3-amino-2-phenyl-N-r5-f1 H-pyrrolor2,3-b1pyridin-4-yl)-2- thienylipropanamide The title compound was prepared as a yellow solid according to Example 2, except substituting 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2- yl)-1 H-pyrrolo[2,3-b]pyridine (2 g, 5.29 mmol) for 1-(phenylsulfonyl)-3-(4,4,5,5- tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3-b]pyridine.
The final procedure for deprotection was modified where following removal of the sulfonamide group under basic conditions, the solution was neutralized with 6N HCI then extracted with DCM. The combined fractions were dried (Na2SO4) and concentrated providing a residue which was immediately treated with TFA/DCM (0.1M, 1 :2). After 0.5h, the solution was concentrated with a toluene azeotrope and the residue neutralized through a 3-10% solution of MeOH in DCM (1% NH4OH). The neutral compound was then taken up in DCM (0.1 M), treated with a 2M solution of HCI in Et2O (7 eq.) and concentrated affording the title compound (195 mg) as the di-HCI salt: LC-MS (ES) m/z = 363 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8.39 (d, J = 6 Hz, 1 H), 8.16 (bs, 2H), 7.80-7.82 (m, 1 H), 7.62-7.68 (m, 1 H) 7.50-7.52 (m, 1 H), 7.31-7.48 (m, 5H), 6.99-7.03 (m, 1 H), 6.91 (d, J = 4.2 Hz, 1 H), 4.21-4.28 (m, 1 H), 3.52-3.61 (m, 1 H), 3.10-3.17 (m, 1 H).
The racemic compound underwent chiral separation using a ChiralPak AD- H column affording the faster eluting enantiomer GSK1155752A (labled E1 , 86 mg, 99% ee) followed by the slower eluting enantiomer GSK1155753A (labeled E2, 89 mg, 98.5 %ee) with identical LCMS and 1H NMR data to the parent racemic compound GSK1070771 A.
Example 6
Preparation of 4-amino-2-phenyl-N-r5-(1 H-Dyrrolof2.3-blPyridin-4-ylV2- thienyllbutanamide The title compound was prepared as an orange solid according to Example
5, except substituting 4-({[(1,1-dimethylethyl)oxy]carbonyl}amino)-2-phenylbutanoic acid ( 0.813 mg, 2.91 mmol) for 3-({[(1, 1-dimethylethyl)oxy]carbonyl}amino)-2- phenylpropanoic acid: LC-MS (ES) m/z = 377 (M+H)\ 1H NMR (d6-DMSO, 400 MHz) S 8.29 (d, J = 5.9 Hz, 1 H), 8.00 (bs, 2H)1 8.7 (d, J = 2.2 Hz, 1 H), 7.7 (s, 1 H), 7.53 (d, J = 5.4 Hz, 1 H), 7.29-7.43 (m, 5H), 7.00 (s, 1H), 6.99 (d, J = 1.0 Hz, 1 H), 4.00-4.09 (m, 1 H), 2.64-2.79 (m, 2H), 2.31-2.41 (m, 1 H), 2.06-2.14 (m ,1 H).
Example 7
Preparation of N-(2-amino-1-phenylethv0-5-(1 H-pyrrolor2.3-blpyridin-4-vO-2- thiophenecarboxamide a) 1 ,1-dimethylethyl (2-hydroxy-2-phenylethyl)carbamate
To a solution of 2-amino-1-phenylethanol (5 g, 36.4 mmol) in THF (182 ml_) at 25 0C was added BoC2O (8.7 g, 40.1 mmol) in one portion. After 0.5h, the solution was concentrated and the residue used directly without further purification: LC-MS (ES) m/z = 238 (M+H)+.
b) 1 ,1-dimethylethyl [2-(1,3-dioxo-1 ,3-dihydro-2H-isoindol-2-yl)-2- phenylethyrjcarbamate
To a solution of 1,1-dimethylethyl (2-hydroxy-2-phenylethyl)carbamate (2 g, 8.44 mmol), phthalimide (1 g, 7.03 mmol) and triphenylphosphine (2.76 g, 10.5 mmol) in THF (35 mL) at 25 0C was added DEAD (1.7 ml_, 10.5 mmol) dropwise. After 0.5h, the solution was concentrated and purified via column chromatography (silica, 15 % EtOAc in hexanes) affording the title compound (2 g, 80%) as a white foam: LC-MS (ES) m/z = 367 (M+H)+.
c) 1,1-dimethylethyl (2-amino-2-phenylethyl)carbamate
A solution of 1 ,1-dimethylethyl [2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-2- phenylethyl]carbamate (2 g, 5.46 mmol) and either MeNH2 (40wt% in H2O, 10eq.) or NH2NH2 (10eq.) in MeOH (0.5M, 10 mL) was heated to 60 0C in a sealed tube. After 12h, the solution was concentrated and purified via column chromatography (silica-dry load, 2% MeOH in DCM (1 % NH4OH)) affording the title compound (1.1 g, 85%) as a white solid: LC-MS (ES) m/z = 237 (M+H)+.
d) 1 ,1-dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-2- phenylethyl)carbamate
To a solution of δ-bromo^-thiophenecarboxylic acid (0.723 mg, 3.49 mmol), PyBrOP (1.62 g, 3.49 mmol) and diisopropylethyl amine (1.2 mL, 6.99 mmol) in DCM (11 mL) at 25 0C was added 1,1-dimethylethyl (2-amino-2- phenylethyl)carbamate (500 mg, 2.12 mmol). After 12h, the solution was partitioned between H2O and washed with DCM. The combined organic fraction were dried (Na2SO4), concentrated and purified via column chromatography (silica, 0.5 % MeOH in DCM) affording the title compound (730 mg, 81%) as a white powder: LC-MS (ES) m/z = 426 (M+H)+.
e) 1 ,1-dimethylethyl {2-phenyl-2-[({5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin-4~ yl]-2-thienyl}carbonyl)amino]ethyl}carbamate
To a solution of 1 ,1-dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-2- phenylethyl)carbamate (356 mg, 0.859 mmol) in dioxane/H2O (5:1 , 8.6 mi_) was added K2CO3 (474 mg, 3.44 mmol), tetrakistriphenylphosphine Pd(O) (50 mg, 42.9 umol), and 1-(phenylsuifonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H- pyrrolo[2,3-jb]pyridine (396 mg, 1.03 mmol). The reaction mixture was heated to 80° C in a sealed tube for 12h. The reaction solution was poured onto H2O (100 mL) and extracted with DCM. The organics were dried (Na2SO4), concentrated under vacuum, and purified on silica gel (1% MeOH in DCM) to give the title compound (496 mg, 96%) as a yellow solid: LC-MS (ES) m/z = 603.
f) 1 , 1-dirnethylethyl [2-phenyl-2-({[5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]carbonyl}amino)ethyl]carbamate
A solution of 1 ,1-dimethylethyl {2-phenyl-2-[({5-[1-(phenylsulfonyl)-1H- pyrrolo[2,3-b]pyridin-4-yl]-2-thienyl}carbonyl)amino]ethyl}carbamate (496 mg, 0.824 mmol) in THF/MeOH (8 mL) was treated with 6N NaOH (8 mL) and stirred 25-50 0C for 2h. The solution was then neutralized with 6N HCI and extracted with DCM. The combined organic fractions were dried (Na2SO4), concentrated and purified via column chromatography (silica-dry load, 2% MeOH in DCM) affording the title compound (123 mg, 32%) as a yellow solid: LC-MS (ES) m/z = 464 (M+H)+. g) N-(2-amino-1-phenylethyl)-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide (GSK1229745A)
1 ,1-dimethylethyl [2-phenyl-2-({[5-(1H-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]carbonyl}amino)ethyl]carbamate (123 mg, 0.266 mmol) was dissolved in MeOH (3 mL) and treated with 4M HCI in dioxane (465 uL, 1.86 mmol). After 12h, the solution was concentrated affording the di-HCI salt of the title compound (102 mg, 34% 2 steps) as a yellow solid: LC-MS (ES) m/z = 364 (M+H)+, 1H NMR (d6- DMSO, 400 MHz) δ 9.47 (d, J = 8.2 Hz, 1 H), 8.33 (d, J = 5.3 Hz, 1 H), 8.24 (bs, 2H), 7.95 (d, J = 4.0 Hz, 1 H), 7.69-7.70 (m, 1 H), 7.51-7.60 (m, 1 H), 7.46-7.52 (m, 2H), 7.38-7.42 (m, 2H), 7.32-7.34 (m, 1 H), 6.93-6.95 (m, 1 H), 5.31-5.38 (m, 1 H), 3.38- 3.42 (m, 1 H), 3.18-3.22 (m, 1 H).
Example 8
Preparation of N-(2-amino-1-phenylethyl)-4-(1 H-pyrrolof2,3-blpyridin-4-yl")-2- thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 7, except substituting 4-bromo-2-thiophenecarboxylic acid (723 mg, 3.49 mmol) for 5- bromo-2-thiophenecarboxylic acid: LC-MS (ES) m/z = 364 (M+H)+, 1H NMR (d6- DMSO, 400 MHz) δ 9.90-9.93 (m, 1 H), 9.01-9.05 (m, 1 H), 8.64-8.69 (m, 1 H), 8.52- 8.54 (m, 1 H), 8.38-8.45 (bs, 2H), 7.81-7.84 (m, 1 H), 7.72-7.75 (m, 1 H), 7.49-7.52 (m, 2H), 7.28-7.41 (m, 4H), 5.30-5.35 (m, 1 H), 3.45-3.51 (m, 1 H), 3.11-3.21 (m, 1 H).
Example 9
Preparation of N-(2-amino-1-phenylethylV4-bromo-5-(1 H-pyrrolor2.3-b1pyridin-4-vO- 2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 7, except substituting 4,5-dibromo-2-thiophenecarboxylic acid (2.2 g, 7.69 mmol) for 5- bromo-2-thiophenecarboxylic acid: LC-MS (ES) m/z = 442 (M+H)+, 1H NMR (d6- DMSO, 400 MHz) δ 9.55-9.59 (m, 1H), 8.34-8.37 (m, 2H), 8.27 (bs, 2H), 7.64-7.66 (m, 1 H), 7.47-7.49 (m, 2H), 7.41 -7.43 (m, 2H), 7.32-7.39 (m, 2H), 6.53-6.54 (m, 1 H), 5.29-5.34 (m, 1 H), 3.32-3.39 (m, 1H), 3.22-3.25 (m, 1 H) .
Example 10
Preparation of 4-bromo-N-r2-(methylarninoV1~phenylethyl1-5-(1 H-pyrrolor2,3- b1pyridin-4-ylV2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 7, except substituting 4,5-dibromo-2-thiophenecarboxylic acid (1.89 g, 6.6 mmol) for 5- bromo-2-thiophenecarboxylic acid and 1,1-dimethylethy! (2-hydroxy-2- phenylethyl)methylcarbamate (2 g, 8 mmol) for 1 ,1-dimethylethyl (2-hydroxy-2- phenylethy))carbamate: LC-MS (ES) m/z = 456 (M+H)\ 1H NMR (d6-DMSO, 400 MHz) δ 9.65 (d, J = 8.2 Hz, 1 H), 8.95-9.02 (m, 2H), 8.36-8.38 (m, 2H), 7.63-7.65 (m, 1 H), 7.48-7.50 (m, 2H), 7.39-7.43 (m, 2H), 7.32-7.36 (m, 2H), 6.53-6.55 (m, 1H), 5.37-5.43 (m, 1 H), 3.49-3.57 (m, 1 H), 3.30-3.36 (m, 1 H), 2.64 (s, 3H).
Example 11
Preparation of N-(2-amino-1-phenylethyl)-4-(1 H-pyrrolor2,3-b1pyridin-3-vQ-2- thiophenecarboxamide The title compound was prepared as a yellow solid according to Example 7, except substituting 1-(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2- yl)-1 H-pyrrolo[2,3-b]pyridine (450 mg, 1.17 mmol) for 1-(phenylsulfonyl)-4-(4, 4,5,5- tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3-b]pyridine and 4-bromo-2- thiophenecarboxylic acid (415 mg, 0.976 mmol) for δ-bromo^-thiophenecarboxylic acid.
Alternatively, the Boc protecting group was removed in 0.5h using TFA- DCM (1 :2, 0.1M) at 25 0C. The resulting solution was concentrated using a toluene azeotrope and the residue neutralized through a silica plug (2-10% MeOH in DCM (1% NH4OH)) affording the neutral compound. Subsequent treatment with excess HCI in diethyl ether to the compound in DCM afforded the di-HCI salt of the title compound: LC-MS (ES) m/z = 363 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9.17 (d, J = 8.4 Hz, 1 H), 8.45-8.48 (m, 1 H), 8.30-8.34 (m, 1 H), 8.15 (bs, 2H), 7.99 (s, 1 H), 7.88 (s, 1H), 7.41-7.49 (m, 5H), 7.32-7.39 (m, 1 H), 7.20-7.23 (m, 1 H), 3.28- 3.58 (m, 2H).
Example 12
Preparation of N-(2-amino-1-phenylethyl)-4-bromo-5-(1 H-pyrrolor2,3-blpyridin-3-yl)- 2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 7, except substituting 1 -(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2- yl)-1 H-pyrrolo[2,3-b]pyridine (289 mg, 0.751 mmol) for 1-(phenylsulfonyI)-4-(4,4,5,5- tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3-b]pyridine and 4,5-dibromo-2- thiophenecarboxylic acid (2.2 g, 7.69 mmol) for 5-bromo-2-thiophenecarboxylic acid.
Alternatively, the Boc protecting group was removed in 0.5h using TFA- DCM (1 :2, 0.1M) at 25 0C. The resulting solution was concentrated using a toluene azeotrope and the residue neutralized through a silica plug (2-10% MeOH in DCM (1% NH4OH)) affording the neutral compound. Subsequent treatment with excess HCI in diethyl ether to the compound in DCM afforded the di-HCl salt of the title compound: LC-MS (ES) m/z = 442 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9.30 (d, J = 8.2 Hz, 1 H), 8.35-8.37 (m, 1H), 8.20 (bs, 2H), 8.12-8.19 (m, 1H), 7.37-7.47 (m, 5H), 7.31-7.35 (m, 1 H), 7.23-7.26 (m, 1 H), 5.27-5.33 (m, 1 H), 3.17-3.37 (m, 2H).
Example 13
Preparation of N-(2-amino-1-phenylethvO-5-(1 H-pyrrolor2.3-blpyridin-3-vD-2- thiophenecarboxamide To a solution of N-(2-amino-1-phenylethyl)-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-3-yl)-2-thiophenecarboxamide (120 mg, 0.273 mmol) [prepared in Example 7] in THF (3 ml_) cooled to -78 0C was added dropwise nBuLi (2.5 M hexanes, 765 uL, 1.91 mmol). After 0.5h, an equal amount of nBuLi was added and the solution stirred an additional 2h. The solution was quenched with H2O then extracted several times with DCM. The combined extracts were dried (Na2SO4), concentrated and purified by silica chromatography (5% MeOH in DCM (1% NH4OH)) affording the neutral compound. Subsequent treatment of the compound in DCM (0.1M) with excess HCI in diethyl ether afforded the di-HCl salt of the title compound: LC-MS (ES) m/z = 363 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9.01- 9.04 (m, 1 H), 8.32-8.35 (m, 2H), 8.12 (bs, 2H), 8.03-8.04 (m, 2H), 7.46-7.50 (m, 5H), 7.38-7.44 (m, 1 H), 7.22-7.34 (m, 1H), 5.29-5.35 (m, 1 H)1 3.17-3.41 (m, 2H).
Example 14
Preparation of N-(2-amino-1-phenylethvO-4-bromo-5-(1 H-pyrrolof2,3-blpyridin-3-vD- 2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 7, except substituting 1-(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2- yl)-1 H-pyrrolo[2,3-b]pyridine (289 mg, 0.751 mmol) for 1-(phenylsu If onyl)-4-(4, 4,5,5- tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3-b]pyridine; 4,5-dibromo-2- thiophenecarboxylic acid (315 mg, 0.626 mmol) for δ-bromo^-thiophenecarboxylic acid, and 1, 1-dimethylethyl (2-hydroxy-2-phenylethyl)methylcarbamate (2 g, 8 mmol) for 1 ,1-dimethylethyl (2-hydroxy-2-phenylethyl)carbamate: LC-MS (ES) m/z = 456 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9.48 (d, J = 7.3 Hz, 1 H), 9.01 (bs, 2H), 8.36-8.38 (m, 1 H), 8.33-8.35 (m, 1 H), 8.22-8.27 (m, 1 H), 8.19-8.21 (m, 1 H), 7.31-7.48 (m, 5H), 7.24-7.27 (m, 1 H), 5.37-5.42 (m, 1 H), 3.47-3.54 (m, 1 H), 3.31- 3.34 (m, 1 H), 2.50 (s, 3H).
Example 15
Preparation of N-(3-amino-1-phenylpropyl)-5-(1 H-pyrrolor2,3-b1pyridin-4-vD-2- thiophenecarboxamide a) 5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin-4-yl]-2-thiophenecarboxylic acid
To a solution of δ-bromo^-thiophenecarboxylic acid (104 mg, 0.5 mmol) in dioxane/H20 (5:1 , 6 mL) was added K2CO3 (328 mg, 2.38 mmol), tetrakistriphenylphosphine Pd(O) (34 mg, 60 umol), and 1-(phenylsulfonyl)-4- (4,4,5t5-tetramethyl-1 ,3,2-dioxaboro!an-2-yl)-1H-pyrrolo[2,3-ιb]pyridine (231 mg, 0.6 mmol). The reaction mixture was heated to 80° C in a sealed tube for 12h. The mixture was basified to Ph 13 with 6N NaOH aqueous solution and washed with dicholormethane. The aqueous layer was subsequently acidified to PH 4 and extracted with dichloromethane. The organic fractions were pooled, dried over Na2SO4 and concentrated to give the title compound (190 mg, quant.) as a brown solid: LC-MS (ES) m/z = 385 (M+H)+.
b) 1 ,1-dimethylethyl {3-phenyl-3-[({5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin-4- yl]-2-thienyl}carbonyl)amino]propyl}carbamate
To a solution of 5-[1-(phenylsu)fonyl)-1 H-pyrrolo[2,3-b]pyridin-4-yl]-2- thiophenecarboxylic acid (95 mg, 0.25 mmol), PyBrOP (1 16.6 mg, 0.25 mmol) and diisopropylethyl amine (0.087 mL, 0.5 mmol) in DCM (3 mL) at 25 0C was added 1 ,1-dimethylethyl (3-amino-3-phenylpropyl)carbamate [prepared from 1 ,1- dimethylethyl (3-hydroxy-3-phenylpropyl)carbamate [described in Preparation 6] according to Example 7] (40 mg, 0.15 mmol). After 12h, the solution was partitioned between H2O and washed with DCM. The combined organic fractions were dried (Na2SO4), concentrated and purified via column chromatography (silica, 0-50 % ethyl acetate in hexane) affording the title compound (82.1 mg, 52%) as a yellow oil: LC-MS (ES) m/z = 617 (M+H)+.
c) 1,1-dimethylethyl [3-phenyl-3-({[5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]carbonyl}amino)propyl]carbamate
A solution of 1 ,1-dimethylethyl {3-phenyl-3-[({5-[1-(phenylsulfonyl)-1 H- pyrrolo[2,3-b]pyndin-4-yl]-2-thienyl}carbonyl)amino]propyl}carbamate (82 mg, 0.13 mmol) in MeOH (2 mL) was treated with 6N NaOH (0.55 ml_, 1.3 mmol) and stirred 25-50 0C for 0.5h. The solution was then neutralized with 6N HCI and extracted with DCM. The combined organic fractions were dried (Na2SO4), concentrated and purified via column chromatography (silica-dry load, 3% MeOH in DCM) affording the title compound (39.2 mg, 62%) as a yellow oil: LC-MS (ES) m/z = 477 (M+H)+.
d) N-(3-amino-1-phenylpropyl)-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide
1,1-dimethylethyl [3-phenyl-3-({[5-(1 H-pyrrolo[2,3-b]pyridin-4-y l)-2- thieny!]carbonyl}amino)propyl]carbamate (39 mg, 0.08 mmol) was stirred in a solution of TFA-DCM (1 :2, 0.1 M) at 25 0C. After 0.5h, the solution was concentrated using a toluene azeotrope and the residue neutralized through a silica plug (2-10% MeOH in DCM (1% NH4OH)) affording the neutral compound. Subsequent treatment with excess HCI in diethyl ether to the compound in DCM afforded the di-HCI salt of the title compound as a yellow solid: LC-MS (ES) m/z = 377 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8.43 (d, J = 6.1 Hz, 1H), 8.03-8.08 (m, 2H), 7.86-7.94 (m, 1 H), 7.78-7.85 (m, 1 H), 7.48-7.55 (m, 2H), 7.40-7.47 (m, 2H), 7.33-7.39 (m, 1 H), 7.28-7.33 (m, 1 H), 5.22-5.32 (m, 1 H), 3.07-3.15 (m, 1 H), 2.92- 3.02 (m, 1 H), 2.28-2.43 (m, 2H).
Example 16
Preparation of N-(3-amino-1-phenylpropylΗ-(1 H-pyrroloF2.3-blpyridin-4-vO-2- thiophenecarboxamide The title compound was prepare as a white solid according to Example 15, except substituting 4-bromo-2-thiophenecarboxylic acid (95 mg, 0.25 mmol) for 5- bromo-2-thiophenecarboxylic acid: LC-MS (ES) m/z = 377 (M+H)+, 1H NMR (d4- MeOH, 400 MHz) δ 8.57 (s, 1 H), 8.47 (s, 1 H), 8.4-8.44 (m, 1 H), 7.68-7.18 (m, 2H), 7.48-7.55 (m, 2H), 7.40-7.46 (m, 2H), 7.31-7.38 (m, 1H), 7.18-7.22 (m, 1H), 5.23- 5.32 (m, 1 H), 3.07-3.16 (m, 1 H), 2.95-3.04 (m, 1 H), 2.28-2.45 (m, 2H).
Example 17
Preparation of N-(3-amino-1-phenylpropyO-4-bromo-5-(1 H-pyrrolor2,3-blpyridin-4- vO-2-thiophenecarboxamide
The title compound was prepare as a yellow solid according to Example 15, except substituting 4,5-dibromo-2-thiophenecarboxylic acid (116 mg, 0.25 mmol) for 5-bromo-2-thiophenecarboxylic acid: LC-MS (ES) m/z = 456 (M+H)+, 1H NMR (d4- MeOH, 400 MHz) δ 8.38 (s, 1 H), 7.95-7.97 (m, 1 H), 7.58-7.67 (m, 1 H), 7.48-7.58 (m, 3H), 7.41-7.47 (m, 2H), 7.31 -7.39 (m, 1H), 6.68-6.79 (m, 1 H), 5.2-5.29 (m, 1 H), 3.07-3.17 (m, 1 H), 2.93-3.03 (m, 1 H), 2.25-2.43 (m, 2H).
Example 18
Preparation of N-(3-amino-1-phenylpropyl)-4-bromo-5-(1 H-pyrrolor2.3-b1pyridin-4- vO-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to Example
15, except substituting 1,1-dimethylethyl (4-amino-4-phenylbutyl)carbamate (40 mg, 0.25 mmol) [preparared from 1 ,1-dimethylethyl (4-hydroxy-4-phenylbutyl)carbamate (Marshall, D. R. J. Chem. Soc, Perkin Trans. 2 1977, 1898. and following preparation 6] for 1,1-dimethylethyl (3-amino-3-phenylpropyl)carbamate: LC-MS (ES) m/z = 391 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8.33 (d, J = 5.2 Hz, 1 H), 7.89-7.96 (m, 2H), 7.63-7.69 (m, 2H), 7.44-7.51 (m, 2H), 7.36-7.43 (m, 2H), 7.26- 7.34 (m, 1 H), 7.06-7.13 (m, 1 H), 5.13-5.23 (m, 1 H), 2.97-3.08 (m, 2H), 2.0-2.15 (m, 2H), 1.69-1.90 (m, 2H).
Example 19
Preparation of N-(4-amino-1-phenylbutyl)-4-π H-pyrrolor2.3-blpyridin-4-yl)-2- thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 15, except substituting 1, 1-dimethylethyl (4-amino-4-phenylbutyl)carbamate (38 mg, 0.15 mmol) [preparared from 1 ,1-dimethylethyl (4-hydroxy-4-phenylbutyl)carbamate (Marshall, D. R. J. Chem. Soc, Perkin Trans. 2 1977, 1898. and following preparation 6] for 1 ,1-dimethylethyl (3-amino-3-phenylpropyl)carbamate as well as 4-dibromo-2-thiophenecarboxylic acid (95 mg, 0.25 mmol) for 5-dibromo-2- thiophenecarboxylic acid: LC-MS (ES) m/z = 391 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8.67 (s, 1 H), 8.59 (s, 1 H), 8.44-8.50 (m, 1 H), 7.84-7.90 (m, 1 H), 7.79-7.84 (m, 1 H), 7.48-7.55 (m, 2H), 7.35-7.43 (m, 2H), 7.26-7.34 (m, 2H), 5.12-5.20 (m, 1 H), 2.98-3.07 (m, 2H), 2.13-2.24 (m, 1H), 2.01-2.11 (m, 1 H), 1.82-1.95 (m, 1 H), 1.68-1.81 (m, 1 H).
Example 20
Preparation of N-(4-amino-1-phenylbutyl)-4-bromo-5-(1 H-Pyrrolor2.3-bipyridin-4-vD- 2-thioρhenecarboxamide
The title compound was prepared as a brown solid according to Example 15, except substituting 1,1-dimethylethyl (4-amino-4-phenylbutyl)carbamate (38 mg, 0.15 mmol) [preparared from 1 ,1-dimethylethyl (4-hydroxy-4-phenylbutyl)carbamate (Marshall, D. R. J. Chem. Soc, Perkin Trans. 2 1977, 1898. and following preparation 6] for 1,1-dimethylethyl (3-amino-3-phenylpropyl)carbamate and 4,5- bromo-2-thiophenecarboxylic acid (116 mg, 0.25 mmol) for 5-dibromo-2- thiophenecarboxylic acid: LC-MS (ES) m/z = 470 (M+ H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8.40-8.50 (m, 1 H), 8.0 (s, 1 H), 7.63-7.74 (m, 2H), 7.42-7.5 (m, 2H), 7.34- 7.42 (m, 2H), 7.25-7.33 (m, 1 H), 6.81-6.89 (m, 1 H), 5.10-5.14 (m, 1 H), 2.96-3.08 (m, 2H), 1 .98-2.15 (m, 2H), 1.80-1.92 (m, 1 H), 1.67-1.79 (m, 1 H).
Example 21
Preparation of 3-amino-2-phenyl-AH4-( 1 /-/-pyrrolor2.3-bipyridin-4-ylV2- thienylipropanamide
a) 1,1-dimethylethyl {4-[1-(phenylsulfonyl)-1H-pyrrolo[2,3-b]pyridin-4-yl]-2- thienyl}carbamate
To a solution of 1 ,1-dimethylethyl (4-bromo-2-thienyl)carbamate (0.5 g, 1.80 mmole) in dioxane (15 ml_) and H2O (2 ml_) was added K2CO3 (1.0 g, 7.2 mmole), tetrakistriphenylphosphine Pd(O) (0.104 g, 0.09 mmole), and 1-(phenylsulfonyl)-4- (4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1H-pyrrolo[2,3-<b]pyridine (0.69 g, 1.8 mmole). The reaction mixture was heated to 70° C in a sealed tube for 4h. The reaction solution was concentrated under vacuum, and purified on silica gel (hexanes/EtOAc, 2:1 ) to give the title compound (560m g, 70%) as a brown solid: LC-MS (ES) m/z = 456 (M+1 )+.
b) 1 ,1-dimethylethyl {4-[1-(phenylsulfonyl)-1H-pyrrolo[2,3-6]pyridin-4-yl]-2- thienyl}carbamate
To a solution of 1 ,1-dimethylethyl {4-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3- <b]pyridin-4-yl]-2-thienyl}carbamate (230 mg, 0.51 mmole) in methylene chloride (5 imL) was added TFA (2 mL) at RT. The reaction was allowed to stir at RT for 1 h and then concentrated to a solid under vacuum.
To a solution of 3-({[(1 ,1-dimethylethyl)oxy]carbonyl}amino)-2- phenylpropanoic acid (0.23 g, 0.85 mmole) in DCM (4 mL) was added PyBrop (0.4 g, 0.90 mmole) and Hunig's base (1.9 mL, 11.0 mmole). After 15 min., the residual amine from above was added to the reaction mixture in DCM (2 mL) and stirred for 12h at RT. The reaction solution was concentrated under vacuum and purified on silica gel (Hexane/EtOAc, 2:1 to 1 :1 ) to give the title compound (97 mg, 32% two steps) as a tan foam: LC-MS (ES) m/z = 603 (M+H)+.
d) 3-amino-2-phenyl-Λ/-[4-(1 /-/-pyrrolo[2,3-b]pyridin-4-yl)-2-thienyl]propanamide To a solution of 1,1-dimethylethyl {4-[1-(phenylsulfonyl)-1 /-/-pyrrolo[2,3- 5]pyridin-4-yl]-2-thienyl}carbamate (0.097 g, 0.16 mmole) in MeOH (3 mL) was added 6N NaOH (1.5 mL). After 0.5 h at 55 °C, the reaction mixture was neutralized with 1M aqueous HCI and extracted with DCM. The DCM solution was dried over Na2SO4, concentrated under vacuum, and purified on silica gel (DCM/MeOH, 95:5) to give a tan solid: LC-MS (ES) m/z = 463 (M+H)+.
The solid material from above was dissolved in MeOH (1 mL) and to the solution was added 1M HCI in dioxane (2 mL). After 12 h at RT, the reaction solution was concentrated under vacuum to give the title compound (31 mg, 53% for two steps) as a green solid: LC-MS (ES) m/z = 363. (M+H)+. 1H NMR (d4-MeOH, 400 MHz) δ 8.39 (d, J = 6.1 Hz, 1 H), 7.88 (s, 1 H), 7.75 (d, J = 3.5 Hz, 1 H), 7.71 (d, J = 6.3 Hz, 1 H), 7.49-7.39 (m, 5H), 7.36 (bs, 1H), 7.15 (d, J = 1.5 Hz, 1H), 4.24 (m, 1 H), 3.70 (m, 1 H), and 3.32 (m, 1 H).
Example 22
Preparation of 4-amino-2-phenyl-Λ/-r4-(1 H-pyrrolor2.3-61pyridin-4-yl)-2- thienylibutanamide
The title compound was prepared as a brown solid according to the procedure of Example 21 , accept substituting 4-({[(1 ,1- dimethylethyl)oxy]carbonyl}amino)-2-phenylbutanoic acid for 3-({[(1 ,1- dimethylethyl)oxy]carbonyl}amino)-2-phenylpropanoic acid: LC-MS (ES) m/z = 377. (M+H)VH NMR (d4-MeOH, 400 MHz) δ 8.38 (d, J = 6.3 Hz, 1 H), 7.86 (d, J = 1.8Hz, H), 7.75 (d, J = 3.5 Hz, 1 H), 7.70 (d, J = 6.3 Hz, 1H), 7.49-7.32 (m, 6H), 7.16 (J = 3.85 Hz7 1 H), 3.90 (dd, J = 7.3, 7.3 Hz, 1 H), 2.98 (m, 1 H), 2.88 (m, 1 H), 2.48 (m, 1 H) and 2.20 (m, 1 H).
Example 23
Preparation of N-\4-(1 H-pyrrolor2,3-ά1pyridin-4-yl)-2-thienyllphenylalaninarnide The title compound was prepared as a green solid according to the procedure of Example 21 , accept substituting A/-{[(1,1-dimethylethyl)oxy]- carbonyl}phenylalanine for 3-({[(1 ,1-dimethylethyl)oxy]carbonyl}amino)-2- phenylpropanoic acid: LC-MS (ES) m/z = 363. (M+H)+.1H NMR (d4-MeOH, 400 MHz) δ 8.42 (d, J = 6.3 Hz, 1 H), 7.94(d, J = 1.8 Hz, H), 7.79 (d, J = 3.5 Hz, 1 H), 7.74 (d, J = 6.3 Hz, 1 H), 7.40-7.32 (m, 6H), 7.17 (d, J = 3.8 Hz, 1 H), 4.34 (dd, J =7.3, 7.6 Hz, 1 H), 3.37 (dd, J = 7.1 , 13.9 Hz, 1 H) and 3.23 (dd, J = 7.6, 13.9 Hz, 1 H).
Example 24
Preparation of 2-amino-2-phenyl-A/-f4-d /-/-pyrrolor2.3-ά1pyridin-4-yl)-2- thienyllacetamide
The title compound was prepared as a green solid according to the procedure of Example 21 , accept substituting ({[(1 ,1-dimethylethyl)oxy]- carbonyl}amino)-(phenyl)acetic acid for 3-({[(1 ,1-dimethylethyl)oxy]carbonyl}amino)- 2-phenylpropanoic acid: LC-MS (ES) m/z = 349. (M+H)+.1H NMR (d4-MeOH, 400 MHz) δ 8.39 (d, J = 6.3 Hz, 1 H), 7.93(d, J = 1.8 Hz, H), 7.76 (d, J = 3.8 Hz, 1 H), 7.73 (d, J = 6.3 Hz, 1 H), 7.66-7.54 (m, 2H), 7.57-7.54 (m, 3H), 7.40 (d, J = 1.8 Hz, 1 H), 7.16 (d, J = 3.8 Hz, 1 H), and 5.29 (s, 1 H).
Example 25
Preparation of N-\5-(~ϊ H-pvrrolor2,3-ά1pvridin-4-vπ-2-thienvHphenvlalaninamide a) 4-(5-nitro-2-thienyl)-1 -(phenylsulfonyl)-i H-pyrroio[2,3-b]pyridine
To a solution of 2-bromo-5-nitrothiophene (0.23 g, 1 .08 mmole) in dioxane (9 imL) and H2O (1 .8 mL) was added K2CO3 (0.40 g, 4.33 mmole), tetrakistriphenylphosphine Pd(O) (0.06 g, 0.056 mmole), and 1-(phenylsulfonyl)-4- (4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3-b]pyridine (0.5 g, 1.29 mmole). The reaction mixture was heated to 70° C in a sealed tube for 4h. The reaction solution was concentrated under vacuum, and purified on silica gel (hexanes/EtOAc, 3:1 ) to give the title compound (400 mg, 80%) as a brown solid: LC-MS (ES) m/z = 386 (M+1 )+.
bJ ΛKKI .I-dimethylethyOoxylcarbonyl^ΛHS-II-tphenylsulfonyO-IH-pyrrolop.a- <b]pyridin-4-yl]-2-thienyl}phenylalaninamide
To a solution of 4-(5-nitro-2-thienyl)-1 -(phenylsulfonyl)-i H-pyrrolo[2,3-
<6]pyridine
(0.70 g, 1.82 mmole) in MeOH (17 mL) was added catalytic Pd(OH)2. The reaction mixture was placed under an atmosphere of H2 and vigorously stirred for 10 hours.
The reaction solution was filtered through Celite (EtOAc/MeOH) and concentrated under vacuum to give a brown solid which was used without further purification The crude brown solid from above (0.18 g, 0.51 mmole) in DCM (5 ml_) was added to a DCM (5 ml_) solution of 3-({[(1 ,1-dimethylethyl)oxy]carbonyl}amino)-2- phenylpropanoic acid (0.22 g, 0.85 mmole), PyBrop (0.39 g, 0.85 mmole) and Hunig's base (0.3 ml_, 1.7 mmole). After 12h at RT, the reaction solution was concentrated under vacuum and purified on silica gel (Hexane/EtOAc, 1 :1 ) to give the title compound (78 mg, 65%) as a tan solid: LC-MS (ES) m/z = 603 (M+1 )+.
c) Λ/-[5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2-thienyl]phenylalaninamide To a solution of Λ/-{[(1,1-dimethylethyl)oxy]carbonyl}-/V-{5-[1- (phenylsulfonyl)-1 /-/-pyrrolo[2,3-ό]pyridin-4-yl]-2-thienyl}ρhenylalaninamide (0.16 g, 0.27 mmole) in MeOH (2 mL) was added 6N NaOH (2 ml_). After 0.5 h at 55 0C1 the reaction mixture was neutralized with 1 M aqueous HCI and extracted with DCM. The DCM solution was dried over Na2SO4, concentrated under vacuum, and purified on silica gel (DCM/MeOH, 95:5) to give a tan solid: LC-MS (ES) m/z = 463 (M+H)+.
The solid material from above was dissolved in MeOH (2 mL) and to the solution was added 1 M HCI in dioxane (1 mL). After 12 h at RT, the reaction solution was concentrated under vacuum to give the title compound (30 mg, 31 % for two steps) as a green solid: LC-MS (ES) m/z = 363. (M+H)+. 1H NMR (d4-MeOH, 400 MHz) δ 8.31 (d, J = 6.6 Hz, 1 H), 8.00 (d, J = 4.3 Hz, H), 7.80 (d, J = 6.3 Hz, 1H), 7.75 (d, J = 3.5 Hz, 1 H), 7.40-7.32 (m, 5H), 7.29 (d, J = 3.7 Hz, 1 H), 6.95 (d, J = 4.3 Hz, 1 H), 4.33 (dd, J =7.3, 7.6 Hz, 1 H), 3.36(dd, J = 7.0, 13.9 Hz, 1H) and 3.23 (CIcI1 J = 7.6, 13.9 Hz, 1 H).
Example 26
Preparation of 3-amino-2-(phenylmethyl>N-r5-(1H-pyπ~olor2,3-ιbiPyridin-4-vO-2- thienylipropanamide
a) 1 ,1-dimethylethyl (5-bromo-2-thienyl)carbamate Br r\ OO I NT "O
The title compound was prepared as a tan solid according to the procedure of Example 1 , accept substituting 5-bromo-2~thiophenecarboxylic acid for 4-bromo- 2-thiophenecarboxylic acid LC-MS (ES) m/z = 279. (M+H)+.
b) 1 ,1-dimethylethyl {5-[1-(phenylsulfonyl)-1H-pyrrolo[2,3-b]pyridin-4-yl]-2- thienyl}carbamate
The title compound was prepared as a tan solid according to the procedure of Example 21 , accept substituting 1,1-dimethylethyl (5-brorno-2-thienyl)carbamate 1 ,1-dimethylethyl (4-bromo-2-thienyl)carbamate: LC-MS (ES) m/z = 456. (M+H)+.
c) 1 ,1-dimethylethyl [3-oxo-2-(phenylmethyl)-3-({5-[1-(phenylsulfonyl)-1 H- pyrrolo[2,3-jb]pyridin-4-yl]-2-thienyl}amino)propyl]carbamate
To a solution of 1,1-dimethylethyl {5-[1-(phenylsulfonyl)-1 /-/-pyrrolo[2,3- £>]pyridin-4-yl]-2-thienyl}carbamate (400 mg, 0.88 mmole) in methylene chloride (5 mL) was added TFA (3 mL) at RT. The reaction was allowed to stir at RT for 1h and then concentrated to a solid under vacuum.
To a solution of 3-({[(1 ,1-dimethylethyl)oxy]carbonyl}amino)-2- (phenylmethyl)propanoic acid (0.5 g, 1.76 mmole) in DCM (4 mL) was added PyBrop (0.84g, 1.76 mmole) and Hunig's base (3 ml_, 17.0 mmole). After 15 min., the residual amine from above was added to the reaction mixture in DCM (2 mL) and stirred for 12h at RT. The reaction solution was concentrated under vacuum and purified on silica gel (Hexane/EtOAc, 1 :1) to give the title compound (80 mg, 15 % two steps) as a yellow foam: LC-MS (ES) m/z = 617 (M+H)+.
d) 3-amino-2-(phenylmethyl)-/V-[5-(1/-/-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]propanamide
To a solution of 1,1-dimethylethyl [3-oxo-2-(phenylmethyl)-3-({5-[1- (phenylsulfonyl)-i H-pyrrolo[2,3-ώ]pyridin-4-yl]-2-thienyl}amino)proρyl]carbamate (80 mg, 0.13 mmole) in MeOH (2 mL) was added 6N NaOH (2 mL). After 0.5 h at 55 °C, the reaction mixture was neutralized with 1M aqueous HCI and extracted with DCM. The DCM solution was dried over Na2SO4, concentrated under vacuum, and purified on silica gel (DCM/MeOH, 95:5) to give a tan solid 30 mg: LC-MS (ES) m/z = 477 (M+H)+.
The solid material from above was dissolved in MeOH (2 mL) and to the solution was added 1M HCI in dioxane (1 mL). After 12 h at RT, the reaction solution was concentrated under vacuum to give the title compound (20 mg, 32% for two steps) as a yellow solid: LC-MS (ES) m/z = 377. (M+H)+. 1H NMR (d4-MeOH, 400 MHz) δ 8.26 (d, J = 6.6 Hz, 1H), 7.94 (d, J = 4.3 Hz, 1 H), 7.75 (d, J = 6.6 Hz,
1 H), 7.70 (d, J = 3.5 Hz, 1H), 7.31-7.20 (m, 6H), 6.94 (d, J = 4.0 Hz, 1 H), 3.40-3.29 (m, 2H), 3.19-3.11 (m, 2H) and 3.01 (dd, J = 7.3, 13.6 Hz, 1 H).
Example 27
Preparation of 3-amino-/vM4-bromo-5-(1H-pyrrolof2,3-ά1pyridin-4-vO-2-thienvH-2- phenylpropanamide
a) 1 , 1-dimethylethyl (4,5-dibromo-2-thienyl)carbamate
To a mixture of 4,5-dibromothiophenecarboxylic acid (9.8 mmoles, 2.8 g) in t-BuOH (20 mL) was added DPPA (12.5 mmoles, 2.7 ml_) and triethylamine (29 mmole, 4.2 mL). The mixture was heated to 85 0C for 12 h under an atmosphere of N2. After cooling to RT, the reaction was concentrated in vacuo. Flash chromatography (silica gel, hexanes/EtOAc, 10:1)) gave the title compound (2.6 g, 74%) as a white solid. LCMS (ES) m/z 357 (M+H)+.
b) 1 ,1-dimethylethyl {4-bromo-5-[1-(phenylsulfonyl)-1/-/-pyrrolo[2,3-6]pyridin-4-yl]-2- thienyl}carbamate
To a solution of 1 ,1-dimethylethyl (4,5~dibromo-2-thienyl)carbamate (1.3 g,
3.64 mmole) in dioxane (10 mL) and H2O (2 mL) was added K2CO3 (2.0 g, 14.5 mmole), tetrakistriphenylphosphine Pd(O) (0.210 g, 0.18 mmole), and 1- (phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1/-/-pyrrolo[2,3- b]pyridine (1.54 g, 4.0 mmole). The reaction mixture was heated to 70° C in a sealed tube for 4h. The reaction solution was concentrated under vacuum, and purified on silica gel (hexanes/EtOAc, 3:1) to give the title compound (600mg, 40% at 80% conversion) as a yellow solid: LC-MS (ES) m/z = 535 (M+H)+.
c) 1,1-dimethylethyl [3-({4-bromo-5-[1-(phenylsulfony!)-1H-pyrrolo[2,3-6]pyridin-4- yl]-2-thienyl}amino)-3-oxo-2-phenylpropyl]carbamate.
To a solution of 1 ,1-dimethylethyl {4-bromo-5-[1-(phenylsulfonyl)-1H- pyrrolo[2,3-ώ]pyridin-4-yl]-2-thienyl}carbamate (250m g, 0.46 mmole) in methylene chloride (3 mL) was added TFA (3 rtiL) at RT. The reaction was allowed to stir at RT for 1 h and then concentrated to a solid under vacuum.
To a solution of 3-({[(1 , 1-dimethylethyl)oxy]carbonyl}amino)-2- phenylpropanoic acid (0.182 g, 0.69 mmole) in DCM (3 mL) was added PyBrop (0.32 g, 0.69 mmole) and Hunig's base (3 mL, 17.0 mmole). After 15 min., the residual amine from above was added to the reaction mixture in DCM (2 mL) and stirred for 12h at RT. The reaction solution was concentrated under vacuum and purified on silica gel (hexane/EtOAc, 2:1 to 1 :1 ) to give the title compound (220 mg, 70% two steps) as a yellow foam: LC-MS (ES) m/z = 681 ( M+).
d) 3-amino-Λ/-[4-bromo-5-(1H-pyrrolot2,3-ό]pyridin-4-yl)-2-thienyl]-2- phenylpropanamide
To a solution of 1 ,1-dimethylethyl [3-({4-bromo-5-[1-(phenylsulfonyl)-1/+ pyrrolo[2,3-6]pyridin-4-yl]-2-thienyl}amino)-3-oxo-2-phenylpropyl]carbamate (0.18 g, 0.26 mmole) in MeOH (3 mL) was added 6N NaOH (2.5 mL). After 0.5 h at 55 0C, the reaction mixture was neutralized with 1 M aqueous HCI and extracted with DCM. The DCM solution was dried over Na2SO4, concentrated under vacuum, and purified on silica gel (DCM/MeOH, 95:5) to give a tan solid (78 mg, 50%): LC-MS (ES) m/z = 542 (M+H)+. The solid material from above was dissolved in MeOH (2 mL) and to the solution was added 4M HCI in dioxane (2.5 mL). After 12 h at RT, the reaction solution was concentrated under vacuum to give the title compound (61 mg, 96%): LC-MS (ES) m/z = 442. (M+H)+. 1H NMR (d4-MeOH, 400 MHz) δ 8.43 (d, J = 6.3 Hz, 1 H), 7.90 (d, J = 6.3 Hz, 1 H), 7.78 (d, J = 3.5 Hz, 1 H), 7.50-7.41 (m, 5H), 7.71 (d, J = 3.5 Hz, 1 H), 6.90 (s, 1 H), 4.23 (dd, J = 8.8, 5.6 Hz, 1 H), and 3.7-3.59 (m, 2H). Example 28
Preparation of 3-amino-2-phenyl-Λ/-[5-(1 H-pyrrolor2.3-)blpyridin-4-vO-3- thienyllpropanamide
a) 4-(4-bromo-2-thienyi)-1-(phenylsulfonyl)-1H-pyrrolo[2,3-b]pyridine
To a solution of 2,4-dibromothiophene (0.57 g, 2.35 mmole) in dioxane (10 ml_) and H2O (2 ml_) was added K2CO3 (0.8 g, 5.8 mmole), tetrakistriphenylphosphine Pd(O) (0.14 g, 0.17 mmole), and 1-(phenylsulfonyl)-4- (4,4,5,54etramethyl-1 ,3,2-dioxaborolan-2-y!)-1H-pyrrolo[2,3-b]pyridine (1.0 g, 2.6 mmole). The reaction mixture was heated to 70° C in a sealed tube for 4h. The reaction solution was concentrated under vacuum, and purified on silica gel
(hexanes/EtOAc, 5:1 ) to give the title compound (520 mg, 53%) as a white solid: LC-MS (ES) m/z = 420 (M+H)+.
b) 1 ,1-dimethylethyl [3-oxo-2-phenyl-3-({5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3- b]pyridin-4-yl]-3-thienyl}amino)propyl]carbarnate
A mixture of 4-(4-bromo-2-thienyl)-1-(phenylsulfonyl)-1 H-pyrrolo[2,3- 6]pyridine (300 mg, 7.2 mmol), 3-({[(1 ,1-dimethylethyl)oxy]carbonyl}amino)-2- phenylpropanoic acid (310 mg, 0.41 mmol), CuI (2 mg, 0.01 mmol), K2CO3 (300 mg, 2.2 mmol), N, N-dimethylethylenediamine (13 μl_, 0.13 mmol) in dioxane (5 ml_) was heated under N2 in a sealed tube at 110 0C for 12 h. After cooling to rt, the suspension was diluted with EtOAc, filtered, and concentrated,. The crude material was purified on silica gel (hexanes/EtOAc, 1 :1) to give the title compound (132 m g, 31%) as a brown solid: LC-MS (ES) m/z = 603 (M+H)+.
c) 3-amino-2-phenyl-Λ/-[5-(1 H-pyrrolo[2,3-6]pyridin-4-yl)-3-thienyl]propanamide
To a solution of 1 ,1-dimethylethyl [3-oxo-2-phenyl-3-({5-[1-(phenylsulfonyl)- 1 H-pyrrolo[2,3-b]pyridin-4-yl]-3-thienyl}amino)propyl]carbarnate (0.132 g, 0.22 mmole) in MeOH (3 ml_) was added 6N NaOH (2.5 ml_). After 0.5 h at 55 0C, the reaction mixture was neutralized with 1 M aqueous HCI and extracted with DCM. The DCM solution was dried over Na2SO4, concentrated under vacuum, and purified on silica gel (DCM/MeOH, 95:5) to give a tan solid LC-MS (ES) m/z = 463 (M+Hf.
The solid material from above was dissolved in MeOH (2 mL) and to the solution was added 4M HCI in dioxane (2.5 mL). After 12 h at RT, the reaction solution was concentrated under vacuum to give the title compound as a green solid (90 mg, 94%): LC-MS (ES) m/z = 363 )+. 1H NMR (d4-MeOH, 400 MHz) δ 8.38 (d, J = 6.3 Hz, 1H), 8.11(d, J = 1.3 Hz, H), 8.06 (d, J = 1.3 Hz, 1H), 7.78 (br s, 1H), 7.77 (d, J = 3.0 Hz, 1 H), 7.52-7.37 (m, 5H), 7.24 (d, J = 3.5 Hz, 1 H), 4.21 (dd, J = 8.8 Hz, 1H), and 3.77-3.59 (m, 2H).
Example 29
Preparation of ethyl 4-f5-({r2-(dimethylamino')-1-phenylethyllamino>carbonylV2- thienyll-1/-/-pyrrolor2.3-blpyridine-2-carboxylate
a) Ethyl 4-bromo-1/-/-pyrrolo[2,3-6]pyridine-2-carboxylate
Ethyl 1H-pyrrolo[2,3-6]pyridine-2-carboxylate 7-oxide (1.0 g, 5.0 mmol), which was prepared according to WO2000044753, and tetramethylammonium bromide (1.2 g, 7.5 mmol) were added to DMF (50 iml_). The mixture was cooled to 0 0C and methanesulfonic anhydride (1.7 g, 10 mmol) was added portion wise. The resulting suspension was warmed up to rt and stirred for 6 h. The mixture was poured in water (100 ml_) and the solution was neutralized with 50 % aqueous NaOH. The resulting solution was extracted with AcOEt, and then, the organic layer was washed by water and brine. Concentration in vacuo gave the residue, which was purified by SCX cartridge to afford the desired compound as a pale yellow solid (1.0 g, 77%). 1H NMR (400MHz, DMSO-c/6) ppm 1.35 (t, 3H1 J = 7.1 Hz), 4.36 (q, 2H, J = 7.1 Hz), 7.05 (d, 1 H, J = 2.0 Hz), 7.48 (d, 1 H1 J = 5.1 Hz), 8.28 (d, 1 H, J = 5.1 Hz), 12.95 (brs, 1 H). LC/MS: m/z 269, 271 (M+1)+
b) Ethyl 4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)- -1AV-pyrrolo[2,3-b]pyridine-2-carboxylate
Ethyl 4-bromo-1 H-pyrrolo[2,3-6]pyridine-2-carboxylate (1.0 g, 3.9 mmol), 4l4,4',4',5,5,5',5'-octamethyl-2,2'-bi-1,3,2-dioxaborolane (2.1 g, 7.8 mmol), KOAc (1.2 g, 11.7 mmol) and Pd(dppf)CI2 (0.3 g, 0.4 mmol) in DMF (20 ml_) was heated at 90 0C for 48 h under inert atmosphere. After cooling to rt, the reaction was quenched with aqueous NH4CI. The resulting mixture was extracted with AcOEt. The organic layer was washed by water, brine, and dried over sodium sulfate. Concentration in vacuo gave the residue, which was purified by YAMAZEN Fast Flow Liquid Chromatography (silica gel, EtOAc.hexane , 1:1) to give the desired product as a white solid (0.8 g, 68 %). 1H NMR (400MHz, DMSO-d6) ppm 1.33- 1.37 (m, 15H), 4.37 (q, 2H, J = 7.1 Hz), 7.29 (d, 1 H1 J = 2.0 Hz), 7.40 (d, 1 H1 J = 4.5 Hz), 8.44 (d, 1 H, J = 4.3 Hz), 12.55 (brs, 1 H). LC/MS: m/z 315 (M-1 )-, 317 (M+1)+.
c) Ethyl 4-[5-({[2-(dimethylamino)-1 -phenylethyl]amino}carbonyl)-2-thienyl]-1 H- pyrrolo[2,3-jb]pyridine-2-carboxylate
5-Bromo-Λ/-[2-(dimethylamino)-1-phenylethyl]-2-thiophenecarboxamide (35.3 mg, 0.1 mmol) and ethyl 4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1/-/- pyrrolo[2,3-b]pyridine-2-carboxylate (31.6 mg, 0.1 mmol) were dissolved in DME (2 ml_) and aqueous Na2CO3 (2M, 0.2 mL). The resulting solution and Pd(PPh3)4 (11.6 mg, 0.01 mmol) was added to the Microwave vial. After capping, the mixture was heated with SmithSynthesizer at 120 0C for 60 min. The mixture was filtered and washed with MeOH. After purification by SCX cartridge via capture-and-release, the residue was purified by LC/MS purification to give the desired compound. 1H NMR (400 MHz, c/6-DMSO) ppm 1.36 (d, 3H, J = 7.1 Hz), 2.23 (s, 6H), 4.38 (q, 2H, J = 7.1 Hz), 5.14-5.22 (m, 1H), 7.25 (dd, 1 H, J = 1.3, 7.1 Hz), 7.33-7.37 (m, 2H), 7.42 (s, 2H), 7.48 (s, 1 H), 7.50 (d, 1 H, J = 5.1 Hz), 7.93 (d, 1 H, J = 4.0 Hz), 8.04 (d, 1 H, J = 4.0 Hz), 8.46 (d, 1 H, J = 5.1 Hz), 8.92 (d, 1 H, J = 8.3 Hz), 12.82 (brs, 1 H). LC/MS: m/z 461 (M-1 )-, 463 (M+1 )+.
Example 30
Preparation of N-r2-(Dimethylamino)-1-phenylethvπ-5-(1 H-pyrrolor2,3-b]pyridin-4- vQ-2-thiophenecarboxamide
a) Λ/-[2-(Dimethylamino)-1 -phenylethyl]-5-{1 -[(4-methylphenyl)sulfonyl]-1 H- pyrrolo[2,3-<b]pyridin-4-yl}-2-thiophenecarboxamide
Prepared according to the procedure of Example 29 , except substituting 1- [(4-methylphenyl)sulfonyl]-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H- pyrrolo[2,3-£>] pyridine (Preparation 3) for ethyl 4-(4,4,5,5-tetramethyl-1,3,2- dioxaborolan-2-yl)-1 /-/-pyrrolo[2,3-5]pyridine-2-carboxylate, to prepare the title compound.
b) Λ/-[2-(Dimethylamino)-1-phenylethyl]-5-(1f/-pyrrolo[2,3-/3]pyridin-4-yl)-2- thiophenecarboxamide (the title compound)
To a solution of the above residue in a mixture of CH2CI2 and MeOH, 6 N aqueous NaOH was added and stirred at rt for 3 h. Neutralized the reaction with 1 Λ/ aqueous HCI and purified by SCX cartridge via capture-and-release. Concentration in vacuo and purification by LC/MS gave the desired compound. 1H NMR (400MHz, DMSO-d6) ppm 2.30 (s, 6H), 2.54 (br, 1 H)1 2.89 (br, 1 H), 5.22 (br, 1 H), 6.84-6.85 (m, 1 H), 7.24-7.45 (m, 6H), 7.62-7.64 (m, 1 H), 7.85 (d, 1 H, J = 3.8 Hz), 8.03 (d, 1H, J = 3.8 Hz), 8.27 (d, 1 H, J = 5.1 Hz), 8.92 (d, 1 H1 J = 7.6 Hz), 11.94 (s, 1 H). LC/MS: m/z 389 (M-1)-, 391 (M+1 )+
Example 31
Preparation of 4-Phenyl-N-r5-(1 H-Dyrrolor2.3-feipyridin-4-yl')-2-thienyll-4- piperidinecarboxamide a) 1-[(4-Methylphenyl)sulfonyl]-4-(5-nitro-2-thienyl)-1H-pyrrolo[2,3-6]pyridine
1-[(4-Methylphenyl)sulfonyl]-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)- 1H-pyrrolo[2,3-b]pyridine (880 mg, 2.2 mmol) and 2-bromo-5-nitrothiophene (416 mg, 2 mmol) were dissolved in DME (10 ml_) and aqueous Na2COa (2M, 2 ml_). The resulting solution and Pd(PPh3)4 (100 mg, 0.087 mmol) was added to the Microwave vial. After capping, the mixture was heated with Creator at 120 0C for 60 min. The crude was extracted with CH2CI2, and washed with aqueous NH4CI solution. After removing the solvent, the residue was directly used for the next step.
b) (5-{1-[(4-Methylphenyl)sulfonyl]-1 H-pyrrolo[2,3-ό]pyridin-4-yl}-2-thienyl)amine
A solution of 1-[(4-methylphenyl)sulfonyl]-4-(5-nitro-2-thienyl)-1H- pyrrolo[2,3-6]pyridine (52 mg, 0.13 mmol) in MeOH (5 ml_) with a catalytic amount of 10% Pd/C was stirred under H2 atmosphere (H2 balloon) at rt for 3 h. The catalyst was removed by filtration with celite pad and washed by MeOH. After purification by SCX cartridge via capture-and-release gave the corresponding title compound, which was directly used without further purification. 1H NMR (400 MHz, d6-DMSO) ppm 2.34 (s, 3H), 5.98 (d, 1 H, J = 3.8 Hz), 6.36 (s, 2H),7.06 (d, 1 H, J = 4.0 Hz), 7.20 (d, 1 H, J = 5.3 Hz), 7.40-7.44 (m, 3H), 7.86 (d, 1 H, J = 4.0 Hz), 7.99 (d, 2H, J = 8.6 Hz), 8.15 (d, 1 H, J = 5.3 Hz). LC/MS: m/z 368 (M-1 )-, 370 (M+ 1)+ c) 1,1-Dimethylethyl 4-{[(5-{1-[(4-methylphenyl)sulfonyl]-1H-pyrrolo[2,3-fe]pyridin-4- yl}-2-thienyl)amino]carbonyl}-4-phenyl-1-piperidinecarboxylate
(5-{1-[(4-Methylphenyl)sulfonyl]-1 /-/-pyrrolo[2,3-ό]pyridin-4-yl}-2- thienyl)amine (37 mg, 0.1 mmol), 1-{[(1 ,1-dimethylethyl)oxy]carbonyl}-4-phenyl-4- piperidinecarboxylic acid (37 mg, 0.12 mmol) and 1-(methylsulfonyl)-1 H-1 ,2,3- benzotriazole (24 mg, 0.12 mmol) were dissolved into anhydrous THF (1 mL) and Et3N (20 mg, 0.2 mmol) in a microwave vial. The mixture was heated by microwave irradiation at 160 0C for 15 min. After removing the solvent, the residue was purified by prep. LC/MS to give the title compound without the calculation of the yield.
d) 4-Phenyl-A/-[5-(1 H-pyrrolo[2,3-6]pyridin-4-yl)-2-thienyl]-4-piperidinecarboxamide
The residue was dissolved into MeOH (3 mL) and cone. HCI (0.5 mL) in a microwave vial. The mixture was heated by microwave irradiation at 80 0C for 30 min. After concentration in vacuo, the residue was dissolved into MeOH (2 mL) and 6 N KOH (0.5 mL). The mixture was heated at 55 0C for 12 h. After removing the solvent, the residue was purified by prep. LC/MS to give the title compound without the calculation of the yield. 1H NMR (400MHz, DMSO-d6) ppm 1.90-3.17 (m, 8H), 6.78-6.80 (m, 1 H)1 6.87 (d, 1 H, J = 4.0 Hz), 7.23 (d, 1 H, J = 5.0 Hz), 7.25-7.29 (m, 1 H), 7.36-7.43 (m, 4H), 7.51-7.54 (m, 2H), 8.16 (d, 1 H, J = 5.0 Hz), 10.84 (br, 1 H), 11.75 (s, 1 H). LC/MS: m/z 401 (M-1 )-, 403 (M-M )+.
Example 32
Preparation of ΛHr5-(1 H-Pyrrolo[2,3-ϋlPyridin-4-ylV2-thienyllcarbonyl>tyrosinamide
a) 5-(1 /-/-Pyrrolo[2,3-/)]pyridin-4-yl)-2-thiophenecarboxylic acid
A mixture of 1-[(4-methylphenyl)sulfonyl]-4-(4,4,5,5-tetramethyl-1 ,3,2- dioxaborolan-2-yl)-1 /-/-pyrrolo[2,3-έ>]pyridine (1.2 g, 3 mmol), 5-bromo-2- thiophenecarboxylic acid (745 mg, 3.6 mmol), Pd(PPh3^ (350 mg, 0.3 mmol), 2M aqueous Na2CO3 (6 ml_) and DMF (15 ml_) was heated at 80 0C for 16 h. After cooling, the reaction mixture was filtered through a filter tube (5.0 μm pore size) and washed with MeOH. 6A/ aqueous NaOH (100 mL) was added to the filtrate and the mixture was stirred at 50 °C for 1 to 2 h. The mixture was acidified with 2Λ/ HCI and purified by SCX. 1H NMR (400MHz, DMSO-c/6) ppm 6.83-6.86 (m, 1 H), 7.43 (d, 1 H, J = 5.1 Hz), 7.64-7.67 (m, 1 H), 7.82 (d, 1 H, J = 3.9 Hz), 7.85 (d, 1 H1 J = 3.9 Hz), 8.28 (d, 1 H, J = 5.1 Hz), 11.99 (br, 1 H), 13.37 (br, 1 H). LC/MS: m/z 243 (M-1 )- , 245 (M+1)+
b) N-{[5-(1 /-/-Pyrrolo[2,3-b]pyridin-4-yl)-2-thienyl]carbonyl}tyrosinamide
To a solution of 5-(1/-/-pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxylic acid
(30 mg, 0.12 mmol) in DMF (2 mL) were added tyrosinamide (45 mg, 0.25 mmol) and HBTU (76 mg, 0.2 mmol), and the mixture was stirred at rt for 16h. Then the mixture was concentrated in vacuo, and purified by prep. LC/MS. 1H NMR (400MHz, DMSO-c/6) ppm 2.79-2.91 (m, 1 H), 2.94-3.05 (m, 1 H), 4.49-4.59 (m, 1 H), 6.63 (d, 2H, J = 8.6 Hz), 6.83 (d, 1H1 J = 3.5 Hz), 7.11 (br, 1H), 7.13 (d, 2H, J = 8.6 Hz), 7.37 (d, 1 H, J = 5.0 Hz), 7.57 (br, 1 H), 7.62 (d, 1 H, J = 3.5 Hz), 7.80 (d, 1 H, J = 4.0 Hz), 7.96 (d, 1 H, J = 4.0 Hz), 8.25 (d, 1 H, J = 5.0 Hz), 8.66 (d, 1 H, J = 8.6 Hz), 9.16 (br, 1 H), 11.93 (br, 1 H). LC/MS: m/z 405 (M-1 )-, 407 (M+1 )+. Example 33
Preparation of N42-(4-Morpholinviyi-phenylethvπ-5-(1H-pyrrolof2,3-fo1pyridin-4-viy- 2-thioρhenecarboxamide
Prepared according to the procedure of Example 32, except substituting 2- (4-morpholinyl)-1-phenylethanamine for tyrosinamide, to prepare the title compound. 1H NMR (400MHz, DMSO-d6) ppm 2.41-2.59 (m, 5H), 2.85 (dd, 1 H, J = 12.6, 9.9 Hz), 3.50-3.61 (m, 4H), 5.20-5.28 (m, 1 H), 6.84 (d, 1 H, J = 3.3 Hz), 7.23- 7.28 (m, 1 H), 7.32-7.40 (m, 3H), 7.41-7.46 (m, 2H), 7.61-7.65 (m, 1 H), 7.85 (d, 1 H, J = 4.0 Hz), 8.02 (d, 1 H, J = 4.0 Hz), 8.26 (d, 1 H, J = 5.1 Hz), 8.90 (d, 1 H, J = 8.3 Hz), 11.93 (br, 1 H). LC/MS: m/z 431 (M-1 )-, 433 (M+1 )+.
Example 34
Preparation of Λ/-r2-Phenyl-2-(1-pyrrolidinvnethvn-5-(1 rt-pyrrolor2,3-άlpyridin-4-vP- 2-thiophenecarboxamide
Prepared according to the procedure of Example 32, except substituting 2- pheny1-2-(1-pyrrolidinyl)ethanamine for tyrosinamide, to prepare the title compound. 1H NMR (400MHz, DMSO-c/6) ppm 1.59-1.70 (m, 4H), 2.31-2.41 (m, 2H), 2.50-2.58 (m, 2H), 3.38-3.55 (m, 2H), 3.76-3.86 (m, 1H), 6.82 (d, 1 H, J = 3.6 Hz), 7.21-7.27 (m, 1 H), 7.29-7.32 (m, 4H), 7.35 (d, 1 H1 J = 4.8 Hz), 7.60-7.64 (m, 1 H), 7.71 (d, 1 H, J = 4.0 Hz), 7.76 (d, 1 H1 J = 4.0 Hz), 8.25 (d, 1 H1 J = 5.1 Hz)1 8.41 (t, 1 H, J = 5.8 Hz)1 11.92 (br, 1 H). LC/MS: m/z 415 (M-1 )-, 417 (M+1 )+.
Example 35
Preparation of N4(2-AminophenvπrnethylV-5-(1 H-pyrrolof2.3-foiDyridin-4-ylV2- thiophenecarboxamide
Prepared according to the procedure of Example 32, except substituting 2- (aminomethyl)aniline for tyrosinamide, to prepare the title compound. 1H NMR
(400MHz, DMSO-c/6) ppm 4.33 (d, 2H, J = 6.1 Hz)1 5.15 (br, 2H)1 6.50-6.56 (m, 1 H), 6.61-6.66 (m, 1 H), 6.85 (dd, 1 H1 J = 3.5, 1.8 Hz), 6.95-7.01 (m, 1 H), 7.03-7.08 (m, 1 H), 7.39 (d, 1 H, J = 5.1 Hz), 7.63 (dd, 1 H1 J = 3.5, 2.5 Hz), 7.83 (d, 1 H1 J = 3.8 Hz), 7.91 (d, W, J = 4.0 Hz)1 8.26 (d, 1 H, J = 5.1 Hz), 9.07 (t, 1 H, J = 6.0 Hz)1 1 1.94 (br, 1 H). LC/MS: m/z 347 (M-1 )-, 349 (M+1)+.
Example 36
Preparation of Λ/-IY3-Aminophenv0methvπ-5-(1 /-/-pyrrolor2.3-frlpyridin-4-vO-2- thiophenecarboxamide
Prepared according to the procedure of Example 32 , except substituting 3- (aminomethyl)aniline for tyrosinamide, to prepare the title compound. 1H NMR (400MHz, DMSO-d6) ppm 4.35 (d, 2H, J = 5.8 Hz), 5.06 (br, 2H), 6.41-6.49 (m, 2H), 6.51-6.55 (m, 1 H), 6.85 (dd, 1 H, J = 3.5, 1.8 Hz), 6.97 (t, 1 H, J = 7.7 Hz), 7.39 (d, 1 H, J = 5.1 Hz), 7.63 (dd, 1 H1 J = 3.3, 2.5 Hz), 7.82 (d, 1 H, J = 4.0 Hz), 7.93 (d, 1 H, J = 4.0 Hz), 8.26 (d, 1 H, J = 5.1 Hz), 9.09 (t, 1 H1 J = 5.9 Hz), 1 1.93 (br, 1 H). LC/MS: m/z 347 (M-1)-, 349 (M+1 )+.
Example 37
Preparation ofΛ/-(2-Aminoethvn-5-(1/-/-ρyrrolor2,3-frlρyridin-4-vn-2- thiophenecarboxamide
Prepared according to the procedure of Example 32, except substituting 1 ,1- dimethylethyl (2-aminoethyl)carbamate for tyrosinamide, followed by Boc- deprotection using TFA to prepare the title compound. 1H NMR (400MHz, DMSO- dβ) ppm 2.80 (t, 2H, J = 6.4 Hz), 3.34-3.39 (m, 2H), 6.85 (d, 1 H, J = 3.5 Hz), 7.39 (d, 1 H1 J = 5.1 Hz), 7.63 (d, 1 H, J = 3.5 Hz), 7.82 (d, 1 H, J = 4.0 Hz), 7.88 (d, 1 H, J = 4.0 Hz), 8.26 (d, 1 H1 J = 5.1 Hz)1 8.82 (t, 1 H, J = 5.4 Hz), 11.94 (br, 1 H). LC/MS: m/z 285 (M-1 )-, 287 (M+1 )+.
Example 38
Preparation of Λ/-(2-amino-1-phenylethylV4-(3-pyridinyl')-5-(1 H-pyrrolol'Σ.S-jblpyridin- 4-ylV2-thiophenecarboxamide
a) 1 ,1-dimethylethyl [2-phenyl-2-({[5-[1-(phenylsulfonyl)-1H-pyrrolo[2,3- b]pyridin-4-yl]-4-(3-pyridinyl)-2-thienyl]carbonyl}amino)ethyl]carbamate
To a solution of 1 ,1-dimethylethyl {2-[({4-bromo-5-[1-(phenylsulfonyl)-1 H- pyrrolo[2,3-/)]pyridin-4-yl]-2-thienyl}carbonyl)amino]-2-phenylethyl}carbamate (0.60 g, 0.88 mmole) in dioxane (25 mL) and H2O (5 ml.) in a screw-cap sealed flask was added pyridine-3-boronic acid (0.22 g, 1.76 mmole), K2CO3 (0.36 g, 2.64 mmole) and Pd(PPh3)4 (0.10 g, 0.09 mmole). After heating to 80 0C for 16h, the reaction solution was concentrated under vacuum and purified on silica (DCIWMeOH; 95:5) to afford a light yellow solid (0.40 g, 67 %): LC-MS (ES) m/z = 681 (M+H)+.
b) A/-(2-amino-1-phenylethyl)-4-(3-pyridinyl)-5-(1 /-/-pyrrolo[2,3-6]pyridin-4-yl)-2- thiophenecarboxamide To a solution of 1 ,1-dimethylethyl [2-phenyl-2-({[5-[1-(phenylsulfonyl)-1 H- pyrrolot2,3-jb]pyridin-4-yl]-4-(3-pyridinyl)-2-thienyl]carbonyl}amino)ethyl]carbamate (0.40 g, 0.59 mmole) in MeOH (3 mL) was added 6N NaOH (1 ml_). After 1 h at RT, the reaction mixture was neutralized with 1M aqueous HCI and extracted with DCM. The DCM solution was dried over Na2SO4, concentrated under vacuum and purified on silica (DCIWMeOH; 95:5) to afford a light yellow solid (0.27 g, 85 %): LC-MS
(ES) m/z = 541 (M+H)+.
The solid material from above was dissolved in MeOH (2 mL) and to the solution was added 4M HCI in dioxane (3 mL). After 6 h at RT, the reaction solution was concentrated under vacuum to give the title compound (quant.) as a light yellow solid: LC-MS (ES) m/z = 441 (M+H)+. 1H NMR (d6-DMSO, 400 MHz) δ 9.91 (d, J = 9.1 Hz, 1 H), 8.87 (s, 1 H), 8.78 (m, 2H), 8.48 (br s, 2H), 8.31 (d, J = 5.1 Hz, 1 H), 8.20 (m, 1 H), 7.86 (m, 1 H), 7.53 (m, 2H), 7.40 (m, 2H), 7.32 (m, 1 H), 7.15 (d, J = 5.1 Hz, 1 H), 6.21 (m, 1 H), 5.39 (m, 1 H), 3.48 (m, 2H), and 3.34 (m, 1H).
Example 39
Preparation of A/-(2-amino-1-phenylethyl)-4-(1 H-pyrazol-4-yl)-5-(1H-pyrrolor2,3- b1pyridin-4-vO-2-thiophenecarboxamide
The title compound was prepared as a light yellow solid according to the procedure of Example 38, except substituting 4-pyrazoleboronic acid (0.34 g, 1.76 mmol) for pyridine-3-boronic acid: LC-MS (ES) m/z = 430 (M+H)\ 1H NMR (d6- DMSO, 400 MHz) 5 9.13 (d, J = 9.4 Hz, 1 H), 8.29 (d, J = 5.0 Hz, 1 H), 8.19 (s, 1 H), 8.12 (br s, 2H), 7.4-7.52 (m, 5H), 7.37 (m, 1 H), 7.10 (d, J = 5.0 Hz, 1 H), 6.19 (s, 1 H), 5.35 (m, 1 H), and 3.31 (m, 2H).
Example 40
Preparation of N-(2-amino-1-phenylethyl)-4-ethenyl-5-(1/V-pyrrolo[2,3-ά1pyridin-4- vD-2-thiophenecarboxamide
The title compound was prepared as a light yellow solid according to the procedure of Example 38, except substituting 2,4,6-trivinylcyclotriboroxane-pyridine complex (85 mg, 0.35 mmole) for pyridine-3-boronic acid: LC-MS (ES) m/z = 390 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9.72 (d, J = 8.1 Hz, 1H), 8.82 (s, 1H), 8.39 (m, 2H), 7.69 (m, 1 H), 7.50 (m, 2H), 7.41 (m, 2H), 7.32 (m, 1 H), 7.21 (m, 1 H), 6.63 (m, 1 H), 6.55 (m, 1 H), 5.95 (d, J = 17.4 Hz, 1 H), 5.39 (d, J = 12.0 Hz, 1 H), 5.30 (m, 1 H), 3.48 (m, 1 H), and 3.21 (m, 1 H).
Example 41
Preparation of ΛH2-amino-1-phenylethvO-4-cvclopropyl-5-(1 H-pyrrolor2.3-άlpyridin- 4-v0-2-thiophenecarboxamide
The title compound was prepared as a light yellow solid according to the procedure of Example 38, except substituting cyclopropane boronic acid (0.13 g, 1.47 mmol) for pyridine-3-boronic acid: LC-MS (ES) m/z = 403 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) 8 9.01 (d, J = 9.0 Hz, 1 H), 8.32 (d, J = 5.0 Hz, 1 H), 8.12 (br s, 2H), 7.61 (m, 1 H)1 7.45 (m, 3H), 7.36 (m, 1H), 7.36 (d, J = 5.0 Hz, 1 H), 6.57 (m, 1 H), 5.33 (m, 1 H), 3.31 (m, 2H), 1.97 (m, 1 H), 1.02 (m, 2H) and 0.79 (m, 2H).
Example 42
Preparation of 3-amino-Λ/-r4-bromo-5-(1 H-pyrrolor2,3-ibipyridin-3-yl)-2-thienvn-2- phenylpropanamide
The title compound was prepared as a light yellow solid according to the procedure of Example 7, except substituting 1-(phenylsulfonyl)-3-(4, 4,5,5- tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1H-pyrrolo[2,3-/b]pyridine (0.09 g, 0.35 mmol) for 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1/-/- pyrrolo[2,3-jb]pyridine and substituting 4,5~dibromo-2-thiophene carboxylic acid (0.79 g, 2.78 mmol) for 5-bromo-2-thiophenecarboxylic acid: LC-MS (ES) m/z = 441 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8.41 (d, J = 4.1 Hz, 1 H), 8.25 (m, 3H), 7.46 (m, 1 H), 7.38 (m, 3H), 6.82 (s, 1 H), 4.30 (m, 1 H), 3.69 (m, 1 H), 3.51 (m, 1H), and 3.11 (m, 1 H).
Example 43
Preparation of Λ/-IY1 SV2-amino-1-(phenylmethyl)ethvn-4-bromo-5-(1 /-/-pyrrolo|"2,3- άlpyridin-4-yl)-2-thiophenecarboxamide a) 4-bromo-5-[1-(phenylsulfonyl)-1 H-pyrroio[2,3-6]pyridin-4-yl]-2- thiophenecarboxylic acid
To a solution of 4,5-dibromo-2~thiophenecarboxylic acid (1.26 g, 4.4 mmol), in dioxane (50 ml_) and H2O (8 ml_) was added K2CO3 (1.82 g, 13.2mmol), tetrakistriphenylphosphine Pd(O) (0.51 g, 0.44 mmole), and 1-(phenylsulfonyl)-4- (4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1H-pyrrolo[2,3-jb]pyridine (1.7 g, 4.4 mmol). The reaction mixture was heated to 80° C in a sealed tube for 12h. The reaction solution was poured onto H2O (100 ml_) and extracted with DCM. The organics were dried (Na2SO4), concentrated under vacuum, and purified on silica gel (1 % MeOH in DCM) to give the title compound (1.0 g, 50%) as a yellow solid: LC-MS (ES) m/z = 464.
b) 4-bromo-Λ/-[(1 S)-2-(1 ,3-dioxo-1 ,3-dihydro-2H-isoindol-2-yl)-1-
(phenylmethyl)ethyl]-5-[1-(phenylsulfonyl)-1/-/-pyrrolo[2,3-ib]pyridin-4-yl]-2- thiophenecarboxamide
To a solution of 4-bromo-5-[1-(phenylsulfonyl)-1f/-pyrrolo[2,3-6]pyridin-4-yl]-
2-thiophenecarboxylic acid (0.51 g, 1.1 mmole) in DCM (50 mL) was added PyBrop (0.64g, 1.38 mmole), Hunig's base (0.8 mL, 4.6 mmole) and 2-[(2S)-2-amino-3- phenylpropyl]-1H-isoindole-1 ,3(2/-/)-dione (0.36 g, 0.92 mmole). After 18 h at RT, the reaction solution was concentrated under vacuum and purified on silica gel (DCM/MeOH 95:5) to give the title compound (0.60 g, 75%) as a white foam: LC- MS (ES) m/z = 726 ( M+H).
c) Λ/-[(1 S)-2-amino-1-(phenyImethyl)ethyl]-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)- 2-thiophenecarboxamide
To a solution of 4-bromo-Λ/-[(1S)-2-(1 ,3-dioxo-1 ,3-dihydro-2/-/-isoindol-2-yl)-
1-(phenylmethyl)ethyl]-5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin-4-yl]-2- thiophenecarboxamide (0.5 g, 0.66 mole) in MeOH (20 mL) at RT was added hydrazine (0.41 mL, 13.3 mmole). After stirring for 18h at RT, the reaction solution was concentrated under vacuum and used directly in the next reaction.
The residue from above was dissolved in THF (10 mL) and MeOH (10 mL) and 6M NaOH (2 mL) was added. After 1 hour at RT, the reaction solution was made neutral pH with 1M HCI and extracted with DCM. The organic solution was dried (Na2SO4) and concentrated under vacuum. Purification on silica (DCM/MeOH/NH4OH, 94:5:1 ) provided the title compound (120 mg) as a yellow solid: LC-MS (ES) m/z = 455 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.79 (s, 1H), 8.55 (m, 1 H), 7.97 (m, 1 H), 7.85 (br s, 1 H), 7.65 (m, 2H), 7.31 (m, 3H), 7.26 (m, 1 H), 7.00 (m, 1 H), 4.61 (m, 1 H), 3.24 (m, 2H), and 3.05 (m, 2H).
Example 44
Preparation of AZ-Fd /?)-2-amino-1-(phenylmethyl)ethyll-4-bromo-5-(1H-pyrrolor2,3- blpyridin-4-yl)-2-thiophenecarboxamide
The title compound was prepared as a light yellow solid according to the procedure of Example 43, except substituting 2-[(2/:?)-2-amino-3-phenylpropyl]-1H- isoindole-1 ,3(2/-/)-dione (0.36 g, 0.92 mmol) for 2-[(2S)-2-amino-3-phenylpropyl]- 1 f/-isoindole-1 ,3(2tf)-dione: LC-MS (ES) m/z = 455 (M+H)\ 1H NMR (CD3OD, 400 MHz) δ 8.79 (s, 1 H), 8.55 (m, 1 H), 7.97 (m, 1 H), 7.85 (br s, 1 H), 7.65 (m, 2H), 7.31 (m, 3H), 7.26 (m, 1 H), 7.00 (m, 1 H), 4.61 (m, 1 H), 3.24 (m, 2H), and 3.05 (m, 2H).
Example 45
Preparation of Λ/-IY1 SV2-amino-1-(phenylmethyl)ethvn-5-(1H-pyrrolor2.3-ά1pyridin-4- vh-2-thiophenecarboxamide
The title compound was prepared as a light yellow solid according to the procedure of Example 43, except substituting 5-bromo-2-thiophene carboxylic acid (0.79 g, 3.8 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid : LC-MS (ES) m/z = 377 (M+H)+, 1H NMR (CD3OD, 400 MHz) S 8.43 (m, 1 H), 8.09 (m, 1 H), 7.93 (m, 1 H), 7.89 (s, 1 H), 7.82 (m, 1H), 7.30 (m, 5H), 7.22 (m, 1 H), 4.61 (m, 1 H), 3.24 (m, 2H), and 3.06 (m, 2H).
Example 46
Preparation of Λ/-r(1/?")-2-amino-1-(phenylmethyπethyn-5-(1/-/-pyrrolor2.3-άlpyridin- 4-vO-2-thiophenecarboxamide
The title compound was prepared as a light yellow solid according to the procedure of Example 43, except substituting 2-[(2f?)-2-amino-3-phenylpropyl]-1H- isoindole-1 ,3(2H)-dione (0.36 g, 0.92 mmol) for 2-[(2S)-2-amino-3-phenylpropyl]- 1H-isoindole-1 ,3(2/-/)-dione and substituting 5-bromo-2-thiophene carboxylic acid (0.79 g, 3.8 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid: LC-MS (ES) m/z = 376 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.43 (m, 1 H), 8.09 (m, 1 H), 7.93 (m, 1 H), 7.89 (S, 1 H), 7.82 (m, 1 H), 7.30 (m, 5H), 7.22 (m, 1 H), 4.61 (m, 1 H), 3.24 (m, 2H), and 3.06 (m, 2H).
Example 47
Preparation of Λ/-f2-amino-1 -(phenylmethv0ethvπ-5-(3-phenyl-1 /-/-pyrrolor2,3- blpvridin-4-ylV2-thiophenecarboxamide
a) 4-bromo-3-phenyl-1-(phenylsulfonyI)-iH-pyrrolo[2,3-Jb]pyridine
To a solution of 4~bromo-3-iodo-1-(phenylsuifonyl)-1H-pyrrolo[2,3-6]pyridine (2.0 g, 4.3 mmole) in dioxane (60 mL) and H2O (6 mL) was added K2CO3 (1.79 g, 13.0 mmole), phenylboronic acid (0.53 g, 4.33 mmole) and tetrakistriphenylphosphine Pd(O) (0.50 g, 0.43 mmole). After stirring for 16 hours at 75°C under N2, the reaction contents were concentrated under vacuum and purified on silica (hexanes/EtOAc, 2:1) to give the title compound (1.2 g, 67%) as an orange solid : LC-MS (ES) m/z = 414 (M+H)+.
b) 1 ,1-dimethylethyl [3-phenyl-2-({[5-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)- 2-thienyl]carbonyl}amino)propyl]carbamate
To a solution of 1 ,1-dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-3- phenylpropyl)carbamate (0.80 g, 1.82 mmole) in DMF (3 mL) was added KOAc (0.54 g, 5.5 mmole), bis(pinocolato)diboron (0.92 g, 3.64 mmole) and Pd(dppf)CI2 (0.15 g, 0.18 mmole). The reaction contents were heated to 80DC in a sealed tube for 18 hours. The reaction solution was concentrated to a solid under vacuum and used directly in the next reaction.
c) 1,1-dimethylethyl {3-phenyl-2-[({5-[3-phenyl-1-(phenylsulfonyl)-1/-/-pyrrolo[2,3- 6]pyridin-4-yl]-2-thienyl}carbonyl)amino]propyl}carbamate
To a solution of 4-bromo-3-phenyl-1-(phenylsulfonyl)-1f/-pyrrolo[2,3- b]pyridine (0.22 g, 0.53 mmole) in dioxane (15 ml_) and H2O (3 ml_) was added 1 ,1- dimethylethyl [3-phenyl-2-({[5-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-2- thienyl]carbonyl}amino)propyl]carbamate (0.25 g, 0.53 mmole), Pd(PPh3)4 (61 mg, 0.05 mmole) and K2CO3 (0.22 g, 1.6 mmole). After heating to 800C for 18h under N2, the reaction solution was concentrated under vacuum and purified on silica (DCM/MeOH, 95:5) to afford the title compound (0.10 g, 27%) as a light yellow solid: LC-MS (ES) m/z = 693 (M+H)+.
d) 1 ,1-dimethylethyl [3-phenyl-2-({[5-(3-phenyl-1f/-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]carbonyl}amino)propyl]
A solution of 1 ,1-dimethylethyl {3-phenyl-2-[({5-[3-phenyl-1-(phenylsulϊonyl)- 1 H-pyrrolop.S-όlpyridin^-ylJ^-thienylJcarbony^aminoJpropylJcarbamate (100 mg, 0.14 mmol) in THF (4 ml_) and MeOH (4 ml_) was treated with 6N NaOH (1 ml_) and stirred at RT for 2h. The solution was then neutralized with 6N HCI and extracted with DCM. The combined organic fractions were dried (Na2SO4), concentrated and purified on silica (5% MeOH in DCM) affording the title compound (45 mg, 58%) as a yellow solid: LC-MS (ES) m/z = 553 (M+H)+.
g) Λ/-[2-amino-1-(phenylmethyl)ethyl]-5-(3-phenyl-1/-/-pyrrolo[2,3-ό]pyridin-4-yl)-2- thiophenecarboxamide
1,1-dimethylethyl [3-phenyl-2-({[5-(3-phenyl-1H-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]carbonyl}amino)propyl] (45 mg, 0.08 mmol) was dissolved in MeOH (3 mL) and treated with 4M HCI in dioxane (2 mL). After 1 h, the solution was concentrated affording the di-HCI salt of the title compound (21 mg) as a yellow solid: LC-MS (ES) m/z = 453 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.35 (d, J = 5.2 Hz, 1 H), 7.62 (s, 1H), 7.33 (m, 7H), 7.24 (m, 1 H), 7.17 (m, 2H), 7.10 (m, 2H), 6.51 (d, J = 5.0 Hz, 1 H), 4.51 (m, 1 H), 3.23 (m, 1 H), 3.14 (m, 1 H) and 3.06 (m, 2H). Example 48
Preparation of N-r2-ammo-1-(phenylmethv0ethvπ-4-π H-pyrrolo)"2,3-fr1pyridin-3-yiy 2-thioρhenecarboxamide
The title compound was prepared as a light yellow solid according to the procedure of Example 7, except substituting 1 ,1-dimethylethyl (2-{[(4-bromo-2- thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (0.30 g, 0.68 mmole) for 1, 1- dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-2-phenylethyl)carbamate and substituting 1-(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H- pyrrolo[2,3-b]pyridine (0.29 g, 0.76 mmole) for 1-(phenylsulfonyl)-4-(4,4,5,5- tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolot2,3-b]pyridine: LC-MS (ES) m/z = 377 (M+H)\ 1H NMR (CD3OD, 400 MHz) δ 9.13 (d, J = 7.2 Hz, 1 H), 8.51 (d, J = 5.5 Hz, 1 H), 8.32 (s, 1 H), 8.08 (s, 1 H), 8.00 (s, 1 H), 7.21 (m, 1 H), 7.38 (m, 1 H), 7.31 (m, 2H), 7.23 (m, 1 H), 4.61 (m, 1 H), 3.25 (m, 2H), 3.13 (m, 1 H) and 3.05 (m, 1 H).
Example 49
Preparation of 3-amino-Λ/-r5-(3-furanyO-4-(1 H-pyrrolor2.3-feipyridin-3-vπ-2-thienyll- 2-(phenylmethyl)propanamide
a) 1 ,1-dimethylethyl [4-bromo-5-(3-furanyl)-2-thienyl]carbamate
To a solution of 1 ,1-dimethylethyl (4,5-dibromo-2-thienyl)carbamate (1.0 g, 2.8 mmole) in dioxane (50 ml_) and H2O (8 mL) was added furan-3-boronic acid (0.31 g, 2.8 mmole), Pd(PPh3)4 (320 mg, 0.28 mmole) and K2CO3 (1.2 g, 8.4 mmole). After heating to 80 °C for 18h under N2, the reaction solution was concentrated under vacuum and purified on silica (DCM/MeOH, 95:5) to afford the title compound (0.55 g, 57%) as a white foam: LC-MS (ES) m/z = 345 (M+H)+.
b) 1 , 1-dimethylethyl {5-(3-furanyl)-4-[1~(phenylsulfonyl)-1H-pyrrolo[2,3-6]pyridin-3- yl]-2-thienyl}carbamate
To a solution of 1 ,1-dimethylethyl [4-bromo-5-(3-furanyl)-2- thienyl]carbamate (0.55 g, 1.6 mmole) in dioxane (50 ml_) and H2O (6 ml_) was added 1 -(phenyisulfonyl)-3-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H- pyrrolo[2,3-b]pyridine (0.68 g, 1.76 mmole), Pd(PPh3)4 (190 mg, 0.16 mmole) and K2CO3 (0.66 g, 4.8 mmole). After heating to 8O0C for 18h under N2, the reaction solution was concentrated under vacuum and purified on silica (hexanes/EtOAc, 1 :1 ) to afford the title compound (0.60 g, 63%) as a light yellow solid: LC-MS (ES) m/z = 522 (M+H)+.
c) 1 ,1-dimethylethyl [3-({5-(3-furanyl)-4-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin- 3-yl]-2-thienyl}amino)-3-oxo-2-(phenylmethyl)propyl]carbamate
To a solution of 1 ,1-dimethylethyl {5-(3~furanyl)-4-[1-(phenylsulfonyl)-1/-/- pyrrolo[2,3-i)]pyridin-3-yl]-2-thienyl}carbamate (0.60 g, 1.0 mmole) in MeOH (5 mL) was added 4M HCI in dioxane (10 mL). after stirring at RT for 6 hours the reaction solution was concentrated under vacuum to give a brown solid which was used directly in the next step: LC-MS (ES) m/z = 422 (M+H)+.
The amine hydrochloride salt from above (1 mmole) was dissolved in DCM (50 mL) and to the solution was added PyBrop (0.70 g, 1.5 mmole), (iPr)2NEt (0.87 mL, 5.0 mmole) and 3-({[(1 ,1-dimethylethyl)oxy]carbonyl}amino)-2- (phenylmethyl)propanoic acid (0.41 g, 1.5 mmole). After stirring at RT for 12h, the reaction solution was concentrated under vacuum and purified on silica
(DCM/MeOH, 97:3) to afford the title compound (0.30 g, 44%) as an off-white solid: LC-MS (ES) m/z = 683 (M+H)+.
d) 1 ,1-dimethylethyl [3-{[5-(3-furanyl)-4-(1 /-/-pyrrolo[2,3-b]pyridin-3-yl)-2- thienyl]amino}-3-oxo-2-(phenylmethyl)propyl]carbamate
A solution of 1 ,1-dimethylethyl [3-({5-(3-furanyl)-4-[1-(phenylsulfonyl)-1H- pyrrolo[2,3-ό]pyridin-3-yl]-2-thienyl}amino)-3-oxo-2-(phenylmethyl)propyl]carbamate (300 mg, 0.44 mmol) in THF/MeOH (10 mL/10 mL) was treated with 6N NaOH (1 mL) and stirred at RT for 2h. The solution was then neutralized with 6N HCI and extracted with DCM. The combined organic fractions were dried (Na2SO4), concentrated and purified on silica (5% MeOH in DCM) affording the title compound (200 mg, 84%) as a yellow solid: LC-MS (ES) m/z = 543 (M+H)+.
e) 3-amino-A/-[5-(3-furanyl)-4-(1H-pyrrolot2,3-5]pyridin-3-yl)-2-thienyl]-2- (phenylmethyl)propanamide
1,1-dimethylethyl [3-{[5-(3-furanyl)-4-(1H-pyrrolo[2,3-b]pyridin-3-yl)-2- thienyl]amino}-3-oxo-2-(phenylmethyl)propyl]carbamate (200 mg, 0.37 mmol) was dissolved in MeOH (3 ml_) and treated with 4M HCI in dioxane (4 ml_). After 2h, the solution was concentrated affording the di-HCI salt of the title compound (125mg) as a light green solid: LC-MS (ES) m/z = 443 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.43 (d, J = 5.6 Hz, 1 H), 8.33 (d, J = 6.7 Hz, 1 H), 7.74 (s, 1 H), 7.53 (m, 1 H), 7.49 (m, 1 H), 7.43 (m, 1 H), 7.31 (m, 4H), 7.27 (m, 1 H), 6.85 (s, 1 H), 6.26 (m, 1 H), 3.38 (m, 1 H), 3.24 (m, 1 H), 3.13 (m, 2H), and 2.99 (m, 1 H).
Example 50
Preparation of 3-amino-2-(phenylmethylHV-r4-(1 H-pyrrolor2,3-fo1pyridin-3-yl')-2- thienyllpropanamide
The title compound was prepared as a tan solid according to the procedure of Example 1, except substituting 3-({[(1,1-dimethyiethyl)oxy]carbσnyl}amino)-2- (phenylmethyl)propanoic acid (0.74 g, 2.6 mmole) for 3-({[(1,1- dimethylethyl)oxy]carbonyl}amino)-2-phenylpropanoic acid: LC-MS (ES) m/z = 377. (M+H)+. 1H NMR (CD3OD, 400 MHz) δ 9.03 (d, J = 8.0 Hz, 1 H), 8.50 (d, J = 5.0 Hz, 1 H), 7.93 (S, 1 H), 7.68 (m, 1 H), 7.32 (m, 5H), 7.27 (m, 1 H), 7.13 (s, 1 H), 3.35 (m, 1 H), 3.24 (m, 1 H), 3.15 (m, 2H) and 2.97 (m, 1 H).
Example 51
Preparation of Λ/-r2-amino-1-(phenylmethvπethyll-5-dH-pyrrolor2.3-iblpyridin-4-vπ- 2-furancarboxamide The title compound was prepared as a light yellow solid according to the procedure of Example 7, except substituting 1 ,1-dimethylethyl (2-{[(5-bromo-2- furanyl)carbonyl]amino}-3-phenylpropyl)carbamate (0.35 g, 0.83 mmole) for 1,1- dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-2-phenylethyl)carbamate: LC- MS (ES) m/z = 361 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.77 (d, J = 8.7 Hz, 1 H), 8.46 (d, J = 6.3 Hz, 1 H), 8.17 (d, J = 6.3 Hz, 1 H), 7.83 (d, J = 3.5 Hz, 1 H), 7.74 (d, J = 3.5 Hz, 1 H), 7.66 (m, 1 H)1 7.58 (m, 1 H), 7.43 (m, 1 H), 7.32 (m, 6H), 7.23 (m, 1 H), 4.69 (m, 1 H), 3.31 (m, 2H), and 3.06 (m, 2H).
Example 52
Preparation of Λ/-r2-amino-1-(phenylmethv0ethyll-5-πrt-pyrrolor2.3-ιblpyridin-3-v0- 2-furancarboxamide
The title compound was prepared as a light yellow solid according to the procedure of Example 7, except substituting 1 ,1-dimethylethyl (2-{[(5-bromo-2- furanyl)carbonyl]amino}-3-phenylpropyl)carbamate (0.35 g, 0.83 mmole) for 1, 1- dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-2-phenylethyl)carbamate and substituting 1 -(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H- pyrrolo[2,3-jb]pyridine (0.35 g, 0.91 mmole) for 1-(phenylsulfonyl)-4-(4,4,5,5- tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1H-pyrrolo[2,3-/?]pyridine: LC-MS (ES) m/z = 361 (M+H)\ 1H NMR (CD3OD, 400 MHz) δ 9.16 (d, J = 7.9 Hz, 1 H), 8.55 (d, J = 5.4 Hz, 1 H), 8.39 (s, 1 H), 7.73 (m, 1 H), 7.37 (m, 1 H), 7.32 (m, 4H), 7.24 (m, 1 H), 7.01 (m, 1 H), 4.62 (m, 1H), 3.29 (m, 2H), and 3.07 (m, 2H).
Example 53
Preparation of N-(YI S)-2-amino-1-{f2-(trifluoromethyl)phenyπmethyl}ethyiy4-bromo- 5-(1H-pyrrolof2,3-biDyricline-4-ylV2-furancarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 43, except substituting 2-{(2S)-2-amino-3-[2- (trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione (0.104 g, 0.3 mmol)[prepared from N-{[(1 , 1 -dimethylethy^oxylcarbonyl^-ttrifluoromethyiy-L- phenylalanine following preparation 7] for 2-[(2S)-2-amino-3-phenylpropyl]-1H- isoindole-1 ,3(2H)-dione : LC-MS (ES) m/z = 508 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.48(br s, 1 H), 8.25 (m, 1 H), 7.77 (m, 1 H), 7.74 (m, 1 H), 7.57 (m, 3H), 7.45 (m, 1 H), 7.31 (m, 1 H), 4.73 (m, 1 H) and 3.22 (m, 4H).
Example 54
Preparation of 3-amino-Λ/-r5-(3-furanyl')-4-(1 H-pyrrolor2,3-frlpyridin-3-vn-2-thienyll-
2-phenylpropanamide The title compound was prepared as a light yellow solid according to the procedure of Example 49, except substituting 3-({[(1 ,1- dimethylethyl)oxy]carbonyl}amino)-2-(phenylmethyl)propanoic acid (0.34 g, 1.3 mmole) for 3-({[(1,1-dimethylethyl)oxy]carbonyl}amino)-2-(phenylmethyl)propanoic acid: LC-MS (ES) m/z = 429 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.33 (m, 1 H), 8.04 (d, J = 7.9 Hz, 1 H), 7.57 (s, 1 H), 7.48 (m, 6H), 7.42 (m, 1 H), 7.29 (m, 1 H), 6.81
(s, 1H), 6.26 (m, 1 H), 4.17 (m, 1 H), 3.69 (m, 1 H), and 3.30 (m, 1 H).
Example 55
Preparation of Λ/-r(1ffl-2-amino-1-(phenylmethvnethvn-5-(1A7-pyrrolof2,3-άlpyridin-4-yl)-2- furancarboxamide
The title compound was prepared as a light yellow solid according to the procedure of Example 43, except substituting 2-[(2R)-2-amino-3-phenylpropyl]-1H- isoindole-1 ,3(2H)-dione (0.45 g, 1.1 mmol) for 2-[(2S)-2-amino-3-phenylpropyl]-1H- isoindole-1 ,3(2H)-dione and substituting 5-bromofuran-2-carboxylic acid for 4,5- dibromo-2-thiophene carboxylic acid : LC-MS (ES) m/z = 361 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.37 (d, J = 5.8 Hz, 1 H), 7.89 (d, J = 5.8 Hz, 1H), 7.71 (m, 1 H), 7.55 (d, J = 3.7 Hz, 1 H), 7.36 (m, 4H), 7.25 (m, 1 H), 7.19 (m, 1 H), 6.61 (m, 1 H), 4.65 (m, 1 H), 3.27 (m, 2H), and 3.08 (m, 2H).
Example 56
Preparation of N-K 1 SV2-amino-1-(phenylmethyl)ethyll-5-(1/-/-pyrrolor2,3-άlpyridin-4- vQ-2-furancarboxamide The title compound was prepared as a light yellow solid according to the procedure of Example 43, except substituting 5-bromofuran-2-carboxylic acid for 4,5-dibromo-2-thiophene carboxylic acid : LC-MS (ES) m/z = 361 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.37 (d, J = 5.8 Hz, 1 H), 7.89 (d, J = 5.8 Hz, 1 H), 7.71 (m, 1 H), 7.55 (d, J = 3.7 Hz, 1 H), 7.36 (m, 4H), 7.25 (m, 1 H), 7.19 (m, 1 H), 6.61 (m, 1 H), 4.65 (m, 1 H), 3.27 (m, 2H), and 3.08 (m, 2H).
Example 57
Preparation of Λ/-f(1 f?)-2-amino-1-(phenylmethvπethyll-4-bromo-5-(1 /-/-pyrrolor2.3- b1pyridin-4-ylV2-furancarboxamide The title compound was prepared as a light yellow solid according to the procedure of Example 43, except substituting 2-[(2R)-2-amino-3-phenylpropyl]-1 H- isoindole-1 ,3(2H)-dione (0.45 g, 1.1 mmol) for 2-[(2S)-2-amino-3-phenylpropyl]-1/-/- isoindo)e-1 ,3(2f/)-dione and substituting 4,5-dibromofuran-2-carboxylic acid (1.52 g, 5.6 mmole) for 4,5-dibromo-2-thiophene carboxylic acid : LC-MS (ES) m/z = 440 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.38 (d, J = 5.8 Hz, 1 H)1 8.01 (d, J = 5.8 Hz, 1 H), 7.67 (m, 1 H), 7.39 (s, 1H), 7.36 (m, 4H), 7.25 (m, 1 H), 7.08 (m, 1 H), 4.62 (m, 1 H), 3.25 (m, 2H), and 3.08 (m, 2H).
Example 58
Preparation of AZ-Fd S)-2-amino-1-(phenylmethyl)ethvπ-4-bromo-5-(1 H-pyrrolor2,3- άipyridin-4-vO-2-furancarboxamide The title compound was prepared as a light yellow solid according to the procedure of Example 43, except substituting 4,5-dibromofuran-2-carboxylic acid (1.52 g, 5.6 mmole) for 4,5-dibromo-2-thiophene carboxylic acid : LC-MS (ES) m/z = 440 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.38 (d, J = 5.8 Hz, 1 H), 8.01 (d, J = 5.8 Hz, 1 H), 7.67 (m, 1 H), 7.39 (s, 1 H), 7.36 (m, 4H), 7.25 (m, 1H), 7.08 (m, 1 H), 4.62 (m, 1 H), 3.25 (m, 2H), and 3.08 (m, 2H).
Example 59
Preparation of Λ/-IY1 SV2-amino-1-phenylethyl1-4-bromo-5-(1H-Dyrrolo[2.3-b1pyridin- 4-vO-2-thiophenecarboxamide The title compound was prepared as a light yellow solid according to the procedure of Example 7, except substituting 1 ,1-dimethylethyl [(2S)-2-amino-2- phenyiethyl]carbamate (0.60 g, 2.54 mmole) for 1 ,1-dimethylethyl (2-amino-2- phenyiethyl)carbamate and substituting 4,5-dibromothiophene-2-carboxyiic acid (1.08 g, 3.81 mmole) for 5-bromo-2-thiophenecarboxylic acid: LC-MS (ES) m/z = 441 (M+H)\ 1H NMR (CD3OD, 400 MHz) δ 9.32 (d, J = 8.3 Hz, 1 H), 8.53 (d, J = 6.0 Hz, 1 H), 8.19 (s, 1 H), 7.83 (m, 2H), 7.44 (m, 2H), 7.47 (m, 1H), 7.39 (m, 1 H), 6.98 (m, 1 H), 5.48 (m, 1 H), 3.62 (m, 1 H), and 3.48 (m, 1 H).
Example 60
Preparation of AZ-Fd f?)-2-amino-1-phenylethvn-4-bromo-5-(1H-pyrrolor2,3-άipyridin- 4-vQ-2-thioph en eca rboxa m ide The title compound was prepared as a light yellow solid according to the procedure of Example 7, except substituting 1 ,1-dimethylethyl [(2f?)-2-amino-2- phenylethy!]carbamate (0.60 g, 2.54 mmole) for 1 ,1-dimethylethyl (2-amino-2- phenylethyl)carbamate and substituting 4,5-dibromothiophene-2-carboxylic acid (1.08 g, 3.81 mmole) for 5-bromo-2-thiophenecarboxylic acid: LC-MS (ES) m/z = 440 (MH-H)+, 1H NMR (CD3OD, 400 MHz) δ 9.32 (d, J = 8.3 Hz, 1 H), 8.53 (d, J = 6.0 Hz, 1 H), 8.19 (s, 1 H), 7.83 (m, 2H), 7.44 (m, 2H), 7.47 (m, 1 H), 7.39 (m, 1H), 6.98 (m, 1H), 5.48 (m, 1H), 3.62 (m, 1H), and 3.48 (m, 1 H). Example 61
Preparation of A/-(2-amino-1-phenylethyl)-5-(1 H-DyrroloF2,3-blpyriclin-4-ylV3- furancarboxamide
The title compound was prepared as a light yellow solid according to the procedure of Example 7, except substituting 2-bromofuran-4-carboxylic acid (0.75 g, 3.92 mmole) [J. Org. Chem. 1976, 41, 2350] for 5-bromo-2-thiophenecarboxylic acid: LC-MS (ES) m/z = 347 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.65 (s, 1 H), 8.43 (d, J = 6.3 Hz, 1 H), 8.27 (s, 1 H), 7.91 (d, J = 6.3 Hz, 1H), 7.80 (m, 1 H), 7.57 (m, 2H), 7.42 (m, 4H), 5.53 (m, 1 H), 3.65 (m, 1 H), and 3.48 (m, 1H).
Example 62
Preparation of N-(2-amino-1-phenylethyl')-5-(1 /-/-pyrrolof2,3-blpyridin-3-yl V3- furancarboxamide The title compound was prepared as a light yellow solid according to the procedure of Example 7, except substituting 2-bromofuran-4-carboxylic acid (0.75 g, 3.92 mmole) [J. Org. Chem. 1976, 41, 2350] for 5-bromo-2-thiophenecarboxylic acid and substituting 1-(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2- yl)-1H-pyrrolo[2,3-d]pyridine (0.39 g, 1.0 mmole) for 1-(phenylsulfonyl)-4-(4,4,5,5- tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1H-pyrrolo[2,3-b]pyridine: LC-MS (ES) m/z = 347 (M+H)+, 1H NMR (CD3OD, 400 MHz) S 9.12 (d, J = 7.8 Hz, 1 H), 8.54 (m, 1 H), 8.32 (s, 1H), 8.10 (s, 1 H), 7.72 (m, 1H), 7.57 (m, 1H), 7.45 (m, 4H), 7.39 (m, 1H), 5.50 (m, 1 H), 3.65 (m, 1 H), and 3.48 (m, 1 H). Example 63
Preparation of Λ/-r2-amino-1-(phenylmethvπethyll-5-f1H-Pyrrolor2,3-ά1pyridin-4-vπ- 3-furancarboxamide
The title compound was prepared as a light yellow solid according to the procedure of Example 7, except substituting 1,1-dimethylethyl (2-{[(5-bromo-3- furanyl)carbonyl]amino}-3-phenylpropyl)carbamate (0.50 g, 1.22 mmole) for 1 ,1- dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-2-phenylethyl)carbamate: LC- MS (ES) m/z = 361 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.50 (s, 1 H), 8.43 (d, J = 6.3 Hz, 1H), 8.11 (s, 1 H), 7.88 (d, J = 6.3 Hz, 1 H), 7.80 (m, 1 H), 7.36 (m, 2H), 7.22 (m, 1 H), 4.62 (m, 1H), 3.61 (m, 1H), 3.25 (m, 1H), and 3.07(m, 7H).
Example 64
Preparation of N-F2-amino-1-(phenv)methyl)ethvH-5-n /-/-pyrrolof2,3-ά1pyridin-3-vO- 3-furancarboxamide
The title compound was prepared as a light yellow solid according to the procedure of Example 7, except substituting 1 ,1-dimethylethyl (2-{[(5-bromo-3- furanyl)carbonyl]amino}-3-phenylpropyl)carbamate (0.50 g, 1.22 mmole) for 1 ,1- dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-2-phenylethyl)carbamate and substituting 1-(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1H- pyrrolo[2,3-jb]pyridine (0.39 g, 1.0 mmole) for 1-(phenylsu!fonyl)-4-(4,4,5,5- tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1H-pyrrolo[2,3-<b]pyridine: LC-MS (ES) m/z = 361 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 9.09 (d, J = 7.7 Hz1 1 H), 8.53 (d, J = 5.5 Hz, 1 H), 8.19 (s, 1 H), 8.10 (s, 1 H), 7.72 (m, 1 H), 7.80 (m, 1 H), 7.31 (m, 4H), 7.23 (m, 1 H), 4.61 (m, 1 H), 3.62 (m, 1 H), 3.26 (m, 1 H) and 3.07 (m, 2H).
Example 65
Preparation of (2-amino-1-phenylethylMf5-(1 H-Dyrrolo^.S-biDyridin^-ylVΣ- thienylimethyDamine
a) 1 ,1-dimethylethyl (2-{[(5-bromo-2-thienyl)methyl]amino}-2-phenylethyl)carbamate
A solution of 5-bromo-2-thiophenecarbaldehyde (131 μl_, 1.1 mmol), 1,1- dimethylethyl (2-amino-2-phenylethyl)carbamate (260 mg, 1.1 mmol)[prepared according to Example 7) and Na2SO4 (313 mg, 2.2 mmol) in DCM/MeOH (6 ml_, 1 :1 ) were stirred at RT over 12h. The solution was cooled to 00C and NaBH4 (125 mg, 3.3 mmol) was added in one portion. After 30min the imine reduction was complete and the solution was partitioned between H2O/DCM. The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 1% MeOH in DCM) yielding the title compound (506 mg, 90%) as a brown oil: LCMS m/z 412 (M+H)+.
b) 1 , 1 -dimethylethyl {2-phenyl-2-[({5-[1 -(phenylsulfonyl)-i H-pyrrolo[2,3-b]pyridin-4- yl]-2-thienyl}methyl)amino]ethyl}carbamate
A solution of 1 ,1-dimethylethyl (2-{[(5-bromo-2-thienyl)methyl]amino}-2- phenylethy!)carbamate (506 mg, 1.23 mmol), 1-(phenylsulfonyl)-4-(4, 4,5,5- tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3-b]pyridine (521 mg, 1.4 mmol)[prepared in Preparation 2], K2CO3 (680 mg, 4.92 mmol) and Pd(PPh3)4 (71 mg, 61.6 μmol) in dioxane/H2O (6 mL, 5:1) were combined in a sealed tube and stirred at 80°C for 2h. The solution was then partitioned between H2O/DCM. The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 1 % MeOH in DCM) affording the title compound (593 mg, 74%) as a yellow foam: LCMS m/z 589 (M+H)+.
c) (2-amino-1-phenylethyl){[5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2-thienyl]methyl}amine
1,1-dimethylethyl {2-phenyl-2-[({5-[1-(phenylsulfonyl)-1 H-ρyrrolo[2,3- b]pyridin-4-yl]-2-thienyl}methyl)amino]ethyl}carbamate (539 mg, 0.917 mmol) in THF-MeOH (9 mL, 1 :1 ) and 6N NaOH (9 mL) was stirred at RT for 2h. The solution was then cooled with ice and neutralized using 6N HCI. The aqueous phase was extracted several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly.
1,1-dimethylethyl [2-phenyl-2-({[5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]methyi}amino)ethyl]carbamate (crude from above) was dissolved in TFA/MeOH (1 :2, 9 mL) and stirred at RT for 30 min. The solution was then concentrated using a toluene azeotrope and neutralized through a silica plug (3% MeOH in DCM (1% NH4OH)) affording the title compound as a free base (200 mg, 63%-2 steps).
The free base, as a solution in MeOH, was then treated with excess HCI in dioxane affording the title compound as the HCI salt: LC-MS (ES) m/z 349 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8.34 (bs, 2H), 8.31 (d, J = 5.3 Hz, 1 H), 7.82 (d, J = 2.7 Hz, 1 H), 7.71-7.73 (m, 3H), 7.52-7.68 (m, 3H), 7.42-7.45 (m, 2H), 6.88 (s, 1 H), 4.68 (bs, 1 H), 4.34-4.39 (m, 1 H), 4.10-4.14 (m, 1 H), 3.73-3.78 (m, 1 H), 3.38- 3.44 (m, 1 H). Example 66
Preparation of N-(2-amino-1-phenylethvO-4-phenyl-5-π H-pyrrolor2,3-b]pyridin-4-yl)- 2-th ioph en ecarboxa m id e
a) 1 ,1-dimethylethyl {2-phenyl-2-[({4-phenyl-5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3- b]pyridin-4-yl]-2-thienyl}carbonyl)amino]ethyl}carbamate
1,1-dimethylethyl {2-[({4-bromo-5-[1-(phenyisulfonyl)-1 H-pyrrolo[2,3- b]pyridin-4-yl]-2-thienyl}carbonyl)amino]-2-phenylethy!}carbamate (225 mg, 0.33 mmol)[prepared in Example 9], phenylboronic acid (48 mg, 0.39 mmol), K2CO3 (182 mg, 1.32 mmol) and Pd(PPh3)4 (19 mg, 16.5 μmol) in doxane/H2O (3 ml_, 5:1) were combined in a sealed tube and stirred at 80 °C for 2h. The resulting solution was then partitioned between H2O/DCM. The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 1 % MeOH in DCM) affording the title compound (160 mg, 71 %) as a brown foam: LCMS m/z 680 (M+H)+.
b) N-(2-amino-1-phenylethyl)-4-phenyl-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide
1,1-dimethylethyl {2-phenyl-2-[({4-phenyl-5-[1-(phenylsulfonyl)-i H- pyrrolo[2,3-b]pyridin-4-yl]-2-thienyl}carbonyl)amino]ethyl}carbamate (160 mg, 0.236 mmol) in THF-MeOH (2 mL, 1 :1 ) and 6N NaOH (2 mL) was stirred at RT for 2h. The solution was then cooled with ice and neutralized using 6N HCI. The aqueous phase was extracted several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly.
The Boc-amine (crude from above) was dissolved in TFA/MeOH (1 :2, 3 mL) and stirred at RT for 30 min. The solution was then concentrated using a toluene azeotrope and neutralized through a silica plug (3% MeOH in DCM (1 % NH4OH)) affording the title compound as a free base (50 mg, 48%-2 steps).
The free base, as a solution in MeOH, was then treated with excess HCI in dioxane affording the title compound as the HCI salt: LC-MS (ES) m/z 440 (M+H)\ 1H NMR (d6-DMSO, 400 MHz) δ 9.49 (d, J = 8.2 Hz, 1 H), 8.42 (s, 1 H), 8.26 (bs, 2H), 8.21-8.23 (m, 1 H), 7.43-7.50 (m, 3H), 7.39-7.41 (m, 2H), 7.30-7.35 (m, 1 H), 7.25-7.29 (m, 4H), 6.98 (d, J = 5.1 Hz, 1 H), 6.18 (dd, J = 3.4, 1.9 Hz, 1 H), 5.32-5.38 (m, 1 H), 3.37-3.42 (m, 1 H), 3.17-3.26 (m, 1H).
Example 67
Preparation of N-(2-amino-1-phenylethyl)-4-methyl-5-(1 H-pyrrolor2.3-blpyridin-4-yl)- 2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 66, except substituting trimethyl boroxine (55 μL, 0.396 mmol) for phenylboronic acid: LC-MS (ES) m/z 378 (M+H)\ 1H NMR (d6-DMSO, 400 MHz) δ 9.41 (d, J = 8.2 Hz, 1 H), 8.30 (s, 1 H), 8.29 (bs, 2H), 8.12 (s, 1 H), 7.66 (dd, J = 3.1 , 3.1 Hz, 1 H), 7.42-7.48 (m, 2H), 7.38-7.40 (m, 2H), 7.31-7.34 (m, 1 H), 7.26-7.28 (m, 1H), 6.60 (s, 1 H), 5.30-5.35 (m, 1 H), 3.37-3.43 (m, 1 H), 3.17-3.23 (m, 1 H).
Preparation of N-(2-amino-2-phenylethvO-4-bromo-5-(1 H-pyrrolor2,3-b1pyridin-4-vO- 2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 7, except substituting 1,1-dimethylethyl (2-amino-1-phenylethyl)carbamate (172 mg, 0.729 mmol) for 1 ,1-dimethylethyl (2-amino-2-phenylethyl)carbamate and 4,5- dibromo-2-thiophenecarboxylic acid (344 mg, 1.20 mmol) for 5~bromo-2- thiophenecarboxylic acid: LC-MS (ES) m/z 442 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) 5 9.30 (dd, 5.5, 5.5 Hz, 1 H), 8.80 (bs, 2H), 8.37 (d, J = 5.1 Hz, 1 H), 8.16 (s, 1 H), 7.66-7.67 (m, 1 H), 7.56-7.58 (m, 2H), 7.38-7.47 (m, 2H), 7.34-7.36 (d, J = 5.1 Hz, 1 H), 6.56 (s, 1 H), 4.53-4.57 (m, 1 H), 3.80-3.86 (m, 1 H), 3.72-3.77 (m, 1 H).
Example 69
Preparation of N-(2-amino-2-phenylethyl)-5-(1 H-pyrrolor2,3-blpyridin-4-yl)-2- thioohenecarboxamide
The title compound was prepared as a yellow solid according to Example 7, except substituting 1,1-dimethylethyl (2-amino-1-phenylethyl)carbamate (172 mg, 0.729 mmol) for 1 ,1-dimethylethyl (2-amino-2-phenylethyl)carbamate: LC-MS (ES) m/z 363 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9.19 (dd, J = 5.5, 5.5 Hz, 1 H), 8.83 (bs, 2H), 8.35 (d, J = 5.5 Hz, 1 H), 8.05 (d, J = 4.0 Hz, 1 H), 7.90 (d, J = 4.0 Hz, 1H), 7.72 (dd, J = 3.1 , 3.1 Hz, 1 H), 7.54-7.58 (m, 2H), 7.37-7.46 (m, 3H), 6.97 (s, 1 H), 4.56-4.58 (m, 1 H), 3.80-3.86 (m, 1 H), 3.71-3.76 (m, 1 H).
Example 70
Preparation of (3-amino-2-phenylpropyl)r5-(1 H-pyrrolor2.3-b1pyridin-4-yl')-2- thienyliamine a) 1 ,1-dimethylethyl {5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin-4-yl]-2- thienyl}carbamate
1,1-dimethylethyl (5-bromo-2-thienyl)Garbamate (1g, 3.59 mmol)[prepared according to the procedure in Example 1 , except substituting 5-bromothiophene-2- carboxylic acid (5 g, 24.1 mmol) for 4-bromothiophene-2-carboxylic acid], 1- (phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3- b]pyridine (1.7 g, 4.32 mmol), K2CO3 (1.98 g, 14.4 mmol) and Pd(PPh3)4 (207 mg, 0.179 mmol) in doxane/H2O (18 ml_, 5:1) were combined in a sealed tube and stirred at 80 0C for 2h. The resulting solution was then partitioned between H2O/DCM. The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 0.5 % MeOH in DCM) affording the title compound (1 g, 61%) as an orange foam: LCMS m/z 457 (M+H)+.
b) 3-(1 ,3-dioxo-1 ,3-dihydro-2H-isoindol-2-yl)-2-phenylpropyl 4- methylbenzenesulfonate
i) To a solution of 2-phenyl-1,3-propanediol (5 g, 32.9 mmol) and Et3N (5.5 ml_, 39.5 mmol) in DCM (164 ml_) at 0 0C were added tosyl chloride (6.3 g, 32.9 mmol) and DMAP (400 mg, 3.29 mmol). After 30 min, the solution was concentrated and purified via column chromatography (silica, 0.5-2% MeOH in DCM) yielding 3-hydroxy-2-phenylpropyl 4-methylbenzenesulfonate (3.5 g, 35%) as a white solid: LCMS m/z 307 (M+H)+. ii) To a solution of 3-hydroxy-2-phenylpropyl 4-methylbenzenesulfonate (1.5 g, 4.9 mmol), phthalimide (600 mg, 4.1 mmol), triphenyl phosphine (1.6 g, 6.1 mmol) in THF (20 mL) at RT was added DEAD (965 μl_, 6.1 mmol), in one portion. After 30 min., the solution was concentrated and purified via column chromatography (silica, DCM) yielding the title compound (1.52 g, 83 %) as a white foam: LCMS m/z 436 (M+H)+.
c) 1 ,1-dimethylethyl [3-(1 ,3-dioxo-1 ,3-dihydro-2H-isoindol-2-yl)-2-phenylpropyl]{5- [1-(phenylsulfonyl)-1H-pyrrolo[2,3-b]pyridin-4-yl]-2-thienyl}carbamate
1,1-dimethylethyl {5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin-4-yl]-2- thienyl}carbamate (228 mg, 0.50 mmol), 3-(1,3-dioxo-1 ,3-dihydro-2H-isoindol-2-yl)- 2-phenylpropyl 4-methylbenzenesulfonate (240 mg, 0.55 mmol) and Cs2CO3 (326 mg, 1.0 mmol) in DMF (5 mL) were combined in a sealed tube and stirred at 70 0C. After 10h, the solution was concentrated and purified via column chromatography (silica, 0.5 % MeOH in DCM) affording the title compound (217 mg, 60%) as a yellow foam: LCMS m/z 719 (M+H)+.
d) 1 ,1-dimethylethyl (3-amino-2-phenylpropyl){5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3- b]pyridin-4-yl]-2-thienyl}carbamate
1,1-dimethylethyl [3-(1,3-dioxo-1 ,3-dihydro-2H-isoindol-2-yl)-2- phenylpropyl]{5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin-4-yl]-2- thienyl}carbamate (253 mg, 0.352 mmol) and hydrazine (219 μL, 7.0 mmol) in THF/MeOH (3.6 mL, 1 :1) were stirred at RT. After 12h, the solution was partitioned between H2O/DCM. The aqueous phase was extracted several times with DCM and the combined organic fractions were dried (Na2SC>4, concentrated and purified via column chromatography (silica, 2% MeOH in DCM (1% NH4OH)) yielding the title compound (110 mg, 53%) as a yellow oil: LCMS m/z 589 (M+H)+.
e) (3-amino-2-phenylpropyl)[5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2-thienyl]amine
1,1-dimethylethyl (3-amino-2-phenylproρyl){5-[1-(phenylsulfonyl)-1 H- pyrrolo[2,3-b]pyridin-4-yl]-2-thienyl}carbamate (110 mg, 0.187 mmol) in THF-MeOH
(2 mL, 1 :1 ) and 6N NaOH (2 mL) was stirred at RT for 2h. The solution was then cooled with ice and neutralized using 6N HCI. The aqueous phase was extracted several times with DCM and the combined organic fractions were dried over
Na2SO4, concentrated and used directly.
The Boc-amine (crude from above) was dissolved in TFA/MeOH (1 :2, 3 mL) and stirred at RT for 30 min. The solution was then concentrated using a toluene azeotrope and neutralized through a silica plug (2% MeOH in DCM (1 % NH4OH)) affording the title compound as a free base (45 mg, 69%-2 steps).
The free base, as a solution in MeOH, was then treated with excess HCI in dioxane affording the title compound as the HCI salt: LC-MS (ES) m/z 349 (M+H)+,
1H NMR (CD3OD, 400 MHz) δ 8.02 (d, J = 6.7 Hz, 1H), 7.93 (d, J = 4.5 Hz, 1 H), 7.53 (d, J = 3.7 Hz, 1 H), 7.35-7.50 (m, 6H), 7.12 (d, J = 3.7 Hz, 1 H), 6.28 (d, J = 3.5
Hz, 1 H), 3.66-3.71 (m, 1H), 3.55-3.60 (m, 1 H), 3.48-3.50 (m, 2H), 3.37-3.40 (m,
1 H).
Example 71
Preparation of 3-amino-3-phenyl-N-r5-(1 H-pyrroloF2,3-blPyridin-4-yl)-2- thienyllpropanamide
The title compound was prepared as a yellow solid according to Example 1 , except substituting 5-bromothiophenecarboxylic acid (5 g, 24.1 mmol) for 4- bromothiophenecarboxylic acid, 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2- dioxaborolan-2-yl)-1 /V-pyrrolo[2,3-6]pyridine (1.6 g, 4.32 mmol) for 1- (phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1/-/-pyrrolo[2,3- b]pyιϊdine and S-^^i . i-dimethylethylJoxyJcarbonylJaminoJ-S-phenylpropanoic acid (226 mg, 0.852 mmol) for 3-({[(1 ,1-dimethylethyl)oxy]carbonyl}amino)-2- phenylpropanoic acid: LC-MS (ES) m/z = 363 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.27 (d, J = 6.5 Hz, 1 H), 7.97 (d, J = 4.4 Hz, 1H), 7.60 (d, J = 6.4 Hz, 1 H), 7.73 (d, J = 3.6 Hz, 1 H), 7.45-7.56 (m, 5H), 7.28 (d, J = 3.7 Hz, 1 H), 6.92 (d, J = 3.3 Hz, 1 H), 4.91-4.97 (m, 1 H), 3.42-3.49 (m, 1H), 3.22-3.27 (m, 1H).
Example 72
Preparation of 4-amino-3-phenyl-N-r5-(1 H-pyrrolor2,3-blPyridin-4-yl)-2- thienyllbutanamide
The title compound was prepared as a yellow solid according to Example 1, except substituting 5-bromothiophenecarboxylic acid (5 g, 24.1 mmol) for 4- bromothiophenecarboxylic acid, 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2- dioxaborolan-2-yl)-1 /V-pyrrolo[2,3-t)]pyridine (1.6 g, 4.32 mmol) for 1- (phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1/-/-pyrrolo[2,3- b]pyridine and 4-({[(1, 1-dimethylethyl)oxy]carbonyl}amino)-3-phenylbutanoic acid (238 mg, 0.852 mmol) for 3-({[(1 ,1-dimethylethyl)oxy]carbonyl}amino)-2- phenylpropanoic acid: LC-MS (ES) m/z = 377 (M+H)+, 1H NMR (d6-DMSO, 400
MHz) δ 8.29 (d, J = 6.1 Hz, 1 H), 8.06 (bs, 2H), 7.88 (d, J = 4.2 Hz, 1 H), 7.70 (dd, J = 3.0 Hz, 1 H), 7.56 (d, 6.1 Hz, 1 H), 7.35-7.37 (m, 4H), 7.25-7.33 (m, 1 H), 7.03 (s, 1 H), 6.86 (d, J = 4.8 Hz, 1H)1 3.54-3.57 (m, 1 H), 3.17-3.22 (m, 1 H), 3.03-3.12 (m, 2H), 2.80-2.86 (m, 1 H).
Preparation of N-(2-amino-1-phenylethvO-4-bromo-5-(3-phenyl-1 H-pyrrolor2,3- bipyridin-4-vQ-2-thiophenecarboxamidθ a) 4-bromo-3-phenyl-1-(phenylsulfonyl)-1/-/-pyrrolo[2,3-/?]pyridine
To a solution of 4-bromo-3-iodo-1-(phenylsulfonyl)-1/-/-pyrrolo[2,3-b]pyridine (1 g, 2.16 mmol) in dioxane (9 mL) and H2O (1.7 mL) was added K2CO3 (1.2 g, 8.64 mmol), phenylboronic acid (263 mg, 2.16 mmol) and tetrakistriphenylphosphine Pd(O) (125 mg, 0.108 mmol). After 12h at 80 0C, the reaction contents were partitioned between H2O/DCM. The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 0.5% MeOH in DCM) affording the title compound (470 mg, 53%) as a tan foam: LC-MS (ES) m/z = 414 (M+H)+.
b) 3-phenyl-1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H- pyrrolo[2,3-b]pyridine
The title compound was prepared as a brown oil according to Preparation 1 , except substituting 4-bromo-3-ρhenyl-1-(phenylsulfonyl)-1 /-/-pyrrolo[2,3-6]pyridine (470 mg, 1.14 mmol) for 3-iodo-1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridine: LCMS (ES) m/z = 461 (M+H)+.
c) 1 ,1-dimethylethyl {2-[({4-bromo-5-[3-phenyl-1-(phenylsulfonyl)-1H-pyrrolo[2,3- b]pyridin-4-yl]-2-thienyl}carbonyl)amino]-2-phenylethyl}carbamate
To a solution of 3-phenyl-1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2- dioxaborolaπ-2-yl)-1 H-pyrrolo[2,3-b]pyridine (392 mg, 0.852 mmol) in dioxane (7.1 ml_) and H2O (1.4 ml_) were added 1 ,1-dimethylethyl (2-{[(4,5-dibromo-2- thienyl)carbonyl]amino}-2-phenylethyl)carbamate (428 mg, 0.852 mmol)[prepared in Example 12], Pd(PPh3)4 (49 mg, 42.6 μmol) and K2CO3 (470 mg, 3.41 mmol). After 4h at 80 0C, the reaction contents were partitioned between H2O/DCM. The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 1 % MeOH in DCM) affording the title compound (485 mg, 75%) as a tan foam: LC-MS (ES) m/z = 758 (M+H)+.
d) N-(2-amino-1-phenylethyl)-4-bromo-5-(3-phenyl-1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide 1,1-dimethylethyl {2-[({4-bromo-5-[3-phenyl-1-(phenylsulfonyl)-1 H- pyrrolo[2,3-b]pyridin-4-yl]-2-thienyl}carbonyl)amino]-2-phenylethyl}carbamate (485 mg, 0.641 mmol) in THF-MeOH (6.5 mL, 1 :1) and 6N NaOH (6.5 ml_) was stirred at RT for 2h. The solution was then cooled with ice and neutralized using 6N HCI. The aqueous phase was extracted several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly.
The Boc-amine (crude from above) was dissolved in TFA/MeOH (1 :2, 3 mL) and stirred at RT for 30 min. The solution was then concentrated using a toluene azeotrope and neutralized through a silica plug (3% MeOH in DCM (1% NH4OH)) affording the title compound as a free base (60 mg, 18%-2 steps). The free base, as a solution in MeOH, was then treated with excess HCI in dioxane affording the title compound as the HCI salt: LC-MS (ES) m/z 518 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9.32 (d, J = 8.2 Hz, 1 H), 8.37 (d, J = 4.9 Hz, 1 H), 8.26 (bs, 2H), 7.92 (s, 1 H), 7.72 (d, J = 2.6 Hz, 1 H), 7.44-7.46 (m, 4H), 7.34-7.42 (m, 1 H), 7.01-7.11 (m, 5H), 5.23-5.28 (m, 1 H), 3.22-3.33 (m, 1 H), 3.17-3.21 (m, 1 H).
Example 74
Preparation of 4-amino-4-phenyl-N-f5-(1 H-pyrrolor2,3-blPyridin-4-ylY-2- thienylibutanamide
The title compound was prepared as a yellow solid according to Example 1, except substituting 5-bromothiophenecarboxyIic acid (5 g, 24.1 mmol) for 4- bromothiophenecarboxylic acid, 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2- dioxaborolan-2-yl)-1 H-pyrrolo[2,3-b]pyridine (1.6 g, 4.32 mmol) for 1- (phenylsulfonyO-S^^.S.S-tetramethyl-I .S^-dioxaborolan^-yO-I H-pyrrolop.S- ό]pyridine and 4-({[(1,1-dimethylethyl)oxy]carbonyl}amino)-4-phenylbutanoic acid (200 mg, 0.747 mmol) for 3-({[(1 ,1 -dimethylethyl)oxy]carbonyl}amino)-2- phenylpropanoic acid: LC-MS (ES) m/z = 377 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8.50 (bs, 2H), 8.25 (d, J = 5.6 Hz, 1H)1 7.77 (bs, 1 H), 7.65 (bs, 1 H), 7.42- 7.53 (m, 6H), 6.93 (bs, 1 H), 6.78 (d, J = 4.1 Hz, 1 H), 4.30-4.35 (m, 1 H), 2.28-2.38 (m, 3H), 2.12-2.20 (m, 1 H).
Example 75
Preparation of 4-bromo-N-r2-(methylam'ιno>1-(phenv)methyl)ethvπ-5-(1 H- PVrrolor2,3-bipyridin-4-yl)-2-thiophenecarboxamide
a) 1 -(methylamino)-3-phenyl-2-propanol
A solution of 2-(phenylmethyl)oxirane (5 g, 36.5 mmol) in MeNH2 (2M solution in MeOH, 100 ml_) was stirred at 25 0C in a sealed tube. After 12h, the solution was concentrated and used directly: LCMS (ES) m/e 166 (M+H)+.
b) 4-bromo-N-[2-(methylamino)-1 -(phenylmethyl)ethy!]-5-(1 H-pyrrolo[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide (GSK1347675A)
The title compound was prepared as a yellow solid according to Example 7, except substituting 1-(methylamino)-3-phenyl-2-propanol (6.2 g, 36.5 mmol) for 2- amino-1-phenylethanol, 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1,3,2- dioxaborolan-2-yl)-1H-pyrrolo[2,3-b]pyridine (172 mg, 0.407 mmol) for 1- (phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3- b]pyridine and 4,5-dibromo-2-thiophenecarboxylic acid (387 mg, 1.35 mmol) for 5- bromo-2-thiophenecarboxylic acid.
Alternatively, the Boc protecting group was removed in 0.5h using TFA- DCM (1 :2, 0.1M) at 25 0C. The resulting solution was concentrated using a toluene azeotrope and the residue neutralized through a silica plug (2-10% MeOH in DCM (1% NH4OH)) affording the neutral compound. Subsequent treatment with excess HCI in diethyl ether to the compound in DCM afforded the di-HCI salt of the title compound: LC-MS (ES) m/z = 470 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9.00 (d, J = 8.6 Hz, 1 H), 8.71-8.89 (m, 2H), 8.35 (d, J = 5.1 Hz, 1H), 8.11 (s, 1H), 7.64 (dd, J = 2.0, 2.0 Hz, 1 H), 7.28-7.31 (m, 4H), 7.22-7.24 (m, 1 H), 6.50 (dd, J = 1.8, 3.4 Hz, 1 H), 4.45-4.51 (m, 1 H), 3.13-3.15 (m, 2H), 2.93-2.95 (m, 2H), 2.51 (s, 3H).
Example 76
Preparation of N-r2-amino-1-(phenylmethyl)ethyll-4-bromo-5-(1 H-pyrrolor2,3- b1pyridin-4-yl)-2-thiophenecarboxamide
a) 1-amino-3-phenyl-2-propanol
A solution of 2-(phenylmethyl)oxirane (7.5 g, 56.3 mmol) in NH4OH (100 ml_) was stirred at 25 °C in a sealed tube. After 12h, the solution was concentrated and used directly. LCMS (ES) m/e 152 (M+H)+.
b) N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 7, except substituting 1-amino-3-phenyl-2-propanol (8.5 g, 56.3 mmol) for 2-amino-1- phenylethanol, 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 l3,2-dioxaborolan-2-yl)- 1 H-pyrrolo[2,3-b]pyridine (336 mg, 0.873 mmol) for 1-(phenylsulfonyl)-3-(4,4,5,5- tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3-b]pyridine and 4,5-dibromo-2- thiophenecarboxylic acid (376 mg, 1.32 mmol) for 5-bromo-2-thiophenecarboxylic acid.
Alternatively, the Boc protecting group was removed in 0.5h using TFA- DCM (1 :2, 0.1M) at 25 °C. The resulting solution was concentrated using a toluene azeotrope and the residue neutralized through a silica plug (2-10% MeOH in DCM (1% NH4OH)) affording the neutral compound. Subsequent treatment with excess HCI in diethyl ether to the compound in DCM afforded the di-HCI salt of the title compound: LC-MS (ES) m/z = 456 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.78 (d, J = 8.6 Hz, 1 H), 8.54 (d, 6.1 Hz, 1 H), 7.95 (s, 1 H), 7.85-7.88 (m, 2H), 7.33-7.37 (m, 3H), 7.24-7.30 (m, 1 H), 7.00 (d, J = 3.6 Hz, 1 H), 4.56-4.59 (m, 1 H), 3.20-3.27 (m, 2H), 3.03-3.05 (m, 2H).
Example 77
Preparation of N42-amino-1-(phenylmethyl)ethyl1-4-bromo-3-(methyloxy')-5-(1 H- pyrrolo[2,3-blPyridin-4-yl)-2-thiophenecarboxamide
a) methyl 4-bromo-3-hydroxy-5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin-4-yl]-2- th ioph en eca rboxyl ate
Methyl 4,5-dibromo-3-hydroxy-2-thiophenecarboxylate (500 mg, 1.59 mmol), 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3- b]pyridine (61 1 mg, 0.1.59 mmol)[prepared in Preparation 2], Pd(PPh3)4 (92 mg, 79.4 μmol) and K2CO3 (876 mg, 6.35 mmol) in dioxane (13 ml_) and H2O (2.6 ml.) were combined in a sealed tube. After 12h at 80 0C, the reaction contents were partitioned between H2O/DCM. The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 1% MeOH in DCM) affording the title compound (420 mg, 54%) as a brown foam: LC-MS (ES) m/z = 495 (M+H)+.
b) Methyl 4-bromo-3-(methyloxy)-5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin-4- yl]-2-thioph en ecarboxyl ate
To a solution of methyl 4-bromo-3-hydroxy-5-[1-(phenylsulfonyl)-1 H- pyrrolo[2,3-b]pyridin-4-yl]-2-thiophenecarboxylate (262 mg, 0.530 mmol), MeOH (26 μl_, 0.530 mmol), PPh3 (209 mg, 0.796 mmol) in THF (5 ml_) at 25 0C was added DEAD (125 μL, 0.796 mmol) in one portion. After 30 min, the reaction contents were partitioned between H2O/DCM. The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 0.5 % MeOH in DCM) affording the title compound (155 mg, 58%) as a clear foam: LC-MS (ES) m/z = 509 (M+H)+.
c) 1 ,1-dimethylethyl [2-({[4-bromo-3-(methyloxy)-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]carbonyl}amino)-3-phenylpropyl]carbamate
i) A solution of methyl 4-bromo-3-(methyloxy)-5-[1-(phenylsulfonyl)-1 H- pyrrolo[2,3-b]pyridin-4-yl]-2-thiophenecarboxylate (155 mg, 0.305 mmol) in 1 N NaOH (3 mL) and THF (3 mL) was stirred in a sealed tube at 80 0C. After 2h, the solution was acidified to pH 3 using 1 N HCI then extracted several times with DCM. The combined organic fractions were dried over Na2SO4, concentrated and used directly: LC-MS (ES) m/z = 353 (M+H)+. ii) To a solution of the crude acid, 1,1-dimethylethyl (2-amino-3- phenylpropyl)carbamate (85 mg, 0.340 mmol)[prepared in Example 76], diisopropylethyl amine (302 μl_, 1.7 mmol) in DCM (3.4 ml.) was added PyBrop (206 mg, 0.442 mmol) in one portion. After 12h, the reaction contents were partitioned between H2O/DCM. The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 2% MeOH in DCM) affording the title compound (199 mg, 92%) as a clear foam: LC-MS (ES) m/z = 586 (M+H)+.
d) N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-3-(methyloxy)-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide
A solution of 1 , 1 -dimethylethyl [2-({[4-bromo-3-(methyloxy)-5-( 1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (199 mg, 0.340 mmol) in TFA-DCM (3 mL, 1 :2) was stirred at 25 0C. After 30min, the solution was concentrated with a toluene azeotrope and the residue neutralized through a silica plug (3% MeOH in DCM (1 % NH4OH)) affording the free base of the title compound.
The free base, as a solution in MeOH, was then treated with excess HCI in dioxane affording the title compound as the HCI salt: LC-MS (ES) m/z 486 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8.34 (d, J = 5.0 Hz, 1 H), 8.09 (bs, 2H), 7.86 (d, J = 8.7 Hz, 1 H), 7.65 (dd, 3.2, 3.2 Hz, 1 H), 7.22-7.35 (m, 5H), 6.53 (dd, J = 1.9, 3.5 Hz, 1 H), 4.55-4.57 (m, 1 H), 3.83 (s, 3H), 3.15-3.18 (m, 1 H), 2.99-3.05 (m, 3H).
Example 78
Preparation of 3-r(2-aminoethvπoxyl-N-r2-amino-1-(phenylmethyl)ethyll-4-bromn-5- (1 H-Dyrrolo[2,3-b1pyπdin-4-viy2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 77, except substituting 1,1-dimethylethyl (2-hydroxyethyl)carbamate (300 mg, 0.607 mmol) for MeOH: LC-MS (ES) m/z 616 (M+H)\ 1H NMR (d6-DMSO, 400 MHz) δ 8.58 (bs, 2H), 8.37 (d, J = 5.1 Hz, 1 H), 8.22-8.24 (m, 2H), 7.68 (dd, J = 3.0, 3.0 Hz, 1H), 7.21-7.35 (m, 6H), 6.58 (dd, J = 1.7, 3.4 Hz, 1 H), 4.50-4.56 (m, 1 H), 4.41-4.49 (m, 1 H), 4.30-4.36 (m, 1 H), 3.34-3.36 (m, 1 H), 3.24-3.32 (m, 2H), 2.97-3.17 (m, 3H).
Example 79
Preparation of N-[2-amino-1-(phenylmethvπethyll-4-crιloro-5-π H-ρyrrolor2.3- blpyridin-4-vO-2-thiophenecarboxamide
a) 1-(4-chloro-2-thienyl)ethanone
To a solution of 1-(2-thienyl)ethanone (5 g, 39.6 mmol) in CHCI3 (50 mL) at 0 C was added AICI3 (16 g, 0.119) portion-wise. After 30 min, a solution of Cl2 in CCI4 (0.4M) was added drop wise via addition funnel. The resulting solution warmed to 25 C over 12h, was partitioned between ice H2CVDCM. The organic fraction was washed with 1 N NaOH, dried over Na2SO4, concentrated and purified via column chromatography (silica, 0.5 EtOAc in hexanes) affording the title compound (2.3 g, 36%) as a yellow oil: LC-MS (ES) m/z = 161 (M+H)+.
b) 1 -(5-bromo-4-chloro-2-thienyl)ethanone
. To a solution of 1-(4-chloro-2-thienyl)ethanone (2.3 g, 14.0 mmol) in CHCI3 (29 mL) was added AlCI3 (5.5 g, 41.0 mmol) portion-wise. After 10 min., a solution of Br2 (1 mL, 20.1 mmol) in CHCI3 (10 mL) was added via addition funnel and the solution was brought to reflux for 2h, was cooled to 25 C and stirred an additional 12h. The resulting solution was partitioned between ice H2CVDCM. The organic fraction was washed with 1 N NaOH, dried over Na2SO4, concentrated and used directly: LC-MS (ES) m/z = 239 (M+H)\
c) δ-bromo^-chloro^-thiophenecarboxylic acid
To a solution of -(5-bromo-4-chloro-2-thienyl)ethanone (3.4 g, 14.3 mmol) in 1 N NaOH (200 mL) at 0 C was added Br2 (2.4 mL, 47.1 mmol) drop wise. After 12h, the basic solution was extracted with DCM. The aqueous phase was adjusted to pH 1 and extracted several times with DCM. The combined organic fractions were dried over Na2SO4 and concentrated affording the title compound (1.5 g, 44%) as a white powder.
d) N-[2-amino-1-(phenylmethyl)ethyl]-4-chloro-5-(1 H-pyrrolo[2,3-b]pyridin-4-yi)-2- thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 7, except substituting 1-amino-3-phenyl-2-propanol (394 mg, 1.65 mmol)[prepared in Example 76] for 2-amino-1-phenylethanol, 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl- 1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3-b]pyridine (450 mg, 1.17 mmol) for 1- (phenyisulfonyl)-3-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3- b]pyridine and δ-bromo^-chloro^-thiophenecarboxylic acid (394 mg, 1.64 mmol) for 5-bromo-2-thiophenecarboxylic acid.
Alternatively, the Boc protecting group was removed in 0.5 h using TFA- DCM (1 :2, 0.1M) at 25 0C. The resulting solution was concentrated using a toluene azeotrope and the residue neutralized through a silica plug (2-10% MeOH in DCM (1% NH4OH)) affording the neutral compound. Subsequent treatment with excess HCI in diethyl ether to the compound in DCM afforded the di-HCI salt of the title compound: LC-MS (ES) m/z = 411 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9.03 (d, J = 8.5 Hz, 1 H), 8.36 (d, J = 5.1 Hz, 1 H), 8.13 (bs, 2H), 7.66 (dd, 3.2, 3.2 Hz, 1 H), 7.29-7.36 (m, 5H), 7.20-7.28 (m, 1 H), 6.56 (dd, J = 1.8, 3.4 Hz, 1 H), 4.39-4.40 (m, 1 H), 3.01-3.09 (m, 2H), 2.93-2.99 (m, 2H).
Example 80
Preparation of N-(2-aminoethv0-4-bromo-N-(phenylmethv0-5-(1 H-pyrrolor2,3- blpyridin-4-v0-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 7, except substituting 1 ,1-dimethylethyl {2-[(phenylmethyl)amino]ethyl}carbamate-HCI (300 mg, 1.05 mmol) for 1,1-dimethylethyl (2-amino-2-phenylethyl)carbarnate, 1- (phenylsulfonyl)-4-(4,4,5,5-tetramethyl'1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3- b]pyridine (468 mg, 1.22 mmol) 1or 1-(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1 ,3,2- dioxaborolan-2-yl)-1 H-pyrrolo[2,3-b]pyridine and 4,5-dibromo-2-thiophenecarboxylic acid (495 mg, 1.73 mmol) for 5-bromo-2-thiophenecarboxylic acid.
Alternatively, the Boc protecting group was removed in 0.5h using TFA- DCM (1 :2, 0.1M) at 25 0C. The resulting solution was concentrated using a toluene azeotrope and the residue neutralized through a silica plug (2-10% MeOH in DCM (1% NH4OH)) affording the neutral compound. Subsequent treatment with excess HCI in diethyl ether to the compound in DCM afforded the di-HCI salt of the title compound: LC-MS (ES) m/z = 41 1 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8.38 (d, J = 5.0 Hz, 1 H), 8.24 (bs, 1 H), 7.67 (s, 1 H), 7.32-7.44 (m, 7H), 6.56 (bs, 1 H), 4.93 (bs, 2H), 3.65-3.69 (m, 2H), 3.09-3.11 (m, 2H).
Example 81
Preparation of N-(2-aminoethylV4-bromo-N-phenyl-5-(1H-pyrrolor2,3-blpyridin-4-y0- 2-th ioph en ecarboxa m id e
The title compound was prepared as a yellow solid according to Example 7, except substituting 1 ,1-dimethylethyl [2-(phenylamino)ethyl]carbamate (300 mg, 1.27 mmol) for 1,1-dimethylethyl (2-amino-2-phenylethyl)carbamate, 1- (phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3- b]pyridine (587 mg, 1.52 mmol) for 1-(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1,3,2- dioxaborolan-2-yl)-1 H-pyrrolo[2,3-b]pyridine and 4,5-dibromo-2-thiophenecarboxylic acid (600 mg, 2.1 mmol) for 5-bromo-2-thiophenecarboxylic acid.
Alternatively, the Boc protecting group was removed in 0.5h using TFA- DCM (1 :2, 0.1M) at 25 0C. The resulting solution was concentrated using a toluene azeotrope and the residue neutralized through a silica plug (2-10% MeOH in DCM (1 % NH4OH)) affording the neutral compound. Subsequent treatment with excess HCI in diethyl ether to the compound in DCM afforded the di-HCI salt of the title compound: LC-MS (ES) m/z = 411 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) S 8.30 (d, J = 5.1 Hz, 1 H), 8.09 (bs, 1 H), 7.55-7.63 (m, 6H), 7.21 (d, J = 5.1 Hz, 1 H), 6.51 (s, 1 H), 6.35 (dd, J = 1.8, 3.4 Hz, 1 H), 4.05-4.09 (m, 2H), 3.02-3.04 (m, 2H).
Example 82
Preparation of N-r2-amino-1-(phenylmethyl)ethvH-4-bromo-3-fluoro-5-(1 H- pyrrolor2,3-blPyridin-4-yl)-2-thiophenecarboxamide
a) methyl 4-bromo-3-fluoro-5-[1-(phenylsulfonyl)-1 H-pyrroIo[2,3-b]pyridin-4-yl]-2- thiophenecarboxylate
Methyl 4,5-dibromo-3-fluoro~2-thiophenecarboxylate (454 mg, 1.43 mmol)[prepared according to Kiryanov, A.A.; et al. tetrahedron Lett. 2001 , 42, 50, 8797.], 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1,3!2-dioxaboroian-2-yl)-1 H- pyrrolo[2,3-b]pyridine (607 mg, 0.1.58 mmol)[prepared in Preparation 2], Pd(PPh3)4 (83 mg, 71.6 μmol) and K2CO3 (790 mg, 5.73 mmol) in dioxane (12 ml_) and H2O (2.3 mL) were combined in a sealed tube. After 12h at 80 0C, the reaction contents were partitioned between H2O/DCM. The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 0.5% MeOH in DCM) affording the title compound (260 mg, 37%) as a brown foam: LC-MS (ES) m/z = 495 (M+H)+.
b) 1 ,1-dimethylethyl [2-({[4-bromo-3-fluoro-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]carbonyl}amino)-3-phenylpropyl]carbamate
i) A solution of methyl 4-bromo-3-fluoro-5-[1-(phenylsulfonyl)-1 H- pyrrolo[2,3-b]pyridin-4-yl]-2-thiophenecarboxylate (260 mg, 0.526 mmol) in 1 N NaOH (5 mL) and THF (5 mL) was stirred in a sealed tube at 80 °C. After 2h, the solution was acidified to pH 3 using 1 N HCI then extracted several times with DCM. The combined organic fractions were dried over Na2SO4, concentrated and used directly: LC-MS (ES) m/z = 342 (M+H)+. ii) To a solution of the crude acid, 1,1-dimethylethyl (2-amino-3- phenylpropyl)carbamate (132 mg, 0.528 mmol)[prepared in Example 76], diisopropylethyl amine (469 μL, 2.64 mmol) in DCM (5 mL) was added PyBrop (320 mg, 0.686 mmol) in one portion. After 12h, the reaction contents were partitioned between H2O/DCM. The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 1% MeOH in DCM) affording the title compound (100 mg, 33%) as a yellow solid: LC-MS (ES) m/z = 574 (M+H)\ c) N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-3-fluoro-5-(1 H-pyrrolo[2,3-b]pyridin- 4-y l)-2-th i oph en eca rboxa m i d e
A solution of 1 ,1-dimethylethyl [2-({[4-bromo-3-fluoro-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (100 mg, 0.175 mmol) in TFA-DCM (3 mL, 1 :2) was stirred at 25 °C. After 30min, the solution was concentrated with a toluene azeotrope and the residue neutralized through a silica plug (3% MeOH in DCM (1% NH4OH)) affording the free base of the title compound.
The free base, as a solution in MeOH, was then treated with excess HCI in dioxane affording the title compound as the HCI salt: LC-MS (ES) m/z 474 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8.36 (d, J = 5.0 Hz, 1 H), 8.15-8.18 (m, 1H), 8.02 (bs, 2H), 7.67 (dd, J = 3.1, 3.1 Hz, 1 H), 7.23-7.32 (m, 5H), 6.54 (dd, J = 1.9, 3.5 Hz, 1 H), 4.49-4.51 (m, 1 H), 3.15-3.17 (m, 2H), 2.91-2.96 (m, 2H).
Preparation of 4-bromo-N-r2-r(1-methylethyl)amino1-1-(phenylmethyl)ethvn-5-(1 H- PVrrolor2,3-blPvπdin-4-vD-2-thiophenecarboxamide
a) 1,1-dimethylethyl (2-hydroxy-3-phenylpropyl)(1-methylethyl)carbamate
A solution of 2-(phenylmethyl)oxirane (7.5 g, 56.3 mmol) in iPrNH2 (15 mL) was stirred at 25 0C in a sealed tube for 12h. The resulting solution was concentrated, re-dissolved in THF (100 mL) and Boc2O (8.95 g, 41.04 mmol) was added in one portion. After an additional 30 min, the solution was concentrated and purified via column chromatography (silica, 1 % MeOH in DCM) yielding the title compound (10 g, 91 %) as a clear oil: LCMS (ES) m/e 294 (M+H)+. b) 1 ,1-dimethylethyl (1-methylethyl)(2-oxo-3-phenylpropyl)carbamate
To a solution of 1,1-dimethylethyl (2-hydroxy-3-phenylpropyl)(1- methylethyl)carbamate (1.1g, 3.75 mmol) in DCM (38 ml_) at 25 C was added PCC (890 mg, 4.13 mmol). After 12h, the solution was filtered through Celite® and concentrated. The residue was purified through a silica plug (0.5% MeOH in DCM) affording the title compound (780 mg, 71 %) as a yellow oil: LCMS (ES) m/e 292 (M+H)+.
c) 1,1-dimethylethyl (2-amino-3-phenylpropyl)(1-methylethyl)carbamate
1 ,1-dimethylethyl (1-methylethyl)(2-oxo-3-phenylpropyl)carbamate (365 mg, 1.25 mmol), ammonium formate (87 mg, 1.38 mmol) and Pd(OH)2 (37 mg, 10 wt.%) in MeOH (3.3 ml_) and H2O (380 μl_) was stirred in a sealed tube 70 C. After 12h, additional ammonium formate and Pd(OH)2 was added and the solution stirred an additional 12h, was filtered through Celite®, concentrated and purified through a silica plug (2% MeOH in DCM (1% NH4OH)) affording the title compound (140 mg, 19%) as a clear oil: LCMS (ES) m/e 292 (M+H)+.
d) 4-bromo-N-[2-[(1-methylethyl)amino]-1-(phenylmethyl)ethyl]-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 7, except substituting 1 ,1-dimethylethyl (2-amino-3-phenylpropyl)(1- methylethyl)carbamate (140 mg, 0.479 mmol) for 2-amino-1-phenylethanol, 1- (phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3- b]pyridine (194 mg, 0.420 mmol) for 1-(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1 ,3,2- dioxaborolan-2-yl)-1 H-pyrrolo[2,3-b]pyridine and 4,5-dibromo-2-thiophenecarboxylic acid (226 mg, 0.791 mmol) for 5-bromo-2-thiophenecarboxylic acid.
Alternatively, the Boc protecting group was removed in 0.5h using TFA- DCM (1 :2, 0.1M) at 25 0C. The resulting solution was concentrated using a toluene azeotrope and the residue neutralized through a silica plug (2-10% MeOH in DCM (1% NH4OH)) affording the neutral compound. Subsequent treatment with excess HCI in diethyl ether to the compound in DCM afforded the di-HCI salt of the title compound: LC-MS (ES) m/z = 498 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9.10 (d, J = 8.5 Hz, 1 H), 8.89 (bs, 1 H)1 8.75 (bs, 1 H), 8.36 (d, J = 5.1 Hz, 1 H), 8.18 (s, 1 H), 7.65 (dd, J = 3.0, 3.0 Hz, 1 H), 7.30-7.33 (m, 4H), 7.20-7.28 (m, 1 H), 6.53 (dd, J = 1.8, 3.5 Hz, 1 H), 4.49-4.51 (m, 1 H), 3.33-3.37 (m, 1 H), 3.21-3.23 (m, 1 H), 3.12- 3.19 (m, 1 H), 2.97-2.99 (m, 2H), 1.26 (d, J = 4.6 Hz, 6H).
Preparation of 4-bromo-N-r2-(ethylamino)-1-(phenylmethyl)ethvH-5-(1 H-pyrrolor2,3- b]pyridin-4-v0-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to Example 83 previous, except substituting ethyl amine (7mL) for i-PrNH2". LC-MS (ES) m/z = 484 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9.06 (d, J = 8.5 Hz, 1 H), 8.83 (bs, 2H), 8.35 (d, J = 5.0 Hz, 1 H), 8.15 (s, 1 H), 7.64 (dd, J = 3.1 , 3.1 Hz, 1 H), 7.28-7.32 (m, 4H), 7.22-7.26 (m, 1 H), 6.53 (dd, J = 1.7, 3.4 Hz, 1 H), 4.10-4.14 (m, 1 H), 3.13-3.17 (m, 2H), 2.93-3.00 (m, 4H), 1.19-1.23 (m, 3H).
Example 85
Preparation of 3-|[2-amino-1-(phenylmethvπethylloxy>-4-bromo-5-(1 H-pyrrolof2,3- blpyridin-4-yl)-2-thiophenecarboxamide a) methyl 4-bromo-3-{[2-({[(1 ,1-dimethy!ethyl)oxy]carbonyl}amino)-1-
(phenylmethyl)ethyl]oxy}-5-[1-(phenylsulfonyl)-1H-pyrrolo[2,3-b]pyridin-4-y!]-2- thiophenecarboxylate
The title compound was prepared as an orange foam according to Example
77), except substituting 1 ,1 -dimethylethyl (2-hydroxy-3-phenylpropyl)carbamate (490 mg, 0.994 mmol) for MeOH: LCMS (ES) m/e 727 (M+H)+.
b) 1,1-dimethylethyl (2-{[2-(aminocarbonyl)-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-4- yl)-3-thienyl]oxy}-3-phenylpropyl)carbamate
A solution of methyl 4-bromo-3-{[2-({[(1 ,1- dimethylethyl)oxy]carbonyl}amino)-1-(phenylmethyl)ethyl]oxy}-5-[1-(phenylsulfonyl)- 1 H-pyrrolo[2,3-b]pyridin-4-yl]-2-thiophenecarboxylate (685 mg, 0.944 mmol) in 7N NH3-MeOH (10 mL) and THF (2 ml_) was combined in a sealed tube and stirred at 70 C. After 12h, the solution was concentrated and purified by silica chromatography (3% MeOH in DCM (1 % NH4OH)) affording the title compound (387 mg, 58%) as a yellow oil: LCMS (ES) m/e 712 (M+H)+.
c) 3-{[2-amino-1-(phenylmethyl)ethyl]oxy}-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-4- yl)-2-thiophenecarboxamide 1 ,1-dimethylethyl (2-{[2-(aminocarbonyl)-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-3-thienyl]oxy}-3-phenylpropyl)carbamate (387 mg, 0.544 mmol) in THF-iPrOH (5 ml_, 1 :1 ) and 6N NaOH (5 mL) was stirred at 50 C. After 12h, the solution was then cooled with ice and neutralized using 6N HCI. The aqueous phase was extracted several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly.
The Boc-amine (crude from above) was dissolved in TFA/MeOH (1 :2, 5.4 mL) and stirred at RT for 30 min. The solution was then concentrated using a toluene azeotrope and neutralized through a silica plug (4% MeOH in DCM (1% NH4OH)) affording the title compound as a free base (76 mg, 30%-2 steps).
The free base, as a solution in MeOH, was then treated with excess HCI in dioxane affording the title compound as the HCI salt: LC-MS (ES) m/z 471 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8.50 (s, 3H), 8.37 (d, J = 5.1 Hz, 1 H), 7.99 (bs, 1 H), 7.68 (s, 1 H), 7.62 (s, 1 H), 7.16-7.28 (m, 4H), 6.54 (d, J = 1.8, 3.2 Hz, 1 H), 5.22-5.23 (m, 1 H), 3.27-3.34 (m, 1 H), 3.05-3.17 (m, 3H).
Example 86
Preparation of N-r2-amino-1-(phenylmethv0ethyl1-4-bromo-N-methyl-5-(1 H- pyrrolof213-blρyridin-4-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 43, except substituting 2-[2-(methylamino)-3-phenylpropyl]-1 H-isoindole-1 ,3(2H)- dione-HCI (131 mg, 0.396 mmol)[prepared from 1 ,1-dimethylethyl [2-hydroxy-1- (phenylmethyl)ethyl]methylcarbamate according to procedure 7] for 2-[(2S)-2- amino-3-phenylpropyl]-1H-isoindole-1,3(2H)-dione: LC-MS (ES) m/z 470 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9.20-9.26 (m, 2H), 8.38 (d, J = 5.1 Hz, 1 H), 8.23 (s, 1 H), 7.68 (dd, J = 2.9, 2.9 Hz, 1 H), 7.33-7.38 (m, 4H), 1.21-12$ (m, 1 H), 6.57 (dd, 1.6, 3.4 Hz, 1H), 3.59-3.61 (m, 1 H), 3.51-3.54 (m, 2H), 3.21-3.22 (m, 1 H), 2.88- 2.94 (m, 1H), 2.68 (s, 3H).
Example 87
Preparation of N-f2-amino-1-(phenylmethyl')ethvn-5-(6-amino-1 H-pyrrolo^^- bipyridin^-ylKMhiophenecarboxamide
a) 4-bromo-1 H-pyrrolo[2,3-b]pyridine 7-oxide
To a solution of 4-bromo-1 H-pyrrolo[2,3-b]pyridine (4 g, 20.3 mmol) in DCM (100 mL) at 0 C was added mCPBA (6.8 g, 30.5 mmol). After 12h warming to 25 C, the solution was partitioned between sat. NaHCO3/DCM. The organic fraction was dried over NaaSCU and concentrated affording the title compound as a pale yellow solid: LC-MS (ES) m/z 214 (M+H)+.
b) 4-bromo-1H-pyrrolo[2,3-b]pyridin-6-amine
To a solution of 4-bromo-1 H-pyrrolo[2,3-b]pyridine 7-oxide (1g, 4.7 mmol) in pyridine (70 mL) at 25 C was added tosyl chloride (1.2g, 6.1 mmol). After 12h, the solution was concentrated, re-dissolved in ethanol amine (20 mL) and stirred at 25 C for 1 h. The resulting solution was partitioned between H2O/DCM and the aqueous phase was washed several times with DCM. The combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 2% MeOH in DCM) affording the title compound (370 mg, 37%) as a pale yellow solid: LC-MS (ES) m/z 213 (M+H)+.
c) 4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3-b]pyridin-6-amine
The title compound was prepared as a brown oil according to Preparation 1 , except substituting 4-bromo-1 H-pyrrolo[2,3-b]pyridin-6-amine (370 mg, 1.75 mrnol) for 3-iodo-1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridine: LC-MS (ES) m/z 260 (M+H)+.
d) 1,1-dimethylethyl [2-({[5-(6-amino-1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]carbonyl}amino)-3-phenylpropyl]carbamate
To a solution of 4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H- pyrrolo[2,3-b]pyridin-6-amine (200 mg, 0.1.13 mmol) in dioxane (9.4 mL) and H2O (1.9 mL) were added 1 , 1-dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-3- phenylpropyl)carbamate (497 mg, 0.1.13 mmol)[prepared in Example 76], Pd(PPh3)4 (65 mg, 56.5 μmol) and K2CO3 (624 mg, 4.52 mmol). After 4h at 80 0C, the reaction contents were partitioned between H2OZDCM. The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 3% MeOH in DCM) affording the title compound (59 mg, 10%) as a tan foam: LC-MS (ES) m/z = 493 (M+H)+.
e) N-[2-amino-1-(phenylmethyl)ethyl]-5-(6-amino-1 H-pyrro!o[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide
1,1-dimethylethyl [2-({[5-(6-amino-1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (59 mg, 0.120 mmol) was dissolved in TFA/MeOH (1:2, 3 mL) and stirred at RT for 30 min. The solution was then concentrated using a toluene azeotrope affording the title compound the TFA salt (64 mg): LC-MS (ES) m/z 393 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 11.62 (bs, 1 H), 8.59 (d, J = 8.5 Hz, 1 H), 7.90 (bs, 2H), 7.82 (d, J = 4.0 Hz, 1 H), 7.75 (d, J = 4.0 Hz, 1 H), 7.26-7.32 (m, 3H), 7.17-7.23 (m, 2H), 6.67 (d, J = 4.8 Hz, 1 H), 4.38- 4.39 (m, 1 H), 2.92-3.03 (m, 2H), 2.88-2.90 (m, 2H).
Example 88
Preparation of 3-r(2-aminoethv0oxy1-N-r2-amino-1-(phenylmethv0ethyri-5-π H- pyrrolor2,3-blPyridin-4-vπ-2-thiophenecarboxamide
a) methyl 3-{[2-({[(1 , 1 -dimethylethyl)oxy]carbonyl}amino)ethyl]oxy}-5-[1 - (phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin-4-yl]-2-thiophenecarboxylate
A solution of methyl 4-bromo-3-{[2-({[(1 ,1- dimethylethyl)oxy]carbonyl}amino)ethyl]oxy}-5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3- b]pyridin-4-yl]-2-thiophenecarboxylate (565 mg, 0.887 mmol)[prepared in Example
78] and Pd(OH )2 (280 mg, 50 wt%) in MeOH (9 ml_) was hydrogenated under 1 atm of pressure. After 12h, the solution was filtered through Celite®, concentrated and used directly: LCMS (ES) m/e 560 (M+H)+.
b) 3-[(2-aminoethyl)oxy]-N-[2-amino-1-(phenylmethyl)ethyl]-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example
77, except substituting methyl 3-{[2-({[(1,1- dimethylethyl)oxy]carbonyl}amino)ethyl]oxy}-5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3- b]pyridin-4-yl]-2-thiophenecarboxylate (-490 mg, 0.887 mmol) for 1 ,1-dimethylethyl t2-({[4-bromo-3-(methyloxy)-5-(1H-pyrrolo[2,3-b]pyriclin-4-yl)-2- thienyl]carbonyl}amino)-3-phenylpropyl]carbamate: LC-MS (ES) m/z 438 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8.29 (d, J = 5.1 Hz, 1 H), 8.17 (bs, 2H), 7.91 (be, 2H), 7.78 (s, 1 H), 7.67 (dd, J = 3.3, 3.3 Hz, 1 H), 7.42-7.44 9m, 2H), 7.32-7.36 (m, 2H), 7.23-7.27 (m, 2H), 6.85 (dd, J = 1.8, 3.5 Hz, 1 H), 4.49-4.56 (m, 3H), 3.29-3.31 (m, 2H), 3.02-3.03 (m, 1 H), 2.95-3.01 (m, 3H).
Example 89
Preparation of N-r2-amino-1-(phenylmethyl)ethyll-5-(3-amino-1 H-pyrrolor2,3- blpyridin-4-vn-2-triiophenecarboxamide
a) 4-bromo-3-nitro-1 H-pyrrolo[2,3-b]pyridine
To a solution of 4-bromo-1 H-pyrrolo[2,3-b]pyridine (1 1 g, 55.8 mmol)[prepared according to Preparation 2] in H2SO4 (50 ml_) cooled to 0 °C was added a pre-cooled solution of HNO3 (5.1 mL) in H2SO4 (3.5 mi_). After 1 h, the solution was poured over ice and the precipitate was filtered and dried affording the title compound (11.4 g, 84%) as a yellow solid: LC-MS (ES) m/z 243 (M+H)+.
b) 4-bromo-1 H-pyrrolo[2,3-b]pyridin-3-amine
N nrVrBr NH2
H
SnCI2 (4.4 g, 23.0 mmol) was added portion-wise to a 70 0C solution of 4- bromo-3-nitro-1 H-pyrrolo[2,3-b]pyridine (1 g, 4.12 mmol) in cone. HBr (7 mL). After 1 h, the solution was added over ice and the pH adjusted to -12. The precipitate was filtered and the aqueous residue was washed with excess DCM. The combined organic fractions were dried over Na2SO4, concentrated and used directly. LC-MS (ES) m/z 213 (M+H)+.
c) 1,1-dimethylethyl [2-({[5-(3-amino-1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]carbonyl}amino)-3-phenylpropyl]carbamate
To a solution of 4-bromo-1 H-pyrrolo[2,3-b]pyridin-3-amine (63 mg, 0.298 mmol) in dioxane (2.5 mL) and H2O (0.5 ml_) was added 1 ,1-dimethylethyl [3- phenyi-2-({[5-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-2- thienyl]carbonyl}amino)propyl]carbamate (145 mg, 0.298 mmol)[prepared in
Example 87], Pd(PPh3)4 (17 mg, 14.9 μmol) and K2CO3 (164 mg, 1.19 mmol). After heating to 800C for 12h in a sealed tube, the reaction solution was partitioned between H2CVDCM. The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified using column chromatography (silica, 3% MeOH in DCM) affording the title compound (60 mg, 41 %) as an orange oil: LC-MS (ES) m/z = 492 (M+H)+. d) N-[2-amino-1-(phenylmethyl)ethyl]-5-(3-amino-1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide
1 , 1 -dimethylethyl [2-({[5-(3-amino-1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (60 mg, 0.122 mmol) was dissolved in TFA/MeOH (1:2, 3 mL) and stirred at RT for 30 min. The solution was then concentrated using a toluene azeotrope and neutralized through a silica plug (3-5% MeOH in DCM (1% NH4OH)) affording the title compound as a free base (21 mg, 44%). The free base, as a solution in MeOH, was then treated with excess HCI in dioxane affording the title compound as the HCI salt: LC-MS (ES) m/z 392 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 10.14 (bs, 2H), 8.98 (d, J = 8.4 Hz, 1 H), 8.36 (d, J = 4.9 Hz, 1 H), 8.24 (bs, 2H), 8.07 (d, J = 3.9 Hz, 1 H), 7.82 (d, J = 2.7 Hz, 1 H), 7.73 (d, J = 3.9 Hz, 1 H), 7.28-7.32 (m, 3H), 7.18-7.24 (m, 2H), 4.42-4.45 (m, 1 H), 2.91- 3.08 (m, 4H).
Example 90
Preparation of N-(4-r5-(-fr2-amino-1 -(phenylmethyl)ethvnamino>carbonvπ-2-thienvn- 1 H-pyrrolor2.3-blpyridin-3-yl}-3-furancarboxamide
a) N-(4-bromo-1 H-pyrrolo[2,3-b]pyridin-3-yl)-3-furancarboxamicle
To a solution of 4-bromo-1 H-pyrrolo[2,3-b]pyridin-3-amine (220 mg, 1.04 mmol)[prepared according to Example 89], 3-furoic acid (128 mg, 1.14 mmol) and diisopropylethyl amine (595 μl_, 3.42 mmol) in DCM (10 mL) at 25 °C was added PyBrop (580 mg, 1.25 mmol) in one portion. After 12h, the solution was partitioned between H2O/DCM. The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified using column chromatography (silica, 3% MeOH in DCM) affording the title compound (290 mg, 91%) as an orange oil: LC-MS (ES) m/z = 307 (M+H)+.
b) N-{4-[5-({[2-amino-1-(phenylmethyl)ethyl]amino}carbonyl)-2-thienyl]-1 H- pyrrolo[2,3-b]pyridin-3-yl}-3-furancarboxamide
The title compound was prepared as an orange solid according to Example
89, except substituting N-(4-bromo-1 H-pyrrolo[2,3-b]pyridin~3-yl)-3- furancarboxamide (112 mg, 0.366 mmol) for 4-bromo-1 H-pyrrolo[2,3-b]pyridin-3- amine: LC-MS (ES) m/z 485 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9.47 (s, 1 H), 8.57 (d, J = 8.3 Hz, 1 H), 8.30 (d, J = 5.0 Hz, 1 H), 8.17 (s, 1 H), 8.06 (bs, 2H), 7.74 (dd, J = 1.6, 1.6 Hz, 1 H), 7.66 (dd, J = 4.2, 4.2 Hz, 2H), 7.40 (d, J = 3.9 Hz, 1 H), 7.16-7.30 (m, 5H), 6.81 (d, J = 1.2 Hz, 1 H), 4.31-4.36 (m, 1 H), 2.88-2.98 (m, 2H).
Example 91
Preparation of 3-amino-N-r4-(2-chloro-1 H-pyrrolor2.3-biPyridin-3-vO-2-thienvH-2- phenylpropanamide
a) 2-chloro-3-iodo-1-(phenylsuifonyl)-1H-pyrrolo[2,3-b]pyridine
3-iodo-1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridine (1 g, 2.6 mrnol)[prepared in Preparation 1] in THF (2.6 ml_) was added drop wise to a -78 0C solution LDA [prepared by adding nBuϋ (1.1 ml_, 2.86 mmoi) to a -78 0C solution of diisopropyl amine (400 μl_, 2.86 mmol) in THF (5 mL)]. After 1 h, PhSO2CI (372 μl_, 2.86 mmol) in THF (5 mL) was added drop wise and the solution warmed to 25 0C. After 12h, the solution was partitioned between H2O/DCM. The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4 and concentrated. The residue was triturated using MeOH and the resulting brown solid was filtered and dried affording the title compound (600 mg, 55%): LC-MS (ES) m/z = 419 (M+H)+.
b) 1 ,1 -dimethylethyl [4-(2-chloro-1 H-pyrrolo[2,3-b]pyridin-3-yl)-2-thienyl]carbamate
To a solution of 2-chloro-3-iodo-1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridine (257 mg, 0.615 mmol) in dioxane (5 mL) and H2O (1 mL) was added 1,1- dimethylethyl [4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-2-thienyl]carbamate (200 mg, 0.615 mmol)[prepared according Example 47 except substituting 1 ,1- dimethylethyl (4-bromo-2-thienyl)carbamate (1 g, 3.6 mmol, prepared in Example 1) for 1 ,1-dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-3- phenylpropyl)carbamate], Pd(PPh3)4 (36 mg, 30.8 μmol) and K2CO3 (340 mg, 2.5 mmol). After heating to 80°C for 12h in a sealed tube, the reaction solution was partitioned between H2O/DCM. The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified using column chromatography (silica, 3% MeOH in DCM) affording the title compound (148 mg, 49%) as an off-white solid: LC-MS (ES) m/z = 490 (M+H)\
c) 3-amino-N-[4-(2-chloro-1 H-pyrrolo[2,3-b]pyridin-3-yl)-2-thienyl]-2- phenylpropanamide
The title compound was prepared as a yellow solid according to Example 1, except substituting , 1-dimethylethyl [4-(2-chloro-1 H-pyrrolo[2,3-b]pyridin-3-yl)-2- thienyl]carbamate (148 mg, 0.302 mmo) for 1 ,1-dimethylethyl {4-[1-(phenylsulfonyl)- 1 Ay-pyrrolo[2,3-ό]pyridin-3-yl]-2-thienyl}carbamate: LC-MS (ES) m/z 398 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8.27 (dd, J = 1.4, 4.7 Hz, 1 H), 8.07-8.12 (m, 3H), 7.31-7.43 (m, 5H), 7.16-7.29 (m, 2H), 4.19-4.38 (m, 1 H), 3.54-3.58 (m, 2H), 3.08- 3.17 (m, 2H).
Example 92
Preparation of N-(2-amino-1-DhenylethvO-4-f2-(3-furanviy-1 H-pyrrolor2.3-blpyridin-3- vn-2-thiophenecarboxamide
a) 1 , 1 -dimethylethyl [3-({4-[2-(3-furanyl)-1 H-pyrrolo[2,3-b]pyridin-3-yl]-2- thienyl}amino)-3-oxo-2-phenylpropyl]carbamate
To a solution of 1 ,1-dimethylethyl (3-{[4-(2-chloro-1 H-pyrrolo[2,3-b]pyridin-3- yl)-2-thienyl]amino}-3-oxo-2-phenylpropyl)carbamate (100 mg, 0.201 mmol)[prepared in Example 91] in dioxane (5 mL) and H2O (1 ml_) was added 3- furanboronic acid (23 mg, 0.201 mmol), Pd(PtBu3)2 (5 mg, 10.1 μmol) and Cs2CO3 (262 mg, 0.805 mmol). After heating 20 min at 150 0C in the microwave, the reaction solution was partitioned between H2O/DCM. The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly: LC-MS (ES) m/z = 529 (M+H)+.
b) N-(2-amino-1-phenylethyl)-4-[2-(3-furanyl)-1 H-pyrrolo[2,3-b]pyridin-3-yl]-2- thiophenecarboxamide
1 , 1 -dimethylethyl [3-({4-[2-(3-furanyl)-1 H-pyrrolo[2,3-b]pyridin-3-yl]-2- thienyl}amino)-3-oxo-2-phenylpropyl]carbamate (crude from above) was dissolved in TFA-DCM (1 :2, 3 mL). After 30 min, the solution was concentrated with a toluene azeotrope then neutralized through a silica plug (3% MeOH in DCM (1 % NH4OH)) affording the title compound as the free base (12 mg, 14%-2 steps).
The free base, as a solution in MeOH, was then treated with excess HCI in dioxane affording the title compound as the HCI salt: LC-MS (ES) m/z 429 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8.27 (dd, J = 1.2, 1.2 Hz, 1H), 8.09 (bs, 2H), 8.03 (s, 1 H), 7.88 (d, J = 7.7 Hz, 1 H), 7.75 (dd, J = 1.3, 3.2 Hz, 1 H), 7.40-7.42 (m, 4H), 7.33-7.35 (m, 1 H), 7.15 (dd, J = 4.9, 7.8 Hz, 1 H), 7.04 (d, J = 1.4 Hz, 1 H), 6.75 (d, J = 1.6 Hz, 1 H), 6.64 (d, J = 1.1 Hz, 1 H), 4.13-4.17 (m, 1 H), 3.51-3.62 (m, 1 H), 3.16- 3.18 (m, 1 H).
Example 93
Preparation of 4-amino-N-F5-(3-furanvO-4-(1 H-pyrrolor2.3-b1pyridin-3-vD-2-thienvπ- 2-phenylbutanamide
The title compound was prepared as an orange solid according to Example 49, except substituting 4-({[(1,1-dimethylethyl)oxy]carbonyl}amino)-2- phenylbutanoic acid (134 mg, 0.480 mmol) for 3-({[(1 ,1- dimethylethyl)oxy]carbonyl}amino)-2-(phenylmethyl)propanoic acid: LC-MS (ES) m/z 444 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8.26 (dd, J = 1.2, 4.8 Hz, 1H), 7.90 (bs, 2H), 7.66 (d, J = 7.4 Hz, 1 H), 7.63 (s, 1 H)1 7.57 (dd, J = 1.7, 1.7 Hz1 1 H)1 7.52 (d, J = 2.5 Hz, 1 H), 7.39-7.41 (m, 4H), 7.29-7.36 (m, 1 H), 7.08 (dd, J = 4.9, 7.9 Hz, 1 H), 6.78 (s, 1 H), 6.25 (s, 1 H), 3.85-3.89 (m, 1 H), 2.75-2.78 (m, 1 H), 2.67-2.73 (m, 1 H), 2.33-2.34 (m, 1 H), 2.03-2.06 (m, 1 H).
Preparation of 3-amino-2-(phenylmethy))-N-[5-phenyl-4-(1 H-pyrrolor2,3-b1pyridin-3- yl)-2-thienyllpropanamide
a) 4-bromo-5-phenyl-2-thiophenecarboxylic acid
To a solution of 4,5-dibromo-2-thiophenecarboxylic acid (1 g, 3.5 mmol) in dioxane (12 ml_) and H2O (2 ml.) was added phenylboronic acid (552 mg, 4.6 mmol), Pd(PPh3)4 (202mg, 0.175 mmol) and K2CO3 (1.9 g, 14.0 mmol). After heating to 80°C for 12h in a sealed tube, the reaction solution was partitioned between 6N NaOH/DCM. The pH of the aqueous phase was adjusted to ~3 and washed several times with DCM. The combined organic fractions were dried over Na2SO4, concentrated and used directly: LC-MS (ES) m/z = 284 (M+H)+.
b) 5-phenyl-4-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin-3-yl]-2- thiophenecarboxylic acid
To a solution of 4-bromo-5-phenyl-2-thiophenecarboxylic acid (crude from above) in dioxane (14.6 ml_) and H2O (2.9 ml_) was added 1-(phenylsulfonyl)-3- (4,4,5,5-tetramethyl-1 ,3,2-dioxaboroian-2-yl)-1 H-pyrroIo[2,3-b]pyridine (1.4 g, 3.5 mmol)[prepared according to Preparation 1], Pd(PPh3)4 (202mg, 0.175 mmol) and K2CO3 (1.9 g, 14.0 mmol). After heating to 800C for 12h in a sealed tube, the reaction solution was partitioned between 6N NaOH/DCM. The pH of the aqueous phase was adjusted to ~3 and washed several times with DCM. The combined organic fractions were dried over Na2SO4, concentrated and used directly. LC-MS (ES) m/z = 461 (M+H)+.
c) 1,1-dimethylethyl {5-phenyl-4-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin-3-yl]-2- thienyl}carbamate
A solution of 5-phenyl-4-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin-3-yl]-2- thiophenecarboxylic acid (crude from above), t-BuOH (18 mL), Et^N (1.5 mL) and diphenylphosphoryl azide (986 mg, 4.56 mmol) was stirred at 80 0C. After 12h, the solution was concentrated and purified via column chromatography (silica, 10-40% EtOAc in hexanes) affording the title compound (160 mg, 10%-3 steps): LC-MS (ES) m/z = 532 (M+H)+. d) 1 ,1-dimethylethyl [3-oxo-2-(phenylmethyl)-3-({5-phenyl-4-[1-(phenylsulfonyl)-1 H- pyrrolo[2,3-b]pyridin-3-yl]-2-thienyl}amino)propyl]carbamate
To a solution of 1 ,1-dimethylethyl {5-phenyl-4-[1-(phenylsulfonyl)-1 H- pyrrolo[2,3-b]pyridin-3-yl]-2-thienyl}carbamate (160 mg, 0.301 mmol) in methanol (3 ml_) was added 4M HCI in dioxane (1.5 ml_). The reaction was allowed to stir at RT for 12h and then concentrated to a solid under vacuum.
To a solution of the crude residue, 3-({[(1 ,1- dimethylethyl)oxy]carbonyl}amino)-2-phenylpropanoic acid (92 mg, 0.331 mmol) in DCM (3 ml_) and diisopropylethyl amine (263 μl_, 1.51 mmol) was added PyBrop (154 mg, 0.331 mmol). After 12h, the reaction solution was partitioned between H2O/DCM. The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 1% MeOH in DCM) affording the title compound (140 mg, 67 %): LC-MS (ES) m/z = 692 (M+H)+.
e) 3-amino-2-(phenylmethyl)-N-[5-phenyl-4-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2- thienyl]propanamide
i ) To a solution of 1,1-dimethylethyl [3-oxo-2-(phenylmethyl)-3-({5-phenyl-4-
[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin-3-yl]-2-thienyl}amino)propyl]carbamate (140 mg, 0.202 mmol) in THF (1 ml_) and iPrOH (1 ml_) was added 6N NaOH (2 ml_). After 1 h at 55 0C, the reaction mixture was neutralized with 1M aqueous HCI and extracted with DCM. The DCM solution was dried over Na2SO4, concentrated under vacuum and used directly: LC-MS (ES) m/z = 553 (M+ H)+. ii) The Boc-amine (crude from above) was dissolved in TFA/MeOH (1 :2, 3 mL) and stirred at RT for 30 min. The solution was then concentrated using a toluene azeotrope and neutralized through a silica plug (4% MeOH in DCM (1% NH4OH)) affording the title compound. The free base, as a solution in MeOH, was then treated with excess HCI in dioxane affording the title compound (38 mg, 42%-2 steps) as the HCI salt: LC-MS (ES) m/z 453 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8.25 (dd, J = 1.1 , 2.8 Hz, 1 H), 8.06 (bs, 2H), 7.47-7.51 (m, 2H), 7.19-7.35 (m, 10H), 7.00-7.35 (m, 1 H), 6.88 (s, 1 H), 3.21-3.25 (m, 1 H), 3.05-3.17 (m, 2H), 2.80-2.89 (m, 2H).
Example 95
Preparation of N-r2-amino-1-(phenylmethyl)ethyll-5-(3-chloro-1 H-Pyrrolor2,3- bipyridin^-vO^-thiophenecarboxamide
a) 4-bromo-3-chloro-1 H-pyrrolo[2,3-b]pyridine
To a solution of 4-bromo-1 H-pyrrolo[2,3-b]pyridine (1 g, 5.1 mmol)[prepared according to Preparation 2] in THF (25 ml_) at 0 0C was added NCS (742 mg, 5.6 mmol) in one portion. After warming to 25 0C, MeOH (2 ml_) was added for solubility and the solution stirred an additional 12h. The reaction mixture was then partitioned between H2O/DCM and the aqueous phase was washed several times with DCM. The combined organic fractions were dried over Na2SO4, concentrated and used directly: LC-MS (ES) m/z 234 (M+H)+.
b) N-[2-amino-1-(phenylmethyl)ethyl]-5-(3-chloro-1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example
89, except substituting 4-bromo-3-chloro-1 H-pyrrolo[2,3-b]pyridine (113 mg, 0.411 mmol) for 4-bromo-1H-pyrrolo[2,3-b]pyridin-3-amine: LC-MS (ES) m/z 411 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8.69 (d, J = 8.5 Hz, 1 H), 8.32 (d, J = 4.9 Hz, 1 H),
8.00 (bs, 2H), 7.88 (d, J= 3.8 Hz, 1 H), 7.78 (d, J = 2.8 Hz, 1 H), 7.39 (d, J = 3.9 Hz, 1 H), 7.28-7.33 (m, 3H), 7.20-7.23 (m, 1 H), 7.14 (d, J = 4.9 Hz, 1 H), 4.37-4.40 (m, 1 H), 2.92-3.17 (m, 4H).
Example 96
Preparation of N-(2-amino-1-phenylethyl)-5-(1 H-pyrrolor2,3-b1pyridin-4-vO-3- thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 7, except substituting 5-bromo-3-thiophenecarboxyiic acid (1 g, 4.85 mmol) [J. Org. Chem. 1976, 41, 2350] for 5-bromo-2-thiophenecarboxylic acid: LC-MS (ES) m/z = 364 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9.15 (d, J = 8.3 Hz, 1 H), 8.50 (dd, J = 7.2, 8.0 Hz, 1 H), 8.36 (dd, J = 3.4, 3.4 Hz, 1 H), 8.25 (bs, 2H), 7.95-7.98 (m, 2H), 7.37-7.48 (m, 2H), 7.30-7.33 (m, 2H), 7.26-7.29 (m, 2H), 5.32-5.38 (m, 1 H), 3.38-3.45 (m, 1 H), 3.17-3.24 (m, 1 H).
Example 97
Preparation of N-(2-amino-1-phenylethyl)-5-(1 H-pyrrolor2,3-bipyridin-3-vO-3- thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 7, except substituting 2-bromofuran-4-carboxylic acid (1 g, 4.85 mmol) [J. Org. Chem. 1976, 41, 2350] for 5-bromo-2-thiophenecarboxylic acid and substituting 1-(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)- 1 H-pyrrolo[2,3-6]pyridine (228 mg, 0.590 mmol) for 1-(phenylsulfonyl)-4-(4,4,5,5- tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1H-pyrrolo[2,3-6]pyridine: LC-MS (ES) m/z = 364 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9.28-9.31 (m, 1 H), 8.56 (s, 1 H), 8.48 (s, 1H), 3.34 (d, J = 5.4 Hz, 1 H), 8.26 (bs, 2H), 7.62 (s, 1 H), 7.53-7.56 (m, 1 H), 7.48-7.50 (m, 1 H), 7.38-7.41 (m, 2H), 7.29-7.31 (m, 1 H), 7.05 (s, 1 H), 5.31-5.36 (m, 1 H), 3.35-3.42 (m, 1 H), 3.18-3.22 (m, 1H).
Example 98
Preparation of N-r2-amino-1-(phenylmethyl)ethyll-5-(1 H-pyrrolor2,3-blpyridin-4-yl)- 3-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 7, except substituting 1 ,1-dimethylethyl (2-{[(5-bromo-3- thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (250 mg, 0.568 mmol) for 1,1- dimethylethyi (2-{[(5-bromo-2-thienyl)carbonyl]amino}-2-phenylethyl)carbamate: LC- MS (ES) m/z = 378 (M+H)\ 1H NMR (d6-DMSO, 400 MHz) δ 8.69 (d, J = 8.3 Hz, 1 H), 8.39 (d, J = 1.0 Hz, 1H), 8.33 (d, J = 5.3 Hz, 1 H), 8.29 (s, 1 H), 8.10 (bs, 2H), 7.71 (dd, J = 3.1 , 3.1 Hz, 1 H), 7.47 (d, J = 5.4 Hz, 1 H), 7.21-7.31 (m, 1 H), 7.19-7.20 (m, 1 H), 7.01 (s, 1 H), 4.41-4.48 (m, 1 H), 2.87-3.02 (m, 4H).
Example 99
Preparation of N-r2-amino-1-(phenylmethv0ethvπ-5-d H-pyrrolor2.3-bipyridin-3-vO- 3-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 7, except substituting 1 ,1-dimethylethyl (2-{[(5-bromo-3- thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (250 mg, 0.568 mmol) for 1,1- dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-2-phenylethyl)carbamate and substituting 1-(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1/-/- pyrro!o[2,3-jb]pyridine (219 mg, 0.568 mmol) for 1-(phenylsulfonyl)-4-(4,4,5,5- tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 /-/-pyrrolo[2,3-b]pyridine: LC-MS (ES) m/z = 378 (M+H)+, 1 H NMR (d6-DMSO, 400 MHz) 58.57 (d, J = 8.5 Hz, 1 H), 8.48 (dd, J = 1.1 , 8.0 Hz, 1 H), 8.36 (d, J = 2.4 Hz, 1 H), 8.12 (bs, 2H), 8.06 (d, J = 1.3 Hz, 1 H), 7.93 (d, J = 2.5 Hz, 1 H), 7.84 (d, J = 1.2 Hz, 1 H), 7.20-7.31 (m, 4H), 7.19-7.20 (m, 1 H), 4.35-4.40 (m, 1 H), 2.82-3.1 1 (m, 4H).
Example 100
Preparation of N-r(1SV2-amino-1-(cvclohexylmethyl)ethyll-4-bromo-5-(1 H- PVrrolo[2,3-blPyridin-4-ylV2-thiophβnecarboxamide
The title compound was prepared as a yellow solid according to Example 43, except substituting 2-[(2S)-2-amino-3-cyclohexylpropyl]-1 H-isoindole-1 ,3(2H)- dione-HCI (177 mg, 0.540 mmol)[prepared according to Procedure 7] for 2-[(2S)-2- amino-3-phenylpropyI]-1H-isoindole-1,3(2H)-dione: LC-MS (ES) m/z = 462 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8.70 (d, J = 8.7 Hz, 1 H), 8.36 (d, J = 5.0, 5.0 Hz, 1 H), 8.14 (s, 1 H), 8.04 (bs, 2H), 7.65 (d, J = 3.2 Hz, 1 H), 7.31 (d, J = 5.1 Hz, 1 H), 6.54 (dd, J = 1.8, 3.5 Hz, 1 H), 4.31-4.44 (m, 1 H), 2.80-3.01 (m, 2H), 1.71-1.82 (m, 1 H), 1.52-1.71 (m, 5H), 1.22-1.41 (m, 2H), 1.12-1.20 (m, 3H), 0.88-1.01 (m, 2H).
Preparation of N-rriS>2-amino-1-(cvclohexylmethv0ethvH-5-(1 H-Pyrrolof2,3- bipyridin-4-vO-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to Example 43, except substituting 2-[(2S)-2-amino-3-cyclohexylpropyl]-1 H-isoindo!e-1,3(2H)- dione-HCI (177 mg, 0.540 mmol)[prepared according to Procedure 7] for 2-[(2S)-2- amino-3-phenylpropyl]-1H-isoindole-1 ,3(2H)-dione and 5-[1-(phenylsulfonyl)-1 H- pyrroloβ.S-bJpyridin^-yl^-thiophenecarboxylic acid (250 mg, 0.649 mmol) for 4- bromo-δ-ti^phenylsulfonyO-I H-pyrroloP.S-bJpyridin^-yl^-thiophenecarboxylic acid: LC-MS (ES) m/z = 384 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8.48-8.51 (m, 1 H), 8.28 (d, J = 5.1 Hz, 1H), 7.87-7.96 (m, 4H), 7.66 (dd, J = 3.0, 3.0 Hz, 1 H), 7.41 (d, J = 5.2 Hz, 1 H), 6.88 (s, 1 H), 4.21-4.31 (m, 1 H), 2.82-3.01 (m, 2H), 1.72- 1.78 (m, 1 H), 1.51-1.71 (m, 5H), 1.42-1.48 (m, 2H), 1.12-1.14 (m, 3H), 0.88-1.11 (m, 2H).
Example 102
Preparation of 3-r(2-aminoethyl)oxy1-Λ/-((1S')-2-amino-1-iT2-
(trifluoromethvπphenyllmethyl>ethyl)-4-bromo-5-(1 H-pyrrolor2,3-bipyridin-4-vπ-2- furancarboxamide
The title compound was prepared as a yellow solid according to the procedure of
Example 77, except substituting 1 ,1-dimethyiethyl (2-hydroxyethyl)carbamate (0.048 g, 0.3 mmol) for methanol and 2-{(2S)-2-amino-3-[2- (trifluoromethyl)phenyl]propyl}-1 H-isoindole-1 ,3(2H)-dione (0.105 g, 0.3 mmol) )[prepared from N-{[(1 ,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L- phenylalanine following preparation 7] for 1 , 1-dimethylethyl (2-amino-3- phenylpropyl)carbamate: LC-MS (ES) m/z = 583 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.39 (m, 1 H), 7.74 (m, 1 H), 7.60 (m, 3H), 7.45 (m, 2H), 6.74 (m, 1 H), 4.73 (m, 1 H), 4.41 (m, 2H), 3.39 (m, 3H) and 3.22 (m, 3H).
Example 103
Preparation of 3-f(2-aminoethyl)oxy1-A/-((1 SV2-amino-1-fr2- (trifluoromethvπphenyllmethyl}ethyl')-5-π H-pyrrolor2.3-61pyridin-4-yl')-2- furancarboxamide
The title compound was prepared as a yellow solid according to the procedure of
Example 88, except substituting 2-{(2S)-2-amino-3-[2- (trifluoromethyl)phenyl]propyl}-1 H-isoindole-1 ,3(2H)-dione (0.105 g, 0.3 mmol)[prepared from N-{[(1 ,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L- phenylalanine following preparation 7] for 1,1-dimethylethyl (2-amino-3- phenylpropyl Carbamate: LC-MS (ES) m/z = 504 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.38 (br s, 1 H), 7.84 (m, 1 H), 7.72 (m, 3H), 7.57 (m, 2H), 7.45 (m, 1 H), 7.13
(m, 1 H), 4.75 (m, 1 H), 4.63 (m, 2H), 3.45 (m, 3H) and 3.26 (m, 3H).
Example 104
Preparation of N-r2-amino-1-(phenylmethvπethyll-5-(3-furanyl)-4-(1 H-pyrrolor2,3- blpyridin-3-yπ-2-thiophenecarboxamide
a) 1 ,1-dimethylethyl (2-{[(4,5-dibromo-2-thienyl)carbonyl]amino}-3- phenylpropyl)carbamate
To a solution of 1 ,1-dimethylethyl (2-{[(4,5-dibromo-2- thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (200 mg, 0.385 mmol)[prepared in Example 76] in dioxane/H2O (5:1 , 3.8 m!_) was added K2CO3 (213 mg, 1.54 mmol), tetrakistriphenylphosphine Pd(O) (22 mg, 19.3 μmol), and 3-furanylboronic acid (43 mg, 0.385 mmol). The reaction mixture was heated to 80° C in a sealed tube for 3h. The reaction solution was poured onto H2O (100 ml_) and extracted with DCM. The organics were dried (Na2SO4), concentrated under vacuum, and used directly: LC-MS (ES) m/z = 506.
b) 1 ,1-dimethylethyl {2-[({5-(3-furanyl)-4-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3- b]pyridin-3-yl]-2-thienyl}carbonyl)amino]-3-phenylpropyl}carbamate
To a solution of 1 ,1-dimethylethyl (2-{[(4,5-dibromo-2- thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (195 mg, 0.385 mmol) in dioxane/H2O (5:1, 3.8 mL) was added K2CO3 (213 mg, 1.54 mmol), tetrakistriphenylphosphine Pd(O) (22 mg, 19.3 μmol), and 1-(phenylsulfonyl)-3- (4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3-b]pyridine (148 mg, 0.385 mmol). The reaction mixture was heated to 80° C in a sealed tube for 12h. The reaction solution was poured onto H2O (100 mL) and extracted with DCM. The organics were dried (Na2SO4), concentrated under vacuum, and purified on silica gel (1 % MeOH in DCM) to give the title compound (250 mg, 95%) as a yellow solid: LC-MS (ES) m/z = 683. c) N-[2-amino-1-(phenylmethyl)ethyl]-5-(3-furanyl)-4-(i H-pyrrolo[2,3-b]pyridin-3-yl)- 2-thiophenecarboxamide i ) To a solution of 1,1-dinnethylethyl {2-[({5-(3-furanyl)-4-[1-(phenylsulfonyl)~ 1 H-pyrrolo[2,3-b]pyridin-3-yl]-2-thienyl}carbonyl)amino]-3-phenylpropyl}carbamate (250 mg, 0.366 mmol) in THF (2 ml_) and MeOH (2 ml_) was added 6N NaOH (4 ml_). After 1 h at 25 0C, the reaction mixture was neutralized with 1 M aqueous HCI and extracted with DCM. The DCM solution was dried over Na2SO4, concentrated under vacuum and used directly: LC-MS (ES) m/z = 543 (M+H)+. ii) The Boc-amine (crude from above) was dissolved in TFA/MeOH (1 :2, 3 ml_) and stirred at RT for 30 min. The solution was then concentrated using a toluene azeotrope and neutralized through a silica plug (4% MeOH in DCM (1% NH4OH)) then purified an additional time through reverse phase chromatography affording the title compound (16 mg, 10%-2 steps) as the TFA salt: LC-MS (ES) m/z 443 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8.58 (d, J = 8.6 Hz, 1 H), 8.28 (dd, J = 1.3, 4.6 Hz, 1 H), 8.06 (bs, 2H), 7.98 (s, 1 H), 7.80 (s, 1 H), 7.71 (d, J = 6.6 Hz, 1 H), 7.66 (s, 1 H), 7.65 (d, J = 1.7 Hz, 1H), 7.26-7.33 (m, 3H), 7.19-7.22 (m, 1 H), 7.04-7.11 (m, 1 H), 6.36 (s, 1 H), 4.38-4.44 (m, 1 H), 2.98-3.00 (m, 2H), 2.89- 2.91 (m, 2H).
Example 105
Preparation of 3-amino-N-r5-(3-furanvO-4-(2-methyl-1 H-pyrrolor2,3-blpyridin-3-vO-2- thienyπ-2-fohenylmethvQpropanamide
a) 3-iodo-2-methyl-1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridine
A solution of LDA was prepared by adding nBuLi (1 ml_, 2.5M in hexanes) to diisopropylamine (0.399 ml_, 2.86 mmol) in THF (5.2 ml_) at -78 C. To this was added dropwise a solution of 3-iodo-1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridine (1 g, 2.6 mmol) in THF (2.6 mL). After 1h, MeI (0.178 ml_, 2.86 mmol) in THF (2.6 ml_) was added dropwise. After warming to 25 0C over 12h, the solution was partitioned between H2O/DCM. The aqueous phase was extracted several times with additional DCM and the combined organic fractions were dried over Na2SO4 and concentrated. The residue was tritrated with MeOH and the solid filtered, dried and used directly (450 mg, 43%): LC-MS (ES) m/z 399 (M+H)+.
b) 2-methyl-1 -(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1 ,3,2-dioxaboro!an-2-yl)-1 H- pyrrolo[2,3-b]pyridine
A solution of 3-iodo-2-methyl-1-(phenylsuIfonyl)-1 H-pyrrolo[2,3-b]pyridine (450 mg , 1 .13 mmol), bis-pinacolatodiboron (574 mg, 2.26 mmol), potassium acetate (333 mg, 3.39 mmol) and Pd(dppf)CI2-complex with dichloromethane (81 mg, 0.102 mmol) in DMF (6 mL) was stirred at 90 0C for 12h in a sealed tube. The solution was cooled by the addition of ice and made basic to pH 12-14 with 6N NaOH. The aqueous phase was extracted with DCM then made acidic to pH ~1 with 6N HCI. The aqeous phase was extracted several times with DCM and the combined fractions were dried (Na2SO4) and concentrated affording the title compound as a brown solid which was used without further purification; LCMS (m/e) 399 (boronic ester M+H)+, 317 (boronic acid M+H)+.
c) 3-amino-N-[5-(3-furanyl)-4-(2-methyl-1 H-pyrrolo[2,3-b]pyridin-3-yl)-2-thienyl]-2~ (phenylmethyl)propanamide
The title compound was prepared as a tan solid according to Example 49, except substituting 2-methyl-1-(pheny!sulfonyl)-3-(4,4,5,5-tetramethyl-1, 3,2- dioxaborolan-2-yl)-1 H-pyrrolo[2,3-b]pyridine (440 mg, 1.28 mmol) for 1-
(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3- b]pyιϊdine: LC-MS (ES) m/z 457 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8.21 (dd, J = 1.3, 5.3 Hz, 1 H), 7.97 (bs, 2H), 7.60 (d, J = 8.0 Hz, 1 H), 7.53 (d, J = 9.4 Hz, 1 H), 7.30-7.35 (m, 4H), 7.24-7.28 (m, 2H), 7.08-7.11 (m, 1 H), 6.69 (s, 1 H), 6.11 (s, 1 H), 3.04-3.16 (m, 3H), 2.50-2.88 (m, 2H), 2.21 (s, 3H).
Example 106
Preparation of 3-amino-2-(phenylmethylVA/-r4-(1 H-pyrrolor2,3-t)ipyridin-4-yl')-2- thienylipropanamide
The title compound was prepared as a brown solid according to the procedure of Example 21 , accept substituting 3-({[(1 ,1- dimethylethyl)oxy]carbony)}amino)-2-(phenylmethyl)propanoic acid (0.37 g, 1.3 mmole) for 3-({[(1,1-dimethylethyl)oxy]carbonyl}amino)-2-phenylpropanoic acid: LC- MS (ES) m/z = 377. (M+H)+. 1H NMR (d4-MeOH, 400 MHz) δ 8.38 (d, J = 7.0 Hz, 1 H), 7.86 (d, J = 1.4 Hz, 1 H), 7.75 (d, J = 3.5 Hz, 1 H), 7.36 (d, J = 1.7 Hz, 1 H), 7.31-7.20 (m, 5H), 7.15 (d, J = 3.5 Hz, 1 H), 3.41-3.25 (m, 2H), 3.19-3.09 (m, 1 H) and 2.00 (dd, J = 7.0, 13.7 Hz, 1 H).
Example 107
Preparation of N-r2-amino-1-(phenylmethyl)ethvn-3.4-dibromo-5-(1 H-pyrrolor2.3- b1pyridin-4-ylV2-thiophenecarboxamide a) 3,4,5-tribromo-2-thiophenecarboxylic acid
nBuLi (2.5M n hexane, 5.52 ml) was added dropwise to tetrabromothiophene (5.0 g, 12.5 mmol) in THF (20 ml_) at -78 0C, and the resulting solution was stirred for 30 min. Solid CO2 (5 g, 113 mmol) was added once to the above solution. The resulting suspension was warmed to 0 0C over 1 h. The mixture was poured onto water, the pH was adjusted to 10 with KOH, and extracted with EtOAc. The aqueous layer was acidified to pH 1 with HCI, and extracted with CH2Cb (3 x 30 ml_). The collected organic layers were concentrated to give the desired acid (2.3 g, 50%) as an off-white solid. LC-MS (ES) m/z = 366 (M+H)+.
b) 3,4-dibromo-5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-ό]pyridin-4-yl]-2- thiophenecarboxylic acid
To a solution of 3,4,5-tribromo-2-thiophenecarboxylic acid (0.36g, 1.0 mmole) in dioxane (5 mL) and H2O (1 mL) was added K2CO3 (0.4 g, 3.0 mmole), tetrakistriphenylphosphine Pd(O) (0.057 g, 0.05 mmole), and 1-(phenylsulfonyl)-4- (4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1/-/-pyrrolo[2,3-6]pyridine (0.38 g, 1.0 mmole). The reaction mixture was heated to 70° C in a sealed tube for 4h. The reaction solution was concentrated under vacuum and diluted with water (5 mL). The suspension was washed with EtOAc (5 mL x 3), the aqueous layers acidified to pH 2, and extracted with CH2CI2 (5 mL x 3). The collected organic layers were dried (Na2SO4), and concentrated to give an off-white solid (550 mg), which was used directly in the next step without further purification. LC-MS (ES) m/z = 543 (M+H)+.
c) 1,1-dimethylethyl {2-[({3,4-dibromo-5-[1-(phenylsulfonyl)-1f/-pyrrolo[2,3-b]pyridin- 4-yl]-2-thienyl}carbonyl)amino]-3-phenylpropyl}carbamate
To a solution of 3,4-dibromo-5-[1-(phenylsulfonyl)-1H-pyrrolo[2,3-jb]pyridin- 4-yl]-2-thiophenecarboxylic acid (0.54 g, 1.0 mmole) in DCM (10 mL) was added PyBrop (0.7 g, 1.5 mmole) and Hunig's base (3 mL, 17.0 mmole). After 15 min., 1 ,1 -dimethyl ethyl (2-amino-3-phenylpropyl)carbamate was added to the reaction mixture in DCM (2 mL) and stirred for 12h at RT. The reaction solution was concentrated under vacuum and purified on silica gel (hexanes/EtOAc, 10-20 %) to give the title compound (260 mg, 33 % two steps) as a yellow foam: LC-MS (ES) m/z = 775 (M +H)+.
d) Λ/-[2-amino-1 -(pheny!methyl)ethyl]-3,4-dibromo-5-(1 H-pyrrolo[2,3-b]pyridin-4-yi)- 2-thioρhenecarboxamide
To a solution of 1 ,1-dimethylethyl {2-[({3,4-dibromo-5-[1-(phenylsulfonyl)-1 /-/- pyrrolo^S-φpyridin^-yl^-thienytycarbonyOaminol-S-phenylpropytycarbamate
(0.260 g, 0.34 mmole) in MeOH (10 mL) was added 6N NaOH (2.0 mL). After 0.5 h at 55 0C, the solvent was removed, and the reaction mixture was extracted with DCM. The DCM solution was dried over Na2SO4, concentrated under vacuum, and purified on silica gel [CHCI3: (CHCI3/MeOH/NH4OH, 90:10:1) = 20%] to give a tan solid (160 mg, 75%). LC-MS (ES) m/z = 635 (M+H)+.
The solid material from above was dissolved in MeOH (2 mL) and to the solution was added 4M HCI in dioxane (2.5 mL). After 12 h at RT, the reaction solution was concentrated under vacuum to give the title compound as a yellow solid (80mg, 70%): LC-MS (ES) m/z = 535 (M+H)+. 1H NMR (d4-MeOH, 400 MHz) δ 8.56 (d, J = 6.6 Hz, 1H), 8.33 (d, J= 9.0, 1 H, NH), 7.85 (d, J = 3.7 Hz, 1 H), 7.81 (d, J =6.6 Hz, 1 H), 7.38-7.25 (m, 5H), 6.94 (d, J = 3.7 Hz, 1 H), 4.66 (m, 1 H), 3.30-3.23 (m, 2H), and 3.15-3.02 (m, 2H). Example 108
Preparation of A/-r2-amino-1-(phenylmethvnethyll-3-(4-methylphenylV4-(1 H- pyrrolor2.3-ά1pyridin-4-vO-2-thiophenecarboxamide
a) Methyl 4-bromo-3-{[(trifluoromethyl)sulfonyl]oxy}-2-thiophenecarboxylate
To a solution of methyl 4-bromo-3-{[(trifluoromethyl)sulfonyl]oxy}-2- thiophenecarboxylate (0.948 g, 4.0 mmol) in CH2CI2 (5 ml_) and pyridine (1 ml_) at 0 0C was added Tf2O (1 .0 ml_, 6.0 mmol). The mixture was stirred for 1 h, and poured onto ice water (10 ml_), and extracted with CH2CI2 (5 ml_ x 3). The collected organic layers were dried (Na2SO4), and concentrated to give a red oil, which was used directly in the next step without further purification.
b) Methyl 4-bromo-3-(4-methylphenyl)-2-thiophenecarboxylate
To a solution of methyl 4-bromo-3-{[(trifluoromethyl)sulfonyl]oxy}-2- thiophenecarboxylate (0.26g, 0.71 mmole) in dioxane (5 mL) was added K3PO4 (0.451 g, 2.3 mmole), tetrakistriphenylphosphine Pd(O) (0.020 g, 0.017 mmole), and (4-methylphenyl)boronic acid (0.12 g, 0.85 mmole). The reaction mixture was heated to 85° C in a sealed tube for 2Oh. The reaction solution was concentrated under vacuum, and purified on silica gel (hexanes/EtOAc, 5:1) to give the title compound (187mg, 85%) as a brown solid: LC-MS (ES) m/z = 312 (M+H)+.
c) 1 , 1 -dim ethyl ethyl [2-({[4-bromo-3-(4-methylphenyl)-2-thienyl]carbonyl}amino)-3- phenylpropyl]carbamate
To a solution of methyl 4-bromo-3-(4-methylphenyl)-2-thiophenecarboxylate (170 mg, 0.55 mmol) in THF/H2O (9/1, V/V, 5 ml_), was added KOH (150 mg, 2.67 mmol), and the resulting mixture was heated at 55 0C for 20 h. After the THF was removed, the aqueous layer was acidified with 6 N HCI to pH = 2, and extracted with CH2CI2 (5 ml_ x 3). The organic fractions were dried over Na2SO4 and concentrated to give a crude acid, which was used directly in the next step. To a solution of 4-bromo-3-(4-methylphenyl)-2-thiophenecarboxylic acid in
DCM (10 ml_) was added PyBrop (0.256 g, 0.55 mmole) and Hunig's base (1 ml_, 6.3 mmole). After 15 min, 1 ,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate was added to the reaction mixture in DCM (2 ml_) and stirred for 12h at RT. The reaction solution was concentrated under vacuum and purified on silica gel (hexanes/EtOAc, 30%) to give the title compound (100 mg, 37 % two steps) as a yellow foam: LC-MS (ES) m/z = 502 (M+H)+.
d) 1 , 1-dimethylethyl {2-[({3-(4-methylphenyl)-4-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3- 6]pyridin-4-yl]-2-thienyl}carbonyl)amino]-3-phenylpropyl}carbamate
To a solution of 1, 1-dimethylethyl [2-({[4-bromo-3-(4-methylphenyl)-2- thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (0.10 g, 0.2 mmol) in dioxane (2 ml_) and H2O (0.4 ml_) was added K2CO3 (0.085 g, 0.6 mmole), tetrakistriphenylphosphine Pd(O) (0.012 g, 0.01 mmole), and 1-(phenylsulfonyl)-4- (4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1H-pyrrolo[2,3-t)]pyridine (0.092g, 0.24 mmole). The reaction mixture was heated to 70° C in a sealed tube for 4h. The reaction solution was concentrated under vacuum, and purified on silica gel (hexanes/EtOAc, 3:1 ) to give the title compound (0.08 g, 57%) as a white solid: LC- MS (ES) m/z = 707 (M+H)+.
e) Λ/-[2-amino-1 -(phenylmethyl)ethyl]-3-(4-methylphenyl)-4-(1 H-pyrrolo[2,3- 6]pyridin-4-yl)-2-thiophenecarboxamide
To a solution 1 ,1-dimethylethyl {2-[({3-(4-methylphenyl)-4-[1-
(phenylsulfonyl)-1 H-pyrrolo[2,3-ib]pyridin-4-yl]-2-thienyl}carbonyl)amino]-3- phenylpropyl}carbamate
(0.08 g, 0.11 mmole) in MeOH (3 ml_) was added 6N NaOH (3.0 ml_). After 0.5 h at 55 0C, the solvent was removed, and the reaction mixture was extracted with DCM to give a solid (60 mg, 93%). LC-MS (ES) m/z = 567 (M+H)+.
The solid material from above was dissolved in MeOH (2 mL) and to the solution was added 4M HCI in dioxane (2.5 mL). After 12 h at RT, the reaction solution was concentrated under vacuum to give the title compound as a yellow solid (50.4mg, 100%): LC-MS (ES) m/z = 467 (M+H)+. 1H NMR (d4-MeOH, 400 MHz) δ 8.20-8.18 (m, 2H), 7.69 (d, J = 4.0 Hz, 1 H), 7.35-7.26 (m, 3H), 7.14-7.11 (m, 5H), 7.01 (s, 1H), 7.00 (d, J = 8.5 Hz, 1 H), 6.97 (d, J = 7.1 Hz, 1 H0, 6.77 (d, J = 3.6 Hz, 1 H), 4.39 (m, 1 H), 3.08 (dd, J = 4.5, 12.7 Hz, 1 H), 2.98 (dd, J = 9.6, 13.3 Hz, 1 H), 2.78 (dd, J = 6.2, 14.0 Hz, 1H), 2.64 (dd, J = 9.0, 13.9 Hz, 1 H), and 2.32 (s, 3H). Example 109
Preparation of Λ/-r2-amino-1-(phenylmethv0ethyll-3-(methyloxyy4-(1H-pyrrolo[2.3- folpyridin-4-vO-2-thiophenecarboxamide
a) Methyl 4-bromo-3-(methyloxy)-2-thiophenecarboxylate
To a suspension of NaH (60% in mineral oil, 242 mg, 6.05 mmol) in DMF ( 20 ml.) at 0 0C was added methyl 4-bromo-3-hydroxy-2-thiophenecarboxylate (1.15 g, 4.85 mmol) in DMF (5 ml_) dropwise and the resulting suspension was stirred for 30 min. To the above mixture was added MeI (1.7 g, 9.7 mmol). After 30 min, the mixture was poured onto water, and extracted with diethyl ether (10 ml_ x 3). The organic fractions were dried, concentrated under vacuum and purified on silica gel (hexanes/EtOAc, 10%) to give the title compound (1.2 g, 95% ) as a white solid: LC-MS (ES) m/z = 252 (M+H)+.
b) 1 , 1-dimethylethyl {2-[({3-(methyloxy)-4-[1-(phenylsulfonyl)-1Λ/-pyrrolo[2,3- <6]pyridin-4-yl]-2-thienyl}carbonyl)amino]-3-phenylpropyl}carbamate
To a solution of methyl 4-bromo-3-(methyloxy)-2-thiophenecarboxylate (500 mg, 2.0 mmol) in THF(5 ml_), was added KOH (8N, 5 ml_, 40 mmol), and the resulting mixture was heated at 55 °C for 5 h. After the THF was removed, the aqueous layer was acidified with 6 N HCI to pH = 2, and extracted with CH2CI2 (5 ml_ x 3). The organic fractions were dried over Na2SO4 and concentrated to give a crude acid, which was used directly in the next step.
To a solution of the above acid (213 mg, 0.9 mmol) in DCM (5 mL) was added PyBrop (0.42 g, 0.9 mmole) and Hunig's base (2 mL, 12.6 mmole). After 15 min, 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (150 mg, 0.6 mmol) was added to the reaction mixture and stirred for 12h at RT. The reaction solution was concentrated under vacuum and purified on silica gel (hexanes/EtOAc, 10-20%) to give the title compound (250 mg, 59 %) as a yellow foam: LC-MS (ES) m/z = 470 (M+Hf.
c) 1 , 1 -dimethylethyl {2-[({3-(methyloxy)-4-[1 -(phenylsulfonyl)-i H-pyrrolo[2,3- 6]pyridin-4-yl]-2-thienyl}carbonyl)amino]-3-phenylpropyl}carbamate
To a solution of 1 ,1-dimethylethyl {2-[({3-(methyloxy)-4-[1-(phenylsulfonyl)- 1 /-/-pyrrolo[2,3-6]pyridin-4-yl]-2-thienyl}carbonyl)amino]-3-phenylpropyl}carbamate (0.280 g, 0.62 mmol) in dioxane (10 mL) and H2O (2 mL) was added K2CO3 (0.34g, 2.4 mmole), tetrakistriphenylphosphine Pd(O) (0.040 g, 0.034 mmole), and 1- (phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1H-pyrrolo[2,3- fo]pyridine (0.236g, 0.62 mmole). The reaction mixture was heated to 70° C in a sealed tube for 2h. The reaction solution was concentrated under vacuum, and purified on silica gel (hexanes/EtOAc, 3:1) to give the title compound (0.20 g, 57%) as a white solid: LC-MS (ES) m/z = 647 (M+H)+.
d) Λ/-[2-amino-1-(phenylmethyl)ethyl]-3-(methyloxy)-4-(1 H-pyrrolo[2,3-ό]pyridin-4- yl)-2-thiophenecarboxamide
To a solution of 1 , 1-dimethylethyl {2-[({3-(methyloxy)-4-t1-(phenylsulfonyI)- 1 H-pyrrolo[2,3-b]pyridin-4-yl]-2-thienyl}carbonyI)amino]-3-phenylpropyl}carbamate (0.17 g, 0.26 mmole) in MeOH (3 ml_) was added 6N NaOH (3.0 ml_). After 0.5 h at 55 0C, the solvent was removed, and the reaction mixture was extracted with DCM to give a pure solid. LC-MS (ES) m/z = 507 (M+H)+.
The solid material from above was dissolved in MeOH (2 ml_) and to the solution was added 4M HCI in dioxane (2.5 mL). After 12 h at RT, the reaction solution was concentrated under vacuum to give the title compound as a yellow solid (55.0 mg, 100%): LC-MS (ES) m/z = 407 (M+H)+.1H NMR (d4-MeOH, 400 MHz) δ 8.48 (d, J = 6.0 Hz, 1 H), 8.22 (s, 1 H), 7.90 (d, J = 8.5 Hz, 1 H), 7.78 (d, J = 3.7 Hz, 1H), 7.72 (d, J =5.8 Hz, 1H), 7.35 (m, 5H), 6.97 (d, 3.7 Hz, 1 H), 4.36 (d, J = 3.7 Hz, 1 H), 4.67 (m, 1 H), 3.36 (s, 3H), 3.30 (m, 2H), 3.14 (dd, J = 5.3, 14.3 Hz, 1 H) and 3.07 (dd, J = 9.3, 14.6 Hz, 1 H).
Example 110
Preparation of 3-amino-Λ/-r4-bromo-5-(1 H-pyrrolor2,3-ib1pyridin-4-yl)-2-thienyll-2- (phenylmethvQpropanamide
The title compound was prepared as a yellow solid according to Example 27, except substituting 3-({[(1,1-dimethylethyl)oxy]carbonyl}amino)-2- (phenylmethyl)propanoic acid (0.47 g, 1.6 mmole), for 3-({[(1,1- dimethylethyl)oxy]carbonyl}amino)-2-phenylpropanoic acid. LC-MS (ES) m/z = 456 (M+H)+. 1H NMR (d4-MeOH, 400 MHz) δ 8.45 (br s, 1 H), 7.93 (d, J = 6.4 Hz, 1 H), 7.80 (d, J = 3.6 Hz, 1 H), 7.35 -7.24 (m, 6 H), 7.11 (d, J = 3.6 Hz, 1 H), 6.91 (s, 1 H), 3.41-3.22 (m, 2H), and 3.00 (dd, J = 7.5, 13.3 Hz, 1 H).
Example 11 1 Preparation of Λ/-r2-amino-1 -(phenvimethvπethyll-5-d /-/-pyrazolor3,4-c/lpyrimiriin-4- ylV2-thiophenecarboxamide
a) 1 ,5-dihydro-4H-pyrazolo[3,4-d]pyrimidin-4-one
The sulfate salt of 3-amino-4-pyrozolecarboxamide (4.0 g, 22.8 mmol) and formaldehyde (15 ml_) were heated at 180-190 0C for 45 mins. After the reaction mixture was cooled to RT, it was poured onto water (30 ml_), and filtered to give the title compound (2.8 g, 88%) as a white solid. LC-MS (ES) m/z = 137 (M+H)+.
b) 4-chloro-1 H-pyrazolo[3,4-d]pyrimidine
To a solution of 1 ,5-dihydro-4/-/-pyrazolo[3,4-c/]pyrimidin-4-one (2.0 g, 14.8 mmol) in POCI3 (40 ml_) was added Λ/,/V-dimethylaniline (5 ml_). The mixture was heated at 125 0C for 1 h. The majority of the POCI3 was removed by vacuum distillation. The residue was poured onto ice-water with stirring, and then extracted with diethyl ether (20 ml_ x 3). The organic fractions were dried, and concentrated to give title compound (1.5 g, 67% ) as a white solid.
c) 1,1-dimethylethyl 4-chloro-1 H-pyrazolo[3,4-d]pyrimidine-1-carboxylate
To a solution of 4-chloro-1 /-/-pyrazolo[3,4-c/]pyriιτιidine (0.5 g, 3.2 mmol) in CH3CN (2 mL) was added Boc2O (0.84 g, 3.8 mmol) and DMAP (~2 mg). After the mixture was stirred at RT for 10 min, it was concentrated under vacuum, and purified on silica gel (hexanes/EtOAc, 3:1) to give the title compound (0.74 g, 90%) as a white solid: LC-MS (ES) m/z = 255 (M+H)+.
d) Methyl 5-(1 /-/-pyrazolo[3,4-d]pyrimidin-4-yl)-2-thiophenecarboxylate
/-PrMgCI (2.0 M in ether, 1.3 mL) was added to 2,2'-oxybis(Λ/,/V- dimethylethanamine) (0.47 mL) in THF (5 mL) at 15 °C. The reaction mixture was warmed to RT and stirred for 10 min. To the above suspension was added methyl 5-bromo-2-thiophenecarboxylate (563 mg, 2.55 mmol) in THF (2 mL). The mixture was then cooled to 0 0C, and 1 ,1-dimethylethyl 4-chloro-1 /-/-pyrazolo[3,4- c/]pyrimidine-1-carboxylate (215 mg, 0.85 mmol) in THF (1 mL) was added. After being stirred at RT for 30 min, the reaction mixture was quenched with NH4CI (sat'd aq), and extracted with CH2CI2 (5 mL x 3). The collected organic layers were dried (Na2SO4), concentrated, and the residue was purified on silica gel (hexanes/EtOAc, 3:1 ) to give the title compound (0.16 g, 74%) as a white solid: LC- MS (ES) m/z = 261 (M+H)+.
e) 1 , 1-dimethylethyl [3-phenyl-2-({[5-(1H-pyrazolo[3,4-c/]pyrimidin-4-yl)-2- thienyl]carbonyl}amino)propy]]carbamate
To a solution of methyl 5-(1H-pyrazolo[3,4-cf]pyrimidin-4-yl)-2- thiophenecarboxylate (50 mg, 0.19 mmol) in THF(5 mL), was added KOH (53 mg, 0.95 mmol), and the resulting mixture was heated at 60 0C for 12 h. After removing theTHF under vacuum, the aqueous layer was acidified with 6 N HCI to pH = 2, and extracted with CH2CI2 (5 mL x 3). The organic fractions were dried over Na2SO4 and concentrated to give a crude acid, which was used directly in the next step.
To the above acid in DCM (2 mL) and THF (2 mL) was added PyBrop (0.132 g, 0.28 mmole) and Hunig's base (0.2 mL, 1.26 mmole). After 15 min, 1 ,1- dimethylethyl (2-amino-3-phenylpropyl)carbamate (71 mg, 0.28 mmol) was added to the reaction mixture and stirred for 12h at RT. The reaction solution was concentrated under vacuum and purified on reverse-phase HPLC (C18 column: H2CVCH3CN gradient) to give the title compound as a TFA salt. The free base (21 mg, 23% two steps) was obtained by treatment of the above TFA salt with NH4OH followed by extraction with CH2CI2. LC-MS (ES) m/z = 479 (M+H)+.
f) Λ/-[2-amino-1 -(phenylmethyl)ethyl]-5-(1 H-pyrazolo[3,4-d]pyrimidin-4-yl)-2- thiophenecarboxamide
1,1-Dimethylethyl [3-phenyl-2-({[5-(1f/-pyrazolo[3,4-d]pyrimidin-4-yl)-2- thienyl]carbonyl}amino)propyl]carbamate (21 mg, 0.043 mmol) was dissolved in MeOH (2 mL) and to the solution was added 4M HCl in dioxane (1 mL). After 12 h at RT, the reaction solution was concentrated under vacuum to give the title compound as a yellow solid (10.0 mg, 63%): LC-MS (ES) m/z = 379 (M+H)\ 1H NMR (d4-MeOH, 400 MHz) δ 8.92 (s, 1 H), 8.69 (s, 1 H), 8.27 (d, J = 4.2 Hz, 1 H), 7.83 (d, J = 4.2 Hz, 1 H), 7.37-7.22 (m, 5H), 4.57 (m, 1H), 3.28-3.12 (m, 2H), and 3.12-2.94 (m, 2H).
Example 112
Preparation of 2-amino-1-(phenylmethyl)ethyl r4-bromo-5-πH-pyrrolo[2.3-fo1pyridin- 4-yl)-2-thienvπcarbamate a) 2-({[(1,1-dimethylethyl)oxy]carbonyl}amino)-1-(phenylmethyl)ethyl (4,5-dibromo- 2-thienyl)carbamate
To a mixture of 4,5-dibromothiophenecarboxylic acid (0.85g, 3.0 mmol) in toluene (10 ml_) was added DPPA (1.0 ml_. 4.5 mmol) and triethyl amine (1.8 ml_, 27 mmol). After the mixture was heated to 85 0C for 10 min under an atmosphere of N2, 1 ,1-dimethylethyl (2-hydroxy-3-phenylpropyl)carbamate (1.5 g, 6.0 mmol) was added in one portion. The mixture was heated to reflux for 10 h. After it was cooled to RT, the reaction mixture was concentrated in vacuo. Flash chromatography (silica gel, hexanes/EtOAc, 3:1)) gave the title compound (516 mg, 32%) as a white solid. LCMS (ES) m/z 535 (M+H)+.
b) 2-({[(1,1-dimethylethyl)oxy]carbonyl}amino)-1-(phenylmethyl)ethyl {4-bromo-5-[1- (phenylsulfonyl)-1H-pyrrolo[2,3-<b]pyridin-4-yl]-2-thienyl}carbamate
To a solution of 2-({[(1, 1-dimethylethyl)oxy]carbonyl}amino)-1- (phenylmethyl)ethyl (4,5-dibromo-2-thienyl)carbamate (0.18 g, 0.33 mmole) in dioxane (15 ml_) and H2O (3 mL) was added K2CO3 (0.138 g, 1.0 mmole), tetrakistriphenylphosphine Pd(O) (0.018 g, 0.015 mmole), and 1-(phenylsulfonyl)-4- (4,4,5,5-tetramethyl-i ,3,2-dioxaborolan-2-yl)-1/-/-pyrrolo[2,3-<b]pyridine (0.123 g, 0.32mmole). The reaction mixture was heated to 70° C in a sealed tube for 10 h. The reaction solution was concentrated under vacuum, and purified on silica gel (hexanes/EtOAc, 2:1 to 1 :1) to give the title compound (110 m g, 46 %) as a brown solid: LC-MS (ES) m/z = 712 (M+H)+.
c) 2-amino-1-(phenylmethyl)ethyl [4-bromo-5-(1H-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]carbamate
To a solution 1 ,1-dlmethylethyl {2-[({3-(4-methylphenyl)-4-[1- (phenylsulfonyl)-1H-pyrrolot2,3-ιb]pyridin-4-yl]-2-thienyl}carbonyi)amino]-3- phenylpropyl}carbamate
(0.06 g, 0.09 mmole) in MeOH (3 mL) was added 6N NaOH (1.0 ml_). After 0.5 h at 55 0C, the solvent was removed, and the reaction mixture was extracted with DCM, and concentrated to give a crude product. LC-MS (ES) m/z = 571 (M+H)+.
The solid material from above was dissolved in CH2CI2 (2 mL) and to the solution was added TFA (0.5 mL). After 10 min, the reaction solution was concentrated, and purified on reverse-phase HPLC (C18 column: H2O/CH3CN gradient) to give the title compound as a yellow solid (30 mg, 51 %): LC-MS (ES) m/z = 471 (M+H)+. 1H NMR (d4-MeOH, 400 MHz) δ 8.39 (bd, J = 5.9 Hz, 1 H), 7.84 (d, J = 5.8 Hz, 1 H), 7.73 (d, J = 3.8 Hz, 1 H), 7.37-7.26 (m, 5H), 7.03 (d, J = 3.4 Hz, 1 H), 6.80 (s, 1 H), 5.33 (m, 1 H), 3.31-3.16 (m, 2H) and 3.13-3.02 (m, 2H).
Example 113
Preparation of 4-r5-f{r2-amino-1-(phenylmethyl)ethvnamino}carbonyl)-2-thienvπ-ΛA- (2-furanylmethyl)-1H-pyrrolor2,3-ά1pyridine-3-carboxarnide
a) 4-bromo-1-(phenylsulfonyl)-1fV-pyrrolo[2,3-b]pyridine-3-carboxylic acid
nBuLi (2.5M n hexane, 0.86 mL) was added dropwise to a solution of 4- bromo-3-iodo-1-(phenylsulfonyl)-1H-pyrrolo[2,3-ιb]pyridine (0.50 g, 2.16 mmol) in THF (5 mL) at -78 0C, and the resulting solution was stirred for 10 min. Dry ice (2 g, 45 mmol) was added once to the above solution. The resulting suspension was warmed to 0 0C over 1h. The mixture was poured onto water, the pH was adjusted to 10 with KOH, and extracted with EtOAc. The aqueous layers was acidified to pH 2 with HCl, and extracted with CH2CI2 (10 mL x 3). The combined organic layers were concentrated to give the desired acid (0.3 g, 73%) as off white solid. MS (ES) m/z = 382 (M+H)+.
b) 4-bromo-Λ/-(2-furanylmethyl)-1-(phenylsulfonyl)-1/-/-pyrrolo[2,3-b]pyridine-3- carboxamide
To a solution of 4-bromo-1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridine-3- carboxylic acid (250 mg, 0.66 mmol) in DCM (5 mL) was added PyBrop (0.31 g, 0.66 mmole) and Hunig's base (0.22 mL, 1.26 mmole). After 15 min, 1-(2- furanyl)methanamine (0.2 mL, 1.9 mmol) was added to the reaction mixture and stirred for 2h at RT. The reaction solution was concentrated under vacuum and purified on silica gel (hexanes/EtOAc, 40%) to give the title compound (270 mg, 90 %) as a white foam: LC-MS (ES) m/z = 461 (M+H)\
c) 1,1-Dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-3- phenylpropyl)carbamate
To a solution of δ-bromo^-thiophenecarboxylic acid (700 mg, 3.38 mmol) in DCM (10 ml_) was added PyBrop (1.81 g, 3.89 mmole) and Hunig's base (2.2 mL, 12.6 mmole). After 15 min, 1 ,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (700 mg, 2.78 mmol) was added to the reaction mixture and stirred for 2h at RT. The reaction solution was concentrated under vacuum and purified on silica gel (hexanes/EtOAc, 40%) to give the title compound (1.12 g, 92 %) as a white solid: LC-MS (ES) m/z = 440 (M+H)+.
d) [5-({[2-({[(1 ,1-dimethylethyl)oxy]carboπyl}amino)-1- (phenylmethyl)ethyl]amino}carbonyl)-2-thienyl]boronic acid
To a solution of 1 ,1-dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-3- phenylpropyl)carbamate (1.1 g, 2.5 mmole) in DMF (10 mL) was added KOAc (0.74 g, 5.5 mmole), bis(pinocolato)diboron (0.76 g, 3.0 mmole) and Pd(dppf)CI2 (0.10 g, 0.13 mmole). The reaction contents were heated to 800C in a sealed tube for 12 hours. The reaction solution was concentrated to a solid under vacuum and used directly in the next reaction. LC-MS (ES) m/z = 405 (M+H)+.
e) 1 ,1-dimethylethyl {2-[({5-[3-{[(2-furanylmethyl)amino]carbonyl}-1-(phenylsulfonyl)- 1f/-pyrrolo[2,3-ό]pyridin-4-yl]-2-thienyl}carbonyl)amino]-3-phenylpropyl}carbamate
To a mixture of [5-({[2-({[(1 ,1-dimethylethyl)oxy]carbonyl}amino)-1- (phenylmethyl)ethyl]amino}carbonyl)-2-thienyl]boronic acid (0.14 g, 0.35 mmole) in dioxane (5 mL) and H2O (1 ml_) was added 4-bromo-Λ/-(2-furanylmethyl)-1- (phenylsulfonyl)-1H-pyrrolo[2,3-ύ]pyridine-3-carboxamide (0.1g, 0.22 mmole), Pd(PPh3)4 (13 mg, 0.011 mmole) and K2CO3 (0.09 g, 0.65 mmole). After heating to 700C for 12h under N2, the reaction solution was concentrated under vacuum and purified on silica (hexanes/EtOAc, 40-50%) to afford the title compound (0.156 g, 97%) as a light yellow solid: LC-MS (ES) m/z = 740 (M+H)+.
f) 4-[5-({[2-amino-1-(phenylmethyl)ethyl]amino}carbonyl)-2-thienyl]-Λ/-(2- furanylmethyl)-1/-/-pyrrolo[2,3-/b]pyridine-3-carboxamide
To a solution 1 ,1-dimethylethyl {2-[({5-[3-{[(2-furanylmethyl)amino]carbonyl}- 1-(phenylsulfonyl)-1H-pyrrolo[2,3-ib]pyridin-4-yl]-2-thienyl}carbonyl)amino]-3- phenylpropyl}carbamate (0.16 g, 0.26 mmole) in MeOH (3 mL) was added 6 N NaOH (2.0 mL). After 0.5 h at RT, the solvent was removed and the reaction mixture was extracted with DCM and concentrated to give a crude product. LC-MS (ES) m/z = 600 (M+H)+.
The solid material from above was dissolved in CH2CI2 (2 mL) and to the solution was added TFA (2 mL). After 10 min, the reaction solution was concentrated, and purified on reverse-phase HPLC (C18 column: H2O/CH3CN gradient) to give the title compound as a yellow solid (80 mg, 51 %): LC-MS (ES) m/z = 500 (M+H)+. 1H NMR (d4-MeOH, 400 MHz) δ 8.37 (br s, 1 H), 7.70 (br s, 2H), 7.50 (d, J = 4.9 Hz, 1 H), 7.48 (m, 1 H), 7.32 -7.29 (m, 5H), 7.26-7.20 (m, 1 H0, 6.40 (dd, J = 1.9, 3.2 Hz, 1 H), 6.37 (dd, J = 0.7, 3.3 Hz, 1 H), 4.50-4.67 (m, 3H), 3.29- 3.17 (m, 2H), and 3.07-2.98 (m, 2H).
Example 114
Preparation of A/-r2-amino-1-(phenylmethyl)ethyll-5-r2-(3-furanvn-1H-pyrrolor2,3- ά1pyridin-4-vn-2-thiophenecarboxamide
a) 4-bromo-2-(3-furanyl)-1-(phenylsulfonyl)-1H-pyrrolo[2,3-ό]pyridine
To a mixture of 4-bromo-2-iodo-1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridine (220 mg, 0.48 mmol) and 3-furanylboronic acid (57 mg, 0.50 mmol) in DMF (2 ml_) and triethylamine (1 mL) was added CuI (10 mg, 0.05 mmol), and Pd(PPh3)2CI2 (17 mg, 0.024 mmol). After stirring for 4 h at RT under N2, the reaction solution was concentrated under vacuum and purified on silica (CHCVMeOH, 95:5) to afford the title compound (0.156 g, 83%) as a light yellow solid: LC-MS (ES) m/z = 404 (MH-H)+.
b) 1,1-dimethylethyl {2-[({5-[2-(3-furanyl)-1-(phenylsulfonyl)-1H-pyrrolo[2,3-6]pyridin- 4-yl]-2-th i en yl}ca rbo nyl )a m i n o] -3-ph e nyl propy l}ca rba m ate
To a mixture of [5-({[2-({[(1,1-dimethylethyl)oxy]carbonyl}amino)-1- (phenylmethyl)ethyl]amino}carbonyl)-2-thienyl]boronic acid (0.16 g, 0.40 mmole) in dioxane (5 mL) and H2O (1 mL) was added 4-bromo-2-(3-furanyl)-1- (phenylsulfonyl)-1f/-pyrrolo[2,3-6]pyridine (O.Oδg, 0.2 mmole), Pd(PPh3)4 (12 mg, 0.011 mmole) and K2CO3 (0.08 g, 0.6 mmole). After heating to 700C for 12h under N2, the reaction solution was concentrated under vacuum and purified on silica (Hex/EtOAc, 30-40%) to afford the title compound (0.055 g, 41 %) as a light yellow solid: LC-MS (ES) m/z = 683 (M +H)+.
c) Λ/-[2-amino-1-(phenylmethyl)ethyl]-5-[2-(3-furanyl)-1 /-/-pyrrolo[2,3-ό]pyridin-4-yl]- 2-thiophenecarboxamide
To a solution of 1 ,1-dimethylethyl {2-[({5-[2-(3-furanyl)-1-(phenylsulfonyl)- I H-pyrroIoP^-όlpyridin^-ylJ^-thienyljcarbonyOaminol-S-phenylpropyllcarbamate (0.042g, 0.06 mmole) in MeOH (2 mL) was added 6N NaOH (2.0 mL). After 0.5 h at RT, the solvent was removed, and the reaction mixture was extracted with DCM, dried over Na2SO4, and concentrated to give a crude product, and used directly in the next step. The solid material from above was dissolved in CH2Cl2 (2 mL) and to the solution was added TFA (2 mL). After 10 min, the reaction solution was concentrated, and purified on reverse-phase HPLC (C18 column: H2O/CH3CN gradient) to give the title compound as a yellow solid (13 mg, 31%): LC-MS (ES) m/z = 443 (M+H)+. 1H NMR (d4-MeOH, 400 MHz) δ 8.21 (br s, 1 H), 7.94 (d, J = 4.1 Hz, 1H), 7.84 (d, J = 3.9 Hz, 1 H), 7.70 (dd, J =1.7, 1.7 Hz, 1H), 7.65 (d, J = 5.9 Hz, 1 H), 7.34-7.33 (m, 5H)1 7.28 -7.22 (m, 2H), 7.03 (dd, J = 2.0, 0.8 Hz, 1 H), 4.59 (m, 1H), 3.28-3.14 (m, 2H) and 3.06 -2.99 (m, 2H).
Example 115
Preparation of A/-f2-amino-1-(phenylmethyl)ethyll-4-bromo-/\/-hvdroxy-5-(1H- PVrrolor2,3-jbiPVridin-4-yl)-2-thiophenecarboxamide
a) 1 ,1-dimethylethyl (2-oxo-3-phenylpropyl)carbamate
To a solution of oxalyl chloride (1.6 mL, 18 mmol) in DCM (80 ml_) at -78 0C was added DMSO (2.0 mL, 28 mmol), and stirred for 20 min. To above suspension was added 1,1-dimethylethyl (2-hydroxy-3-phenylpropyl)carbamate (3.0 g, 12 mmol) in DCM (3 mL). After the mixture was stirred at -78 0C for 2h, triethyl amine (20 mL) was added. The resulted suspension was warmed to 0 0C over 1 h. After the mixture was recooled to -78 0C, it was quenched with 50 mL of sat'd NH4CI. The mixture was extracted with DCM and the combined organic phases were dried (Na2SO4), and concentrated in vacuo. The residue was purified on silica gel (Hexane/EtOAc, 20%) to give the title compound (2.2 g, 70 %) as a colorless oil: LC-MS (ES) m/z = 250 (M+H)+.
b) 1 ,1-dimethylethyl [2-(hydroxyamino)-3-phenylpropyl]carbamate
To a mixture of 1,1-dimethylethyl (2-oxo-3-phenylpropyl)carbamate
(2.0 g, 8 mmol), hydroxylammonium chloride (1.65 g, 24 mmol) in EtOH (10 mL) and water (20 mL) was added NaOAc (2.64 g, 32 mmol). After being stirred for 30 min, the mixture was concentrated to give crude 1 ,1-dimethylethyl [(2£)-2- (hydroxyimino)-3-phenylpropyl]carbamate. LC-MS (ES) m/z = 265 (M+H)+.
To a solution of the above compound (~8 mmol) in THF (20 ml_) and AcOH (5 mL) at 0 0C was added NaBH3CN (1.5 g, 24 mmol) in one portion. After the mixture was stirred for 2h, it was quenched with 10 mL of sat'd NH4CI. The mixture was extracted with DCM and the combined organic phases were dried (Na2SO4), and concentrated in vacuo. The residue was purified on silica gel (Hexane/EtOAc, 10%) to give the title compound (1.6 g, 74 %) as a colorless oil: LC-MS (ES) m/z = 267 (M+H)+.
c) 1 ,1 -dimethylethyl {2-[[(4,5-dibromo-2-thienyl)carbonyl](hydroxy)amino]-3- phenylpropyl}carbamate
To a solution of 4,5-dibromo-2-thiophenecarboxylic acid (1.0 g, 3.25 mmol) in DCM (10 mL) was added PyBrop (1.5 g, 3.25 mmole) and Hunig's base (1 mL,
6.3 mmole). After 15 min, 1 ,1-dimethylethyl [2-(hydroxyamino)-3- phenylpropyl]carbamate
(350 mg, 1.31 mmol) was added to the reaction mixture in DCM (2 mL) and stirred for 2h at RT. The reaction solution was concentrated to give crude 1 ,1-dimethylethyl [2-([(4,5-dibromo-2-thienyl)carbonyl]{[(4,5-dibromo-2-thienyl)carbonyl]oxy}amino)-3- phenylpropyl]carbamate. LC-MS (ES) m/z = 803 (M+H)+.
To a solution of 1,1-dimethylethyl [2-([(4,5-dibromo-2-thienyl)carbonyl]{[(4,5- dibromo-2-thienyl)carbonyl]oxy}amino)-3-pheny!propyl]carbamate in MeOH (5 mL) was added K2CO3 (1.0 g, 7.3 mmol). The mixture was stirred at RT for 2h. The mixture was concentrated under vacuum and purified on silica gel (hexanes/EtOAc,
30%) to give the title compound (350 mg, 50 % two steps) as a yellow solid: LC-MS
(ES) m/z = 535 (M+H)+.
d) 1 ,1-dimethylethyl {2-[({4-bromo-5-[1-(phenylsulfonyl)-1H-pyrrolo[2,3-ό]pyridin-4- yl]-2-thienyl}carbonyiχhydroxy)amino]-3-phenylpropyl}carbamate
To a solution of 1 ,1-dimethylethyl {2-[[(4,5-dibromo-2- thienyl)carbonyl](hydroxy)amino]-3-phenylpropyl}carbamate (0.30 g, 0.56 mmol) in dioxane (5 ml_) and H2O (1 mL) was added K2CO3 (0.23g, 1.67 mmole), tetrakistriphenylphosphine Pd(O) (0.032 g, 0.028 mmole), and [i-(phenylsulfonyl)- 1 H-pyrrolo[2,3-/b]pyridin-4-yl]boronic acid (0.204g, 0.62 mmole). The reaction mixture was heated to 70° C in a sealed tube for 2h. The reaction solution was concentrated under vacuum, and purified on silica gel (hexanes/EtOAc, 3:1) to give the title compound (0.29 g, 72%) as a yellow solid: LC-MS (ES) m/z = 712 (M+H)+.
e) Λ/-/2-amino-1 -(phenylmethy!)ethyl]-4-bromo-Λ/-hydroxy-5-(1 H-pyrrolo[2,3- 6]pyridin-4-yl)-2-thiophenecarboxamide
To a solution of 1 ,1-dimethylethyl {2-[({4-bromo-5-[1-(phenylsulfonyl)-1 H- pyrrolo[2,3-b]pyridin-4-yl]-2-thienyl}carbonyl)(hydroxy)amino]-3- phenylpropyl}carbamate
(0.12 g, 0.17mmole) in MeOH (3 mL) was added 6N NaOH (2.0 mL). After 0.5 h at RT, the solvent was removed, and the reaction mixture was extracted with DCM, dried over Na2SO4, and concentrated to give a crude product, which was used directly in the next step.
The solid material from above was dissolved in CH2CI2 (2 mL) and to the solution was added TFA (2 mL). After 10 min, the reaction solution was concentrated, and purified on reverse-phase HPLC (C18 column: H2O/CH3CN gradient) to give the title compound as a yellow solid (61 mg, 51%) as a 10:1 isomer mixture : LC-MS (ES) m/z = 472 (M+H)+. 1 H NMR (d4-MeOH, 400 MHz) of major isomer: δ 8.40 (br s, 1 H), 7.94 (s, 1 H), 7.65 (d, 2.9 Hz, 1 H), 7.53 (d, J = 6.4 Hz, 1 H), 7.35-7.21 (m, 6H), 6.77 (d, J = 2.9 Hz, 1 H), 5.16 (m, 1 H), 3.39 (dd, J = 11.3, 13.4 Hz, 1 H), 3.180-3.11 (m, 2H), and 2.97 (dd, J = 6.3, 14.0 Hz, 1 H).
Example 116
Preparation of N-[2-amino-1-(phenylmethvnethyll-A/-hvdroxy-4-f1/-/-Dyrrolof2.3- bipyridin-4-vO-2-thiODhenecarboxamide
The title compound was prepared as a brown solid according to Example 115, except substituting 4-bromo-2-thiophenecarboxylic acid (0.23 g, 1.12 mmole) for 4,5-dibromo-2-thiophenecarboxylic acid: LC-MS (ES) m/z = 393. (M+H)+.1H NMR (d4-MeOH, 400 MHz) δ 8.85 (d, J = 8.6 Hz, 1 H), 8.45 (br s, 1 H), 8.24 (s, 1 H), 8.03 (d, J = 1 .5 Hz, 1 H), 7.96-7.92 (m, 1 H), 7.60-7.56 (m, 1 H), 7.36-7.32 (m, 2H), 7.29-7.25 (m, 2H), 7.22-7.18 (m, 1 H), 5.19 (m, 1 H), 3.40 (dd, J = 10.8, 13.5 Hz, 1 H), 3.19-3.13 (m, 2H), and 2.96 (dd, J = 7.0, 13.9, 1 H).
Example 117
Preparation of N42-amino-1-(phenylmethyl')ethyll-Λ/-hvdroxy-3-(1/-/-pyrrolo[2,3- frlpyridin-3-vO-2-thiophenecarboxamide
The title compound was prepared as a brown solid according to Example 115, except substituting 4-bromo-2-thiophenecarboxylic acid (0.23 g, 1.12 mmole) for 4,5-dibromo-2-thiophenecarboxylic acid, and substituting 1-(phenylsulfonyl)-3- (4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1/-/-pyrroIo[2,3-b]pyridine (0.2 g, 0.52 mmole) for 1-(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H- pyrrolo[2,3-b]ρyridine: LC-MS (ES) m/z = 393 (M+H)+. 1H NMR (Ci4-MeOH, 400 MHz) δ 8.84 (br d, J = 7.3 Hz, 1 H), 8.45 (br d, J = 3.0 Hz, 1 H), 8.24 (s, 1 H), 8.04 (d, 7.5, 1 H), 7.96-7.93 (m, 1 H), 7.60-7.56 (m, 1 H), 7.35 -7.18 (m, 5H), 5.20 (m, 1 H), 3.40 (dd, J = 11.0, 14.0 Hz, 1 H), 3.19-3.13 (m, 2H), and 2.96 (dd, J = 7.0, 13.5 Hz, 1 H).
Example 118
Preparation of N-r2-amino-1-(phenylmethyl)ethyl1-/S/-Uphenylrnethyl)oxyl-4-(1 H- pyrrolof2.3-άlpyridin-4-yl')-2-thiophenecarboxamide
The title compound was prepared as a brown solid according to Example 1 16, except substituting 1 ,1-dimethylethyl (3-phenyl-2- {[(phenylmethyl)oxy]aminα}propyl)carbarnate (0.15 g, 0.42 mmole) for 1,1- dimethylethyl [2-(hydroxyamino)-3-phenylpropyl]carbamate. LC-MS (ES) m/z = 483. (M+H)+. 1H NMR (d4-MeOH, 400 MHz) 58.54 (d, J = 1.5 Hz, 1H), 8.39 (d, J = 5.6 Hz1 1 H), 8.25 (d, J = 1.5 Hz, 1H), 7.70 (d, J =3.8 Hz, 1H), 7.53 (d, J = 6.0 Hz, 1 H), 7.40- 7.36 (m, 5H), 7.34-7.16 (m, 5H), 6.93 (d, J = 3.5 Hz, 1 H), 4.95 (s, 2H), 4.88 (m, 1 H), 3.60 (dd, J = 9.2, 12.8 Hz, 1 H), 3.43-3.35 (m, 2H), and 3.15 (dd, J = 6.0, 14.0 Hz, 1 H).
Example 119
Preparation of N-r2-amino-1-(phenylmethyl')ethyll-Λ/'-hvdroxy-5-(1 /-/-pyrrolor2.3- blpyridin-4-ylV2-thiophenecarboximidamide
a) 5-bromo-2-thiophenecarbaldehyde oxime (isomers A and B)
A (30%) B (60%)
To a mixture of 5-bromo-2-thiophenecarbaldehyde (3.82 g, 20 mmol), hydroxylammonium chloride (4.14 g, 60 mmol) in EtOH (10 ml_) and water (20 ml_) was added NaOAc (6.5 g, 80 mmol). After being stirred for 30 min, the mixture was concentrated, and purified using flash chromatography (silica gel, hexanes/EtOAc, 1 : 1 ) to give separable isomers A (1.2 g, 30%) and isomer B (2.41 g, 60%) respectively, as tan solids. Relative geometry unknown, but assigned as written. LCMS (ES) m/z 207 (M+H)+.
b) 1,1-dimethylethyl (2-{[(5-bromo-2-thienyl)(hydroxyamino)methylidene]amino}-3- phenylpropyl)carbamate (from Isomer B)
To a solution of isomer B (730 mg, 3.54 mmol) in DMF (5 ml_) at RT was added N-chlorosuccinamide (478 mg, 3.6 mmol). The resulting mixture was heated at 70 0C for 30 min, and cooled to RT. To the above mixture was added 1 ,1- dimethylethyl (2-amino-3-phenylpropyl)carbamate (1.15 g, 4.6 mmol). After being stirred for 30 min, the mixture was concentrated, and purified using flash chromatography (silica gel, hexanes/EtOAc, 2:1 ) to give the title compound (300 mg, 20 % two steps) as a tan solid. LCMS (ES) m/z 455(M+H)\
cJ Λ/-[2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-(phenylmethyl)ethyl]-/V-hydroxy- 5-[1-(phenylsulfonyl)-1/-/-pyrrolo[2,3-ό]pyridin-4-yl]-2-thiophenecarboximidamide (from Isomer B)
To a solution of 1,1-dimethylethyl (2-{[(5-bromo-2- thienyl)(hydroxyamino)methylidene]amino}-3-phenylpropyl)carbamate_(from Isomer
B) (0.3 g, 0.66 mmole) in dioxane (10 ml_) and H2O (2 ml_) was added K2CO3 (0.27 g, 1.95mmole), tetrakistriphenylphosphine Pd(O) (0.075 g, 0.06 mmole), and 1- (phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1/-/-pyrroIo[2,3- 6]pyridine (0.26 g, 0.68 mmole). The reaction mixture was heated to 70° C in a sealed tube for 2 h. The reaction solution was concentrated under vacuum, and purified on silica gel (hexanes/EtOAc, 2:1 to 1 :1 ) to give the title compound (340 m g, 82 %) as a brown solid: LC-MS (ES) m/z = 632 (M+ H)+.
d) Λ/-[2-amino-1 ~(prιeny)methyl)ethyl]-N'-hydroxy-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboximidamide
To a solution of Λ/-[2-(1,3-dioxo-1 ,3-dihydro-2/-/-isoindol-2-yl)-1- (phenylmethyl)ethyl]-Λ/'-hydroxy-5-[1-(phenylsulfonyl)-1H-pyrrolo[2,3-5]pyridin-4-yl]- 2-thiophenecarboximidamide (from Isomer B) (0.077g, 0.12 mmole) in MeOH (2 ml_) was added 6N NaOH (1.0 ml_). After 0.5 h at RT, the solvent was removed, and the reaction mixture was extracted with DCM, and concentrated to give a crude product, which was used directly in the next step.
The solid material from above was dissolved in CH2CI2 (2 ml_) and to the solution was added TFA (1 ml_). After 30 min, the reaction solution was concentrated, and purified on reverse-phase HPLC (C18 column: H2O/CH3CN gradient) to give the title compound as a yellow solid (26 mg, 35% over two steps): LC-MS (ES) m/z = 392 (M+H)+. 1H NMR (d4-MeOH, 400 MHz) δ 8.34 (d, J = 5.8 Hz, 1H), 7.84 (d, J = 3.8 Hz, 1H), 7.71 (d, J = 3.5 Hz, 1H), 7.60 (d, J = 5.6 Hz, 1H), 62453
7.31-7.30 (m, 3H), 7.20-7.18 (m, 2H), 7.07-7.04 (m, 2H), 4.12 (m, 1 H), 3.25-3.24 (m, 2H), and 2.96-2.82 (m, 2H).
Example 120
Preparation of Λ/-r2-amino-1-(phenylmethvπethyl1-Λ/Miydroxy-5-(1 H-pyrrolof2,3- blpyridin-4-ylV2-thiophenecarboximidamide (from oxime isomer A)
The title compound was prepared according to the procedure of Example 119, except substituting 5-bromo-2-thiophenecarbaldehyde oxime isomer A (0.73 g, 0.54 mmole) for isomer B. LC-MS (ES) m/z = 392 (M+H)+.1H NMR (d4-MeOH, 400 MHz) δ 8.34 (d, J = 5.8 Hz, 1 H), 7.84 (d, J = 3.8 Hz, 1 H), 7.71 (d, J = 3.5 Hz, 1 H), 7.60 (d, J = 5.6 Hz, 1H), 7.31-7.30 (m, 3H), 7.20-7.18 (m, 2H), 7.07-7.04 (m, 2H), 4.12 (m, 1 H), 3.25-3.24 (m, 2H), and 2.96-2.82 (m, 2H).
Example 121
Preparation of 3-amino-2-(phenylmethyl)-Λ/-r5-(3-pyridinyl)-4-(1 H-pyrrolor2,3- folpyridin-3-vO-2-thienyllpropanamide
a) [4-(methyloxy)phenyl]methyl 4,5-dibromo-2-thiophenecarboxylate
To a mixture of 4,5-dibromo-2-thiophenecarboxylic acid (5.0 g, 17.4 mmol) and DCC (4.38 g, 22.5 mmol) was added [4-(methyloxy)phenyl]methanol (2.86 mL, 22.5 mmol) dropwise. After stirring at RT under N2for 12 h, the reaction solution was concentrated under vacuum and purified on silica (hexanes/EtOAc, 5:95) to afford the title compound (6.8 g, 96%) as a white solid.
b) [4-(methyloxy)phenyl]methyl 4-bromo-5-(3-pyridinyl)-2-thiophenecarboxylate
To a solution of [4~(methyloxy)phenyl]methyl 4,5-dibromo-2- thiophenecarboxylate (0.5 g, 1.2 mmole) in dioxane (5 mL) and H2O (1 mL) was added 3-pyridinylboronic acid (0.24 g, 1.9 mmole), Pd(PPh3)4 (130mg, 0.11 mmole) and K2CO3 (0.54 g, 3.9 mmole). After heating to 70 0C for 10h under N2, the reaction solution was concentrated under vacuum and purified on silica (hexanes/EtOAc, 40:60) to afford the title compound (0.403 g, 81%) as a white foam: LC-MS (ES) m/z = 405 (M+H)+.
c) [4-(methyloxy)phenyl]methyl 4-[1-(phenylsulfonyl)-1 /-/-pyrrolo[2,3-fa]pyridin-3-yl]- 5-(3-pyridinyl)-2-thiophenecarboxylate
To a solution of [4-(methyloxy)phenyl]methyl 4-bromo-5-(3-pyridinyl)-2- thiophenecarboxylate (0.5 g, 1.2 mmole) in dioxane (10 mL) and H2O (2 mL) was added 1 -(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H- pyrrolo[2,3-b]pyridine (0.68 g, 1.76 mmole), Pd(PPh3)4 (130 mg, 0.11 mmole) and K2CO3 (0.50 g, 3.6 mmole). After heating to 700C for 10h under N2, the reaction solution was concentrated under vacuum and purified on silica (hexanes/EtOAc, 1 :2) to afford the title compound (0.52 g, 72%) as a light yellow solid: LC-MS (ES) m/z = 582 (M +H)+. d) 1 ,1-dimethylethyl [4-[1-(phenylsulfonyl)-1H-pyrrolo[2,3-b]pyridin-3-yl]-5-(3- pyridinyl)-2-thienyl]carbamate
To a solution of [4-(methyloxy)phenyl]methyl 4-[1-(phenylsulfonyl)-1 H- pyrrolo[2,3-jb]pyridin-3-yl]-5-(3-pyridinyl)-2-thiophenecarboxylate (1.2 g, 2.1 mmole) in CH2CI2 (15 ml_) was added TFA (2 mL). After stirring at RT for 1 hour, the reaction solution was concentrated under vacuum to give 4-[1-(ρhenylsulfonyl)-1H- pyrrolo[2,3-jb]pyridin-3-yl]-5-(3-pyridinyl)-2-thiophenecarboxylic acid as a red solid which was used directly in the next step: LC-MS (ES) m/z = 463 (M+H)+. To a mixture of the above acid in t-BuOH (15 mL) was added DPPA (2.5 mmoles, 0.55 mL) and triethyl amine (14.4 mmole, 2.0 mL). The mixture was heated to 85 0C for 10 h under an atmosphere of N2. After cooling to RT, the reaction was concentrated in vacuo. Flash chromatography (silica gel, hexanes/EtOAc, 4:1) gave the title compound (0.69 g, 63%) as a yellow foam. LCMS (ES) m/z 533 (M+H)+.
e) 1,1-dimethylethyl [(4Z,6Z)-4-ethenyl-2-({[4-[1-(phenylsulfonyl)-1H-pyrrolo[2,3- 5]pyridin-3-yl]-5-(3-pyridinyl)-2-thienyl]amino}carbonyl)-4,6-octadien-1-yl]carbamate
To a solution of 1,1-dimethylethyl [4-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3- 6]pyridin-3-yl]-5-(3-pyridinyl)-2-thienyl]carbamate (0.3 g, 0.56 mmole) in CH2CI2 (5 mL) was added TFA (2 mL). After stirring at RT for 1 hour, the reaction solution was concentrated under vacuum to give [4-[1-(phenylsulfonyl)-1H-pyrrolo[2,3-b]pyridin- 3-yl]-5-(3-pyridinyl)-2-thienyl]amine as a red solid which was used directly in the next step: LC-MS (ES) m/z = 433 (M+H)+. The amine TFA salt from above (0.5 mmole) was dissolved in DCM (5 ml_) and to the solution was added PyBrop (0.417 g, 0.89 mmole), (JPr)2NEt (1.74 mL, 10.0 mmole) and 3-({[(1 ,1-dimethylethyl)oxy]carbonyl}amino)-2- (phenylmethyl)propanoic acid (0.25 g, 0.89 mmole). After stirring at RT for 12h, the reaction solution was concentrated under vacuum and purified on silica
(hexanes/EtOAc, 1 :2) to afford the title compound (0.19 g, 49% for two steps) as an off-white solid: LC-MS (ES) m/z = 694 (M-HH)+.
f) 3-amino-2-(phenylmethyl)-Λ/-[5-(3-pyridinyl)-4-(1H-pyrrolo[2,3-/b]pyridin-3-yl)-2- thienyl]propanamide
To a solution of 1 ,1-dimethylethyl [(4Z,6Z)-4-ethenyl-2-({[4-[1- (phenylsulfonyl)-1 /-/-pyrrolo[2,3-6lpyridin-3-yl]-5-(3-pyridinyl)-2- thienyl]amino}carbonyl)-4,6-octadien-1-yl]carbamate (0.170 g, 0.25 mmole) in MeOH (5 mL) was added 6N NaOH (2.0 mL). After 0.5 h at RT, the solvent was removed, and the reaction mixture was extracted with DCM and concentrated to give a crude product which was used directly in the next step.
The solid material from above was dissolved in CH2CI2 (2 mL) and to the solution was added TFA (1 mL). After 10 min, the reaction solution was concentrated, and purified on reverse-phase HPLC (C18 column: H2O/CH3CN gradient) to give the title compound as a yellow solid (55 mg, 33% over two steps): LC-MS (ES) m/z = 454 (M+H)+.1H NMR (d4-MeOH, 400 MHz) δ 8.65 (br s, 1 H), 8.57 (br s, 1 H), 8.36-8.34 (m, 2H), 7.94 (d, J = 7.8 Hz, 1 H), 7.81 (m, 1 H), 7.62 (s, 1 H), 7.34-7.23 (m, 6H), 6.91 (s, 1 H), 3.39 (dd, J = 8.6, 12.9 Hz, 1 H), 3.23 (m, 1 H), 3.18-3.11 (m, 2H), and 3.00 (dd, J = 6.8, 13.4 Hz, 1H).
Example 122
Preparation of 3-amino-Λ/-r5-(1 ,3-oxazol-2-ylV4-(1H-pyrrolor2.3-foiPyridin-3-vh-2- thienyll-2-(phenylmethvnpropanamide
a) [4-(methyloxy)phenyl]methyl 4-bromo-5-(1 ,3-oxazol-2-yl)-2-thiophenecarboxylate
To a solution of [4-(methyloxy)phenyl]methyl 4,5-dibromo-2- thiophenecarboxylate
(1.2 g, 0.3 mmole) in dioxane (15 ml_) was added 2-(tributylstannanyl)-1,3-oxazole (1.4 g, 3.9 mmole), and Pd(PPh3)4 (277mg, 0.24 mmole). After heating to 100 0C for 72h under N2, the reaction solution was concentrated under vacuum and purified on silica (hexanes/EtOAc, 2:1) to afford the title compound (0.35 g, 30%) as a white solid: LC-MS (ES) m/z = 395 (M+H)\
b) [4-(methyloxy)pheπyl]methyl 5-(1 ,3-oxazo!-2-yl)-4-[1-(phenylsulfonyl)-1 H- pyrrolo[2,3-&]pyridin-3-yl]-2-thiophenecarboxylate
To a solution of [4-(methyloxy)phenyl]methyl 4-bromo-5-(1 ,3-oxazol-2-yl)-2- thiophenecarboxylate (0.35 g, 0.89 mmole) in dioxane (10 ml_) and H2O (2 ml_) was added 1 -(phenylsulfonyl)-3-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H- pyrrolo[2,3-b]pyridine (0.4 g, 1.04 mmole), Pd(PPh3)4 (115 mg, 0.1 mmole) and K2CO3 (1.24 g, 7.2 mmole). After heating to 7O0C for 1Oh under N2, the reaction solution was concentrated under vacuum and purified on silica (hexanes/EtOAc, 1 :2) to afford the title compound (0.42 g, 84%) as a light yellow solid: LC-MS (ES) m/z = 572 (M+H)+. c) 1 ,1-dimethylethyl {5-(1 ,3~oxazol-2-yl)-4-[1-(phenylsulfonyl)-1 H-pyrroio[2,3- b]pyridin-3-yl]-2-thienyl}carbamate
To a solution of [4-(methyloxy)phenyl]methyl 5-(1,3-oxazol-2-yl)-4-[1- (phenylsulfonyl)-1H-pyrrolo[2,3-6]pyridin-3-yl]-2-thiophenecarboxylate (0.55 g, 0.96 mmole) in CH2CI2 (10 ml_) was added TFA (2 ml_). After stirring at RT for 1 hour, the reaction solution was concentrated under vacuum to give 5-(1 ,3-oxazol-2-yl)-4-[1- (phenylsulfonyO-IH-pyrrolo^.S-όlpyridin-S-yl^-thiophenecarboxylic acid as a red solid which was used directly in the next step: LC-MS (ES) m/z = 452 (M+H)+.
To a mixture of the above acid in t-BuOH (10 mL) was added DPPA (1.16 mmoles, 0.25 mL) and triethyl amine (14.4 mmole, 2.0 mL). The mixture was heated to 85 0C for 10 h under an atmosphere of N2. After cooling to RT, the reaction was concentrated in vacuo. Flash chromatography (silica gel, hexanes/EtOAc, 4:1 ) gave the title compound (0.33 g, 65% over two steps) as a yellow foam. LCMS (ES) m/z 523 (M+H)+.
d) 1 , 1-dlmethylθthyl {(4Z,6Z)-4-ethenyl-2-[({5-(1 ,3-oxazol-2-yl)-4-[1-(phenylsulfonyl)- 1 H-pyrrolo[2,3-b]pyridin-3-yl]-2-thienyl}amino)carbonyl]-4,6-octadien-1-yl}carbamate
To a solution of 1,1-dimethylethyl {(4Z,62)-4-ethenyl-2-[({5-(1,3-oxazol-2-yl)- 4-[1-(phenylsulfonyl)-1H-pyrrolo[2,3-b]pyridin-3-yl]-2-thienyl}amino)carbonyl]-4,6- octadien-1~yl}carbamate (0.15 g, 0.28 mmole) in CH2Cl2 (5 mL) was added TFA (2 mL). After stirring at RT for 1 hour, the reaction solution was concentrated under vacuum to give 5-(1 ,3-oxazol-2-yl)-4-[1 -(phenylsulfonyl)-i H-pyrrolo[2,3-<b]pyridin~3-yl]-2- thiophenamine as a red solid which was used directly in the next step: LC-MS (ES) m/z = 423 (M+H)+.
The amine TFA salt from above (0.28 mmole) was dissolved in DCM (5 mL) and to the solution was added PyBrop (0.260 g, 0.56 mmole), (JPr)2NEt (5 mL, 28 mmole) and 3~({[(1 , 1-dimethylethyl)oxy]carbonyl}amino)-2-(phenylmethyl)propanoic acid (0.16 g, 0.56 mmole). After stirring at RT for 12h, the reaction solution was concentrated under vacuum and purified on silica (hexanes/EtOAc, 1 :2) to afford the title compound (0.078 g, 40% for two steps) as an off-white solid: LC-MS (ES) m/z = 684 (M+H)+.
f) 3-amino-Λ/-[5-(1 ,3-oxazol-2-yl)-4-(1 W-pyrrolo[2,3-b]pyridin-3-yl)-2-thienyl]-2- (phenylmethyl)propanamide
To a solution of 1 ,1-dimethylethyl {(4Z,6Z)-4-ethenyl-2-[({5-(1,3-oxazol-2-yl)-
4-[1-(phenylsulfonyl)-1H-pyrrolo[2,3-b]pyridin-3-yl]-2-thienyl}amino)carbonyl]-4,6- octadien-1-yi}carbamate (0.065g, 0.095 mmole) in MeOH (2 mL) was added 6N NaOH (1.0 mL). After 0.5 h at RT, the solvent was removed, and the reaction mixture was extracted with DCM, and concentrated to give a crude product which was used directly in the next step.
The solid material from above was dissolved in CH2Cl2 (2 mL) and to the solution was added TFA (1 mL). After 10 min, the reaction solution was concentrated, and purified on reverse-phase HPLC (C18 column: H2O/CH3CN gradient) to give the title compound as a yellow solid (32 mg, 51% over two steps): LC-MS (ES) m/z = 444 (M+H)+. 1H NMR (d4-MeOH, 400 MHz) δ 8.44 (br s, J = 5.0 Hz, 1 H), 8.26 (dd, J = 1.0, 7.8 Hz, 1 H), 7.94 (s, 1 H), 7.74 (s, 1 H), 7.48 (m, 1 H), 7.35 -7.23 (m, 5H), 7.15 (s, 1 H), 6.87 (s, 1 H), 3.39 (dd, J = 8.3, 12.6 Hz, 1 H), 3.25-3.09 (m, 3H) and 2.98 (dd, J = 6.6, 12.9 Hz, 1 H).
Example 123
Preparation of N-{2-amino-1-f2-(methyloxy)phenyl1ethyl}-5-(1 H-pyrrolor2.3-b1pyridin- 4-vπ-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 15, except substituting 1,1-dimethylethyl {2-amino-2-[2- (methyloxy)phenyl]ethyl}carbamate (40 mg, 0.25 mmol) [prepared from 2- (methyloxy)benzaldehyde and following preparation 9] for 1 ,1-dimethylethyl (3- amino-3-phenylpropyl)carbamate: LC-MS (ES) m/z 393 (M+H)+, 1H NMR (400 MHz, d4-MeOH) δ ppm 3.40 - 3.44 (m, 2 H) 3.97 (s, 3 H) 5.75 (dd, J=8.34, 6.06 Hz, 1 H) 6.93 (d, J=3.54 Hz, 1 H) 7.04 (t, J=7.58 Hz, 1 H) 7.11 (d, J=7.83 Hz, 1 H) 7.37 - 7.44 (m, 3 H) 7.55 (d, J=3.54 Hz, 1 H) 7.79 (d, J=3.79 Hz, 1 H) 7.93 (d, J=4.04 Hz, 1 H) 8.26 (d, J=5.31 Hz, 1 H).
Example 124
Preparation of N~f2-amino-1-[3-(methyloxy)phenvnethyl}-5-(1 H-pyrrolor2,3-blpyridin- 4-vO-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 15, except substituting 1,1-dimethylethyl {2-amino-2-[3- (methyloxy)phenyl]ethyl}carbamate (84 mg, 0.32 mmol) [prepared from 3- (methyloxy)benzaldehyde and following preparation 9] for 1,1-dimethylethyl (3- amino-3-phenylpropyl)carbamate: LC-MS (ES) m/z 393 (M+H)+, 1H NMR (400 MHz, d4-MeOH) δ ppm 3.16 - 3.18 (m, 2 H) 3.83 (s, 3 H) 5.20 (dd, J=7.96, 6.19 Hz, 1 H) 6.87 - 6.91 (m, 1 H) 6.93 (d, J=3.54 Hz, 1 H) 7.01 - 7.04 (m, 2 H) 7.32 (t, J=8.21 Hz, 1 H) 7.42 (d, J=5.05 Hz, 1 H) 7.54 (d, J=3.79 Hz, 1 H) 7.77 (d, J=4.04 Hz, 1 H) 7.93 (d, J=4.04 Hz, 1 H) 8.24 (d, J=5.05 Hz, 1 H).
Example 125
Preparation of N--f2-amino-1-f4-(methyloxy)phenvπethyl}-5-(1 H-pyrrolor2,3-blpyridin- 4-ylV2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 15, except substituting 1 ,1-dimethylethyl {2-amino-2-[4- (methyloxy)phenyl]ethyl}carbamate (84 mg, 0.32 mmol) [prepared from 4- (methyloxy)benzaldehyde and following preparation 9] for 1 ,1-dimethylethyl (3- amino-3-pheny]propy!)carbamate: LC-MS (ES) m/z 393 (M+H)\ 1H NMR (400 MHz, d4-MeOH) δ ppm 3.38 - 3.48 (m, 2 H) 3.82 (s, 3 H) 5.39 (dd, J=9.47, 5.43 Hz, 1 H) 6.93 (d, J=3.54 Hz, 1 H) 6.98 - 7.02 (m, 2 H) 7.40 - 7.44 (m, 3 H) 7.55 (d, J=3.54 Hz, 1 H) 7.77 (d, J=4.04 Hz, 1 H) 7.90 (d, J=4.04 Hz, 1 H) 8.25 (d, J=5.05 Hz, 1 H).
Example 126
Preparation of N-f2-amino-1-[2-(methyloxy)phenyllethyl>-4-bromo-5-(1 H-pyrrolof2,3- blpyridin-4-vO-2-thiophenecarboxaιτιide
The title compound was prepared as a yellow solid according to Example 15, except substituting 1 , 1-dimethylethyl {2-amino-2-[2- (methyloxy)phenyl]ethyl}carbamate (200 mg, 0.43 mmol) [prepared from 2- (methyloxy)benzaldehyde and following preparation 9] for 1 ,1-dimethylethyl (3- amino-3-phenylpropyl)carbamate and 4,5-dibromo-2-thiophenecarboxylic acid (2.07 g, 5.4 mmol) for 5-bromo-2-thiophenecarboxylic acid: LC-MS (ES) m/z 472 (M+H)+, 1H NMR (400 MHz, d4-MeOH) δ ppm 3.24 - 3.41 (m, 2 H) 3.79 - 3.83 (m, 3 H) 5.31 (del, J=9.35, 5.56 Hz, 1 H) 6.62 (d, J=3.79 Hz, 1 H) 6.96 - 7.01 (m, 2 H) 7.35 (d, J=5.05 Hz, 1 H) 7.37 - 7.42 (m, 2 H) 7.52 (d, J=3.54 Hz, 1 H) 7.94 (s, 1 H) 8.30 (d, J=5.05 Hz, 1 H).
Example 127
Preparation of N-l2-amino-1-F3-(methyloxy)phenyriethyl}-4-bromo-5-(1 H-pyrrolor2,3- b1pyridine-4-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 15, except substituting 1,1-dimethylethyl {2-amino-2-[3- (methyloxy)phenyl]ethyl}carbamate (159 mg, 0.60 mmol) [prepared from 3- (methyloxy)benzaldehyde and following preparation 9] for 1 ,1-dimethylethyl (3- amino-3-phenylpropyl)carbamate and 4,5-dibromo-2-thiophenecarboxylic acid (2.07 g, 5.4 mmol) for 5-bromo-2-thiophenecarboxylic acid: LC-MS (ES) m/z 472 (M+H)+, 1H NMR (400 MHz, d4-MeOH) δ ppm 3.07 - 3.14 (m, 2 H) 3.83 (s, 3 H) 5.13 (dd, J=7.83, 6.32 Hz, 1 H) 6.62 (d, J=3.54 Hz, 1 H) 6.86 - 6.91 (m, 1 H) 6.99 - 7.03 (m, 2 H) 7.29 - 7.37 (m, 2 H) 7.51 (d, J=3.54 Hz, 1 H) 7.97 (s, 1 H) 8.30 (d, J=5.05 Hz, 1 H).
Example 128
Preparation of N-{2-amino-1-r4-(methyloxy1phenvπethyl>-4-bromo-5-π H-pyrrolor2.3- b1pyridin-4-v0-2-thiophenecarbox3mide
The title compound was prepared as a yellow solid according to Example 15, except substituting 1,1-dimethylethyl {2-amino-2-[4- (methyloxy)phenyl]ethyl}carbamate (118 mg, 0.44 mmol) [prepared from 4- (methyioxy)benzaldehyde and following preparation 9] for 1 ,1-dimethylethyI (3- amino-3-phenylpropyl)carbamate and 4,5-dibromo-2-thiopheneGarboxylic acid (2.07 g, 5.4 mmol) for δ-bromo^-thiophenecarboxylic acid: LC-MS (ES) m/z 472 (M+H)+, 1H NMR (400 MHz, d4-MeOH) δ ppm 3.39 - 3.44 (m, 2 H) 3.96 (s, 3 H) 5.74 (t, J=7.07 Hz, 1 H) 6.66 (d, J=3.54 Hz, 1 H) 7.01 - 7.06 (m, 1 H) 7.09 (d, J=7.58 Hz, 1 H) 7.35 - 7.43 (m, 4 H) 7.55 (d, J=3.54 Hz, 1 H) 7.99 (s, 1 H) 8.34 (s, 1 H).
Example 129
Preparation of N-{(1 RV2-amino-1-r(4-fluorophenyl)methvnethyl>-4-bromo-5-(1 H- pyrrolof2,3-blPVridin-4-vO-2-thiophenecarboxamide
The title compound was prepared as a light yellow solid according to the procedure of Example 43, except substituting 2-[(2/?)-2-amino-3-(4- fluorophenyl)propyl]-1 f/-isoindole-1 ,3(2H)-dione (0.45 g, 1.3 mmol) for 2-[(2S)-2- amino-3-phenylproρyl]-1H-isoindole-1,3(2H)-dione: LC-MS (ES) m/z 473 (M+Hf, 1H NMR (400 MHz, d4-MeOH) δ ppm 2.99 (td, J=14.08, 8.21 Hz, 2H) 3.18 - 3.29 (m, 2 H) 4.55 (td, J=6.19, 3.54 Hz, 1 H) 6.75 (d, J=3.54 Hz, 1 H) 7.01 - 7.09 (m, 2 H) 7.28 - 7.36 (m, 2 H) 7.54 (d, J=5.56 Hz, 1 H) 7.65 (d, J=3.79 Hz, 1 H) 7.83 (s, 1 H) 8.39 (d, J=5.31 Hz, 1 H).
Example 130
Preparation of N-{(1 SV2-amino-1-r(4-fluorophenyl)methyllethylV4-bromo-5-(1 H- pyrrolor2,3-biρyridin-4-vπ-2-thiophenecarboxarnide
The title compound was prepared as a light yellow solid according to the procedure of Example 43, except substituting 2-[(2S)-2-amino-3-(4- fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (0.25 g, 0.7mmol)[prepared from N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine according to preparation 7] for 2-[(2S)-2-amino-3-phenylpropyl]-1H-isoindole-1,3(2H)-dione: LC- MS (ES) m/z 474 (M+H)+, 1H NMR (400 MHz, d4-MeOH) δ ppm 2.99 (td, J=13.89, 8.08 Hz, 2 H) 3.12 - 3.23 (m, 2 H) 4.50 (ddd, J=6.00, 3.28, 3.09 Hz, 1 H) 6.60 (t, J=3.54 Hz1 1 H) 7.03 - 7.09 (m, 2 H) 7.33 (td, J=5.94, 2.02 Hz, 3 H) 7.41 - 7.46 (m, 1 H) 7.52 (d, J=3.79 Hz, 1 H) 7.83 - 7.88 (m, 1 H) 8.28 - 8.32 (m, 1 H).
Example 131
Preparation of N-ri-(aminomethvO-3-phenylpropyπ-4-bromo-5-(1 H-pyrrolo[Z3- blpyridin-4-ylV2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 15, except substituting 1,1-dimethylethyl (2-amino-4-phenylbutyl)carbamate (222 mg, 0.84 mmol) [prepared from 2-(2-phenylethyl)oxirane and following preparation 10] for 1 ,1-dimethylethyl (3-amino-3-phenylpropyl)carbamate and 4,5-dibromo-2- thiophenecarboxylic acid (2.07 g, 5.4 mmol) for 5-bromo-2-thiophenecarboxylic acid: LC-MS (ES) m/z 470 (M+H)+, 1H NMR (400 MHz, d4-MeOH) δ ppm 1.97 - 2.09 (m, J=8.91 , 8.56, 8.56, 5.56 Hz, 2 H) 2.73 - 2.84 (m, 2 H) 3.08 (dd, J=13.01 , 9.73 Hz, 1 H) 3.15 - 3.24 (m, 1 H) 4.32 (ddd, J=9.35, 5.05, 4.80 Hz, 1 H) 6.64 (d, J=3.54 Hz, 1 H) 7.15 - 7.21 (m, 1 H) 7.22 - 7.30 (m, 4 H) 7.37 (d, J=5.05 Hz, 1 H) 7.54 (d, J=3.54 Hz, 1 H) 7.85 (s, 1 H) 8.32 (s, 1 H).
Example 132
Preparation of N-((1 S)-2-amino-1-{r4-(methyloxy)phenyllmethyl>ethyl')-4-bromo-5-
(1 H-pyrrolo[2.3-bipyridin-4-ylV2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example
43, except substituting 2-{(2S)-2-amino-3-[4-(methyloxy)phenyl]propyl}-1H- isoindole-1 ,3(2H)-dione (476 mg, 1.37 mmol) [prepared from 1 ,1-dimethylethyl ((1 S)-2-hydroxy-1-{[4-(methyloxy)phenyl]methyl}ethyl)carbamate and following preparation 11] for 2-[(2S)-2-amino-3-phenyipropyl]~1 H-isoindole-1 ,3(2H)-dione: LC-MS (ES) m/z 486 (M+H)\ 1H NMR (400 MHz, d4-MeOH) δ ppm 2.95 (d, J=7.33 Hz, 2 H) 3.13 - 3.25 (m, 2 H) 3.75 (s, 3 H) 4.50 (d, J=5.81 Hz, 1 H) 6.57 - 6.61 (m, 1 H) 6.85 - 6.90 (m, 2 H) 7.21 - 7.26 (m, 2 H) 7.32 (t, J=4.55 Hz, 1 H) 7.51 (t, J=3.16 Hz, 1 H) 7.83 - 7.88 (m, 1 H) 8.26 - 8.31 (m, 1 H).
Example 133
Preparation of N-((1 RV2-amino-1-{r4-(methyloxy')phenyllmethyl>ethylV4-bromo-5- (1 H-pyrrolor2,3-blpyridin-4-vQ-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 43, except substituting 2-{(2F?)-2-amino-3-[4-(methyloxy)phenyl]propyl}-1 H- isoindole-1 ,3(2f/)-dione (368 mg, 1.06 mmol) [prepared from Λ/-{[(1 ,1- dimethylethy!)oxy]carbonyl}-0-mei;hyl-D-tyrosine and following preparation 11] for 2- [(2S)-2-amino-3-phenylpropyl]-1 H-isoindole-1 ,3(2H)-dione: LC-MS (ES) m/z 486 (MH-H)+, 1H NMR (400 MHz, d4-MeOH) δ ppm 2.93 (d, J=7.83 Hz, 2 H) 3.03 - 3.19 (m, 2 H) 3.77 (s, 3 H) 4.45 (td, J=6.69, 3.54 Hz, 1 H) 6.60 (t, J=2.91 Hz, 1 H) 6.87 - 6.91 (m, 2 H) 7.20 - 7.24 (m, 2 H) 7.33 - 7.36 (m, 1 H) 7.50 - 7.54 (m, 1 H) 7.80 (s, 1 H) 8.28 - 8.32 (m, 1 H).
Example 134
Preparation of N-{(1 SV2-amino-1-r(4-fluorophenvπmethyllethylV5-(1 H-pyrrolor2.3- b1pyridin-4-v0-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 43, except substituting 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole- 1 ,3(2H)-dione (612 mg, 1.83 mmol) [prepared from A/-{[(1,1- dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine and following preparation 11] for 2-[(2S)-2-amino-3-phenylpropyl]-1 /-/-isoindole-1 ,3(2H)-dione and 5-bromo-2- thiophenecarboxylic acid (5.39 g, 14.0 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid : LC-MS (ES) m/z 495 (M+H)+, 1H NMR (400 MHz, d4-MeOH) δ ppm 2.81 - 3.00 (m, 4 H) 4.30 (ddd, J=7.96, 5.18, 2.53 Hz, 1 H) 6.91 (d, J=3.54 Hz, 1 H) 6.98 - 7.04 (m, 2 H) 7.30 (dd, J=8.46, 5.43 Hz, 2 H) 7.39 (d, J=5.31 Hz, 1 H) 7.52 (d, J=3.79 Hz, 1 H) 7.71 (d, J=4.04 Hz, 1 H) 7.77 (d, J=4.04 Hz, 1 H) 8.23 (d, J=5.05 Hz, 1 H).
Example 135
Preparation of N-((1 R)-2-amino-1-{r4-(methyloxy)phenyl1methyl}ethyl)-5-(1 H- pyrrolor2,3-blpyridin-4-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 43, except substituting 2-{(2f?)-2-amino-3-[4-(methyloxy)phenyl]propyl}-1/-/- isoindole-1 ,3(2H)-dione (405 mg, 1.17 mmol) [prepared from /V-{[(1 ,1- dimethylethyl)oxy]carbonyl}-O-methyl-D-tyrosine and following preparation 1 1] for 2- [(2S)-2-amino-3-phenylpropyl]-1 H-isoindole-1 ,3(2H)-dione and 5-bromo-2- thiophenecarboxylic acid (5.39 g, 14.0 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid: LC-MS (ES) m/z 407 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 2.64 - 2.68 (m, 2 H) 2.73 - 2.89 (m, 2 H) 3.70 (s, 3 H) 3.99 (s, 1 H) 6.83 (d, J=6.32 Hz, 2 H) 6.84 (s, 1 H) 7.17 (d, J=8.59 Hz, 2 H) 7.37 (d, J=5.05 Hz, 1 H) 7.63 (d, J=3.54 Hz1 1 H) 7.80 (d, J=4.04 Hz, 1 H) 7.89 (d, J=4.04 Hz, 1 H) 8.26 (d, J=5.05 Hz, 1 H) 11.92 (s, 1 H).
Example 136
Preparation of N-((1 SV2-amino-1-{T4-(methyloxy)phenvnmethyl>ethvn-5-(1 H- Pyrrolor2.3-blpyridin-4-vO-2-thioprienecarboxamide The title compound was prepared as a yellow solid according to Example 43, except substituting 2-{(2S)-2-amino-3-[4-(methyloxy)phenyi]propyl}-1 H- isoindole-1 ,3(2f/)-dione (0.57 g, 1.64 mmol) [prepared from Λ/-{[(1 ,1- dimethylethyl)oxy]carbonyl}-O-methyl-L-tyrosine and following preparation 11] for 2- [(2S)-2-amino-3-phenylpropyl]-1H-isoindole-1,3(2/-/)-dione and 5-bromo-2- thiophenecarboxylic acid (5.39 g, 14.0 mmol) for 4,5-dibromo-2-thiophenecarboxyiic acid: LC-MS (ES) m/z 407 (M+H)+, 1H NMR (400 MHz, d4~MeOH) δ ppm 2.80 - 2.90 (m, 4 H) 3.73 (s, 3 H) 4.23 - 4.31 (m, 1 H) 6.81 - 6.86 (m, 2 H) 6.89 (d, J=3.54 Hz, 1 H) 7.17 - 7.22 (m, 2 H) 7.35 - 7.38 (m, 1 H) 7.51 (t, J=2.91 Hz, 1 H) 7.69 (t, J=3.28 Hz, 1 H) 7.76 (d, J=4.04 Hz, 1 H) 8.21 (d, J=5.05 Hz, 1 H).
Example 137
Preparation of N-Id R)-2-amino-1-r(4-fluorophenvnmethyllethyl}-5-(1 H-pyrrolor2,3- b1pyridin-4-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 43, except substituting 2-[(2f?)-2-amino-3-(4-fluorophenyl)propyl]-1/-/-isoindole- 1 ,3(2H)-dione (624 mg, 1.86 mmol) [prepared from Λ/-{[(1,1- dirnethylethyl)oxy]carbonyl}-4-fluoro-D-phenylalanine and following preparation 11] for 2-[(2S)-2-amino-3-phenylpropyl]-1/-/-isoindole-1 ,3(2H)-dione and 5-bromo-2- thiophenecarboxyiic acid (5.39 g, 14.0 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid: LC-MS (ES) m/z 395 (M+H)+, 1H NMR (400 MHz, d4-MeOH) δ ppm 2.75 - 3.00 (m, 4 H) 4.29 (ddd, J=7.96, 5.18, 2.27 Hz, 1 H) 6.91 (d, J=3.54 Hz, 1 H) 7.01 (ddd, J=8.91, 6.63, 2.15 Hz, 2 H) 7.27 - 7.33 (m, 2 H) 7.39 (d, J=5.31 Hz, 1 H) 7.52 (d, J=3.54 Hz, 1 H) 7.71 (d, J=4.04 Hz, 1 H) 7.77 (d, J=3.79 Hz, 1 H) 8.23 (d, J=5.05 Hz, 1 H).
Example 138
Preparation of N-((1 SV2-amino-1-ir4-(trifluoromethyl)Dhenyllmethyl}ethvπ-4-bromo- 5-(1H-Pyrrolof2,3-bipyridin-4-vO-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 43, except substituting 2-{(2S)-2-amino-3-[4-(trifluoromethyl)phenyl]propyl}-1 H- isoindole-1 ,3(27-/)-dione (1.63 mg, 4.24 mmol) [prepared from Λ/-{[(1 ,1- dimethylethyl)oxy]carbonyl}-4-(trifluoromethyl)-L-phenylalanine and following preparation 11] for 2-[(2S)-2-amino-3-phenylpropyl]-1 H-isoindole-1 ,3(2H)-dione: LC-MS (ES) m/z 524 (M+H)+, 1H NMR (400 MHz, d4-MeOH) δ ppm 2.82 - 3.13 (m, 4 H) 4.32 - 4.40 (m, 1 H) 6.61 (d, J=3.54 Hz, 1 H) 7.34 (d, J=5.05 Hz, 1 H) 7.47 - 7.54 (m, 3 H) 7.61 (d, J=8.08 Hz, 2 H) 7.79 (s, 1 H) 8.30 (d, J=5.05 Hz, 1 H).
Example 139
Preparation of N-((1S)-2-amino-1-{r4-(trifluoromethyl)phenyllmethyl}ethyl)-5-(1 H- PVrrolo[2,3-b1pyridin-4-vO-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 43, except substituting 2-{(2S)-2-amino-3-[4-(trifluoromethyl)phenyl]propyl}-1 /-/- isoindole-1 ,3(2fy)-dione (1.56 mg, 4.05 mmol) [prepared from A/-{[(1,1- dimethylethyl)oxy]carbonyl}-4-(trifluoromethyl)-L-phenylalanine and following preparation 11] for 2-[(2S)-2-amino-3-phenylpropyl]-1/-/-isoindole-1,3(2H)-dione and 5-bromo-2-thiophenecarboxylic acid (5.39 g, 14.0 mmol) for 4,5-dibromo-2- thiophenecarboxylic acid: LC-MS (ES) m/z 445 (M+H)+, 1H NMR (400 MHz, d4- MeOH) δ ppm 2.87 - 3.13 (m, 4 H) 4.39 (ddd, J=8.08, 5.05, 2.78 Hz, 1 H) 6.92 (t, J=3.16 Hz, 1 H) 7.40 (d, J=5.05 Hz, 1 H) 7.50 (d, J=8.08 Hz, 2 H) 7.54 (t, J=2.91 Hz, 1 H) 7.60 (d, J=8.08 Hz, 2 H) 7.72 - 7.75 (m, 1 H) 7.76 - 7.79 (m, 1 H) 8.23 - 8.26 (m, 1 H).
Example 140
Preparation of 3-r(2-aminoethyl)oxy1-N-(phenylmethvD-5-(1 H-pyrrolor2,3-b1PVridin-4~ vπ-2-thiophenecarboxamide
a) methyl 4-bromo-3-hydroxy-5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin-4-yl]-2- thiophenecarboxylate
Methyl 4,5-dibromo-3-hydroxy-2-thiophenecarboxylate (4.43 g, 14.0 mmol), 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3- bjpyridine (5.37 g, 14.0 mmol)[prepared in Preparation 2], Pd(PPh3)4 (808 mg, 0.70 mmol) and K2CO3 (7.7 g, 55.9 mmol) in dioxane (120 mL) and H2O (28 mL) were combined in a sealed tube. After 12h at 70 °C, the reaction contents were partitioned between H2O/ CHCI3- The aqueous phase was washed several times with CHCI3 and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 1 :3 EtOAc/Hexane) affording the title compound (5 g, 72%) as a yellow solid: LC-MS (ES) m/z 494 (M+H)+.
b) methyl 4-bromo-3-{[2-({[(1 ,1-dimethylethyl)oxy]carbonyl}amino)ethyl]oxy}-5-[1- (phenylsulfony])-1H-pyrroio[2,3-b]pyridin-4-yl]-2-thiophenecarboxylate
To a solution of methyl 4-bromo-3-hydroxy-5-[1-(phenylsulfonyl)-1 H- pyrrolo[2,3-b]pyridin-4-yl]-2-thiophenecarboxylate (5 g, 10.13 mmol), 1 ,1- dimethylethyl (2-hydroxyethyl)carbamate (1.6 mL, 10.34 mmol), PPh3 (3.2 g, 12.20 mmol) in THF (50 mL) at 25 0C was added DEAD (1.6 mL, 8.31 mmol) in one portion. After 30 min, the reaction was concentrated and purified via column chromatography (silica, 1 :3 EtOAc/Hexane) affording the title compound (5.0 g, 95%) as a yellow solid: LC-MS (ES) m/z 637 (M+H)+.
c) methyl 3-{[2-({[(1 , 1-dimethylethyl)oxy]carbonyl}amino)ethyl]oxy}-5-[1- (phenylsulfonyl)-1H-pyrrolo[2,3-/3]pyridin-4-yl]-2-thiophenecarboxylate
A solution of methyl 4-bromo-3-{[2-({[(1 ,1- dimethylethyl)oxy]carbonyl}amino)ethyl]oxy}-5-[1-(phenylsulfonyl)-1/-/-pyrrolo[2,3- fa]pyridin-4-yl]-2-thiophenecarboxylate (1 .2 g, 1.89 mmol) in MeOH (30 mL with 20wt% Pd(OH)2 (525 mg) was placed on a Parr shaker at 30 psi H2 for 12 hours. Reaction was filtered to remove catalyst, concentrated to give a white solid (0.71 g, 1.27 mmol) and was carried forward without further purification: LC-MS (ES) m/z 558 (M+H)+. d) 1 ,1-dimethylethyl (2-{[2-{[(phenylmethyl)amino]carbonyl}-5-(1H-pyrrolo[2,3- ύ]pyridin-4-yl)-3-thienyl]oxy}ethyl)carbamate
i) A solution of methyl 3-{[2-({[(1,1- dimethylethyl)oxy]carbonyl}amino)ethyl]oxy}-5-[1-(phenylsulfonyl)-1H-pyrroIo[2,3- £>]pyridin-4-yl]-2-thiophenecarboxylate (2.5 g, 3.93 mmol) in 6N NaOH (3 mL) and THF (6 mL) was stirred in a sealed tube at 80 0C. After 4h, the solution was acidified to pH 5 using 2.5N HCI then extracted several times with CHCI3. The combined organic fractions were dried over Na2SO4, concentrated and used directly: LC-MS (ES) m/z 483 (M+H)+. ii) To a solution of the crude acid, 3-{[2-({[(1,1- dimethylethyl)oxy]carbonyl}amino)ethyl]oxy}-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxylic acid (132 mg, 0.328 mmol), 1-phenylmethanamine (50 μl_, 0.46 mmol), diisopropylethy! amine (290 μL, 1.66 mmol) in CHCI3 (15 ml_) was added PyBrop (180 mg, 0.386 mmol) in one portion. After 12h, the reaction contents concentrated and purified via column chromatography (silica, 5% MeOH in CHCI3 (0.5% NH4OH)) affording the title compound (110 mg, 68%) as a white solid: LC-MS (ES) m/z 493 (M+H)+.
e) 3-[(2-aminoethyl)oxy]-N-(phenylmethyl)-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)~2- thiophenecarboxamide
A solution of 1 ,1-dimethylethyl (2-{[2-{[(phenylmethyl)amino]carbonyl}-5-(1 H- pyrrolo[2,3-jb]pyridin-4-yl)-3-thienyl]oxy}ethyl)carbamate (110 mg, 0.223 mmol) in CHCI3 (15 mL) and MeOH (3ml_) was added 4M HCI in dioxane (3 ml_) and stirred at 25 0C overnight. The solution was concentrated and dry loaded onto a silica plug (5% MeOH in CHCI3 (0.5% NH4OH)) affording the free base of the title compound. The free base, as a solution in MeOH, was then treated with excess HCI in Et2O affording the title compound as the HCl salt: LC-MS (ES) m/z 393 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 3.00 (t, J=5.31 Hz, 2 H) 4.35 (t, J=5.31 Hz, 2 H) 4.54 (d, J=6.06 Hz, 2 H) 6.88 (d, J=3.54 Hz, 1 H) 7.23 - 7.29 (m, 1 H) 7.30 - 7.37 (m, 4 H) 7.42 (m, 1 H) 7.64 (m, 1 H) 7.78 (s, 1 H) 8.28 (m, 1 H) 8.43 (t, J=6.06 Hz, 1 H) 1 1.96 (s, 1 H),
Example 141
Preparation of 3-lY2-aminoethyl)oxyl-N-(3-phenylpropyl)-5-(1 H-pyrrolor2,3-b1pyridin- 4-vD-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to Example
140, except substituting 2-phenylethanamine (90 μL, 0.72 mmol) for 1- phenylmethanamine: LC-MS (ES) m/z 407 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 1.81 - 1.89 (m, 2 H) 2.61 - 2.69 (m, 2 H) 2.96 (t, J=5.31 Hz, 2 H) 3.25 - 3.40 (M, 2 H) 4.30 (t, J=5.31 Hz, 2 H) 6.87 (d, J=3.54 Hz, 1 H) 7.19 (t, J=7.20 Hz, 1 H) 7.22 - 7.26 (m, 2 H) 7.30 (t, J=7.45 Hz, 2 H) 7.42 (d, J=5.05 Hz, 1 H) 7.64 (d, J=3.54 Hz, 1 H) 7.77 (s, 1 H) 8.04 (t, J=5.68 Hz, 1 H) 8.28 (d, J=5.05 Hz, 1 H) 11.95 (s, 1 H).
Example 142
Preparation of 3-f(2-aminoethvπoxyl-N-(2-phenylethylV5-(1 H-Dyrrolo[2.3-biDyridin- 4-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 140, except substituting (3-phenylpropyl)amine (90 μl_, 0.63 mmol) for 1- phenylmethanamine: LC-MS (ES) m/z 421 (M+H)+, 1H NMR (400 MHz, DMSOd6) δ ppm 2.82 - 2.90 (m, 4 H) 3.53 - 3.61 (m, 2 H) 4.23 (t, J=5.56 Hz, 2 H) 6.87 (d, J=3.54 Hz, 1 H) 7.21 - 7.26 (m, 1 H) 7.26 - 7.36 (m, 4 H) 7.40 (t, J=4.29 Hz, 1 H) 7.64 (d, J=3.54 Hz, 1 H) 7.75 (s, 1 H) 7.96 (t, J=5.81 Hz, 1 H) 8.27 (d, J=5.05 Hz, 1 H) 11.95 (s, 1 H).
Example 143
Preparation of N-((1 sy2-amino-1-{r3-(trifluoromethvnphenvπmethyl}ethvO-5-(1 H- PVrrolor2,3-b1pyridin-4-vO-2-furancarboxamide
The title compound was prepared as a yellow solid according to Example 43, except substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1/V- isoindole-1 ,3(2/-/)-dione (424 mg, 1.1 mmol) [prepared from Λ/-{[(1 ,1- dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L-phenylalanine and following preparation 11] for 2-[(2S)-2-amino-3-phenylpropyl]-1/-/-isoindole-1 ,3(2H)-dione and 5-bromo-2-furancarboxylic acid (2.5 g, 6.5 mmol) for 4,5-dibromo-2- thiophenecarboxylic acid: LC-MS (ES) m/z 428 (M+H)+, 1H NMR (400 MHz, d4- MeOH) δ ppm 2.85 - 2.95 (m, 2 H) 2.98 (dd, J=13.77, 8.97 Hz, 1 H) 3.06 - 3.14 (m, 1 H) 4.33 - 4.42 (m, 1 H) 6.93 (d, J=3.54 Hz, 1 H) 7.25 (s, 2H) 7.44 - 7.52 (m, 3 H) 7.57 (d, J=6.82 Hz, 1 H) 7.62 - 7.67 (m, 2 H) 8.26 (d, J=5.05 Hz, 1 H).
Example 144
Preparation of N-((1 SV2-amino-1-fr3-(trifluoromethyl)phenyllmethyl>ethvπ-4-bromo- 5-(1 H-pyrrolor2,3-b1pyridin-4-yl)-2-furancarboxamide
The title compound was prepared as a yellow solid according to Example 43, except substituting 2-{(2S)-2-aminσ-3-[3-(trifluoromethyl)phenyl]propyl}-1 f/- isoindole-1 ,3(2H)-dione (510 mg, 1.3 mmol) [prepared from Λ/-{[(1 ,1- dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L-phenylalanine and following preparation 11] for 2-[(2S)-2-amino-3-phenylpropyl]-1H-isoindole-1 ,3(2H)-dione and 4,5-dibromo-2--fυrancarboxylic acid (2.5 g, 6.6 mmol) for 4,5-dibromo-2- thiophenecarboxylic acid: LC-MS (ES) m/z 507 (M+H)+, 1H NMR (400 MHz, d4- MeOH) δ ppm 3.06 - 3.16 (m, 2 H) 3.28 (d, J=7.07 Hz7 2 H) 4.62 (dd, J=8.97, 6.44 Hz, 1 H) 6.90 (d, J=3.54 Hz, 1 H) 7.33 (s, 1 H) 7.37 - 7.43 (m, 1 H) 7.46 - 7.54 (m, 2 H) 7.55 - 7.60 (m, 1 H) 7.63 (s, 1 H) 7.74 (d, J=5.05 Hz, 1 H) 7.81 - 7.87 (m, 1 H) 8.26 (d, J=5.05 Hz, 1 H).
Example 145
Preparation of 3-f(2-aminoethyl)oxy1-4-bromo-N-(phenylmethvπ-5-(1 H-pyrrolor2.3- b1pyridin-4-vO-2-thiophenecarboxamide
a) methyl 4-bromo-3-hydroxy-5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin-4-yl]-2- thiophenecarboxylate
Methyl 4,5-dibromo-3-hydroxy-2-thiophenecarboxylate (4.43 g, 14.0 mmol), 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3- b]pyridine (5.37 g, 14.0 mmol)[prepared in Preparation 2], Pd(PPh3)4 (808 mg, 0.70 mmol) and K2CO3 (7.7 g, 55.9 mmol) in dioxane (120 ml_) and H2O (28 ml_) were combined in a sealed tube. After 12h at 70 0C, the reaction contents were partitioned between H2O/ CHCI3. The aqueous phase was washed several times with CHCI3 and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, V.3 EtOAc/Hexane) affording the title compound (5 g, 72%) as a yellow solid: LC-MS (ES) m/z 494 (M+H)+.
b) methyl 4-bromo-3-{[2-({[(1 ,1-dimethylethyl)oxy]carbonyl}amino)ethyl]oxy}-5-[1- (phenylsulfonyl)-1H-pyrrolo[2,3-jb]pyridin-4-yl]-2-thiophenecarboxylate
To a solution of methyl 4-bromo-3-hydroxy-5-[1-(phenylsulfonyl)-1 H- pyrrolo[2,3-b]pyridin-4-yl]-2-thiophenecarboxylate (5 g, 10.13 mmol), 1 ,1- dimethylethyl (2-hydroxyethyl)carbamate (1.6 mL, 10.34 mmol), PPh3 (3.2 g, 12.20 mmol) in THF (50 mL) at 25 0C was added DEAD (1.6 mL, 8.31 mmol) in one portion. After 30 min, the reaction was concentrated and purified via column chromatography (silica, 1 :3 EtOAc/Hexane) affording the title compound (5.0 g, 95%) as a yellow solid: LC-MS (ES) m/z 637 (M+H)+. c) 1 , 1 -dimethylethyl (2-{[4-bromo-2-{[(phenylmethyl)amino]carbonyl}-5-(1 H- pyrrolo[2,3-6]pyridin-4-yl)-3-thienyl]oxy}ethyl)carbamate
i) A solution of methyl 4-bromo-3-{[2-({[(1 ,1- dimethylethyl)oxy]carbonyl}amino)ethyl]oxy}-5-[1-(phenylsulfonyl)-1/-/-pyrrolo[2,3- ό]pyridin-4-yl]-2-thiophenecarboxylate (2.5 g, 3.93 mmol) in 6N NaOH (3 ml_) and THF (6 ml.) was stirred in a sealed tube at 80 °C. After 4h, the solution was acidified to pH 5 using 2.5N HCI then extracted several times with CHCI3. The combined organic fractions were dried over Na2SO4, concentrated and used directly. LC-MS (ES) m/z 483 (M+H)+. ii) To a solution of the crude acid, 4-bromo-3-{[2-({[(1,1- dimethylethyl)oxy]carbonyl}amino)ethyl]oxy}-5-(1H-pyrrolo[2,3-6]pyridin-4-yl)-2- thiophenecarboxylic acid (132 mg, 0.328 mmol), 1-phenylmethanamine (50 μl_, 0.46 mmol), diisopropylethyl amine (290 μl_, 1.66 mmol) in CHCI3 (15 mL) was added PyBrop (180 mg, 0.386 mmol) in one portion. After 12h, the reaction contents concentrated and purified via column chromatography (silica, 5% MeOH in CHCI3 (0.5% NH4OH)) affording the title compound (110 mg, 68%) as a white solid: LC-MS (ES) m/z 493 (M+H)+.
d) 3-[(2-aminoethyl)oxy]-4-bromo-N-(phenylmethyl)-5-(1 H-pyrrolo[2,3-b]ρyridin-4- yI)-2-thiophenecarboxamide
A solution of 1 ,1-dimethylethyl (2-{[4-bromo-2- {[(phenylmethyl)amino]carbonyl}-5-(1H-pyrrolo[2,3-6]pyridin-4-yl)-3- thienyl]oxy}ethyl)carbamate (110 mg, 0.223 mmol) in CHCI3 (15 mL) and MeOH (3mL) was added 4M HCI in dioxane (3 mL) and stirred at 25 0C overnight. The solution was concentrated and dry loaded onto a silica plug (5% MeOH in CHCI3 (0.5% NH4OH)) affording the free base of the title compound.
The free base, as a solution in MeOH, was then treated with excess 2M HCI in Et2O affording the title compound as the HCI salt: LC-MS (ES) m/z 472 (M+H)+, 1H NMR (400 MHz1 DMSO-cy6) δ ppm 2.95 (t, J=4.93 Hz, 2 H) 4.26 (t, J=4.93 Hz, 2 H) 4.50 (d, J=5.05 Hz, 2 H) 6.55 (d, J=3.54 Hz, 1 H) 7.23 - 7.35 (m, 5 H) 7.63 (d, J=3.28 Hz, 1 H) 8.33 (d, J=4.80 Hz, 1 H) 9.96 (s, 1 H) 11.99 (s, 1 H). Example 146
Preparation of 3-f(2-aminoethyl')oxyl-4-bromo-N-f3-phenylpropyl1-5-(1 H-pyrrolor2.3- blpyridin-4-vn-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 145, except substituting (3-phenylpropyl)amine (130 μl_, 0.91 mmol) for 1- phenylmethanamine: LC-MS (ES) m/z 500 (M+H)+, 1H NMR (400 MHz, DMSOd6) δ ppm 1.82 - 1.92 (m, 2 H) 2.61 - 2.67 (m, 2 H) 2.96 (t, J=4.80 Hz, 2 H) 3.30 - 3.37 (m, 2 H) 4.23 (t, J=4.80 Hz, 2 H) 6.55 (d, J=3.28 Hz, 1 H) 7.16 - 7.21 (m, 1 H) 7.23 - 7.31 (m, 4 H) 7.62 (d, J= 1.52 Hz, 1 H) 8.31 - 8.35 (m, 1 H) 9.38 - 9.32 (m, 1 H) 1 1.99 (s, 1 H).
Example 147
Preparation of 3-[(2-aminoethy0oxy1-4-bromo-N-(2-phenylethv0-5-( 1 H-pyrrolor2.3- blpyridin^-ylV∑-thiophenecarboxamide The title compound was prepared as a yellow solid according to Example
145, except substituting (2-phenylethyl)amine (100 μL, 0.80 mmol) for 1- phenylmethanamine: LC-MS (ES) m/z 486 (M+H)+, 1H NMR (400 MHz, DMSO-c/6) δ ppm 2.84 - 2.91 (m, 4 H) 3.49 - 3.57 (m, 2 H) 4.15 (t, J=4.93 Hz, 2 H) 6.55 (d, J=3.28 Hz, 1 H) 7.21 - 7.35 (m, 5 H) 7.63 (d, J=3.28 Hz, 1 H) 8.31 - 8.35 (m, 1 H) 9.40 (t, J=5.56 Hz, 1 H) 11.99 (s, 1 H).
Example 148
Preparation of N-l2-amino-1-r3-(trifluoromethvQphenyriethyl}-5-(1 H-pyrrolor2.3- b]pyridin-4-yD-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 15, except substituting 1,1-dimethylethyl {2-amino-2-[3- (trifluoromethyl)phenyl]ethyl}carbamate (0.52 g, 1.7 mmol) [prepared from 3- (trifluoromethyl)benzaldehyde and following preparation 9] for 1 ,1-dimethylethyl (3- amino-3-phenylpropy!)carbarnate: LC-MS (ES) m/z 431 (M+H)+, 1H NMR (400 MHz, DMSO-c/e) δ ppm 2.91 - 3.02 (m, 2 H) 5.05 (s, 1 H) 6.85 (d, J=3.54 Hz, 1 H) 7.39 (d, J=5.05 Hz, 1 H) 7.57 - 7.65 (m, 3 H) 7.70 (d, J=7.07 Hz, 1 H) 7.75 (s, 1 H) 7.86 (d, J=4.04 Hz, 1 H) 8.07 (d, J=4.04 Hz, 1 H) 8.27 (d, J=5.05 Hz, 1 H) 8.97 (s, 1 H) 11.94 (s, 1 H).
Example 149
Preparation of N-l2-amino-143-(trifluoromethv0phenyl1ethyl}-4-bromo-5-(1 H- pyrrolor2.3-blpyridin-4-vπ-2-thioρhenecarboxamide
The title compound was prepared as a yellow solid according to Example 15, except substituting 1,1-dimethylethyl {2-amino-2-[3- (trifluoromethyl)phenyl]ethyl}carbamate (0.45 g, 1.5 mmol) [prepared from 3- (trifluoromethyl)benzaldehyde and following preparation 9] for 1 ,1-dimethylethyl (3- amino-3-phenylpropyl)carbamate and 4,5-dibromo-2-thiophenecarboxylic acid (3.41 g, 11.9 mmol) for δ-bromo^-thiophenecarboxylic acid: LC-MS (ES) m/z 510 (M+H)+, 1H NMR (400 MHz, d4-MeOH) δ ppm 3.07 - 3.1 1 (m, 2 H) 5.19 (dd, J=8.08, 6.06 Hz, 1 H) 6.61 (d, J=3.54 Hz, 1 H) 7.35 (d, J=5.05 Hz, 1 H) 7.51 (d, J=3.54 Hz, 1 H) 7.58 - 7.64 (m, 2 H) 7.70 (d, J=7.07 Hz, 1 H) 7.76 (s, 1 H) 7.98 (s, 1 H) 8.29 (d, J=5.05 Hz, 1 H).
Example 150
Preparation of 4-bromo-N-r(1 S)-2-hydroxy-1 -(phenylmethyl)ethvfl-5-(1 H-pyrrolor2,3- b1pyridin-4-vn-2-thiophenecarboxamide
a) (2S)-2-amino-3-phenylpropyl benzoate
i) A solution of benzoyl chloride (5.9 g, 42.2 mmol) in CHCI3 (25 ml_) was added to a solution of 1 ,1-dimethylethyl [(1 S)-2-hydroxy-1-
(phenylmethyl)ethyl]carbamate (5.3 g, 21.0 mmol) and Et3N (8.8 ml_, 63.1 mmol) in CHCI3 (105 mL) and stirred at room temperature overnight. The reaction was quenched with MeOH and solvent was evaporated and resulting oil dry loaded on silica (1 :3 EtOAc / Hexane) to give a clear oil (7.5 g, quant.): LC-MS (ES) m/z 355 (M+H)+.
ii) (2S)-2-({[(1 ,1-dimethylethyl)oxy]carbonyl}amino)-3-phenylpropyl benzoate was placed in CHCI3 (75 mL) and MeOH (10 mL) and 4M HCI in dioxane (29 mL) added and the reaction stirred overnight. The solvent was evaporated to yield the title compound (2.47 g, 46%) as a white solid: LC-MS (ES) m/z 255 (M+H)+.
b) (2S)-2-[({4-bromo-5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-ώ]pyridin-4-yl]-2- thienyl}carbonyl)amino]-3-phenylpropyl benzoate
To a solution of the crude acid, 4-bromo-3-{[2-({[(1 ,1- dimethylethyl)oxy]carbonyl}amino)ethyl]oxy}-5-(1H-pyrrolo[2,3-ό]pyridin-4-yl)-2- thiophenecarboxylic acid (905 mg, 1.95 mmol) [prepared in Preparation 2], (2S)-2- amino-3-phenylpropyl benzoate (545 mg, 2.13 mmol), diisopropylethyl amine (1.3 mL, 7.46 mmol) in CHCI3 (15 mL) was added PyBrop (1.2 g, 2.57 mmol) in one portion. After 12h, the reaction contents concentrated and purified via column chromatography (silica, 1 :3 EtOAc/Hexane) affording the title compound (593 mg, 43%) as a white solid: LC-MS (ES) m/z 701 (M+H)+.
c) 4-bromo-N-[(1S)-2-hydroxy-1-(phenylrnethyl)ethyl]-5-(1 H-pyrrolo[2,3-b]pyridin-4- yl)-2-thiophenecarboxamide
To a solution of (2S)-2-[({4-bromo-5-[1-(phenylsulfonyl)-1 /-/-pyrrolo[2,3- /j]pyridin-4-yl]-2-thienyl}carbonyl)amino]-3-phenylpropyl benzoate in THF (10 mL) and MeOH (2 mL) was added 6N NaOH (1 mL) and the mixture stirred overnight at room temperature. The reaction mixture was made slightly acidic using 2.5N HCI, the solvent evaporated and the mixture dry loaded onto a silica plug (5% MeOH in CHCI3 (0.5% NH4OH)) affording the free base of the title compound (35 mg, 10%).
The free base, as a solution in MeOH, was then treated with excess 2M HCI in Et2O affording the title compound as the HCI salt: LC-MS (ES) m/z 457 (M+H)+, 1H NMR (400 MHz, DMSO-c/6) δ ppm 2.79 (dd, J=13.64, 9.09 Hz, 1 H) 2.96 (dd, J=13.64, 5.05 Hz, 1 H) 3.48 (ddd, J=19.83, 10.61 , 5.94 Hz, 2 H) 4.13 (dt, J=14.46, 5.40 Hz, 1 H) 4.92 (s, 1 H) 6.51 (d, J=3.28 Hz, 1 H) 7.15 - 7.23 (m, 1 H) 7.26 - 7.30 (m, 5 H) 7.59 - 7.63 (m, 1 H) 8.04 (s, 1 H) 8.33 (d, J=4.8ϋ Hz, 1 H) 11.98 (s, 1 H).
Example 151
Preparation of N-f(1Sy2-hydroxy-1-(phenylrnethv0ethyr|-5-(1 H-pyrrolo[2,3-b1pyridin- 4-vπ-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to Example
154, except substituting 5-bromo-2-thiophenecarboxylic acid (3.16 g, 15.3 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid: LC-MS (ES) m/z 378 (M+H)+, 1H NMR (400 MHz, DMSO-de) δ ppm 2.81 (dd, J=13.77, 9.22 Hz, 1 H) 2.97 (dd, J=13.77, 5.18 Hz, 1 H) 3.43 - 3.55 (m, 2 H) 4.14 (dd, J=8.59, 3.54 Hz, 1 H) 4.90 (t, J=5.68 Hz, 1 H) 6.84 (dd, J=3.54, 1.77 Hz7 1 H) 7.17 (td, J=5.56, 2.78 Hz, 1 H) 7.24 - 7.30 (m, 4 H) 7.37 (d, J=5.05 Hz, 1 H) 7.61 - 7.64 (m, 1 H) 7.80 (d, J=4.04 Hz, 1 H) 7.90 (d, J=4.04 Hz, 1 H) 8.26 (d, J=5.05 Hz, 1 H) 8.34 - 8.39 (m, 1 H) 11.92 (s, 1 H). Example 152
Preparation of N-(2-amino-1-r2-(trifluoromethynphenyl1ethyl}-5-(1 H-pyrrolor2,3- b1pyridin-4-vO-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 15, except substituting 1,1-dimethylethyl {2-amino-2-[2- (trifluoromethyl)phenyl]ethyl}carbamate (0.31 g, 1.0 mmol) [prepared from 2- (trifluoromethyl)benzaldehyde and following preparation 9] for 1 , 1-dimethylethyl (3- amino-3-phenylpropyl)carbamate: LC-MS (ES) m/z 431 (M+H)+, 1H NMR (400 MHz, d4-MeOH) δ ppm 3.06 - 3.08 (m, 2 H) 5.53 - 5.61 (m, 1 H) 6.92 (d, J=3.54 Hz, 1 H) 7.40 (d, J=5.30 Hz, 1 H) 7.49 (t, J=7.1Λ Hz, 1 H) 7.52 (d, J=3.79 Hz, 1 H) 7.67 (t, J=7.58 Hz, 1 H) 7.73 - 7.78 (m, 3 H) 7.95 (d, J=4.04 Hz, 1 H) 8.23 (d, J=5.05 Hz, 1 H).
Example 153
Preparation of N-|2-amino-1-r2-(trifluoromethvDphenvπethyl}-4-bromo-5-(1 H- pyrrolor2.3-b1pyridin-4-yl')-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 15, except substituting 1,1-dimethylethyl {2-amino-2-[2- (trifluoromethyl)phenyl]ethyl}carbamate (0.37 g, 1.2 mmol) [prepared from 2- (trifluoromethyl)benzaldehyde and following preparation 9] for 1, 1-dimethylethyl (3- amino-3-phenylpropyl)carbamate and 4,5-dibromo-2-thiophenecarboxylic acid (7.25 g, 18.9 mmol) for 5-bromo-2-thiophenecarboxylic acid: LC-MS (ES) m/z 510 (M+H)\ 1H NMR (400 MHz, d4-MeOH) δ ppm 3.04 (d, J=6.82 Hz, 2 H) 5.53 (t, J=6.82 Hz, 1 H) 6.58 (d, J=3.54 Hz, 1 H) 7.31 (d, J=5.05 Hz, 1 H) 7.43 - 7.50 (m, 2 H) 7.64 (t, J=7.71 Hz, 1 H) 7.73 (d, J=8.34 Hz, 2 H) 7.99 (s, 1 H) 8.27 (d, J=5.05 Hz, 1 H). Example 154
Preparation of 3-r(2-aminoethyπoxy1-N-((1S')-2-amino-1-{r3-
(trifluoromethvπphenyllmethyl}etrivπ-4-bromo-5-(1/-/-pyrrolor2.3-biPyridin-4-vπ-2- thiophenecarboxamide
a) methyl 4-bromo-3-hydroxy-5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin-4-yl]-2- thiophenecarboxylate
Methyl 4,5-dibromo-3-hydroxy-2-thiophenecarboxylate (4.43 g, 14.0 mmol), 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3- b]pyridine (5.37 g, 14.0 mmol)[prepared in Preparation 2], Pd(PPh3)4 (808 mg, 0.70 mmol) and K2CO3 (7.7 g, 55.9 mmol) in dioxane (120 ml.) and H2O (28 mL) were combined in a sealed tube. After 12h at 70 0C, the reaction contents were partitioned between H2O/ CHCb- The aqueous phase was washed several times with CHCl3 and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 1 :3 EtOAc/Hexane) affording the title compound (5 g, 72%) as a yellow solid: LC-MS (ES) m/z 494 (M+H)+.
b) methyl 4-bromo-3-{[2-({[(1 ,1-dimethylethyl)oxy]carbonyl}amino)ethyl]oxy}-5-[1- (phenylsulfonyl)-1/-/-pyrrolo[2,3-6]pyridin-4-yl]-2-thiophenecarboxylate
To a solution of methyl 4-bromo-3-hydroxy-5~[1-(phenylsulfonyl)-1 H- pyrrolo[2,3-b]pyridin-4-yl]-2-thiophenecarboxylate (5 g, 10.13 mmol), 1 ,1- dimethylethyl (2-hydroxyethyl)carbamate (1.6 ml_, 10.34 mmol), PPh3 (3.2 g, 12.20 mmol) in THF (50 mL) at 25 0C was added DEAD (1.6 rnl_, 8.31 mmol) in one portion. After 30 min, the reaction was concentrated and purified via column chromatography (silica, 1 :3 EtOAc/Hexane) affording the title compound (5.0 g, 95%) as a yellow solid: LC-MS (ES) m/z 637 (M+H)+. c) 1,1-dimethylethyl (2-{[2-{[((1 S)-2-amino-1-{[3-
(trifluoromethyl)phenyl]methyl}ethyl)amino]carbonyl}-4-bromo-5-(1 H-pyrrolo[2,3- ό]pyridin-4-yl)-3-thienyl]oxy}ethyl)carbamate
i) A solution of methyl 4-bromo-3-{[2-({[(1 ,1- dimethylethyl)oxy]carbonyl}amino)ethyI]oxy}-5-[1-(phenylsulfonyl)-1f/-pyrrolo[2,3- 6]pyridin-4-yl]-2-thiophenecarboxylate (2.5 g, 3.93 mmol) in 6N NaOH (3 mL) and THF (6 mL) was stirred in a sealed tube at 80 0C. After 4h, the solution was acidified to pH 5 using 2.5N HCI then extracted several times with CHCl3. The combined organic fractions were dried over Na2SO4, concentrated and used directly: LC-MS (ES) m/z 483 (M+H)+. ii) To a solution of the crude acid, 4-bromo-3-{[2 -({[(1,1- dimethylethyl )oxy]carbonyl}amino)ethyl]oxy}-5-(1H-pyrrolo[2,3-/b]pyridin-4-yl)-2- thiophenecarboxylic acid (280 mg, 0.450 mmol), 2-{(2S)-2-amino-3-[3- (trifluoromethyl)phenyl]propyl}-1 H-isoindole-1 ,3(2/-/)-dione (227 mg, 0.59 mmol) [prepared from Λ/-{[(1 ,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L- phenylalanine and following preparation 11], diisopropylethyl amine (0.5 ml_, 2.87 mmol) in CHCI3 (20 ml_) was added PyBrop (289 mg, 0.62 mmol) in one portion. After 12h, the reaction contents concentrated and purified via column chromatography (silica, 5% MeOH in CHCI3 (0.5% NH4OH)) affording the title compound (0.36 g, quant) as a white solid: LC-MS (ES) m/z 813 (M+H)+.
iii) To a solution of 1 ,1-dimethylethyl (2-{[2-{[((1S)-2-amino-1-{[3- (trifluoromethyl)phenyl]methyl}ethyl)amino]carbonyl}-4-bromo-5-(1 f/-pyrrolo[2,3- b]pyridin-4-yl)-3-thienyl]oxy}ethyl)carbamate in THF (10 ml_) and MeOH (5 ml_) was added hydrazine (150 μl_, 4.8 mmol) and the mixture stirred overnight at room temperature. The solution was concentrated and dry loaded onto a silica plug (5% MeOH in CHCI3 (0.5% NH4OH)) affording a white solid (84 mg, 0.123 mmol): LC- MS (ES) m/z 683 (M+H) +.
d) 3-[(2-aminoethyl)oxy]-Λ/-((1 S)-2-amino-1-{[3-
(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1/-/-pyrrolo[2,3-6]pyridin-4-yl)-2- thiophenecarboxamide
To a solution of 1 ,1-dimethylethyl (2-{[2-{[((1 S)-2-amino-1-{[3-
(trifluoromethyl)phenyl]methyl}ethyl)amino]carbonyl}-4-bromo-5-(1 /-/-pyrrolo[2,3- ό]pyridin-4-yl)-3-thienyl]oxy}ethyl)carbamate (84 mg, 0.123 mmol) in CHCI3 (15 mL) and MeOH (3mL) was added 4M HCI in dioxane (1.2 mL) and stirred at 25 0C overnight. The solution was concentrated and dry loaded onto a silica plug (5% MeOH in CHCI3 (0.5% NH4OH)) affording the free base of the title compound (56 mg, 78%).
The free base, as a solution in MeOH, was then treated with excess 2M HCI in Et2O affording the title compound as the HCI salt: LC-MS (ES) m/z 583 (M+H)+, 1H NMR (400 MHz, d4-MeOH) δ ppm 2.91 (d, J=6.06 Hz, 2 H) 3.01 - 3.12 (m, 4 H) 4.19 (ddd, J=13.26, 9.85, 4.42 Hz, 2 H) 4.35 (dd, J=8.08, 6.32 Hz, 1 H) 6.60 (d, J=3.79 Hz, 1 H) 7.29 (d, J=5.05 Hz, 1 H) 7.48 - 7.55 (m, 3 H) 7.56 - 7.61 (m, 1 H) 7.64 (s, 1 H) 8.29 (d, J=5.05 Hz, 1 H).
Example 155
Preparation of Λ/-((1 S^-amino-i-frS-ftrifluoromethvπphenylimethyllethylM-bromo- 3-(methyloxyV5-(1 /-/-pyrrolof2.3-blpyridin-4-ylV2-thiophenecarboxamide
a) methyl 4-bromo-3-hydroxy-5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin-4-yl]-2- thioph en eca rboxyl ate
Methyl 4,5-dibromo-3-hydroxy-2-thiophenecarboxylate (4.43 g, 14.0 mmol), 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1 ,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3- b]pyridine (5.37 g, 14.0 mmol)[prepared in Preparation 2], Pd(PPh3)4 (808 mg, 0.70 mmol) and K2CO3 (7.7 g, 55.9 mmol) in dioxarie (120 mL) and H2O (28 ml_) were combined in a sealed tube. After 12h at 70 0C, the reaction contents were partitioned between H2O/ CHCI3. The aqueous phase was washed several times with CHCI3 and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 1 :3 EtOAc/Hexane) affording the title compound (5 g, 72%) as a yellow solid: LC-MS (ES) m/z 494 (M+H)+.
b) methyl 4-bromo-3-(methyloxy)-5-[1-(phenylsulfonyl)-1H-pyrrolo[2,3-ϋ]pyridin-4- yl]-2-th iophen ecarboxyl ate
To a solution of methyl 4-bromo-3-hydroxy-5-[1-(phenylsulfonyl)-1 H- pyrrolo[2,3-b]pyridin-4-yl]-2-thiophenecarboxylate (2.2 g, 4.48 mmol), MeOH (1 mL, 25 mmol), PPh3 (1.4 g, 5.4 mmol) in THF (60 mL) at 25 0C was added DEAD (835 μl_, 5.30 mmol) in one portion. After 30 min, the reaction was concentrated and purified via column chromatography (silica, 1 :3 EtOAc/Hexane) affording the title compound (1.6 g, 71%) as a white solid: LC-MS (ES) m/z 508 (M+H)+.
c) Λ/-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-3- (methyloxy)-5-(1H-pyrrolo[2,3-(b]pyridin-4-yl)-2-thiophenecarboxamide
i) A solution of methyl 4-bromo-3-(methyloxy)-5-[1-(phenylsulfonyl)-1 H- pyrrolo[2,3-£>]pyridin-4-yl]-2-thiophenecarboxylate (611 mg, 1 .2 mmol) in 6N NaOH (1 mL) and THF (10 mL) was stirred in a sealed tube at 80 0C. After 4h, the solution was acidified to pH 5 using 2.5N HCI then extracted several times with CHCI3. The combined organic fractions were dried over Na2SO4, concentrated and used directly: LC-MS (ES) m/z 354 (M+H)+. ii) To a solution of the crude acid, 4-bromo-3-(methyloxy)-5-(1 H-pyrrolo[2,3-
<fc>]pyridin-4-yl)-2-thiophenecarboxylic acid (0.34 g, 0.963 mmol), 2-{(2S)-2-amino-3- [3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2/-/)-dione (380 mg, 0.99 mmol) [prepared from Λ/-{[(1 ,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L- phenylalanine and following preparation 11], diisopropylethyl amine (0.88 mL, 5.05 mmol) in CHCI3 (15 mL) was added PyBrop (549 mg, 1.18 mmol) in one portion. After 12h, the reaction contents concentrated and purified via column chromatography (silica, 5% MeOH in CHCI3 (0.5% NH4OH)) affording the title compound (110 mg, 0.16 mmol) as a yellow oil: LC-MS (ES) m/z 684 (M+H)+.
d) A/-((1 S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-3- (methyloxy)-5-(1/-/-pyrrolo[2,3-ύ]pyridin-4-yl)-2-thiophenecarboxamide
To a solution of 4-bromo-Λ/-((1S)-2-(1 ,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)- 1-{[3-(trifluoromethyl)phenyl]methyl>ethyl)-3-(methyloxy)-5-(1H-pyrrolo[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide in THF (10 ml_) and MeOH (2 mL) was added hydrazine (50 μl_, 1.6 mmo!) and the mixture stirred overnight at room temperature. The solution was concentrated and dry loaded onto a silica plug (5% MeOH in CHCI3 (0.5% NH4OH)) affording a white solid (19 mg, 21%): LC-MS (ES) m/z 554 (M+H) +.
The free base, as a solution in MeOH, was then treated with excess 2M HCI in Et2O affording the title compound as the HCI salt: LC-MS (ES) m/z 472 (M+H)+, 1H NMR (400 MHz, d4-MeOH) δ ppm 2.93 (br. s, 2 H) 2.99 - 3.08 (m, 1 H) 3.10 - 3.19 (m, 1 H) 3.91 (s, 3 H) 4.39 (td, J=5.87, 3.16 Hz, 1 H) 6.59 (d, J=3.54 Hz, 1 H) 7.29 (d, J=5.05 Hz, 1 H) 7.49 - 7.56 (m, 3 H) 7.60 (d, J=6.57 Hz, 1 H) 7.65 (s, 1 H) 8.29 (d, J=5.05 Hz, 1 H).
Example 156
Preparation of Λ/-((1 SV2-amino-1-ir3-(trifluoromethyl)phenyllmethyl>ethvπ-3- (methyloxyV5-π H-pyrrolor2.3-άlpyridin-4-ylV2-thiophenecarboxamide
a) methyl 4-bromo-3-hydroxy-5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3-b]pyridin-4-yl]-2- thiophenecarboxylate
Methyl 4,5-dibromo-3-hydroxy-2-thiophenecarboxylate (4.43 g, 14.0 mmol), 1-(phenylsulfonyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrrolo[2,3- b]pyridine (5.37 g, 14.0 mmol)[prepared in Preparation 2], Pd(PPh3)4 (808 mg, 0.70 mmol) and K2CO3 (7.7 g, 55.9 mmol) in dioxane (120 mL) and H2O (28 mL) were combined in a sealed tube. After 12h at 70 0C, the reaction contents were partitioned between H2O/ CHCI3. The aqueous phase was washed several times with CHCI3 and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 1 :3 EtOAc/Hexane) affording the title compound (5 g, 72%) as a yellow solid: LC-MS (ES) m/z 494 (M+H)+.
b) methyl 4-bromo-3-(methyloxy)-5-[1-(phenylsulfonyl)-1H-pyrrolo[2,3-6]pyridin-4- yl]-2-thioph en ecarboxyl ate
To a solution of methyl 4-bromo-3-hydroxy-5-[1-(phenylsulfonyl)-1 H- pyrrolo[2,3-b]pyridin-4-yl]-2-thiophenecarboxylate (2.2 g, 4.48 mmol), MeOH (1 ml_, 25 mmol), PPh3 (1.4 g, 5.4 mmol) in THF (60 ml_) at 25 0C was added DEAD (835 μl_, 5.30 mmol) in one portion. After 30 min, the reaction was concentrated and purified via column chromatography (silica, 1 :3 EtOAc/Hexane) affording the title compound (1.6 g, 71%) as a white solid: LC-MS (ES) m/z 508 (M+H)+.
c) methyl 3-(methyloxy)-5-[1-(phenylsulfonyl)-1/-/-pyrrolo[2,3-jb]pyridin-4-yl]-2- thiophenecarboxylate
A solution of methyl 4-bromo-3-(methyloxy)-5-[1-(phenylsulfonyl)-1H- pyrrolo[2,3-£>]pyridin-4-yl]-2-thiophenecarboxylate (1 g, 1.97 mmol) in MeOH (20 mL) with 20wt% Pd(OH)2 (525 mg) was placed on a Parr shaker at 30 psi H2 for 12 hours. Reaction was filtered to remove catalyst, concentrated to give a white solid (0.41 g, 0.96 mmol) and was carried forward without further purification: LC-MS (ES) m/z 429 (M+H)+.
d) Λ/-((1 S)-2-(1 ,3-dioxo-1 ,3-dihydro-2H-isoindol-2-yl)-1 -{[3-
(trifluoromethyl)phenyl]methyl}ethyl)-3-(methyloxy)-5-(1H-pyrrolo[2,3-ib]pyridin-4-yl)- 2-thiophenecarboxamide
i) A solution of methyl 3-(methyloxy)-5-[1-(phenylsulfonyl)-1 H-pyrrolo[2,3- 6]pyridin-4-yl]-2-thiophenecarboxylate (0.41 g, 0.96 mmol) in 6N NaOH (2 ml_) and THF (20 ml_) was stirred in a sealed tube at 80 0C. After 4h, the solution was acidified to pH 5 using 2.5N HCI then extracted several times with CHCI3. The combined organic fractions were dried over NaaSCU, concentrated and used directly: LC-MS (ES) m/z 275 (M+H)+. ii) To a solution of the crude acid, 3-(methyloxy)-5-(1/-/-pyrrolo[2,3-<b]pyridin- 4-yl)-2-thiophenecarboxylic acid (262mg, 0.96 mmol), 2-{(2S)-2-amino-3-[3- (trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2/-/)-dione (420 mg, 1.1 mmol) [prepared from Λ/-{[(1 ,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L- phenylalanine and following preparation 11], diisopropylethyl amine (1.7 ml_, 9.76 mmol) in CHCI3 (15 ml_) was added PyBrop (700 mg, 1.5 mmol) in one portion. After 12h, the reaction contents concentrated and purified via column chromatography (silica, 5% MeOH in CHCI3 (0.5% NH4OH)) affording the title compound (1 10 mg, 68%) as a white solid: LC-MS (ES) m/z 605 (M+H)+.
e) 3-[(2-aminoethyl)oxy]-Λ/-(phenylmethyl)-5-(1 H-pyrrolo[2,3-6]pyridin-4-yl)-2- thiophenecarboxamide
To a solution of Λ/-((1 S)-2-(1 ,3-dioxo-1 ,3-dihydro-2H-isoindol-2-yl)-1-{[3- (trifluoromethyl)phenyl]methyl}ethyl)-3-(methyloxy)-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)- 2-thiophenecarboxamide in THF (10 mL) and MeOH (2 mL) was added hydrazine (360 μL, 1 1.5 mmol) and the mixture stirred overnight at room temperature. The solution was concentrated and dry loaded onto a silica plug (5% MeOH in CHCl3 (0.5% NH4OH)) affording a white solid (50 mg, 8%): LC-MS (ES) m/z 475 (M+H)+.
The free base, as a solution in MeOH, was then treated with excess HCI affording the title compound as the HCI salt: LC-MS (ES) m/z 475 (M+H)+, 1H NMR (400 MHz, DMSO-tf6) δ ppm 3.02 - 3.13 (m, 4 H) 4.10 (s, 3 H) 4.47 (m, 1 H) 6.86 (dd, J=3.66, 1.89 Hz, 1 H) 7.43 (d, J=5.05 Hz, 1 H) 7.53 (d, J=8.59 Hz, 1 H) 7.55 - 7.61 (m, 2 H) 7.65 (dd, J=6.06, 3.03 Hz, 2 H) 7.77 (s, 1 H) 7.92 (br. s, 2 H) 8.28 - 8.38 (m, 1 H) 12.03 (s, 1 H).
Example 157
Preparation of N-r2-amino-1-(phenylmethv0ethvπ-4-π H-pyrrolor2.3-b1pyridin-4-yl)- 2-thiophenecarboxamide The title compound was prepared as a light yellow solid according to the procedure of Example 15, except substituting 4-bromo-2-thiophenecarboxylic acid (0.62 g, 3.0 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and 1 ,1- dimethylethyl (2-amino-3-phenylpropyl)carbamate (0.75 g, 3.0 mmol) [prepared in Example 76] for 1 ,1-dimethylethyl (3-amino-3-phenylpropyl)carbamate: LC-MS (ES) m/z = 377 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.47 (s, 1 H), 8.43 (m, 1 H), 8.3 (m, 1 H), 7.74 (m, 1 H), 7.67 (m, 1 H)1 7.33 (m, 4H), 7.23 (m, 1 H)1 7.14 (m, 1 H), 4.6 (m, 1 H), 3.21 (m, 2H), and 3.04 (m, 2H).
Example 158
Preparation of N-f2-amino-1-(phenylmethyl)ethvH-5-(1 H-pyrrolof2,3-bipyridin-4-ylV 2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 15, except substituting 5-bromo-2-thiophenecarboxylic acid (0.62 g, 3.0 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and 1 ,1- dimethylethyl (2-amino-3-phenylpropy!)carbamate (0.75 g, 3.0 mmol)[prepared in Example 76] for 1,1-dimethylethyl (3-amino-3-phenylpropyl)carbamate : LC-MS (ES) m/z = 377 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.38 (br s, 1 H), 7.92 (m, 1 H), 7.82 (m, 1 H), 7.69 (m, 2H), 7.33 (m, 4H), 7.25 (m, 1 H), 7.12 (m, 1 H)1 4.59 (m, 1 H), 3.25 (m, 1H), 3.17 (m, 1H) and 3.03 (m, 2H).
Example 159
Preparation of N-IY2S>2-amino-3-phenylpropyll-5-(1 H-pyrrolor2.3-blDyridin-4-yl')-2- thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 15, except substituting 5-bromo-2-thiophenecarboxylic acid (0.05 g, 0.25 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and 1 ,1- dimethylethyl [(1 S)-2-amino-1-(phenylmethyl)ethyl]carbamate (0.06 g, 0.25 mmol)[prepared from N-{[(1,1-dimethylethyl)oxy]carbonyl}-L-phenylalanine according to Example 7] for 1,1-dimethylethy) (3-amino-3-phenylpropyl)carbamate : LC-MS (ES) m/z = 377 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.36 (br s, 1 H), 7.92 (m, 1 H), 7.84 (m, 1 H), 7.69 (m, 1 H), 7.65 (m, 1 H), 7.38 (m, 5H), 7.11 (m, 1 H), 3.73 (m, 1 H), 3.64 (m, 2H) and 3.04 (m, 2H).
Example 160
Preparation of N-r(2RV2-amino-3-phenylpropyπ-4-bromo-5-(1 H-pyrrolor2,3- blpyridin-4-ylV2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 15, except substituting 1 ,1-dimethylethyl [(1 f?)-2-amino-1- (phenylmethyl)ethyl]carbamate (0.063 g, 0.25 mmol)[prepared from N-{[(1, 1- dimethylethyl)oxy]carbonyl}-D-phenylalanine according to Example 7] for 1,1 - dimethylethyl (3-amino-3-phenylpropyl)carbamate : LC-MS (ES) m/z = 456 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.38 (m, 1 H), 7.80 (m, 1 H), 7.61 (m, 1 H), 7.47 (m, 6H), 6.7 (m, 1H), 3.73 (m, 1H), 3.62 (m, 2H) and 3.03 (m, 2H).
Preparation of N-f(2SV2-amino-3-phenylproDvπ-4-bromQ-5-(1 H-pyrrolor2.3- biPyridin-4-vO-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 15, except substituting 1 ,1 -dimethylethyl [(1 S)-2-amino-1- (phenylmethyl)ethyl]carbamate (0.063 g, 0.25 mmol)[prepared from N-{[(1,1- dimethylethyl)oxy]carbonyl}-L-phenylalanine according to Example 7] for 1,1- dimethylethyl (3-amino-3-phenylpropyl)carbamate : LC-MS (ES) m/z = 456 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.39 (s, 1 H), 7.80 (m, 1 H), 7.63 (m, 1 H), 7.5(m, 1 H), 7.41 (m, 5H), 6.72 (m, 1H), 3.77 (m, 1H), 3.47 (m, 2H) and 3.03 (m, 2H).
Example 162
Preparation of N-Ff2R>2-amino-3-phenylpropyll-5-f 1 H-pyrrolof2.3-b1pyridin-4-yl)-2- thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 15, except substituting 5-bromo-2-thiophenecarboxylic acid (0.052 g, 0.25 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and 1 ,1- dimethylethyl [(1f?)-2-amino-1-(phenylmethyl)ethyl]carbamate (0.063 g, 0.25 mmol)[prepared from N-{[(1,1-dimethylethyl)oxy]carbonyl}-D-phenylalanine according to Example 7] for 1 ,1 -dimethylethyl (3-amino-3-phenylpropyl)carbamate : LC-MS (ES) m/z = 377 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.36 (br s, 1 H), 7.12 (m, 1 H), 7.84 (m, 1 H), 7.67 (m, 2H), 7.38 (m, 5H), 7.11 (m, 1 H), 3.74 (m, 1 H), 3.66 (m, 2H) and 3.03 (m, 2H).
Example 163
Preparation of N-(3-amino-1-phenylpropyl)-5-(1 H-pyrrolor2,3-b1pyridin-3-vD-2- thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 15, except substituting 5-bromo-2-thiophenecarboxylic acid (0.052 g, 0.25 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and 1,1- dimethylethyl (3-amino-3-pheny)propyl)carbamate (0.063 g, 0.25 mmol)[prepared from preparation 6 and following Example 7] for 1 ,1-dimethylethyl (3-amino-3- phenylpropyl)carbamate : LC-MS (ES) m/z = 377 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.64 (m, 1 H), 8.4 (br s, 1 H), 7.96 (m, 1 H), 7.84 (s, 1 H), 7.49 (m, 6H), 7.34 (m, 1 H), 5.25 (m, 1 H), 3.12 (m, 1H), 3.0 (m, 1 H) and 2.35 (m, 2H).
Example 164
Preparation of N-F2-3mino-1-(4-fluorophenv0ethvπ-4-bromo-5-(1 H-pyrrolor2,3- blπyridine-3-ylV2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 15, except substituting 1 ,1-dimethylethyl [2-amino-2-(4- fluorophenyl)ethy!]carbamate (0.064 g, 0.25 mmol)[prepared from 4- fluorobenzaldehyde following preparation 9] for 1 ,1-dimethylethyl (3-amino-3- phenylpropyDcarbamate : LC-MS (ES) m/z = 460 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.34 (br s, 1 H), 7.94 (m, 1 H), 7.53 (m, 3H), 7.4 (m, 1 H), 7.21 (m, 2H), 7.64 (m, 1 H), 5.45 (m, 1H) and 3.48 (m, 2H). Example 165
Preparation of N-r2-amino-1-(4-fluorophenyl)ethvn-5-(1H-pyrrolor2.3-blpyridin-3-yl)- 2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 15, except substituting δ-bromo^-thiophenecarboxylic acid (0.052 g, 0.25 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and 1 ,1- dimethyl ethyl [2-amino-2-(4-fluorophenyl)ethyl]carbamate (0.064 g, 0.25 mmol)
[prepared from 4-fluorobenzaldehyde following preparation 9] for 1,1-dimethylethyl (3-amino-3-phenylpropyl)carbamate : LC-MS (ES) m/z = 381 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.3 (m, 1 H), 7.95 (m, 2H), 7.68 (m, 2H), 7.54 (m, 2H), 7.15 (m, 3H), 5.49 (m, 1 H) and 3.5 (m, 2H).
Example 166
Preparation of N42-amino-1-(2-fluoroDhenvπethvπ-5-(1 H-pyrrolo[2,3-blpyridin-3-vπ- 2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 15, except substituting 5-bromo-2-thiophenecarboxylic acid (0.052 g, 0.25 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and 1 ,1- dimethylethyl [2-amino-2-(2-fluorophenyl)ethyl]carbamate (0.064 g, 0.25 mmol) [prepared from 2-fluorobenzaldehyde following preparation 9] for 1,1-dimethylethyl (3-amino-3-phenylpropyl)carbamate : LC-MS (ES) m/z = 381 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.36 (m, 1 H), 7.97 (m, 2H), 7.69 (m, 2H), 7.58 (m, 1H), 7.46 (m, 1 H), 7.26 (m, 2H), 7.12 (m, 1H), 5.78 (m, 1 H) and 3.51 (m, 2H).
Example 167
Preparation of N-r2-amino-1-(2-fluoroDhenvnethvπ-4-bromo-5-(1 H-pyrrolor2.3- b1pyridin-3-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 15, except substituting 1 ,1-dimethylethyl [2-amino-2-(2- fluorophenyl)ethyl]carbamate (0.064 g, 0.25 mmol) [prepared from 2- fluorobenzaldehyde following preparation 9] for 1,1-dimethylethyl (3-amino-3- phenylpropyl)carbamate : LC-MS (ES) m/z = 460 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.36 (m, 1 H), 7.99 (s, 1 H), 7.56 (m, 2H), 7.45 (m, 2H), 7.26 (m, 2H), 6.68 (m, 1 H), 5.74 (m, 1 H) and 3.5 (m, 2H).
Example 168
Preparation of N-r2-amino-1-(3-fluorophenvπethvπ-4-bromo-5-(1 H-pyrrolof2.3- blpyridin-3-vO-2-thiophenecarboxamide
The title compound was prepared as a brown solid according to the procedure of Example 15, except substituting 1 ,1-dimethylethyl [2-amino~2-(3- fluorophenyl)ethyl]carbamate (0.064 g, 0.25 mmol) [prepared from 3- fluorobenzaldehyde following preparation 9] for 1 ,1-dimethylethyl (3-amino-3- phenylpropyl)carbamate : LC-MS (ES) m/z = 460 (M+H)\ 1H NMR (CD3OD, 400 MHz) δ 8.38 (m, 1H), 7.98 (m, 1H), 7.63 (m, 1 H), 7.51 (m, 2H), 7.3 (m, 2H), 7.14 (m, 1 H), 6.75 (m, 1 H), 5.48 (m, 1 H) and 3.49 (m, 2H).
Example 169
Preparation of N-r2-amino-1-(3-fluorophenylkithvπ-5-(1 H-pyrrolor2.3-b1pyridin-3-yl)- 2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 15, except substituting 5-bromo-2-thiophenecarboxylic acid (0.052 g, 0.25 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and 1 ,1- dimethylethyl [2-amino-3-fluorophenyl)ethyl]carbamate (0.064 g, 0.25 mmo!) [prepared from 3-fluorobenzaldehyde following preparation 9] for 1,1-dimethylethyl (3-amino-3-phenylpropyl)carbamate : LC-MS (ES) m/z = 381 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.37 (m, 1 H), 7.99 (m, 2H), 7.72 (m, 2H), 7.48 (m, 1H), 7.34 (m, 1 H), 7.28 (m, 1), 7.14(m, 2), 5.51 m, 1 H) and 3.51 (m, 2H).
Example 170
Preparation of N-rf2RV2-amino-3-(3-flυorophenvπpropyll-4-bromo-5-(1 H- pyrrolor2.3-b1Pyridin-4-vO-2-thiophenecarboxamide
The title compound was prepared as a brown solid according to the procedure of Example 43, except substituting 2-[(2/?)-2-amino-3-(3- fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione (0.075 g, 0.25 mmol) )[prepared from N-{[(1 ,1-dimethylethyl)oxy]carbonyl}-3-fluoro-D-phenylalanine following Example 7] for 2-[(2S)-2-amino-3-phenylpropyl]-1 /-/-isoindole-1 ,3(2H)-dione: LC-MS (ES) m/z = 474 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.41(m, 1H), 7.85 (m, 1H), 7.67 (m, 1 H), 7.52 (m, 1 H), 7.44 (m, 1 H), 7.19 (m, 2H), 7.09 (m, 1 H), 6.75 (m, 1 H), 3.78 (m, 1 H), 3.66 (m, 2H) and 3.08 (m, 2H).
Preparation of N-((1 R)-2-amino-14(2-fluorophenv0methyriethyl}-4-brorno-5-(1 H- pyrrolor2.3-blPyridin-4-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 43, except substituting 2-[(2S)-2-amino-3-(2- fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione (0.075 g, 0.25 mmol) )[prepared from N-{[(1 ,1-dimethylethyl)oxy]carbonyl}-2-fluoro-D-phenylalanine following preparation 7] for 2-[(2S)-2-amino-3-phenylpropyl]-1/-/-isoindole-1,3(2/-/)-dione : LC- MS (ES) m/z = 474 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.36(m, 1 H), 7.8 (m, 1H), 7.61 (m, 1 H), 7.49 (m, 1H), 7.32 (m, 2H), 7.14 (m, 2H), 6.7 (m, 1 H), 4.61 (m, 1 H), 3.27 (m, 1 H), 3.16 (m, 2H) and 3.03 (m, 1 H).
Example 172
Preparation of N-{(1 R)-2-amino-1-r(3-fluorophenvDmethvπethyl}-4-bromo-5-(1 H- pyrrolo[2,3-blpyridin-4-vπ-2-thioρhenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 43, except substituting 2-[(2S)-2-amino-3-(3- fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione (0.075 g, 0.25 mmol) )[prepared from N-{[(1 , 1 -dimethylethyl)oxy]carbonyl}-3-fluoro-D-pheny!alanine following preparation 7] for 2-[(2/:?)-2-amino-3-phenylpropyl]-1 H-isoindoie-1,3(2H)-dione : LC- MS (ES) m/z = 474 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.4(m, 1 H), 7.8 (m, 1 H), 7.65 (m, 1 H), 7.52 (m, 1H), 7.37 (m, 1H), 7.13 (m, 2H), 7.0 (m, 1 H), 6.74 (m, 1 H), 4.6 (m, 1 H), 3.26 (m, 1 H), 3.15 (m, 1 H) and 3.01 (m, 2H).
Preparation of N-K 1 RV2-amino-1-K3-fluorophenvnmethvnethv[V-5-n H-pyrrolor2.3- blpyridin-4-vπ-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 43, except substituting 5-bromo-2-thiophenecarboxylic acid (0.052 g, 0.25 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and 2-[(2S)-2- amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione (0.075 g, 0.25 mmol) )[prepared from N-{[(1 ,1-dimethylethyl)oxy]carbonyl}-3-fluoro-D-phenylalanine following preparation 7] for 2-[(2S)-2-amino-3-phenylpropyl]-1H-isoindole-1 ,3(2H)- dione : LC-MS (ES) m/z = 395 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.33(m, 1 H), 7.88 (m, 1 H)1 7.81 (m, 1 H), 7.67 (m, 1 H)5 7.61 (m, 1 H), 7.34 (m, 1 H), 7.11 (m, 3H), 6.99 (m, 1H), 4.59 (m, 1H), 3.27 (m, 1H), 3.17 (m, 1 H) and 3.02 (m, 2H).
Example 174
Preparation of N-K 1 Sy2-amino-H(3-fluorophenv0methyllethylV4-bromo-5-(1 H- pyrrolor2,3-b1pyridin-4-vπ-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 43, except substituting 2-[(2S)-2-amino-3-(3- fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione (0.075 g, 0.25 mmol) )[prepared from N-{[(1 ,1-dimethylethyl)oxy]carbonyl}-3-fluoro-L-phenylalanine following preparation 7] for 2-[(2S)-2-amino-3-phenylpropyl]-1 H-isoindole-1 ,3(2H)-dione : LC- MS (ES) m/z = 474 (M+H)\ 1H NMR (CD3OD, 400 MHz) δ 8.36(m, 1 H), 7.79 (m, 1 H), 7.6 (m, 1 H), 7.46 (m, 1 H), 7.35 (m, 1 H), 7.11 (m, 2H), 7.0 (m, 1 H), 6.68 (m, 1 H), 4.57 (m, 1 H), 3.26 (m, 1H), 3.15 (m, 1H) and 3.02 (m, 2H).
Example 175
Preparation of N-((1S)-2-amino-1-r(3-fluorophenyl)methyllethyl}-5-(1 H-pyrrolor2.3- blpyridin-4-ylV2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 43, except substituting 5-bromo-2-thiophenecarboxylic acid (0.052 g, 0.25 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and 2-[(2S)-2- amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione (0.075 g, 0.25 mmol) )[prepared from N-{[(1 , 1 -dimethylethyl)oxy]carbonyl}-3-fluoro-L-phenylalanine following preparation 7] for 2-[(2S)-2-amino-3-phenylpropyl]-1/7-isoindole-1 ,3(2/7)- dione : LC-MS (ES) m/z = 395 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.35(m, 1 H), 7.92 (m, 1 H), 7.82 (m, 1 H), 7.68 (m, 2H), 7.33 (m, 1 H), 7.12 (m, 3H), 6.99 (m, 1 H), 4.58 (m, 1 H), 3.27 (m, 1H), 3.18 (m, 1 H) and 3.03 (m, 2H).
Example 176
Preparation of N-f(1 S)-2-amino-1-r(2-fluorophenvnmethyl1ethyl)-5-(1 H-pyrrolor2,3- b1pyridin-4-ylV2-thiophenecarboxamidβ
The title compound was prepared as a yellow solid according to the procedure of Example 43, except substituting 5~bromo-2-thiophenecarboxylic acid (0.052 g, 0.25 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and 2-[(2S)-2- amino-3-(2-fluorophenyl)propyl]-1 H-isoindole-1 ,3(2H)-dione (0.075 g, 0.25 mmol) )[prepared from N-{[(1 , 1 -dimethylethyl)oxy]carbonyl}-2-fluoro-L-phenylalanine following preparation 7] for 2-[(2S)-2-amino-3-phenylpropyl]-1H-isoindole-1 ,3(2H)- dione : LC-MS (ES) m/z = 395 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.37(m, 1 H), 7.96 (m, 1 H), 7.84 (m, 1 H), 7.72 (m, 2H), 7.36 (m, 1 H), 7.3 (m, 1 H), 7.11 (m, 3H), 4.63 (m, 1 H), 3.21 (m, 3H) and 3.03 (m, 1 H).
Example 177
Preparation of N~f(1 R)-2-amino-1-r(2-fluorophenv0methvπethyl}-4-bromo-5-(1 H- pyrrolor2,3-biPyridin-4-vD-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 43, except substituting 2-[(2R)-2-amino-3-(2- fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione (0.075 g, 0.25 mmol) )[prepared from N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-fluoro-D-phenylalanine following preparation 7] for 2-[(2S)-2-amino-3-phenylpropyl]-1Λ/-isoindole-1,3(2H)-dione : LC- MS (ES) m/z = 474 (M+H)\ 1H NMR (CD3OD, 400 MHz) δ 8.38(m, 1 H), 7.81 (m, 1 H), 7.64 (m, 1 H), 7.51 (m, 1 H), 7.32 (m, 2H), 7.13 (m, 2H), 6.72 (m, 1 H), 4.61 (m, 1 H), 3.28 (m, 1 H), 3.21 (m, 1 H), 3.13 (m, 1 H) and 3.02 (m, 1 H).
Example 178
Preparation of N-Td RV2-amino-1-r(2-fluoroDhenvnmethyllethyl}-5-(1 H-oyrrolor2.3- blpyridin-4-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 43, except substituting 5-bromo-2-thiophenecarboxylic acid (0.052 g, 0.25 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and 2-[(2R)-2- amino-3-(2-fluorophenyl)propyl]-1 H-isoindole-1 ,3(2H)-dione (0.075 g, 0.25 mmol) )[prepared from N-{[(1 ,1-dimethylethyl)oxy]carbonyl}-2-fluoro-D-phenylalanine following preparation 7] for 2-[(2S)-2-amino-3-phenylpropyl]-1H-isoindole-1 ,3(2H)- dione : LC-MS (ES) m/z = 395 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.35(m, 1H), 7.91 (m, 1 H), 7.82 (m, 1 H), 7.66 (m, 2H), 7.33 (m, 2H), 7.12 (m, 3H), 4.63 (m, 1 H), 3.28 (m, 1 H), 3.17 (m, 2H) and 3.03 (m, 1 H).
Preparation of N-["2-amino-1-φhenylmethv0ethyll-3-r(3-aminopropyDoxyl-4-bromo- 5-(1 H-Pyrrolor2.3-b1pyridin-4-vπ-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 77, except substituting 1 ,1-dimethyIethyl (3- hydroxypropyl)carbamate (0.088 g, 0.5 mmol) for methanol: LC-MS (ES) m/z = 529 (M+H)\ 1H NMR (CD3OD, 400 MHz) δ 8.42(m, 1 H), 7.65 (m, 1 H), 7.51 (m, 1 H), 7.35 (m, 4H), 7.27 (m, 1 H), 6.76 (m, 1 H), 4.67 (m, 1 H), 4.01 (m, 1 H), 3.93 (m, 1 H), 3.29 (m, 2H), 3.20 (m, 2H), 3.08 (m, 2H) and 2.09 (m, 2H).
Example 180
Preparation of N-(2-amino-1-r(2,6-difluorophenyl)methyllethyl)-4-bromo-5-(1 H- Dyrrolor2.3-blDyridin-4-ylV2-thioρhenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 43, except substituting 2-[2-amino-3-(2,6- difluorophenyl)propyl]-1 H-isoindole-1 ,3(2H)-dione (0.126 g, 0.4 mmol)[prepared from N-{[(1 , 1 -dimethylethyl)oxy]carbonyl}-2,6-difluorophenylalanine following preparation 7] for 2-[(2S)-2-amino-3-phenylpropyl]-1H-isoindole-1,3(2H)-dione : LC- MS (ES) m/z = 492 (M+H)+, 1H NMR (CD3OD1 400 MHz) δ 8.37(m, 1 H), 7.80 (m, 1 H), 7.62 (m, 1 H), 7.47 (m, 1 H), 7.34 (m, 1 H), 7.01 (m, 2H)1 6.68 (m, 1 H), 4.62 (m, 1 H), 3.30 (m, 1 H), 3.25 (m, 1 H) and 3.10 (m, 2H).
Example 181
Preparation of N-{(1 SV2-amino-1-|"(3.5-difluorophenvπmethvnethyl}-4-bromo-5-(1 H- pyrrolor2,3-biPyridin-4-ylV2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 43, except substituting 2-[2-amino-3-(3,5- difluorophenyl)propyl]-1 H-isoindole-1 ,3(2H)-dione (0.126 g, 0.4 mmol)[prepared from N-{[(1,1-dimethylethyl)oxy]carbonyl}-3,5-difluoro-L-phenylalanine following preparation 7] for 2-[(2S)-2-amino-3-phenylpropyl]-1 H-isoindole-1 , 3(2H)-dione : LC-MS (ES) m/z = 492 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.37(m, 1 H), 7.83 (m, 1 H), 7.62 (m, 2H), 6.96 (m, 2H), 6.82 (m, 2H), 4.58 (m, 1 H), 3.27 (m, 1 H), 3.18 (m, 1 H), 3.05 (m, 1 H) and 2.98 (m, 1 H). Example 182
Preparation of N-{2-amino-1-r(3,5-difluorophenyl)methyllethylV-5-(1 H-pyrrolor2,3- blpyridin-4-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 43, except substituting 5-bromo-2~thiophenecarboxylic acid (0.082 g, 0.4 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and 2-[2-amino-3- (3,5-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (0.126 g, 0.4 mmol)[prepared from N-{[(1,1-dimethylethyl)oxy]carbonyl}-2,6-difluorophenylalanine following preparation 7] for 2-[(2S)-2-amino-3-phenylpropyl]-1/-/-isoindole-1,3(2H)- dione : LC-MS (ES) m/z = 413 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.35(m, 1 H), 7.92 (m, 1 H), 7.82 (m, 1 H), 7.67 (m, 2H), 7.11 (m, 1 H), 6.97 (m, 2H), 6.85 (m, 1 H), 4.59 (m, 1 H), 3.27 (m, 1 H), 3.18 (m, 1H), 3.08 (m, 1 H) and 2.99 (m, 1 H).
Example 183
Preparation of N-(M sy2-amino-Mr3-(trifluoromethvnphenyl1methyl}ethviy5-(1 H- pyrrolor2.3-blpyridin-4-vD-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 43, except substituting 5-bromo-2-thiophenecarboxylic acid (0.102 g, 0.5 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and 2-{(2S)-2- amino-3-[3-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione (0.174 g, 0.5 mmol)[prepared from N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L- phenylalanine following preparation 7] for 2-[(2S)-2-amino-3-phenylpropyl]-1 f/- isoindole-1,3(2H)-dione : LC-MS (ES) m/z = 445 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.43(m, 1 H), 8.05 (m, 1 H), 7.95 (m, 1 H), 7.87 (m, 1 H), 7.82 (m, 1 H), 7.68 (m, 1 H), 7.62 (m, 1H), 7.53 (m, 2H), 7.27 (m, 1H), 4.61 (m, 1H), 3.27 (m, 2H) and 3.14 (m, 2H). Example 184
Preparation of N-((1 S)-2-amino-1-ir3-αrifluoromethyl)phenyllmethyl}ethyl)-4-bromo- 5-(1 H-pyrrolor213-b1pyridin-4-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 43, except substituting 2-{(2S)-2-amino-3-[3- (trifluoromethyl)phenyl]propyl}-1 H-isoindole-1 ,3(2H)-dione (0.174 g, 0.5 mmol)[prepared from N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L- phenylalanine following preparation 7] for 2-[(2S)-2-amino-3-phenylpropyl]-1A7- isoindole-1 ,3(2H)-dione : LC-MS (ES) m/z = 524 (M+H)+, 1H NMR (CD3OD, 400 MHz) 58.53 (m, 1H), 7.93 (m, 1H), 7.82 (m, 2H), 7.66 (m, 1H), 7.62 (m, 1H), 7.55 (m, 2H), 6.95 (m, 1H), 4.58 (m, 1 H) and 3.17 (m, 4H).
Example 185
Preparation of N-((1 SV2-amino-1-(r2-(trifluoromethyl)phenyllmethyl)ethylV4-bromo- 5-(1 H-pyrrolor2.3-blpyridin-4-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 43, except substituting 2-{(2S)-2-amino-3-[2- (trifluoromethyl)phenyl]propyl}-1 H-isoindole-1 ,3(2H)-dione (0.174 g, 0.5 mmol)[prepared from N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L- phenylalanine following preparation 7] for 2-[(2S)-2-amino-3-phenylpropyl]-1 H- isoindole-1 ,3(2H)-dione : LC-MS (ES) m/z = 524 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.57(m, 1 H), 8.07 (m, 1 H), 7.89 (m, 2H), 7.73 (m, 1 H), 7.59 (m, 2H), 7.45 (m, 1 H), 7.0 (m, 1 H), 4.69 (m, 1 H), 3.27 (m, 3H) and 3.18 (m, 1 H).
Example 186
Preparation of N-((1 S)-2-amino-1-fr2-(trifluoromethvnphenvnmethyl}ethylV5-(1 H- Pyrrolor2.3-b1PVridin-4-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 43, except substituting 5~bromo-2-thiophenecarboxy!ic acid (0.102 g, 0.5 mmol) for 4,5-dibromo-2-thiophenecarboxyiic acid and 2-{(2S)-2- amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione (0.174 g, 0.5 mmol)[prepared from N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L- phenylalanine following preparation 7] for 2-[(2S)-2-amino-3-phenylpropyl]-1H- isoindole-1 ,3(2H)-dione : LC-MS (ES) m/z = 445 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.46(m, 1 H), 8.09 (m, 2H), 7.89 (m, 1 H), 7.83 (m, 1 H), 7.72 (m, 1 H), 7.63 (m, 1H), 7.54 (m, 1H), 7.44 (m, 1H), 7.27 (m, 1H), 4.72 (m, 1H) and 3.21 (m, 4H).
Example 187
Preparation of N-f2-amino-1-r(2,6-difluorophenyl)methvπethyl}-5-(1 H-pyrrolor2.3- b1pyridin-4-vD-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 43, except substituting 5-bromo-2-thiophenecarboxylic acid (0.08 g, 0.4 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and 2-[2-amino-3- (2,6-difluorophenyl)propyl]-1 H-isoindoIe-1,3(2H)-dione (0.126 g, 0.4 mmol)[prepared from N-{[(1,1-dimethylethyl)oxy]carbonyl}-2,6-difluorophenylalanine following preparation 7] for 2-[(2S)-2-amino-3-phenylpropyl]-1H-isoindole-1 ,3(2H)- dione : LC-MS (ES) m/z = 413 (M+H)+, 1H NMR (CD3OD5 400 MHz) δ 8.36(m, 1 H), 7.92 (m, 1 H), 7.82 (m, 1 H), 7.68 (m, 2H), 7.31 (m, 1 H), 7.1 1 (m, 1 H), 6.98 (m, 2H), 4.66 (m, 1 H), 3.26 (m, 2H) and 3.12 (m, 2H).
Example 188
Preparation of N-rπS)-2-amino-1-(4-pyridinylmethyl)ethyll-4-bromo-5-(1 H- PVrrolor2,3-blPVridiπ-4-vπ-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 43, except substituting 2-[(2S)-2-amino-3-(4-pyridinyl)propyl]- 1 H-isoindole-1,3(2H)-dione (0.086 g, 0.3 mmol)[prepared from N-{[(1,1- dimethylethyl)oxy]carbonyl}-3-(4-pyridinyl)-L-alanine following preparation 7] for 2- [(2S)-2-amino-3-phenylpropyl]-1H-isoindole-1,3(2H)-dione : LC-MS (ES) m/z = 457 (M+H)\ 1H NMR (CD3OD, 400 MHz) δ 8.80(m, 2H), 8.39 (m, 1 H)1 8.04 (m, 2H), 7.85 (m, 1 H), 7.66 (m, 1 H)1 7.52 (m, 1 H), 6.66 (m, 1H), 4.79 (m, 1 H), 3.41 (m, 2H) and 3.29 (m, 2H).
Example 189
Preparation of N-r(1S)-2-amino-1-f4-pyridinylmethyl)ethvπ-5-(1 H-ρyrrolor2,3- b~|pyridin-4-vO-2-triiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 43, except substituting 5-bromo-2-thiophenecarboxylic acid (0.062 g, 0.3 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and 2-[(2S)-2- amino-3-(4-pyridinyl)propyl]-1 H-isoindoie-1,3(2H)-dione (0.086 g, 0.3 mmol)[prepared from N-{[(1 ,1-dimethylethyl)oxy]carbonyl}-3-(4-pyridinyl)-L-alanine following preparation 7] for 2-[(2S)-2-amino-3-phenylpropyl]-1 H-isoindole-1 , 3(2 H)- dione : LC-MS (ES) m/z = 378 (M+H)\ 1H NMR (CD3OD, 400 MHz) δ 8.80(m, 2H), 8.4 (m, 1 H), 8.11 (m, 2H), 7.94 (m, 1 H), 7.89 (m, 1 H), 7.72 (m, 2H), 7.19 (m, 1 H), 4.82 (m, 1 H) and 3.42 (m, 4H).
Example 190
Preparation of N-((1 S)-2-amino-1-fr2-(trifluoromethvnphenvnmethyl)ethv0-5-(1 H- pyrrolor2.3-b1Pyridin-4-vπ-2-furancarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 43, except substituting δ-bromo^-thiophenecarboxylic acid (0.062 g, 0.3 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and 2-{(2S)-2- amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione (0.104 g, 0.3 mmol)[prepared from N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L- phenylalanine following preparation 7] for 2-[(2S)-2-amino-3-phenylpropyl]-1 Λ/- isoindole-1 ,3(2H)-dione : LC-MS (ES) m/z = 378 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.50(d, J =4Hz, 1 H), 8.24 (d, J=8Hz, 1 H), 7.84 (d, J=4Hz, 1 H), 7.78 (d, J =4Hz , 1 H)1 7.71 (d, J=8Hz ,1H), 7.64 (d, J=8Hz, 1 H), 7.53 (m, 2H), 7.42 (m, 2H), 4.77 (m, 1 H), 3.42 (m, 1 H) and 3.27 (m, 3H).
Example 191
Preparation of N-((1 SV2-amino-1-ir2-(trifluoromethyl)phenyllmethyl>ethylV4-bromo- 3-(methyloxyV5-(1 H-pyrrolor2.3-b1pyridin-4-yl)-2-furancarboxamide
The title compound was prepared as a yellow solid according to the procedure of
Example 77, except substituting 2-{(2S)-2-amino-3-[2-
(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1 ,3(2H)-dione (0.105 g, 0.3 mmol) ^prepared from N-{[(1 ,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L- phenylalanine following preparation 7] for 1 , 1-dimethylethyl (2-amino-3- phenylpropyl)carbamate: LC-MS (ES) m/z = 554 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8.34 (m, 1 H), 7.88 (m, 1 H), 7.76 (m, 1 H), 7.60 (m, 2H), 7.48 (m, 1H), 7.38 (m, 1 H), 6.66 (m, 1 H), 4.78 (m, 1 H), 3.96 (m, 3H), 3.39 (m, 1 H) and 3.27 (m, 3H). Example 192 - Capsule Composition
An oral dosage form for administering the present invention is produced by filing a standard two piece hard gelatin capsule with the ingredients in the proportions shown in Table I, below.
Table I
INGREDIENTS AMOUNTS
3-amino-2-phenyl-/V-[4-(1H-pyrrolo[2,3-ό]pyridin-3-yl)-2- 25 mg thienyl]propanamide
(Compound of Example 1)
Lactose 55 mg
Talc 16 mg
Magnesium Stearate 4 mg
Example 193 - Injectable Parenteral Composition
An injectable form for administering the present invention is produced by stirring 1.5% by weight of 4-bromo-N-[2-(methylamino)-1-phenylethyl]-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide (Compound of Example 10) in 10% by volume propylene glycol in water.
Example 194- Tablet Composition
The sucrose, calcium sulfate dihydrate and an Akt inhibitor as shown in Table Il below, are mixed and granulated in the proportions shown with a 10% gelatin solution. The wet granules are screened, dried, mixed with the starch, talc and stearic acid;, screened and compressed into a tablet.
Table Il
INGREDIENTS AMOUNTS
3-amino-2-phenyl-Λ/-[4-(1H-pyrrolo[2,3-b]pyridin-4-yl)-2- 20 mg thienyl]propanamide (Compound of Example 21) calcium sulfate dihydrate 30 mg sucrose 4 mg starch 2 mg talc 1 mg stearic acid 0.5 mg
While the preferred embodiments of the invention are illustrated by the above, it is to be understood that the invention is not limited to the precise instructions herein disclosed and that the right to all modifications coming within the scope of the following claims is reserved.

Claims

What is claimed is:
1. A compound of Formula (I):
0) wherein:
V is selected from the group consisting of: CH and N;
Z is selected from the group consisting of: CR and N, where R is selected
20 20 from: hydrogen, -CO2 R and Ci-3alkyl, where R is selected from: hydrogen and
Ci_3alkyl;
5 10 W, X and Y are selected from the group consisting of CR , CR and N, where R is selected from: hydrogen, Ci-3alkyl, aryl, heteroaryl, -CO2R , -CN and -COR , and R is a substituent of Formula (X):
where:
1 2ft
R and R are independently selected from: hydrogen, halogen, aryl, substituted aryl, heteroaryl, substituted heteroaryl, Ci-3alkyl, -
14 1 *ϊ ^O
NR R , cyano, and -OR , L1 is selected from: -NR6CO-, -CONR6-, -NRδSθ2-, -SO2NR6-, -NR6CH2-,
-CH2NR6-, -CH=CH-, -CF=CH- and -CH=CF-, 2 R is selected from: hydrogen, -(CH2)m-ai"yl, -(CH2)m-C3~7cycloalkyl, Ci_
3alkyl, substituted -(CH2)m-aryl, substituted -(CH2)m-C3-7cycloalkyl and substituted Ci_3alkyl, where m is 0 to 4,
25 25 3 4
R is hydrogen or R is taken together with R or R to form a 4 to 7 member carbocyclic ring optionally containing 1 additional heteroatom,
3 4 3
R and R are independently selected from: hydrogen and Ci_5alkyl, or R
4 and R taken together with the nitrogen to which they are attached form a 4 to 6 member carbocyclic ring, optionally containing 1 or 2 additional heteroatoms, or R or R is taken together with R to form a 4 to 7 member carbocyclic ring optionally containing 1 additional heteroatom, and
Q is selected from: -(CH2)paryl(CH2)p-, substituted -(CH2)paryl(CH2)p- and -(CH2)n-. where p is 0 to 4 and n is 0 to 4 and when n is not 0, the - (CH2)rr group is optionally substituted by oxo, where R is selected from the group consisting of: hydrogen and Ci-
3alkyl,
30 R is selected from the group consisting of: hydrogen, -
PR ?7 Pfi P7
(CH2)qNR R and Chalky!, where q is 0 to 4 and R and R are
26 27 selected from hydrogen and C-j-salkyl, or R and R taken together with the nitrogen to which they are attached form a 4 to 6 member carbocyclic ring, optionally containing 1 or 2 additional heteroatoms, and
14 15
R and R are independently selected from: hydrogen and C-|-
3alkyl, and where R is selected from: hydrogen and Ci-3alkyl; 10 provided that one and only one of W, X and Y is CR ; and provided that no more than 3 of V, W, X, Y and Z are N.
2. A pharmaceutically acceptable salt, hydrate, solvate or pro- drug of a compound of Formula (I), as described in claim 1.
3. A compound of Claim 1 represented by the following Formula (Ia):
wherein:
7 7 20 20
Z is CR , where R is selected from: hydrogen and -CO2R , where R is selected from: hydrogen and C-|-3alkyl;
5 10 W, X and Y are selected from the group consisting of CR , CR and N, where R is selected from: hydrogen, Ci_3alkyl, aryl, heteroaryl, -CO2R , -CN and
8 10
-COR , and R is a substituent of Formula (X):
where: R is selected from: hydrogen, halogen, aryl, substituted aryl, heteroaryl, substituted heteroaryl, C 1-3 alkyl, -NR R , cyano and -OR , L1 is selected from: -NR6CO-, -CONR6-, -NR6Sθ2-, -SO2NR6-, -NR6CH2-, -CH2NR6-, -CH=CH-, -CF=CH- and -CH=CF-, 2 R is selected from: hydrogen, -(CH2)m-ai"yl, -(CH2)m-C3-7cycloalkyl, C-i_
3alkyl, substituted -(CH2)m-aryl- substituted -(CH2)m-C3-7cycloalkyl and substituted Ci_3alkyl, where m is 0 to 4,
25 25 3 4
R is hydrogen or R is taken together with R or R to form a 4 to 7 member carbocyclic ring,
3 4 3
R and R are independently selected from: hydrogen and Ci_5alkyl, or R
4 and R taken together with the nitrogen to which they are attached form a 4 to 6 member carbocyclic ring, optionally containing 1 or 2
3 4 25 additional heteroatoms, or R or R is taken together with R to form a 4 to 7 member carbocyclic ring, and
Q is selected from: -(CH2)paryl(CH2)p-, substituted -(CH2)paryl(CH2)p- and
-(CH2)n-: where p is 0 to 4 and n is 0 to 4 and when n is not 0, the - (CH2)rr group is optionally substituted by oxo, where R is selected from the group consisting of: hydrogen and C-|- 3alkyl,
30 R is selected from the group consisting of: hydrogen, -
(CH2)qNR R and Ci-3alkyl, where q is 0 to 4 and R and R are Q7 selected from hydrogen and Ci-salkyl, or R and R taken together with the nitrogen to which they are attached form a 4 to 6 member carbocyclic ring, optionally containing 1 or 2 additional heteroatoms, and
14 15
R and R are independently selected from: hydrogen and Ci-
3alkyl, and
8 where R is selected from: hydrogen and Ci-3alkyl;
10 provided that one and only one of W, X and Y is CR ; and provided that no more than 3 of W, X, Y and Z are N.
4. A pharmaceutically acceptable salt, hydrate, solvate or prodrug of a compound of Formula (Ia), as described in claim 3.
5. A compound of Claim 3 wherein:
7 7 20 20
Z is CR , where R is selected from: hydrogen and -CO2R , where R is selected from: hydrogen and Ci-3alkyl;
5 10
W, X and Y are selected from the group consisting of CR and CR , where
5 10
R is hydrogen, and R is a substituent of Formula (X):
where:
R is selected from: hydrogen, halogen, aryl, heteroaryl and cyano,
L is selected from: -NR CO- and -CONR -,
2 R is selected from: hydrogen, -(CH2)rrrary'. substituted -(CH2)rrraryl> where m is 0 to 4,
25 25 3 4
R is hydrogen or R is taken together with R or R to form a 4 to 7 member carbocyclic ring,
3 4 3
R and R are independently selected from: hydrogen and C-|-5alkyl, or R
4 and R taken together with the nitrogen to which they are attached form a 4 to 6 member carbocyclic ring, optionally containing 1 or 2
3 4 25 additional heteroatoms, or R or R is taken together with R to form a 4 to 7 member carbocyclic ring, and Q is selected from: -(CH2)paryl(CH2)p- and -(CH2)m where p is 0 to 4 and n is 0 to 4 and when n is not 0, the -(CH2)rr group is optionally substituted by oxo, where R is selected from the group consisting of: hydrogen and Ci_
3alkyl, and
10 provided that one and only one of W, X and Y is CR .
6. A pharmaceutically acceptable salt, hydrate, solvate or prodrug of a compound of Formula (Ia), as described in claim 5.
7. A compound of claim 1 selected from:
3-amino-2-phenyl-N-[4-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2- thienyl]propanamide;
3-amino-2-phenyl-Λ/-[5-(1/-/-pyrrolo[2,3-ib]pyridin-3-yl)-2- thienyl]propanamide;
4-amino-2-phenyl-Λ/-[4-(1/-/-pyrrolo[2,3-5]pyridin-3-yl)-2-thienyl]butanamide; 4-amino-2-phenyl-Λ/-[5-(1/-/-pyrrolo[2,3-b]pyridin-3-yl)-2-thienyl]butanamide;
3-amino-2-phenyl-N-[5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]propanamide;
4-amino-2-phenyl-N-[5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2-thienyl]butanamide;
N-(2-amino-1-phenylethyl)-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-(2-amino-1-phenylethyl)-4-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-(2-amino-1-phenylethyl)-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide; 4-bromo-N-[2-(methylamino)-1-phenylethyl]-5-(1 H-pyrroio[2,3-b]pyridin-4-yl)-
2-thiophenecarboxamide;
N-(2-amino-1-phenylethyl)-4-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2- thiophenecarboxamide;
N-(2-amino-1-phenylethyl)-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2- thiophenecarboxamide;
N-(2-amino-1-phenylethyl)-5-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2- thiophenecarboxamide;
N-(2-amino-1-phenylethyl)-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2- thiophenecarboxamide; N-(3-amino-1-phenylpropyl)-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-(3-amino-1-phenylpropyl)-4-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide; N-(3-amino-1 -phenylpropyl)-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-(3-amino-1-phenylpropyl)-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-(4-amino-1-phenylbutyl)-4-(1H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-(4-amino-1-phenylbutyl)-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
3-amino-2-phenyl-N-[4-(1/-/-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]propanamide; 4-amino-2-phenyl-Λ/-[4-(1H-pyrrolo[2,3-t)]pyridin-4-yl)-2-thienyl]butanannide;
Λ/-[4-(1H-pyrrolo[2,3-jb]pyridin-4-yl)-2-thienyl]phenylalaninamide;
2-amino-2-phenyl-Λ/-[4-(1/-/-pyrrolo[2,3-5]pyridin-4-yl)-2-thienyl]acetamide;
Λ/-[5-(1H-pyrrolo[2,3-6]pyridin-4-yl)-2-thienyllphenylalaninamide;
3-amino-2-(phenylmethyl)-Λ/-[5-(1H-pyrrolo[2>3-έ»]pyridin-4-yl)-2- thienyl]propanamide;
3-amino-Λ/-[4-bromo-5-(1H-pyrrolo[2,3-b]pyridin-4-yl)-2-thienyI]-2- phenylpropanamide;
3-amino-2-phenyl-N-[5-(1/-/-pyrrolo[2,3-jb]pyridin-4-yl)-3- thienyljpropanamide; ethyl 4-[5-({[2-(dimethylamino)-1-phenylethyl]amino}carbonyl)-2-thienyl]-1 H- pyrrolo[2,3-b]pyridine-2-carboxylate;
N-p-CDimethylaminoJ-i-phenylethyl^S-CI H-pyrroloP.S-bJpyridin^-yl)^- thiophenecarboxamide;
4-Phenyl-A/-t5-(1H-pyrrolo[2,3-ifci]pyridin-4-yl)-2-thienyl]-4- piperidinecarboxamide;
/V-{[5-(1 H-Pyrrolo[2,3-ό]pyridin-4-yl)-2-thienyl]carbonyl}tyrosinamide;
/V-[2-(4-Morpholinyl)-1-phenylethyl]-5-(1H-pyrrolo[2,3-ϋ]pyridin-4-yl)-2- thiophenecarboxamide;
Λ/-[2-Phenyl-2-(1-pyrrolidinyl)ethyl]-5-(1/-/-pyrrolo[2,3-ib]pyridin-4-yl)-2- thiophenecarboxamide;
Λ/-[(2-Aminophenyl)methyl]-5-(1/-/-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide; /V-[(3-Aminophenyl)methyl]-5-(1H-pyrrolo[2,3-ό]pyridin-4-yl)-2- thiophenecarboxamide;
A/-(2-Aminoethyl)-5-(1f/-pyrrolo[2,3-ιb]pyridin-4-yl)-2-thiophenecarboxamide;
N-(2-amino-1-phenylethyl)-4-(3-pyridinyl)-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
Λ/-(2-amino-1-phenylethyl)-4-(1H-pyrazol-4-yl)-5-(1/-/-pyrrolo[2,3-ό]pyridin-4- yl)-2-thiophenecarboxamide;
Λ/-(2-arnino-1-phenylethyl)-4-ethenyl-5-(1/-/-pyrrolo[2,3-ό]pyridin-4-yI)-2- thiophenecarboxamide; Λ/-(2-amino-1-phenylethyl)-4-cyclopropyl-5-(1 H-pyrrolo[2,3-6]pyridin-4-yl)-2- thiophenecarboxamide;
3-amino-Λ/-[4-bromo-5-(1H-pyrrolo[2,3-b]pyridin-3-yl)-2-thienyl]-2- phenylpropanamide;
Λ/-[(1 S)-2-amino-1-(phenylm6thyl)ethyl]-4-bromo-5-(1/V-pyrrolo[2,3-jb]pyridin- 4-yl)-2-thiophenecarboxamide;
/S/-[(1/R)-2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1/-/-pyrrolo[2,3-ib]pyridin- 4-yl)-2 -thiophenecarboxamide;
Λ/-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-(1/-/-pyrrolo[2,3-Jb]pyridin-4-yl)-2- thiophenecarboxamide; Λ/-[(1f?)-2-amino-1-(phenylmethyl)ethyl]-5-(1H-pyrrolo[2,3-5]pyridin-4-yl)-2- thiophenecarboxamide;
Λ/-[2-amino-1-(phenylmethyl)ethyl]-5-(3-phenyl-1 H-pyrrolo[2,3-t)]pyridin-4- yl)-2-thiophenecarboxamide;
A/-[2-amino-1-(phenylmethyl)ethyl]-4-(1/-/-pyrrolot2,3-5]pyridin-3-yl)-2- thiophenecarboxamide;
3-amino-N-[5-(3-furanyl)-4-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2-thienyl]-2- (phenylmethyl)propanamide;
3-amino-2-(phenylmethyl)-/V-[4-(1H-pyrrolo[2,3-b]pyridin-3-yl)-2- thienyl]propanamide; Λ/-[2-amino-1-(phenylmethyl)ethy!]-5-(1H-pyrrolo[2,3-b]pyridin-4-yl)-2- furancarboxamide;
Λ/-[2-amino-1-(phenylmethyl)ethyl]-5-(1/-/-pyrrolo[2,3-6]pyridin-3-yl)-2- furancarboxamide;
3-amino-Λ/-[5-(3-furanyl)-4-(1/-/-pyrrolo[2,3-ib]pyridin-3-yl)-2-thienyl]-2- phenylpropanamide; N-[(1 R)-2-amino-1-(phenylmethyl)ethyl]-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- furancarboxamide;
Λ/-[(1 S)-2-amino-1-(phenylmethyl)ethyl]-5-(1H-pyrrolo[2,3-fc»]pyridin-4-yl)-2- furancarboxamide; /V-[(1/:?)-2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1H-pyrrolo[2,3-b]pyridin-
4-yl)-2-furancarboxamide;
Λ/-[(1 S)-2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1/-/-pyrrolo[2,3-Jfc)]pyridin- 4-yl)-2-furancarboxamide;
Λ/-[(1 S)-2-amino-1 -phenylethyl]-4-bromo-5-(1 H-pyrrolo[2,3-ύ]pyridin-4-yl)-2- thiophenecarboxamide;
Λ/-[(1 f?)-2-amino-1-phenylethyl]-4-bromo-5-(1 H-pyrrolo[2J3-b]pyridin-4-yl)-2- thiophenecarboxamide;
Λ/-(2-amino-1-phenylethyl)-5-(1 H-pyrrolo[2,3-b]pyridin-4-y))-3- furancarboxamide; Λ/-(2-amino-1-phenylethyl)-5-(1H-pyrrolo[2,3-6]pyridin-3-yl)-3- furancarboxamide;
Λ/-[2-amino-1-(phenylmethyl)ethyl]-5-(1/-/-pyrrolo[2,3-b]pyridin-4-yl)-3- furancarboxamide;
Λ/-[2-amino-1-(phenylmethyl)ethyl]-5-(1 H-pyrrolo[2,3-/b]pyridin-3-yl)-3- furancarboxamide;
(2-amino-1-phenylethyl){[5-(1H-pyrrolo[2,3-b]pyridin-4-yi)-2- thienyl]methyl}amine;
N-(2-amino-1-phenylethyl)-4-phenyl-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide; N-(2-amino-1-phenylethyl)-4-methyl-5-(i H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-(2-amino-2-phenylethyl)-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-(2-amino-2-phenylethyl)-5-(1H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
(3-amino-2-phenylpropyl)[5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2-thienyI]amine;
3-amino-3-phenyl-N-[5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thienyl]propanamide;
4-amino-3-phenyl-N-[5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2-thienyI]butanamide; N-(2-amino-1-phenylethyl)-4-bromo-5-(3-phenyl-1 H-pyrrolo[2,3-b]pyridin-4- yl)-2-thiophenecarboxamide;
4-amino-4-phenyl-N-[5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2-thienyl]butanamide;
4-bromo-N-[2-(methylamino)-1-(phenylmethyl)ethyl]-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-4-bronno-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)- 2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-3-(methyloxy)-5-(1H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide; 3-[(2-aminoethyl)oxy]-N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-4-chloro-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)- 2-thiophenecarboxamide,-
N-(2-aminoethyl)-4-bromo-N-(phenylmethyl)-5-(1 H-pyrrolo[2,3-b]pyridin-4- yl)-2-thiophenecarboxamide;
N-(2-aminoethyl)-4-bromo-N-phenyl-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-3-fIuoro-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide; 4-bromo-N-[2-[(1-methylethyl)amino]-1-(phenylmethyl)ethyl]-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide;
4-bromo-N-[2-(ethylamino)-1-(phenylmethyl)ethyl]-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
3-{[2-amino-1-(phenylmethyl)Gthyl]oxy}-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-N-methyl-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-5-(6-amino-1 H-pyrrolo[2,3-b]pyridin-4-yl)- 2-thiophenecarboxamide; 3-[(2-aminoethyl)oxy]-N-[2-amino-1 -(phenylmethyl)ethy!]-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-5-(3-amino-1 H-pyrrolo[2,3-b]pyridin-4-yl)- 2-thiophenecarboxamide;
N-{4-[5-({[2-amino-1-(phenylmethyl)ethyl]amino}carbonyl)-2-thienyl]-1 H- pyrrolo[2,3-b]pyridin-3-yl}-3-furancarboxamide;
3-amino-N-[4-(2-chloro-1 H-pyrrolo[2,3-b]pyridin-3-yl)-2-thienyl]-2- phenylpropanamide; N-(2-amino-1-phenylethyl)-4-[2-(3-furanyl)-1 H-pyrrolo[2,3-b]pyridin-3-yl]-2- thiophenecarboxamide;
4-amino-N-[5-(3-furanyl)-4-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2-thienyl]-2- phenylbutanamide; 3-amino-2-(phenylmethyl)-N-[5-ρhenyl-4-(1 H-pyrrolot2,3-b]pyridin-3-yl)-2- thienyi]propanamide;
N-[2-amino-1-(phenylmethyl)ethyl]-5-(3-chloro-1 H-pyrrolo[2,3-b]pyridin-4-yl)- 2-thiophenecarboxamide;
N-(2-amino-1-phenylethyl)-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-3- thiophenecarboxamide;
N-(2-amino-1-phenylethyl)-5-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-3- thiophenecarboxamide;
N-^-amino-i-CphenylmethyOethyll-S-CI H-pyrroloβ.S-bjpyridin^-yO-S- thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-5-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-3- thiophenecarboxamide;
N-^IS^-amiπo-i-CcyclohexylmethylJethylM-bromo-δ^i H-pyrroloP.S- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-[(1 S)-2-amino-1 -(cyGlohexylmethy[)ethyl]-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)- 2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-5-(3-furanyl)-4-(1 H-pyrrolo[2,3-b]pyridin-
3-y I )-2-th i oph en eca rboxa m i d e;
3-amino-N-[5-(3-furanyl)-4-(2-methyl-1 H-pyrrolo[2,3-b]pyridin-3-yl)-2- thienyl]-2-(phenylmethyl)propanamide; 3-amino-2-(phenylmethyl)-Λ/-[4-(1H-pyrrolo[2,3-6]pyridin-4-yl)-2- thienyl]propanamide;
N-[2-amino-1-(phenylmethyl)ethyl]-3,4-dibromo-5-(1 H-pyrrolo[2,3-b]pyridin- 4-y I )-2-th i oph en eca rboxa m i d e ;
/V-[2-amino-1-(phenylmethyl)ethyl]-3-(4-methyIphenyl)-4-(1 H-pyrrolo[2,3- 6]pyridin-4-yl)-2-thiophenecarboxamide;
Λ/-[2-amino-1-(phθnylmethyI)ethyl]-3-(methyloxy)-4-(1/-/-pyrrolo[2,3-ιb]pyridin- 4-yl)-2-thiophenecarboxamide;
3-amino-Λ/-[4-bromo-5-(1H-pyrrolo[2,3-ό]pyridin-4-yl)-2-thienyl]-2- (phenylmethyl)propanamide; Λ/-[2-amino-1-(phenylmethyl)ethyl]-5-(1/-/-pyrazolo[3,4-d]pyrimidin-4-yl)-2- thiophenecarboxamide; 2-amino-1-(phenylmethyl)ethyl [4-bromσ-5-(1H-pyrrolo[2,3-6]pyridin-4-yl)-2- thienyl]carbamate;
4-[5-({[2-amino-1-(phenylmethyl)ethyl]amino}carbonyl)-2-thienyl]-Λ/-(2- furanylmethyl)-1/-/-pyrrolo[2,3-b]pyridine-3-carboxamicle; Λ/-[2-amino-1-(phenylmethyl)ethyl]-5-[2-(3-furanyl)-1 H-pyrrolo[2,3-ιb]pyridin-
4~yl]-2-thiophenecarboxa m id e;
Λ/-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-Λ/-hydroxy-5-(1H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide
Λ/-[2-amino-1-(phenylmethyl)ethyl]-Λ/-hydroxy-4-(1 H-pyrrolo[2,3-ib]pyridin-4- yl)-2-thiophenecarboxamide;
Λ/-[2-amino-1-(phenylmethyl)ethyl]-Λ/-hydroxy-3-(1 H-pyrrolo[2,3-fo]pyridin-3- yl)-2-thiophenecarboxamide;
Λ/-[2-amino-1-(phenylmethyl)ethyl]-Λ/-[(phenylmethyl)oxy]-4-(1H-pyrrolo[2,3- ό]pyridin-4-yl)-2-thiophen6carboxamide; Λ/-[2-amino-1-(phθnylmethyl)ethyl]-Λ/'-hydroxy-5-(1H-pyrrolo[2,3-ιf)]pyridin-4- yl)-2-thiophenecarboximidamide;
Λ/-[2-amino-1-(phenylmethyl)ethyl]-Λ/'-hydroxy-5-(1/-/-pyrrolo[2,3-jb]pyridin-4- yl)-2-thiophenecarboximidamide;
3-amino-2-(phenylmethyl)-Λ/-[5-(3-pyridinyl)-4-(1H-pyrrolo[2,3-b]pyridin-3-yl)- 2-thienyl]propanamide;
3-amino-Λ/-[5-(1 ,3-oxazol-2-yl)-4-(1H-pyrrolo[2,3-b]pyridin-3-yl)-2-thienyl]-2- (phenylmethyl)propanamide;
N-{2-amino-1-[2-(methyloxy)phenyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide; N-{2-amino-1-[3-(methyloxy)phenyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-{2-amino-1-[4-(methyloxy)phenyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-{2-amino-1-[2-(methyloxy)phenyl]ethyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiopheneGarboxamide;
N-{2-amino-1-[3-(methyloxy)phenyl]ethyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridine-4-yl)-2-thiophenecarboxamide;
N-{2-amino-1-[4-(methyloxy)phenyl]ethyl}-4-bromo-5-(1 H-pyrro!o[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide; N-{(1 R)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-fiuorophenyl)methyl]ethyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamicie N-[1-(aminomethyl)-3-phenylpropyl]-4-bromo-5-(1 H-pyrrolo[2,3-b]ρyridin-4- yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[4-(methyloxy)phenyl]methyl}ethyl)-4-bromo-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide;
N-((1 R)-2-amino-1-{[4-(methyloxy)phenyl]methyl}ethyl)-4-bromo-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide;
N-((1 R)-2-amino-1-{[4-(methyloxy)phenyl]methyl}ethyl)-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[4-(methyloxy)phenyl]methyl}ethyl)-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{(1 R)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[4-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[4-(trifluoromethyl)phenyl]methyI}ethyl)-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide;
3-[(2-aminoethyl)oxy]-N-(phenylmethyl)-5-(1H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide; 3-[(2-aminoethyl)oxy]-N-(3-pheπylpropyl)-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
3-[(2-aminoethyl)oxy]-N-(2-pheπylethyl)-5-(1H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-furancarboxamide;
N-((1 S)-2-amino-1 -{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-furancarboxamide;
S^-aminoethyOoxyJ^-bromo-N-CphenylmethyO-S-CI H-pyrroloP^-blpyridin- 4-y!)-2-thiophenecarboxamide; 3-[(2-aminoethyl)oxy]-4-bromo-N-(3-phenylpropyl)-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiopheπecarboxamide; 3-[(2-aminoethyl)oxy]-4-bromo-N-(2-phenylethyl)-5-(1 H-pyrrolo[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide;
N-{2-amino-1-[3-(trifluoromethyl)phenyl]ethyl}-5-(1 H-pyrrolo[2J3-b]pyridin-4- yl)-2-thiophenecarboxamide; N-{2-amino-1 -[3-(trifluorornethyl)phenyl]ethyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
4-bromo-N-[(1S)-2-hydroxy-1-(phenylmethyl)ethyl]-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamidei
N-KIS^-hydroxy-i-CphenylmethyOethyU-S-CI H-pyrrolop.S-bJpyridin^-yl)^- thiophenecarboxamide;
N-{2-amino-1-[2-(trifluoromethyl)phenyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyridin-4- yl)-2-thiophenecarboxamide;
N-{2-amino-1-[2-(trifluoromethyl)phenyl]Gthyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide; 3-[(2-aminoethyl)oxy]-A/-((1 S)-2-amino-1-{[3-
(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1/-/-pyrroIo[2,3-ib]pyridin-4-yl)-2- thiophenecarboxamide;
Λ/-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-3- (methyloxy)-5-(1H-pyrrolo[2,3-ό]pyridin-4-yl)-2-thiophenecarboxamide; ^-((IS^-amino-i-^S-CtrifluoromethyOphenyOmethyllethyO-S-Cmethyloxy^δ-
(1H-pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-4-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-[(2S)-2-amino-3-phenylpropyl]-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-[(2R)-2-amino-3-phenylpropyl]-4-bromo-5-(1H-pyrrolo[2,3-b]pyridin-4-yl)- 2-thiophenecarboxamide; N-[(2S)-2-amino-3-phenylpropyl]-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-
2-thiophenecarboxamide;
N-[(2R)-2-amino-3-phenylpropyl]-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- thiophenecarboxamide;
N-(3-amino-1-phenylpropyl)-5-(1H-pyrrolo[2,3-b]ρyridin-3-yl)-2- thiophenecarboxamide; N-p-amino-i-C^fluorophenyOethyO^-bromo-δ^i H-pyrroloP.S-bJDyridine-S- yl)-2-thiophenecarboxamide;
N-[2-amino-1-(4-fluorophenyl)ethyl]-5-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2- thiophenecarboxamide; N-[2-amino-1-(2-fluorophenyl)ethyl]-5-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2- thiophenecarboxamide;
N-[2-amino-1-(2-fluorophenyl)ethyl]-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-3- yl)-2-thiophenecarboxamide;
N-[2-amino-1-(3-fluorophenyl)ethyl]-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-3- yl)-2-thiophenecarboxamide;
N-[2-amino-1-(3-fluorophenyl)ethyl]-5-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-2- thiophenecarboxamide;
N-[(2R)-2-amino-3-(3-fluorophenyl)propyl]-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide N-{(1 R)-2-amino-1 -[(2-fluorophenyl)methyl]ethyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{(1R)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{(1 R)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyI}-5-(1 H-pyrrolo[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide,' N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyridin-
4-yl)-2-thiophenecarboxamide;
N-{(1R)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{(1 R)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-3-[(3-aminopropyi)oxy]-4-bromo-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{2-amino-1-[(2,6-difluorophenyl)methyl]ethyl}-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide; N-{(1S)-2-amiπo-1-[(3,5-difluorophenyi)methyl]ethyl}-4-bromo-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thioρhenecarboxamide; N-{2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenGcarboxamide;
N-((1 S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trlfluorornethyl)phenyl]methyl}ethyl)-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-thiophenecarboxamide;
N-{2-amino-1-[(2,6-difIuorophenyl)methyl]ethyl}-5-(1 H-pyrrolo[2,3-b]pyridin- 4-yl)-2-thiophenecarboxamide;
N-[(1 S)-2-amino-1 -(4-pyridinylmethyl)ethyl]-4-bromo-5-(1 H-pyrrolo[2,3- b]pyridin-4-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1-(4-pyridinylmethyl)ethyl]-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-
2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1 H- pyrrolo[2,3-b]pyridin-4-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-brorno-5-(1 H- pyrrolo[2,3-b]Dyridine-4-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-3- (methyloxyJ-δ-CI H-pyrroloP^-blpyridin^-yl^-furancarboxamidθ;
3-[(2-aminoethyl)oxy]-Λ/-((1 S)-2-amino-1 -{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- furancarboxamide; and
3-[(2-aminoethyl)oxy]-Λ/-((1 S)-2-amino-1 -{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-5-(1 H-pyrrolo[2,3-b]pyridin-4-yl)-2- furancarboxamide.
8. A pharmaceutically acceptable salt, hydrate, solvate or prodrug of a compound of claim 7.
9. A pharmaceutical composition comprising a compound according to claim 1 , and/or a pharmaceutically acceptable salt, hydrate, solvate or pro-drug thereof and a pharmaceutically acceptable carrier.
10. A process for preparing a pharmaceutical composition containing a pharmaceutically acceptable carrier or diluent and an effective amount of a compound of Formula (I) as described in claim 1 and/or a pharmaceutically acceptable salt, hydrate, solvate or pro-drug thereof, which process comprises bringing the compound of Formula (I) and/or a pharmaceutically acceptable salt, hydrate, solvate or pro-drug thereof into association with a pharmaceutically acceptable carrier or diluent.
11. A method of treating or lessening the severity of a disease or condition selected from cancer and arthritis in a mammal in need thereof, which comprises administering to such mammal a therapeutically effective amount of a compound of Formula I, as described in claim 1 and/or a pharmaceutically acceptable salt, hydrate, solvate or pro-drug thereof.
12. The method of claim 11 wherein the mammal is a human.
13. A method of treating or lessening the severity of a disease or condition selected from cancer and arthritis in a mammal in need thereof, which comprises administering to such mammal a therapeutically effective amount of a compound of Formula Ia, as described in claim 3 and/or a pharmaceutically acceptable salt, hydrate, solvate or pro-drug thereof.
14. The method of claim 13 wherein the mammal is a human.
15. The method according to claim 11 wherein said cancer is selected from brain (gliomas), glioblastomas, Bannayan-Zonana syndrome, Cowden disease, Lhemnitte-Duclos disease, breast, colon, head and neck, kidney, lung, liver, melanoma, ovarian, pancreatic, prostate, sarcoma and thyroid.
16. The method according to claim 13 wherein said cancer is selected from brain (gliomas), glioblastomas, Bannayan-Zonana syndrome, Cowden disease, Lhermitte-Duclos disease, breast, colon, head and neck, kidney, lung, liver, melanoma, ovarian, pancreatic, prostate, sarcoma and thyroid.
17. Use of a compound of Formula (I), as described in claim 1 and/or a pharmaceutically acceptable salt, hydrate, solvate or pro-drug thereof, in the manufacture of a medicament for use in treating or lessening the severity of a disease or condition selected from cancer and arthritis.
18. The method of inhibiting Akt activity in a mammal in need thereof, which comprises administering to such mammal a therapeutically effective amount of a compound of Formula I, as described in claim 1 and/or a pharmaceutically acceptable salt, hydrate, solvate or pro-drug thereof.
19. The method of claim 18 wherein the mammal is a human.
20. A method of treating cancer in a mammal in need thereof, which comprises: administering to such mammal a therapeutically effective amount of a) a compound of Formula (I), as described in claim 1 and/or a pharmaceutically acceptable salt, hydrate, solvate or pro-drug thereof; and b) at least one anti-neoplastic agent.
21. The method claim 19, wherein the at least one anti-neoplastic agent is selected from the group consisting essentially of anti-microtubule agents, platinum coordination complexes, alkylating agents, antibiotic agents, topoisomerase Il inhibitors, antimetabolites, topoisomerase I inhibitors, hormones and hormonal analogues, signal transduction pathway inhibitors; non-receptor tyrosine kinase angiogenesis inhibitors; immunotherapeutic agents; proapoptotic agents; and cell cycle signaling inhibitors.
22. The method of claim 20, wherein the at least one antineoplastic agent is an anti-microtubule agent selected from diterpenoids and vinca alkaloids.
23. The method of claim 20, wherein the at least one antineoplastic agent is a diterpenoid.
24. The method of claim 20, wherein the at least one antineoplastic agent is a vinca alkaloid.
25. The method of claim 20, wherein the at least one antineoplastic agent is a platinum coordination complex.
26. The method of claim 20, wherein the at least one antineoplastic agent is paclitaxel, carboplatin, or vinorelbine.
27 The method of claim 20, wherein the at least one antineoplastic agent is paclitaxel.
28. The method of claim 20, wherein the at least one antineoplastic agent is carboplatin.
29. The method of claim 20, wherein the at least one antineoplastic agent is vinorelbine.
30. The method of claim 20, wherein the at least one anti- neoplatic agent is a signal transduction pathway inhibitor.
31. The method of claim 30, wherein the signal transduction pathway inhibitor is an inhibitor of a growth factor receptor kinase selected from the group consisting of VEGFR2, TIE2, PDGFR, BTK, IGFR-1, TrkA, TrkB, TrkC, and c- fms.
32. The method of claim 30, wherein the signal transduction pathway inhibitor is an inhibitor of a serine/threonine kinase selected from the group consisting of rafk, akt, and PKC-zeta.
33. The method of claim 30, wherein the signal transduction pathway inhibitor is an inhibitor of a serine/threonine kinase selected from the src family of kinases.
34. The method of claim 33, wherein the signal transduction pathway inhibitor is an inhibitor of c-src
35. The method of claim 30, wherein the signal transduction pathway inhibitor is an inhibitor of Ras oncogene selected from inhibitors of farnesyl transferase and geranylgeranyl transferase.
36. The method of claim 30, wherein the signal transduction pathway inhibitor is an inhibitor of a serine/threonine kinase selected from the group consisting of PI3K.
37. The method of claim 19, wherein the at least one antineoplastic agent is a cell cycle signaling inhibitor.
38. The method of claim 37, wherein the cell cycle signaling inhibitor is selected from inhibitors of the group CDK2, CDK4, and CDK6.
39. A pharmaceutical combination as claimed in claim 19 for use in therapy.
40. The use of a pharmaceutical combination as claimed in claim 19 for the preparation of a medicament useful in the treatment of cancer.
EP06846739A 2005-12-22 2006-12-21 INHIBITORS OF Akt ACTIVITY Withdrawn EP1968568A4 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US75303305P 2005-12-22 2005-12-22
US79319806P 2006-04-19 2006-04-19
PCT/US2006/062453 WO2007076423A2 (en) 2005-12-22 2006-12-21 INHIBITORS OF Akt ACTIVITY

Publications (2)

Publication Number Publication Date
EP1968568A2 true EP1968568A2 (en) 2008-09-17
EP1968568A4 EP1968568A4 (en) 2011-04-13

Family

ID=38218824

Family Applications (1)

Application Number Title Priority Date Filing Date
EP06846739A Withdrawn EP1968568A4 (en) 2005-12-22 2006-12-21 INHIBITORS OF Akt ACTIVITY

Country Status (3)

Country Link
EP (1) EP1968568A4 (en)
JP (1) JP2009521504A (en)
WO (1) WO2007076423A2 (en)

Families Citing this family (62)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2270014A1 (en) 2005-09-22 2011-01-05 Incyte Corporation Azepine inhibitors of janus kinases
US7625890B2 (en) 2005-11-10 2009-12-01 Smithkline Beecham Corp. Substituted imidazo[4,5-c]pyridine compounds as Akt inhibitors
CN103214484B (en) 2005-12-13 2016-07-06 因塞特控股公司 Pyrrolo-[2,3-b] pyridine replaced as the heteroaryl of Janus inhibitors of kinases and pyrrolo-[2,3-b] pyrimidine
ES2408318T3 (en) 2005-12-23 2013-06-20 Glaxosmithkline Llc Aurora kinase azaindole inhibitors
GB0617161D0 (en) * 2006-08-31 2006-10-11 Vernalis R&D Ltd Enzyme inhibitors
ES2415863T3 (en) 2006-12-22 2013-07-29 Incyte Corporation Substituted heterocycles as Janus Kinase inhibitors
UY30892A1 (en) * 2007-02-07 2008-09-02 Smithkline Beckman Corp AKT ACTIVITY INHIBITORS
WO2008098105A1 (en) * 2007-02-07 2008-08-14 Smithkline Beecham Corporation Inhibitors of akt activity
HUE029236T2 (en) 2007-06-13 2017-02-28 Incyte Holdings Corp Crystalline salts of the janus kinase inhibitor (r)-3-(4-(7h-pyrrolo[2,3-d]pyrimidin-4-yl)-1h-pyrazol-1-yl)-3-cyclopentylpropanenitrile
CL2008001709A1 (en) 2007-06-13 2008-11-03 Incyte Corp Compounds derived from pyrrolo [2,3-b] pyrimidine, jak kinase modulators; pharmaceutical composition; and use in the treatment of diseases such as cancer, psoriasis, rheumatoid arthritis, among others.
US8173635B2 (en) 2007-11-02 2012-05-08 Vertex Pharmaceuticals Incorporated Kinase inhibitors
PL2231606T3 (en) * 2007-12-07 2013-07-31 Vertex Pharma METHODS OF MAKING CYCLOALKYL CARBOXYAMIDOPYRIDINOBENZOIC ACIDS
CA2711782C (en) * 2008-01-09 2017-01-03 Array Biopharma Inc. 5h-cyclopenta[d]pyrimidines as akt protein kinase inhibitors
TWI444382B (en) 2008-03-11 2014-07-11 Incyte Corp Azetidine and cyclobutane derivatives as jak inhibitors
JP2011525929A (en) * 2008-06-26 2011-09-29 グラクソスミスクライン・リミテッド・ライアビリティ・カンパニー Inhibitor of Akt activity
CA2750565C (en) 2009-01-30 2015-10-20 Glaxosmithkline Llc Crystalline n-{(1s)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1h-pyrazol-5-yl)-2-thiophenecarboxamide hydrochloride
WO2010093885A1 (en) * 2009-02-12 2010-08-19 Glaxosmithkline Llc Inhibitors of akt activity
CA2760387A1 (en) * 2009-04-30 2010-11-04 Sumitomo Chemical Company, Limited Thiophene derivative
MY156727A (en) 2009-05-22 2016-03-15 Incyte Corp N-(hetero)aryl-pyrrolidine derivatives of pyrazol-4-yl-pyrrolo[2,3-d]pyrimidines and pyrrol-3-yl-pyrrolo[2,3-d]pyrimidines as janus kinase inhibitors
EP2432472B1 (en) 2009-05-22 2019-10-02 Incyte Holdings Corporation 3-[4-(7h-pyrrolo[2,3-d]pyrimidin-4-yl)-1h-pyrazol-1-yl]octane- or heptane-nitrile as jak inhibitors
TW201113285A (en) 2009-09-01 2011-04-16 Incyte Corp Heterocyclic derivatives of pyrazol-4-yl-pyrrolo[2,3-d]pyrimidines as janus kinase inhibitors
MX2012004180A (en) 2009-10-09 2012-07-17 Incyte Corp Hydroxyl, keto, and glucuronide derivatives of 3-(4-(7h-pyrrolo[2,3-d]pyrimidin-4-yl)-1h-pyrazol-1-yl)-3-cyclo pentylpropanenitrile.
EP3354652B1 (en) 2010-03-10 2020-05-06 Incyte Holdings Corporation Piperidin-4-yl azetidine derivatives as jak1 inhibitors
AR084691A1 (en) 2010-05-21 2013-06-05 Incyte Corp TOPICAL USE FORMULATION FOR A JAK INHIBITOR AND METHOD TO TREAT SKIN DISORDER
CA2818542A1 (en) 2010-11-19 2012-05-24 Incyte Corporation Cyclobutyl substituted pyrrolopyridine and pyrrolopyrimidine derivatives as jak inhibitors
WO2012068440A1 (en) 2010-11-19 2012-05-24 Incyte Corporation Heterocyclic-substituted pyrrolopyridines and pyrrolopyrimidines as jak inhibitors
WO2012112847A1 (en) 2011-02-18 2012-08-23 Novartis Pharma Ag mTOR/JAK INHIBITOR COMBINATION THERAPY
MY165963A (en) 2011-06-20 2018-05-18 Incyte Holdings Corp Azetidinyl phenyl, pyridyl or pyrazinyl carboxamide derivatives as jak inhibitors
CA2844507A1 (en) 2011-08-10 2013-02-14 Novartis Pharma Ag Jak pi3k/mtor combination therapy
TW201313721A (en) 2011-08-18 2013-04-01 Incyte Corp Cyclohexyl azetidine derivatives as JAK inhibitors
UA111854C2 (en) 2011-09-07 2016-06-24 Інсайт Холдінгс Корпорейшн METHODS AND INTERMEDIATE COMPOUNDS FOR JAK INHIBITORS
TW201406761A (en) 2012-05-18 2014-02-16 Incyte Corp Piperidinylcyclobutyl substituted pyrrolopyridine and pyrrolopyrimidine derivatives as JAK inhibitors
MD20140130A2 (en) 2012-06-29 2015-04-30 Pfizer Inc. Novel 4-(substituted-amino)-7H-pyrrolo[2,3-d]pyrimidines as LRRK2 inhibitors
DK2880025T3 (en) * 2012-08-02 2019-03-18 Nerviano Medical Sciences Srl SUBSTITUTED PYROLES ACTIVE AS KINase INHIBITORS
DE102012019369A1 (en) 2012-10-02 2014-04-03 Merck Patent Gmbh 7-Azaindolderivat
TWI761825B (en) 2012-11-15 2022-04-21 美商英塞特控股公司 Sustained-release dosage forms of ruxolitinib
MX384910B (en) 2013-03-06 2025-03-14 Incyte Holdings Corp PROCESSES AND INTERMEDIATE FOR MAKING A JAK INHIBITOR.
TW201533043A (en) 2013-04-18 2015-09-01 Lundbeck & Co As H Arylpyrrolopyridine derived compounds as LRRK2 inhibitors
SG11201600815WA (en) 2013-08-07 2016-03-30 Incyte Corp Sustained release dosage forms for a jak1 inhibitor
WO2015092592A1 (en) 2013-12-17 2015-06-25 Pfizer Inc. Novel 3,4-disubstituted-1h-pyrrolo[2,3-b]pyridines and 4,5-disubstituted-7h-pyrrolo[2,3-c]pyridazines as lrrk2 inhibitors
CN103833725B (en) * 2014-03-03 2016-06-08 上海北卡医药技术有限公司 A kind of method synthesizing 5-N-tertiary butoxy carbonyl-5-N-methylamino-2-thiophenic acid
WO2015184305A1 (en) 2014-05-30 2015-12-03 Incyte Corporation TREATMENT OF CHRONIC NEUTROPHILIC LEUKEMIA (CNL) AND ATYPICAL CHRONIC MYELOID LEUKEMIA (aCML) BY INHIBITORS OF JAK1
WO2016004305A2 (en) 2014-07-02 2016-01-07 Pharmacyclics Llc Inhibitors of bruton's tyrosine kinase
CN108137586B (en) 2015-09-14 2021-04-13 辉瑞大药厂 Novel imidazo[4,5-c]quinoline and imidazo[4,5-c][1,5]naphthyridine derivatives as LRRK2 inhibitors
EP3426674A4 (en) 2016-03-09 2019-08-14 Blade Therapeutics, Inc. CYCLIC CE-AMIDE COMPOUNDS AS MODULATORS OF CALPAIN, AND METHODS OF MAKING AND USING SAME
EP3481835A4 (en) 2016-07-05 2020-02-26 Blade Therapeutics, Inc. CALPAIN MODULATORS AND THEIR THERAPEUTIC USES
SG10201912574WA (en) 2016-09-28 2020-02-27 Blade Therapeutics Inc Calpain modulators and therapeutic uses thereof
CN108948002A (en) 2017-05-19 2018-12-07 厦门大学 Five yuan and hexa-atomic nitrogen heteroaromatic rings class compound, preparation method, Pharmaceutical composition and its application
KR20190043437A (en) 2017-10-18 2019-04-26 씨제이헬스케어 주식회사 Heterocylic compound as a protein kinase inhibitor
US10596161B2 (en) 2017-12-08 2020-03-24 Incyte Corporation Low dose combination therapy for treatment of myeloproliferative neoplasms
US11261196B2 (en) 2017-12-13 2022-03-01 Harbin Zhenbao Pharmaceutical Co., Ltd. Salt serving as AKT inhibitor and crystal thereof
JP7393348B2 (en) 2018-01-30 2023-12-06 インサイト・コーポレイション Process and intermediates for producing (1-(3-fluoro-2(trifluoromethyl)isonicotinyl)piperidin-4-one)
CN113768934A (en) 2018-03-30 2021-12-10 因赛特公司 Treatment of hidradenitis suppurativa with JAK inhibitors
JP7402857B2 (en) * 2018-04-04 2023-12-21 エピオダイン,インク. Opioid receptor modulators and related products and methods
WO2020078865A1 (en) 2018-10-16 2020-04-23 F. Hoffmann-La Roche Ag Use of akt inhibitors in ophthalmology
KR102195348B1 (en) 2018-11-15 2020-12-24 에이치케이이노엔 주식회사 Novel compound as a protein kinase inhibitor, and the pharmaceutical composition comprising thereof
WO2020150417A2 (en) * 2019-01-17 2020-07-23 Ifm Due, Inc. Compounds and compositions for treating conditions associated with sting activity
US11833155B2 (en) 2020-06-03 2023-12-05 Incyte Corporation Combination therapy for treatment of myeloproliferative neoplasms
CN112266349B (en) * 2020-11-17 2022-02-15 上海凌凯医药科技有限公司 Method for preparing 2-amino-4-methyl-1-propyl-1H-pyrrole-3-carbonitrile
CN115073469B (en) * 2021-03-15 2023-12-22 药雅科技(上海)有限公司 Preparation and application of pyrrolopyrimidine compound as kinase inhibitor
WO2022216717A1 (en) * 2021-04-05 2022-10-13 The Cleveland Clinic Foundation Citron kinase inhibitors
PY2269135A (en) 2021-08-10 2024-01-29 Ifm Due Inc COMPOUNDS AND COMPOSITIONS FOR TREATING CONDITIONS ASSOCIATED WITH STING'S ACTIVITY

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050130954A1 (en) * 2003-11-21 2005-06-16 Mitchell Ian S. AKT protein kinase inhibitors
WO2005103050A2 (en) * 2004-04-02 2005-11-03 Vertex Pharmaceuticals Incorporated Azaindoles useful as inhibitors of rock and other protein kinases
WO2006004984A1 (en) * 2004-06-30 2006-01-12 Vertex Pharmaceuticals Incorporated Azaindoles useful as inhibitors of protein kinases
ZA200704888B (en) * 2004-11-22 2009-02-25 Vertex Pharma Pyrrolopyrazines and pyrazolopyrazines useful as inhibitors of protein kinases
KR20080016659A (en) * 2005-05-20 2008-02-21 버텍스 파마슈티칼스 인코포레이티드 Pyrrolopyridines useful as inhibitors of protein kinase

Also Published As

Publication number Publication date
WO2007076423A2 (en) 2007-07-05
EP1968568A4 (en) 2011-04-13
WO2007076423A3 (en) 2007-11-29
JP2009521504A (en) 2009-06-04

Similar Documents

Publication Publication Date Title
WO2007076423A2 (en) INHIBITORS OF Akt ACTIVITY
EP2117523B1 (en) Inhibitors of akt activity
US20080255143A1 (en) Inhibitors of Akt Activity
US20100056523A1 (en) Inhibitors of akt activity
JP5363997B2 (en) Inhibitor of Akt activity
EP1720855A1 (en) Inhibitors of akt activity
US8338434B2 (en) Inhibitors of Akt activity
US20080318947A1 (en) Inhibitors of Akt Activity
WO2009032653A1 (en) Inhibitors of akt activity
WO2010093885A1 (en) Inhibitors of akt activity
WO2007076320A2 (en) Compounds
US20090227616A1 (en) Inhibitors of akt activity
US20110196009A1 (en) INHIBITORS OF Akt ACTIVITY
US20080269131A1 (en) Inhibitors of Akt Activity

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20080704

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: HR

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: GLAXOSMITHKLINE LLC

A4 Supplementary search report drawn up and despatched

Effective date: 20110311

RIC1 Information provided on ipc code assigned before grant

Ipc: A61P 19/02 20060101ALI20110307BHEP

Ipc: A61P 35/00 20060101ALI20110307BHEP

Ipc: A61K 31/33 20060101AFI20080722BHEP

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20110609